preface - Tạp chí Khoa học Công nghệ

Transcription

PREFACE
In pursuance of the press restructuring approved by the Prime Minister and the
proposal made by the Ministry of Education and Training, the Ministry of Culture and
Information issued the Decision No 519/GP-BVHTT dated November 25th, 2002,
licensing the publication of the University of Danang journal entitled “Science and
Technology”.
The Press Bureau under the Ministry of Culture and Information issued the official
dispatch No 816/BC dated August 10th, 2006, permitting the University of Danang to
publish the “Science and Technology” every two months instead of every three months.
The National Scientific and Technological Information Centre under the Ministry
of Science and Technology issued the official dispatch No 44/TTKHCN-ISSN dated
February 6th, 2007, agreeing to grant an international standardized code, namely ISSN
1859-1531 to the UD journal “Science and Technology”.
The Press Bureau under the Ministry of Information and Communications issued
the official dispatch No 210/CBC of March 5th, 2008, allowing the UD journal “Science
and Technology” to be published in English and French in addition to the Vietnamese
publication.
On September 15th, 2011, the Ministry of Information and Communications issued
the Decision No 1487 /GP-BVHTT, granting an additional licence which permits the UD
journal “Science and Technology” to increase the publication period frequency from
every 2 months to every month and to raise the number of pages from 80 to 150 pages.
On January 7th, 2016, the Ministry of Information and Communications issued
Decision No 07 /GP-BVHTT, granting a print licence which permits the UD journal
“Science and Technology” to operate with a publication frequency of 15 issues per year
(of which 3 issues are published in English).
The UD journal “Science and Technology” has been established in view of
announcing and introducing scientific researches in the fields of teaching and training,
offering information on the domestic and foreign scientific research results that serve the
education in colleges and universities and propagating the State and Party’s guidelines
and policies in education and training as well as in scientific and technological researches.
Over the past 40 years, the UD journal “Science and Technology” has been
published as the continuity and development of the scientific information journals and
conference proceedings published at the University of Danang and its member
universities.
The journal’s editorial staff wishes to receive many-sided contributions of the
scientists and educators from within the university and from other colleges and
universities inside and outside the country so that the journal’s quality will be more and
more improved in the future.
Journal’s Editorial Staff
CONTENTS
ISSN 1859-1531 – THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
ENGINEERING AND TECHNOLOGY
Pointing error effects on performance of Amplify-and-Forward relaying fso systems using
SC-QAM signals over Gamma-Gamma atmospheric turbulence channels
Duong Huu Ai, Do Trong Tuan, Ha Duyen Trung
1
Boosting frame rate performance of fall detection system on heterogeneous platform
Nguyen Thi Khanh Hong, Le Huu Duy, Pham Van Tuan, Cecile Belleudy
6
Applying automation in remote health care
Truong Thi Bich Thanh
11
Researching on and designing temperature controller for heaters
Vu Van Thanh, Thai Van Tien
16
The effects of variable thermophysical properties on droplet evaporation in high temperature
convective flow environment
Nguyen Thi Bang Tuyen, Subhasish Mitra, Duong Viet Dung, Nguyen Vo Dao, G.M. Evans
21
A tool for unit commitment schedule in day-ahead in pool based electricity markets
Pham Nang Van, Nguyen Duc Huy, Nguyen Van Duong, Nguyen The Huu
25
Using dual formulations for correction of thin shell magnetic models by a finite element
subproblem method
Dang Quoc Vuong, Bui Duc Hung, Khuong Van Hai
30
NATURAL SCIENCES
A survey on consensus protocols in multi-agent systems
Tran Thi Minh Dung
35
Organization of a knowledge base to reuse workflow templates: an ontological approach
Nguyen Thi Hoa Hue, Le Thanh Nhan
40
A new proposed method for automatic number plate recognition
Bui Huu Phu, Trinh Hoang Hon
45
SOCIAL SCIENCES
Research on application of servperf model in assessing Viettel’s mobile internet service quality
in Danang city
Dam Nguyen Anh Khoa, Nguyen Hoang Thao Nguyen
50
Student plagiarism – causes and suggested solutions
Vu Thi Chau Sa, Nguyen Pham Thanh Uyen
55
The impact of focus on form in language teaching
Nguyen Pham Thanh Uyen
59
HUMAN SCIENCES
Strategies and functions of other-repair in English and Vietnamese conversations
Nguyen Thi Minh Hanh, Nguyen Thi Quynh Hoa
63
Linguistic features of advertisements on road safety equipment in English
Nguyen Thi Quynh Hoa, Nguyen Thi Hong Minh, Nguyen Ngoc Nhat Minh
67
Functional analysis of behavioral clauses denoting smiling in English and Vietnamese
Phan Van Hoa, Tran Huu Phuc, Nguyen Thi Tu Trinh
71
A critical discourse analysis of discursive strategies used in economic news in economist.com
and tuoitre.vn
Luu Quy Khuong, Vo Thi Hoang Ngan, Nguyen Ngoc Nhat Minh
76
Enhancing intercultural sensitivity and problem-solving skills of language learners via critical
incidents in cross-cultural communication: a constructivist approach
Ho Si Thang Kiet
83
Humor strategies in English and Vietnamese sitcoms from pragmatic perspectives
Pham Thi Thanh Ly
88
Nonverbal strategies used in closing a conversation at offices by English and Vietnamese staff
and managers
Hoang Tra My
93
Rules of switching meanings to form new words with two methods of metaphor and metonymy
in the system of modern Vietnamese
Bui Trong Ngoan, Ho Thi Duyen
98
A study of syntactic and lexical features of the introduction of English M.A. theses in linguistics
in Vietnam and Australia
Tran Thi Ngoc Phuong
101
Movement terms in English and Vietnamese conceptually metaphorical expressions of love
Ho Trinh Quynh Thu
106
MEDICAL PHARMACEUTICAL SCIENCES
Identification of the frequency of drug resistance mutations of helicobacter pylori in gastric
patients in Hai Duong provincial general hospital
Le Thi Phuong
110
ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
1
POINTING ERROR EFFECTS ON PERFORMANCE OF AMPLIFY-ANDFORWARD RELAYING FSO SYSTEMS USING SC-QAM SIGNALS OVER
GAMMA-GAMMA ATMOSPHERIC TURBULENCE CHANNELS
Duong Huu Ai1 , Do Trong Tuan2, Ha Duyen Trung2
1
VietNam Korea Friendship Information Technology College; aidh@viethanit.edu.vn
2
Hanoi University of Science and Technology; trung.haduyen@hust.edu.vn
Abstract - This paper presents the theoretical analysis of the average
symbol error rate (ASER) of free space optical (FSO) communication
system combined with multiple-input multiple-output (MIMO) relay
based on Amplify-and-Forward (AF) technique employing subcarrier
quadrature amplitude modulation (SC-QAM) signal over strong
atmospheric turbulence, which is modeled by Gamma-Gamma
distributions and pointing error. The pointing error effect is studied by
taking into account the influence of beamwidth, aperture size and jitter
variance on the ASER. The influence of the number of relay stations,
link distance and different MIMO/FSO configurations on the system’s
ASER are also discussed in this paper. The numerical results present
the impact of pointing error on the performance of systems and how
we use proper values of beamwidth and aperture to improve the
performance of such systems.
R2
R1
R c-1
Rc
Figure 1. A serial relaying SISO/FSO system
e(t) s(t) a) Source node s1 (t) e1 (t) b) Relaying node Key words - AF; atmospheric turbulence; ASER; FSO; QAM;
pointing error.
r(t) 1. Introduction
re (t) c) Destination node Free-space optical (FSO) communications have gained significant research attention due to their ability to cater to high bandwidth demand. However, the optical links are vulnerable to adverse channel conditions caused by atmospheric turbulence and pointing error [1]. The turbulence induced scintillation and misalignment-fading is modeled using the Gamma-Gamma distribution, which is suitable for moderate to strong turbulence regimes [2]. To mitigate the impact of turbulence, multi-hop relaying FSO systems have been proposed as a promising measure to extend the transmission links and the turbulence-induced fading. Recently, performance of multi-hop relaying FSO systems over atmospheric turbulence channels has been studied in [3-10]. We consider an AF relaying FSO system using SC-QAM signals depicted in Figure 1, with single transmitter and single receiver, in which signal from the source node S is transmitted to the destination node D serially through c relay stations R1 , R 2 ,..., R c-1 , R c . The schemes are illustrated in Figure 2, QAM symbol is first up-converted to an intermediate frequency f c . The electrical SC-QAM signal at the output of QAM modulator can be written as In this work, the ASER expressions of systems in the Gamma-Gamma atmospheric turbulence channel are analytically obtained by taking into account the influence of pointing errors represented by beam-width, aperture size and jitter variance. The SC-QAM scheme is adopted for the performance analysis. Moreover, the number of relaying stations is included in the statistical model of the combined channel together with atmospheric loss, atmospheric turbulence and pointing error. quadrature signals, respectively.ai (t ), b j (t )are the in-phase and the quadrature information amplitudes of the transmitted data symbol, respectively, g ( t ) is the shaping pulse and Ts denotes the symbol interval. The QAM signal is used to modulate the intensity of a laser of the transmitter, the transmitted signal can be written as The rest of the paper is organized as follows: Section 2 introduces the system description. Section 3 discusses the atmospheric turbulence model of AF MIMO/FSO/SCQAM systems with pointing error. Section 4 is devoted to ASER derivation of AF MIMO/FSO links. Section 5 presents the numerical results and discussion. The conclusion is reported in Section 6. 2. System description
2.1. AF relaying SISO/FSO system using SC-QAM signals
Figure 2. The source node, relaying node and destination node
of SISO/FSO systems
e(t )  sI (t ) cos(2 fc t )  sQ (t )sin(2 fc t ) (1)  ii  

where sI (t ) 
ai (t ) g ( t  iTs ) and sQ (t )   jj  
b
(
t
)
g
(
t

jT
)
are the in-phase and the  j
s


s  t   Ps 1   [ sI (t ) cos(2 f ct )  sQ (t )sin(2 fc t )] (2) where Ps denotes the average transmitted optical power per symbol at each hop and  is the modulation index. Due to the effects of both atmospheric loss, atmospheric turbulence and the pointing error, the received optical signal at the first relay node can be expressed as 

s1  t   X Ps 1   [ sI (t ) cos(2 fc t )  sQ (t )sin(2 fc t )] (3) where X presents the signal scintillation caused by atmospheric loss, atmospheric turbulence and the pointing error. At each relay node, AF module is used for signal 2
amplification as shown in Figure 2b. Due to slow turbulence changes, the DC term X Ps can be filtered out by a bandpass filter. The electrical signal output of AF module at the first relay node therefore can be expressed as e1  t   XP1 Ps e(t )  1 (t ) (4) where  is the PD’s responsivity and P1 is the amplification power of the first relaying node. The receiver noise 1 (t )
can be modeled as an additive white Gaussian noise (AWGN) process. Repeating such manipulations above, the electrical signal output of the PD at the destination node can be derived as follows c
c
re  t   Ps e(t )  i 0 2i 1 X i 1 Pi    i 0i (t ) 

(5) 2.2. AF relaying MIMO/FSO system using SC-QAM signals
error X p . They can be described as X  X l X a X p 3.1. Atmospheric loss
Atmospheric loss X l is a deterministic component and no randomness, thus acting as a fixed scaling factor over a long time period. It is modeled in [4] as X l  e L (10) where  denotes a wavelength and weather dependent attenuation coefficient, and L is the link distance. 3.2. Gamma-gamma atmospheric turbulence
For moderate to strong turbulence, the most widely accepted model is the gamma-gamma distribution, which has been validated through studies [4, 5]. The pdf of the irradiance intensity of gamma-gamma channel is given as  
f Xa  X a  
b) Relay node c) Destination node Figure 3. The source node, relay node and destination node of
MIMO/FSO systems
a) Source node In this section, we consider a general AF relaying M  N MIMO/FSO system using SC-QAM signals with M-lasers pointing toward an N-aperture receiver as depicted. The schemes are illustrated in Figure 3. The MIMO/FSO channel can be modeled by M  N matrix of M ,N
the turbulence channel, denoted as X   X mn m , n 1. The electrical signal at the input of QAM demodulator of the destination node can be expressed as M
N

M
N
c


 
2
Γ   Γ   
Xa
2
1


K   2  X a (11)
 
 
 
 exp 
 
 
1
2
0.49 2
1  0.18d
2
12 / 5
 0.56 2

7 /6
  0.51 2 1  0.69 12 / 5  5 / 6
2
2
 exp 
  1  0.9d 2  0.62 212 / 5
 


 
  1  
 
(12) 1
 
  1  
 
(13) 2
(6) c  M N

    vmn  (t )
i  0  m 1 n 1
i
where X mn denotes the stationary random process for the turbulence channel from the m th laser to the n th PD. In this system model, the instantaneous electrical SNR can be expressed as a finite sum of sub-channels as     
2  
where  ( ),  (  ) is the Gamma function and K    (.) denotes the modified Bessel function of the second kind. The positive parameter  represents the effective number of large-scale cells of the scattering process, and the positive parameter  represents the effective number of small-scale cells of the scattering process in the atmospheric. c


re  t   Ps e(t )     X i 1 mn2i 1 Pi 
 m1 n1 i 0

(9) 2

 imn  In Eqs. (12) and (13), d  kD /4L where k  2 / is the wave number,  is the wavelength, L is the link distance, and D is the receiver aperture diameter, and  2 is the Rytov variance, it expressed by [4]  22  0.492Cn2 k 7 / 6 L11/ 6 where C is the refractive-index structure parameter. Through c relay stations, there are ( c  1) turbulence channels, The pdf of X c 1 is as follows:  
(7)  m 1 n 1 i  0
where  imn is the random variable defined as the instantaneous electrical SNR component of the sub-channel from the mth laser to the nth PD, it can be expressed as 2
c
 1

2 i 1
2
 MN  Ps  X i 1 Pi 
c
i 1
   X   
  i 1 
N0
 i 0

(14) 2
n
f X mn

c 1
X mn
2  
   2
2
   c  1 Γ   Γ    X

mn
2
c
 K   2  X mn
(15) 
3.3. Pointing error model
(8) where  is defined as the average electrical SNR. 3. Atmospheric turbulelce models with pointing error
In Eqs. (7) and (8), X is the channel state. X models the optical intensity fluctuations resulting from atmospheric loss X l , atmospheric turbulence fading X a and pointing A statistical pointing error model is developed in [7, 8], the pdf of X p is given as [7] fX (X p ) 
p
2
2
A0
2
 2 1
Xp
,
0  X  A0 (16) where A0   erf (v ) is the fraction of the collected power at radial distance 0, v is given by v   r / ( 2 z ) with r and  z respectively denote the aperture radius and the beam ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
waist at the distance z and    zeq / 2 s , where the equivalent beam radius can be calculated by [7]  zeq   z (  erf( v ) / 2 v  exp(  v 2 ))1/ 2 (17) Pe ( )  1  1  2q( M I )Q( AI )   1  2 q( M Q )Q( AQ  )  (24) 


where q ( x)  1  x1, Q ( x ) is the Gaussian Q-function, 3.4. Combined channel model
We derive a complete statistical model of the channel considering the combined effect of atmospheric turbulence, atmospheric loss and pointing error. The unconditional pdf of the channel state is obtained [8, eq. (17)]. fX
 X    fX Xa  X
where f X
X
Xa
X a  fX
a
 X a  dX a (18) X a  denotes the conditional probability given a turbulence state, and it can be expressed by [8]. 
(19)  X a .Xl
 X a .Xl 
As a result, we can derive the unconditional pdf. The pdf can be expressed by 1
fX X  X Xa  
a
2
fX ( X ) 
2
( )
( c  1)( A0 X l )





(   )/ 2
2
X
2
 1

 ( )(  )
(   )
1 2  c
Xa 2
K  
(20) (2  X a )dX a
 
c1
2
1c

X  2
fX ( X ) 
 

A0 X l 
(c  1)( A0 X l )( )( ) 

 (21)   2
1
  c


X
3,0
2
 G1,3











 A0 Xl 

  2  c,
,

2
2
2 
 ( )
Eq. (21) can be further simplified using [12, eq. (9.31.5)] as fX ( X ) 

2
( )
c 1
( c  1)( A0 X l ) ( )  (  )
3,0
 G1,3


2
X


2
A0 X l   1,   1  c ,   1  c 


(22) 4. Aser calculation
We can derive the average symbol error rate of AF relaying MIMO/FSO/SC-QAM, which can be generally expressed as Pse 


quadrature to in-phase decision distance ratio, M I and M Q are in-phase and quadrature signal amplitudes, respectively. Eq. (24) can further be written as follows Pe ( )  2q( M I )Q( AI  )  2q( M Q )Q( AQ  )
4q ( M I )q ( M Q )Q( AI  )Q( AQ  )

0
Pe ( ) f ( ) d  (23) (25) Assuming that MIMO sub-channels’ turbulence processes are uncorrelated, independent and identically distributed, according to Eq. (8), Eq. (22) and formula contact between probability density function, we obtain the pdfs of AF relaying MIMO/FSO systems over gammagamma channel as f
mn
c 1
( mn2 ) 
2
 ( )
c 1
1
(c  1)( A0 X l ) ( ) (  )
2
2

(26) ( /  )0.5 
3,0


 G1,3
A0 X l  2  1,   1  c,   1  c 


Substituting Eq. (25) and Eq. (26) into Eq. (23), the ASER of the systems can be obtained as 
The modified Bessel function of the second kind K     . can be expressed as a special case of the Meijer G-function, given by the following relationship [11] , 1/2

Pse ( )  2q( M I ) Q( AI  ) f ( )d   2q(M Q ) Q ( AQ  ) f ( )d 
X / X l A0
1/2

AQ  6r2 / (MI2 1)  r2 (MQ2 1) , in which r  d Q /d I as the X
fX 
p

AI  6/ (MI2 1)  r2 (MQ2 1)
Q ( x)  0.5erfc( x/ 2), 1/ 2
where, z  0 1   (  L / 02 ) 2  with  0 is the 

transmitter beam waist radius at z  0,   (1  202 )/02 and  0  (0.55C n2 k 2 L )  3 / 5 is the coherence length. 3
0
0
(27) 
4q( M I )q( M Q ) Q( AI  )Q( AQ  ) f ( )d 
0
5. Numerical results and discussion
Using previous derived expressions, Eq. (26) and Eq. (27), we present numerical results for ASER analysis of the AF relaying MIMO/FSO systems. The systems’s ASER can be estimated via multi-dimensional numerical integration with the help of the MatlabTM software. Relevant parameters considered in our analysis are provided in Table 1. In Figure 4, the system’s ASER is presented as a function of transmitter beam waist radius under several of number relay stations. In these figures it is clearly depicted that for a given condition including specific values of number relay stations, aperture radius and average SNR, the minimum of ASER can be reached to a specific value of  0 . This value is called the optimal transmitter beam waist radius. Apparently, the more the value of transmitter beam waist radius comes close to the optimal one, the lower the value of system’s ASER is. Table 1. Sysem parametters and constants
Symbol
Value
Laser Wavelength Parameter
λ 1550 nm where Pe ( ) is the conditional error probability (CEP), Photodetector responsivity ℜ 1 A/W   nm , n1,..., N , m1,..., M  is the matrix of the MIMO/FSO Modulation Index channels. For using SC-QAM modulation, the conditional error probability presented as Total noise variance  N0
10-7A/Hz 1 4
0
In-phase/Quadrature signal amplitudes M I / MQ
8/4 Index of refraction structure C n2 31014 m2/3 0
Average symbol error rate, ASER
10
-1
10
c = 0
-2
10
10
SISO/FSO
-2
10
2x2MIMO/FSO
-3
10
4x4MIMO/FSO
s = 0.10m, c = 0
-4
10
s = 0.08m, c = 0
s = 0.10m, c = 1 (PAF = 3.5dB)
s = 0.08m, c = 1 (PAF = 3.5dB)
-5
c = 1 (PAF = 3.5dB)
10
0.04
-3
0.045
0.05
10
 s = 0.09m
 s = 0.08m
 s = 0.07m
-4
10
0.01
0.015
0.02
0.025
0.03
0.035
0.065
0.07
0
10
0
10
-1
SISO/FSO
-2
10
2x2 MIMO/FSO
Figure 4. ASER performance versus transmitter beam waist
radius0 for various values of  s with the aperture radius
r  0.065m, the average SNR = 23 dB and L  1000 m.
SISO/FSO
-1
10
-2
10
4x4 MIMO/FSO
-3
10
-4
10
Relay stations, c = 0
Relay stations, c = 1, PAF = 3.5dB
2x2MIMO/FSO
-3
10
-5
10
1000
1100
1200
1300
1400
4x4MIMO/FSO
r = 0.060m, c = 1 (PAF = 3.5dB)
0.07
0.08
0.09
0.1
0.11
1600
1700
1800
1900
2000
Figure 7. ASER performance versus link distance with of SISO,
2  2 and 4  4 MIMO/FSO systems. s  0.08 m, beam waist
radius0  0.022 m, r  0.055 m and L  1000 m.
-5
0.06
1500
Link distance, L(m)
r = 0.055m, c = 0
r = 0.060m, c = 0
r = 0.055m, c = 1 (PAF = 3.5dB)
-4
10
10
0.05
0.06
Figure 6. ASER performance against the aperture radius r for
various values of  s with the beam waist radius 0  0.022 m,the
average SNR = 23 dB and L  1000 m.
Tranmitter beam waist radius, 0(m)
10
0.055
Aperture radius, r(m)
c = 2 (P AF = 3.5dB)
-1
10
0.12
0.13
0.14
0
10
The pointing displacement standard deaviation, s(m)
Relay stations, c = 0
-1
Figure 5. ASER performance against  s for various values of
aperture radius with transmitter beam waist radius
0  0.022 m, the average SNR = 23 dB and L  1000 m.
10
SISO/FSO
-2
Figure 5 illustrates the ASER performance against the pointing error displacement standard deviation of the AF relaying MIMO/FSO systems with different MIMO configuration of 2  2 and 4  4 MIMO/FSO systems. As it is clearly shown, the system’s ASER is improved significantly with the increase of number of lasers, receivers and relay stations. In addition, the pointing error effects impact more severely on the system’s performance since higher values of ASER are gained. The impact of the aperture radius and the transmitter beam waist radius on the system’s performance is more significant in low  s regions than in high  s regions. Figure 8. ASER performance versus average SNR of SISO, 2  2
and 4  4 MIMO/FSO system. s  0.08 m,beam waist radius
0  0.022 m, r  0.055 m and L  1000 m.
Figure 6 illustrates the ASER performance against the aperture radius under various relay stations of the AF relaying MIMO/FSO systems. As a result, the system’s ASER significantly decreases when the values of aperture radius and number relay stations increase. It is found that, in low-value region when aperture radius increases, system’s ASER does not change much. However, when aperture radius exceeds the threshold value, ASER plummets when aperture radius increases. Figure 7 depicts the ASER performance as function of the transmission link distance L for various number of relay stations with different MIMO/FSO configurations. It can be seen from the figure that the ASER increases when the transmission link distance is longer. In addition, when using relay stations combined with MIMO/FSO systems, ASER will get better performance. Figure 8 illustrates the ASER as a function of the average electrical SNR for different number relay stations and different MIMO 10
2x2 MIMO/FSO
-3
10
-4
10
4x4 MIMO/FSO
-5
10
0
5
10
15
20
25
30
Signal-to-Noise Ratio, SNR(dB)
configurations. The ASER decreases with the increase of the SNR, number of relay stations and MIMO/FSO. It can be found that simulation results show a closed agreement with analytical results. 6. Conclusion
In this paper, we have theoretically analyzed the ASER of AF relaying MIMO/FSO communication systems employing SC-QAM signals over Gamma-Gamma atmospheric turbulence and pointing error.The results present the theoretical expressions for ASER performance of SISO and MIMO systems by taking into account the number of AF relay stations, MIMO configurations and the pointing error effect. The numerical results show the impact of pointing error on the system’s performance. By analyzing ASER performance, we can conclude that using proper values of aperture radius, transmitter beam waist radius, partially surmounted pointing error and number of relay stations combined with MIMO/FSO configurations
could greatly benefit the performance of such systems. [3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
REFERENCES
[1] X. Zhu and J. M. Kahn, “Free-space optical communication through atmospheric turbulence channels”, IEEE Trans. Commun., vol. 55, no. 8, pp. 1293–1300, Aug. 2002. [2] M. A. Al-Habash, L. C. Andrews, and R. L. Philips, “Mathemati-cal model for the irradiance probability density function of a laser beam [11]
[12]
5
propagating through turbulent media”, Opt. Eng., vol. 40, no. 8, pp. 1554–1562, 2001. Mona Aggarwal, ParulGarg and Parul Puri, “Exact Capacity of Amplify and-Forward Relayed Optical Wireless Communication Systems”, IEEE
Phôtnics Technology Letters, Vol. 27, No. 8, April 15, 2015. Majumdar, A. K., Ricklin, J. C., Free-space laser communications: principles and advances, New York Springer (2008) Andrews, L., Phillips, R., Hopen, C., Laser Beam Scintillation with Applications, Bellingham, WA: SPIE Press (2001). Safari, M., Uysal, M, “Relay-Assisted Free-Space Optical Communication”, IEEE Trans. Wireless Communication. (2008) 5441-5449. Arnon, S., “Effects of atmospheric turbulence and building sway on optical wireless communication systems”, Opt. Lett. 28 (2003) 129–131 Trung, H. D., Tuan, D. T., Anh, T. P., “Pointing error effects on performance of free-space optical communication systems using SC-QAM signals over atmospheric turbulence channels”, AEU-Int.
J. of Elec. and Commun. 68 (2014) 869-876 Kostas P. Peppas, “A New Formula for the Average Bit Error Probability of Dual-Hop Amplify-and-Forward Relaying Systems over Generalized Shadowed Fading Channels”, IEEE Wireless
Ccommunications Letters, Vol. 1, No. 2, april 2012. Kostas P. Peppas, Argyris N. Stassinakis, Hector E. Nistazakis, and George S. Tombras, “Capacity Analysis of Dual Amplify-andForward Relayed Free-Space Optical Communication Systems Over Turbulence Channels With Pointing Errors”, J. Opt. Commun. Netw./Vol. 5, No. 9/september 2013. Harilaos G. Sandalidis, Theodoros A. Tsiftsis, Member, and George K. Karagiannidis, Senior, “Optical Wireless Communications With Heterodyne Detection Over Turbulence Channels With Pointing Errors”, journal of lightwave technology, Vol. 27, No. 20, october 15, 2009. I. S. Gradshteyn and I. M. Ryzhik, Table of Integrals, Series, and Prod-ucts, 7th ed. New York: Academic, 2008. (The Board of Editors received the paper on 05/03/2016, its review was completed on 25/03/2016)
6
BOOSTING FRAME RATE PERFORMANCE OF FALL DETECTION SYSTEM
ON HETEROGENEOUS PLATFORM
Nguyen Thi Khanh Hong1 , Le Huu Duy1 , Pham Van Tuan2, Cecile Belleudy3
1
College of Technology, The University of Danang, Vietnam; ntkhong@dct.udn.vn; lhduy@dct.udn.vn
2
University of Science and Technology,The University of Danang, Vietnam; pvtuan@dut.udn.vn
3
University of Nice Sophia Antipolis, Nice, France; Cecile.Belleudy@unice.fr
Abstract - Heterogeneous computing platform, Zynq- 7000 all
programmable system-on-chip, not only accomplishes high
efficiency solutions in accelerating the power consumption,
execution time for implementing the Fall Detection application but
also takes the advantage of Open source Computer Vision
(OpenCV) libraries. The main goal of this work is to design and
implement the Fall Detection System on Zynq platform. In addition,
the execution time and calculated energy are extracted from the
platform implementation. Besides, the Accuracy, Recall and
Precision factors of Fall Detection System which are executed on
the computer and platform implementation are compared. Finally,
NEON optimization is used to boost the frame rate performance of
Fall Detection System on Zynq Platform.
Key words - Fall Detection; energy consumption; execution time;
boosting frame rate.
ellipse, skeleton…), silhouette tracking. Then, calculating the feature extractions í done to understand what kind behaviors of object based on one of these modeling. The problems are that these features must encapsulate unique characteristics for the same action made by different people. In order to avoid misdetection and false alarms for this system not only depends on the techniques but also confronts some challenges such as dynamic background, brightness, occlusion, static object. After tracking and extracting the object features, the problem of the system has to understand the meaning of the object actions through its features in the recognition block. 1.2. Implementation of Fall Detection Application
1. Introduction and Related works
It is necessary to have systems which can automatically monitor human activities in order to reduce the pressure on training and expanding force for health solutions. As a result, it is important to develop an automated Fall Detection application to prevent fall risk of elderly and rehabilitants and provide immediate help to them. 1.1. Fall Detection Approaches
Automatic fall detection in general can be performed by many different techniques: Indoor sensors [1], [2], [3]; Wearable sensors [4]; Video systems [5], [6], [7]. Among them, the wearable sensors help to capture the high velocities, which occur during the critical phase and the horizontal orientation during the post fall phase. However, in these methods the users have to wear the device all the time, and therefore, if it is inconvenient, it could bother them. Additionally, such systems require recharging the battery frequently, which could be a serious limitation for practical application. On the other hand, video systems enable an operator to rapidly check if an alarm is linked to an actual fall or not. A block diagram of Fall Detection based on video processing is described in Figure 1. Figure 1. Block diagram of Fall Detection application
A moving object will be extracted from background of a video clip. The moving area will be detected by using background subtraction techniques which define the different of pixels in consecutive frames. After blobbing and smoothing the object, this result will be tracked by 2D modeling such as point tracking, kernel tracking (rectangle, We now review some implementations for Fall Detection System which uses various methods. Besides, Michal Kepski and Bogdan Kwolek deploy the Kinect and accelerate-meter in fall detection system [8]. They implement this system on PandaBoard ES, which is a lowpower and low-cost single board computer development platform based on Texas Instruments OMAP4 line of processors. In addition, a method for detecting falls at homes of elderly using a two-stage fall detection system is presented by Erik E. Stone et al. [9]. The first stage of the detection system characterizes a person’s vertical state in individual depth image frames. The segmentation on ground events from the vertical state time series is then obtained by tracking the person according time. The second stage uses an ensemble of decision trees to compute a confidence that a fall precede on a ground event. Their database consists of 454 falls where 445 falls are performed by trained stunt actors and 9 are resident falls. The database is collected in nine years at the actual homes of older adults living in 13 apartments. This means that the data collection allows for characterization of system performance under real-world condition, which is not shown in other studies. Cross validation results are included for standing, sitting and lying down positions, within 4 m versus far fall locations and occluded versus not occluded fallers. Martin Humenberger et al. in [10] present a bioinspired and embedded fall detection system by the combination of FPGA and DSP. Bio-inspired means that the use of two optical detector chips with event-driven pixels is sensitive to relative light intensity changes only. The chips are used as stereo configuration which facilitates a 3D representation of the observed area with a stereo matching technique. Moreover, the stationary installed fall detection system has a better acceptance for independent living compared to permanently worn devices. The fall ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
detection is performed by a trained neural network. First, a meaningful feature vector is calculated from the point clouds. Then the neural network classifies the actual event as fall or non-fall. All processing is done on an embedded device consisting of an FPGA for stereo matching and a DSP for neural network calculation achieving several fall evaluations per second. The results of evaluation indicate that a fall detection rate of more than 96% with false positives below 5% for the pre-recorded database consisting of 679 fall scenarios. In the next section, the research objective is mentioned. Fall Detection application will be described with four steps: object segmentation, filter, feature extractions and recognition in Section 3. In Section 4 an insightful experiment of implementation and evaluation is described. Finally, Section 5 contains the conclusions of this paper. Optimized Libraries is applied. As Cortex-A9 on Zynq platform prevails in embedded designs, many software libraries are optimized for NEON and have performance improvements and cache efficiency. In our study, we extract the execution time, power consumption of whole Fall Detection System which is deployed on ARM processor of Zynq -7000 AP SoC platform. After that, NEON is used for boosting the frame rate performance of Fall Detection System. 3. Fall Detection Application
3.1. Object segmentation
Background subtraction is method used to detect moving object. This method detects and distinguishes object or foreground with the rest of the frame called background [12] by subtracting current frame to estimated background [13]. The estimated background is update as follows: 2. Research objective
In this study, the Fall Detection System in High Level Languages specified in C/C++ integrated OpenCV, crosscompiled along with libraries which implement the communication Application Programming Interfaces (APIs) and runtime layer using gcc/g++ toolchains are designed. The toolchains generate an.elf file downloaded to the processor ARM Cortex A9 on Zynq platform supported by SDK tools. Our system is executed by the configuration of image resolutions, frequencies of processor cores. The recognition rate is then evaluated and compared with other system. For designing and implementing our Fall Detection System on Zynq platform, the case study is presented as follows:  Input video is recorded by the Camera Web CamPhilips SPC 900NC 1 that is mounted on the wall at the distance of 3m from the floor.  Resolution of input video: 320x240 pixels, 680x480 pixels.  Core frequency: 222 MHz, 333MHz and 667 MHz.  Output: warning signal (FALL or NONFALL), execution time, energy consumption. 7
Bi 1  aI i  (1  a) Bi (1) Where B i is current background, B i+1 is a updated background, and a is update coefficient and is kept small to prevent artificial tails forming behind moving objects. In the study, an average of 3 consecutive frames is used instead of the current frame Ii Bi 1  (1  a ) Bi  a
1
3
i

Ij (2) j j 2
Where α is chosen 0.05 as in [12]. Figure 2a and Figure 2b show the input frame and the the result of background after estimating. Moving object is estimated by subtracting the current frame from background and comparing with threshold value τ. Pixels are considered if | I i  Bi |  (3) Where is τ is predefined threshold. The result after being compared to τ is described in Figure 2c Moreover, the recognition parameters such as Accuracy, Recall and Precision are compared based on computer and Zynq platform. The configuration of computer is described as follows: 


(a)
CPU: Intel Core i3 2.6Ghz Ram: 2GByte Operating System: Windows 7 And the characters of Zynq platform are: The Zynq®7000 XC7Z020 CLG484 -1 AP SoC is a product based on the Xilinx All Programmable SoC architecture. It integrates a feature-rich dual-core ARM® Cortex™-A9 based processing system (PS) and 28 nm Xilinx programmable logic (PL) in a single device. The ARM Cortex-A9 CPUs are the heart of the PS and also include on-chip memory, external memory interfaces, and a rich set of peripheral connectivity interfaces [11]. Finally, from the observed results which are extracted by implementation of Zynq platform, the NEON (c)
(d)
Figure 2. (a) Estimate Background; (b) Input Frame;
(c) Background Subtraction method; (d) GMM method.
However, the result of background subtraction process is greatly affected by shadow of the object. In order to distinguish object from background, another method of estimating background/foreground is applied. An adaptive Gaussians mixture model (GMM) that was proposed by 1
(b)
http://www.p4c.philips.com/cgi-bin/dcbint/cpindex.pl?ctn=SPC900NC/00&scy=gb&slg=en 8
Stauffer and Grimson at [16] is applied here. In this work, the values of a particular pixel over time is considered as a “pixel process”, and each pixel is modeled by a mixture of K Gaussian distributions, which is used to estimate that pixel belongs to foreground or background. Thanks to probability distribution, GMM method could produces a better result than Background subtraction, even in the case of shadow caused by object (Figure 2d). is considered as the velocity of the moving object. The equation of Cmotion is described as follows. And Figure 4 shows Motion History Image in case of moving and falling. 3.2. Morphology Filter
Morphology Mathematic (MM) methods are used to improve the quality of image from the object binary image. Some of MMs are dilation, erosion, opening, closing or the combination of these. 3.3. Body modelling and features extraction
3.3.1. Ellipse model
Ellipse model is a simple model describing the motion or other factors of object like velocity, location, or the shape of the human body. In this model, a single object is surrounded by an ellipse that represents human body. Three main and important parameters are considered in an ellipse model as follows [5]: a. Centroid of ellipse
It is the location O(Ox, Oy) or the centroid coordinates of ellipse each frame, and it is calculated as an average of all x coordinates and all y coordinates of white pixels in binary image. b. Vertical angle of the object
Figure 4. Motion History Image
c. Deviation of the angle (Ctheta)
Ctheta is standard deviation of vertical angle calculated from 15 successive frames. Ctheta is usually higher when a fall occurs [5]. d. Eccentricity
Eccentricity e at current frame is computed: e  1
(9) a2
Where a, b is semi-major and semi-minor axis of ellipse perspective. e is smaller when direct fall happens e. Deviation of the centroid.
Ccentroid is standard deviation of centroid coordinates calculated from 15 continuously frames. Ccentroid falls rapidly when a fall occurs. 3.3.3. Recognition based on Template Matching
It presents the angle of object. It is also the angle between the major axis of ellipse and horizontal line. Figure 3. walking Cross fall Direct fall Theta
150
100
50
78.590
88.9022
Figure 3. Current angle of an object
CMotion
0
0
c. Major and minor axis of the object:
O 1 is the average of all x coordinates and the all y coordinates of white pixels which have a limited angle so Current angle is vertical angle of the ellipse which presents the object [5]. b. Coefficient of motion
This is also known as an image of motion history and 20
a)
25
30
35
40
5
10
15
20
b)
25
30
35
40
5
10
15
20
c)
25
30
35
40
5
10
15
20
d)
25
30
35
40
5
10
15
30
35
40
10
0.8
0.6
0.4
0.2
15
CCentroid.
a. Current angle
15
20
0
0
3.3.2. Feature extraction
5 major features are extracted from ellipse model of moving object and binary image: 10
1
Eccentricity

