mechanism of action of ID4 in prostate cancer

Transcription

Atlanta University Center
DigitalCommons@Robert W. Woodruff Library, Atlanta
University Center
ETD Collection for AUC Robert W. Woodruff Library
7-1-2013
ID4 as a tumor suppressor: mechanism of action of
ID4 in prostate cancer
Ashley L. Evans
Clark Atlanta University
Follow this and additional works at: http://digitalcommons.auctr.edu/dissertations
Part of the Male Urogenital Diseases Commons
Recommended Citation
Evans, Ashley L., "ID4 as a tumor suppressor: mechanism of action of ID4 in prostate cancer" (2013). ETD Collection for AUC Robert
W. Woodruff Library. Paper 743.
This Dissertation is brought to you for free and open access by DigitalCommons@Robert W. Woodruff Library, Atlanta University Center. It has been
accepted for inclusion in ETD Collection for AUC Robert W. Woodruff Library by an authorized administrator of DigitalCommons@Robert W.
Woodruff Library, Atlanta University Center. For more information, please contact cwiseman@auctr.edu.
ABSTRACT
BIOLOGICAL SCIENCES
EVANS, ASHLEY L
B.S., South Carolina State University, 2006
ID4 AS A TUMOR SUPPRESSOR: MECHANISM OF ACTION
OF ID4 IN PROSTATE CANCER
Committee Chair: Dr. Jaideep Chaudhary, Ph.D.
Dissertation dated July 2013
Id proteins are members of basic helix-loop-helix family. However, Id proteins
lack the basic binding domain, which prevents DNA binding, and thereby regulates
transcription. There are four members in the Id protein family termed Idl-4. In prostate
cancer the expression of Idl and Id3 is high, whereas member Id4 expression is low.
Decreased expression of Id4 is due to promoter hypermethylation in prostate cancer as
well as many other cancers. This observation led us to hypothesize that Id4 acts as a
tumor suppressor in prostate cancer. Furthermore, evidence suggests ectopic Id4
expression in metastatic prostate cancer cell line DU145 induced cell cycle arrest,
apoptosis, and senescence. In this study, we expanded on these earlier studies to
demonstrate that gain of Id4 attenuates cancer phenotype whereas loss of Id4 promotes
cancer phenotype in prostate cancer cell lines DU145 and LNCaP, respectively. Upon
over-expression of Id4 in DU145 cells (DU145+W4), there was an increase in apoptosis,
due to decreased mitochondrial membrane potential (MMP) and increased expression of
1
pro-apoptotic markers (PUMA, BAX, and p21). Inversely, silencing of Id4 in LNCaP
cells (LNCaP-Id4) led to decreased apoptosis due to an intact mitochondrial membrane
and decrease in the expression of pro-apoptotic markers (PUMA, BAX, and p21). Since
BAX, PUMA, and p21 are direct transcriptional targets of p53, these results therefore
prompted us to investigate the effect of Id4 on expression and activity of p53. LNCaP
cells express wild-type p53.
DU145 cells harbor mutant p53 (P223L and V274F), which
lies within the DNA binding domain and abrogates p53 transcriptional activity. DU145
cells also express high levels of p53, due extended half-life. Surprisingly, there was
decreased expression of p53 in DU145+Id4 cells associated with nuclear localization
indicating enhanced transcriptional activity. We investigated p53 DNA binding and
transcriptional activity. We determined that mutant p53 in DU145+Id4 cells was
transcriptionally active evident by increased luciferase activity and binding of p53 to the
promoters of its targets. In LNCaP-Id4, p53 expression was decreased which resulted in
decreased p53 transcriptional activity and decreased DNA binding ability. The data
suggested that Id4 can restore mutant p53 activity, which is a significant observation. Our
results also suggest that Id4 promotes the assembly of a macromolecular complex
involving CBP/p300 that results in acetylation of p53 at K373, a critical post-translational
modification required for its biological activity. Loss of Id4 in LNCaP cells also
abrogated wild type p53 DNA binding and transcriptional activity with concomitant loss
of CBP/p300 requirement and decreased acetylation. In conclusion, we demonstrated
that loss of Id4 promotes cancer phenotype in LNCaP cells. We also demonstrated that
the tumor suppressor activity of Id4 is in part through regulation of CBP/p300 dependent
acetylation and function of p53.
11
ID4 AS A TUMOR SUPPRESSOR: MECHANISM OF ACTION OF ID4 IN
PROSTATE CANCER
A DISSERTATION
SUBMITTED TO THE FACULTY OF CLARK ATLANTA UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR
THE DEGREE OF DOCTOR OF PHILOSOPHY
BY
ASHLEY LECOLE EVANS
DEPARTMENT OF BIOLOGICAL SCIENCES
ATLANTA, GEORGIA
JULY 2013
©2013
ASHLEY LECOLE EVANS
All Rights Reserved
ACKNOWLEDGMENTS
I would first like to give thanks to my Lord and Savior Jesus Christ, because
without Him this would not have been possible. I would like to thank my mentor, Dr.
Jaideep Chaudhary, for his unwavering support, encouragement, and listening ear during
my matriculation. Thank you for pushing me to reach my greatest potential and not only
teaching me about science, but also mentorship. I would also like to thank my committee
members: Drs. Cimona Hinton, Shaflq Khan, Valerie Marah, and Joann Powell. Thank
you for your time, criticisms, and hard lessons that have all helped to make me a better
scientist. While there are too many to list, a special thanks goes out to all the
former/current members of Dr. Chaudhary's lab, graduate students, Dr. Campbell,
faculty, and staff. Also a special thanks to those who contributed to this research. Finally
and most importantly, I would like to thank my family for their love and support. Many
times when I felt like giving up, you pushed me forward, I love and thank you for that.
You are my rocks: My husband (Bryan Knowell), my parents, my grandparents, my
brothers, Grandmother-in-law, bestfnend/colleague Shanora Glymph Brown, and all of
my other relatives and friends. I am thankful for the most precious gift I have ever
received my Bryley Ashlen Knowell, I am grateful for the motivation and love you give
me daily. You make every struggle and pain worth it all. I love you!! This work was
funded by NIH/NCRR/RCMI grant #G12RR03062 and NIH grant #R01CA128914.
ii
TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS
ii
LIST OF FIGURES
vi
LIST OF TABLES
vii
LIST OF ABBREVIATIONS
viii
CHAPTER 1. INTRODUCTION
1
CHAPTER 2. LITERATURE REVIEW
5
2.1 Prostate Development
5
2.1.1 Androgen and Androgen Receptor
6
2.2 Prostate Cancer Incidence
7
2.3 Prostate Cancer Disease Progression
8
2.3.1 Androgens, AR, and Prostate Cancer
2.3.2 Genetic Disposition in Prostate Cancer Progression
2.4 Id Proteins
9
12
12
2.4.1 Id proteins in Development
14
2.4.2 Id Proteins in Cancer
16
2.4.3 Id Proteins in Cell Cycle and Apoptosis
16
2.4.4 The Role of Id proteins in Prostate Cancer
17
2.5 Id4
18
2.5.1 Id4 in Development
18
Page
2.5.2 Id4 in Cancer: Tumor Promoter vs. Tumor Suppressor
19
2.5.3 Id4 as a Tumor Promoter
20
2.5.4 Id4 as a Tumor Suppressor
21
2.5.5 Id4 in Prostate Cancer
22
2.5.6 Summary
22
2.6 Tumor Suppressor p53 "Guardian of the Genome"
23
2.6.1 p53 and Cell cycle
26
2.6.2 p53 and Apoptosis
26
2.6.3 Regulation of p53
28
2.6.4 Protein Stability
28
2.6.5 Phosphorylation of p53
28
2.6.6 Acetylation of p53
29
2.6.7 p53 Mutations
30
2.6.8 p53 Missense Mutations
30
2.6.9 p53 Dominant Negative Manner and Gain of Function
31
2.6.10 Therapeutic Applications of p53
32
2.6.11 p53 and Id4
34
2.6.12 Summary
35
CHAPTER 3. MATERIALS AND METHODS
36
CHAPTER 4. RESULTS
45
4.1 Loss of Id4 promotes tumorigenecity of prostate cancer cells
4.1.1 Expression of Id4 in prostate cancer cell lines
45
45
4.1.2 Effects of Loss of Id4 on cell proliferation and apoptosis
45
4.1.3 Effect of loss of Id4 on migration
46
4.1.4 Gene expression changes following loss of Id4
46
4.1.5 Effect of loss Id4 on tumor growth
47
4.2 Id4 dependent acetylation restores mutant-p53 transcriptional activity
4.2.1 Id4 promotes apoptosis
48
48
4.2.2 Id4 restores mutant p53 DNA binding and transcriptional activity..50
4.2.3 Id4 recruits CBP/p300 to promote p53 acetylation
53
4.3 Id4 sensitizes prostate cancer cells to antitumor drug Doxorubicin
54
4.3.1 Id4 sensitizes DU145 cells to Doxorubicin treatment by apoptosis .54
4.3.2 Id4 may induce sensitization via MYC regulation
CHAPTER 5. DISCUSSION
55
57
56
57
61
CHAPTER 6. CONCLUSION
64
APPENDIX
66
REFERENCES
107
LIST OF FIGURES
Figure
Page
1. bHLH family of transcription factors: Id proteins lobes
71
2. The adult prostate and classification of zones
73
3. Schematic depiction of progression of prostate
75
4. Id sequence comparison
77
5. Model for Id gene function in cell cycle regulation
78
6. p53 gene and cancer derived p53 mutations
79
7. p53 pathway for apoptosis and cell cycle
81
8. Id4 expression in prostate cancer cell lines and stable knockdown of Id4
82
9. Loss of Id4 attenuates apoptosis and promotes proliferation
84
10. Loss of Id4 promotes migration
86
11. Gene expression changes following loss of Id4
88
12. Id4 silencing promotes anchorage dependent growth and tumor formation
89
13. Id4 promotes apoptosis by regulating MMP and pro-apoptotic proteins
91
14. Id4 regulates p53 expression and cellular localization
94
15. Id4 promotes DNA binding and transcriptional activity of wt and mt p53
96
16. Expression of MDM2 and its transcriptional regulation
99
17. Acetylation of p53 and interaction with CBP/p300 and Id4
VI
101
Figure
Page
18. Id4 sensitizes prostate cancer cells to Doxorubicin treatment
102
19. Idl, MYC, and MDM2 crosstalk
104
20. Overall Scope
105
VII
LIST OF TABLES
Table
Page
1. Primer Sequences for Qualitative and Quantitative PCR
66
2. Antibodies for Western blotting and ICC
67
2. Classes of HLH proteins
68
3. Id4 and p53 status in cell lines
69
4. Modulation of Id4 in Cancer
70
vni
LIST OF ABBREVIATIONS
ANOVA
Analysis of Variance
AR
Androgen Receptor
BCS
Bovine Calf Serum
bp
base pair
BPH
Benign Prostatic Hyperplasia
BCRP
Breast Cancer Resistance Proteins
BMP
Bone Morphogenetic protein
BRCA1
Breast Cancer 1
BSA
Bovine Serum Albumin
cDNA
Complementary Deoxyribonucleic Acid
Ct
Cycle threshold
DAPI
4'-6-Diamidino-2-phenylindole
DNA
Deoxyribonucleic Acid
dNTP
Dinucleotide Triphosphate
ECL
Enhanced Chemiluminescence
EGF
Epidermal Growth Factor
ER
Estrogen Receptor
FBS
Fetal Bovine Serum
ix
HLH
ICC
ID
Helix Loop Helix
Immunocytochemisty
Inhibitor of Differentiation
MAPK
Mitogen Activated Protein Kinases
MDM2
Murine double minute 2
MMP
Matrix Metalloproteinase
MMP
Mitochondrial Membrane Potential
mRNA
MS-PCR
Messenger Ribonucleic Acid
Methylation Specific-Polymerase Chain Reaction
PBS
Phosphate Buffered Saline
PCR
Polymerase Chain Reaction
PIN
Prostatic-IntraepithelialNeoplasia
PSA
Prostate Specific Antigen
PVDF
Polyvinylidene Difluoride
RT
RT-PCR
RNA
RPMI
Reverse Transcriptase
Reverse Transcription Polymerase Chain
Ribonucleic Acid
Roswell Park Memorial Institute
CHAPTER 1
INTRODUCTION
Id proteins have been implicated in the progression of many malignant cancers (7)
that include adenocarcinoma, neural tumors, squamous cell carcinoma, melanoma,
sarcoma, leukemia, breast cancer, lymphocytes, and prostate cancer (2-7). In general, Idl,
Id2, and Id3 are highly expressed in cancer. Idl, Id2, and Id3 are expressed at low levels
in the normal prostate epithelium and benign prostate hyperplasia (8), whereas the
expression of Id4 is relatively high (9). In prostate cancer tissues, there were increased
Idl, Id2, and Id3 levels (8) whereas Id4 is decreased (9). Id4 expression has been found
to be decreased due to promoter hypermethylation in prostate cancer. However, the exact
function of Id proteins in prostate cancer is not known. Id proteins have the ability to
affect multiple molecular pathways. Id proteins are capable of regulating the expression
of a large number of genes through specific bHLH and non-bHLH interactions that in
turn regulate many cellular processes such as cell cycle progression (10, 11), cell fate
(12-14), invasiveness (75, 16), and apoptosis (12, 17). Id proteins homo or hetero
dimerize with other bHLH proteins in the HLH domains. However, Id proteins lack the
basic DNA binding domain and cannot bind to DNA (18) (Figure 1). All Id proteins
interact with bHLH, TCF3 (19, 20), but their interaction with non-bHLH proteins appears
in large part to be isoform dependent- Idl: CASK, ELK1, GATA4, caveolin; Id2: ELK1,
1
3 and 4, CDK2, PAX2, 5 and 8, Rb and related pocket proteins, Id3: ELK1 and 4, ADD1
((79, 20) and public databases). Specific non-bHLH interaction partners for Id4 are
currently not known.
Many of the factors that contribute to prostate cancer progression have been
associated with Idl. Idl has been implicated in the transition from androgen dependent
prostate cancer to androgen independent prostate cancer (21), which is a hallmark of
cancer progression. Idl is also involved in VEGF stimulation of angiogenesis (22) and
proliferation mediated by EGFR (21) as well as by inactivation of cyclin dependent
kinases (23). Over expression of Idl in LNCaP cells resulted increased proliferation, and
increased invasiveness thorough increased MMP-2. (24, 25). Silencing of Idl sensitized
prostate cancer cells to chemotherapeutic drug Taxol. Also in DU145 and PC3 cells,
which are androgen independent cell lines, the levels of Idl, Id2, and Id3 are significantly
higher than normal prostate epithelial cells (26). However, Id4 has an inverse expression
pattern as compared to other Ids in prostate cancer. Id4 is the most recently discovered
member of the Id family and is the focus of this study. Oncomine database provides
evidence that in more advanced stages of prostate cancer Id4 was found to be decreased.
In metastatic prostate cancer cell line DU145, there is decreased expression of Id4 due to
promoter hypermethylation (26). Collectively these studies suggest that Id4 acts as a
tumor suppressor. Previously we published data to support the role of Id4 as a tumor
suppressor, in which we studied cellular processes such as cell cycle, proliferation,
senescence, and apoptosis. Upon over-expression of Id4 into DU145 cells (which have
very little to no Id4 expression due to promoter methylation), there is a marked decrease
in proliferation due to increased cyclin dependent kinases p21 and p27 expression (26).
Cyclin dependent kinase inhibitors are involved in proliferation and cell cycle arrest. The
induction of p21 has been linked to Gl arrest, making it a key component of Gl
checkpoint response. P27 has been found to attenuate proliferation in prostate cancer
cells. Id4 also induces senescence and apoptosis in DU145 cells (26). Collectively the
data suggested that Id4 acts as a tumor suppressor in prostate cancer. To further
investigate the anti-tumor properties of Id4, we silenced Id4 in LNCaP cells (express Id4)
to determine whether loss of Id4 facilitates cancer phenotype. We hypothesize that loss of
Id4 will promote tumorigenesis in prostate cancer cells. We investigated processes
associated with cancer phenotype which included proliferation, apoptosis, anchorage
independent growth, and tumor growth in vivo.
Tumor suppressor p53 is one of the most commonly inactivated genes in human
cancer (27, 28). The inactivation of p53 occurs for many reasons, such as lesions that
prevent p53 activation, mutations within the gene itself or mutations in downstream
effectors that affect p53's function (29). Some mutations in p53 usually fall within the
DNA binding domain and renders p53 transcriptionally inactive (30). Transcriptional
inactivation of p53 hinders the activation of p53 transcriptional targets that may induce
cell cycle arrest or apoptosis. Deregulated apoptosis is a common event in cancer
progression. Interestingly, DU145 cells harbor mutant p53 that lacks transcriptional
activity (31). The p53 mutants (P223L and V274F) in DU145 cells are rare but within the
DNA binding domain (DBD 94-292) known to abrogate p53 transcriptional activity due
to structural de-stabilization and/or DNA interactions (32, 33). The 274F in DU145 cells
is next to 273H, a DNA contact and one of the most highly mutated amino acid (33).
Both these amino acids (274F and 273H) are within the conserved region of p53 beta
strand S10 whereas 223L lies in the outer loop (30). Some but not all p53 mutations
maintain transactivation potential for some promoters (e.g. CDKN1 A) but not others (e.g.
BAX, PUMA and Pig3) (34). The mutant p53 in DU145 also lacks the ability to transactivate CDKN1A (37).
While there is overwhelming evidence that Id4 acts as tumor suppressor in
prostate cancer, its mechanism of action is not known. We hypothesize Id4 functions as a
tumors suppressor by inducing apoptosis in a p53 dependent manner in prostate cancer
cells. The aim of this study is to investigate the molecular mechanism by which Id4 acts
as a tumor suppressor in prostate cancer.
To investigate this hypothesis following aims
were designed:
1.
To identify Id4 regulated molecular pathways involved in tumor suppression.
2.
Determine the mechanism of Id4 regulated apoptotic pathways in prostate cancer
cells.
CHAPTER 2
LITERATURE REVIEW
2.1 Prostate Development
The growth and development of the prostate begins at the fetal stages and
concludes at sexual maturity (35). The prostate develops from the urogenital sinus
(UGS), which is part of the cloaca. Urogenital sinus is a midline structure with epithelial
layer surrounded by a mesodermally derived mesenchymal layer and is found at the neck
of the developing bladder (36). The UGS is found in both male and female humans at
about 7 weeks of gestation (35). Prostatic morphogenesis occurs once the UGS is
distinguishable at 10-12 weeks. The adult human prostate has a compact morphology and
is about the size of a walnut (Figure 2A). The adult prostate is organized into three
zones, a central zone, a transition zone, and a peripheral zone (Figure 2B) (37). The
paired central zone is posterior to the stromal region. Interior to the central zone is the
transition zones which is located on either side of the urethra. The transition zone
represents the smallest zone in the normal prostate (38). The peripheral zone is the largest
region of the normal adult prostate, which is located on the posterior side of the prostate.
The significance of this architecture is based upon the relationship of these zones to
prostatic disease. Benign prostatic hyperplasia (BPH), a nonmalignant overgrowth that is
6
fairly common among aging men, occurs mainly in the transition zone, whereas prostate
carcinoma arises primarily in the peripheral zone (39).
Mature prostatic ducts consist of three major cell types (Figure 3B), luminal
secretory epithelial cells, basal epithelial cells and stromal smooth muscle cells (40, 41).
The cell types can be distinguished from one another by differentiation markers. The
expression markers for the luminal cells are androgen receptor and cytokeratins 8 and 18.
Markers for basal epithelial cells are p63, cytokeratins 4 and 14. There are also less
common cell types that include neuroendocrine cells and rare basal epithelial cells that
have unique marker expression profiles and are candidates for epithelial stem cells (41).
The stromal layer is mostly composed of smooth muscle, but also contains flbroblasts,
neuronal, lymphatic, and vascular cell types (40). Stromal markers include smooth
muscle alpha-actin and vimentin. Neuroendocrine cells are a minor population of cells in
the normal prostate, are androgen-independent, and express chromogranin A, serotonin,
and neuropeptides (36).
2.1.1 Androgens and Androgen Receptor
Leydig cells, a minor population of non-epithelial cells in the testis, produce
androgens. Androgens have an important role in male sexual differentiation, sexual
maturation, and the maintenance of spermatogenesis (42-44). Androgens also have an
essential role in reproductive organ development, and mediate physiological response in
many other tissues and organs which include the skin, skeletal muscle, cardiac muscle,
liver, kidney, central nervous system and the hematopoietic system (42, 45). Androgens
mainly target the prostate gland and modulates its response through androgen receptor
(AR). Androgen action functions through an axis involving the testicular synthesis of
testosterone, its transport to target tissues, and the conversion by 5-reductase to the more
active metabolite dihydrotestosterone (DHT). Testosterone and DHT exert their
biological effects through binding to AR and inducing AR transcriptional activity.
After the development of the prostate gland, androgens continue to promote survival of
the secretory epithelial cells, the primary cell type involved in the malignant
transformation to prostate adenocarcinoma. AR belongs to the nuclear receptor
superfamily and is a ligand-inducible transcription factor that regulates tissue-specific
expression of target genes. It is uniformly expressed in most human organs; however
there is an absence of expression in the spleen and bone marrow (46). The AR gene
consists of eight exons and encodes four functional domains which are similar to other
nuclear receptor superfamily members. These domains include a conserved DNA-
binding domain, hinge region, a COOH-terminal ligand-binding domain (LBD), and less
conserved NH2-terminal domain (47).
2.2 Prostate Cancer Incidence
Prostate cancer is the second most common cancer among men in the United
Sates, only behind non-melanoma skin cancer. It is also the leading cause of cancer
death among men of all races (48).
Statistics suggest that black men are more likely to
die of prostate cancer than any other group. The incidence of prostate cancer
dramatically increases in later stages of life and affects men at a ratio of 1:9 over the age
of 65 (49) (50).
8
2.3 Prostate Cancer Progression
In the normal prostate the balance between low rates of proliferation and low
levels of apoptosis maintain homeostasis. In prostate cancer there is a disturbance of this
balanced state (57). Prostatic intraepithelial neoplasia (PIN) has been coined the
precursor of prostate cancer. PIN is low to high grade lesions that are localized in the
prostate ducts (52, 53). In PIN and early invasive carcinomas there is a seven to ten fold
increase in proliferation. PIN eventually leads to invasive carcinoma (Figure 3A),
characterized by loss of basal lamina, over proliferation of basal and luminal cells, and
full expression of markers associated with invasive carcinoma such as MMP 2 (matrix
metalloproteinase-2) (54). Invasive carcinoma may progress to a more aggressive
phenotype which allows local invasion to the seminal vesicles (54) (55). The transition
from androgen dependent to androgen independent may result in metastatic prostate
cancer (54) (55). Metastatic prostate cancers also display an approximately 60% decrease
in the rate of apoptosis (57) and migration to other body parts (54, 55).
Prostate cancer can be detected through elevated serum prostate serum antigen
