Predation by Myxococcus xanthus Induces Bacillus subtilis To Form

Predation by Myxococcus xanthus Induces Bacillus subtilis To Form
Spore-Filled Megastructures
Susanne Müller,a Sarah N. Strack,a Sarah E. Ryan,a Daniel B. Kearns,b John R. Kirbya
Department of Microbiology, University of Iowa, Iowa City, Iowa, USAa; Department of Biology, Indiana University, Bloomington, Indiana, USAb
B
iofilm formation is part of the life cycle for many bacterial
species, leading to the accumulation of cells or spores embedded within a matrix (1, 2). Biofilms can be multispecies in composition (3) or comprised of a single species, as observed for Bacillus subtilis and Myxococcus xanthus. For both B. subtilis and M.
xanthus, biofilms arise in response to environmental challenges,
such as interspecies interactions or competition for nutrients, and
culminate in sporulation, an escape into dormancy as a long-term
survival mechanism. Entry into the dormant state is an energyconsuming process, and thus, the decision whether to enter the
dormant state is critical for cells and is controlled by complex
regulatory networks (4). An advantage gained by B. subtilis is that
spores are widely resistant to predation by the protozoan Tetrahymena thermophile, the bacterivorous nematode Caenorhabditis elegans (5, 6), as well as the predatory bacterium M. xanthus (7). An
advantage gained by M. xanthus spore production within fruiting
bodies is that subsequent germinating populations are at critical
numbers for group behavior, including predation.
For both B. subtilis and M. xanthus, the biofilms that house
dormant spores display varied structural complexity. The various
biofilms produced by myxobacteria range from tree-like structures in Stigmatella aurantiaca (8) to domes for M. xanthus (9).
These structures are called fruiting bodies, as they contain quiescent spores capable of germinating after extended periods of dormancy. For B. subtilis, cells produce wrinkled biofilms containing
spores on solid surfaces (colony biofilms or fruiting bodies) or at
an air-liquid interface (pellicles) (10, 11). Both M. xanthus and B.
subtilis biofilms consist of a matrix component made of exopolysaccharides (EPSs) and proteins encompassing spatially organized
subpopulations of cells and spores (9, 12).
Several interspecies interactions are known to trigger physiological responses in soil-dwelling microbes, including M. xanthus
and B. subtilis (13–15). As both organisms are typically isolated
from soil, they are likely to encounter each other in the environment. However, unlike B. subtilis, M. xanthus is known to be a
predatory bacterium that consumes a wide variety of microbes,
January 2015 Volume 81 Number 1
including the yeast Saccharomyces cerevisiae and phages (16–18).
Secretion of lytic enzymes and secondary metabolites enables M.
xanthus to engage in predatory behavior (16), and regulation of
this process appears to be specific. For example, antibiotic TA has
no effect on Gram-positive organisms (16, 18). For M. xanthus,
multicellular development occurs during the later stages of predation, when a step-down in nutrients results from depletion of the
prey source (19). Thus, M. xanthus coordinates its predatory lifestyle with development and interspecies interactions.
In this study, we investigated the fate of B. subtilis following
prolonged exposure to the predator M. xanthus. The B. subtilis
NCIB3610 ancestral strain transiently resists bacterial predation
via production of a secondary metabolite, bacillaene, and by sporulation (7). In the study described here, we found that prolonged
exposure to M. xanthus under conditions conducive to predation
induces B. subtilis NCIB3610 to generate a highly branched megastructure filled with spores. Predation-induced megastructures
are genetically distinct from those classically defined as B. subtilis
colony biofilms arising on MSgg growth medium. In addition, the
megastructures are found adjacent to M. xanthus fruiting bodies
approximately 99% of the time, suggesting that M. xanthus is unable to acquire sufficient nutrients from B. subtilis megastructures.
Received 24 July 2014 Accepted 14 October 2014
Accepted manuscript posted online 17 October 2014
Citation Müller S, Strack SN, Ryan SE, Kearns DB, Kirby JR. 2015. Predation by
Myxococcus xanthus induces Bacillus subtilis to form spore-filled megastructures.
Appl Environ Microbiol 81:203–210. doi:10.1128/AEM.02448-14.
Editor: M. A. Elliot
Address correspondence to John R. Kirby, john-kirby@uiowa.edu.
Supplemental material for this article may be found at http://dx.doi.org/10.1128
/AEM.02448-14.
Copyright © 2015, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.02448-14
Applied and Environmental Microbiology
aem.asm.org
203
Downloaded from http://aem.asm.org/ on April 11, 2015 by Univ of North Dakota
Biofilm formation is a common mechanism for surviving environmental stress and can be triggered by both intraspecies and
interspecies interactions. Prolonged predator-prey interactions between the soil bacterium Myxococcus xanthus and Bacillus
subtilis were found to induce the formation of a new type of B. subtilis biofilm, termed megastructures. Megastructures are treelike brachiations that are as large as 500 ␮m in diameter, are raised above the surface between 150 and 200 ␮m, and are filled
with viable endospores embedded within a dense matrix. Megastructure formation did not depend on TasA, EpsE, SinI, RemA,
or surfactin production and thus is genetically distinguishable from colony biofilm formation on MSgg medium. As B. subtilis
endospores are not susceptible to predation by M. xanthus, megastructures appear to provide an alternative mechanism for survival. In addition, M. xanthus fruiting bodies were found immediately adjacent to the megastructures in nearly all instances,
suggesting that M. xanthus is unable to acquire sufficient nutrients from cells housed within the megastructures. Lastly, a B.
subtilis mutant lacking the ability to defend itself via bacillaene production formed megastructures more rapidly than the parent. Together, the results indicate that production of the megastructure facilitates B. subtilis escape into dormancy via
sporulation.
Müller et al.