have a limited angle so that | W O h  (   / 2) | 600 . 0.4
0.2
0
0
0
0
0
that | W O h   | 60 and O2 is the average of all x coordinates and the all y coordinates of white pixels which 5
1
0.8
0.6
30
CTheta
Major and minor axis are twice as much as the distance from centroid of ellipse O to O1 and O2 respectively, in which: 
b2
10
5
0
0
20
25
Time - frame
e)
Figure 5. Feature evolution for walking, fall-down in two direct
Five extracted features from extraction block will be reasonably combined to recognize fall action. First, suitable thresholds are indicated through training process. A decision is estimated based on combination of some features with appropriate rules. This will be applied in test process to recognize action. From training, some rule are applied as follows: Theta and Cmotion are necessary in all case of data because there is a major change in two features when fall-behaviors occurs. So the combination of two features could effectively distinguish fall from non-fall behavious of old people such as walking, bending, sitting or lying in the bed; Eccentricity plays a key role in direct fall detection because other features are difficult to recognize in this case. More specific information of each case is shown in Figure 5. 4. Implementation & Evaluation
4.1. Platform implementation
4.1.1. Classification Performance
The DUT-HBU database [5] is used in this system. All video data are compressed in.avi format and captured by a single camera in a small room with the changeable conditions such as brightness, objects, direction of camera, etc. Database: the fall direction is subdivided into three basic directions: Direct fall: object falls face to the camera; Cross fall: occurs when the object falls cross to the camera; Side fall: the object perpendicularly falls to the both sides of the camera. In terms of non-fall videos, usual activities which can be misrecognized with fall action such as lying, sitting, creeping, bending are also classified into three directions above. 9
DUT-HBU database [5]. Figure 6 presents the comparison of these parameters which are executed on computer and implemented on Zynq platform. The result of computer is higher about 8% than Zynq platform. However, the Recall, Precision and Accuracy are achieved by 90.5%, 86.2% and 87.1%. These parameters are considerably improved compared with the same of study in [14]. 4.1.4. Experiment results for the Fall Detection System on
platform
In our study, the measurement of power is taken by the Fusion Digital Power Designer GUI. The TI USB Adapter includes Power Management Bus (PMBus). PMBus is an open standard power-management protocol. This flexible and highly versatile standard allows for communication between Zynq platform and PC based on both analog and digital technologies and provides true interoperability, which will reduce design complexity and shorten time to market for power system designers. The Table 1 shows the power and energy consumption at various image resolutions and frequencies. 4.1.2. Classifying Evaluation
ROC (Receiver Operating Characteristics) is one of the methods to evaluate the efficient and accuracy of a system by calculating the Precision (PR), Recall (RC) and Accuracy (Acc). See in the Equation 10. TP
TP
PR 
; RC 
;
TP  FP
TP  FN
(10) TP  TN
Acc 
TP  TN  FP  FN
Where TP, TN, FN, FP are defined as follows: True positives (TP): amount of fall actions which are correctly classified as fall. False positives (FP): amount of non-fall actions which are wrongly considered to be fall. False negatives (FN): amount of fall actions which are wrongly rejected and classified as non-fall actions. True negative (TN): amount of non-fall actions which are correctly classified as non-fall. 4.1.3. Recognition performance
In this study, Template Matching algorithm is used in recognition block. We combine five features: , Ctheta, Cmotion, Ccentroid, e and four models of the fall to detect a fall event. In some case, the models are not enough to describe all cases when falls may occur. The recognition parameters such as Recall, Precision and Accuracy are calculated by using the clear data set in Figure 6. The results of Template Matching Algorithm.
Table 1. The Power/Energy of Fall Detection System on platform
Image
resolution
320x240
640x480
Frequency
(MHz)
667
333
222
667
333
222
Power
mW
420
304.55
254.55
437.27
323.64
269.09
Energy
mJ
45.11
65.26
79.83
188.73
268.68
335.39
4.1.5. NEON for boosting performance
Xilinx Zynq®-7000 AP SoC platform is an architecture that integrates a dual-core ARM®Cortex™-A9 processor, which is widely used in embedded products. Both ARM Cortex-A9 cores have an advanced single instruction, multiple data (SIMD) engine, also known as NEON. It is specialized for parallel data computation on large data sets. Parallel computation is the next strategy typically employed to improve CPU data processing capability. The SIMD technique allows multiple data to be processed in one or just a few CPU cycles. NEON is the SIMD implementation in ARM v7A processors. Effective use of NEON can produce significant software performance improvements [15]. SIMD is particularly useful for digital signal processing or multimedia algorithms, such as: Block-based data 10
processing; Audio, video, and image processing codecs; 2D graphics based on rectangular blocks of pixels; 3D graphics; Color-space conversion; Physics simulations; Error correction. The NEON to optimize Open Source Libraries such as ffmpeg and OpenCV is applied in this study. The Table 2 describes the improvement of average execution time and frame rate of two implementation stages on Zynq Platform. 5. Conclusion and Future works
[3]
[4]
[5]
[1]
In this paper, a Fall Detection Application is implemented on Zynq-7000 AP Soc platform with two video input resolutions and various frequencies. Its recognition performance has been evaluated and compared with the other system in terms of recall, precision and accuracy. The platform implementation of the application shows an average accuracy of almost over 85%. We also measure on-line power consumption and execution time of this system. Besides, the NEON optimizes Open source libraries to improve the frame rate performance with maximum number of 3fps In this system, we can use the other method such as accelerating on hardware, hardware/software co-design. [6]
[7]
[8]
[2]
Table 2. Frame rate improvement by using NEON
Frequency Average execution time(ms) Frame rate (fps)
Image resolution
320x240
640x480
(MHz)
Standard
NEON
[9]
Standard NEON
667
96.5
75.5
10.4
13.2
333
182
163.2
5.5
6.1
222
277.4
255.1
3.6
3.9
667
395.7
358.6
2.5
2.8
333
761.5
690.3
1.3
1.4
222
983.5
923.8
1
1.1
[10]
[3]
[11]
REFERENCES
[1]
[2]
A. Sixsmith, N. Johnson, and R. Whatmore, “Pyroelectric IR sensor arrays for fall detection in the older population”, Journal of Physics
IV (Proceeding), vol. 128, pp. 153–160, Sep. 2005. T. Pallejà, M. Teixidó, M. Tresanchez, and J. Palacín, “Measuring gait using a ground laser range sensor”, Journal of Sensors (Basel), vol. 9, no. 11, pp. 9133–9146, Jan. 2009. [12]
[13]
Y. Zigel, D. Litvak, and I. Gannot, “A method for automatic fall detection of elderly people using floor vibrations and sound-proof of concept on human mimicking doll falls”, IEEE Transaction on
Biomedical Engineering, vol. 56, no. 12, pp. 2858–2867, Dec. 2009. M. Tolkiehn, L. Atallah, B. Lo, and G.-Z. Yang, “Direction sensitive fall detection using a triaxial accelerometer and a barometric pressure sensor”, Conference Proceeding of IEEE Engineering in
Medicine Biology Society, vol. 2011, pp. 369–372, Jan. 2011. Y. T. Ngo, H. V. Nguyen, and T. V. Pham, “Study on fall detection based on intelligent video analysis”, International Conference on
Advanced Technologies Communication, pp. 114–117, Oct. 2012. E. Auvinet, F. Multon, A. Saint-arnaud, J. Rousseau, and J. Meunier, “Fall Detection with Multiple Cameras : An Occlusion-Resistant Method Based on 3-D Silhouette Vertical Distribution”, IEEE
Transaction on Information Technology in Biomedicine, vol. 15, no. 2, pp. 290–300, 2011. S. Gasparrini, E. Cippitelli, S. Spinsante, E. Gambi, and U. Politecnica, “A Depth-Based Fall Detection System Using a Kinect® Sensor”, Journal of Sensors, vol. 14, pp. 2756–2775, 2014. M. Kepski and B. Kwolek, “Human Fall Detection Using Kinect Sensor”, in Proceedings of the 8th International Conference on Computer Recognition Systems CORES, 2013, pp. 743–752. E. E. Stone and M. Skubic, “Fall detection in homes of older adults using the Microsoft Kinect”, IEEE J. Biomed. Heal. informatics, vol. 19, no. 1, pp. 290–301, Jan. 2015. M. Humenberger, S. Schraml, C. Sulzbachner, A. N. Belbachir, A. Srp, and F. Vajda, “Embedded fall detection with a neural network and bio-inspired stereo vision”, in IEEE Computer Society
Conference on Computer Vision and Pattern Recognition
Workshops (CVPRW), 2012, pp. 60–67. M. Kepski and B. Kwolek, “Fall Detection on Embedded Platform Using Kinect and Wireless Accelerometer”, Proceedings of the 13th
International Conference on Computers Helping People with
Special Needs, vol.2, pp. 407–414, 2012. A.M. McIvor, “Background subtraction techniques. In Proc. Of Image and Vision Computing:, Auckland, New Zealand,2000. A. Derek, James M.Keller, Marjorie Skubic, Xi Chen, and Zhihai He, “Recognizing Falls from Silhouettes” Proceedings of the 28th IEEE EMBS Annual International Conference New York City, USA, Aug 30-Sept, 2006. Hong Thi Khanh Nguyen,, Cecile Belleudy, Pham Van Tuan, “Fall Detection Application on an ARM and FPGA Heterogeneous Computing Platform”, International Journal of Advanced Research
in Electrical, Electronics and Instrumentation Engineering, Volume 3, pp 11349-11357, 20 August 2014. Haoliang Qin, “Boost Software Performance on Zynq-7000 AP SoC with NEON”, Xilinx XAPP1206, 2014. C.Stauffer, W.E.L. Grimson, “Adaptive background mixture models for real-time tracking”, IEEE Conf. Computer Vision and
Pattern Recognition vol. 2 pp. 246-252, June 23-24 1999. (The Board of Editors received the paper on 13/04/2016, its review was completed on 22/05/2016)
11
APPLYING AUTOMATION IN REMOTE HEALTH CARE
The University of Danang, University of Science and Technology; ttbichthanh@gmail.com
Abstract - The increasing cost of aging population and dependants
has now become a growing concern. However, the advancement
of science and technology, especially of information technology,
has created opportunities to improve health care services. This is
also a motivation for new researches designed to supplement the
capabilities of the elderly as well as the disabled to ensure that they
can maintain a healthy and independent lifestyle in their own
homes as long as possible. In the present context, the research in
this paper presents an idea for health care services at home via an
analysis of users’ habits. Existing home entertainment tasks and
other activities are regarded as built-in sensors. Based on the
modeling of the tasks, a reinforcement algorithm is applied to the
analysis of users’ habits. Then frequently used scenarios
supplementing user capabilities are discovered.
Home, many studies target technical support for disabled and elderly people, with the design of an intelligent environment adapted to the users’ needs [6, 7]. Key words - analysis of users’ habits; scenario; event quality;
grouping; modeling.
1.2. Our Approach
1. Introduction
According to the chapter ‘Population Division’ in [2], in 2000, 11% of the world’s elderly people aged 60 or older are 80 or more. By 2050, this rate could increase to approximately 20%. With this rapid growth rate of the elderly population, the need for services for aged and disabled people is increasing, including the need for assisted-living facilities. We also observe a trend toward maintaining people in their private homes as long as possible. This is motivated first by people’s own wishes, and second by cost reduction objectives. In this context, more and more research is being done on the monitoring of dependant people (i.e. elderly and disabled people) in their own environment, with more or less intrusive approaches such as telemonitoring or sensor techniques. These techniques will allow the residents to remain safely in their home far longer than could otherwise be expected. Our work takes place in this context, and includes two steps: i) providing the user with new services based on an analysis of his habits, namely the way he is using the home automation and multimedia services; ii) providing a low-level and non-intrusive personal supervision based on the above analysis. This paper is organized as follows: after reviewing in Section 1 the general background and our own approach, we will introduce the modeling used in our work in section 2. In section 3, we will present the analysis of our approach. Section 4 presents the test platform used for the validation of our work, and Section 5 describes the obtained simulation results. Finally, in Section 6, we will draw up some conclusions and perspectives. 1.1. Background
To determine what the elderly require, to enable them to remain in their homes as long as possible, Bargers et al. described in [3] a mixed-model framework, to develop a new probability model of behavior patterns. In the same field of research (tracking a user’s behavior), other contributions are presented in [4, 5]. In terms of Smart Most of these approaches integrate various sensors and cameras to most of the environment’s devices. However, input from users and professionals, including occupational therapists (OT), indicate that such intrusive methods are uncomfortable and therefore not easily accepted. This is an important issue since the primary objective is the user’s safety and well-being. Furthermore, the use of sensors also requires an investment in costly equipment. With the aim of contributing something new to the support and assistance of dependant people, we attempted to find a non-intrusive solution, without sensors, and based on existing services. We also used our analysis to propose an online composition of services, i.e. a proactive meta-service. In our approach, using returned services, we built up an ontology model of daily services and relevant scenarios, to model the existing home automation and multimedia system. Instead of sensors, we calculated the quality of service (QoS) and probability models, both for anomaly detection and for the day by day monitoring of the user. The QoS specification of our approach is directly based on the users’ needs and habits. With a modified reinforcement algorithm [9] presented in this paper (in Section 3), we can detect the user’s habits and offer him new automatic scenarios. Figure 1 shows the principle of our method. Occupational therapists (OTs) have an important role to play in the search for techniques to assist dependent persons. This point is often forgotten in existing approaches. Hence, in our approach, as real-life experience proves that cooperation with these professionals is essential, we integrate dependent persons and OTs into the loop. Figure 1. Scheme of service scenario adaptation
Our approach is based on two steps. The first is performed online. In the Initialization phase, with the help of an OT, we draw up a Service model from the existing home automation and multimedia system. In this online phase, the system’s design is optimized to improve the QoS, and the QoS values adapt proposed services with the help of the OT. The second phase is run online. Following the optimization of the QoS criteria, our analysis features a 12
modified reinforcement algorithm, in order to offer new scenarios. The “Proposition” phase is then validated by the OT and the user’s opinion, and the service model updated. Adding probability models to the analysis allows us to detect an anomaly, a departure from the usual user profile, and to warn the family members, doctor and OT via internet. 2. Modeling
In the context of our subject - existing home automation and multimedia services - our approach is based on the ontology of returned services. Therefore, our first important design phase is the service and scenario modeling described in this section. 2.1. Service modeling
In order to provide semantics for the various elements of the service architecture, we will give some definitions in the context of home automation and multimedia systems. - Operation: an operation is a function performed by a resource (e.g. ‘switch on light’ with a PDA, ‘turn on TV’ with a remote control). - Service is a function or a set of mutually dependent functions carried out by the user. We set for each service a Quality of Service value (QoS). We recognize two types of service: - An elementary service is a function (e.g. ‘turn off light’), or a set of mutually dependent functions (e.g. ‘open door’ consists of two mutually dependent functions ‘command open door’ and ‘door open’). An elementary service cannot be broken down into sub-services. - A scenario is made up of at least two elementary services (e.g. a ‘go out’ scenario is achieved through a set of services: ‘open door’, ‘turn off light’ and ‘close door’.) Within a scenario, according to the importance of function failure, we classify functions into two categories: - Critical function: a function is critical if its failure causes the failure of the whole scenario. - Normal function: a non-critical function. To define the status of the services, we have three service modes: - Out of order mode: the mode which causes the scenario’s failure. architecture of services, from which we can acquire the configuration of a scenario brought about by a sum of services. 2.2. Scenario graph
A set of at least two services make up a scenario; a service may contain several functions. Thus, the performance of a scenario corresponds to an ordered performance of all the functions which make up the scenario. In order to present this form of scenario, we will show the construction of a scenario graph. Beside simple services which involve only one operation such as ‘Switch on light’, ‘Turn on television’, there are complex services made up of several functions, in which the occurrence of the next function depends on the result of the previous one. For example, in order to open a door, the function ‘Unlock door’ must already be accomplished. In order to draw up a scenario graph, we need to discriminate, in the scenario, between functional dependency and ordering dependency. - Functional dependency: the term is used to express the connection between a sequence of functions performed in a predefined order. The occurrence of the next function depends on the result of the previous function in the sequence. Therefore, in order to complete this sequence, all the functions must have been executed. For example, achieving the service ‘Listen to Web radio’ depends on three functions with functional dependencies: + Go on the Internet + Connect to a selected site + Play the radio The service ‘Listen to Web radio’ implies that these three functions run correctly. - Ordered dependency: the term is used to express the connection in a sequence of normal functions in temporal order. The performance of a function does not depend on the result of a previous function. For example, we have a sequence of three functions: ‘switch on light’, ‘open shutter’, and ‘turn on television’, which is performed in temporal order one after the other, but the function ‘open shutter’ does not depend on the result of the function ‘switch on light’. With these definitions, a scenario can be presented as a functions graph as shown in Figure 2. - Deteriorated mode: the mode indicating a decrease in the scenario’s QoS without bringing the scenario to an end. - Normal mode: the mode in which all functions run normally. Each of the means by which a function can be activated is considered as a distinct operation. We therefore assume the existence of different types of resources, allowing the user to activate a service through different means. - Direct: the user accesses the resource directly, we have a type of resource or device. - Electronic: through electronic control buttons. - Domotic: through a user interface such as PDA, PC or touch screen. From these definitions, we can build up a hierarchical Figure 2. Illustration of a scenario as a function graph
In this graph, the nodes perform the functions in the scenario. The dotted edges represent the ordered dependency of two consecutive functions, whereas the ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
plain edges denote the functional dependency between two functions. Node ‘End’ and node ‘Start’ are the graph’s terminal nodes, indicating the beginning and end of the scenario. If a critical function fails, the scenario stops immediately; a point-edge to the ‘End’ node is realized. This construction makes it possible to visualize all the data contained in a scenario, such as the way a scenario is performed, critical functions within the scenario, as well as the relationship between the functions. This graph therefore enables us to describe the new scenarios provided by the analysis presented in the following section. 3. Analysis
As shown in Figure 1, with the acquired service models, our analysis consists in offering new possible scenarios and detecting anomalies. To be able to offer new scenarios with a better QoS, we need to learn the user’s habits. This is one of the main purposes of our analysis. The guiding principle of our work is shown in Figure 3. 13
corresponding to the user’s needs - or according to the OT’s opinion - (e.g. T = 30 minutes). Because the time activation between services is an important parameter in a context dealing with dependent people, the smaller the interval of time activation between services, the greater the weight of the edge. We therefore consider time intervals within the window T, in order to take into account the importance of time activation between services. The principle of this algorithm is therefore based on the computation of the weight (i, j) through the following formula: 1
=
1+
(
)
(1) ℎ
Where N is the number of time intervals in the time window T, and n is the nth interval (1 ≤ n ≤ N). Then, the value of weight(i,j) updated is given by ℎ (, )=
ℎ ( , )+
(2) Observing the above formula, it can be noted that the computed value of weight (i, j) presents an occurrence percentage for a pair of services (i, j). As a result, we obtain a graph of services in which the weight (i, j) of each pair of services (i, j), is sufficient, according to the OT’s opinion (e.g. weight (i, j) >Pthreshold). Figure 3. Our method’s guiding principle
On the basis of this graph, we can offer new scenarios by assembling possible sets out of services already existing in the graph. With these new scenarios, the user can access a set of services with a single command. If the user changes his habits, the reinforcement algorithm can learn the new behavior, and adapt the services to this change. Finally, the scenario graph can be used to present the obtained scenario in a time order corresponding to the performance time of the services in the scenario. From the chaos of services in the user’s environment, we learn the user’s habits through a modified reinforcement algorithm, and then detect the sets of usual services to be offered in new scenarios. To evaluate the proposed automatic scenarios, we need to measure how satisfactory they are in relation to the user’s needs and capabilities. It is moreover essential to quantify the advantages of the proposed scenarios. 3.1. Modified reinforcement algorithm analysis
3.2. QoS validation
Every day, the user performs various activities, among which can usually be detected habits, based on sets of services requested in a coherent way. It is well known that for disabled and elderly people with a limited movement capacity, it takes a long time to achieve a scenario consisting of several services, if they are performed separately. In order to reduce effort and to improve access to services, we collect the sets of services often performed together, through a reinforcement algorithm, and make them accessible within a scenario launched by a single command. Our algorithm is based on the graph construction. In order to validate the performance of proposed scenarios, we use the QoS criterion to assess user satisfaction as to the performance of a service. QoS is the quality of service as perceived by the user. - Vertex i: the service i. - Edge: expresses the continuity of two services i and j, each edge being characterized by a weight value (i, j) which is reinforced with each repetition of the ‘i, j’ set. In order to detect whether a pair of two services (i, j) occur, we use a time window T. Basically, we limit the search space to compact scenarios, namely scenarios providing a number of services in a short period of time. For example, we limit the T value to a predefined value In the context of home automation and multimedia systems, we take into account the user’s needs as well as the user’s ability to perceive the QoS. We therefore extract the models of QoS calculation according to user needs and user abilities as well as user habits. Since our calculation is directly related to the user’s needs, an improved QoS value should produce an improved quality of life. In this sense, a service performed automatically, through an automatic resource, must achieve a maximum QoS value. According to this definition of service modeling, the QoS of an operation, generated by the performance of a function j on a physical resource I, is given by: =
Where: ×
0 ≤ Ri ≤ 1: specific QoS resource i 0 ≤ Rj ≤ 1: specific QoS function j (3) 14
For a service consisting of a sequence of several functions in ordered dependency, the QoS is computed with the following formula: = ∑
=
(
) (4) At the scenario level, if a critical function fails, the scenario is interrupted and we obtain a zero value of QoS. Since the performance of a scenario depends on the operation of the critical function it contains, we calculate the QoS of a scenario with the following formula: =
,
(5) Where QoScritical: QoS value of all the contained critical functions in the scenario. If this principle is applied to new scenarios, once the user accepts our scenario proposal, all the services within the scenario are performed by automatic resources, offering a maximum QoS. Otherwise, the user must activate each service within the scenario manually, and the resulting QoS is lower than that of the automatic scenario. This difference in QoS is illustrated in Figure 4. simulator’s design. Basically, the simulator is used to generate typical events, derived from the user’s activities, and to show the QoS of the services requested. Since our method is built into existing home automation and multimedia systems, the simulator’s input is the list of services including probability, dependencies, resource type and criticality of the services. These profiles, based on interviews conducted by the OT at Kerpape center [1], are imported into the user’s profile data in the simulator. This simulator also has the capacity of integrating the type of dynamic analysis introduced in the previous section, to draw up better service proposals and new scenarios. This information is transmitted by internet to both the OT and the users for validation. As a result, our method can be applied to a close approximation of the user’s real daily life. The principle of the simulator is shown in Figure 5. Figure 5. Scheme of simulator design
Figure 4. The QoS difference
The above figure shows how the better QoS of the automatic scenario generates both a gain of time and a gain of effort for the user. Therefore, the QoS validation proves the relevance of new scenarios. In short, on the basis of returned services for the user, we can perform the analysis which enables us to create new scenarios with better QoS. Then, by observing the performance of the accepted scenarios over time, and in relation to the user’s habits, we can detect possible anomalies. Without using sensors, our method shows how user habits can be monitored in a non-intrusive way, and warning signs detected. At this point, before going on to actual experimentation with the users, the relevance of our models must be assessed. 4. Test plateform
4.1. Introduction
In order to test both our model and our approach of dynamically adapting the services to the user through solutions of non-intrusive monitoring, we developed a simulator using the Scilabsoftware [8]. This is an opensource equivalent of Matlab, used to simulate the user’s everyday activities. Moreover, this software enables us to create a reinforcement algorithm, and to draw up a scenario proposal graph automatically, in conjunction with the Graphvizsoftware. For these reasons, we chose a simulator for our test platform. 4.2. Simulation design
This subsection describes the principles of our As can be seen in this figure, on the basis of the profile data obtained from information on the user’s daily activities, a set of everyday services is generated, simulating a real-life period of N days. From this output, we obtain a test database enabling us to analyze the use of services and perform the QoS calculation. We then apply the reinforcement algorithm to the generated events to draw up our proposal for a new scenario. By observing the use of the accepted scenarios in the defined time period, we can detect warning signs in discrepancies with the user’s usual habits. Finally, the user profile data is updated with the accepted scenarios. Due to the attributes of profile data based on real-life observation, the generator can build up a relevant test database. Our analysis thus provides reliable results, adapted to the user’s needs. 5. Simulation results
This section describes the results of the experimental simulation. According to the simulator design diagram, the engineering of a simulation consists in the following steps: - Step 1: Specify the table of services based on real-life observation and OT advice. For example, Figure 6 illustrates this type of table: Figure 6. Table of the user’s everyday activities
- Step 2: Simulation of N days based on probability. Basically, from the probability of the need for each service, we draw up the list of the daily services required by the ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
user as shown in Figure 7. 15
forward new scenarios adapted to the change. Time
Daily activities
Resource
E14
15:00:00 Turn on computer
PC
E1
08:00:00
Switch on light
PC
E15
17:00:00 Turn off computer
E2
08:05:00
Open shutter
PC
E16
19:00:00
E3
08:10:00
Turn on TV
PC
E17
20:00:00
E4
08:15:00
Turn on hot water
PC
E18
20:30:00
E5
08:30:00
Unlock door
PC
E19
21:00:00
Turn on light ext
PDA
E6
08:45:00
Turn off TV
PDA
E20
21:15:00 Hang on telephone
PDA
E7
08:55:00
Open door
PDA
E21
21:30:00 Hang up telephone
PDA
E8
09:00:00
Switch off light
PDA
E22
21:50:00
Close shutter
E9
09:05:00
Close door
PDA
E23
22:00:00
Turn off DVD
PDA
E10
13:00:00
Open door
PDA
E24
22:00:00
Locate beb
Touch screen
E11
13:10:00
Close door
PDA
E25
22:15:00
Turn off TV
PC
E12
13:25:00
Install beb
PC
E26
22:30:00 Switch off light ext
PC
E13
14:30:00
Uninstall bed
PC
E27
22:40:00
PC
PC
Switch on light
PDA
Turn on TV
PDA
Watch DVD
PDA
Switch off light int
PDA
This paper has described a non-intrusive method with a test platform in SCILAB to detect automatically the user’s habits and to offer new scenarios. The result enables us to observe the user’s daily life without recourse to the use of sensors, and to improve the user’s quality of life while facilitating his or her use of daily services. Figure 7. Table of user profile
- Step 3: Analysis of user habits through the reinforcement algorithm and the QoS calculation. - Step 4: Offer of new services. Based on the results of Step 3, new scenarios made up of relevant services are automatically drawn up. - Step 5: User agreement. When the user accepts a new scenario, this means that the habits detected are reliable. Instead of having to activate all the services manually, the user can press one button to access the entire scenario. This reduces the user’s effort while improving his or her access to services. Figure 9. QoS value of proposed scenario
In the next step, our simulator is used to test our strategies of anomaly detection, so as to offer a complete non-intrusive monitoring of the users’ daily life. To detect anomalies, a probability model for computing the duration or delay in the use of a service is given. For real-life experiments, we plan to use an open-source Linux MCE to present the user interface – a well-adapted solution to create a genuine test environment in a user’s home or in one of the rooms. TÀI LIỆU THAM KHẢO
Figure 8. Graph of “Sleep” scenario proposal
For instance, by applying the five steps listed above with a threshold value of 50%, a ‘Sleep’ scenario has been obtained, consisting of a set of services rendered in a predefined order. This new scenario has been automatically drawn up, as shown in the scenario graph (Figure 8). Our test is based on observation, and elaborated in collaboration with OTs from Kerpape Center, a large treatment center for the disabled. This figure shows a critical “Switch off light” function. The activation of the whole scenario depends on the activation of this specific function: if it operates normally, this automatic scenario gains maximum QoS. While in manual way, obtained QoSvalue is smaller due to difficulty of user in activationaction for each service. Figure 9 shows the QoS of a proposed scenario with better value. From the simulation results, we can derive a nonintrusive observation of the user through his activities with existing home automation and multimedia systems. If the user’s behavior changes, the reinforcement algorithm makes it possible to detect these new habits, and to put [1] Kerpape mutualistic functional reeducation and rehabilitation center. [2] World population ageing 1950-2050. [3] http://www.un.org/esa/population/publications/worldageing195020
50/, 2002 [4] T.S.Barger, D.E.Brown, and M.Alwan. Health-status monitoring through analysis of behavioral patterns. IEEE Transactions on
Systems, Man, and Cybernetics, Part A, 35(1):22–27, 2005. [5] N.Kushwaha, M.Kim, D-Y.Kim, and W-D.Cho. An intelligent agent for ubiquitous computing environments: Smart home UT-AGENT. In WSTFEUS, pages 157–159. IEEE Computer Society, 2004.
[6] Dobkin, Bruce H., and Andrew Dorsch. The Promise of mHealth: Daily Activity Monitoring and Outcome Assessments by Wearable Sensors. Neurorehabilitation and neural repair 25.9 (2011): 788–
798. PMC. Web. 2 May 2016. [7] Ali Hussein and all. Smart Home Design for Disabled People based on Neural Networks.Procedia Computer Science, Volume 37, 2014,
Pages 117-126.
[8] Basma M. Mohammad El-Basioniand all. Independent Living for Persons with Disabilities and Elderly People Using Smart Home Technology. International Journal of Application or Innovation in
Engineering & Management (IJAIEM), Volume 3, Issue 4, April
2014. [9] S.Campell, J-P.Chancelier, and R.Nikoukhah. Modelingand
Simulation in Scilab/Scicos. Hardcover, 2006. [10] R.S. Sutton and A.G.Barto. Reinforcement Learning: An Introduction (Adaptive Computation and MachineLearning). Hardcover edition, 1999. (The Board of Editors received the paper on 12/04/2016, its review was completed on 15/05/2016)
16
RESEARCHING ON AND DESIGNING TEMPERATURE
CONTROLLER FOR HEATERS
The University of Danang, University of Science and Technology
vuvanthanh85@gmail.com; vantienbk@gmail.com
Abstract - This paper presents design solutions of control circuit
and temperature stability in a closed environment, in order to
increase stability and the fast response of heaters to save energy
efficiently. A PIC micro-controller is used to perform P.I.D and
ON/OFF algorithms in temperature control and stabilization.This is
the new point compared to traditional temperature stability
systems. The temperature of the heater is updated through the
PT100 temperature sensor. The output of the control system
includes the cooling fan and thermal wire to create temperature.
The output control signal is a stimulus angle control signal of the
Triac. This signal is calculated by P.I.D algorithm. The control
program of system contains the P.I.D and ON/OFF program. The
results of the paper are to evaluate the fast response, stability,
reliability and accurate control of the circuit.
2. Temperature Stable and Control System
The control system includes an heater containing a 500W thermal wire to generate heat, one PT100 temperature sensor, a sensor amplifier circuit located outside, Zero crossing detector, one Triac controller and an AC cooling fan. MCU circuit using PIC16F877A microcontroller perform PID algorithm for control of stimulus corner and ON/OFF of the Triac. Key words - PIC16F877A; PID control; ON/OFF control; Zero
Crossing; Temperature Control.
1. Introduction
Temperature control application areas are very broad, which could be as large as industrial production, aerospace or as small as our daily life. Currently, most temperature control systems use computer control technology with a microprocessor core, both improving the degree of automation of the device and the accuracy of the control. PID control is by far the most common control method. Because of its high reliability, simplicity and algorithm robustness, it is widely used in process control, especially for establishment of deterministic system of a precise mathematical model. PID control effect depends entirely on the four parameters [1], [2], namely the sampling period Ts, the proportional coefficient K p, integral coefficient K i and differential coefficient K d. Thus, the PID parameter setting and optimization are two important topics of research in the field of automatic control. PID in industrial process control applications nearly has a hundred years of history, and during this period, despite the advent of many control algorithms, thanks to the long-term use of the PID algorithm and its own characteristics, coupled with people accumulating a wealth of experience it is widely used in industrial control. In PID algorithm, the key issues lie in the setting and optimization of the three parameters of the P.I.D [3], [4]. With the continuous development of science and technology, people have increasingly high requirement for temperature control system, so temperature control system that is highly precise, intelligent and humane is the inevitable trend of development at home and abroad. The introduction, application, development and production of programmable controller begin along with the reform and opening up. The PID controller output is converted into high and low signal input control, controlling the zero trigger plate according to certain duty cycle conduction. It controls energization time of both ends of thermal resistance wire or cool fan, achieving closed-loop temperature control. Figure 1. Block diagram of the control system
Input of control system has a PT100 sensor, one sensor amplifier and zero crossing detector. C3
0.1uF
R18
4.7k
R15
R16
1k
47k
VR2
4.7k
R19
R14
50k
220k
R12
U8
220k
U9
AN0
R17
R13
1k
220k
PT100
lm358
lm358
R21
100
R20
D5
zener 5.1V
220k
Figure 2. Heat sensor and Measurement amplifier
PT100 sensor and R18, R19, R20 make up a resistor bridge; the output of this resistor bridge is put into the differential amplifier using Opamp, then further passed through the non-inverting amplifier with amplification factor adjusted by VR2. To calibrate the circuit, by replacing PT100 with 195.9Ω resistor and adjust VR2 so that the voltage will be 5V at AN0 pins. R17 and zener D5 controlling the output voltage of the amplifier is 5.1V, the load which is not connected to the sensor. When the temperature changes from 0 - 255°C, corresponding to the output voltage changes from 0 - 5V. Thus, if using an 8-bit ADC converter respectively to one,the change level of the ADC is 1°C. ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
high. The paralleling of R 10 can improve the interference resistance.
R1
R11 U1
10k 6
5
INT0
10k
1
2
Q1
2N2222
17
BR1
C1
10u
4
R4
220k
R6
C2
22k
1nF220k
V1
QUAT/NHIET TRO
220VAC
R9
R5
R10
100
2.2K
OPTOCOUPLER-NPN
BRIDGE
1
U6
6
D4
V3
DIODE
U7
2
LED-GREEN
4
220VAC
TRIAC
MOC3021
D3
Figure 3. Zero Crossing detector circuit
VDK
Zero-crossing detector is located between 02 semi period of the AC source, helping the microcontroller determine the accurate positioning to find the stimulus angle, δ = 00 of Triac. Figure 6. Isolation circuit and Triac controller
3. Control Method
The controller allows the temperature in the heater to stabilize at one pre-determined value by controlling speed of the cooling fan and the heating level of the thermal wire. 3.1. ON/OFF control
Figure 4. Zero Crossing detector signal
Experimental results from Zero Crossing detector circuit is given by Figure 5, performed on oscilloscope meter. Figure 5. Zero Crossing detector real signals
Because PIC microcontroller uses external interrupt 0 and impacts along the side down to find the location zero crossing, the signal out of detector should need reversephase versus the signals in Figure 4. An on-off controller is the simplest form of temperature control device. The output from the device is either on or off, with no middle state. An on-off controller will switch the output only when the temperature crosses the setpoint. For heating control, the output is on when the temperature is below the setpoint, and off above setpoint. Since the temperature crosses the setpoint to change the output state, the process temperature will be cycling continually, going from below setpoint to above, and back below. In cases where this cycling occurs rapidly, and to prevent damage to contractors and valves, an on/off differential, or “hysteresis,“ is added to the controller operations. This differential requires that the temperature exceed setpoint by a certain amount before the output turns off or on again. On-off differential prevents the output from “chattering” (that is, engaging in fast, continual switching if the temperature’s cycling above and below the setpoint occurs very rapidly). On-off control is usually used where a precise control is not necessary, in systems which cannot handle the energy’s being turned on and off frequently, where the mass of the system is so great that temperatures change extremely slowly, or for a temperature alarm. One special type of on-off control used for alarm is a limit controller. This controller uses a latching relay, which must be manually reset, and is used to shut down a process when a certain temperature is reached. Trigger and Triac control circuit include an opto-triac MOC3021 used to isolate stimulus signal of microcontroller with the grid power 220V/ 50Hz. =(
− )/ . Where: V F is the forward voltage of infrared light - emitting diode and it can take values from 1.2V to 1.4V; IFT is the trigger current of infrared emitting diode. If the working temperature is below 25O C, the value of IFT should be appropriately increased. R 10 is the triac gate resistor. In the case of relative high SCR sensitivity, the gate resistance is also Figure 7. ON/OFF control signal
18
3.2. PID control
A PID (Proportional-Integral-Derivative) controller is a control loop feedback mechanism commonly used in industrial control systems. A PID controller continuously calculates an "error value" as the difference between a measured process variable and a desired setpoint. The controller attempts to minimize the error over time by adjusting a control variable, such as the position of a control valve, a damper, or the power supplied to a heating element, to a new value determined by a weighted sum: ( )=
( )+
∫
( )
+
(1) Control signal of the PID controller for each sampling interval (T) is determined as; =
+(
−
)
+(
2
+
)
+( + )
(2) Where, K p , K d and K i are coefficients of proportional, integral and derivative elements, respectively. P 0 is the control signal of the previous sampling, e1 is the current error, e2 is error of previous sampling and e3 is the error of the sampling before previous sampling [5]. harmonics, the power factor presented to the a.c. supply will be less than unity except when δ = 0. For a sinusoidal current the rectified mean current, IT(AV) and the rms current, IT(RMS), are related to the peak current, IT(MAX), by equation 4. 2. (
)
= 0.637. (
( ) =
) (
)
(
=
)
√
= 0.707.
) (
Where, (
)
=
(
)
=
√ . (
)
Flowchart of the program is shown in Figure 9: Figure 8. Phase controller - resistive load
The sequence is repeated giving current pulses of alternating polarity which are fed to the load. The duration of each pulse is the conduction angle α, that is (180 - δ)˚. The output power is therefore controlled by variation of the trigger angle δ. For all values of α other than α = 180˚ the load current is non-sinusoidal. Thus, because of the generation of (4) 4. Experimental Results
The control program is written in C codes and converted to hexadecimal codes by the PIC.C software. Hex codes are transferred to the PIC by a programmer that we have formed according to the scheme below [6]. Application of PID to control temperature stability is to calculate stimulus angle for Triac by the phase angle control method. The operation of a phase controller with a resistive load is the simplest situation to analyse.Waveforms for a full wave controlled resistive load are shown in Figure 8. The triac is triggered at angle δ, and applies the supply voltage to the load. The triac then conducts for the remainder of the positive half-cycle, turning off when the anode current drops below the holding current, as the voltage becomes zero at θ = 180˚. The triac is then re-triggered at angle (180 + δ)˚, and conducts for the remainder of the negative half-cycle, turning off when its anode voltage becomes zero at 360˚. (3) Figure 9. The control program flow chart
Figure 10. Temperature result in the heater
While the temperature of the outer environment is 29 0 C, the heater is heated during 6 minutes and then heat of inner environment is measured at 400 C. Graph of heating versus time for the heater is shown in Figure 10. Ziegler-Nichols method is used to adjust PID for temperature control system of the heater. Model open-loop system of the heater is implemented in the laboratory as follows: K=200, L=40,T=1200, then transfer function of the object: ( ) = (
. This function is )(
19
Control system with PID algorithm determines the stimulus angle, δ to enable Triac controlling the rotation speed of the cooling fan, helping the heater temperature reduce to the setpoint value of 360C. The figure below shows the changes of δ corresponding to the changes of temperature in the heater. )
performed on simulink such as Figure 11. 200
40 + 1
1
1200 + 1
step Tranfer 1 Tranfer 2 Scope1 Figure 11. Model open-loop system of the heater
(a) Temperature >=400C (b) Temperature = 390C Figure 12. The response of the open-loop system
In Figure 12, we draw a tangent at the inflection point to figure out the parameters T1 = 5, T2 = 80 then find out the parameters of the PID controller follow ZieglerNichols method: Table 1. Adjust the PID parameters follow Ziegler-Nichols
Controller
PID KP
1.2
= 0.1 Ti
Td
2T 1 =10 0.5T1 =2.5 Find G(PID)s: G (PID)=Kp (1+
+
)=0.1+0.01s+0.25s (c) Temperatue = 380C (d) Temperature = 370C Figure 14. (a), (b), (c), (d) are the different temperature
When the temperature into the heater is larger and greater than setpoint value, the error (current temperature value – setpoint) increases. The stimulus angle, δ = 00 means Triac for active load with 100% capacity. As the temperature decreases to the setpoint, δ will gradually increase to 1800 meaning the value of the heater temperature reaches the setpoint and the Triac will turn off, corresponding to the load of the cooling fan or in the opposite, the thermal wire will stop operations. Temperature (oC)
42
41
40
39
38
37
36
35
34
Figure 13. PID controller by simulink
Through the survey of the parameters affecting Kp , Kd, K i, PID controller can find a transfer function of the controller to respond to the best of the object: Kp = 0.5, K d = 0.2, Ki = 0.01. 1 5 10t(min)
Figure 15. PID control results on the circuit
Using ON/OFF controller is started with setpoint is 36 0C, as shown in Figure 16. 20
away sufficiently. That is why temperature occasionally increases and decreases. In order to set the temperature under the heat of the outer environment, a cooler, such as Peltier cooling elements can be used instead of the fan. These elements can reduce the temperature under negative degrees. This will also reduce the settling time. The results have proved that the PID control system has fast response, high accuracy and stability. Acknowledgment
Figure 16. ON/OFF control results on the circuit.
From the results of the two of control methods, we can see that: settling time of the PID controller is faster than the ON/OFF controller. Overshoots and undershoots are relatively small. Thus, compared with the control method of the traditional heater, the control circuit and temperature stabilization by PID and ON/OFF enables the heater to have more flexible control and temperature stability, energy saving through reducing the losses due to the phenomenon of temperature control inefficiency of ON/OFF methods. 5. Conclusion
In the temperature control system, the heater is aimed to be cooled by PID and ON/OFF control methods. In the both methods, system is cooled linearly until a certain degree which is above the heat of outer environment. Oscillations after this temperature is sourced by rolling-off the PAN speed. Cooling rate is reduced relative to the reduction in the error and can not remove the heated air Many thanks to the reviewers for their detailed and constructive comments, which meaningfully helps to improve this paper. REFERENCES
[1] Yun Niu, Lurong Cao, Xuguang Wu, ShouJun Song, "Optimal Codesign of Control and Scheduling for Distributed Industrial", AISS, Vol.4, No. 13, pp. 135 ~ 143, 2012. [2] Jung-Sook Kim, "Development of Intelligent Machinery and IT Convergence Using Case-Based Reasoning", JCIT, Vol. 6, No. 5, pp. 61 ~ 68, 2011. [3] Chen Chao-Da Lv Zhi-Sheng, "Temperature Control In Agricultural Preservation Application Research", IJACT, Vol. 4, No. 1, pp. 470 ~ 476, 2012. [4] Jun Bi, Dongfusheng Liu, Kexin Zhan, "PID Parameters Optimization for Liquid Level Control System Based on Genetic Algorithm", JDCTA, Vol. 6, No. 1, pp. 361 ~ 368, 2012. [5] N. Kuo, C. Benjamin, Digital Control Systems,Saunders College Publishing, 1992. [6] Flash PIC Programmer, www.rotgradpsi.de/mc/index.html. (The Board of Editors received the paper on 10/11/2015, its review was completed on 21/01/2016)
21
THE EFFECTS OF VARIABLE THERMOPHYSICAL PROPERTIES
ON DROPLET EVAPORATION IN HIGH TEMPERATURE CONVECTIVE
FLOW ENVIRONMENT
Nguyen Thi Bang Tuyen1,2 , Subhasish Mitra1, Duong Viet Dung2, Nguyen Vo Dao2, G.M. Evans1
1
Discipline of Chemical Engineering, School of Engineering, University of Newcastle, NSW 2308, Australia
2
University of Science and Technology, The University of Danang, bangtuyennguyen@gmail.com
Abstract - Evaporation of fuel droplets in a convective environment
has significant applications in several energy systems, for example
in internal combustion engines. Appropriate estimation of
evaporation rate is critical in predicting performance of the system,
which involves computation of the relevant heat and mass transfer
terms. All of these terms are sensitive to the physical properties of
the phases and affected by the transient variation of the
corresponding phase temperature. In the present study, effects of
temperature dependent thermo-physical properties of both liquid and
gas phases on the evaporation behaviour of the droplet are
investigated using a previously reported vaporization model (Nguyen
et al., 2015) and compared with the available experimental data.
Analysis shows that in a high temperature ambiance, use of
temperature dependent thermo-physical properties for the gas phase
and constant properties at an average temperature for the liquid
phase produce the best agreement with experimental data.
Nguyen et al. (2015) using experimental data of Ranz and Marshall (1952) and Downing (1966). A major concern in the vapour-liquid equilibrium based evaporation models is the flow of droplet’s vapour around interface, which significantly reduces the evaporation rate by preventing contact between fresh hot gas and the droplet. Since the introduction of the Frossling’s empirical correlations in 1938, there have been several modified evaporation models to account for this vapour blowing effect (Stefan flow) in the modelsusing appropriate correction factors (Ranz and Marshall, 1952; Yuen and Chen, 1976; Renksizbulutand Yuen., 1983; Miller et al., 1998; Sazhin et al., 2006). Key words - evaporation, heat transfer, mass transfer, thermosphysical properties; average temperature.
1. Introduction
Droplet evaporation has many significant applications in several energy systems such as in internal combustion engines, gas turbines, liquid rocket engines, liquid fuel fired industrial furnace etc. The fuel droplet evaporation models have been categorized into the following six groups with increasing level of complexity in computation (Sirignano, 2010): (1) constant droplet temperature models (2) infinite liquid thermal conductivity models; (3) finite liquid thermal conductivity models; (4) effective liquid thermal conductivity models where both the finite liquid thermal conductivity and the recirculation inside droplets are accounted; (5) vortex model where the recirculation inside droplets in terms of vortex dynamics is described; and (6) Navier-Stokes solution models where the complete solution of the flow field can be obtained. The 1st group of models assumes isothermal condition and neglects any temperature gradient inside droplet which enables related computations to be faster.Nonetheless, such assumption in the context of real application is over-simplified and may be inappropriate for droplets evaporating in a high temperature environment. In contrast, the fifth and sixth group models are computationally expensive even for single droplet calculations and often limited by the available computational resources for use in spray calculation (multi-droplet system). Models belonging to group (2), (3) and (4) have been used in droplet evaporation studies over several decades. Although simple, the infinite thermal conductivity (ITC) modelfrom 2nd group has been applied successfully in application like spray combustion (Chen and Periera, 1996) for its sufficient accuracy. Also, this model was previously revised and validated by Miller et al. (1998) and later by Figure 1. A subcooled liquid droplet evaporating in hot gasstream
Briefly, the evaporation process of a single subcooled droplet in a hot convective environment involves simultaneous heat transfer from gas to liquid phase and mass transfer from the liquid phase to gas phase (Figure 1). In a high temperature environment, gas phase temperature may be assumed to remain unchanged; however; temperature of both liquid and vapour mixture near interface will substantially increase during the evaporation process. Conversely, for a low temperature case, change in droplet and vapour mixture temperature is insignificant and therefore can be ignored. However, for a significant change in the liquid temperature due to a high gas temperature, dependence of the physical properties on temperature needs to be taken into account to determine the evaporation rate. The present study paper aims to investigate the effects of variable thermo-physical properties on the droplet evaporation in high temprature of the gas stream. Calculations in the present study are obtained by using the revised ITC model in which the modified Nu and Sh numbers suggested by Abramzon and Sirignano (1989) based on film theory are used to account for the Stefan flow.Details of the model can be found in the earlier study of the authors (Nguyen et al., 2015). The model is evaluated against the experimental data of Wong and Lin (1992) for a single decane droplet evaporating in high temperature of the ambient gas. 22
Nguyen Thi Bang Tuyen,, Subhasish Mitra, Duong Viet Dung, Nguyen Vo Dao, G.M. Evans
2. Model descriptions
Assuming spherical shape and uniform temperature in the entire liquid droplet, the transient temperature (Td ) and mass (m d ) of the droplet can be written as: dTd
  dNu / kG TG  Td   Lv m d dt
m d   d  G Dv Sh ln 1  B M  md C pL
(1) (2) The droplet diameter could be calculated either from the droplet evaporation ratem̄dor from the total droplet mass md 1/ 3
simply asd   6 md /  L  which is used in the present study. Thermodynamic liquid-vapour equilibrium state at the droplet surface is assumed and the Clausius-Clapeyron correlation is utilized to estimate the vapour pressure; mole and mass fraction of the vapour at the droplet interface. Substituting vaporization term from Eq. (2) into Eq. (1), Eq. (1) is integrated by a 4th order Rung-Kutta method in MATLAB (ver: 2013) to determine the transient temperature and diameter variation of the droplet. The time step size is selected based on the characteristic heating-up time, which is found to be smallest compared to other characteristic times. Temperature dependent liquid phase properties such as density (L), viscosity (L ), thermal conductivity (kL) and heat capacity (C pL) are computed using Peng-Robinson equation of state model in Aspen Properties package (V8.4).Binary diffusion coefficient (D v) is obtained from the Chapman-Enskog formulation (ref). Vapour phase properties specifically heat capacity (Cpv) and latent heat of evaporation (Lv) and all physical properties of carrier gas are calculated at the wet bulb temperature correlation proposed by Miller et al. (1998) as follows: TWB  137  TB / 373.15 
0.68
log10 (TG ) - 45 higher vaporization rate, which in turn predicts a lower droplet temperature. In this study D v is estimated using the Chapman-Enskog theory based on the Lennard-Jones parameters obtained from four different sources (see Appendix). Temperature term in the expression of D v is computed using the wet bulb temperature TWB given in Eq. (3). Four different sources of Lennard-Jones parameters provide a wide range of D v from 0.55 x 10-5 to 1.11 x 10-5 m2/s. Figure 2 and Figure 3 compare droplet size and temperature using these four different diffusivity parameters. The largest deviation in the model prediction is ~ 2.5% for droplet lifetime (Figure 2) and ~ 3.6% for droplet temperature (Figure 3) which results in 11o difference. Results obtained by the largest D v at 1.11 x 10-5 are found to agree with experimental data. Figure 2. Effects of the diffusion coefficient on the droplet size.
Conditions are: Td0=315K. TG=1000K. TB=447.1K. d0=2mm. Red0=17
(3) 3. Results and Discussions
The numerical results obtained from the model are evaluated against the experimental data of Wong and Lin (1992). This particular experimental research reports both the temporal squared diameter and temperature of a single decane droplet (d 0 =2.0mm) evaporating in a very high temperature low Reynolds number ambiance (TG =1000K, Re d0 =17 or U G =1.0m/s). Unlike many other experimental studies where only the temporal reduction of droplet diameter is reported, data of Wong and Lin (1992) also comprises transient temperature measurement of the droplet, which allows a thorough evaluation of the models. As the temperature of the liquid droplet varies during the vaporization process, the relevant physical properties such as density, heat capacity, thermal conductivity, viscosity, latent heat of vaporization and binary diffusion coefficient need to be computed at the corresponding temperature. The impacts of these variable physical properties on the evaporation time are investigated in the present study. First, the effects of the binary diffusion coefficient on the evaporation behavior are examined. Equation (2) indicates that binary diffusivity (D v) is related to the vaporization rate of droplet which in turn affects the droplet temperature as can be found in Eq. (1). One can see that a higher value of diffusion coefficient results in a Figure 3. Effects of the diffusion coefficient on the droplet
temperature. Conditions of Figure 2
Figure 4. Effects of the temperature dependent diffusion
coefficient on droplet size. Conditions of Figure 2
23
caution is worth noting when carrier gas temperature is lower than the boiling point of droplet. Use of average temperature expression mentioned before in this case may lead to a lower value compared with the real average droplet temperature. 4. Conclusion
Figure 5. Effects of the temperature dependent diffusion
coefficient on droplet temperature. Conditions of Figure 2
Figure 4 and Figure 5 present the droplet size and temperature profiles with the two different diffusion coefficient evaluation methods, i.e. Dv=f(TWB ) and D v=1.11 x 10-5 (constant). Better agreement with experimental data is obtained when the temperature dependent D v is used which results in NRMSD=0.10 for droplet size and NRMSD=0.06 for droplet temperature compared with constant D v which yields an NRMSD=0.14 and 0.12 for droplet size and temperature respectively. The effects of the thermo-physical properties of the gas and liquid phase are evaluated by using the revised infinite thermal conductivity model and published experimental data. For the gas phase (vapour mixture), calculations using temperature dependent binary diffusion coefficient provides a better agreement compared to constant diffusion coefficient. For the liquid phase, a deviation ~ 12% in the evaporation time are found as the physical liquid properties evaluated once at the droplet’s initial condition whereas a negligible change in the evaporation time (~2%) as these properties are evaluated once at the temperature average temperature (compared to the base case of instantaneous temperature dependent properties). This study therefor concludes that temperature dependent properties for the gas phase and constant properties at the average temperature for the liquid phase should be used for the droplet evaporation calculations in high temperature environment to obtain better agreement with experimental data. Notation
T temperature, K U  velocity of gas respecting to droplet, m/s
M molecular weight, kg/kmol
m mass, kg d
droplet, m C p heat capacity, J/kgK m d evaporation rate, kg/s LV latent heat of evaporation, J/kg k
Figure 6. Effects of the liquid properties on the droplet
evaporation time. Conditions of Figure 2
The effects of the liquid physical properties on the droplet lifetime are presented in Figure 6. Relevant thermos-physical properties of liquid phase such as density, viscosity, thermal conductivity and heat capacity are estimated by three different methodologies: (1) at droplet temperature, Td (base case); (2) at constant droplet temperature,Td0 ; and (3) at constant average droplet temperature, Tavg . The average temperature Tavg is obtained as Tavg =0.5(Td0 +TB )=381K (Abramzon&Sirignano, 1989) based on the assumption that droplet temperature will increase to boiling point from its initial temperature while evaporating in a high temperature environment. The evaporation time is found to be ~ 12% larger when the liquid properties are evaluated at Td0 compared to the base case at Td . Deviation in model prediction reduced to only ~ 2% when thermos-physical properties are estimated at Tavg . This insignificant difference suggests use of average temperature to estimate properties in the model for droplet evaporation in high temperature carrier gas. However, a thermal conductivity, W/mK D v diffusion coefficient of vapour into air, m 2/s
Sh=Kd d/Dv, (K is mass transfer coefficient) Nu=hd d/kG , (h is heat transfer coefficient)
Pr  G C pG / k G
Prandtl number of Re d   GU  d d /  G Reynolds number of gas phase Greek letters
 viscosity, Ns/m2  density,kg/m3 Subscripts
d
Droplet G gas L liquid V vapour NRMSD: Normalized Root Mean Squared Deviation, itwas defined by ratio between the RMSD and the range of the measured data (maximum value minus minimum value). 24
Nguyen Thi Bang Tuyen,, Subhasish Mitra, Duong Viet Dung, Nguyen Vo Dao, G.M. Evans
APPENDIX
 and  /kB of the vapour (V) of four different sources are Physical properties of liquid Decane
Vapour (Abramzon&Sirignano, 1989) TW B /1000  0.8 : shown in Table 1. Table 1. Lennard Jones potential model constants of different
sources for decane
C pV  106.6  5765  TW B / 1000  1675  (TW B / 1000)2
 473.1  (TW B / 1000)3
TW B / 1000  0.8 :
C pV  411.1  5460  TW B /1000  2483  (TW B /1000)2
 422.9  (TW B /1000)3
Liquid (Aspen Properties V8.4)
 L  5.916  104 Td2  3.974  101Td  8.982 102 , kg / m3
k L  1.678  107 Td2  1.208  104 Td  1.832  101 , W / mK
 L  1.809  10 10  Td3  2.292  107  Td2
 9.877  10 5  Td  1.470958  102 , Ns / m 2
Physical properties of (Aspen Properties V8.4)
3
2
G  4.195  109  TWB
 9.608 106  TWB
 7.941103  TWB  2.79525, kg / m3
2
C pG  2.632 108  TWB
 1.764 104  TWB  9.368 102 , J / kgK  4.812  103 ,W / mK
4
3
G  5.982 1017  TWB
 1.608  10 13  TWB
2
 1.542  1010 TWB
 1.029 10 7 TWB  1.913 10 6 , Ns / m 2
Binary diffusion coefficient of vapour in air
The binary diffusion coefficient of decane into air is estimated using the Chapman-Enskog theory as: Dv  1.8583  107 
T 3 (1/ M V  1 / M C )
pC  VC 2 VC
where the pressure term p c is equal to 1 atm. The integral collision  VC is calculated using the following correlation VC 

1.06036
0.193
1.03587


T *0.1561 exp (0.47635  T * ) exp (1.52996  T * )
1.76474
exp (3.89411  T * )
v
v/kB Dv[m2/s] Tavares (1997) 4.604 238.80 1.11E-05 Yu and Gao (2000) 5.233 226.46 9.64E-06 Parades et al (2000)-M1 6.563 456.74 6.44E-06 Parades et al (2000)-M2 7.164 572.56 5.49E-06 REFERENCE
C p L  9.428  104 Td2  3.977Td  8.088  102 , J / kgK
2
kG  1.196 108  TWB
 7.089 105  TWB
Sources T *  T k B /  ,  VC  0.5( V   C ), k B  1.3 8065  10 23 ,
  V   C
The Lennard Jones potential model constants  and  /kB
ofair are 3.711 and 78.6 respectively (Bird et al, 2007). [1] Abramzon, B., & Sirignano, W. (1989). Droplet vaporization model for spray combustion calculations. International Journal of Heat
and Mass Transfer, 32(9), 1605-1618. [2] Bird, R. B., Stewart, W. E., & Lightfoot, E. N. (2007). Transport phenomena (pp. 866): John Wiley & Sons. [3] Chen, X.-Q., & Pereira, J. (1996). Computation of turbulent evaporating sprays with well-specified measurements: a sensitivity study on droplet properties. International Journal of Heat and Mass
Transfer, 39(3), 441-454. [4] Miller, R., Harstad, K., & Bellan, J. (1998). Evaluation of equilibrium and non-equilibrium evaporation models for manydroplet gas-liquid flow simulations. International Journal of
Multiphase Flow, 24(6), 1025-1055. [5] Nguyen, T. T., Mitra, S., Pareek, V., Joshi, J., & Evans, G. (2015). Comparison of vaporization models for feed droplet in fluid catalytic cracking risers. Chemical Engineering Research and Design. [6] Paredes, M. L., Nobrega, R., & Tavares, F. W. (2001). An analytic equation-of-state for mixture of square-well chain fluids of variable well width. Fluid phase equilibria, 179(1), 231-243. [7] Ranz, W., & Marshall, W. (1952). Evaporation from drops. Chem.
Eng. Prog, 48(3), 141-146. [8] Renksizbulut, M., & Yuen, M. (1983). Numerical study of droplet evaporation in a high-temperature stream. Journal of Heat Transfer,
105(2), 389-397. [9] Sazhin, S., Kristyadi, T., Abdelghaffar, W., & Heikal, M. (2006). Models for fuel droplet heating and evaporation: comparative analysis. Fuel, 85(12), 1613-1630. [10] Sirignano, W. A. (2010). Fluid dynamics and transport of droplets
and sprays: Cambridge University Press. [11] Tavares, F. W., Chang, J., & Sandler, S. I. (1997). A completely analytic equation of state for the square-well chain fluid of variable well width. Fluid phase equilibria, 140(1), 129-143. [12] Wong, S.-C., & Lin, A. (1992). Internal temperature distributions of droplets vaporizing in high-temperature convective flows. Journal
of Fluid Mechanics, Cambridge University Press, 237. [13] Yu, Y.-X., & Gao, G.-H. (2000). Lennard–Jones chain model for self-diffusion of n-alkanes. International journal of thermophysics,
21(1), 57-70. [14] Yuen, M., & Chen, L. (1976). On drag of evaporating liquid droplets. (The Board of Editors received the paper on 04/11/2015, its review was completed on 24/04/2016)
25
A TOOL FOR UNIT COMMITMENT SCHEDULE IN DAY-AHEAD IN POOL
BASED ELECTRICITY MARKETS
Pham Nang Van1 , Nguyen Duc Huy1 , Nguyen Van Duong2, Nguyen The Huu2 1
Hanoi university of Science and technology; ngduchuy@gmail.com; van.phamnang@hust.edu.vn
2
Ministry of Industry and Trade; nvduong.ie.vn@gmail.com; nguyenthehuu@gmail.com
Abstract - Operating the power system in a deregulated framework
is now becoming a common trend in many countries in the world,
including Vietnam. In order to ensure effective operation of the
power market, there is a need for a good infrastructure for
information exchange, and especially high performance computing
tools which allows determining the optimal unit commitment
schedule, based on price signal. These computing tools also serve
to derive optimal bidding strategies for generating companies. Thi
paper presents a computational tool for day ahead market clearing,
based on price signals. The program has been tested with large
size data, which proves its capability to handle the computational
task of the Vietnam power market.
Key words - Power system operation; electricity market; day
ahead unit commitment; marginal pricing; mixed integer linear
programming.
in this work not only provides with solutions for day-ahead dispatching schedule but also determines the Locational Marginal Pricing. The program is tested with a large size problem which is based on actual data from the Vietnam pool based market. The computational performance of the program is shown to be very good. The paper is organized as follows: section 2 presents the mathematical formulation of the dayahead price based unit commitment problem. Section 3 discusses the calculation of LMP based on the solution of the UC program. Section 5 presents numerical results for a 111 bus system, which is based on actual data of the Vietnam pool based electricity market. 2. Mathematical formulation
1. Introduction
Nowadays, several countries in the world have moved towards the deregulation of the power market. This change in the power system operation provides more incentive for investors, as well as for power companies to optimize their operation. One early model for the deregulated power market is the "Single Buyer" model. In this deregulated framework, the single buyer receives bidding from generation companies (GENCO), and combines with forecast load demand to determine the optimal generation schedule (unit commitment - UC) for the next day. The objective function of this calculation is to minimize energy cost purchased from generating companies. Currently in Vietnam, the National Load Dispatch Center (NLDC) has used some professional programs to determine the optimal generation scheduling. However, there is still a need to develop a domestic tool for calculating unit commitment. On one hand, this tool can be modified more easily, and with more flexibility to accommodate new rules in the power market operation. On the other hand, this kind of software serves as a fundamental tool for deriving GENCOs' optimal bidding strategies. Conventional unit commitment program are based on dynamic programming and Lagrange relaxation algorithm. The Lagrange relaxation algorithm has been tested with large network model. However, there is an essential drawback associated with this algorithm [1] due to the fact that there can be several solutions which are similar in terms of objective function, but with different scheduling variables. In recent years, the programs based on Mixed Integer Linear Programming have been more and more commonly used [2-8]. One of the main advantages of MILP formulation is that there has been considerable progress in the performance of MILP solvers in recent years. In this paper, a MILP formulation for the day-ahead market clearing problem is presented. The program developed 2.1. Objective function
The objective function of the unit commitment problem is to minimize total cost paid to the GENCOs, in order to satisfy the forecasted load demand. Figure 1 describes the market equilibrium. The objective function can be described explicitly as follows: T
N G N Git
F     cibt .PGibt (1) t 1 i 1 b 1
In Eq. (1), cibt is the bidding price of the generation unit i, corresponding to block b at time t, P ibt is the generating power of the same unit at the same time; T is the duration considered in the unit commitment problem (T = 24); N G is the number of generating units in the system, N Git is the number of bidding blocks at time t (N Git = 3). Price
Market clearing price
GE NCO s surplus
Energ y
Figure 1. Market equilibrium
4
2
5
2
6
1
1
7
3
3
8
9
Figure 2. Handling of 3 blocks of generation bidding
26
In this paper, to account for GENCOSs' 3-step bid, we propose using 3 pseudo units to replace one real unit, as depicted in Figure 2. At one time, only one pseudo-unit can operate. t  1, 24, i  1, N G (2) NGit

PGibt (3) b 1
max
0  PGibt  PGibt
(4) where: P Git is the active power of unit i at time t, Pibt is the max
active power of the unit i, block b at time t, Pibt
is the upper limit of block b; u i,t is a binary variable, indicating whether the unit is operating (if the unit is active, u i,t = 1 and u i,t = 0 otherwise). Since one generating unit now consists of 3 pseudo units as in Figure 2, a maximum of only one pseudo unit can be active at one time. Therefore we have the following constraint: u 1i ,t  u i2,t  ui3, t  1 (5) 2.2.2. Constraint on ramp-up/ramp-down rate
The limit on the ramp-up and ramp down rate of generating units are expressed as follows: Riup
 i, t (6)  i, t (7) In expressions (5) and (6), Ridown ,
Riup are respectively the PGit  PGi , t 1 
limits on maximum ramp-up and ramp-down rate of unit i. 2.2.3. Minimum up-time
Thermal generating units normally has a constraint on minimum up-time. These constraints are expressed as follows [2]: t  Minupi 1

ui , n  UTi . ui ,t  ui ,t 1 
n t
(8) i  1, N G ; t  2,  T  UTi  1
In (7), UT i is the minimum up-time of unit, and u i,n is the state of unit i at time n. At hour t = 1 and t = 24, the constraints on minimum up-time are expressed as Eq. (8) and (9). (11) i  1, NG ; t  2, T  DTi  1
DTi
 1  u
i ,n 

 DTi ui ,0  ui ,1  (12) n 1
T
 1  u
i,n

  ui ,t 1  ui ,t   0
n t
(13) In Eq. (10-12), DT i is the minimum down-time requirement of unit i. 2.2.5. Operating state of generating units
The state of one generating unit being started up and being shut-down are mutually exclusive. Hence, we need to add the following constraints [11]: yi ,t  zi ,t  ui ,t  ui ,t 1
(14) i  1, N G , t  1, T
yi ,t  zi ,t  1
(15) i  1, N G , t  1, T
where yi,t is a binary variable reflecting the start-up state of generating unit i at time t (1 if the unit starts at the beginning of time t); zi,t is a binary variable reflecting the shut down state of unit i (1 if unit i shuts down at the beginning of time t). 2.3. System constraints
2.3.1. Active power balance
Branch currents and bus voltages in the power system obey the Kirkhop equations, which are non-linear. In order to solve the power flow equations, an iterative algorithm needs to be used. However, in unit commitment programs, a DC formulation is often used for its simplicity. In the DC power flow formulation, the reactive power loss and active power loss are ignored. Besides, the branch flows are assumed to be proportional to the angle difference between the sending end bus and the receiving end bus. With these assumptions, active power flowing into a bus i can be expressed by the following equation: NL
Pi 
 B 
ij
i

 j (16) j 1
N
Minupi
u
i ,n
 UTi . ui ,1  ui ,0  (9) n 1
ui ,n  ui ,t  ui ,t 1   0
n t
 P
Gi
 PDi  Pi   0 (17) i 1
T

 i  1, N G ;  t  T  DTi  2, T
i, b, t PGi , t 1  PGit  Ridow n
1  ui ,n   DTi . ui ,t 1  ui ,t 
n t
At all times, the active power of each generating unit is subject to its minimum and maximum limit. This constraint is expressed as follows: PGit 
t  DTi 1

2.2. Constraints for power plants
2.2.1. Minimum and maximum active power
PGi min .u i,t  PGit  PGi max .u i,t
to the minimum down-time after shutting down, before the unit can be started up again. The minimum down-time constraints are expressed as follows [2]: (10)
i  1, N G ; t  T  UTi  2  ,T
2.2.4. Minimum down-time constraint
Thermal generating units also have a limit with regard where N L is the number of branches in the power system, P i is active power injected at bus i into the network, N is the total number of buses, P Gi is active power generated at bus i, P Di is active power demand at bus i; i is voltage angle at bus i. 2.3.2. Power flow limit on system branches
In the DC power flow method, the branch flow is ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
determined by the following equation: 

Pij  Bij  i   j 1.
(18) The branch flow limit is thus expressed as follows: Pijmin
 Pij 
Pijmax (19) 2.3.3. Spinning reserve requirement
In order to regulate the system frequency, the system should maintain at all time a certain amount of active power reserve, which is the active power that can be dispatched from online generating units. The amount of required reserve depends on the reliability criteria for each power system. In a general form, the spinning reserve constraint can be written as follows: NG
max
i ,t PGi
u
 PDt  PRt t (20) 2.
27
In step 1, the UC problem (1) is solved, which gives the optimal values for binary as well as continuous variables. In step 2, the binary variables obtained from step 1 are fixed. The optimization problem is solved again with the continuous variables. At this step, the LMP for system buses can be obtained. The results in this study show that the optimal values for the continous variables obtained in step 1 and step 2 are the same. Step 2 is carried out only to determine LMP. 4. Problem size
The optimization problem presented in section 2 is a Mixed Integer Linear Programming problem, with large number of variables. In our program, the optimization variables are organized as in Figure 3. i 1
3. Locational Marginal Pricing
3.1. Theoretical overview
One of the technical problems in power system operation is managing the branch flows so that they can remain below acceptable limits, which depend on stability/thermal constraints. The most common approach to deal with branch flow limit (or congestion management) in the power market is Locational Marginal Pricing (LMP). Due to space limit, we do not go into details the theory behind LMP. In essence, LMP is the sensitivity of the objective function F with regard to the demand power at each bus [13]: F
LMPi 
PDi
(21) In the optimal solution of the unit commitment, LMPs is in fact the Lagrange multipliers corresponding to the power balance constraints at system buses. In theory, LMP based method is really effective to handle congestions due to branch flow limit [9]. However, its implementation in practice requires exact knowledge of the branch flow limits. It is not always easy to determine branch flow limits, because there are several underlying technical considerations: thermal, voltage stability, angle stability, etc. Currently, in Vietnam, a more simple version of LMP is adopted. In this model, the branch flow limits of only 2 branches are used: between the Northern grid and the Central grid, and between the Central grid and the Southern grid. This model is refered to as ZMP (Zonal Marginal Price). In ZMP model, it is assumed that there is no branch flow limit within one area (North, Central, South). 3.2. Post UC calculation of Locational Marginal Prices
The LMPs are obtained after solving the DCOPF problem at each hour. The LMP at each bus is in fact equal to the sensitivities of constraint (17) at the same bus. In order to obtain sensitivity measures, the optimization problem should be a Linear Programming problem, with only continuous variables. The Unit Commitment problem, however, is a MILP which contains binary variables. Therefore, in most market clearing programs, the UC and LMP are calculated using two-step procedures [13]: Figure 3. Structure of optimization variables
If the system has N buses, N G generating units and a total of T time periods, the size of each variable blocks in Figure 3 are given by: u

 T . N 1 
 P 

 T . N 1 
 x    y T . N 1 


 z 

 T . N 1 
 

 T .( N 1)1  (3. N  2. N
(22) G
G
G
1). T  1
In summary, the vector of optimization variable [x] has (3N+2N G -1) T variables, of which (N+2N G ) T are binaries. In this paper, the optimization model is applied to a power system model that is based on actual data of the Vietnam power system in 2014. The total number of buses is 111, in which 108 are generation buses. It should be noted that in the ZMP formulation (see section 3), there is no branch flow constraint within one region. Therefore all load of each region can be aggregated into a single load bus. Hence, there are only 3 load buses, representing load demands of the North, Central and South areas. With the above parameters, the proposed optimization problem has 46848 variables, of which 7848 are binaries. The total number of constraints is 80112, of which 58980 constraints are nonlinear. 5. Application results
5.1. System description
The optimization problem presented in sections 2 to 4 is applied for a real large system, which is based on actual data of Vietnam power system in 2014 [12]. The bidding 28
prices of generating units consist of 3 blocks, as shown in Table 1. Table 1. Example of generation bidding data
1 2 3 Block Pmin Pmax Pmin Pmax Pmin Pmax Power 160 Price (VND/kWh) 260 260 1220 320 1280 320 400 1360 Besides the bidding data in Table 1, GENCOs should also provide technical constraints for the generating units, such as ramp rates, maximum and minimum uptime/downtime. The optimization problem is programmed in MATLAB language [11]. In order to solve the MILP problem, CPLEX software [13], version 12.6 is used. The program is run on a personal computer with 4GB of RAM, and Intel Core i3 processor. With this computing platform, it takes approximately 30s to solve the market clearing problem. The market clearing is calculated for two operating scenarios: normal operating scenario and a contingency scenario, in which one 500kV circuit between the North and the Central areas is lost. 5.2. Optimization results
5.2.1. Normal operating scenario
The optimal daily schedule for of generating units for the normal operating condition is shown in Figure 4. Each color represents one generating unit. The ZMP for Northern, Central and Southern grid are shown in Figure 5, and the branch flows between areas are shown in Figure 6. Figure 6. Branch flows between areas, normal scenario
From Figure 6, it can be seen that the interface between the Central and the South area is almost always utilized up to its maximum capacity. This is due to the fact that there are many hydro power plants in the Northern areas, with cheaper bidding prices than the thermal units in the South system. Since the connection between the Central area and the South area is almost always at maximum active power transfer, the ZMP of the South system is higher than that of the Central and the North system. On the other hand, the ZMP of the North system and the Central system are always equal. 5.2.2. Contingency scenario
In the contingency scenario, it is assumed that one 500kV circuit between the North and the Central area is lost. Hence maximum power transfer capacity of the North - Central interface is reduced to 900MW. The power transfer between regions in this case is shown in Figure 7. Figure 7. Branch flows for contingency operating scenario
Figure 4. Solution for normal operating scenario
Figure 5. Zonal marginal prices, normal operating scenario
It can be seen from Figure 7 that the interface between the North and the Central areas is almost always fully utilized. In fact, due to reduced limit on the North-Central interface, electricity from cheap hydro power plants from the Northern area can not be transferred to the Southern area. The power transfer between the Central area and Southern area even decreases near peak load hours (19h), because most power generation from the Central area at peak load hours is used to serve its own load. The ZMP for this scenario are shown in Figure 8. At times when the interface between Central and South areas is not fully utilized, their ZMP are equal. Another remark can be drawn from this result is: As the transmission capacity is limited, the receiving system (Southern area) has to pay higher price for electricity. ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
29
allows them to determine suitable bidding strategies. REFERENCES
Figure 8. ZMP for contingency operating scenario
6. Conclusion
In this paper, a program for determining the optimal unit commitment, based on price signal of generating units has been developed in MATLAB environment. The program takes into account 3 bidding blocks for each unit, as well as several practical constraints of the unit commitment problem, such as active power balance, ramp rate, minimum up-time and down-time, etc. The optimization problem is solved successfully and quickly for large scale power system model of Vietnam. The program developed in this work can be easily modified to determine dispatching schedule for actual Vietnam power system, which consists of both day-ahead market and long-term contracts. Based on the developed optimization tool, the various aspects of power market operation can be studied. Moreover, the program will help generation companies study the market behavior, which [1] Jose Manuel Arroyo and Antonio J. Conejo, “Multi period auction for a pool-based electricity market”, IEEE Trans. Power Syst., vol. 17, pp. 1225-1231, Aug. 2002. [2] Miguel Carrion and Jose M. Arroyo, “A computationally efficient mixed-integer linear formulation for the thermal unit commitment problem”, IEEE Trans. Power Syst., vol. 21, pp. 1371-1378, Aug. 2006. [3] C. Wang and S. M. Shahidehpour, “Ramp-rate limits in unit commitment and economic dispatch incorporating rotor fatigue effect”, IEEE Trans. Power Syst., vol. 9, pp. 1539-1545, 1994. [4] H. Pandzic, Ting Qui, D.S Kirschen, “Comparison of state-of-theart transmission constrained unit commitment formulations”, IEEE
Power and Energy Society General Meeting, July. 2013. [5] E. Litvinov, “Design and opertion of the locational marginal pricesbased electricity markets”, IET Generation, Transmission &
Distribution, vol. 4, pp. 315-323, Feb. 2010. [6] G. Morales-Espana, J. M. Latorre, A. Ramos, “Tight and compact MILP formulation for the Thermal Unit Commitment Problem”, IEEE Trans. Power Syst., vol. 28, pp. 4897-4908, Nov. 2013. [7] J. Ostrowski, M. F. Anjos, A. Vannelli, “Tight Mixed Integer Linear Programming Formulations for Unit Commitment Problem”, IEEE
Trans. Power Syst., vol. 27, pp. 39-46, Feb.2012. [8] M. Shahidehpour, H. Yamin and Z.Y. Li, Market operations in
electric power system, John Wiley &Sons, Inc., New York, 2002. [9] Z. Li and H. Daneshi, “Some observations on market clearing price and locational marginal price”, IEEE Power Engineering Society
General Meeting, pp. 2702-2709, Jun. 2005. [10] Matlab R2014b, http://www.mathworks.com/products/matlab/ [11] Cao Xuân Hoàng, “Optimal unit commitment in the power system.”, Master thesis, Hanoi Uni. of Science and Technology, 2014. [12] IBM, “IBM ILOG CPLEX Optimization Studio Community Edition”. [13] Allen J. Wood, Bruce F. Wollenberg, Gerald B. Sheble, Power
generation, operation and control, Wiley & Sons, Inc, New Jersey, 2014”. (The Board of Editors received the paper on 14/12/2015, its review was completed on 12/03/2016)
30
USING DUAL FORMULATIONS FOR CORRECTION OF THIN SHELL
MAGNETIC MODELS BY A FINITE ELEMENt SUBPROBLEM METHOD
Dang Quoc Vuong1, Bui Duc Hung1, Khuong Van Hai2
1
Hanoi University of Science and Technology; vuong.dangquoc@hust.edu.vn
2
Water Resources University
Abstract - Dual formulations for finite element magnetostatic and
magnetodynamic subproblems are developed to correct the
inaccuracies near edges and corners of thin shell magnetic models.
Such models replace volume thin regions by surfaces but neglect
border effects in the vicinity of their edges and corners, which can
cause inaccuracy in solving thin sheel problems. The developed
surface-to-volume correction problem is defined as a step of the
multiple subproblems applied to a complete problem (inductors and
conductor regions), considering successive additions of inductors
and magnetic or conducting regions, some of which are thin
regions. Each subproblem is independently solved on its own
domain and mesh, which facilitates meshing and increases
computational efficiency.
Key words - Eddy current, finite element method (FEM),
magnetodynamics, subproblem method (SPM), thin shell (TS)
 i, with boundary i i h,i b,i. The eddy current conducting part of  p is denoted  c,p and the nonC
C
conducting one  c,i , with i  c,i  c,i . Stranded C
inductors belong to  c,i , whereas massive inductors belong to  c,i. The equations, material relations and boundary conditions (BCs) of SP i are curl hi  ji , div bi  0 , curl ei   t bi
hi = μi -1 bi + hs,i , ji = σ i ei + js,i
n  hi  = j f ,i , n  bi  = f f ,i h ,i
n  ei
 e ,i  b ,i
(1a - b - c)
(2a - b)
(3a - b) b ,i
= k f ,i (3c)
1. Introduction
where hi is the magnetic field, bi is the magnetic flux density, As proposed in [1], [2], thin shell (TS) finite element (FE) models are used to avoid meshing thin regions, which are replaced by surfaces with interface conditions (ICs). Nevertheless, these ICs lead to inaccuracies on the computation of local electromagnetic quantities (current density, magnetic flux density and magnetic field) in the vicinity of geometrical discontinuities (edges and corners). Such inaccuracies increase with the thickness, and are exhacerbated for quadratic quanti-ties like forces and Joule losses, which are often the primary quantities of interest. To cope with these disadvantages, a subproblem method (SPM) based on magnetic flux density formulations, proposing a surface-to-volume local correction, has been proposed in [3]. The SPM for TS correction is explicitly developed for dual finite element (FE) b- and h- formulations, with generalized mesh projections of solutions between the subproblems (SPs). Also, the SPM naturally allows parameterized analyses of the thin region characteristics: permeability, conductivity and thickness. In the proposed SP strategy, a reduced problem (SP u) with only inductors is first solved on a simplified mesh without thin and volume regions. Its solution gives surface sources (SSs) as ICs for added TS regions (SP p), and volume sources (VSs) for possible added volume regions (SP k). The TS solution is then corrected by a volume correction via SSs and VSs that suppress the TS representation and add the volume model. The method allows coupling SPs in two procedures: one-way coupling and two-way coupling. The one-way coupling is a SP sequence, where no iteration between the SPs is necessary. On the other hand, with twoway coupling, each SP solution is influenced by all the others, which thus must be included in an iterative process. ei is the electric field, ji is the electric current density, i is the magnetic permeability, i is the electric conductivity and n is 2. Thin Shell Correction in a SPM
2.1. Canonical magnetodynamic or static problem
A canonical magnetodynamic problem i, to be solved at step i of the SPM (i u, p or k), is defined in a domain the unit normal exterior to i. The field hs,i and js,i and in (2a) and (2b) are VSs that can be used for expressing changes of a material property in a volume region [3]. The fields jf,i
and kf,i in (3a) and (3b) are SSs and generally equal zero for classical homogeneous BCs. ICs can define their discontinuities through any interface i (i+ and i–) in i, with the notation [  ]i =  i+ –  i–. If nonzero, they define possible SSs that account for particular phenomena occurring in the idealized thin region between i+ and i– [3]. This is the case when some field traces in SP p are forced to be discontinuous (e.g. in TS model), whereas their continuity must be recovered via a SP k; with the SSs fixed as the opposite of the trace discontinuity solution of SP p. 2.2. Subproblem: “Adding a thin shell”
Figure 1. Interface condition between SP u and SP p
The solution of an SP u is first known for a particular configuration, e.g. for an inductor alone (Figure 1, a), or more generally resulting from the superposition of several SP solutions. The next SP p consists in adding a TS to this configuration (Figure 1, b). From SP u to SP p, the solution u gives SSs for the added TS p , through TS ICs [2]. The b-formulation uses a magnetic vector potential a i (such that ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
curl a i = bi), split as a = a c,i + a d,i [2]. The h-formulation uses a similar splitting for the magnetic field, h = hc,i +
hd,i. The fields a c,i, hc,i, and a d,i, hd,i, are continuous and discontinuous respectively through the TS. The traces discontinuities in SP p [n  hp ]p and [n  ep]p (with nt = -n) in both formulations can be expressed as paper [2] 31
accounts for natural BCs of type (3a), usually zero. At the discrete level, the required meshes for each SP i differ. 3.1.1. Inductor alone - SP u
The weak form of an SP u with the inductor alone is first solved via the first and last volume integrals in (11) (i u) where ji is the fixed current density in on  s. [n × (hu × hp )]γ = [n × hp ]γ = μ p β p  t (2ac, p + ad, p ) (4) 3.1.2. Thin shell FE model- SP p
[n × (eu × e p )]γ = [n × e p ]γ =  p β p  t (2 hc, p + hd, p ) (5)  p   p 1 tanh(  p .d p / 2 ),  p  ( 1  j ) /  p (6) The TS model is defined via the term  [n hp ] p , ad, p '  p in (11) (i p). The test function a i' is p
p
because there are no discontinuities in SP u (before adding p), where dp is the local TS thickness,  p  2 / (  p  p )
is the skin depth in the TS,  = 2f, f is the frequency and j
is the imaginary unit. Also, the traces of ep and hp on the positive side p+ are expressed as [2] 1
1
n × hp  = [ p β p t (2ac, p + ad, p ) 
ad, p ] - n × hu  
(7)
 p
p
2
 p βp
1
1
n × e p  = [ p β p t (2hc, p + hd, p ) 
ad, p ] - n × eu  
(8)
 p
p
2
 p βp
2.3. Subproblem: “Correcting a thin shell”
A TS solution obtained in an SP p can be further improved by a volume correction SP k via SSs and VSs that overcome the TS assumptions. SP k has to suppress the TS representation via SSs opposed to TS discontinuities, in parallel with VSs in the added actual volume that account for changes of material properties in the added volume region from p and  p in SP p to from k and  k in SP k (with p = 0 , k = volume,  k = 0 and k =  volume). This defines a surface-to-volume correction. Such a correction generally leads to local modifications of the solution, which thus allows reducing the calculation domain and its mesh in the surroundings of the thin regions. The VSs for SP k are paper [3] bs,k = (μk - μp )(hu + hp ), js,k = (σ p - σ p )(ec, p + ed, p )
hs,k = ( μ1k - μ1 p )(bu + bp ), es,k = -(ec, p + ed, )
(9a - b)
(10a - b)
 n hp | , ad , p '  p
(12) p
The terms of the RHS of (12) are developed using (4) and (7) respectively, i.e.  [n  hp ] p , ac, p '  p   [n  h] p , ac, p '  p   p p t (2ac, p  ad, p ), ac, p '  p (13)  [n hp ] , ad, p '  p    n hu | , ad, p '   p
p
p
1
1
  p pt (2ac, p  ad , p ) 
, ad, p '  p 2
 p p
(14) The last surface integral term in (14) is related to a SS that can be naturally expressed via the weak formulation of SP u (11), i.e.   n  hu |
 p
, ad , p ' 
 p
 ( u 1 curl au , curl a d , p ')
 p
At the discrete level, the volume integral in (15) is thus limited to a single layer of FEs on the side   p touching p + , because it involves only the associated trace n  a d,p'| p . Also, the source a u, initially in the mesh of SP u, has to be projected on the mesh of SP p, using a projection method [5]. 3.1.3. Volume correction replacing the TS representation - SP k
The TS SP p solution is then corrected by SP k via the volume integrals ( hs , p , curl a ') p and ( js , p , a ') in (11). 3. Finite Element Weak Formulations
p
3.1. Magnetic Vector Potential Formulation
The weak b i -formulation (in terms of a i) of SP i (i u,
p or k) is obtained from the weak form of the Ampère equation (1a), i.e. [3], [4] (i 1 curl ai , curl ai ')i  (hs,i , curl ai ')i  ( js,i , ai ')i
 (i t ai , ai ')i  n hi , ai ' h,i t ,i  [n hi ]t ,i , ai ' t ,i  ( js ,i , ai ')i ,  ai '  Fi1 (i ) split into continuous and discontinuous parts a'c,p and a'd,p
(with a'd,p zero on  p) [2]. One thus has  [n  hp ] p , a p '  p  [n  hp ] p , ac, p '  p  (11) where Fi1(i) is a curl-conform function space defined in i, gauged in c,iC, and containing the basis functions for a as well as for the test function ai' (at the discrete level, this space is defined by edge FEs; the gauge is based on the tree-co-tree technique); (·, ·) and < ·, · > respectively denote a volume integral in  and a surface integral on  of the product of their vector field arguments. The surface integral term on h,i The VSs js,k and hs,k are given in (9) and (10), respectively. Simultaneously to the VSs in (11), SSs have to suppress the TS discontinuities, with ICs to be defined as [n  hk ] k  [n  h p ] k and [n  a] k  [n  a p ] k . The trace discontinuity [n  hk ] occurs in (11) via k
 [n hk ]k , ak '  p    [n  hp ]k , ak ' k (16) and can be weakly evaluated from a volume integral from SP p similarly to (15). However, directly using the explicit form (4) for [n  hp ] gives the same contribution, which k
is thus preferred. 3.2. Magnetic Field Formulation
3.2.1. h-Formulation with source and reaction magnetic fields
The hi   i formulation of SP i (i u; p or k) is obtained 32
from the weak form of Faraday’s law (1 c) [6]. The field hi is split into two parts, hi = hs,i + hr,i where hs,i is a source field defined by curl hs,i = js,i and hr,i is unknown. One has [n  e p ] k  [n  e p ] k . discontinuity [ n  e p ] occurs in (17) via defined, where F i1( i) is a curl-conform function space defined in  i and contains the basis functions for hi as well as for the test function h i'. The surface integral term on  e,i accounts for natural BCs of type (3 b), is usually zero. A 3-D test problem is based on TEAM problem 21 (model B, coil and plate, Figure 2). The model SP u with only the inductor is first solved with (17) (i p). The source field hs,u is defined via a projection method of a known distribution js,u [5], i.e (curl hs,u ,curl hs,u ')  ( js,u ,curl hs, u ') , u
 hs ,u '  Fu1 ( u ) (18) 3.2.3. Thin shell FE model - SP p
TS model is defined via the term  [n ep ] p , hd, p '  p in (11) (i p). The test function hi' is split into continuous and discontinuous parts h'c,p and h'd,p
(with h'd,p zero on  p ) [2]. One thus has  [n  ep ] p , hp '  p  [n  ep ] p , hc, p '  p   n  ep | , hd , p '  . p
p
  pp t (2hc, p  hd, p ), hc, p '  p ,(20) p
Figure 2. Geometry of TEAM (Testing Electro-magnetic
Analysis Methods) problem 21 – Model B [8]
 [n ep ] , hd , p '  p    n eu | , hd, p '   p
1
1
  p pt (2hc, p  hd, p ) 
, hd, p '  p 2
 p p
(21) The last surface integral term in (21) is related to a SS that can be naturally expressed via the weak formulation of SP u (17), i.e.   n  eu |  , hd , p '     (u t (hs, u  hs, u ), hd , p ') (22) p
(19) The terms of the right-hand side of (19) are developed using (5) and (8) respectively, i.e.  [n  ep ] p , hc, p '  p   [n  e] p , hc, p '  p p
(23) 4. Application Examples
3.2.2. Inductor model SP u
p
trace and can be weakly evaluated from a volume integral from SP p similarly to (22).   [n  ei ]i , hi ' i  0,  hi '  Fi1 (i ) The The k
 [n  ek ]k , hk '  p    [n  ep ]k , hk ' k t (i (hr ,i  hs,i ), hi ')i  (i 1 curl hi ,curl hi ')i 
t (bs,i , hi ,')i  (es,i , curl hi ')i   n  ei , hi ' e,i
u
and p
The sources hs,i and hr,i, initially in the mesh of SP u, have to be projected on the mesh of SP p using a using a projection method [5]. 3.2.4. Volume correction replacing the TS representation SP k
Once obtained, the TS solution in SP p is corrected by SP k via the volume integrals  t (bs, p , h ') p and (es, p , curl hk ')k . The VSs bs,k and es,k are also given in (9) and (10), respectively. The VS es,k in (10) is to be obtained from the still unknown electric fields eu and ep and their determination needs to solve an electric problem [6]. In parallel with the VSs in (17), ICs compensate the TS discontinuities to suppress the TS representation via SSs opposed to previous TS ICs, i.e., hd,k = -hd,k to be strongly Figure 3. TEAM problem 21 (1/4th of the geometry): magnetic
flux density bu (in a cut plane) generated by a stranded inductor
(left), eddy current density jp on TS model (middle) and its
volume correction jk (right) (thickness d = 10 mm)
An SP scheme considering three SPs is developed. A first FE SP u with the stranded inductors alone is solved on a simplified mesh without any thin region (Figure 3, left). Then an SP p is solved with the added thin region via a TS FE model (Figure 3, middle). At last, a SP k replaces the TS FEs with the actual volume FEs (Figure 3, right). The inaccuracies on the Joule power loss densities of TS SP p are pointed out by the importance of the correction SP k (Figure 4). Significant error on TS SP p along the zdirection reaches 73% near the plate ends (Figure 4, top) or 85% along the y-direction (Figure 4, bottom) with  = 2.1 mm and thickness d = 7.5mm for both cases. For d = 1.5mm, it is reduced to below 10%. In particular, accurate local corrections with volume correction SP k are checked to be close to the reference solution computed from the FEM. ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
33
Table I shows the Joule losses in the plate with an approximate BC for SP k. The exterior boundary of SP k is first chosen at a distance Dbound = 200d from the thin region, with thickness d = 10 mm. The inaccuracies on Joule losses for TS SP p reach 58.9%, or 1.2% for volume correction SP k, with f = 50 Hz,  = 100 and = 6.484 MS/m in both cases. The proposed SP strategy allows locally focusing on the mesh of volume correction SP k and its neighborhood. It is shown that even if Dbound is reduced to 2d, the error on SP k is 1.53%, which is still very accurate. For d = 1mm, the errors on Joule losses for SP p are reduced to 1.17%, or 0.05% for SP k. or 0.05% for SP k. Figure 5. 2-D geometry of an inductor and two plates
(d = 5mm, H1 = 120mm, H2 = H3 = 45mm, H4 = 80mm,
H5 = 67.5mm, dx = dy = 12mm)
Figure 6. Norm of the eddy current density j (A/m) along
the plate 1 at different iterations
Figure 4. Power loss density with TS and volume solutions
along the z-direction (top) and along the y-direction (bottom),
with effects of d (f = 50 Hz, r = 200,  = 6.484 MS/m)
The second test problem is a convergence test of twoway coupling (f = 50 Hz, r = 1,  = 59 MS/m) (Figure 5). The test at hand is considered in five SPs. It is first solved via an SP u with the stranded inductor alone, then adding a TS FE SP p 1 that does not include the stranded inductor via SP u with a stranded inductor alone, then adding a TS FE SP p 1 that does not include the stranded inductor anymore. An SP k1 then replaces the TS SP p 1 with an actual volume covering the plate 1. Next, another TS SP p2 is added. Table 1. Joule losses in the plate with approximate BCs
(f = 50 Hz,  = 100,  = 6.484 MS/m), with with b- formulation
d = 10 mm Errors % Dbound TS Pthin (W) Vol Pvol (W) Ref Pref (W) 200d 0.0196 0.0477 0.0483 58.9 1.2 20d 0.0196 0.0476 0.0483 58.9 1.35 2d 0.0196 0.0475 0.0483 58.9 Between Pthin Between and Pref Pvol and Pref d = 1 mm 1.53 200d 0.0113 0.0115 0.0115 1.74 0.0001 2d 0.0113 0.0115 0.0115 1.77 0.05 Figure 7. Exact local errors (top) on the norm of eddy current j
between the total solution and the reference solution at right end
of plate 1, with the number of iterations
An SP k2 eventually replaces the TS SP p 2 with another actual volume covering the plate 2. In the correction process of SP p1, the fields generated by SP p 2 and SP k2
are reaction fields that influence the source solutions calculated from previous SP p 1. This means that some iterations between the SPs are required to determine an accurate solution considered as a series of corrections. The problem is first tested on the same mesh to avoid an additional error due to mesh-to-mesh projections. It is then solved with different meshes taking the projection errors into account. Figure 6 represents the convergence of the TS solution SP p 1 and volume solution SP k1 along the plate 1, for different iterations. The accurate local volume solution is checked to be close to the reference solution during 8 iterations. Relative local errors on the norm of eddy current j between the total solution and the reference solution at the 34
right end of plate 1 are shown in Figure 7. The error is less than 1% (0.78%) with no projection, and increases slightly up to 1.17% with projection error, during 9 iterations for both cases. 5. Conclusions
The SPM allows correcting the inaccuracies proper to the TS model. Accurate eddy current and power loss densities are obtained, especially along the edges and corners of the thin regions, also for significant thicknesses. The refined mesh for volume correction can be reduced to a close neighborhood of the thin region. ACKNOWLEDGMENT
This work was supported by the fund of Hanoi University of Science and Technology (HUST). REFERENCES
[1] L. Krähenbühl and D. Muller, “Thin layers in electrical engineering. Examples of shell models in analyzing eddy-currents by boundary and finite element methods”, IEEE Trans. Magn., Vol. 29, No. 2, pp. 1450-1455, 1993. [2] C. Geuzaine, P. Dular, and W. Legros, “Dual formulations for the modeling of thin electromagnetic shells using edge elements”, IEEE
Trans. Magn., vol. 36, no. 4, pp. 799–802, 2000. [3] C. Geuzaine, P. Dular, and W. Legros, “Dual formulations for the modeling of thin electromagnetic shells using edge elements”, IEEE
Trans. Magn., vol. 36, no. 4, pp. 799–802, 2000. [4] P. Dular, Vuong Q. Dang, R. V. Sabariego, L. Krähenbühl and C. Geuzaine, “Correction of thin shell finite element magnetic models via a subproblem method”, IEEE Trans. Magn., Vol. 47, no. 5, pp. 158 –1161, 2011. [5] P. Dular, R. V. Sabariego, M. V. Ferreira da Luz, P. Kuo-Peng and L. Krähenbühl, “Perturbation Finite Element Method for Magnetic Model Refinement of Air Gaps and Leakage Fluxes”, IEEE Trans.
Magn., vol.45, no. 3, pp. 1400-1403, 2009. [6] C. Geuzaine, B. Meys, F. Henrotte, P. Dular and W. Legros, “A Galerkin projection method for mixed finite elements”, IEEE Trans.
Magn., Vol. 35, No. 3, pp. 1438-1441, 1999. [7] P. Dular and R. V. Sabariego, “A perturbation method for computing field distortions due to conductive regions with h-conform magnetodynamic finite element formulations”, IEEE Trans. Magn., vol. 43, no. 4, pp. 1293-1296, 2007. [8] Zhiguang CHENG and Norio TAKAHASHI and Behzad FORGHANI “TEAM Problem 21 Family". Approved by the International Compumag Society Board at Compumag-2009, Florianópolis, Brazil. (The Board of Editors received the paper on 25/02/2016, its review was completed on 26/04/2016)
35
A SURVEY ON CONSENSUS PROTOCOLS IN MULTI-AGENT SYSTEMS
Tran Thi Minh Dung
The University of Danang, University of Science and Technology; greenfield01@gmail.com
Abstract - In the past few year, the research community has paid
much attention to consensus problems in multi-agent systems,
especially, for wireless sensor networks, i.e. control systems that
are physically distributed and cooperate by exchanging information
through a communication network. This paper gives a brief survey
on consensus problems for multi-agent systems based on the
current literature. In particular, the general view of the consensus
protocols as well as its applications in various fields are presented.
Furthermore, we also summarize the studies on designing the
consensus matrix according to its convergence analysis. Finally,
we give some open problems that can be investigated in the future.
consisting of multiple vehicles (which are considered to be the agents) with several sensors and actuators that are intended to perform a coordinated task. In recent years, these cooperative control capabilities including formation control, rendez-vous, attitude alignment, flocking, congestion control in communication networks, task and role assignment, air traffic control have been analysed. Key words - Consensus Protocols; Multi-agent systems; Graph
Theory; Formation control; Coordination control.
1. Introduction
Multi-agent systems (MASs) have received a growing interest in the last decades. They are developed for the demand of flexibility, robustness, and re-configuration features that appear in various application domains including manufacturing, logistics, smart power grid, building automation, disaster relief operation, intelligent transportation systems, surveillance, environmental monitoring and exploration, infrastructure security and protection, etc. A MAS is a system composed of multiple interacting intelligent agents (sensors, plants, vehicles, robots, etc.) and their environment in Figure 1. Agents Environment Figure 1. A Multi-agent system with their agents and
the environment.
To summarize, a MAS is a group of nodes (agents) representing vehicles, sensors, plants, etc., which are able to exchange information in order to reach a common goal. Schematically, MAS can be represented by a network of nodes interconnected via a communication topology. Interconnections between agents in a MAS are usually modeled by directed or undirected graphs. One thing to note here is that a MAS can deal with tasks that are difficult or even impossible to be accomplished by an individual agent. During recent decades, MASs gain a widespread interest in many disciplines such as mathematics, physics, biology, computer science and social science. An increasing range of research topics in MASs includes cooperation and coordination, distributed computation, automatic control, wireless communication networks, etc. In automatic control, the interests of MASs is particularly relevant when one has to face with systems (a)
(b)
Figure 2. Examples with cooperative control and formation
control: (a) cooperative localization of robots, (b) a simple
formation control. Pictures from the website:
(http://www.cis.upenn.edu/~cjtaylor/RESEARCH/projects/Multi
bots/Multibots.html).
In cooperative control strategies to be successful, numerous issues must be addressed, including the definition and management of shared information among a group of agents to facilitate the coordination of these agents. Furthermore, the shared information may take the form of common objectives, common control algorithms, relative position information, or a world map. Information necessary for cooperation may be shared in a variety of ways. For instance, relative position sensors may enable vehicles to construct state information for other vehicles, knowledge may be communicated between vehicles using a wireless network, or joint knowledge might be preprogrammed into the vehicles before a mission begins. Therefore, cooperation requires that the group of agents reach consensus on the coordination data. In a typical centralized structure, a fusion center (FC) collects all measurements from the agents and then makes the final computations. However, due to the high information flow to FC, congestion can occur. Such a structure is vulnerable to FC failure. Also, the hardware requirements to build wireless communications can be one of reasons for an increase in the cost of the devices and thus, a higher overall cost of the network. For these reasons, a centralized structure can be inefficient. Hence, the research trend of MASs has shifted to decentralize MASs where the interaction between agents is implemented locally without global knowledge. A good example is wireless sensor networks (WSNs), which find broad application domains such as military applications (battlefield surveillance, monitoring friendly forces, equipment and ammunition, etc.), environment applications (forest fire detection, food detection, etc.), health applications (tele-monitoring of human physiological data, etc.), home 36
Tran Thi Minh Dung
automation, formation control, etc.. Figure 3 depicts a WSN that collects data for the air quality, light intensity, sound volume, heat, precipitation and wind. each node repeatedly updates its value as a weighted linear consensus scheme so that, at each time-step, each node will have only to transmit a single value of its neighbors. In this paper, we make a brief survey on consensus problem in multi-agent systems in Section 1 and cite a few of its applications in this Section. After introducing the mathematic background on graph theory in Section 2, we present the consensus problem and the consensus matrix design in Section 3. Finally, we conclude this paper and point out some open problems for future research in Section 4. 2. Graph Theory
As we state in the Section I, the interconnection between agents in a network can be modeled by a graph as shown in Figure 4 with graphG (V, E). Figure 3. A network of wireless sensors
on the light poles all over the city
Where V = {1, 2, … , N} is the set of vertices (nodes or agents), and E  V  V is the set of edges (links between agents). Therefore, based on local information and interactions between agents, how can all agents reach an agreement (consensus)? This problem is called consensus problem, which is to design a network protocol based on the local information obtained by each agent so that all agents finally will reach an agreement on certain quantities of interest. Consensus problems of MASs have received tremendous attention from various research communities due to its broad applications in many areas including multisensors data fusion [1], flocking behavior of swarms [2], [3], multi-vehicle formation control [4], distributed computation [5], rendez-vous problem [6] and so on. More specifically, average consensus protocols (i.e. the agreement corresponds to the average of the initial values) are commonly used as building block for several distributed control, estimation or inference algorithms. In the recent literature, one can find average consensus protocols embedded in the distributed Kalman filter [7], distributed Least Squares algorithm [8], distributed Alternating Least Square for tensors factorization [9], distributed Principal Component Analysis [10], or distributed joint input and state estimation [11] to cite few. However, the asymptotic convergence of the consensus protocols is not suitable for these kinds of sophisticated distributed algorithms. A low asymptotic convergence cannot ensure the efficiency and the accuracy of the algorithms, which can lead to other unexpected effects. For example, regarding to the WSNs, a reduction in the total number of iterations until convergence can lead to a reduction in the total amount of energy consumption of the network, which is essential to guarantee a longer lifetime for the entire network. On the other hand, the protocols that guarantee a minimal execution time are much more appealing than those ensuring asymptotic convergence. For this purpose, several contributions dedicated to finite-time consensus have been recently published in the literature [12]. In other words, the consensus is obtained in a finite number of steps. There are several approaches used by a number of researchers to reach the finite-time consensus in recent years: linear iteration, leader-follower type architecture, and so on. In literature, most authors use a linear iteration, where Nodes (vertices) Edge (link) Figure 4. Graph
( , )
According to the communication policy, the graph G (V, E) can be distinguished as undirected graph and directed graph. If there is no direction assigned to the edges, then both edges ( , ) and ( , ) are included in the set of the edges E. The graph is called undirected graph. It is said that if agent and are connected, then link between i and j is included in E, ( , ) E. And then, i and j are both called neighbors. The set of neighbors of agent i is denoted by Ni and its degree is presented by di = |N|, where |.| stands for the cardinality. Conversely, if a direction is assigned to the edges, the relations are asymmetric and the graph is called a directed graph. For a directed edge( , ), i is called the head and j is called the tail. A vertex i is connected to j by a directed edge, or that j is a neighbor of i if ( , ) E. In an undirected graph G, two vertices i and j are connected if there is a path from i to j. And an undirected graph G is connected if for any two vertices in G there is a path between them. Conversely, two vertices i and j in G are disconnected if there is no path from i to j. A directed graph is strongly connected if between every pair of distinct vertices (i, j) in G, there is a directed path that begins at i and ends at j. It is called weakly connected if replacing all of its directed edges with undirected edges produces a connected undirected graph. A graph is said to be complete if every pair of vertices has an edge connecting them, which means that the number of neighbors for each vertex is equal to N-1. We denote by A the adjacency matrix of the graph with 1, ( , ) ∈
the entries , given by , =
. The graph 0, ℎ
Laplacian matrix L is defined as the matrix with entries , ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
∑
=
,
,
. Degree matrix D of − ,
≠
the graph has vertex degree di, i V on its diagonal and zeros elsewhere. given by ,
=
3. Consensus problem
Consensus issue in networks of autonomous agents has been widely investigated in various fields, including computer science and engineering. In such networks, according to an a-priori specified rule, also called protocol, each agent updates its rate based on the information received from its neighbors with the aim of reaching an agreement to a common value. When the common value corresponds to the average of the initial states average consensus is to be achieved. Example 1: Consider an arbitrary network of 5 agents communicating with each other as described in Figure 5. Each agent has an initial value. A consensus protocol is an interaction rule that specifies the information exchange between an agent and all of its neighbors on the network to reach an agreement regarding a certain quantity of interest that depends on the state of all agents. Informally, despite the initial values of all agents, the output of the given network is converged to the common value (in the case, the average of initial values). 4.8 2 final values
Initial values
4.8 5 4 4.8 6 7 At the beginning 4.8 3.1. Definition
In this part, the definition of the consensus problem is given according to discrete-time systems and continuoustime systems. Given a graph G (V, E), each node has an associated value xi defined as the state of node i. Let (0) … (0)] be the vector of initial (0) = [ (0)
states of the given network. In general, given the initial states at each node (0), ∈ , the main task is to compute the final consensus value using distributed linear
iterations.Each iteration involves local communication between nodes. In particular, each node repeatedly updates its value as a linear combination of its own value and those of its neighbors. The main benefit of using a linear iterations scheme is that, at each time-step, each node only has to transmit a single value to each of its neighbors. 3.1.1. Discrete-time systems
The linear iteration-based consensus update equation is: ( + 1) =
( ) ( )+∑
= 1,2, … , ( + 1) =
Figure 5. Average Consensus in a network:
initial condition (left) and steady state (right)
In the literature, consensus protocols can be classified as follows [13]: ( ) ( ), Where W(k) is the ( ) = 0 ( , ) ∉ and ∑
matrix ∈
∪{ }
(2) with entries ( ) = 1. The system is said to achieve the distributed consensus asymptotically if lim ( ) =
, meaning that all nodes →
agreed on the value . When  is equal to the average of the initial values, i.e. = ∑
(0), the system is said to achieve the average consensus, meaning that: lim
( ) ( ), (1) ∈
Or equivalently in matrix form: 4.8 Finish 37
=
→
. (3) The convergence conditions are described as follows: Theorem 1[15]: Consider linear iteration protocol (2), the distributed consensus is achieved if and only if the weighted consensus matrix W satisfies the following conditions: a.
b. (
=
−
)<
) is the spectral radius of Where ( −
and c is chosen so that = 1. −
Then, the weighted matrix has row-sum equal to 1 and 1 is a simple eigenvalue of W and that all other eigenvalues are strictly less than one in magnitude. It is said that the weighted matrix is a row-stochastic matrix. Theorem 2 [15]: Equation (3) holds if and only if: c.
d.
e.
=
=
−
<
Meaning that W is a doubly stochastic matrix. 3.1.2. Continuous-time systems
Figure 6. Classification of Consensus protocols
We still consider a system modeled as a graph ( , ) with N agents, in which each agent has a value ∈ . In 38
Tran Thi Minh Dung
[13] a continuous-time consensus protocol can be expressed as follows: ̇ ( ) = −∑
∈ ( )
( )
( )−
( ) , (4) Where ( ) represents the set of agents whose information is available to agent i at time t and ( ) denotes a positive time-varying weighting factor. In other words, the process of calculation is implemented by the fact that the node just integrates its values or, the information state of each agent is driven toward the states of its neighbors at each time. The protocol (4) can be expressed in matrix form as ̇ = − , where L is the graph Laplacian and … ] . =[
3.1.3. Finite-time consensus problems [14]
In actual complicated systems, the execution time is getting more and more impact. Therefore, the purpose is now to design a finite-time average consensus algorithm allowing all nodes to reach the average consensus value in a finite number of steps D for self-configuration protocols, i.e. ( )=
(0) (5) Meaning that, we are about to design a set of consensus matrices ,
,…,
such that ∏
=
. 3.2. Consensus Matrix Design
In the literature, there are some works devoted to the design of the weighted matrix W that satisfies the convergence conditions of the consensus protocols. For instance, in [15]: A. Maximum-degree weights: An approach to design the weighted matrix W in a graph with fixed topology consists of assigning a weight on each edge equal to the maximum-degree of the network, i.e. 1
∈
⎧
+1
⎪
=
=
⎨1 −
+1
⎪
⎩
0 ℎ
Where = max ≤ . B. Metropolis weights: The metropolis weights matrix W for a graph with a time-invariant topology is proposed with the entries: 1
∈
⎧
⎪ max { , } + 1
=
=
⎨ 1−
⎪
⎩
0 ℎ
C. Constant edge weights: This is widely model for the weight matrix in both timevarying and time-invariant topologies. The W is defined as follows: ∈
= 1− | |
= 0 ℎ
as The weighted matrix can be expressed in matrix form =
−
with being identity matrix. D. In analysis of consensus problem, convergence rate is an important index that evaluates the performance of the proposed consensus protocol. Therefore, there are some works dealing with accelerating the rate of convergence of the consensus protocol by solving some optimization problems in centralized way. In [15], the authors have proposed an optimization method to obtain the optimum weighted matrix W
achieving the average consensus in linear time invariant topologies as the solution of a semi-definite convex programming. 1
−
min
∈ ,
= ,
=
Where ∈
expresses the constraint on the sparsely pattern of the matrix W with the set defined as follows: =
∈
×
|
=0
(, )∉
≠
.
4. Conclusion
In this paper, we have reviewed the consensus protocols in the context of Multi-agent systems (MAS), in particular for Wireless Sensor Network (WSN). In addition, we have cited out some application domains of the consensus protocols that can be embedded in various important fields such as military, environment, health, automation control, and formation control, etc. Since the research on consensus is ongoing, this survey is waiting for future contributions to the literature. Moreover, we have pointed out the general picture of consensus protocols and some designs of the consensus matrix. In fact, most applications of consensus are asymptotic convergence that is not suitable for these kinds of sophisticated distributed algorithms. A low asymptotic convergence cannot ensure the efficiency and the accuracy of the algorithm, which can lead to other unexpected effects. Therefore, the orientation of research now is shifted to the protocols that guarantee a minimal execution time. For this purpose, some works are dedicated to accelerate the convergence rate of the algorithms or finite-time consensus. REFERENCES
[1] R. Olfati-Saber and J.S. Shamma. Consensus filters for sensor networks and distributed sensor fusion. In Proc. of the 44th IEEE
Conference on Decision and Control and European Control
Conference. CDC-ECC ’05, pages 6698–6703, Dec 2005. [2] R. Olfati-Saber. Flocking for multi-agent dynamic systems: algorithms and theory. The IEEE Transactions on Automatic
Control, 51(3): 401–420, March 2006. [3] V. D. Blondel, J. M. Hendrickx, A. Olshevsky, and J. N. Tsitsiklis. Convergence in multi-agent coordination, consensus, and flocking. In Proc. of the 44th IEEE Conference on Decision and Control, 2005 and 2005 European Control Conference. CDC-ECC ’05, pages 2996–3000, December 2005. [4] D.V. Dimarogonas and K.J. Kyriakopoulos. Formation control and collision avoidance for multi-agent systems and a connection between formation infeasibility and flocking behavior. In Proc. of
the 44th IEEE Conference on Decision and Control and European
Control Conference. CDC-ECC ’05, pages 84–89, Dec 2005. ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
[5] V. Borkar and P.P. Varaiya. Asymptotic agreement in distributed estimation. IEEE Transactions on Automatic Control, 27(3): 650–
655, Jun 1982. [6] J. Cortes, S. Martinez, and F. Bullo. Robust rendezvous for mobile autonomous agents via proximity graphs in arbitrary dimensions. IEEE
Transactions on Automatic Control, 51(8): 1289–1298, Aug 2006. [7] R. Olfati-Saber. Distributed Kalman filtering for sensor networks. In Proc. of the 46th IEEE Conf. on Decision and Control, pages 5492–
5498, New Orleans, LA, USA, December 12–14 2007. [8] S. Bolognani, S. Del Favero, L. Schenato, and D. Varagnolo. Distributed sensor calibration and least-squares parameter identification in WSNs using consensus algorithms. In Proc. of 46th
annual Allerton Conference, pages 1191–1198, Allerton House, UIUC, Illinois, USA, 2008. [9] A.Y. Kibangou and A.L.F. de Almeida. Distributed PARAFAC based DS-CDMA blind receiver for wireless sensor networks. In
Proc. of the IEEE Workshop SPAWC, Marrakech, Morocco, June 20-23 2010. [10] S. V. Macua, P. Belanovic, and S. Zazo. Consensus-based distributed principal component analysis in wireless sensor [11]
[12]
[13]
[14]
[15]
39
networks. In Proc. of the IEEE Workshop SPAWC, Marrakech, Morocco, June 20-23 2010. A. Esna-Ashari, A.Y. Kibangou, and F. Garin. Distributed input and state estimation for linear discrete-time systems. In Proc. 51st IEEE
Conf. on Decision and Control (CDC), Maui, Hawaii, USA, December 2012. S. Sundaram and C. Hadjcotis. Finite-time distributed consensus in graphs with time-invariant topologies. In Proc. of the American
Conference on Control (ACC), pages 711–716, New York, USA, July 2007. R. Olfati-Saber and R. M. Murray. Consensus problems in networks of agents with switching topology and time-delays. i vol. 49, pp. 1520-1533, Sep. 2004. A. Y. Kibangou. Step-size sequence design for finite-time average consensus in secure wireless sensor networks. Systems and Control
Letters, 67:19–23, March 2014. L. Xiao, S. Boyd, and S. Kim. Distributed average consensus with least-mean-square deviation. Journal on Parallel Distributed
Computation, 67(1): 33–46, January 2007. (The Board of Editors received the paper on 14/04/2016, its review was completed on 25/04/2016)
40
ORGANIZATION OF A KNOWLEDGE BASE TO REUSE WORKFLOW
TEMPLATES: AN ONTOLOGICAL APPROACH
Nguyen Thi Hoa Hue1, Le Thanh Nhan2
1
Information Technology Faculty Vietnam - Korea Friendship Information Technology College
Da Nang, Vietnam; huenth@gmail.com
2
Nice Sophia Antipolis University, Sophia Antipolis, France; Nhan.LE-THANH@unice.fr
Abstract - Nowadays, business process models have been used
in a wide range of enterprise applications. As a result, it is
necessary to take interest in how to create business processes
correctly in terms of semantics and syntax. Moreover, attention
needs to be paid to the acceleration of the efficiency of reusing the
existing models. In this paper, we introduce a knowledge base
established to assist the choice of appropriate workflow templates
for the development of a new business workflow template. We
describe a repository that contains business workflow templates
whose syntactic and semantic correctness has been checked. The
repository provides an organizational mechanism for control flowbased business workflow templates to guarantee an effective
search for necessary workflow templates. In addition, we also
propose a process for developing workflow templates in the paper.
Key words - business process; knowledge base; ontology;
SPARQL; reuse; workflow template.
1. Introduction
The design of business workflow management systems (WfMSs) is generally independent from the concrete business area of employing enterprises. Consequently, this workflow technology follows a generic approach. Therefore, IT experts play an important role in implementing business processes of the enterprise and establishing its software infrastructure. It is important to note that business workflows are aimed at automating and optimizing an organization's processes in an administrative context to reduce costs (e.g., human resources) and increase revenue. Up to now, there have been more than a hundred business WfMSs, such as FileNet, SAP, JBPM and Spiff Workflow. Insurance, banking and health industries, for example, are domains using business workflows. However, the specification of a real-world business process is generally manual and is thus vulnerable to human errors. An incorrectly designed workflow may lead to failed workflow processes, execution errors or not meet the requirements of customers, etc. There is an inherent problem regarding the problem of modelling semantically rich business workflow templates1 , workflow templates sharing and subsequently their reuse need to be considered. Continuing our previous work [9, 10, 11], which focus on how to model semantically rich business workflow templates and check their correctness at the syntactic and semantic level, in this paper we introduce a solution to the reuse of workflow templates. Let us consider the following scenario. A person plans to create an ordering process for his own purpose. He has either some experience in working on it or none at all. The question is how he can create his process model in the most effective way without developing it from scratch. In fact, the different existing workflow templates extracted from a set of process models can support modellers to create new workflows or process models by providing the knowledge about potential and suitable workflow activities. We are interested in the organization of a knowledge base which guides the search for suitable workflow templates in order to reuse them. Users can adapt the resulting workflow templates for each specific use case. This is the knowledge on how to model a business process reusing control flow-based business workflow templates (CBWTs). Hence, the annotation and storage of workflow templates play a very important role in the success of reusable CBWTs, which guarantee an effective search for modelling a business process. The rest of this paper is structured as follows: In Section 2 we present related works. We then propose an organization of the knowledge base of CBWTs in Section 3. We also indicate that the SPARQL [13] query language is used to retrieve a list of workflow templates from the CBWT repository we have proposed. In Section 4, we introduce a process for developing workflow templates. Finally, Section 5 concludes the paper with an outlook on future research. 2. Related Works
Up to now, the problem of reusing process models or workflows is mentioned in some existing approaches. In general, workflows can be reused manually or semiautomatically [4, 6, 7]. Moreover, modellers can partly or fully reuse a workflow [1, 3, 4, 8]. The authors in [8] specify a method for business process design via view integration which takes two process views as input. At first, semantic relationships between elements of different process models are formalized. On this basis, the integrated process model applying the merge operator is calculated. [1] also presents a formal approach for constructing customized process views on structured process models to improve effective cross-organizational collaborations. Each customized process is constructed by hiding and/or omitting activities not requested by the process consumer. However, neither of them considers contentbased reuse. In order to overcome that issue, the authors in [4] introduce a set of Domain Process Patterns (DPPs) that capture process model parts. A DPP represents a specific business function of a 1
In our work, we define a definition for business workflow template: A business workflow template is a generic business workflow that can be customized according to the application. ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
process model part in a modelling domain. DPPs facilitate reuse from a content perspective by focusing on domaincentered reuse of process model content. Nevertheless, DPPs do not provide any syntactic needs for modelling business processes. However, by capturing process model parts with a particular structure, DPPs do not support syntactic checks which are supported in our approach. In our approach, a workflow template is stored in the repository if and only if it is checked at the syntactic and semantic level, and no errors exist. In [2], the authors propose a framework to enable ontology-driven process modelling. By utilizing the framework, users can define, analyze and re-engineer their process models in complex and dynamic contexts with semantically enriched processes. But they are mainly interested in structuring and exploiting design knowledge. They do not focus on the meaning of all the concepts and relationships in the knowledge base, this is in contrast with our approach. 3. Organization of the Knowledge Base of Control
Flow-based Workflow Templates
In literature, the main goals of workflow reuse are to improve workflow template quality and to increase its development productivity [5]. In other words, the more workflow templates are available, the more difficult they are to be suitable in a specific reuse case. It is worth noting that the reuse of workflow templates is only beneficial if the cost to find and adapt an existing workflow template is smaller than the cost needed to develop a new one from scratch. After finding suitable workflow templates, it is important for users to understand what the workflow templates actually do. Thus, there is a strong need that the knowledge base of workflow templates could provide enough information for modellers to be able to determine which template is suitable for the reuse case at hand. In [9, 10], we introduce an approach to develop a workflow template relying on a set of semantic constraints and the structure of CPNs. The workflow template is formalized via an RDF [13] graph in which the dependencies between its activities are expressed. In this paper, we propose a method to semantically annotate workflow templates. Their retrieval through metaworkflow templates will model expert knowledge and guide the use of existing workflow templates. The idea of using content which characterizes workflow templates is not original. Indeed, it seems reasonable to use explicit information to find suitable templates to build a business workflow. This is particularly important for workflow modellers to be able to deal with the great number of workflow templates. Based on the analysis of the state-of-the-art concerning the organization and reuse of workflow templates, we annotate workflow templates by the following properties as follows: 41
 templateName: Description of the main task being enacted by the template.  description: Description of the template.  keywords: List of words that characterizes the template. It also includes the words that name the template.  listOfActivityLabels: The labels are extracted from activity labels in the template.  creationDate: The date when the template is created.  modificationDate: The date the template is last modified.  relatedTemplates: List of related templates (if any). The related templates can be predecessors and successors of the template.  bpOnt: Indicating the business process ontology used to develop the template. The properties templateName, description, keywords and relatedTemplates are determined by using expert knowledge. In contrast, the values of the properties creationDate and modificationData are automatically captured at the moment of storing the template. Depending on all the activity labels in the template, the value of the property listOfActivityLabels is automatically retrieved. For example, to get all activity labels of the template http://WFTemplate#Payment_Processing, the following SPARQL2 query is first executed to get all IDs of its transitions: SELECT distinct ?trans WHERE
{k:Payment_Processing h:hasTrans ?trans}
Then the labels of these transitions are cut from their IDs and added to the list of activity labels. The property bpOnt captures the names (or URLs) of the business process ontology file. This property leads us to the representation of additional knowledge that facilitates modellers to search for suitable templates, which can be used to design a new one. An ontology is thus developed to annotate workflow templates. The ontology describes the main classes and properties for RDF annotations of workflow templates (see Figure 2). In fact, the semantic annotations of workflow templates have been inspired by this idea: the knowledge added to these annotations will be helpful for the (re-)use of workflow templates. Those meta-workflow templates allow retrieving a list of workflow templates that correspond to different criteria. For example, to acquire all existing workflow templates relating to payment by credit card, two criteria are used: (i) one keyword of such template is credit card; (ii) description of such template contains payment procecss. This can be performed by the SPARQL3 query as follows: 2
SPARQL is a query language, inspired by SQL for querying RDF data. It is adapted to the specific structure of RDF and relies on the triplets that constitute them. SPARQL allows adding, removing, searching and/or modifying data in RDF format. SPARQL can also be used to query RDFS or OWL vocabularies (written in RDF). 3
PREFIX anno:<http://ontWFTemplateAnnotationsURI.owl#> 42
Figure 1. Example of the semantic annotation of Payment workflow template
SELECT * WHERE
{ ?workflow anno:keywords ?keyword
FILTER (?keyword ~ "credit card"^^xsd:string)
?workflow anno:description ?descr
FILTER (?descr ~ "payment process"^^xsd:string)
?workflow anno:templateName ?name;
anno:listOfActivityLabels ?actLabel;
anno:relatedTemplates ?relatedTemp;
anno:creationDate ?crtDate;
anno:modificationDate ?modDate }
As a result, a semantic annotation of workflow templates which expresses knowledge relative to their properties is proposed here. The expert knowledge is captured as RDF annotations to conduct users to model new business processes. Figure 1 illustrates a simplified example of such semantic annotation. templates allow retrieving workflow templates, which are annotated with additional expert knowledge formalized with the help of the CPN ontology (for more details please see [10]) and the BP ontology (for more details please see [9]). In the following we introduce an excerpt of the RDF annotation related to the workflow template http://WFTemplate#Payment depicted in Figure 1. <rdf:RDF
xmlns ="http://ontWFTemplateAnnotationsURI.owl#"
xmlns:wf="http://WFTemplate#"
xmlns:rule="http://ECARule#"
... >
<TemplateAnnotation rdf:ID="wf0012">
<templateName
rdf:resource="http://WFTemplate#Payment"/>
<keywords>Cash;Credit card; Payment; Payment
processing </keywords>
<listOfActivityLables>Request
payment;
Provide
payment methods; Get payment data; Process check or
cash; Process credit card; Accept payment; Reject
payment </listOfActivityLables>
<description>Template payment processing is used to
handle the payment process...</description>
<relatedTemplates
rdf:resource="http://WFTemplate#Invoicing"/>
<relatedTemplates rdf:resource=
"http://WFTemplate#OrderProcessing"/>
...
<bpOnt rdf:resource="http://BPOntology#
Payment"/>
Figure 2. Extract of the annotation ontology used to annotate
workflow templates
It is important to emphasize that those meta-workflow ...
</TemplateAnnotation>
</rdf:RDF>
4. Process for Developing Workflow Template
In this section, we introduce a process for developing workflow templates, which is regarded as part of a process for developing an encompassing workflow application. The process consists of the main following phases (see Figure 3):  Search for reusable workflow templates: An analysis of the process(es) is performed before implementing it. This results in a set of requirement descriptions as well as a business process model. The information is then used to start the process for developing workflow templates which may involve the search for reusable workflow templates.  Understand and select potential, suitable
templates: In this phase, modellers have to carefully consider the found workflow templates. They try to understand them to decide which ones are (partly or fully) reused for their application.  Modify selected templates: If the selected templates do not comply with all the requirements, they have to be modified accordingly. For example, some new activities can be added into a selected template.  Create new sub-workflow templates: Besides reusing part or all of the existing templates, modellers might have to create new sub-workflow templates to meet all the requirements. However, the creation of a new subworkflow template is only necessary if no existing templates can be reused instead for the same purpose.  Complete workflow templates: The last phase is to complete a new workflow template. The existing unmodified, modified and new sub-workflow templates are integrated into a new workflow template for a specific use case. Each of these workflow templates is considered as a sub-workflow of the new workflow template. It is then verified at the syntactic and semantic level. In case of errors, the errors have to be solved. The new workflow template is stored in the CBWT repository if and only if there exist neither syntactic errors nor semantic errors. Figure 3. Development of reuse-based workflow template
To find suitable workflow templates, users can define their criteria via keyword, description or activity labels. If the search process returns only one template, users can 43
easily make their decision that the template is selected or not selected. Otherwise, the value of the property RelatedTemplates can be used to provide more information for users to make their decision. To sum up, the semantic annotations of workflow templates integrating expert domain knowledge formalized via an RDF graph are used to organize and retrieve workflow templates and their business process ontologies. The resulting templates and their rules can be used in a process for implementing software components or in a process for developing workflow templates. 5. Conclusion
In this paper, we have presented a process for developing workflow templates, which specially emphasizes the different phases of workflow template reuse comprising the tasks of searching, understanding and modifying workflow templates. Each phase provides useful support to facilitate the reuse of workflow templates. Moreover, in order to better support the search for suitable workflow templates, the annotation ontology has been developed to annotate workflow templates. The ontology provides adequate information about the workflow templates for workflow modellers to determine whether a workflow template is able to be reused. At the moment, only build-time is supported and we know that verifying workflow templates at the build-time is not sufficient to guarantee that workflows can be executed correctly. The correctness of workflow execution must also be checked. Therefore, in future work, we plan to develop a run-time environment for validating concrete workflows. REFERENCES
[1] Rik Eshuis and Paul W. P. J. Grefen. Constructing customized process views. Data Knowl. Eng., vol. 64, no. 2, 2008, pages 419-438 [2] G. Greco, A. Guzzo, L. Pontieri, L. and D. Saccà (2004). An ontology-driven process modeling framework. In 15th International Conference on Database and Expert Systems Applications, IEEE Computer Society, Zaragoza, Spain, pp. 13–23. [3] Agnes Koschmider, Thomas Hornung and Andreas Oberweis. Recommendation-based editor for business process modeling. Data Knowl. Eng., vol. 70, no. 6, 2011, pages 483-503 [4] Agnes Koschmider and Hajo A. Reijers. Improving the process of process modelling by the use of domain process patterns. Enterprise IS, vol. 9, no. 1, 2015, pages 29-57. [5] Markus Kradolfer. A workflow metamodel supporting dynamic, reuse-based model evolution. PhD thesis, 2000 [6] Ruopeng Lu, Shazia Sadiq and Guido Governatori. On Managing Business Processes Variants. Data Knowl. Eng., vol. 68, no. 7, July 2009, pages 642-664. [7] Ivan Markovic and Alessandro Costa Pereira. Towards a Formal Framework for Reuse in Business Process Modeling. In Proceedings of the 2007 International Conference on Business Process Management, BPM'07, Berlin, Heidelberg, 2008. Springer-Verlag, pages 484-495. [8] Jan Mendling and Carlo Simon. Business Process Design by View Integration. In Business Process Management Workshops, BPM 2006 International Workshops, BPD, BPI, ENEI, GPWW, DPM, semantics4ws, Vienna, Austria, September 4-7, 2006, Proceedings, 2006, pages 55-64. [9] Thi-Hoa-Hue Nguyen and Nhan Le-Thanh. Ensuring the Semantic Correctness of Workflow Processes: An Ontological Approach. In 44
Proceedings of 10th Workshop on Knowledge Engineering and Software Engineering (KESE10) co-located with 21st European Conference on Artificial Intelligence (ECAI 2014), volume 1289. CEUR Workshop Proceedings, Prague, Czech Republic, August 2014, pages 30-41. [10] Thi-Hoa-Hue Nguyen and Nhan Le-Thanh. An Ontology-Enabled Approach for Modelling Business Processes. In Beyond Databases, Architectures, and Structures, volume 424 of Communications in Computer and Information Science. Springer international Publishing, 2014, pages 139-147. [11] Thi-Hoa-Hue Nguyen and Nhan Le-Thanh. Ensuring the Correctness of Business Workflows at the Syntactic Level: An Ontological Approach. In Proceedings of ACIIDS 2016, Da Nang, Vietnam, 2016, pages 533-543. [12] https://www.w3.org/RDF/, accessed in April 2016 [13] https://www.w3.org/TR/rdf-sparql-query/, accessed in April 2016
(The Board of Editors received the paper on 12/04/2016, its review was completed on 20/04/2016)
45
A NEW PROPOSED METHOD FOR AUTOMATIC NUMBER PLATE
RECOGNITION
Bui Huu Phu1, Trinh Hoang Hon2
1
2
Institute of Applied Mechanics and Informatics; huuphu@iami.vast.vn
Hochiminh City University of Technology; trinhhoanghon09@gmail.com
Abstract - This paper describes our new proposed method for
automatically identifying the text of vehicle number plate. From a
new image, the method automatically extracts plate, classifies and
recognizes characters (digits). Firstly, Laplace operator is used to
calculate the magnitude of gradient which then is binarized based
on a threshold. In the second phase, a sub-window slides all
images to search the candidate of plate.The best candidate is
chosen by aspect ratio conditions. The extracted plate is then
enhanced and classified by colour segment conditions to find
candidates of characters as foreground. The horizontal and vertical
histograms are used to classify and extract each character
separately. Finally, Support Vector Machine algorithm is used to
identify the characters. The experimental results have shown that
our proposed method obtains high accuracy and is available for
real applications.
Key words - Automatic number plate recognition (ANPR); Laplace
operator; plate extraction; plate classification; plate identification.
1. Introduction
Automatic number plate recognition (ANPR), also called other names as Automatic license-plate recognition (ALPR), Automatic license-plate reader (ALPR), Automatic vehicle identification (AVI), Car plate recognition (CPR), License-plate recognition (LPR), Lecture automatique de plaques d'immatriculation (LAPI), Mobile license-plate reader (MLPR), or Vehicle licenseplate recognition (VLPR), is a technology that uses optical character recognition on images to read vehicle registration plates. It can use existing closed-circuit television, roadrule enforcement cameras, or cameras specifically designed for the task. ANPR is used by police forces around the world for law enforcement purposes. It is also used for electronic toll collection on pay-per-use roads and as a method of cataloging the movements of traffic for example by highway agencies. Automatic number plate recognition can be used to store the images captured by the cameras as well as the text from the license plate, with some configurable to store a photograph of the driver. Systems commonly use infrared lighting to allow the camera to take the picture at any time of the day [1-3]. ANPR technology tends to be regionspecific, owing to plate variation from place to place. ANPR was invented in 1976 at the Police Scientific Development Branch in the UK. Prototype systems were working by 1979, and contracts were let to produce industrial systems, first at EMI Electronics, and then at Computer Recognition Systems (CRS) in Wokingham, UK. Early trial systems were deployed on the A1 road and at the Dartford Tunnel. However it did not become widely used until new developments in cheaper and easier to use software was pioneered during the 1990s. The first arrest through detection of a stolen car was made in 1981 and the first documented case of ANPR in helping solve a murder occurred in November 2005 after the murder of Sharon Beshenivsky, in which City of Bradford based ANPR played a vital role in locating and subsequently convicting her killers [4]. The software aspect of the system runs on standard home computer hardware and can be linked to other applications or databases. It first uses a series of image manipulation techniques to detect, normalize and enhance the image of the number plate, and then optical character recognition (OCR) to extract the alpha-numeric of the license plate. ANPR systems are generally deployed in one of two basic approaches: one allows for the entire process to be performed at the lane location in real-time, and the other transmits all the images from many lanes to a remote computer location and performs the OCR process there at some later point in time. When done at the lane site, the information captured of the plate alphanumeric, date-time, lane identification, and any other information required is completed in approximately 250 milliseconds. This information can easily be transmitted to a remote computer for further processing if necessary, or stored at the lane for later retrieval. In the other arrangement, there are typically large numbers of PCs used in a server farm to handle high workloads, such as those found in the London congestion charge project. Often in such systems, there is a requirement to forward images to the remote server, and this can require larger bandwidth transmission media. ANPR uses optical character recognition (OCR) on images taken by cameras. When Dutch vehicle registration plates switched to a different style in 2002, one of the changes made was to the font, introducing small gaps in some letters (such as P and R) to make them more distinct and therefore more legible to such systems. Some license plate arrangements use variations in font sizes and positioning—ANPR systems must be able to cope with such differences in order to be truly effective. More complicated systems can cope with international variants, though many programs are individually tailored to each country. There are seven primary algorithms that the software requires for identifying a license plate: - Plate localization – responsible for finding and isolating the plate on the picture. - Plate orientation and sizing – compensates for the skew of the plate and adjusts the dimensions to the required size. - Normalization – adjusts the brightness and contrast of the image. - Character segmentation – finds the individual characters on the plates. - Optical character recognition. 46
- Syntactical/Geometrical analysis – check characters and positions against country-specific rules. develop a domestic ANPR with the same quality but much cheaper than imported ones. - The averaging of the recognized value over multiple fields/images to produce a more reliable or confident result. Any single image may contain a reflected light flare whether it is partially obscured or other temporary effect. In the paper, the authors present our own proposal of ANPR. We have developed a new algorithm, then build the software, and test it in the realistic environment. The results have shown that our ANPR software has worked very well and given high precision nearly 100% under the industrial test. The authors believe the software can be packed to be commercialized in the near future. The complexity of each of these subsections of the program determines the accuracy of the system. During the third phase (normalization), some systems use edge detection techniques to increase the picture difference between the letters and the plate backing. A median filter may also be used to reduce the visual noise on the image. ANPR has been widely studied in the world. In [6], the author has described a fast algorithm for automatic license plate detection system for the Egyptian license plates that achieves a high detection rate without the need for a high quality images from expensive hardware. The system captures images of the vehicles with a digital camera. An algorithm for the extraction of the license plate has been explained and designed using Matlab. The result can be achieved at about 96% detection rate for small dataset. In [7], as few constraints as possible on the working environment are considered. The proposed LPR technique consists of two main modules: a license plate locating module and a license number identification module. The former characterized by fuzzy disciplines attempts to extract license plates from an input image, while the latter conceptualized in terms of neural subjects aims to identify the number present in a license plate. Experiments have been conducted for the respective modules. In the experiment on locating license plates, 1088 images taken from various scenes and under different conditions were employed. Among them, 23 images have been failed to locate the license plates present in the images; the license plate location rate of success is 97.9%. In the experiment on identifying license number, 1065 images, from which license plates have been successfully located, were used. Among them, 47 images have failed to identify the numbers of the license plates located in the images; the identification rate of success is 95.6%. Combining the above two rates, the overall rate of success for our LPR algorithm is 93.7%. In [8], the proposed method applied on yellow color license plate. It has two main stages. Firstly, exact location of the license plate is detected from an input image by using image acquisition and optical character recognition and Sobel edge is used for character segmentation. Secondly, template matching is used to test the recognized characters with templates. This paper also proposes vehicle authorization by checking the license plate number from database and electronic mail is send to administrator if authorization fails. In [9], the Edge Detection methods are used to locate the rectangles from an image. This is very simple and fast technique. Morphology [10] is used to extract the license plate from the original image. It helps to remove unwanted small parts from license plate. In Vietnam, the demand for the software of ANPR is very high in many applications. Until now, in the Vietnam market, only the imported software licenses with the high price have been used. Therefore, the authors want to The remaining of the paper has the structure as follows. In section 2 the model of ANPR is presented. In sections 3 and 4, our proposed algorithm and processing steps of ANPR are described. The experimental results are shown in section 5. Finally, the conclusions are discussed in section 6. 2. Model of Automatic Number Plate Recognition
In general, the processing steps of ANPR are shown in Figure 1. The input images got from digital cameras will detect and extract the plate region, and then the software will classify and identify characters and digits. Finally it gives the result of recognizing the number plate of the vehicle. Figure 1. Proposed scheme for identifying plate vehicles
In ANPR, the steps of plate extraction, character (digit) classification, and character (digit) identification are the most important, and decide the quality and correction of the software. a. One row of characters/digits b. Two rows of characters/digits
Figure 2. Several types of vehicle plates in Vietnam
Because the number plates of vehicles are different in countries, the processing algorithms will be different. In Vietnam, basically, there are 2 common kinds of vehicle plates shown in Figure 2. The number plate recognition of vehicles in Vietnam is quite difficult because many number plates are not clear, bended, and mounted with strange things. In the following sections, our proposed methods in the important steps of ANPR are presented. 3. Plate Extraction
The vehicle plate structure in Vietnam is determined by the Vietnamese government. The dimension and font size of vehicle plates are standardized commonly. There are usually ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
two kinds of plates as one row or two rows characters, shown in Figure 2. The dimension of one row character plates is 470mmx110mm, the height of characters is approximately 75% but not higher than 80% of the plates, and the width of characters equals a half of the height. For the plates with two row characters, the dimension is 280mmx200mm, but the size of characters is similar to the first kind. In the realistic environments, the plates are affected by the distortion such as scale, skew, rotation, and cameras. So in the process, the relative dimensions are used with tolerance ratio between plate's dimensions built by the experience. 47
the candidate is chosen from candidates if its aspect ratio is passed the condition in the non-equation (3), whereas nonequations 3(a) and 3(b) are applied for one row and two row character plates respectively. Figure 4 (d) shows a result of plate detection. 0.15 ≤
≤ 0.3
ℎ
(3 )
≤ 0.95
ℎ
(3 )
0.5 ≤
4. Character (Digit) Identification
The extracted plates are binarized to get foreground shown in Figure 5a, the intensity of pixel is inverted to get the white foreground as shown in Figure 5b. Four line segments nearby bounding box are used to retrieve the rectangular shape. To do so, the 2D-2D projection is used. Then the plates are normalized to the real aspect ratio of =
. (b)
(a)
Figure 3. (a) Original image, (b) Magnitude of gradient with
Laplace operation
a)
(a)
(b)
(b)
(c)
Figure 5. (a) enhanced characters of two row plate, (b) inverted
image, (c) vertical histogram and broken point
(c)
(d)
Figure 4. Plate extraction; (a) Binary image, (b) survived
image, (c) aspect ratio verification, (d) example of results of
plate extraction.
Firstly, the input image (Figure3 (a)) is performed to get edge enhancement by Gaussian operator [11] as Eq.1 whose  is chosen √2; and Gaussian Kernel size is 3 × 3 pixels. ( , )=
exp(−
), ∑
( , )
≥ 15, (b)
(1) The results (an example in Figure3 (b)) are binarized with the threshold of = 0.07, then a subwindow with 16 × 8 size is slided to search candidates of plates, the candidates which satisfy condition in (2) will survive. ∑
(a)
(2) where, BW is considered as binary image, w and h are the width and height of sub-window. Threshold value is chosen as 15 by our experience. A demonstration of this step can be seen in Figure 4 (b). A bounding box of each plate candidate is calculated, (c)
(d)
Figure 6. Character (digit) classification: (a) horizontal histogram,
(b) characters separated, (c) width and area of the candidate of
characters, (d) example of results of character classification
In the case of two row character plates, a horizontal histogram is set up to separate the first and the second row of character. A vertical histogram of each row of both kinds of plates is calculated as shown in Figure 6. Two thresholds are issued for this contest, one is a character width (
) 48
and the other is the min area (
). (
) is selected by from 70% to 130% the real size;. This means that 9 ≤ TCW ≤ 17 (4) pixels. For example T CW min = 0,7 x 40 x = 8,9 ≈ 9 (5) pixels, while Amin is defined as the product of the character width and the peak of vertical histogram. All the conditions are demonstrated in Figure 6. In practice, if the horizontal histogram of two row character plates and/or the vertical histogram have not been broken points, this means that the rows or characters could not be classified, then the plates are treated as the negative error of the previous step; the negative error defines that non-plate is undetected as a plate. 5. Experimental Results and Discussions
Based on the proposed algorithms, the authors have developed the ANPR software completely. The software is developed based on C++ through Visual Studio 2008, and uses image processing library OpenCV version 2.4.9. The authors have set up a ANPR system at An Suong An Lac Tolling Station for testing the software and system. The camera used for testing our software is IRLab with the model CIR- HUW34WP and the resolution of 700TVL. During the time testing, there are about 10000 vehicle samples collected and tested. The authors have evaluated that with about 9000 clear and good appearance plates, the ANPR system can give very good and correct results. The system can work well in day time and night time. In addition, the software can well recognize the number of the blue and red color plates. Below are some results that have done at An Suong An Lac Tolling Stations. (a)
(b)
(c)
Figure 7. Complete process steps in ANPR: (a) plate extraction,
(b) character/digit classification, (c) character/digit
identification
The last step for this phase is character identification; the supported vector machine [1] algorithm is used to identify the extracted characters. The training set of characters is automatically extracted as previous steps, and then 50 correct ways of each character or digit are chosen by program. They are then used as the input data for the training function. The training process is performed in offline mode. Figure 7 illustrates a complete process steps in ANPR, consisting of the input image and the result of plate extraction, shown in Figure 7(a); the result of character classification, shown in Figure 7(b); and the character identification, shown in Figure 7c. Figure 8. Some test results of the proposed ANPR system
Although, the ANPR software has given a good result, in some realistic cases, the system can not recognize the number of plates. After reviewing and evaluating, we see that there are some reasons why the ANPR can not work well as follows: - The plates are damaged, curved, distorted. - The plates are attached to some abnormal subjects. - The plates are too dim ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
In the future, we will consider developing new methods to improve the quality and correction of our ANPR system. 6. Conclusions
In the paper, we have presented our proposal to develop ANPR algorithm and system. The important steps in the proposal have been described in detail. After completely building the software and setting up the system at An Suong An Lac Tolling Collection Station, the authors have tested it under the realistic environments for a month with about 10000 vehicle number plate samples. As a result, we see that our proposed ANPR software can work very well and give very high precision of number recognition. In the standard condition, the ratio of the correct number recognition is approximately 100%. However, in some special cases when the number plates are damaged, distorted, or dim, the software does not work well. With the result, it is obvious that our proposed and developed ANPR software can be packed to be used for realistic applications in the future. Acknowledgment
The authors would like to thank National Key Laboratory of Digital Control and System Engineering (DCSELAB) and Hochiminh City Department of Science and Technology for supporting and funding the research project. 49
REFERENCES
[1] "ANPR Tutorial". ANPR Tutorial. 15 August 2006. Retrieved 2012-01-24. [2] Shan Du; IntelliView Technol., Inc., Calgary, AB, Canada; Ibrahim, M.; Shehata, M.; Badawy, Wael; Automatic License Plate Recognition (ALPR): A State-of-the-Art Review". IEEE. 1 Feb
2013. Retrieved 2014-01-09. [3] "An introduction to ANPR". Cctv-information.co.uk. Retrieved 2012-01-24. [4] "CCTV network tracks getaway car". BBC News. 21 November 2005. Retrieved 2013-08-12. [5] Amr E. Rashid, “A fast algorithm for license plate detection”, International Conference on Signal Processing Image Processing &
Pattern Recognition (ICSIPR), pp. 44-48, Feb. 2013. [6] S.L. Chang, L.S. Chen, Y.C. Chung, and S.W. Chen, “Automatic license plate recognition”, IEEE Transactions on Intelligent
Transportation Systems, vol. 5, pp. 42-53, Mar. 2004. [7] V. Sharma, P. C. Mathpal, and A. Kaushik “Automatic license plate recognition using optical character recognition and template matching on yellow color license plate”, International Journal of
Innovative Research in Science, Engineering and Technology, Vol. 3, pp. 12984 – 12990, May 2014. [8] Zheng, D., Zhao, Y., and Wang, J., “An Efficient Method of License Plate Location”, Pattern Recognit. Lett.., vol.26, pp.2431-2438, 2005. [9] Nelson, C., and Babu,,K., “A License Plate Localization using Morphology and Recognition”, IEEE India conference, pp.34-39, 2008. [10] Dingyun, W., Lihong, Z., and Yingbo, L., “A New Algorithm for License Plate Recognition Based on Improved Edge Detection and Mathematical Morphology”, IEEE International Conference on
Information Science and Engineering, pp.1724-1727, 2010. [11] G.T. Shrivakshan, and C. Chandrasekar, “A Comparison of various Edge Detection Techniques used in Image Processing”, International Journal
of Computer Science Issues, Vol. 9, Issue 5, No 1, September 2012. (The Board of Editors received the paper on 22/04/2016, its review was completed on 05/05/2016)
50
RESEARCH ON APPLICATION OF SERVPERF MODEL IN ASSESSING
VIETTEL’S MOBILE INTERNET SERVICE QUALITY IN DANANG CITY
Dam Nguyen Anh Khoa1, Nguyen Hoang Thao Nguyen2
1
The University of Danang, University of Science and Technology; dnakhoa@dut.udn.vn
2
Minh Toan Service & Trading Co. Ltd; nguyennguyen@minhtoangalaxyhotel.vn
Abstract - Nowadays, telecommunication industry has grown rapidly
in Vietnam market. The popularity of smart phones and tablets leads
to the increase in users of Internet mobile services. In the race of profit,
telecommunications providers in Vietnam have been improving
service quality to satisfy current customers and attract potential
customers. Despite being one of the three largest telecommunication
providers with significant investment in this industry, Viettel’s quality of
Internet mobile services has not really met customer expectations.
This study applies the SERVPERF model to assess the Internet
mobile service of Viettel and figures out the existing problems of this
provider in Danang market. Then the author gives recommendations
in terms of staff, convenience, and responsiveness to improve the
quality of Viettel’s Internet mobile services.
Key words - telecommunications providers; Internet mobile
services; SERVPERF model; service quality; customer
satisfaction.
1. Problem Statement
Along with many factors, Mobile Internet users are really not satisfied with the service quality. In spite of large investment in 3G technology, Viettel Corporation has not yet earned customer satisfaction.Kotler defined customer satisfaction as the extent to which a product’s perceived performance matches a buyer’s expectations [9]. Therefore, Viettel need to find effective measures to develop services and meet customer expectations. To assess the service quality of Viettel Mobile Internet, we have to interview and survey users, then analyze database through SPSS software to find out the relationship of customer satisfactions and service quality, based on theoretical basis and suitable analysis model. These analysis models such as SERVQUALI/SERVPERF model [3] or Parasurman [1] is one of the effective approaches to measure the service quality, but it is quite hard to learn and very time-consuming to implement assessment [12]. According to GSMA Intelligence [3], there had been by the end of year 2013 about 123.7 million mobile connections in Vietnam, while the total population in Vietnam is 92.1 million. By the end of year 2013, the number of Mobile Internet users was 24.74 million (occupying 20% mobile connections), an increase of 36.83% year-on-year. These statistics indicate that the Mobile Internet is fast becoming an important part of daily life in Vietnam. Nowadays, mobile Internet is a potential and competitive market. To have stable foothold and improve service quality, each company always has to set up reasonable strategies, and scales to capture the trend, and overcome weaknesses, and understand feedbacks from customers [2]. Therefore, understanding consumer behavior is an important factor in the process of building quality scale [4] of Mobile Internet services in Da Nang City. Research objectives include: - Exploring components of the service quality. - Assessing the quality of Viettel’s Mobile Internet service Da Nang City at present by applying SERVPERF model. - Understanding customers’ behavior in using Viettel’s Mobile Internet service through customers’ feedbacks. - Finding out the measures to overcome weaknesses and improve Mobile Internet service quality of Viettel in Da Nang City. 2. Research methodology
2.1. Data collection methods
Documentary review: Secondary data, such as books, articles, academic journals, electronic database or theses are good materials for reference. Primary Data: Based on the quantitative method, we use questionnaire to collect quantitative data by survey links or hard copy questionnaires to send out to Viettel’s users of mobile Internet services. Sample size is fixed at 300. 2.2. Literature Review
2.2.1. Service
Services are economic activities offered by one party to another, most commonly employing time-based performances to bring about desired results in recipients themselves or in objects or other assets for which purchasers have responsibility [6]. In exchange for their money, time, and effort, service customers expect to obtain value from access to goods, labor, professional skills, facilities, networks, and systems; but they do not normally take ownership of any of the physical elements involved [7]. 2.2.2. Nature of service
Intangibility:
Services differ from products in the way that they cannot be touched, felt, seen or tasted in the same way products can [9]. Unlike products, services are performed experiences and not objects. The lack of tangible attributes causes the services to be harder to evaluate than products [8]. Simultaneously:
The process of production and consumption of services occur simultaneously. Different from physical production, production of services is unavailable in storage to deliver then to consumers. The manufacturing process occurs simultaneously with consumption of services [10]. Heterogeneity:
Quality of service usually fluctuates in a wide range, depending on the circumstances that create services (for ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
51
example: suppliers, time and place to supply service). Consumers can evaluate a tangible product through product design, the color of the packaging etc and can touch, smell, see, or taste the product before purchase [5]. H2: Reliability has positive relationship with perceived service quality Perishability:
Perishability suggests that services, unlike products, cannot be stored and saved for a later occasion. Consumption of services is limited by time [8]. H4: Assurance has positive relationship with perceived service quality 2.2.3. SERVPERF model
H6: Customer satisfaction has a positive relationship with service quality. In 1992, Cronin and Taylor worked together to present a new model which can replace SERVQUAL model. SERVPERF was developed by their efforts to get over the “Perceptions – minus – Expectations”. Besides the wide range of propositional theoretical concepts, Cronin and Taylor also provided the variety of realistic evidences in four industries (namely banking, pest control, dry cleaning and fast food) to reveal the superiority of SERVPERF in comparison with SERVQUAL. SERVPERF model uses only 22 questions, which ask about the customer perceptions in five dimensions to measure service quality [11]. 2.2.4. Service quality and customer satisfaction
H3: Responsiveness has positive relationship with perceived service quality H5: Empathy has positive relationship with perceived service quality 3. Data Analysis & Findings
3.1. Descriptive Statistics
3.1.1. Gender
In this research, subjects surveyed mostly under 20 years old and from 25 to 35 years old account 53.7%, and 35.3% respectively. These two kinds of subjects are of great influence on the research. 3.1.2. Frequencies of Usage
Based on the analysis results, most of the respondents say that the use of Mobile Internet Service is necessary and almost everyone uses Internet every day. Only 10% sometimes use it and 0.3% never use it. 3.2. Overall Satisfaction:
Conditions to ensure reliability: 

Cronbach Alpha ≥ 0.6 Corrected Item - Total Correlation > 0.3 The measure taken is principal component because satisfaction scale is single direction variable. The scale will be accepted when: Figure 1. Customer perceptions of quality and customer
satisfaction [11]
Figure 1 shows the relationship between customer satisfaction and service quality. The author has shown a situation where service quality is a focused evaluation which reflects the customer's perception of reliability, assurance, responsiveness, empathy, and Tangibility while customer satisfaction is more comprehensive and it is affected by perceptions of service quality, product quality, price, situational factors and personal factors [11]. 2.2.5. Conceptual framework



0.5 ≤ KMO ≤ 1 Variance ≥ 50% Eigenvalues > 1 3.2.1. Reliability of data – Cronbach Alpha test
Table 1. Cronbach Alpha test
Cronbach Alpha: 0.750 N: 4 Corrected Item - Total Correlation SAT1 0.51 SAT2 0.613 SAT3 0.506 SAT4 0.567 From Table 1, Cronbach Alpha of overall satisfaction (SAT) scale is 0.750 > 0.6, and no variable that is smaller than 0.3 in Corrected Item-Total Correlation, and there are also no variables in Cronbach's Alpha if Item Deleted bigger than Cronbach Alpha (0.750). Therefore, no variable is eliminated and overall satisfaction scale is enough conditions to ensure reliability [11]. 3.2.2. Exploratory factor analysis
Figure 2. Conceptual framework
Figure 2 shows the following hypotheses:
H1: Tangibility has positive relationship with perceived service quality Table 2 shows that four variables of overall satisfaction are extracted with one component with Eigenvalue = 2.305 > 1; % of Variance = 57.628% > 50%; and KMO = 0.759 is in the range of 0.5 and 1. If all variables fully meet the 52
conditions, overall satisfaction scale is accepted. Table 2. Component Matrix
Component Matrix
Component SAT1 0.726 SAT2 0.808 SAT3 0.726 SAT4 0.774 Eigenvalue 2.305 % of Variance 57.628% KMO 0.759 3.2.3. SERVPERF model evaluation
According to literature review, SERVPERF model is divided into five dimensions. This part aims to test these dimensions of SERVPERF model with collected data with such methods as: Cronbach Alpha, Exploratory factor analysis (EFA), Correlation, Regression, T-Test, and One way-ANOVA test. The result indicates that three dimensions, namely staff, convenience, responsiveness have total correlation and Cronbach’s Alpha is acceptable. With assurance dimension, Cronbach’s Alpha coefficient is <0.6 and it can not delete the variable to increase reliability coefficient (because reliability analysis model requires the number of variables over or equal 3, and if we delete the variable, it will not be accepted) thus assurance dimension is rejected from research model. Therefore, SERVPERF model is changed about the dimensions in quality of services after it is used to evaluate the service quality of Mobile Internet on cell phone from five dimensions to three dimensions and it also changes the name, the concept, the notation. The new model includes three dimensions: Staff, Convenience, and Responsiveness. correlation matrix between dependent variables - Satisfaction and independent variables into four Servperf dimensions are set. Table 4. Correlation Matrix
Staff
Staff
1 Convenience
.297** 1 Convenience Responsiveness Satisfaction
Responsiveness .377** .250** .424** .347** Satisfaction
1 .460** 1 According to Table 4, if significant level of 1% is used, then independent variables such as Staff, Convenience and Responsiveness are significantly correlated with dependent variables – customer satisfaction. Satisfaction correlates closely with the 3 dimensions of SERVPERF and 3 dimensions are also closely correlated with each other. Therefore, 3 dimensions are also independent variables in the next regression model. Due to the correlation of these dimensions, testing multicollinearity is conducted. Table 5. Regression Analysis
Model Summary Model R R Square Adjusted R Square Std. Error of the Estimate 1 0.564 0.318 0.311 0.55779 Coefficients Unstandardized
Coefficients
Standardized
Coefficients
Model B Std. Error Beta (Constant) 0.919 0.231 3.982 0.000 Staff 0.237 0.051 0.246 4.619 0.000 Convenience 0.187 0.049 0.194 3.816 0.000 3.2.4. Linear regression analysis
Responsiveness 0.356 0.059 0.319 6.072 0.000 Each dimension has several observed variables; therefore we need to calculate the mean of observed variables in each dimension group before testing the relationships. Through factor analysis and Cronbach Alpha testing, research model are calibrated from five dimensions to three dimensions. The new model includes three dimensions renamed as Staff, Convenience, and Responsiveness. Therefore, we calculate the mean of calibrated variables by the Transform/Compute command. It can also be used to collapse several variables that measure the same concept into a single variable, thus increasing the reliability of the measure. To calculate the mean score for each dimension, we type these formulas into Numeric Expression box as shown in Table 3. According to Table 5, we have three independent variables with significant level less than 0.05, namely Staff (0.237), Convenience (0.187), and Responsiveness (0.356). Table 3. Average values of target variables
Target Variables
Numeric Expression
STAFF MEAN(RP7,AS4,EP1,EP2,EP3) CONVENIENCE MEAN(TG2, TG3, TG4, TG5, RP1) RESPONSIVENESS MEAN(RP2,RP5,RP6,RL1,RL2,RL3) To test the suitability of the research model, the t Sig. Then the following multiple regression model characteristics for theoretical models are consistent with market data: Satisfaction = 0.237×Staff + 0.187×Convenience
+ 0.356×Responsiveness + 0.919 ± 0.55779
From these results, we should conclude that the higher quality of staff are related to higher satisfaction, that higher convenience is associated with higher satisfaction, and responsiveness is strongly related to satisfaction. 4. Findings
4.1. Key finding 1: Exploring the dimensions of the
service quality – SERVPERF model
According to the SERVPERF model, there are 22 questions used to measure the service quality and they are based on the users’ perception alone. The questions cover the customer’s assessment through 5 dimensions: Tangibility, Assurance, Responsiveness, Reliability and Empathy. ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
The reason why SERVPERF model is used to measure Viettel’s Mobile Internet service is its simplicity. Generally, SERVQUAL uses 44 questions in both two aspects (customer’s expectation and customer’s perception) to measure the service quality and then figure out the service quality by using the function: SERVICE QUALITY = PERCEPTION – EXPECTATION In terms of SERVPERF, only the customer’s perception is measured and the service quality is calculated more easily,so it prevents the insipidity of customers when they do the questionnaire. SERVICE QUALITY = PERCEPTION 4.2. Key finding 2: Assessing the quality of Viettel’s
Mobile Internet service Da Nang City at present by
applying SERVPERF model
In the process of applying the SERVPERF model, with the combination of previous studies about service quality and preliminary studies, 22 variables of SERVPERF model are formed. After testing the reliability of the scale by Cronbach Alpha at the first time, 19 observed variables are retained. Secondly, after doing EFA analysis, SERVPERF model had a change from five dimensions to 4 dimensions. Through the second Cronbach Alpha test, SERVPERF model only retains three dimensions with high reliability. The dimensions are calibrated and renamed as follows: 53
satisfaction in responsiveness will be low. There are differences in Staff evaluation through Education. We can draw the conclusion that customers with high level of education will evaluate service quality strictly. There is no difference in service quality assessing through gender. All customers in two genders have equivalent satisfaction with Mobile Internet Service that they are using. 5. Conclusions
In conclusion, this research explores important dimensions in service quality assessing, thus finding out suitable model for this study, especially in Mobile Internet service industry. It affirms that service quality can be assessed from the view of customer satisfaction because of their relationship. Under careful consideration, all collected data are screened, processed, and analyzed to clarify three main key findings of the research including: exploring dimensions of service quality, testing the suitability of SERVPERF model, and understanding customers’ behavior through their feedback. Then at last, some recommendations re presented to enhance the service quality of Viettel’s Mobile Internet service in Da Nang City, and in Viet Nam generally. Staff expresses communication skills, expertise, and empathy to gain trust from the customers. However, this study also reveals some limitations such as: financial difficulty, and academic knowledge barriers. In addition, the project has some certain areas which are not addressed completely. Convenience shows mobility and convenience for customers including factors related to facilities and services. 6. Recommendations
Serving is the knowledge and style of service personnel making customers trust (this dimension was eliminated after the second Cronbach Alpha test). 6.1. Recommendation 1: To enhance the training for
staff to be more aware of the relationship between service
quality and customer satisfaction
Responsiveness shows the ability to meet customers’ needs of service. Enhancing the awareness of staff about customer service is very important. Viettel should organize training courses for staff of customer service department to help them increase their knowledge and skill to serve customers. For example, each month, we invite a speaker to guide the method to serve customers. Company should also usually collect feedbacks from customers through hotline, email or survey. With the result, the conclusions will be conducted as follows: Firstly, we can know the dimensions of service quality and the impact of these components on customer satisfaction. Secondly, because many different subjects use this service, assessing the quality of service by the views of these objects is obvious. Thirdly, the evaluation by the explored structure does not reject or reduce sense of theory as well as SERVPERF model because the characteristics of observed variables the old dimensions still exist in the new dimensions. Selecting suitable lecturers and documents to train staff is the second important point. Viettel should combine theory and practicability on training programs; it helps the staff to orientate the proper way on job. At first, they can begin with small groups before expanding model. Besides, they should improve staff’s skill of using computer, computer software as well as English. 4.3. Key finding 3: Understanding customers’ behaviors
in using Viettel’s Mobile Internet service through
customers’ feedbacks
6.2. Recommendation 2: To increase the level of
satisfaction about Responsiveness dimension, company
should add new features
Convenience is the dimension that satisfy customers most, and the next is Staff, but Responsiveness is the dimension which has the lowest satisfaction degree. Testing deeper in customer satisfaction with such factors as income, gender, and education, we get some conclusions as follows: Viettel needs to upgrade their technology to improve service quality. They should apply the new feature: DC-HSDPA (Dual Cell high-speed downlink packet access) to increase the speed of download. HSDPA is a product of 3G technology; it allows the network on UMTS system to transmit data faster. HSDPA technology has its limits and to enhance its issues, DC-HSDPA is introduced. This new There are differences in Responsiveness evaluation through income. With people whose income is high, their 54
feature will help to increase the current rate six times It has good effect on customer satisfaction through the efforts. In the competitors’ website, the fee for each package is clearly presented; however, Viettel skip this step.This will confuse customers when they are reading and using the service. Therefore, Viettel needs to be careful on designing and announcing information to customers. [2]
[3]
[4]
6.3. Recommendation 3: To improve the interface of
Viettel to attract customers’ attention
The company should enhance the interface of website, layout the category, contents carefully to attract customers. Besides, they should update information regularly to help customers capture the new information. The information in website at this time is outdated, and customers find it very difficult to update news, event programs, or tariff. Viettel should use English language on the website. Now, they only use Vietnamese language and if they want to expand the market with potential customers, they have to do that. The foreigner can know the news or the feature of Viettel service when they visit the website. And through that, they will be aware of Viettel service and brand. REFERENCES
[1] ChiPhan and PhongNham, “Impact of service quality on customer [5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
satisfaction of automated teller machine service: Case study of a private commercial joint stock bank in Vietnam”, Business: Theory
and Practice, 2015, 16(3):280-289. Anh Chu, Turku University of Applied Sciences, Factors influence
customer satisfaction in mobile commerce, 2015. Lien Nguyen and Li Long, Soongsil University, A Study On The
Effect of Mobile Communication Service Quality On Customers
Loyalty in Vietnam, 2013. Gilbert A Churchill, Jr. and Lacobucci, Marketing research, Research: Ethological Foundations, 9th edn. USA: Stratford publishing service, 2005. Ishaq, M., “A study on relationship between service quality and customer satisfaction: An empirical evidence from Pakistan telecommunication industry”, Management Science Letters, 2011, 1(4), 523-530. John Wiley & Sons, Marketing Research Essential, 5thEdn, Inc Carl McDaniel & Roger Gates, 2006. K. Hoffman and John Bateson. Services Marketing: Concepts, Strategies, & Cases, 2010. Parasuraman A., Zeithaml, V. A., & Berry L., “A conceptual model of service quality and its implications for future research”, Journal
of Marketing, 1985, 49, 41-50. Philip Kotlerand Gary Armstrong, "Principles of Marketing", 14th Edns, Prentice Hall, 2012. Kuo YF, “A study on service quality of virtual community websites”, Total Quality Management & Business Excellence, 2003. Lewlyn and R. Rodrigues, “Service Quality Measurement: Issues and Perspectives”, Publisher: Anchor Academic Publishing, 2013. Kumar RaiCustomer, Relationship management: Concepts and cases, 2012. (The Board of Editors received the paper on 15/12/2015, its review was completed on 08/03/2016)
55
STUDENT PLAGIARISM – CAUSES AND SUGGESTED SOLUTIONS
University of Foreign Language Studies, The University of Danang
uyennpt@yahoo.com, chausavu@gmail.com
Abstract - This paper describes the phenomenon of plagiarism
among students at the English Department, University of Foreign
Language Studies, the University of Danang. This phenomenon
can be chiefly attributed to the availability and the easy access to
the internet and other digital information sources, students’ low
English proficiency, improper learning strategies and lack of
academic skills including quoting, referencing and paraphrasing.
It is also due to the tolerant attitude of the university and the
teachers as well as plagiarism acceptance among the student
community. In order to prevent plagiarism, it is suggested that the
university and the English Department should have transparent
policies, reliable plagiarism detection tools and severe penalty
systems. Besides, some courses should be modified to enhance
students’ language and academic skills; also, the staff should set
good examples in performing their professional skills. All of these
measures are expected to be taken thoroughly and consistently.
Key words - plagiarism; academic integrity; English Department;
causes; solutions.
1. Rationnales
One of the major objectives of university education is to build up scientific research capacity as well as academic ethics and integrity among students (Law on University Education, 2012). However, academic misconducts have been a big concern for the society and the education community. Plagiarism is one of the relatively popular and increasing acts of academic research ethical violation. Despite a variety of antiplagiarism measures being applied, this type of misconduct has not yet shown a sight of decrease in level and scope but increased to the extent that was so-called “epidemic cheating” (East, 2010; Park, 2003). Studies have shown that plagiarism at various levels can be seen among students from Europe, America, Asia and Africa, whose majors spread from natural sciences to social sciences. In other words, the misconduct is prevalent irrespective of disciplines, nationalities and cultures, and tends to multiply together with the rapid, deep and strong advances in Information Technology (Park, 2003). In our country, the year 2010 witnessed a heated discussion on plagiarism among the academic community, starting from the event where three articles by a group of Vietnamese authors were withdrawn from the Euro Physics Letters (a tear-one European physics journal) due to serious plagiarism while their act of misconduct was widely announced in the world’s scientific community. The event had negative effects on domestic scientists and damaged the image of Vietnam in the eye of the international academic world (Vũ Phương Anh, 2013; Trần Nam Dũng, 2013). On forums, Vietnamese social scientists and educators expressed various viewpoints on plagiarism, then its different aspects were mentioned in a series of articles, such as “What is plagiarism? What does a plagiarist violate?” and “Preventing plagiarism from a cultural perspective” by Dr. Vu Thi Phuong Anh, “The cultural source of plagiarism” by Prof. Ngo Tu Lap, “Plagiarism and scientific ethics” by Dr. Tran Nam Dung. According to a study by Tran Thi Tuyet (from Hanoi National University) on the causes of plagiarism among students at La Trobe and Melbourne Universities released in December 2012, plagiarism is “the result of the mutual interaction between a variety of personal and contextual causes” such as writing styles, learning styles, learning motivation, academic skills, etc. The concerns of academic community relating to the misconduct for years prove that plagiarism is a big challenge for the country’s education and science development. Most universities across the world have antiplagiarism supporting tools for students and apply strict punishments for plagiarism violators. Nevertheless, universities in Vietnam, especially the University of Danang (UD), have not yet paid due attention to this problem. Very few studies on honesty and integrity in academic research have been conducted; moreover, UD’s member universities have not imposed specific regulations on plagiarism prevention. In that context, we conducted an investigation into the current situation of plagiarism among students at the English Department (ED), University of Foreign Language Studies (UFLS), the University of Danang. This paper provides a summary of the study results, suggests causes of plagiarism and puts forward some fixing measures. 2. What is plagiarism? Why shouldn’t we plagiarize?
According to Oxford Dictionary (2012), plagiarism is “the practice of taking someone else’s work or ideas and pasing them off as one’s own”. Standler (2000) (cited from Vũ Phương Anh, 2013, p.2) “in mild cases, plagiarism may mean the quoting of several sentences without the quotation marks and citation of the authors. In worst cases, the majority of the writing piece or work belongs to others, the plagiarist eliminated the author’s name, replaced it with his/her name and adjusted the document format”. At universities in developed countries, the concept of plagiarism is clearly defined and explained in regulations on students’ academic research and testing and assessment, which are maintained in libraries and course syllabi. Always accessible to students, these documents help them avoid violations warned by the universities. After looking into materials from various universities, colleges and research institutes, we would like to present here the main types of plagiarism: - Students copy partially or entirely an essay or work of others and submit it under their name (with or without permission of the original authors). 56
- Students quote a part of an essay or work of others without attribution. - Students copy some content from different sources and rearrange it into their assignment. - Students paraphrase others’ ideas with their own words without attribution. - Students translate entirely others’ ideas or essays without attribution. - Students investigate and synthesize information from newspapers, magazines and online media on the Interner into their assignments without attribution. The above-mentioned behaviours, regardless of being intentional or accidental, are considered as violations of plagiarism. Plagiarism should be avoided for the following reasons: From the social perspectives, plagiarism is an act of stealing, dishonesty and cheating; therefore, it is always criticized by the community. Plagiarism is not only an ethical issue but a legal one. It is a form of intellectual property infringement, which is still a minor violation in Vietnam, yet an intolerable illegal act in many nations worldwide. From the education and training perspectives, plagiarism leads to the formation of academics who are lazy and dependent on others’ ideas and available information sources while losing their own independent and creative thinking. The lack of academic skills results in plagiarism, which in turn cause students to lose their confidence; in the long run, when integrating into regional or international academic environment, students will face many difficulties, barriers and surprises. Moreover, honesty in learning and science shows one’s self-respect, self-esteem and pride of their hard-earned achievements and genuine individual capacity. From the scientific and advanced education development perspectives, compromising plagiarism helps form an uncivilized, unjust and unprofessional education environment, where hard work and intellectual property are underated. In testing and assessment, plagiarism causes the unfairness in evaluating learners’ efforts. Many plagiarism cases are undetected and well applauded, while genuine assignments completed with serious efforts are not highly evaluated. Besides, plagiarism prevention offers a way to ensure reliability for students’ testing and assessment, which is a significant component in any curricula. 3. The current situation of plagiarism among students
at the English Department, University of Foreign
Language Studies, the University of Danang.
3.1. Research method
We conducted a survey on 200 junior and senior students at the English Department (ED), UFLS in schoolyear 2012-2013 and interviewed 20 lecturers of the department, who are leading academic writing courses and other courses with big assignments or graduation papersas assessment tools. The means of data collection included questionnaires for students, interviews for teachers, and students’ assignment analysis. Questions were simple and clear; researchers were ready to provide clarification if needed. The authors committed to utilize the collected data for research purposes only and emphasized the necessity of honest responses to ensure the study’s reliability. 3.2. Research results
3.2.1. Popularity
Plagiarism was common among students at the ED. 100% of students admitted this fact, 100% of lecturers acknowledged that they usually recognized plagiarism violations in assessing students’ big assignments, essays and graduation papers. 86% of students’ assignment samples showed plagiarism violations under different forms; the most common one was the copying a part of someone else’s assignment and citing information from books, newspapers and other sources without attribution. 3.2.2. Students’ knowledge
Most students did not understand what plagiarism was and misunderstood that plagiarism only meant copying the whole assignment of others without the authors’ permission. There was a correlation between students’ awareness of plagiarism and their violation rates. For example, supposing that paraphrasing others’ ideas with their own words without attribution was not registered as plagiarism, students committed this act on a regular basis. Similarly, they usually translated or made reference to information and failed to make attribution without knowing that it was a violation of academic ethics. Therefore, it can be seen that plagiarism behaviours among students can be intentional (intentionally copying or paraphrasing others’ work), or unintentional (due to the lack of referencing skills) or failing to understand the seriousness of their deed. 3.2.3. Students’ attitude
In general, students failed to acknowledge the severity of plagiarism behaviours. A small portion (3%) even supposed that plagiarism was allowed by the university and teachers; 42% stated that the act was accepted widely by their friend circle and the student community. Only 27% considered it as a violation that needed preventing. Overall, plagiarism was not only common but also registered as a natural and accepted deed among students. 3.2.4. Causes
Causes for students’ violation of plagiarism are presented as follows. The first cause: the easier internet-enabled information and reference searching. The increasing availability and accessibility of informarion regardless of time and place allows one to google out a series of relevant data and articles with just a few words typed in and a click. The temptation of this information supporting source makes students subjective, dependent and refrain from working hard for their school tasks. The second cause: the lack of confidence in one’s ability to express himself in English and difficulties in ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
choosing appropriate words, structures and writing styles. Consequently, students choose to borrow someone else’s words to replace their ideas. The third cause: the lack of students’ time and efforts invested in big assignments or graduation papers. When it comes to due time for submission, students grow to be baffled and confused. The only way for them to hand in assignments in time is to take risks and copy others’ work or paraphrase contents from online sources or materials, books and newspapers. The fourth cause: failure to apprehend the concept of plagiarism. The misconception and misunderstanding of plagiarism lead to students’ higher frequency of violation and no chances to correct their wrongdoings. The fifth cause: poor academic skills, especially quoting, citation and referencing ones. On the other hand, a popular cause is the failure in distinguishing between applying common knowledge and rephrasing others’ ideas. Students also lack skills to analyze, evaluate and synthesize various information sources and opinions then putting forwards their personal viewpoints. The sixth cause: the unavailability of appropriate regulations on plagiarism prevention, detection and punishments. The unstrict attitude and the loosening of academic research regulations set foundation for students to think that plagiarism is natural, popular and widely acceptable. The seventh cause: students’ perspectives and attitude toward the course. A large number of students take certain courses for granted and refrained from working hard for big assignments. A number of students even suppose that the completion of tasks is necessary in principle only since the teachers cannot afford time to read and score each assignment submitted and will just skim through for scoring, therefore, there is no need to invest a lot of time and efforts for the exercise. 3.2.5. Attitude of the University, Department and lecturers
Up to now, there have been no official documents on punishing plagiarism behaviours from the Ministry of Education and Training, the University of Danang, UFLS, the English Department or the lecturers. The typical punishment forms decided by lecturers include warning, task redoing, or deducing 25% or 50% of the total task scores. The plagiarism detection process in students is not consistent, unified and frequent. Most detected plagiarism cases are attributed to experiences of lecturers through illogical essay structures, abrupt changes in writing styles from silly to very coherent with solid arguments, careful and precise word choices or comparison with completed assignments of previous students. Some teachers spot plagiarism by typing a suspected paragraph and searching on Google to trace its origins from huge online databases. As for students, 89% admitted that they had never identified as committing plagiarism; a small number confessed they were caught with the act but the punishments were mild warnings and insignificant score deduction. 57
The university and the department have not issued specific students’ guidelines on plagiarism prevention. The course on university learning methodology comprises no orientations for the issue as well as the fundamental regulations on assignment implementation and submission at university level. The course on Scientific Research Methods incorporates one additional reading on plagiarism but often neglected while instructions on citing, quoting, referencing and other research skills account for only a small amount of course time, which is inadequate for proper skill development and practice. The University of Danang requires all master graduation papers to include a statement of authorship in the very first page of the book. However, the ED has not yet requested students to commit to no plagiarism in graduation papers as well as in big assignments, essays and other writing tasks. To sum up, the university and lecturers still underestimate the consequences of plagiarism and fail to apply appropriate policies and measures to strictly prevent, detect and punish violations of plagiarism. 3.3. Some suggested measures
3.3.1. The first measure
It is necessary that the university, departments and lecturers build common regulations on preventing, detecting and strictly punishing violations of plagiarism. For instance, copying a paragraph is equivalent to 25% of the total score deduction, entire work duplication to score zero, etc. Then, these regulations should be announced publicly and repeated in each course where students are supposed to submit assignments. All students should be required to write “the commitment of no plagiarism” on each of their big assignments, theses or research works. “No plagiarism” should be a criterion to assess students’ work. On the other hand, it is advisable that electronic plagiarism detection systems (e.g. Turnitin) be utilized so as to save lecturers’ time and effort. A resolute attitude toward eliminating plagiarism together with the unity and consensus among levels or among lecturers of various courses is the prerequisite condition to improve the current disturbing situation. 3.3.2. The second measure
It is important to educate students about honesty and integrity in academic work, pointing out the positive reasons for plagiarism prevention right from the start when students are fresh at the university. These contents should be embraced in both courses of university learning methodology and scientific research methods. Specifically, different types of plagiarism behaviours should be clearly defined, explained and illustrated by examples so that students can have a sharper understanding of plagiarism to avoid it. 3.3.3. The third measure
The training of academic and research skills for students should be intensified, particularly, (1) quoting, (2) referencing, (3) distinguishing between common knowledge (no need for citation) and others (that need 58
citation) and (4) paraphrasing skills. It is recommended that more time and more practical tasks be designed to diligently train students of those practical skills. This was also the wish of most students under the survey. Websites should be provided for students for reference, for example, “the how to avoid plagiarism” by Sue Thompson, posted on Plagiarism Prevention for Students Website – in which, academic research skills are clearly explained with examples, citation and comparison, very convenient for study. Besides, available online is a convenient APA-style citation tool at http://citationmachine.net/index2.php This tool can help save time and avoid mistakes in referencing. 3.3.4. The fourth measure
Another way to address the problem is to help students develop language skills, idea expressions, vocabulary and structures typical in academic writing. Currently, the ED has a team of native volunteer teachers, who can be a great help for students in building up their language and proofreading their big assignments or graduation paper. We believe this supporting system can significantly decrease plagiarism among students. 3.3.5. The fifth measure
Lecturers should set good examples in academic research, strictly upholding the professional academic spirit in teaching. Lecturers are to form a habit to integrate references into their presentations in class or at conferences, give feedback to students on the strong and weak points of their assignments, strictly punish plagiarism if any, creating a perception among students that their assignments are strictly monitored and their hard work is highly appreciated. 4. Conclusion
In order to fulfill the mission of education in training well-rounded intellectuals, the goals of strengthening the academic ethics teaching as well as eliminating all forms of cheating should be implemented thoroughly. The current situation of plagiarism worldwide and nationwide has shown that this is not an easy task, but with patience, determined attitude, together with effective measures, plagiarism will step by step be pushed back. REFERENCES
[1] Luâ ̣t Giáo du ̣c Đa ̣i ho ̣c số 08/2012/QH 13 ngày 18 tháng 06 năm 2012. [2] Trầ n Nam Dũng, Đa ̣o văn và đa ̣o đức khoa ho ̣c Nguồ n: http://www.yenhuong.com.vn/zone/193/news/699-dao-van-va-daoduc-khoa-hoc.aspx, truy câ ̣p ngày 12/03/2013. [3] Vũ Thi ̣ Phương Anh (2013) Đa ̣o văn là gı̀, và kẻ đa ̣o văn pha ̣m những tô ̣i gı̀? Nguồ n: Vũ Thi Phương Anh, Pho
̣
̀ ng chố ng đa ̣o văn từ góc nhı̀n văn hóa. Nguồ n http://sgtt.vn/Khoa-giao/132031/Phongchong-dao-van-tu-goc-nhin-van-hoa.html truy câ ̣p ngày 12/03/2015. [4] East, J. (2010) Judging plagiarism: A problem of morality ad convention, Higher Education, 59 (1) 69-83. [5] Park, C. (2003) In other words: plagiarism by university students – literature and lessons, Assessment and Evaluation in Higher Education, 28 (5). [6] Trần Thị Tuyết (2012) The perceptions and Attitudes of International Students toward Plagiarism, The ACPET Journal for Private Higher Education 1 (2). [7] Griffith Institute for Higher Education, Good Practice Guide (2013) Issue of Academic Integrity: Plagiarism. [8] Oxford Dictionary (2012), Oxford, UK: Oxford University Press. (The Board of Editors received the paper on 28/05/2016, its review was completed on 05/06/2016)
59
THE IMPACT OF FOCUS ON FORM IN LANGUAGE TEACHING
University of Foreign Language Studies, The University of Danang; uyennpt@yahoo.com
Abstract - The benefits of focus on form instruction as “the miracle
method that many teachers had always been searching for” (Poole,
2005, p.47) has been one of the main interests in the second
language teaching community to date. This paper attempts to
generalize findings from different empirical studies which
contribute to the confirmation of the effectiveness of focus on form
instruction, which can be implemented by using two typical
techniques: input enhancement and corrective feedback in
interaction to draw learners’ attention to formal language in the
meaning-based context of learning. Five research articles
descriptions and the summary of the contribution to the asserting
the role of attention to form are presented and discussed, and on
this base, some implications for teaching in the current context are
recommended.
Key words - focus on form; grammar; attention; input and
interaction; second language teaching.
1. Rationale
There have been particular concerns regarding the lack of accuracy in learners’ performance in communicative language teaching and learning. Communicative language teaching, as an innovated mode of teaching to the traditional method, also brings about unexpected results, since “some linguistic features do not ultimately develop to target-like level” and “this is so despite years of meaningful input and opportunities for interaction” (Doughty & Williams, 1998, p.2). In response to this, Long (1991) and Long Robinson (1998) put forth the approach of focus on form in second language teaching, which can be described as an incidental attention to form in the context of meaning-focused instruction. A more operational definition is that “focus on form consists of an occasional shift of attention to linguistic code features – by the teachers and/or one or more students – triggered by perceived problems with comprehension or production” (Long, 1991, p.23). The noticeable feature is that focus on form can be initiated by learners, or set up by teachers, material designers or researcher. Learner’ attentional resources can be achieved pedagogically by various methods: input enhancement (repeated use in the input, explicit discussion of the form, enhance salience due to typographic modification - being underlined or italicized), explicit negative feedback, implicit negative feedback – with recast is an example. The second language theory underpinning focus on form is the role of attention to form in promoting second language acquisition. Attention to form plays a key role in enhancing language learning, and focusing on learners’ attention on features of the second language is a major component of focus on form. Schmidt (1995) stated that “not all language features can be acquired when learners’ attention is focused exclusively on meaning” and “input and interaction, attention, and awareness are all crucial for learning”.
However, conceptual arguments must be tested, verified and developed in empirical studies before they can meaningfully guide major language policy and curriculum initiatives and subsequently, have significant effects on millions of language teachers and learners. Therefore, the effectiveness of these above techniques in focusing learners’ attention to formal language and leading to successfully subsequent language production needs more support from empirical research.. 2. Procedure
The studies under review were selected by considering the objectives of the empirical research and the findings with practical implications and implementation of focuson- form instruction. To minimize arbitrariness, various measures have been taken: carefully reading the abstracts, identifying the objectives, going through the methodological descriptions, examining the strengths and weaknesses of the empirical studies and evaluating the contribution of the studies to second language teaching. The paper starts with a brief description and explanation of the key terms, i.e. focus on form versus focus on forms, the role of noticing and attention in second language instruction, followed by the description of the five empirical studies. The assessment of the studies in relation to the noticing and attention theory in second language acquisition is presented and some implications in implementing input enhancement and corrective feedback in form-focused instruction for language teaching are recommended.
3. Focus on form versus focus on forms
Focus on form refers to an approach in which learners and teachers address formal features of language that play a role in the meanings that are negotiated. In other words, focus-on-form emphasizes meaning in communication and form of language is inadvertently noticed. This is contrasted with a focus on forms, which emphasizes formal aspects rather than meaningful activities (Carter andNunan, 2001). Focus-on-forms focuses on form of the language and draw learners to memorizing plenty of rules. Long (1991) have encapsulated the differences of these two extremes in grammar instruction: focus on form refers to drawing students attention to linguistic elements as they arise incidentally in lessons whose overriding focus is on meaning or communication. Meanwhile, focus on forms is equated with the traditional teaching of discrete points of grammar in separate lessons. The comparison of the features of these two approaches is presented in Table 1.
Table 1. Focus on form vs Focus on Forms
Focus on form
Focus on Forms
Triggered by perceived problems Pre-selected in the syllabus in comprehension or production Linguistic features are explored in Forms are taught in isolation contexts. Analytical approach Synthetic approach 60
The word form refers to language Forms refers to discrete, isolated,
in form in general specific language forms. Learners first engage in meaning, Primary attention to form then explore some linguistic features. Occasional shift of attention to form. Most attention to form (Carter and Nunan, 2001; Long, 1995)
4. Noticing and attention in SLA
The central role of attention in naturalistic and instructed second language acquisition has been identified in the research of SLA. The naturalistic view stresses leaners’ attention to meaning in communication in the process of learning. The view of focusing on form emphasized the role of attention in language learning, together with input and interaction. There will be no learning without attention, and attention is required for learning (Schmidt, 1994).
Fine-grained analysis of attention states three components of attention: alertness, orientation and detection. Alertness represents an overall, general readiness to deal with incoming stimuli or data, orientation facilitates detection, which is the process that selects, or engages, a particular and specific bit of information (Schmidt, 1995).
Different types of attention that learners may pay to language form are: noticing, understanding and awareness. Noticing is the process of bringing some stimulus into focal attention and is the necessary and sufficient condition of input to intake for learning, therefore, more noticing leads to more learning (Schmidt, 1995). Differently, Tomlin and Villa (1994) maintained that detection, not awareness, is the minimally necessary component of attentional process in second language learning. Irrespective of the discrepancy about the presence of conscious registration in addition to focal attention, there is an agreement that noticing, or being aware of certain forms, requires focal attention processing to internalise input into intake.
The hypotheses illustrates the role of attention and noticing in second language acquisition are the Interaction hypothesis (Long, 1996), consciousness raising and the noticing hypothesis (Schmidt, 1995). The Interactional hypothesis holds the view that conversational interaction promotes second language acquisition, and negative feedback during interaction draw learners’ attention to the form, and consequently causing learners’ notice the gap between their own output and the target model. Learners’ attention specifically to the formal structures of the target language can be enhanced by consciousness raising, with the assistance of input enhancement (typographical modification, intonational focus…) (Sharwood Smith, 1993).
Findings from empirical studies have provided insights about the roles of input and interaction in drawing learners’ attention to form and consequently promoting success in language learning.
5. Description of the five studies
The first article under review is “Does textual enhancement promote noticing? A think-aloud protocol analysis” by Jourdenaise, Ota, Stauffer, Boyson and Doughty, 1995. This empirical research was done with the purpose to determine whether input enhancement technique (textual modification) can make target language forms more noticeable and affect learners online processing. The study took place in Georgetown University, with 14 native speakers of English in Spanish class.The target form was “the preterit” (past tense) (Jourdenaise et al, 1995) and imperfect verbs. Think aloud protocols were collected during a subsequent task in which participants wrote a picture-based narrative similar to that presented in the same text. The results of the study were that more episodes related to selection and conjugation of the target verbs were found in enhancement participant protocol than the comparison participants, and enhancement participants produced more target features in their production. The logical interpretation for the results is that textual enhancement promotes noticing of the target second language form and has an effect on learners’ subsequent output.
Another study focusing on the effects of manipulating and enhancing input in drawing learners’ attention to form is executed by Joanne White in 1998. The context of the study is an elementary school near Montreal, Canada with three intensive grade 6 ESL classes and the target forms were the possessive determiners and third person singular pronouns. Three different groups received three treatment conditions: group E (N=27) with typographically enhanced input plus extensive reading and listening, group E (N=30) with a typographically enhance input flood, and group U (N=29) with a typographically unenhanced input flood. Data were quantitatively and qualitatively analysed involving frequency counts and accuracy ratios as well as a stage analysis of the learners’ development. The findings from this study also confirm the effficacy of input enhancement in speeding up acquisition of a language feature, but it raised a question that drawing learners’ atttention to a linguistic feature is “not adequate in cases involving L1-L2 contrast, they need more explicit instruction in more advanced developmental stages” (White, 1998, p.106).
The above insight leads to the consideration of another form-focused technique in promoting learners’ success in language learning. One small-scale study on the impact of recast on learners’ second language production was carried out by Zhaohong Han in 2003, in which eight adult learners of English were divided into two groups (recast and nonrecast) and produced written and oral narratives prompted by cartoon strips with the target from was the tense consistency in learners’ output. The methodology adopted a pretest and posttest and delayed posttest design, with eight regular sessions between pretest and posttest for the recast group and eight regular sessions for the non-recast. The study concluded that recast was successful since it raised learner awareness and led to considerable improvement in learners’ performance in the target form.
The effect of recast was also the focus in the laboratory study done by Leeman in 2003 with the subjects were 74 adult learners of Spanish and the target form was nounadjective agreement. Different aspects of recasts were investigated by providing four different treatments on the subjects: negative evidence alone, enhanced salience alone, recasts (as a combination of negative evidence and ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
enhanced salience) and the control group receiving ordinary models of the target form. The result was that the group exposed to input with enhanced salience and the recasts group performed better than the group exposed to unenhanced input. This suggests that “enhancing the salience of certain forms certainly led learners to attend to those forms,… and interactional features, recasts among them, can lead to greater development by highlighting specific forms in the input” (Leeman, 2003, p.57).
The impact of input salience and interaction remains a concern of second language researchers. In a study carried out in Midwestern University on 110 English speaking learners of Spanish at the age of 17-36 with an average of 3.5 years of Spanish instruction, GassTorres (2005) investigated the effects of input and interaction seperately and in combination. The language focuses were gender agreement, and estar + location and seven vocabulary items. The effects of input and interaction were examined in four different conditions: material focused solely on input, material focused solely on interaction, input-focused material followed by interaction, and interaction-focused material followed by input. The findings suggested that input and interaction in combination resulted in greater improvement than input or interaction alone. Besides, the study interpreted the differential effects of input and interaction on different grammatical areas for the complexity and abstractness of those grammatical features.
6. Evaluation of the studies in relation to the noticing
and attention theory in SLA
The five studies under review shed some light on the efficacy of input enhancement and interaction as the typical techniques for focusing learners’ attention to form, which is vital in promoting second language acquisition. The role of input enhancement is highlighted in the sudy done by Journedaise et al (1995), which asserts that typographical modification may lead to better subsequent second language production of the form. In the process inputintake conversion, textual enhancement was a driving factor for the process taking place.
However, the role of typographical modification as a technique to enhance salience of input is not a single powerful tool for directing learners’ attention to the target form. White (1998) claimed from her study that input enhancement is necessary, but not sufficient in speeding up language acquisition, especially when involving complexity and contrast between the first and second language. Language development requires the assistance of explicit instruction and, the role of interaction cannot be underestimated. The small-scale study by Han (2003) and the laboratory study by Leeman (2003) on recasts as component of interaction provide insights about the significant function of attention for second language uptake. While Han (2003) spotlights the success of recasts in heightening learners’ awareness and leading to considerable improvement in the target form, Leeman (2003) concentrates on the ambiguous status of recast, which is made up of negative evidence alone, enhance salience alone, and negative evidence and enhance salience 61
in combination. The underscoring suggestion from her study is that the saliency of the new form within the recast is the most helpful in catching learners’ attention and facilitates the process of input-intake conversion. Negative evidence alone is of minor importance in accelerating this process. The findings strengthen the view held by many interactionists such as Long (1996) and Pica (1994) that interaction fosters the environment for developing second language processing capacity with the presence of selective attention as an essential factor.
The value of interaction in promoting second language acquisition is highlighted by Gass and Torres with the conclusion that “interaction, as an attention-drawing device, followed by input, as a forum for data gathering, is the most powerful of the externally driven enhancement” (Gass& Torres, 2005, p.24). The study provides further support on the role of attention in second language acquisition, and states that combination of treatments (input followed by interaction but not interaction followed input) yields better learning rates than one treatment alone. One important rider in this study is that level of attention may vary according to the complexity and the nature of each language area, i.e. vocabulary, syntax or morphosyntax requires different levels of attention.
To sum up, the five studies contribute to the tenet about the role of attention in language learning in second language theory and confirm the distinct effectiveness of input enhancement and recasts as a form of interaction in improving learners language output. This also places the focus on form instruction in a highly valuable position in second language teaching, and serves as the fundamental support for other empirical studies on the effectiveness of form-focused instruction in different learning conditions.
7. Implications for teaching
The studies above bring about some thoughts on innovation in our teaching context, regarding improving learners’ accuracy in the second language performance.
Firstly, it is proposed that implementing focus-on-form would be productive with the combination of different techniques, highlighting the target forms in the input (input enhancement) and recast as a type of interaction (and many other types such as clarification request, confirmation check, etc.), among which, the ordering input-interaction proves to be the most effective.
Secondly, the complexity and properties of a linguitic feature should be taken into account in selecting and designing a focus-on-form task. Thirdly, salience of target forms in the input is very important in catching learners’ attention, even in corrective feedback. Teachers should provide learners the salience target form, which enables learners noticing their errors and doing uptake.
Finally, the studies also inspire further research in investigating the effectiveness of form-focused instruction among which, learners’ attention to form is the essential factor triggering language development.
62
8. Conclusion
Focus on form instruction with the goal of accelerating learners noticing to form is gaining cogency in second language teaching and learning. Its role as “a cognitive focusing device or advance organizer for learner attention” is emphasized by many researchers such as R. Ellis (1993). Schmidt and Frota (1986) and Sharwood Smith (1991). It is now widely recognized that a pure meaning-focused approach to second langguage teaching is not promising and fruitful. Ellis (1994, cited in Schmidt, 1995, p.47) maintained that “there are many possible ways to combine exposure to input and communicative pratice with a focus on form and consciousness raising”. Schmidt was very optimistic about the “theoretically interesting and practically important research ahead” which may provide answers to the question of integrating form-focused instruction into communicative language teaching. The empirical studies under review in this paper partly accomplish the confirmation of the role of form focus instruction stills needs more evidence from empirical research in diverse instructional practices of different cultural and educational settings. Personally, I think that this is a good place for teachers to begin their study on focus on form instruction to enhance the effectiveness of second language learning and teaching.
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
TÀI LIỆU THAM KHẢO
[1] Carter, R. and Nunan, D. (2001) The Cambridge Guide to Teaching English to Speakers of Other Languages. Cambridge: CUP.
[2] Doughty, C. and Williams, J. (1998) “Isues and Terminology”. In C. Doughty & J. Williams (Eds.). Focus on Form in Classroom Second Language Acquisition. (pp. 1-12). Cambridge: CUP.
[3] Gass S.M. & Torres M.J.A. (2005) “Attention When? An Investigation of the Ordering Effect of Input and Interaction”. Studies in Second Language Acquisition, 27, 1-31.
[4] Han, Z (2002). “A Study of the Impact of Recasts on the Consistency in L2 Output”. TESOL Quarterly, 36, 542-572.
[5] Jourdenais, R., Ota M., Stauffer, S., Boyson B. & Doughty C. (1995) “Does Textual Enhancement Promote Noticing? A Think-Aloud [15]
[16]
[17]
Protocol Analysis”. In R. Schmidt (Ed.), Attention and Awareness in Foreign Language Learning (pp. 183-216). Honolulu: Second Language Teaching & Curriculum Center University of Hawaii at Monoa.
Leeman, J. (2003) “Recasts and Second Language Development: Beyond Negative Evidence”. Studies in Second Language Acquisition, 25, 37-63.
Long, M. H. (1991). “Focus on Form: A Design Feature in Language Teaching Methodology”. In K. de Bot, R. Ginsberg & C. Kramsch (Eds.), Foreign Language Research in Cross Cultural Perspective (pp. 39-52). Amsterdam: John Benjamins.
Long, M. H. (1996). “The Role of the Linguistic Environment in Second Language Acquisition”. In Ritchie, W.C. and Bhatia, T.K. (Eds.), Handbook of Second Language Acquisition. San Diego, CA: Academic Press, 413-68.
Long, M. H. & Robinson, P (1998). “Focus on Form: Theory, Research and Practice”. In C. Doughty & J. Williams (Eds.), Focus on Form in Classroom Second Language Acquisition. (pp. 15-41). Cambridge: CUP.
Pica, T. (1994). “Research on Negotiation: What does It Reveal about Second Language Learning Condition, Process and Outcome?” Language Learning, 44, 493-527.
Poole, A. (2005) “Focus on Form Instruction: Foundations, Applications and Criticism.” The Reading Matrix, 5 (1), 47-53.
Sharwood Smith, M. (1993). “Input Enhancement in Instructed SLA: Theorical Bases.” Studies in Second Language Acquisition, 15, 165-179.
Schmidt, R (1994). “Deconstructing Conciousness in Search of Useful Definitions for Applied Linguistics.” AILA Review 11, 11-26.
Schmidt, R. (1995). “Conciousness and Foreign Language Learning: A Tutorial on the Role of Attention and Awareness in Learning”. In R. Schmidt (Ed.), Attention and Awareness in Foreign Language Learning (pp. 1-64). Honolulu: Second Language Teaching & Curriculum Center University of Hawaii at Monoa.
Schmidt, R. &nFrota, S (1986). “Developing Basic Conversational Ability in a Second Language: A Case Study of an Adult Learner of Portugese”. In Day, R.R. (Ed.), Talking to Learn: Conversation in Second Language Acquisition. Rowley, MA: Newbury House, 237-322.
Tomlin, R.S., & Villa. (1994) “Attention in Cognitive Science and Second Language Acquisition”. Studies in Second Language Acquisition, 16, 183-203.
White, J. (1998) “Getting Learner’s Attention: A Typographical Input Enhancement Study”. In C. Doughty & J. William (Eds.), Focus on Form in Classroom Second Language Acquisition. (pp. 85113). Cambridge: CUP.
63
STRATEGIES AND FUNCTIONS OF OTHER-REPAIR IN ENGLISH AND
VIETNAMESE CONVERSATIONS
Nguyen Thi Minh Hanh1, Nguyen Thi Quynh Hoa2 1
2
Doctoral Student of the English Language Course 31 (2015-2019);hanhtky@gmail.com
The University of Danang, University of Foreign Language Studies; hoadng@dng.vnn.vn
Abstract - Knowing the strategies which listeners use to ask for
speakers’ trouble sources causing breakdowns in conversations and
knowing the functions of other-repair are necessary because these
factors help the interlocutors gain more effectiveness in
communication. Schefloff et al. [3] mentioned other-repair with such
features as positions, strategies and functions of correcting the
trouble sources causing communication breakdowns from the
listeners. The results of this research help the listeners know how to
manage when they have difficulties in hearing and understanding the
information from the speakers. This paper presents and analyzes the
strategies and the functions of other-repair in English and
Vietnamese conversations, based on the theory of Schegloff et al. [3]
with the aim to discover the similarities and differences in the
strategies and the functions of repairing the trouble sources from the
listeners in two languages. The results will provide learners with
some useful ways to make effective conversations.
Key words - other-repair; strategies; functions; conversation; the
theory of Schegloff et al.
1. Introduction
In daily communication, listeners sometimes cannot understand all the utterances from speakers. The reasons are that the listeners cannot hear the speakers’ utterances clearly; or the listeners can hear them but they cannot understand them clearly or they do not understand the speakers’ thoughts. All of these difficulties are the causes of communication breakdowns. To overcome the trouble, the listeners use some strategies to show their difficulties in hearing or understanding what the speakers say. Then, the speakers will correct their trouble sources or they can express their thoughts in other ways so that the listeners can understand what they mean. Up to now, there has not been any research on this matter in Vietnam. Therefore, this article is aimed at presenting the findings of the strategies and functions of other-repair in English and Vietnamese conversations with the hope of contributing a small part to the teaching and learning of the speaking skill. 2. Theoretical Background
2.1. Emanuel Abraham Schegloff‘s theory of repair
Shegloff et al. [3] first characterized the nature and organization of repair in naturally occuring conversations. They gave out the findings of the positions, strategies and functions of self repair and other-repair. They also mentioned that other-repair may be more frequent in interactions among “not-yet-competent” speakers. This comment has stimulated a lot of studies on other-repair in interactions with non-native speakers (Hosoda [1], Wong [5],...) In this paper, we apply this theory to investigate and compare the strategies and functions of other-repair in English and Vietnamese conversations. 2.2. Repair in Conversations
According to Schegloff et al. [3, p361], “repair” is the treatment of trouble occuring in interactive language use or “a mechanism that operates in conversation to deal with problems in speaking, hearing, and understanding the talk in conversation”. It includes processes for mutual comprehension such as word search as well as a replacement or correction on hearable errors or mistakes. Schegloff et al. [2] gave out two types of repair: selfinitiated repair and other-initiated repair. Each type consists of three components, namely trouble - source,
repair initiator and repair completion. - Trouble source refers to any element in a conversation which cause communication breakdown. It could be found anywhere during conversational interactions and any element could be repaired by participants in conversations, even if it is a grammatically correct form or a pragmatically appropriate expression. - Repair Initiation: A trouble-source can be identified by the speaker in his/her own talk (i.e., self-initiated) or by the recipient in someone else’s talk (i.e., other-initiated), and then the speaker (self-initiator) or the listener (otherinitiator) initiates to use the repair strategies to repair it or to ask for repair. - Other is the party who recognizes the trouble source from the speakers and asks for repair. - Repair strategies include the interlocutor’s verbal responses to another interlocutor’s wrong, incomplete, or silent responses. They also include interlocutors’ responses that either repair the trouble directly in the same turn or initiate repair that another interlocutor will complete. - Repair completion: After a trouble source is identified, it can be repaired by the self-initiator or by the other-initiators. Schegloff et al. [4] divided the functions of other-repair into three types: clarification request, confirmation check and comprehension check. -Clarification request: When the information provided is insufficient or unclear, the listeners initiate repairs. - Confirmation check: When the listeners are afraid of misunderstanding the utterance from the speakers, they ask for confirmation. - Comprehension check: When the listeners cannot understand the utterance from the speakers, they ask for explanation. 2.3. Other-Repair
According to Sack, Schegloff and Jefferson [4] otherrepair generally involves a recipient of the problematic talk initiating the repair, but either he/she leaves it for the speakers of the trouble-source to deal with the trouble 64
themselves in the ensuing turn or he/she will repair it. in Vietnamese such as “Hả?”, “Cái gì?”, “Ai?”, “Ở đâu?”, “Tại sao?”... For example: (1) S: Were you uh you were in therapy with a private
doctor ?
H: yah
S: Have you ever tried a clinic?
H: What?
S: Have you ever tried a clinic?