(PSA) levels. The PSA test has been widely used to screen and help in early detection of
prostate cancer. PSA levels are detected at a range of 2.5-10 ng/mL in prostate cancer
samples, results confirmed by histology of biopsies. Although PSA detection is very
sensitive, it is an imperfect system for detecting prostate cancers (56). Previously,
prostate cancer was detected by clinical symptoms or digital rectal examination (DRE).
This method of detection resulted in the discovery of advanced tumors that had stretched
beyond the organ capsule or whether metastasis had occurred (56).
9
2.3.1 Androgens, AR, and prostate cancer
In 1941, Huggins and Hodges reported that the normal prostate and early stages of
prostate cancer were strongly dependent on androgens (57). The activity of AR and AR
modulators is an essential aspect of prostate cancer. Approximately 80-90% of prostate
cancers are sensitive to androgens at its initial diagnosis (58).
After Huggins and
Hodges discovery, treatments of prostate cancer focused on androgen ablation by
castration or chemical castration. Androgen deprivation usually results in favorable
clinical response and dramatic tumor regression. Androgen depletion is an essential part
of many prostate cancer treatments, despite the frequent reoccurrence of prostate cancer
post androgen ablation therapy. However, this does not mean that the cancer is fully
gone, after continuous treatments, the treatment can stop working and an androgen
independent cancer may re-develop and spread throughout the body. Casodex
(bicalutamide) is a pharmaceutical drug, and is commonly used as an anti-androgen drug
to treat recurrent prostate cancer. Casodex prevents androgen binding to AR by blocking
its binding sites and acting as a competitive inhibitor of AR. Androgen dependent cells
are growth inhibited by Casodex; however androgen independent cells are refractory to
this type of treatment. AR is expressed throughout prostate cancer progression and
persists in the majority of patients with hormone refractory prostate cancer. The
mechanisms involving progression of prostate cancer have been extensively studied and
are seemingly involved in prostate carcinoma development. However, frequent
amplification of AR gene is observed in prostate carcinomas growing under low levels of
androgens resulting in increased sensitivity towards minimal levels of androgens (59).
10
AR coactivators are also responsible for mediating effects of AR on chromatin structure
and transcriptional initiation (60).
Low serum testosterone levels of men newly
diagnosed with prostate cancer have shown a correlation with increased AR expression,
increased capillary density within the tumor, and higher Gleason score (61). Increased
AR expression also correlates with decreased recurrence free survival and disease
progression.
AR can be transactivated by coactivators also referred to as coregulators. It has
been suggested that differing levels in the expression of coregulators may be involved in
the development and progression of prostate cancer (60). Coactivators are coregulators
that activate AR and corepressors repress AR. Examples of coactivators include ARA70
(Androgen receptor associated coregulator 70), SRC1 (alias NCOA1 nuclear receptor
coactivator 1), CBP (alias CREBBP CREB binding protein (Rubinstein-Taybi
syndrome)), pSOO (alias EP300 El A binding protein p300) (62), and 5 putative
corepressors include NCoRl (nuclear receptor co-repressor 1), AES (amino-terminal
enhancer of split), cyclin Dl (alias CCNDl),prohibitin (PHB),md PAK6
(p21(CDKN1'^-activated kinase 6) (63).
In the absence of androgens, androgen receptor is located in the cytoplasm in a
complex with HSP90. Upon infusion of androgens the globular C-terminal domain of the
receptor accepts the ligand and structural changes occur that result in the dissociation of
AR from HSP90 or other heat shock proteins.Then, nuclear AR binds to AREs, and
recruits various cofactors. HSP90 forms a stable heterocomplex with AR and has been
shown to translocate AR to the nucleus.
11
Androgen receptor also has regulatory abilities for other prostate cancer
associated proteins.
Three known AR transcriptional targets are PSA, NKX3.1, and
ETV1. Prostate specific antigen is considered to be the most sensitive biochemical
marker for evaluating prostatic disease and response to therapy. PSA is a known
glycoprotein that is a member of the kallikrein family of serine proteases (64). In the
normal prostate PSA is secreted into the glandular ducts, it is there that it degrades
proteins produced in seminal vesicles to prevent coagulation of the semen. During
prostate cancer progression, PSA levels increase as a result of aberration of the normal
prostate ductal structure by neoplastic epithelial cells. This allows PSA to be actively
secreted into the extracellular space and enter the circulation. AR is the primary regulator
of PSA expression, by binding to three androgen response element containing enhancer
elements located within the PSA promoter region (64). E-twenty six (Ets) transcription
factors, epithelium-specific Ets factor 2 (ESE2), and prostate-derived Ets factor (PDEF)
can also induce the transcription of a PSA reporter gene in AR negative cell line CV-1.
NKX3.1 is also a transcriptional target of AR and required for prostate tumor
progression. Androgen receptor (AR) positively regulates NKX3.1 expression, whereas
NKX3.1 negatively modulates AR transcription and consequently the AR-associated
signaling events (65). Ets Variant Gene 1 (ETV1) is a novel androgen-regulated gene.
Studies demonstrate that ETV1 mRNA and protein are up-regulated in response to
ligand-activated AR in androgen-dependent cells, but there is no detectable ETV1
expression in normal prostate cells (66). The ETV1 promoter is induced by androgens
and recruits AR, as a feedback loop (67).
12
2.3.2 Genetic disposition in prostate cancer progression
Literature suggests that genetic disposition may play a role in prostate cancer
progression since about 5-10% of prostate cancer cases are considered to be hereditary
(68, 69). Polymorphisms are DNA sequence variation in genes that are associated with
hormone response, DNA repair, cell protection, and nucleotide metabolism.
Polymorphisms have been implicated in prostate cancer progression. Gene
amplifications as a result of chromosomal alterations have been observed in many
cancers. The frequency of structural chromosomal alterations have been found to be
increased in advanced stages of prostate cancer. Specific chromosomal regions have
been identified ashaving a role in chromosomal alterations, these regions include 5q, 6q
and 7p (70) .
Another facet of prostate cancer progression is the inactivation of tumor
suppressor genes such as p53, retinoblastoma (RB), and Phosphatase and tensin homolog
(PTEN), which are the most notable tumor suppressors and are inactivated, silenced or
mutated in cancers (71) (72).
Chromosomal alterations and point mutations are
responsible for functional inactivation of p53 in prostate cancer (73). Point mutations
have also been reported for PTEN that result in transcriptional reduction of expression
(72). The Rb gene is located at 13ql4, which is a chromosomal region frequently deleted
in prostate carcinoma suggesting that tissue specific tumor suppressor genes play key
roles in prostate carcinoma (74).
13
2.4 Id Proteins
The inhibitor of differentiation (Id) proteins belong to a class of helix loop helix
(HLH) proteins involved in the development of many cell types. Id proteins were first
characterized in the early 1990s (75). There are four members of the Id family, Idl, Id2,
Id3 and Id4. The most studied Id proteins are Idl and Id3. Id4 is the most recently
discovered family member and the least understood. The Id protein have a conserved
HLH domain, that allows for homo or hetero dimerization with other proteins that have a
HLH domain. However, Id proteins lack a basic region (DNA binding domain) and
cannot bind DNA. Through protein-protein interactions Id proteins regulate transcription
(Figure 1) (18). Id proteins have divergent structures and functions, but they do share
sequence homology in the HLH domain. Idl and Id3 share the highest sequence
similarity (Figure 4). There are seven classes of HLH proteins that are categorized by
their tissue distribution, dimerization and tissue binding abilities (1) (Table 4). The class
I HLH protein are referred to as basic HLH proteins and E proteins contain a motif of
positively charged amino acids adjacent to the HLH domain and bind to the E box
sequence CANNTG. These proteins possess the ability to homodimerize or hetero
dimerize with their HLH domains; however their binding specificity is limited to E
boxes. The class II proteins can also form homodimers and heterodimerize with the class
I proteins (18, 76). The class IV proteins are known to interact with the class III proteins.
The class V proteins (consists of Idl, Id2, Id3 and Id4) lack the basic DNA binding
domain and have the ability to negatively regulate class I and II proteins (7^).The size of
Ids range from 119 amino acids (Id3) to 199 residues (Id4) (14). Id proteins have
14
different expression patterns which suggests an isoform specific role for individual Id
proteins (77). Id protein expression is high in developing tissue and proliferating cells but
absent in terminally differentiated tissues such as adult tissues (75) (77). Id proteins
hetero dimerize with several classes of bHLH proteins as well as non bHLH proteins. The
interaction repertoire of Id proteins also involves several non-bHLH proteins. All Id
proteins interact with bHLH TCF3 (19, 20), but their interaction with non-bHLH proteins
appears in large part to be isoform dependent. Specific non-bHLH interaction partners for
Id4 are currently not known. Thus Id proteins are capable of regulating the expression of
a large number of genes through specific bHLH and non-bHLH interactions that in turn
regulates many cellular processes such as cell growth, differentiation, and apoptosis (12).
2.4.1 Id Proteins in Development
Id proteins are expressed in many organs and tissues during development (79) and
the expression of Idl, Id2, and Id3 are overlapping, whereas Id4 has a unique pattern
(80). It has been determined that many organs and cell types require Id proteins for
normal development, which is when cells rapidly proliferate and differentiate in various
living systems.
Idl and Id3 are essential components for neurogenesis (81),
angiogenesis (82), and tumor vascularization (81), which provides evidence of the role of
Id proteins during development and in cancer. Idl/Id3 knockout mice have severe brain
deficiencies (81) and angiogenesis and invasion were severely inhibited in knockout mice
(83). As for overexpression studies, constitutive expression of Idl impaired mouse B cell
development (76) (84). Also, overexpression of Id2 has been determined to lead to
inhibition of T-cell development (55). Id proteins may also act as antagonists to other
15
HLH transcription factor proteins during development (76). Inhibitory effects of Id
proteins on E proteins blocks the activation of E protein target genes, which results in the
loss of tissue specific gene expression and a disruption of differentiation program in
many cell types (86). In lymphocyte development, E2A is required for normal
lymphocyte development and function, when Id2 binds E2A, its function is blocked
which results in defective lymphocyte development. Based on that study it was
determined that Id2 expression is an essential factor in lymphatic organ development
(87).
The retroviral overexpression of Id4 induces the disappearance of ectoderm
overlaying the neural tube which causes these cells to be converted into neural crest cells
(88).
From these studies, we can conclude that Id4 has essential functions in neuronal
cells and mammalian embryos. Id2 and Id4 show similar expression patterns in
migrating post-mitotic neurons (89). Id4 is selectively expressed in the nervous system
during development suggesting a unique role of Id4 compared to other Id proteins during
development. Id4 is expressed in the cerebellum and olfactory bulb, while Idl and Id3
are not expressed in the brain of adult animals (82). In Id4 -/- mice, the brains are
severely transformed and the hypothalamus is disorganized and reduced in size (76). In
Id4 -/- mice, oligodendrocyte production is also extremely reduced in the brain of these
mice (90). Id4 is an essential regulator of neural stem cell proliferation and fate
determination (91). Id4 expression is unique during embryogenesis as compared to other
Ids (80). During embryogenesis, Idl, Id2, and Id3 were expressed in multiple tissues,
whereas Id4 was only detected in neuronal tissues and the ventral portion of the
16
epithelium of the developing stomach (92). Collectively while all Id proteins have a role
in development, their roles may not be the same.
2.4.2 Id Proteins in Cancer
Id proteins have been recognized as molecules coordinating inhibition of
differentiation with a host of cellular functions that include proliferation, cell cycle
progression, migration, invasiveness, cell fate, and angiogenesis. Id proteins have the
ability to affect multiple molecular pathways. (93, 94).
More tumor promoting abilities
exist with Idl and Id3. Ids affect the invasiveness of cells. Idl over-expression in SCp2
mammary epithelial cells caused increased invasiveness (7). Idl has also been implicated
in promoting migration in mammary epithelial cells due to increased production of
MMP2 (95). Studies have shown that Id proteins, more specifically Idl, have a role in
regulating senescence and immortalization. Idl was found to have a role in promoting the
immortalization of primary keratinocytes (9(5), esophageal epithelial cells (97), and
prostate epithelial cells (98). In breast cancer, elevation of Idl correlates with a more
aggressive subset of breast cancer and cervical cancer (99). Id2 also has role in regulating
cell processes. In neuroblastoma, elevation of Id2 is able to inactivate the Rb pathway,
which promotes the cell cycle (10). Over-expression of Id2 was found to determine cell
fate specification in the ectoderm by suppressing the epidermal lineage (88). Id3 has been
shown to be highly expressed in various cancers including prostate cancer, pancreatic
cancer, and colorectal cancer, while Id3 expression is decreased in ovarian cancer (100).
17
2.4.3 Id Proteins in Cell Cycle and Apoptosis
Id proteins play an important role in Gl -S-phase transition in the cell cycle
(Figure 5). Idl and Id2 proteins are required for cell cycle progression through the Gl
phase and levels of these proteins decline as cells enter senescence in fibroblasts (101).
The retinoblastoma (Rb) protein represents a crucial protein in cell cycle regulation and
the disruption of Rb is one hallmark of cancer (102). In U2OS cells, which have
functional Rb and p53, Id2 over expression results in increased proliferation. However,
this is not the case in SAOS-2 cells, which lack functional Rb, indicating that Id2 protein
exerts its effect on the cell cycle in an Rb dependent manner (10). Furthermore, the loss
of Id2 expression rescues Rb-/- embryos and delays tumorigenesis of pituitary tumors in
Rb+/- mice (103). Id2 is therefore an effector of cell cycle regulation and proliferation via
Rb regulation. Evidence suggests that Id4 may also have a role in cell cycle regulation in
neural precursors, being that it is required for the Gl to S phase transition (104). Id4 has
also been demonstrated to increase cyclin E levels in cdkn2a -/- astrocytes, which drives
their proliferation (17). Id proteins are regulated by mitogenic factors, which causes an
up-regulation in expression and propelling of the cell cycle. Literature suggests a role for
Id proteins in apoptosis. Idl is highly expressed in advanced prostate cancer cells that are
resistant to apoptosis, and down regulation may result in increased sensitization to
prostate cancer treatments (105). Inhibition of Id2 led to apoptosis in some prostate
cancer cells (LNCaP and PC3) and not others (DU145) (106).
18
2.4.4 Id proteins in prostate cancer
Idl, Id2, and Id3 are expressed at low levels in the normal prostate epithelium and
benign prostate hyperplasia (8), whereas the expression of Id4 is relatively high (9). In
prostate cancer tissues, there were increased Idl, Id2, and Id3 levels (8) whereas Id4 was
decreased (9). Id4 expression has been found to be decreased due to promoter
hypermethylation in prostate cancer. However, the exact function of Id proteins in
prostate cancer is not known. Id proteins are capable of regulating many pathways via
specific bHLH and non-bHLH interactions. Many of the factors that contribute to
prostate cancer progression have been associated with Idl. Expression of Idl has been
associated with poor survival of prostate cancer patients, which suggests a role of Idl in
prostate cancer progression (105).
Idl has been implicated in the transition from
androgen dependent prostate cancer to androgen independent prostate cancer (27), which
a hallmark of cancer progression. Over expression of Idl in LNCaP cells resulted in
androgen independent proliferation, which suggests the regulation of AR expression and
activity by Idl (24). Idl is also involved in VEGF stimulation of angiogenesis (22) and
proliferation mediated by EGFR (21) as well as by inactivation of cyclin dependent
kinase inhibitors (23). Silencing of Idl sensitized prostate cancer cells to
chemotherapeutic drug Taxol. Also in DU145 and PC3 cells, which are androgen
independent cell lines, the levels of Idl, Id2, and Id3 are significantly higher than normal
prostate epithelial cells (26). Inactivation of Idl by small interfering RNA attenuated cell
proliferation and promotes apoptosis and senescence in PC3 cells (107). In vivo studies
in which PC3 cells with silenced Idl, developed smaller tumors as compared PC3
19
control. Decreased tumor formation of PC3-Idl was possibly due to decreased
proliferation marker PCNA and invasion marker MMP2 (107).
2.5 Id4
2.5.1 Id4 in development
Id4 is the most recently discovered member of the Id family and the focus of the
current studies. Id4 plays a critical role during development. Several studies provide
evidence that Id4 plays a major role in the development of the nervous system, more
specifically oligodendrocyte development (97). Id4 is expressed in oligodendrocyte
precursor cells and may have a role in controlling the timing of differentiation of
oligodendrocytes (108). Recently, Id4 was found to directly interact with bHLH, OLIG1
and OLIG2 in neural progenitor cells. Id4 inhibits oligodendrocyte development by
blocking the transport of Oligl from the cytoplasm to the nucleus (109). Knock-out
studies revealed that Id4 is required for normal brain size. Knock-out studies also
suggested Id4 regulates neural stem cells proliferation and differentiation, specifically Id4
regulates lateral expansion of proliferative zone in the developing cortex and
hippocampus (104).
Dong et al. found that Id4 null mice exhibit impaired mammary development such
as ductal elongation, side-branching, and possibly alveologenesis (110). Id4 also
stimulates the proliferation of mammary epithelium during puberty, pregnancy as well as
cell proliferation induced by estrogen and/or progesterone. Data provided evidence that
Id4 promotes mammary gland development by suppressing p38MAPK activity. Id4 was
20
identified as a distinguishing marker of spermatogonial stem cells in the mammalian
germline and plays an important role in the regulation of self-renewal (110).
2.5.2 Id4 as tumor promoter vs. tumor suppressor
Localization studies of Id4 during cancer progression suggest an inverse
relationship to Idl, Id2 and Id3 in many different cancers such as prostate cancer,
colorectal adenocarcinoma, and thyroid cancer (26, 80, 111-114). Therefore, Id4
expression is unique as compared to Idl, Id2, and Id3. In many cancers, Id4 is
epigenetically silenced due to promoter hypermethylation, which leads to reduced levels
(115). The reduced levels of Id4 in these cancers may indicate its role as a tumor
suppressor. However, there are also lines of evidence that suggests Id4 may act as a
tumor promoter in some cases of cancer (115). Id4 has been implicated in many
malignancies and may function as both a tumor suppressor and/or an oncogene in a
context dependent manner.
2.5.3 Id4 as a tumor promoter
There are some cases in which Id4 acts as a tumor promoter in ovarian, breast,
and bladder cancer. In ovarian cancer, nanoparticle delivery of siRNA sequence for Id4
in ovarian tumor-bearing mice suppressed growth of established tumors while
significantly improving survival. They also found that Id4 down-regulates BRCA1 in
ovarian and breast cancers (116). In breast cancer, Park et al. found that knockdown of
Id4 expression suppressed the properties of cancer stem cells (CSCs) including sphere-
forming ability and side population phenotype. Based on this data, Id4 may be a
21
therapeutic target for the treatment of advanced breast cancer. Id4 is also a potential
oncogene in a small subset of bladder cancers (117).
2.5.4 Id4 as a tumor suppressor
Chan et al. found that Id4 is hypermethylated in gastric adenocarcinomas. Id4
was determined to be a potential tumor suppressor gene since epigenetic inactivation has
a role in the colorectal cancer progression (118). Also in colorectal adenocarcinoma,
cdc42 induced methylation of CpG island of the Id4 promoter, which resulted in
decreased Id4 expression. In 60% of colorectal cancer samples, Cdc42 was found to be
over-expressed and this expression was associated with Id4 silencing (119). Id4 gene
methylation status was examined in patients with acute myeloid leukemia (AML) and
84.8% (39/46) AML patients were Id4 gene was methylated while the 10 iron deficiency
anemia (IDA) patients with completely non-methylated Id4. They did determine that the
degree of Id4 gene methylation changes in AML patients with different subtypes and
stages, which suggests that Id4 gene methylation may be an early molecular event in the
progression of AML (120). Zhao et al. found increased occurrence of acute leukemia in
AL-CR patients, which are patients with methylated Id4gene (121). Castro et al.
examined multiplexed methylation profiles of tumor suppressor genes including Id4 and
clinical outcomes in lung cancer and Id4 was frequently methylated in lung cancer cell
lines (122). In breast cancer, Id4 promoter methylation was found to be 68.9% (117/170)
in breast cancer samples. The focus of this paper was to investigate the impact of Id4
promoter methylation on breast cancer progression. Treatments to demethylate breast
cancer cells lines were associated with Id4 re-expression (100). Another study found that
