Thermal adaptation of the crucian carp (Carassius carassius

Am J Physiol Regul Integr Comp Physiol 301: R255–R265, 2011.
First published April 20, 2011; doi:10.1152/ajpregu.00067.2011.
Thermal adaptation of the crucian carp (Carassius carassius) cardiac delayed
rectifier current, IKs, by homomeric assembly of Kv7.1 subunits without MinK
Minna Hassinen, Salla Laulaja, Vesa Paajanen, Jaakko Haverinen, and Matti Vornanen
University of Eastern Finland, Department of Biology, Joensuu, Finland
Submitted 4 February 2011; accepted in final form 14 April 2011
thermal adaptation; temperature acclimation; physiological plasticity;
fish heart
CONSIDERING THE HIGH SENSITIVITY of endothermic hearts to
arrhythmias in hypothermia and fever, it is surprising that the
hearts of ectothermic vertebrates function properly over a wide
range of temperatures. For example, thermal tolerance of
temperate fish species range from 0°C to 36°C with undisturbed cardiac function, and involving heart rates from a few
beats over 140 beats per min and cardiac action potentials (AP)
varying from a few hundred ms to almost 3 s in duration (2, 11,
23, 34). The robustness of cardiac function over extensive
temperature ranges requires that ion channel function provides
adequate membrane excitability in different thermal conditions, but still ensures electrical stability under acute and
chronic temperature changes.
Address for reprint requests and other correspondence: M. Vornanen, Univ.
of Eastern Finland, Dept. of Biology, P.O. box 111, 80101 Joensuu, Finland
(e-mail: Matti.Vornanen@uef.fi).
http://www.ajpregu.org
In fish hearts there are specific K⫹ channels or channel
isoforms which modify the shape of cardiac AP under chronic
and acute temperature changes (8 –10, 12, 23, 38). However,
the role of the slow delayed rectifier K⫹ current in thermal
responses of the fish heart has not been examined. In endotherms, the slowly activating delayed rectifier K⫹ current (IKs)
plays an important role in controlling repolarizing phase of
the cardiac AP. IKs functions as repolarization reserve that
prevents excessive prolongation of cardiac AP when betaadrenergic tone is high or when other K⫹ channels fail (16).
IKs is also important in limiting the duration of cardiac AP
at high heart rates due to its ability to accumulate at high
frequencies (24).
In mammals the cardiac IKs is carried by channels consisting
of the Kv7.1 (encoded by KCNQ1 gene) pore-forming alpha
subunits and the MinK (encoded by KCNE1 gene) regulatory
subunits (25). The MinK (also called IsK) is a small protein of
about 130 amino acids with a single membrane spanning
sequence and short C- and N-terminal tails. The Kv7.1 comprises 6 transmembrane sequences and as a homotetramer
produces functional K⫹ ion channels. Though Kv7.1 alone can
generate a K⫹ current, association with the MinK is required to
recapitulate the native mammalian cardiac IKs. When Kv7.1 is
coexpressed with the ancillary MinK subunit, the behavior of
the channel dramatically changes. MinK affects drug binding
which is expressed as higher sensitivity of the Kv7.1/MinK
channels to chromanol compared with the Kv7.1 channels (4).
MinK is also necessary for beta-adrenergic enhancement of the
IKs and frequency-dependent modulation of the IKs (14, 17).
Finally, the Kv7.1/MinK channels and the native cardiac IKs
channels display extremely slow activation kinetics and
strong temperature dependence (31, 32). Indeed, IKs would
be nonfunctional at low body temperatures of many ectothermic animals if endowed with kinetic properties of the
mammalian IKs.
Considering the importance of IKs in AP repolarization
under various physiologically situations, we hypothesized that
IKs would be valuable in stabilizing the electrical activity of the
ectothermic hearts. To this end, we examined (1) the presence,
(2) electrophysiological properties and (3) molecular background of the IKs current in cardiomyocytes of the crucian carp
(Carassius carassius L.), a teleost fish species with a wide
thermal tolerance range (13). The properties of atrial IKs were
compared with the currents produced by the Kv7.1 channels
alone and the coassembly of Kv7.1 and MinK channels of the
crucian carp in Chinese hamster ovary (CHO) cells. It is shown
that the atrial IKs of the crucian carp heart is similar to the
current generated by the homotetrameric Kv7.1 channels in
regard to activation kinetics, voltage-dependence of activation
and sensitivity to chromanol. These findings suggest that unlike endothermic hearts, the IKs of the crucian carp heart is
0363-6119/11 Copyright © 2011 the American Physiological Society
R255
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
Hassinen M, Laulaja S, Paajanen V, Haverinen J, Vornanen
M. Thermal adaptation of the crucian carp (Carassius carassius)
cardiac delayed rectifier current, IKs, by homomeric assembly of
Kv7.1 subunits without MinK. Am J Physiol Regul Integr Comp
Physiol 301: R255–R265, 2011. First published April 20, 2011;
doi:10.1152/ajpregu.00067.2011.—Ectothermic vertebrates experience acute and chronic temperature changes which affect cardiac
excitability and may threaten electrical stability of the heart. Nevertheless, ectothermic hearts function over wide range of temperatures
without cardiac arrhythmias, probably due to special molecular adaptations. We examine function and molecular basis of the slow delayed
rectifier K⫹ current (IKs) in cardiac myocytes of a eurythermic fish
(Carassius carassius L.). IKs is an important repolarizing current that
prevents excessive prolongation of cardiac action potential, but it is
extremely slowly activating when expressed in typical molecular
composition of the endothermic animals. Comparison of the IKs of the
crucian carp atrial myocytes with the currents produced by homomeric Kv7.1 and heteromeric Kv7.1/MinK channels in Chinese hamster ovary cells indicates that activation kinetics and pharmacological
properties of the IKs are similar to those of the homomeric Kv7.1
channels. Consistently with electrophysiological properties and homomeric Kv7.1 channel composition, atrial transcript expression of
the MinK subunit is only 1.6 –1.9% of the expression level of the
Kv7.1 subunit. Since activation kinetics of the homomeric Kv7.1
channels is much faster than activation of the heteromeric Kv7.1/
MinK channels, the homomeric Kv7.1 composition of the crucian carp
cardiac IKs is thermally adaptive: the slow delayed rectifier channels
can open despite low body temperatures and curtail the duration of
cardiac action potential in ectothermic crucian carp. We suggest that
the homomeric Kv7.1 channel assembly is an evolutionary thermal
adaptation of ectothermic hearts and the heteromeric Kv7.1/MinK
channels evolved later to adapt IKs to high body temperature of
endotherms.
R256
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
Table 1. Primer pairs used in cloning
Target gene
ccKCNE1
ccKCNE1
ccKCNQ1
ccKCNQ1
ccKCNQ1
ccKCNQ1
ccKCNE1
ccKCNE1
Primers for 2nd PCR
F: GGCCACGCGTCGACTAGTACGGGXXGGGXXGGGXXG
R: GACCTTTAGAGCCAAATGC
F: CACCCACRTCCAGGGCCGMGTCTACAA
R: CTGCCAGATACACGAAGCAG
F: GCTCCTGGGCTCYGTRGTCTTCATYCA
R: GGMKGAGTCRGGRTTCTCVGCRGCATA
F: GCTCCTGGGCTCYGTRGTCTTCATYCA
R: CATRAGGTTSAGGTGGCCCTGSGAGTA
F: GATATGGAAACCGAGCTGGA
R: GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT
F: ATGAGCTCTCCACCTCACA
R: TCTGTGGTTCAGTGCTGCTT
F: ATGCTGGAGCAGAACTCCA
R: ATATACTGATGRTAGRGAT
F: ATGCTGGAGCAGAACTCCA
R: GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT
F: ATGCTGGAGCAGAACTCCA
R: TCAAACTCTGTCACGGGCT
F: GGCCACGCGTCGACTAGTAC
R: CTGACCACAGACGTACTGCAT
F: CACCCACRTCCAGGGCCGMGTCTACAA
R: CTGCCAGATACACGAAGCAG
F: GCTCCTGGGCTCYGTRGTCTTCATYCA
R: CTGCVGCYGGGATCTGCCGGTTGAAGT
F: TCCTAGGCTCCAGTTTTGCTC
R: CATRAGGTTSAGGTGGCCCTGSGAGTA
F: CAGCAAGCACGTAAACCGTA
R: GGCCACGCGTCGACTAGTAC
F: ATGAGCTCTCCACCTCACA
R: ACAATAGAGGCCACCACCAC
F: ATGCTGGAGCAGAACTCCA
R: TTCTTKGAGCGGATGWAGC
F: TACACCACCACATCATCCACCT
R: GGCCACGCGTCGACTAGTAC
F: ATGCTGGAGCAGAACTCCA
R: TCAAACTCTGTCACGGGCT
Amplified Region
⫺191–442
205–760
657–1024
967–1605
1534–⫹803
1–1956
1–239
96–⫹33
1–396
The primers are in 5=-3= direction. The upper sequence shows the forward and the lower sequence of the reverse primer.
mainly composed of homotetrameric Kv7.1 channels that produce fast activating currents at low body temperatures of the
ectothermic crucian carp.
MATERIALS AND METHODS
Animals. Crucian carp (Carassius carassius L.) caught in summer
and winter were directly placed at acclimation temperatures of 18°C
(warm-acclimation, WA) and 4°C (cold-acclimation, CA), respectively. Four weeks were allowed for thermal acclimation under a 15 h:
9 h light:dark photoperiod in the lab before experiments. WA crucian
carp were fed three times a week with aquarium fish food (Tetra,
Melle, Germany), while no food was given to CA crucian carp
since winter-acclimatized crucian carp do not forage. The body
masses of WA and CA fish were 58 ⫾ 12 g (n ⫽ 22) and 46 ⫾ 8
g (n ⫽ 25) (P ⬎ 0.05), respectively. All experiments were
conducted with the consent of the national committee for animal
experimentation (permission STH252A).
Cloning and sequencing of crucian carp KCNQ1 and KCNE1.
Total RNA of the heart was used to clone KCNQ1 and KCNE1 genes.
RNA was extracted with TriZOL Reagent (Invitrogen, Carlsbad, CA)
from atrium and ventricle powdered under liquid nitrogen. RNA
integrity and quantity were assessed by agarose gel electrophoresis
and spectrophotometry (NanoDrop ND-1000, Wilmington, DE,
USA), respectively. RNA was treated with DNase (Promega, Madison, WI) and reverse-transcribed using M-MuLV Reverse Transcriptase RNase H- (Finnzymes, Espoo, Finland) and random primers
(Promega). The resulting cDNA was PCR amplified using degenerative primers for KCNQ1 or KCNE1 (Table 1), DynaZyme EXT DNA-Polymerase (Finnzymes) and PCR conditions described earlier (9). PCR products were run on a 0.8% agarose gel and
if no products were observed, 0.5 ␮l of the PCR product was
reamplified with same or nested primers as described earlier (9).
5=-RACE and 3=-RACE kits (Invitrogen) were used according to
manufacturer’s instructions to clone the sequences for 5=- and 3=untranslated region (UTR) of the genes, respectively. Finally, the
whole open reading frames (ORF) for ccKCNQ1 and ccKCNE1 were
cloned by PCR using the following PCR protocol: initial denaturation
at 96°C for 4 min, 35 cycles at 94°C for 30 s, 55–57°C (depending on
the primers) for 30 s and 72°C for 1.0 (for KCNE1) or 2.0 min (for
KCNQ1) and final extension at 72°C for 5 min. For cloning, the PCR
products were gel purified by Qiaex II Gel Extraction Kit (Qiagen,
Valencia, CA), ligated to the pGEM-T Easy cloning vector (Promega)
and transformed to DH5␣ cells. From the clones obtained, at least one
was sequenced using ABI Prism 310 Genetic Analyzer (Applied
Biosystems, Foster City, CA). Finally, the sequences were confirmed
by sequencing the PCR-amplified ORFs straight from the PCRproduct.
Partial sequences were assembled and analyzed with AutoAssembler
software. Transeq software was used to convert cDNA-sequences into
amino acid sequences, and the predicted phosphorylation and glycosylation sites were sought using Prosite. Similarities of the crucian
carp KCNQ1 and KCNE1 sequences with orthologous genes of other
species were determined using Stretcher and ClustalW softwares. For
the phylogenetic analysis, protein sequences of the KCNQ and KCNE
family members were searched from Ensemble-database. Fish sequences of the KCNQ-family (KCNQ1–5) were aligned with the
putative crucian carp KCNQ1 using ClustalX. Because only a few
KCNE sequences were available for fish, the mouse orthologues
(KCNE1l and KCNE1– 4) were included in the alignment. The phylogenetic trees of KCNQ and KCNE gene families were rooted using
Caenorhabditis elegans KCNQ-like gene KQT-1 and KCNE-like
gene MPS-1, respectively. ClustalX and TreeView programs were
used to construct and draw the neighbor-joining (NJ) tree. In the NJ
analysis, Phylip distance measure and 1000 bootstrap replicates were
used.
Transcript abundance. Five separate samples were prepared for
extraction of the total RNA. Depending on the size of fish each sample
represents a pooled tissue of 3–10 atria or ventricles. RNA was treated
with DNase to avoid genomic DNA contamination. First strand cDNA
synthesis was performed with M-MuLV RT H⫹ (Finnzymes) with a
control reaction (RT-control) containing all other components except
RT-enzyme. Quantitative RT-PCR was performed using Chromo4
Continuous Fluorescence Detector (MJ Research, Waltham, MA) and
primers represented in Table 2 under previously described PCR
Table 2. Primer pairs (in 5=-3= direction) used for
quantitative RT–PCR
Target Gene
ccKCNQ1
ccKCNE1
ccDnaJA2
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
Primer Sequences
F: GCTGGATGCCGGAGTAAATA
R: ACAATAGAGGCCACCACCAC
F: GATATCCACGCTCTGCTGGT
R: ATGCACAGGTGGATGATGTG
F: AGGACTTGTACGACCGTTATGG
R: CGCCAAAGATATGGGAAAAGAT
www.ajpregu.org
Amplicon
Size (bp)
101
102
93
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
ccKCNE1
Primers for 1st PCR
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
currents (I/Imax) were plotted as a function of membrane voltage and
fit to the Boltzmann equation: y ⫽ 1/[1⫹exp (V ⫺ V0.5)/S], where V
is membrane potential, V0.5 is the midpoint and S is the slope of the
curve.
Because KCNQ1 and IKs currents often show complex (sigmoid)
activation kinetics, time to half maximal current was used to describe
time course of activation and was plotted against the voltage of
depolarizing pulses. Temperature dependence of IKs kinetics was
expressed as a Q10-value and was obtained from the equation where
T1 and T2 are the temperatures that produce the kinetic rates of R1 and
R2, respectively: Q10 ⫽ 共R2 ⁄ R1兲关10 ⁄ 共T2⫺T1兲兴.
Chromanol 293B (Tocris) block of the IKs of atrial myocytes and
the currents generated by homomeric KCNQ1 and heteromeric
KCNQ1/KCNE1 channels were examined at 1, 10 and 100 ␮M
concentrations. Chromanol was dissolved in ethanol as a 20 mM
stock solution and diluted in the external saline solution to give the
desired concentrations. Currents were elicited by depolarizing
pulses from ⫺60 mV to ⫹70 mV for 4 s and the cells were exposed
to each concentration until steady-state block was achieved.
For AP measurements sinoatrial preparations were gently fixed
with insect pins on Sylgard-coated bottom of the 10-ml recording
chamber filled with oxygenated (100% O2) physiological saline
(36). The preparation was allowed to equilibrate for about 1 h to
reach a stable beating rate before APs were recorded with sharp
microelectrodes. Pipettes had a resistance of about 22 M⍀s when
filled with 3 M KCl. Analog signals were amplified by a highimpedance amplifier (KS-700, WPI, UK) and digitized (Digidata1200 AD/DA board, Axon) with sampling rate of 2 kHz before
storing on the computer with the aid of Axotape (Axon) acquisition
software. AP characteristics were analyzed with Clampfit software
(Axon).
RESULTS
Sequencing and ccKCNQ1 (Kv7.1) and ccKCNE1 (MinK).
For heterologous expression of the IKs, putative molecular components of the channel complex were cloned and sequenced from
crucian carp. The cDNA sequences of the crucian carp KCNQ1
and KCNE1 genes are denoted as ccKCNQ1 (GenBank No
GU073448) (cc for Carassius carassius) and ccKCNE1 (GenBank no. GU073449), respectively. The ccKCNQ1 is composed of 191 bp 5=-UTR sequence, an ORF of 1,956 bp coding
for 651 amino acid residues and 3=-UTR of 803 bp (Fig. 1A).
The deduced amino acid sequence of the ccKv7.1 shares 88.1%
and 70% similarity with zebrafish and mammalian Kv7.1,
respectively (Fig. 1D). In the phylogenetic comparison, the
ccKCNQ1 gene grouped with KCNQ1 genes of other fish
species, indicating that it is orthologous to other vertebrate
KCNQ1s (Fig. 2A).
Sequences of P-loop and S6-transmembrane domain are
important for K⫹ ion selectivity, binding of the MinK beta
subunit to the Kv7.1 and affinity of the channel complex to
its blocker, chromanol. Both the P loop and the S6 domain
are identical in the ccKv7.1 and the mammalian Kv7.1. Thus,
ccKv7.1 includes all those amino acid residues that are
Fig. 1. Amino acid alignments (A and B), transmembrane topologies (C), and sequence similarities of vertebrate Kv7.1 and MinK channels (D). A and B: identical
and similar amino acid residues are shown with black and gray shading, respectively. Species included and their GenBank accession numbers are as follows:
clawed frog, xt (NM_001122875 for Kv7.1 and ENSXETT0000000787 for MinK); Mus musculus, mm (NM_008434 and NM_008424); Homo sapiens, hs
(NM_000218 and NM_001127670); Squalus acanthias, sa (AJ223714 for Kv7.1); and Danio rerio, dr (NM_001123242 for Kv7.1). Transmembrane domains
S1–S6 and conserved pore loop (P) of the sequence are indicated by horizontal lines. Consensus sequences for glycosylation and PKC mediated phosphorylation
and amino acid residues important for chromanol binding are indicated with •, ’ and *, respectively. C: membrane topology and functional sites of the Kv7.1:
membrane spanning ␣-helices (S1–S6), pore loop (P), putative glycosylation sites (•) and PKC-dependent phosphorylation sites (’) are indicated. D: amino acid
identities and similarities (%) are given at right and left side of the oblique line, respectively.
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
conditions (9). No-template control and RT-control reactions were run
for quality assessment in every run. The specificity of the PCR
reaction was monitored by melting curve analysis. DnaJ homolog
subfamily A member 2 (DnaJA2) was used as an endogenous reference gene, and its expression level was used to normalize mRNA
levels of the ion channel genes. In thermal acclimation, fish DnaJA2
is more stably expressed than many conventionally used reference
genes making it a suitable reference gene (37).
Heterologous expression of KCNQ1 and KCNE1. Crucian carp
KCNQ1 and KCNE1 were expressed in Chinese hamster ovary
(CHO) cells (18). Open reading frames (ORF) for KCNQ1 and
KCNE1 were digested from pGEM-T Easy plasmids and ligated to
cohesively digested pcDNA3.1(zeo⫹). CHO cells were cultured in
Ham’s Nutrient Mixture F-12 (EuroClone) with 4% fetal bovine
serum at 37°C. CHO cells, cultured on glass cover slips, were
transfected for 10 –16 h in 3.5 ml dishes containing 15 ␮l Effectene
Transfection Reagent (Qiagen), 0.3 ␮g pEGFP-N1 and 0.9 ␮g
KCNQ1 or KCNE1 in pcDNA3.1(zeo⫹). The pEGFP-N1 plasmid
produces green fluorescent protein and was used to visualize transfection of the cells. For cotransfection of KCNQ1 and KCNE1, 0.3 ␮g
of each plasmid was used. Cells were used in patch clamp experiments
48 –72 h after the transfection.
Electrophysiology. Atrial myocytes were used for electrophysiological experiments because IKs is much larger in atrial than ventricular myocytes of the crucian carp, and therefore easier to record at low
temperatures. Also the interfering inward rectifier current, IK1, is
smaller in atrial cardiomyocytes (11). Atrial myocytes of the crucian
carp heart were isolated with enzymatic digestion and were used
within 8 h from isolation (35). Whole-cell voltage clamp experiments
were performed using an Axopatch 1-D (Axon Instruments, Union
City, CA) or an EPC-9 (HEKA Instruments, Lambrecht/Pfalz, Germany) amplifier (8). The experiments with CA myocytes were conducted at 4°C and 11°C and those with WA myocytes at 11°C and
18°C. Hence results were obtained both at the physiological body
temperatures of the animals and at the common experimental temperature of 11°C, the latter enabling direct comparison of results between
the acclimation groups. Temperature was adjusted to the desired value
by Peltier devices (TC-10 or HCC-100A, Dagan, Minneapolis, USA)
and was continuously monitored by thermistors positioned close to the
myocyte. Patch pipettes were pulled from borosilicate glass (Garner,
Claremont, Calif., USA) using a vertical two-stage puller (Narishige,
PC-10). In each figure the results are at least from 3 different fish
individuals, while n indicates the number of myocytes.
During the experiments myocytes were superfused with an external
saline solution at the rate of 1.5–2.0 ml min⫺1. The solution contained
(mmol l⫺1): 150 NaCl, 5.4 KCl, 1.8 CaCl2, 1.2 MgCl2, 10 glucose and
10 HEPES (pH adjusted to 7.7 with NaOH). When working on cardiac
myocytes, tetrodotoxin (0.5 ␮M, Tocris Cookson, UK), nifedipine (10
␮M, Sigma), glibenclamide (10 ␮M, Sigma) and E-4031 (10 ␮M,
Tocris) were added to the solution to block Na⫹, Ca2⫹, ATP-sensitive
K⫹ current and rapid component of the delayed rectifier (IKr), respectively. The pipette solution contained (mmol l-1): 140 KCl, 1 MgCl2,
5 EGTA, 4 MgATP and 10 HEPES (pH adjusted to 7.2 with KOH).
Voltage dependence of steady-state (SS) activation was obtained
by a voltage protocol, where membrane potential was clamped from
the holding potential of ⫺50 mV to test potentials between ⫺40 and
⫹60 mV in 10 mV increments to activate the channels. Normalized
R257
R258
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
regarded important for chromanol binding and interaction
with the MinK (Fig. 1A). The P-loop of the ccKv7.1 has the
signal sequence (TxGYG) of the voltage-dependent K⫹
channels. Moreover, the ccKv7.1 contains 8 consensus sites
for phosphorylation by the protein kinase C (PKC).
A partial cDNA of the ccKCNE1 forms an ORF of 396 bp
coding for 131 amino acid residues and a 12 bp 3=-UTR
sequence (Fig. 1B). The 5=-UTR sequence of the ccKCNE1
remained undetermined. The primary amino acid sequence
of the ccMinK shows high similarity within the membrane
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
www.ajpregu.org
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
R259
spanning domain of other species’ MinK. However, the Nand C-termini were highly variable between fish and mammalian genes, leading to low (about 40%) global similarity
between crucian carp and mammalian MinK (Fig. 1D). The
similarity between crucian carp and zebrafish MinK was
much higher (82.4%), indicating that the cloned crucian
carp gene is orthologous to the zebrafish MinK. This was
further strengthened by the phylogenetic analysis of vertebrate KCNE gene family, which clearly showed that ccKCNE1 groups with KCNE1 genes rather than with other
members of the KCNE family (Fig. 2B). The deduced amino
acid sequence of ccMinK contained three PKC phosphorylation sites at positions 79, 118 and 126, one of which (S79)
was similar with the phosphorylation site of the mammalian
MinK (Fig. 1B and C).
Transcript expression of ccKCNQ1 and ccKCNE1. Transcripts of ccKCNQ1 and ccKCNE1 were expressed in both
atrium and ventricle of the crucian carp heart (Fig. 3). However, the ccKCNE1 transcript abundance was only 1.9 ⫾ 0.1
and 1.6 ⫾ 0.3% of the ccKCNQ1 expression in the CA and
WA carp atrium, respectively. In the ventricle, the abundance
of ccKCNE1 compared with the ccKCNQ1 expression was a
little higher, 5.0 ⫾ 0.5 and 3.1 ⫾ 0.4% in CA and WA carp,
respectively. The higher relative expression of the ccKCNE1 in
ventricular tissue is due to lower ccKCNQ1 level in the
ventricle (P ⬍ 0.05): expression in the atrium was 2.3 ⫾ 0.3
and 2.6 ⫾ 0.1 fold as high as in the ventricle of CA and WA
crucian carp, respectively. There were no differences (P ⬎
0.05) in the expression levels of ccKCNE1 and ccKCNQ1
between the acclimation groups.
IKs of the crucian carp atrial myocytes. The maximum
density of IKs was 6.98 ⫾ 0.68 and 1.77 ⫾ 0.23 pA/pF (P ⬍
0.05) in WA and CA myocytes, respectively, when measured
at the acclimation temperatures of the fish (18°C and 4°C)
(Fig. 4C). At 11°C, the current density did not differ between
acclimation groups (4.80 ⫾ 0.64 and 4.37 ⫾ 0.39 pA/pF for
CA and WA fish, respectively). Noticeably, current density
increased between 4°C and 11°C with Q10 of 4.15 and between
11°C and 18°C with a value of 1.96. The voltage dependence
of activation was also similar in both acclimation groups,
and was characterized by a sigmoidal shape with halfactivation voltages of 6.61 ⫾ 3.62 and 4.78 ⫾ 2.15 mV for
WA and CA fish, respectively (P ⬎ 0.05) (Fig. 4B). Collectively, these findings indicate that thermal acclimation
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
Fig. 2. Phylogenetic sequence analysis of putative KCNQ1 (A) and KCNE1 (B) genes. Neighbor-joining trees were rooted by the corresponding genes of the
nematode Caenorhabditis elegans; ce. Bootstrap values for 1,000 replicates are indicated on the relevant nodes. The following species were included: Carassius
carassius, cc; Danio rerio, dr; Gasterosteus aculeatus, ga; Oryzias latipes, ol; Squalus acanthias, sa; Tetraodon nigroviridis, tn; Takifugu rubripes, tr and Mus
musculus, mm.
R260
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
does not change current density or voltage-dependence of
activation of the IKs.
Time course of IKs activation was voltage- and temperaturedependent (Fig. 4D). Considering the relatively low experimental temperatures of 4°C and 18°C, the time course of
activation was fast for the IKs current. At the plateau voltage of
cardiac AP (⫺10 to ⫹10 mV), the time to half-activation of the
current was 2.80 ⫾ 0.29 s and 1.34 ⫾ 0.11 s at 4°C (CA) and
18°C (WA), respectively. These values are similar as measured
for the human IKs at 37°C (41). Thus, the IKs of crucian carp
atrial myocytes is characterized by fast activation kinetics
compared with mammalian IKs and current generated by
ccKv7.1/ccMinK channels (see Comparison of cloned channels
and atrial IKs).
Fig. 4. Characterization of IKs in atrial myocytes of thermally acclimated crucian carp. A: voltage protocol (left) and representative current tracings of IKs
activation in CA and WA atrial myocytes. Tail currents are shown on extended time scale (oblique arrows indicate the hook). B: voltage dependence of IKs
activation at 4°C and 18°C for CA and WA fish, respectively. C: density of IKs at ⫹60 mV at the acclimation temperature of the fish and at 11°C. D: time course
of IKs activation as a function of membrane potential at the acclimation temperature of the fish. Means were compared using Student’s t-test for unpaired data
or after logarithm conversion of the data using nonparametric Mann-Whitney U-test. Significant differences (*P ⬍ 0.05) between WA and CA fish (B and D)
or between the values at 11°C and acclimation temperatures (4°C or 18°C) (C). The results are means ⫾ SE of 5–12 cells.
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
Fig. 3. Expression of ccKCNQ1 and ccKCNE1 transcripts relative to the
DnaJA2 mRNA (means ⫾ SE; n ⫽ 5) in atrial and ventricular tissue of cold
acclimation (CA) and warm acclimated (WA) crucian carp. Statistically
significant difference (*P ⬍ 0.05) between atrial and ventricular preparations
by Student’s t-test for paired data.
Tail currents of the crucian carp atrial IKs displayed an initial
transient increase before the slow deactivation, producing a
“hooked” current tail, in particular following depolarization to
strongly positive voltages (Fig. 4A). The hook is attributed to
channel gating where recovery from inactivation occurs faster
than deactivation (31). Hence, the transient increase of the tail
current suggests that the current partly inactivates during depolarization and causes subsequently a small and rapid recovery from inactivation. Partial inactivation of the Kv7.1 current
is typical to the homotetrameric Kv7.1 channels, but not the
currents produced by heteromeric Kv7.1/MinK channels. The
hooked tail current in atrial myocytes of both WA and CA
crucian carp suggests therefore that channels responsible for
the atrial IKs are mainly formed by the homotetrameric ccKv7.1
channels without the ancillary ccMinK subunit.
Comparison of cloned channels and atrial IKs. To compare
whether the native IKs resembles more the pure ccKv7.1 currents than currents generated by coexpression of ccKv7.1 and
ccMinK subunits, ccKv7.1 was expressed separately and concurrently with the ccMinK in CHO cells (Fig. 5). Consistent
with the previous findings from other vertebrate species,
ccKv7.1 currents activated much faster (t0.5 ⫽ 0.14 ⫾ 0.01 s at
⫹70 mV) than currents generated by coexpression of the
ccKv7.1 and the ccMinK, which were extremely slow to
activate (t0.5 ⫽ 20.36 ⫾ 4.32 s at ⫹70 mV) (P ⬍ 0.05)
(compare Fig. 4A to Fig. 5A). The homomeric ccKv7.1 current
differs from the atrial IKs in that there is prominent inactivation
of the current during the depolarizing pulses, in particular, at
strongly positive voltages (Fig. 5A).
Although the real SS-activation of the ccKv7.1/ccMinK
currents couldn’t be determined due to very slow activation of
the current, it is evident that ccMinK has a drastic effect of
voltage-dependence of SS-activation. The presence of ccMinK
in the channel complex shifted SS-activation curve to positive
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
R261
voltages (V0.5 ⫽ 25.15 ⫾ 5.91 mV) compared with homomeric
ccKv7.1 channels (V0.5 ⫽ ⫺9.97 ⫾ 6.25) (P ⬍ 0.01) (Fig. 5B).
These findings indicate that activation kinetics and voltagedependence of the pure ccKv7.1 currents are similar, although
not identical, to the characteristics of the native crucian carp
IKs, and that the currents generated by coassembly of ccKv7.1
and ccMinK are far too slow in activation and too positive in
voltage-dependence of SS-activation to produce IKs of the
crucian carp atrial myocytes.
The MinK subunit is known to increase the binding of
chromanol to the Kv7.1 channels, thereby decreasing the drug
concentration needed to inhibit the IKs. The ccKv7.1/ccMinK
channels were about 10 times more sensitive to chromanol than
the pure ccKv7.1 channels with IC50 values of 23.24 ⫾ 4.99
and 106.07 ⫾ 39.62 ␮M, respectively (P ⬍ 0.01) (Fig. 6).
Chromanol sensitivity of the native IKs (at 18°C) was similar to
the homotetrameric ccKv7.1 channels with an IC50 value of
233.25 ⫾ 55.43 ␮M. These findings strongly suggest that the
atrial IKs of the crucian carp heart is mainly carried by the
homotetrameric ccKv7.1 subunits.
Effects of forskolin on the IKs. Density of IKs in the mammalian heart is upregulated by PKA-dependent phosphorylation of the Kv7.1 subunit. Furthermore, the response is critically dependent on the presence of the MinK, although the
accessory subunit itself is not phosphorylated. Activation of
the PKA pathway with 10 ␮M forskolin did not increase IKs of
the crucian carp atrial myocytes (Fig. 7). Similar results were
obtained when using 1 ␮M isoprenaline (data not shown).
Thus, IKs of the crucian carp heart is not increased by activation of the PKA.
Frequency response of the IKs. One of the characteristics of
the cardiac IKs is its accumulation at high heart rates due to
incomplete deactivation, while the pure Kv7.1 current does not
build up. Experiments on the cloned crucian carp channels in
CHO cells are consistent with this: current density of the pure
ccKv7.1 current remains stable at pacing frequencies of 40, 50
and 60 times per min, while the ccKv7.1/ccMinK channels
show prominent increase in current density with higher frequencies (Fig. 8). The IKs of crucian carp atrial myocytes
shows a very weak frequency response, fairly similar (P ⬎
0.05) to that of the homomeric ccKv7.1 channels.
Significance of IKS in the regulation of AP duration. Contribution of IKs to AP duration of crucian carp atrial myocytes
was tested in intact atrial preparations of WA fish (Fig. 9).
100 ␮M chromanol, which blocks about 30% of the IKs,
caused 12% increase in duration of AP (APD50) from 209 ⫾
24 ms to 233 ⫾ 26 ms (P ⬍ 0.05).
DISCUSSION
Fig. 6. Chromanol sensitivity of the native IKs of WA crucian carp and currents
produced by ccKv7.1 and ccKv7.1/ccMinK channels in CHO cells. After
log-transformation of the data, one-way ANOVA with least significant difference post hoc test was used for comparisons of the means. The current
produced by ccKv7.1 channels differed (*P ⬍ 0.05) from the currents of
ccKv7.1 and IKs. Experimental temperature was 18°C. The results are expressed as means ⫾ SE from 6 –12 cells.
This is the first report of IKs and its molecular background in
the heart of an ectothermic vertebrate. It is shown that genes of
both the alpha subunit (ccKv7.1) and the ancillary beta subunit
(ccMinK) of the slow delayed rectifier channel are expressed in
the crucian carp heart. However, both transcript expression of
the subunits and electrophysiological properties of the atrial IKs
suggest that the crucian carp cardiac IKs is mainly formed by
the homomeric ccKv7.1 channels instead of the heteromeric
ccKv7.1/ccMinK complex. This molecular arrangement produces kinetically fast activating IKs which is necessary for the
contribution of IKs to AP repolarization at low body temperatures of ectothermic crucian carp. On the other hand, the
homomeric channel composition does not allow beta-adrenergic stimulation or frequency dependent modulation of the IKs
(14, 17). The absence of these responses is, however, physio-
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
Fig. 5. Comparison of currents produced by ccKv7.1 and ccKv7.1/ccMinK channels in Chinese hamster ovary cells (CHO). Voltage dependence of activation
for currents generated by ccKv7.1/ccMinK and ccKv7.1 channels (A). Insets show representative current recordings for depolarizing pulses from the holding
potential of ⫺80 mV. B: comparison of normalized currents between ccKv7.1/ccMinK, ccKv7.1 channels and atrial IKs of the WA crucian carp. C: comparison
of activation kinetics of currents produced by ccKv7.1 channels, ccKv7.1/ccMinK channels, and atrial IKs. One-way ANOVA with Tukey’s honestly significant
difference post hoc test was used for comparisons of the means (*P ⬍ 0.05). Experiments were made at 18°C. The results are means ⫾ SE from 5–14 cells.
R262
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
Fig. 7. Forskolin, an activator of adenylate
cyclase, does not affect the IKs of the crucian
carp atrial myocytes (P ⬎ 0.05, Student’s
t-test for unpaired data). Experiments were
done on atrial myocytes of WA crucian carp
at 18°C. The results are expressed as means ⫾
SE of 7 myocytes.
sequence analysis suggests that the crucian carp IKs could be
regulated by PKC but not by PKA. Indeed, activation of the
PKA pathway with forskolin did not increase IKs of the crucian
carp atrial myocytes. Since PKA-mediated regulation of the IKs
requires coexpression of Kv7.1 with MinK (17), the IKs of the
crucian carp atrial myocytes would probably be insensitive to
PKA-stimulation even if the phosphorylation site existed in the
ccKv7.1.
Crucian carp IKs is mainly produced by the homomeric
ccKv7.1 channels. In mammals, the slow delayed rectifier is
formed by coassembly of four Kv7.1 and two MinK subunits
(5, 22, 40). According to this molecular arrangement the
transcript abundance of the ccKCNE1 should be about half that
of the ccKCNQ1. However, the transcript level of the ccKCNE1
was only 1.6 –1.9% of the ccKCNQ1 mRNAs. Therefore, no
more than 3.2–3.8% of the atrial IKs channels are expected to
be heteromeres of ccKv7.1 and ccMinK channels. Even if the
protein level were not directly proportional to gene transcripts,
the low transcript expression suggests that the quantity of the
ccMinK subunits is not sufficient to produce large numbers of
the heteromeric ccKv7.1/ccMinK channels, i.e., majority of the
functional delayed rectifiers in crucian carp atrial myocytes
does not have the ancillary ccMinK subunit. Indeed, the transcript expression of ccKCNE1 in the crucian carp atrium is
much less than e.g., in the human atria, where KCNE1 transcripts are about 50% and 100% of the KCNQ1 expression in
left and right atrium, respectively (19). However, a small
amount of ccKCNE1 expression may be needed for trafficking
of the ccKv7.1 to the membrane and a minor population of
ccKv7.1/ccMinK channels might explain the small deviations
in current characteristics between IKs and ccKv7.1.
In mammalian channels, the coassembly of MinK with
Kv7.1 changes electrophysiological properties of the IKs lead-
Fig. 8. Frequency response of the IKs produced by the
ccKv7.1 and ccKv7.1/ccMinK channels and the atrial
IKs of WA crucian carp at 18°C. One-way ANOVA
with Tukey’s HSD post hoc test was used for statistical comparisons. Currents produced by ccKv7.1/
ccMinK differed (P ⬍ 0.05) from those of ccKv7.1
and IKs after 13.5, 14.5, and 5 s (indicated by horizontal lines) at stimulation rates of 40, 50, and 60
beats per min (bpm), respectively. IKs did not differ
from the current produced by ccKv7.1 channels. The
results are means ⫾ SE from 5 to 10 cells.
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
logically relevant for this species considering the blunted
beta-adrenergic responsiveness of the crucian carp heart (36).
Sequence structures of ccKCNQ1 ccKCNE1. In mammals,
the cardiac IKs current is produced by the coassembly of the
pore-forming Kv7.1 channel and the accessory ␤-subunit,
MinK (1, 25). The primary amino acid sequence of the ccKv7.1
shows high similarity (about 70%) to its mammalian orthologues, whereas the sequences of the mammalian MinK and
the ccMinK differ considerably (similarity about 40%) from
each other. The low sequence similarity of fish and mammalian
MinK subunits is due to highly different N- and C-termini.
Mutations associated with the long QT syndrome in the C-terminus of the MinK often accelerate deactivation of the IKs,
diminish single channel conductance and reduce open probability of the Kv7.1/MinK channels (6, 27). Differences in the
C-termini of fish and mammalian MinK are probably not
only due to the evolutionary distance of the two vertebrate
classes, but may be indicative of species-specific differences
in function of the accessory subunit (although not necessarily with the IKs).
In mammals, IKs is regulated by serine-threonine (30, 33, 39,
42) and tyrosine kinases (21). The ccKv7.1 of the crucian carp
heart contains 8 putative PKC phosphorylation sites. Four of
them are conserved in both mammals and crucian carp (T217,
S361, S376, and S559), two are conserved among fish species
(S348 and S491) and two are specific for the ccKv7.1 (T50 and
S426). Interestingly, the ccKv7.1 does not have any consensus
sequence for PKA phosphorylation site. In the mammalian
Kv7.1, PKA-dependent phosphorylation of the S27 mediates
the activating effect of the sympathetic nervous system on IKs
(20). Moreover, the ccMinK contains three putative cytoplasmic phosphorylation sites at positions S79, S118 and S126, one
of which (S79) is conserved in the mammalian MinK. Thus,
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
ing to increased current amplitude, slower activation kinetics,
abolition of inactivation and shift of SS-activation to more
positive membrane potentials (31, 41). Furthermore, the presence of the MinK in the channel complex changes pharmacological properties of the IKs, which appears e.g., as increased
sensitivity to the blocking effect of chromanol (4, 32).
Comparison of the properties of the atrial IKs with the
currents produced by homomeric ccKv7.1 and heteromeric
ccKv7.1/ccMinK channels expressed in the CHO cells
strengthens the assumption that IKs of the crucian carp atrial
myocytes is mainly formed by the homomeric ccKv7.1 channels rather than by the heteromeric ccKv7.1/ccMinK coassembly. Fast activation kinetics and more negative position of the
SS-activation curve of the crucian carp atrial IKs current are
closer to those of the homomeric ccKv7.1 channels. The IKs of
the atrial myocytes was about ten times less sensitive to
chromanol block than the heteromeric Kv7.1/MinK channels
but similar to the sensitivity of the homomeric Kv7.1 channels.
Moreover, the tail current of the atrial IKs had a “hook”
indicating that the current inactivates. Taken together, activation kinetics, voltage-dependence of activation, inactivation of
the current and reduced sensitivity to chromanol block are
indicative that the ancillary ccMinK subunit is not involved in
the formation of crucian carp native IKs.
Frequency-dependence of the IKs. IKs has a special function
as repolarization reserve in situations where AP tends to
prolong either due to high beta-adrenergic tone or failure of
other repolarizing K⫹ currents (15). This property stems from
time- and frequency-dependence of the IKs: due to relatively
slow activation kinetics the current increases with increased
duration of depolarization, while the slow deactivation leaves
some of the delayed rectifier channels in open state at short
diastolic intervals and therefore immediately conductive when
the driving force is restored by the next depolarization (14, 24,
29). These characteristics of the IKs are dependent on the
heteromeric coassembly of the Kv7.1 and MinK subunits and
absent in the homomeric Kv7.1 channels.
In contrast to the heteromeric channels of the mammalian
heart, the homomeric ccKv7.1 channels of the crucian carp
atrial myocytes produce a flat frequency response of the IKs. In
this regard, it is important to note that the beta-adrenergic
signaling has practically no effect on heart rate in crucian carp
(36) (but compare (28)). In the absence of positive chrono-
tropic response to the activation of the beta-adrenergic cascade,
the weak frequency response of the IKs is completely appropriate
for cardiac function in this species. The absence of phosphorylation site for PKA in the ccKv7.1 and the consequent absence of
beta-adrenergic stimulation of the IKs is also meaningful considering that the beta-adrenergic stimulation is totally absent in the
sinoatrial tissue of crucian carp (36). Indeed, the parsimonious
molecular composition of the cardiac IKs channel is a relevant and
well adjusted channel construction that fulfills the requirements of
cardiac function in crucian carp.
