Role of infrapatellar fat pad in knee osteoarthritis

Transcription

Role of infrapatellar fat pad
in knee osteoarthritis
Lipid lowering drugs as potential therapeutic strategy
Proefschrift voorgelegd tot het behalen van de
graad van doctor in de Wetenschappen aan de
Universiteit Antwerpen te verdedigen door
Stefan Clockaerts
PROMOTORS
prof. dr. Gerjo Van Osch
prof. dr. Johan Somville
CO-P ROMOTOR
prof. dr. Luc De Clerck
Faculteit Geneeskunde en gezondheidswetenschappen
Departement Orthopedische Chirurgie en Traumatologie
Antwerpen 2013
Antwerpen
2012
Stefan Clockaerts
1
The research for this thesis was performed in collaboration with the department
of Orthopaedics of the Erasmus MC, Rotterdam
The research for this thesis was performed within the framework of the Erasmus
Postgraduate School Molecular Medicine and the TI Pharma consortium.
Printing of this thesis and organization of the defense was financially supported
by:
All rights reserved
University of Antwerp
Universiteitsplein 1, 2610 Antwerp
stefan.clockaerts@ua.ac.be
Layout: Nathalie Van Dijck
2
X
Rol van infrapatellair vet in artrose van de knie
Lipidenverlagende middelen als potentiële therapie
Proefschrift voorgelegd tot het behalen van de
graad van doctor in de Wetenschappen aan de
Universiteit Antwerpen te verdedigen door
Stefan Clockaerts
Promotors
prof. dr. Gerjo Van Osch
prof. dr. Johan Somville
Co-Promotor
prof. dr. Luc De Clerck
Voorzitter jury
prof. dr. G. Hubens
Juryleden
prof. dr. P. Parizel
prof. dr. G. Stassijns
Externe juryleden
prof. dr. F. Luyten
prof. dr. P. Verdonk
Faculteit Geneeskunde en gezondheidswetenschappen
Departement Orthopedische Chirurgie en Traumatologie
Antwerpen 2013
3
4
To my wife Katia and to my children Lisa and Mathis,
Without their support and encouragement
this thesis would not have been possible.
In fond memory of Marleen Goossens,
For her love and support, and her belief in my succeeding.
5
6
Table of contents
List of abbreviations
p. 9
Chapter 1: Introduction and aims of this thesis
p. 13
Chapter 2: The infrapatellar fat pad should be considered as an active
p. 27
osteoarthritic joint tissue: a narrative review
Chapter 3: Infrapatellar fat pad of patients with end-stage osteoarthritis
p. 41
inhibits catabolic mediators in cartilage
Chapter 4: Cytokine production by infrapatellar fat pad can be stimulated
p. 59
by interleukin 1β and inhibited by PPARα agonist
Chapter 5: Peroxisome proliferator activated receptor alpha agonist
p. 81
decreases inflammatory and destructive responses in
osteoarthritic cartilage
Chapter 6: Statin use is associated with reduced incidence and progression
p. 97
of knee osteoarthritis in the Rotterdam study
Chapter 7: General discussion, conclusion and clinical perspectives for
p. 115
the future
Biografie en curriculum vitae
p. 127
Nederlandse samenvatting
p. 135
Referenties
p. 149
Lekensamenvatting
p. 171
Dankwoord
p. 177
7
8
List of abbreviations
ACL
anterior cruciate ligament
ACTB
β-actin (used as house keeping gene)
ADAMTS
a disintegrin and metalloproteinase with thrombospondin motifs
AIA
adjuvant induced arthritis
B2M
β2-microglobulin (used as house keeping gene)
BMD
bone mineral density
BMI
body mass index
CRP
C reactive protein
CD
cluster of differentiation
CI
confidence interval
CTXII
cross-linked C-telopeptides of type II collagen
DMB
dimethylmethylene blue
DMEM
Dulbecco’s Modified Eagle Medium
DMOAD
disease modifying drugs for osteoarthritis
DMSO
dimethylsulfoxide
ELISA
enzyme-linked immunosorbent assay
ESR
erythrocyte sedimentation rate
FCM
fat conditioned medium
FGF
fibroblast growth factor
GAG
glycosaminoglycan
GAPDH
glyceraldehyde-3-phosphate dehydrogenase (used as house keeping gene)
GEE
generalized estimated equations
GM-CSF
granulocyte monocyte colony stimulating factor
HPRT1
hypoxanthine phosphoribosyltransferase 1 (used as house keeping gene)
IκBα
inhibitor κBα
IL
interleukin
iNOS
inducible nitric oxide synthase
IPFP
infrapatellar fat pad
ITS
insuline-transferrin-selenium
K&L
Kellgren and Lawrence
LIF
leukemia inhibitory factor
LDH
lactate dehydrogenase
LDL
low density lipoprotein
MCP
monocyte chemoattractant protein
MEC
medical ethical committee
MMP
matrix metalloproteinase
mPGES
microsomal prostaglandin synthase
NAMPT
nicotinamide phosphoribosyltransferase, pre-B-cell colony-enhancing
factor 1 (PBEF1) or visfatin
NFκB
nuclear factor κB
9
10
NO
nitric oxide
NSAID
non steroidal antiinflammatory drug
OA
osteoarthritis
OR
odd ratio
PG
prostaglandin
PPAR
peroxisome proliferator activated receptor
PTGS2
prostaglandin endoperoxide synthase 2, also known as cyclooxygenase 2
RA
rheumatoid arthritis
RT-PCR
real time polymerase chain reaction
SD
standard deviation
sPLA2
soluble phospholipase A2
TGF
transforming growth factor
TIMP
tissue inhibitor of metalloproteinases
TNF
tumor necrosis factor
VEGF
vascular endothelial growth factor
11
12
Chapter
1
Introduction and aims of this thesis
13
14
Osteoarthritis (OA) is the most common joint disease worldwide, affecting 9.6% of men
and 18% of women aged >60 years1. It can occur in any joint, but is most prevalent in
the hip, knee, joints of the hand, foot, ankle and spine2. OA accounts for 3% of global
years of living with disability, making it one of the leading causes of disability worldwide3.
OA is the most important cause of disability in people aged >65 years4. In addition, OA
is the second most common cause of chronic pain, after migraine5. The occurrence of
OA results in high direct and indirect costs. Direct costs such as contacts with health
professionals, medical examinations, drugs, and hospital stays accounted for a mean total
of 44.5 euro per OA patient per month in a cohort of city employees of Liege city6. In
addition, indirect costs such as sick-leave days were 66.3 euro per OA patient per month6.
Age is the strongest predicator for OA in general. Other risk factors for OA are more joint
specific (Table 1).
The United Nations estimate that the world population will increase at least by 2.5 billion between 2005 en 2050 and half of the increase will involve people over 60 years of
age. The rising prevalence of obesity (Figure 1), developing nation progress and lifestyle
changes also make that OA prevalence and the disease burden of OA will increase even
further the following years3.
Considerable evidence indicates that OA has a multifactorial etiology with a combination
of biomechanical, genetic, inflammatory and hormonal factors7-10. Abnormal biomechanical loading can be caused by joint malalignment, muscle weakness, partial or total
meniscectomy (in the knee joint), obesity or peripheral neuropathy 8, 11. The increased
repetitive overloading of joints leads to tissue damage or wear, or activates mechanoreceptors in chondrocytes and osteoblasts, which in turn induces chondrocyte apoptosis and
activates inflammatory pathways12-15.
Inflammation is known to play a role in the development of OA. Clinical features of
inflammation, such as joint pain, swelling and stiffness, are present during clinical examination16. Inflammatory mediators, such as interleukin (IL)1β and tumor necrosis
factor (TNF)α, are released by cartilage, bone, synovium and other joint tissues and are
capable of inducing matrix metalloproteinases (MMP), a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS) 4,5 and other catabolic factors. These
cartilage breakdown enzymes cause remodelling of the extracellular cartilage matrix.
Inflammatory mediators also induce the production of prostaglandin E2 by stimulating the expression or activity of cyclooxygenase (COX)2, microsomal prostaglandin E2
synthase 1 (mPGES1), and soluble phospholipase A2 (sPLA2). They also upregulate the
production of nitric oxide via inducible nitric oxide synthase (iNOS) and induce proinflammatory cytokines such as IL1β, TNFα, IL6, leukemia inhibitory factor (LIF), IL17,
IL18, and chemokines, including IL8. The expression of a number of proteins associated
with a differentiated chondrocyte phenotype, including collagen type II, are suppressed
by inflammatory mechanisms8. The suppression of productions of cartilage matrix molecules (mainly aggrecan and collagen type II) and the upregulation of cartilage break
down enzymes (MMPs and ADAMTS) result in an imbalance in favour of degradation.
15
Knee
Hip
Hand
Age
Age
Age
High body mass index
Genetics
Genetics
Genetics
(including congenital deformities)
Intense sport activities
Female sex
Physical activity
Grip strength
Physical activity
Previous injury
Occupation
Bone density
Previous injury
Hormone replacement
therapy (protective)
Vitamin D
Quadriceps strength
(protective)
Malalignment
Table 1: Risk factors for incidence/progression of osteoarthritis2, 44, 45
16
Figure 1: Changes in prevalence of overweight and obesity in adults in selected countries (International Obesity Task Force EU Platform Briefing Paper prepared in collaboration with
the European Association for the Study of Obesity March 15 2005 Brussels; EU Platform on
Diet, Physical Activity and Health)
17
At this moment, the relative importance of biomechanical versus inflammatory pathways
leading to OA is unclear. It is not unlikely that this is joint specific, but also, it is plausible
that the initiating factor or underlying risk factor determines the pathogenesis of OA.
In addition to biomechanical and inflammatory mechanisms, genetic abnormalities can
result in an early initiation of OA. For knee and hip OA, the influence of genetic factors
on the onset of OA is believed to be between 30 and 70 percent. Many of these genes
affect extracellular cartilage matrix and cartilage signalling molecules, and increase the
susceptibility of cartilage to loss of structure10, 17.
Cartilage damage is the hallmark of OA, however, other joint tissues such as synovium and
subchondral bone are also involved (Figure 2). Synovial inflammation is in part correlated
with clinical symptoms18. Synovitis may be induced by cartilage derived factors such as
IL1β or hyaluronan fragments that activate synovial macrophages19. These macrophages
respond by producing catabolic mediators that break down cartilage extracellular matrix,
which in turn enhances synovial inflammation and creates a vicious cycle20.
Subchondral bone changes are a main characteristic of OA. Osteophyte formation, bone
remodelling, subchondral sclerosis and attrition are visible on radiographs and are caused
by biomechanical and inflammatory triggers. Several of these features are not only present
in end stage OA, but also before loss of cartilage structure. It is likely that subchondral
bone changes can also contribute to progression of cartilage damage and that a mechanical and biochemical (through perforations in the subchondral plate or calcified cartilage)
interaction exists between cartilage and subchondral bone21, 22.
18
Figure 2: Schematic representation of the healthy versus osteoarthritic knee joint. Osteoarthritis is a disease of the whole joint, including the cartilage, synovium, subchondral bone and
blood vessels43.
19
The most important symptom of OA is pain, experienced intermittent and worst during
or after activities. It is also typically present after a period of inactivity or in the morning and resolves in less than 30 minutes. Another feature is disability with limitations in
mobility and day-to-day activities. OA is associated with depression and disturbed sleep,
which influences pain and disability38. During clinical examination, joint enlargement
due to joint effusion and/or bony swelling, restrictions in passive movement, crepitus,
locking and joint deformities may be visible.
Plain radiograph remains the gold standard in imaging of OA since it is inexpensive,
fast and easily available. Radiographs can only visualize calcified bone and therefore the
cartilage can only be evaluated indirectly by observing joint space. Other features of OA
on radiographs are osteophytes, joint deformities and subchondral bone sclerosis. Other
imaging techniques such as computed tomography (CT) scan, MRI and ultrasound have
the major disadvantage of being time consuming, expensive and/or require higher radiation exposure, while adding insufficient amount of information to be used routinely for
OA.
Another potential technique to assess and diagnose OA is the use of biomarkers. Biomarkers are molecules generated by the joint metabolism or OA disease process and are present
in synovial fluid, blood or urine. More than 20 biomarkers have already been described
in literature. These are markers of cartilage, bone and synovium synthesis or degradation.
Cross linked C-telopeptide of type II collagen (CTXII) in urine and cartilage oligomeric
matrix protein (COMP) in serum have been studied most extensively, but similar to all
biomarkers, they do not seem effective to aid diagnosis or prognosis in individual OA
patients at this moment39.
An effective diagnostic and prognostic technique to evaluate OA may identify patients
at risk for OA, which may benefit from (future) preventive strategies. A more precise
diagnosis of OA could differentiate the choice of therapy for patients and would improve
clinical studies for OA by defining the study population more precisely.
Treatment of OA should aim at reducing pain and improving joint function. In addition,
therapeutic strategies should prevent disease progression or restore joint tissues. Possible
non-pharmacological interventions are: informing the patient about OA, improvement
of social and mental wellbeing to decrease the influence of psychological co-morbidity,
exercise to improve muscles and aerobic condition, and weight reduction of at least 10%.
Braces, canes or other forms of joint protection, insoles, lasers, transcutaneous electrical nerve stimulation, ultrasound, electrotherapy, or acupuncture have only limited effect sizes40. Oral analgetics such as paracetamol or non-steroidal anti-inflammatory drugs
(NSAIDs) can be used to decrease pain, and if ineffective, weak opioids and narcotic
analgesics can be used during a short period if no side effects subside. Topical NSAIDs
have been reported to be as effective as oral NSAIDs40. Today, no effective disease modifying drugs exist for OA. Nutraceuticals such as glucosamines and chondroitin sulphate,
joint lubrificans such as hyaluronic acid, or the IL1β inhibitor diacerein have still not
20
fully proven their efficacy in well designed clinical trials or meta-analysis. Other potential
disease modifying drugs targeting cartilage catabolism (inhibitors of MMPs, ADAMTS,
iNOS or cell signalling pathways), cartilage anabolism (e.g. transforming growth factor
β, bone morphogenetic protein, fibroblast growth factor), synovial layer or subchondral
bone (e.g. biphosphonates, calcitonin) are still being investigated41. At this moment, total
joint replacements are the most effective treatment available with significant decreases in
out-of-pocket expenses for patients and use of drugs. In addition, studies report patient
satisfaction rates for hip and knee replacement up to 100% and 75% respectively, even
after 8 years42.
Taken together, although the physical and economical burden of OA is high and will
increase in the future, effective disease modifying drugs are still unavailable. More knowledge is required concerning the etiological mechanisms of the OA disease process to
elucidate new targets for potential disease modifying drugs for OA.
21
The link between obesity and OA
Outcome of multiple potential underlying disease
processes
Obesity and high body mass index are associated with a higher risk of developing osteoarthritis12. Changed kinetics of weight-bearing joints can lead to the initiation and progression of OA, and obesity could enhance this mechanism by increasing loading forces23, 24.
However, the risk of developing OA in non-weight-bearing joints such as joints of the
hand, is also higher in obese than in healthy people25-28. This correlation indicates that
alternative mechanisms might be responsible for the link between obesity and OA.
There is growing evidence from epidemiological studies that the OA disease process might
be influenced by metabolic diseases associated with obesity. Observational studies have
described a correlation between atheromatous vascular disease and OA32, but the causal
relationship is still subject of investigation. The main hypothesis is that venous outlet obstruction and intraosseous hypertension in the subchondral bone might impair the supply of nutrients to the overlying cartilage plate and lead to an alteration in the mechanical
properties of the bone. The impaired mechanical properties of the bone may in turn result
in a reduced ability of the bone to absorb forces, which enhances the susceptibility of
cartilage to damage during repetitive loadings30.
Hypercholesterolemia and hypertriglyceridemia have also been related to incidence and
progression of OA in epidemiological studies. The correlation between dyslipidemia and
OA might be the result of the immunomodulatory effects of fatty acids on cartilage. n-3
polyunsaturated fatty acids lower GAG release by cartilage under inflammatory conditions whereas n-6 polyunsaturated fatty acids increase GAG release under inflammatory
conditions31-36.
Alternatively, the correlation between BMI and OA might also be explained by the increased secretion of cytokines (e.g. IL6, monocyte chemoattractant protein 1) and adipokines (e.g. leptin, resistin, nicotinamide phosphoribosyltransferase) by adipose tissue in
people with obesity29. This low grade systemic inflammation may enhance inflammatory
processes in the OA joint. Interestingly, the increased release of cytokines and adipokines
by adipose tissue is not only due to the presence of a larger amount of adipose tissue in
obese people. There is also an increased cytokine/adipokine production by visceral adipose
tissue70 compared to subcutaneous adipose tissue. This difference in endocrine behavior
of adipose tissue located at different anatomical sites was confirmed by epidemiological studies investigating cardiovascular risk factors, that indicate that the ratio between
visceral/subcutaneous tissue shows higher associations with cardiovascular disease than
body mass index (BMI)208. Although literature is inconclusive regarding the mechanisms
leading to the difference in adipose tissue phenotype, the anatomic location of adipose
tissue may play a significant role in its behavior as endocrine organ. Different responses
of adipose tissues to stress related interleukin 1β (IL1β) may in part explain adipose tissue distribution and variation in production57. In this regard, it is interesting to notice
22
that the knee joint contains a large infrapatellar fat pad (IPFP) that might act as a third
type of adipose tissue, next to visceral and subcutaneaous adipose tissue. Considering its
anatomical location in the joint, the IPFP is prone to be exposed to high concentrations
of IL1β present in arthritic joints.
Fain et al70 demonstrated that not just the adipocytes, but the macrophages are mainly
responsible for the secretion of inflammatory mediators by adipose tissue. Macrophages
are present in high amount in visceral adipose tissue. Studies indicate that macrophages
also drive inflammatory and destructive responses in the OA joint113. These macrophages
were assumed to be present in the synovium, but are even likely to be present in the IPFP,
making the IPFP a potential source of inflammation in the joint. This is confirmed by
studies reporting different concentrations of adipokines in the synovial fluid and serum,
which cannot be explained by permeability of the inflamed synovium alone; resistin for
example, is present in lower amount in synovial fluid than leptin, although its molecular
weight is similar79,80,95,109. This was the first indication that production by local, intra-articular adipose tissue determines cytokine/adipokine concentration in the synovial fluid.
Although numerious studies have demonstrated the influence of BMI on visceral and
subcutaneous cytokine production70, no data are available yet conconcerning the influence of BMI on cytokine or adipokine production by IPFP.
23
24
Aims and scope of this thesis
The association between obesity and OA exists due to different etiological mechanisms.
Next to increased joint loading, metabolic and inflammatory pathways related to visceral
adipose tissue, data indicate that the IPFP may act as a local source of inflammatory mediators influencing the cartilage.
The aim of this thesis is to investigate:
1) the role of intra-articular adipose tissue, such as the infrapatellar fat pad (IPFP)
in knee OA.
2) whether lipid lowering drugs, such as statins and fibrates, can be considered as
disease modifying drugs for OA (DMOADs) because they target inflammatory
and destructive processes in IPFP, but also cartilage and synovium.
In Chapter 2, we performed a review of literature to examine the potential role of intraarticular adipose tissue in the OA disease process of the knee joint. Based on these results,
we described the hypothesis that the infrapatellar fat pad may influence the OA disease
process by the excretion of cytokines, adipokines and growth factors directly into the knee
joint. We tested this hypothesis by examining the effect of the infrapatellar fat pad on
inflammatory and destructive processes in cartilage (Chapter 3). We analyzed cytokines
secreted by the infrapatellar fat pad and examined whether their production is influenced
by body mass index or by inflammatory stimuli that are also present in osteoarthritic
synovial fluid (Chapter 4). Then we analyzed whether we could counteract the production of inflammatory mediators by adding a ligand for Peroxisome Proliferator Activated
Receptor (PPAR)α. PPARα ligands are lipid lowering drugs such as fibrates, that also
exert anti-inflammatory effects on blood vessels, kidneys and the liver. To investigate their
effect, we co-cultured infrapatellar fat pad explants with this drug (Chapter 4). In addition, we performed culture experiments adding PPARα ligands to synovial membrane
(Chapter 4) and cartilage (Chapter 5) explants to examine their anti-inflammatory and
anti-destructive effects on both joint tissues. To investigate the hypothesis that lipid lowering drugs might inhibit the OA disease process, we analyzed the association between
statin use and OA progression of the knee and the hip in a large population based cohort
study (Chapter 6). Finally, Chapter 7 presents the general discussion in which I discuss
and summarize the results of the work performed and elaborate on potential applications
or future research.
25
26
Chapter
2
The infrapatellar fat pad should be considered as an
active osteoarthritic joint tissue: a narrative review
S. Clockaerts, Y.M. Bastiaansen – Jenniskens, J. Runhaar, G.J.V.M. Van Osch,
J.F. Van Offel, J.A.N. Verhaar, L.S. De Clerck, J. Somville
Osteoarthritis Cartilage. 2010 Jul;18(7):876-82. Epub 2010 Apr 22. Review.
27
Abstract
Introduction
Osteoarthritis (OA) of the knee joint is caused by genetic and hormonal factors, and by
inflammation in combination with biomechanical alterations. It is characterized by loss
of articular cartilage, synovial inflammation and subchondral bone sclerosis. Considerable evidence indicates that the menisci, ligaments, periarticular muscles and the joint
capsule are also involved in the OA process. This paper will outline the theoretical framework for investigating the infrapatellar fat pad as an additional joint tissue involved in the
development and progression of knee-OA.
Methods
A literature search was performed in Pubmed from 1948 untill October 2009 with keywords intrapatellar fat pad, Hoffa fat pad, intraarticular adipose tissue, knee, cartilage,
bone, cytokine, adipokine, inflammation, growth factor, arthritis, osteoarthritis.
Results
The infrapatellar fat pad is situated intracapsularly and extrasynovially in the knee joint.
Besides adipocytes, the infrapatellar fat pad from patients with knee-OA contains macrophages, lymphocytes and granulocytes, which are able to contribute to the disease process of knee-OA. Furthermore, the infrapatellar fat pad contains nociceptive nerve fibers
that could in part be responsible for anterior pain in knee-OA. These nerve fibers secrete substance P, which is able to induce inflammatory responses and cause vasodilation,
which may lead to infrapatellar fat pad edema and extravasation of the immune cells. The
infrapatellar fat pad secretes cytokines, interleukins, growth factors and adipokines that
influence cartilage by upregulating the production of matrix metalloproteinases, stimulating the expression of pro-inflammatory cytokines and inhibiting the production of
cartilage matrix proteins. They may also stimulate the production of pro-inflammatory
mediators, growth factors and matrix metalloproteinases in synovium.
Conclusion
These data are consistent with the hypothesis that the infrapatellar fat pad is an osteoarthritic joint tissue capable of modulating inflammatory and destructive responses in kneeOA.
28
Chapter 2: The infrapatellar fat pad should be considered as an active osteoarthritic joint tissue: a narrative review
Introduction
In the recent past, knee osteoarthritis (OA) was considered as a pathologic condition that
affects cartilage and bone. We now appreciate that all joint tissues, including the synovium, menisci, ligaments, periarticular muscles and the joint capsule are involved43. In
addition to these structures, the knee joint also contains adipose tissue: the infrapatellar
fat pad (IPFP)46. Although it has been known that adipose tissue secretes inflammatory
mediators that are able to influence cartilage and synovium, a theoretical framework for a
role of the IPFP in knee-OA has not been described47.
Considering the intraarticular location of the IPFP, the metabolic properties of adipose
tissue and the fact that the OA disease process involves all the joint tissues, it is likely
that the IPFP could also be involved in knee-OA. Our hypothesis is that immune cells
could infiltrate IPFP as a result of knee-OA and that the combination of immune cells,
nerve fibers and adipocytes could then contribute to the disease process by producing
and releasing inflammatory mediators, capable of modifying inflammatory and destructive responses in cartilage and synovium (Figure 1). In this article, an overview is given of
literature that supports this hypothesis.
29
Articular cartilage
Infrapatellar
fat pad
INFLAMMATION
Synovial layer
Fat pad edema
Extravasation of WBC
Synovial fluid
Interleukins
Growth factors
Nitric oxide
Leukotrienes
Prostaglandines
Lymphocytes
Granulocytes
Monocytes
Blood
vessel
Substance P
Leptin
Adiponectin
NAMPT
Resistin
Adipocytes
Sensory nerve
(C-fibre)
Articular cartilage
Figure 1: A schematic overview of the infrapatellar fat pad as an active osteoarthritic joint
tissue. The infrapatellar fat pad shows signs of inflammation secondary to osteoarthritis of the
knee joint. The infrapatellar fat pad contains adipocytes and has an increased number of immune cells such as lymphocytes, monocytes and granulocytes that have migrated from the blood
circulation. Substance P nerve fibers are also present in the infrapatellar fat pad and contribute to the immune regulation within the infrapatellar fat pad by the secretion of substance P.