22
Id4 is constitutively expressed in normal human mammary epithelium but is suppressed
in ER-positive breast carcinomas and preneoplastic lesions; however in ER-negative
carcinomas Id4 is expressed. This identifies a role for Id4 as a tumor suppressor in
human breast cancer and suggests expression is regulated by estrogen (723). Collectively,
in breast cancer tissues Id4 is a potential tumor suppressor gene that undergoes epigenetic
silencing during carcinogenesis which may lead to an increased risk for tumor relapse.
In Burkitt's lymphoma, Id4 gene was also found to be methylated. Qu et al. used arsenic
trioxide (ATO) in Raji cells to demethylate Id4 and recover Id4 mRNA expression. Id4
gene hypermethylation may be the cause of malignant proliferation of Raji cells (124).
Id4 was also found to be inactivated by DNA methylation in malignant lymphoma and
may function as a tumor suppressor gene (125). Id4 has been identified as a potential
tumor suppressor gene in many cancers; however the mechanism of action of Id4 has not
been investigated.
2.5.5 Id4 in prostate cancer
There is convincing evidence that Id4 acts as tumor suppressor in prostate cancer,
data suggests that over-expression of Id4 induces apoptosis, senescence, and cell cycle
arrest in metastatic prostate cancer cell line DU145 (26). Carey et al. provided evidence
that in the presence of ectopic Id4 in prostate cancer cell lines, an S phase arrest and
apoptosis occurs, which resulted in increased the levels of p21 and p27 expression (26).
Sharma et al. also showed that Id4 is hypermethylated in prostate cancer tissues as
compared to normal controls, which suggests tumor suppressive functions for Id4 (9).
Vinarskaja et al. found that Id4 expression is significantly decreased in prostate cancer,
23
and hypermethylation was detected by MS-PCR and pyrosequencing (126). This study
used 47 carcinoma and 13 benign prostatic tissues. The results from this study, directly
supports that role of Id4 as a tumor suppressor in prostate cancer (126).
2.5.6 Summary
Several lines of evidence have been mentioned that suggests a unique role of Id4
as compared to other Ids (Idl, Id2, and Id3) in developmental biology as well as cancer
biology. There are more instances of how Id4 promoter methylation in cancer results in
little to no expression of Id4, which may suggest its role as a tumor suppressor.
However, the mechanisms by which Id4 may act as a tumor suppressor or tumor
promoter are far from understood.
2.6 Tumor suppressor protein p53
p53 was first identified as a transformation-related protein in 1979 (127).
p53
was identified as a cellular protein which binds tightly to the simian virus 40 large T
antigen and accumulates in the nuclei of cancer cells (128, 129).
Initially p53 was
thought to have oncogenic properties due to its overexpression in mice and in tumor cells
(130). About ten years later, it was discovered that mutant p53 (missense mutant form)
was originally coined as wild-type p53, so the onocogenic properties (131) observed
actually resulted from a p53 mutation (132, 133). The first knockout studies of wild type
p53 provided clear evidence that p53 is indeed a tumor suppressor (134).
Many studies
thereafter provided more lines of evidence of p53 as a tumor suppressor. p53 was found
to
be
involved
in
cell-cycle
regulation,
induction
of
apoptosis,
development,
differentiation, gene amplification, DNA recombination, chromosomal segregation, and
24
cellular senescence (135). Mutations or loss of p53 has been observed in more 50% of all
human cancer cases. p53 is a member of a unique family of proteins that also includes
p63 (136) and p73 (137). While this family is structurally and functionally related, p53
has evolved more than the others.
p53 is able to prevent tumor development, whereas
p63 and p73 have distinct roles in normal development biology (138).
Human p53 has molecular weight of 53 kD and is encoded by a 20-Kb gene
containing 11 exons and 10 introns (139). P53 is located on chromosome 17p. Wildtype
p53 consists of 393 amino acids and consists of several domains: transactivation domain,
proline-rich region, DNA-binding domain, tetramerization domain,
domain
(Figure
6A)
(29,
140,
141).
The N-terminal
and regulatory
domain is
required for
transactivation activity and this domain interacts with various transcription factors
including murine double minute 2 (MDM2) and acetyltransferases (142, 143). The
central core, which contains the DNA binding domain, is required for sequence specific
DNA binding (144).
The C-terminal domain includes tetramerization and regulatory
domains and functions as a negative regulatory domain (29) and has been implicated in
induction of cell death (145). When the C-terminus and core DNA binding domain are
disrupted by posttranslational modifications, such as phosphorylation or acetylation, the
DNA binding domain becomes active and thereby induces an enhanced transcriptional
activity (146). The enhanced transcriptional activity is the activation of p53 and targets
that induce cell cycle arrest and apoptosis.
Structure-based studies have revealed the
most p53 mutations found in cancers are missense mutations that are located in the
25
central DNA-binding domain. 80% of p53 mutation studies are centered around
mutations that lie within the residues between 126-306 (Figure 6B) (30).
p53 has an important role in maintaining the balance of proliferation and genome
integrity following genotoxic stress (29, 147). There are several types of genotoxic stress
that include DNA damage, heat shock, hypoxia, and oncogene over-expression, following
stress, wildtype p53 is activated and triggers biological responses to combat that stress
through DNA repair or apoptosis mechanisms (147, 148).
This activated p53, likely
causes an increase in the expression of p53 as well as other changes through
posttranslational modifications, which results in activation of p53-target genes (149). In
the case of DNA damage, ATM protein kinase is activated and then activates Chk2
kinase (750). ATM and ChK2 then both phosphorylate p53 at distinct sites which can
lead to p53-dependent cell cycle arrest and apoptosis (151, 152).
p53 target genes
activate downstream pathways that have a role in cell-cycle checkpoints, cell survival,
apoptosis, and senescence (153). Many different approaches have been used to identify
targets of p53, resulting in hundreds of physiologically p53 responsive genes being
reported (Figure 6). The genes identified are involved in cell cycle (p21 and GADD45),
DNA repair (GADD45, p48, p53R2, APE1), apoptosis (PUMA, BAX, BCL-2 family),
and senescence genes (p21 and p66) (154). p53 is also involved in the repression of gene
expression; the genes that may be repressed are bcl-2, bcl-X, Bl, MAP4, and survivin.
Some of these genes are negative regulators of apoptosis (29, 155).
26
2.6.1 p53 and cell cycle
p53 plays a role in the regulation of the cell cycle, by inducing a cell cycle arrest.
Cell cycle arrest allows the cell time to repair DNA damage before entering the critical
stages of DNA synthesis and mitosis.
p53 can use nucleotide excision repair and base
excision repair mechanisms before the arrested cells are released back into the
proliferating pool (156).
One of the most well-known and studied p53 target genes is
cyclin dependent kinase inhibitor, p21. P21 is a known cell cycle regulator, which is a
primary mediator of p53-dependent Gl cell cycle arrest following DNA damage. p21 is
upregulated by p53 in response to stress and DNA damage (157-159), therefore blocks
cyclin E/CDK-mediated phosphorylation of Rb and release of E2F, which functions to
induces the expression of gene involved in S phase entry (145). Increased expression of
GADD45 results in p53-driven G2 cell cycle arrest (160, 161). This occurs through the
binding of GADD45 to CDC2, which prevents cyclin B/CDC2 complex formation and
inhibits kinase activity (160).
2.6.2 p53 and apoptosis
One of the tumor suppressive functions of p53 is to monitor cellular stress and to
induce apoptosis as necessary.
In situations of cell stress and damage p53 can initiate
apoptosis and eliminate damaged cells (153).
Apoptotic genes that regulate apoptosis
includes BAX, DR5/KILLER, DRSL, Fas/CD95, PIG3, Puma, Noxa, PIDD, PERP,
Apaf-1, Scotin, p53AIPl, and many others.
The p53 apoptotic targets are divided into
two groups, extrinsic pathway (Fas/CD95, DR5/KILLER, DR4) and intrinsic pathway
(Bcl-2 family pro-apoptotic and anti-apoptotic members) (154).
27
When the extrinsic pathway (also referred to as death receptor pathway) is
activated, p53 initiates apoptosis through activation of the death receptors located on the
plasma membrane (162). P53 signals the inhibition of the production of IAPs (inhibitor
of apoptosis proteins), which controls apoptosis (162).
Alternatively, the intrinsic
pathway is the main pathway activated in p53 dependent apoptosis, whereas extrinsic
pathway is used to supplement the apoptotic response (163). The intrinsic pathway is the
mitochondrial pathway, and is activated when cells undergo stress.
regulated by the Bcl-2 family proteins (164, 165).
This pathway is
Bel-family consists of both pro-
apoptotic members (Bax, Bak, Bcl-xl, BH3-only members Bid, Bad, Puma, and Noxa)
and anti-apoptotic members (Bcl-2 and Bcl-Xl). When the intrinsic pathway is activated,
the pro-apoptotic proteins such Bax, Bid, Puma, Noxa, and p53aIPl localize to the
mitochondria which causes loss of the mitochondrial membrane potential and cytochrome
c release. Next the grouping of the apoptosome complex with Apaf-1 triggers the
activation of caspases through caspase 9, which executes apoptosis. (166-168). Loss of
Bax is responsible for nearly 50% of accelerated tumor growth in brain tumors (169,
170). Bax is also required for p53-dependent apoptosis in colorectal cancer cells, but is
dispensable in apoptosis of thymocytes and intestinal epithelial cells (154).
instances cell cycle arrest can protect cells from apoptosis.
In some
There is a crucial balance
between Puma and p21 which determines if cell undergo cell cycle arrest or apoptosis in
colorectal cancer cells, if p21 is disrupted cells die through apoptosis, however if Puma is
disrupted, apoptosis is prevented (171, 172).
28
2.6.3 Regulation of p53
In normal conditions within the cell, p53 is maintained at very low levels and in
the inactive latent form (148). In normal growing cells, the half-life of p53 is restricted to
minutes, however cellular stress or DNA-damage can prolong it to hours (173).
Increased expression of p53 protein is usually a result of lengthening of its half-life.
Expression of p53 and its activities are dependent upon the cell's needs and extracellular
stimuli. Many proteins can regulate p53 levels and activity, such as HPV16 E6, WT-1,
E1B/E4, SV40 T-antigen, MDM2, JNK, Pirh2, and PARP-1 (154).
2.(tA Protein stability
The stability of p53 can be increased by binding of SV40 T antigen, WT1 or
E1B/E4, whereas MDM2 or E6 association results in degradation of p53 (174). MDM2
is a well-known p53 regulator that inhibits p53 activity by blocking its transcriptional
activity, by facilitating its nuclear export and degradation (175, 176).
The E3 ubiquitin-
ligase activity that MDM2 possess can regulate ubiquitylation and proteasome-dependent
degradation of p53 (176). The MDM2 gene is also under the control of p53 and can be
transcriptionally regulated by p53 following cellular stress (177). The p53 protein is
targeted by MDM2 for degradation, however mt p53 is not targeted by MDM2 while
results in high levels in cancer cells (154).
2.6.5 Phosphorylation of p53
In response to stress, posttranslational modifications can also affect p53 activity
and stability (178).
These posttranslational modifications include phosphorylation,
acetylation, ADP-ribosylation, ubiquitination, sumoylation, neddylation, and cytoplasmic
29
sequestration, and usually occur in the N- and C- terminal regions of p53 (154).
The
most commonly studied modifications are acetylation and phosphorylation because of
their enhancement of p53 transcriptional activity.
These modifications result in p53
stabilization and nuclear accumulation which allows p53 to interact with sequence-
specific sites of its target genes (779, 180). While phosphorylation is the most commonly
reported protein modification in mammalian cells, it seems that acetylation may actually
be more crucial than phosphorylation (154,
181).
p53 phosphorylation results in
stabilization and increased DNA-binding, twenty serine and threonine sites have been
identified as phosphorylated on p53. Phosphorylation at these sites is mostly induced by
DNA damage, but a few sites are repressed by genotoxic stress (181).
P53 can be
phosphorylated by protein kinases (ATM/ATR) (152).
2.6.6 Acetylation of p53
Acetylation
may
also
have
an
important
role
in
stabilization
(182)
and
transcriptional activation of p53 (183). Many types of cell stress may increase acetylated
p53 in various cell types.
Acetylation occurs on lysine residues, and commonly
acetylated p53 residues include Lys305, Lys320, Lys372, Lys373, Lys381, Lys382 and
Lys386. The aforementioned residues are located in the regulatory domains adjacent to
tetramerization domain (154). P53 can also be acetylated by two histoacetyltransferases,
CBP/300 and PCAF.
CBP/300 acetylates the C terminus of p53 at Lys305, Lys372,
Lys373, Lys381, and Lys382, however PCAF acetylates Lys320 (184-186). It is believed
that the recruitment of coactivators stabilizes p53 and facilitates DNA binding, which
enhances the transactivation activity of p53 in cells, whereas deacetylation has an
30
opposite effect and suppresses activity (141). The acetylation of p53 can promote the
sequence-specific DNA binding activity, which may be due to an acetylation induced
conformational changes in p53 (755, 757, 755).
Acetylation and phosphorylation can work together to promote p53 activity, in
response to UV radiation, the p53 N terminus is first phosphorylated at Ser37 and Ser33,
and then the phosphorylated p53 activates CBP/300 and PCAF to induce p53 acetylation
at Lys373/Lys382 and Lys320 (189, 190).
In some instances phosphorylation may be
required in order for acetylation to occur (797).
Overall, p53 modulation is a very
complex process and p53 may be activated or regulated in different ways including
posttranslational modifications.
2.6.7 p53 mutations
P53 is one of the most commonly inactivated genes in human cancers (27, 28).
More than 18,000 mutations have been found in the p53 gene in different types of
cancers.
Studies suggest that about mutations of p53 occur in all tumor types and at
varying rates of 10% (in hematopoietic malignancies) to close to 100% (in high-grade
serous carcinoma of the ovary), which leads to p53 loss of function (754).
hi lung
cancer, p53 mutations occur in 70% of tumors, 60% in colon, heard and neck, ovary, and
bladder cancer, and 45% in stomach cancer (154). hi 50% of human tumors in which p53
is mutated, this loss of function is due to mutations in regulators of p53, MDM2 or E6 of
HPV, or deletion of pl4arf (192). While wt p53 is a tumor suppressor, mt p53 harbors
oncogenic properties.
For example, patients with Li-Fraumeni syndrome, who have an
inherited p53 germline mutation in one of the p53 alleles, are higher risk for developing
31
cancer during their lifetime (154). As well as loss of wt p53 allele led to tumors of the
brain, breast, connective tissue, hematological system, and adrenal gland (134). Loss of
wt p53 also leads to tumor formation. Mice with deficient wt p53 are more susceptible to
spontaneous tumor development (134). p53 protein mutations can result in eradication of
protein function and loss of function may be related to tumor progression and genetic
instability (154). Collectively, mutations in p53 gene aids in the progression of cancer.
2.6.8 p53 Missense mutations
While most tumor suppressor genes, such as RB, APC, or BRCA1 are inactivated
during cancer progression by deletions or truncating mechanisms, p53 usually undergoes
missense mutations, which means a single nucleotide is substituted by another (193).
When this happens a full-length protein containing only a single amino acid substitution
is produced. Mutations of p53 have diverse locations however the majority of mutations
result in loss of p53 DNA binding capabilities.
This affects p53's ability to bind DNA in
a sequence-specific manner and thus activate transcriptional of p53 target genes (194).
P53 mutations are found in all coding exons of the gene, with a strong preference to the
exon 4-9, which encodes the DNA-binding domain of the protein.
Of mutations in the
DNA-binding domain, 30% fall within 6 "hotspot" residues which are frequently mutated
in all cancers. These residues are R175, G425, R248, R249, R273, and R282), and may
exist due to susceptibility of particular codons to alterations (30).
2.6.9 P53 Dominant negative manner and Gain of Function
Many p53 mutants are able to promote tumor development not only through loss
of wild-type function but also other mechanisms (195).
For example, when there is
32
heterozygous mutation, which means there are wild-type and mutant alleles, mutant p53
can antagonize the wild-type p53 functions and render it inactive in a dominant negative
manner. The inactivation of wt p53 by mt p53 in a dominant negative manner relies on
the fact that transcriptional activity of wt p53 is dependent upon p53 as a tetramer and
somehow mt p53 may interfere with the structure (131, 196, 197).
p53 mutations are
commonly followed by loss of heterozygosity during cancer progression (198). Lines of
evidence support the idea that many mutant p53 isoforms may exert oncogenic properties
by a gain-of-function mechanism, referring to the oncogenic properties acquired by mt
p53.
Collectively, DN and GOF effects have a major role in the selection of missense
mutations in p53 during tumor progression (135, 199). Data provides evidence that p53
may be mutated in early and late stages of tumorigenesis.
However, the genetic
aberrations determine the tumor progression and aggressiveness of the disease rather than
the stage that the mutations occur.
2.6.10 Therapeutic Applications of p53
Inactivation of tumor suppressor p53 has a major role in tumorigenesis so it of
interest to determine mechanisms that may activate p53.
One of the commonly studied
negative regulators of p53 is MDM2. It is believed that inhibiting the E3 activity of
MDM2 may provide a strategy to kill tumor cells by restoring p53 activity (200). As a
result, many drug development studies are focused on p53-MDM2 interaction, one being
nutlins. Nutlins are small molecule inhibitors that are able to inhibit p53-MDM2
interaction n in vitro and in vivo.
Treatment with this molecule induces expression of
p53 and its target genes which induces apoptosis (201, 202).
Another inhibitor of p53-
33
MDM2 interaction, benzodiazepinedione, was found to induce p53 and its target,
decrease proliferation of tumors cell with wt p53 (203). Antisense oligodeoxynucleotides
targeted against MDM2 and p21 were also found be a potential therapeutic strategy
because it sensitized tumor cells to antineoplastic agents (204).
Since p53 has a known
role in apoptosis, other therapies include treatments that induce apoptosis though p53
targets.
Surprisingly, p53 apoptotic targets are rarely mutated in human cancers.
Therefore, p53 apoptotic targets Bax, Puma, p53AIPl, Noxa, and others could be used as
targets for gene therapy (205).
Introduction of wt p53 into tumors is also a cancer
therapy, expression of wt p53 was found to induce rapid loss of cell viability with
characteristics of apoptosis (154).
There are also therapies to reactivate p53 function
from mt p53, since mt p53 is not able to perform wt p53 functions due to protein folding.
Peptide and small molecule development have been investigated to combat protein
folding. These molecules stabilize the structure of p53 which leads to restored p53 DNA
binding abilities, transcription, and apoptotic functions (154).
Synthetic peptides have
been derived from the C-terminus of p53 (206), CBD3 (207), and PRIMA-1 (208).
CBD3 is known to stabilize the structure of p53, binds mt p53, and induce the refolding
of two hot spot mutations (His273 and Hisl75) in cancer cells (207, 209).
PRIMA-1
inhibits the growth of tumor cells by inducing apoptosis in transcription-dependent
manner through the conformational changes of p53 mutants that promotes p53 DNA
binding (208). A small synthetic molecule, CP-31398 is able to restore wt p53 function
to mutants, possibly through the intrinsic pathway (210, 211).
While there are clues of
34
mechanistic insight of these molecules, the exact mechanism by which these molecules
regulate the misfolded mt p53 to restore functionality is not known.
2.6.11 p53 and Id4
In the literature there are correlations between Id4 and p53 expression, which
suggest that there is some interaction between p53 and Id4.
Coradini et al found that in
breast cancer tissues with missense mutations in p53 there is decreased Id4 expression,
whereas in severe mutations (loss of p53 expression through deletions) Id4 expression is
surprisingly high (212). While these findings were unexpected, its suggests an interesting
relationship
between
p53
mutations,
mammary
cell
dedifferentiation,
and
the
concomitant acquisition of stem-like properties. Fontemaggi et al. determined altered p53
protein is prevalent in a class of triple-negative breast cancers. Further analysis of Id4 and
p53 interaction in breast cancer cell lines suggested that transcriptional activation of Id4
promoter is exerted by a complex mutant p53/E2Fl/p300 axis. In this study, mutant p53
regulation of Id4 expression was specific to mutation
and R273H exerted the highest
regulatory function over Id4 expression, which may explain rarity in mutant p53
regulation of Id4 in prostate cancer. They concluded that Id4 displays tumor suppressor
functions in ER+ breast tumors, while it is frequently inactivated by promoter
hypemethylation, whereas in tumors that express mutant p53 and are ER-, Id4 displays
oncogenic activities (213). There has been an association between mutant p53 and Id4 in
breast cancer, however this association has not been investigated in other cancers.
35
2.6.12 Summary
In summary, p53 is characterized as a tumor suppressor due to its role in
apoptosis, cell cycle arrest, DNA damage, senescence, differentiation, and DNA repair.
P53 is at the heart of many stress response pathways and regulator of many genes that
modulate various cellular processes such as DNA damage control, cell cycle arrest,
senescence, and apoptosis.
Mutations of p53 can provide an environment for genetic
instability of tumor cells, which can result in accelerating tumor progression. There has
also been a correlation between Id4 and mutant p53 in breast cancer, which suggests an
interaction between the two proteins.
CHAPTER 3
MATERIALS AND METHODS
3.1 Id4 over-expression and silencing in prostate cancer cell lines
The prostate cancer cell lines LNCaP, DU145 and PC3 were purchased from
ATCC and cultured as per ATCC recommendations. Human Id4 was over-expressed in
DU145 cells as previously described (26). Id4 was stably silenced in LNCaP cells using
gene specific shRNA retroviral vectors (Open Biosystems #RHS1764 -97196818, -
97186620 and 9193923 in pSM2c, termed as Id4shRNA A, B and C respectively).
The
cells transfected with non-silencing shRNA (RHS1707) was used as control cell line.
Transfections and selection of transfectants (puromycin) were performed as suggested by
the supplier. Successful Id4 gene silencing was confirmed by qRT-PCR, Western blot
analysis, and ICC.
3.2 RNA extraction
Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA) as described
previously [43]. The final RNA pellet was re-suspended in diethylpyrocarbonate
(DEPC)-treated H2O at a concentration of 1 mg/ml and stored at -80°C until analysis.
36
37
3.3 Reverse Transcriptase
RNA (2 jxg) was reverse transcribed in a final volume of 25 ul as per standard
protocols (RT-Mix: 1.25 mM each of dNTP's; 250 ng oligo dT (Promega, Madison, WI),
10 mM dithiothreitol, and 200 U MMLV reverse transcriptase (Invitrogen) in the MMLV
first-strand synthesis buffer (Invitrogen)). The RNA was denatured for 10 min at 65°C,
and then cooled on ice before addition of RT mix and enzyme. The reverse transcriptase
reaction was carried out at 42°C for 1 h and 95°C for 5 minutes. Samples were stored at 20°C until analysis.
3.4 Quantitative Real Time PCR (qRT-PCR)
qRT-PCR was performed as described previously using gene specific primers
(Table 1) on RNA purified from cell lines (8).
3.5 Protein Extraction
Total cellular proteins were prepared from cultured prostate cancer cell lines
using M-PER (Thermo Scientific) (26). Protein samples were quantitated using the The
Bio-Rad DC Protein Assay according to manufacturer protocol. A standard curve was
determined using BSA and sample absorbance read at 750 ran. Samples were
concentrated in 30 ug/ul volume and then mixed 1:1 with 2X Sample Buffer.
3.6 Western Blot Analysis
30 ug of total protein was size fractionated on 4-20% SDS-polyacrylamide gel
(5% for CBP/p300 western blotting) and subsequently blotted onto a nitrocellulose
membrane (Whatman). The blotted nitrocellulose membrane was subjected to western
blot analysis using respective protein specific antibodies (Table 2). After washing with lx
38
PBS, 0.5% Tween 20, the membranes were incubated with horseradish peroxidase (HRP)
coupled secondary antibody against rabbit IgG and visualized using the Super Signal
West Dura Extended Duration Substrate (Thermo Scientific) on Fuji Film LAS-3000
Imager.
3.7 Proliferation Assay
Cell proliferation analyses were performed using 3-(4, 5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) assay. LNCaP+NS and LNCaP-Id4 cells were
seeded in 96-multi well plates at a density of 5 x 105 cells/ well without serum overnight.
Cells were then cultured for 72 hrs. MTT assay was performed using CellTiter 96 NonRadioactive Cell Proliferation Assay kit (Promega) following manufacturer's
instructions.
3.8 Scratch Wound Assay
Migratory properties of LNCaP+NS and LNCaP-Id4 cells were measured using a
scratch wound assay. Cells were plated in 6-well plates (5 x 105 cells/well) in RPMI with
5 % FBS and cultured overnight. Before treatment, wells were scratched down the middle
with a 200 ul pipette tip. Culture media were replaced with RPMI containing 5 % FBS.
Cells were allowed to migrate across the scratch for 48 h. Images of the scratch area were
recorded at three random spots at 0 and 48 h. The migrating cells were counted using a
standard size field for each image.
3.9 Migration Assay
LNCaP+NS and LNCaP-Id4 cells were used for in vitro cell migration assay.
Assay was performed using 24-well trans-well inserts (8 um). Briefly, cells were washed
39
once with RPMI and harvested from cell culture dishes by EDTA-trypsin into 50 ml
conical tubes. The cells were centrifuged at 500 x g for 10 minutes at room temperature;
the pellets were re-suspended into RPMI supplemented with 0.2% bovine serum albumin
at a cell density of 3 x 105 cells/ml. Outsides of the trans-well insert membrane were
coated with 50 ul of rat tail collagen (50 ug/ml) overnight at 4°C. Following day, aliquots
of rat tail collagen (50 ul) were added into the trans-well inserts to coat the inside of the
membranes. Insert were kept at room temperature for 1.5 h before being washed
thoroughly with 3 ml of RPMI. Chemoattractant solutions were made in RPMI
supplemented with 0.2% bovine serum albumin. Control and chemoattractant solutions
(400 ul) were added into different wells of a 24-well plate. 100 ul aliquots of cell
suspension were loaded into trans-well inserts that were and placed into the 24-well plate.
The trans-well insert-loaded plate was placed in a cell culture incubator for 5 h. At the
end of the incubation. The cleaned inserts were fixed in 300 ul of 4% paraformaldehyde
(pH 7.5) at room temperature for 20 minutes. Cells on the outside of the trans-well insert
membrane were stained using HEMA 3 staining kit (Fisher Scientific, Inc.). Then,
stained cells were counted in four non-overlapping fields using low-power with a light
microscope, and the average number of cells reflected the cell migration status in each
trans-well insert. Results were indicated by migration index, which is defined as the
average number of cells per field for test substance / the average number of cells per field
for the medium control. (214).
40
3.10 Soft agar assay
Prepared 0.8% base agar layer, followed by 0.7% top agarose solution in 10cm
plates. LNCaP+NS and LNCaP-Id4 cells (-20,000 cells) were harvested, and
resuspended in the top agar. Cells were then aliquoted appropriately on top of base agar
layer (pre-warmed to 37°C). Then incubated the plates for 21 days and fed cells 2 times a
week. Colony growth was monitored and at the end of incubation colony was quantitated
and charted.
3.11 Mouse model studies
Male nude mice that are 6-8 weeks old were obtained upon IACUC approval from
Charles River Laboratories International Inc (Wilmington, MA). These mice were kept
in conventional pathogen-free housing at Mercer University and were used for study in
accordance with National Institutes of Health Guide for the Care and Use of Laboratory
Animals. LNCaP+NS and LNCaP-Id4 cells were cultured until growth reached a
concentration of 3 x 106 million cells. Then cells were trypsinized, rinsed with PBS, and
resuspended in serum-free media. Cells were then mixed with a 1:1 dilution of matrixgel
(BD biosciences) and kept on ice until further use. Mice were injected subcutaneously,
the left flank of nude mice with LNCaP+NS cells and the right flank with LNCaP-Id4
cells. Then tumor growth was observed over a period of 12 weeks. Weight, tumor
growth dimensions were monitored several times weekly. Weight measured in grams,
tumor size measured by weight x height.
41
3.12 Statistical Analysis
Data was analyzed by SPSS 13.0 statistics software. Experimental data is
presented as means ± the standard deviations. A p-value of <0.05 will be considered
statistically significant.
3.13 Co-Immunoprecipitation
To detect the protein-protein interactions, co-immunoprecipitation was performed
using protein A coupled to magnetic beads (Protein A Mag beads, GenScript) as per
manufacturer's instructions. Briefly, protein specific IgG (anti-p53 or -Id4, Table SI)
was first immobilized to Protein A Mag Beads by incubating overnight at 4°C. To
minimize the co-elution of IgG following immuno-precipitation, the immobilized IgG on
protein A Mag beads was cross-linked in the presence of 20mM dimethyl pimelimidate
dihydrochloride (DMP) in 0.2M triethanolamine, pH8.2, washed twice in Tris (50mM
Tris pH7.5) and PBS followed by final re-suspension and storage in PBS . The cross-
linked protein specific IgG-protein A-Mag beads were incubated overnight (4C) with
freshly extracted total cellular proteins (500 ng/ml). The complex was then eluted with
0.1 M Glycine (pH 2-3) after appropriate washing with PBS and neutralized by adding
neutralization buffer (1 M Tris, pH 8.5) per 100 ul of elution buffer.
3.14 Chromatin Immuno-precipitation (ChIP) Assay
Chromatin immuno-precipitation was performed using the ChIP assay kit
(Millipore, Billerica, MD) according to the manufacturer's instructions. The chromatin
(total DNA) extracted from cells was sheared (Covaris S220), subjected to immunoprecipitation with p53, mouse/ rabbit IgG or RNA poll antibodies (Table SI), reverse
42
cross linked and subjected to qRT- PCR in Bio-Rad CFX. The previously published
ChIP primer sets spanning the consensus p53 response element sites in the promoters of
BAX (215), p21 (215), PUMA (216) and MDM2 (215) were used (Table SII).
3.15 Electrophoretic Mobility Shift Assay (EMSA)
The nuclear proteins from respective cell lines were prepared using the nuclear
extraction kit from Affymetrix (AY2002) according to the manufacturer's instructions.
1 ul of nuclear proteins were used in an EMSA reaction using Biotin end labeled p53
double stranded oligonucleotide (Affymerix, AY1032, p53(l) EMSA kit containing the
p53 response element (215)). The nuclear proteins and labeled oligonucleotide or excess
unlabeled oligonucleotide were incubated for 20 min at room temperature, separated on
5% non-denaturing polyacrylamide gel and transferred onto nitrocellulose membrane and
detected following manufacturer's instructions. The EMSA using LNCaP+NS cells with
wild type p53 and p53 null PC3 was used as positive and negative controls, respectively.
3.16 p53 Activity Assay
p53 DNA binding activity and quantitation on nuclear extracts was performed by
capturing p53 with double stranded oligonucleotides containing a p53 consensus binding
site immobilized in a 96 well format (TF-Detect p53 Assay, Genecopoeia) followed by
detection with p53 specific antibody in a sandwich ELISA based format according to
manufacturer's instructions (essentially a quantitative super-shift assay).
3.17 Transient Transfections and Reporter Gene Assay
Cells were cultured in 96-well plates to 70-80% confluency and transiently
transfected by mixing either PG13-luc (containing 13 copies wt p53 binding sites (217),
43
Addgene) or MG15-luc (containing 15 mutant p53 binding sites (277), Addgene) with
pGL4.74 plasmid (hRluc/TK: Renilla luciferase, Promega) DNA in a 10:1 ratio with
FuGENE HD transfection reagent (Promega) in a final volume of 100 ul of Opti-MEM
and incubated for 15 min at room temperature. The transfection mix was then added to
the cells. After 24 h, the cells were assayed for firefly and Renilla luciferase activities
using the Dual- Glo Luciferase reporter assay system (Promega) in LUMIstar OPTIMA
(MHG Labtech). The results were normalized for the internal Renilla luciferase control.
3.18 Immuno-cytochemistry
Cells were grown on glass chamber slides up to 75% confluency. The slides were
then washed with PBS (3x) and fixed in ice cold methanol for 10 min at room
temperature and stored at -20C until further use. Before use, the slides were equilibrated
at room temperature, washed with PBS (5min x3), blocked with 1% BSA in PBST for 30
min at room temp and incubated overnight (4°C) with primary antibody (1% BSA in
PBST, Table SI). The slides were then washed in PBS and incubated with secondary
antibody with fluorochrome conjugated to DyLight (Table SI) in 1% BSA for lhr at room
temp in dark. The slides were subsequently washed again and stained in DAPI (1 |ig/ml)
for 1 min and mounted with glycerol. Images were acquired by Zeiss fluorescence
microscopy through Axiovision software.
3.19 Apoptosis Assay and mitochondrial membrane potential (MMP)
Apoptosis and MMP was quantitated using Propidium Iodide and Alexa Fluor
488 conjugated Annexin V (Molecular Probes) and dual-sensor MitoCasp (Cell
Technology) as described previously {218)
44
3.20 Statistical Analysis:
Quantitative real time data was analyzed using the delta delta Ct method. The
ChIP data was analyzed using % chromatin (1%) as input (Life Technologies). Within
group Student's t-test was used for evaluating the statistical differences between groups.
3.21 Cell Treatments
2xlO5 cells were seeded in a tissue grade six well plate and allowed to attach
overnight. The following day 500nM of Doxorubicin was added to the media and
incubated for 24hrs for apoptosis assay. lOxlO3 cells were plated in a 96 cell culture plate
and allowed to attached overnight. The following day 500nM of Doxorubicin was added
to the plates and cells were incubated for 24, 48 and 72 hours to measure proliferation.
CHAPTER 4
RESULTS
4.1.1 Expression of Id4 in prostate cancer cell lines
Id4 is undetectable in DU145 cells due to promoter hyper-methylation (9). In
contrast, Id4 was expressed in LNCaP cells due to promoter hypo-methylation. These
two cell lines were used to either over-express (DU145+Id4) or silence (LNCaP-Id4) Id4.
Two different retroviral shRNA vectors (vectors A and C) were used to silence Id4
(Figure 8) in LNCaP cells. The shRNA mediated stable knockdown of Id4 in LNCaP
using vector A (LNCaP-Id4), Id4 over-expressing DU145 cells (DU145+Id4, Figure 8C)
and their respective vectors only transfected cells were used for all subsequent
experiments. A non-silencing control vector was also transfected into LNCaP cells
(LNCaP+NS). Expression of Id4 was measured by q-PCR, western blotting, and ICC.
4.1.2 Effect of Loss of Id4 on cell apoptosis and proliferation
Upon Id4 silencing, there is a marked decrease in apoptosis as compared to
LNCaP+NS control (Figure 9A). The rate of apoptosis was measured using Annexin V
staining and analyzed by FACs analysis. Apoptotic cells decreased from 47% in
LNCaP+NS to 10% in LNCaP-Id4. Proliferation rates almost doubled after Id4 silencing
45
46
as shown by MTT assay (Figure (9B). This data suggests loss of Id4 promotes increased
proliferation and suppresses apoptosis.
4.1.3 Effect of loss of Id4 on cell migration
To investigate the effect of loss of Id4 on migratory abilities of LNCaP cells,
which do not typically migrate, we employed the scratch wound assay (Figure 10A). We
plated 5 x 105 cells in a six well plate and then used a 20uL tip to make an even wound in
the control samples as well as LNCaP-Id4 cells. The wound was allowed to heal over a
48 h period. After 48 h, we measured wound healing, and we determined that the wound
was more healed in LNCaP-Id4 cells. Data indicated that loss of Id4 increased migratory
abilities of cells. However, it is difficult to quantitate the scratch wound assay so
migration was measured using a more quantitative manner. We used the Transwell
migration assay to measure the number of migratory cells (Figure 10B). After the 5
hours of incubation, the inserts were then stained and counted under an inverted
microscope. We counted twice the amount of migratory cells in LNCaP-Id4 as compared
to LNCaP+NS controls. Collectively, the data provides evidence that loss of Id4 promote
migration in LNCaP cells.
4.1.4 Gene expression changes following loss of Id4
We investigated proliferation marker cyclin dependent kinase inhibitor p27.The
expression of p27 was detected by q-PCR (Figure 11C). The expression of p27 is
decreased by 9-fold upon loss of Id4, as compared to LNCaP+NS controls. Thus the
increase in proliferation may be due deregulation of p27. The decrease in apoptosis
could be due to the decrease in p53 and its downstream targets, which will be discussed
47
later. We also observed increased migratory capabilities after silencing of Id4 in LNCaP
cells. So then, expression of markers involved in migration and invasion, (MMP2,
MMP13, and Idl) were investigated. We found a four fold increase in MMP2 expression
(Figure 1 IB) and MMP13 by a little more than two fold induction (Figure 1 IB). We also
noted 14 fold increase in Idl expression in LNCaP-Id4 cells as compared to the controls
(Figure 11 A). So the increased migratory capabilities of LNCaP-Id4 may be a result of
increased expression of MMPs and Idl.
4.1.5 Effect of loss of Id4 on tumor growth
Next, we wanted to determine the effect of loss of Id4 on tumor growth. First, we
used an in vitro technique, the clongenic assay, to determine if LNCaP-Id4 would form
larger and more colonies as compared to the parental LNCaP+NS (Figure 12A). We
plated 50,000 cells in the agar filled plates and incubated them for 14 days. After 14
days, we observed not only more colony growth, but also larger colonies (2.5 fold
increase), which would indicate that loss of Id4 promotes tumor growth in LNCaP cells.
Since the LNCaP-Id4 cells were able to form colonies, we decided to proceed with in
vivo studies in nude mice. We injected 6 mice with LNCaP+NS cells on the left flank
and LNCaP-Id4 cells on the right flank. After the mice were injected tumor growth was
monitored. After about three weeks, we noticed tumor growth on the LNCaP-Id4 flank
(Figure 12B). We monitored tumor growth and mice weight weekly throughout the
growth period (Figure 12C). After six weeks, the mice were sacrificed and the tumors
excised (Figure 12E). The tumor weight and volume of LNCaP-Id4 cells (weight 0.62,
tumor size 15mm x 10mm)were significantly higher than the LNCaP+NS control (weight
48
0.02g, tumor size 4mm x 2mm), which indicates loss of Id4 promotes tumor growth in
nude mice. Not only were the weight (Figure 12 D) and volume (Figure 12F)
significantly increased, but the LNCaP-Id4 tumors grew at a faster rate than LNCaP+NS
tumors (Figure 12G).
4.2.1 Id4 Promotes Apoptosis
A significant increase in apoptotic cells was observed in DU145+Id4 (64+3.3%,
PO.001, Figure 13A) cells as compared DU145 cells (24+5.1%, Figure 13A) whereas
number of cells undergoing apoptosis decreased in LNCaP-Id4 (10.5+2.3%) as compared
to LNCaP (47.2+6.5%) cells (Figure 13 A). Apoptosis in DU145+Id4 cells was
accompanied by increased fraction of cells with lower mitochondrial membrane potential
(MMP, 21.3+4.65%, Figure 13B) whereas decreased apoptosis in LNCaP-Id4 cells was
associated with increased fraction of cell with high MMP (1.5+0.09%) as compared to
DU145 (0.7+0.08%) and LNCaP+NS (14.3+2.60%) respectively (Figure 13B). Thus Id4
promotes apoptosis through changes in MMP that eventually promotes cytochrome c
release from the mitochondria {219).
Increased BAX expression and/or PUMA dependent dissociation of BAX from
Bcl-2 promotes translocation of BAX to mitochondria resulting in decreased
mitochondrial membrane potential (220). The expression of pro-apoptotic BAX and
PUMA increased in DU145+Id4 cells whereas a corresponding decrease in BAX and
PUMA was observed in LNCaP-Id4 cells at the protein (Figure 13C) and transcript (Fig.
13D) level as compared to DU145 and LNCaP+NS cells respectively (Figures. 13C and
49
13D). These results clearly implicated the role of Id4 in promoting apoptosis through
increased expression of BAX and PUMA. Apoptotic stimuli induce BAX activation,
characterized by translocation and multimerization on the mitochondrial membrane
surface resulting in exposure of an amino terminal epitope recognized by the
confirmation specific monoclonal antibody BAX 6A7 (221). Co-localization of BAX
(BAX 6A7 antibody) with mitochondrial PDH (pyruvate dehydrogenase) demonstrated
that BAX undergoes conformational change and translocates to the mitochondria in
DU145+W4 and LNCaP+NS cells (Figure 13E) but not in DU145 and LNCaP-Id4 cells
possibly due to undetectable levels of BAX (Figure 13C).
Both BAX and PUMA are also transcriptional targets of the tumor suppressor
protein p53 (222). As expected, decreased apoptosis in part due to loss of BAX and
PUMA expression in LNCaP-Id4 cells was associated with low p53 expression as
compared to LNCaP+NS cells (Figure 14A). A similar relationship between Id4 and p53
expression was not observed in DU145 cells. Unlike wt-p53 in LNCaP+NS cells, the
DU145 cells harbor mut-p53. The two mutations (P223L and V274F) are within the
DNA binding domain that results in a transcriptionally inactive form of p53 (32). Mut-
p53 protein generally accumulates at high levels due to loss of regulatory mechanisms
(223) as seen in DU145 cells (Figures 14A and 14B, 12 fold higher as compared to
LNCaP+N cells). Surprisingly, we observed decreased levels of mut-p53 in DU145+W4
cells at the transcript (Figure 14B, 2 fold compared with LNCaP cells normalized to 1)
and protein level (Figure 14A). These results are significant especially in context of
increased expression of BAX and PUMA in DU145+W4 cells in spite of low mut-p53
50
expression. We reasoned that one of the mechanisms by which mut-p53 could up-
regulate BAX/PUMA expression could be through gain of transcriptional activity by
mut-p53 in DU145+Id4 cells. Immuno-cytochemical localization of p53 also revealed
that mut-p53 is localized to the nucleus and cytoplasm in DU145 (FigureH C, DU145,
arrows) cells but is primarily nuclear in DU145+Id4 cells (Figure. 14 C, DU145+W4,
arrows). Previous studies have also shown a predominant cytoplasmic staining of mutant
p53 in prostate cancer whereas wt- p53 is primarily nuclear (224).
We also investigated the expression of CDKN1A (p21) which is also a well
characterized p53 target gene (225). Increase in the expression of p21 (Figures 13C and
13D, 9 fold as compared to DU145), in addition to PUMA and BAX further consolidated
our observations that mut-p53 in DU145+Id4 cells may have gained transcriptional
activity through site specific DNA binding in the respective promoter elements.
4.2.2 Id4 restores mutant p53 DNA binding and transcriptional activity
An EMSA with canonical p53 DNA response element was used to determine the
DNA binding ability of wt- (LNCaP+NS) and mut-p53 (DU145). LNCaP+NS cells with
wt-p53 resulted in a gel shift (Fig. 15A) whereas, a gel shift of lower intensity was
observed in LNCaP-Id4 as compared to LNCaP+NS cells possibly due to lower
expression of wt-p53 (Figures 15A and B). A distinct gel shift was observed in the
presence of DU145+Id4 nuclear extracts but no gel shift was observed with DU145
nuclear extracts suggesting that mut-p53 in the absence of Id4 lacks DNA binding
activity. Increased p53 DNA binding activity using p53 response element immobilized
on a 96 well plate followed by detection with p53 specific antibody was also observed in
51
LNCaP+NS and DU145+W4 that was significantly higher as compared to LNCaP-Id4
and DU145 cells respectively (Figure 15B). In a functional transcriptional assay using a
p53 response element (wt-p53RE) luciferase reporter plasmid, the relative p53 luciferase
activity decreased significantly in LNCaP-Id4 cells as compared to LNCaP+NS cells
