HPV Selbstuntersuchung - Jena 2002
Transcription
HPV Selbstuntersuchung - Jena 2002
Epigenetic signature as molecular marker for the detection of HPVinduced severe dysplasia and cervical carcinoma A new trend in cancer diagnostics? A. Hansel, M. Dürst MBD Gynäkologische Molekularbiologie, Universitäts-Frauenklinik, Jena HMT Me Ac HPV Infection and Cervical Carcinoma •Cervical cancer (CxCa) is 2nd most common cancer in women worldwide •500,000 new cases, 270,000 deaths / year worldwide •hr-HPV infection is a prerequisite for cancer •HPV is transmitted sexually >50% of people get infected (cumulative) in most cases infections clear within a year HPV Infection and Cervical Carcinoma Wheeler, 2007; Nat Clin Pract Oncol 4 early detection of precancerous lesions → almost 100% curable Detection of CIN2+ using Pap-based cytology Uneven distribution of cellular material associated with the conventional Pap smear (A) may be avoided by ThinPrep technology (B). Nonetheless the success depends mainly upon the experience of the cytologist. Detection of CIN2+ using Pap-based cytology (Cuzick et al., Int J Cancer (2006) 119:1095-1101) Sensitivity Pap-Test 53%, positive predictive value 20.3% (n = 60.000) → reliable markers for the detection of precancerous lesions are required Detection of CIN2+ using Pap-based cytology and HPV test (Cuzick et al., Int J Cancer (2006) 119:1095-1101) Sensitivity HPV-Test 96.1% but PPV only 15.5% Sensitivity Pap-Test 53%, positive predictive value (PPV) 20.3% (n = 60.000) → reliable markers for the detection of precancerous lesions are required Promoter CpG island hypermethylation may contribute to carcinogenesis CpG-island methylation → carcinogenesis •hypomethylation of repetitive elements •hypermethylation of CpG islands •hypermethylation may occur early in carcinogenesis → inactivation of genes: repair, cell cycle, apoptosis, control of gene expression, cell adhesion CpG island methylation may be tumor-specific tumor entity gene Esteller, M. Hum. Mol. Genet. 2007 16:50-59 → epigenetic signatures may be useful as carcinogenesis markers? Search for candidate CpG islands •Gene expression profiles: normal vs CxCa tissue •CpG island arrays: HPV-positive cervical scrapes vs. CxCa tissue sections Search for candidate genes CpG island microarrays: •27,800 CpG islands covering 21 MB •237,220 probes in or within 95bp of CpG islands AGACCATGTAAGAGACAATGTCTTGTCGAAATTGTCATTGTTTTTTGATTCCAGACAAATGGGGTGTGGGGAACAG AAAGGCGATTTGGACTAGTTTCCCCGGACGGGATGAGGCAGCGCCGGAAGTATGACGCTCATTTCTTTAAGCCACT AGAAGCTCACCGTGAGTCCATTCACAGGGCCAGAGTTCCAAGTGTGCGGCGTGGGCGGGGCCTGCAGAAAGGGACG GGGCCTGCAGAAAGGGACGGGGCTGGCAAAGGCCTGGTCTACCTCACCGATCCGGGTCGCGGGGGCTCCTAGGGGG TTCCTTCCACAGCTGGTGCGCGTGCGCAAGAGTGCGTCGAGGTTGTTCCGCGGCAATTTATGAAACTCGGAGCCGG CAGTGAGTTGAGGGTTCGGCGAGGTCAGGGATTCCTAGTTGCAGCGTGATTACCAACGCCAGCTCCCTTCACTGTC