Substance P is able to induce extravasation of white blood cells and is also known to enhance
inflammation in white blood cells. The combination of these cells is able to secrete adipokines
such as leptin, adiponectin, NAMPT and resistin, but also interleukins, growth factors, nitric
oxide, leukotrienes and prostaglandins which have shown to influence cartilage, synovium and
osteophyte formation.
Methods
A literature search was performed in Pubmed from 1948 untill October 2009 using key
words infrapatellar fat pad, Hoffa fat pad, intraarticular adipose tissue, knee, cartilage,
bone, cytokine, adipokine, inflammation, growth factor, arthritis, osteoarthritis. We excluded papers that were not written in English. Cadaver knee joints were dissected to
make photographs and figures.
30
Results
Inflammation in OA
Considerable evidence indicates that OA has a multifactorial etiology with a combination
of biomechanical, genetic, inflammatory and hormonal factors7-10. Abnormal biomechanical loading is an etiological factor in OA that can be caused by partial or total meniscectomy, malalignement, joint instability, muscle weakness or peripheral neuropathy, and
obesity8, 11. In addition to tissue damage or wear, repeated overloading of joints activates
mechanoreceptors in chondrocytes and osteoblasts, which in turn activates inflammatory
pathways that lead to the production of cartilage degradation mediators12-15.
Several lines of evidence indicate that genetic abnormalities can result in an early initiation of OA. For knee-OA, the influence of genetics on the onset of OA is believed to be
between 39 and 65 percent. Many of these genes affect extracellular cartilage matrix and
cartilage signalling molecules10.
Inflammatory pathways are known to play a role in the development of OA. Clinical features of inflammation, such as joint pain, swelling and stiffness, are indeed present during
clinical examination16. Inflammatory mediators, such as interleukin (IL)1β and tumor
necrosis factor (TNF)α, are released by cartilage, bone, synovium and other surrounding joint tissues and are capable of inducing matrix metalloproteinases, aggrecanases and
other catabolic genes8, 48. This causes remodeling of the extracellular cartilage matrix.
These inflammatory mediators induce the production of prostaglandin E2 by stimulating
the expression or activity of cyclooxygenase (COX)2, microsomal prostaglandin E2 synthase 1 (mPGES1), and soluble phospholipase A2 (sPLA2)48. They also up-regulate the
production of nitric oxide via inducible nitric oxide synthase (iNOS) and induce proinflammatory cytokines such as IL1, TNFα, IL6, leukemia inhibitory factor (LIF), IL17,
IL18, and chemokines, including IL8. The expression of a number of genes associated
with a differentiated chondrocyte phenotype, including collagen type II are suppressed
by inflammatory mechanisms 8, 48, 49. Transforming growth factor β produced by synovial
macrophages, is able to induce the formation of osteophytes in animal studies50, 51.
Inflammatory events in the subchondral bone layer may induce hypertropic differentiation of chondrocytes or stimulate chondrocytes in a paracrine manner52-54. However, it is
not known whether the subchondral bone inflammation is partly caused or stimulated by
inflammatory mediators present in osteoarthritic joints.
Obesity is associated with OA
Obesity and high body mass index are associated with a higher incidence risk of
osteoarthritis12,24,55,56. Changed kinetics of weight-bearing joints can lead to the initiation
and progression of OA, and obesity could enhance this mechanism by increasing the
loading forces23,24. However, non-weight-bearing joints such as joints of the hand also
have higher incidence risk for OA in obese people compared to healthy people25-28, 45. Fur-
31
thermore, Toda et al showed that the loss of body fat is more beneficial for symptomatic
relief in knee-OA than the loss of body weight58. Wang reported a correlation between the
risk of primary knee or hip replacement for osteoarthritis and central obesity or adipose
mass. The latter could be explained by the higher amount of visceral adipose tissue, which
is known to secrete more pro-inflammatory cytokines compared to peripheral subcutaneous adipose tissue29. These data suggest that adipose tissue is an endocrine organ that is
able to exert metabolic effects on the joint tissues.
The infrapatellar fat pad or Hoffa’s fat pad is located in the
knee joint
The IPFP or Hoffa fat pad was first described by Albert Hoffa in 190459. It is situated in
the knee underneath the patella, between the patellar tendon, femoral condyle and tibial
plateau, where it completely fills the potential spaces between these structures (Figure 2).
Therefore, it is located closely to the synovial layers and cartilage surfaces of the knee joint
(Figure 2 and 3). The IPFP is composed of a fibrous scaffold, on which constitutional fat
tissue is embedded, which is developed under the influence of sex hormones. The joint
facing surface is covered by the antero-inferior synovial membrane, thus the IPFP localization can be described as intracapsular and extrasynovial60, 61. It attaches to the lower
border of the inner non-articulating surface of the patella, to the notch between the two
condyles of the femur by running continuously with the infrapatellar plica posterosuperiorly, and to the periosteum of the tibia and the anterior part of the menisci46 (Figure 3).
An extensive anastomotic network of vessels protects the IPFP against necrosis during
extensive surgical exposures or arthroscopic procedures62. Only the central portion of the
IPFP has a more limited vascular network. It is supplied by branches of the superior and
inferior genicular artery. The inferior portion of the anastomotic ring passes through the
IPFP and supplies part of the patella60, 63, 64.
Many studies mention that the IPFP is innervated by the posterior articular branch of
the tibial nerve.65-67 However, in one of the most detailed studies about innervation of
the knee, Gardner68 describes branches rising from the saphenous, tibial and obturator
nerves, and the nerve to the vastus medialis, innervating the anteromedial portion of
the IPFP. The anterolateral part of the IPFP is innervated by articular branches from the
nerve to the vastus lateralis, the tibial nerve, recurrent peroneal nerve and common peroneal nerve. These branches accompany blood vessels throughout the IPFP68.
IPFP facilitates the distribution of synovial fluid and may act to absorb forces through
the knee joint. Other functions of the IPFP have not yet been determined. Pathologic
processes that occur within the IPFP are Hoffa disease, chondromas, nodular synovitis
and surgery related complications.
Other small fat pads of the knee joint have been mentioned: a posterior knee fat pad, an
anterior suprapatellar fat pad (quadriceps) and a posterior suprapatellar fat pad (prefemoral) (Figure 2)69.
32
4
3
patella
femur
1
2
tibia
Figure 2: A midsagittal plane of the knee joint. This figure shows the location of the infrapatellar fat pad (1) and also the presence of other smaller fat pads in the knee joint: posterior fat
pad (2), anterior suprapatellar fat pad (3) and posterior suprapatellar fat pad (4). The infrapatellar fat pad is located inferior from the patella and posterior from the patella tendon. It is
covered by the joint capsule (white arrow) from anterior and the synovium (black arrow) on
his joint facing surface. Thus it is located intracapsular, but extrasynovial. Also notice its close
contact with articulating cartilage surfaces.
33
Figure 3: A dissection of a left knee in flexion showing the infrapatellar fat pad from an anterior view (broken lines). The patella tendon has been dissected proximally and retracted to
show the joint facing surface of the patella and the infrapatellar fat pad. The infrapatellar fat
pad is located in the knee joint and closely to the articulating cartilage surfaces and the synovium. Notice the attachments of the infrapatellar fat pad at the lower border of the patella
(black arrows). The attachment at the intercondylar region with the ligamentum mucosum
(white arrow) is located before the anterior cruciate ligament.
34
The infrapatellar fat pad contains cells capable of modifying
the OA disease process
Once it was thought that white adipose tissue acted only as a reservoir for excess calories
that are stored as triacylglycerols. After the discovery of leptin in 1994 it became tangible
that the white adipose tissue could play an active role in physiologic and pathologic processes, including immunology and inflammation70, 71. The adipose tissue is considered as
a specialized form of connective tissue, which contains large numbers of adipocytes, fibroblasts, macrophages, leukocytes, and other cells involved in inflammation. These cells
are present in an intercellular matrix consisting of collagen and elastic fibers, on which
network epithelial structures can rest and muscle and nervous tissue are embedded70.
The IPFP is a very sensitive structure together with the synovium72. This is due to the
presence of peptidergic C-fibers, nerve fibers staining positive for substance P73. The human OA IPFP contains even more small sized nerves compared to medium- or large sized
substance P nerves74. This suggests that the IPFP contains part of the terminal sensory
innervation for the knee joint and could be an important source of pain in knee-OA.
The highest rates of substance P nerves are found around vessels of IPFP: substance P
causes vasodilation that leads to extravasation of immune cells and causes IPFP edema.
In turn, edema leads to soft tissue impingement, ischemia and lipomatous tissue necrosis73. The presence of IPFP edema was investigated in vivo by Lawson et al. on MRI in
patients with Lyme arthritis. Results of this study indicate that IPFP edema can develop
as a result of arthritis75. Ischemia induces the release of neuro-tropin neural growth factor,
which in turn activates the release of substance P. This type of autostimulation may cause
chronicity of inflammation of the IPFP in joint diseases73. O’Shaughnessy et al. showed
that substance P induces the production of nitric oxide in rheumatoid synoviocytes and
experimental models of inflammation76. Furthermore, it stimulates IL1β, TNFα, nuclear
factor κB and superoxide anion production in various cell types. Substance P has also a
strong effect on fibroblast activation and extracellular matrix production74.
Sympathetic nerve fibers are known to secrete anti-inflammatory norepinephrine and
endogenous opiods that are able to inhibit pain perception in a bidirectional cross talk
with substance P fibers74. In healthy synovium the density of sensory versus sympathetic
nerve fibers is balanced at 1:177. In synovium from rheumatoid arthritis patients, the
preponderance of the substance P positive nerve fibers over sympathetic nerve fibers is
approximately 8:1. For the IPFP, the ratio of sensory versus sympathetic nerve fibers is
higher in patients with anterior knee pain after total knee arthroplasty than in patients
with knee-OA74. Whether the density of sensory nerve fibers was higher than normal in
the IPFP of knee-OA patients has not yet been established. Based on these findings, we
conclude that substance P nerves are present in IPFP and can act as inflammatory cells,
besides the well described sensory function of these nerves.
An increased amount of immune cells, edema, fat necrosis and fibrosis was reported in
subsynovial IPFP in animal models of induced arthritis, together with signs of alterations
35
in joint diseases that involve synovial proliferation on MRI images60, 78-81. Inflammatory
cell infiltrations were present in 36 percent of Hoffa fat pad specimens collected from patients with knee-OA while severe fibrosis was present in 33 percent of cases82. An osteoarthritis animal model revealed that the wet weight of IPFP in monoiodoacetate injected
joints was 2 fold higher than the vehicle controls. Numbers of neutrophils, eosinophils
and basophils, and in particular monocytes were increased66. Jedrzejczyk et al. also found
lymphocytes in the IPFP83.
The infiltration of immune cells in synovium could contribute to the OA disease process
by the production of pro-inflammatory and/or pro-fibrotic cytokines50, 51, 84, 85. Based on
the anatomical location of the IPFP, it is possible that similar processes exist for immune
cells in the IPFP. Cartilage breakdown molecules may activate monocytes by binding to
receptors that are associated with receptors of innate immunity86. Activated macrophages
produce various growth factors, cytokines and enzymes that enhance osteophyte formation, mitigate cartilage breakdown by matrix metalloproteinase activity, induce joint effusion by vasodilation and might influence subchondral bone metabolism. Neutrophils
play a role in cartilage breakdown and necrosis of adipose tissue by the production of
cytokines such as IL1, IL8 and MMP866, 87. Eosinophils and basophils release histamine
that increases production of matrix degrading enzymes and pro-inflammatory mediators
in synovial fibroblasts and cartilage88. Lymphocytes from OA joints express Th1 cytokines
which can directly degrade cartilage or activate macrophages through cell-cell interaction
to produce cartilage degrading mediators89.
We conclude that IPFP contains inflammatory cells and substance P nerve cells that
could be able to influence inflammatory and destructive responses in knee-OA. Substance
P nerve cells in the IPFP could also play a role in the pain pathophysiology of knee-OA.
Adipose tissue as an endocrine organ
Adipose tissue secretes cytokines, interleukins, growth factors and adipokines in an endocrine, autocrine or paracrine manner. These inflammatory mediators are found in synovial fluid and are able to influence the cartilage and synovium metabolism47, 90, 91. The
immune cells present in the adipose tissue could be responsible for most of the production and release of inflammatory mediators, except for leptin and adiponectin, which are
mainly secreted by adipocytes70 (Figure 1).
Interesting adipokines are leptin and adiponectin, as they are secreted in high amounts by
adipose tissue70, 90, 92. Leptin was thought to be beneficial for OA, because injection of leptin in a knee joint upregulated proteoglycan synthesis, production of growth factors and
stimulated its own synthesis in different joint tissues47, 90. However, recent research has
contradicted this idea. At present, leptin is known to stimulate IL1β production, to increase the effect of pro-inflammatory cytokines and induce the expression of MMPs in the
OA cartilage47, 93-97. Leptin is able to activate no synthase synergistically with interferon-γ
or to enhance activation of NO synthase 2 by IL194. Leptin also facilitates the activation
36
of macrophages, neutrophils, dendritic cells, natural killers cells and Th1 cells98.
Adiponectin has been cited as a protective adipokine against obesity and vascular diseases, but might act as a pro-inflammatory agent in joint diseases99. Adiponectin induces
MMP1 and IL6 production in synovial fibroblasts, which are known to have adiponectin
receptors100. The presence of adiponectin receptors in chondrosarcoma cells, capable of
inducing type 2 nitric oxide synthase, suggests that adiponectin receptors are also present in normal or OA chondrocytes101. Indeed, adiponectin treated chondrocytes produce
IL6, MMP3, MMP9 and monocyte chemoattractant protein(MCP)192.
Other adipokines are resistin and nicotinamide phosphoribosyltransferase (NAMPT).
Resistin is elevated after traumatic joint injuries and induces production of inflammatory
cytokines and loss of proteoglycans in cartilage. The injection of resistin into mice joints
induces arthritis-like conditions99, 102. NAMPT seems to have a pro-inflammatory effect
on chondrocytes and synovial fibroblasts99, 103, 104. The role of adipokines on bone is not
yet clarified. Leptin and resistin may stimulate bone formation and adiponectin might
have an inhibitory effect105.
Many other inflammatory mediators such as IL1 α and β, TNFα, IL4, IL6, IL8, IL10,
IL18, IL1 receptor antagonist, MCP1, prostaglandin E2, nitric oxide and growth factors
such as vascular endothelial growth factor (VEGF), transforming growth factor (TGF)β
and fibroblast growth factor (FGF)2 are produced by adipose tissue and have shown to
be involved in joint diseases47, 70.
IPFP produces and releases inflammatory mediators in the
knee joint
The adipokines leptin, resistin and adiponectin are found in the synovial fluid90, 91, 96, 106.
The concentration of adipokines in the synovial fluid differs from serum levels. Resistin
and adiponectin are present in lower amounts in the synovial fluid than in circulating
blood, while leptin is present in higher amounts95, 106. A correlation between leptin concentration in the synovial fluid and severity of knee-OA has been shown by Ku et al107.
The presence of adipokines in the knee joint can not be explained by a higher permeability of the inflamed synovium alone, because resistin is present in lower concentration in
synovial fluid than leptin, although its molecular weight is similar108, 109. Leptin is present in higher amount in synovial fluid from female OA patients, but interestingly not in
male OA patients. Except for adiponectin, the synovial fluid levels of resistin and leptin
appears to be higher for women then for men. This effect can not be explained by the
higher serum levels of leptin in woman, caused by influence of sex hormones, because the
synovium fluid/serum level ratios between men and women are also different95.
Ushiyama et al showed that the human OA IPFP contained significant protein levels of
FGF2, VEGF, TNFα and IL6. These cytokines were also measured in the synovial fluid.
Although synovial fluid levels and IPFP content did not correlate, a similar distribution
of FGF2 and VEGF content was found in human OA synovium compared to IPFP110.
Presle showed that cultured explants of IPFP produced large amounts of adiponectin and
37
leptin, although surprisingly explants obtained from osteophytes produced even more
leptin95.
The amount of IL6, soluble IL6 receptor and adiponectin that is produced by the IPFP is
higher than in subcutaneous adipose tissue from obese people, although the production
of leptin is lower. These data, together with a decrease of genes related to lipid metabolism in the IPFP, indicate that the IPFP should be regarded as adipose tissue with its own
characteristics111.
Intra-articular production of inflammatory mediators can occur in different joint tissues
such as cartilage, synovium, menisci or osteophytes95. Based on these findings, we conclude that IPFP is also able to produce and excrete important inflammatory mediators
directly into the knee joint.
38
Discussion
This article reviews some significant points that could explain the role of the IPFP in the
disease process of knee-OA.
Inflammation plays an important role in the etiopathogenesis of OA. The association
between obesity and OA can not only be explained by biomechanical alterations, but also
by the inflammatory properties of adipose tissue. The IPFP can be regarded as a special
form of adipose tissue due to its location, which is in close contact with synovial layers
and articulating cartilage.
Infiltration of immune cells has been demonstrated in the IPFP in human OA joints and
in animal models for arthritis and OA. Furthermore, nociceptive nerve fibers are present
that can cause anterior pain and are capable of maintaining inflammation by the release of
substance P. The combination of adipocytes, immune and nerve cells IPFP produce and
secrete adipokines, but also cytokines, chemokines and growth factors that are capable of
altering cartilage and synovium.
Further in vitro and in vivo studies should be performed to confirm the release of inflammatory mediators in the synovial compartment. It should be investigated whether
the IPFP from knee-OA patients produces more inflammatory mediators than healthy
IPFP and whether IPFP from obese people differs from non-obese people in content
or production of cytokines. Furthermore, adipose tissue secretes anti-inflammatory mediators such as FGF2, IL4 or IL10, which could have beneficial effects on cartilage and
synovium70. Therefore, effects of the combination of all factors secreted by the IPFP on
cartilage should be explored. It should be investigated whether substance P fibers are present in higher amounts in the IPFP from osteoarthritic knees as compared to healthy knee
joints. Furthermore, their potential role in pain and inflammation in knee-OA should be
elucidated.
We conclude that IPFP could play an important role in the initiation and progression of
knee-OA and should be further investigated in search for new therapeutic strategies.
Acknowledgements
The authors would like to thank D. Malan and F. Van Glabbeek for providing anatomical
figures and photographs. The research of Yvonne Bastiaansen-Jenniskens is funded by the
Dutch Arthritis Association and Top Institute Pharma.
39
40
Chapter
3
Infrapatellar fat pad of end-stage osteoarthritis
patients inhibits catabolic mediators in cartilage
Y.M. Bastiaansen-Jenniskens, S. Clockaerts, C. Feijt, A. Zuurmond,
V. Stojanovic-Susulic, C. Bridts, L. De Clerck, J. DeGroot, J.A.N. Verhaar,
M. Kloppenburg, G.J.V.M. van Osch
Ann Rheum Dis. 2012 Feb;71(2):288-94. Epub 2011 Oct 13.
41
Abstract
Objective
Adipose tissue is known to release inflammatory cytokines and growth factors. In this
exploratory study, we examined whether the infrapatellar fat pad (IPFP), closely located
to cartilage in the knee joint, can affect cartilage metabolism. In addition we analyzed
whether the macrophage types present in IPFP could explain the effect on cartilage.
Methods
IPFP explants obtained during total knee replacement of 29 OA patients were used to
make fat conditioned medium (FCM). Explants of bovine cartilage were cultured with
or without FCM. Nitric oxide (NO) and glycosaminoglycan (GAG) release, and gene
expression of matrix degrading enzymes in cartilage were analyzed. To stimulate catabolic
processes in the cartilage IL1β was added and the effect of 6 FCMs was evaluated. The
presence of different types of macrophages (CD68+, CD86+, and CD206+) in OA IPFPs
was compared with subcutaneous adipose tissue samples and IPFP samples from patients
with an anterior cruciate ligament (ACL) rupture.
Results
FCM alone reduced NO and GAG release and MMP1 gene expression by the cartilage.
Moreover, when catabolic conditions were enhanced with IL1β, FCM inhibited NO
production, MMP1 and MMP3 gene expression, and increased collagen type II gene
expression. Significantly more CD206+ cells were present in OA IPFP samples than in
subcutaneous fat or ACL IPFP samples.
Conclusion
In contrast to our expectations, medium conditioned by end-stage OA IPFP inhibited
catabolic processes in cartilage. CD206+ cells present in the IPFPs used for making the
fat conditioned medium might have contributed to the inhibition of catabolic processes
in the cartilage.
42
Chapter 3: Infrapatellar fat pad of end-stage osteoarthritis patients inhibits catabolic mediators in cartilage
Introduction
Osteoarthritis (OA) is characterized by cartilage damage, bone alterations, but also inflammation of the synovium is often seen in OA. OA is a multifactorial disease with a
greater incidence in females, obese and older subjects112. Isolation and energy storage are
two well-known and important functions of adipose tissue. Adipose tissue is also known
to produce inflammatory mediators and adipokines such as interleukin (IL)1, IL6, IL8,
monocyte chemotattractant protein (MCP)1, leptin, adiponectin and others114, 115.
The infrapatellar fat pad (IPFP) is an integral part of the joint together with cartilage,
ligaments, menisci and synovium. The main role of IPFP is to facilitate distribution of
synovial fluid and distribute mechanical forces through the knee joint. The IPFP is situated in the knee underneath the patella, between the patellar tendon, femoral condyle
and tibial plateau116 and thus located closely to the synovial layers and cartilage surfaces
where it can influence these structures.
Several adipokines and cytokines are known to be locally produced in the knee joint by
the IPFP95, 110, 117, 118, making the IPFP able to influence inflammatory processes in the
knee. In addition, the IPFP was recently found to be a high producer of IL6, even higher
than subcutaneous adipose tissue111. Adipose tissue consists of adipocytes lying in the
stromal vascular fraction and is often infiltrated by immune cells such as macrophages. In
addition, T-cells, B-cells, natural killer cells and mast cells are also found in adipose tissue119-123. Many secreted proteins are derived from the non-adipocyte fraction of adipose
tissue124 and it is even suggested that most of the cytokines produced by the adipose tissue
are macrophage-derived70, 125. The macrophage phenotype can change in response to cytokines and growth factors126, 127, resulting in different populations of macrophages with
distinct functions. Classically activated macrophages (M1) are important immune cells
that are vital to host defense; they can propagate inflammatory responses by producing
cytokines IL1β, tumor necrosis factor (TNF) α, IL6, IL12 and IL23128. Another subtype
of macrophages are the alternatively activated macrophages (M2)129, 130. These cells express
the mannose receptor CD206, scavenger receptors and IL1 receptor antagonist (IL1ra).
M2 macrophages produce predominantly IL10 and almost no IL12 and IL23, indicative
for a anti-inflammatory phenotype128. Taken together, adipose tissue can be considered as
an organ that secretes factors that can contribute to the progression of OA115, 126, 131. This
holds especially true for the IPFP as a consequence of its anatomical location in the knee
joint, close to other joint tissues.
The exact effect of IPFP on cartilage in OA has not been elucidated. Here, we hypothesize
that the IPFP might exhibit deleterious effect on cartilage by inducing catabolic changes
in chondrocytes. To investigate whether the infrapatellar fat pad should be considered as
an active osteoarthritic joint tissue116, we investigated the influence of medium conditioned by IPFP on cartilage metabolism. Surprisingly, FCM inhibited catabolic processes
which led us to the addition of an extra catabolic stimulus in an exploratory manner. We
analyzed whether type of macrophages in the IPFP could explain the effect on cartilage.
43
Materials and methods
Preparation and analysis of fat-conditioned medium
29 IPFPs obtained as anonymous waste material from human subjects with OA who underwent total knee arthroplasty were used to produce fat-conditioned medium (FCM).
The patients did not give informed consent, but did have the right to consent as stated
by guidelines of the Federation of Biomedical Scientific Societies (www.federa.org), approved by the local ethical committee in Rotterdam, The Netherlands (number MEC
2008-181). The mean age of the donors was 67.9 years (range 54 – 81) and the mean
BMI of the donors was 29.6 (range 22.8 – 48.5). The inner parts of the fat pads where
no synovium is present were cut into small pieces of approximately 10 mg and cultured
in suspension for 24 hours in a concentration of 50 mg tissue/ml in Dulbecco’s Modified
Eagle Medium (DMEM) with Glutamax (GibcoBRL, Grand Island, NY, USA) containing insulin, transferrin, selenic acid and albumin (ITS+, BD Biosciences, Breda, The
Netherlands) 100 times diluted, 50 μg/ml gentamicin and 1.5 μg/ml fungizone (both
GibcoBRL).
Previously, the release of several signaling molecules from adipose tissue was investigated124. Based on these results, we chose to incubate the IPFP explants for 24 hours. After
24 hours, the medium was harvested, centrifuged at 300 g for 8 minutes and frozen at
-80°C in aliquots of 1.5 ml resulting in 29 different batches of fat conditioned medium.
Preparation and culture of cartilage explants
The experiment for testing the effect of FCM on cartilage was performed twice. The first
time with 17 different FCM batches, the second time with 12 different FCM batches.
To be able to test multiple FCM batches in one experiment avoiding cartilage donor
differences, articular cartilage explants were harvested from at least eight bovine metacarpophalangeal joints (aged 6–12 months). Full thickness explants of 6 mm diameter
and 0.9–1.2 mm thick were made and pooled followed by random distribution over the
wells, 3 explants were cultured per well and formed one sample. For each of the 29 FCM
batches, we had three samples.
Explants were pre-cultured for one day in DMEM glutamax, ITS+ 1:100 followed by
fat-conditioned medium 1:1 mixed with fresh medium. Control conditions (one sample
of three explants per well, three wells per experiment) were cultured in unconditioned,
but previously frozen medium 1:1 mixed with fresh medium. To further evaluate (anti)
catabolic effects of FCM, 1 ng/ml IL1β (R&D, Oxon, UK) was added to cartilage explants during pre-culture and during the incubation with six different batches of FCM.
The six batches for the second set of experiments were based on availability from the 29
earlier tested.
Power calculation using the results from the first set of experiments revealed six FCM
batches to be sufficient to identify a difference. After two days, cartilage explants were
snap-frozen in liquid nitrogen and stored at -80°C and medium was collected and stored
44
at -20°C until further use.
RNA isolation and quantitative RT-PCR
Frozen cartilage was processed using a Mikro-Dismembrator S (B. Braun Biotech International GmbH, Melsungen, Germany). RNA was extracted, cDNA was made and gene
expression analysis for GAPDH, MMP1, MMP3, MMP13, ADAMTS4, ADAMTS5,
collagen type II and aggrecan was performed as described previously132.
Quantitative RT-PCR
Primer sequences for the genes were as followed: Glyceraldehyde-3-phosphate dehydrogenase (GAPDH reference gene) forward: GTCAACGGATT TGGTCGTATTGGG,
reverse: TGCCATGGGTGGAATCATATTGG, and probe: Fam-TGGCGCCCCAACCAGCC-Tamra. MMP1 forward: TGGAGCAATGTCACACCCTTG, reverse: TTGTCACGATGATCTCCCCTG. MMP3 forward: CACTCAACCGAACGTGAAGCT,
MMP3 reverse: CGTACAGGAACTGAATGCCGT MMP13 forward: TCTTGTTGCTGCCCATGAGT, reverse: GGCTTTTGCCAGTGTAGGTGAT. ADAMTS4 forward:
GAAGCAATGCACTGGTCTGA, ADAMTS4 reverse: CCGAAGCCATTGTCTAGGAA. ADAMTS5 forward: GCAGTATGACAAATGTGGCG, ADAMTS5 reverse:
TTTATGTGAGTCGCCCCTTC. Collagen type II forward: CCGGTATGTTTCGTGCAGCCATCCT, Collagen type II reverse: GGCAATAGCAGGTTCACGTACA,
Collagen type II probe: CGATAACAGTCTTGCCCCACTT Aggrecan forward: AATTACCAGCTACCCTTCACCTGTA, Aggrecan reverse: TCCGAAGATTCTGGCATGCT, Aggrecan probe: AGGGCACAGTGGCCTGCGGA For GAPDH, collagen type
II, and aggrecan Taqman 2x Universal PCR Mastermix (Applied Biosystems BV, the
Netherlands) was used in the reaction. For MMP1, MMP3, MMP13, ADAMTS4, and
ADAMTS5, qPCR Mastermix Plus SYBR Green I (Eurogentec, Maastricht, the Netherlands) was used in the reaction. PCR conditions were as follows: 2 minutes at 50°C and
10 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C,
with data collection during the last step. All PCRs were performed in a total volume of
20 μl. Relative quantification of PCR signals was performed by comparing the threshold
cycle value (Ct) for the gene of interest in each sample with the Ct value for the reference
gene GAPDH.
Biochemical analysis of cartilage culture medium
GAG amount in the culture medium was quantified using the dimethylmethylene blue
(DMB) assay as described previously133. The metachromatic reaction of GAG with DMB
was monitored with a spectrophotometer, and the ratio A530:A590 was used to determine the amount of GAG present. NO production was determined by quantifying its
derived product, nitrite, in medium using a spectrophotometric method based upon the
Griess reaction134.
45
Characterization of macrophages in adipose tissue.
Subcutaneous adipose tissue was obtained from seven patients being operated for a total
knee replacement of which we also received IPFP, harvested during the total knee replacement proximal of the knee joint. In addition, we obtained IPFPs from five patients
undergoing repair of their anterior cruciate ligament (ACL), both with ethical approval
(MEC-2008-181). Mean age of subcutaneous adipose tissue donors was 64.8 years (range
54 – 81 years) and the mean BMI was 31.7 (range 23.5 – 48.5). The mean age of the
ACL-IPFP donors was 37.4 years (range 24 – 58 years) and the mean BMI was 23.5
(range 21.8 – 27.1).
We used antibodies against CD68 (DAKO, clone EBM11, Heverlee, Belgium), CD86
(Abcam, clone EP1158Y, Cambridge, UK) and CD206 (Abcam, clone 15-2, Cambridge,
UK) for immunohistochemistry. Samples were mounted in tissue tek KP-Cryocompound
(Klinipath) and frozen in liquid nitrogen. 10 μm sections were fixed in acetone and incubated with monoclonal antibodies against CD68 (DAKO, clone EBM11), CD86 (Abcam, clone EP1158Y) and CD206 (Abcam, clone 15-2), followed by incubation with
link and label from the link-label kit (BioGenex, San Ramon, CA, USA) when CD68
and CD206 were detected or goat-anti rabbit AP (Sigma, St. Louis, MO, USA, 1:20)
and APAAP (Sigma 1:40) when CD86 was analyzed. Freshly prepared neo-fuchsin was
used as substrate. A cell was considered positive when stained red. Mouse IgG (DAKO)
for CD68 en CD206 en rabbit IgG (DAKO) for CD86 were used as irrelevant isotype
controls.
Samples were ranked by two blinded observers based on their relative number of positive
cells in four sections per sample. Ranking was done for each marker separately and IPFP,
subcutaneous adipose tissue samples and IPFP from patients undergoing ACL repair
were given a number between 1 and 41 (29 IPFP samples, 7 subcutaneous samples and
5 IPFPs from anterior cruciate ligament repairs) based on the staining intensity. This
resulted in two single ranks from each blinded observer (YBJ and CF) for CD68, CD86
and CD206. The average of these two ranks was used for further analysis. To compare OA
IPFP and subcutaneous adipose tissue, we only used the samples from patients of which
we obtained both adipose tissue types. For the comparison between OA IPFP and ACL
IPFP, samples were matched based in BMI.
Quantification of macrophages and their subtypes using
fluorescence-activated cell sorting
To quantify different types of macrophages in OA IPFP, flowcytometric analysis on stromal vascular fraction of 11 IPFPs obtained during total knee replacement was performed.
In Antwerp, Belgium, the patients gave informed consent as approved by the Local Ethical committee in Antwerp (number B30020096260). The mean age of the donors was
60.1 years (range 42 – 78 years) and the mean BMI of the donors was 30.9 (range 22.8
– 40.0). IPFP fragments of approximately 3x3 mm were incubated for 2 hours at 37°C
46
with 1 mg/ml collagenase type Ia (Sigma) in DMEM with Glutamax (GibcoBRL) with
10% FCS (Gibco BRL), and filtered through a nylon mesh (100 μm). After centrifugation at 480 g for 10 minutes, floating adipocytes and fat were removed, cell pellet was
resuspended and filtered again through a nylon mesh (40 μm). DNAase I 350 μg/ml PBS
(Sigma) was added for 20 minutes at room temperature. The cells were incubated with
the following antibodies: phycoerythrin(PE)-conjugated CD45, allophycocyanin (APC)conjugated CD206, and fluorescein isothiocyanate(FITC)-conjugated CD86 (BD Biosciences). Cells were fixed in Phosflow, Lyse Fix (BD Biosciences) and resuspended in PBS
with 1% FCS. Cells were analyzed on a FACSCalibur flow cytometer (BD Biosciences).
Macrophages were selected based on side scatter and CD45 positivity.
Statistical analysis
The average gene expression, GAG release and NO production in cartilage cultured in
control medium versus FCM, and histological scores for OA IPFP and ACL IPFP were
compared using a Mann Whitney test. For the experiments with(out) IL1β and FCM,
this was done with a Kruskal-Wallis test with a post-hoc Dunn’s multiple comparison
test. Wilcoxon signed rank test was used to compare histological scores for OA IPFP and
paired subcutaneous adipose tissue (SPSS 18.0).
47
Results
Effect of fat-conditioned medium on cartilage biology
To investigate the effect of infrapatellar fat pad (IPFP) on cartilage, cartilage explants
were cultured in fat-conditioned media (FCM) from 29 different IPFPs. Culturing cartilage in FCM resulted in lower NO production (1.9 fold, p = 0.004) and GAG release
(1.3 fold, p = 0.021) than in the untreated controls (Figure 1A). FCM down-regulated
gene expression of MMP1 in comparison to cartilage cultured in the control condition
without FCM (6.4 fold, p = 0.003). MMP3, MMP13, ADAMTS4 and ADAMTS5 gene
expression as well as collagen type II and aggrecan gene expression were not altered by the
FCM (Figure 1B and C).
Figure 1 : Effect of fat conditioned medium (n = 29) on cartilage biology a) NO production
and GAG release, b) gene expression of MMP1, MMP13, ADAMTS4 (ATS4) and ADAMTS5 (ATS5), and c) collagen type II and aggrecan gene expression in healthy cartilage. All
expressed relative to the untreated control without FCM (n = 6, set at 1). Basal NO content
was 63.4 ± 3.5 μM and basal GAG release was 51.6 ± 5.2 μg/explant. P-values indicate a
significant difference from the control.
To investigate whether BMI of the IPFP donor influenced the effect of FCM on cartilage,
a post-hoc subgroup analysis was performed; FCM made from IPFPs of which the donor had a BMI smaller than 27 or a BMI equal or bigger than 27. No difference on NO
production, GAG release or MMP1 gene expression was observed between the two BMI
sub-groups. Both groups were still significantly different from the control condition (see
Supplementary figure 1).
48
Supplementary figure 1: Subgroup analysis to examine the effect of BMI of the IPFP donor on
the relation between FCM and cartilage regarding A) NO production, B) GAG release and
C) MMP1 gene expression. N = 14 for BMI < 27, N = 15 for BMI > = 27. All expressed
relative to the untreated control without FCM (N = 6, set at 1). P-values indicate a significant
difference from the control condition.
Fat-conditioned medium counteracts IL1β induced effects
In the above described experiments the effect of FCM on cartilage was not catabolic in
contrast to our hypothesis but rather seemed to inhibit catabolic processes. Although in
healthy cartilage catabolic processes take place as part of normal turnover, the expression
of most of the matrix degrading enzymes was very low. Therefore we conducted experiments where FCM was applied under catabolic conditions (in the presence of IL1β) to
the cartilage, to investigate whether IPFP from end-stage OA patients indeed has anticatabolic effects on cartilage. Cartilage explants were cultured in the presence of 1 ng/ml
IL1β with or without six of the earlier tested FCM batches as proof of principle.
When catabolic processes were stimulated, FCM was able to inhibit NO production (p
= 0.036), MMP1 gene expression (p = 0.042), and MMP3 gene expression (p = 0.0002),
and increase collagen type II gene expression (p = 0.012) (Figure 2). Same trends were
seen for MMP13, ADAMTS4 and ADAMTS5 although not significant. GAG release
and aggrecan gene expression were not altered.
49
Figure 2: Fat conditioned medium lowers IL1β induced effects in cartilage (n=6). a) NO and
GAG release, b) gene expression of extracellular matrix degrading enzymes c) gene expression
of matrix proteins and. Control without IL1β or FCM is set at 1 (n = 6, dotted line). Basal
NO content was 78.2 ± 6.9 μM and basal GAG release was 48.3 ± 4.6 μg/explant. Boxplots
indicate relative difference from control. P-values indicate a significant difference between the
IL1β treated condition and IL1β+FCM.
Figure 3: Macrophages in infrapatellar fat of osteoarthritic patients. Immunolocalization of
CD 68 (panel A, B) CD86 (panel C, D) and CD206 (panel E,F). Positive cells are shown
in red and indicated with arrows. Magnification 100 times (A, C and D) and 400x (B, D
and E).
50
Macrophages contributing to the effects seen in cartilage
Since the inhibition of catabolic processes in cartilage by FCM was unexpected, we hypothesized that this might be due to the phenotype of macrophages present in the adipose
tissue. Macrophages contribute to the secretion of factors by the adipose tissue, and therefore we determined the presence of macrophages and their phenotype in the IPFPs used
to make fat-conditioned medium. Representative immunohistological samples are shown
in Figure 3. CD68+, CD86+ and CD206+ macrophages were detected in all samples. No
correlation was seen between the rank of CD68+, CD86+ or CD206+ cells and the BMI
of the IPFP donor.
Comparing IPFP and subcutaneous adipose samples from matched donors (n = 7) revealed no difference regarding the presence of CD68, CD86, and CD206 positive cells
(Figure 4a). In a separate analysis, IPFPs obtained from patients undergoing a reconstruction of their anterior cruciate ligaments (ACL, n = 5), were compared with BMI matched
OA IPFP samples. The ACL IPFP samples were ranked lower for CD206 (p = 0.003 vs
OA IPFP) (Figure 4b).
51
Figure 4: The immunohistochemical rank distribution of CD68, CD86 and CD206 in A)
OA infrapatellar fat pads (OA IPFP) and paired subcutaneous fat samples (Sc fat) obtained
from patients undergoing total knee replacement (both n = 7, mean age 64.8 (range 54 – 81)
and mean BMI 31.7 (range 23.5 – 48.5)), and B) immunohistochemical rank distribution of
OA infrapatellar fat pads (OA IPFP, n = 12, mean age 65.6 (range 55 - 78) and mean BMI
25.1 (range 22.8 - 27.0)) with BMI matched infrapatellar fat pad samples obtained during
anterior cruciate ligament rupture repair (ACL IPFP, n = 5, mean age 37.4 (range 24 – 58)
and mean BMI 23.5 (range 21.8 – 27.1)). P-value indicate a significant difference.
Above-mentioned observations were all made on histological samples. To quantify the
presence of CD206 and CD86 cells in OA IPFP, we evaluated 11 IPFP samples with
fluorescence-activated cell sorting (FACS) analysis. For this analysis, we used other IPFP
samples from end-stage OA patients than examined in the earlier experiments, since fresh
IPFP samples were necessary. 28.9 ± 22.9 % of the CD45+ cells were CD86+CD206and 17.5 ± 13.6 % were CD86-CD206+ (p = 0.375). Double positive CD206+CD86+
macrophages were also detected, on average 21.8% ± 20.9 (See Supplementary figure
2).
52
Supplementary figure 2: Flow cytometric analysis of macrophages in the stromal vascular fraction of the IPFP of end-stage OA patients undergoing total joint replacement surgery. a) Gating strategy and definition of macrophages in infrapatellar fat pad of end-stage osteoarthritis
patients. Macrophages were selected based on CD45 positivity and side scatter. B) fluorescence
minus one (FMO) negative controls for CD86 and C) CD206. D) the final gate strategy and
analysis of CD86 and CD206 stainings of macrophages. Results of the third patient are shown.
E) The percentage of CD206 positive (black bars), CD86 and CD206 double positive (light
grey bars), and CD86 positive cells (dark grey bars) in the macrophage population as selected
in A is shown. Each bar represents one OA IPFP donor.
53
Discussion
Osteoarthritis is a disease of the articular joint, characterized by cartilage damage with
an unclear role for inflammation in the etiology and disease progression. However, data
are accumulating that suggest OA as an inflammatory disease in which cytokines and
immune cells play a role135. Adipose tissue in general can be considered as an endocrine
organ secreting cytokines and growth factors and with significant infiltration of immune
cells including macrophages115, 126, 131. In this study, we explored the contribution of the
infrapatellar fat pad obtained from joints of OA patients on cartilage metabolism.
Earlier publications suggest that IPFP contributes to cytokine and growth factor levels in
the synovial fluid95, 110, 111, and that IPFP from end-stage OA patients has a different secretory profile than subcutaneous adipose tissue118. However, the effect of IPFP on cartilage
was never investigated before.
Here we report that medium conditioned by IPFP can indeed influence cartilage metabolism. In contrast to our hypothesis that conditioned media from OA IPFP would
induce catabolic changes in cartilage, we observed a decrease in catabolic processes in the
cartilage explants as demonstrated by a decrease in NO and GAG release and MMP1
expression when incubated with FCM alone. Although the decrease in GAG release was
not supported by changes in gene expression of ADAMTS4 or ADAMTS5, it is well
known that aggrecanase activity is regulated by altered activation or posttranslational
protein production136.
Aggrecan and collagen gene expression were unaltered indicating no direct effects on
production of the main matrix components. Although healthy cartilage has a turnover
involving matrix degradation, the expression of some catabolic factors was very low so
addition of FCM could not inhibit it. Therefore catabolic processes were stimulated by
addition of IL1β. FCM was able to inhibit the IL1β stimulated NO production, MMP1
and MMP3 gene expression, and reverse the IL1β-induced decrease in collagen type II
gene expression. Taken together, these findings suggest that osteoarthritic IPFP and its
secreted factors inhibit catabolic processes in cartilage.
The results might have been more clear if we would have only selected primary end-stage
OA samples. However, primary and secondary OA are different regarding the onset of
the disease, but is has never been proven that the end-stage is different. In this study, medium conditioned by IPFP should be considered as a black box since many known and
unknown factors might have contributed to the effects we observed. Future studies using
inactivating antibodies or scavenger receptors might identify possible factors or interactions responsible for the inhibition of catabolic processes.
We hypothesized that FCM would have a catabolic effect on cartilage and therefore we
chose to use healthy bovine cartilage. Bovine cartilage is a frequently used and accepted
system to study the effect of growth factors and cytokines on cartilage133, 137-139. We needed
54
a large amount of cartilage and preferred to prevent heterogeneity in metabolic status that
is known to happen in human osteoarthritic cartilage.
Based on the results of our studies, we believe we have indications that factors secreted
from end-stage osteoarthritic infra-patellar fat can inhibit catabolic processes in cartilage.
However, we cannot exclude that factors secreted by infra-patellar fat into the joint cavity
in patients have different effects because of the complexity of the joint including the presence of synovium and bone, the influence of joint mechanics and the difference between
human and bovine cartilage.
We examined whether the phenotype of macrophage (M1 characterized by CD86 or M2
characterized by CD206) might explain the anti-catabolic effect of FCM on cartilage.
Based on immunohistochemistry, BMI matched osteoarthritic IPFP samples contained
more anti-inflammatory M2/CD206+ macrophages than IPFPs obtained from ACL rupture patients. The presence of CD206+ macrophages in the OA IPFP supports the finding
that FCM from end-stage OA IPFP exhibits anti-catabolic effects on cartilage. CD206
positive or M2 macrophages express, among many other molecules, arginase140, an enzyme that competes with nitric oxide synthase 2 (NOS-2) activity and thereby might
inhibit NO production 141. The presence of these arginase expressing macrophages in the
IPFPs might have contributed to the anti-catabolic effects of FCM on cartilage. The comparison between OA IPFP and ACL IPFP underlines the more acute inflammation state
of the ACL IPFP, since the latter contained less CD206 positive cells. Unfortunately, we
only obtained sufficient amounts of these adipose tissue types for immunohistochemistry
and not for the preparation of FCM and thus their effects on cartilage could not be studied. In addition, we were not able to obtain IPFPs from healthy subjects for immunohistochemical comparison. Subcutaneous adipose tissue of lean people mainly contains M2
macrophages142, 143 and when people gain weight, a shift from M2 to M1 macrophages is
seen144, 145. In our study, BMI of the OA IPFP donors was not associated with the presence
of CD68, CD86 or CD206 positive cells.
The effect of the FCM on cartilage was also independent of the BMI of the IPFP donor.
In a recent study, OA IPFP produced more IL6 than subcutaneous adipose tissue from
the same donor although there was no difference in the presence of CD14 and CD68
(both used as markers for macrophages) positive cells between IPFP and subcutaneous
adipose tissue111. This suggests that IPFPs from OA knees may have specific phenotypic
characteristics as supported by presence of different types of macrophages and their secreting factors and that IL6 production by de IPFP in knee OA is probably not related to
a general phenotype in obesity but rather to a specific characteristic of the IPFP.
In our previous study118, a relation between TNFα secretion and BMI of the IPFP donor was found. This TNFα was produced by CD3+/CD4+ cells, CD3+/CD8+ cells,
and CD14+ cells. In the current study, we show that the presence of CD68+, CD86+
and CD206+ cells is not associated with BMI. FACS analysis showed a variation in the
presence of pro-inflammatory CD86 macrophages and anti-inflammatory CD206 mac-
55
rophages between the 11 different donors. This might relate to different subtypes of OA
or to different stages in the OA process, earlier observed for synovium146, which deserves
further research. Many double positive cells were also observed underlining that the division between M1 and M2 macrophages is a gliding scale as proposed earlier147, 148. Further
experiments are warranted to elucidate whether our observation is only due to products
released by macrophages or that the macrophages interact with adipocytes or other cells
resulting in an altered release profile of the IPFP. Next to macrophages, other immune
cells are present in adipose tissue albeit in smaller amounts118, which might also contribute to the interaction between IPFP and cartilage.
To our knowledge, this is the first study examining the effect of adipose tissue on cartilage
and potential involvement of the infrapatellar fat pad on cartilage metabolism and activity. This study indicates that IPFP of end-stage osteoarthritis patients has an anti-catabolic
effect on cartilage and not a pro-catabolic effect originally hypothesized by us. This could
be due to a compensatory mechanism and to prevent further cartilage damage. Additional experiments are required to validate these results and examine them in more detail
in human cartilage, to examine the effect of FCM on the entire osteoarthritic process,
and to investigate whether the effect we found is specific for the IPFP of end-stage OA
patients or whether this is a general (OA) IPFP or phenomenon. This knowledge might
eventually contribute to the treatment or prevention of OA and guidelines for whether or
not to remove the IPFP during total knee replacement or during the early onset of OA.
Acknowledgements
This study was performed within the framework of the Dutch Top Institute Pharma
project # T1-213. Stefan Clockaerts was financially supported by a research mandate of
the University of Antwerp.
Seconds author’s contribution
S.C. contributed to the analysis and interpretation of data, drafting and critically reviewing the manuscript, collection and assembly of the data and final approval of the submitted version.
56
57
58
Chapter
4
Cytokine production by infrapatellar fat pad can be
stimulated by interleukin 1β and inhibited by
peroxisome proliferator activated receptor α agonist
S. Clockaerts, Y.M. Bastiaansen-Jenniskens, C. Feijt, L.S. De Clerck, J.A.N.
Verhaar, A. Zuurmond, V. Stojanovic-Susulic, J. Somville, M. Kloppenburg,
G.J.V.M. Van Osch
Ann Rheum Dis. 2012 Jun;71(6):1012-8. Epub 2012 Feb 2.
59
Abstract
Objective
Infrapatellar fat pad (IPFP) might be involved in osteoarthritis by production of cytokines. We hypothesized that production of cytokines is sensitive to environmental conditions. We evaluated cytokine production by IPFP in response to IL1β and investigated
the ability to modulate this response with an agonist for peroxisome proliferator activated
receptor α (PPARα). PPARα is also activated by lipid lowering drugs such as fibrates.
Methods
Cytokine secretion of IPFP was analyzed in the medium of explants cultures of 29 osteoarthritic patients. IPFP (5 donors) and synovium (6 donors) were cultured with IL1β and
PPARα agonist Wy14643. Gene expression of IL1β, MCP1, IL6, TNFα, leptin, VEGF,
IL10, prostaglandin-endoperoxide synthase(PTGS)2 and release of TNFα, MCP1 and
PGE2 were compared to unstimulated IPFP and synovium explants.
Results
IPFP released large amounts of inflammatory cytokines, adipokines and growth factors.
IL1β increased gene expression of PTGS2, TNFα, IL1β, IL6 and VEGF and TNFα release in IPFP. MCP1, leptin, IL10 gene expression and MCP1, leptin and PGE2 release
did not increase significantly. Synovium responded similar to IL1β as IPFP, except for
VEGF gene expression.
Wy14643 decreased gene expression of PTGS2, IL1β, TNFα, MCP1, VEGF and leptin
in IPFP explants and IL1β, TNFα, IL6, IL10 and VEGF in synovium that responded to
IL1β.
Conclusion
IPFP is an active tissue within the joint. IPFP cytokine production increases by IL1β and
decreases by a PPARα agonist. The effects were similar to effects observed in synovium.
Fibrates could represent a potential disease modifying drug for osteoarthritis by modulating inflammatory properties of IPFP and synovium.
60
Chapter 4: Cytokine production by IPFP can be stimulated by IL 1β and inhibited by PPARα agonist
Introduction
Osteoarthritis (OA) is the most common form of arthritis with loss of cartilage structure
as its main characteristic. Besides subchondral bone sclerosis, synovitis with overproduction of cytokines by macrophages and fibroblasts is often seen20, 43, 113.
Evidence has emerged for a role of the infrapatellar fat pad (IPFP) or Hoffa’s fat pad in
the osteoarthritis disease process of the knee, since it contains adipocytes, nerve fibers,
macrophages and other immune cells capable of producing cytokines116, 149, 150.
The IPFP is located within the joint closely to the articular cartilage, synovium and bone,
thus allowing the release of cytokines directly into the synovial fluid. IPFP has shown to
produce interleukin (IL)1β, tumor necrosis factor (TNF)α, IL6, IL8, monocyte chemoattractant protein (MCP)1, fibroblast growth factor (FGF)2, vascular endothelial growth
factor (VEGF), leptin, resistin and adiponectin95, 110, 111, 150. However, the basal production
of many other mediators including anti-inflammatory cytokines, chemokines and growth
factors by the IPFP has not been investigated. It is also unclear whether the production of
cytokines by the IPFP is influenced by inflammatory cytokines (e.g. IL1β) present in the
OA knee joint or if there is a cross-talk between the joint and IPFP. In addition, modulation of production of pro-inflammatory mediators secreted from IPFP by potential
disease modifying drugs for OA is not known.
Recent publications151, 152 suggest the potential of fibrates as disease modifying drugs for
OA. Fibrates are Peroxisome Proliferator Activated Receptor (PPAR)α agonists. PPARα
is a type I nuclear receptor, a member of the superfamily of ligand-dependent transcription factors regulating the transcription of target genes in a DNA dependent manner
by binding to PPAR response elements after heterodimerization to retinoid X receptor.
PPARα can also modulate gene transcription in a DNA binding-independent manner153.
Agonists for PPARα are suggested as a potential therapeutic strategy for OA, since they
exert anti-inflammatory effects on chondrocytes151, 152 and synovial fibroblasts154, which
might be partially explained by their inhibitory effect on nuclear translocation of nuclear
factor κB (NFκB)151, 154, 155.
We hypothesized that next to synovium, the IPFP might contribute to the local OA
disease process. We aimed to analyze whether the IPFP produces a large range of inflammatory cytokines and that the production of cytokines is influenced by the pro-inflammatory environment in the OA joint as represented partially by elevated levels of IL1β, a
cytokine present in the synovial fluid of osteoarthritic knee joints and known to induce
cytokine production in synovium8, 157.
In this study, we evaluated the production of several cytokines by IPFP explants from osteoarthritic joints during the first 24h after harvesting. We investigated whether increased
inflammation, simulated by addition of IL1β, is capable of inducing the mRNA expression and/or release of cytokines from cultured human OA IPFP and compared this with
synovium. Then, we examined whether activation of PPARα by a ligand could modulate
the effect of IL1β on the production and release of cytokines from IPFP.
61
Materials and methods
Preparation of IPFP explants and study design
Human IPFPs were obtained as anonymous left-over material from 29 patients [age 76.19
year (54 – 81); BMI 29.54 (23 – 48)] with knee OA undergoing total knee replacement.
The patients had the right to consent as stated by the guidelines of the Dutch Federation
of Biomedical Scientific Societies (www.federa.org). This study was approved by the Local
Ethical Committee (number MEC 2008-181).
To examine the basal cytokine production, the inner parts of the IPFPs were cut into
pieces of approximately 50 mg, taking care to avoid obtaining synovium present at the
outside of the IPFP, and immediately cultured in suspension for 24 hours in a concentration of 50 mg/ml in Dulbecco’s Modified Eagle Medium (DMEM) with Glutamax (GibcoBRL, Grand Island, NY, USA) containing insulin, transferrin, selenic acid and albumin
(ITS+, Becton Dickinson Biosciences, Breda, The Netherlands) 100 times diluted, 50
μg/ml gentamicin and 1.5 μg/ml fungizone (both GibcoBRL, Grand Island, NY, USA).
After culture, the medium was harvested, centrifuged at 200 g for 8 minutes and frozen
at -80°C in aliquots.
To investigate the response of IPFP explants to IL1β and PPARα agonist, IPFP explants
of approximately 50 mg were obtained from 5 OA patients. In addition, the synovia from
6 OA patients were dissected and cut into pieces of 50 mg. Each IPFP and synovium
sample consisted of 3 explants. We performed triplicate cultures for IPFP and duplicate
cultures for synovium. IPFP and synovium explants were first pre-cultured in DMEM
high glucose (GibcoBRL, Grand Island, NY, USA), supplemented with 2% fetal calf
serum (Lonza, Basel, Switzerland), 50 μg/ml gentamycin (GibcoBRL, Grand Island, NY,
USA) and 1.5 μg/ml fungizone (GibcoBRL, Grand Island, NY, USA) for 24 h. The explants were then washed in phosphate buffered saline and the medium was replaced by
DMEM high glucose with 1:100 ITS+. During the next 48h, the explants were cultured
with or without 10 ng/ml IL1β and with or without 10-5-10-3 M Wy14643 (Cayman
Chemical, Ann Arbor, MI, USA), a potent and selective PPARα agonist. Wy14643 was
dissolved in Dimethyl-Sulfoxide (DMSO; Sigma, St. Louis, MO, USA). Detrimental
effects of 10-5 and 10-4M Wy14643 on viability of the IPFP and synovium explants were
excluded with a lactate dehydrogenase (LDH) cytotoxicity assay (Online supplementary
Figure 1)10-3 M Wy14643 increased LDH concentration in the culture media and was
therefore not used for further experiments.
Initial studies with 10-5 M Wy14643 showed no apparent effect on expression of genes
of interest in IL1β stimulated explants, therefore we only used 10-4 M in further experiments. After 48h of culture, the explants were frozen in liquid nitrogen and the harvested
culture media were stored at -80 °C as described above.
62
Chapter 4: Cytokine production by IPFP can be stimulated by IL1β and inhibited by PPARα agonist
(M Wy 14643)
0
10-6 10-5 10-4 Triton
(M Wy 14643)
0
10-6 10-5 10-4 Triton
Online supplementary figure 1: Lactate dehydrogenase release by osteoarthritic infrapatellar fat
pad and synovium explants. Analysis of lactate dehydrogenase in culture media of infrapatellar
fat pad explants (in triplicate) and synovium explants (in duplicate) from 1 donor that were
cultured during 48h with or without PPARα agonist Wy14643 or triton (positive controle).
Bars indicate mean in arbitrary units with standard deviation.
63
RNA extraction and real-time polymerase chain reaction (PCR)
Frozen IPFP and synovium samples were homogenized with a Mikro-Dismembrator
(Braun Biotech International GmbH, Melsungen, Germany) and suspended in 1.8 mL
RNA-Bee (Bioconnect) per 100 mg tissue. The RNA-bee solution was precipitated with
0.2 ml chloroform. RNA was purified using an RNeasy Micro Kit (Qiagen, Hilden,
Germany). 500 ng of total RNA was reverse-transcribed into cDNA using RevertAid
First Strand cDNA Synthesis Kit (MBI Fermentas, St. Leon-rot, Germany). Forward and
reverse oligonucleotides are described in Online supplementary Table 1.
TNFα, IL1β, MCP1, IL6 are pro-inflammatory cytokines involved in the OA disease
process and are produced by adipose tissue70, 99, 158. Cyclo-oxygenase (COX)2 is an enzyme responsible for the production of inflammatory cytokines such as PGE2 and is
induced by TNFα and IL1β158. The gene of COX2 is prostaglandin-endoperoxide synthase (PTGS)2. IL10 is described as an anti-inflammatory cytokine159 and leptin is an
important adipokine that might enhance the inflammatory processes in the joint99. We
also analyzed PPARα and PPARγ mRNA expression. TaqMan Universal PCR Master
Mix (ABI, Branchburg, New Jersey) or qPCR™ Mastermix Plus for SYBR®Green I (Eurogentec, Nederland B.V., Maastricht, The Netherlands) was used to perform Real-time
(RT)-PCR in 20 μl reactions according to the manufacturer’s guidelines and using the
ABI PRISM 7000 Sequence Detection System with software version 1.2.3. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was compared with β-actin (ACTB), β2microglobulin (B2M), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and with
the average of all tested housekeeping genes and appeared to be the most stable. With
GAPDH, we observed no differences in CT values between conditions or between tissues
(data not shown). GAPDH was used to calculate relative gene expression by means of the
2-ΔCT formula.
Assays on culture media for viability and cytokines
A Cytotoxicity Detection Kit (Roche Diagnostics, Indianopolis IN, USA) was used in
accordance with the manufacturer’s instructions to determine the presence of LDH in
culture media, in order to test the effect of Wy14643 on the viability of IPFP and synovium explants. The culture media of the explants were analyzed for cytokine, chemokine,
adipokine and growth factor content using Milliplex kits (catalog number: MPXHCYTO60KPMX42 and HADCYT-61K, Millipore, MA, USA). The Milliplex assays were
analyzed with Luminex 100 IS (Luminex Corporation, Austin, TX). Prostaglandin (PG)
E2 and MCP1 content of the culture media were determined using the PGE2 and MCP1
Assay respectively (RnD systems, Minneapolis, USA) according to manufacturer’s instructions.
64
assay-on-demand (Hs01573474.g1, Applied Biosystems, Capelle a/d IJssel, the
Netherlands
Fw: GCCGCATCGCCGTCTCCTAC
Rv: AGCGCTGAGTCGGTCACCCT
Fw: CCCTAAACAGATGAAGTGCTCCTT
Rv: GTAGTCGGATGCCGCCAT
Fw: CATTGTGGCCAAGGAGATCTG
Rv: CTTCGGAGTTTGGGTTTGCTT
Fw: TCGAGCCCACCGGGAACGAA
Rv: GCAGGGAAGGCAGCAGGCAA
Fw: CCTGGAGGAGGTGATGCCCCA
Rv: GACAGCGCCGTAGCCTCAGC
Fw: TGTGAATGCAGACCAAAGAAAGA
Rv: GCTTTCTCCGCTCTGAGCAA
Fw: ACATTTCACACACGCAGTCAGT
Rv: CCATCTTGGATAAGGTCAGGAT
Fw: GACGTGCTTCCTGCTTCATAGA
Rv: CCACCATCGCGACCAGAT
assay-on-demand (Hs01115513_m1, Applied Biosystems, Capelle a/d IJssel,
the Netherlands)
Prostaglandin-endoperoxide
synthase 2
Tumor necrosis factor α
Interleukin 1β
Monocyte chemoattractant protein 1
Interleukin 6
Interleukin 10
Vascular endothelial growth factor
Leptin
Peroxisome proliferator activated
receptor α
Peroxisome proliferator activated
receptor γ
Online supplementary Table 1: primer sequences
fw: ATGGGGAAGGTGAAGGTCG
Rv: TAAAAGCAGCCCTGGTGACC
Probe: CGCCCAATACGACCAAATCCGTTGAC
Glyceraldehyde-3-phosphate
dehydrogenase
65
Data analysis
For determining the release of cytokines directly after harvesting, the culture media of
IPFPs of 29 OA patients were measured in duplicate and averaged. Correlation with BMI
was tested using a Spearman’s rank correlation test and adjustment for multiple testing
was done with a Bonferroni test for assessing the significance of these correlations.
The effect of IL1β with or without PPARα agonist on cytokine production was tested
in IPFPs of 5 OA patients (cultured in triplicate samples) and synovium explants of 6
OA patients (cultured in duplicate samples). PCR analysis was performed on each of the
samples, and supernatant assays were performed on the culture media that were pooled
per condition for each patient.
Data were analyzed with SPSS 18.0. A linear mixed model was used for the PCR analysis
of the samples and a general linear model was used for the supernatant assays, after confirming the normal distribution of the residuals using a Wilks-Shapiro test. Both types of
linear regression are rather robust for violation of this assumption.
Since previous studies with Wy14643 with cartilage have shown that the effect of
Wy14643 is highly dependent on the response of tissue to IL1β151, we also analyzed the
interaction between the effect of PPARα activation and the response to IL1β in the linear
mixed models by adding an interaction term. This analysis shows whether the effect of
Wy14643 is depended on the response to IL1β.
66
Results
IPFP explants produce a variety of cytokines and the production is increased by local cytokine stimulation
IPFP explants released leptin, adiponectin, resistin and cytokines such as IL6, IL8, MCP1,
IL4, fractalkine, interferon inducible protein (IP)10, hepatocyte growth factor (HGF),
VEGF, growth related protein (GRO), granulocyte colony stimulating factor (G-CSF)
and fibroblast growth factor (FGF)2 (Figure 1 and Online supplementary Table 2).
Figure 1: Cytokine release by osteoarthritic infrapatellar fat pad explants. Multiplex ELISA
analysis of culture media of infrapatellar fat pad explants from 29 donors that were cultured
for 24 hours (50 mg adipose tissue/ml). Whisker box plots with minimum and maximum
values. IL: interleukin, TNF: tumor necrosis factor, MCP: monocyte chemoattractant protein,
IFN: interferon, VEGF: vascular endothelial growth factor, FGF: fibroblast growth factor.
(See also Online supplementary Table 1)
67
leptin
adiponectin
resistin
IL1β
TNFα
IL6
IL8
IFNγ
MCP1
IL4
IL10
HGF
NGF
t-PAI
G-CSF
GM-CSF
MCP3
VEGF
IL17
EGF
Eotaxin
FGF2
Flt-3l
fractalkine
GRO
IFNα
IFN-1α
Il1ra
IL2
IL3
IL5
IL7
IL9
IL12 (p40)
68
Mean (pg/h/g)
Standard deviation
1530.0
109283.0
86.1
2.3
3.4
2932.0
2619.0
9.2
4698.0
10.3
2.3
564.4
2.2
998.9
54.7
19.8
7.6
57.5
59.6
9.1
24.6
85.1
13.4
187.2
605.8
20.8
139.2
12.3
8.6
24.0
0.2
59.6
0.0
18.5
(1530.0)
(47063.0)
(102.8)
(1.5)
(4.2)
(2597.0)
(2943.0)
(8.5)
(2330.0)
(1.8)
(1.5)
(557.4)
(2.9)
(517.0)
(80.2)
(15.5)
(4.7)
(35.9)
(32.7)
(4.2)
(13.4)
(55.4)
(7.4)
(223.7)
(644.5)
(13.5)
(362.6)
(16.6)
(1.8)
(14.4)
(0.1)
(32.7)
(0.0)
(9.5)
IL12 (p70)
IL13
IL15
IP10
MDC
MIP1a
MIP1b
sCD40l
sIl-2RA
TGFα
TNFβ
PDGF-AA
RANTES
PDGF-AB
2.3
3.7
1.7
533.1
10.9
36.3
69.7
8.9
15.5
1.0
1.1
6.5
22.1
4.8
(1.290)
(2.9)
(1.3)
(1388.0)
(8.3)
(43.8)
(84.5)
(12.3)
(8.3)
(0.3)
(0.5)
(4.6)
(24.5)
(3.7)
Online supplementary Table 2: cytokine release by osteoarthritic infrapatellar fat pad explants.
Multiplex ELISA analysis of culture media of infrapatellar fat pad explants from 29 donors that
were cultured for 24 hours (50 mg adipose tissue/ml). Mean and standard deviation (between
brackets) are shown. IL: interleukin, TNF: tumor necrosis factor, MCP: monocyte chemoattractant patient, IFN: interferon, IP: interferon inducible protein, MDC: macrophage derived
chemoattractant, MIP: macrophage inflammatory protein, CD: cluster of differentiation, sIL:
soluble interleukin, RANTES: regulated upon activation, normal T-cell expressed and secreted,
HGF: hepatocyte growth factor, NGF: nerve growth factor, CSF: colony stimulating factor,
GM: granulocyte monocyte, G: granulocyte, PDGF: platelet derived growth factor, VEGF:
vascular endothelial growth factor, FGF: fibroblast growth factor, TGF: transforming growth
factor, EGF: epidermal growth factor, GRO: growth related oncogene. (See also Figure 1)
To investigate whether the release of cytokines by the IPFP is influenced by BMI, we
examined the correlation between BMI and cytokines that are secreted in high amounts
by the IPFP and/or are known to be involved in the OA disease process8, 158. Only adiponectin and MCP1 were negatively correlated with BMI, although these results were
not significant after adjustment for multiple comparisons (Online supplementary Table
3). In addition, we dichotomized BMI (≤27.5 and >27.5), but only found a difference in
release between these groups for adiponectin (p=0.05).
69
cytokine
Spearman’s r
p value
leptin
-0.1146
0.60
adiponectin
-0.5079
0.01
resistin
0.1330
0.55
IL1β
0.1237
0.56
TNFα
0.07883
0.69
IL6
-0.1090
0.59
IL8
0.1662
0.42
IFNγ
-0.1157
0.57
MCP1
-0.5025
0.04
IL4
0.2484
0.37
IL10
-0.09589
0.63
VEGF
-0.1670
0.41
FGF2
0.04060
0.84
IL1ra
-0.01252
0.95
TGFα
0.06514
0.79
TNFβ
0.08099
0.80
Online supplementary Table 3: correlations between cytokine release by IPFP and body mass
index (BMI).
To investigate whether the cytokine production by IPFP explants changes due to local inflammatory stimuli, we added 10 ng/ml IL1β and analyzed mRNA expression and release
of cytokines produced by IPFP. Similar experiments were performed on synovium explants (Figure 2). In the IPFP explants, the addition of IL1β increased the mRNA expression 132.4 times for PTGS2 (p=0.02), 2.8 times for TNFα (p=0.04), 74.0 times for IL1β
(p=0.01), 43.1 times for IL6 (p=0.02) and 4.6 times for VEGF (p=0.01). Leptin mRNA
expression showed a trend towards an increase of 10.1 times (p=0.09) respectively, while
IL10 (p=0.12) and MCP1 (p=0.16) were not altered after treatment with IL1β.
To confirm these results, we analyzed protein release of TNFα, a cytokine involved in
OA disease, and MCP1 and PGE2 since these cytokines are known to be released in high
amounts by adipose tissue and synovium. Adding IL1β to the IPFP explants increased the
release of TNFα 5.5 times (p=0.04), while there were no significant differences for MCP1
(p=0.20) and PGE2 (p=0.23).
70
Figure 2: Interleukin 1β increases the production of cytokines by infrapatellar fat pad and synovium explants. IPFP samples (n=15 samples, obtained from 5 OA patients) and synovium
samples (n=12 samples, obtained from 6 OA patients) were cultured during 48h with or
without 10 ng/ml interleukin 1β. A) mRNA expression, normalized to GAPDH, fold increase
relative to control. B) protein release into culture media, fold increase relative to control.
Table indicates absolute protein release with standard deviation between brackets. Bars show
the fold increase compared to control without IL1β that is set at 1 (dotted line). Light bars
71
indicate IPFP samples, dark bars indicate synovium samples. * and ** indicate a significant
difference from control without IL1β (p<0.05 and p<0.0001 respectively). Significant differences (p<0.0001) between synovium and IPFP are indicated with ##. PTGS: prostaglandinendoperoxide synthase, TNF: tumor necrosis factor, IL: interleukin, MCP: monocyte chemoattractant protein, VEGF: vascular endothelial growth factor, PG: prostaglandin.
The effect of IL1β on IPFP was comparable with the stimulatory effect of IL1β in the
synovium samples, where mRNA expression was increased 2.1 times for TNFα (p=0.02),
69.8 times for IL6 (p=0.01) and a trend towards increase of 35.5 times for PTGS2
(p=0.08) and 102.1 times for IL1β (p=0.08). MCP1 gene expression was not altered
(p=0.17).
The relative gene expression of leptin in synovium explants was very low and did not
increase (p=0.16) by adding IL1β as shown in Figure 2. There was no increase in IL10
mRNA expression (p=0.23) and VEGF mRNA expression (p=0.87). Only VEGF mRNA
expression was significantly differently affected by IL1β in synovium compared to IPFP
samples (p<0.0001). The addition of IL1β to synovium samples did not increase the release of TNFα (p=0.15), MCP1 (p=0.22) or PGE2 (p=0.23).
We found no differences in mRNA expression of PPARα and PPARγ between IPFP and
synovium or between controle and explants cultured with IL1β (data not shown).
In summary, treatment with IL1β leads to a significant increase in expression of mainly
pro-inflammatory cytokines in IPFP and synovium explants. The increase in cytokine
production by IPFP explants was comparable to the synovium explants, except for VEGF
that was increased by IL1β in IPFP but not in synovium.
PPARα activation inhibits IL1β induced cytokine production
by IPFP
Wy14643, a PPARα agonist 160, had no effect on production of cytokines by IPFP and
synovium in culture conditions without IL1β (data not shown). To investigate whether
PPARα activation could inhibit IL1β induced cytokine production, we treated the IL1β
stimulated IPFP explants with 10-4 M Wy14643. The addition of 10-4 M Wy14643 decreased the IL1β induced mRNA expression of VEGF 2.6 fold (p=0.01) in IPFP samples
(Figure 3a). In addition, a trend towards decrease for IL1β mRNA expression with 1.5
fold (p=0.10), IL10 with 1.4 fold (p=0.10) and leptin with 3.0 fold (p=0.08) was observed, whereas no significant differences for PTGS2 (p=0.11), TNFα (p=0.40), MCP1
(p=0.44) and IL6 (p=0.97) were observed. There was a significant interaction between
IL1β response and the effect of PPARα for PTGS2, IL1β, TNFα, MCP1, VEGF and
leptin, which might indicate that the effect of PPARα activation was depended on the
effect of IL1β. No interaction for IL6 and IL10 was observed.
72
Figure 3: PPARα agonist Wy14643 on cytokine mRNA expression and protein release of infrapatellar fat pad. Explants of infrapatellar fat pad were cultured during 48h in the presence
of interleukin 1β with or without PPARα agonist Wy14643. A) mRNA expression relative to
housekeeping gene of prostaglandin-endoperoxide synthase (PTGS)2, interleukin (IL)β, tumor
necrosis factor (TNF)α, monocyte chemoattractant protein (MCP)1, IL6, vascular endothelial
growth factor (VEGF), leptin and IL10. N=15 samples, obtained from 5 OA patients. B)
Release of tumor necrosis factor (TNF)α, monocyte chemoattractant protein (MCP)1, prostaglandin (PG)E2 and leptin in the culture media.
73
In addition, we analyzed the secretion of TNFα, MCP1 and PGE2 to the culture media to
confirm the mRNA expression data. We also analyzed leptin since this adipokine is mainly secreted by adipose tissue70. We observed no significant differences for TNFα (p=0.88),
MCP1 (p=0.52), PGE2 (p=0.45) and leptin (p=0.64) release when adding Wy14643 to
the IL1β stimulated explants of IPFP (Figure 3b). There was an interaction between IL1β
response and PPARα activation for leptin indicating that the effect of Wy14643 depends
on the IL1β response, but not for TNFα, MCP1 and PGE2.
In synovium, there was no effect of Wy14643 on the IL1β induced changes in mRNA
expression of PTGS2 (p=0.74), IL1β (p=0.85), TNFα (p=0.76), MCP1 (p=0.62), IL6
(p=0.74), IL10 (p=0.19), VEGF (p=0.93) and leptin (p=0.69) (Figure 4a). It is conceivable that PPARα could exhibit its activity in a highly pro-inflammatory environment
in the synovium tissue samples that are highly responsive to IL1β. To investigate this
hypothesis we evaluated the effects of PPARα ligand in synovium tissue from donors
with a high response to IL1β, and investigated the interaction between both. A statistical
interaction between IL1β response and PPARα effect for IL1a, TNFα, IL6, IL10 and
VEGF was found, but not for PTGS and leptin.
Wy14643 did not decrease TNFα (p=0.14), MCP1 (p=0.30) or PGE2 release (p=0.63) by
synovium explants to the culture medium. There seemed to be an interaction with IL1β
response for MCP1 release, but not for PGE2 or TNFα (Figure 4b).
74
Figure 4: PPARα agonist Wy14643 on cytokine mRNA expression and protein release of synovium. Explants of synovium were cultured during 48h in the presence of interleukin 1β with
or without PPARα agonist Wy14643. A) mRNA expression relative to housekeeping gene
of prostaglandin-endoperoxide synthase (PTGS)2, interleukin (IL)β, tumor necrosis factor
(TNF)α, monocyte chemoattractant protein (MCP)1, IL6, vascular endothelial growth factor
(VEGF), leptin and IL10. N=12 samples, obtained from 6 OA patients. B) Release of tumor
necrosis factor (TNF)α, monocyte chemoattractant protein (MCP)1 and prostaglandin (PG)
E2 in the culture media. * indicates a significant difference (p<0.05). The interaction term
indicates that the effect of PPARα agonist Wy14643 depends on the response of the patient to
IL1β.
75
Discussion
There is increasing evidence that the IPFP contributes to the OA disease process in the
knee joint by the production of cytokines that could induce destructive and inflammatory responses in cartilage70, 95, 110, 111, 116. The secretion of IL1β, TNFα, IL6, IL8, MCP1,
FGF2, VEGF, leptin, resistin and adiponectin by IPFP has been described previously95,
110, 111, 150
. Our study confirms the production of these cytokines and shows that additional
cytokines, such as IL4, IL10 are produced by osteoarthritic IPFP explants. We found
large variation in cytokine production between donors, possibly related to the presence
of immune cells149, 150
Although no studies have investigated the diffusion of synovial fluid cytokines to the
IPFP, the anatomical location and the presence of immune cells (e.g. macrophages, T
cells) in osteoarthritic IPFP116, 150, 149 make it likely that the IPFP itself is influenced by cytokines present in the synovial fluid. We therefore examined the effect of IL1β, a pro-inflammatory cytokine present in osteoarthritic synovial fluid157, on production of COX2,
IL1β, TNFα, MCP1, IL6, VEGF, leptin and PGE2 and found an increased production of PTGS2 and all cytokines, besides IL10 and leptin. Since IL10 is a cytokine with
anti-inflammatory and chondroprotective properties159, the lack of increase in IL10 gene
expression confirms the pro-inflammatory phenotype that seems to develop in the IPFP
by adding IL1β. Leptin is produced by adipocytes while all other cytokines are mainly
produced by the non-adipocyte fraction - mostly infiltrated immune cells 70. Therefore,
the absence of a significant effect on leptin production in the IPFP samples may indicate
that the IL1β effect on cytokine production mainly occurs through an effect on immune
cells and not on adipocytes. The effects of IL1β on the cytokine production in IPFP
samples were comparable with the responses in the synovium explants, except for VEGF
and PGE2. Although the explants were not obtained from the same donor, this demonstrates that in addition to synovium, the IPFP is also an important joint tissue that can
be stimulated by local inflammatory responses in the joint and could contribute to the
OA disease process.
We investigated whether the basal production of cytokines by IPFP was correlated with
BMI, since this might provide an explanation for the association between obesity and
incidence/progression of knee OA112. However, no correlation between BMI and IPFP
cytokine production was demonstrated and if so, the correlation tended to be negative
for many cytokines. We concluded that intra-articular influences such as IL1β may be
more important in regulating cytokine production than systemic influences such as BMI.
Additional analysis in more patients and with a lower mean BMI should confirm the lack
of correlation between BMI and cytokine production by the IPFP. Since we did not use
IPFP of healthy joints, it remains unclear whether BMI is correlated with IPFP production in the healthy joint.
76
We examined whether PPARα activation could inhibit the IL1β stimulatory effect on
IPFP explants. This nuclear receptor is expressed in white adipose tissue, but also cartilage synovium and bone, and is a target for agonists such as fibrates, which are potential
disease modifying drugs for OA151, 154, 162. In our study, Wy14643 leads to a decrease
in IL1β induced gene expression of VEGF by adding Wy14643. Additional statistical
analyses demonstrated an interaction between response to IL1β and effect of PPARα
activation, indicating that PPARα agonist Wy14643 only had an effect in the donors that
responded to IL1β, and not in the non-responsive donors. This was supported by the absence of an effect of PPARα agonist Wy14643 in cultures without IL1β. Furthermore, we
have observed similar results in a study on cartilage explants151, where we demonstrated
that PPARα activation inhibits the nuclear translocation of NFκB. Immune cells such
as macrophages70, 149, 150,may be responsible for the increase in cytokine production by
adding IL1β. The inhibition of NFκB in this cell fraction by PPARα activation has been
described and may be an important mechanism for the observed effects in our study155.
Other intracellular signalling pathways such as mitogen-activated protein kinase phosphorylation or cleavage of inflammasome/caspase-1 may also be involved155, 163. Future
experiments could elucidate the underlying mechanisms and the potential influence of
other pro- and anti-inflammatory cytokines on IPFP.
When adding Wy14643 to IL1β stimulated synovium explants, we observed a trend towards decrease for MCP1 gene expression and interaction between IL1β and Wy14643
in 5 genes of interest. Previous in vitro experiments have shown that PPARα agonists decrease the production of IL6 and IL8 in IL1β induced synoviocytes and also decrease the
release of cytokines by macrophages, which are also present in osteoarthritic synovium154,
155, 164
. The less pronounced effect of analyses of supernatants did not confirm all gene
expression results of cultures with Wy14643. This might be due to the high secretion of
cytokines by the explants, making the effects of a relative short period of culture with
Wy14643 insufficient to result in significant differences between conditions.
The protein data also had a large variation between samples. This might be due to differences in number of cells between explants, although we have standardized the weight of
the explants per volume medium. Differences in cell number between the explants were
easily corrected with housekeeper gene expression in the mRNA expression analyses but
we could not correct the secreted protein data for these variations.
PPARα agonists such as fibrates are used as lipid lowering drugs. Besides their lowering
effect on plasma triglyceride levels, they exert anti-inflammatory systemic effects. PPARα
agonists have also been shown effective in reducing inflammatory responses in osteoarthritic cartilage 151. This study provides a proof of principle that PPARα activation also
leads to a decrease in production of cytokines by the IPFP. Since OA pathogenesis probably involves systemic and metabolic factors such as dyslipidemia and atherosclerosis30, 31,
165
, the combination of local anti-destructive and anti-inflammatory effect in the joint,
with systemic effects on serum lipid levels and vascular pathology makes fibrates drugs of
interest as a therapeutic strategy for OA166, 167.
77
Conclusion
The IPFP is a source of cytokines. The production of cytokines can be stimulated by
IL1β, an important cytokine present in the synovial fluid of osteoarthritic joints. PPARα
activation significantly decreases the production of inflammatory cytokines in the IPFP
explants and to a lesser extent in the synovium explants. This study reinforces the potential role of adipose tissue in the etiopathogenesis of OA and shows that PPARα agonists
such as fibrates are a potential therapeutic strategy for OA.
Acknowledgements
The authors thank the orthopaedic surgeons and the nursing team for their assistance in
obtaining infrapatellar fat pad and synovium of patients undergoing total knee replacement. This study/work was performed within the framework of the Dutch Top Institute
Pharma project # T1-213. Stefan Clockaerts received a scholarship of the University of
Antwerp and the Anna Foundation.
78
79
80
Chapter
5
Peroxisome proliferator activated receptor alpha
activation decreases inflammatory and destructive
responses in osteoarthritic cartilage
S. Clockaerts, Y.M. Bastiaansen-Jenniskens, C. Feijt, J.A.N. Verhaar, J. Somville,
L.S. De Clerck, G.J.V.M. Van Osch
Osteoarthritis Cartilage. 2011 Jul;19(7):895-902. Epub 2011 Mar 31.
81
Abstract
Objective
Peroxisome proliferator activated receptor α (PPARα) agonists are used in clinical practice as lipid-lowering drugs and are also known to exert anti-inflammatory effects on
various tissues. We hypothesized that PPARα activation leads to anti-inflammatory and
anti-destructive effects in human OA cartilage.
Methods
Cartilage explants obtained from six OA patients were cultured for 48 h with 10 ng/ml
interleukin (IL)1β as a pro-inflammatory stimulus. 100 μM Wy-14643, a potent and
selective PPARα agonist, was added to the cultures and gene expression of matrix metalloproteinase (MMP)1, MMP3, MMP13, collagen type II (COL2A1), aggrecan and
PPARα in cartilage explants and the release of glycosaminoglycans (GAGs), nitric oxide
(NO) and prostaglandin E2 (PGE2) in the culture media were analyzed and compared to
the control without Wy-14643.
Results
Addition of Wy-14643 decreased mRNA expression of MMP1, MMP3 and MMP13
in cartilage explants that responded to IL1β, whereas Wy-14643 did not affect gene expression of COL2A1 and aggrecan. Wy-14643 also decreased secretion of inflammatory
marker NO in the culture medium of cartilage explants responding to IL1β. Wy-14643
inhibited the release of GAGs by cartilage explants in culture media.
Conclusion
PPARα agonist Wy-14643 inhibited the inflammatory and destructive responses in human OA cartilage explants and did not have an effect on COL2A1 or aggrecan mRNA
expression. These effects of PPARα agonists on osteoarthritic cartilage warrant further
investigation of these drugs as a potential therapeutic strategy for osteoarthritis (OA).
82
Chapter 5: PPARα activation decreases inflammatory and destructive responses in osteoarthritic cartilage
Introduction
Loss of structure of articular cartilage is an important characteristic of osteoarthritis
(OA). Inflammatory responses in the joint, leading to the production of cartilage matrix
enzymes and proinflammatory cytokines, contribute to the disruption of the balance
between anabolism and catabolism in cartilage8. To date, no drugs are able to prevent
the initiation and progression of OA168. PPARα is a class I nuclear receptor belonging to
the superfamily of ligand-dependent transcription factors regulating the transcription of
target genes by binding retinoid X receptor. In addition, PPARα modulates gene transcription in a DNA binding-independent manner154, 169. Natural ligands of PPARα are
polyunsaturated fatty acids or arachidonic metabolites (prostaglandins and leukotrienes).
Synthetic ligands of PPARα are Wy-14643 and fibrates, including gemfibrozil, clofibrate,
fenofibrate and bezafibrate167, 170, 171. Fibrates are clinically used as drugs that lower plasma
triglyceride and cholesterol levels through the induction of β- and ω-oxidative pathways, which neutralize and degrade fatty acids172. In addition, anti-inflammatory effects
of PPARα activation have been described173. These anti-inflammatory effects depend on
the inhibition of the nuclear translocation of nuclear factor-κB (NF-κB), which plays an
important role in the regulation of inflammatory responses155.
PPARα is present in a broad range of cells such as hepatocytes, myocardiocytes, skeletal
myocytes, endothelial cells, and also in chondrocytes162, 175-178. PPARα activation inhibits
the production of metalloproteinases in rabbit articular chondrocytes cultured in monolayer and stimulated with interleukin (IL1β) by potentiating the IL1β induced upregulation of IL1 receptor antagonist (IL1ra)152. The inhibitory effects of PPARα activation on
MMP production were confirmed by Poleni et al179. They also showed that PPARα might
decrease proteoglycan and collagen type II synthesis in rat chondrocytes embedded in alginate beads160. The effect of PPARα activation on inflammatory and destructive responses
in human OA cartilage explants has not yet been established. The aim of this study is to
investigate whether PPARα stimulation can reduce inflammatory responses in human
OA cartilage to further explore the influence of this stimulation on anabolic factors collagen type II and aggrecan. More evidence for a beneficial role of PPARα stimulation on
cartilage homeostasis is crucial in order to clarify the potential of drugs such as fibrates as
a therapeutic strategy for OA161.
In this study, we investigated the effect of Wy-14643 on anabolic, catabolic and inflammatory markers in osteoarthritic cartilage explants. Collagen type II (COL2A1) and aggrecan are important molecules in the extracellular matrix and matrix metalloproteinase
(MMP)1 (collagenase 1), MMP3 (stromelysin 1), MMP13 (collagenase 3) are involved
in matrix degradation in OA181, 182. To assess the anti-inflammatory properties of Wy14643, we analyzed NO and PGE2 production by the cartilage explants since these are
known mediators of inflammation, destruction and pain183-185. As mentioned before, the
NF-κB is a target of PPARα agonists. Therefore, we investigated whether PPARα activation inhibits the nuclear translocation of NF-κB in human OA chondrocytes.
83
Materials & methods
Preparation of human cartilage explants and human
chondrocytes.
Cartilage was obtained as anonymous waste material from six human OA patients who
underwent total knee arthroplasty. The patients had the right to consent as stated by the
guidelines of the Dutch Federation of Biomedical Scientific Societies (www.federa.org).
This method was approved by the Local Ethical Committee (number MEC 2004-322).
Explants with diameter of 6 μm were prepared using biopsy punches. Nine explants were
consolidated in 3 ml Dulbecco’s Modified Eagle’s Medium (DMEM) high glucose (GibcoBRL, Gaithersburg, MD, USA), supplemented with 2% fetal calf serum (Lonza, Basel,
Switzerland), 50 μg/ml gentamycin (GibcoBRL, Grand Island, NY, USA) and 1.5 μg/ml
fungizone (GibcoBRL, Grand Island, NY, USA) for 24 h in six well plates.
Study design
After pre-culture the explants were washed in phosphate buffered saline and the culture
medium was replaced by DMEM high glucose with Insulin-Transferrin-Selenium (Becton
Dickinson Biosciences, Erembodegem, Belgium). Explants were cultured simultaneously
with or without 10 ng/ml IL1β (Peprotech Rocky Hill, NJ, USA) as a pro-inflammatory
stimulus and with or without 10 or 100 μM Wy-14643 (Cayman Chemical, Ann Arbor,
MI, USA), a potent and selective PPARα agonist. Because Wy-14643 was dissolved in
Dimethyl-Sulfoxide (DMSO; Sigma, St. Louis, MO, USA), DMSO was also added to
the control and 10 μM conditions in order to correct for the concentration present in 100
μM Wy-14643. After 48 hours of culture, cartilage explants and culture media were snap
frozen in liquid nitrogen and stored in -80°C until further use.
RNA extraction and real-time polymerase chain reaction
(PCR)
For each of the six donors, 3 cartilage samples per condition were homogenized with a
Mikro-Dismembrator (Braun Biotech International GmbH, Melsungen, Germany) and
suspended in 1.8 mL/100 mg tissue RNA-Bee (Bioconnect, Huissen, The Netherlands).
RNA-bee suspended RNA was precipitated with 0.2 ml chloroform. RNA was purified using an RNeasy Micro Kit (Qiagen, Hilden, Germany). 500 ng of total RNA was
reverse-transcribed into cDNA using RevertAid First Strand cDNA synthesis Kit (MBI
Fermentas, St. Leon-rot, Germany). By means of PrimerExpress 2.0 software (Applied
Biosystems, Foster City, CA, USA), forward and reverse primers for the real-time RTPCR reaction were designed to meet TaqMan requirements, and to bind the separate
exons to avoid amplification of genomic DNA. The designed primer sequences were run
against a genome-wide database (BLASTN) to ensure gene specificity of the primers and
probes. The following forward and reverse oligonucleotides were used: MMP1 (Fw: CTCAATTTCACTTCTGTTTTCTG Rv: CATCTCTGTCGGCAAATTCGT probe: CA-
84
CAACTGCCAAATGGGCTTGAAGC; GenBank accession no. NM_002421), MMP3
(Fw: TTTTGGCCATCTCTTCCTTCA Rv: TGTGGATGCCTCTTGGGTATC
probe: AACTTCATATGCGGCATCCACGCC; GenBank accession no. NM_002422),
MMP13 (Fw: AAGGAGCATGGCGACTTCT Rv: TGGCCCAGGAGGAAAAGC
probe: CCCTCTGGCCTGCGGCTCA; GenBank accession no. NM_002427), collagen type II (COL2A1; Fw: GGCAATAGCAGGTTCACGTACA Rv: CGATAACAGTCTTGCCCCACTT probe: CCGGTATGTTTCGTGCAGCCATCCT; GenBank accession no. NM_033150), aggrecan (Fw: TCGAGGACAGCGAGGCC Rv:
TCGAGGGTGTAGCGTGTAGAGA probe: ATGGAACACGATGCCTTTCACCACGA; GenBank accession no. NM_001135) and PPARα (Fw: GACGTGCTTCCTGCTTCATAGA Rv: CCACCATCGCGACCAGAT; GenBank accession no. NM_005036).
TaqMan Universal PCR Master Mix (ABI, Branchburg, NJ, USA) or qPCR™ Mastermix
Plus for SYBR®Green I (Eurogentec, Nederland B.V., Maastricht, The Netherlands) was
used to perform Real-time (RT)-PCR in 20 μl reactions according to the manufacturer’s
guidelines and using an ABI PRISM 7000 with SDS software, version 1.2.3. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; fw: ATGGGGAAGGTGAAGGTCG Rv:
TAAAAGCAGCCCTGGTGACC Probe: CGCCCAATACGACCAAATCCGTTGAC
GenBank accession no. NM_002046.3) was compared with two other housekeeping
genes (data not shown) and was found to have good stability throughout the conditions
and samples. Relative gene expression was calculated by means of the 2-ΔCT formula.
Assays on culture media for viability, NO, PGE2 and GAGs
The pooled culture media of three samples per condition for each patient (N=6 patients)
were harvested to test the effect of Wy-14643 on the viability of chondrocytes using
the Cytotoxicity Detection Kit (Roche Diagnostics, IN, USA) in accordance with the
manufacturer’s instructions to determine the presence of lactate dehydrogenase (LDH) in
culture media. The amount of NO was measured using the spectrophotometric method
based on the Griess reaction (Sigma, St. Louis, MO, USA). Absorbance was measured at
540 nm. PGE2 content of the culture media was determined using the PGE2 Assay (RnD
systems, Minneapolis, MN, USA) according to manufacturer’s instructions at absorbance
of 450 nm. The release of GAGs from cartilage explants into the culture medium was
analyzed with the dimethylmethylene blue (DMB) assay186. The metachromatic reaction
with DMB was monitored with a spectrophotometer and a ratio A530:A590 was used to
determine the GAG amount with chondroitin sulfate C (Sigma) as standard.
85
NF-κB nuclear translocation in humane chondrocytes
Chondrocytes were isolated by pronase (2 mg/ml, Sigma, St. Louis, MO, USA) digestion
for 1 hour and a half, followed by overnight digestion with collagenase B (1.5 mg/ml,
Roche Diagnostics, Mannheim, Germany). The obtained chondrocytes were seeded in a
48 wells plate with at a density of 20,000 cells/cm2 and cultured in DMEM high glucose
(GibcoBRL, Gaithersburg, MD, USA), supplemented with 10% fetal calf serum (Lonza,
Basel, Switzerland), 50 μg/ml gentamycin (GibcoBRL, Grand Island, NY, USA) and 1.5
μg/ml fungizone (GibcoBRL, Grand Island, NY, USA). Chondrocytes were precultured
during 5-7 days. A preliminary experiment showed that one hour of IL1β incubation was
the optimal moment to evaluate NF-κB activation (data not shown), as also previously
reported187. Chondrocytes were cultured for immunohistochemical detection of NF-κB
with or without 10 ng/ml IL1β and with or without 100 μM Wy-14643 during one
hour. The cells were fixated on the plate in formalin 4%. This was followed by incubation for one hour with rabbit polyclonal NF-κB p65 antibody (1/100 Ab-276; Signalway
Antibody, Leusden, the Netherlands). Finally, alkaline phosphatase labeled secondary antibody was used in combination with a freshly prepared new fuchsine substrate (Chroma,
Kongen, Germany). An isotype IgG1 monoclonal antibody was used as negative control.
If the nucleus stained intensively red, cells were defined as positive for the nuclear presence of NF-κB. The percentage of positive cells was determined by two blinded and
independent observers by scoring three times 100 cells/well.
Data analysis
Data were analyzed with PSAW statistics 18.0 (SPSS inc. Chicago, IL, USA). A mixed
linear model was used for the mRNA expression data and a univariate analysis of variance for the assays on the media. To account for the differences in IL1β response between
donors, the statistical models for analyzing the effect of PPARα activation were adjusted
for IL1β response. Therefore, the statistical analysis indicates whether there is a significant effect of PPARα activation when considering the IL1β response. For the histological
analysis of NF-κB, a one-way analysis of variance (ANOVA) was performed with a Bonferroni post hoc test, after testing the residuals for normality with a Wilks-Shapiro test.
P<0.05 was considered statistically significant.
86
Results
PPARα genes were expressed in human OA cartilage. Stimulation with IL1β did not have
effect on PPARα gene expression (data not shown).
In order to exclude detrimental effects of Wy-14643 on viability of chondrocytes, we
performed an LDH cytotoxicity assay on cartilage explants cultured in 1 μM, 10 μM,
100 μM and 1000 μM of Wy-14643. Only at the concentration of 1000 μM Wy-14643
LDH concentration in the culture media was increased, indicating a deleterious effect of
Wy-14643 on chondrocyte viability. Viability was preserved at concentrations of 1, 10
and 100 μM Wy-14643 (data not shown).
We observed no effects of 10 μM Wy-14643 on MMP, COL2A1, aggrecan gene expression, GAG release, NO or PGE2 production and therefore used the 100 μM concentration in our experiments.
We investigated the effect of Wy-14643 on degradation markers in OA cartilage by gene
expression analysis on MMP1, MMP3 and MMP13 in OA cartilage explants stimulated
with 10 ng/ml IL1β. The addition of IL1β increased mRNA expression of MMP1 in explants of five of six patients (P=0.01), MMP3 in explants of five of six patients (P=0.08)
and MMP13 in explants of all patients (P=0.06).
mRNA expression of MMP1 (P<0.0001), MMP3 (P=0.01) and MMP13 (P<0.0001)
was significantly decreased by the addition of Wy-14643 in the explants from patients
that responded to the IL1β stimulation by an increased expression of MMPs (Figure 1).
The addition of IL1β decreased mRNA expression of COL2A1 in explants of four of six
patients (P=0.02) and aggrecan in explants of five of six patients (P=0.02). This effect was
not counteracted by Wy-14643 (Figure 2).
NO and PGE2 were analyzed in culture media of the cartilage explants as markers of
inflammation.
IL1β increased the production of NO in five of six patients (P=0.10) and PGE2 production was increased in five of six patients (P=0.13). Wy-14643 decreased the production
of NO (P=0.02) and PGE2 (P=0.07) in explants that responded to IL1β by an increased
production of NO and PGE2 (Figure 3).IL1β increased GAG release in the culture media in three of six patients (P=0.23). Wy-14643 decreased the release of GAG, again
only in explants that responded to IL1β by an increased release of glycosaminoglycans
(P=0.005) (Figure 3).
87
Figure 1: Catabolic responses of cartilage explants after 48 h of culture with IL1β and
with(out) PPARα agonist Wy-14643. mRNA expression of (A) MMP 1, (B) MMP3 and (C)
MMP13. Gene expression is normalized to GAPDH. For each condition, N = 18 samples of
cartilage, obtained from six donors. Averages of three samples are shown for each donor. Each
symbol represents one donor.
88
Figure 2: Anabolic responses of cartilage explants after 48 h of culture with IL1β and with(out)
PPARα agonist Wy-14643. Relative mRNA expression of (A) COL2A1 and (B) aggrecan.
Gene expression is normalized to GAPDH. For each condition, N = 18 samples of cartilage,
obtained from six donors. Averages of three samples are shown for each donor. Each symbol
represents one donor.
89
Figure 3: Inflammatory and destructive responses of cartilage explants after 48 h of culture
with IL1β and with(out) PPARα agonist Wy-14643: supernatant was analyzed for (A) NO,
(B) PGE2 and (C) GAG release. For each condition and for each donor pooled culture media
were analyzed, resulting in N = 6 (donors). Each symbol represents one donor.
90
To investigate whether inhibition of the nuclear translocation of NF-κB is an underlying
mechanism contributing to the anti-destructive and anti-inflammatory effects of PPARα
activation, we examined the location of NF-κB in human chondrocytes with immunohistochemistry (Figure 4). Here, we observed a 30% increase of positive staining cells for
nuclear NF-κB when adding 10 ng/ml IL1β (P=0.008). There was no effect of adding
Wy-14643 to the cells that were not incubated with IL1β, but we observed a decrease of
34% (P=0.001) by adding 100 μM Wy-14643 to the IL1β incubated cells.
Figure 4: Nuclear translocation of NF-κB in human chondrocytes cultured in monolayer.
Immunolocalization (magnification 200 times) of (A) NF-κB in cells cultured in medium
alone, (B) with IL1β, (C) and with the combination of IL1β and 100 μM Wy-14643. N = 3
different cultures. P indicates a cell with positive nuclear staining, n: chondrocyte without intranuclear presence of NF-κB. Figure 4D shows the percentages of cells with a positive nuclear
staining for NF-κB in the different conditions. Bars indicate standard deviation.
91
Discussion
Addition of 100 μM PPARα agonist Wy-14643 decreased gene expression of the catabolic markers MMP1, MMP3, MMP13, GAG and NO release in human OA cartilage
explants. There was no effect of Wy-14643 on COL2A1 and aggrecan mRNA expression.