(normalized to 1, Figure 15C), which is consistent with the expression of p53 in these cell
lines. Surprisingly, mut-p53 in DU145+Id4 cells demonstrated high luciferase activity as
compared to DU145 (normalized to 1, wt-p53RE). The mutant p53 luciferase plasmid
(mt-p53RE) used as a negative control, as expected, did not result in luciferase activity.
In context of using LNCaP+NS as a positive control, our results strongly suggested that
mut-p53 gains DNA binding and transcriptional activity in the presence of Id4 that is in
part independent of its expression level. Silencing of p53 through siRNA was used to
further clarify the role of mutant p53 in DU145. However, siRNA based p53 silencing
led to massive apoptosis in DU145 (226).
Real time quantitative PCR analysis on Chromatin immuno-precipitated (ChIP)
with p53 antibody demonstrated the binding of wt-p53 to its respective response elements
on BAX (Figure 15D), p21 (Figure 15E) and PUMA (Figure 15F) promoters in LNCaP
cells. The decreased p53 expression in LNCaP-Id4 correlated with decreased binding to
its respective promoter elements on BAX, p21 and PUMA promoters (P<0.001) (Figures
15D-F). As anticipated, in DU145 no significant binding of mutant p53 was observed on
p21, PUMA and BAX promoters (Figures 15D-F). However, in DU145+W4 cells, a
significant increase in the binding of mut-p53 as compared to DU145 was observed on
BAX, p21 and PUMA promoters (Figures 15D-F).
52
Incidentally, p53 regulates MDM2, (an E3 ubiquitin ligase involved in p53 protein
degradation) expression in a highly complex manner. In this study we focused on
investigating whether MDM2 expression is regulated in a p53 dependent manner at the
promoter level, rather than on interaction between wt- and mut-p53 with MDM2 at the
protein level. Unpredictably, MDM2 protein expression was higher in LNCaP-Id4 (2.4+
0.32 fold, Figure 16A) cells as compared to LNCaP+NS cells (Figure 16A and semi
quantitation in lower panel) in spite of lower p53 expression (Figure 16A and B) The
expression in DU145 cells (2.6+0.11 fold) was comparable to LNCaP-Id4 cells (Figure
16A). However, MDM2 expression was lower in DU145+W4 (1.2+0.13) cells as
compared to DU145 but was comparable to LNCaP+NS cells (normalized to 1). MDM2
expression is regulated by a p53 response element located within the P2 promoter in
intron 1 (Figure 16B) (227). The alternative, PI promoter, upstream of exonl is
generally considered p53 independent (228).
Both PI and P2 transcript however are
translated from the common start site in exon 2. Abundance of PI and P2 transcripts was
then performed to understand whether MDM2 expression is regulated in a p53 dependent
(P2) or independent (PI) manner.
The results suggested that MDM2 expression in
LNCaP+NS cells is primarily due to transcription from the P2 promoter in part due to the
binding of p53 (Figure 16D), whereas in LNCaP-Id4 cells, MDM2 expression is a result
of activation from the PI promoter (Figure 16C).
In DU145 cells, the PI promoter was
active as compared to P2, but in DU145+Id4 cells, the p53 dependent (Figure 16D) P2
promoter was transcriptionally active (Figure 16C). These results suggested that the
regulation of MDM2 expression is highly complex and that in cells lacking Id4 (LNCaP-
53
Id4 and DU145), the PI promoter is transcriptionally active whereas in cells with Id4
(LNCaP+NS and DU145+W4) the p53 dependent P2 promoter is active (Figure 16D).
4.2.3 Id4 Recruits CBP/p300 to promote p53 acetylation
Acetylation, independent of phosphorylation status promotes p53 stabilization and
transcriptional activity but de-stabilizes its interaction with MDM2 (229). Recent studies
have also shown that acetylation of some mutant forms of p53 can restore the DNA
binding activity (230). These studies led us to explore whether Id4 promotes acetylation
of mut-p53 in DU145+Id4 cells. The total p53 protein was first immuno-precipitated and
then immuno-blotted with acetylated lysine antibody. Increased global p53 lysine
acetylation was observed in DU145+Id4 and LNCaP+NS cells as compared to LNCaPId4 and DU145 cells. In p53, K320 is acetylated by PCAF and promotes p53-mediated
activation of cell cycle arrest genes such as p21 (231). In contrast, acetylation of K373
leads to hyper-phosphorylation of p53 NH2-terminal residues and enhances the
interaction with promoters for which p53 possesses low DNA binding affinity, such as
those contained in pro-apoptotic genes, BAX and PUMA (231). The results shown in
Figure 17A demonstrated a significant increase in K373 acetylation in DU145+Id4 cells
whereas no significant change was observed between LNCaP+NS and LNCaP-Id4 cells.
The K320 expression was also significantly higher in DU145+Id4 and LNCaP+NS cells
as compared to DU145 and LNCaP-Id4 cells. These results provided evidence that Id4 is
involved in promoting acetylation of specific residues in wt- and mut-p53 that promotes
its binding to respective response elements. The increased K320 acetylation in
DU145+Id4 cells clearly is consistent with the study by Parez et al (230) in which the
54
authors demonstrated acetylation at this specific residue restores mutant p53 biological
activity. We were however intrigued with a significant increase in the expression of
acetylated K373 in DU145+W4 cells. Acetylation at K373 is CBP/P300 dependent
(232). We hypothesized that if CBP/P300 is involved in K373 acetylation than it could
co-precipitate with p53. Results demonstrated that indeed mutant p53 is physically
associated with CBP/P300 at significantly higher levels than mut-p53 from DU145 cells
alone (Figure 17A). These results led us to propose a model whereby, Id4 could recruit
or promote the assembly of CBP/P300 and p53. Immuno-precipitation with Id4 and
blotting with p53 demonstrated the presence of p53 in this complex in DU145+Id4 and
LNCaP+NS cells but not in DU145 and LNCaP-Id4 cells suggesting that Id4 directly
associates with p53. These results consolidated our hypothesis that Id4 promotes the
recruitment of CBP/p300 on p53 to promote acetylation and restore its biological activity.
4.3.1 Id4 sensitizes prostate cancer cell DU145 to doxorubicin treatments by
apoptosis and proliferation
DU145 and DU145+W4 cells were treated with 500 nM of Doxorubicin for 24
hours. After 24 hours apoptosis was measured, there was an increase in apoptosis in both
DU145 and DU145+Id4 cells (Figure 18A); however the observation that Id4 alone can
induce apoptosis at a rate similar to that of antitumor drug, Doxorubicin is an intriguing
observation. There were also significantly more dead cells in DU145+Id4 as compared to
DU145 cells, 30% to 22%, respectively. This data suggested that Id4 sensitizes cells to
doxorubicin treatment.
55
4.3.2 Id4 may induce sensitization via MYC regulation
To investigate the mechanisms by which Id4 may sensitize DU145 cells to
chemotherapeutic agent Doxorubicin, we wanted to investigate genes known to sensitize
cells to doxorubicin treatment. There were two genes that were of interest p53 and MYC.
Since we have provided evidence that Id4 restores mutant p53 function in an acetylation
dependent manner, this may be the mechanism by which Id4 sensitizes prostate cancer
cells to therapeutic treatment. However, there may be an alternate pathway involved,
MYC regulation. So we first investigated the expression of MYC in prostate cancer cells,
DU145 and DU145+Id4, we observed a decrease in expression MYC upon over-
expression of Id4 (Figures 19 A and B). Downstream of MYC lies MDM2, which also a
well-known tumor promoter. In DU145+Id4 cell, MDM2 expression is decreased as
well. Therefore Id4 down regulates MDM2 possibly via MYC regulation (Figure 18C).
Then we wanted to investigate whether MYC is binding to its downstream target MDM2,
so we used a ChIP assay (Figure 19D). We immunoprecipitated with MYC and
measuring binding to the MDM2 promoter. We determined that MYC is binding to the
MDM2 promoter in DU145 cells, however there is decreased binding in DU145+Id4
possibly as result of decreased expression of MYC in DU145+Id4 cells. Collectively, the
data provides evidence that Id4 down regulated MYC expression in DU145+Id4 cells, as
a result MDM2 expression is down regulated due to decreased MYC expression.
CHAPTER 5
DISCUSSION
Id4 has been characterized as a tumor suppressor in many cancers, due to its
promoter methylation in cancer tissues. Previous studies from Carey et al, provided
evidence in prostate cancer that ectopic Id4 induced apoptosis in prostate cancer cell lines
DU145, while attenuating the cell cycle and proliferation (26). Since LNCaP cells
express Id4, it was determined to be an ideal model in which to silence Id4. Upon
silencing of Id4, there was decreased apoptosis, which may be contributed to decreased
p53, BAX, and PUMA expression. Upon silencing of Id4, there was an increase in
proliferation of the LNCaP-Id4 cells. Studies have shown that there is inhibition of
p27kipl expression in prostate cancer, which results a proliferative phenotype (233-235).
So the increased proliferation of LNCaP-Id4 cells may be due to decreased p27kipl
expression. Increased migration also occurred in LNCaP-Id4 cells which may be a result
of increased Idl, MMP2, and MMP9.
Idl is strongly associated with prostate cancer. Idl has been found to promote migration
and invasiveness of cancer cells (16, 106). During invasion, the extracellular matrix can
be degraded by MMPs, which results in their increased expression (236). Aalinkeel et al.
found that upon overexpression of MMP-9 in LNCaP cells, there was fairly common
56
57
increased invasion.
While there was no overexpression of MMP-9 in these studies, loss
of Id4 did increase the expression of MMP-9 which may support the increased migration
and invasion that was observed (23 7).
Not only did loss of Id4 increase migratory and
invasive abilities of LNCaP-Id4 cells, but also resulted increased tumor formation in nude
mice. LNCaP-Id4 tumors were not only larger than the controls (LNCaP+Id4) but also
formed at a faster rate which may also be due to increased Idl levels. Idl expression has
been associated with tumor growth in prostate cancer through activation of VEGF (22).
5.2 Id4 dependent acetylation restores mutant p53 transcriptional activity
In this study, we provide evidence that Id4 regulates p53 at two different levels:
transcriptional regulation of wt-p53 in LNCaP cells and restoring the biological activity
of mutant p53 in DU145 cells. Although the transcriptional regulation of wt- p53 by Id4
is clearly evident in our studies, we focused on investigating the mechanism by which Id4
restores the biological activity of mutant p53, clearly an area of high interest given that
mutant p53 is observed in one third of prostate cancers (238) and more than 50% of all
cancers (239).
The core domain of p53 is inherently unstable. Point mutations in this domain
promote instability and unfolding, leading to decreased or completely abrogated
transcriptional activity (240). Both alleles of p53 in DU145 cells carry mutations
resulting in the expression of mutant p53 (p223L and V274F) (32). Although none of
these mutations represent the known hotspot mutations but together these mutants
maintain a predominantly denatured confirmation, are accumulated in large amounts in
cells and lacks transactivation function in DU145 cells and when over-expressed in p53
58
null PC3 cells (241). Hence the mutants in DU145 cells are excellent models to
understand the mechanisms involved in promoting its function in context of Id4 which is
epigenetically silenced in these cells.
In our studies, we clearly show that mutant p53 expression is high in DU145 cells
but lacks transactivation potential and DNA binding activity as compared to LNCaP cells
with wt-p53. Studies have also shown that virtually all tumor derived p53 mutants are
unable to activate BAX transcription but some retain the ability to activate p21
transcription (34). However, our results clearly suggest the p53 mutations in DU145 are
incapable
of transactivating not only p21 but BAX as well due to lack of promoter
1
binding.
Multiple lines of evidence support the gain of transactivation potential of mutant
p53 in DU145 cell over-expressing Id4: First, mutant p53 in DU145+Id4 cells promotes
p53 dependent luciferase reporter activity, second, mutant p53 gains DNA binding
activity as demonstrated by EMSA and direct DNA binding followed by detection with
p53 specific antibody and thirdly, site specific binding to the respective p53 binding sites
on BAX, PUMA, p21 and MDM2 P2 promoters, that is also consistent with their
corresponding increase in expression and apoptosis.
The decrease in the expression of
mutant p53 in DU145+Id4 cells as compared to DU145 could also suggest that mutant
p53 responds to the regulatory network required to maintain its normal physiological
(compared to LNCaP cells) levels. Although we did not follow up on the mechanisms
involved in the regulation of p53 expression, post-translation modifications within p53
(discussed below) can promote its function at multiple levels by attenuating its interaction
59
with MDM2, recruitment to p53 responsive promoters and favoring nuclear retention as
observed in DU145+Id4 cells.
Acetylation at lysine residues has emerged as a critical post-translational
modification of p53 for its function in vivo such as growth arrest, DNA binding, stability
and co-activator recruitment {{229, 231) and reviewed in {242)). The global de-
acetylation of p53 and specifically at K320 and K373 in LNCaP-Id4 cells provide strong
evidence that acetylation is a major modification required to maintain p53 activity.
Previous studies have demonstrated that certain post-translational modifications such as
PCAF dependent acetylation of K320 can restore mutant p53 activity (G245A and
R175H) {230). Our results on mutant p53 acetylation, global and K320/ 373 in
DU145+Id4 are particularly novel and provide direct evidence that mutant p53 activity
can be restored by acetylation. The increased K320 acetylation of DU145 p53 mutants is
most likely also mediated by PCAF but we did not directly investigate this mechanism.
However, a significant observation made in this study was co-elution CBP/P300 with wt(LNCaP) and mutant p53 (DU145+Id4) and increased K373 acetylation in an Id4
dependent manner. Moreover, co-elution of Id4 as part of this complex with p53
antibody and co-elution of p53 with Id4 antibody suggest that Id4 can recruit CBP/P300
on wt- and mutant p53 to promote acetylation. Alternatively, CBP/p300 could recruit Id4
to promote large macromolecular assembly on p53 that could result in its acetylation and
increased biological activity. Thus certain p53 mutations with some degree of
conformational flexibility, upon co-factor recruitment such as Id4 and CBP/p300 could
gain biological activity that is similar to wt-p53.
60
Acetylation at specific lysine residues can also promote specific p53 functional
modifications: acetylation at K320 by PCAF results in increased cytoplasmic levels
whereas CBP/P300 dependent acetylation of K3 70/3 72/3 73 leads to increased nuclear
retention of p53 (231, 232). In contrast, MDM2, a negative regulator of p53, actively
suppresses p300/CBP-mediated p53 acetylation in vivo and in vitro (243). Although we
did not investigate phosphorylation of wt- or mut-p53, but K373 acetylation mimic
p53Q373 undergoes hyper-phosphorylation and interacts more strongly with low affinity
pro-apoptotic promoters such as BAX. In contrast, the p53Q320 interacts efficiently with
the high-affinity p21 promoter (231). The ChIP data demonstrating high p53 binding on
p21 promoter in DU145+Id4 cells with increased p53 K320 acetylation may suggest
increased phosphorylation that correlates well and further supports acetylation dependent
increase in mutant p53 activity.
As such low MDM2 levels observed in DU145+W4 cells as compared to DU145
could be one of the mechanism by which mutant p53 could gain its trans-activation
potential together with increased acetylation. MDM2 binds to the N-terminal end of p53
to inhibit its trans-activation function and consequently, disruption of p53-MDM2
interaction promotes p53 to act as transcription factor (244). Studies in DU145 and
LNCaP cells using nutlin, a disruptor of p53-MDM2 interaction suggested that blocking
MDM2 interaction or decreasing its cellular levels may be sufficient to promote wt- p53
activity (LNCaP cells) but is not sufficient for promoting mutant p53 transcriptional
activity in DU145 cells (31). Acetylation also destabilizes p53-MDM2 interaction and
61
enables p53 mediated response including recruitment to respective promoters and
apoptosis (225).
Collectively, we provide evidence that mutant p53 in DU145 cells retains the
ability to undergo acetylation in the presence of Id4. Id4, a transcriptional regulator, may
promote the p53 acetylation by recruiting CBP/p300 and/or PCAF independent of p53
mutations. Acetylated p53 in turn acquires transcriptional activity through structural
changes that could possibly involve destabilization of p53-MDM2 interaction, and
subsequent recruitment to p53 responsive promoters and apoptosis. The global
acetylation promoted by Id4 suggests that additional lysines such as K120 and K164,
known to promote binding to specific promoters such as PUMA could also be involved,
but remains to be investigated. Whether Id4 promotes the activity of p53 mutants found
only in DU145 cells or it has the ability to promote transactivation potential of other
well-known p53 hot-spot mutants is an obvious next step that needs to be investigated.
Nevertheless, the acetylation mechanism is nearly universal in nature and suggests that
Id4 could promote the biological activity of other mutants, however whether such
mutants retains sufficient structural flexibility following acetylation remains to be
determined.
5.3 Id4 sensitizes DU145 cells to Doxorubicin treatment
Id4 sensitized prostate cancer cell lines DU145 to Doxorubicin (anti-cancer drug)
via
MYC regulation.
There is a correlation between decreased MYC expression and
increased sensitivity to doxorubicin.
expression
(antisense
Abaza et al. determined that decreased MYC
oligonucleotides)
sensitized
colorectal
cancer
cells
to
62
chemotherapeutic drugs (245). Combination studies of doxorubicin and MYC antisense
resulted in increased therapeutic effects in melanoma (246).
Also a MYC inhibitor,
10058-F4 was found to inhibit proliferation and enhance chemosensitivity in human
hepatocellular carcinomoa cells (247). As a consequence of decreased MYC expression,
there is also a decreased in tumor promoter MDM2. Slack et al. determined that MDM2
is a direct transcriptional target of MDM2 (248). Here we provide evidence that MYC
binding to MDM2 promoter in DU145 cells, however there is decreased binding in
DU145+W4 cells, which may be due to decreased expression. Collectively these studies
provide evidence that decreased MYC, regardless of mode of down regulation, may result
in chemosensitization of cancer cells.
So we conclude through Id4 regulation of MYC
and/or reactivation of mutant-p53, DU145 cells are sensitized to Doxorubicin treatment,
which is very important observation.
CHAPTER 6
CONCLUSION
In many cancers including prostate cancer Id4 gene is hypermethylated which
suppresses expression of Id4. Previous studies found that upon overexpression of Id4 in
metastatic prostate cancer cell line DU145, in which Id4 is methylated there was an
induction of senescence and apoptosis. Despite the fact that three genes primarily
involved in senescence, RB, p53, and pi6, are mutated in this cell line.
P53 is also
involved in apoptosis. That led us to investigate the mechanism by which Id4 may induce
apoptosis in DU145 cells. After evaluating the expression of known and well-studied
pro-apoptotic markers, PUMA, BAX, and p21, we determined that Id4 up regulated the
expression of each target. One common factor of these pro-apoptotic markers is that p53
can regulate their expression. So therefore it was imperative to investigate p53
expression and function, since p53 is mutated in DU145 cells there is an accumulation of
p53 protein due to an extended half-life. In DU145+Id4 cells there is decreased
expression of p53 and increased binding of p53 to the promoters of its targets (BAX, p21,
and PUMA). This data suggested that Id4 restores mutant p53 function in DU145 cells.
We determined that Id4 is promoting wild-type p53 function through acetylation of
mutant p53. We also determined that Id4 is recruiting CBP/p300 to acetylate p53. This
is a very important observation, because in many cases small molecules or other drugs
63
64
are needed for mutant p53 restoration. We also determined that loss of Id4 promotes
tumorigenecity of prostate cancer cells. LNCaP cells express Id4, so we decided to
silence Id4 in these cells to see if it would promote cancer phenotype. Upon silencing of
Id4 in LNCaP cells, there was a decrease in apoptosis, but an increase in proliferation and
migration. Loss of Id4 also resulted in tumor formation in nude mice; the tumors were
not only larger but formed at a faster rate than the LNCaP+NS controls. This data further
supports our hypothesis that Id4 acts as a tumor suppressor in prostate cancer. We also
determined that Id4 sensitizes prostate cancer cells to antitumor drug, Doxorubicin.
While this data is intriguing, it is of interest to determine if this phenomenon is mutation
specific or cancer specific or if Id4 may be able to restore mutant p53 in other systems. It
is also very important to understand exactly how Id4 may regulate tumor suppression
pathways as (Figure 20) as well as translational modifications such as acetylation.
APPENDIX
Table 1. qRT-PCR and ChIP primers used in the study.
PCR primers
Forward (51)
Reverse (5')
Id4
CCCTCCCTCTCTAGTGCTCC
GTGAACAAGCAGGGCGCA
GAPDH
GAAGGTGAAGGTCGGAGTC
GAAGATGGTGATGGGATTTC
PUMA
CTGTATCCTGCAGCCTTTGC
ACGGGCGACTCTAAGTGCT
BAX
CAG AGG CGG GGT TTC ATC
AGC TTC TTG GTG GAC GCA T
p21
GCCATTAGCGCATCACAG
TGCGTTCACAGGTGTTTCTG
p53
GCTCGACGCTAGGATCTGAC
GCTTTCCACGACGGTGAC
MDM2P1
GGGTCTCTTGTTCCG
Promoter
MDM2 P2
Promoter
CTTTTTCTCTGCTGATCCAGG
CAGGGTCTCTTGTTCCGAAGCTG
CHiP Primers spanning the p53 response elements
MDM2
GGTTGACTCAGCTTTTCCTCTTG
GCTATTTAAACCATGCATTTTCC
p21 Chip
GTGGCTCTGATTGGCTTTCTG
TCCTTGGGCTGCCTGTTTTCAG
BAX chip
TAATCCCAGCGCTTTGGAAG
GCTGAGACGGGGTTATCTC
PUMA chip
GCGAGACTGTGGCCTTGTGT
CGTTCCAGGGTCCACAAAGT
65
66
APPENDIX
Table 2. Antibodies used for Immunoblots and immunocytochemistry, and ChIP
Company
Dilutions
Protein
Antibodies
WB/ICC
Id4
Aviva
1:1200, 1:200
Id4
BioCheck
1:1000
GAPDH
Cell Signalling
1:1000,1:200
Rockland
1:1000
PUMA
Immunochemical
BAX
Cell Signalling
1:1000
BAX6A7
Abeam
1:1000,1:150
p21
Cell Signalling
1:1000
p53
Cell Signalling
1:1000,1:200
Novus
MDM2
Biologicals
MYC
Cell Signalling
RNA Pol II
Millipore
Global Acetylated