CAAGACAGCGATTCCGCGGCTCCTCTGAGAACTGGCGCTTGTGAGTGACTGAACGGGCCACTGGAGAGGAGCGGTG CTCACGGGTATCGTTCTCGTCAGCGGGCGGTGGGGACGCGGGGTCTTGGAATTGGGAATCACGCTTGAGGGCGTCC ATGCGGAACGTGCAGCTTACCTCAGCTTGCTTGCAGTTACCCAGTTTCCACGCTGCCCTCCAAGGTCTGTGCCGGA AAACCTGGAGGAGGGCGCGAGCTGACGGGAGGGATGGAAACGTGGGCTGCGGAAGTAAGACAAGCGTTGAGAGCAG CGACAGAGGGCGAGGGGGTGGGCGGCGGGACGGCTGGGGTCAGGATCCAGCTCCGCTAAAGCAAGGATTTAACCAC ACTCCTGTCGCCTCTTCCACTCTGCAATAGGGGCAGTCTCCAGACGCGCAGAGTGG → putative marker candidates Experimental workflow CpG islands in candidate genes: Microarray results give hints for primer positions Design and test MS-PCR primers with in vitro CpG-methylated DNA Isolate DNA from tumor and control samples Bisulfite treatment of DNA Realtime MS-PCR Methylated DNA genomic Bisulfite-converted MS-PCR primer Unmethylated DNA genomic Bisulfite-converted MS-PCR primer CGCGTACGTGCACTCCCCCGGCGGGATCATCGTCCTCGG… CGCGTACGTGTATTTTTTCGGCGGGATTATCGTTTTCGG… CGCGTACGTGTATTTTTTCGGC CGCGTACGTGCACTCCCCCGGCGGGATCATCGTCCTCGG… TGTGTATGTGTATTTTTTTGGTGGGATTATTGTTTTTGG… CGCGTACGTGTATTTTTTCGGC Sensitivity and specificity of methylationspecific PCRs Methylated DNA genomic Bisulfite-converted MS-PCR primer Unmethylated DNA genomic Bisulfite-converted MS-PCR primer 1pg 100fg 10fg CGCGTACGTGCACTCCCCCGGCGGGATCATCGTCCTCGG… CGCGTACGTGTATTTTTTCGGCGGGATTATCGTTTTCGG… CGCGTACGTGTATTTTTTCGGC CGCGTACGTGCACTCCCCCGGCGGGATCATCGTCCTCGG… TGTGTATGTGTATTTTTTTGGTGGGATTATTGTTTTTGG… CGCGTACGTGTATTTTTTCGGC 1fg → primers are highly specific for the methylated and bisulfite-treated DNA region AHRR is a bad methylation signature marker AHRR TM2 TM3 TM4 TM5 TM6 KM1 KM2 Kmeth AHRR: Test of candidate genes with DNA pools TM = DNA-Pools from CxCa tissue sections KM = pooled DNA from cervical scrapes from HPV-positive, inconspicious women Kmeth = in vitro-methylated genomic DNA •Reported to be nonmethylated in inconspicious, and increasingly methylated in lesions → CxCa Gene 4: a good methylation signature marker Gen 4 TM1 TM2 TM3 TM4 TM5 TM6 KM1 KM2 KM3 Kmeth Gene 4: •Downregulated: CIN → CxCa (cDNA array) Test of candidate genes with DNA pools TM = DNA-Pools from CxCa tissue sections KM = pooled DNA from cervical scrapes from HPV-positive, inconspicious women Kmeth = in vitro-methylated genomic DNA •Methylated: inconspicious → CxCa (CpG array) A signature of six methylation markers.... Methylation in cervical scrapes 100 % methylated samples 90 80 70 HPV-negative (77) 60 50 HPV-positive (90) CIN3 (48) 40 CxCa (65) 30 20 10 0 at at at a le st st a le st 6 5 4 3 2 1 a le en G en G en G en G en G en G r th tw on s s ne ne ne ge ge ge ee o e Sensitivity for CIN3+ >90%, positive predictive value ca. 90% Epigenetic signature for the detection of CIN2+ Professor Dürst‘s research group „gynecologic molecular biology“ •Daniel Steinbach •Norman Häfner •Matthias Dürst special thanks to: