A requirement for the immediate early gene Zif268 in the

Transcription

© 2001 Nature Publishing Group http://neurosci.nature.com
articles
A requirement for the immediate
early gene Zif268 in the expression
of late LTP and long-term memories
M. W. Jones1, M. L. Errington1, P. J. French1, A. Fine1, T. V. P. Bliss1, S. Garel2, P. Charnay2,
B. Bozon3, S. Laroche3 and S. Davis3
1 Division of Neurophysiology, National Institute for Medical Research, Mill Hill, London NW7 1AA, UK
2 Biologie Moléculaire du Développement, INSERM U-368, Ecole Normale Supérieure, 75230 Paris, France
3 Laboratoire de Neurobiologie de l’Apprentissage, de la Mémoire et de la Communication, CNRS UMR 8620, Université Paris-Sud, 91405 Orsay, France
Correspondence should be addressed to S.D. (sabrina.davis@ibaic.u-psud.fr)
The induction of long-term potentiation (LTP) in the dentate gyrus of the hippocampus is associated
with a rapid and robust transcription of the immediate early gene Zif268. We used a mutant mouse
with a targeted disruption of Zif268 to ask whether this gene, which encodes a zinc finger transcription factor, is required for the maintenance of late LTP and for the expression of long-term memory.
We show that whereas mutant mice exhibit early LTP in the dentate gyrus, late LTP is absent when
measured 24 and 48 hours after tetanus in the freely moving animal. In both spatial and non-spatial
learning tasks, short-term memory remained intact, whereas performance was impaired in tests
requiring long-term memory. Thus, Zif268 is essential for the transition from short- to long-term
synaptic plasticity and for the expression of long-term memories.
Distinct cellular and molecular mechanisms underlie different
temporal phases of hippocampal LTP: induction requires elevated postsynaptic calcium1, early maintenance is mediated by the
activation of protein kinases2, and later phases depend on gene
transcription3,4 and protein synthesis5–7. Consistent with the presumption that synaptic plasticity provides the neural basis for
long-term information storage in the brain, several forms of longterm memory involving both hippocampal and cortical structures also depend on protein synthesis8–10.
Following induction of LTP in the dentate gyrus, a cascade of
genes is activated at different time points11,12. The transient activation of immediate early genes is believed to be a critical step
in these successive waves of gene expression. Zif268 (also known
as Krox-24, EGR-1 or NGFI-A) is one such immediate early gene,
encoding a zinc finger transcription factor13–15. In the dentate
gyrus, Zif268 mRNA is transiently upregulated between ten minutes and two hours following LTP-inducing stimulation16–18, a
time course that precludes a role for Zif268 protein in the earliest
stages of LTP, but that is consistent with an involvement in the
transition from the early phase of LTP to the protein synthesisdependent late phase19. Expression is also upregulated in the insular cortex following LTP-inducing stimulation of afferents from
the basolateral amygdala20, suggesting a role for Zif268 in activity-dependent neuronal function in other brain regions.
The association between Zif268 activation and LTP has been
known for over a decade. More recent studies have provided evidence that Zif268 mRNA is upregulated in the hippocampus in
the behaving rat following exposure to a novel stimulus21, and
in the inferior temporal gyrus of the monkey during associative
learning22. However, it remains uncertain whether the activation
of Zif268 is necessary for the generation of late LTP, or for the
formation of long-term memories. To address these questions,
nature neuroscience • volume 4 no 3 • march 2001
we examined short- and long-term synaptic plasticity in the dentate gyrus of mice with a targeted inactivation of the Zif268
gene23, using both anesthetized and freely moving animals. We
have also examined a variety of hippocampus-dependent and
independent tasks that make demands on short- and/or longterm memory. Our results demonstrate that activation of Zif268
is required for the expression of long-term but not short-term
synaptic and behavioral plasticity.
RESULTS
Hippocampal anatomy in Zif268–/– mice
We used several histochemical and immunohistochemical markers to examine hippocampal anatomy in control and mutant
mice. Nissl staining (data not shown) and NeuN immunoreactivity (which labels a neuronal-specific DNA-binding protein24;
Fig. 1a) were indistinguishable in wild-type (Zif268+/+) and
homozygous mutant (Zif268–/–) mice. Parvalbumin labels a calcium-binding protein in a subpopulation of GABAergic interneurons in the hippocampus25, again showing similar staining in
both Zif268 +/+ and Zif268 –/– mice (Fig. 1b). Synaptophysin
immunoreactivity in synaptic layers also appeared normal in
Zif268–/– mice (Fig. 1c). Thus, basic neuronal architecture was
not affected by the Zif268 mutation.
Short-term plasticity and LTP in anesthetized mice
We measured LTP and short-term plasticity of both the field excitory postsynaptic potential (fEPSP) and population spike in urethane-anesthetized mice. Paired-pulse stimulation (inter-pulse
interval, 10–100 ms) at intensities sub-threshold for a population spike resulted in facilitation of the fEPSP, maximal at interpulse intervals of 10–20 ms, in both Zif268+/+ and Zif268–/– mice
(Fig. 2a). Paired-pulse facilitation of the fEPSP is attributable to
289
articles
a
b
c
Fig. 1. Gross hippocampal anatomy is normal in Zif268–/– mice. (a)
NeuN immunoreactivity, (b) parvalbumin staining and (c) synaptophysin
immunoreactivity all appeared similar in Zif268–/– (right) and Zif268+/+
(left) mice.
presynaptic mechanisms26. Paired-pulse stimulation at intensities just above threshold for evoking a population spike resulted
in complete suppression of the population spike at short interstimulus intervals (10–25 ms) and spike facilitation at longer
intervals in both Zif268+/+ and Zif268–/– mice (Fig. 2b). Spike
facilitation peaked at inter-pulse intervals of 60–80 ms in all mice
tested. This profile of spike depression at short inter-stimulus
intervals followed by facilitation at longer intervals reflects recurrent inhibition and disinhibition and is therefore, in part, a postsynaptic phenomenon. Thus, short-term presynaptic plasticity
and network excitability in the dentate gyrus seem to be normal
in Zif268 mutant mice.
Following tetanic stimulation, both genotypes showed
significant and similar potentiation of the population spike
50–60 minutes after tetanus (2.8 ± 0.5 mV increase in Zif268+/+
and 2.8 ± 0.7 mV in Zif268–/– mice, p < 0.05 versus baseline;
Fig. 2c). LTP of the fEPSP slope was also similar in the two
genotypes (23 ± 5.3% in Zif268+/+ and 21 ± 6.1% in Zif268–/–
mice, p < 0.05 with respect to baseline; Fig. 2d).
Fig. 2. Short-term synaptic plasticity and LTP in the dentate gyrus of
anesthetized Zif268 mutant mice. (a) At low stimulus intensities,
paired-pulse facilitation of EPSP amplitude shows the same dependence
on inter-stimulus interval (ISI) in Zif268–/– (, n = 5) and Zif268+/+ mice
(, n = 4). Sample responses show facilitation at 15 ms ISI in a Zif268–/–
mouse. (b) At stimulus intensities just above threshold for evoking a
population spike, paired-pulse depression and facilitation of the population spike also show the same dependence on ISI in Zif268–/– and
Zif268+/+ mice. Sample responses show depression (10 ms ISI) and
facilitation (50 ms ISI) from a Zif268–/– mouse. (c, d) LTP of the population spike (c) and the field EPSP (d) in Zif268–/– and Zif268+/+ mice (,
n = 5, and , n = 4, respectively). Mean changes in the amplitude of the
population spike (c), and percentage changes in the slope of the field
EPSP (d), plotted with respect to the mean values in the 10 min preceding tetanic stimulation (arrows). Test stimuli were given to the perforant path at a frequency of 1 per 30 s. A similar level of potentiation
of the population spike and EPSP was seen in Zif268+/+ and Zif268–/–
mice for the first hour after tetanus.
290
Long-lasting synaptic plasticity in freely moving mice
We investigated LTP over several days in freely moving mice. Test
stimulus intensities required to evoke responses with comparable
fEPSP slopes and population spike amplitudes were not different between genotypes (Fig. 3a). Following two days of baseline
recording, tetanic stimulation of the perforant path induced significant potentiation of the population spike in all genotypes
(p < 0.05 versus baseline for spike amplitude 50–60 minutes after
tetanus in Zif268+/+ and Zif268–/– mice, p < 0.01 in Zif268+/–
mice). The decrease in the latency of the population spike after
tetanic stimulation made it impractical to compare the initial
slope of the fEPSP before and after LTP induction (Fig. 3a). Thus,
as in anesthetized mice, potentiation in mutants was similar to
that in wild types in the first hour following induction. Wildtype mice maintained significant spike potentiation 24 and
48 hours following the tetanic stimulation (p < 0.05 versus control). In contrast, neither Zif268+/– nor Zif268–/– mice supported
significant potentiation at these time points (p > 0.06 versus control values, p < 0.05 versus Zif268+/+ mice; Fig. 3b). Thus, the
Zif268 gene is necessary for the expression of the later phases of
LTP in the dentate gyrus.
Lack of expression of Zif268 in the hippocampus
We examined levels of Zif268 mRNA in Zif268+/+ and Zif268–/–
mice by in situ hybridization. The results confirmed a complete
absence of Zif268 mRNA in the Zif268–/– mice, whereas in the
a
b
c
d
articles
Fig. 3. LTP in the dentate gyrus of awake Zif268 mutant
mice. (a) Stimulus intensity required to evoke field potentials
with comparable EPSP slopes and population spike amplitudes was independent of genotype. Sample responses are
shown for mice of each genotype before (dotted line) and
10 min after (solid line) tetanic stimulation. Values for the
mean amplitudes (± s.e.m.) of the population spike are given
1 h and 48 h after the tetanus (*p < 0.05, **p < 0.01 compared to pre-tetanus amplitudes). (b) Time course of LTP in
the awake animal. Baseline responses were recorded for
2 days (20 min per day). A tetanus was delivered (arrow) on
the second day, and responses were monitored for 1 h, and
again for 20 min per day for the next 2 days. Zif268+/+ (, n
= 7), Zif268+/– (, n = 11) and Zif268–/– (, n = 6) mice all
showed significant potentiation of the population spike 1 h
after tetanic stimulation, but only Zif268+/+ mice maintained
this potentiation over the following 48 h.
a
Zif268+/+ mice, Zif268 expression was normal and LTP
inducible (Fig. 4). The construct used to inactivate
Zif268 in the mutant mice23 involved the insertion of
a lacZ cassette downstream of the promoter; in situ
hybridization demonstrated normal constitutive and
LTP-regulated expression of the lacZ gene in the
Zif268–/– mice (Fig. 4), suggesting that the activity of
the Zif268 promoter was not affected by the mutation.
This was confirmed by in situ hybridization with a common probe derived from the 5´ untranslated region of
Zif268, and located upstream of the site of insertion of
lacZ. As expected, the common probe detected equivalent levels of LTP-inducible mRNAs in Zif268+/+ and
Zif268–/– mice (Fig. 4).
b
Learning and memory deficits in Zif268 mutant mice
We next examined whether the deficits in synaptic plasticity in
Zif268 mutant mice, particularly evident in the late phases of LTP,
were paralleled by corresponding deficits in learning and memory.
We first evaluated short-term, working memory by testing spontaneous alternation in a T-maze, a spatial behavior that depends
on the integrity of the hippocampus27. All three genotypes (n = 6
per genotype) showed normal alternation between the arms visited on the first and second runs of a trial when a 30-second delay
was imposed between runs (Zif268+/+, 75 ± 6.8%; Zif268+/–,
76 ± 3.0%; Zif268–/–, 69 ± 5.1% alternation; p < 0.05 versus
chance in each case). Mice were also tested with a ten-minute
delay between runs; again, there was no significant difference in
the levels of alternation among genotypes (Zif268+/+, 70 ± 4.4%;
Zif268+/–, 71 ± 7.7%; Zif268–/–, 60 ± 6.1%; n = 12 per group).
All mice made a similar mean number of entries into the arms
during habituation, indicating a similar level of exploratory behavior and locomotion. This type of spatial working
memory can therefore occur in the absence of Zif268
expression. To assess the role of Zif268 in longer-lasting forms
of spatial and associative memory, we trained mice in four other
behavioral tasks.
First, we tested spatial learning and memory in an open-field
water maze, using a massed training protocol where the acquisition phase was conducted within a two-hour period. All genotypes
took the same time to find the escape platform in the first training
trial (Fig. 5a). As the training progressed, there was a reduction in
escape latencies for all three genotypes. However, both Zif268+/–
and Zif268–/– mice took significantly longer than Zif268+/+ mice,
suggesting they had a learning deficit (F2,24 = 8.14; p < 0.01). A corresponding memory deficit was evident in a probe trial done
48 hours after training, during which Zif268+/+ mice showed a significant preference for the target quadrant (F3,32 = 6.01, p < 0.01),
whereas Zif268+/– and Zif268–/– (F < 1 for both genotypes) mice
showed no spatial bias for the training quadrant (Fig. 5b). Swim
speeds were similar for all genotypes, and mice did not exhibit
floating behavior. The deficits observed in the acquisition and
Fig. 4. Expression of Zif268 in the dentate gyrus. In situ hybridization shows that mRNAs for Zif268 (in Zif268+/+ mice) and lacZ
(in Zif268–/– mice) are expressed in the dentate gyrus 1 h following LTP-inducing stimulation of the perforant path. (Compare
hybridization signal in the left (tetanized) and right (untetanized)
dentate gyrus in each case.) A hybridization probe for a region of
the Zif268 gene transcribed in both Zif268–/– and Zif268+/+ mice
(‘common’) revealed similar expression in mice of both genotypes (right).
291
articles
a
b
c
d
retention (and/or recall) of this task could not therefore be
explained by aberrant motor behavior.
Complex tasks can often be more efficiently learned with
extended and distributed training28. Using a protocol in which
training was distributed over ten days, all genotypes showed similar acquisition curves (Fig. 5c), and all groups spent more time
in the training quadrant in a probe trial given eight days later (all
p-values < 0.01; Fig. 5d). Thus, with extended training, Zif268
mutant mice show normal acquisition and long-term recall.
As spatial learning takes place over many trials, we examined
performance in three non-spatial tasks in which learning is
Fig. 6. Conditioned taste aversion. Aversion indices (volume sucrose
consumed/total volume consumed; mean ± s.e.m.) for Zif268+/+ (n = 8),
Zif268+/– (n = 10) and Zif268–/– (n = 10) mice, following exposure to
LiCl or to NaCl. When sucrose was followed by an intraperitoneal
injection of lithium chloride, Zif268+/+ mice avoided sucrose and preferentially drank water 24 h after conditioning (*p < 0.05). In contrast, neither Zif268–/– nor Zif268+/– mice showed a significant aversion to
sucrose at 24 h. Control mice in which drinking the novel sucrose solution was followed by a sodium chloride injection (n = 4 for each genotype) drank similar volumes of sucrose and water.
Fig. 5. Spatial navigation in the water
maze. (a) During massed training, all
mice took the same amount of time
to escape the water on the first trial
(Tr1). During acquisition, all mice
learned to locate the hidden platform,
although the Zif268+/– (, n = 9) and
Zif268–/– (, n = 9) were slower to
learn the task than the Zif268+/+ mice
(, n = 9). (b) In a probe trial given
48 h later, Zif268+/+ mice showed a
spatial bias for the training quadrant
(*p < 0.01), but this was not the case
with Zif268+/– or Zif268–/– mice (F < 1
for both genotypes), which distributed their time equally among the 4
quadrants. (c) If extended and distributed training was given, all mice
(Zif268+/+, n = 11; Zif268+/–, n = 13;
Zif268–/–, n = 10) learned the task at
similar rates and (d) showed retention of the learning in a probe trial
given 8 days later (*p < 0.01).
achieved after a single trial (conditioned taste aversion and social
transmission of food preference) or after a brief training period
(novel object recognition). In conditioned taste aversion, waterdeprived mice learn to associate a novel taste (15% sucrose solution) with the malaise induced by injection of lithium chloride29.
When subsequently offered the choice between water and sucrose
solutions, animals tend to avoid the sucrose. This task is not hippocampus-dependent, but requires structures including the basolateral amygdala and insular cortex. Zif268 mRNA is upregulated
following induction of LTP in the pathway connecting these two
structures20. We found that 24 hours after LiCl injection, mice
showed significant aversion to the sucrose (p < 0.05 versus NaClinjected Zif268+/+ mice; Fig. 6). However, neither Zif268+/– nor
Zif268–/– mice exhibited significant aversion at 24 hours (p > 0.1).
Analysis of variance confirmed a significant difference in aversion index between genotypes (F2,24 = 9.58; p < 0.01 for three
LiCl-injected groups). The same effects were also observed
48 hours after LiCl injections (data not shown). The three groups
that were injected with NaCl showed no preference for sucrose
or water, either 24 or 48 hours after injection.
These data show that Zif268 is necessary for generating a
long-term memory of an association formed in a single trial.
Because of the malaise induced by injections of LiCl, we were
unable to test the mice at short intervals, so we could not determine whether short-term memory of the association was affected in Zif268 mutants. Therefore, in two other experiments, we
used a within-animal protocol to test for both short- and longterm memory. In the first task, we used social transmission of
food preference to test one-trial learning both immediately and
24 hours after learning. This is an olfactory discrimination task
in which rodents show preference for a novel food that has
recently been smelled on the breath of another (demonstrator)
animal30. Food-deprived demonstrator mice were given either
cocoa- or coriander-scented food to eat over a period of two
hours and then allowed to interact with observer mice for
20 minutes. Food-deprived observer mice were then given free
292
articles
Fig. 7. Discrimination learning at short and long delays.
Olfactory discrimination in social transmission of food preference (a, b) and object recognition (c, d) is normal at short
time intervals but impaired at long intervals in Zif268 mutant
mice. (a) Preference index exhibited by the observer mice for
the scented food eaten by the demonstrator mouse (demonstrated food consumed/total food consumed) at 30-s delay (a)
and 24-h delay (b) after interaction between demonstrator and
observer mice. All mice (n = 10 for each genotype) learned the
discrimination when there was minimal delay (*p < 0.05),
showing a significant preference above chance level for the
food eaten by the demonstrator mice. When a 24-h delay was
imposed, only Zif268+/+ mice (n = 10; *p < 0.05) retained the
memory for the odor. Neither Zif268+/– (n = 7) nor Zif268–/–
(n = 9) mice showed a significant preference for the flavor to
which they had been exposed during the interactive period.
(c, d) Percent time spent exploring the novel object (time
spent exploring the novel object/total time × 100) at a 10-min
and 24-h delay in the object recognition task. (c) All mice (n = 8
for each genotype) spent significantly more time exploring the
novel object at the 10 min delay (*p < 0.05). (d) After a 24-h
delay, Zif268+/+ and Zif268+/– mice spent more time exploring
the novel object (*p < 0.05), whereas Zif268–/– mice no longer
showed a preference for the novel object.
a
b
c
d
choice between cocoa and coriander either 30 seconds
after the interaction, or 24 hours later. Thirty seconds
after the interaction, all genotypes showed a significant
preference for the food they had smelled on the breath of the
demonstrators (all p-values < 0.05; Fig. 7a). Twenty-four hours
later, however, whereas Zif268+/+ mice still showed a preference
for the demonstrated food, Zif268+/– and Zif268–/– mice consumed similar amounts of both food types (Fig. 7b). Analysis
of the consumption of each scented food (F1,53 = 1.05; p > 0.05)
showed no difference among genotypes, and the amount of food
consumed by demonstrators (F2,52 = 1.95; p > 0.05) was equivalent, suggesting that there was no bias toward a particular food,
and that the demonstrators for each genotype consumed enough
food to transmit the smell. These data show that Zif268 is important for the formation of long-term memory for an olfactory
event, whereas short-term memory for the same event is not
dependent on Zif268.
Rodents tend to explore a novel object in preference to a
familiar object. Novel object recognition is hippocampus dependent31, and we used this as a second task in which to assess both
short- and long-term memory in the same groups of animals.
Mice were allowed to explore 2 objects for 20 minutes. Following
a 10-minute or 24-hour delay, one of the familiar objects was
replaced with a novel object, and the time spent exploring the
novel and familiar objects was measured. At the ten-minute
delay, mice of all genotypes spent significantly longer exploring
the novel object than the familiar object (all p-values < 0.05;
Fig. 7c), indicating similar levels of motivation and short-term
memory. In contrast, with a 24-hour interval between exploring the familiar and novel objects, Zif268+/+ and Zif268+/– mice
still preferentially explored the novel object (p < 0.01) whereas
Zif268–/– mice did not (p > 0.05; Fig. 7d). Thus, as with social
transmission of food preference, Zif268+/+ mice were able to
retain information acquired 24 hours earlier, whereas Zif268–/–
mice could not. The performance of Zif268+/– mice was again
intermediate, although, in contrast to their performance in social
transmission of food preference, they exhibited significant retention at 24 hours.
DISCUSSION
In this paper, we demonstrate an absence of late phase LTP in
the dentate gyrus of freely moving mice with a targeted inactivation of the immediate early gene Zif268. The observation that
LacZ reporter mRNA is upregulated after tetanic stimulation suggests that signaling events upstream of Zif268 transcription are
not affected in mice with the mutant gene. We conclude that the