Effects of temperature on IKs. Electrophysiological properties
of the crucian carp IKs are intimately associated with its homomeric ccKv7.1 composition and can be seen as adaptation to low
temperature. The homomeric ccKv7.1 assembly provides a simple
molecular solution for thermal compensation of ion channel function, since removal of the MinK subunit form the channel assembly makes the activation kinetics of the IKs much faster (41). The
homomeric Kv7.1 channels enable contribution of the IKs to
repolarization of the crucian carp cardiac AP, which would be
impossible for the Kv7.1/MinK channels of the endothermic
hearts.
It has been shown that the inward rectifier (IK1) and the fast
delayed rectifier (IKr) K⫹ current have an essential role in
thermal acclimation of cardiac AP duration in fish (9, 10, 38).
By analogy, it could be assumed that IKs is also involved in
regulation of AP duration under chronic temperature changes.
However, neither transcript expression of the channel subunits
nor electrophysiological characteristics of the cardiac IKs displayed any differences between CA and WA crucian carp.
Acute cooling decreases the density of IKs, but there is no
compensatory increase of IKs that would counteract the acute
temperature effect in CA fish. Therefore, the importance of the
IKs in AP regulation is associated with acute temperature
changes to accelerate/decelerate repolarization of cardiac AP
when temperature and heart rate rises/drops. It has been previously shown that activation kinetics of the Kv7.1/MinK
channels have stronger temperature dependence (Q10 2.5) than
that of the homomeric Kv7.1 channels (Q10 1.5) (32). The
weaker temperature dependence of the homomeric Kv7.1 channels is also adaptive, since it extends the thermal tolerance
range of the functional IKs to lower temperatures.
Limitations of the study. Although electrophysiological
properties of the IKs of the crucian carp myocytes are in several
respects similar to those of the homomeric ccKv7.1 channels,
the two currents are not completely identical. This could be due
to the presence of some heteromeric ccKv7.1/ccMinK channels
and/or assembly of the ccKv7.1 channels with some other
␤-subunit. Mammalian heart is known to express five KCNE
genes (KCNE1-KCNE5), which could produce heteromeres
with the KCNQ1 gene product (3). However, when coexpressed with KCNQ1, KCNE2 and KCNE3 produce currents
that have instantaneous activation, while association of either
KCNE4 or KCNE5 with KCNQ1 strongly suppresses density
of the IKs (3, 7, 19, 26). Furthermore, in a complex where both
KCNE1 and KCNE4 are coexpressed with KCNQ1, KCNE1
seems to exert dominant effect as far as the current is practically identical to that of KCNQ1/KCNE1 channels (3). Considering that the IKs of the crucian carp atrial myocytes is not
instantaneous and its density is high, it seems unlikely that IKs
would be significantly contributed by any of the known
KCNQ1/KCNE2-KCNE5 heteromeres. However, possible ef-
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
Fig. 9. Effect of chromanol (100 ␮M) on action potential (AP) duration in
intact atrium of WA crucian carp. Left: original recordings of atrial AP in
the absence and presence of chromanol. Right: Effects of chromanol on AP
duration at 50% repolarization level are shown. Values are expressed as
means ⫾ SE. Statistically significant difference between control and
chromanol treatment by Student’s t-test for paired data (*P ⬍ 0.05).
Number of examined hearts (n) was 5.
R263
R264
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
fects of different KCNE products on crucian carp IKs cannot be
completely excluded without characterizing all possible channel combinations of ccKCNQ1 with putative ccKCNE products in heterologous system and measuring expression levels of
different ccKCNE genes in the crucian carp heart.
Perspectives and Significance
ACKNOWLEDGMENTS
We thank Anita Kervinen and Riitta Pietarinen for excellent technical
assistance.
GRANTS
This work was financed by a research grants from the Academy of Finland
to M. Vornanen (projects 210400 and 127192). M. Hassinen was supported by
a personal grant from the Finnish Cultural Foundation.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
REFERENCES
1. Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, Romey G.
KvLQT1 and IsK (minK) proteins associate to form the I(Ks) cardiac
potassium current. Nature 384: 78 –80, 1996.
2. Beitinger TL, Bennett WA. Quantification of the role of acclimation
temperature in temperature tolerance of fishes. Env Biol Fishes 58:
277–288, 2000.
3. Bendahhou S, Marionneau C, Haurogne K, Larroque MM, Derand R,
Szuts V, Escande D, Demolombe S, Barhanin J. In vitro molecular
interactions and distribution of KCNE family with KCNQ1 in the human
heart. Cardiovasc Res 67: 529 –538, 2005.
4. Bett GCL, Morales MJ, Beahm DL, Duffey ME, Rasmusson RL.
Ancillary subunits and stimulation frequency determine the potency of
chromanol 293B block of the KCNQ1 potassium channel. J Physiol 576:
755–767, 2006.
5. Chen H, Kim LA, Rajan S, Xu S, Goldstein SAN. Charybdotoxin
binding in the IKs pore demonstrates two MinK subunits in each channel
complex. Neuron 40: 15–23, 2003.
6. Chen J, Zheng R, Melman YF, McDonald TV. Functional interactions
between KCNE1 C-terminus and the KCNQ1 channel. PloS ONE 4:
e5143, 2009.
7. Grunnet M, Jespersen T, Rasmussen HB, Ljungström T, Jorgenesen
NK, Olesen SP, Klaerke DA. KCNE4 is an inhibitory subunit to the
KCNQ1 channel. J Physiol 542.1: 119 –130, 2002.
8. Hassinen M, Haverinen J, Vornanen M. Electrophysiological properties
and expression of the delayed rectifier potassium (ERG) channels in the
heart of thermally acclimated rainbow trout. Am J Physiol Regul Integr
Comp Physiol 295: R297–R308, 2008.
9. Hassinen M, Paajanen V, Haverinen J, Eronen H, Vornanen M.
Cloning and expression of cardiac Kir2.1 and Kir22 channels in thermally
acclimated rainbow trout. Am J Physiol Regul Integr Comp Physiol 292:
R2328 –R2339, 2007.
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
This is the first time that cardiac IKs of a vertebrate species
has been shown to be mainly produced by the homomeric
Kv7.1 channels rather than the heteromeric Kv7.1/MinK assemblies. The homomeric channel composition allows fast
activation of the IKs at temperatures that are 20 –35°C lower
than body temperatures of endothermic animals. To our knowledge, this is a novel molecular mechanism for evolutionary
thermal compensation of ion channel function. These findings
predict that similar homomeric molecular arrangement of the
IKs delayed rectifier channels would be present in the hearts of
other cold-living ectotherms and that the heterotetrameric assembly of the Kv7.1/MinK channels might be associated with
the development of endothermy. Comparative electrophysiology and associated molecular studies in various vertebrate
groups are needed to test this hypothesis.
10. Hassinen M, Paajanen V, Vornanen M. A novel inwardly rectifying K⫹
channel, Kir2.5, is upregulated under chronic cold stress in fish cardiac
myocytes. J Exp Biol 211: 2162–2171, 2008.
11. Haverinen J, Vornanen M. Responses of action potential and K⫹
currents to chronic thermal stress in fish hearts. Phylogeny or thermal
preferences? Physiol Biochem Zool 82: 468 –482, 2009.