TABLE 1 Bacterial strains used in this study
Genotype
Reference
Myxococcus xanthus
DZ2
DZ4168
JK1666
JK2178
JK3346
JK4189
JK4190
JK4191
Wild type
frzE::Tn5⍀226
difE::kan
⌬pilA
attB8::kan
⌬aglZ
⌬mglAB
⌬pilA ⌬aglZ
43
44
This study
This study
This study
This study
This study
This study
Bacillus subtilis
NCIB3610
DK2308
DS91
DS92
DS143
DS662
DS1994
DS2099
DS2152
DS2679
DS3323
DS3337
DS4085
DS4927
Wild type
⌬epsE tasA::Tn10 spec
sinI::spec
sinR::spec
srfAA::mls
spo0A::mls
degU::mls
spoIVA::Tn10 spec
⌬epsE
remA::TnYLB kan
tasA::Tn10 spec
sfp::mls
pksL::cat
bslA::spec
45
This study
33
46
46
11
47
This study
48
35
49
47
7
This study
a
Strain DZ4168 and strains with the prefix JK are derivatives of wild-type strain DZ2.
Strain DK2308 and strains with the prefix DS are derivatives of wild-type strain
NCIB3610.
Lastly, a bacillaene mutant which lacks the ability to defend itself
in the short term was observed to form megastructures more rapidly than the parent strain. Therefore, it appears that production
of the megastructure is another mechanism for B. subtilis to protect cells during an escape to dormancy via sporulation.
MATERIALS AND METHODS
Bacterial strains and media. The bacterial strains used in this study are
described in Table 1. M. xanthus cultures were grown to mid-log phase at
32°C in liquid casitone-yeast extract (CYE) medium (20). If needed,
kanamycin sulfate was added to a final concentration of 50 ␮g/ml. B.
subtilis strains were grown in liquid LB medium to a final optical density at
600 nm (OD600) of 2. For the cultivation of B. subtilis strains, the following
antibiotics were used at the indicated concentrations: chloramphenicol, 5
␮g/ml; kanamycin, 5 ␮g/ml; lincomycin, 25 ␮g/ml; and spectinomycin,
100 ␮g/ml.
Construction of mutants. To construct M. xanthus in-frame deletion
mutants, we took advantage of a method established by Wu and Kaiser
(21). Briefly, about 800 bp of the upstream and downstream regions of the
gene of interest was amplified by PCR and cloned into plasmid pBJ113.
The DZ2 wild-type strain was transformed and mutants were selected on
CYE agar plates containing kanamycin. Insertion into the chromosome
was verified by PCR, and in-frame deletions were obtained by counterselection on galactose (22). The B. subtilis mutant strain DS2099 was generated by transposon mutagenesis as previously described (23). The bslA::
spec insertion deletion allele was generated by long flanking homology
PCR (using primers 1535 [CGGCACTGATCCATTCTCCGTCA] and
1536 [CAATTCGCCCTATAGTGAGTCGTGCCCGCTTTTCACCTCC
TCTGA] and primers 1537 [CCAGCTTTTGTTCCCTTTAGTGAGGCG
TTTTACCCTCCCCTTTTTCTCT] and 1538 [GTGGCCCATGATCAC
CAGGCAA]), and DNA containing a tetracycline drug resistance gene
(pAH54) was used as a template for marker replacement (24, 25).
204
aem.asm.org
Predation assays. M. xanthus and B. subtilis strains were prepared as
previously described to achieve a final M. xanthus concentration of 2 ⫻
109 cells/ml in MMC buffer (10 mM MOPS [morpholinepropanesulfonic
acid; pH 7.6], 4 mM MgSO4, 2 mM CaCl2) and a final B. subtilis concentration of 1 ⫻ 1011 cells/ml in water (7). Inside-out predation assays were
performed as qualitative assays where 2 ␮l of the predator M. xanthus
isolate was spotted onto a 7-␮l prey spot. Predation assays were performed
on CFL starvation medium as previously described (19). For megastructure formation, predator and prey cells were prepared as described above,
mixed in equal volumes, and spread on CFL agar plates. Predation assays
were monitored by microscopy using a Nikon SMZ1500 dissecting microscope. Images were taken using a QImaging Micropublisher charge-coupled-device camera and processed with QCapture software.
Determination of megastructure size. The average diameter of three
individual megastructures produced by the NCIB3610 strain was determined using a stage micrometer calibration measure for microscopes
(AmScope) that has a total length of 1 mm with a resolution of 0.01-mm
increments. The average height of three individual NCIB3610 megastructures was calculated using 2-␮m thin-layer cuts from samples that were
prepared for transmission electron microscopy (TEM) as described
below.
Quantitative analysis of megastructure cell content. M. xanthus
(JK3346 [DZ2 attB8::kan]) and B. subtilis strains (NCIB3160 and DS4085
[NCIB3160 pksL::cat]) were prepared as described above, mixed in equal
volumes, and spread onto CFL agar plates. Megastructures were removed
from the agar surface with a sterile needle after 3, 5, and 8 days and
transferred into an Eppendorf tube that contained 100 ␮l H2O. A tissue
grinder was used to disrupt the megastructures. Serial dilutions were
plated onto selective medium containing the appropriate antibiotics. Selection for NCBI3610 was performed on LB agar plates, and selection for
the pksL mutant was performed on LB agar plates containing chloramphenicol at 37°C. Serial dilutions were additionally heated to 85°C for 20
min to kill vegetative cells and plated onto LB agar plates as described
above to count mature spores that were able to germinate.
Sample preparation for electron microscopy (SEM, TEM). For scanning electron microscopy (SEM), samples of Bacillus subtilis megastructures were fixed in 2% osmium tetroxide-perfluorocarbon solution for 1 h
at room temperature, dehydrated with three 100% ethanol washes, and
dried with hexamethyldisilazane to preserve biofilm formation (26). Samples were mounted onto aluminum stubs, sputter coated with gold-palladium, and examined under a Hitachi S-4800 scanning electron microscope. For TEM, samples were fixed using the same procedure described
above for SEM, embedded into Epon resin, sectioned, and viewed under a
JEM-1230 transmission electron microscope. Alternatively, samples for
TEM were fixed in 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer, dehydrated in a series of increasing concentrations of ethanol, and
embedded into Epon resin. All microscopy was performed at the University of Iowa Central Microscopy Research Facility.
Bacillus colony biofilm formation. B. subtilis strains were grown as
described above to an OD600 of 2. Three microliters of each strain was
spotted onto MSgg agar plates (5 mM potassium phosphate, 100 mM
MOPS [pH 7], 2 mM MgCl2, 50 ␮M MnCl2, 50 ␮M FeCl3, 700 ␮M CaCl2,
1 ␮M ZnCl2, 2 ␮M thiamine, 0.5% glycerol, 0.5% glutamate, and 50
␮g/ml tryptophan and phenylalanine) (11) and CFL agar plates, followed
by incubation at 32°C for 3 to 5 days. Photos were taken periodically
throughout the incubation period.