H: ((sigh)) No, I don’t want to go to a clinic. [3, p.367] Instead of answering the speaker’s (S) question after S’s turn is finished, the hearer (H) initiates repair in the fourth line by using wh-question word “what” that displays his/her trouble in hearing or understanding S’s prior talk. In the fifth line, S repeats his prior utterance in response to H’s repair initiation. (2)
S: Coi chừng đi đậu phụng đó nghe!
(3) S:“Let’s go.”
H:“Huh?”
S:“Let’s go,” I repeat, and with such obvious
authority that she began to follow me as I walked toward the
[Love Story, Segal, E.] In (3), S produces the trouble-source because H does not understand where S is going, so H initiates a repair on that trouble-source with “Huh” and in the next turn, S self completes by repeating the utterance along with the action. (4) S:“Even the Sonovabitch?” she asked.
H:“Who?”
S:“Oliver Barrett III.”
H:“Ah, he’s a nice guy. You’ll really like him.”
[Love Story, Segal, E.] H: Đi đâu cơ?
S: Đi đậu phụng!.. Cái anh!- Cô giao liên té nước
lên thuyền.- Anh nhà báo ơi, đậu phụng ở quê em, ngoài
Bắc các anh là lạc đó. Anh hiểu ra chưa?
H: À ra thế! Đi lạc. Đi lạc.- Lê nhắc lại, thích thú.
(5) S: Nó bỏ đi rồi hở chị? H: Ai cơ?
S: Con mèo ấy.
H:Ừ, con mèo đã bỏ đi rồi.
[Kính vạn hoa, Nguyễn Nhật Ánh] [Bồ câu không đưa thư, Nguyễn Nhật Ánh] Similarly, in this example, H has trouble in understanding when S uses her dialect “đậu phụng” to express the loss of way and H initiates repair by using wh-question “Đi đâu
cơ?”. S tries to explain her dialect in her next response. Schegloff [4] investigated and systematically described
other - repair in conversations. This type of other - repair has four strategies Using question words; Repeating a part
of the trouble source turn plus a question word; Judging
ideas from the speaker’s utterance; Repeating a part of the
speaker’s talk with upward intonation and it has three functions such as clarification request, confirmation check
and comprehension check. 3. Methodology
This study is conducted with the descriptive and analytic methods. Three criteria to select samples have been established: 1-the samples have to be conversations, 2-they have to contain other - repair, 3- the sources have to be reliable. The sources are 30 English stories and 30 Vietnamese stories in the 1970s. Each of them contains from 200 to 500 pages.The year of publication is carefully chosen with the hope that the utterances in conversations are modern and similar to what people say in daily conversations at the present time. Some of the data is taken from the internet. 300 English conversations and 300 Vietnamese conversations have been collected to build up the data with such a set of criteria. The numbers of conversations like this can be reliable enough and various to represent the features of other–repair. 4. Findings and discussion
4.1. Strategies of Other -Repair
Vietnamese Conversations
4.1.1. Using question words
(6) S: Anh Sáu, thằng Lê đây mà !
H: Hả?
S: Lê nhà báo đây!
[Khắc khoải, Hồ Hải Học] In these above examples, Ss produce the troublesources because Hs cannot know who Sonovabitch, Lê and Nó are, so Hs initiate repairs on these trouble-sources by using question words “Who?”, “Ai cơ?”, “Hả?” and in the next turn, Ss self complete. 4.1.2. Repeating a part of the trouble source turn plus a
question word
(7) S: “Go to Cairo,” Teddy said without opening his eyes. H: “Sure. And do what?” S: “Wait.” H: “Wait for what?” S: “Wait for the ground to shake. Stay away from the embassy.” [The Brethren, John Grisham] (8) S: Cô ơi, cái chân... H: Chân em làm sao ? S: Trắng quá! Tôi sợ nó phát hiện. [Khắc khoải, Hồ Hải Học] In these two above examples, Hs repeat a part of Ss’ utterances plus question words “What” and “làm sao?” to show the wish for Ss to repair their utterances more clearly. 4.1.3. Judging ideas from the speaker’s utterance
in
English
and
Question words in English consists of “what”, “who”...; (9) S: "You're not a woman," she said. "I sometimes wonder if I am myself, the way I live." H: "You mean the impermanence?" S: She looked at him angrily. "No, I don't! I mean ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
the monotony with nothing to show for it-no kids. You're married, aren't you?" [Gentlement in their season, Gabriel, F.] In (9), H gives the judgement of what S has just said with the purpose of confirming information or repair it to make its meaning more explicit. (10) S: Đáng lo ở chỗ tụi mình không biết Hiền Hòa nói thật hay nói dối. H: Ý mày muốn bảo ba Hiền Hòa không có nhà nhưng Hiền Hòa vờ nói có ư? S: Có thể lắm! [Kính vạn hoa, Nguyễn Nhật Ánh] In this example, H gives the thoughts of what S has just spoken with the hope that the information will be reconfirmed or repaired more clearly. 4.1.4. Repeating a part of the speaker’s talk with upward
intonation
(11) S: "We didn't strike yet, because I'm waiting for a stick."
H: "A stick?"
S: "That's right. A stick. And do you know what
I'm going to do with the stick?"
[American Gods, Gaiman, N,]
H specifies the trouble source by repeating a partial part of the prior talk A stick with an upward intonation in the second turn. S completes the repair by confirming the utterance. (12) S: Đây là người ta đánh nhầm.
H: Đánh nhầm? - Quý ròm kêu bật lên.
S: Ừ!
[Kính vạn hoa, Nguyễn Nhật Ánh]
the intonation, so these two strategies are chosen to use when the hearers want the speakers to repair their utterances. In Vietnamese, it is impossible to say “Hả?”,
“Ai?”, “Làm sao?” to the adults or the people with their high social positions. However, more Vietnamese people use the strategies Repeating a part of the trouble source
turn plus a question word and Repeating a part of the
speaker’s talk with upward intonation. When using these two strategies, the hearers can either employ words of modality like“ạ”, “chứ”, “chứ ạ” or not to identify their relationships with the speakers. 4.2. Functions of Other-Repair
Vietnamese Conversations
4.2.1. Clarification Request
[Gentlemen in their Season, Gabriel, F.] In this example, H hears what S has just asked, but H wants to make it clearer, so H initiates a repair and in the next turn, A self completes the utterance. (14) S: Thưa cụ, bà con chúng con toàn người dưới Nam.
H:Nam nào? Nam Định hay Thái Bình hay Hà
Nam, Phủ Lý?
S: Thưa với cụ, cả Nam Định và Hà Nam ạ.
[Tác phẩm văn học được giải thưởng HCM, Nguyên Hồng]
In (14), the phrase người dưới Nam causes some opacity to H because in Viet Nam, there are many localities whose names begin with Nam or includes the word Nam. So, H must ask S for clarification. S:"Yes".
Vietnamese
and
S: "I said 'wife'-though they're the same thing really."
Table 1 below is the summary of the strategies of otherrepair and the frequency of its presenting from 187 English conversations and 180 Vietnamese conversations. English
English
H: "Did you say 'wife' or 'life'?"
4.2.2. Confirmation Check
Strategies
in
(13) S: "You've made me wonder about my own wife."
In this example, H makes a partial repeat of the prior talk with upward intonation such as “Đánh nhầm?” to clarify what he/she has just heard from S. Table 1. Strategies of Other-Repair
in English and Vietnamese Conversations
65
(15) S: "I don't know him. Is there any comparison?"
H: You mean in his attitude?"
[Gentlemen in their season, Gabriel, F.] In the example (15), H hears what S has just said clearly, but H does not want to cause misunderstanding, so H asks for confirmation of what S is thinking. And S confirms it in the next turn. Occurrence
%
Occurrence
%
1. Clarification request
50 26.7 63 35 (16) S: Đáng lo ở chỗ tụi mình không biết Hiền Hòa
nói thật hay nói dối.
2. Confirmation check
72 27.8 H: Ý mày muốn bảo ba Hiền Hòa không có nhà
nhưng Hiền Hòa vờ nói có ư?
3. Comprehension check
65 Total
187/300
38.5 50 S: Có thể lắm!
34.8 100
67 180/300
37.2 100
The statistics indicates that two strategies such as Using
question words and Judging ideas from the speaker’s
utterance are more commonly used in English conversations than in Vietnamese ones. This shows the difference that there is only one word you for the second person in English conversations and the interlocutors use [Kính vạn hoa, Nguyễn Nhật Ánh]
In the example, the other initiator uses the strategy “ý
mày muốn...” to affirm what S is saying and thinking. 4.2.3. Comprehension Check
(17) S: "You're perfectly right; I'm depressed. Let us
talk about Hotchkis' wife. Last time we met I could see that
you were about to meet her."
H: "How do you mean?"
66
S: "You looked lustful. I told Helen that your
marriage was in danger. 'He's involved,' I said, 'with a
woman for whom murder was done.”
[Gentlemen in their season, Gabriel, F.] In this example, H cannot understand what S is saying although H hears it clearly, so H initiates repair and S explains to H in the next turn. (18) S: À quên, thưa cô...việc đó thì em biết ạ.
H: Việc đó là việc gì?
S: Việc tại sao bạn Hiền Hòa bị điểm 2 đó cô.
[Kính vạn hoa, Nguyễn Nhật Ánh] The other-initiator does not understand what S has just told her, so she must ask for comprehension. Table 2 below is a summary of the functions of otherrepair and its frequency taken from 187 English conversations and 180 Vietnamese conversations. Table 2. Functions of Other-Repair
in English and Vietnamese Conversations
English Strategies Vietnamese Occurrence % Occurrence % 1. Clarification request 50 26.7 63 35 2. Confirmation check 72 38.5 50 27.8 3. Comprehension check 65 34.8 67 37.2 187/300 100 180/300 100 Total This table shows that three functions such as “clarification request”, “confirmation check” and “comprehension check” are presented in English and Vietnamese conversations. However, the function confirmation check in English conversations takes up the higher rates than in Vietnamese ones. The listeners ask for repair because they want the speakers to confirm their utterances or to check whether the speakers’ thoughts are the same with the listeners’ ones. English have many multisyllablic words, so its vocabulary is one of the factors causing the trouble-sources for the listeners. Meanwhile, the function comprehension check has the highest rate in Vietnamese conversations. Vietnamese people have a habit of beating about the bush and their utterances have more underlying meanings, so the listeners must ask for their clarification. 5. Conclusion
The results of the investigation show that English and Vietnamese conversations cover all of the features of strategies and functions of other-repair according to the theory of Schegloff et al. There are four strategies namely Using question words; Repeating a part of the trouble
source turn plus a question word; Judging ideas from the
speaker’s utterance; Repeating a part of the speaker’s talk
with upward intonation and three functions namely clarification
request,
confirmation
check
and comprehension check. The differences in strategies and functions show that each language always reflects the cultural features of its speech community. The results of the research can be applied to teaching English and Vietnamese conversations. The features of the strategies and functions of other - repair help learners know how to employ suitable strategies to show their problems in hearing and understanding speakers’ utterances. REFERENCES
[1] Hosoda, Y. (2000), “Other-repair in Japanese conversations between nonnative and native speakers”, Issues in Applied Linguistics, 11, p.39-65. [2] Sack, H., Schegloff, E. & Jefferson, G. (1974), “A simplest systematics for the organization of turn-taking in conversation”, Language 50/4: p.693-735.3. [3] Schegloff, E.A., Jefferson, G., & Sacks, H. (1977), “The preference for self-correction in the organization of repair in conversation”, Language, 53, p.361-382. [4] Schegloff, E.A. (2000), “When others initiate repair”, Applied
Linguistics, 21, p244-267.
[5] Wong, J. (2000), “Delayed next turn repair initiation in native/nonnative speaker English conversation”, Applied Linguistics, 21, p.274-97. [6] Nguyễn Nhật Ánh (2003), Kính vạn hoa, Tập 1-Tập 15, Nxb Kim Đồng. [7] Nguyễn Nhật Ánh (2003), Kính vạn hoa, Tập 31-Tập 45, Nxb Kim Đồng [8] Nguyễn Nhật Ánh (2007), Bồ câu không đưa thư, Nxb Trẻ. [9] Hồ Hải Học (2001), Khắc khoải, Nxb Thanh Niên. [10] Nguyên Hồng (2005), Tác phẩm văn học được giải thưởng Hồ Chí
Minh, Quyển II, Nxb Văn học. [11] Gabriel Fielding (1966), Gentlemen in Their Season, William Morrow & Co, New York. [12] Gaiman, N. (2003), American Gods, Harper Collins Publishers Inc., New York. [13] John Grisham (2000), The Brethren, Arrow Books. [14] Segal, E. (2000), Love Story, Bantam Books. (The Board of Editors received the paper on 07/04/2016, its review was completed on 25/04/2016)
67
LINGUISTIC FEATURES OF ADVERTISEMENTS
ON ROAD SAFETY EQUIPMENT IN ENGLISH
Nguyen Thi Quynh Hoa1 , Nguyen Thi Hong Minh2, Nguyen Ngoc Nhat Minh1
1
University of Foreign Language Studies, The University of Danang; quynhhoandng@gmail.com
2
Master Student of the English Language Course 28 (2013-2015) Abstract - Nowadays, the use of road safety equipment to protect
ourselves from accidents has become a great necessity in our
lives. In this paper, we are interested in eight types of road safety
equipment namely helmets, seat belts, child safety seats, safety
vests, safety glasses, safety gloves, safety shoes and emergency
motor/car kits with the aim to help customers choose the best and
safest equipment for use in traffic. In line with this, we have
collected and analyzed online advertisements on these types of
road safety equipment with a view to finding out the common
linguistic features in terms of their syntactic features, lexical
choices and cohesive devices. We do hope that this investigation
into advertisements on road safety equipment (ARSEs) at the
linguistic level will be beneficial to the teaching and learning of
English in Vietnam. This study may also be useful for those who
are interested in advertising, especially advertisements on road
safety equipment.
Key words - linguistic features; road safety advertisements;
syntactic features; lexical choices; cohesive devices.
1. Rationale
Nowadays, road safety has become an increasingly growing public concern since it is closely related to traffic safety. In order to protect ourselves from road accidents, we must equip ourselves with the safest equipment. As a matter of fact, the need for road safety equipment which includes specially designed items to protect people - especially pedestrians, motorcyclists, cyclists, drivers and passengers in transport - from accidents has been increasing rapidly. There are various kinds of road safety equipment which can help prevent and protect people from accidents. In this article, due to their popularity and necessity, the eight essential kinds of road safety equipment namely seat belts,
child safety seats, helmets, safety vest, safety glasses, safety
gloves, safety shoes and motor/car kits are chosen for investigation. These kinds of equipment, especially helmets, are commonly used in our daily lives. Thanks to the importance of road safety equipment in transport, advertisements on road safety equipment have attracted much of our attention. To seek the information for road safety equipment, customers can look up on newspapers, magazines, televisions or on the Internet. Nowadays, however, searching on the Internet for information as well as advertisements is becoming more and more widespread. In addition, online shopping has been increasingly popular in the world as well as in Vietnam. Therefore, ARSEs in this article are selected from the prestigious websites in the United Kingdom and the United States of America, for instance, www.amazon.com, www.ebay.com, www.bestbuy.com, www.tesco.com, www.argos.co.uk. This research is conducted with a strong aspiration to help English language students with comprehension and production of the advertising language. Additionally, this study will probably bring students and teachers of English an insight into a number of linguistic features of ARSEs.
2. Theoretical Background
2.1. Definitions of Terms
- Road Safety Equipment is considered as a set of specially designed items necessary for protecting people from road traffic accidents. - Advertisements on road safety equipment are the ones that introduce to customers specially designed items necessary for protecting people from road traffic accidents. All in all, advertisements on road safety equipment in this article are online advertisements in the field of road safety equipment selected from prestigious websites of companies in the United Kingdom and the United States. They provide detailed information about the equipment or the products with a view to influencing the audience as well as persuading them to purchase the equipment or the products. 2.2. Methodology
The aim of the study is to identify and clarify the nature of ARSEs in order to find out their linguistic features in terms of syntactic features, lexical choices and cohesive devices. In order to achieve this aim, we combined different research methods as follows: The descriptive method is used to give a detailed description of linguistic features of ARSEs. The analytic method is used to classify and justify a certain feature or characteristic. The inductive method is helpful in drawing out the generalizations from the findings and making conclusions. Three criteria for selecting samples have been established: 1-the samples must be advertisements on road safety equipment, 2-the sources of the samples must be the official websites in the United States and the United Kingdom, 3- The samples are from 100 to 300 words in length. With such set of criteria, 112 ARSEs have been collected to build up the data. 3. Findings and discussion
3.1. Syntactic features of ARSEs
Advertising language has specific characteristics in terms of syntax and syntactic features. In order to make advertisements become more persuasive, advertisers make great efforts to convey the information in the most concise manner. ARSEs are not exceptions. The outstanding syntactic structures in ARSEs are the passive voice, relative clauses, imperative sentences and conditional sentences. In 112 collected ARSEs, the passive voice, 68
relative clauses, imperative sentences and conditional sentences are used with high percentages for the purpose of making the ARSEs more appealing and persuasive. Here is the distribution of the passive voice, relative clauses, imperative sentences and conditional sentences in ARSEs. Table 1. Distribution of Passive Voice, Relative Clauses,
Imperative Sentences and Conditional Sentences in ARSEs
Syntactic Structures
Occurrence
%
Relative Clauses 175 20.3 Conditional Sentences 89 10.3 Passive Voice 473 54.8 Imperative Sentences 126 14.6 Total 863 100 Table 1 shows that the passive voice takes up the highest percentage in ARSEs with 54.8%, relative clauses account for 20.3% and imperative sentences and conditional sentences are the lowest with 14.6% and 10.3% respectively. Here are a number of reasons for this trend: First of all, the passive voice is the most frequent because it makes ARSEs more objective and persuasive. The second reason is that relative clauses make the advertisements concise and succinct. Last but not least, imperative sentences and conditional sentences play important roles in urging customers to purchase the equipment. In the passive voice, we can see that two auxiliary verbs be and get are often used in sentences. However, Quirk, R. et al. [5, p.161] argue that the get-passive is avoided in formal style, and even in informal English, it is less frequent than the be-passive. The reason for this trend is that the get-passive puts the emphasis on the subject rather than the agent, and on what happens to the subject as a result of the event. Conversely, it is interesting to know that, in ARSEs, two cases of the get-passive are found. Here are the examples: (1) Sharks first LED helmet: Get seen on those dark nights! (http://www.getgeared.co.uk/shark......300) (2) The ANSI 2 5-PT Breakaway Safety Vest system keeps
you from getting caught on vehicles, machinery, and more. (http://www.tsasafety.com/ansi......safety-vest) Despite accounting for a very small percentage, the getpassive shows their necessity in replacing the be-passive in cases where there is a potential confusion. In ARSEs, relative clauses are found to convey the indispensable or vital information about origins, functions, and benefits of the equipment. The following examples are illustrated for each kind. The origins of equipment (3) The helmets, made with a composite fibreglass
shell and polystyrene shock absorption liner, is fully
leather liner. (http://www.davida.co.uk/type.php?id=speedster) The equipment’s functions (4) The Viking wear ANSI 3 DOT safety Vest is designed
for jobs and situations that demand maximum visibility. (http://www.tsasafety.com/viking....vest) The equipment’s benefits (5) This is a superb warm weather street riding glove that
subtly incorporates advanced polymer knuckle guards to
provide great impact performance and improved street styling. (http://www.jsaccessories.co.uk/spartan....black.html) The results also suggest that relative clauses are essential in the advertising language because they help to arouse the reader’s attention, proved by the high frequency in ARSEs. It can be easily seen that the affirmative imperative sentences with a high percentage (85.9%) dominate the negative ones. Here are some examples of affirmative and negative imperative sentences: (6) Get Yours today – because you deserve safety,
comfort and peace of mind!
(http://www.jsaccessories.co.uk/spartan.....black.html) (7) Use for Striker Series Goggles only. (http://www.amazon.com/FAA.....B00701EIRS) (8) Do not purchase this item, unless your seat belt
metal tongue’s dimensions (where you need the extender)
match all the above measurements.
(http://www.argos.co.uk/static/....2668938) One of the best ways to increase the consumption of the equipments is to urge customer’s immediate action. In example (6) and (7), the verbs get and try are instances of this action. They appear to urge customers to buy the equipment as soon as possible. Additionally, get and try
connote the meaning of doing the purchase voluntarily, not paying money to buy the equipment. Hence, readers can consider these imperative sentences as recommendations. In example (8), the negative imperative sentence is used to stress the warning to customers. In addition to relative clauses, conditional sentences play an important role in ARSEs. The conditional sentence is one of the syntactic features that need studying in advertisements, especially in ARSEs. Before making a decision to buy any equipment, customers often have a strong tendency to wonder whether the chosen equipment is as good as they have expected or not. In this case, making customers believe in the equipment is very important and necessary. In ARSEs, three groups of conditional sentences are identified: Group 1: persuading customers to buy their equipment with a number of sensible reasons. (9) If you are in need of a sturdy helmet for the great
outdoors, the VFX-W is one of the best.
(http://www.revzilla.com/shoei....helmets) Group 2: giving customers instructions for using the road safety equipment. Below is one example: ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
69
(10) If you intend to wear over a bulky jacket; you will
require at least one or two sizes larger than your regular size.
- The speaker thinks of X as something that could be good for the hearer. (http://www.ebay.co.uk/...221655699069) - The speaker thinks that the hearer may want it to happen. Group 3: raising questions, making customers feel reasonable to buy the equipment: Thus, when we offer to do something or a product offers something, we mean that we are willing to do it and will do it if the hearer says that he wants us to do it because X is beneficial to the hearer as the customer. (11) If an accident or personal injury were to occur
during your trip, would you be ready to deal with it? (http://www.amazon.com/.....B0006MQJ20) As can be seen from above, the unreal conditional sentences are only used in group 3 with the aim to convince customers to buy the equipment by raising some unexpected situations in traffic. However, this is not a good method in persuasion because readers may feel stressed or doubtful about the equipment at the thought that bad things may happen to them. That is the reason why unreal conditional sentences are not commonly used in ARSEs. 3.3. Personal reference in ARSEs
According to Halliday and Hasan [1, p.37], personal reference is reference by means of function in the speech situation, through the category of person. The category of personals includes the three classes of personal pronouns, possessive determiners (usually called possessive adjectives) and possessive pronouns. In the collected data, only personal pronouns and possessive determiners were found. 3.2. Weasel words in ARSEs
Below are some examples for personal references and possessive determiners: Hornby [4, p.1745] defines weasel words as terms that are deliberately not clear or frank, used when one wishes to avoid committing oneself to a definite statement. (15) In-Mold construction provides strength, integrity
and is so lightweight, you’ll have to remind yourself that
you’ve got a helmet on at all. Weasel words have become a powerful device in advertising. Weasel words are used to evade or retreat from a direct or forthright statement or position. Although the ultimate goal of advertising is to persuade readers to buy a certain kind of product, the word “buy” is rarely used in ads. Linghong, [22, p.73] explains that because the word “buy” contains the meaning “to obtain something by giving money” which often makes people associate with their “unwilling outgoing”. Accordingly, in ARSEs, we found a wide range of verbs with the connotation of “buy”, for example, “give, provide, offer, bring, help, keep, try”. Here is an example: (12) Give your child (and yourself) a smooth and easy
ride with the SleekRide Premier Travel System featuring an
OnBoard 35 Infant Car Seat with side impact protection. (http://www.walmart.com/.....36932147) The word “give” here connotes the meaning of “causing someone to have something as present”, and so it avoids giving readers the impression that they are being persuaded or even lured to do the purchase. The advertisers use weasel words to convince readers that they are trying to offer help with their product or equipment instead of simply selling it out. For example: (13) Provides protection whilst skating, scootering and
skateboarding, with foam padding for extra comfort and fit. (http://www.argos.co.uk/....2268424) (14) Designed to offer secure protection to the head of
your child should they ever require it, offering you some
peace of mind.
(http://www.argos.co.uk/...1512975) In the above examples, a large number of verbs are used in order to persuade the readers to buy the equipment such as provide, offer, bring. These verbs belong to the offer group. According to Wierzbicka [6, p.191], offer has some typical semantic features: (http://www.dickiesstore.co.uk/product/FA13310) (16). With a harness rated to 65 pounds, the Alpha
EliteTM Convertible Car Seat lets you keep your child
safely in a harnessed seat for longer.
(http://www.davida.co.uk/type.php?id=speedster) It can be easily seen that the use of personal reference you and possessive determiner your is extremely frequent in ARSEs in private and in advertising in common. Linghong [2, p.74] takes the view that the personal reference you and possessive determiner your make the language sound warm and friendly, helping to narrow the gap between the advertiser and the reader, and make the advertisements more appealing. In the above examples, the use of personal reference you and possessive determiner your make the reader feel that he/she is the particular person the advertisers care about and are eager to help. Through the use of personal reference you and possessive determiner your, the advertisers try to convince the reader that all the equipment they offer is for his/her particular needs and benefits, and hence persuade the reader to do the purchase. 3.4. Ellipsis in ARSEs
Nunan [3, p.25] defines ellipsis that a certain structural
element is omitted from a sentence or clause and only can
be recovered by referring to an element in the preceding
text. Ellipsis is normally an anaphoric relation and consists of three types: nominal, verbal and clausal. However, in ARSEs, only nominal and verbal ellipses are found. Nominal (17) This vest is made of soft polyester mesh to keep you
cool and has zipper front closure. It includes four front
pockets, two Φ on chest and two Φ on lower waist.
(http://www.tsasafety.com/...vest) In the above example of nominal ellipsis, the noun as the subject of the sentence is omitted and it can be only referred 70
to the preceding text, which is the name of the equipment. Verbal
(18) It still made to the same precise and exacting
manufacturing standards as it has always been Φ,
although now unable to be approved for road use due to
recent regulatory changes. The helmet, made with a
composite fibreglass shell and polystyrene shock
absorption liner, is fully leather lined. (http://www.davida.co.uk/...Leather_Jackets) The omitting of the verb made in the clause it has
always been makes the sentence more appealing. 3.5. Repetition in ARSEs
Repetition is an expressive means of language used when the speaker is under the stress of strong emotion. It shows the speaker’s state of mind. In ARSEs, it is found that repetition is used mainly as a means to bring the specific qualities of the equipment. Let us consider the example below: (19) The Premium Flame-Resistant Mesh Safety Vest by
Occunomix protects you two ways and keeps you cool too.
This safety vest boosts your visibility as well as provides
flame resistance. Plus, it uses a mesh material for added
ventilation. It is constructed of 100% ANSI Modacrylic
mesh with NomexThreas FR binding and hook and loop
closure. Plus, it uses 2’’W Flame-Resistant 3MTM
ScotchliteTM Reflective Material. One outside pocket for
your tools. Material meets ASTM F1506.
(http://www.safetygearonline.com/...class-2-safety) In ARSEs, repetition is employed to make the preceding element stand out and to intensify the benefits of the equipment. In addition, the repetition of certain safety expressions can help the reader memorize some safety characteristics of the equipment. 3.6. Conclusion
This article is aimed at clarifying some common linguistic features of ARSEs in terms of syntactic features, lexical features and cohesive devices. Hence, this article was of much benefit not only for writing advertisements on road safety equipment in English on websites but also for the field of teaching and learning English. To teachers: The study will probably be a useful resource for teaching English to Vietnamese learners. Hopefully, the result of this study will provide teachers with useful knowledge of linguistic features, especially the linguistic features of ARSES. Additionally, teachers can pay more attention to writing skill to help students know how to write advertisements in general and ARSES in particular effectively. To English learners: This study will provide a good knowledge of linguistic features, especially the linguistic features of ARSEs, which help them have a basic background and good methods to write an effective and persuasive ARSE. REFERENCES
[1] Halliday, M.A.K. and Hasan, R. (1976), Cohesion in English, Longman, New York. [2] Linghong, Z. (2006), “The Linguistic Features of English Advertising”, CALEA Journal. Inc. (Vol.29, No.1) [3] Nunan, D. (1993), Introducing Discourse Analysis, Peguin English. [4] Hornby, A.S. (2010), Oxford Advanced Learner’s Dictionary, 8th
edition, OUP.
[5] Quirk, R. et al. (1985), A Comprehensive Grammar of the English
Language, London: Longman. [6] Wierzbicka, A. (1987), English Speech Act Verbs, Academic Press. (The Board of Editors received the paper on 26/11/2015, its review was completed on 22/01/2016)
71
FUNCTIONAL ANALYSIS OF BEHAVIORAL CLAUSES DENOTING SMILING
IN ENGLISH AND VIETNAMESE
Phan Van Hoa1 , Tran Huu Phuc2, Nguyen Thi Tu Trinh3
1
2
The University of Danang, Viet Nam; hoauni@gmail.com
University of Foreign Language Studies, the University of Danang, Viet Nam; thphuc@ufl.udn.vn
3
Department of English, College of Transport II, Viet Nam; trinhntt@caodanggtvt2.edu.vn
Abstract - In his framework of functional grammar, Halliday
[4] determines three kinds of meaning called textual,
interpersonal and experiential. The experiential meaning is
expressed in 6 process types: material, mental, relational,
behavioral, verbal, and existential. Among them, smiling
belongs to behavioural processes. Smiling not only serves
as emotional expression functions but also has significant
communicative and social ones. Smiling is considered as a
universal emotion of human beings. However, the language
used to express smiling could have dialects that differ subtly
from each other. This paper is aimed at interpreting the
linguistic expressions related to the meaning of smiling and
describing the patterns of behavioural processes encoded
in language. Based upon Halliday’s [4] experimental
meaning analysis and the data collected in eight short
stories and novels, this paper focuses on highlighting: (1)
patterns of smiling processes, (2) functions of participants
in smiling processes and (3) social functions of smiling.
Key words - functional grammar; smiling; behavioural
clauses; processes; social functions.
1. Introduction
All forms of communication can be categorized as either verbal or nonverbal. Much of the communication that takes place between people is verbal; it is based on language whereas nonverbal includes the use of visual cues such as gestures, facial expressions basically known as body language.This paper focuses on transferring the meanings of smiling in the light of Halliday’s functional grammar. Halliday [4] makes it very clear that his theory is intended to give an account of linguistic communication. Therefore, one of the fundamental tenets of functional grammar is that languages are primarily means of human communication. 1.1. Theoretical Background
“A Functional Grammar is one that construes all the units of a language-its clauses, phrases and so-on as organic configurations of functions.”[4].Thus, Halliday’s aim is to develop a grammar system as instrument for people’s communication, for social purposes. To him, there are three types of meaning within grammatical structures: Experimental, Interpersonal and Textual. Among them, the Experimental meaning has to do with the ways language represents our experience of the world and the inner world of our thoughts and feelings. In other words, we have turned our experience of actions, happenings, feelings, beliefs, situations, states, behaviours, etc., into meaning and into wording. It construes the word into a manageable set of Process types and of Participants. Process refers to a semantic verb related to doing, feeling and anything that it expresses events, relations, physical, mental or emotional states in the semantic system of the clause; due to functional features of process, it is classified into material, relational, mental, verbal, behavioral, and existential and its Participants are labelled as Actor, Goal, Senser, Phenomenon, Carrier, Behaver and other terms. In Halliday’s transitivity system, the material process describes concrete and tangible actions involving participants as Actor and Goal, for example: Thomas Actor Sent Pro: material her book Goal to David. Beneficiary Mental processes encode the inner world of cognition, perception and affection. There are two constant participants in a mental process: a Senser and a Phenomenon, even if the Phenomenon is not explicitly realized, for example: He Actor Loved Pro:mental his wife Phenomenon at first sight. Circumstance Relational processes are processes of “being”. That is to say, there are always two participants in relational processes which consist of two main modes: Attributive and Identifying: - Attributive: “A is an attributive of X” - Identifying: “A is the identity of X” Abraham Lincoln Carrier Was Pro: attributive very tall and thin. Attribute Abraham Lincoln Token Was Pro: identifying the16th president of the United States. Value Behavioural processes are processes of psychological and physiological process, like breathing, coughing, smiling, dreaming, chatting, watching, etc. These construe human behaviour including mental and verbal behaviour as an active version of verbal and mental processes. She Behaver is listening Pro: behavioral to the radio. behavioral circumstance Verbal processes can be identified as the processes of saying which are expressed by verbs tell, say, ask, suggest, etc. She Sayer Talks Pro: Verbal to him Receiver about her childhood. Verbiage Existential processes represent experience by positing that “there was/ is something”. There is only one participant known as the Existent. Once upon a time Circumstance there Was Pro: existential a little girl. Existent 1.2. Some Previous Studies
Halliday’s functional grammar has been studied and developed. Thomas Bloor and Meriel Bloor [1] present a 72
short account to the analysis of English for those starting out with functional grammar. Eggins [2] introduces the principles and techniques of the functional approach to language. Martinez [5] examines objectivity in research articles with SFL application and proposes objectivity in the presentation of the text. Fowler [3] figures out that functional grammar is a semantic system to analyze representations of reality in a linguistic text and create the same experience through various lexico-grammatical options influenced by different mind styles or authorial ideology. From our viewpoint, it is impossible to cover all matters of functional grammar in their work and Halliday [4] leaves some unsolved problems of this field especially behavioural clauses. In Vietnamese, Cao Xuân Ha ̣o [7] releases his book “Sơ thảo ngữ pháp chức năng” and he makes a breakthrough of grammar study by introducing functional grammar into Vietnamese in 1991. He presents Systemic Functional Grammar raised by Halliday M.A.K [4] and he tries his best to cover a wide range of issues and terminologies of functional grammar but later in his preface of third edition of this work in 2006 [8] he states that this work is a kind of "navigation" of a new trend, namely, functional grammar and he leaves many existing gaps in analyzing Vietnamese in the light of functional grammar for next generation researchers. Diê ̣p Quang Ban [6] offers a functional analysis of Vietnamese clauses with three metafunctions mapped on the structure clause. Nevertheless, he states that he tries to keep some good points of traditional grammar and combines these with the achievements of functional grammar in analyzing Vietnamese clauses. There is not a clear-cut analysis of functional grammar whilst our study is carried out with a complete shift from traditional grammar to functional grammar. Hoàng Văn Vân [9] considers ‘cú’ in Vietnamese as an equivalent unit ‘clause’ in English for the functional perspective. From this, he initiates a new way in the comparison between English and Vietnamese in terms of functional units in languages but he does not offer a close examination of behavioral processes. In this paper, we focus on analyzing behavioral clauses, especially the patterns of smiling processes and the social functions of smiling in English and Vietnamese. Less attention has been paid to Behavioral processes than other processes due to its complexity and ambiguousness. Phan Van Hoa, Tran Huu Phuc, Nguyen Thi Tu Trinh
genres since stories and novels reflect the reality via the lens and skillful wording of talented writers. Therefore, the participants, processes and circumstances which are paid to attention in this research are in a wide range of use. In addition, they are fruitful land of character’s behaviours. Therefore, they are rich in examples of behavioural clauses and we can explore more human’s behaviour smiling via the verbal channel. Finally, based on our set criteria to determine behavioural clauses denoting smiling, we thoroughly selected and obtained a list of two hundred behavioural clauses from English and Vietnamese short stories and novels. “Jane Eyre”, “Rainbow”, “Women in love” and “Ulysses” are the four English novels written by Charlotte Bronte, David Herbert Lawrence and James Joyce. In their works, the characters with their personal experience and behaviours are brilliantly described via the lively wording of the talented writers. Besides, the three great novels “Sống mò n”, “Dế mèn phiêu lưu ký”, “Số đỏ” and a short story “Cánh đồ ng bấ t tâ ̣n” are thoroughly selected due to their popularity and wonderful narrative devices denoting personal experience and behaviours. 2.2. Data analysis
We analyzed and figured out the patterns in English and Vietnamese and categorize participants and circumstances. Then we investigated the similar and distinctive characteristics of behavioural processes denoting smiling. Finally, we interpreted the findings in terms of instinct behaviour and social behaviour of smiling processes and drew out some conclusions. 3. Results and Discussion
The most typical behavioural process clause pattern consists of a core participant, process and circumstance: Behaver + Process: Behavioural + Circumstance
3.1. Participant-Behaver
“It is the nature of the participants involved in the
processes that determines the different process types” [4]. A typical clause realized by a behavioural process has only one participant: “Behaver” (Beh.). (1) For this paper, in sections 3.1, 3.3 and 3.4, the collected data are examined at clause level since functional analysis is concerned with the aspect of grammar which confines to clauses; whilst in section 3.2, we discuss and interpret behavioral processes of smiling. Hence, the selected data are put in both at clause level and textual contexts. In addition, this study employs verbs as the core of the clauses. The selection of clauses began with selecting verbs that realize the smiling process in eight 19th and 20th century short stories and novels. The list of short stories and novels used in the research can be found in the data sources. We have decided to carry out the research in stories and novels but not in other is smiling
at me
with these coral lips
Behaver
Pro:
behavioural
Circumstance
Circumstance:
Manner
2. Method
2.1. Data collection
She
[1A] (2) I
smiled at
Bessie’s frank answer
Behaver
Pro: behavioural
Circumstance
[1A] (1) and (2) are behavioural processes; “smiling” is often used as an example of the behavioural process and “she” is interpreted as “Behaver”. The entity displaying the behaviour encoded in behavioural process clauses above is labeled “Behaver”. There is only one participant occurring in behavioural process clauses. For example: (3) He (Beh.) smiled faintly. (4) Gerald (Beh.) smiled grimly at this humorism. [4A]] [4A] ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
(5) They (Beh.) both laughed, looking at each other. [4A] (6) He (Beh.) laughed dangerously, from the blood. [4A] Halliday [4] classifies participants into simple participants and macro-participants: Simple Macro Participants Things Quality (7) The two women (Beh.) were jeering at him. [4A] It is clear that in behavioural clauses with process “smiling”, “laughing”, “jeering” that “Behaver” is always endowed with a conscious being, namely things, not quality. Like in English, “Behaver” in Vietnamese behavioural clauses with the process “mỉm cười”or “cười” is acted by a person.
(8) Người đàn ông (Beh.) cười hề hề. [6A] (9) Thịnh (Beh.) cười khanh khách. [7A] (10)San (Beh.) cười phì một cái ra đằng mũi. [5A] The “Behaver” introduced above is the one that smiles. For example, “Người đàn ông” in “Người đàn ông cười hề
hề”. “Người đàn ông” is a human being, a conscious being. But as the following examples illustrate, a part of body (face, eye) can be construed as conscious. (11) His eyes (Beh.) smiled on her, boldly. [3A] (12) Buck Mulligan’s face (Beh.) smiled with delight. [2A] (13) M’Coy’s white face (Beh.) smiled about it at instants. [8A] (14) The face of the Italian (Beh.) flashed with a noncomprehending smile. [2A] Aside from the role of a process, the process “smiling” can be nominalized and plays the role of a participant. This role is characterized as the process Range labeled “Behaviour”. (15) A little social smile (Behaviour) came on her face. [4A] (16)A soft smile (Behaviour) fitted over her grave face. [1A] (17) Attractive smile (Behaviour) came over his eyes and brows. [4A] (18) The laugh (Behaviour) was repeated in its low, syllabic tone, and terminated in an odd murmur. [4A] (19)A slow mocking smile (Behaviour) dawned on Gudrun’s face. [4A]
(20)So many smiles (Behaviour)have been shed into Mr. Rochester’s eyes that they overflow like two cups filled above the brim [1A] (21)A tolerant smile (Behaviour) curled his lips. [2A] According to cognitive perspective, “Behaviour”
above is commonly called “cognate subject” which are derived from the process themselves or from a semantic unit with those processes. They are often coupled with a delexicalized verb such as come over, fit over, dawn, give,
make… Such verbs have lost their full lexical content and become “dummies” in the context. While the kind of action “behaviour” is specified by the noun, as a participant function, the verb may be entirely general in meaning as in, have a smile on his/ her face. 73
Below is an example of the smiling process which is nominalized and labelled as a behaviour in Vietnamese. (22) Nụ cười đong đưa, tung tẩy trên khóe mắt. [6A] 3.2. Interpretation of behavioural processes denoting
smiling
Behaviour is simply something you do in response to a situation. It can be determined by genetics, the environment, your own experience, or a combination of these factors. When we deal with smiling processes, two types of smiling behaviours are explored: instinct behaviour and social behaviour. How do you react when you are happy and excited? You probably smile or giggle. How do you react when you want to jeer at someone or let someone or something down? You just probably mock at him or it. These are both examples of the smiling behaviour. One is instinct the other is social. All these behaviours are coded in smiling processes. (23) Xuân Tóc Đỏ lại cười hí hí như ngựa. [8A] (24) To both of which questions the man grinned. [4A] (25) Then she chuckled gleefully, and turning to … [4A] “Horse-laughing”, “grinning” and “chuckling” are kinds of instinct behaviours when you are full of joy or excitement. Naturally, everyone smiles or laughs when they are cheerful or blissful. In this case, the smiling behaviour belongs to the instinct one. However, in some cases, it belongs to social behaviour as follows: (26) “You utterly misinterpret my words”, I said, at once seizing his hand: “I have no intention to grieve or pain you - indeed, I have not”. Most bitterly he smiled - most
decidedly he withdrew his hand from mine.
[1A] (27) Instead of speaking, I smiled. [1A] In (26) “He”, Mr. Rochester - the main character in Jane Eyre, the “Behaver” of the process “smiling” is not happy or blessed to smile in this case. He smiles to show his terrible bitterness and disappointment when Miss. Eyre refuses his care and love. Interestingly, people tend to smile to hide their feelings when they are too disappointed and mentally or physically painful to speak out. In the light of meanings beyond the clause, the process “smiling” in (26) is completely different from the one in (27). “I”, Miss. Jane Eyre, is smiling when Mr. Rochester urges her to talk about her feelings, thoughts of their relationship. In this case, she smiles when she has no answer or she does not want to reply. Occasionally when people want to express a mental reaction like fear or anxiety, they smile. Language is not only what people write and speak, but also the means by which this is done: the sounds spoken, the signs written or read, and the meanings conveyed by them. That is meaning beyond the clause, which is clarified in functional grammar raised by Halliday [4]. Human behaviours become meaningful only in the context of social life and occur as language and through language. These cases are also found in Vietnamese clauses denoting smiling as in: (28) Chị cười mếu máo. [6A] (29) Thằng Xuân cười tình, nháy một cái. [8A] (30) Tôi cười khểnh, nói lịch sự mỉa mai. [7A] 74
Phan Van Hoa, Tran Huu Phuc, Nguyen Thi Tu Trinh
(31) Chúng tôi nhắm mắt lại cười vào mũi lão như thế thì lão cáu lắm. [7A] In fact, it is impossible to have a clear border between instinct behaviour and social behaviour. For example, as discussed above, smiling is neither 100% instinct nor 100% social. Sometimes, it becomes social when showing people’s sorrow, embarrassment, uncertainty, fear, surprise or disappointment and so on. This type of behaviour may be called complex behavior. In this case, when we interpret complex behaviour expressions, we should put them in certain textual contexts. Clearly, human behaviour cannot be understood if we separate language and social practice. Language without social practice and social practice without language are senseless. From this perspective, language, as an essential component of social practice, reflects our experience. 3.3. Circumstances
Halliday [4] classifies circumstances into nine types: Extent,
Location,
Manner,
Cause,
Contingency,
Accompaniment, Role, Matter, Angle. Circumstances are very significant with special interpretations wherever they occur. Some circumstances just go with certain clauses. For example, circumstances of Matter are fairly popular with mental, verbal and behavioral clauses but quite rare with the other process types. After we thoroughly investigate and analyze the selected data based on Halliday functional grammar account, three certain types of circumstance are found: Circumstance as Participant, Circumstance of Cause and Circumstance of Manner. 3.3.1. Circumstance as participant
Let us take a look at the following examples: (32) The two sometimes bestowed a courteous word or smile on me. (Circumstance: participant)
[1A] (33) He smiled at me with a certain smile he had of his own. (circumstance: participant)
[1A]
(34) I smiled at him. (Circumstance: participant)
[2A] To Halliday [4], there are some difficulties in identifying circumstantial elements, especially prepositional phrases functioning as circumstance. The Behavioural process “smiling” usually features a prepositional phrase with on, at, with in (32), (33) and (34). In the above examples, Circumstances are prepositional phrases, which function as participants. (35) Nếu mỗi lần cha nhìn đăm đắm và mỉm cười với một
người đàn bà mới chúng tôi lại thắt thẻo. [6A] In Vietnamese, in the above example “với một người đàn bà mới”, a prepositional phrase is also labeled as Participant as in English. 3.3.2. Circumstance of cause
(36) I smiled at the speaking likeness. (Circumstance:
Cause)
[1A] (I was amused by the speaking likeness) (37) He smiled at bronze’s teabathed lips. (Circumstance:
Cause)
[1A] (He was amused by bronze’s teabathed lips) In (36) and (37), the prepositional phrases are labeled as Circumstances of Cause which construe the reason why the process is actualized. Particularly, the prepositions above are closely bonded with verb “smile”. (38) Tôi bấm bụng nhịn cười thầy đồ Cóc rồi dùng cái khoa giao thiệp hoa mỹ khôi hài đó đáp đùa lạ. [7A] In the light of this analysis, the nominal group“thầy đồ
Cóc” is considered as Circumstance of Cause. 3.3.3. Circumstance of manner
Halliday [4] figures out that there are four subcategories in Manner, namely Means, Quality,
Comparison and Degree. a. Quality
Quality is typically realized by an adverbial group, with a –ly adverb as Head. Phrasal expressions of quality in the following examples modify the specifications of the manner of the process “smiling” in terms of speed, shape,
tone, sound, etc. (39) He smiled, uncomfortably, cynically. (Manner:
Quality) [3A]
(40) Mr. Bloom smiled joylessly on Ringsend road. (Manner: Quality)
[2A]
She raised her small gloved fist, yawned ever so gently, tip tapping her small gloved fist on her opening mouth and smiled tinily, sweetly. (Manner: Quality) [2A] (41) He smiles uneasily. (Manner: Quality)
[2A] In Vietnamese, a lot of adverbial groups served as Circumstance: Quality are found in this study since they are all-purpose devices which help writers describe their character’s behaviour efficiently. Some examples are as follows: (42) Phó Ðoan nhìn trộm nó mà mỉm cười toe toét. [8A] (43) Anh cười nhạt.
[7A] (44) Anh tôi cười khẩy. [7A] (45) Lão ngoác mỏ ra cười khà khà rồi nói. [7A] (46) Tôi giận lắm, nhưng chỉ cười thầm. [7A] (47) Mấy đứa trẻ xem chọi dế cười ha hả. [7A] As illustrated in the examples, Circumstance of Quality
plays a crucial role in demonstrating the different types of smiling and they may embody the interpersonal metaphor that contains the attitude of the Behaver. b. Comparison
Comparison is typically expressed by a prepositional phrase with like or unlike. For example: (48) He smiled like a weather man, like an ecstatic patron
of recurrent light. (Manner: Quality)
[1A]
In Vietnamese, circumstance of Comparison is always realized by the word “như” as in the following example. (49) Bà Phó Đoan cười như trong rạp hát mà rằng: [8A] 3.4. Troubleshooting
Material or behavioural processes
The distinction between a material and behavioural ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
process is sometimes vague and it is difficult to have a clear borderline. Let us consider the following examples. (50) He is putting on a cheerful smile. [4A] (51) She gave a wry smile. [2A] If we analyze these two examples above in terms of grammatical labels with the core element of process “put” and “give”, they are material processes. When we examine them in terms of semantic domain, they belong to behavioural processes. Consider the two pairs of clauses (50a) He is putting on a cheerful smile, (50b) He is smiling
cheerfully and (51a) She gave a wry smile, (51b) She smiled
wryly. These are synonymous in terms of semantics but are completely different in the choice of participant and process. (50a) He is putting Actor
Pro: material
on a cheerful smile. Circumstance: behaviour
(50b) He is smiling Behaver Pro: behavioural
cheerfully Circumstance: manner
(51a) She gave Actor
Pro: material
a wry smile. Participant
(51b) He smiles Behaver Pro: behavioural
wryly Circumstance: manner
[6A] Actually, the verb “nở” itself is a common verb in material process, but in the expression “nở nụ cười”, it
contains the meaning of behaviour “smile” and it should
be analyzed as a behavioural process. Here are some more
examples. (53) Chúng tôi nhắm mắt, nhắm mũi lại lăn ra cười. [7A] (54) Nói tới chỗ này tôi mắc cười muốn chết. as Behaviour. Secondly, when we deeply interpret the meaning of the process “smiling”, we find out that although the process “smiling” belongs to behavioral clauses, there are two different kinds of meanings related to instinct and social behaviour. The former is inborn. As we are happy, satisfied or excited, we smile. We react on our basic instincts. But the latter is social. We cannot simply interpret human’s behaviours based on their natural instincts because in many cases, people try to hide their true feelings and behaviours via common behaviours. To deal with them, we suggest interpreting human’s behaviour of smiling in the context of social life. That is what Halliday states in his work [4]. Finally, there is troubleshooting when we analyze behavioural clauses that denote smiling meaning. That is whether it is material or behavioural. Once again, in this paper, we do believe that there is a tight and mutual relationship between human language and human behaviour. In other words, in real life, human behaviour is coded in words and expressions and these words and expressions are clearly interpreted and encoded based on Halliday’s functional grammar account. REFERENCES
Halliday [4] states that “grammatical and semantic categories are not in one-to-one correspondence, then if we use grammatical terms that are semantic in import, we cannot expect them to be appropriate for all instances. The reason is quite valid; grammatical labels are rarely appropriate for all instances of a category”. Likewise, some Vietnamese clauses are either material or behavioural in terms of grammatical or semantic categories. For example, (52) Nương ôm bu ̣ng bầ u nở nụ cười.
75
[6A] 4. Conclusion
Based on the analysis of the selected data, firstly, it is shown that the typical pattern of behavioural processes denoting smiling is Behaver + Behavioural process +
Circumstance. Besides, Behaver almost functions as participant in behavioural clauses, there is also a case of nominalization of the process “smiling” typically labelled [1] Bloor, T. and Bloor, M. (1995). The Functional Analysis of English:
A Hallidayan Approach. Edward Arnold. [2] Eggins, S. (1994). An introduction into Systemic Functional
Linguistics. London and New York: Continuum. [3] Fowler, R. (1996). On Critical Linguistics1. Texts and Practices:
Readings in Critical Discourse Analysis. London: Routledge. [4] Halliday M.A.K. (1994). An Introduction to Functional Grammar. Arnold, London. [5] Martinez, I. (2001). Impersonality in the Research Article as
Revealed by Analysis of the Transitivity Structure. English for Specific Purposes, 20(3), 227-247. [6] Diê ̣p Quang Ban (2009). Ngữ pháp Tiế ng Viê ̣t. Nxb Giáo du ̣c Viê ̣t Nam. [7] Cao Xuân Ha ̣o (1991). Tiế ngViê ̣t – Sơ thảo ngữ pháp chức năng. Nxb KHXH. Hà Nô ̣i. [8] Cao Xuân Ha ̣o (2006). Tiế ng Viê ̣t – Sơ thảo ngữ pháp chức năng. Nxb KHXH. Hà Nô ̣i. [9] Hoàng Văn Vân (2002). Ngữ pháp kinh nghiê ̣m của cú tiế ng Viê ̣t,
mô tả theo quan điể m chức năng hê ̣ thố ng. Nxb KHXH. Hà Nô ̣i. DATA SOURCES
[1A] Bronte, C. (1847). Jane Eyre. Smith, Elder & Co. of London, England. [2A] Joyce, J. (1922). Ulysses. Dover publications, Inc. New York. [3A] Lawrance, D.H. (2004). The Rainbow. Collector’s Library, China. [4A] Lawrance, D.H. (1920). Women in Love. Dover publications, Inc. New York. [5A] Nam Cao (1956). Sống mòn. Literature Publishing House. Viet Nam. [6A] Nguyễn Ngọc Tư (2011). Cánh đồng bất tận. Youth Publishing House. Viet Nam. [7A] Tô Hoài (1941). Dế mèn phiêu lưu ký. Kim Dong Publishing House. Viet Nam. [8A] Vũ Trọng Phụng (2014). Tuyể n tập Vũ Trọng Phụng, Tập 1, Literature Publishing House. Viet Nam. (The Board of Editors received the paper on 17/05/2016, its review was completed on 14/06/2016)
76
A CRITICAL DISCOURSE ANALYSIS OF DISCURSIVE STRATEGIES USED
IN ECONOMIC NEWS IN ECONOMIST.COM AND TUOITRE.VN
Luu Quy Khuong1, Vo Thi Hoang Ngan2, Nguyen Ngoc Nhat Minh1
1
University of Foreign Language Studies, The University of Danang; lqkhuong@cfl.udn.vn 2
American Academy English Center (AMA); hoangngan.dn@ama.edu.vn
Abstract - Economic news we read everyday is probably our main
source of economic knowledge.Thus, it has an important role in
shaping our public knowledge, attitudes and behavior. Concerned
with significance of critical comprehending of economic news, this
research is conducted to investigate how writers in economist.com
and tuoitre.vn address economic issues as well as discover
similarities and differences of English and Vietnamese economic
news. More importantly, the researcher aims at shedding light on
implications of critical discourse analysis (CDA) for understanding
and writing economic news. In this study, Van Dijk’s framework [4] is
employed to detect 12 common discursive strategies used by
journalists in 200 samples (100 samples in English and 100 samples
in Vietnamese) collected from the two newspapers in English and
Vietnamese: economist.com and tuoitre.vn. Findings show that
discursive strategies are used differently in the two languages to
address economic issues based on different ideologies of the writers.
ideologies and concluded that the representation of news is the display of writers’ ideologies in a hidden way through lexical items to manipulate ideas in such a way to make up the readers’ minds. Zhang [5] brought up an exploration of linguistic features, news production and social contexts of political news reports based on Fairclough’s three dimensional framework and Halliday’s functional grammar. Zhang [5] strengthened the view that language in the news report are never bias-free and branded by social values and different ideology, that is, with the same event, different writers from different points of view which are determined by their own values and perspectives make an effort to guide readers’ opinion towards the writer’s interest. Key words - critical discourse analysis; discursive strategy;
economic news; ideology; journalism.
3. Some theoretical concepts
3.1. Critical discourse analysis
1. Introduction
Accompanying the rapid advancement of science and technology in the 21st century is the great dependence of positive and negative changes in the society on media. It is because news reports we read every day are probably the main source of political and social knowledge, belief and attitudes to the world. Thus, the media’s central role in moulding public knowledge, attitudes, and behavior justifies the increasing attention of discourse analysis practitioners to it. Very necessary as a critical discourse analysis of news discourse is, the application of critical discourse analysis in media research is relatively new. According to Van Dijk [3], numerous levels of description, from grammatical description to more complex properties such as coherence relations between sentences, topics, schematic forms as well as rhetorical dimensions can be employed to analyze news discourse. This can be done by analyzing the use of discursive strategies used in English and Vietnamese news discourse, which is also the ultimate aim of this research. This research is hoped to bring about some contributions to the readers, EFL students and teachers in comprehending and writing economic news in the two newspapers. There has been much research on CDA for decades, however, Van Dijk’s research [18] offered the most unified and systematic critical analysis of discursive strategies in news with abundance of illustrative examples. According to Van Dijk [4, p353], CDA is “a type of discourse
analytical research that primarily studies the way social
power abuse, dominance, and inequality are enacted,
reproduced, and resisted by text and talk in the social and
political context.” CDA differs itself from other disciplines of discourse analysis in the way that it explores the relationship between language and society. According to critical discourse analysts, the use of language is considered as a form of social practice. All social practices are inseparable to specific historical contexts and situational contexts; all social practices are employed to reproduce and enact social relations. That is why discourse is influenced by social structures and reproduced in social interaction. Conforming to these requirements, the main tenets of CDA are suggested by Van Dijk [12] as follows: 1. CDA addresses social problems. 2. Power relations are discursive. 2. A brief review of the previous studies related to the
research
Van Dijk [3] offered us a systematic analysis of news as discourse and myriad of examples of structure analysis of international news and domestic news. Fairclough and Wodak [1] proposed a detailed work on basic tenets and 8 basic principles of CDA. Their framework focuses on three components: textual analysis including Halliday’s systemic
functional linguistics, discourse practices and social
practices. Sana, Hafiz, Maria, Zikra and Huma [2] carried out a research on the choice of lexical items representing different 3. Discourse constitutes society and culture. 4. Discourse does ideological work. 5. Discourse is historical. 6. The link between text and society is mediated. 7. Discourse analysis is interpretative and explanatory. 8. Discourse is a form of social action. 3.2. Ideology