12. Haverinen J, Vornanen M. Temperature acclimation modifies Na⫹
current in fish cardiac myocytes. J Exp Biol 207: 2823–2833, 2004.
13. Horoszewicz L. Lethal and “disturbing” temperatures in some fish species
from lakes with normal and artificially elevated temperature. J Fish Biol 5:
165–181, 1973.
14. Imredy JP, Penniman JR, Dech SJ, Irving WD, Salata JJ. Modeling of
the adrenergic response of the human IKs current (hKCNQ1/hKCNE1)
stably expressed in HEK-293 cells. Am J Physiol Heart Circ Physiol 295:
H1867–H1881, 2008.
15. Jost N, Papp JG, Varro A. Slow delayed rectifier potassium current (IKs)
and the repolarization reserve. Ann Noninv Electrocardiol 12: 64 –78,
2007.
16. Jost N, Virag L, Bitay M, Takacs J, Lengyel C, Biliczki P, Nagy Z,
Bogats G, Lathrop DA, Papp JG, Varro A. Restricting excessive
cardiac action potential and QT prolongation: A vital role for IKs in human
ventricular muscle. Circulation 112: 1392–1399, 2005.
17. Kurokawa J, Chen L, Kass RS. Requirement of subunit expression for
cAMP-mediated regulation of a heart potassium channel. Proc Natl Acad
Sci USA 100: 2122–2127, 2003.
18. Lundby A, Ravn LS, Svendsen JH, Olesen SP, Schmitt N. KCNQ1
mutation Q147R is associated with atrial fibrillation and prolonged QT
interval. Heart Rhythm 4: 1532–1541, 2007.
19. Lundquist AL, Manderfield LJ, Vanoye CG, Rogers CS, Donahue BS,
Chang PA, Drinkwater DC, Murray KT, George Jr. Expression of
multiple KCNE genes in human heart may enable variable modulation of
IKs. J Mol Cell Cardiol 38: 277–287, 2005.
20. Marx SO, Kurokawa J, Reiken S, Motoike H, D’Armiento J, Marks
AR, Kass RS. Requirement of a macromolecular signaling complex for
beta adrenergic receptor modulation of the KCNQ1-KCNE1 potassium
channel. Science 295: 496 –499, 2002.
21. Missan S, Qi J, Crack J, McDonald T, Linsdell P. Regulation of
wild-type and mutant KCNQ1/KCNE1 channels by tyrosine kinase.
Pflügers Arch 458: 471–480, 2009.
22. Morin TJ, Kobertz WR. Counting membrane-embedded KCNE betasubunits in functioning K⫹ channel complexes. Proc Natl Acad Sci USA
105: 1478 –1482, 2008.
23. Paajanen V, Vornanen M. Regulation of action potential duration under
acute heat stress by IK,ATP and IK1 in fish cardiac myocytes. Am J Physiol
Regul Integr Comp Physiol 286: R405–R415, 2004.
24. Rocchetti M, Besana A, Gurrola GB, Possani LD, Zaza A. Rate
dependency of delayed rectifier currents during the guinea-pig ventricular
action potential. J Physiol 534: 721–732, 2001.
25. Sanguinetti MC, Curran ME, Zou A, Shen J, Specter PS, Atkinson
DL, Keating MT. Coassembly of KVLQT1 and minK (IsK) proteins to
form cardiac IKS potassium channel. Nature 384: 80 –83, 1996.
26. Schroeder BC, Waldegger S, Fehr S, Bleich M, Warth R, Greger R,
Jentsch TJ. A constitutively open potassium channel formed by KCNQ1
and KCNE3. Nature 403: 196 –199, 2000.
27. Sesti F, Goldstein SAN. Single-channel characteristics of wild-type IKs
channels and channels formed with two MinK mutants that cause long QT
syndrome. J Gen Physiol 112: 651–663, 1998.
28. Stecyk JAW, Stenslokken KO, Farrell AP, Nilsson GE. Maintained
cardiac pumping in anoxic crucian carp. Science 306: 77, 2004.
29. Stengl M, Volders PGA, Thomsen MB, Spätjens RLHMG, Sipido KR,
Vos MA. Accumulation of slowly activating delayed rectifier potassium
current (IKs) in canine ventricular myocytes. J Physiol 551: 777–786,
2003.
30. Toshe N, Nakaya H, Kanno M. Alpha1-adrenoceptor stimulation enhances the delayed rectifier K⫹ current of guinea pig ventricular cells
through the activation of protein kinase C. Circ Res 71: 1441–1446, 1992.
31. Tristani-Firouzi M, Sanguinetti MC. Voltage-dependent inactivation of
the human K⫹ channel KvLQT1 is eliminated by association with minimal
K⫹ channel (minK) subunits. J Physiol 510: 37–45, 1998.
32. Unsöld B, Kerst G, Brousos H, Hübner M, Schreiber R, Nitschke R,
Greger R, Bleich M. KCNE1 reverses the response of the human K⫹
channel KCNQ1 to cytosolic pH changes and alters its pharmacology and
sensitivity to temperature. Pflügers Arch 441: 368 –378, 2000.
THERMAL ADAPTATION OF CARDIAC POTASSIUM CURRENT IN CRUCIAN CARP
33. Varnum MD, Busch AE, Bond CT, Maylie J, Adelman JP. The min K
channel underlies the cardiac potassium current IKs and mediates species-specific
responses to protein kinase C. Proc Natl Acad Sci USA 90: 11528–11532, 1993.
34. von Skramlik E. Über den Kreislauf bei den Fischen. Ergebnisse Biol 11:
1–130, 1935.
35. Vornanen M. Sarcolemmal Ca influx through L-type Ca channels in
ventricular myocytes of a teleost fish. Am J Physiol Regul Integr Comp
Physiol 272: R1432–R1440, 1997.
36. Vornanen M, Hälinen M, Haverinen J. Sinoatrial tissue of crucian carp
heart has only negative contractile responses to autonomic agonists [Online]. BMC Physiol 10: 10, 2010.
37. Vornanen M, Hassinen M, Koskinen H, Krasnov A. Steady-state effects of
temperature acclimation on the transcriptome of the rainbow trout heart. Am
J Physiol Regul Integr Comp Physiol 289: R1177–R1184, 2005.
R265
38. Vornanen M, Ryökkynen A, Nurmi A. Temperature-dependent expression of sarcolemmal K⫹ currents in rainbow trout atrial and ventricular
myocytes. Am J Physiol Regul Integr Comp Physiol 282: R1191–
R1199, 2002.
39. Walsh KB, Kass RS. Regulation of a heart potassium channel by protein
kinase A and C. Science 242: 67–69, 1988.
40. Wang KW, Goldstein SAN. Subunit composition of mink potassium
channels. Neuron 14: 1303–1309, 1995.
41. Wang Z, Fermini B, Nattel S. Rapid and slow components of delayed
rectifier current in human atrial myocytes. Cardiovasc Res 28: 1540 –
1546, 1994.
42. Yang T, Kanki H, Roden DM. Phosphorylation of the IKs channel
complex inhibits drug block: novel mechanism underlying variable antiarrhythmic drug actions. Circulation 108: 132–134, 2003.
Downloaded from http://ajpregu.physiology.org/ by 10.220.32.246 on October 21, 2016
AJP-Regul Integr Comp Physiol • VOL
301 • JULY 2011 •
www.ajpregu.org