RESULTS
Bacillus subtilis NCIB3610 produces megastructures in response to M. xanthus predation. The ancestral B. subtilis strain
NCIB3610 resists predatory advances from M. xanthus by at least
two different mechanisms, including the synthesis of an inhibitory
secondary metabolite, bacillaene, and the formation of predationresistant endospores (7). Results from a previous study indicated
that B. subtilis mutants lacking the capacity to produce bacillaene
Applied and Environmental Microbiology
January 2015 Volume 81 Number 1
Downloaded from http://aem.asm.org/ on April 11, 2015 by Univ of North Dakota
Bacterial straina
Predation-Induced Megastructures in Bacillus subtilis
display an enhanced susceptibility to predation by M. xanthus,
even though mature endospores from those mutants were able to
survive predation (7). Those observations led us to assay predatorprey interactions over prolonged periods (days or weeks). Cells
from strain NCIB3610 were grown to late log phase, washed, and
spread onto low-nutrient agar plates with and without the predator, M. xanthus. The plates were incubated at 32°C and monitored
by microscopy every day for up to 2 weeks. After 3 days, very large
macroscopic structures were observed to rise above the agar surface when B. subtilis and M. xanthus were plated together, as described in Materials and Methods (Fig. 1). The size of the structure
gradually increased and appeared to plateau after about 5 days
(Fig. 1). NCIB3610 structures reached a diameter of about 500 ␮m
and rose between 150 and 200 ␮m above the agar surface (see Fig.
S1 in the supplemental material). TEM thin-layer cuts of three
individual structures indicated heights of between 163 and 175
␮m, although these numbers are low due to sample contraction
upon treatment for TEM. We have chosen to designate these macroscopic aggregates as megastructures, both due to the large size of
the structures, dwarfing those of M. xanthus fruiting bodies, and
to distinguish them both from M. xanthus fruiting bodies and
from B. subtilis colony biofilms, as described previously (9, 10).
Megastructures consist of B. subtilis cells at different stages
of development embedded within matrix material. Phase-contrast microscopy revealed that virtually all megastructures display
a tree-like brachiation pattern and are found in close proximity to
prototypical fruiting bodies for M. xanthus following a step-down
in nutrient availability during the later stages of predation (Fig. 2).
To facilitate visualization of M. xanthus fruiting bodies relative to
the megastructures, we added Congo red, which binds exopoly-
January 2015 Volume 81 Number 1
FIG 2 Sporulation is required to maintain megastructure integrity. Shown are
photomicrographs of 3-day-old megastructures (diameter, approximately 500
␮m) made by B. subtilis cells in the presence of the M. xanthus predator. (A)
NCIB3610 on medium containing Congo red; (B) NCIB3610; (C) the pksL
mutant; (D) the spoIVA mutant. Congo red allows differential staining of M.
xanthus fruiting bodies that arise following predation and are visible as red
mounds. Bar, 0.5 mm.
saccharides, to the medium (27). Congo red appeared to stain M.
xanthus fruiting bodies more extensively than B. subtilis (Fig. 2A),
making the fruiting bodies and megastructures easily distinguishable. Examination of the relative positions of the megastructures
and Congo red-stained fruiting bodies allowed us to verify that
nearly all megastructures (⬎99%) were found adjacent to M. xanthus fruiting bodies.
To determine whether the megastructures contained B. subtilis
and/or M. xanthus cells, we utilized transmission electron microscopy (TEM) (Fig. 3A and B) and scanning electron microscopy
(SEM) (Fig. 3C). The morphology for M. xanthus spores is characterized by electron-dense material comprised of lipid bodies
and/or polyphosphate particles (28, 29), making these dormant
cells easily distinguishable from spores generated by B. subtilis. We
harvested structures from the agar surfaces following 4 days of
predation. TEM revealed that the majority of cells were B. subtilis
cells at different stages of endospore development embedded
within a matrix (Fig. 3B). In association with the M. xanthus
spores, we also observed horizontal layers of matrix and secreted
membrane vesicles, like those seen within M. xanthus fruiting
bodies, as previously described (28, 30, 31). When we examined
the junction between the neighboring fruiting body and the megastructure using TEM, we could identify a region where M. xanthus spores and B. subtilis spores were juxtaposed. The region of
the megastructure containing B. subtilis spores contains cells at
various stages of endospore formation. It is worth noting that
there appears to be a small region between the M. xanthus spores
and the B. subtilis spores that was devoid of cells (Fig. 3A) and that
may define a boundary between the fruiting body and the me-
Applied and Environmental Microbiology
aem.asm.org
205
Downloaded from http://aem.asm.org/ on April 11, 2015 by Univ of North Dakota
FIG 1 Interspecies interactions between M. xanthus and B. subtilis induce
megastructure formation. The predator M. xanthus (strain DZ2) and potential
prey strains of B. subtilis (ancestral parent strain NCIB3610 and pksL and
spoIVA mutants) were prepared as described in Materials and Methods,
mixed, and spread onto CFL agar plates as described in Materials and Methods.
Branched megastructures (S) are approximately 500 ␮m in diameter and develop only at later time points when the predator has been mixed with the prey
source. M. xanthus forms fruiting bodies (F) in areas where prey has been
consumed. Structures generated by the spoIVA mutant do not mature and
collapse (CS). Cells from each strain were plated alone as controls. The patterns, ridges, and mounds observed with B. subtilis are due to the high cell
densities spread on the agar surface. Bar, 0.5 mm.
Müller et al.
removed from the agar surface after 3, 5, and 8 days, disrupted, and plated on
strain-selective medium to obtain CFU from spores. Dark gray bars, number
of spores made by the ancestral parent B. subtilis NCIB3610; light gray bars,
pksL mutant spore formation.
FIG 3 TEM and SEM analysis of B. subtilis megastructures. Samples were
prepared as described in Materials and Methods. (A) A thin layer cut through
a megastructure of B. subtilis NCIB3610 that was situated on top of an M.
xanthus fruiting body. Regions containing spores from either M. xanthus or B.
subtilis are indicated at the left. The red square highlights an area where M.
xanthus spores were found and is shown enlarged on the right. Myxococcus
spores (S), matrix (M), and membrane vesicles (V) are also visible. (B) (Left) A
section containing B. subtilis spores embedded within a matrix; (right) different aspects of endospore formation are apparent. (C) Scanning electron microscopy of 4-day-old megastructures reveals that developing cells and/or
spores (B. subtilis NCIB3610) are embedded within a dense matrix material.
Samples were prepared as described in Materials and Methods and analyzed at
different magnifications: ⫻10,000 (left) and ⫻20,000 (right).
gastructure. SEM reveals that B. subtilis spores/cells are embedded
within a dense matrix component (Fig. 3C).
To directly determine the amount of spores within the megastructure, we examined megastructures made by NCIB3610 and
the pksL mutant strain (chloramphenicol resistant). The M. xanthus strain used for this experiment (strain JK3346) is a kanamycin-resistant derivative of the wild-type strain DZ2. The megastructures were removed from the agar surface with a needle
and disrupted using a tissue grinder. Serial dilutions were plated
on selective medium prior to and after heat shock treatment to
eliminate vegetative cells. LB agar was used for NCIB3610, and LB
agar with chloramphenicol was used for the pksL mutant strain.
Incubation was at 37°C. M. xanthus does not grow on LB agar
plates at 37°C. To identify M. xanthus, serial dilutions were plated
onto CYE agar plates within top agar containing kanamycin. Relatively few CFU of M. xanthus were found, and those cells that
were found were likely due to contamination from fruiting bodies
adjacent to the megastructure. Overall, the quantification of vegetative cells and spores from the megastructures indicated that the
total number of spore CFU increased over the time course of the
predation assay (Fig. 4), consistent with the continued process of
endospore formation by B. subtilis. These data indicate that megastructures are primarily comprised of B. subtilis cells undergoing sporulation.
206
aem.asm.org
Endospore maturation is required to maintain the integrity
of the megastructures. Spores generated from either ancestral or
laboratory (domesticated) strains that are otherwise wild type for
endospore formation were found to be resistant to predation (7).
Therefore, we expected that mutants defective in spore production would be susceptible to predation, possibly altering formation of the megastructure. To test this possibility, cells from a B.
subtilis spoIVA mutant were challenged with prolonged exposure
to M. xanthus predation. The spoIVA mutant cells are defective in
spore coat production and are unable to complete sporulation
(32). When challenged with predation by M. xanthus, the spoIVA
mutant cells initiated formation of megastructures, but they were
fewer in number relative to the number formed by the parent
strain and they failed to maintain the integrity of those megastructures over the course of a few days (Fig. 1). The spoIVA mutant
megastructures became translucent and collapsed onto the agar
surface after about 3 days (Fig. 1, 2, and 5). This result suggests
that production of viable spores is important for the maturation
and integrity of the megastructure.
Bacillaene (encoded by the pks locus) transiently protects B.
subtilis cells from predation by M. xanthus (7). Thus, we predicted
that the pksL mutant, deficient for bacillaene production, would
be unable to generate megastructures. However, in contrast to
both the parent and spoIVA mutant cells, the pksL mutant cells
commenced megastructure formation at earlier time points (Fig.
1) and in larger amounts. The pksL mutant megastructures were
also highly branched in form, similar to those produced by the
parent strain. We note that the pksL mutant cells are more susceptible to predation in standard predation assays yet are also capable
of forming mature endospores (7). Thus, we conclude that megastructure formation under the conditions of this assay is independent of the production of bacillaene and occurs more rapidly
to facilitate long-term survival for the pksL mutant cells via sporulation within the megastructure.
B. subtilis megastructures house viable spores for subsequent germination. The results presented above suggest that the
megastructure provides a long-term storage facility for B. subtilis
spores. Spores should be capable of germination when environmental conditions once again become favorable for growth. Thus,
we isolated megastructures that were at least 6 weeks old and assayed for viable spores as described above. We assayed both the
pksL mutant and the parent strain by transferring individual me-
Applied and Environmental Microbiology
January 2015 Volume 81 Number 1
Downloaded from http://aem.asm.org/ on April 11, 2015 by Univ of North Dakota
FIG 4 Megastructures contain viable B. subtilis spores. Megastructures were
Predation-Induced Megastructures in Bacillus subtilis
biofilm formation by B. subtilis. Shown are photomicrographs of B. subtilis
strains plated on MSgg agar to induce colony biofilm formation (A), CFL agar
to assay colony development (B), and CFL agar in the presence of M. xanthus
to induce megastructure formation (C). Cells were prepared as described in
Materials and Methods. Many B. subtilis strains known to be defective in colony biofilm formation (e.g., sfp, epsE, sinI, and remA mutants) were capable of
generating megastructures. All photos were taken at 3 days. White bars, 1 cm
(A and B) and 0.5 mm (C).
gastructures from CFL agar onto rich medium (LB medium) to
promote the outgrowth of germinating spores (see Fig. S2 in the
supplemental material). The pksL mutant is resistant to chloramphenicol, allowing us to determine the number of CFU on LB
medium containing the antibiotic. To eliminate contamination
from vegetative cells, we first transferred the megastructures into
an Eppendorf tube with H2O and sonicated them prior to plating
on rich medium. Within 24 h of incubating the megastructures on
rich medium, we observed the outgrowth of cells, consistent with
what is expected for germinating B. subtilis endospores on rich
medium. As controls, M. xanthus cells and fruiting bodies were
assayed on LB medium and were not able to promote growth on
LB medium with chloramphenicol. Together, the results allow us
to conclude that B. subtilis spores are stably housed within the
megastructures for relatively long time periods.
Megastructure formation is genetically distinguishable from
colony biofilm formation on MSgg medium. The B. subtilis
NCIB3610 ancestral strain forms complex biofilms on solid surfaces on MSgg medium (Fig. 5A) and is also capable of pellicle
formation at air-liquid interfaces (11). To determine whether megastructures were manifestations of the B. subtilis biofilm formation described previously (10), we assayed a suite of B. subtilis
mutants known to affect colony biofilm formation on MSgg medium and CFL medium and during long-term predation assays.