absence of late LTP is due to a failure in the synthesis of downstream effector proteins encoded by genes for which Zif268 is an
obligatory transcription factor.
As a consequence of pituitary and ovarian defects, homozygous Zif268 mutant mice have a reduced body size and are sterile, although heterozygous mice are phenotypically normal in
terms of size and fertility23. However, LTP decayed at a similar
rate in both heterozygous and homozygous mice, which also
showed similar deficits in two of the learning tasks that placed
demands on long-term memory, suggesting that endocrine dysfunction does not contribute to the observed phenotype. Histological examination using cellular, neuronal and presynaptic
markers confirmed similar cell densities and hippocampal architecture in wild-type and mutant mice, showing that disruption of
Zif268 had no gross effects on hippocampal circuitry.
Basal synaptic transmission, neuronal excitability and shortterm plasticity were normal in mutant mice. All genotypes
showed an equivalent magnitude of LTP for the first hour following its induction. However, whereas LTP was maintained for
at least 48 hours after induction in wild-type mice, LTP in both
heterozygous and homozygous mutant mice decayed to baseline within 24 hours. The level of Zif268 mRNA in heterozygous
animals is approximately half that seen in wild-type mice (data
not shown), suggesting that this is insufficient to achieve the
levels of Zif268 activation required for the successful expression
of late LTP.
Other immediate early genes have also been implicated in LTP
and learning. For example, mRNA for Homer, a protein that
293
articles
binds metabotropic glutamate receptors, is upregulated following
LTP induction32,33. Arc (also known as Arg 3.1), another mRNA
species upregulated after LTP34,35, is necessary for both late LTP
and spatial learning36, as shown by antisense techniques. Together with our results, these data suggest that several immediate early
genes act together to establish late LTP.
To examine the involvement of Zif268 in short- and longterm memory, we used a variety of behavioral tasks making
use of single or repeated training, different types of reinforcement and the processing of spatial or non-spatial information.
Some of these tasks are hippocampus dependent, and some are
not. Our results provide evidence that at least some forms of
short-term memory are intact in the Zif268 mutant mice,
because they demonstrated normal levels of spontaneous alternation, an innate behavior that relies upon spatial working
memory. In common with early LTP, spontaneous alternation
requires activation of the NMDA receptor and phosphorylation of protein kinase C37, events that are upstream of gene
transcription, and that seem to be sufficient to mediate shortterm memory. Consistent with the notion that loss of functional Zif268 does not affect short-term memory processes,
Zif268 mutant mice were also able to perform olfactory discrimination in social transmission of food preference, and visual discrimination in an object recognition task, when minimal
delay was imposed.
In contrast to the lack of effect on short-term memory, longterm memory in Zif268 mutant mice was severely impaired. In
three forms of learning, conditioned taste aversion, olfactory
discrimination and novel object recognition, homozygous mice
exhibited no significant recall when tested 24 hours later. These
findings support the notion that Zif268 is critical in the expression of the long-term memory trace. Spatial navigation is a more
complex type of learning, requiring several trials to reach criterion. During massed training, both heterozygous and homozygous mice showed impaired acquisition and a severe deficit in
long-term spatial memory assessed in probe trials 24 hours later,
suggesting that Zif268 is required either for memory consolidation during and following the process of learning or for retrieval.
We found that spatial memory deficits in Zif268 mutant mice
could be completely rescued by extended and distributed training. Similar deficits in the consolidation of learning and the
potential for rescue by extended training have been reported in
mice with targeted disruption of the gene encoding the cAMP
response element binding protein CREB38. In addition, genetic
studies in Drosophila have suggested that the ability to form longterm memories following disruption of CREB signaling is influenced by the temporal structure of the training schedule39. The
upstream regulatory elements of the Zif268 gene include six
serum response elements (SRE) and two cAMP response elements (CRE)40,41, and LTP-dependent transcriptional regulation of Zif268 is controlled by the mitogen-activated protein
kinase (MAPK) pathway42. Both CREB and MAPK signaling
have been implicated in synaptic plasticity43,44 and certain types
of learning45,46. Our data therefore strengthen the evidence that
Zif268 is an essential participant in the signaling cascade required
for synaptic and behavioral plasticity, with the proviso that in
the absence of Zif268, other unidentified signaling pathways can
be recruited under certain conditions (such as distributed training) to allow information to enter an accessible long-term memory store.
In summary, activation of Zif268 is essential for stabilizing
synaptic plasticity in the hippocampus and for the expression of
hippocampal and non-hippocampal forms of long-term mem294
ory. Our results also establish an isomorphism between hippocampal LTP and hippocampus-dependent learning with
respect to the effects of the Zif268 mutation: short-term plasticity and short-term memory are unaffected, whereas long-term
plasticity and long-term memory are impaired.
METHODS
Animals. Mice were generated using 129/SV ES cells injected into
C57BL/6J blastocysts and backcrossed onto a C57BL/6J background23.
The mutation involved insertion of a lacZ-neo cassette between promoter and coding sequence, and addition of a frameshift mutation at
the level of an Ndel restriction site corresponding to the beginning of the
DNA-binding domain. Age-matched (2–8 month old) Zif268 +/+ ,
Zif268+/– and Zif268–/– littermates were tested in several behavioral
tasks, with the sequence of tasks randomized. A subset of mice was used
for electrophysiology. All procedures carried out at CNRS were conducted in accordance with recommendations of the EU (86/609/EEC)
and the French National Committee (87/848) and those at NIMR in
accordance with the UK Animals (Scientific Procedures) Act (1986).
Spontaneous alternation. Mice were habituated to the T-maze for
10–20 min/day for two days. During testing (4–8 trials/day for three
days), they were placed in the start box for 30 s and then given a forced
choice run (randomly assigned). On entering the open arm, they were
held there for 30 s, then returned to the start box, held for 30 s or 10 min
and released, with both arms accessible. The percent number of trials on
which mice alternated was subjected to angular transformation and differences analyzed with Student’s t-test.
Spatial navigation. The water maze (1.5 m diameter) contained an escape
platform (10 cm) in a fixed position. After a 1-day habituation period
(2 blocks of 4 trials with the hidden platform in the center of the maze)
massed trials were given the following day (5 blocks of 5 trials; 120 s intertrial interval; 60 s maximum swim time; 15 min inter-block interval). A
60 s probe trial was run 48 h post training. In distributed training, mice
were given 1 block of 4 pre-training trials, and, during acquisition,
2 blocks (5-h interval) of 4 trials (60-s interval; maximum swim time of
90 s) a day for 10 days. A 90-s probe trial was given 8 days later. ANOVA
was conducted on escape latencies (acquisition) and time in each quadrant (probe trial).
Conditioned taste aversion. Water-deprived mice were trained for 3 days
to drink ad libitum from 2 identical water bottles in the home cage
(30 min/day). Bottles were weighed to measure consumption. On the
conditioning day, mice received 15% sucrose from 2 identical bottles for
30 min. One hour later, mice were either injected with 0.9% saline, or
0.3 M LiCl (10% body weight i.p.). At 24 and 48 h after conditioning,
mice could choose between water and sucrose for 30 min. The aversion
index (volume of sucrose consumed × 100/total volume consumed) was
subjected to angular transformation and analyzed with Student’s t-test
(aversion index) and ANOVA (group difference).
Social transfer of food preference. Mice were habituated to test cages
and placed on a food-restricted diet for several days. On test days,
demonstrators were given scented food (coriander, 0.3%, or bitter cocoa,
2.0% by weight) for 2 h. Observers were then exposed to demonstrators for 20 min, and placed in test cages either 30 s or 24 h later, where
they had free access to both foods for 20 min. Both male and female
mice were used in this task, and as performance was similar between
sexes, animals were grouped for analysis. Food consumed was calculated by weighing, before and after testing. The preference ratio (demonstrated food eaten × 100/total food eaten) was analyzed using Wilcoxon
ranked scores test.
Object recognition. Mice were habituated to test boxes (30 × 20 × 10 cm)
for 20 min per day for 3–4 days. Two objects were placed in the box in
fixed positions, and mice were allowed two 10-min exploration sessions,
with a 10-min interval in home cages. We quantified the time mice spent
with both forelimbs orientated toward and within 4 cm of either object.
articles
During the test phase (10 min or 24 h later), one object was replaced by
a novel object, and time spent exploring the objects was recorded. Exploration indices (time exploring object × 100/total exploration time) were
compared using Student’s paired t-test.
Surgery and electrophysiology. Acute experiments were done under urethane anesthesia. A concentric bipolar stimulating electrode was positioned
in the perforant path, and a glass micropipette recording electrode in the
hilus of the ipsilateral dentate gyrus. Pairs of pulses (inter-pulse intervals,
10–100 ms) were used to study paired-pulse facilitation at two intensities,
one to evoke a pure EPSP and the other a population spike of approximately
1 mV. Three responses were collected at each and averaged. Test responses
were evoked by monophasic stimuli (1/30 s; 100–300 µA, 50–60 µs). Pulse
width was doubled during tetani, which consisted of 6 series of 6 trains of
6 stimuli at 400 Hz, 100 ms between trains, 20 s between series.
Long-term plasticity was studied in the dentate gyrus of freely moving mice as described47. Following surgery, animals were allowed to recover (at least seven days) before recording, and were habituated to the
recording chamber. Test responses elicited by monophasic pulses (80 µs,
26–250 µA, 1/30 s) were recorded for 20-min periods on consecutive
days at an intensity that evoked a 1–3 mV population spike. Following
two days of stable baseline, a tetanus was delivered to the perforant path
(same parameters as above, except pulse duration 100 µs). Responses
were measured for 60 min after tetanus and again, for 20 min at 24 h and
48 h after tetanus. Data are expressed as change in amplitude (mV) relative to the baseline measured over the 10 min before tetanic stimulation. Student’s t-test was used to compare mean levels of potentiation.
In situ hybridization. One hour after tetanic stimulation, brains were
removed, frozen on dry ice and stored at –70°C. Sections (14 µm) were
mounted on poly-L-lysine coated glass slides, and in situ hybridization was
done as described17. After fixation, sections were hybridized overnight at
42°C in 100 ml buffer containing 50% formamide, 4× SSC (150 mM sodium chloride/50 mM sodium citrate), 10% dextran sulphate, 5× Denhardt’s,
200 mg/ml acid-alkali cleaved salmon testis DNA, 100 mg/ml long-chain
polyadenylic acid, 25 mM sodium phosphate (pH 7.0), 1 mM sodium
pyrophosphate and 100,000 c.p.m. radiolabeled probe (∼1 ng/ml) under
parafilm coverslips. Sections were washed in 1× SSC at 55°C (30 min),
0.1× SSC at room temperature (5 min), dehydrated in 70% and 95% ethanol,
and exposed to autoradiographic film. [35S]ATP end-labeled probes (NEN)
were generated using terminal deoxynucleotidyl transferase (Promega,
France) according to manufacturer’s instructions. A 50-fold excess of unlabeled oligonucleotide was used as negative control. Oligonucleotides had a
unique sequence (Oswel, UK). Probe sequences were as follows: Zif268,
CCGTGGCTCAGCAGCATCATCTCCTCCAGTTTGGGGTAGTTGTCC,
complementary to nucleotides spanning amino acids 2–16 (ref. 13). LacZ,
TTGGTGTAGATGGGCGCATCGTAACCGTGCATCTGCCAGTTTGAG,
complementary to nucleotides 261–305. The probe against the 5´ UTR of
Zif268, common to both wild-type and mutant mice, was GGGTTACATGCGGGGTGCAGGGGCACACTGCGGGGAGT, complementary to
nucleotides 90–128 upstream of the AUG start codon.
Histology. Mice were perfused with 4% paraformaldehyde in PBS and
brains post-fixed overnight. Free-floating sections (40 µm) were washed
4 times in PBS (0.1 M, 10 min per wash). Cresyl violet was used as a general cell stain, anti-NeuN (1/6000, Chemicon) to mark viable cells, antisynaptophysin (1/100, Boehringer Mannheim, France) to mark presynaptic
boutons, and anti-parvalbumin (1/1000, Sigma). Non-specific epitopes
were blocked by incubation in 10% normal goat serum and 0.1% Triton
X-100 in PBS for 1 h. Sections were incubated with the primary antibodies for 48 h at room temperature and then washed three times in PBS. Secondary antibody was applied for 1 h at room temperature, and the sections
washed in PBS (×3). Immunostaining was visualized using an ABC elite
system (Vector Labs, France) and a VIP revelation kit (Biosystems, France).
ACKNOWLEDGEMENTS
This work was supported in part by CNRS PICS programme (N°756). We thank
P. Veyrac and M. Guegan for doing the immunohistochemistry, and S. Hiard for
rearing and genotyping the mice.
RECEIVED 23 OCTOBER 2000; ACCEPTED 16 JANUARY 2001
1. Lynch, G., Larson, J., Kelso, S., Barrionuevo, G. & Schottler, F. Intracellular
injections of EGTA block induction of hippocampal long-term
potentiation. Nature 305, 719–721 (1983).
2. Soderling, T. R. & Derkach, V. A. Postsynaptic protein phosphorylation
and LTP. Trends Neurosci. 23, 75–80 (2000).
3. Nguyen, P. V., Abel, T. & Kandel, E. R. Requirement of a critical period of
transcription for induction of late-phase LTP. Science 256, 1104–1107
(1994).
4. Frey, U., Frey, S., Schollmeier, F. & Krug, M. Influence of actinomycin D,
an RNA synthesis inhibitor, on rat hippocampal neurons in vivo and in
vitro. J. Physiol. (Lond.) 490, 703–711 (1996).
5. Bliss, T. V. P. & Collingridge, G. L. A synaptic model of memory: long-term
potentiation in the hippocampus. Nature 361, 31–39 (1993).
6. Frey, U., Krug, M., Reymann, K. G. & Matthies, H. Anisomycin, an
inhibitor of protein-synthesis, blocks late phases of LTP phenomena in the
hippocampal CA1 region in vitro. Brain Res. 452, 57–65 (1988).
7. Otani, S. & Abraham, W. C. Inhibition of protein synthesis in the dentate
gyrus, but not the entorhinal cortex, blocks the maintenance of long-term
potentiation in rats. Neurosci. Lett. 106, 175–180 (1989).
8. Meiri, N. & Rosenblum, K. Lateral ventricle injection of the protein
synthesis inhibitor anisomycin impairs long-term memory in a spatial
memory task. Brain Res. 789, 48–55 (1998).
9. Squire, L. R. & Barondes, S. H. Memory impairment during prolonged
training in mice given inhibitors of cerebral protein synthesis. Brain Res.
56, 215–225 (1973).
10. Rosenblum, K., Meiri, N. & Dudai, Y. Taste memory: the role of protein
synthesis in gustatory cortex. Behav. Neural Biol. 59, 49–56 (1993).
11. Fazeli, M. S., Cobet, J., Dunn, M. J., Dolphin, A. C. & Bliss, T. V. P. Changes
in protein synthesis accompanying long-term potentiation in the dentate
gyrus in vivo. J. Neurosci. 13, 1346–1353 (1993).
12. Davis, S. & Laroche, S. A molecular biological approach to synaptic
plasticity and learning. C. R. Acad. Sci. III 321, 97–107 (1998).
13. Milbrandt, J. A nerve growth factor-induced gene encodes a possible
transcriptional regulatory factor. Science 85, 7857–7861 (1987).
14. Lemaire, P., Revelant, O., Bravo, R. & Charnay, P. Two genes encoding
potential transcription factors with identical DNA-binding domains are
activated by growth factors in cultured cells. Proc. Natl. Acad. Sci. USA 85,
4691–4695 (1988).
15. O’Donovan, K. J., Tourtellotte, W. G., Milbrandt, J. & Baraban, J. M. The
EGR family of transcription-regulatory factors: progress at the interface of
molecular and systems neuroscience. Trends Neurosci. 22, 167–173 (1999).
16. Cole, A. J., Saffen, D. W., Baraban, J. M. & Worley, P. F. Rapid increase of
an immediate early gene messenger RNA in hippocampal neurons by
synaptic NMDA receptor activation. Nature 340, 474–476 (1989).
17. Wisden, W. et al. Differential expression of immediate early genes in the
hippocampus and spinal cord. Neuron 4, 603–604 (1990).
18. Richardson, C. L. et al. Correlation between the induction of an immediate