Ideologies are the fundamental beliefs of a group and its members, that is, it is defined as “a systems of ideas which ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
77
are socio-cognitively defined as shared representations of social groups and more specifically as the ‘axiomatic’ principles of such representations” [4, p115]. - Generalization: language users may choose to generalize or make the claims broader and more generally applicable to illustrate their ideology. 3.3. Discursive strategies (DSs)
- Implication: News discourse writer will leave much information implicit, either because it is a common knowledge known in the readers’ culture or because it is the information inconsistent with their positive self-image and the writer does not want to present it openly. The word ‘discursive’ means relating to discourse or modes of discourse. The word ‘strategy’ can be understood as conscious and strategic discourse choice adapted to specific situation and individuals. According to Van Dijk [18], discursive strategies, in terms of critical discourse analysis, are linguistic moves language users use to influence or control readers’ minds. Discursive strategies are represented in news in the way that different, possibly opposed opinions, beliefs, interests of different ideologically conflicted groups are hidden beneath ideological representations of social events. Such representations are often spelled along “Us” versus “Them” dimension, in which speaker of one group has a tendency to illustrate them and their group in positive terms and other groups in negative terms. Given these content of ideology, Van Dijk [4] tried to incorporate such underlying ideologies to expressions in discourse, to be specific, to DSs in his ‘ideological square’ theory. The ‘ideological square’ theory covers a very general strategy of most ideological discourse: - Say positive things about “Us” - Say negative things about “Them” Because of the scope limit, the researcher only examines 12 discursive strategies among 40 discursive strategies in Van Dijk’s framework [18]. After conducting a research on frequency of 40 strategies mentioned in 100 economic news (50 Vietnamese economic news and 50 English economic news), the researcher chooses twelve mostly used strategies [18] for investigation. - Authority: language users can employ a discursive move of authority in which they mention or quote authorities to support their argument. Authorities here may include organizations or people who are generally recognized as experts, leaders, the government, scholars, the media, the church or the court, etc. - Categorization: groups tend to be distinguished and categorized so that the writer can attribute positive or negative characteristics to them and distance in-group and out-group members. - Contrast: this is a prevalent strategy which emphasizes Our good things and Their bad things in which ideologies are represented in polarized terms in order to differentiate in-group and out-group membership. - Empathy: the use of empathy can have an important role in managing positive impression of the readers towards the writer, which contributes to the credit that the writer has, and to the reliability of the argument of the writers. - Explanation: the negative actions of in-group members tend to be explained away, whereas negative actions of out-group members tend to be explained as an inherent property of the whole group. - Fallacy: fallacy is identified when in an argument, the relations between premises and a conclusion may be faulty or conjectural without solid evidence. - Lexicalization: a major discursive strategy (DS) of ideological analysis. To refer to the same person, same group or social issues and event, language users can have a variety of word choices, depending on discourse genre, personal context (opinions, standpoint, perspective,…) and social context (in-group membership, out-group membership, dominance relation) and socio-cultural context (norms, values). - Norm expressions: The writer may want to use normstatements about what ‘we’ and ‘they’ should or should not do. - Number game: Numbers and statistics are the major means to emphasize objectivity which represents the factual information against subjective opinion and comment. So one of the best move to objectivity is to use numbers and statistics to make them credible for the argument. - Presupposition: most of the meaning of the text is presupposed to be known by the readers. Presupposition may represent the truth values which are taken for granted or unchallenged. 3.4. News
News is information about events or happenings which is reported by newspapers, radio, or television. News’ purpose is to inform readers of what is happening in the world around them. Common topics for news include war, politics and business, athletic contests, quirky or unusual events, etc. News must be factual, which means that news must be based on actual occurrences, situations, thoughts and ideas. News must be accurate, balanced, concise and clear. The samples are collected in two reputable and reliable newspapers: economist.com and tuoitre.vn. economist.com is a reputable English weekly newspaper owned by the Economist Group and edited in offices in London. tuoitre.vn is one of the most read online newspaper of Vietnam. It is the official organ of Vietnam’s Youth Community. Because of their equivalent popularity and credibility in the two countries, economist.com and tuoite.vn are opted for investigation in the research. 4. Research Procedure
In order to conduct the research, the following steps are taken. Firstly, to determine the length of the samples, 500 news in English and Vietnamese are investigated in terms of number of words. As a result, samples which have 900 to 1000 words are chosen for investigation because of their popularity in the total news investigated.After the average length of news is set, news about specific economic events or happenings reported in the two online newspapers are collected and two economic news about the same event in English and Vietnamese are paired to be compared. After collecting the data, 100 news in English and 100 articles in Vietnamese are put into investigation. The researcher 78
detects, describes and analyzes discursive strategies used and the way journalists represent different ideologies by using discursive strategies. Finally, the research results are compared and contrasted to point out the similarities and differences between the two languages. The researcher also thus suggests some implications for news readers and teaching and learning English as a foreign language. 5. Analysis of DSs in English Economic News (EENs)
and Vietnamese Economic News (VENs)
5.1. DS of authority
The strategy of authority is a common move used. However, in ENs, this strategy is used in a canny way. (1) The most influential, by Peter Petri, Michael
Plummer and Fan Zhai, for the ENst-West Centre, a
research institute, forecasts that the deal would raise the GDP of the 12 signatories by $285 billion, or 0.9%, by 2025 [7]. In example (1), the strategic use of authority brings out the credibility of the opinions stated in the news by citing opinions of a person whose job is closely related to the field, in particular, a banker, who does calculate and predict the rise and fallacy of the economy and who is under the direct influence of bobbing of figures and quotes. The strategy of authority can also work toward overall negative characterization of Others.
(2) “Nếu người ta thật sự tin rằng cá nuôi cần phải được kiểm tra nhiều hơn thì tại sao không phải tất cả các loại cá nuôi?” - ông Matt Fass, chủ tịch Công ty Các sản phẩm
biển quốc tế, một nhà phân phối ở Virginia, nói với
AP.Lý do thật sự, theoông Fass, là tiền bạc” [11]. There is a conflict of interest between the Vietnamese writer and the American writer on this matter so in order to convince readers that the Vietnamese writer’s argument is authentic and logical, he/she quotes supportive statements from the director of a big American company related to the field concerned – a marine product company. This strategy kills two birds with one stone. Taking an opinion from an authoritative figure in America to support Vietnam is a judicious move, on one hand, to prove that Vietnam’s actions are of no illegality, even from the perspective of an authority in America, on the other hand, to demonstrate the internal division in America, to show that not all citizens or authorities in America agree with the decision to impose dumping suit on Vietnam. 5.2. DS of categorization
The DS of categorization is exercised in the news to distance “Us” and “Them”. (3) Some Asians are blaming the West [9]. The DS of categorization “Asians” and “the West” is used to pronounce the disparity of Asian countries and Western countries, further accentuates the wrongdoing that Asians blame on Westerns. (4) AP cho biết các nhà nuôi cá Mỹ đang ráo riết vận động hành lang để lại có một đạo luật mới: họ muốn những con cá nhập khẩu từ VN lại được gọi là… cá da trơn, và do đó sẽ bị đặt dưới một chế độ kiểm tra mới mà họ đã thúc đẩy thông qua Quốc hội Mỹ năm 2008 [11]. The DS of categorization is exercised in the news to distance Vietnamese exporters and Vietnam’s catfish from American farmers and America’s catfish. In specific, the phrase “các nhà nuôi cá Mỹ” is adopted to address American farmers and American authorities, while an inclusive noun “Việt Nam” is used, on one hand, to include the whole Vietnamese people and authorities to the writer’s side, on the other hand, to assert that “tra” and “basa” fish are the specials of Vietnam and Vietnam produces the incomparable catfish in terms of quality. 5.3. DS of contrast
The contrast between “Us” and “Them” can also be subtly expressed by description of an event or a process. For example, in the following example, the writer describes the process to launch a product in China and a Western software firm. (5) Whereas a Western software firm typically releases an early “beta” version of a product only to a select group of guinea-pigs, Chinese firms are more likely to launch theirs straight into the market [8]. The software firm in the West conforms to standard process of launching a product, while Chinese firms are depicted as conversing the process for sake of profits. (6) Phố Main là tên phố thông thường ở các thị trấn trung lưu tại Mỹ, đối ngược với Phố Wall giàu có [13]. Here, the contrast between Main Street and Wall Street is drawn to assert the polarization between middle class and bankers and businessmen representing Wall Street. 5.4. DS of empathy
In discourse about economics, strategy of empathy may be largely strategic and is intended to manage the writer’s impression with the readers. However, there is no DS of empathy used in EENs. Let us explore an example of empathy used in VENs. (7) “Thần mưa không nghe lời cầu khẩn của chúng tôi và ông Thủ tướng Modi cũng giả điếc trước lời cầu xin giúp đỡ của chúng tôi. Tôi đang nợ nần ngập đầu” - ông Tarachand Mathur nói trong nước mắt, tay chỉ ra cánh đồng trồng lúa mì thất bát của mình [14]. Here, the writer uses a tragic story of a farmer in India to evoke pity in the readers, which helps to prove his/her argument that Indian government should not deprive farmers of their lands. 5.5. DS of explanation
The strategy of explanation is exploited in a way that negative acts of out-group members are explained in detail or positive act of in-group members are ignored or explained away, as shown in the examples below: (8)Instead, most economists use what is known as computable general equilibrium (CGE) analysis... Researchers line things up so that the model yields the same output as a real benchmark year. Once that is achieved, they “shock” the model, adjusting trade barriers to see how outcomes shift, both immediately and over time. [7] Specifically, in example (8), the assets of CGE, a method which the writer advocates are deciphered meticulously. Meanwhile, in example (9) below, the deficiency of the ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
view: bailing out working class Americans or bailing out no one can help American economy is pointed out. (9) Nhưng thời thế đã thay đổi. Nhiều người trẻ ở Mỹ than thở nền kinh tế ì ạch đang giết chết “giấc mơ Mỹ”, ... Họ than phiền dù học hành và làm việc chăm chỉ đến mấy cũng không tiết kiệm đủ tiền để mua nhà, học đại học, hưởng các dịch vụ y tế... Điều đó hoàn toàn trái ngược với những gì chúng tôi được dạy từ nhỏ: “Là một người Mỹ có nghĩa là có quyền tiếp cận với sự thịnh vượng” [13]. With a detailed explanation of how hard it is for American people to realize their American dream in the present, the writer expresses his/her underlying ideology: there is a big gap between notion of American dream and
a harsh reality of economic downturn.
5.6. DS of fallacy
Fallacy is one of the very effective DS used in expressing ideologically different opinions and in the articles, it is employed cleverly. Have a look at these examples: (10) Many will not have jobs to go back to [9]. Without any solid scientific evidence, the writers represents his/her own formulation, prediction based on his/her knowledge and asserts it as it is true to make the readers believe in what he/she stated. (11) Nếu điều đó xảy ra, họ sẽ đánh mất “định mức tín nhiệm” cả đời và sẽ rất khó có thể vay tiền mua nhà ở Mỹ [13]. Here, the writer states his/her argument and prediction about difficulties that American people have to face to buy a house for themselves and made the readers believe in what he/she believes. 5.7. DS of generalization
The strategy of generalization is intended to manage opinions and impression of the scale and popularity of the subject. This strategy can be exploited to give the impression about large scale of the subject as in the example: (12) China's breakneck growth has stalled. The rest of East Asia, too,... has found itself hit as hard as anywhere in the world and in some cases harder [8]. The lexical choice “anywhere” is used to make readers believe that the whole globe, not China only has to suffer from a halt in economic upheaval. This type of strategy is meant to include all other countries in the world in economic subsidence, to shift the attention of the readers away from China’s failure and diminish that failure off China. (13) Cuộc gặp đó cho thấy các nước BRICS vẫn chưa chung một bầu trời với nhau cho lắm, mỗi nước đều giữ những góc trời riêng [16]. In example (13), a concrete event or action is generalized, which makes the claim broader and applicable to every one or almost everyone at least. This happens with the quantifier for noun “đều” to include all countries to the actions concerned. 5.8. DS of implication
The strategy of implication is proved effective in hinting the bad sides of “Them” or good sides of “Us” which can be interpreted in one or many ways, depending the context. 79
(14) This orthodoxy rests on three propositions: that CEO pay just keeps on going up; that it is not tied to performance; and that boards are not doing their job of holding fat cats’ paws to the fire [10]. Interesting to the analysis, the job of holding fat cats’ paws to the fire is considered a very intrigue and dangerous one, which leads to the interpretation of the sentence as follows: the pay of CEO always increases, although their performance is not boosting nor they are doing anything threatening or complicated. (15) Cuộc gặp đó cho thấy các nước BRICS vẫn chưa chung một bầu trời với nhau cho lắm, mỗi nước đều giữ những góc trời riêng [16]. Here, the strategy of implication is observed in the phrase “chung một bầu trời” and “giữ những góc trời riêng” which can be understood that members of BRICs do not put their alliance ahead of their own benefits: they do not see eye to eye in many issues and are not willing to compromise for the best of their alliance. 5.9. DS of lexicalization
As regards the analysis of lexicalization of the news, the choice of words can be effective in representing ideologically controlled opinions of the writers. For example, (16) This week, however, as they feasted to the deafening rattle of the firecrackers lit to greet the Year of the Ox, their celebrations had an anxious tinge. [9] The opinion represented is very explicit through the means of lexicalization, as is most obvious in the choice of “feasted” instead of “celebrate”, “tinge” instead of “feeling”, along with the lexical choice of “rattle”, “firecrackers” and “greet”, all of which create sound effect of festival. So the writer’s opinion that Chinese celebrates a well-off festival is made clear through a clever use of lexicalization. (17) “Cơn điên ngày thứ sáu đen tối” [15] The opinion represented is very explicit through the means of lexicalization, as is most obvious in the choice of “đen tối” instead of “đen” in the translation of “Black Friday” into Vietnamese “Thứ sáu đen tối”. While “black” in “Black Friday” originally indicates benefits, and “Black Friday” means moving from the red (indicating losses) to the black (indicating profits), the phrase can be translated as “Thứ sáu đen”, the writer intentionally mistranslate “black” into “đen tối”, an explicit forms of derogation term. 5.10. DS of norm expressions
Economic news relates much of advice or comment on what is best for one economy or the whole world economy. As a result, strategy of norm expressions is one of the most important strategies to suggest measures and solutions to economic problems. In the following examples, the writers used norm expressions to recommend to save Asia’s countries from smash by developing internal economic strength and detaching themselves from dependence of export in the first example, and in the second example the writer gave advice on authorities to boost development of agriculture. (18) To get onto a sustainable long-term growth path and to help pull the rest of the world out of recession - 80
Asia's economies need to become less dependent on exports in other ways [9]. (19) Tiếp theo đó, các đảng phái này phải phối hợp nhau để cải thiện cuộc sống của người dân nông thôn [14]. 5.11. DS of number game
Number game is a powerful tool in ideological management. It is even more powerful in economic news where statistics is the most influential way to conceive and analyze economic development or evaluate an economic event or phenomenon. This strategy is used many times in the news to articulate the quantity, comparison, contrast as shown respectively in the examples below. (20) China’s lunar new year sees the world's largest migration, as tens of millions of workers flock home.[9] (21) Thực tế, khoảng 1/2 người Mỹ ở nhà thuê phải chi hơn 30% tổng thu nhập cho việc thuê nhà, tăng kỷ lục 12
điểm % cơ bản so với cách đây 10 năm.[13] 5.12. DS of presupposition
The use of presupposition can be most effectively exploited when it is used in line with characterization of Us and Them regarding good points and bad points respectively. The writer’s ideological stand is represented by the use of the word “even” as follows: (22) Even in China, exports are spluttering, down by 2.8% in December compared with the previous year [9]. Here, the lexical item “even” bears a presupposition that China’s export was strong and is supposed to remain strong during the economic slump. However, the economic downturn is so devastating that it can make China’s export fall. Another lexical item which can bear a presupposition is “tiếp tục”. (23) Báo cáo tháng 6 năm nay của Goldman Sachs ghi nhận: “Những năm gần đây, các nước BRICS đã tiếp tục vươn lên mạnh mẽ trên bảng xếp hạng quy mô các nền kinh tế [16]. The use of “tiếp tục” suggests that members of BRICs did climb to a higher position in economic ladder once and then they were making a consistent effort to gain economic achievement in recent years. Statistics in the tables below summarize the occurrence and percentage of twelve DSs examined in EENs and VENs. Table 1. A Summary of DSs Used in EENs
DSs in EENs
Occurrence
%
1842 50.49 Lexicalization
703 19.27 Number game
342 9.38 Implication
284 7.79 Presupposition
252 6.91 Authority
148 4.06 Categorization
76 2.08 Explanation
57 1.56 Fallacy
134 3.67 Generalization
32 0.88 Norm expressions
29 0.79 Contrast
0 0.00 Empathy
3648 100.00 Total
Table 2. A Summary of DSs Used in VENs
DSs in VENs
Number game
Lexicalization
Authority
Implication
Presupposition
Generalization
Explanation
Empathy
Norm expressions
Categorization
Fallacy
Contrast
Total
Occurrence
850 709 578 129 126 34 32 17 14 13 8 4 2514 %
23.3 19.4 15.8 3.5 3.5 0.9 0.9 0.5 0.4 0.4 0.2 0.1 68.9 6. Findings
To put statistics for DSs used in economist.com and tuoitre.vn in comparison and contrast, the researcher draws out some following similarities and differences between English and Vietnamese. 6.1. Similarities
The first similarity is that the strategies of number game, authority, lexicalization, implication, presupposition are considered most effective and important in economic news in both languages, as evident in its popularity among the DSs concerned. The reason is understandable: Firstly, economics is a field which is based on statistics and figures to generalize the situations and make predictions, that is why the strategy of number game
dominates economic news. Secondly, different from other field, in economics, there are a variety of ideas and predictions regarding economic issues, that is, each person can interpret economic statistics in a different way, whether positive or negative. As a result, it is not as persuasive for journalists to make their own arguments as to quote specialists’, authorities’, government’s and experts’ opinions. That is why DS of authority is favored in economic news. Thirdly, much as dry and rigid economic news may have been, DSs of lexicalization, implication, presupposition add flavor to economic news, making the news more interesting and impressive. 6.2. Differences
In general, that English writers employ more DSs than Vietnamese ones is proved by the fact that occurrence of all DSs in economist.com is 1.5 times higher than that in tuoitre.vn. Moreover, occurrence of each DS varies when comparing between English and Vietnamese. In particular, albeit DS of authority occupies a large proportion in both English and Vietnamese economic news, its occurrence in Vietnamese economic news is twofold that in English economic news. It can be said that the role of government, authorities or experts is more emphasized in Vietnamese economic news than in English ones. This reflects the respect for authority of Vietnamese people, in specific, the ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
Vietnamese are supposed to take a very limited role in experiencing, assessing or taking initiatives in dealing with economic issues, hence, opinions, guidelines and predictions about economic issues are mostly led by the government or experts. In contrast, in English economic news, the government or experts play a less prominent role in guiding the public’s opinions and actions and the writer or readers are supposed to be more engaged, more critical and initiative in understanding and dealing with economic issues. Secondly, high in occurrence in both languages as implication and presupposition are, the two DSs in English economic news are used much more times than in Vietnamese economic news. This difference can be explained in terms of ideological positioning. To make it clear, the disparity between English and Vietnamese economic news in the use of implication and presupposition represents the link between comprehensibility of economic news and education or social position of speakers that the newspapers target. The economist.com is the newspaper which offers authoritative insight and penetrating opinion on economic news, meanwhile, tuoitre.vn normally provides readers with informative account or description of economic events and issues in the world. In line with that function, economist.com caters a version of news with much of implication and presupposition, whereas writers in tuoitre.vn may be consciously aiming to make their report simplified, thus making their news palatable to common readers, not just the elite. Thirdly, the DS of explanation also accounts for a higher proportion in English economic news than in Vietnamese ones. With focus on analyzing and giving insightful opinions on an issue, writers in economist.com have a tendency to give many detailed explanations of the news. Fourthly, the DS of generalization ranks 6th among all DSs used in Vietnamese economic news, while it takes the 9 th position in English economic news, which can be concluded that Vietnamese writers tend to use more of generalization strategy than English writers. The difference can be explained that Vietnamese are collectivists, who usually have a tendency to assign individual attributes to the whole group. Another difference worth mentioning is that the occurrence of use of categorization in English news is nearly 11 times as many as that in Vietnamese news, namely 148 times and 13 times respectively. It may be that the journalists in English economic news show no fear of conflict, as would be expected in an English news source. English journalists are considered as more openly critical in their outlook and analysis of an economic event, so they incline to categorize themselves and other countries that do no good for their country more often than Vietnamese journalists. In contradiction to English journalists, Vietnamese journalists seem to try to go great lengths to avoid sharp contrast between “Us” and “Them” and to be neutral in some economic issues, especially international economic issues. This explanation can be applied to clarify why Vietnamese journalists have a trend to use more empathy and fewer contrast strategies than English ones. Both later strategies are used to emphasize the strong position or more affirmative and candid opinions of the writers, thus 81
employed more by English journalists. The distinction can be seen in the more use of empathy by Vietnamese journalists, which can bring out their neutral tone. One noteworthy discrepancy is that in VENs, strategy of empathy appears 14 times in the corpus of the research, however, there is no strategy of empathy used in EENs. This can be interpreted by the fact that English journalists in economist.com try to be objective in their account and analysis of economic events, that is, not to take sides or give any empathetic comment on the events. However, Vietnamese are collectivists who have tendency to show sympathetic expressions towards others’ mishap. Last but not least, fallacy and norm expressions are other domains in which ideological stances may be expressed. It is proved that more powerful arguers may manage the opinion of the readers by making self-serving arguments more prominent and affirmative. Because of economic and military strength of America, its media’s voice is more influential than that of Vietnam, thus American journalists are more vigorous arguers. That fact can shed light on how English journalists employ more of fallacy and norm expressions than Vietnamese ones. 7. Conclusion
The data analysis reveals that language and ideology is mutually determined. In detail, the language used by journalists in specific and the language in news discourse in general is biased and the journalists report an economic events or issues in accordance with their own interest and ideologies. Therefore, they use DSs to represent their own ideologies and opinions. Moreover, the use of DSs in English and Vietnamese bears some similarities as well as differences. The research brings about practical implications for readers, students as well as teachers. Firstly, the research helps to raise readers’ critical awareness of news discourse as well as achieve a better understanding of what they read in economic news. Secondly, it helps learners to be aware of biased nature of news discourse to conduct a selective acquisition of foreign thoughts, beliefs and ideologies. Therefore, learners can decide which set of thoughts, beliefs and ideologies is worth adopting and transmitting and which one is not suitable to their own culture, thus resisting the imposition of foreign ideologies on them. Last but not least, teachers can introduce DSs or other parts of this framework to students so that students can learn how to analyze a discourse critically. Furthermore, the findings of the study can be beneficial to teachers in a way that they can be more aware of the discourse they use as a material in class to avoid using negative embedded-ideology materials. REFERENCES
[1] Fairclough, N. L., & Wodak, R. (1997), “Critical Discourse Analysis, in Van Dijk T.A”, Discourse Studies: A Multidisciplinary
Introduction, 258-284. [2] Sana, N., Hafiz, B. A., Maria, K., Zikra, F., & Huma, N. (2013), “Media Discourse and Their Implicit Idelogies”, Asian Journal of
Social Sciences & Humanities, 328-337. [3] Van Dijk, T. (1988), News Analysis. New Jersey: Lawrence Arlbaum Associates. 82
[4] Van Dijk, T. (2003), Ideology and discourse: A Multidisciplinary
Introduction, Barcelona: Ariel. [5] Zhang, M, (2014), “A Critical Discourse Analysis of Political News Reports”, Theory and Practice in Language Studies, 2237 - 2277. [6] Bail-outs and safety nets. (2015, August 12). Retrieved October 10, 2015, from http://www.economist.com/blogs/democracyinamerica/2013/08/libertarianpopulism [7] A weighting game. (2015, May 30). Retrieved October 10, 2015, from http://www.economist.com/cge15 [8] The China wave. (2014, September 11). Retrieved October 10, 2015, from http://www.economist.com/news/business/21616974-chinesemanagement-ideas-are-beginning-get-attention-they-deserve-china-wave [9] Asia's suffering. (2009, January 29). Retrieved October 10, 2015, from http://www.economist.com/node/13022085 [10] Bargain bosses. (2012, December 06). Retrieved October 10, 2015, from http://www.economist.com/node/21562189 [11] Cá tra lại bị xử ép ở Mỹ. (2009, July 12). Retrieved October 10, [12]
[13]
[14]
[15]
[16]
2015, from http://tuoitre.vn/tin/kinh-te/20090702/ca-tra-lai-bi-xuep-o-my/324463.html 5 điều khiến người Mỹ luôn cảm thấy nghèo. (2014, May 12). Retrieved October 10, 2015, from http://tuoitre.vn/tin/kinhte/20140512/5-dieu-khien-nguoi-my-luon-cam-thayngheo/606345.html "Giấc mơ Mỹ" tan vỡ. (2011, October 17). Retrieved October 10, 2015, from http://tuoitre.vn/tin/the-gioi/20111017/giac-mo-my-tanvo/460801.html Chính phủ Ấn Độ nhượng bộ nông dân. (2015, April 26). Retrieved October 10, 2015, from http://tuoitre.vn/tin/thegioi/20150426/chinh-phu-an-do-nhuong-bo-nong-dan/738884.html Cơn điên "thứ sáu đen tối" ở Mỹ. (2011, November 27). Retrieved October 10, 2015, from http://tuoitre.vn/tin/the-gioi/cau-chuyencuoi-tuan/20111127/con-dien-thu-sau-den-toi-o-my/466891.html BRICS: Từ ước mơ đến hiện thực. (2011, October 01). Retrieved October 10, 2015, from BRICS: Từ ước mơ đến hiện thực (The Board of Editors received the paper on 05/11/2015, its review was completed on 06/03/2016)
83
ENHANCING INTERCULTURAL SENSITIVITY AND PROBLEM-SOLVING
SKILLS OF LANGUAGE LEARNERS VIA CRITICAL INCIDENTS IN
CROSS-CULTURAL COMMUNICATION: A CONSTRUCTIVIST APPROACH
Ho Si Thang Kiet
University of Foreign Language Studies, The University of Danang; kiet.ho@ufl.udn.vn
Abstract - This paper describes an action research study which
uses critical incidents in a cross-cultural communication course at
a university in Vietnamto enhance intercultural sensitivity and
problem-solving skills of English learners with a constructivist
approach to language learning. The findings show that by actively
engaging in the critical incidents the students were able to enhance
their intercultural sensitivity about the ways in which different
expectations, values, beliefs and behaviours can affect
communication across cultures. They were also empowered with a
variety of problem-solving skills to deal with cross-cultural
misunderstandings in the incidents. The learners also positively
evaluated the use of critical incidents as an effective way of crosscultural learning. The study is expected to be used as a reference
for implementing a critical incident-based pedagogy in crosscultural communication courses.
Key words - intercultural sensitivity; problem-solving skills; critical
incidents; cross-cultural communication; constructivist.
1. Introduction
In the globalization trend, our world has become a ‘global village’ where intercultural contacts between people from different cultural backgrounds are part of everyday life for many people. The possibilities for intercultural communication have become greater than ever and their benefits are visible in the foreign language classroom (Vogt, 2006). A misunderstanding can easily occur in a crosscultural encounter when people do not understand each other’s cultural values and beliefs. Intercultural sensitivity has become an important goal of foreign language teaching and learning in response to the need for language learners to function effectively in an increasingly multicultural world. This study investigates how language learners understand cross-cultural communication problems in a target community and how they develop intercultural sensitivity and problem-solving skills to solve misunderstandings in cross-cultural communication dilemmas. 2. Theoretical background
2.1. Critical incident and its value
A critical incident is a narrative that illustrates a misunderstanding between two or more people from different cultural backgrounds. Educators have used critical incidents as a method for developing learning in a range of professional disciplines such as nursing, education, and social work. In the fields of intercultural and cross-cultural communication, it is a standard training tool (Cushner and Brislin, 1996). Apedaile and Schill (2008) define critical incidents in intercultural communication training as “brief descriptions of situations in which a misunderstanding, problem, or conflict arises as a result of the cultural differences of the interacting parties, or a problem of cross-cultural adaptation and communication” (p.7). In this study, the students’ critical incidents refer to cross-cultural dilemmas in which misunderstandings occur due to different cultural values and beliefs of participants. Critical incidents can contribute to the development of students’ personal learning and growth. Cope and Watts (2000) claim that “critical incidents…accelerated [the] process of learning and growing self-awareness, and therefore often proved to be seminal moments within this process of change (p.113). Tripp (1993) argues that “critical incidents should question the way things normally operate” (p.28). This can make learners think how the participants act or behave in such a way and critically analyze the hidden cross-cultural misunderstandings that occur in cross-cultural communication. The opportunity given to students to think critically and analytically about a cross-cultural dilemma promotes their intercultural sensitivity and fosters their motivation for learning about culture-based behaviour in intercultural communication. 2.2. Intercultural sensitivity
Hammer, Bennett and Wiseman (2003) distinguish between “intercultural sensitivity” and “intercultural competence”. According to them, the term ‘‘intercultural sensitivity’’ refers to “the ability to discriminate and experience relevant cultural differences”, while “intercultural competence” is “the ability to think and act in interculturally appropriate ways” (p.422). In this study, intercultural sensitivity refers to the students’ ability to demonstrate their awareness of cultural differences that cause misunderstandings in the critical incidents. Hammer et al. (2003) argue that greater intercultural sensitivity is associated with greater potential for exercising intercultural competence. Intercultural sensitivity is, therefore, essential for language learners to acquire in order to become interculturally competent. Intercultural sensitivity is a developmental process. Bennett (1993) proposes the Developmental Model of Intercultural Sensitivity (DMIS) over a continuum from Denial, Defense and Minimization (ethnocentric stages), to Acceptance, Adaptation and Integration (ethnorelative stages). The model assumes that a person develops his or her competence in intercultural relations as the experience of cultural differences becomes more complex (Vogt, 2006). However, the DMIS gets critics from some scholars. Scarino (2009) argues that the linear progression of the model does not accord with the complexity of the development of intercultural sensitivity; while Liddicoat, Papademetre, Scarino, and Kohler (2003) claim that the model assumes that language learners have no prior exposure to issues of intercultural communication. Once learners have acquired intercultural sensitivity, they will be 84
able to avoid stereotypes and make cultural generalizations to deal with intercultural incidents. 2.3. Stereotypes and generalizations
According to Levine and Adelman (1993), stereotypes are exaggerated beliefs and images about groups of people which are often based on a lack of information or contact, while generalizations are general beliefs and images about groups of people which are based on some common sources of information. In this study, stereotypes refer to false beliefs about people of the target culture in the critical incidents, while cultural generalizations refer to general beliefs about the target culture that the students need to gain for accurate judgment. To become interculturally competent, language learners need to use cultural generalizations to predict the outcomes and participants’ behaviours in the critical incident. Cultural generalizations can prevent them from falling into cultural stereotypes which usually create a false impression, inaccurate observations and reinforce their cultural biases. Apedaile and Schill (2008) argue that cultural generalizations can provide clues to better understand people’s behaviours and actions. 3. Methodology
Traditionally, learners are provided with a critical incident that has a number of explanations. They are encouraged to select the one that best explains the misunderstanding and mark their answers with "the best choice", "satisfactory", "less than satisfactory", or "the worst choice" (Cushner and Brislin, 1996). However, such a way to deal with critical incidents may have some negative points as in real life situations there might be more than one explanation that can be considered appropriate or correct. In addition, learners rely too much on the given options for explanations rather than developing their own critical thinking for problem-solving skills. To avoid this drawback, this study adopts a constructivist approach to language learning, which is “a theory about knowledge and learning… [that] defines knowledge as temporary, developmental, socially and culturally mediated..." (Brooks & Brooks, 1993, p vii). The central principles of this approach are that “learning involves an active process in which learners construct meaning by linking new ideas with their existing knowledge." (Naylor & Keogh, 1999, p.93). Applying this concept of the constructivist approach, the participants in this study actively construct meaning by connecting their own ideas with their existing knowledge of cross-cultural communication in the course in dealing with cross-cultural problems in the critical incidents. To deal with the issues above, the study is aimed at answering the following research questions: (1) How do the language learners enhance
intercultural sensitivity and problem-solving skills through
critical incidents?
(2) How do the language learners evaluate the benefits
of critical incidents in cross-cultural communication?
One hundred and twenty third-year students of the English major at a university in Vietnam participated in the Ho Si Thang Kiet
study. These students were chosen as they were studying the cross-cultural communication course which the author was teaching. As this study was a kind of action research on the author’s own teaching, the participants were not representatives for the whole population. The research instruments for data collection include the critical incidents (CI) created by students’ groups, classroom observations and evaluation questionnaire. The criteria for selecting the samples of the students’ critical incidents are that they all reflect the topics and the key content of the course including cross-cultural contacts, cross-cultural adjustment process, verbal and non-verbal communication, friendship and acquaintances, family types, educational values, stereotypes and ethnocentric judgments in cross-cultural communication. The samples focus on American culture and the students’native culture, for the course mainly deals with American culture in cross-cultural communication. The samples of critical incidents include the following: CI#1: Stereotypes about black people CI#2: Cross-cultural contact with Americans CI#3: Adjustment process in the American society CI#4: Communication styles between American and Vietnamese cultures CI#5: Ethnocentric judgments about American foods CI#6: Non-verbal communication between American and Vietnamese cultures CI#7: Socializing with American friends CI#8: American and Vietnamese perceptions of friendship CI# 9: American and Vietnamese parenting styles CI#10: American culture of learning Classroom observations were made by the author to record the students’ solutions to the critical incidents. Two groups of learners worked face-to-face in the classroom; one group presented their critical incident, the other group discussed together to work out the cross-cultural misunderstandings in the incident and came up with appropriate solutions to the cross-cultural problems. The students engaged in What, Why and How questions to work out the cross-cultural misunderstanding in each incident based on the cross-cultural values of the selected samples (CI#1-CI#10): • How did the cross-cultural misunderstanding occur in the incident? • Why did the participants in the incident act/behave the way they did? • What cultural values appear to be important in the participants’ actions? • What should have been done to avoid the crosscultural misunderstanding? After the students finished their presentations of critical incidents, they were all asked to complete a short evaluation questionnaire which was used to examine how the students evaluated the use of critical incidents in the course. The questionnaire consisted of ten statements for evaluation on a five-point Likert scale (1=strongly ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
disagree; 2=disagree; 3=neither agree nor disagree; 4=agree; 5=strongly agree) (Table 1).The statements were constructed on the values of critical incidents in crosscultural communication as described in section 2. Table 1. Students’ evaluation questionnaire
No.
Statementsfor evaluation
Rating scale
I found critical incidents an effective way of 1. learning about other cultures in cross-cultural communication. 1 2 3 4 5 I was able to minimize cultural shock in dealing 2. with other cultures. 1 2 3 4 5 3. I was able to use cultural generalizations to predict the outcomes and participants’ behaviours. 1 2 3 4 5 4. I was able to cultivate attitudes of curiosity, openness, appreciation and empathy towards other cultures. 1 2 3 4 5 5. I was able to develop my problem-solving skills. 1 2 3 4 5 6. I was able to enhance my intercultural sensitivity. 1 2 3 4 5 I was able to mediate between cultures to find the 7. most appropriate way for both cultures. 1 2 3 4 5 I was able to successfully cope with the new intercultural environment. 1 2 3 4 5 9. I was able to develop my critical thinking skills. 1 2 3 4 5 10. I was motivated a lot to learn about other cultures. 1 2 3 4 5 8. For data analysis, the study deals with both qualitative and quantitative approaches due to the nature of the research. The qualitative approach was used to find outthe emerging themes of the students’ problem-solving strategies as solutions tothe critical incidents, while their strategy use was also quantified to illustrate which strategy was used the most. In addition, the quantitative approach with one sample t-test was also applied in the analysis of the students’ evaluation questionnaire for the comparison of the means. 4. Findings and discussion
4.1. Learners’ demonstration of intercultural sensitivity
and problem-solving skills
From the analysis of the students’ solutions to the critical incidents, nine themes have emerged as problemsolving strategies with a total of twenty-three uses as shown in Table 2. The total of uses refers to the number of strategy use by the groups of students when they offered solutions to the critical incidents. Table 2. Problem-solving strategies in students’ critical incidents
No.
Problem-solving strategies
Total of
uses
Percentage
S1 Consulting people of the target culture for advice 1 4.3% 1 4.3% Making inquiries about unfamiliar S2 situations in the target culture with native speakers S3 Using cultural values of the target culture to explain the incident 6 26.1% S4 Using cultural values of one’s home culture to explain the incident 4 17.4% S5 Suggesting different ways to tackle the incident 1 4.3% S6 Mediating between the two cultures to reach a cross-cultural perspective 5 21.8% 85
S7 Raising awareness of cultural differences to minimize cultural shocks 3 13.2% S8 Avoiding ethnocentric judgments to deal with the incident. 1 4.3% S9 Avoiding stereotypes to deal with the incident. 1 4.3% 23 100% Total (Note: S=Problem-solving strategies) As can be seen from Table 2, using cultural values of the target culture to explain the incident (S3) is the most important problem-solving strategy which accounts for the highest percentage (26.1%), while using cultural values of one’s home culture to explain the incident (S4) is in the third position with 17.4%. It is important for participants in a cross-cultural encounter to contrast cultural values of the target culture with one’s home culture so that they can avoid the wrong assumption about the other culture. For example, in the CI#2, privacy and equality are the two important cultural values in the American society, while the concept of these two values is quite different in the Vietnamese culture. For Americans, the emphasis on privacy exists as individuals feel their needs must be respected. The American tendency is to minimize status differences rather than to emphasize them, while there is a hierarchy between the boss and the subordinates at the workplace in Vietnamese culture. Similarly, in the CI#8, the concept of friendship for American people is very different for Vietnamese people in that American people tend not to have a deep friendship with someone unless they feel they are committed to it. In the CI#4, while the American business people actively engaged in the business meeting, their Vietnamese partners tended to wait for their turn. This indicates that American people have a preference for the “high involvement” communication style whereas Vietnamese people are in favour of the “high considerateness” pattern. In the CI#6, American people should not misinterpret the Vietnamese lack of eye contact as a lack of attention or interest because such behaviour can mean respect and deference in a hierarchical culture. Contrasting cultural values of the target culture with the ones of their home culture, the students were able to develop awareness of cultural differences in order to better understand the participants’ behaviours in the incident. The second important problem-solving strategy is to mediate between the two cultures to reach a cross-cultural perspective (S6), which accounts for 21.8%. This strategy is crucial for language learners to become interculturally competent. For example, the CI#9 refers to different parenting styles between an American father and a Vietnamese mother in a cross-cultural family. The students mediated between the American culture and the Vietnamese culture to adopt a cross-cultural perspective that is appropriate for both cultures. For instance, the crosscultural parents should encourage their children to be independent by themselves even from an early age although they can still take some care of their children. They should not forbid their children to leave home at 18 years old, but spend time on sharing their experiences about life with their children and give support to them 86
whenever they need. Such a cross-cultural perspective can reconcile cultural differences between the two cultures so that the cross-cultural family can avoid conflicts in parenting and feel happy together. Raising awareness of cultural differences to minimize cultural shocks (S7) is the fourth important problemsolving strategy with 13.2%. The CI#10 shows that an awareness of independent study and plagiarism in American universities could prevent the Vietnamese student from getting shocked. Especially, this strategy is essential for an individual’s adjustment to a new culture. In the CI#3, the Vietnamese girl (Huong) and the Japanese girl (Harumi) went through the same stages from the honeymoon period to culture shocks and initial adjustment when they first arrived in the USA. However, while Harumi fell into depression and then decided to return to Japan, Huong was able to skip the depression stage and moved directly to the final stage of acceptance. By acquiring language and cultural knowledge of the target culture as well as intercultural sensitivity with great effort, Huong successfully integrated into the target culture. This confirms that Bennett (1993)’s DMIS over a linear progression is not realistic. A person’s adjustment to a new culture can be different for different people as it depends a lot on their intercultural sensitivity and ability to cope with changes in their life, which can make their adjustment process in the target culture shorter or longer. The students also used some other problem-solving strategies with equal frequent use (4.3%). For instance, for the CI#8 the students suggested different ways to tackle the incident (S5) via facebook, email or phone calls to get in touch with the American friend who seemed to ignore his two friends. In the CI#5, Minh had difficulty adjusting to the American society because of his ethnocentric judgments about the American foods with which he could not accurately interpret the cultural values and behaviour of his American homestay friend except through his own cultural perspectives. Avoiding ethnocentric judgments (S8) is, therefore, a good strategy to solve cross-cultural misunderstandings. Similarly, the CI#1 shows that stereotypes can be dangerous as they are formed with exaggeration and lack of information or contact about the target people. The stereotype that black people are dishonest people is completely wrong. Avoiding stereotypes (S9) definitely can help solve the false assumptions that the American couple had for the black boy in the incident. Consulting people of the target culture for advice (S1) or making inquiries about unfamiliar situations in the target culture with native speakers (S2) can also be good strategies to use. For the CI#7, such strategies can help the Vietnamese girl avoid embarrassment when her American friend asked about the bill and the shop where she had bought the gift. In short, the students used a variety of strategies to find out solutions to cross-cultural misunderstandings that occurred in the incidents. Among them, an understanding of cultural values of the target culture and one’s home culture, and the ability to mediate between cultures are the most important strategies to deal with the cross-cultural problems in the incidents. Ho Si Thang Kiet
4.2. Learners’ evaluation of critical incidents
Apart from the students’ participation in solving the cross-cultural misunderstandings in the critical incidents, they also positively evaluated the use of this technique in the course (Table 3). The results in Table 3 show that the majority of students agreed that critical incidents can help them enhance their intercultural sensitivity with the highest mean (M=4.43, SD=.589, t=26.489, p<0.05), followed closely by problemsolving skills (M=4.41, SD=.494, t=31.256, p<0.05). This shows that the students’ awareness of cultural differences between cultures enabled them to adopt problem-solving skills to deal with the cross-cultural misunderstandings in the incidents. The students were also able to use cultural generalizations, rather than stereotypes, to predict the participants’ behaviours (M=4.18, SD=.496, t=25.929, p<0.05) so that they could understand what caused the misunderstanding in the incident. The students found critical incidents an effective way of learning about other cultures in cross-cultural communication (M=4.38, SD=.522, t=29.056, p<0.05) and this technique made them feel more motivated in cross-cultural learning (M=4.08, SD=.656, t=18.098, p<0.05). Moreover, the students were also able to cultivate positive attitudes towards other cultures as they became more open, sympathetic and appreciative of cultural values in other cultures (M=4.23, SD=.498, t=27.151, p<0.05). Such positive attitudes were essential for them to decentre from their own culture and mediate between cultures to find appropriate ways for both cultures (M=4.20, SD=.422, t=31.144, p<0.05). This is the evidence of the students’ acquisition of intercultural competence through critical incidents. Being interculturally competent, the students were able to cope with the new intercultural environment successfully (M=3.88, SD=.700, t=13.817, p<0.05). Finally, through critical incidents, the students were also able to develop critical thinking skills (M=3.86, SD=.598, t=15.717, p<0.05) and minimize cultural shock to deal with other cultures (M=3.80, SD =.616, t=14.220, p<0.05). Table 3. Learners’ evaluation of critical incidents
Learners’ evaluation
1. I was able to enhance my intercultural sensitivity. N
M
S.D.
t
p*
120 4.43 .589 26.489 .000 2. I was able to develop my problem120 4.41 .494 31.256 .000 solving skills. 3. I found critical incidents an effective way of learning about other cultures in 120 4.38 .522 29.056 .000 cross-cultural communication. 4. I was able to cultivate attitudes of curiosity, openness, appreciation and 120 4.23 .498 27.151 .000 empathy towards other cultures. 5. I was able to mediate between cultures to find the most appropriate way for both cultures. 120 4.20 .422 31.144 .000 6. I was able to use cultural generalizations to predict the outcomes 120 4.18 .496 25.929 .000 and participants’ behaviours. 7. I was motivated a lot to learn about 120 4.08 .656 18.098 .000 other cultures. 8. I was able to successfully cope with 120 3.88 .700 13.817 .000 ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
the new intercultural environment. 9. I was able to develop my critical thinking skills. 120 3.86 .598 15.717 .000 10. I was able to minimize cultural shock in dealing with other cultures. 120 3.80 .616 14.220 .000 * Significant at p <0.05 (N=number of participants, M=Mean, SD=Standard deviation, t=one sample t-test value, p= probability value). In short, the students positively evaluated the use of critical incidents in the cross-cultural communication course thanks to the benefits they gained. They believed critical incidentis an effective way of cross-cultural learning which helped them enhance their intercultural sensitivity, develop their problem-solving skills, adopt positive attitudes and acquire the ability to mediate between cultures to successfully cope with intercultural encounters. 5. Conclusions
The study has provided positive findings which show that by actively engaging in the critical incidents the students were empowered with a variety of problem-solving strategies to deal with cross-cultural misunderstandings in the cross-cultural dilemmas. The students positively evaluated the use of critical incidents in the course as an effective way of cross-cultural learning which helped them enhance intercultural sensitivity and problem-solving skills to successfully cope with the new intercultural environment. Adopting the constructivist approach to language learning, the study shows that the students developed a realistic sense of challenges to meet cultural conflicts and tensions in cross-cultural communication dilemmas. The nature of the cross-cultural communication study enabled them to see cross-cultural situations from different perspectives, cultivate attitudes of curiosity, openness, appreciation and empathy towards other cultures, and develop intercultural sensitivity of different cultural values that have an impact on people’s behaviours in crosscultural communication. The study offered the students valuable opportunities to engage in the target culture 87
through critical incidents at a deeper level while connecting classroom learning to situations that potentially occur in the global community. With intercultural sensitivity and problem-solving skills acquired from critical incidents, language learners are able to become interculturally competent to successfully deal with cross-cultural encounters in reality. With such an outcome of the study, a critical incident-based pedagogy can be beneficial for language learners in a cross-cultural communication course. REFERENCES
[1] Apedaile, S. and Schill, L. (2008). Critical incidents for intercultural communication: An interactive tool for developing awareness, knowledge and skills. NorQuest College. [2] Bennett, M. J. (1993). Towards ethnorelativism: A developmental model of intercultural sensitivity. In R. M. Paige (Ed.), Education for intercultural experience (2nd) (pp. 21-72). Yarmouth, ME: Intercultural Press. [3] Brooks, J. and Brooks, M. (1993). The case for the constructivist classrooms. Alexandria, VA: ASCD. [4] Cope, J. and Watts, G. (2000). Learning by doing. An exploration of experience, critical incidents and reflection in entrepreneurial learning. International Journal of Entrepreneurial Behaviour and Research, 6(3), 104–124. [5] Cushner, K. and Brislin, R. (1996). Intercultural interactions: A practical guide. London: Sage. [6] Levine, D.R. and Adelman, M.B. (1993). Beyond language: Crosscultural communication. USA: Prentice Hall Regents. [7] Liddicoat, A. J., Papademetre, L., Scarino, A., and Kohler, M. (2003). Report on intercultural language learning. Canberra, ACT: Commonwealth of Australia. [8] Hammer, M. R., Bennett, M. J., and Wiseman, R. (2003). Measuring intercultural sensitivity: The intercultural development inventory. International Journal of Intercultural Relations, 27, 421-443. [9] Naylor, S. and Keogh, B. (1999). Constructivism in classroom: Theory into practice. Journal of Science Teacher Education, 10, 93-106. [10] Scarino, A. (2009). Assessing intercultural capacity in learning languages: Some issues and considerations. Language Teaching, 42(1), 67-80. [11] Tripp, D. (1993) Critical incidents in teaching: Developing professional judgement. London: Routledge. [12] Vogt, K. (2006). Can you measure attitudinal factors in intercultural communication? Tracing the development of attitudes in e-mail projects. ReCALL, 18(2), 153-173.
88
Pham Thi Thanh Ly
HUMOR STRATEGIES IN ENGLISH AND VIETNAMESE SITCOMS FROM
PRAGMATIC PERSPECTIVES
Pham Thi Thanh Ly
FPT University; lyptt@fpt.edu.vn
Abstract - This study aims to explore how English and Vietnamese
sitcom characters violate Grice's Cooperative Principle [2] as
humor strategies in their daily conversation to create humor. In the
light of Grice’s Cooperative Principle, the conversational maxims
violated as humor strategies in English and Vietnamese sitcoms
are figured out to help EFL learners improve their English
competence. Under the investigation into 300 samples from 26
English and Vietnamese sitcoms, we find out 12 groups. The
analysis where the descriptive method has been used combined
with the qualitative and quantitative approaches is carried out to
find out similarities and differences of humor strategies in English
and Vietnamese sitcoms.
Key words - pragmatics; humor; humor strategies; sitcoms;
cooperative principle; languages.
2. Humor strategies resulting from violated maxims
Four maxims of Grice’s Cooperative Principle [2], i.e. Quality, Quantity, Relation and Manner are used to examine how the characters violate the principle to evoke the audience’s laughter. We also find out humor strategies which result from Grice’s Cooperative Principle Violation and put them into suitable maxims. This study is outlined to give a look at frequency of humor strategies classified into maxims at first and then to analyze the humor strategies one by one in individual maxim. 2.1. Maxim of Quality
2.1.1. Irony
1. Introduction
Sitcom, the blending of situation and comedy, has been more and more popular among people all over the world. It is also a good audio-visual resource for EFL learners. Humor in it has, however set up a lot of obstacles for non-English native audiences in understanding the humor in English sitcoms. It is worthwhile to study humor mechanism to help the audience have a better understanding and appreciation of humor in such TV series and meanwhile to help EFL learners improve their English competence as well. This being the case, the research attempts to study on the inner mechanism of humor within the framework of the theoretical perspective - Grice’s Cooperative Principle and make some tentative explorations in this direction. In order to achieve the above aims and objectives, the following research questions are put forward: 1. What maxims of conversation are violated to create humor in English and Vietnamese sitcoms? 2. What kinds of humor strategies resulting from Grice’s Conversational Maxim Violation are used in English and Vietnamese sitcoms? 3. What are the similarities and differences in humor strategies resulting from Grice’s Conversational Maxim Violation in English and Vietnamese sitcoms? In this research, 450 episodes from 26 ESs and VSs (ESs and VSs in abbreviation for English sitcoms and Vietnamese sitcoms) are collected, 150 samples in English and the same number in Vietnamese are picked out for analysis. One main feature of sitcoms is canned laughter. Therefore, for objectiveness, judging whether a line of sitcoms is funny or not is based on the occurrence of canned laughter in the characters’ conversations. For data analysis, three following steps are carried out: examining which conversational maxim is violated, under each maxim, determining which humor strategy is used, comparing and contrasting to find out the similarities and differences between the two languages. Irony refers to the strategy that the speaker expresses something that is completely different from the literal meaning in order to make fun of or tease someone else. (2.1) Ms. Novak: I have a painting, a sculpture and a
photograph that I think you’ll like. Here’s the painting.
This was painted by a Russian artist that I really like. It’s
called “Sun on the water”. The artist was inspired by
looking at the sea. What do you think?
Cheryl: It’s fantastic.
Marie: How interesting!
Bob: It’s very blue.
(Top Notch TV) Cheryl, Marie and Bob are working in a travel agency. Ms. Novak who is a friend of their boss Evans talks about 3 art pieces for decorating the office. She shows the painting which has nothing but a big blue rectangle and a small red circle in it. However, Ms. Novak praises the piece with gorgeous words. The utterances given by Cheryl, Marie and Bob are appreciations of the painting, and these even appear to be an act of insincerity. As a matter of fact, their admiration statements are meant to tease Ms. Novak by implying that she does not have good sense of art. Thus, the comments "it’s
fantastic", “how interesting” and “it’s very blue” are ironical expressions to ridicule Ms. Novak’s sense of art. 2.1.2. Exaggeration
Exaggeration refers to the way that the speaker overstates the features, defects or the strangeness of someone or something. (2.2) Mộng Vân: Thôi nè, mọi người tới đông đủ rồi,