First, we assayed for colony biofilm formation on MSgg medium (Fig. 5A). The NCIB3610 ancestral strain produced the prototypical biofilm on MSgg medium, while mutants defective in
matrix production (bslA, epsE, tasA, epsE tasA, sinI, and remA
mutants), surfactin production (srfAA and sfp mutants), and sporulation (spo0A and spoIVA mutants) displayed altered colony
January 2015 Volume 81 Number 1
Applied and Environmental Microbiology
aem.asm.org
207
Downloaded from http://aem.asm.org/ on April 11, 2015 by Univ of North Dakota
FIG 5 Megastructure formation is genetically distinguishable from colony
architectures, as described previously (10). Also as expected, mutations in the master regulators sinI and sinR had opposing effects
on colony biofilms (33), while the degU mutant had reduced colony biofilm formation (34) and the remA mutant was blocked for
colony biofilm formation (35). Lastly, we note that the pksL mutant formed colony biofilms very similar to those made by the wild
type (Fig. 5A). In stark contrast, however, none of the B. subtilis
strains displayed colony biofilm formation on CFL agar plates,
where megastructure formation is observed (Fig. 5B). Each of the
above-mentioned strains was then tested for its ability to generate
megastructures during the long-term predation assays. Except for
the spo0A and spoIVA mutant cells, each strain formed a megastructure, albeit variable in size, on CFL agar surfaces and did so
only in the presence of the predator, M. xanthus (Fig. 5C). From
these results, we conclude that formation of megastructures is
independent of the genes required for the synthesis and regulation
of the colony biofilm matrix.
Mutations affecting regulation of motility in M. xanthus attenuate formation of megastructures. B. subtilis megastructure
formation occurred only in the presence of predator M. xanthus
cells, indicating that an interspecies interaction is a requirement
for this type of biofilm formation. Predation entails complex multicellular behavior that involves the secretion of lytic enzymes and
secondary metabolites and coordinated motility, which enhances
the efficiency of predation (16). Decimation of a prey colony depends on the ability of the predator to outpace the prey regarding
growth; in other words, cells that can grow rapidly over an agar
surface simply escape the predator via growth (16). Thus, we hypothesized that megastructure formation by B. subtilis would be
attenuated when mutants of M. xanthus lacking the capacity to
coordinate motility were used as predators. To test this, we assayed megastructure formation with predator strains defective in
type 4 pilus-based motility (S motility), focal adhesion complexbased motility (A motility), and regulation by MglAB or the Frz
and Dif chemosensory systems.
We first tested each M. xanthus mutant in a standard insideout predation assay with either sensitive strain Escherichia coli
DH5␣ (Fig. 6A) or resistant ancestral strain B. subtilis NCIB3610
(Fig. 6B) as the prey. As expected, each M. xanthus mutant was
able to digest E. coli, as indicated by the clearing of the prey spot.
The only strain displaying a significant reduction in predation for
E. coli (where the outer edge of the original prey spot remained
intact) was the mglAB mutant. mglAB mutant cells display a hyperreversing phenotype and are therefore unable to direct motility
in response to stimuli (36, 37). In contrast, none of the M. xanthus
strains were able to efficiently consume the resistant B. subtilis
strain, as expected.
Long-term exposure to the mutant predator strains revealed a
role for coordinated motility for production of the megastructure
(Fig. 6C). While neither the ⌬pilA mutation nor the ⌬aglZ mutation alone eliminated megastructure formation, the ⌬aglZ ⌬pilA
double mutant (lacking both modes of motility) was unable to
induce megastructure formation. Similarly, the ⌬mglAB mutant
was unable to induce megastructure formation by B. subtilis
NCIB3610. Thus, an efficient and sustained predatory attack by
M. xanthus is required to induce B. subtilis to generate megastructures. While the frzE mutant was able to induce megastructure
formation, the resulting structures were smaller in size (Fig. 6C
and D), perhaps reflecting the reduction in predation efficiency
noted previously (38). Overall, these results indicate that coordi-
Müller et al.
nated motility by predator cells is required to induce megastructure formation by B. subtilis NCIB3610.
DISCUSSION
Here we show that predator-prey interactions between M. xanthus
and B. subtilis induce the latter to generate stress-resistant
megastructures filled with spores. TEM and SEM revealed that
megastructures harvested at 4 days were replete with spores but
also contained cells undergoing endospore formation. Thus, generation of the megastructure appears to be a response to the stress
of predation and allows B. subtilis cells to produce spores which
are inherently resistant to predation by M. xanthus. In this regard,
megastructure formation is part of an overall strategy allowing B.
subtilis a chance to survive predatory attacks culminating in an
escape to dormancy (Fig. 7).
While the composition of the matrix has not been determined
at this point, it appears that spores are encased in material, consistent with previous reports indicating that exopolysaccharide,
protein, nucleic acids, or some combination thereof is secreted by
cells during biofilm formation. In this case, the matrix encases
spores in a tree-like megastructure that rises from the agar surface.
Mutants defective in loci known to be required for colony biofilm
formation on MSgg medium (tasA, epsE, sinI, remA) were not
required for megastructure formation, whereas loci required for
FIG 7 Model for predator-induced megastructure formation by B. subtilis. M.
xanthus and B. subtilis engage in interspecies interactions, where B. subtilis
NCIB3610 cells transiently resist predation due to the production of the secondary metabolite bacillaene. Long-term survival for B. subtilis occurs by escape into dormancy due to the formation of spore-filled megastructures. In the
absence of suitable prey, M. xanthus undergoes development and builds sporefilled fruiting bodies (red mounds) in close proximity to the B. subtilis
megastructures.
208
aem.asm.org
production of spores (spo0A, spoIVA) were required for
megastructures to persist. Thus, in the absence of endospore maturation, M. xanthus is capable of degrading the nascent megastructure, suggesting that the matrix alone may not be enough to
deter predation. Alternatively, the spoIVA mutant may generate a
defective matrix, thereby allowing degradation by M. xanthus lytic
factors. Overall, we conclude that formation of the predationinduced megastructure follows a pathway genetically distinct
from that regulating colony biofilm formation.