Interestingly, effects of PPARα activation were only found in explants that responded to
IL1β.
We show that PPARα agonists are able to counteract inflammatory and destructive responses but only in IL1β responsive human OA explants, as analyzed statistically with
IL1β response as a covariable. Our results are in concordance with a study of Francois et
al, that demonstrated that the addition of clofibrate, another PPARα agonist, counteracts
IL1β induced MMP1, 3 and 13 production in rabbit articular chondrocytes and also had
no effects without IL1β. Their study demonstrated that the decrease in MMP1, 3 and 13
by PPARα activation is due to the potentiation of IL1β stimulated production of IL1ra.
Without PPARα activation, IL1β modestly induces the production of IL1ra, but the
combination of IL1β and PPARα leads to higher IL1ra levels that inhibit IL1β stimulation152. In our study however, IL1ra mRNA expression (data not shown) did not correlate
with the outcome parameters. Therefore, other mechanisms were considered for explaining the effect of PPARα activation. We investigated the role of NF- κB. PPARα ligands
have been described to inhibit the nuclear translocation of NF-κB, in part by increasing
the expression of inhibitor κB-α (IκB-α)155. Under normal conditions, NF-κB is present
in the cytoplasm in an inactive form bound to IκB-α, but inflammatory reactions induce
the degradation of IκB-α and allow NF-κB to translocate to the nucleus where it orchestrates the transcription of cytokines, growth factors, chemokines, and survival genes155.
We confirmed that a PPARα ligand partly inhibits the nuclear translocation of NF-κB in
human IL1β stimulated chondrocytes.
Not all IL1β induced responses were counteracted by the PPARα agonist. IL1β decreased
gene expression of collagen II and aggrecan in cartilage explants but this was not influenced by Wy-14643. COL2A1 and aggrecan mRNA expression in the IL1β stimulated
explants was very low. To exclude the possibility that expression of these genes could not
be lowered by adding Wy-14643 because the expression was already very low, we have
added 100 μM Wy-14643 to unstimulated explants and analyzed the mRNA expression of COL2A1 and aggrecan. Here, 100 μM Wy-14643 also did not affect the gene
expression of COL2A1 and aggrecan (data not shown) indicating that the main effect of
PPARα activation is inhibiting inflammatory and destructive, but not anabolic processes
in cartilage. There was a correlation between mRNA expression level (MMPs) and protein
release (NO, PGE2 and GAG) since the explants of two patients responded modestly to
IL1β at both mRNA expression and protein level, while four other patients had a great
response at both levels.
In this study, we used human OA cartilage explants. Explants resemble the in vivo situation since the extracellular matrix that influences chondrocyte metabolism is still present.
92
The explants were stimulated with 10 ng/ml IL1β to mimic inflammatory processes in
an in vitro model for OA158, 188, 189. However, not all cartilage donors responded to the
IL1β stimulation. The difference in IL1β response of the human cartilage explants to
IL1β in our study are comparable with previous studies using IL1β to stimulate human
explants190. The large variability in response may be due to differences in age, different
levels in oxidative stress responsible for activating NF-κB, and zonal differences in cartilage metabolism191-193.
We observed no effect of IL1β on PPARα mRNA expression, in accordance with the
results of previous studies162, 194.
Wy-14643 was selected because it is a potent and selective PPARα agonist. It exhibits 10
times more affinity for PPARα (kd<1 μM) than does clofibrate and fenofibrate195-197 and
is 50 to 500 times more selective for PPARα than other subtypes of PPAR. Wy-14643 has
been used in concentrations higher than 100 μM before in other in vitro studies160, 162, 198
and was demonstrated to remain a selective PPARα agonist in chondrocytes at concentrations of 100 μM160. In our study, 10 μM Wy-14643 had no effect on any parameter in
the explants cultures, although effects of even lower concentrations of less potent PPARα
agonists have been observed on chondrocytes152. The absence of an effect for 10 μM Wy14643 might be explained by difficulties in penetration in the extracellular matrix of the
explants, since other studies were using chondrocyte cultures in monolayer. Nonetheless,
100 μM Wy-14643 did show a significant decrease for both destructive and inflammatory markers on our cartilage explants, confirming the proof of principle that PPARα
activation leads to a decrease of inflammatory and destructive responses.
Further studies are needed to examine whether PPARα ligands such as fibrates, that are
used in clinical practice such as fibrates, can induce similar responses in cartilage as observed in this study. Polyunsaturated fatty acids are naturally occurring agonists of PPARα
and have been described to exert anti-inflammatory properties on articular cartilage35,180.
Since fatty acids are PPARα ligands with low affinity, we believe that high concentrations
or a high total flux of fatty acids might induce the anti-inflammatory effects of fatty acids
in a joint through the activation of PPARα.
93
Conclusion
Drug research in OA has mainly focussed on cartilage, although metabolic factors such
as body mass index, plasma triglycerides, cholesterol levels and subchondral vascular pathology might play a role in the OA pathogenesis30-32, 45, 116, 174, 199. Therefore it would be
interesting to find drugs capable of altering metabolic factors together with inhibiting
destructive or inflammatory responses in cartilage. PPARα agonists may indirectly influence the OA disease process by the prevention of subchondral vascular pathology, by lowering triglycerides and cholesterol levels in plasma, and through their anti-inflammatory
effects on the blood vessels153, 178, 201.
Our data provide evidence that PPARα agonists, used as lipid-lowering drugs in clinical
practice (e.g. fibrates), may improve cartilage metabolism in an osteoarthritic joint by
lowering MMP1, 13 gene expression, GAG release and NO production. Therefore, we
believe that the use of the synthetic ligands of PPARα as a potential therapeutic strategy
for OA should be further explored.
Acknowledgements
The authors want to thank the orthopaedic surgeons and the nursing team for their assistance in obtaining cartilage from patients undergoing total knee replacement. Also thanks
to JH Waarsing for his helpful assistance in the statistical analysis of the data. This study/
work was performed (partly) within the framework of the Dutch Top Institute Pharma
project # T1-213. Stefan Clockaerts received a scholarship of the University of Antwerp
and the Anna Foundation
94
95
96
Chapter
6
Statin use is associated with reduced incidence and
progression of knee osteoarthritis
in the Rotterdam study
S. Clockaerts, G.J.V.M. Van Osch, Y.M. Bastiaansen-Jenniskens, J.A.N.
Verhaar, F. Van Glabbeek, J.B. Van Meurs, H.J.M. Kerkhof, A. Hofman,
B.H.Ch. Stricker, S.M. Bierma-Zeinstra
Ann Rheum Dis. 2012 May;71(5):642-7. Epub 2011 Oct 11.
97
Abstract
Background
Osteoarthritis is the most frequent chronic joint disease causing pain and disability. Besides biomechanical mechanisms, the pathogenesis of osteoarthritis may involve inflammation, vascular alterations and dysregulation of lipid metabolism. As statins are able to
modulate many of these processes, this study examines whether statin use is associated
with a decreased incidence and/or progression of osteoarthritis.
Methods
Participants in a prospective population-based cohort study aged ≥55 years (n=2921)
were included. X-rays of the knee/hip were obtained at baseline and after on average 6.5
years, and scored with the Kellgren & Lawrence score for osteoarthritis. Any increase in
score was defined as overall progression (incidence and progression). Data on co-variables
were collected at baseline. Information on statin use during follow-up was obtained from
computerized pharmacy databases. The overall progression of osteoarthritis was compared between users and non-users of statins. Using a multivariate logistic regression
model with generalized estimated equation, odd ratios and 95% confidence intervals
were calculated after adjusting for confounding variables.
Results
Overall progression of knee and hip osteoarthritis occurred in 6.9% and 4.7% of the
cases, respectively. The adjusted odds ratio for overall progression of knee osteoarthritis in
statin users was 0.43 (95% CI 0.25-0.77, p=0.01). The use of statins was not associated
with overall progression of hip osteoarthritis.
Conclusions
Statin use is associated with more than 50% reduction in overall progression of osteoarthritis of the knee, but not of the hip.
98
Chapter 6: Statin use is associated with reduced incidence and progression of knee osteoarthritis in the Rotterdam study
Introduction
Osteoarthritis is the most common form of arthropathy. It affects 9.6% of men and 18%
of women aged 60 years or older and is the leading cause of disability in the elderly2,
202
. The etiology of osteoarthritis is not completely understood. Besides genetic variation
and biomechanical mechanisms, inflammation can lead to cartilage matrix breakdown,
synovial hypertrophy, subchondral bone sclerosis and osteophyte formation43, 158, 203. The
pathogenesis of osteoarthritis might also involve altered lipid metabolism and vascular
pathology30, 31, 204.
Current treatment of osteoarthritis consists of exercise therapy and lifestyle adjustment
with pharmacotherapeutic treatment of symptoms when needed. However, the therapeutic efficacy of this treatment is small to moderate205. Until now, there is no diseasemodifying compound for osteoarthritis43, 205. In the last decades, drug research and development has mainly focused on articular cartilage, even though the whole joint is affected
in osteoarthritis and the disease process may also be influenced by systemic factors.
In addition to lowering the circulating level of low density lipoproteins (LDL), statins
have a broad range of biologic effects including anti-inflammatory properties in different cell types. In-vitro studies revealed that statins have anti-oxidative effects, decrease
the production of matrix metalloproteinases, interleukins and increase the production
of aggrecan and COL2A1 in chondrocytes206. In synovial cells, statins also decrease the
production of matrix metalloproteinases, interleukins, chemokines and induce apoptosis
in synovial fibroblasts206. Furthermore, statins might influence osteoarthritis by their ability to inhibit osteoclastogenesis, to stimulate bone formation and to counteract possible
underlying mechanisms of osteoarthritis, such as decreasing plasma LDL levels, vascular
pathology and systemic inflammation165,207,209.
Statins are now frequently used as lipid-lowering drugs. Since statins seem capable of targeting different underlying mechanisms of osteoarthritis, these drugs have been suggested
as possible disease-modifying drugs for osteoarthritis30, 199, 210, 211. However, reliable data
to support this assumption are lacking. Therefore, this study examines the association
between statin use and the incidence and/or progression of knee and/or hip osteoarthritis
in a large population-based study.
99
Methods
Study population
The Rotterdam study is a prospective population-based cohort study set up to investigate
the occurrence and determinants of diseases in an aging population212. All 10,275 inhabitants aged 55 years and older who have lived for at least 1 year in the Ommoord district
of the city of Rotterdam were asked to participate. The response rate was 78%, which
means that 7,983 subjects responded. The Medical Ethics Committee of the Erasmus
MC University Medical Center approved the study and all participants gave written informed consent. Baseline measurements were obtained from 1990 to 1993 and consisted
of a home interview and visits to the research center for physical examinations. Followup data were collected during a follow-up visit from 1996 to 1999. The present study
includes participants for whom radiographs of knees and hips at baseline and follow-up
were present and scored. Patients with Bechterew’s disease, rheumatoid arthritis, gout,
upper leg fractures (for knee osteoarthritis) and hip fractures (for hip osteoarthritis) were
excluded.
Exposure assessment
Within the Ommoord district, seven fully computerized pharmacies are linked to one
computer network. 98% of the participants filled their prescriptions in one of these pharmacies during the period from baseline to follow-up. All data on dispensed drugs are
available in computerized form on a day-to-day basis. Information is available on the
date of prescribing, the total amount of drug units on each prescription, the prescribed
daily number of units, the product name of the drugs and the Anatomical Therapeutic
Chemical (ATC) code213. For each participant, the use of statins was extracted for the
period between baseline and follow-up visit. To avoid non-differential misclassification
of exposure, we excluded participants that were taking statins at baseline, since no data
were available on the duration of use of statins during the period before baseline. Subjects
with a cumulative use of <120 days and/or a daily intake of <50% of recommended daily
adult dose for treatment of hypercholesterolemia in the Netherlands were considered as
non-users because below this period and dose a substantial protective effect on a slowly
progressive disease such as osteoarthritis can not be expected. To investigate effects of
increasing cumulative exposure, we defined a priori three intervals of statin use for subjects with an average daily intake of ≥50%: 1-119 days, 120-364 days and ≥365 days.
Lipophilic statins (in this study: atorvastatin, simvastatin, fluvastatin and lovastatin) and
hydrophilic statins (pravastatin) have a common mechanism of action, but differ in terms
of absorption, distribution, metabolism and excretion214. Therefore, we distinguished between lipophilic and hydrophilic statins in the additional analyses.
100
Outcome assessment
Weight-bearing anteroposterior radiographs of the knee and hip were obtained at 70
KV, a focus of 1.8, and a focus to film distance of 120 cm, applying a Fuji High Resolution G 35 x 43 cm film. The knee was extended with the patella in a central position.
Radiographs of the pelvis were obtained with both feet in 10° internal rotation and the
X-ray beam centered on the umbilicus. Radiographs were assessed following the Kellgren
& Lawrence (K&L) grading system,215-218atlas based, in five (0-4) grades (Table 1). In
addition, we defined a joint prosthesis as grade 5219. Each radiograph was scored by one
trained reader of in total 7 readers. The inter-rater reliability between two of the seven
readers was tested in a random set of 10% of radiographs. The Kappa value (cut off value:
Kellgren & Lawrence score ≥2) was 0.71 (95% CI 0.66 - 0.76) for the knee and 0.74
(95% CI 0.70 - 0.78) for the hip. The radiographs at baseline and follow-up were read
without knowledge of the clinical status of the participants or without knowledge of the
research hypothesis or exposure status of the participants. Left and right radiographs were
grouped per subject and read by pairs in chronological order220. Since there is no consensus on the definition of incidence and progression, we combined both in one definition
for overall progression of osteoarthritis. This was defined as an increase in the K&L score
between baseline and follow-up of 1 or more. In case of a baseline score 0, overall progression was defined as an increase of 2 or more. Patients with score 4 or 5 at baseline were
left out of the analysis. For transparency we also reported on previously used outcomes
for incidence and progression separately (incidence defined as score 0 or 1 at baseline and
a follow-up score of 2 or more; progression defined as a baseline score of 1, 2, 3 and an
increase of 1 or more)221.
101
102
No features of osteoarthritis
No osteoarthritis
Doubtful
Mild
Moderate
Severe
0
1
2
3
4
No features of osteoarthritis
Hip
Table 1. Kellgren and Lawrence scores for osteoarthritis of the knee and the hip.
Large osteophytes, marked narrowing of joint Gross loss of joint space with sclerosis and
space, severe sclerosis and definite deformity of cysts, marked deformity of femoral head and
acetabulum and large osteophytes
bone ends
Moderate multiple osteophytes, definite narrow- Marked narrowing of joint space, definite osing of joint space and some sclerosis and possible teophytes, some sclerosis and cyst formation,
and deformity of the femoral head and acetabdeformity of bone ends
ulum
Definite osteophytes and possible narrowing of Definite narrowing of joint space inferiorly,
joint space
definite osteophytes, and slight sclerosis
Doubtful narrowing of joint space and possible Possible narrowing of joint space medially and
osteophytic lipping
possible osteophytes around the femoral head;
or osteophytes alone
Knee
Grade
Co-factors
Trained interviewers gathered information on medical history and risk factors for chronic
diseases. Participants were invited to visit the research center for clinical examinations
and laboratory assessments. The following information was collected and defined as possible confounders for the present study: gender, age, body mass index [BMI; weight (kg)/
height (m2)], femoral bone mineral density (BMD; measured by DXA; Lunar DPX-L
densitometer), total cholesterol/high density lipoprotein (HDL) ratio (serum total cholesterol determined by an enzymatic procedure, HDL measured after precipitation of
non-HDL cholesterol), current smoking (self-reported), diabetes mellitus (use of glucose lowering medication or non-fasting random or postload glucose levels exceeding
11.0 mmol/liter), peripheral artery disease (ankle/brachial index <0.9 in at least one leg),
arterial hypertension (systolic blood pressure of 160 mmHg or higher, diastolic blood
pressure of 95 mmHg or higher, or use of antihypertensive drugs for hypertension), educational level, and number of months between baseline and follow-up.
Statistical analysis
Baseline characteristics of statin users/non-users were compared with Student’s t-test and
Pearson’s χ2 test. When examining the association between statin use and osteoarthritis,
a joint-based analysis of knees and hips was used with generalized estimating equations
(GEE) to fit the models for correlations between the right and left extremity in each
individual222. A multivariate logistic regression model including statin use and adjusting
for confounding variables, was fitted to calculate odds ratios, 95% confidence intervals
and p-values for overall progression of knee and hip osteoarthritis. The definition of progression implies that participants are restricted (i.e. conditioned) by baseline presence of
OA. The estimates of an effect of exposure on outcome are therefore potentially biased.
The effects of determinant on the estimate of outcome can only be assessed correctly by
including all potential confounders in the multivariate analysis, thereby creating a model
in which the conditioning by baseline is minimized223. Therefore, we adjusted for all
possible confounding variables based on literature. We also adjusted for months between
baseline and follow up visit, and for baseline K&L score. Subjects with missing values
were excluded from the analysis. The dataset contained 1 (0.03%) missing value for age
and gender, 14 missing values (0.48%) for BMI, 29 (0.99%) for hypertension, 5 (0.17%)
for diabetes mellitus, 248 (8.49%) for femoral BMD, 137 (4.69%) for HDL/total cholesterol ratio, 18 (0.01%) for education, 230 (7.87%) for peripheral artery disease, and 17
(0.58%) for smoking. The category reflecting no use of statins was set as reference. Results
with a p-value below 0.05 were considered statistically significant.
103
Results
Of the total 7983 participants, 2921 were included in this study (Figure 1). Osteoarthritis
(K&L score of ≥2) was present in 677 knees (12.5%) and 335 hips (5.8%) at baseline, and
in 939 knees (17.5%) and 508 hips (8.8%) at follow-up. After exclusion of participants
with fractures of the femur (for knee osteoarthritis) and the hip (for hip osteoarthritis),
and with end-stage osteoarthritis or joint prosthesis, the overall progression of left or right
knee osteoarthritis in the study population was 6.9%, and 4.7% for the hip joints.
Of this group, 317 (10.9%) were defined as statin users. Statin users were younger, had
higher plasma total cholesterol/HDL ratios, and more frequently reported arterial hypertension and diabetes mellitus than non-users (Table 2). Between statin users and nonusers there were no differences in gender, educational level, BMI, femoral BMD, those
that reported to smoke, and individuals with peripheral artery disease. The occurrence of
hip fractures, femur fractures and the follow-up period was similar in both groups.
104
10275 subjects
response rate 78%
7984 subjects
5879 subjects
2105 subjects without radiographs at baseline
for left/right knee/hip (20% deceased before
visiting the examination center, others were
unable to visit the research center)
3065 subjects
2814 subjects without radiographs at follow up
for left/right knee/hip (32% deceased during
follow up, others were unable to visit the
examination center)
55 subjects with rheumatoid artritis, gout,
and/or Bechterew disease
3010 subjects
89 subjects with baseline use of statins
2921 subjects
2 patients with
femurfracture
413 knees with
K&L 5 or
prosthesis
5425 knees* included in this study
140 patients with
hipfracture
176 hips with
K&L 5 or
prosthesis
5386 hips# included in this study
Figure 1: Flow chart showing subjects from eligibility to inclusion in the present study. 972
knees (*) and 919 hips (#) were excluded from the multivariate analyses due to missing values
in covariables.
105
106
65.9 (6.8)
1495 (57.4)
26.27 (3.4)
0.85 (0.13)
5.11 (1.5)
707 (27.4)
230 (9.6)
539 (20.8)
176 (6.8)
546 (10.5)
77.78 (4.5)
2 (0.1)
130 (5.0)
279 (11.8)
383 (16.4)
341 (13.9)
481 (19.7)
133 (5.2)
198 (7.7)
64.1 (5.6)
178 (56.3)
26.4 (3.48)
0.9 (0.13)
6.5 (2.13)
111 (35.4)
30 (10.1)
79 (25.2)
31 (9.8)
60 (9.6)
77.7 (4.3)
0 (0.0)
10 (3.2)
25 (8.5)
34 (11.8)
32 (10.9)
38 (13.1)
15 (4.7)
20 (6.3)
Age (years)
Female (%)
Body mass index (kg/m2)
Femoral bone mineral density (g/cm2)
Plasma total cholesterol/HDL ratio
Arterial hypertension
Peripheral artery disease
Smoker
Diabetes mellitus
Higher education
Follow-up period (months)
Femur fracture
Hip fracture
Kellgren and Lawrence score ≥2 of left knee
Baseline
Follow-up
Kellgren and Lawrence score ≥2 of right knee
Baseline
Follow-up
Kellgren and Lawrence score ≥2 of left hip
Baseline
Follow-up
Nonusers (n=2604)
means (SD) or n (%)
Statin users (n=317)
means (SD) or n (%)
Variables
0.74
0.37
0.16
0.01
0.09
0.04
<0.001
0.71
0.45
0.11
<0.001
0.01
0.80
0.07
0.05
0.44
0.70
0.62
0.15
p Value
16 (5.0)
26 (8.2)
171 (6.6)
264 (10.3)
0.28
0.24
Table 2: Characteristics of the study population (n=2921). Statin use was defined as the use of statins for ≥120 days, and ≥50% of the daily
recommended intake. Data are means (SD) or n (%). Subjects with missing values were excluded from the analysis. Osteoarthritis is defined as
a Kellgren & Lawrence score of 2 or more. All subjects with baseline statin use, rheumatoid arthritis, gout, Bechterew disease, femur fracture (for
knee osteoarthritis) and hip fracture (for hip osteoarthritis) were excluded.
Kellgren and Lawrence score ≥2 of right hip
Baseline
Follow-up
107
108
15 (3.0)
Statin users
53 (6.3)
3 (2.4)
18 (4.1)
1-119
120-364
≥365
0.49
0.30
1.77
1.00
0.43
1.00
0.26 – 0.92
0.08 – 1.19
0.71 – 4.44
-
0.25 – 0.77
-
95% CI
0.03
0.09
0.22
-
0.01
-
value
p-
17 (3.6)
6 (4.8)
3 (4.1)
228 (4.8)
21 (4.0)
177 (4.5)
(%)
No. of progressors
1.00
1.05
1.05
1.00
1.10
1.00
OR
Adjusted
0.51 – 1.98
0.38 – 2.88
0.20 – 5.62
-
0.63 – 1.90
-
95% CI
Hip osteoarthritis
0.92
0.92
0.95
-
0.74
-
value
p-
Table 3:Association between statin use and progression of knee and hip osteoarthritis. Adjusted odds ratios (OR), 95% confidence intervals (CI)
and p-values were computed by multivariate analysis with generalized estimated equations to account for left and right correlations. The odds
ratios were adjusted for baseline K&L score, gender, age, body mass index, femoral bone mineral density, total cholesterol/high density lipoprotein
(HDL) ratio, current smoking, diabetes mellitus, peripheral artery disease, arterial hypertension, educational level and months between baseline
and follow-up. Statin use was defined as the use of statins of ≥120 days, and ≥50% of daily recommended intake. To analyze the effect of increasing cumulative exposure, three intervals of statin use were defined for subjects with an average daily intake of ≥50%: 1-119 days, 120-364 and
≥365 days whereas all other subjects were defined as non-users.
346 (7.2)
Non-users
Period of statin use (days)
288 (7.3)
OR
(%)
Non-users
Adjusted
No. of progressors
Knee osteoarthritis
The use of statins is associated with a reduction of the overall progression of knee osteoarthritis (OR 0.43, 95% CI 0.25-0.77, p=0.01) after adjustment for baseline K&L
score, possible confounders, and months between baseline and follow-up (Table 3). These
results were confirmed by analyzing the effect of cumulative exposure to statin use (daily
intake ≥50%) in users of lipophilic statins (OR 0.50, 95% CI 0.26-0.95, p=0.03). The
data were underpowered to examine the association between hydrophilic statin use and
overall progression of knee OA.
To investigate whether the association between statin use and overall progression of knee
osteoarthritis is (or is not) due to confounding by indication, we computed models for
the difference between statin users, minimal users (subjects that used statins <120 days
or <50% of the recommended daily adult dose) and non-users. There was a significant
decrease of overall progression of knee osteoarthritis in the user group (OR 0.44, 95%
CI 0.25-0.77, p=0.01) and no association in the minimal user group (OR 1.17, 95%
0.50-2.71, p=0.72). Additional analyses with previously used definitions of incidence
and progression 221 also found significant associations between statin use and incidence
of osteoarthritis of the knee (OR 0.45, 95% CI 0.24 – 0.85, p=0.01) and progression of
osteoarthritis in the knee (OR 0.39, 95% CI 0.20-0.75, p=0.01).