early gene, zif268, and long-term potentiation in the dentate gyrus. Brain
Res. 580, 147–154 (1992).
19. Abraham, W. C., Dragunow, M. & Tate, W. P. The role of immediate early
genes in the stabilization of long-term potentiation. Mol. Neurobiol. 5,
297–314 (1991).
20. Jones, M. W., French, P., Bliss, T. V. P. & Rosenblum, K. Molecular
mechanisms of long-term potentiation in the insular cortex in vivo.
J. Neurosci. 19, RC36, 1–8 (1999).
21. Hall, J., Thomas, K. L. & Everitt, B. J. Rapid and selective induction of
BDNF expression in the hippocampus during contextual learning. Nat.
Neurosci. 3, 533–535 (2000).
22. Miyashita, Y., Kameyama, M., Hasegawa, I. & Fukushima, T.
Consolidation of visual associative long-term memory in the temporal
cortex of primates. Neurobiol. Learn. Mem. 70, 197–211 (1998).
23. Topilko, P. et al. Multiple pituitary and ovarian defects in Krox-24
(NGFI-A, Egr-1)-targeted mic. Mol. Endocrinol. 12, 107–122 (1998).
24. Wolf, H. K. et al. NeuN: a useful neuronal marker for diagnostic
histopathology. J. Histochem. Cytochem. 44, 1167–1171 (1996).
25. Kosaka, T., Katsumaru, H., Hama, K., Wu, J. Y. & Heizmann, C. W.
GABAergic neurons containing the Ca2+-binding protein parvalbumin in
the rat hippocampus and dentate gyrus. Brain Res. 419, 119–130 (1987).
26. Katz, B. & Miledi, R. The role of calcium in neuromuscular facilitation.
J. Physiol. (Lond.) 195, 481–492 (1968).
27. Gerlai, R. A new continuous alternation task in T-maze detects
hippocampal dysfunction in mice: a strain comparison and lesion study.
Behav. Brain Res. 95, 91–101 (1998).
28. Rasmussen, M., Barnes, C. A. & McNaughton, B. L. A systematic test of
cognitive mapping, working memory and temporal discontiguity theories
of hippocampal function. Psychobiology 17, 335–348 (1989).
29. Garcia, J., Kimmeldorf, D. J. & Koelling, R. A. Conditioned aversion to
saccharin resulting from exposure to gamma radiation. Science 122,
157–158 (1955).
30. Strupp, B. J. & Levitsky, D. A. Social transmission of food preference in
adult hooded rats (Rattus norvegicus). J. Comp. Physiol. 98, 257–266
295
articles
(1984).
31. Rampon, C. et al. Enrichment induces structural changes and recovery
from nonspatial memory deficits in CA1 NMDAR1-knockout mice. Nat.
Neurosci. 3, 238–244 (2000).
32. Brakeman, P. R. et al. Homer: A protein that selectively binds metabotropic
glutamate receptors. Nature 386, 284–288 (1997).
33. Kato, A. et al. Novel members of the Vesl/Homer family of PDZ proteins
that bind metabotropic glutamate receptors. J. Biol. Chem. 273,
23969–23975 (1998).
34. Link, W. et al. Somatodendritic expression of an immediate early gene is
regulated by synaptic activity. Proc. Natl. Acad. Sci. USA 92, 5734–5738
(1995).
35. Lyford, G. L. et al. Arc, a growth factor and activity-regulated gene,
encodes a novel cytoskeleton-associated protein that is enriched in
neuronal dendrites. Neuron 14, 433–445 (1995).
36. Guzowski, J. F. et al. Inhibition of activity-dependent Arc protein
expression in the rat hippocampus impairs the maintenance of long-term
potentiation and the consolidation of long-term memory. J. Neurosci. 20,
3993–4001 (2000).
37. Walker, D. L. & Gold, P. E. Intrahippocampal administration of both the Dand L- isomers of AP5 disrupts spontaneous alternation behavior and
evoked potentials. Behav. Neural Biol. 62, 151–162 (1994).
38. Kogan, J. H. et al. Spaced training induces normal long-term memory in
CREB mutant mice. Curr. Biol. 7, 1–11 (1996).
39. Yin, J., Del Vecchio, M., Zhou, H. & Tully, T. CREB as a memory
modulator: induced expression of a dCREB2 activator isoform enhances
296
long-term memory in Drosophila. Cell 81, 107–115 (1995).
40. Changelian, P. S., Feng, P., King, T. C. & Milbrandt, J. Structure of the
NGFI-A gene and detection of upstream sequences responsible for its
transcriptional induction by nerve growth factor. Proc. Natl. Acad. Sci.
USA 86, 377–381 (1989).
41. Sakamoto, K. M. et al. 5´ upstream sequence and genomic structure of the
human primary response gene, EGR-1/TIS8. Oncogene 6, 867–871 (1991).
42. Davis, S., Vanhoutte, P., Pagès, C., Caboche, J. & Laroche, S. The
MAPK/ERK cascade targets both Elk-1 and cAMP response elementbinding protein to control long-term potentiation-dependent gene
expression in the dentate gyrus in vivo. J. Neurosci. 20, 4563–4572 (2000).
43. Impey, S., Obrietan, K. & Storm, D. R. Making new connections: role of
ERK/MAP kinase signaling in neuronal plasticity. Neuron 23, 11–14
(1999).
44. Bailey, C. H., Bartsch, D. & Kandel, E. R. Toward a molecular definition of
long-term memory storage. Proc. Natl. Acad. Sci. USA 93, 13445–13452
(1996).
45. Silva, A. J., Kogan, J. H., Frankland, P. W. & Kida, S. CREB and memory.
Annu. Rev. Neurosci. 21, 127–148 (1998).
46. Blum, S., Moore, A. N., Adams, F. & Dash, P. K. A mitogen-activated
protein kinase cascade in the CA1/CA2 subfield of the dorsal hippocampus
is essential for long-term spatial memory. J. Neurosci. 19, 3535–3544
(1999).
47. Davis, S., Bliss, T. V. P., Dutrieux, G., Laroche, S. & Errington, M. L.
Induction and duration of long-term potentiation in the hippocampus of
the freely moving mouse. J. Neurosci. Methods 75, 75–80 (1997).

A requirement for the immediate early gene Zif268 in the

Transcription

Similar documents

The Hammerling Experiment The Hammerling Experiment

when animal research hits the headlines

WSC 12-13 Conf 16 Layout

Session 467 Autoimmunity

7th Annual - Feinberg Labs

Degrees Will Be Granted To 136 Girls At 63ril Commencement

section home - Centre for Trophoblast Research

A Global View of Animal Experiments 2014

Medical advances and aniMal research - Pro-Test

View Full Page PDF