The secondary metabolite bacillaene is produced by B. subtilis
and likely acts to deter M. xanthus transiently, providing time for
B. subtilis cells to complete spore production (7). The results provided here allow us to extend the argument that bacillaene deters
predator cells transiently, allowing B. subtilis cells to assemble the
megastructure, where spores can subsequently mature to avoid
predation. In support of this model, the absence of bacillaene in
the pksL mutant leads to the more rapid generation of megastructures. We surmise that the B. subtilis pksL mutant senses the stress
of predation sooner than the parent does, due to the absence of
bacillaene. Thus, the pksL mutant is premature for its developmental program due to the enhanced ability of the predator to
engage the prey.
We also found that coordinated motility by M. xanthus via
either type 4 pili or focal adhesion complexes was sufficient to
induce the formation of the megastructure. Neither the ⌬aglZ
⌬pilA mutant strain nor the ⌬mglAB mutant strain was able to
induce megastructure formation, whereas mutations generated
individually in either motility system had only modest effects.
Likewise, a mutation altering cell reversals (frzE) or altering EPS
production (difE) had only minor effects on the formation of the
megastructure by B. subtilis. Thus, it appears that sustained and
coordinated predatory attacks are required to induce B. subtilis
NCIB3610 cells to build a megastructure.
The majority of the B. subtilis megastructures were found adjacent to or even on top of M. xanthus fruiting bodies (Fig. 2A),
supporting the notion that B. subtilis utilizes structure formation
as a mechanism to avoid predation. M. xanthus forms fruiting
bodies under starvation conditions and following predation when
a step-down in nutrient availability occurs (16). Thus, as B. subtilis
cells generate the megastructure, predator cells remain behind and
Applied and Environmental Microbiology
January 2015 Volume 81 Number 1
Downloaded from http://aem.asm.org/ on April 11, 2015 by Univ of North Dakota
FIG 6 M. xanthus mutations affecting B. subtilis megastructure formation. Inside-out predation assays were conducted as described in Materials and Methods.
Mutations affecting M. xanthus motility were assayed for predation using E. coli (A) and NCIB3610 (B) as the prey, and the strains were photographed after 48
h. The same M. xanthus mutants were assayed for induction of megastructures in the presence of B. subtilis NCIB3610 and photographed at 3 days (C) or 5 days
(D). Mutations eliminating motility (⌬aglZ ⌬pilA) or severely disabling the regulation of motility (⌬mglAB) did not induce megastructure formation by
NCIB3610 cells. Black bars, 0.5 cm (A) and 0.5 mm (D).
Predation-Induced Megastructures in Bacillus subtilis
ACKNOWLEDGMENTS
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Support for this work was provided by NSF grant MCB-1244021 and the
University of Iowa Carver College of Medicine to both S.M. and J.R.K.
Additional support was provided by NIH grant GM093030 to D.B.K.
DNA sequencing was performed by the Nevada Genomics Center
(University of Nevada, Reno).
We thank Jianqiang Shao of the University of Iowa Central Microscopy Research Facility for assistance with TEM and SEM sample processing and analysis. We also thank members of the J. R. Kirby lab, with a
special acknowledgment to Susie Harris for support during the project
period.
19.
20.
21.
22.
REFERENCES
1. O’Toole G, Kaplan HB, Kolter R. 2000. Biofilm formation as microbial
development. Annu Rev Microbiol 54:49 –79. http://dx.doi.org/10.1146
/annurev.micro.54.1.49.
2. Kolter R, Greenberg EP. 2006. Microbial sciences: the superficial life of
microbes. Nature 441:300 –302. http://dx.doi.org/10.1038/441300a.
3. Burmolle M, Ren D, Bjarnsholt T, Sorensen SJ. 2014. Interactions in
multispecies biofilms: do they actually matter? Trends Microbiol 22:84 –
91. http://dx.doi.org/10.1016/j.tim.2013.12.004.
4. Lennon JT, Jones SE. 2011. Microbial seed banks: the ecological and
evolutionary implications of dormancy. Nat Rev Microbiol 9:119 –130.
http://dx.doi.org/10.1038/nrmicro2504.
5. Lazarevic V, Soldo B, Medico N, Pooley H, Bron S, Karamata D. 2005.
Bacillus subtilis alpha-phosphoglucomutase is required for normal cell
January 2015 Volume 81 Number 1
23.
24.
25.
26.
morphology and biofilm formation. Appl Environ Microbiol 71:39 – 45.
http://dx.doi.org/10.1128/AEM.71.1.39-45.2005.
Klobutcher LA, Ragkousi K, Setlow P. 2006. The Bacillus subtilis spore
coat provides “eat resistance” during phagocytic predation by the protozoan Tetrahymena thermophila. Proc Natl Acad Sci U S A 103:165–170.
http://dx.doi.org/10.1073/pnas.0507121102.
Muller S, Strack SN, Hoefler BC, Straight PD, Kearns DB, Kirby JR.
2014. Bacillaene and sporulation protect Bacillus subtilis from predation
by Myxococcus xanthus. Appl Environ Microbiol 80:5603–5610. http://dx
.doi.org/10.1128/AEM.01621-14.
Muller S, Shen H, Hofmann D, Schairer HU, Kirby JR. 2006. Integration into the phage attachment site, attB, impairs multicellular differentiation in Stigmatella aurantiaca. J Bacteriol 188:1701–1709. http://dx.doi
.org/10.1128/JB.188.5.1701-1709.2006.
Shimkets LJ. 1999. Intercellular signaling during fruiting-body development of Myxococcus xanthus. Annu Rev Microbiol 53:525–549. http://dx
.doi.org/10.1146/annurev.micro.53.1.525.
Vlamakis H, Chai Y, Beauregard P, Losick R, Kolter R. 2013. Sticking
together: building a biofilm the Bacillus subtilis way. Nat Rev Microbiol
11:157–168. http://dx.doi.org/10.1038/nrmicro2960.
Branda SS, Gonzalez-Pastor JE, Ben-Yehuda S, Losick R, Kolter R.
2001. Fruiting body formation by Bacillus subtilis. Proc Natl Acad Sci U S
A 98:11621–11626. http://dx.doi.org/10.1073/pnas.191384198.