In the hip joint, no associations were found between statin use and overall progression of
osteoarthritis (OR 1.10, 95% CI 0.63-1.90, p=0.74). Incidence of hip osteoarthritis (OR
0.87, 95% CI 0.46-1.67, p=0.70) or progression (OR 1.25, 95% CI 0.70-2.21, p=0.45)
in the hip separately were also not associated with statin use (data not shown).
109
Discussion
This population-based study demonstrates that the use of statins is associated with a decrease in overall progression of osteoarthritis of the knee, but not of the hip.
For this study, we used a large population-cohort study, the Rotterdam Study, in which all
relevant clinical, radiological and pharmacological data were collected from a population
at risk for progression of osteoarthritis. Detailed pharmacological data for the total period
were available in computerized databases of the local pharmacies. We included potential confounders that could influence the association between statin use and osteoarthritis, and adjusted for baseline presence of osteoarthritis in our analyses of progression223.
Many of these covariables are characteristics of a cardiovascular and metabolic profile,
since osteoarthritis is a disease with a multifactorial etiology involving biomechanical,
genetic, inflammatory, vascular and metabolic factors31, 203, 204.
In this study, overall progression of osteoarthritis was defined as the combination of the
incidence and progression of existing osteoarthritis at baseline, since both outcome parameters can not be accurately defined based on radiographic examination alone. Although the Rotterdam Study is a large study, the number of statin users and subjects
with overall progression were low. Using separate definitions of incidence and progression
would have decreased the numbers even further. However, when we used those separate
definitions of incidence and progression, we found similar results.
The use of statins was clearly associated with reduced progression of knee osteoarthritis,
whereas this was not the case for the hip joint. This difference can not be attributed to a
lack of power, since the number of included hips was comparable to that of knee joints.
The difference in effect on hip joints in the present study may indicate a difference in
pathogenesis between the knee and the hip. Since statins only target non-biomechanical
mechanisms, our data may suggest that osteoarthritis of the knee is influenced more by
metabolic factors such as the secretion of cytokines and adipokines by adipose tissue, vascular pathology in the subchondral bone or direct effects of lipids on joint tissues30, 31, 116,
204
than osteoarthritis of the hip. Together with changed mechanics in especially the knee
due to obesity224, this might explain why BMI is a major risk factor for knee osteoarthritis, but not for the hip26, 112, 225. Systemic factors such as disordered glucose metabolism,
lipid metabolism and atherosclerosis have already been linked to knee OA. Besides the
potential role of cytokines and adipokines secreted by subcutaneous and visceral adipose
tissue, there is also the presence of a large intra-articular fat pad that has been suggested
to play an important role in knee OA116, 208. It would have been worthwhile to investigate
effect modification by obesity, age and gender by stratified analysis, but the data were
underpowered to perform these extra analyses.
In the present study no association was found between statin use and hip osteoarthritis.
An earlier study among 5678 woman (aged 65 years and older) on the association between statin use and radiographic hip osteoarthritis reported a higher incidence of hip
osteoarthritis in the group of statin users over a period of 8 years; they also reported a
110
trend towards a decrease in progression, albeit not significant. However, in their study,
the multivariate models were not adjusted for confounding variables such as diabetes mellitus or serum cholesterol level. Furthermore, statin use was based on statin prescriptions
gathered by patients at follow-up and no data were available on statin intake during the
follow-up period, or on dose or period of intake226. This is in contrast to our study, where
we obtained data on statin use from computerized databases of local pharmacies during
the follow-up period. Another study investigated the association between statin use and
osteoarthritis in a retrospective cohort study among the members of a 1.8 million health
maintenance organization in Israel, and found no significant association after long-term
follow-up. In that study, however, they only investigated reported general osteoarthritis
(based on ICD-9 codes 715.x) without stratifying by joint227, whereas we were able to
investigate osteoarthritis of the knee and the hip separately, based on radiographic examination.
The use of anterior-posterior radiographs of the knee in 20-30 degrees flexion improves
the reliability of joint space width compared to the straight leg radiographs used in the
Rotterdam Study228. Therefore, our reported association for the knee might be less precise
than with use of flexed knee radiographs. In addition, the radiographs were scored in
known time order, which increases the sensitivity to change. Due to the observational
nature of the present study, selection bias, information bias or confounding are potential
limitations. Although the high participation rate in the Rotterdam Study makes selection bias less likely, baseline hip and/or knee radiographs were available for about 74%
of participants. In addition, due a loss to follow up, baseline and follow up radiographs
were available for only 38% of the initially 7984 included participants. Patients had to
be mobile and motivated enough to come to the examination center at baseline and follow up, and had to survive the follow up period to have radiographs at both time points
This caused a health based selection bias. In the group with baseline radiographs compared those without, subjects were younger (68 years versus 78), there were less subjects
with arterial hypertension (33.8% versus 45.5%) and less people with diabetes mellitus
(9.8% versus 14.7%) There were also more men in the subjects with baseline radiographs
(41.7% versus 31.1% women). It is difficult to say how this has affected our findings
unless healthy participants show a better response to statins than unhealthy non-participants. Because of the prospective nature of this study, information bias is highly unlikely
and, since we adjusted for all known confounders, our results are probably valid. Confounding by indication was investigated by calculating the risk estimates for those who
used statins for <120 days. In this group, there was a slight but non-significant increase in
progression of knee osteoarthritis instead of a decrease. This suggests that confounding by
indication would tend to underestimate a true protective effect. The statin users tended
to have less K&L scores of 2 or more at baseline. However, statins users were younger and
there were less females in the statin users group. When performing statistical analysis with
adjustment for these covariables, there was no longer a tendency to lower K&L scores at
baseline in the statin user group (data not shown).
111
Statins may be a candidate for the pharmacological management of osteoarthritis since
they are drugs capable of altering serum lipid levels, inflammatory pathways in endothelial cells, macrophages, chondrocytes, synoviocytes and they have protective effects on
subchondral bone by inhibiting osteoclastogenesis and stimulating bone formation206, 207,
210, 229-233
. However, it should be noted that our study only indicates the disease-modifying
effect of statins, and did not investigate differences in pain or disability between statin
users and non-users. Additional studies on the use of statins as a potential therapy for
osteoarthritis are required. It would be interesting to investigate the association between
statin use and hand OA, which is likely to be more metabolically influenced than knee
OA234. The effect of statins on clinical outcome measures such as pain or disability should
also be investigated.
In conclusion, we found that statin use is associated with a reduction of overall progression of knee osteoarthritis after adjustment for potential confounding variables. Although
these findings need to be replicated, they indicate that the causal association between
statins and osteoarthritis should be further investigated.
Competing interests
None declared.
Funding
This study is financially supported by the Nuts-Ohra Foundation. Stefan Clockaerts received a scholarship from the University of Antwerp and the Anna Foundation. The Rotterdam Study is funded by Erasmus Medical Center and Erasmus University in Rotterdam,
the Netherlands Organization for the Health Research and Development (ZonMw), the
Research Institute for Diseases in the Elderly (RIDE), the Ministry of Education, Culture
and Science, the Netherlands Genomics Initiative (NGI)/Netherlands Consortium for
Healthy Aging (NCHA) project nr. 050-060-810, the European Commission framework
7 programme TREAT-OA (grant 200800), the Ministry for Health, Welfare and Sports,
the European Commission (DG XII), and the Municipality of Rotterdam.
Acknowledgments
The authors are very grateful to the participants and staff from the Rotterdam Study, the
participating general practioners and the pharmacists. We would like to thank M. Reijman, A. Bergink, A. van Vaalen, M. Kool, J.S. Dekkers for the scoring of radiographs and
E. Oei for assistance.
112
113
114
Chapter
7
Summary, discussion and perspectives
115
116
Chapter 7: Summary, discussion and perspectives
Obesity and OA are associated via different etiological processes. Next to increased joint
loading, metabolic and inflammatory pathways related to adipose tissue could explain the
increased incidence and progression of OA in obese people.
It has been described that adipose tissue contains immune cells and adipocytes. These
cells produce cytokines, adipokines and growth factors that may induce or inhibit inflammatory and catabolic processes in cartilage.
This thesis investigates two main hypotheses:
Intra-articular adipose tissue, such as the IPFP, influences cartilage metabolism by the
excretion of inflammatory factors into the joint.
The hypothesis that the IPFP is involved in OA development and progression of the knee,
was based on a narrative review of literature (Chapter 2). In this review, we addressed
some significant points that are evidence for a role of the IPFP in the disease process of
knee-OA:
1) The IPFP is a special form of adipose tissue which is, due to its location, in
close contact with synovial layers and articulating cartilage.
2) Differences between serum and synovial fluid levels of adipokines indicate the
importance of local IPFP cytokine production.
3) Infiltration of immune cells has been demonstrated in the IPFP in human OA
joints and in animal models for arthritis and OA.
4) The presence of adipocytes, immune and nerve cells in IPFP causes secretion
of adipokines, but also cytokines, chemokines and growth factors that are capable of altering cartilage and synovium.
The conclusion of the review is that the IPFP could be regarded as a joint tissue contributing to the osteoarthritis process.
We reinforced the conclusion of the review by examining the inflammatory mediators
secreted by the IPFP, their effect on cartilage and the regulation of their production.
First, we investigated the effect of the factors secreted by the IPFP on inflammatory and
destructive processes in cartilage, and analyzed which cytokines, adipokines or growth factors were secreted by IPFP. We cultured cartilage explants in IPFP conditioned medium
or control medium during 48 hours. In chapter 3, we describe that culturing cartilage
in IPFP conditioned medium led to a decrease in catabolic processes as demonstrated by
a decrease in NO and GAG release and matrix metalloproteinase 1 gene expression. The
results were confirmed by performing similar experiments with IL1β stimulated explants
where we observed similar effects. The data were also reinforced by the abundant presence
of M2 macrophages in the IPFP which are known to have an anti-inflammatory function. Although the data clearly indicate that IPFP can influence cartilage metabolism, the
medium conditioned by IPFP explants was considered as a black box since many known
and unknown factors might have contributed to the effects we observed.
To elucidate this black box we analyzed cytokines secreted by the IPFP (Chapter 4).
117
We confirmed the secretion of IL1β, TNFα, IL6, IL8, MCP1, FGF2, VEGF, leptin,
resistin and adiponectin by IPFP, which has been described previously, and show that
additional cytokines such as IL4, IL10 are produced by osteoarthritic IPFP explants. We
found large variation in cytokine production between donors. In a recent study, Hui et
al235 performed experiments similar to ours. However, they found a pro-catabolic effect of
the fat conditioned medium (FCM) on chondrocytes, whereas we found an anti-catabolic effect using cartilage explants. The different results between this study and our study
could also be due to donor variation, although an effect of differences in culture period
could also not be excluded (48h versus 72h).
We set out to determine what could explain the variation between donors in cytokine
release by IPFP. We first evaluated whether the variation between donors was caused by
differences in body mass index. We performed statistical analyses of the correlation between body mass index and cytokine release by the IPFP and found no significant results
(Chapter 4). It should be noted that the lack of association between body mass index
and cytokine production in our study may be due to a lack of power. A study by KleinWieringa et al demonstrates a link between body mass index and cytokine production by
the IPFP150. Since BMI did not explain the differences between donors in our study, we
hypothesized that differences in OA disease status, represented by synovial fluid cytokine
concentrations in the knee, may alter IPFP cytokine production.
Although no studies had investigated the diffusion of synovial fluid cytokines to the IPFP,
the anatomical location and the presence of immune cells (e.g. macrophages, T cells) in
osteoarthritic IPFP116, 149, 150 make it likely that the IPFP itself is influenced by cytokines
present in the synovial fluid. In chapter 4, we describe our study on the effect of IL1β,
a pro-inflammatory cytokine present in OA synovial fluid157, on production of COX2,
IL1β, TNFα, MCP1, IL6, VEGF, leptin and PGE2. We found an increased mRNA expression of the gene encoding for COX2, and all cytokines, besides IL10 and leptin. IL10
is a cytokine with anti-inflammatory and chondroprotective properties159. The lack of
increase in IL10 gene expression confirms the pro-inflammatory phenotype that seems to
develop in the IPFP by adding IL1β. It may indicate that IPFP will only induce catabolic
responses in cartilage when it is stimulated by a pro-inflammatory stimulus within the
joint. Based on our in vitro experiment where IPFP explants were cultured with IL1β,
we believe that intra-articular environmental factors such as IL1β are also important in
inducing fast changes in cytokine production by the IPFP.
If intra-articular adipose tissue acts as OA joint tissue, it might be possible to target it
by drugs that are currently used in the prevention of metabolic diseases, such as fibrates
or other Peroxisome Proliferator Activated Receptor (PPAR)α agonists. To examine this,
we investigated whether a ligand for PPARα inhibits the secretion of pro-inflammatory
cytokines by IPFP (Chapter 4). Besides their lipid lowering capacities, they are able to
decrease inflammation in different cell types. We performed culture experiments adding
PPARα ligand Wy14643 to IPFP explants and found that Wy14643 leads to a decrease
in IL1β induced gene expression of VEGF. Additional statistical analyses demonstrated
118
an interaction between response to IL1β and effect of the PPARα ligand, indicating that
Wy14643 had an effect in the tissues that responded to IL1β, and not in the non-responsive tissues. These results demonstrate that the IPFP is not only a possible contributor to
the OA disease process in the knee joint, but also a target for potential disease modifying
drugs such as fibrates.
Considering the anti-inflammatory effects on IPFP, we wondered whether a PPARα ligand can also decrease inflammatory and destructive responses in osteoarthritic synovium.
When adding Wy14643 to IL1β stimulated synovium explants (Chapter 4), we observed
a trend towards decrease for MCP1 gene expression and interaction between IL1β and
Wy14643 in 5 genes of interest. Previous in vitro experiments have shown that PPARα
agonists decrease the production of IL6 and IL8 in IL1β induced synoviocytes and also
decrease the release of cytokines by macrophages, which are also present in osteoarthritic
synovium154, 155, 164.
Next to the anti-inflammatory effects of a PPARα ligand in IPFP and synovium, we investigated whether the same ligand could induce anti-catabolic and anti-destructive effects
in OA cartilage (Chapter 5). Addition of 100 μM PPARa agonist Wy-14643 decreased
gene expression of the catabolic markers MMP1, MMP3 and MMP13, and decreased
release of GAG and NO in human OA cartilage explants. Interestingly, effects of PPARα
activation were found in explants that responded to IL1β, indicating that only inflamed
cartilage explants were influenced by Wy14643. Our study was in line with a previous
study of Francois et al152, who also used other PPARα ligands such as fenofibrate.
In the three forementioned experiments, we examined PPARα ligand Wy14643 on cartilage, synovium and IPFP in vitro, to study whether inflammatory an destructive pathways
could be inhibited by these drugs. We used explants of tissues obtained from end stage
OA patients undergoing total knee replacements. We pre-incubated them during 24h and
then cultured them with IL1β to induce a pro-inflammatory phenotype comparable with
early stages of OA. Animal and human studies indicate that end stage OA is associated
with an other type of inflammation or more specific, a more a pro-fibrotic state compared
to early OA in which more pro-inflammatory responses have been described66,156. This
was also in line with our own study examing the presence of pro- and anti-inflammatory
macrophages in IPFP, where we found less anti-inflammatory macrophages in patients
undergoing anterior cruciate ligament reconstruction compared to end stage OA patients
undergoing total knee replacement.
The in vitro anti-inflammatory and anti-catabolic effects of PPARα ligand Wy14643 on
cartilage, synovium and IPFP may indicate that fibrates are a potential therapeutic strategy for OA. Other in vitro, animal studies and human clinical studies have also shown
that PPARα ligands target cartilage, synovium and bone, and regulate metabolic alterations that are a possible cause or consequence of OA, such as dyslipidaemia, systemic
inflammation and vascular pathology152, 154, 162, 236, 200.
119
Interestingly, other lipid lowering drugs such as statins, also exert anti-inflammatory effects. Lazzerini et al206 summarized available literature on the effect of statins and cartilage, synovium and bone and concluded that statins might be considered as a potential
therapeutic strategy for OA. Next to effects on the joint, we believe that statins may also
beneficially influence the OA disease process by its effects on systemic metabolic dysregulations165. Statins decrease systemic inflammation, regulate serum and synovial fluid lipid
profile and prevent atherosclerosis. These targets have been related to OA previously. To
investigate the potential efficacy of statins to prevent the incidence and progression of
OA, we used a large population-cohort study, the Rotterdam Study, in which all relevant
clinical, radiological and pharmacological data were collected from a population at risk
for progression of OA (Chapter 6). Detailed pharmacological data for the total period
were available in computerized databases of local pharmacies. We included potential confounders that could influence the association between statin use and osteoarthritis, and
adjusted for baseline presence of OA in our analyses of progression. This study demonstrates that the use of statins is associated with a decrease in overall progression of
osteoarthritis of the knee, but not of the hip. Since statins only target non-biomechanical
mechanisms, our data may suggest that OA of the knee is influenced more by metabolic
factors such as the secretion of cytokines and adipokines by (intra-articular) adipose tissue, vascular pathology in the subchondral bone or direct effects of lipids on joint tissues.
Together with changed mechanics in especially the knee due to obesity, this might explain
why body mass index is a major risk factor for knee osteoarthritis, but not for the hip.
Unfortunately, it should be noted that our study only indicates the disease-modifying effect of statins, and did not investigate differences in pain or disability between statin users
and non-users.
120
Conclusion
In this thesis, we demonstrate that the IPFP is an additional joint tissue contributing to
the OA disease process in the knee and that it can be a target for potential disease modifying drugs for OA (DMOAD). We describe that PPARα ligands inhibit inflammatory
processes in osteoarthritic cartilage, synovium and IPFP explants. This thesis provides
evidence for the potential of lipid lowering drugs, such as statins, as DMOAD. We report
the first study showing a clinical correlation between statin use and knee OA.
121
Perspectives
The IPFP should be considered as an OA joint tissue as it produces both pro- and antiinflammatory cytokines, capable of influencing cartilage metabolism. Additional studies
are required to examine the effect of IPFP on cartilage in more detail and to demonstrate
the effect of fat secreted factors on the entire OA process, including inflammatory and
destructive responses in synovium and subchondral bone. Moreover, the IPFP contains a
high number of nerve cells with an unidentified role in knee pain. Therefore, the potential role of IPFP in pain should be investigated. This knowledge may contribute to the
treatment of OA, and guidelines for whether or not to remove the IPFP during total knee
replacement or during the early onset of OA.
In this thesis, we have reported anti-inflammatory effects of FCM of late stage OA patients on cartilage. It is important to realize that the effect of FCM of IPFP from patients
with early stage OA may exert different effects on cartilage. Studying this could provide
new insights in the role of inflammation in OA development and progression. Future experiments should identify the cytokines, adipokines or growth factors responsible for the
effects of FCM on cartilage. These experiment could use specific antibodies to inactivate
the effect of certain factors present in the FCM, thereby providing specific therapeutic
targets and insights in cartilage metabolism. This thesis also showed that IPFP can express various phenotypes, regulated by local environmental factors such as the presence
of the inflammatory cytokine IL1β. Future experiments could elucidate the underlying
mechanisms and the potential influence of other pro- and anti-inflammatory cytokines
on IPFP.
It would be interesting to compare the inflammatory phenotypes between healthy and
OA IPFP, and between different stages of OA and to examine the IPFP of RA patients or
patients with other joint diseases. This might reveal new insights in the possible role of
intra-articular fat tissue in joint homeostasis and in joint diseases. We have reported an
effect of PPARα ligand Wy-14643 on inflammation in IPFP in this thesis.
Next to their anti-inflammatory effects on IPFP, we have demonstrated that PPARα ligands decrease inflammatory and destructive processes in vitro in synovium and cartilage
explants. In addition, we found an association between decreased incidence and progression of radiological knee OA, and the use of statins, another lipid lowering drug. Taken
together, these results indicate that lipid lowering drugs, such as fibrates and statins, are
a potential therapeutic strategy for OA and they should be examined further.
It would be interesting to investigate the association between statin use and hand OA,
which may be more metabolically influenced than knee OA. This could confirm the association between decreased incidence and progression of knee OA and statin use that we
found in our study.
In the Rotterdam study, we were able to demonstrate an association between decreased
radiological knee OA incidence and progression, and statin use. It should be noted that
pain remains the most important therapeutic indication and that statins have an impor-
122
tant complication, namely myopathy, which needs to be taken into account when studying statins as therapy for OA. There were no data concerning pain or function available
in this study to investigate an association with statin use. The effects of statins on clinical outcome measures such as pain or disability should be further investigated in other
observational studies. The association we have found between statin use and knee OA in
the Rotterdam study does not necessarily prove a causal relationship. Causality could be
demonstrated with an animal study. The animal model used, should integrate metabolic
alterations such as dyslipidaemia, vascular pathology and/or diabetes mellitus in order to
elucidate underlying therapeutic mechanisms of statins or fibrates. Moreover, a randomized controlled clinical trial could prove causality. Before such a randomized controlled
trial can be started however, identification of inclusion criteria for OA patients should be
defined.
This should be based on knowledge of potential underlying mechanisms of statins and
fibrates. Therefore, it would be interesting to study:
1) The effect of different types of fatty acids on cartilage, synovium, bone and IPFP to
indicate whether targeting serum lipids may prevent or decrease OA initiation or progression.
2) The role of vascular pathology in the OA disease process since statins and fibrates are
known to be able to prevent the development of atherosclerosis.
3) The pharmacodynamics of statins and fibrates in regard to the joint. These are not fully
understood. Considering the high first pass-clearance of statins at the liver (90%), it is
not unlikely that statins do not reach the joint in physiological effective concentrations.
Although fibrates do not have such a high first pass effect, it is unclear what their local
concentrations are. The lack of physiological relevant concentrations intra-articular of
statins or fibrates is not contra-indicative for a therapeutic effect of these drugs, since their
effect on OA development may be mainly due to systemic metabolic effects. Based on the
beneficial in vitro effects of both drugs on joint tissues, alternative ways of administration
(e.g. intramuscular or intra-articular) may give additional anti-inflammatory effects on
the joint.
Based on the results of studies that can reveal the possible working mechanism of statins and fibrates, large, well designed randomized controlled clinical trials should be performed to investigate the potential of these drugs in decreasing incidence and progression
of OA, but also in improving clinical outcome (function, pain) of OA. In OA, inflammation leads to a disbalance between cartilage anabolism and catabolism.
This thesis has mainly focused on the influence of adipose tissue on inflammatory processes in OA and the potential of targeting these processes by lipid lowering drugs. It is
the goal of many potential therapeutic agents for OA to reduce catabolic responses and
increase anabolism in cartilage. In case of acute cartilage fractures or cartilage defects,
treatment also aims at reducing catabolic and increasing anabolic processes. Traumatic
123
events can lead to posttraumatic arthritis, although the cellular mechanisms in this process are unclear9. It is not unlikely that therapeutic interventions for repair of cartilage
defects, such as microfracture, (matrix) autologous chondrocyte implantation or mosaic
osteochondral implantation techniques, may show better clinical outcomes when combined with a drug capable of decreasing environmental inflammatory response.
This thesis indicates that statins and fibrates decrease inflammatory and destructive responses in cartilage, synovium and IPFP, and prevent systemic disease that theoretically
limit cartilage regeneration, such as vascular vascular pathology, or dyslipidemia. Therefore, it can be hypothesized that these drugs may improve clinical and structural outcome
after cartilage repair surgery. Future studies could be performed to investigate statins and
fibrates as per- and postoperative drugs supporting cartilage repair.
124
125
126
Biografie
Biografie
Stefan Clockaerts werd geboren in Lier op 5 november 1983, als jongste zoon van Nicole
Charle en Jan Clockaerts. Jochen en Peter zijn zijn oudere broers.
Stefan woont sinds 2008 samen met zijn vriendin Katia Wouters. Samen hebben ze een
zoontje Mathis, geboren op 28 oktober 2009 en een dochtertje Lisa, geboren op 26 april
2012.
Hij groeide op in Kontich, waar hij zowel de kleuter- als de lagere school bezocht in Gemeenschapsschool De Schans. De middelbare school doorliep hij van 1995 tot 2001 aan
het Koninklijk Atheneum van Mortsel.
In 2001 ging hij Biomedische Wetenschappen studeren aan de Universiteit van Antwerpen en na een jaar, in 2002, schakelde hij over op de studie Geneeskunde aan dezelfde
universiteit. Zijn kandidatuur behaalde hij in 2004 met onderscheiding. In 2007 studeerde hij af als arts met grote onderscheiding.
Tijdens zijn opleiding tot basisarts liep hij in 2006 en 2007 stage op het Orthopaedic
Research Lab van het Erasmus MC in Rotterdam. In 2008 startte hij zijn doctoraatsopleiding, waarvoor het onderzoek deels op het Orthopaedic Research Lab van het Rotterdamse Erasmus MC werd gevoerd en deels op de diensten Orthopedische Chirurgie en
Traumatologie, en Reumatologie van de Universiteit Antwerpen.