bây giờ mình ra xe đi nhà hàng nhe.
Hoa: Ááá, bây giờ là giây phút trọng đại nhất cuộc đời
tôi đã tới. Giây phút tôi mong chờ cuối cuộc đời đã đến.
Trời ơi, tôi được ăn giập mật rồi, tranh thủ ăn đi, ăn
thủng nồi trôi rế, sau đó đẻ cũng vừa lòng. Há há há.
Mộng Vân: Ờ, thôi đi đi mọi người ơi.
Hoa: Á… á… (la lên vì đau bụng)
Mọi người: Cái gì vậy? Cái gì vậy?
89
number. That's... 0118 999 881 999 119 725......3!”
(The IT Crowd) Hoa: Có một sự đau nhẹ.
Mọi người: Hả? Đau nhẹ?
(Tiệm bánh hoàng tử bé) Hoa is so excited with the wedding of her friend Mong Van. When hearing the invitation to the restaurant, she speaks out her excitement with exaggeration words such as “giây phút quan trọng nhất cuộc đời tôi” (the most important moment in my life), “giây phút tôi mong chờ cuối
cuộc đời” (the moment I long for till the end of my life), “được ăn giập mật” (eat until my gall is bruised), “ăn thủng
nồi trôi rế” (eat until the pot is pierced and the pot holder is drifted). The humor of the scene escalates toits pitch with her words “Có một sự đau nhẹ” (there is a little pain) which implies the birth pangs. The amusing exaggeration in Hoa’s utterances evokes the audience’s laughter. 2.1.3. Meiosis
The speaker makes up a meiosis in order to solve problems or avoid others' accusations in an embarrassing situation. Meiosis strategy is seldom used in both ESs and VSs. Take a deeper look into some following examples (2.3) Phoebe: Oh, I didn't know you wanted her too!
Monica: Huh!
Rachel: Well, I mean, sure, of course. But... you
already gave that to Monica, so...
Monica: You know, I would give her up, for you.
(Friends) Phoebe promises Monica to give her a painting which she makes by herself. In fact, Monica does not want that painting at all. Rachel does not want to tell Phoebe the truth that she dislikes that painting, so she is trying to think of a meiosis to avoid getting that painting. The incongruity comes from the discrepancy between Rachel's lying and her real feelings. This incongruity can be resolved when the audience found that Rachel is making meiosis to let the chance of getting that painting slips away unnoticeably. It is the process that evoked the audience's laughter. 2.2. Maxim of Quantity
In the violation of Quantity Maxim, we have two contrary strategies, i.e. (i) too much unnecessary information, (ii) less informative response strategy. Moss invents an emergency service which is in his idea much better than service 999. He makes an advertisement clip in TV which is transcript in (2.4). The audience cannot stop laughing as hearing such a long and hard-remembering phone number. Nicer ambulances, faster response times, and better looking drivers in the advertisement but too complicated number lead to non-stop laughing. 2.2.2. Less information response
Besides providing superflous information, another strategy is used when the speaker provides less than enough information. This is employed when the director aims at stressing on the contrast between the characters or situations. Have a look into an instance of this strategy. (2.5) Jen: Guess who I'm about to meet now? Helen
Bewley. Oh, come on. She took that football team to court
for institutional sexism. Won massive damages and now
she's head CEO of BHDR Industries.
Moss: Sorry, I kind of switched off after the word,
football.(The IT Crowd) Jen enthusiastically tells Moss about her news. Since she is so excited, she speaks very quickly and floods Moss with information, in which he is not interested. Even though Jen considers her news very interesting and entertaining, she does not realize that Moss, who is certainly not the most social character in the series, would find her monologue unnecessarily prolonged. The viewers find the answer of Moss amusing, because they can relate to his situation that someone provides too much information on an uninteresting subject. 2.3. Maxim of Relation
Grice's Maxim of Relation requires the speaker to say something relevant to the context. Four kinds of humor strategies violating the Maxim of Relation are found, including irrelevant statements, icebreaker, changing the topic and “no offence”. 2.3.1. Irrelevant statement
Speakers may make some irrelevant comments in order to refuse to answer some embarrassing questions or to emphasize something or to tease someone. For instance: (2.6) Monica: What do you think?
2.2.1. Too much unnecessary information
Chandler: I think.... I think I can see your scalp.
This strategy states that one’s contribution should provide sufficient, but not too much information. If speaker provides much more information than enough to be socially appropriate, he creates surprise for the hearer as well as the audience, and hence, comic effect is produced. Monica: Don't you just love it?
For instance: (2.4) “Has this... ever happened to you?
From today, dialing 999 won't get you the emergency services.
And that's not the only thing that's changing.
Nicer ambulances, faster response times, and better
looking drivers mean they're not just the emergency services;
they're "your" emergency services. So remember the new
Ross: Ye... Yeah....You got shellfish in your head.
(Friends) Monica just comes back from the hairdressing salon. She is so excited and satisfied with her new hair style, but her friends do not think so. When Monica asks her friends' opinions about her new hair style, she expects to hear some good comments because she herself likes it very much. Her friends do not feel the same, and, as a matter of fact, they think that Monica's hair style is rather weird. Nonetheless, they do not want to tell Monica the truth, so they give Monica some irrelevant answers when she asks for their opinions. Their responses do not match what Monica asks 90
Pham Thi Thanh Ly
for, but this kind of response is relatively safer in comparison with the consequences if they just go ahead and boldly tell her the truth. 2.3.2. Icebreaker
Sometimes people will say something that is irrelevant to the current context so as to avoid silent and awkward moments being produced between or among interlocutors. (2.7) Bà Hoa: Định lấy tiền của chị hả, đâu có dễ vậy.
(vứt tờ hóa đơn tính tiền)
Ông Bảo: (tuýt còi)
Bà Hoa: Ủa, gió thổi mất tờ hóa đơn của tui đâu rồi
ta. Đâu rồi, đâu rồi? (giả vờ tìm quanh) À đây rồi.
Ông Bảo: Trời lặng im như vậy mà bảo có gió, định
qua mắt tui hả, đừng có nằm mơ.
(Tiệm bánh hoàng tử bé) Hoa is embarrassed, she does not know what she should do and she has to say something to save the face. “Ủa, gió thổi
mất tờ hóa đơn của tui đâu rồi ta” (Ooh, where has the wind blown the bill away?) are uttered to achieve the purpose. 2.3.3. Changing the topic
Speakers may change the topic of the conversation in order to divert attention from the current situation or to show that they are not interested in the previous topics. (2.8) Chandler: Yeah. I mean, this girl could decide
against adoption or she could like another couple better.
Phoebe: What are you gonna name the baby?
Chandler: I can develop a condition in which I talk and
talk and no one hears a word.
(Friends) Monica and Chandler are telling their friends that they are not getting what they hope for by adopting a baby, because they know there may be a lot of difficulties in the process of adoption. Apparently, Phoebe does not pay any attention to what Chandler says about how difficult the process will be, and she just keeps asking some questions irrelevant to the topic that they are discussing. 2.3.4. “No offence”
The speaker says something to upset or insult the hearer, but the hearer does not feel insulted. This strategy is usually used in the interactions among friends, colleagues or people who have known each other. It is uttered to upset or insult the hearer but the hearer does not feel insulted, so it is usually embeded with hedges. (2.9) Jen: It's a date, I'm sure it is. Why else would he
ask me out?
Moss: Well, don't take this the wrong way, but could he
have thought you were a man? (The IT Crowd) Jen wonders whether her colleague, Philip, asked her out on a date or friendly night out. Roy and Moss speculate that Philip might be homosexual. Jen’s question is rhetorical. She does not expect her colleagues to actually answer it, especially not in the way Moss does. Even though Moss uses the hedge "don’t take this the wrong way", he still untactfully suggests that Jen looks like a man. "No offence" is often used in the sitcom to create a lot of funny moments. (2.10) Trình: Ủa, anh Huỳnh sao tới sớm vậy? Định
tập thể dục ở công ty hả?
Huỳnh: Dụng cụ gì mà dụng cụ, cái gậy chơi gôn, ông nội.
Trình: Gậy chơi gôn hả. Trời ơi, đắt tiền lắm nha. Anh
lượm ở đâu vậy?
Huỳnh: Cái gì?Cái gì? Lượm ở đâu á hả, mua đó.
(Camera công sở) (2.11) Andrei: Chào hai bà chị xinh đẹp, hai bà chị
dùng gì ạ?
Maika: Trời đất ơi, lại đây chị coi coi. Nhân viên mới
đây đó hả. Đẹp trai dễ sợ không. Mũi nó đẹp ha, mũi thiệt
không em?
(Tiệm bánh hoàng tử bé) In (2.10) and (2.11), with “no offence” strategy, the charactennrs utter “Anh lượm ở đâu vậy?” (where did you pick it up?) and “mũi thiệt không em?” (Your nose isn’t fake, is it?). If these utterances are made without hedges
“Trời ơi, đắt tiền lắm nha” (Oh my god, it looks classy) and “Đẹp trai dễ sợ không. Mũi nó đẹp ha” (Wow, handsome boy! Beautiful nose!), they are actually insulting to the listeners. The hedges and “no offence” utterances create a contrast that amuse the audience. 2.4. Maxim of Manner
Three strategies violating Maxim of Manner: lexical puns, referential ambiguity, without brief and ordered utterance are found. Lexical puns are discussed with respect to the type of their underlying ambiguity: phonological, morphological and lexical ambiguity. 2.4.1. Lexical puns
a. Phonological ambiguity
Phonological ambiguity plays with sounds. It is a change at the phonological level that initially causes the dual meaning (Jojić, Olja) [5]. (2.12) Frasier: Just as I thought. You bought the Diego
sweater.
Martin: Well, what's the big deal? It's just a sweater.
Frasier: It is not "just a sweater," it is a work of art by
Spain's fabled master weaver Diego – who uses only the soft
chin hairs of Andalusia mountain goats. Our sweater man
could only get one this year. Niles and I made a pact that
neither of us would buy it. (to Niles) You can't even keep a
simple sweater pact!
Martin: Ah, Ronee – now there's a gal who can keep a
sweater packed! (Frasier) Frasier and Martin are seated at a table of Café Nervosa. Niles enters with a GAP shopping bag. Frasier snatches the shopping bag and pulls out a white cashmere sweater. Martin teases Frasier. The phonetic pun in (2.12) is based on the exploitation of the entirely distinct but phonetically identical noun “pact” and adjective “packed”. Phonological ambiguity can also be the product of phonetic similarity, not only identity. This is otherwise known as "paronymy", the similarity in both pronunciation and orthography (2.13) Bà Hoa: Trời ơi, mới sáng sớm mà gặp trai đẹp
kiểu này thì chiều nay đông khách, làm móng mệt xỉu luôn
à nha.(Kevin bỏ đi, bà Hoa níu lại)
Bà Hoa: Kevin, có chuyện gì mà mới sáng sớm chị thấy
em u sầu, xanh xao, xuống sắc, mặt xấu xí vậy?
Kevin: Để em yên đi, em đang chán nản lắm rồi đó.
(Tiệm bánh hoàng tử bé) In (2.13), the audience laughs for the phonetic pun: the consonants /x/ and /s/ in “u sầu, xanh xao, xuống sắc, mặt
xấu xí”. b. Morphological ambiguity
The examples below illustrates the way reinterpretation is used to create humor. By eliminating prefix “de”, basis “filed” continues to exist as a nonce structure which generates humor. Consider the example below in the situation of Evelyn's house; Charlie used to date Tommy's daughter Olivia whom he dumped without explanation; Olivia shows up unexpectedly with Tommy at Evelyn's house (2.14) Charlie: Anyway, Tommy seems like a real nice
guy. I am very happy for you. Goodnight.
Evelyn: Charles. You are not going anywhere. This man
is very important to me.Now, we are going to have a nice
dinner, you are going to be charming and Tommywill remain
oblivious to the fact that you defiled his daughter.
Charlie: Hey, she wasn't exactly filed when I met her.
(Two and a Half Men)
c. Lexical ambiguity
Lexical ambiguity refers to an individual lexical item which expresses more than one meaning. Meaning opposition is generated on the basis of the descriptive and figurative (or idiomatic) uses of the word. The speaker attempts to use this strategy on purpose to make fun of the hearer or to lead the hearer to interpret the messages in a wrong way. (2.15) Trình: Trời ơi sếp ơi, bữa nay sếp nuôi chim nữa
hả sếp?
Tài: Trời ơi, tôi đâu có rảnh đâu mà nuôi chim. Con
chim này của ông chủ tịch đó. Ông chủ tịch đi vắng, nhờ
tui giữ hộ đó.
Trình: Trời ơi, đúng là chim ông chủ tịch nha, đẹp ghê.
Tài: Nè, đừng nói là chim ông chủ tịch, mà đây là con
vật yêu quý của ông chủ tịch nghe hông.
(Camera công sở) Tai and Trinh’s intended meanings of the lexeme “chim” (bird vs. male sexual organ) are here contrasted to create humor. 2.4.2. Referential ambiguity
Referential ambiguity refers to a sentence or a phrase where the referent is not clear. This type of ambiguity will make the hearer confused about what the speaker really refers to at that moment. (2.16) Jen: I've got Aunt Irma visiting.
Moss: Oh, do you not like Aunt Irma? I've got an aunt
like that. (Roy and Moss look confused)
Jen: It's my term for my time of the month.
Moss: What time of the month? The weekend?
(The IT Crowd) 91
Jen tries to explain to Moss and Roy that she is a little bit grumpy during her period of menstruation. She uses the term "Aunt Irma" to deliver the message. At first, Jen does not provide enough information, because she does not want to talk Moss and Roy openly about her private matters. “Aunt Irma” refers to menstruation as Jen’s thinking and it also refers to an aunt named Irma as Moss and Roy’ thinking. While Roy manages to decode Jen’s message after she decides to specify her explanation, Moss does not get the meaning of her words. The audience finds it funny, because Moss seems to overlook the implicature. 2.4.3. Without ordered and brief utterance strategy
People sometimes do not talk in an orderly way because they are eager to explain something or accuse someone of what he did before or embarassed with something. (2.17) Beo: (slowly start talking) Kính thưa má, sở dĩ
mời má ra đây, giờ phút này, không có gì lớn nhưng má
phải chứng kiến có một cuộc họp đột xuất ngoài ý muốn
của chúng con, nhưng không họp thì không được. Vì vậy,
chúng ta phải họp. Hôm nay, ba đi vắng, đại diện trong gia
đình chỉ còn có má, con muốn nói với má là… đã lâu lắm
rồi gia đình mình không có họp, cho nên bây giờ mình họp
lại để củng cố trong thời gian ăn nhờ ở đậu ở đây. Trong
lúc nhà chúng ta đang sửa thì gia đình mình ở đợ bên này,
có nhiều vấn đề xảy ra mà không ai biết, nó cũng không
lớn gì. Nói chung là họp … không coi báo.
(Gia đình đốc-tờ Beo) In (2.17), Beo’s family has a meeting on cutting down expenses. Just for the purpose of organizing a family meeting, Beo is so embarassed that he says “họp” (meet), “cuộc họp”(meeting) 6 times without brief and ordered way. Besides, some phrases like “giờ phút này, không có gì
lớn”(at this moment, there is nothing serious), “ba đi vắng” (Dad is absent from home) “con muốn nói với má là…”(I would like to talk to you that…), “nó cũng không lớn
gì”(there is nothing serious) make the utterances disordered. 3. Similarities and differences
The results and analyses show that close relationships between humor and the violation of Grice’s Cooperative Principle do in fact exist. It is found that a lot of funny lines can result from certain kinds of humor strategies which violate Grice’s Principle. As regard to maxims, it is found that in ESs, the violation of Maxim of Quality is most frequently used (42%). Second is Maxim of Relation (29.3%). Maxim of Manner contributes 20.0% while Maxim of Quantity makes up the least, 8.7%. In addition, in VSs, Maxim of Manner ranks top with 35.3%. Second and third are Maxim of Quality (28.0%) and Maxim of Relation (24.7%) respectively. Similar to ESs, the lowest is Maxim of Quantity (12.0%). Furthermore, humor strategies violating Maxim of Quantity count for the least in both ESs and VSs, 8.7% of ESs and 12% of VSs. With reference to strategies, it is found that less information response strategy is the least frequently used among all humor strategies employed. Its frequency is 2.0% in ESs and, similarly, only 1.3% in VSs. Meiosis, less 92
Pham Thi Thanh Ly
information response, icebreaker, changing the topic and referential ambiguity make up a small rate, not more than 5% for each and under 20% for total. 3.1. Similarities
There are some remarkable similarities in humor strategies violating Grice’s Cooperative Principle in ESs and VSs. Firstly, looking at the result in the Table 4.1, we find out that there are 12 humor strategies and 3 sub-strategies violating four maxims of Grice’s Cooperative Principles. All of them occur in both ESs and VSs. Secondly, humor strategies violating Maxim of Quantity count for the least in both ESs and VSs. 8.7% of ESs and 12% of VSs are shown in the results. Note that all of the maxims can be violated individually, but some of them frequently cooccur. The violation of the maxim of Quantity is usually tied to the violation of the maxim of Manner, and this happens when a character either says too much, or remains obscure and does not say enough. In this case, we count for Manner. When people exaggerate, they violate Quality and tend to violate Quantity for saying too much unneccessary information. In this case, we count for Quality. Therefore, Quantity contributes the least in both ESs and VSs. Table 1. Frequency of humor strategies in ESs and VSs
Strategies
Maxim of Quality
Irony Exaggeration Meiosis Maxim of Quantity
Too much unnecessary information Less informative response Maxim of Relation
Irrelevant statement Icebreaker Changing the topic "No offence" Maxim of Manner
Lexical puns Phonological ambiguity
Morphological ambiguity
Lexical ambiguity
Referential ambiguity Without brief and ordered utterance Total
English sitcoms Vietnamese sitcoms
N.
%
N.
%
63
42.0
42
28.0
32 21.3 18 12.0 24 16.0 20 13.3 7 4.7 4 2.7 13
8.7
18
12.0
10 6.7 16 10.7 3 44
22 5 7 10 30
18 8
4
6
5 2.0 29.3
14.7 3.3 4.7 6.7 20.0
12.0 5.3
2.7
4.0
3.3 2 37
11 5 4 17 53
33 18
7
8
6 1.3 24.7
7.3 3.3 2.7 11.3 35.3
22.0 12.0
4.7
5.3
4.0 7 4.7 14 9.3 150
100.0
150
100.0
Thirdly, it is noted that Less Information Response Strategy is the least frequently used among all humor strategies to be employed. Its frequency is 2.0% in ESs and, similarly, only 1.3% in VSs. Fourthly, Meiosis, Less Information Response, Icebreaker, Changing The Topic and Referential Ambiguity make up a small rate, not more than 5% for each and under 20% for total. 3.2. Differences
First, Quality in ESs and Manner in VSs make up a notable rate. The results show that the strategies of Quality, in ESs, are most employed (42%) and the strategies of Manner, in VSs, is highest contributed (35.3%). Secondly, Irony in ESs and Lexical Puns in VSs are the strategies making up the highest rates. Each of them counts up to one fifth of the whole, i.e. Irony 21.3%, Lexical Puns 22.0%. Lexical Puns refers to the ambiguity in phonological, morphological and lexical aspects. Lexical Puns are common methods in arousing laughter in Vietnamese funny stories. Sitcoms are hence affected by this tradition. In contrast, Irony is used more in ESs. Finally, there are some strategies which make up relatively converse percentage.They are Irony, Irrelevant Statements, “No offence”, Phonological Ambiguity. The rate of Irony is 21.3% in ESs and 12.0% in VSs; the proportion of Irrelevant Statements is 14.7% in ESs and 7.3% in VSs; “No offence” is recorded at 6.7% in ESs and 11.3% in VSs; and Phonological Ambiguity is 5.3% in ESs and 12.0% in VSs. The study of humor in sitcoms from pragmatic perspectives offer English teachers and learners a general view of humor strategies by violating conversation maxims in both English and Vietnamese. It would be a good reference for them in systematically understanding humor strategies resulting from violating maxims. It would help them recognize humor situations in order to understand the speaker’s intention, hence to improve communication competence.English learners should know the purpose of each humor utterance, and realize the strategy that the speaker uses to create humor in every English conversation. With each specific purpose, the learners can choose the most appropriate humor strategies to communicate effectively. REFERENCES
[1] Attardo, S. (1994), Linguistic Theories of Humor, Berlin: Mouton de Gruyter. [2] Grice, P. (1975), Logic and Conversation, In P. Cole, & J. L. Morgan (Eds.), Syntax and semantics (Vol.3): Speech acts (pp. 41-58), NY: Academic Press. [3] Ho, L. & Le, T.H. (2002), Sử dụng Từ ngữ trong Tiếng Việt (Thú
chơi chữ), Nxb Khoa học Xã hội. [4] Holmes, J. & Marra, M. (2002), Over the Edge? Subversive Humor
between Colleagues and Friends, Humor, 15(1), 65-87. [5] Jojić, Olja (2013), Lexical Pun in Sitcoms, Series: Linguistics and Literature Vol. 11, No 1, 2013, pp. 23 - 34, Facta Universitatis. [6] Levinson, S. C. (1983), Pragmatics, Cambridge University Press. [7] Ross, A. (1998), Language of Humor, London: Routledge. [8] Seewoester, S. (2011), "The Role of Syllables and Morphemes as
Mechanisms in Humorous Pun Formation", In: Dynel, Marta (ed.), The Pragmatics of Humor across Discourse Domains, John Benjamins Publishing Company, Amsterdam/Philadelphia, pp. 71-104. (The Board of Editors received the paper on 31/12/2015, its review was completed on 07/04/2016)
93
NONVERBAL STRATEGIES USED IN CLOSING A CONVERSATION AT
OFFICES BY ENGLISH AND VIETNAMESE STAFF AND MANAGERS
Hoang Tra My
Mientrung University of Civil Engineering; hoangtramy.hn@gmail.com
Abstract - A conversation can be closed verbally or nonverbally.
While people can learn to speak a language, they need to experience
to behave appropriately. Furthermore, behaving well in the mother
tongue is difficult but much more challenging in a foreign language.
For this reason, the present study is to compare and contrast the
ways English and Vietnamese staff and managers utilize nonverbal
strategies to terminate their conversations at offices. From
conversation analysis perspective, 60 English and 60 Vietnamese
conversations with closing sections gathered in films are selected
basing on strict criteria on contents, airtime and broadcast channels.
Nonverbal closing strategies are noted down, generalized, compared
and contrasted in both languages. As similarities, English and
Vietnamese subjects often perform physical behaviors of standing up
and moving towards the door due to the typical setting – working
environment. Regarding differences, as opposed to English subjects,
Vietnamese subjects tend to produce indirect closings by employing
more numbers and types of nonverbal strategies in combination with
roundabout leg movement. Especially, English subjects show their
attentiveness by direct eye contact while Vietnamese ones display
their respect and attention by smiling and head-nodding.
Key words - conversational closings; conversation closing
strategies;
nonverbal
strategies;
conversation
analysis;
conversations at offices; conversation between managers and staff
1. Introduction
1.1. Aims of the study
Human communication process can be carried out in various channels, among which nonverbal communication is regarded as the most basic. According to Knapp, Hall and Horgan [9], nearly 65% of all human communication is expressed via nonverbal cues, which indicates its crucial role in daily social interactions. Sharing the same point of view, Bruce [2] even claims that more than 85% of all human communication is nonverbal. Moreover, behaving appropriately and effectively in face-to-face conversations with others is exceedingly challenging, especially the process of closing a conversation. A conversation can be closed verbally or nonverbally. Closing a conversation verbally seems to be less difficult thanks to the speakers’ linguistics competence and knowledge; however, to produce proper nonverbal behaviors at the end of a conversation, participants need sufficient cultural background knowledge as well as experience. Additionally, currently, there are lots of Vietnamese people working with those coming from English speaking countries. The need of communication among them is becoming more and more vital. At offices, Vietnamese parties have lots of obstacles in understanding as well as communicating nonverbally with foreigners. Particularly, they have difficulties in breaking contact with foreigners because “knowing how to close or say goodbye in one native language does not ensure success in another language” [1, p.6]. Consequently, this study is designed to equip English and Vietnamese staff and managers with adequate nonverbal strategies to help them terminate their conversations at office courteously. This study is only limited to the description of nonverbal strategies taken by both English and Vietnamese staff and managers. From the description, some similarities and differences between English and Vietnamese subjects in the ways of terminating a conversation will be presented and discussed. It is hoped that the study will provide Vietnamese users of English with essential nonverbal strategies to help them to behave appropriately and politely with English speaking partners at offices in the process of closing a conversation. Precisely, this study is to answer two research questions: (1) what are nonverbal strategies employed by English and Vietnamese staff in closing conversations at offices? And (2) what are nonverbal strategies utilized by English and Vietnamese managers in closing conversations at offices? 1.2. Literature review
1.2.1. Conversational closing
Historically, conversational closing was first developed by Goffman [5]. Besides Goffman, Schegloff and Sacks [16] may also be considered other groundbreakers with an extension of their earlier work on conversational openings with the data collected from 500 telephone conversations. Following researchers have developed this area unsystematically from numerous perspectives. As regards the data sources, due to the challenges in gathering naturally occurring conversations as the data for analysis, researchers have delved into this field in various ways. Lots of researchers have made use of conversations in written genre [1] while some others take advantage of telephone conversations [7] or rely on some channels of mediated communication like online chats [15] or talk
show interviews [13]. Particularly, there have been some researchers who try to record naturally occurring conversations ([6], [10]) or create nearly natural data via role-plays with the help of volunteers [17]. In connection with perspectives, conversational closing can be approached in pragmatics or conversation analysis. For example, from pragmatic perspective, David et al. [3] focus upon politeness strategies used in closings of service encounters in Government agencies or from conversation analysis perspective, LeBaron and Stanley [10] specially analyze a single naturally occurring encounter between two clients in a beauty salon. 1.2.2. Nonverbal conversational closing strategies
Despite the essentiality and importance of nonverbal behaviors in closing a conversation, this field has been examined extremely limitedly worldwide and totally absent in Vietnamese due to the restricted accessibility of data sources. Factually, this area has only been inspected as a small part in bigger studies. From its background, some significant results 94
from previous investigations can be remarked. Regarding the level of intimacy among partners, Summerfield and Lake [17] assume that friends look at their partners more often than strangers. Likewise, Knapp, Hart, Friedrich and Shulman [8], with the data of formal interviews between acquaintances and strangers of equal and unequal status, introduce a number of nonverbal behaviors associated to leave-taking, for example, breaking eye contact, smiling, nodding head, leg movement,
leaning forward and movement in the direction of proposed
exist. In addition, by observing nonverbal behaviors of departure of an individual in an F-Formation, Kendon [6] realizes some remarkable movement behaviors including stepping backwards, then stepping back into the group, and
finally walking away. Focusing on more diverse behaviors, Lockard, Allen, Schiele, and Wiemar [11] put forward some other nonverbal strategies indicating imminent departure like unequal weight stances and weight shifts, breaking of eye
contact and hand gestures. Erickson [4] adds postural shifts as a signal of a change in topic or an intention to part. Finally, O’Leary and Gallois [14, p.8-24], with the attention to the relationship of parties, investigate the last ten turns of twoparty conversations in comparison with the ten middlemost turns. They claim that unlike strangers, friends employ more
activities, behavior clusters and specific appointments with
continuity statements. However, both of them have a preference for smiling, using hand gestures, looking away along with leverage/ lean forward and grooming by the departing subject as well as head nodding by the staying subject. In conclusion, the background of this field points out that studies on nonverbal strategies in closing a conversation are deficient and unsystematic. Among researches in this field, the study by O’Leary and Gallois [14, p.8] seems to be the most sufficient. Being well aware of no existing previous framework on nonverbal behaviors, they analyze the data basing on their own framework including categories of looking, head movement, arm/hand movement, facial expressions, trunk movement and leg movement. In the same way, in this study, the writer takes note every nonverbal behavior of subjects and then summarizes from the most to the least popular ones. The categories of nonverbal behaviors are illustrated in the following Table: Table 1. Categories of nonverbal behavior used in data analysis
(Extracted from O’Leary and Gallois, [14, p.8])
+ At: eyes and nose pointed at partner's face + Away: eyes and nose pointed away from partner's face + Shaking: movement from side to side Head Movement + Nodding: movement up and down + Gesture: movement accompanying own speech Arm/Hand + Grooming: touching of own body (to stroke or groom) Movement + Leveraging: hands placed on arms of chair in a manner that would assist rising from chair Facial + Smiling: raising or upturning of the corners of the Expression mouth + Leaning forward: movement of trunk forward 30° or more from previous position Trunk + Leaning backward: movement of trunk back 30° Movement or more from previous position + Standing: rising from a sitting to standing position. Leg + Orientation (while standing): any movement of Looking Hoang Tra My
Movement legs resulting in a significant change in posture + Door: trunk oriented in direction of door. 1.3. Methodology
The results of this study base on the data of 120 conversations (60 English and 60 Vietnamese). Conversations selected must have the closing sections and be between two participants – a staff and a manager with the age from 20 to 60. To ensure equivalent contents and forms, English and Vietnamese films selected have to follow the same criteria such as broadcast channels, airtime and contexts. Exactly, Vietnamese movies must be aired in the golden hours on Vietnam Television (VTV) – the national broadcaster of Vietnam while English movies are selected from Vietnam Cable Television (VTVCab) channels such as HBO, Star movie, Star world. These movies must also be produced from 2000 up to date, discussing current issues in modern contexts of offices. From these criteria, one English film - “House of cards” and two Vietnamese films - “Đối thủ kỳ phùng” and “Cảnh sát hình sự - Chạy án” are selected. All nonverbal behaviors performed by English and Vietnamese subjects in closing sections of selected conversations are noted down then generalized from the most to the least popular ones. These strategies are analyzed and evaluated basing on their frequency of appearance in relation with 60 collected conversations. The conclusions display both similarities and differences in the ways the subjects in both languages terminate their conversations nonverbally at offices. 2. Results and Discussions
2.1. Nonverbal strategies by English and Vietnamese staff
Nonverbal strategies taken by English and Vietnamese staff are presented in the Figure 1 below: 50
40
30
20
10
0
1
3
5
7
English
9
11
13
15
17
19
Vietnamese
Figure 1. Nonverbal strategies by English and Vietnamese staff
Note:
1: Looking at partner’s face, eyes 10: Arm/Hand gesture 2: Breaking eye contact 11: Turning back 3. Looking away from partner’s face 12: Touching shoulder 4: Head Nodding 13: Looking at the watch 5: Smiling 14: Wearing the coat 6: Standing up 15: Leaning forward 7: Movements oriented in 16: Holding the other’s hands direction of door 17: Gazing at objects at a distance 8: Packing things up 18: Moving closer 9: Hand Shaking 19: Holding hands in front of ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
In overall, nonverbal behaviors of Vietnamese staff are more intricate than those of English ones because of more number and types of strategies employed. Vietnamese staff produce 166 nonverbal strategies categorized into 18 types whist English staff only need 129 ones categorized into 13 types. Unlike the Vietnamese, the English belong to lowcontext culture; hence, they have low use of nonverbal elements in communication. Their communication is mainly expressed explicitly via words. Furthermore, the ways they restore each strategy are also different. To depict the similarities and differences, these nonverbal strategies will be analyzed from the most to the least frequency of occurrence. With reference to the most frequently employed nonverbal strategies, it is notable that the strategies of standing up and moving towards the door are made use of most often with 25% and 63.3% by English staff and 28.3% and 73.3% by Vietnamese ones respectively. Their regular appearance is accounted by the typically official architecture and working environment. It can be inferred that in both cultures, staff-manager conversations often occur in the managers’ rooms and the difference between these two strategies implies that staff may be sitting or standing while talking to their managers. Except for these two strategies, English staff prefer looking at partner’s eyes or faces (65%) while Vietnamese staff enjoy nodding heads (65%) and smiling (28.3%) to end conversations with their managers at offices. Significantly, English individuals highly appreciate direct eye contact in interaction. In fact, direct eye contact is highly valued in the U.S culture and in communication, direct eye contact is to convey the attentiveness, respect, truthfulness, and self-confidence [12, p.56]. It can be inferred that the excessive employment of direct eye contact of English staff in examined conversations is to show the deference and attentiveness towards their managers. In contrast, in Vietnamese culture, it is especially inappropriate and even impolite for the less powerful partners like staff to look directly and constantly at the eyes or faces of the more powerful ones like their managers. This finding is in agreement with Martin and Chaney’s point of view. They suppose that people in many Asian countries are uncomfortable with direct eye contact. They are inclined to look below the partners’ chin during the conversation because looking into the partner’s eyes would be quite rude [12, p.57]. The thorough observation of the collected data reveals that Vietnamese staff’ eye contact is inconstant and varying or they express the respect towards their managers by avoiding direct eye contact and most of the cases, they look at their managers’ chin rather than their eyes. Instead, Vietnamese staff have a tendency to nod their heads or smile at their managers. According to Martin and Chaney [12, p.58], smiling accompanied by a slight nod-heading, in some cultures, is restored in conversation to acknowledge what the partner has said. Likewise, head nodding and smiling are a display of agreement, contentment and involvement in the conversation. The repeated occurrence of these strategies exposes the staff’ acknowledgement and involvement in the talk with their managers. Surprisingly, smiling and headnodding appear in only two (3.3%) and five English conversations (8.3%). In English speaking countries, smiling associates with happiness [12, p.58]; hence, it seems 95
to be inappropriate for them to smile in a formal conversation with their managers at offices. With regard to the less frequently used nonverbal strategies, both English and Vietnamese staff can inform the conversational closings by packing things up and handshaking. The act of packing things up accounts for 16.7% in both languages. Generally, the staff will come into their managers’ rooms and they may carry something with them like their handbag or a folder of document. By collecting or packing these things, the staff notice or inform their managers about the ending of their conversations and then their leaving. The act of handshaking makes up 10% in English and 13.3% in Vietnamese. Handshaking is an extremely popular behavior in Western countries, especially at the beginning of a meeting. However, due to the globalization of business, this behavior has become common in business around the world. It can be inferred that in English and Vietnamese official environment, it is proper for participants to shake their hands at the end of a conversation. Moreover, English staff also employ breaking eye contact while Vietnamese ones make use of moving closer to the
partner to notify the closing. That the act of breaking eye contact is employed to terminate a conversation has been proved by earlier researchers [8, 10]. This reassures the importance of eye contact in interaction of English subjects. The act of moving closer to the partner to inform the closing of Vietnamese partners is an illustration of the Vietnamese’s indirectness. Being an Asian country, Vietnamese culture is group-oriented; hence, working harmoniously within a group is highly valued whist directness and forthrightness are considered rude or impolite [13, p 47]. Regarding rarely exploited strategies, nonverbal strategies including looking away from the partner’s face,
looking at the watch, arm or hand gesture, turning back and
touching the partner’s shoulder are used remarkably restrictedly in both languages. In fact, these strategies only occur in one or two conversations among 60 ones examined. The tremendous limitation of these strategies is explained by the partners’ inequality of power. In both languages, it is inappropriate or even impolite for the less powerful partners to look away or turn back from the more powerful ones, except for some extraordinary or emergency situations. It is also worth noting that the touching behaviors are uncommon in English speaking countries [12, p.67] or they do not have a habit of touching. In addition, there also exist some other strategies which are only taken by Vietnamese staff such as gazing at distant objects, leaning forward, wearing the coat,
holding the other’s hands and holding their own hands in
front of. Because of exceedingly rare appearance, it is not advisable for these strategies to be exploited in conversational closing sections. In conclusion, English and Vietnamese staff are different in the way they make use of their looking, facial expressions, head movement and postural shifts to signal their conversational closings. English staff prefer direct and instant eye contact as well as straight movement towards the exit while Vietnamese staff enjoy smiling, nodding their heads and moving towards their managers before moving towards the door. Nevertheless, they both rarely look way 96
Hoang Tra My
from their partner’s eyes or faces, look at the watch, turn back, touch their managers’ shoulders and so on. these two strategies is due to the special architectural structures and working environment at offices. 2.2. Nonverbal strategies by English and Vietnamese
managers
In terms of the less frequently used nonverbal strategies, English managers tend to utilize behaviors which make them and their staff becomes more distant such as breaking
eye contact (13.3%), looking away from partner’s face or
eyes (11.7%), working again (11.7%), turning back (10%) and leaning backward (8.3%). These behaviors are significant signals of closing because the managers show their incorporation in continuing the conversation. Especially, the behaviors of working again and turning
back seem to threaten the staff’ faces because the managers reveal that they are not eager or happy to continue talking with them. In normal conversations, these strategies may be considered inappropriate or even impolite in English culture. However, in conversations of unequal power, it is acceptable for the more powerful partners – the managers to make use of these strategies to close a conversation with the less powerful partners – the staff. Nonverbal strategies taken by English and Vietnamese managers are presented in the Figure 2 below: 35
30
25
20
15
10
5
0
1
3
5
7
9
English
11
13
15
17
19
21
Vietnamese
Figure 2. Nonverbal strategies by English and Vietnamese
managers
Note:
1: Looking at partner’s face, eyes 11: Smiling 2: Movements oriented in 12: Leaning forward direction of door 13: Wearing the coat 3: Standing up 14: Looking around 4: Breaking eye contact 15: Arm/Hand grooming 5: Looking away from partner’s face 16: Arm/Hand Leveraging 6: Working again 17: Packing things up 7: Turning back 18: Looking at the watch 8: Shaking hands 19: Touching shoulder 9: Leaning backward 20: Moving closer 10: Nodding head 21: Gazing at objects at a distance 22: Arm/Hand gesture
Although the total number of nonverbal strategies employed by English and Vietnamese managers is nearly the same, with 121 and 122, the frequency of occurrence of each strategy is exceedingly dissimilar. With regards to the most frequently used strategies, the behavior of looking at
the partner’s faces/ eyes accounts for the highest restoration by English managers with 50%. English managers prefer stable, straight and instant eye contact. Contradictorily, Vietnamese ones usually nod their heads
and smile to indicate the closing with 56.7% and 31.7% respectively. As discussed above, English native speakers highly appreciate direct eye contact in interaction because it shows the attentiveness, respect, truthfulness, and selfconfidence. With the exploitation of direct eye contact, English managers express their directness as well as their concentration on what the staff has said. Contrary to English managers, Vietnamese managers smile and nod their head to support what their staff has said. It can be inferred that Vietnamese managers are more pleasant and affable to talk to than English ones due to their enormous utilization of smiling and head-nodding. Next, the behaviors of standing up and moving towards the door are performed fairly frequently with 21.7% and 38.3% by English managers and 15% and 23.3% by Vietnamese ones respectively As discussed above, the high employment of In contrast, Vietnamese ones rarely utilize these strategies, for instance, turning back (3.3%), leaning backward (1.7%) or working again (0%). Instead, they have a tendency to use behaviors creating the closeness like looking at partner’s eyes
or faces (18.3%), touching partner’s shoulder (15%) and moving closer to the partner (13.3%). The Vietnamese culture is collectivism or group-oriented; hence, behaving and working harmoniously in a community is greatly appreciated whereas directness and straightforwardness are regarded as rude or impolite [13, p. 47]. For this reason, they try to behave closely and warmly even at the leave-taking of a conversation. Especially, in Vietnamese culture, the act of touching partner’s shoulder is the privilege of the more powerful partners to show their sympathy and encouragement to the less powerful ones. Exceptionally, handshaking is a behavior performed quite similarly by the managers in both languages, with 13.3% and 10%. Last but not least, despite the appearance of a variety of nonverbal strategies, most of them are employed in an extremely small percentage. The rarely used strategies by both English and Vietnamese managers are wearing the
coat, leaning forward, looking at the watch, looking
around, packing up things, gazing objects from distance
and arm/ hand gesture. Factually, these strategies appear only in one or two conversations in both languages. Because of their unpopularity, it is advisable for the managers in both languages to avoid or limit the use of them to close a conversation with their staff. In summary, in closing a conversation with their staff at offices, English and Vietnamese managers are similar in the regular exploitation of standing up and moving towards the
door. As regards the differences, English managers tend to concentrate on the eye contact by looking at the partner’s
eyes or faces, looking away and breaking eye contact and keep distant from their staff by working again, turning back,
and leaning backward. Vietnamese managers, inversely, have a preference to make them closer to their staff by nodding head, smiling, moving closer to the partner and
touching partner’s shoulder. These differences can be accounted by the individualism of English culture and ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
collectivism or group-oriented of Vietnamese culture. 3. Conclusions and suggestions for further studies
3.1. Conclusions
To compare the employment of nonverbal strategies of the subjects in the two languages, there exist much more differences than similarities. As regards similarities, official working environment accounts for the massive employment of the strategies like standing up and moving towards the
door by both subjects. Likewise, normal physical behaviors give an explanation for the occurrence of packing things up
and handshaking of subjects in both languages. In connection with differences, generally, nonverbal behaviors by Vietnamese subjects are much more complicated than English ones due to more numbers and types utilized. In addition, because of belonging a highcontext culture, Vietnamese closings are rather roundabout or indirect with the preference of moving closer to the
partner and touching the partner’s shoulder before departing. These strategies are used to help Vietnamese subjects to avoid hasty or sudden closings which may threaten the interlocutor’s face in Vietnamese culture. On the contrary, belonging to a low-context culture, English subjects tend to be goal-focused and straightforward. That is the reason why they move towards the door right after the conversation finishes and are uncomfortable with touching. Furthermore, English subjects show their involvement in the conversation by direct eye contact whist Vietnamese display their attention and politeness by smiling and head-nodding. It can also be inferred from the exploitation of these strategies that the relation between Vietnamese staff and managers is rather warm and close whereas that of English ones is rather formal and distant. Finally, English managers appear more powerful than Vietnamese ones through the use of such strategies as working again, turning back and
leaning backward. It can be concluded that English subjects tend to focus on the goal in interaction or produce workbased conversations whilst Vietnamese ones concentrate on both the effectiveness of the work and the establishment of rapport among interlocutors in interaction. The features of low-context culture of English and high-context culture of Vietnamese justify for these differences. 3.2. Suggestions for further studies
The author is well aware of the limitation as well as the weakness of using the conversations in films as the data. The study will be much more valuable and meaningful if naturally occurring conversations are collected as the data for analysis; hence, it is advisable for other researchers to examine conversational closing strategies with real life data. Moreover, because of being conducted in conversation 97
analysis perspective, this study cannot expose the cultural origin of nonverbal behaviors of subjects in the two languages. A further study to examine English and Vietnamese nonverbal behaviors in closing a conversation under the cultural perspective is particularly meaningful and interesting. Finally, to produce a good closing, verbal strategies play an extremely essential role; consequently, it is better for other researchers to focus on verbal strategies in combination with nonverbal ones in closing a conversation. REFERENCES
[1] Bardovi-Harlig, K., Hartford, B.A.S., Mahan-Taylor, R., Morgan, M. J., & Reynold, D. W., “Developing pragmatic awareness: closing the conversation”, ELT Journal, 45, 1991, 12 (4-15). [2] Bruce, T., Early childhood education. London: Hodder Headline Group, 2005. [3] David, M., Hei, K. & DeAlwis, C., “Politeness Strategies in Openings and Closings of Service Encounters in Two Malaysian Government Agencies”, The Journal of the South East Asia Research Centre for
Communication and Humanities, 4 (2), 2012, 17 (61-77). [4] Erickson, F., One function of proxemic shifts in face-to-face interaction, In A. Kendon, R. Harris, & M. R. Key (Eds.), Organization of behavior
in face-to-face interactions, The Hague: Mouton, 1975. [5] Goffman, E., “On cooling the mark out: some aspects of adaptation to failure”, Psychiatry, 25, 1952, 13 (451-463). [6] Kendon, A., “The F-formation system: The spatial organization of social encounters”, Man Environment Systems, 6, 1976, 6 (291-296). [7] Khadem, A. & Rasekh, E. A., “Discourse Structure of Persian Telephone Conversation: A Description of the Closing”, International
Review of Social Sciences and Humanities, 2 (2), 2012, 12 (150-161). [8] Knapp, M.L., Hart, R.P., Friedrich, G.W., & Shulman, G.M., “The rhetoric of goodbye: Verbal and nonverbal correlates of human leavetaking”, Speech Monographs, 40 (August), 1973, 17 (182-198). [9] Knapp, M., Hall, J., & Horgan, T., Nonverbal communication in
human interaction, Harcourt College Pub, 4th ed., 1996. [10] LeBaron, C. D., & Stanley, E. J., “Closing up Closings: Showing the Relevance of the Social and Material Surround to the Completion of Interaction”, Journal of Communication, September, 1976, 24 (542-565). [11] Lockard, J. S., Allen, D. J., Schiele, B. J., & Wiemar, M J., “Human postural signals: stance, weight-shifts, and social distance as intention movements to depart”, Animal Behavior, 26, 1978, 6 (219-224). [12] Martin, S. J., & Chaney, H, L., Global business etiquette: a guide to international communication customs, London: Praeger Publisher, 2006. [13] Martinez, R.E., “Accomplishing closings in talk show interviews: A comparison with news interviews”, Discourse Studies, 5(3), 2003, 20 (283-302). [14] O’leary, M. J., & Gallois, C., “The last ten turns: Behavior and sequencing in friends’ and strangers’ conversational findings”, Journal of Nonverbal Behavior, 9, 1985, 20 (8-27). [15] Pojanapunya, P. & Jaroenkitboworn, K., “How to say ‘‘Good-bye’’ in Second Life”, Journal of Pragmatics, 43, 2011, 12 (3591–3602). [16] Schegloff, E. A. & Sacks, H., “Opening up closings”, Journal of the
International Association for Semiotic Studies, 8, 1973, 39 (289-327). [17] Summerfield, A. B. & Lake, J. A., “Non-verbal and verbal behaviors associated with parting”, British Journal of Psychology, 68, 1977, 4 (133-136). (The Board of Editors received the paper on 03/03/2016, its review was completed on 07/04/2016)
98
RULES OF SWITCHING MEANINGS TO FORM NEW WORDS
WITH TWO METHODS OF METAPHOR AND METONYMY
IN THE SYSTEM OF MODERN VIETNAMESE
Bui Trong Ngoan1, Ho Thi Duyen2
1
University of Education, the University of Danang; buitrongngoandn@yahoo.com.vn
2
Cao học Ngôn ngữ K28, Đại học Đà Nẵng; hothiduyen242@gmail.com
Abstract - There always exist new things, phenomena, concepts
in our society, which creates the introduction of new words.
Therefore, the emergence of new word is a regular process of
linguistics for the enrichment of Vietnamese. However, there are
not many scientific studies of this issue. Meanwhile, two methods
of changing metaphor and metonymy to create new words are very
popular and play an important role in forming structure of new
words. After carrying out the research, we find that the majority of
new words which are formed by switching meaning use existing
units, not potential units. In order to identify the object, show the
features, characteristics, and states or operation of new things,
Vietnamese people have used existing word units for combination
based on associative relations. In addition, studying methods of
word formation with metaphor and metonymy not only helps us
exploit the depth of creating new word but also contributes to better
understanding cognitive process as well as Vietnamese culture.
Key words - switch meaning; metaphor; metonymy; new words.
1. Introduction
Within ten recent years, together with the development in economy, society, science, technology and international contact, there has been a change in thinking and accordingly, there has been a considerable increase in Vietnamese words. It can be said that the appearance of new words is an usual growth of languages in general and of Vietnamese in particular to enrich languages. However, there has not been much research on this issue. It was not until in 2008 that there was “A dictionary of new Vietnamese words” compiled by Vietnam Language Institute. The birth of the dictionary should have been an opportunity for language researchers to discuss and investigate new words but it was not the case. Therefore, discussion about the formation of new words is of great scientific value. In Vietnam, much research on terminology always mentions the concept of new words and their formation but there has not been a thorough study of new words. Meanwhile, two methods of switching meanings to form new words, namely metaphor and metonymy, are very popular and play a key role in forming new words. In addition, understanding the two above-mentioned methods not only helps to exploit the depth of word formation but also enhances the understanding of cognition process and Vietnamese culture. For the above reasons, we research on the rules to switch meanings to form new words with metaphor and metonymy in the system of modern Vietnamese new words. The data we focus on is the vocabulary in “A dictionary of new Vietnamese words” compiled by Vietnam language Institute in 2008 and published by Ho Chi Minh city publisher. 2. Rules to switch meanings to form new words with
metaphor and metonymy
After survey and investigation, we find out 4 rules to switch basic meanings to form new words with metaphor and metonymy. They are Metaphor- a popular and diversified method to switch meaning; metaphor to form new meanings- a base to form new words; metonymy- a popular method to switch meanings in context, and forming new words by combining metaphor with metonymy. 2.1. Metaphor - a popular and diversified method to
switch meaning
By examining the system of modern Vietnamese new word in “A dictionary of new Vietnamese words” compiled by Vietnam language Institute in 2008, we see that most new words are formed by switching the metaphoric meaning. The number of new words by switching the metaphoric meaning is 275 words, accounting for 78.2% while the number of new words by switching the meaning with metonymy is 78 words, making up 21.8%. This is usual with any vocabulary system. In Vietnamese as well as in other languages, metaphor and metonymy are two popular methods to switch the meaning. Metaphor plays an important role in forming new modern Vietnamese words, accounting for a number 3.5 times larger than metonymy.. Based on the similar relationship among objects and phenomena, metaphor forms a large number of words, enriching Vietnamese vocabulary. We have analyzed in detail subtypes of metaphor which base on the similarity in form, color, function, characteristics, action…Most people think that metaphor only exists as nouns and noun groups but this is no longer true. In the system of new words of modern Vietnamese, we have examined and found 173 words as metaphors based on the similarity in characteristics, features, actions and action ways. Of 173 words, 103 are metaphors of actions and action ways, making up 36.9%. Considering some examples, we can see the abundance and diversity of the method of switching the metaphoric meaning to form new words. Metaphors based on the similarity in characteristics are metaphors of characteristics. This type of metaphor is popular in noun groups, verb groups such as a golden goal, a golden hand, red spot, fair play, unfair play… [8]. This type of metaphor accounts for 25.1%. Metaphors of actions are ones based on the similarity in actions, action ways. This type of metaphor makes up 36.9%. Apart from the abundance in sub types, metaphor can ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
switch the meaning within the word. It means that only the meaning of one or two words, not of all the words, are switched. For example, pillow cake, petrol tree, credit card, market goods… [8]. In the noun group Market goods, only the meaning of the word market is switched to mean cheap or low quality goods. (Nowadays, some artists claim to paint market pictures but when their pictures are sent to the gallery, they are still copied and made fake) [8, p.101]. In the group industrial concrete, only the meaning of industrial is switched to mean available, professional or fresh as in
fresh concrete [8, p.14]. There are cases when the meanings of the whole group are switched. For example, the group the plan fails to mean unwanted pregnancy in (She knows well all the women in her charge and detect in time those whose plan has failed to encourage them to get rid of pregnancy early to keep their health safe) [8, p.272]. This type of metaphor occupies a small number). There are cases when the meanings of the new word are switched with metaphor and the word belongs to two subtypes. For example, the word áo phông (jumper), a kind
of T-shirt made of cotton, with picture or word at the front
or at the back [8, p.2] can be metaphor based on the similarity in form (phông) or based on the similarity in function (áo). Another example is the word bán hoa
(selling flowers: a prostitute) can be a metaphor of feature (hoa: flower) or one of actions (bán: selling). Why the word bán hoa belongs to two sub types of metaphor is that the meaning of bán is switched as an action while the meaning of hoa is switched as a feature. Thus, it can be said that in the new word system of modern Vietnamese, metaphor is a key and popular method to switch the meaning with different sub types. The number of words whose meanings are switched with metaphor in the new word system of modern Vietnamese is very large and belongs to different sub types. Sometimes, the same word, the same group belongs to different sub types. 2.2. Metaphor makes new meanings - a base to form new
words
“Metaphor goes through our life. It exists not only in
language but also in thinking and actions. The concept
system based on which we think and act is metaphor in
nature”. Actually, metaphor plays a very important role in forming words. Together with examining new words whose meanings are switched with metaphor and metonymy, we also find a large number of words whose meanings are switched without being new words. They only have new meanings and are also called multi-meaning words. We think that these words will become new words through change and meaning switching. Of the two methods of switching meanings with metaphor and metonymy. Nearly 100% words have their meanings switched with metaphor. For this reason, a part of our study is for understanding the meaning switching with metaphor to form new meanings without forming new words. Through examination, we find 75 words whose meanings are switched to form new meanings as shown in 99
table 1 Table 1. Words with meanings switched to form new meanings
Parts of Speech Number Percentage (%) Noun 33 44 Verb 25 33.3 Adjectively 17 22.7 Total 75 100 Considering some examples with the data taken from new word system of modern Vietnamese, we can see their meaning switching better: “Bèo” means a plant living in the water which can be used as feed for animals or as manure (cutting water-fern, cutting potato). “Bèo” also means low price, very cheap as in (I didn’t sell the thing because it is paid at a vey low price) [8, p.13]. Another example is the word mềm which has 6 meanings, one of which is new. The word is often used in spoken language to mean at a reasonable price as in good quality things at reasonable prices [8, p.151]. These words,whose meanings if switched another time or combined with other words may become new words, for example, “harvest success” (harvest); “lose some shots in row” (shots); (miss being on duty” (miss); father of Romeo and Juliet play (father) [8]. It can be affirmed that the birth of “A dictionary of new Vietnamese words” is very necessary to explain enquiries and make clear these new words. In the future, with the continual change to meet the demand for communication, Vietnamese will become richer, more diversified because of the switched, changed and added meanings to make new words. 2.3. Metonymy- a method to switch meaning in context
Through survey and statistics, we see that the number of words whose meanings are switched with metonymy is much smaller than that with metaphor. In practical usage, the number of words whose meanings are switched with metonymy is very large but through the survey with the new word system, the number is very small, of 78 words, making up 21.8%. What is the reason for this? The question attracts the attention of many language researchers who study the method of switching word meanings with metonymy. Let us consider the following examples: “lái” means “drive” “lơ” means “sub-drive”. The meanings of these two words are not switched; they are only used in brief forms. However, when we say “một lái”, “một lơ”, the same way as in “một đen” “một sữa” (a cup of black coffee, a cup of brown coffee), then the meanings of “lái” “lơ” “đen” “sữa” are switched with metonymy based on the logic relations between “job and job doer” “container and thing contained”. Similarly, the word “bảo kê” whose old meaning is to insure, protect, used negatively, now means the people who do the work of protecting. Thus, the meaning of “lái”, “lơ”, “đen”, “sữa”, “bảo kê” in a particular context is switched with metonymy. However, when these words stand alone, out of context, they do not have switched meaning with metonymy any more. 100
Therefore, when these words appear in the dictionary, they only have their original meaning. From the above analysis, we can reach the conclusion that the process of switching meaning never stops, it always continues and develops in different ways. Metonymy never stops in a fixed position in vocabulary, it continues in its own way in the language world. And it can be denied that metonymy becomes more vivid in context and more diversified when it is put in different contexts. Our study of this issue has taken initial steps. We hope that there will be further research on this issue. In the article “Metonymy from the perspective of cognition” the writer Ta Thanh Nhan discussed: “Metaphor is related with the principle of selection and replacement on the basis of similarity. Metonymy is related with the principle of combination and continuity on the basis of continuity. According to structuralism, metaphor is related with the change axis while metonymy is related with the combination axis of language” [7, p.47]. Now, we have realized the reason why the number of new words whose meanings are switched with metonymy is smaller than that with metaphor. If a word is put in context in the combination axis, its switched meanings with metonymy will be richer and more diversified. 2.4. Forming new words with the combination of