Lopez D, Vlamakis H, Kolter R. 2009. Generation of multiple cell types
in Bacillus subtilis. FEMS Microbiol Rev 33:152–163. http://dx.doi.org/10
.1111/j.1574-6976.2008.00148.x.
Perez J, Munoz-Dorado J, Brana AF, Shimkets LJ, Sevillano L,
Santamaria RI. 2011. Myxococcus xanthus induces actinorhodin
overproduction and aerial mycelium formation by Streptomyces coelicolor. Microb Biotechnol 4:175–183. http://dx.doi.org/10.1111/j
.1751-7915.2010.00208.x.
Barger SR, Hoefler BC, Cubillos-Ruiz A, Russell WK, Russell DH,
Straight PD. 2012. Imaging secondary metabolism of Streptomyces sp.
Mg1 during cellular lysis and colony degradation of competing Bacillus
subtilis. Antonie Van Leeuwenhoek 102:435– 445. http://dx.doi.org/10
.1007/s10482-012-9769-0.
Straight PD, Fischbach MA, Walsh CT, Rudner DZ, Kolter R. 2007. A
singular enzymatic megacomplex from Bacillus subtilis. Proc Natl Acad
Sci U S A 104:305–310. http://dx.doi.org/10.1073/pnas.0609073103.
Berleman JE, Kirby JR. 2009. Deciphering the hunting strategy of a
bacterial wolfpack. FEMS Microbiol Rev 33:942–957. http://dx.doi.org/10
.1111/j.1574-6976.2009.00185.x.
Morgan AD, MacLean RC, Hillesland KL, Velicer GJ. 2010. Comparative analysis of Myxococcus predation on soil bacteria. Appl Environ Microbiol 76:6920 – 6927. http://dx.doi.org/10.1128/AEM.00414-10.
Xiao Y, Wei X, Ebright R, Wall D. 2011. Antibiotic production by
myxobacteria plays a role in predation. J Bacteriol 193:4626 – 4633. http:
//dx.doi.org/10.1128/JB.05052-11.
Berleman JE, Kirby JR. 2007. Multicellular development in Myxococcus
xanthus is stimulated by predator-prey interactions. J Bacteriol 189:5675–
5682. http://dx.doi.org/10.1128/JB.00544-07.
Bretscher AP, Kaiser D. 1978. Nutrition of Myxococcus xanthus, a fruiting myxobacterium. J Bacteriol 133:763–768.
Wu SS, Kaiser D. 1996. Markerless deletions of pil genes in Myxococcus
xanthus generated by counterselection with the Bacillus subtilis sacB gene.
J Bacteriol 178:5817–5821.
Julien B, Kaiser AD, Garza A. 2000. Spatial control of cell differentiation
in Myxococcus xanthus. Proc Natl Acad Sci U S A 97:9098 –9103. http://dx
.doi.org/10.1073/pnas.97.16.9098.
Kearns DB, Chu F, Rudner R, Losick R. 2004. Genes governing swarming in Bacillus subtilis and evidence for a phase variation mechanism controlling surface motility. Mol Microbiol 52:357–369. http://dx.doi.org/10
.1111/j.1365-2958.2004.03996.x.
Kain J, He GG, Losick R. 2008. Polar localization and compartmentalization of ClpP proteases during growth and sporulation in Bacillus subtilis. J Bacteriol 190:6749 – 6757. http://dx.doi.org/10.1128/JB.00589-08.
Wach A. 1996. PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12:259 –265.
http://dx.doi.org/10.1002/(SICI)1097-0061(19960315)12:3⬍259::AID
-YEA901⬎3.0.CO;2-C.
Singh PK, Schaefer AL, Parsek MR, Moninger TO, Welsh MJ, Greenberg EP. 2000. Quorum-sensing signals indicate that cystic fibrosis lungs
Applied and Environmental Microbiology
aem.asm.org
209
Downloaded from http://aem.asm.org/ on April 11, 2015 by Univ of North Dakota
generate fruiting bodies. We note that M. xanthus fruiting body
formation occurs only after the megastructures have begun formation above the agar surface. Thus, there appears to be a temporal component to the overall process: M. xanthus engages in predatory activity which depends on sustained coordinated behavior,
B. subtilis resists predation transiently due to production of bacillaene, B. subtilis generates the megastructure to produce and
house spores, and lastly, M. xanthus cells undergo nutrient depletion and subsequently build a fruiting body. In this way, megastructures naturally occur in very close proximity to M. xanthus
fruiting bodies. Thus, two common microbial species produce
spore-filled structures with the capacity to withstand relatively
harsh environmental conditions and ensure survival over extended periods of time.
Both M. xanthus and B. subtilis are soil-dwelling bacteria
known for their intraspecies and interspecies interactions. Intraspecies interactions for each organism result in formation of biofilms: M. xanthus produces fruiting bodies that are filled with
spores embedded within a matrix to survive nutrient-limiting
conditions (39), whereas B. subtilis forms complex colony biofilms under specific matrix-inducing conditions (11). In both
cases multiple signaling cascades coordinate motility, EPS production, and sporulation to form those biofilms (9, 10). Our results presented here indicate that direct competition for survival
induces B. subtilis to generate megastructures which may be specific to predatory advances by M. xanthus. Such specific responses
may not be unusual in the microbial world, with several examples
having been described previously. In particular, we note that B.
subtilis matrix production is mediated by members of the Bacillus
genus (40), while interactions between B. subtilis and Streptomyces
inhibited aerial hypha formation and secondary metabolite production in the latter (15, 41). Similarly, production of galactoglucan by Sinorhizobium meliloti may serve as a predation-specific
protectant against M. xanthus (42). These examples illustrate
highly specific responses by microbes to potentially lethal environmental stresses.
Müller et al.
27.
28.
29.
30.
32.
33.
34.
35.
36.
37.
38.
210
aem.asm.org
39. Pathak DT, Wei X, Wall D. 2012. Myxobacterial tools for social interactions. Res Microbiol 163:579 –591. http://dx.doi.org/10.1016/j.resmic
.2012.10.022.
40. Shank EA, Klepac-Ceraj V, Collado-Torres L, Powers GE, Losick R,
Kolter R. 2011. Interspecies interactions that result in Bacillus subtilis
forming biofilms are mediated mainly by members of its own genus. Proc
Natl Acad Sci U S A 108:E1236 –E1243. http://dx.doi.org/10.1073/pnas
.1103630108.