1:1000
1:1000
1:1000
lysine
Cell Signalling
K320
Millipore
1:1000
K373
Abeam
1:1000
goat anti-rabbit
1:10000
Secondary
Antibody
Millipore
PDH
Cell Signalling
1:250
ICC secondary
antibodies
DyLight 594 goat
anti-mouse (red)
Thermoscientific
DyLight 488 goat
anti-rabbit (green)
Thermoscientific
DyLight 594 goat
anti-rabit (red)
Thermoscientific
DyLight 488 goat
anti-mouse (green)
Thermoscientific
1:200
1:200
1:200
1:200
67
APPENDIX
Table 3. Id4 and p53 status in cell lines
Cell line
Id4 status
LNCaP
+
LNCaP-Id4
wildtype
(silenced)
(promoter
methylation)
DU145
p53 status
DU145+W4
+++ (over-expressed)
PC3
++
wildtype
mutated
mutated
null
68
APPENDIX
Table 4: The classes of the HLH proteins with their specific domains and tissues
distribution adapted from (75)
Class
Examples of Proteins
Specific Domain
I
E2A(E12/E47),TCF12,
Basic DNA binding domain
Tissue
Distribution
TCF4
II
MyoD, Neuro D,
Ubiquitously
expressed
ABF-1
More tissue
specific
expression
III
IV
MYC family of
Basic DNA binding domain,
Ubiquitously
transcription factors
leucine zipper frame
expressed
Mad, Max, Mixi,
Varied tissue
specific
c-Myc
expression
V
Idl,Id2,Id3,andId4
VI
Hairy (Drosophilia)
No Basic DNA binding
domain
and a proline in the DNA
binding domainwith PAS
domain
VII
Aromatic hydrocarbon
receptor
with PAS domain
69
APPENDIX
Table 4. Modulation of Id4 in cancer adapted from (115) Id4 was found to be
hypermethylated in a variety of malignancies such as leukemia, prostate cancer, and
breast cancer. Hypermethylation of Id4 leads to decreased expression of Id4.
Kind of Modulation
Kind of
Tumor type
analysis
Nuclear localization in cancer vs. cytoplasmic
protein
Seminoma
mRNA
Bladder
Hypermethylation
promoter DNA
Gastric adenocarcinoma
Hypermethylation
promoter DNA
Colorectal carcinoma
Downregulation
protein
Hypermethylstion
promoter DNA
Colorectal adenocarcinoma
Downregulated in low grade cancer vs.
protein
Prostate
localization in spermatogonia
Upregulstion association to amplification at
J>p22.3
hyperplasia upregulated in high grade vs low
grade
Downregulated
mRNA
Prostate
Hypermethylation
promoter DNA
Leukemia
Hypermethylation
promoter DNA
Lymphoma
Downregulated
protein
Breast
Upregulated
protein
Breast (rat)
Hypermethylation
promoter DNA
Breast
Upregulated in basal-like cancer vs non-basal
mRNA
Breast
Hypermethylation
promoter DNA
Breast
Upregulated in p53-expression cancer
protein
Breast
Upregulated in cancer vs normal brain
mRNA
Glioblastoma multifome
Upregulated in cancer vs adjacent normal tissue
protein
Small cell lung cancer
Hypermethylation
promoter DNA
Cholangiocarcinoma
cancer
(GBM)
70
APPENDIX
Figure 1
a
Id proteins
E-proteins
Air
blUI
u\
Ui
In'
!«;■»
UJ3
n n
in.;
I'iit\5:%/ir;t on
T'rf;f",otC'
enhance
box
Nature Reviews | immunology
71
APPENDIX
Figure 1. Bhlh family of transcription factors: Id proteins. (A) Basic helix loop helix
(bHLH) transcription factors regulate the differentiation programs of multiple cell
lineages. This protein family shares a common sequence domain, which is where these
proteins bind. (B) However Id protein family lacks the basic binding domain which
prevents DNA binding. Id proteins are transcriptional regulators in many developmental
processes. Id proteins drive differentiation. Figure taken from (249)
72
APPENDIX
Figure 2
A
i: i
i'ii It
sho-AS the prcstale anS nearby organs
This sifio-.vs Jt'.o inside of ?t-o prostate, urellra,
73
APPENDIX
Figure 2. The adult prostate and surrounding structures. (A) The base of the prostate
is located at the bladder neck. The urethra bisects the prostate. Image taken from
http://www.cancer.gov/cancertopics/. (B) The three histologically distinct zones are
shown: the central zone, the transitional zone, and the peripheral zone. Figure taken from
Prostate Histology April 13,2012 (2003-2012) Pathology Outlines.com, Inc.
74
APPENDIX
Figure 3
Stroma
NORMAL
-Tight {unctions
PROSTATE DUCT
Neuroercdocrine
8a«aSeplthtlia>
cells
cell
Stroma
Basal lamina
PIN
iM --s
Secretory
luminai
\i^epithelial cells
Neuroendocrine
cell
INVASIVE
CARCINOMA
METASTASIS
Tight junctions
Basal epithelial
cells
75
APPENDIX
Figure 3. Progression of prostate cancer. (A) Schematic representation of cancer
progression, normal prostate duct to metastasis of the prostate. The structure of the
normal prostate is maintained by its androgen dependence. However the onset of PIN
leads to disorganization of prostate cells and eventually leads to invasive carcinoma and
then metastasis to other body sites. (B) Schematic of metastatic cascade and depiction of
the cell types within a human prostatic duct. There are three types of cells in the normal
prostate, secretory luminal epithelial cells, and neuroendocrine cells, and basal epithelial
cells. Image taken from (250)
76
APPENDIX
Figure 4
^ST."" _ •., ft-ft*"»i'
I •> ''
)*.*■ j
1 .!„''
". '
1 •! '
,i
* 1
'
• ,i 1
al i-
Hi
»i
_":_
1 ..)■■!
*
»
""._^-
-i-
;"
'i 1 i" 11
.1.,
r>".
.' j
r«S<3.», it.»» .
|'|t
r 1 ' ,•*
1
1
iliSiVi.
'
■
".'.Its"'
ly
. J'l
-riji-n.
■--.L"J
-
i-iti,
«J
-'3MM
. •
i
f i '
j
A,'
1 .
"
'
.ilu"
jt-
i
r,
_
v
'ijv
,1 • u "jiin
,?"."■>
^....o.f.—hrLj,
,
ij
TTi™
^
.
' '>
."V-,
. 4 is
,
• 11 -
•■■ - 'J1
Figure 4. Id sequence and protein structure comparison. Id proteins shared a conserved
HLH domain sequence.
77
APPENDIX
Figure 5
Mitotjrnac
Figure 5. Model for Id gene function in cell cycle progression. The role of Id proteins
in the cell cycle. Id proteins are key regulators of the GI phase of the cell cycle and
regulate RB, a crucial cell cycle gene. Figure taken from (251)
78
APPENDIX
Figure 6
A
Functional domain of p53
Ac:ivation
domain
Sequence-specific DNA
binding domain
Tetramerization
domain
NH211
fransactlvation
393
GOGH
core domain:
sequence specific DNA binding
COOH-terminal domain:
tetramerization
79
APPENDIX
Figure 6. P53 gene and cancer derived p53 mutations. (A) The full length protein of
p53 is shown schematically and four domains are defined: activation domain, DNA
binding domain, tetramerization domain, and regulatory domain. (B) Commonly mutated
regions of p53 protein. The relative number of times and placement of a particular point
mutation is depicted as a histogram above the schematic. The majority of tumor-derived
mutations are found in the core/DNA binding domain. This figure was adapted from (30).
80
APPENDIX
Figure 7
Cell-cycle
arrest
Target genes
kinases(ATM.
acetylases cpcaf
P21
MDM2
Bax
GA0D4S
Apoptosis
/
DNA damage
R
Figure 7. p53 pathway, depicting p53 regulatory network. P53 can be regulated by
MDM2 and pl4ARF. P53 can also regulate p21, MDM2, Bax, and Gadd45, which
eventually leads to cell-cycle arrest and apoptosis. This figure was taken from ((252)
>
Q.
Id4/DAPI
\
\
©
©
!d4/DAPi
in
o
H|
b
H
ui
Relative Expression/GAPDH
3
00
ofo"
oo
82
APPENDIX
Figure 8 Stable knockdown of Id4 by retroviral shRNA in LNCaP cells (retroviral
vectors A and C) and stable over-expression of hld4 in Dul45 cells. (A) Real time
quantitative polymerase chain reaction for Id4 expression in LNCaP (NS, non-specific)
following transfection with Id4shRNA vectors A and C and non-silencing shRNA (NS)
(***: PO.001). (B) Western blot analysis of Id4 expression in LNCaP cells with non
specific shRNA (NS) and Id4 specific shRNA (-Id4, vector A). (C) Immunocytochemical analysis of stable knockdown of Id4 expression in LNCaP cells (LNCaP Id4, vector A) as compared to cells with non-specific shRNA (LNCaP+NS). The red
staining indicates Id4 expression (DyLight 594). Id4 expression in DU145 cells stably
transfected with Id4 expression vector (DU145+Id4) as compared to DU145 cells
transfected with empty vector (DU145+NS). The green staining represents Id4 (DyLight
488). DAPI was used to stain the nuclei (blue) in both LNCaP and DU145 cells.
Representative images are shown.
83
APPENDIX
Figure 9
Apoptosis Data
Live cells
Apoptotic
Dead cells
cells
LNCaP+NS
50%
47%
4%
LNCaP-ld4
83%
10.5%
6.5%
Proliferation Assay
***
o
CO
0.0
84
APPENDIX
Figure 9. Loss of Id4 attenuates apoptosis and promotes proliferation. Apoptosis
was measured using Annexin V staining. Proliferation was measured using an MTT
assay. (A) In cell line LNCaP-Id4, apoptosis is decreased by -37% . (B) There is an
increase in the proliferation of LNCaP-Id4 cells by fold change of 2. Data is statistically
significant. Each bar represents Mean ± SD from a representative experiment. (P< 0.05).
85
APPENDIX
Figure 10
B
LNCaP+NS
LNCaP-ld4
***
Oh, ?',
3
u
Transwell Migration Assay
86
APPENDIX
Figure 10. Loss of Id4 promotes migration. Effects of loss of Id4 on cell migration in
prostate cancer cell line LNCaP. Representative images of (A) Scratch Wound Assay (B)
LNCaP and LNCaP-Id4 cells after migration of cells through transwell. Cells were
visualized under 10X objectives. LNCaP+NS was used as a control. The number of
migratory cells doubles upon loss of Id4. Each bar represents Mean SEM (n=3). *
Significantly different (P < 0.05) compared to untreated controls.
87
APPENDIX
Figure 11
B
A
I
.2
« 10
I
Ui
«
5.
>
■■s
1 0
■ -10
rf
Dark gray: MMP2
Light gray: MMP13
Figure 11. Gene expression changes following loss of Id4. The expression of cyclin
dependent kinase p27 was decreased upon loss of Id4. P27 has been implicated in cell
proliferation (11C). The expression of migration markers Idl (11 A) and MMPs 2 and 13
were increased in LNCaP-Id4 cells as compared to LNCaP+NS. The increase in
migration markers may provide the mechanism by which loss of Id4 promotes migration
of prostate cancer cells. The mean+SEM of three experiments in triplicate are shown.
The delta delta Ct (normalized to GAPDH and LNCaP normalized to 1) is shown (*:
PO.001).
88
APPENDIX
Figure 12
2000
***
1500
£ 1000O
500-
T
Non-castrated week 6
K
i ■'■.-:
E
i \( .ii
Nor-ca«itr.ited week 6
,i
■JW
I NC.il1 M+
400-
E
O
W
300-
,\
1
200-
O
E
3
100-
2
-100-
4
Weeks
LNCaP+NS
{
LNCaP-ld4
i
6
8
89
APPENDIX
Figure 12. Loss of Id4 promotes anchorage independent growth and tumor growth
in vivo. Loss of Id4 increases anchorage-independent cell growth. The colonies were
grown for 21 days and then the images were captured using a microscope (10X) (A)
After quantitation of the colonies, there were 3 times as many colonies in LNCaP-Id4 as
there were in the control LNCaP-Id4 (B). (C) Images of the tumor growth were captured
weekly to visual tumor size. (D) After the extraction of the tumor, the tumor size was
determined to be LNCaP+NS Weight: 0.02g Tumor dimensions: 4mm x 2mm and
LNCaP-Id4 Weight: 0.62g Tumor dimensions 15mm xlOmm, which a significant
increase in tumor size. (E) and (F) Graph represent tumor weight and volume which
increased 5 and 6 times greater than the LNCaP+NS control, respectively.
(G)
Representation of the rate and size of tumor growth over a period of six weeks, shows not
only increased tumor size in LNCaP-Id4 but also increased rate of tumor growth. Data is
expressed of six different mice mean+SEM, *: P<0.05).
90
APPENDIX
Figure 13
B
100-
80-
"5
60-
S?
40-
O
2520-
I
m
f 15-
° 10-
Apoptotic
m
* zl
Q.
20-
0
3CH
Dead
i 2-
Live
D
D+ld4
L
1-
0
L-ld4
A. Western Blot
D+ld4
L
BAX6A7
GAPDH
C. ICC: BAX localization with PDH
L
L-ld4
20
15
0}
g> 10-
6
a
a
0-
PUMA
D+ld4
B.q-Real Time PCR
L-ld4
p21
BAX
D
-5-
-10-
a
I
p2i
BAX
PUMA
b
b
b
l~l WM liiT'l
V
b*
D
D+ld4
L-ld4
91
APPENDIX
Figure 13. Id4 promotes apoptosis by regulating mitochondrial membrane potential
and the expression of pro-apoptotic genes. A: percent cells undergoing apoptosis was
determined by propidium iodide and Annexin V staining followed by flow cytometery.
Significant increase in apoptosis (***: PO.001) was observed in DU145 cells overexpressing Id4 (D+Id4) when compared with DU145 cells alone (D). A significant
decrease in apoptosis was observed in LNCaP cells that lacked Id4 (L-Id4) as compared
to LNCaP cells (L, ***: PO.001). B. Percent cells with high mitochondrial membrane
potential (Gated, FL2>100 fluorescence units). In the presence of Id4 (D+Id4 and L), the
mitochondrial membrane potential decreased as compared to the corresponding cells that
lack Id4 (D and L-Id4). (***: P<0.001 - L vs. L-Id4 and D vs. D+Id4). C. Western blot
analysis of p21, BAX, confirmation specific BAX (BAX6A7) and PUMA in D, D+Id4, L
and L-Id4 cells. GAPDH was used as loading control. Representative western blots of
three different experiments are shown. D. Real time quantitative analysis of p21, BAX
and PUMA expression in D, D+Id4, L and L-Id4 cells. The mean+SEM of three
experiments in triplicate are shown. The delta delta Ct (normalized to GAPDH) between
D and D+Id4 (D normalized to 1, designated as "a') and between L and L-Id4 (L
normalized to 1, designated as "b") is shown (*: P<0.001). E. Immuno-cytochemical
analysis demonstrating co-localization of confirmation specific BAX (using BAX 6A7
92
APPENDIX
antibody) with mitochondrial pyruvate dehydrogenase (PDH). Blue: DAPI, red: PDH,
green: BAX 6A7 and yellow: co-localization of BAX and PDH (observed only in LNCaP
and DU145+Id4 panels. Representative images from three different experiments are
shown.
93
APPENDIX
Figure 14
L
L-ld4
D
D+ld4
B
P53
GAPDH
1
-6H
-10J
Merged
n_
I—1
j
L
L-ld4
D
D+ld4
94
APPENDIX
Figure 14. Id4 regulates p53 expression and cellular localization. Analysis of p53
protein (A) and transcript (B) expression in L, L-Id4, D and D+Id4 cells. The western
blot analysis shown in panel A is the representative of three different experiments. The
p53 real time quantitative expression is mean+SEM of triplicates. The data normalized to
GAPDH and represented as fold change with p53 expression in LNCaP used as positive
control set to 1 (D DCt). (*:P<0.001 as compared to LNCaP). C. Immuno-cytochemical
localization of p53 in L, L-Id4, D and D+Id4 cells. Nuclear and cytoplasmic (253)
expression of p53 is clearly evident in L, L-Id4 and D cells. Whereas p53 is primarily
nuclear in D+Id4 cells (253). Red: p53, Blue: DAPI. Representative images are shown.
95
APPENDIX
Figure 15
EU
L
L-ld4
D
D+ld4
P
D
0.03-1
^ 0.02-
°
1
0.01-
O.OO-11-!
L
L-ld4
D
D+ld4
L
L-ld4
D
D+ld4
L
L-ld4
D
D+ld4
96
APPENDIX
Figure 15. Id4 promotes DNA binding and transcriptional activity of wild type and
mutant p53. A. EMSA with p53 consensus DNA binding response element with nuclear
extracts from LNCaP (L), LNCaP-Id4 (L-Id4), DU145 (D), DU145+W4 (D+Id4) and
PC3 cells. Nuclear extracts from PC3 cells, null for p53 and LNCaP cells with wild type
p53 were used as negative and positive controls respectively. Excess unlabeled (EU) p53
response element was used to monitor non-specific binding. B. Quantitative p53 DNA
binding in a sandwich ELISA based system. P53 was captured by double stranded
oligonucleotide with p53 response element immobilized on a 96 well plate. The captured
p53 was detected using p53 antibody by measuring the intensity at 450nm using HRP
coupled secondary antibody. C. The p53 transcriptional activity as determined by
transiently transfecting cell lines as indicated above with p53 response element driven
luciferase reported plasmid (wt-p53RE). The data is normalized to Renilla luciferase.
The mutant p53 luciferase reporter plasmid was used as a negative control (mt-p53RE).
The p53-luciferase reporter activity in LNCaP-Id4 (L-Id4) was normalized to LNCaP (L)
and that of DU145+Id4 (D+Id4) with DU145 (D). The data from 3 different experiments
in triplicate is expressed as mean+SEM (*: P<0.001). D, E and F. Chromatin immuno-
precipitation assay demonstrating the binding of p53 to its respective response element in
the BAX (D), p21 (E) and PUMA (F) promoters. The data is expressed as percent input
97
APPENDIX
is mean+SEM of three experiments in triplicate (a: between L and L-id4 and b: between
D and D=Id4, *: PO.001, BD: Below Detection).
98
APPENDIX
Figure 16
A
L
L-ld4
D
D+ld4
B
P2
P1
MDM2
GAPDH
Exon 1b
Exon la
Exon 2
p53RE
*
n
LL {J
L
n
L-ld4
D
PI
Exon 1a
Exon 2
P2
Exon 1b
Exon 2
- >
D+ld4
25-i
a,b
1=1
M
0)
CD
g5
o
20o
uu
P1
t
n
i
-5H
-10-
T
I.15"
P2
a
!
20-
^10T
5-
L
L
L-ld4
D D+ld4
L-ld4
D
D+ld4
99
APPENDIX
Figure 16. Expression of MDM2 and its transcriptional regulation. A. MDM2
immuno blot in cells with (L and D+W4) and without Id4 (L-Id4 and D). GAPDH was
used as loading control. Representative data from three different experiments is shown.
The bottom panel is semi-quantitative analysis of fold change in MDM2 expression
relative to LNCaP (L) and normalized to GAPDH (mean+SEM, *: P<0.001, compared to
L). B. Schematic of MDM2 promoter organization. MDM2 is transcribed from two
independent promoters PI and P2 but both the transcripts are translated from a common
start site in exon2. PI promoter is p53 independent whereas P2 promoter is p53
dependent due to a p53 response element in intron 1 (p53RE). Specific primers were
used to determine the transcript abundance of PI (p53 independent) and P2 (p53
dependent) transcripts. C. PI and P2 transcript abundance with Real time quantitative
PCR analysis in cell lines expressed as fold change from three different experiments in
triplicate (mean+SEM). The expression is first normalized to GAPDH and then to PI
transcript in L and D cells set to 1 (comparison between L and L-Id4 and between D and
D+Id4, a: PO.001 as compared to PI transcript b: PO.001 compared to P2 transcript).
D. Chromatin immuno-precipitation assay demonstrating the binding of p53 to its
respective response element in the MDEM2 P2 promoter (intron 1). Data is expressed as
mean+SEM of three different experiments performed in triplicate (mean+SEM, *:
PO.001).
100
APPENDIX
Figure 17
A
D+ld4
L-ld4
!P: p53
IB: Global
,.*
IB: Ac-373
IB:Ac-320
IB: CBP/p300
Input
B
IP
p53
Id4
p53
Id4
p53
Id4
p53
Id4
IB: p53
DU145+ld4
DU45
LNCaP
LNCaP-ld4
Figure 17. Acetylation of p53 and interaction with CBP/p300 and Id4. A. p53, immunoprecipitated from cell lines was blotted with antibodies against acetylated lysine (global), p53
acetylated at either K373 (Ac-373) or K320 (Ac-320) and CBP/ p300. B. The total protein lysate
from cell lines as indicated was immuno-precipitated (IP) with either p53 or Id4 antibody. The
immuno-precipitated lysate was then immuno-blotted with p53 antibody (IB:p53).
Representative data is shown.
101
APPENDIX
Figure 18
Plst 6. du145 control 24hr
GATE
V
Plet 6 du1<J5 SOOnm
PI
6ATE
I01-IJL
(VMJR
0.8%
X
M
|0 0%
! 9 5%
01
3k
...i
i.j
„:•■
...*
■•;:•
FL2-A
.,.-1
FL2-A
C
C
Plots duiddcontrol
QAT6 PI
men
■PfC
Piet6 duicH SOOnm
V
^
©ATE
P1
■M-IJL.
OI.ijc
V
C'1-LR
.- "
,,.'
,.J
FL2-A
c
□
,.j
..'i
»'•
FL2A
nor
C
wee
% Live
% Apoptotic
% Dead
DU145 control
95.9
3.3
0.8
DU145+ 500nM Dox
31.0
44.1
19.5
DU145+M4 control
40.2
31.0
28.8
DU145+W4 +500nM
22.2
44.1
33.7
Dox
102
APPENDIX
Figure 18. Id4 sensitizes prostate cancer cell to doxorubicin treatment. (A) and
increase in apoptosis (16B). Proliferation was measured at 0, 24H, 48H, and 72H and
apoptosis was measured after 24H. Cells were treated with 500nM of dox.
103
APPENDIX
Figure 19
c Myc
Act in
HI
C
S
o
B
MMDM2
B-Actin
Figure 19. Id4 regulation of MYC and MDM2. Id4 down-regulated Myc expression in
DU145+Id4 cells (17A). MDM2 is a direct target of MYC and its expression is
decreased in DU145+Id4 probably due to decreased levels of MYC (17B) There is
decreased binding of MYC in DU145+Id4 possibly due to decreased level of MYC (17C)
DU145 was calculated as 1.
104
APPENDIX
Figure 20
105
APPENDIX
Figure 20. Id4 pathway involved in tumor suppression. Id4 may regulate multiple
tumor suppression pathways, but we have provided evidence that Id4 regulates MYC
which can in turn regulate many unique pathways. We also provided concise evidence
that Id4 protein directly binding to p53 protein which can then activate cell cycle and
apoptosis pathways.
106
REFERENCES
1.
Perk, J., Iavarone, A., and Benezra, R. (2005) Id family of helix-loop-helix
proteins in cancer, Nat Rev Cancer 5, 603-614.
2.
Iavarone, A., and Lasorella, A. (2004) Id proteins in neural cancer, Cancer Lett
204, 189-196.
3.
Yuen, H. F., Chan, Y. P., Chan, K. K., Chu, Y. Y., Wong, M. L., Law, S. Y.,
Srivastava, G., Wong, Y. C, Wang, X., and Chan, K. W. (2007) Id-1 and Id-2 are
markers for metastasis and prognosis in oesophageal squamous cell carcinoma, Br
J Cancer 97, 1409-1415.
4.
Arnold, J. M., Mok, S. C, Purdie, D., and Chenevix-Trench, G. (2001) Decreased
expression of the Id3 gene at Ip36.1 in ovarian adenocarcinomas, BrJ Cancer 84,
352-359.
5.
Cummings, S. D., Ryu, B., Samuels, M. A., Yu, X., Meeker, A. K., Healey, M.
A., and Alani, R. M. (2008) Idl delays senescence of primary human
melanocytes, Mol Carcinog 47, 653-659.
6.
Park, H. R., Jung, W. W., Kim, H. S., Santini-Araujo, E., Kalil, R. K., Bacchini,
P., Bertoni, F., Unni, K. K., and Park, Y. K. (2006) Upregulation of the oncogenic
helix-loop-helix protein Id2 in Ewing sarcoma, Tumori 92,236-240.
7.
Ishiguro, A., Spirin, K., Shiohara, M., Tobler, A., Norton, J. D., Rigolet, M.,
Shimbo, T., and Koeffler, H. P. (1995) Expression of Id2 and Id3 mRNA
in human lymphocytes, LeukRes 19, 989-996.
8.
Sharma, P., Patel, D., and Chaudhary, J. (2012) Idl and Id3 expression is
associated with increasing grade of prostate cancer: Id3 preferentially regulates
CDKN1B, Cancer Medicine 1,187-197.
9.
Sharma, P., Chinaranagari, S., Patel, D., Carey, J., and Chaudhary, J. (2012)
Epigenetic inactivation of inhibitor of differentiation 4 (Id4) correlates with
prostate cancer, Cancer Medicine, n/a-n/a.
10.
Lasorella, A., Noseda, M., Beyna, M., Yokota, Y., and Iavarone, A. (2000) Id2 is
a retinoblastoma protein target and mediates signalling by Myc oncoproteins,
Nature 407, 592-598.
107
11.
Wong, Y. C, Wang, X., and Ling, M. T. (2004) Id-1 expression and cell survival,
Apoptosis 9, 279-289.
12.
Norton, J. D., Deed, R. W., Craggs, G., and Sablitzky, F. (1998) Id helix-loop-
helix proteins in cell growth and differentiation, Trends Cell Biol 8, 58-65.
13.
Tzeng, S. F. (2003) Inhibitors of DNA binding in neural cell proliferation and
'differentiation, Neurochem Res 28, 45-52.
14.
Norton, J. D. (2000) ID helix-loop-helix proteins in cell growth, differentiation
and tumorigenesis, J Cell Sci 113 (Pt 22), 3897-3905.
15.
Coma, S., Amin, D. N., Shimizu, A., Lasorella, A., Iavarone, A., and Klagsbrun,
M. Id2 promotes tumor cell migration and invasion through transcriptional
repression of semaphorin 3F, Cancer Res 70, 3823-3832.
16.
Ciarrocchi, A., Piana, S., Valcavi, R., Gardini, G., and Casali, B. (2011) Inhibitor
of DNA binding-1 induces mesenchymal features and promotes invasiveness in
thyroid tumour cells, European Journal ofcancer 47, 934-945.
17.
Bedford, L., Walker, R., Kondo, T., van Cruchten, I., King, E. R., and Sablitzky,
F. (2005) Id4 is required for the correct timing of neural differentiation, Dev Biol
280, 386-395.
18.
Massari, M. E., and Murre, C. (2000) Helix-loop-helix proteins: regulators of
transcription in eucaryotic organisms, Mol Cell Biol 20, 429-440.
19.
Ruzinova, M. B., and Benezra, R. (2003) Id proteins in development, cell cycle
and cancer, Trends Cell Biol 13, 410-418.
20.