metaphor and metonymy
New words can be formed not only with their meanings switched with metaphor or metonymy separately but also with the combination of the two methods. Let us consider the example, “bàn tay vàng” in “The
contest has selected 54 contestants with golden hand.” means “a people who is skillful at a labour or technical operation”. Thus in the above group, the word “hand” is switched with metonymy to denote a people and “gold” is switched with metaphor to denote a good and rare skill..Thus, metaphor is the key basis to switch the meaning of the group “bàn tay vàng” to make it become a new word. Previously, this change appears only in poetry, when the meaning of a word depends on context. Now the change appears in common vocabulary”. Hoa khuê các (flowers of
nobility), bướm giang hồ (errant butterflies” is an example. There has been a change in word formation in Vietnamese. It is influenced not only by language change, word borrowing, language interference (Chinese, English, French …) but also by western culture. It is this that leads to the appearance of a series of sentence structures of the language. “More than one flower have fallen” [6, p.30] or
“fresh concrete”, “golden score”, “high technology”,
“clean technology” [8] are examples of new structures. Besides the influence of languages, western culture in the way of thinking, translating, writing, new words are also affected by the internal change of Vietnamese. In poetry, there appear new words whose meanings are switched with the two methods to create an imagery and figurative way of speaking, then the birth of new words is obvious. It is the natural development of language. 3. Conclusion
Vietnamese is developing incessantly and identifying its development is very complicated. However, it can be affirmed that formation of new words cannot be without meaning switching In the study, we see that most new words which are formed through meaning switching use existing word units, not new ones. To name objects, denote features or characteristics, states or activity of new objects, Vietnamese people always use existing words for combination based on the relationship of connection. Apart from the above-mentioned rules in new word formation, there are other rules of switching meaning in Vietnamese new word system. However, they are not popular, so, they are not mentioned in our study. Together with the development of language with the timeline, we can affirm that the appearance of new rules of meaning switching is obvious. Together with the methods of forming new words, switching meaning will become the key method to increase Vietnamese vocabulary. Through the study, we believe that word metaphor and metonymy will make language develop more. They not only enrich the language but also express the way of thinking, way of living and culture of a community, a people. We hope that there will be further research on new word system in other aspects such as semantics, phonology and grammar. REFERENCES
[1] Trần Thanh Ái (2009), Dictionary of Borrowed Words of Modern
Vietnamese, Hanoi National University Publisher. [2] Đỗ Hữu Châu (2004), Textbook of Vietnamese Vocabulary. Hanoi Education University Publisher. [3] Nguyễn Văn Khang (2013), Foreign Words in Vietnamese.Ho Chi Minh University Publisher.
[4] George Lakoff. & Mark Johnson (2003), Metaphors we live by, London: University of Chicago press, Chicago, USA.
[5] Hoàng Phê (editor) (2010), Vietnamese Dictionary. Encyclopedia. [6] Trần Đình Sử (General Editor) (2007), Vietnamese Language,
advanced 11, volume 2. Ho chi Minh city Publisher.
[7] Tạ Thành Tấn (2014), “Metonymy from Perspective of Cognition (6BC/2014 VN), Science. Hanoi University of Education. [8] Language Institute (2008), Dictionary of Vietnamese New Words
HochiMinhcityPublisher. (The Board of Editors received the paper on 02/06/2016, its review was completed on 10/06/2016)
101
A STUDY OF SYNTACTIC AND LEXICAL FEATURES
OF THE INTRODUCTION OF ENGLISH M.A. THESES IN LINGUISTICS
IN VIETNAM AND AUSTRALIA
University of Foreign Language Studies, The University of Danang; phuongtran@ufl.udn.vn
Abstract - Based on the theories of discourse analysis, this study
focuses on describing and analyzing typical discourse features of
English language master thesis introductions in Australia
(A-ELMTIs) and English language master thesis introductions in
Vietnam (V-ELMTIs) in terms of syntactic and lexical features.
From the investigation, we have found out their differences and
similarities. With regard to syntactic features, it is evident that the
largest differences are in the use of simple and compound
sentences. Simple sentences are used with far greater frequency
in V-ELMTIs than in A-ELTMIs, whereas there is more use of
complex sentences in A-ELTMIs. Lexically, A-ELMTIs use a higher
proportion of “contrast terms” and “quantifiers and quasi-negatives”
than V-ELTMIs do. Meanwhile, the use of “contrast terms” and
“negatives” is very low in both.
Key words - master’s (MA) thesis; discourse analysis; syntax;
lexicon; English language.
1. Introduction
To get a master’s degree in a certain field, students usually write a thesis to fulfill the requirements of the course or the degree, and hence, the introduction to theses plays an integral part in this process. It is the introduction that helps the readers decide whether they are interested in that topic or will continue to read through the thesis or not. At the very least, introductions consist of a rationale, aims and objectives, a scope of the study, significance of the study, research questions and an overview of the structure of the thesis. Even if the theses are written in English, there are differences in the way the introductions are written in universities in Vietnam and in Australia. For years, Australia is a country whose educational environment has attracted a great number of Vietnamese students. Therefore, in order to help Vietnamese students to undertake research or write a thesis in Australian universities with less trouble and less confusion, it is necessary to carry out research on this issue. Moreover, research on the differences and similarities between English Language Master’s Theses (ELMTs) in Vietnam and Australia will help to promote training in Masters of Arts in Linguistics in Vietnam to an international level in order to achieve a global educational standard. This study is part of a larger study that aims to analyze the discourse features of the introductions of master’s theses written in Englishin the field of linguistics in Vietnam and in Australia. Due to space limitations, this particular study is limited to describing the discourse features of the introductions of the theses in terms of their syntactic and lexical features in order to illustrate the potential differences in writing theses in different regions even when the same language is used.The syntactic and lexical aspects are less obvious than the layout and structure, but research into other types of documents suggests that differences exist [9], hence they form the focus of the current study. 2. Theoretical Background
2.1. Discourse analysis
Brown and Yule [2, p.iii] describe discourse as“language in use” and remark that “the term discourse analysis has become to be used with a wide range of meanings which cover a wide range of activities at the intersection of many disciplines from sociolinguistics, psychological linguistics to computational linguistics”. Based on concepts proposed by Salkie [10, p. ix], Cook [5, p. 156] argues that discourse is “stretches of language perceived to be meaningful, unified and purposeful”. Furthermore, Nunan [7, p. 5] asserts “Discourse can be defined as a stretch of language consisting of several sentences which are perceived as being related in some way. Sentences can be related not only in terms of the ideas they share, but also in terms of their functions”.In conclusion, all the above concepts of discourse have mentioned the application of language. Hence, recently discourse analysts have tended to base their research on observing language usage during conversations in sequences of sentences. The analysis of discourse is, necessarily, the analysis of language in use. As such, as Brown and Yule argue, it cannot be restricted to the description of linguistic forms independent of the purposes or functions which these forms are designed to serve in human relationships [2, p. 1]. 2.2. Cohesion
Cohesion can be thought of as all the syntactic and lexical links that connect one part of a text to another. This consists of the use of synonyms, lexical sets, pronouns, verb tenses, time references, grammatical reference, and so forth to help to sequence a text and link ideas and arguments in the text. Halliday suggests that a text “has texture and this is what distinguishes it from something that is not a text… The texture is provided by the cohesive relation” [6, p.2]. Cohesion refers to the explicit linguistic devices that are expressed partly through the syntax and partly through the vocabulary. In other words, cohesion consists of syntactic cohesion and lexical cohesion. While the term may be used in a much broader sense as well, in the context of the current study, the focus is on these two main elements. 3. Method
3.1. Data Collection
The introduction texts analyzed in this study are taken from a total of 30 ELMTs in Vietnam (15) and in Australia (15) on topics related to linguistics. All theses are written in English and include a chapter entitled “Introduction” ranging in length from 700 - 1400 words. Thesis 102
introduction samples are those in the library of, University of Foreign Language Studies, the University of Danang and the University of Foreign Language Studies, Vietnam National University, Hanoi or published online. A total of 15 master’s theses are obtained from Australian universities in the field of linguistics through the thesis collection of The University of Queensland and through contacting both teachers and students directly in Australia. Authors of all theses in Vietnam are Vietnamese while authors of theses in Australia are varied in their native languages including English, Chinese, Indonesian, Swedish and Vietnamese. 3.2. Data Analysis
After collecting the data, these are categorized and divided into Australiansources and Vietnamese sources. The introductions are analyzed in terms of the syntacticand lexical features using both both qualitative and quantitative methods.For lexical choice, software named AntConc is used to count the tokens (the total number of words), and look inside that for the types (the number of repeated words). From this, it is possible to identify the range of words being used (type-token ratio) and the most frequently used words in the theses. 4. Results & Discussion
4.1. Syntactic Features
In this part, we would like to investigate some syntactic devices used in Australian thesis introductions (A-ELMTIs) and Vietnamese thesis introductions (V-ELMTIs), particularly passive voice and sentence types. 4.1.1. Voice in A-ELMTIs and V-ELMTIs
In English, the passive voice is a syntactic form in which the subject receives the action of a transitive verb, where the passive sentence emphasizes the process rather than who is performing the action [14]. Quirk [9] suggests that the passive voice is more commonly used in informative than in imaginative writing. The get-passive often reflects an unfavorable attitude towards the action [7]. Fortunately, only be-passive is found in our data as can be found in the examples in Vietnamese thesis #14 [V-14] and Australian thesis #4 [A-4]: (1) The fact that little research has been done on
discourse features of AdEs and little instruction has been
given about it in academic writing course in Vietnam
creates a need to have research on it. [V-14] (2) It was also found that the teacher tended to perceive
the classroom environment that was more positive than
they perceived as actually being the case. [A-4] Two types of passive voice are investigated in the study; passive with purpose and passive without purpose. In this paper, passive voice with purpose is a specific passive voice used when talking about the aims and objectives or placing the emphasis on the goal (e.g., I was fined 500.000 VND for speeding). Meanwhile, passive voice without purpose is a general passive voice which moves the emphasis from who is performing the action to the object or the process. (e.g., It is believed that the rising oil price will have a huge impact on food prices). Tran Thi Ngoc Phuong
Table 1. Distribution of Passive Voice in A-ELMTIs
and V-ELMTIs
Passive Voice
A-ELMTIs
V-ELMTIs
Occurrence
%
Occurrence
%
With purpose 36 11.4 54 18.6 Without purpose 279 88.6 237 81.4 Total
315
100
291
100
The rate of using passive voice for purpose in AELMTIs and V-ELMTIs is quite modest, accounting for 11.4% and 18.6% respectively. As observed and analyzed from the data, the majority of cases of passive voice with purpose are used to point out the aims or purposes to conduct the theses which are considered as an essential requirement for any author. For example: (3) This study was aimed at developing and then
observing the use of a computerized simulation as a
language teaching tool which is designed to help learners
to maintain motivation through their language study
through involving them in meaningful interactions, thus
encouraging learners to continue with their language
studies. [A-1] (4) The study is expected to investigate and describe
syntactic features, lexical features and cohesive devices
used in this type of discourse. [V-7] Meanwhile, in some cases, in order to write the introduction, authors tend to use the passive voice without purpose to emphasize the objects or certain things mentioned. That is also the reason for this kind of passive voice to be used very frequently in both ELMTIs, reaching 88.6% and 81.4% respectively. For example: (5) Action Research is also different to empirical research
which tends to be done by a researcher on “subjects” who
have little to do with the research process. [A-7] (6) Issues of personal, social, and cultural identity were
challenged every day. [A-6] (7) This absence of the mentioned above factors in
identifying and recognizing the information organizing
devices and the relationships between portion of pieces of
information will be compensated by resorting the linguistic
materials. [V-10] (8) This thesis is predicted to help learners and users of
English understand and use tautologies properly. [V-13] To sum up, in the current study, the passive voice is used predominantly to focus on the object rather than the goal or the performer of the action, which is a technique used quite regularly in academic writing. 4.1.2. Sentence Types
According to Thorne [12], sentence type includes four categories; simple sentences (consisting of one independent clause), complex sentences (containing one independent clause and one or more dependent clauses), compound sentences (containing two or more independent clauses joined together by a coordinator, conjunctive adverb or semicolon) and compound-complex sentences (a combination of two or more independent clauses and one or more dependent clauses). ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
Table 2. Distribution of Sentence Types in A-ELMTIs
Sentence Types
Simple Complex Compound Compound-Complex Total Sentences
160 285 69 77 591 Yet %
27.1 48.2 11.7 13.0 100 The results show that compound-complex sentences appear to be used rather modestly in A-ELMTIs, (i.e. 11.7% and 13.0% respectively),and simple and complex sentences are frequently used. It is quite surprising, however, that complex sentences are the most preferred in A-ELMTIs than simple ones, and that they account for the highest percentage of 48.2% while simple sentences make up a markedly smaller percentage of 27.1%. Table 3. Distribution of Sentence Types in V-ELMTIs
Sentence Types
Simple Complex Compound Compound-Complex Total Sentences
299 228 72 62 661 %
45.2 34.5 10.9 9.4 100 In contrast, in V-ELMTIs, compound and compoundcomplex sentences appear with modest percentages (i.e. 10.9% and 9.4% respectively),and simple sentences are the most preferred in V-ELMTIs, making up the highest percentage of 45.2% with complex sentences still accounting for a comparatively large proportion of 34.5%. 4.2. Lexical Choice
Alo [1] defines lexis as “…the level of linguistic analysis and description concerned with the way in which the vocabulary of a language is organized”. In linguistics, Yeibo [13] describes lexis as the storage of language in our mental lexicon as prefabricated patterns that can be recalled and sorted into meaningful speech and writing. Thus, lexis, as a concept, has a distinct identity from other traditional levels of linguistic study or interpretation, as it refers specifically to the word-stock of a language from which writers and speakers make choices for self-expression according to their purpose or intended meaning.For the purpose of this study, the following linguistic indicators defined by Swales and Feak [11] are used in the analysis: contrastive terms (i.e. however; yet; while/ meanwhile; but; although; nevertheless), quantifiers and quasi-negatives (i.e. limited; few; little) and negatives (none of; not been; no). 4.2.1. Contrastive terms
A concordance search is conducted and examined to determine the role of contrastive terms in the establishment of opposite statements, as listed in the table below. Table 4. Contrastive Termsused in A-ELMTIs and V-ELMTIs
Contrastive
Terms
A-ELMTIs
V-ELMTIs
Occurrence
%
Occurrence
%
28 33.7 35 50 However 23 27.7 16 22.8 Although 6 7.2 7 10 24 28.9 8 11.4 But While/ meanwhile
2 2.4 103
2 2.9 Nevertheless 0 0 2 2.9 Total
83
100
70
100
A significantly high usage of “but” is found in both A-ELMTIs and V-ELMTIs, making up 33.7% and 50% respectively. “But” usually signals two types of contrast: (i) “denial-of-expectation” (what is expected after a reading of the first conjunct turns out not to be true from a reading of the second); and (ii) the “marker of semantic contrast” (Celce-Murcia & Larsen-Freeman, [3]). “However” is another contrastive term used frequently in both ELMTIs with 23 instances (27.7%) in A-ELMTIs and 16 cases (22.8%) in V-ELMTIs, but this word alone does not guarantee a clear indication of the gap between issues. With nearly the same number of examples in A-ELMTIs and V-ELMTIs (6 cases and 7 cases respectively), “although” seems to be a popular choice after “but, however, while” for the expression of knowledge when the authors want to hedge the weaknesses identified in the already used research and point out what need to be studied. There is insufficient space to provide examples of all of the sentences types, but two of the more notable expressions are “yet” and “nevertheless”. There are only two cases each for A-ELMTIs and V-ELMTIs for “yet”, and an example of each is given below. (9) It is interesting that people use incomplete sentences in
conversations and even in written texts, yet they are still
successful in communication; and that a set of separate
sentences put together can make sense while correct sentences
connected by lots of cohesive devices cannot. [V-11] (10) Language loss research may be conducted in a
variety of way. It may be studied in its sociocultural,
political, pedagogical or psycholinguistic context; yet all
aspects will deal with the competence-performance
dichotomy as expressed in Chomsky’s model… [A-15] Two clear-cut cases of the use of “nevertheless” are found in V-ELMTIs while no cases are found in A-ELMTIs to express opposing ideas as in the following examples. (11) Nevertheless, the study of culture, especially crossculture, is not recognized well enough in Vietnam. [V-6] (12) Especially, all risks of medicine are enumerated in
advertisements so as to help people avoid unexpected
reactions and allergies. Nevertheless, it is sometimes
difficult to express medical terms in simple ways without
changing their meanings. [V-9] The reason for the lack of use of this expression in the Australian theses is not clear, but it could simply be a result of the sample size in the current study. 4.2.2. Quantifiers and quasi-negatives
According to Swales and Feak [11, p.258], the “most common way to indicate a gap is to use a ‘quasi-negative’ subject”. Quantifiers, such as the following, could be helpful in pointing out the shortcomings of the previous research and thus preparing ground to accommodate the current work. “Few” and “little”, although not morphologically negative, are negative in meaning and in 104
syntactic behavior. There is a different trend in using quantifiers and quasi-negatives in A-ELMTIs and VELMTIs, as shown in the table below: Table 5. Quantifiers and quasi-negatives used in A-ELMTIs
and V-ELMTIs
A-ELMTIs
Quantifiers and
quasi-negatives
Occurrence
%
Limited Few the following table. Table 6. Negatives used in A-ELMTIs and V-ELMTIs
Negatives
Occurrence
% 4 26.7 5 41.7 8 53.3 0 0 Little 3 20 7 58.3 Total
15
100
12
100
In particular, while “few” with a 53.3% occurrence seems to be at the top in A-ELMTIs, “Little” which is found with a 58.3% occurrence seems to be at the top in V-ELMTIs, no cases of “little” are found in the AELMTIs. Using “limited” is one way to show that other investigators’ work or the scope of the thesis has been limited in certain ways or to certain areas, and thus it is intended to be encompassed by the present research. The word “limited” appear four times in A-ELMTIs and five times in V-ELMTIs. Some examples of usage from the sample are given below: (13) Of the relatively few studies that have specifically
addressed the role of written autobiographical narrative,
Pavlenko’s (1998; also Pavlenko&Lantolf, 2000) research
is most relevant to mine. [A-11] (14) Many studies regarding the speech act of request,
giving and receiving compliments, promising or
addressing terms and so on have been carried out in
Vietnam and in other interlanguage of English learners of
different language backgrounds, but little attention is paid
to the speech act of complaining. [V-4] (15) However, research on the topic of language
chunks is limited, particularly compared with studies in
syntax, phonology, discourse and other aspects of second
language acquisition (SLA). [A-14] The role of limiting the scope of the respective areas being described is very clear from the above examples. It can be contrasted with the following section. 4.2.3. Negatives
The third category of the linguistic indicators studied in this data analysis is negatives. As Celce-Murcia and Larsen-Freeman [3, p.196] explain,“The chief use of negatives is directed at a proposition already in the discourse” and they are used more to respond than to initiate. They further elaborate that one might assume that the negative would receive prominent stress whereas it is reduced to mitigate the disagreement, presumably in the interest of maintaining social harmony. Negatives are generally known to be used for pinpointing something which is either faulty or has not been paid sufficient attention to. One would then assume the use of negatives as a natural choice to pave the way for one’s own work. Contrary to this speculation, the tendency of the usage of negatives is lower here when compared to that of conjunctions and quantifiers/quasi-negatives, as shown in V-ELMTIs
Occurrence
%
Occurrence
% 0 0 0 0 Not been 2 100 3 100 No 0 0 0 0 2
100
3
100
None V-ELMTIs
A-ELMTIs
Total
“None” and “no” do not appear in any of the thesis introductions, while “not been” occurs twice in A-ELMTIs and three times in V-ELMTIs. For example: (16) There have not been a great number of
computerised simulations documented to date, but the
reactions of learners to the ones that have been utilised
have been very positive so far. [A-1] (17) In other words, complaining in an area that has
not been researched much. [V-4] It might be thought that the use of “none” and “no” are too definitive, indicating that there are absolutely no examples of research that have been conducted before. In both of the examples above, “not been” has been softened through the use of “a great number” and “much” respectively, suggesting that there are studies that have been carried out before, although these may not necessarily be described in the introduction. 5. Conclusion
This study describes an analysis of the syntactic and lexical features of master’s thesis introductions written in English in Australia and Vietnam to identify if differences exist in ELMTIs written in these two different environments. With regard to syntactic features, it is evident that the largest differences are in the usage of simple and compound sentences. Simple sentences are used with far greater frequency in V-ELMTIs than in A-ELTMIs, whereas there is more use of complex sentences in A-ELTMIs. With regard to lexical choice, both ELMTIs in Australia and Vietnam use a specific number of “contrast terms”, “quantifiers and quasi-negatives” as well as “negatives” to express opposite statements among related issues. In particular, A-ELMTIs use a higher proportion of “contrast terms” and “quantifiers and quasi-negatives” than those in V-ELTMIs, namely “contrast terms” and “negatives”, which are used at a very low rate in both. Thesis writing is a specialized form of writing requiring knowledge of not only vocabulary and syntax but also of discourse features. While similar findings appear in other types of documents [9], it should be pointed out that the purpose is not to distinguish ELMTIs from other genres, but rather to shed light on thesis introductions written in English in different environments.Through investigating the discourse features of A-ELMTIs and V-ELMTIs, learners of English who intend to pursue a master’s degree in English linguistics can gain a better understanding of how to write their theses and of the potential variations that might exist. It is hoped the research can contribute to our knowledge of typical discourse features in writing of this kind. ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
REFERENCES
[1] Alo, M. (1995), Applied English Linguistics: An Introduction, PortHarcourt. Aeddy Link. [2] Brown, G. &Yule, G. (1983), Discourse Analysis, Cambridge University Press. [3] Celce-Murcia, M. & D. Larsen-Freeman (1999), The Grammar Book, 2nd ed. Boston: Heinle and Heinle. [4] Choudara, R. &Kono, Y. (2012). Beyond more of the same: The top four emerging markets for international student recruitment. World
Education News & Reviews, 25 (9). Retrieved from http://papers.ssrn.com/sol3/papers.cfm?abstract_id=2187362. [5] Cook, G. (1998), Discourse, Oxford University Press, Oxford. [6] Halliday, M.A.K. & Hasan, R. (1989), Language, context, and text. Oxford University Press, Oxford, UK. [7] Nunan, D. (1993), Introducing Discourse Analysis, Penguin English. 105
[8] Pennycook, A. (2013). The Cultural Politics of English as an International Language. Routledge, New York. [9] Quirk, R et al. (1985), A Comprehensive Grammar of the English Language, London: Longman. [10] Salkie, R. (1995), Text and Discourse Analysis, Routledge, London & New York. [11] Swales, J.M. & C. Feak (2004), Academic Writing for Graduate Students. Essential Tasks and Skills, 2nd ed. Ann Arbor: The University of Michigan Press. [12] Thorne, S. (1997), Mastering Advanced English Language, Macmillan press. [13] Yeibo, E. (2011), “Patterns of Lexical Choices and Stylistic Function in J.P. Clark-Bekederemo’s Poetry”, International Journal
of English Linguistics, 1 (1), 138. [14] http://en.wikipedia.org/wiki/English_passive_voice#Usage_and_style (The Board of Editors received the paper on 05/10/2015, its review was completed on 20/01/2016)
106
Ho Trinh Quynh Thu
MOVEMENT TERMS IN ENGLISH AND VIETNAMESE CONCEPTUALLY
METAPHORICAL EXPRESSIONS OF LOVE
Ho Trinh Quynh Thu
PhD Candidate, University of Foreign Language Studies, The University of Danang; hotrinhquynhthu@yahoo.com
Abstract - Movement has a tremendous impact on human actions
and thoughts because it is closely attached to our daily activities. As
a result, terms of movement play an important role in expressing
changes in both physical and emotional worlds, including love. Love
becomes more vivid and diversified thanks to the terms of movement,
which is a result of our investigation under the light of the conceptual
metaphor theory raised by Lakoff and Johnson. Examining more than
700 terms of movement in metaphorical expressions of love
extracting from 254 English poems and the same number of
Vietnamese ones, we have found out that all the key conceptual
metaphors of love are similar between English and Vietnamese.
Interestingly, a lot of linguistic metaphors are also the same in the
two languages. These resemblances may be put in plain words by
the universality of metaphor. However, coming from two different
cultures, some terms of movement in metaphorical expressions of
love are found different between English and Vietnamese.
concepts’ [5]; and that ‘locus of metaphor is thought’ [8]. It is pervasive in our everyday way of thinking, speaking and acting [8]. Metaphor in the light of cognitive view is called cognitive or conceptual metaphor. Its working mechanism is a cross-domain mapping which is defined as “a fixed set of ontological correspondences between entities in a source domain and entities in a target domain” [7; 8]. The cognitive mappings of metaphors are tightly structured, asymmetric, unidirectional, partial based on daily experience and have a definite structure: TARGETDOMAIN IS/AS SOURCE-DOMAIN [8] (Figure 1). Key words - metaphor; conceptual metaphor; metaphorical
expressions; movement terms; English; Vietnamese
1. Introduction
While other sciences study the nature and the operation mechanisms of love, linguistics studies how the concept of love is expressed via language. In fact, for lack of an adequate vocabulary to clearly explicate and discuss the abstract idea of love, our language utilizes metaphors that draw from concrete experience as a means to relate this emotion in understandable terms [3]. Love is thus perhaps the most highly “metaphorized” emotion concept and more and more attractive to researchers. Based on the conceptual metaphor theory raised by Lakoff & Johnson [9] and the typical English love metaphors Lakoff & Johnson [9], Lakoff [8] and Kövecses [3] offer, the conceptual metaphor of love has been more examined in monolingual (i.e. English, Chinese, Hungarian, Vietnamese,...) or bilingual (i.e. English versus such another as Chinese, Persian or Vietnamese) data in different registers (e.g., psychology, literature in general, poetry, song lyrics, …). Several researches have also proved the universality and variation of the conceptual metaphors of love in different languages [4; 13; 14]. However, we have not found any study relating to movement terms metaphorically used to conceptualize love, which will be studied in details in this paper. Among many senses of love, romantic love - the love between male and female - provides one of the most powerful motivations for human action [1]. Therefore in the limitation of this research, we only focus on investigating this kind of love. 2. Theoretical background
2.1. Metaphor and metaphorical expressions
Unlike traditional views treating metaphors as a linguistic phenomenon, a product of outstanding talents, cognitive approach shows that metaphor is a ‘property of Figure 1. Conceptual mapping
In the mapping, linguistic metaphors (or metaphorical
expressions) are what expressed by language; and conceptual metaphor (or metaphorical concept) refers to a mental representation describing how two words or expressions from apparently different domains may be associated at an underlying cognitive level. Let us consider the instance of the metaphor LOVE IS/AS A JOURNEY. In this metaphor, “LOVE IS A JOURNEY” is the name of the mapping or conceptual metaphor; LOVE is the target domain, JOURNEY is the source domain; such sentences as We can’t turn back now [8] and Đôi ta lên thác xuống gềnh
(Ca dao) (We are up hill and down dale) [14] are individual linguistic metaphors or metaphorical expressions. 2.2. Identification of metaphorical expressions
Identification of linguistic metaphors is an important step in the procedure for studying metaphors because to know the existence of conceptual metaphors in a discourse, we need to know which linguistic metaphors point to them [5]. It helps ensure the reliability and validity of the study results. In this study, we will apply the approaches to metaphor identification raised by Pragglejaz Group [11] and the extension of Pragglejaz’s procedure including four steps: (1) Read the entire text–discourse to establish a general understanding of the meaning. Next, (2) determine the lexical units in the text–discourse. Then (3) take into account what comes before and after the lexical unit, determine if it has a more basic contemporary meaning in other contexts than the one in the given context. If yes, decide whether the contextual meaning contrasts with the basic meaning but can be understood in comparison with it. If yes, (4) mark the lexical unit as metaphorical. ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
107
3. Research methodology
organism, container and unity. 3.1. Data collection
The data for investigation are collected from eight English and Vietnamese poetry books with 254 poems in each language. They are all about love, the matter we are interested in and possibly regarded as equivalent in composing time (during the 20th century). In English, they are Love poems by Jason Sturner, Love poems (vol.1) by Bobette Bryan, Love poems by Nicolas Gordon, Heart clips by Alan Harris and A collection of 100 greatest poems by many authors. In Vietnamese, there are Bởi vì ta yêu nhau by many authors, Thơ tình nữ thi sĩ Việt Nam by Kiều Văn, Xuân Diệu: Ông hoàng của thơ tình yêu by Hà Minh Đức. 4.2. Discussion
4.2.1. Terms of movement in English and Vietnamese
metaphorical expressions of love
3.2. Research methodology
To carry out this study, we employ descriptive, statistical and comparative methods. They helps us analyse, understand and synthesize love metaphorical expressions, discover the cultural features that have an effect on expressing love metaphors and determine the similarities and differences of love metaphorical expressions between English and Vietnamese. 4. Findings and Discussion
4.1. Findings
After investigating the poetry books above, we find over 700 metaphorical expressions of love (encompassing 366 English and 360 Vietnamese ones). They are rather diversified and manifested in Tables 1 and 2. Table 1. Word classes (WCls) expressing movement
in English love metaphorical expressions
WCls
No
Expressions
course, drip, flow, instil, stir, swirl, lock, catch, release, melt, consume, drift, stop, go, come, enter, back, bend, depart, dip, lose, Verb 244 miss, bear, sail, scale, wait, roam, alter, reach, give, receive, accept, soar, step, run, move, follow, pound, linger, … turn, turning, journey, giving, exchange, Noun 11 conceal, parting Adjective 5 wandering, slow, unreachable, given Preposition 22 into, off to, past, through, from … to, down, across free from, channel through … into, fall in, take …
Others 84 to, skip a beat, fall apart, go away, break from,
betray … out of, bring … to, carry off, come off,…
Table 2. Word classes (WCls) expressing movement
in Vietnamese love metaphorical expressions
WCls No
Expressions
thả, vuột khỏi, chắt lọc, chảy, chìm, chuốc, lạc, cuộn,
dốc, hút, tát, tràn, ngả nghiêng, luyến, rơi, xuống,
Verb 252 xuôi, trộn, đi, đến, ở lại, ùa, đuổi, xuyên, ẩn, bỏ, chạy,
chờ, nằm, nâng, ở lại, ra đi, rón rén, sinh sôi, về, trao,
bước, dẫn dắt, chen, đỗ, đợi, gặp, nổi trôi, ra… Noun 2 quán tính, chuyến hành trình Adjective 8 ào ạt, bất biến, chậm thổi bùng, xoay tròn, chìm lặn, băng qua, bỏ … Others 98 đi, bước (đến, lùi, ra, tới, vào, xuống), cưỡi sóng, tan vào, đi cùng, đưa về, len vào, quay trở lại,… Underlying these expressions are five major conceptual metaphors of love in both English and Vietnamese. They include the source domains namely object, journey, living Movement is defined as the act or process of moving; especially, change of place, position or posture [2]. In this part, we focus on discussing how movement terms are used in linguistic metaphors of love. First, let look at the following example, (1) And love burst into bloom, with a very special fragrance (Martin Johnson, Surprised by love) In this verse, the verb “burst” describes the process of changing love shape. The preposition “into” perhaps makes a decisive contribution to this change and the final product is bloom. It is movement. The movement may change the look (as in example 1) and the structure inside as well. (2) There's a batch of romance now simmering in the heart (Jason Sturner, A holiday for the heart) It is interesting to find that via the conceptual metaphor LOVE IS A CONTAINER, the love in (2) is expressed as some fluid that is filled in the heart by the term “simmer”. This verb is additionally defined as to cook something so that it is almost boiling [2]. As such, love here may also be conceptualized as fire. When it is said to be simmering, the love is gradually changing its inner structure and towards a complete alternation of its appearance. In other words, the movement of the elements inside love produces the changes of its posture. Yet, it is difficult to realize this moving process until the final product appears. Contrary to this type of movement, the act of moving from one place or position to another may be easier to realize. Following are some such instances. (3) Love loves not lust, but finds its joy in giving: Pleasure, yes, but passion slowly fades. (Nicholas Gordon, Please don’t mind) (4) We do not need gold coins when love comes without cost (Jason Sturner, About love) (5) We fell in love the best way, sight unseen Pure hunger than nor feast nor flesh could sate, Two hidden flames fair fed by phrases burning (Nicholas Gordon, We met…) (6) The dream seemed impossible, far away ... unreachable. (Bryan B., Sailing On Dreams of You) In all four stanzas above, there are changes of position of love or of the persons in love. In (3) and (4), love is personified, so it can come and find its joy in giving. Both the noun “giving” and the verb “come” imply changed positions. If the position of love in (3) alters when it is given from one to another, the love in (4) changes its place by itself. Meanwhile, the movement in (5) and (6) is done by the persons who are in love; and love is the destination they like to reach. The phrasal verb “fall in” describes a 108
Ho Trinh Quynh Thu
process of moving from a higher position toward the inside of something lower. Accordingly, someone falls in love, which arouses an image of that he is sinking inward love. However, whether the result of this love is the goal the couple arrives at or it is just a dream that is never reachable as in (6). The missing feeling appears to be a general state of mind that everybody in love may experience once they cannot have their expected love, which explains the reason why we can also find it in Vietnamese. (7) Dẫu biết lòng vẫn yêu em Nhưng anh đã đi sau một bước. Anh không nỡ làm khổ đau người đến trước. Đành hẹn em thôi ở kiếp sau này. (Though my heart still loves you, I have to make a promise for the next life to see you first. I decide to give this opportunity to the person coming to you before me) (Thanh Tùng, Đành hẹn) Moving terms in this verse are applied to relate lovers’ acts, including the verbs đi (go) and đến (come). When they are in love, the couple always dream of going with each other to the end of their lives. Nevertheless, just a slowpaced step, the dream vanishes, the opportunity has belonged to another. It can be said that an everlasting love is always couples’ desires; however, everything sometimes seems unlike the expectation: (8) Khi tất thảy sự si mê đã hết Chợt thấy trái tim em Như hòn cuội bẽ bàng Anh lia nó vào bên đường cát bụi Ai nhặt nó lên như trái tim vàng? (When all passion runs out, I feel ashamed that my heart is like a stone you’ve thrown to a dusty roadside; but regarded as a gold heart, it is picked up by another.) (Nguyễn Thị Thu Hương, Ai?) The image “heart” is a symbol of love in many different cultures. It stands for the woman’s love in this stanza. This love has just completed an unexpected travel from a man’s hand to the roadside and finally to another man’s hand. Thanks to the words lia … vào (throw to), nhặt … lên (pick up), we can catch a passive movement the love experiences. Anyway, the end of this love’s journey is fairly good; therefore, let receive it without hesitation. (9) Hãy yêu đi khi tình yêu đã đến (Let’s love once love arrives) (Thanh Tùng, Yêu để đời thêm yêu) Different from (8) where it can only change its position due to the impact from its outside, the love in (9) can move without any help. Structuralized as a living organism, love can come. It is verb “đến” (arrive) that gives us such comprehension. As mentioned above, everyone always desires for an eternal love where they are able to live forever with their beloved. Also in this aspiration, Xuan Dieu conceptualizes love as a unity of wave and shore in which he is waves. (10) Anh xin làm sóng biếc (…) Cũng có khi ào ạt Như nghiến nát bờ em (I wish to be waves (…) sometimes impetuous as if they could grind the shore into flour) (Xuân Diệu, Biển) The Vietnamese adjective “ào ạt” (impetuous) in these lines refers to strong and quick movement. This adjective, on the one hand, tells us one of the features of waves, corresponding to the impetuosity of a man in love. On the other hand, “ào ạt” represents the man’s violent love for the woman he loves. In general, movement terms are used in metaphorical expressions of love are popular in both English and Vietnamese poetry. Due to these terms, love becomes diversified and more concrete. There are many similarities found in English and Vietnamese movement terms used for love expressions. However, born in different cultures, these terms relatively vary in the both languages. We will discuss these problems right in the next part. 4.2.2. Universality and variation of using movement terms
in English and Vietnamese love metaphorical expressions
The act of moving can be found in both English and Vietnamese metaphorical expressions of love. The word kind mainly used to describe movement is verb (66.67 percent in English and 70 percent in Vietnamese) though we also discover some other classes of words employed for movement in love linguistic metaphors (see Tables 1, 2). As mentioned above, movement terms used in linguistic metaphors mainly belong to five concepts in both English and Vietnamese including object, journey, living organism, container and unity (see Table 3). Interestingly, object and journey are two concepts topping the others in both languages. Object is used the most frequently in English and ranks second in Vietnamese. Conversely, journey tops in Vietnamese and follows object in English. These analogies may be illuminated by the universality of conceptual metaphors. Table 3. Five major conceptual metaphors for love
in English and Vietnamese
LOVE IS …
OBJECT JOURNEY LIVING ORGANISM CONTAINER UNITY OTHERS ENGLISH
frequency % 124 33.88 105 28.68 VIETNAMESE
frequency % 102 28.33 121 33.61 63 17.21 31 8.61 24 11 39 6.56 3.01 10.66 29 44 33 8.05 12.22 9.17 Surprisingly, besides the source domains, English and Vietnamese also share linguistic metaphors of love that contains movement terms. They may be the motion verbs (e.g., go – đi, come – đến, run – chạy, bring – mang đến…) utilized to personify love; for example, (11a) Love … comes and goes as it decides (Nicholas Gordon, Love is like cat) (11b) Tình yêu đến, tình yêu đi, ai biết! (One guesses if love comes and goes!) (Xuân Diệu, Giục giã) ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
Love is additionally conceptualized as an object whose position may be changed by the actions of sending, giving,
receiving, taking in English and cho, gửi, trao, tặng, nhận,
lấy in Vietnamese. (12a) I give you my heart (Bryan, True love) (12b) Ngậm ngùi tặng trái tim lưu lạc (Grieved at giving you my drifting heart) (Xuân Diệu, Muộn màng) Beside the similarities, there still exist some differences in using movement terms between English and Vietnamese love metaphorical expressions. They may be results of the distinctions of customs, habits and lifestyles that poets in different cultures go through. Although two languages share the same conceptual metaphors, their frequency is not the same (see Table 3). As mentioned above, while OBJECT metaphor ranks first in English with 33.88 percent, it ranks second in Vietnamese with 28.33 percent. The leader in Vietnamese is JOURNEY metaphor (making up over 33 percent), but it follows OBJECT metaphor in English with 28.68 percent. The third frequent metaphors are LOVE IS A LIVING ORGANISM (accounting for 17.21 percent) in English and LOVE IS A UNITY in Vietnamese (over 12 percent). These differences may be caused by cultural distinction. Influenced by industrial culture, the Westerners (including Northern American and Western European) are usually in favour of materialism. This explains why the largest part of English love metaphorical expressions comes from the source domain of object. On the other hand, Western cultures conceive love as personal and internal experiences [12]. It is the result of a person’s private wishes and desires; that is, love is coveted by virtue of a person’s personal benefit. In consequences, once this benefit is not met, love will no longer exist; and the two persons in love will also not be a couple as a unity. Meanwhile, the Vietnamese believe in God and fate [10]. When two persons are in love, they think it is their predestination. They are bound together in love and marriage with a red thread by matchmaker God. Therefore, they tend to make every effort to maintain their relationship despite any difficulties or obstacles. It may be the reason for journey and unity metaphors to be more common in Vietnamese poetry. In addition, examining the love metaphorical expressions, we discover some interesting distinctive characteristics between English and Vietnamese. Let us look at the following extract as an example where Vietnamese love does an action that cannot be found in English; (13) Lòng ta hãy ôm trong như giếng tạnh Nước vẫn sâu khơi mà bờ vắng lạnh; Tình! Chính ngươi đến soi mặt, êm sao! Thả gàu múc nước, rúng trăng sao. (My heart is like a well deserted but with fresh water; Love! you come with it to look your face, which makes me pleasant; but your scooping water makes a disturbance here) (Xuân Diệu, Con sáo sang sông) 109
The actions of “đến soi mặt” (coming to look at its face in a well) and “thả gàu múc nước” (scooping water out of a well) are imbrued with Vietnamese culture. Along with banyan-tree and public court, well is very important and characteristic in Vietnamese traditional villages; it is also the beginning place of love [15]. As a result, it cannot seemingly be found anywhere accept Vietnam. 5. Conclusion
As an abstract domain, love is fairly variably described thanks to metaphors with movement terms in both English and Vietnamese. A majority of these terms are expressed by verbs. Because of the universality of metaphor, love is uncovered to be conceptualized in five similar source domains in the two languages namely object, journey, living organism, unity and container. Besides the same conceptual metaphors, both languages also share many linguistic metaphors, which can be explained by Kovecses’s [6] argument: ‘there may be some universal basis for the same metaphors to develop in the diverse languages’. Despite the universality of love conceptual metaphors in English and Vietnamese, there are still some variations. While following the OBJECT in English, JOURNEY metaphor is the leader in Vietnamese. In addition, some terms of movement used in Vietnamese love metaphorical expressions are not found in English. These differences can be regarded as results of cultural distinctions. REFERENCES
[1] Bartels A. and Zeki S., “The neural correlates of maternal and romantic love”, Neuro Image, 21, 2004, 1155– 1166. [2] Encyclopedia Britannica Company, Merriam-Webster Collegiate
Dictionary, 11th Edition, 2010. [3] Kövecses Z., Metaphor and Emotion: Language, Culture, and body in human feeling, Cambridge: Cambridge University Press, 2000. [4] Kövecses Z., “Universality and Variation in the Use of Metaphor”, The 2006 and 2007 Stockholm Metaphor Festivals, Eds. Johannesson & Minugh, 2008, 51–74, Stockholm: Department of English, Stockholm University. [5] Kövecses Z., Metaphor: A Practical Introduction, 2nd Edition, Oxford: Osford University Press, 2010. [6] Kövecses Z., “Metaphor and Culture”, Acta Universitatis
Sapientiae, Philologica, 2(2), 2010, 197-220. [7] Lakoff G., Women, Fire, and Dangerous Things: What Categories Reveal about the Mind, University of Chicago Press, 1987. [8] Lakoff G., The Contemporary Theory of Metaphor, Second Edition, Cambridge: Cambridge University Press, 1993. [9] Lakoff G. and Johnson M., Metaphors We Live By, The University of Chicago Press, 1980. [10] Norenzayan A., Lee A., “It was meant to happen: explaining cultural variations in fate attributions”, J Pers Soc Psychol, 98(5), 2010, 702-720. [11] Pragglejaz Group, “MIP: A Method for Identifying Metaphorically used Words in Discourse”, Metaphor and Symbol, 22(1), 2007, 1-39. [12] Tessari H., “Love in words: Experience and conceptualization in the modern English lexicon of love”, Perspectives on Variation: Sociolinguistic,
Historical, Comparative, Delbecque N., Auwera J. & Geeraerts D. (ed.), 2005, 143-176, Berlin & New York: Mouton de Gruyter. [13] Zitu Lv., “Universality and Variation of Conceptual Metaphor of Love in Chinese and English”, Theory and Practice in Language
Studies, Vol. 2, No. 2, 2012, 355-359. [14] Phan Văn Hòa, Hồ Trịnh Quỳnh Thư, “Ấn dụ ý niệm ‘Tình yêu là cuộc hành trình’ trong tiếng Anh và tiếng Việt”, Tạp chí Ngôn ngữ
và Đời sống, 9(191), 2011, 15-19. [15] http://vanhoagiaoduc.vn/bao-van-hoa-giao-duc-thu-vi-gieng-lang-13265.html (The Board of Editors received the paper on 01/15/2016, its review was completed on 03/23/2016)
110
Le Thi Phuong
IDENTIFICATION OF THE FREQUENCY OF DRUG RESISTANCE MUTATIONS
OF HELICOBACTER PYLORI IN GASTRIC PATIENTS IN HAI DUONG
PROVINCIAL GENERAL HOSPITAL
Le Thi Phuong
Hai Duong Medical Technical University; phuongsinh@ymail.com
Abstract - In this study, 131 gastric biopsies were taken from patients
with gastritis who came to Hai Duong Provincial General Hospital for
examination and treatment by request from January 2015 to July 2015
and they met the criteria: i) aged from 18-80; ii) infected with chronic
gastritis, ulcer or gastric cancer; iii) not using antibiotic for a month
before endoscopy. These patients were taken for endoscopy to have
endoscopic biopsy samples at the antrum, body and edge of the
gastric ulcer, organizations suspected of contracting stomach cancer.
These DNA gastric biopsies were extracted and the 23S rRNA gene
was amplified to detect Helicobacter pylori (H.pylori). The 23S rRNA
gene in patients with H.pylori positive was sequenced to determine
mutation related to anti-drug of H.pylori. The results have shown that
58 of 131 (44.2%) gastric patients were infected with Helicobacter
pylori and 15 of 58 (25.8%) patients with Helicobacter pylori infection
were found to have mutations.
2.2. Methods: Cross - sectional study
Key words - Mutation; Helicobacter pylori; Drug Resistance;
Frequency; Gastric Ulcer.
DNA was extracted by improved conventional methods in accordance with our lab’s conditions. The steps were performed as follows: the samples were crushed into flour, added 100 µl of LB (lysis buffer) to break up the cells, incubated at 370C for an hour; added 2.5 µl protease K (20mg/ml) and incubated at 560C overnight (8-16 hours); added a volume of 200 µl solution of CH3 COONH4 7.5M, incubated at 40C for an hour; centrifuged 12,000 rpm, at 4 0C for 30 minutes; collecting the solution in the upper part (repeating this steps two times); added 500 µl of 96% ethanol (stored in cold), samples were stored at -200C for 2 hours; centrifuged at 12,000 rpm, stored at 40C for 30 minutes; precipitated; added 500 µl of 70 % ethanol (to wash the collected precipitate), centrifuged at 12,000 rpm, at 40C for 20 minutes; precipitated; samples were dried at the temperature of the room. 1. Introduction
Gastritis is a pathological condition that is relatively clear, causing mucosal irritation by exogenous or endogenous factors. H. pylori is known as a major cause or culprit of chronic gastritis, peptic ulceration and is the strongest known risk factor for gastric cancer, especially in developing countries [5, 7]. Many studies have shown that H. pylori is the leading cause of pre-gastric cancer and gastric cancer [8]. People with H.pylori infection increase the risk of gastric cancer 6 times higher than normal people. In recent years, gastric diseases related to H. pylori have been treated by using a regimen of anti- acid secretion and antibiotic in Vietnam as well as many countries in the world. In fact, the appearance of drug - resistance of H.pylori strains has reduced the effect of drug eradication, so many patients were in the wrong treatment of H.pylori eradication or incomplete treatment. Amoxicillin (Amox) and Clarithromycin (Cla) are frequently used in the treatment of H.pylori eradication (Dr. Nguyen Van Thinh, 2010 - Hospital of Post and
Telecoms), 23.7 % were found drug - resistant of H.pylori, much higher than other countries in Europe, America, West Asia, Hong Kong, Japan, and a little higher than Korea [4, 6]. It is quite necessary to apply modern biomedicine techniques as PCR to determine the antibiotic resistance of H.pylori strains to have effective treatment. 2. Subjects and methods
2.1. Subjects
131 patients were examined by request from January 2015 to July 2015 in Hai Duong Provincial General Hospital and met the criteria: i) chronic gastritis, gastric ulcer or gastric cancer. ii) not using antibiotic for one month before endoscopy. 2.2.1. Sampling process
131 patients were taken for endoscopy, then images of endoscopy were taken to determine the types of gastritis as: chronic gastritis, gastric ulcer, gastric cancer. The endoscopic biopsy samples were taken at the antrum, body and edge of the gastric ulcer, organizations suspected of contracting stomach cancer. The biopsy samples were stored in liquid nitrogen at 20 0 C or -700 C until research.
2.2.2. DNA extraction
The precipitate was dissolved in 30 µl of TE buffer and the samples were stored at -200C. After DNA extraction, the agarose gel electrophoresis was used for DNA qualitative analysis. 2.2.3. PCR amplification of 23S rRNA to identify the point
mutations of H.pylori
The 23S rRNA fragment gent was peculiarly amplified for two purposes: i) to determine H.pylori. ii) to analyse and determine resistant mutations of H.pylori to Cla by DNA sequencing. PCR was performed with 1- 10 mg of genomic DNA containing the specific primer pairs and components of reaction. 2 µl DNA (1-10 ng) was added into the 23-μl reaction mixture for H. pylori-specific 23S rRNA gene amplification. Forward: 5’-CCACAGCGATGTGGTCTCAG; Reverse: 5’- CTCCATAAGAGCCAAAGCCC (F: positions 1891-1911; R: positions2200–2220). The thermal cycler used was set at 940C for 5 minutes ISSN 1859-1531 - THE UNIVERSITY OF DANANG, JOURNAL OF SCIENCE AND TECHNOLOGY, NO. 6(103).2016
0 in the first round; 35 cycles consist of: 1 min. at 94 C, 45 sec. at 560 C, 1 min. at 720 C. The last round was set for 10 minutes. at 720C. PCR products were analysed on Agarose gel 1.2%, 0.5 xTBE buffer. 2.2.4. Analysis of point mutations in bioinformatics program
Agarose gel electrophoresis 1.5% was used to check PCR products, 0.5xTAE buffer and cleaned with QIAquick PCR purification Kit (Qiagen, Valencia, CA, USA). PCR sequencing was performed with Macrogen (Korea). 3. Results
111
3.3. Amplification and sequencing the 23S rRNA for
H.pylori infection identification
Of 131 patients who were examined in Hai Duong Provincial Hospital, the results of PCR show 58 DNA samples with positive, 58/131 patients with H.pylori infection (H.pylori infection incidence was 44.2%). DNA fragments were amplified, directly sequenced and scanned by the BLAST program to determine if there was H.pylori origin. For instance, PCR products of the patient ID 199 were 99% similar to the 23S rRNA gene sequences in 52 H.pylori strains. 3.1. Total of DNA extraction Total of gastric biopsy specimens of patients with gastritis who were DNA extracted in Hai Duong Provincial General Hospital were checked on agarose gel 1.2%. Figure 1 shows the light trails on agarose gel 1.2% after electrophoresis as a result of being DNA extracted from specimens. The bands in most lanes were bright and clear with molecular size of larger than 10 kb, which has shown high purity of being extracted DNA and less prone. Figure 3. The 23S rRNA fragment sequence
3.4. Searching for resistant mutations to Cla by using
bioinformatics method
Figure 1. Agarose gel electrophoresis of total DNA products
extracted from samples
M: 1kb DNA ladder; 1→ 16: total DNA samples The results show that obtained products can be guaranteed for both quality and quantity in further studies. 3.2. PCR reaction
The 23S rRNA gene fragment which was amplified from DNA biopsy samples on agarose gel 1.2% was a band of about 400 bp in size; there might have 3 bands in many cases (Figure 2). Because of the specific character of the 23S rRNA which carried a lot of repeated fragments, PCR products together formed different complexes. 1 2 3 4 5 6 7 8 M 9 10 11 12 13 14 15 Figure 2. Checking PCR products of the 23S rRNA
with agarose gel electrophoresis
M: DNA standard ladder 100 base pairs; Positive samples: 3,4,5,6,7,8,12,13,15; Negative samples: 1,2,9,14. Many studies have shown that there were 3 points of resistant mutations at 2142 (A2142G and A2142C) and at 2143 (A2143G) in the peptidyl transferral of the 23S rRNA gene [2].
We used the method of revealing point mutations in the 23S rRNA to identify Clarithromycin resistance. However, we could not make antibiogramme due to severe infection among bacterium. Bacterium did not continue to develop; they only existed in the coccoid form. The resistant mutations to Cla at A2143G were present in 20.6% (12/58) and T2182C were present in 5.2% (3/58) (Figure 4) by using DNA test and bioinformatics. Hence, the incidence of both mutations was 25.8% (15/58). These mutations decreased the association with drugs, the mutation at A2143G made resistant bacteria to Clarythromicin at a high level (4 µg/ml). Figure 4. A2143G and T2182C in the 23S rRNA resistance to
Cla were found in H.pylori strains isolated from patients
There were not any resistance mutations to Cla in H.pylori, so they were sensitive to Clarithromycin (74.2%). Therefore, Cla is still used to eradicate H.pylori at present. 112
Le Thi Phuong
Figure 5 shows the results of the 23S rRNA fragment gene sequence from antidrug patients with H.pylori infection. Duc Toan (2012), the number of mutations at A2143G was 33.3%; there were not any mutations at A2142G [3]. One of the most concerned issues is multi drug resistance (MRD). Currently, the prevalence of MRD tends to increase, a major cause of treatment failure. However, our study in Hai Duong shows that there was only Cla resistance,not Amox resistance in patients. Therefore, it is very important to design regimens for patients with H.pylori infection in Hai Duong. 4. Conclusion
3.5. The results on the prevalence of H.pylori resistance
to antibiotic
Of 131 gastric patients came to Hai Duong Provincial General Hospital for examination and treatment, 58 patients (44.2%) were found H.pylori infected. The 23S rRNA gene fragment from patients with H.pylori infection was sequenced to detect Cla resistance mutations. The frequency of A2143G mutation was found in 12 of 58 patients (20.6%) and T2182C in 3 of 58 (5.2%). The number of patients with H.pylori infection did not carry Cla resistance mutations was 74.2%. Hence, Cla is still used to eradicate H.pylori at present. Table 1. The prevalence of patients carried mutations
in the 23S rRNA gene (resistance to Cla)
REFERENCES
A2143G mutation
Figure 5. The results of the 23S rRNA gene sequence from
samples with positive mutations
Results Patients carried mutations Rates % Non-mutations 43/58 74.2 Mutations 15/58 25.8 Total 58 100 Hence, the number of H.pylori resistance to Cla was 25.8% in Hai Duong. The figure was higher than that of 5.5 % in the study by Nguyen Thuy Vinh et al (2004, Hanoi), but lower than that of 38.5% in the study by Le Dinh Minh Nhan et al (2006, Ho Chi Minh City). However, our study results were in accordance with studies in Asia. The number of Cla resistance increased from 12.8% up to 23.8% (from 2000 to 2009 in China), from 7.00% up to 15.2% in Japan, from 7.6% up to 18.6% in Korea [1, 9]. Hansomburana et al (Thailand, one of South Esat Asian countries) reported that the prevalence of mutations was the most common at A2142G (36.4%) and 18.2% of H.pylori strains simultaneously carried two mutations. The study by Abadi A.T et al in Iran (2011) detected 93.7% mutation resistance to Cla at A2143G and 3.1% mutations at A2144G, but not any H.pylori strains simultaneously carried two mutations. The studies in Viet Nam showed that mutations were primary at A2143G. According to the study by Nguyen [1] Kim Jung Mogg1, Joo Sung Kim, Nayoung Kim, Yeoung Jeon Kim, In Young Kim, Young Joon Chee, Chul-Hoon Lee, and Hyun Chae Jung, 2008. Gene Mutations of 23S rRNA Associated with
Clarithromycin Resistance in Helicobacter pylori Strains Isolated
from Korean Patients. J. Microbiol. Biotechnol. 18(9), pp.1584-1589. [2] Mégraud Francis and Lehours Philippe, 2007. Helicobacter
pylori Detection and Antimicrobial Susceptibility Testing. Clin Microbiol Rev. 2007 Apr; 20(2): 280-322. [3] Nguyen Duc Toan, Nguyen Van Thinh, Nguyen Thi Nguyet, Nguyen Thi Hong Hanh, Duong Thu Huong, Ta Long, Le Huu Song, 2012. The circumstances of antibiotic resistance of Helicobacter
pylori in patients with gastritis and peptic ulcer. Vietnamese Journal of Science and Digestion, 7(27), pp. 1783-1788. [4] Nguyen Thi Hong Hanh, Nguyen Thi Nguyet, 2004. HP1125
variants. Genetics and Applications, (3), pp. 5 -10. [5] Nguyen Thi Nguyet and Nguyen Thi Hong Hanh, 2004. The sequence
of a domain in HP1125 gene coding for an outer membrane protein of
Helicobacter pylori. Genetics & Applications 2, pp.19-24. [6] Nguyen Van Thinh, Nguyen Thi Nguyet and Nguyen Thi Hong Hanh, 2007. “Summary of scientific reports and conferences”. Basic research in the life sciences, pp.196-198. [7] Stephens J.C., Stewart J.A., Folwell A.M., Rathnone B.J., 1998. “Helicobacter pylori cagA status, vacA genotype and ulcer
diseases”. Eur J Gastroenterol Hepatol, pp. 381-384. [8] Ta Long (2003), “Peptic disease and Helicobacter pylori bacteria”. Hanoi Medical Publishing House. [9] Wu W., Yang Y., Sun G., 2012. “Recent insights into antibiotic
resistance in Helicobacter pylori eradication”, Gastroenterol Res Pract, pp 723- 783. (The Board of Editors received the paper on 18/01/2016, its review was completed on 01/04/2016)

preface - Tạp chí Khoa học Công nghệ

Transcription

Similar documents

Catalyzer #05 - 46th IChO (2014)

presentation here

Distribution Programmed by Vietnamese for Vietnamese

16 - SACEI`s

our Black April Information Packet

15 movies to be released in Vietnam in June

I`m helping to end MS by participating in the 2016 Jayman BUILT MS

The Board of Directors of Qatar Fuel (WOQOD) is pleased to invite

5 `S` Training Program at ABV-IIITM, Gwalior on 21.07.2016

Holy Spirit Catholic Church Fountain Valley