41. Straight PD, Willey JM, Kolter R. 2006. Interactions between Streptomyces coelicolor and Bacillus subtilis: role of surfactants in raising
aerial structures. J Bacteriol 188:4918 – 4925. http://dx.doi.org/10.1128
/JB.00162-06.
42. Perez J, Jimenez-Zurdo JI, Martinez-Abarca F, Millan V, Shimkets LJ,
Munoz-Dorado J. 2014. Rhizobial galactoglucan determines the predatory pattern of Myxococcus xanthus and protects Sinorhizobium meliloti
from predation. Environ Microbiol 16:2341–2350. http://dx.doi.org/10
.1111/1462-2920.12477.
43. Muller S, Willett JW, Bahr SM, Darnell CL, Hummels KR, Dong CK,
Vlamakis HC, Kirby JR. 2013. Draft genome sequence of Myxococcus
xanthus wild-type strain DZ2, a model organism for predation and development. Genome Announc 1(3):e00217-13. http://dx.doi.org/10.1128
/genomeA.00217-13.
44. Shi W, Kohler T, Zusman DR. 1993. Chemotaxis plays a role in the social
behaviour of Myxococcus xanthus. Mol Microbiol 9:601– 611. http://dx
.doi.org/10.1111/j.1365-2958.1993.tb01720.x.
45. Zeigler DR, Pragai Z, Rodriguez S, Chevreux B, Muffler A, Albert T, Bai
R, Wyss M, Perkins JB. 2008. The origins of 168, W23, and other Bacillus
subtilis legacy strains. J Bacteriol 190:6983– 6995. http://dx.doi.org/10
.1128/JB.00722-08.
46. Kearns DB, Losick R. 2003. Swarming motility in undomesticated Bacillus subtilis. Mol Microbiol 49:581–590. http://dx.doi.org/10.1046/j.1365
-2958.2003.03584.x.
47. Patrick JE, Kearns DB. 2009. Laboratory strains of Bacillus subtilis do not
exhibit swarming motility. J Bacteriol 191:7129 –7133. http://dx.doi.org
/10.1128/JB.00905-09.
48. Guttenplan SB, Blair KM, Kearns DB. 2010. The EpsE flagellar clutch is
bifunctional and synergizes with EPS biosynthesis to promote Bacillus
subtilis biofilm formation. PLoS Genet 6:e1001243. http://dx.doi.org/10
.1371/journal.pgen.1001243.
49. Chu F, Kearns DB, Branda SS, Kolter R, Losick R. 2006. Targets of the
master regulator of biofilm formation in Bacillus subtilis. Mol Microbiol
59:1216 –1228. http://dx.doi.org/10.1111/j.1365-2958.2005.05019.x.
Applied and Environmental Microbiology
January 2015 Volume 81 Number 1
Downloaded from http://aem.asm.org/ on April 11, 2015 by Univ of North Dakota
31.
are infected with bacterial biofilms. Nature 407:762–764. http://dx.doi.org
/10.1038/35037627.
Arnold JW, Shimkets LJ. 1988. Inhibition of cell-cell interactions in
Myxococcus xanthus by Congo red. J Bacteriol 170:5765–5770.
Hoiczyk E, Ring MW, McHugh CA, Schwar G, Bode E, Krug D,
Altmeyer MO, Lu JZ, Bode HB. 2009. Lipid body formation plays a
central role in cell fate determination during developmental differentiation of Myxococcus xanthus. Mol Microbiol 74:497–517. http://dx.doi
.org/10.1111/j.1365-2958.2009.06879.x.
Dahl JL, Fordice D. 2011. Small acid-soluble proteins with intrinsic
disorder are required for UV resistance in Myxococcus xanthus spores. J
Bacteriol 193:3042–3048. http://dx.doi.org/10.1128/JB.00293-11.
Palsdottir H, Remis JP, Schaudinn C, O’Toole E, Lux R, Shi W,
McDonald KL, Costerton JW, Auer M. 2009. Three-dimensional macromolecular organization of cryofixed Myxococcus xanthus biofilms as
revealed by electron microscopic tomography. J Bacteriol 191:2077–2082.
http://dx.doi.org/10.1128/JB.01333-08.
Evans AG, Davey HM, Cookson A, Currinn H, Cooke-Fox G, Stanczyk
PJ, Whitworth DE. 2012. Predatory activity of Myxococcus xanthus
outer-membrane vesicles and properties of their hydrolase cargo. Microbiology 158:2742–2752. http://dx.doi.org/10.1099/mic.0.060343-0.
Roels S, Driks A, Losick R. 1992. Characterization of spoIVA, a sporulation gene involved in coat morphogenesis in Bacillus subtilis. J Bacteriol
174:575–585.
Kearns DB, Chu F, Branda SS, Kolter R, Losick R. 2005. A master
regulator for biofilm formation by Bacillus subtilis. Mol Microbiol 55:
739 –749. http://dx.doi.org/10.1111/j.1365-2958.2004.04440.x.
Verhamme DT, Kiley TB, Stanley-Wall NR. 2007. DegU co-ordinates
multicellular behaviour exhibited by Bacillus subtilis. Mol Microbiol 65:
554 –568. http://dx.doi.org/10.1111/j.1365-2958.2007.05810.x.
Winkelman JT, Blair KM, Kearns DB. 2009. RemA (YlzA) and RemB
(YaaB) regulate extracellular matrix operon expression and biofilm formation in Bacillus subtilis. J Bacteriol 191:3981–3991. http://dx.doi.org
/10.1128/JB.00278-09.
Hartzell P, Kaiser D. 1991. Upstream gene of the mgl operon controls the
level of MglA protein in Myxococcus xanthus. J Bacteriol 173:7625–7635.
Spormann AM, Kaiser D. 1999. Gliding mutants of Myxococcus xanthus
with high reversal frequencies and small displacements. J Bacteriol 181:
2593–2601.
Berleman JE, Scott J, Chumley T, Kirby JR. 2008. Predataxis behavior in
Myxococcus xanthus. Proc Natl Acad Sci U S A 105:17127–17132. http:
//dx.doi.org/10.1073/pnas.0804387105.