Coppe, J. P., Smith, A. P., and Desprez, P. Y. (2003) Id proteins in epithelial
cells, Exp Cell Res 285, 131-145.
21.
Ling, M. T., Wang, X., Lee, D. T., Tarn, P. C, Tsao, S. W., and Wong, Y. C.
(2004) Id-1 expression induces androgen-independent prostate cancer cell growth
through activation of epidermal growth factor receptor (EGF-R), Carcinogenesis
25, 517-525.
22.
Ling, M. T., Lau, T. C, Zhou, C, Chua, C. W., Kwok, W. K., Wang, Q., Wang,
X., and Wong, Y. C. (2005) Overexpression of Id-1 in prostate cancer cells
promotes angiogenesis through the activation of vascular endothelial growth
factor (VEGF), Carcinogenesis 26, 1668-1676.
108
23.
Ouyang, X. S., Wang, X., Ling, M. T., Wong, H. L., Tsao, S. W., and Wong, Y.
C. (2002) Id-1 stimulates serum independent prostate cancer cell proliferation
through inactivation of pl6(INK4a)/pRB pathway, Carcinogenesis 23, 721-725.
24.
Zielinski, A. J., Fong, S., Allison, J., Kawahara, M., Coppe, J. P., Feiler, H., Lee,
N. M., and Desprez, P. Y. (2010) The helix-loop-helix Id-1 inhibits PSA
expression in prostate cancer cells, Int J Cancer 126, 2490-2496.
25.
Coppe, J. P., Itahana, Y., Moore, D. H., Bennington, J. L., and Desprez, P. Y.
(2004) Id-1 and Id-2 proteins as molecular markers for human prostate cancer
progression, Clin Cancer Res 10, 2044-2051.
26.
Carey, J. P., Asirvatham, A. J., Galm, O., Ghogomu, T. A., and Chaudhary, J.
(2009) Inhibitor of differentiation 4 (Id4) is a potential tumor suppressor in
prostate cancer, BMC Cancer 9, 173.
27.
Hollstein, M., Sidransky, D., Vogelstein, B., and Harris, C. C. (1991) p53
mutations in human cancers, Science 253,49-53.
28.
Kastan, M. B., and Bartek, J. (2004) Cell-cycle checkpoints and cancer, Nature
432,316-323.
29.
Vousden, K. H., and Lu, X. (2002) Live or let die: the cell's response to p53, Nat
Rev Cancer 2, 594-604.
30.
Cho, Y., Gorina, S., Jeffrey, P. D., and Pavletich, N. P. (1994) Crystal structure of
a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations,
Science 265, 346-355.
31.
Logan, I. R., McNeill, H. V., Cook, S., Lu, X., Lunec, J., and Robson, C. N.
(2007) Analysis of the MDM2 antagonist nutlin-3 in human prostate cancer cells,
Prostate 67, 900-906.
32.
Isaacs, W. B., Carter, B. S., and Ewing, C. M. (1991) Wild-type p53 suppresses
growth of human prostate cancer cells containing mutant p53 alleles, Cancer Res
57,4716-4720.
33.
Joerger, A. C, and Fersht, A. R. (2007) Structure-function-rescue: the diverse
nature of common p53 cancer mutants, Oncogene 26, 2226-2242.
34.
Campomenosi, P., Monti, P., Aprile, A., Abbondandolo, A., Frebourg, T., Gold,
B., Crook, T., Inga, A., Resnick, M. A., Iggo, R., and Fronza, G. (2001) p53
mutants can often transactivate promoters containing a p21 but not Bax or PIG3
responsive elements, Oncogene 20, 3573-3579.
109
35.
W. Hamilton, J. B., H. Mossman. (1959) Human Embryology, Williams adn
Wlikins Co.
36.
Marker, P. C, Donjacour, A. A., Dahiya, R., and Cunha, G. R. (2003) Hormonal,
cellular, and molecular control of prostatic development, Dev Biol 253,165-174.
37.
McNeal, j. e. (1983) THE PROSTATE GLAND: MORPHOLOGY AND
PATHOBIOLOGY, Monogr. Urol 4, 3-37
38.
McNeal, J. E. (1988) Normal histology of the prostate, The American journal of
surgical pathology 12, 619-633.
39.
Abate-Shen, C, and Shen, M. M. (2000) Molecular genetics of prostate cancer,
Genes & development 14, 2410-2434.
40.
Collins, A. T., Habib, F. K., Maitland, N. J., and Neal, D. E. (2001) Identification
and isolation of human prostate epithelial stem cells based on alpha(2)beta(l)integrin expression, J Cell Sci 114, 3865-3872.
41.
Wang, Y., Hayward, S., Cao, M., Thayer, K., and Cunha, G. (2001) Cell
differentiation lineage in the prostate, Differentiation 68, 270-279.
42.
Rahman, M., Miyamoto, H., and Chang, C. (2004) Androgen receptor
coregulators in prostate cancer: mechanisms and clinical implications, Clin
Cancer Res 10, 2208-2219.
43.
Keller, E. T., Ershler, W. B., and Chang, C. (1996) The androgen receptor: a
mediator of diverse responses, Front Biosci 1, d59-71.
44.
McLachlan, R. I., Tempel, B. L., Miller, M. A., Bicknell, J. N., Bremner, W. J.,
and Dorsa, D. M. (1991) Androgen receptor gene expression in the rat central
nervous system: Evidence for two mRNA transcripts, Mol Cell Neurosci 2,\\1122.
45.
Mooradian, A. D., Morley, J. E., and Korenman, S. G. (1987) Biological actions
of androgens, Endocr Rev 8, 1-28.
46.
Tsai, M. J., and O'Malley, B. W. (1994) Molecular mechanisms of action of
steroid/thyroid receptor superfamily members, Annu Rev Biochem 63,451-486.
47.
MacLean, H. E., Warne, G. L., and Zajac, J. D. (1997) Localization of functional
domains in the androgen receptor, J Steroid Biochem Mol Biol 62, 233-242.
110
48.
Division of Cancer Prevention and Control, N. C. f. C. D. P. a. H. P. (2012)
Prostate Cancer Rates by Race and Ethnicity, Prostate Cancer Incidence Rates*
by Race and Ethnicity, U.S., 1999-2008.
49.
Jordan, K. P., Hayward, R. A., Blagojevic-Bucknall, M., and Croft, P. (2013)
Incidence of prostate, breast, lung and colorectal cancer following new
consultation for musculoskeletal pain: A cohort study among UK primary care
patients, Int J Cancer.
50.
Penson, D. F., and Albertsen, P. C. (2002) Lessons learnt about early prostate
cancer from large scale databases: population-based pearls of wisdom, Surgical
oncology 11, 3-11.
51.
Berges, R. R., Vukanovic, J., Epstein, J. I., CarMichel, M., Cisek, L., Johnson, D.
E., Veltri, R. W., Walsh, P. C, and Isaacs, J. T. (1995) Implication of cell kinetic
changes during the progression of human prostatic cancer, Clin Cancer Res 1,
473-480.
52.
Reid-Pitts, W., Jr. (2001) Prostatic intraepithelial neoplasia and putative precursor
lesions of prostate cancer: a clinical perspective, BJU international 88, 985-986.
53.
Helpap, B., Bonkhoff, H., Cockett, A., Montironi, R., Troncoso, P., Waters, D.,
and Bostwick, D. (1997) Relationship between atypical adenomatous hyperplasia
(AAH), prostatic intraepithelial neoplasia (PIN) and prostatic adenocarcinoma,
Pathologica 89, 288-300.
54.
Arnold, J. T., and Isaacs, J. T. (2002) Mechanisms involved in the progression of
androgen-independent prostate cancers: it is not only the cancer cell's fault,
Endocr Relat Cancer 9, 61-73.
55.
Craft, N., Chhor, C, Tran, C, Belldegrun, A., DeKernion, J., Witte, O. N., Said,
J., Reiter, R. E., and Sawyers, C. L. (1999) Evidence for clonal outgrowth of
androgen-independent prostate cancer cells from androgen-dependent tumors
through a two-step process, Cancer Res 59, 5030-5036.
56.
Balk, S. P., Ko, Y. J., and Bubley, G. J. (2003) Biology of prostate-specific
antigen, J Clin Oncol 21, 383-391.
57.
Huggins, M. L. (1941) A New Society for X-Ray and Electron Diffraction
Research Workers, Science 93, 489-490.
58.
Heinlein, C. A., and Chang, C. (2004) Androgen receptor in prostate cancer,
Endocr Rev 25, 276-308.
Ill
59.
Veldscholte, J., Voorhorst-Ogink, M. M., Bolt-de Vries, J., van Rooij, H. C,
Trapman, J., and Mulder, E. (1990) Unusual specificity of the androgen receptor
in the human prostate tumor cell line LNCaP: high affinity for progestagenic and
estrogenic steroids, Biochim Biophys Acta 1052, 187-194.
60.
Heinlein, C. A., and Chang, C. (2002) Androgen receptor (AR) coregulators: an
overview, Endocr Rev 23, 175-200.
61.
Lee, D. (2003) High androgen receptor levels are predictive of decreased survival
in prostate cancer, Clin Prostate Cancer 2, 13-14.
62.
Heemers, H. V., and Tindall, D. J. (2007) Androgen receptor (AR) coregulators: a
diversity of functions converging on and regulating the AR transcriptional
complex, Endocr Rev 28, 778-808.
63.
Wang, L., Hsu, C. L., and Chang, C. (2005) Androgen receptor corepressors: an
overview, Prostate 63,117-130.
64.
Sun, Z., Pan, J., and Balk, S. P. (1997) Androgen receptor-associated protein
complex binds upstream of the androgen-responsive elements in the promoters of
human prostate-specific antigen and kallikrein 2 genes, Nucleic Acids Res 25,
3318-3325.
65.
Tan, P. Y., Chang, C. W., Chng, K. R., Wansa, K. D., Sung, W. K., and Cheung,
E. Integration of regulatory networks by NKX3-1 promotes androgen-dependent
prostate cancer survival, Mol CellBiol 32, 399-414.
66.
Cai, C, Hsieh, C. L., Omwancha, J., Zheng, Z., Chen, S. Y., Baert, J. L., and
Shemshedini, L. (2007) ETV1 is a novel androgen receptor-regulated gene that
mediates prostate cancer cell invasion, Mol Endocrinol 21,1835-1846.
67.
Lonergan, P. E., and Tindall, D. J. Androgen receptor signaling in prostate cancer
development and progression, J Carcinog 10, 20.
68.
Carter, B. S., Beaty, T. H., Steinberg, G. D., Childs, B., and Walsh, P. C. (1992)
Mendelian inheritance of familial prostate cancer, Proceedings ofthe National
Academy ofSciences ofthe United States ofAmerica 89, 3367-3371.
69.
Matikaine, M. P., Pukkala, E., Schleutker, J., Tammela, T. L., Koivisto, P.,
Sankila, R., and Kallioniemi, O. P. (2001) Relatives of prostate cancer patients
have an increased risk of prostate and stomach cancers: a population-based,
cancer registry study in Finland, Cancer causes & control: CCC12, 223-230.
112
70.
Bonkhoff, H., and Berges, R. (2010) From pathogenesis to prevention of
castration resistant prostate cancer, The Prostate 70,100-112.
71.
Lee, J. Y., Kang, M. B., Jang, S. H., Qian, T., Kim, H. J., Kim, C. H., Kim, Y.,
and Kong, G. (2009) Id-1 activates Akt-mediated Wnt signaling and p27(Kipl)
phosphorylation through PTEN inhibition, Oncogene 28, 824-831.
72.
Chen, Z., Carracedo, A., Lin, H. K., Koutcher, J. A., Behrendt, N., Egia, A.,
Alimonti, A., Carver, B. S., Gerald, W., Teruya-Feldstein, J., Loda, M., and
Pandolfi, P. P. (2009) Differential p53-independent outcomes of pl9(Arf) loss in
oncogenesis, Science signaling 2, ra44.
73.
Tomlins, S. A., Mehra, R., Rhodes, D. R., Cao, X., Wang, L., Dhanasekaran, S.
M., Kalyana-Sundaram, S., Wei, J. T., Rubin, M. A., Pienta, K. J., Shah, R. B.,
and Chinnaiyan, A. M. (2007) Integrative molecular concept modeling of prostate
cancer progression, Nat Genet 39,41-51.
74.
Hickman, E. S., Moroni, M. C, and Helin, K. (2002) The role of p53 and pRB in
apoptosis and cancer, Current opinion in genetics & development 12, 60-66.
75.
Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L., and Weintraub, H. (1990)
The protein Id: a negative regulator of helix-loop-helix DNA binding proteins,
Cell 61, 49-59.
76.
Yokota, Y. (2001) Id and development, Oncogene 20, 8290-8298.
77.
Langlands, K., Yin, X., Anand, G., and Prochownik, E. V. (1997) Differential
interactions of Id proteins with basic-helix-loop-helix transcription factors, The
Journal of biological chemistry 272,19785-19793.
78.
Pesce, S., and Benezra, R. (1993) The loop region of the helix-loop-helix protein
Idl is critical for its dominant negative activity, Mol CellBiol 13, 7874-7880.
79.
Evans, S. M., and O'Brien, T. X. (1993) Expression of the helix-loop-helix factor
Id during mouse embryonic development, Dev Biol 159,485-499.
80.
Riechmann, V., van Cruchten, I., and Sablitzky, F. (1994) The expression pattern
of Id4, a novel dominant negative helix-loop-helix protein, is distinct from Idl,
Id2 and Id3, Nucleic acids research 22, 749-755.
81.
Lyden, D., Young, A. Z., Zagzag, D., Yan, W., Gerald, W., O'Reilly, R., Bader,
B. L., Hynes, R. O., Zhuang, Y., Manova, K., and Benezra, R. (1999) Idl and Id3
are required for neurogenesis, angiogenesis and vascularization of tumour
xenografts, Nature 401, 670-677.
113
82.
Benezra, R. (2001) Role of Id proteins in embryonic and tumor angiogenesis,
Trends Cardiovasc Med 11, 237-241.
83.
Jen, Y., Manova, K., and Benezra, R. (1997) Each member of the Id gene family
exhibits a unique expression pattern in mouse gastrulation and neurogenesis, Dev
Dyn 208,92-106.
84.
Sun, X. H. (1994) Constitutive expression of the Idl gene impairs mouse B cell
development, Cell 79, 893-900.
85.
Morrow, M. A., Mayer, E. W., Perez, C. A., Adlam, M., and Siu, G. (1999)
Overexpression of the Helix-Loop-Helix protein Id2 blocks T cell development at
multiple stages, Mol Immunol 36, 491-503.
86.
Rivera, R., and Murre, C. (2001) The regulation and function of the Id proteins in
lymphocyte development, Oncogene 20, 8308-8316.
87.
Yokota, Y., Mansouri, A., Mori, S., Sugawara, S., Adachi, S., Nishikawa, S., and
Gruss, P. (1999) Development of peripheral lymphoid organs and natural killer
cells depends on the helix-loop-helix inhibitor Id2, Nature 397, 702-706.
88.
Martinsen, B. J., and Bronner-Fraser, M. (1998) Neural crest specification
regulated by the helix-loop-helix repressor Id2, Science 281, 988-991.
89.
Neuman, T., Keen, A., Zuber, M. X., Kristjansson, G. I., Gruss, P., and Nornes,
H. O. (1993) Neuronal expression of regulatory helix-loop-helix factor Id2 gene
in mouse, Dev Biol 160, 186-195.
90.
Sablitzky, F., Moore, A., Bromley, M., Deed, R. W., Newton, J. S., and Norton, J.
D. (1998) Stage- and subcellular-specific expression of Id proteins in male germ
and Sertoli cells implicates distinctive regulatory roles for Id proteins during
meiosis, spermatogenesis, and Sertoli cell function, Cell Growth Differ 9,10151024.
91.
Kondo, T., and Raff, M. (2000) The Id4 HLH protein and the timing of
oligodendrocyte differentiation, EMBO J19,1998-2007.
92.
Jen, Y., Manova, K., and Benezra, R. (1996) Expression patterns of Idl, Id2, and
Id3 are highly related but distinct from that of Id4 during mouse embryogenesis,
Dev Dyn 207, 235-252.
93.
Ohtani, N., Zebedee, Z., Huot, T. J., Stinson, J. A., Sugimoto, M., Ohashi, Y.,
Sharrocks, A. D., Peters, G., and Hara, E. (2001) Opposing effects of Ets and Id
114
proteins on pl6INK4a expression during cellular senescence, Nature 409,10671070.
94.
Zebedee, Z., and Hara, E. (2001) Id proteins in cell cycle control and cellular
senescence, Oncogene 20, 8317-8325.
95.
Desprez, P. Y., Lin, C. Q., Thomasset, N., Sympson, C. J., Bissell, M. J., and
Campisi, J. (1998) A novel pathway for mammary epithelial cell invasion induced
by the helix-loop-helix protein Id-1, Mol Cell Biol 18, 4577-4588.
96.
Alani, R. M., Hasskarl, J., Grace, M., Hernandez, M. C, Israel, M. A., and
Munger, K. (1999) Immortalization of primary human keratinocytes by the helixloop-helix protein, Id-1, Proceedings of the National Academy ofSciences ofthe
United States ofAmerica 96, 9637-9641.
97.
Cheung, P. Y., Yip, Y. L., Tsao, S. W., Ching, Y. P., and Cheung, A. L. (2011)
Id-1 induces cell invasiveness in immortalized epithelial cells by regulating
cadherin switching and Rho GTPases, J Cell Biochem 112,157-168.
98.
Schmidt, M., Asirvatham, A. J., and Chaudhary, J. (2010) Inhibitor of
differentiation 1 (ID1) promotes cell survival and proliferation of prostate
epithelial cells, Cellular & molecular biology letters 15, 272-295.
99.
Lasorella, A., Uo, T., and Iavarone, A. (2001) Id proteins at the cross-road of
development and cancer, Oncogene 20, 8326-8333.
100.
Noetzel, E., Veeck, J., Niederacher, D., Galm, O., Horn, F., Hartmann, A.,
Knuchel, R., and Dahl, E. (2008) Promoter methylation-associated loss of ID4
expression is a marker of tumour recurrence in human breast cancer, BMC Cancer
8,154.
101.
Hara, E., Yamaguchi, T., Nojima, H., Ide, T., Campisi, J., Okayama, H., and Oda,
K. (1994) Id-related genes encoding helix-loop-helix proteins are required for Gl
progression and are repressed in senescent human fibroblasts, The Journal of
biological chemistry 269, 2139-2145.
102.
Giacinti, C, and Giordano, A. (2006) RB and cell cycle progression, Oncogene
25, 5220-5227.
103.
Lasorella, A., Rothschild, G., Yokota, Y., Russell, R. G., and Iavarone, A. (2005)
Id2 mediates tumor initiation, proliferation, and angiogenesis in Rb mutant mice,
Mol Cell Biol 25, 3563-3574.
115
104.
Yun, K., Mantani, A., Garel, S., Rubenstein, J., and Israel, M. A. (2004) Id4
regulates neural progenitor proliferation and differentiation in vivo, Development
131, 5441-5448.
105.
Forootan, S. S., Wong, Y. C, Dodson, A., Wang, X., Lin, K., Smith, P. H.,
Foster, C. S., and Ke, Y. (2007) Increased Id-1 expression is significantly
associated with poor survival of patients with prostate cancer, Hum Pathol 38,
1321-1329.
106.
Asirvatham, A. J., Carey, J. P., and Chaudhary, J. (2007) ID1-, ID2-, and ID3regulated gene expression in E2A positive or negative prostate cancer cells, The
Prostate 67, 1411-1420.
107.
Ling, Y. X., Tao, J., Fang, S. F., Hui, Z., and Fang, Q. R. (2011) Downregulation
of Idl by small interfering RNA in prostate cancer PC3 cells in vivo and in vitro,
European journal of cancer prevention : the officialjournal of the European
Cancer Prevention Organisation 20, 9-17.
108.
Samanta, J., and Kessler, J. A. (2004) Interactions between ID and OLIG proteins
mediate the inhibitory effects of BMP4 on oligodendroglial differentiation,
Development 131, 4131-4142.
109.
Guo, S. J., Hu, J. G., Zhao, B. M., Shen, L., Wang, R., Zhou, J. S., and Lu, H. Z.
(2011) Oligl and ID4 interactions in living cells visualized by bimolecular
fluorescence complementation technique, Mol Biol Rep 38,4637-4642.
110.
Dong, J., Huang, S., Caikovski, M., Ji, S., McGrath, A., Custorio, M. G.,
Creighton, C. J., Maliakkal, P., Bogoslovskaia, E., Du, Z., Zhang, X., Lewis, M.
T., Sablitzky, F., Brisken, C, and Li, Y. (2011) ID4 regulates mammary gland
development by suppressing p38MAPK activity, Development 138, 5247-5256.
111.
Kebebew, E., Peng, M., Treseler, P. A., Clark, O. H., Duh, Q. Y., Ginzinger, D.,
and Miner, R. (2004) Idl gene expression is up-regulated in hyperplastic and
neoplastic thyroid tissue and regulates growth and differentiation in thyroid
cancer cells, J Clin Endocrinol Metab 89, 6105-6111.
112.
Gomez Del Pulgar, T., Valdes-Mora F, Bandres E. Perez-Palacios R, Espina C,
Cejas P, Garcia-cebezas. (2008) Cdc42 is highly expressed in colorectal
adenocarcinoma and downregulates ID4 through an epigenetic mechanism, IntJ
Oncol 33, 185-193.
113.
Umetani, N., Takeuchi, H., Fujimoto, A., Shinozaki, M., Bilchik, A. J., and Hoon,
D. S. (2004) Epigenetic inactivation of ID4 in colorectal carcinomas correlates
116
with poor differentiation and unfavorable prognosis, Clin Cancer Res 10, 74757483.
114.
Chen, H., Weng, Y. C, Schatteman, G. C, Sanders, L., Christy, R. J., and
Christy, B. A. (1999) Expression of the dominant-negative regulator Id4 is
induced during adipocyte differentiation, Biochemical and biophysical research
communications 256, 614-619.
115.
Dell'Orso, S., Ganci, F., Strano, S., Blandino, G., and Fontemaggi, G. ID4: a new
player in the cancer arena, Oncotarget 1, 48-58.
116.
Ren, Y., Cheung, H. W., von Maltzhan, G., Agrawal, A., Cowley, G. S., Weir, B.
A., Boehm, J. S., Tamayo, P., Karst, A. M., Liu, J. F., Hirsch, M. S., Mesirov, J.
P., Drapkin, R., Root, D. E., Lo, J., Fogal, V., Ruoslahti, E., Hahn, W. C, and
Bhatia, S. N. (2012) Targeted tumor-penetrating siRNA nanocomplexes for
credentialing the ovarian cancer oncogene ID4, Science translational medicine 4,
147rall2.
117.
Wu, Q., Hoffmann, M. J., Hartmann, F. H., and Schulz, W. A. (2005)
Amplification and overexpression of the ID4 gene at 6p22.3 in bladder cancer,
Mol Cancer 4, 16.
118.
Chan, A. S., Tsui, W. Y., Chen, X., Chu, K. M, Chan, T. L., Li, R., So, S., Yuen,
S. T., and Leung, S. Y. (2003) Downregulation of ID4 by promoter
hypermethylation in gastric adenocarcinoma, Oncogene 22, 6946-6953.
119.
Gomez Del Pulgar, T., Valdes-Mora, F., Bandres, E., Perez-Palacios, R., Espina,
C, Cejas, P., Garcia-Cabezas, M. A., Nistal, M, Casado, E., Gonzalez-Baron, M.,
Garcia-Foncillas, J., and Lacal, J. C. (2008) Cdc42 is highly expressed in
colorectal adenocarcinoma and downregulates ID4 through an epigenetic
mechanism, Int J Oncol 33, 185-193.
120.
Xu, R. R., Liu, F., Cui, X., Zhang, X. W., and Wang, Y. (2011) [ID4 promoter
methylation in acute myeloid leukemia], Zhongguo Shi Yan Xue YeXue Za Zhi
19, 582-584.
121.
Zhao, Y., Wang, Q. S., Dou, L. P., Bo, J., Li, H. H., Jing, Y., and Yu, L. (2007)
[Methylation of Id4 gene promoter in acute leukemia], Zhongguo Shi Yan Xue Ye
Xue Za Zhi 75,1156-1160.
122.
Castro, M., Grau, L., Puerta, P., Gimenez, L., Venditti, J., Quadrelli, S., and
Sanchez-Carbayo, M. (2010) Multiplexed methylation profiles of tumor
suppressor genes and clinical outcome in lung cancer, J Transl Med 8, 86.
117
123.
de Candia, P., Akram, M., Benezra, R., and Brogi, E. (2006) Id4 messenger RNA
and estrogen receptor expression: inverse correlation in human normal breast
epithelium and carcinoma, Hum Pathol 37,1032-1041.
124.
Qu, F., Zhao, C. H., Diao, Y. Q., Zhu, X. L., Chen, J., Li, M., Liu, C. P., Jiang, L.,
and Jin, J. (2010) [Methylation of Id4 gene and inhibitive effect of arsenic
trioxide on it in Raji cells.], Zhonghua Xue Ye Xue Za Zhi 31, 821-825.
125.
Hagiwara, K., Nagai, H., Li, Y., Ohashi, H., Hotta, T, and Saito, H. (2007)
Frequent DNA methylation but not mutation of the ID4 gene in malignant
lymphoma, J Clin Exp Hematop ^7, 15-18.
126.
Vinarskaja, A., Goering, W., Ingenwerth, M., and Schulz, W. A. (2012) ID4 is
frequently downregulated and partially hypermethylated in prostate cancer, World
journal of urology 30, 319-325.
127.
DeLeo, A. B., Jay, G., Appella, E., Dubois, G. C, Law, L. W., and Old, L. J.
(1979) Detection of a transformation-related antigen in chemically induced
sarcomas and other transformed cells of the mouse, Proceedings ofthe National
Academy ofSciences ofthe United States ofAmerica 76, 2420-2424.
128.
Lane, D. P., and Crawford, L. V. (1979) T antigen is bound to a host protein in
SV40-transformed cells, Nature 278, 261-263.
129.
Linzer, D. I., and Levine, A. J. (1979) Characterization of a 54K dalton cellular
SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal
carcinoma cells, Cell 17,43-52.
130.
Dippold, W. G., Jay, G., DeLeo, A. B., Khoury, G., and Old, L. J. (1981) p53
transformation-related protein: detection by monoclonal antibody in mouse and
human cells, Proceedings of the National Academy ofSciences ofthe United
States ofAmerica 78,1695-1699.
131.
Sigal, A., and Rotter, V. (2000) Oncogenic mutations of the p53 tumor
suppressor: the demons of the guardian of the genome, Cancer Res 60, 67886793.
132
Baker, S. J., Fearon, E. R., Nigro, J. M., Hamilton, S. R., Preisinger, A. C,
Jessup, J. M., vanTuinen, P., Ledbetter, D. H., Barker, D. F., Nakamura, Y.,
White, R., and Vogelstein, B. (1989) Chromosome 17 deletions and p53 gene
mutations in colorectal carcinomas, Science 244, 217-221.
133.
Finlay, C. A., Hinds, P. W., and Levine, A. J. (1989) The p53 proto-oncogene can
act as a suppressor of transformation, Cell 57,1083-1093.
118
134.
Donehower, L. A., Harvey, M., Slagle, B. L., McArthur, M. J., Montgomery, C.
A., Jr., Butel, J. S., and Bradley, A. (1992) Mice deficient for p53 are
developmentally normal but susceptible to spontaneous tumours, Nature 356,
215-221.
135.
Oren, M., and Rotter, V. (1999) Introduction: p53--the first twenty years, Cell
Mol Life Sci 55, 9-11.
136.
Schmale, H., and Bamberger, C. (1997) A novel protein with strong homology to
the tumor suppressor p53, Oncogene 15,1363-1367.
137.
Kaghad, M., Bonnet, H., Yang, A., Creancier, L., Biscan, J. C, Valent, A., Minty,
A., Chalon, P., Lelias, J. M., Dumont, X., Ferrara, P., McKeon, F., and Caput, D.
(1997) Monoallelically expressed gene related to p53 at Ip36, a region frequently
deleted in neuroblastoma and other human cancers, Cell 90, 809-819.
138.
Irwin, M. S., and Kaelin, W. G. (2001) p53 family update: p73 and p63 develop
their own identities, Cell Growth Differ 12, 337-349.
139.
Lamb, P., and Crawford, L. (1986) Characterization of the human p53 gene, Mol
Cell Biol 6,1379-1385.
140.
Slee, E. A., O'Connor, D. J., and Lu, X. (2004) To die or not to die: how does p53
decide?, Oncogene 23,2809-2818.
141.
Bode, A. M., and Dong, Z. (2004) Post-translational modification of p53 in t
umorigenesis, Nat Rev Cancer 4, 793-805.
142.
Fields, S., and Jang, S. K. (1990) Presence of a potent transcription activating
sequence in the p53 protein, Science 249,1046-1049.
143.
Lin, J., Chen, J., Elenbaas, B., and Levine, A. J. (1994) Several hydrophobic
amino acids in the p53 amino-terminal domain are required for transcriptional
activation, binding to mdm-2 and the adenovirus 5 E1B 55-kD protein, Genes &
development 8,1235-1246.
144.
Kern, S. E., Kinzler, K. W., Bruskin, A., Jarosz, D., Friedman, P., Prives, C, and
Vogelstein, B. (1991) Identification of p53 as a sequence-specific DNA-binding
protein, Science 252, 1708-1711.
145.
Chen, X., Ko, L. J., Jayaraman, L., and Prives, C. (1996) p53 levels, functional
domains, and DNA damage determine the extent of the apoptotic response of
tumor cells, Genes & development 10, 2438-2451.
119
146.
Kaelin, W. G., Jr. (1999) The emerging p53 gene family, Journal of the National
Cancer Institute 91, 594-598.
147.
Vogelstein, B., Lane, D., and Levine, A. J. (2000) Surfing the p53 network,
Nature 408, 307-310.
148.
Levine, A. J. (1997) p53, the cellular gatekeeper for growth and division, Cell 88,
323-331.
149.
Fritsche, M., Haessler, C, and Brandner, G. (1993) Induction of nuclear
accumulation of the tumor-suppressor protein p53 by DNA-damaging agents,
Oncogene 8, 307-318.
150.
Matsuoka, S., Huang, M, and Elledge, S. J. (1998) Linkage of ATM to cell cycle
regulation by the Chk2 protein kinase, Science 282, 1893-1897.
151.
Banin, S., Moyal, L., Shieh, S., Taya, Y., Anderson, C. W., Chessa, L.,
Smorodinsky, N. I., Prives, C, Reiss, Y., Shiloh, Y., and Ziv, Y. (1998) Enhanced
phosphorylation of p53 by ATM in response to DNA damage, Science 281,16741677.
152.
Canman, C. E., Lim, D. S., Cimprich, K. A., Taya, Y., Tamai, K., Sakaguchi, K.,
Appella, E., Kastan, M. B., and Siliciano, J. D. (1998) Activation of the ATM
kinase by ionizing radiation and phosphorylation of p53, Science 281,1677-1679.
153.
Hofseth, L. J., Hussain, S. P., and Harris, C. C. (2004) p53: 25 years after its
discovery, Trends in pharmacological sciences 25, 177-181.
154.
Bai, L. a. Z., Wei-Guo. (2006) p53: Structure, Function, and Therapeutic
Applications, Journal of Cancer Molecules 2, 141-153.
155.
Hoffman, W. H., Biade, S., Zilfou, J. T., Chen, J., and Murphy, M. (2002)
Transcriptional repression of the anti-apoptotic survivin gene by wild type p53,
The Journal of biological chemistry 277, 3247-3257.
156.
Zhou, J., Ann, J., Wilson, S. H., and Prives, C. (2001) A role for p53 in base
excision repair, EMBO J 20,914-923.
157.
el-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J.
M., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. (1993) WAF1, a
potential mediator of p53 tumor suppression, Cell 75, 817-825.
120
158.
Harper, J. W., Adami, G. R., Wei, N., Keyomarsi, K., and Elledge, S. J. (1993)
The p21 Cdk-interacting protein Cipl is a potent inhibitor of Gl cyclin-dependent
kinases, Cell 75, 805-816.
159.
Xiong, Y., Harmon, G. J., Zhang, H., Casso, D., Kobayashi, R., and Beach, D.
(1993) p21 is a universal inhibitor of cyclin kinases, Nature 366, 701-704.
160.
Zhan, Q., Antinore, M. J., Wang, X. W., Carrier, F., Smith, M. L., Harris, C. C,
and Fornace, A. J., Jr. (1999) Association with Cdc2 and inhibition of
Cdc2/Cyclin Bl kinase activity by the p53-regulated protein Gadd45, Oncogene
18, 2892-2900.
161.
Colman, M. S., Afshari, C. A., and Barrett, J. C. (2000) Regulation of p53
stability and activity in response to genotoxic stress, Mutat Res 462, 179-188.
162.
Takimoto, R., and El-Deiry, W. S. (2000) Wild-type p53 transactivates the
KILLER/DR5 gene through an intronic sequence-specific DNA-binding site,
Oncogene 19, 1735-1743.
163.
Fridman, J. S., and Lowe, S. W. (2003) Control of apoptosis by p53, Oncogene
22, 9030-9040.
164.
Cory, S., and Adams, J. M. (2002) The Bcl2 family: regulators of the cellular lifeor-death switch, Nat Rev Cancer 2, 647-656.
165.
Schlesinger, P. H., Gross, A., Yin, X. M., Yamamoto, K., Saito, M., Waksman,
G., and Korsmeyer, S. J. (1997) Comparison of the ion channel characteristics of
proapoptotic BAX and antiapoptotic BCL-2, Proceedings ofthe National
Academy ofSciences ofthe United States ofAmerica 94,11357-11362.
166.
Nakano, K., and Vousden, K. H. (2001) PUMA, a novel proapoptotic gene, is
induced by p53, Molecular cell 7, 683-694.
167.
Oda, E., Ohki, R., Murasawa, H., Nemoto, J., Shibue, T., Yamashita, T., Tokino,
T., Taniguchi, T., and Tanaka, N. (2000) Noxa, a BH3-only member of the Bcl-2
family and candidate mediator of p53-induced apoptosis, Science 288,1053-1058.
168.
Matsuda, K., Yoshida, K., Taya, Y., Nakamura, K., Nakamura, Y., and Arakawa,
H. (2002) p53AIPl regulates the mitochondrial apoptotic pathway, Cancer Res
62, 2883-2889.
169.
Symonds, H., Krall, L., Remington, L., Saenz-Robles, M., Lowe, S., Jacks, T.,
and Van Dyke, T. (1994) p53-dependent apoptosis suppresses tumor growth and
progression in vivo, Cell 78, 703-711.
121
170.
Yin, C, Knudson, C. M., Korsmeyer, S. J., and Van Dyke, T. (1997) Bax
suppresses tumorigenesis and stimulates apoptosis in vivo, Nature 385,637-640.
171.
Yu, J., Wang, Z., Kinzler, K. W., Vogelstein, B., and Zhang, L. (2003) PUMA
mediates the apoptotic response to p53 in colorectal cancer cells, Proceedings of
the National Academy ofSciences of the United States ofAmerica 100, 19311936.
172.
Yu, J., and Zhang, L. (2005) The transcriptional targets of p53 in apoptosis
control, Biochemical and biophysical research communications 331, 851-858.
173.
Maltzman, W., and Czyzyk, L. (1984) UV irradiation stimulates levels of p53
cellular tumor antigen in nontransformed mouse cells, Mol Cell Biol 4,16891694.
174.
Jones, S. N., Roe, A. E., Donehower, L. A., and Bradley, A. (1995) Rescue of
embryonic lethality in Mdm2-deficient mice by absence of p53, Nature 378,206208.
175.
Haupt, Y., Maya, R., Kazaz, A., and Oren, M. (1997) Mdm2 promotes the rapid
degradation of p53, Nature 387, 296-299.
176.
Honda, R., Tanaka, H., and Yasuda, H. (1997) Oncoprotein MDM2 is a ubiquitin
ligase E3 for tumor suppressor p53, FEBS letters 420, 25-27.
177.
Wu, X., Bayle, J. H., Olson, D., and Levine, A. J. (1993) The p53-mdm-2
autoregulatory feedback loop, Genes & development 7, 1126-1132.
178.
Oren, M. (1999) Regulation of the p53 tumor suppressor protein, The Journal of
179.
Appella, E., and Anderson, C. W. (2001) Post-translational modifications and
activation of p53 by genotoxic stresses, European journal ofbiochemistry /FEBS
268, 2764-2772.
180.
Xu, Y. (2003) Regulation of p53 responses by post-translational modifications,
Cell death and differentiation 10,400-403.
181.
Hupp, T. R., and Lane, D. P. (1994) Allosteric activation of latent p53 tetramers,
Curr Biol ¥,865-875.
182.
Rodriguez, M. S., Desterro, J. M., Lain, S., Lane, D. P., and Hay, R. T. (2000)
Multiple C-terminal lysine residues target p53 for ubiquitin-proteasome-mediated
degradation, Mol Cell Biol 20, 8458-8467.
122
183.
Barlev, N. A., Liu, L., Chehab, N. H., Mansfield, K., Harris, K. G., Halazonetis,
T. D., and Berger, S. L. (2001) Acetylation of p53 activates transcription through
recruitment of coactivators/histone acetyltransferases, Molecular cell 8,12431254.
184.
Gu, W., Shi, X. L., and Roeder, R. G. (1997) Synergistic activation of
transcription by CBP and p53, Nature 387, 819-823.
185.
Gu, W., and Roeder, R. G. (1997) Activation of p53 sequence-specific DNA
binding by acetylation of the p53 C-terminal domain, Cell 90, 595-606.
186.
Liu, L., Scolnick, D. M., Trievel, R. C, Zhang, H. B., Marmorstein, R.,
Halazonetis, T. D., and Berger, S. L. (1999) p53 sites acetylated in vitro by PCAF
and p300 are acetylated in vivo in response to DNA damage, Mol Cell Biol 19,
1202-1209.
187.
Kouzarides, T. (2000) Acetylation: a regulatory modification to rival
phosphorylation?, EMBO J19,1176-1179.
188.
Sterner, D. E., and Berger, S. L. (2000) Acetylation of histones and transcriptionrelated factors, Microbiology and molecular biology reviews : MMBR 64,435459.
189.
Sakaguchi, K., Herrera, J. E., Saito, S., Miki, T., Bustin, M., Vassilev, A.,
Anderson, C. W., and Appella, E. (1998) DNA damage activates p53 through a
phosphorylation-acetylation cascade, Genes & development 12, 2831-2841.
190.
Lambert, P. F., Kashanchi, F., Radonovich, M. F., Shiekhattar, R., and Brady, J.
N. (1998) Phosphorylation of p53 serine 15 increases interaction with CBP, The
Journal of biological chemistry 273, 33048-33053.
191.
Ou, Y. H., Chung, P. H., Sun, T. P., and Shieh, S. Y. (2005) p53 C-terminal
phosphorylation by CHK1 and CHK2 participates in the regulation of DNAdamage-induced C-terminal acetylation, Mol Biol Cell 16,1684-1695.
192.
Sherr, C. J. (1998) Tumor surveillance via the ARF-p53 pathway, Genes &
development 12, 2984-2991.
193.
Hainaut, P., and Hollstein, M. (2000) p53 and human cancer: the first ten
thousand mutations, Adv Cancer Res 77, 81-137.
194.
Bullock, A. N., and Fersht, A. R. (2001) Rescuing the function of mutant p53, Nat
Rev Cancer 1, 68-76.
123
195.
Rivlin, N., Brosh, R., Oren, M., and Rotter, V. (2011) Mutations in the p53
Tumor Suppressor Gene: Important Milestones at the Various Steps of
Tumorigenesis, Genes & cancer 2, 466-474.
196.
Milner, J. (1991) A conformation hypothesis for the suppressor and promoter
functions of p53 in cell growth control and in cancer, Proceedings. Biological
sciences / The Royal Society 245,139-145.
197.
Milner, J., and Medcalf, E. A. (1991) Cotranslation of activated mutant p53 with
wild type drives the wild-type p53 protein into the mutant conformation, Cell 65,
765-774.
198.
Miller, C, Mohandas, T., Wolf, D., Prokocimer, M., Rotter, V., and Koeffler, H.
P. (1986) Human p53 gene localized to short arm of chromosome 17, Nature 319,
783-784.
199.
Brosh, R., and Rotter, V. (2009) When mutants gain new powers: news from the
mutant p53 field, Nat Rev Cancer 9, 701-713.
200.
Yang, Y., Li, C. C, and Weissman, A. M. (2004) Regulating the p53 system
through ubiquitination, Oncogene 23, 2096-2106.
201.
Midgley, C. A., Desterro, J. M., Saville, M. K., Howard, S., Sparks, A., Hay, R.
T., and Lane, D. P. (2000) An N-terminal pl4ARF peptide blocks Mdm2dependent ubiquitination in vitro and can activate p53 in vivo, Oncogene 19,
2312-2323.
202.
Chene, P., Fuchs, J., Bohn, J., Garcia-Echeverria, C, Furet, P., and Fabbro, D.
(2000) A small synthetic peptide, which inhibits the p53-hdm2 interaction,
stimulates the p53 pathway in tumour cell lines, JMol Biol 299, 245-253.
203.
Grasberger, B. L., Lu, T., Schubert, C, Parks, D. J., Carver, T. E., Koblish, H. K.,
Cummings, M. D., LaFrance, L. V., Milkiewicz, K. L., Calvo, R. R., Maguire, D.,
Lattanze, J., Franks, C. F., Zhao, S., Ramachandren, K., Bylebyl, G. R., Zhang,
M., Manthey, C. L., Petrella, E. C, Pantoliano, M. W., Deckman, I. C, Spurlino,
J. C, Maroney, A. C, Tomczuk, B. E., Molloy, C. J., and Bone, R. F. (2005)
Discovery and cocrystal structure of benzodiazepinedione HDM2 antagonists that
activate p53 in cells, Journal ofmedicinal chemistry 48, 909-912.
204.
Sato, N., Mizumoto, K., Maehara, N., Kusumoto, M., Nishio, S., Urashima, T.,
Ogawa, T., and Tanaka, M. (2000) Enhancement of drug-induced apoptosis by
antisense oligodeoxynucleotides targeted against Mdm2 and p21WAFl/CIPl,
Anticancer Res 20, 837-842.
124
205.
Yu, J., and Zhang, L. (2003) No PUMA, no death: implications for p53-dependent
apoptosis, Cancer Cell 4, 248-249.
206.
Selivanova, G., Ryabchenko, L., Jansson, E., Iotsova, V., and Wiman, K. G.
(1999) Reactivation of mutant p53 through interaction of a C-terminal peptide
with the core domain, Mol Cell Biol 19, 3395-3402.
207.
Friedler, A., Hansson, L. O., Veprintsev, D. B., Freund, S. M., Rippin, T. M,
Nikolova, P. V., Proctor, M. R., Rudiger, S., and Fersht, A. R. (2002) A peptide
that binds and stabilizes p53 core domain: chaperone strategy for rescue of
oncogenic mutants, Proceedings ofthe National Academy ofSciences of the
United States ofAmerica 99, 937-942.
208.
Bykov, V. J., Issaeva, N., Shilov, A., Hultcrantz, M., Pugacheva, E., Chumakov,
P., Bergman, J., Wiman, K. G., and Selivanova, G. (2002) Restoration of the
tumor suppressor function to mutant p53 by a low-molecular-weight compound,
Nature medicine 8, 282-288.
209.
Issaeva, N., Friedler, A., Bozko, P., Wiman, K. G., Fersht, A. R., and Selivanova,
G. (2003) Rescue of mutants of the tumor suppressor p53 in cancer cells by a
designed peptide, Proceedings ofthe National Academy ofSciences ofthe United
States ofAmerica 100, 13303-13307.
210.
Foster, B. A., Coffey, H. A., Morin, M. J., and Rastinejad, F. (1999)
Pharmacological rescue of mutant p53 conformation and function, Science 286,
2507-2510.
211.
Wang, W., Takimoto, R., Rastinejad, F., and El-Deiry, W. S. (2003) Stabilization
of p53 by CP-31398 inhibits ubiquitination without altering phosphorylation at
serine 15 or 20 or MDM2 binding, Mol Cell Biol 23, 2171 -2181.
212.
Coradini, D., Fornili, M., Ambrogi, F., Boracchi, P., and Biganzoli, E. (2012)
TP53 mutation, epithelial-mesenchymal transition, and stemlike features in breast
cancer subtypes, Journal ofbiomedicine & biotechnology 2012, 254085.
213.
Fontemaggi, G., Dell'Orso, S., Trisciuoglio, D., Shay, T., Melucci, E., Fazi, F.,
Terrenato, I., Mottolese, M., Muti, P., Domany, E., Del Bufalo, D., Strano, S., and
Blandino, G. (2009) The execution of the transcriptional axis mutant p53, E2F1
and ID4 promotes tumor neo-angiogenesis, Nat Struct Mol Biol 16,1086-1093.
214.
Strong, N., Millena, A. C, Walker, L., Chaudhary, J., and Khan, S. A. (2012)
Inhibitor of differentiation 1 (Idl) and Id3 proteins play different roles in TGFbeta
effects on cell proliferation and migration in prostate cancer cells, The Prostate.
125
215.
Kaeser, M. D., and Iggo, R. D. (2002) Chromatin immunoprecipitation analysis
fails to support the latency model for regulation of p53 DNA binding activity in
vivo, Proceedings of the National Academy ofSciences of the United States of
America 99, 95-100.
216.
Brekman, A., Singh, K. E., Polotskaia, A., Kundu, N., and Bargonetti, J. (2011) A
p53-independent role of Mdm2 in estrogen-mediated activation of breast cancer
cell proliferation, Breast cancer research : BCR 13, R3.
217.
el-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K. W., and Vogelstein, B.
(1992) Definition of a consensus binding site for p53, Nat Genet 1,45-49.
218.
Patel, D., and Chaudhary, J. (2012) Increased expression of bHLH transcription
factor E2A (TCF3) in prostate cancer promotes proliferation and confers
resistance to doxorubicin induced apoptosis, Biochemical and biophysical
research communications 422,146-151.
219.
Gottlieb, E., Armour, S. M, Harris, M. H., and Thompson, C. B. (2003)
Mitochondrial membrane potential regulates matrix configuration and cytochrome
c release during apoptosis, Cell death and differentiation 10, 709-717.
220.
Wolter, K. G., Hsu, Y. T., Smith, C. L., Nechushtan, A., Xi, X. G., and Youle, R.
J. (1997) Movement of Bax from the cytosol to mitochondria during apoptosis,
The Journal ofcell biology 139, 1281-1292.
221.
Peyerl, F. W., Dai, S., Murphy, G. A., Crawford, F., White, J., Marrack, P., and
Kappler, J. W. (2007) Elucidation of some Bax conformational changes through
crystallization of an antibody-peptide complex, Cell death and differentiation 14,
447-452.
222.
Beckerman, R., and Prives, C. (2010) Transcriptional regulation by p53, Cold
Spring Harbor perspectives in biology 2, a000935.
223.
Muller, P. A., Vousden, K. H., and Norman, J. C. (2011) p53 and its mutants in
tumor cell migration and invasion, The Journal ofcell biology 192, 209-218.
224.
Van Veldhuizen, P. J., Sadasivan, R., Garcia, F., Austenfeld, M. S., and Stephens,
R. L. (1993) Mutant p53 expression in prostate carcinoma., The Prostate 22,2330.
225.
Tang, H. Y., Zhao, K., Pizzolato, J. F., Fonarev, M., Langer, J. C, and Manfredi,
J. J. (1998) Constitutive expression of the cyclin-dependent kinase inhibitor p21 is
transcriptionally regulated by the tumor suppressor protein p53., The Journal of
126
226.
Zhu, H., Mao, Q., Lin, Y., Yang, K., and Xie, L. (2011) RNA interference
targeting mutant p53 inhibits growth and induces apoptosis in DU145 human
prostate cancer cells, Med Oncol 28 Suppl 1, S381-387.
227.
Zauberman, A., Flusberg, D., Haupt, Y., Barak, Y., and Oren, M. (1995) A
functional p5 3-responsive intronic promoter is contained within the human mdm2
gene, Nucleic acids research 23, 2584-2592.
228.
Barak, Y., Gottlieb, E., Juven-Gershon, T., and Oren, M. (1994) Regulation of
mdm2 expression by p53: alternative promoters produce transcripts with
nonidentical translation potential, Genes & development 8, 1739-1749.
229.
Tang, Y., Zhao, W., Chen, Y., Zhao, Y., and Gu, W. (2008) Acetylation is
indispensable for p53 activation., Cell 133, 612-626.
230.
Perez, R. E., Knights, C. D., Sahu, G., Catania, J., Kolukula, V. K., Staler, D.,
Graessmann, A., Ogryzko, V., Pishvaian, M., Albanese, C, and Avantaggiati, M.
L. (2010) Restoration of DNA-binding and growth-suppressive activity of mutant
forms of p53 via a PCAF-mediated acetylation pathway, Journal ofcellular
physiology 225, 394-405.
231.
Knights, C. D., Catania, J., Di Giovanni, S., Muratoglu, S., Perez, R., Swartzbeck,
A., Quong, A. A., Zhang, X., Beerman, T., Pestell, R. G., and Avantaggiati, M. L.
(2006) Distinct p53 acetylation cassettes differentially influence gene-expression
patterns and cell fate., The Journal ofcell biology 173, 533-544.
232.
Gu, W., and Roeder, R. G. (1997) Activation of p53 sequence-specific DNA
binding by acetylation of the p53 C-terminal domain., Cell 90, 595-606.
233.
Viglietto, G., Motti, M. L., and Fusco, A. (2002) Understanding p27(kipl)
deregulation in cancer: down-regulation or mislocalization, Cell Cycle 1, 394-400.
234.
Bringold, F., and Serrano, M. (2000) Tumor suppressors and oncogenes in
cellular senescence, Exp Gerontol 35, 317-329.
235.
Supriatno, Harada, K., Kawaguchi, S., Yoshida, H., and Sato, M. (2003) Effect of
p27Kipl on the ability of invasion and metastasis of an oral cancer cell line,
Oncol Rep 10, 527-532.
236.
Pulukuri, S. M., and Rao, J. S. (2008) Matrix metalloproteinase-1 promotes
prostate tumor growth and metastasis, IntJ Oncol 32, 757-765.
127
237.
Aalinkeel, R., Nair, B. B., Reynolds, J. L., Sykes, D. E., Mahajan, S. D., Chadha,
K. C, and Schwartz, S. A. (2011) Overexpression of MMP-9 contributes to
invasiveness of prostate cancer cell line LNCaP, Immunol Invest 40, 447-464.
238.
Chi, S. G., deVere White, R. W., Meyers, F. J., Siders, D. B., Lee, F., and
Gumerlock, P. H. (1994) p53 in prostate cancer: frequent expressed transition
mutations, Journal of the National Cancer Institute 86, 926-933.
239.
Olivier, M, Eeles, R., Hollstein, M., Khan, M. A., Harris, C. C, and Hainaut, P.
(2002) The IARC TP53 database: new online mutation analysis and
recommendations to users, Human mutation 19, 607-614.
240.
Joerger, A. C, and Fersht, A. R. (2008) Structural biology of the tumor
suppressor p53, Annual review ofbiochemistry 77, 557-582.
241.
Gurova, K. V., Rokhlin, O. W., Budanov, A. V., Burdelya, L. G., Chumakov, P.
M., Cohen, M. B., and Gudkov, A. V. (2003) Cooperation of two mutant p53
alleles contributes to Fas resistance of prostate carcinoma cells, Cancer Res 63,
2905-2912.
242.
Dai, C, and Gu, W. (2010) p53 post-translational modification: deregulated in
tumorigenesis., Trends in molecular medicine 16, 528-536.
243.
Ito, A., Lai, C. H., Zhao, X., Saito, S., Hamilton, M. H., Appella, E., and Yao, T.
P. (2001) p300/CBP-mediated p53 acetylation is commonly induced by p53activating agents and inhibited by MDM2., The EMBO journal 20,1331-1340.
244.
Oliner, J. D., Pietenpol, J. A., Thiagalingam, S., Gyuris, J., Kinzler, K. W., and
Vogelstein, B. (1993) Oncoprotein MDM2 conceals the activation domain of
tumour suppressor p53., Nature 362, 857-860.
245.
Abaza, M. S., Al-Saffar, A., Al-Sawan, S., and Al-Attiyah, R. (2008) c-myc
antisense oligonucleotides sensitize human colorectal cancer cells to
chemotherapeutic drugs, Tumour biology : the journal of the International Society
for Oncodevelopmental Biology and Medicine 29, 287-303.
246.
Pastorino, F., Mumbengegwi, D. R., Ribatti, D., Ponzoni, M., and Allen, T. M.
(2008) Increase of therapeutic effects by treating melanoma with targeted
combinations of c-myc antisense and doxorubicin, Journal ofcontrolled release :
officialjournal ofthe Controlled Release Society 126, 85-94.
247.
Lin, C. P., Liu, J. D., Chow, J. M., Liu, C. R., and Liu, H. E. (2007) Smallmolecule c-Myc inhibitor, 10058-F4, inhibits proliferation, downregulates human
128
telomerase reverse transcriptase and enhances chemosensitivity in human
hepatocellular carcinoma cells, Anticancer Drugs 18, 161-170.
248.
Slack, A., Chen, Z., Tonelli, R., Pule, M., Hunt, L., Pession, A., and Shohet, J. M.
(2005) The p53 regulatory gene MDM2 is a direct transcriptional target of MYCN
in neuroblastoma, Proceedings of the National Academy ofSciences of the United
States ofAmerica 102, 731-736.
249.
Kee, B. L. (2009) E and ID proteins branch out, Nat Rev Immunol 9, 175-184.
250.
Montano, X., and Djamgoz, M. B. (2004) Epidermal growth factor, neurotrophins
and the metastatic cascade in prostate cancer, FEBS letters 571,1-8.
251.
Sikder, H. A., Devlin, M. K., Dunlap, S., Ryu, B., and Alani, R. M. (2003) Id
proteins in cell growth and tumorigenesis, Cancer Cell 3, 525-530.
252.
http://www.ibibiosolutions.com/projects/p53/IMAGE/pathway.gif. (2013).
253.
Albertsen, P. C, Hanley, J. A., Barrows, G. H., Penson, D. F., Kowalczyk, P. D.,
Sanders, M. M., and Fine, J. (2005) Prostate cancer and the Will Rogers
phenomenon, Journal of the National Cancer Institute 97, 1248-1253.

mechanism of action of ID4 in prostate cancer

Transcription

Similar documents

nardalert S3 - Narda Safety Test Solutions

MR Ga68-PSMA prostate imaging brochure ART.indd

Book Flyer/Sell Sheet - Conquer Prostate Cancer Now

DynaCAD Prostate Brochure

as a PDF

prostate - New Chapter

Press Release

June 2014 - Lafon Nursing Facility

The Messenger for September 6, 2015

Livestock Matters - Summer 2011