Elke dinsdag van 1 augustus 2010 tot en met 31 juli 2011 werkte hij als assistent in het
Heilig Hartziekenhuis, bij de Associatie Orthopedie in Lier. Op 1 augustus 2011 startte
hij zijn werk als full time assistent op de afdeling Heelkunde van het Middelheim ziekenhuis in Antwerpen tot 31 januari 2012. Van 1 februari 2012 tot 31 juli 2012 werkte hij
als assistent op de afdeling Orthopedie aan het Heilig Hartziekenhuis in Lier en momenteel is hij werkzaam bij SPM orthopedie AZ Monica Ziekenhuis te Deurne, Antwerpen.
Diane Broeckhoven
Schrijfster en journaliste
127
Curriculum Vitae
Wetenschappelijke publicaties
Clockaerts S, De Knop K, Demuynck S, Van Offel J, De Clerck L. Pijnlijke, rode streng
in de slaapstreken bij een 70-jarige vrouw. Tijdschrift voor geneeskunde 2008 Jan; 64(1):32-33.
Botter SM, Glasson SS, Hopkins B, Clockaerts S, Weinans H, van Leeuwen JP, van
Osch GJ. ADAMTS5-/- mice have less subchondral bone changes after induction of osteoarthritis
through surgical instability: implications for a link between cartilage and subchondral bone changes. Osteoarthritis Cartilage 2009 May;17(5):636-45. Epub 2008 Oct 17.
Clockaerts S, Bastiaansen-Jenniskens YM, Runhaar J, Van Osch GJ, Van Offel JF, Verhaar JA, De Clerck LS, Somville J. The infrapatellar fat pad should be considered as an active osteoarthritic joint tissue: a narrative review. Osteoarthritis Cartilage 2010 Jul;18(7):876-82. Epub
2010 Apr 22.
Verborgt O, De Smedt T, Vanhees M, Clockaerts S, Parizel PM, Van Glabbeek F. Accuracy of placement of the glenoid component in reversed shoulder arthroplasty with and without
navigation. J Shoulder Elbow Surg 2011 Jan;20(1):21-6.
Clockaerts S, Dossche L. Technical note: combined arthroscopic techniques in
the treatment of nonunited anterior tibial spine fracture. Acta Orthopaedica Belgica 2011
Jun;77(3):394-7.
Botter SM, van Osch GJ, Clockaerts S, Waarsing E, Weinans H, van Leeuwen JP. Osteoarthritis induction leads to early and temporal subchondral plate porosity in the tibial plateau of
mice: an in vivo micro CT study. Arthritis Rheum 2011 Sep;63(9):2690-9.
Clockaerts S, Bastiaansen-Jenniskens YM, Feijt C, Verhaar JAN, Somville J, De Clerck
LS, Van Osch GJVM. Peroxisome proliferator activated receptor alpha activation decreases inflammatory and destructive responses in osteoarthritic cartilage. Osteoarthritis Cartilage 2011
Jul;19(7):895-902. Epub 2011 Mar 31.
Runhaar J, Koes BW, Clockaerts S, Bierma-Zeinstra SMA. A systematic review on changed biomechanics of lower extremities in obese individuals: a possible role in development of
osteoarthritis. Obes Rev 2011 Dec;12(12):1071-82.
Clockaerts S, Bierma-Zeinstra SM. Letter to the editor: Comment on review ‘Statins and
the Joint: Multiple target for a Global Protection?’ By Lazzerini et al 2010 sep 28. Semin Arthritis
Rheum 2011 Jun;40(6):588. Epub 2011 Mar 27.
Clockaerts S, Van Osch GVJM, Bastiaansen-Jenniskens YM, Verhaar JAN, Van Glabbeek F, Van Meurs JB, Kerkhof HJM, Hofman A, Stricker BHCh, Bierma-Zeinstra SM. Statin use
is associated with reduced incidence and progression of knee osteoarthritis in the Rotterdam study.
Ann Rheum Dis 2012 May;71(5):642-7.
128
Curriculum vitae
Clockaerts S, Bastiaansen-Jenniskens YM, Verhaar JAN, Somville J, Van Osch GVJM.
Artrose als metabole aandoening. Ortho/reumato 2011 Jun/Jul 9(3):109-115.
Bastiaansen-Jenniskens YM, Clockaerts S, Feijt C, Zuurmond AM, Stojanovic-Susulic
V, Bridts C, de Clerck L, DeGroot J, Verhaar JA, Kloppenburg M, van Osch GJ. Infrapatellar fat
pad of patients with end-stage osteoarthritis inhibits catabolic mediators in cartilage. Ann Rheum
Dis 2012 Feb;71(2):288-94. Epub 2011 Oct 13.
Clockaerts S, Bastiaansen-Jenniskens YM, Feijt C, Verhaar JAN, Somville J, De Clerck
LS, Zuurmond A, Stojanovic-Susulic V, Kloppenburg M, Van Osch GJVM. Cytokine production
by infrapatellar fat pad can be stimulated by interleukin 1β and inhibited by Peroxisome Proliferator Activated Receptor α agonist. Ann Rheum Dis 2012 Jun;71(6):1012-8 Epub 2012 Feb 2.
Hoeven TA, Kavousi M, Clockaerts S, Kerkhof HJ, Van Meurs JB, Franco OH, Hofman
A, Bindels PJ, Witteman JC, Bierma-Zeinstra SM. Association of atherosclerosis with presence
and progression of osteoarthritis: the Rotterdam Study. Ann Rheum Dis. Epub May 2012.
van Eekeren ICM, Clockaerts S, Bastiaansen-Jenniskens YM, et al. Fibrates as therapy for
osteoarthritis and rheumatoid arthritis? A systematic review. Accepted for publication in Therapeutic Advances in Musculoskeletal Disease 2012.
Persartikels/interviews
‘Statins linked to reduced onset of knee OA’. Internal medicin news 2010 Nov 15.
‘Statin Use Linked to 57% Reduction in Knee OA Incidence’. Family practice news
2010 Nov 15.
‘Cholesterolpillen voorkomen artrose’. De Morgen Nov 2012.
‘Artrose bestrijden met cholesterolmedicatie’. Metro (NL) Nov 2012.
‘Bekend middel werkt mogelijk ook bij artrose’. Trouw Nov 2012.
‘Artrose bestrijden met cholesterolverlagers’. Dokteronline.nl Nov 2012.
‘Artrose bestrijden met cholesterolverlagers’. Dwars Nov 2012.
‘Could cholesterol medication possibly combat arthritis?’ Erasmusmc.nl Nov 2012.
‘Artrose mogelijk te bestrijden’ Gezondheidsnet.nl Nov 2012.
‘Cholesterolverlagers tegen artrose’ Leefwijzer.nl Nov 2012.
‘Cholesterolpillen voorkomen artrose’. Pharma.be Nov 2012.
‘Cholesterolremmers mogelijk medicatie tegen artrose’. Reumafonds.nl Nov 2012.
‘Cholesterolpillen remmen ook artrose af ’. Vief.be Nov 2012.
Mednet interview Dec 2012.
Artsenkrant Dec 2012.
‘Artrose mogelijk te bestrijden met cholesterolmedicatie’. Orthopedie.nl Nov 2012.
‘Artrose mogelijk te bestrijden met cholesterolmedicatie’ TVonline.nl Nov 2012.
‘Artrose mogelijk te bestrijden’ Nu.nl Nov 2012.
129
Boeken (hoofdstuk)
Van Glabbeek F, Clockaerts S. The elbow, current concepts in treatment of basic
pathology. Chapter: Functional anatomy. Arko Sports Media 2009.
ISBN 978-90-5472-108-6.
Clockaerts S, Vanhees M, Van Glabbeek F. Stanley & Trail, Operative Elbow Surgery.
Chapter: Surgical anatomy of the elbow. Churchill Livingstone.
ISBN: 978-0-7020-3099-4.
Reviews voor wetenschappelijke tijdschriften
Strategies in Trauma and Limb Reconstruction: Aug2009.
Journal of Rheumatology: Dec 2010.
Cell Proliferation: Aug 2011.
European Journal of Nutrition: Nov 2011.
The Knee: January 2012, Aug 2012.
Annals of Rheumatic Disease: Feb 2012, March 2012, May 2012, June 2012.
Annals of Internal Medicine: March 2012, Nov 2012.
Plos One: Nov 2012.
Arthritis Research and Therapy: Oct 2012.
Congressen en symposia
Podiumpresentaties
Clockaerts S, Bastiaansen-Jenniskens YM, De Clerck LS, Verhaar JAN, Somville J, Van
Osch GVJM. PPARα agonists decrease inflammatory and destructive responses of osteoarthritic
cartilage and synovium. Congress of the Dutch Society for Matrix biology, Lunteren, The Netherlands, 2009.
Bastiaansen-Jenniskens YM, Clockaerts S, Feijt C, Zuurmond A, Stojanovic-Susulic V,
Bridts C, de Clerck L, DeGroot J, Verhaar JAN, Kloppenburg M, van Osch GJVM. The role of
infrapatellar fat pad in onset of osteoarthritis, Top Institute Pharma Spring Meeting, Utrecht, The
Netherlands 2009.
cartilage and synovium. Congress of the Dutch Orthopedic Society, Utrecht, The Netherlands,
2010.
cartilage, synovium and infrapatellar fat pad. Gordon Conference Musculoskeletal Biology &
Bioengineering, Proctor Academy, Andover, NH, United States, 2010.
Clockaerts S. Obesitas en orthopedie. Geneeskundige Dagen Antwerpen, 2010.
130
Curriculum vitae
Clockaerts S, Van Osch GVJM, Bastiaansen-Jenniskens YM, Verhaar JAN, Van Glabbeek F, Van Meurs JB, Kerkhof HJM, Hofman A, Stricker BHCh, Bierma-Zeinstra SM. Statin
use is associated with reduced incidence and progression of knee osteoarthritis. OARSI, Belgium,
2010.
Clockaerts S, Bastiaansen–Jenniskens YM, Van Osch GVJM, Van Offel JF, Verhaar JAN,
De Clerck LS, Somville J. The infrapatellar fat pad should be considered as an active osteoarthritic
joint tissue. World Congress on Osteoarthritis, Brussels, Belgium, 2010.
Bridts C, de Clerck L, DeGroot J, Verhaar JAN, Kloppenburg M, van Osch GJVM. Infrapatellar
fat pad of late osteoarthritis patients induces an anti-catabolic response in cartilage. OARSI, Brussels, Belgium 2010.
use is associated with reduced incidence and progression of knee osteoarthritis. Primary Care
MUSculoskeletal Research Congress, Rotterdam, The Netherlands 2010.
Clockaerts S, Myncke J. Case report: botoedeem ter hoogte van femurhals en
femurkop. Antwerpse orthopeden, Antwerpen, Belgie 2011.
Clockaerts S. Sport en artrose. Antwerpse orthopeden, Antwerpen, Belgie 2011.
use is associated with reduced incidence and progression of knee osteoarthritis. World Congress
on Debates & Consensus in Bone, Muscle & Joint Diseases (BMJD), Barcelona, Spain 2012.
Clockaerts S, Bastiaansen-Jenniskens YM, Feijt C, De Clerck LS, Verhaar JAN, Zuurmond AM, Stojanovic-Susulic V, Somville J, Kloppenburg M, Van Osch GJVM. Cytokine production by infrapatellar fat pad can be stimulated by interleukin 1β and inhibited by Peroxisome
Proliferator Activated Receptor α agonist. World Congress on Debates & Consensus in Bone,
Muscle & Joint Diseases (BMJD), Barcelona, Spain 2012.
Poster presentaties
Clockaerts S, Gielis E, Garmyn M, Lambert J, Nijsten T. Chemoprevention of skin cancer. EMSA congress, Antwerp, Belgium 2008.
Clockaerts S, Verborgt O, De Smedt T, Van Glabbeek F. Fixation of the transmitter on
the coracoid process in computer assisted shoulder replacement surgery: a fast and reliable technique. 21st Congress of the European Society for Surgery of the Shoulder and the Elbow, Bruges,
Belgium 2008.
cartilage and synovium. OARSI, Montreal, Canada, 2009.
131
Bridts C, de Clerck L, DeGroot J, Verhaar JAN, Kloppenburg M, van Osch GJVM. Infrapatellar
fat pad is able to influence cartilage metabolism. OARSI, Montreal, Canada 2009.
Clockaerts S, Bastiaansen-Jenniskens YM, Verhaar JAN, Somville J, De Clerck LS, Van
cartilage. Annual MolMed Day, Rotterdam, The Netherlands, 2009.
cartilage. Congress of the Belgian Society of Rheumatologists, Liege, Belgium, 2010.
Clockaerts S, Van Osch GVJM, Bastiaansen-Jenniskens YM, Verhaar JAN, Van Glabbeek F, Van Meurs JB, Kerkhof HJM, Hofman A, Stricker BHCh, Bierma-Zeinstra SM. Statin use
is associated with reduced incidence and progression of knee osteoarthritis. Orthopaedic Research
Society, Long Beach, LA, CA, USA, 2011.
cartilage. Orthopaedic Research Society, Long Beach, LA, CA, USA, 2011.
Clockaerts S, Bastiaansen-Jenniskens YM, Verhaar JAN, De Clerck LS, Somville J, Van
Osch GVJM. Production of proinflammatory cytokines by infrapatellar fat pad of patients with
knee osteoarthritis is further increased by interleukin 1β and inhibited by activation of peroxisome
proliferator activated receptor α activation. Orthopaedic Research Society, Long Beach, LA, CA,
USA, 2011.
Clockaerts S, Bastiaansen-Jenniskens YM, Feijt C, De Clerck LS, Verhaar JAN, Zuurmond AM, Stojanovic-Susulic V, Somville J, Kloppenburg M, Van Osch GJVM. Cytokine production by infrapatellar fat pad can be stimulated by interleukin 1β and inhibited by Peroxisome
Proliferator Activated Receptor α agonist. OARSI, San Diego, VS, 2011.
Prijzen en beurzen
2008: DePuy Research award. Congress of the Belgian Society of Orthopaedic Surgery and Traumatology, Antwerp, Belgium.
2009: Award for best oral presentation by a PhD student. Congress of the Dutch Society of
Matrix Biology, Lunteren, The Netherlands.
2010: Nomination best PhD student of the Year, EPAR (Erasmus Phd Association Rotterdam)
2010: Anna Fonds beurs, Dutch Society of Orthopaedic Research.
2012: Young Scientist Award. World Congress on Debates & Consensus in Bone, Muscle & Joint
Diseases (BMJD), Barcelona, Spain, 2012.
132
Lidmaatschap
2008 – 2011: MolMed School Erasmus MC, Rotterdam.
2008 – 2011: Young Investigators of the Osteoarthritis Research Institute
International (OARSI).
2009: Dutch Society of Matrix Biology.
2008 – 2013: Belgian Society of Orthopaedic Surgeons.
2008 – 2013: Belgian Orthopaedics and Traumatology Residents Association.
2012 – 2013: International Cartilage Research Society
133
134
135
136
Introductie en doel van deze thesis
Artrose wordt gekenmerkt door verlies van kraakbeenstructuur, subchondrale botsclerosering, synovitis en synoviale fibrose. Er bestaan aanwijzingen dat ook ligamenten en
menisci mee betrokken zijn in het ziekteproces van artrose. Twee belangrijke processen
spelen een rol in de pathofysiologie van artrose, namelijk mechanische beschadiging en
inflammatie (Figuur 1). Traumatische of repetitieve mechanische belastingen op het gewricht kunnen leiden tot kraakbeenschade. Sommige patiënten zijn gevoeliger voor mechanische beschadiging vanwege genetische factoren of ten gevolge van veroudering van
de chondrocyt, waardoor het kraakbeen niet in staat is de omliggende matrix te onderhouden of te herstellen door productie van collageen type II en aggrecan. De beschadiging van kraakbeen initiëert inflammatoire processen in het kraakbeen, in het synovium
en wellicht ook het subchondrale bot, wat ertoe leidt dat deze weefsels pro-inflammatoire
cytokines produceren, zoals interleukine (IL)1β en tumor necrosis factor (TNF)α. Deze
cytokines komen terecht in de synoviale vloeistof en bij de omliggende gewrichtsweefsels.
Pro-inflammatoire cytokines induceren een verhoogde productie van kraakbeendegraderende enzymen in het kraakbeen en synovium, zoals matrix metalloproteïnase 1, 3, 13
(MMP 1, 3, 13) of a disintegrin and metalloproteinase with thrombospondin motifs 4,5
(ADAMTS 4, 5). Tevens remmen pro-inflammatoire cytokines de productie van kraakbeenmatrix (collageen type II en aggrecan) en induceren ze apoptose van chondrocyten,
vorming van osteofyten en infiltratie/activatie van synoviale macrofagen.
Er zijn tal van studies die aantonen dat artrose ook zou kunnen ontstaan door ontstekingsprocessen in synovium of subchondraal bot, of door subchondrale microtraumata.
Repetitieve mechanische beschadigingen en inflammatie leiden tot een verstoring van het
evenwicht tussen kraakbeenafbraak en –opbouw. Hierdoor ontstaat er progressie naar een
eindfase van artrose met een uitgebreid verlies van kraakbeenstructuur.
Artrose is de meest voorkomende gewrichtsaandoening en een belangrijke oorzaak van fysieke belemmering bij ouderen. Risicofactoren voor artrose zijn onder meer toenemende
leeftijd, vrouwelijk geslacht en obesitas (Figuur 2). Tot voor kort werd aangenomen dat
de associatie tussen obesitas en artrose alleen een gevolg was van biomechanische overbelasting op gewrichten, ten gevolge van een verhoogd lichaamsgewicht. Echter, er zijn
aanwijzingen dat andere factoren mee de associatie tussen obesitas en artrose kunnen
verklaren. Zo leidt een hogere belasting van gezond, jong kraakbeen tot een toename van
kraakbeenkwaliteit en -kwantiteit in plaats van een afname. Obesitas is ook geassocieerd
met artrose van de hand, ondanks het feit dat de handen geen gewichtsdragende gewrichten zijn en dus geen biomechanische invloeden ondervinden van obesitas. Samenvattend,
de relatie tussen obesitas en artrose zou men kunnen verklaren door een verhoogde biomechanische belasting, maar ook door andere inflammatoire en/of metabole aandoeningen die zich voordoen bij obese mensen.
137
Figuur 1: Overzicht pathofysiologie van artrose. Zowel mechanische beschadigingen als inflammatoire processen dragen bij tot de initiatie en progressie van artrose.
138
Vetweefsel werd vroeger beschouwd als een opslagplaats voor overtollige energie, maar de
voorbije decennia is bekend geworden dat vet immunomodulatoire capaciteiten bezit.
Vetweefsel bevat adipocyten en immuuncellen die in staat zijn adipokines (leptine, adiponectine, resistine, visfatine/nicotinamidefosforibosyltransferase of NAMPT) en cytokines (b.v. TNFα, IL1β, IL6, transforming growth factor β of TGFβ, monocyte chemoattractant protein 1 of MCP 1) te produceren. Voor de meerderheid van deze inflammatoire
mediatoren hebben in vitro- en in vivo studies aangetoond dat ze kraakbeenschade kunnen initiëren of verergeren. Bij obese personen is er niet alleen een toename van hoeveelheid vetweefsel, maar ook een toename in de productie van cytokines en adipokines in
voornamelijk het viscerale vetweefsel. De verhoogde hoeveelheid cytokines en adipokines
die vrijkomen geeft een laaggradige systemische inflammatie die het artroseproces zou
kunnen initiëren of onderhouden.
De knie bevat een groot stuk vetweefsel, het infrapatellaire vetlichaam (IPVL), dat zich
vlakbij het kraakbeen, synovium en subchondraal bot bevindt. Het is onbekend in welke
mate dit vet bijdraagt aan het artroseproces en in welke mate BMI of andere factoren de
productie van cytokines door het IPVL beïnvloeden.
In observationele studies werden associaties gevonden tussen artrose en metabole ziektebeelden. Zo hebben recente studies aangetoond dat er een associatie bestaat tussen vasculaire pathologie en artrose. Atherosclerose in het subchondrale bot zou kunnen leiden tot
een verminderde nutritie van het kraakbeen ter hoogte van de overgang met bot. Tevens
zou atherosclerose van de vaten tot subchondrale ischemische letsels kunnen leiden met
botsclerosering als gevolg. Observationele studies hebben aangetoond dat plasmaspiegels
van triglyceriden en cholesterol geassocieerd zijn met artrose in de knie. In vitro zijn
bepaalde vetzuren in staat gebleken om het kraakbeenmetabolisme te beïnvloeden door
inflammatoire pathways te activeren of inhiberen. Ten slotte wijzen in vitro- en observationele studies uit dat diabetes mellitus de initiatie en progressie van artrose zou kunnen
bevorderen.De ziektebeelden die deel uitmaken van het metabool syndroom, zoals obesitas, diabetes mellitus, atherosclerose, dyslipidemie en/of een algemeen verhoogde inflammatoire status, kunnen dus geassocieerd worden met artrose. Daarom pleiten sommigen
ervoor artrose op te nemen als ziektebeeld behorend tot het metabool syndroom.
139
Figuur 2: Overzicht van de risicofactoren van artrose. Systemische factoren kunnen de vatbaarheid voor artrose vergroten, terwijl lokale gewrichtspecifieke risicofactoren een directe aanleiding kunnen geven tot het ontstaan van artrose.
140
Doel van deze thesis
Het doel van deze thesis is het onderzoek naar de rol van intra-articulair vetweefsel in
artrose en na te gaan of lipidenverlagende geneesmiddelen een potentiële therapie kunnen
zijn voor artrose.
De specifieke onderzoeksvragen waren:
- Wat is bekend over de rol van intra-articulair vetweefsel in artrose, met name het
lichaam van Hoffa of het infrapatellaire vetlichaam (IPVL) dat zich in de knie
bevindt? Hoe kan IPVL het artroseproces in de knie beïnvloeden? Overzicht van
literatuur. (Hoofdstuk 2)
- Wat is de invloed van cytokines uitgescheiden door het IPVL van artrose patienten op kraakbeen? (Hoofdstuk 3)
- Wat beïnvloedt de cytokineproductie in het IPVL? Systemische factoren (obesitas) of een lokale factor (interleukine 1β, een cytokine aanwezig in de synoviale
vloeistof van een artrotisch gewricht)? (Hoofdstuk 4)
- Kan de productie van cytokines door het IPVL en synovium worden tegengegaan
door het toevoegen van een PPARα agonist, wat in staat is serum triglyceriden
te verlagen en tevens anti-inflammatoire effecten uitoefent op diverse weefsels?
(Hoofdstuk 4)
- Wat is het effect van een PPARα agonist op inflammatoire en destructieve reacties in artrotisch kraakbeen? (Hoofdstuk 5)
- Bestaat er een associatie tussen statinegebruik en artrose incidentie en progressie?
(Hoofdstuk 6)
141
Resultaten
In hoofdstuk 2 beschrijven we het literatuuroverzicht dat aanleiding gaf tot de hypothese
dat het infrapatellaire vetlichaam betrokken is bij knie-artrose. Gezien het vermogen van
vetweefsel om te fungeren als bron van inflammatoire mediatoren (cytokines, adipokines, groeifactoren), bestaat de mogelijkheid dat intra-articulair vetweefsel mee bijdraagt
aan het lokale artroseproces. Het lichaam van Hoffa of IPVL is vetweefsel dat zich in de
knie bevindt onder de patella, extrasynoviaal en intraarticulair. Studies tonen aan dat het
IPVL door zijn intraarticulaire locatie in staat is cytokines, groeifactoren en adipokines
te produceren en vrij te geven, die direct in het gewricht terechtkomen. Deze cytokines
en groeifactoren, maar ook adipokines zijn in staat het kraakbeenmetabolisme gunstig of
ongunstig te beïnvloeden. Uit een dierenstudie blijkt dat het IPVL van een artrotisch gewricht in vergelijking met het IPVL van een gezond gewricht meer immuuncellen bevat,
waaronder macrofagen en granulocyten. Het IPVL kan dus worden beschouwd als een
gewrichtsweefsel dat betrokken is bij het artroseproces in de knie.
In hoofdstuk 3 hebben we onderzocht of cytokines geproduceerd door IPVL het kraakbeenmetabolisme beïnvloeden. Er werd een kweekexperiment uitgevoerd waarbij we het
effect van de combinatie van cytokines uitgescheiden door IPVL op kraakbeen testten.
Hiervoor werden eerst IPVL explantaten in cultuur gebracht gedurende 24u en nadien
werd het supernatant, of vetgeconditioneerd medium, geoogst. Bij het kweken van gezonde kraakbeenexplantaten afkomstig van runderen in vetgeconditioneerd medium
vonden we protectieve effecten: vrijstelling van stikstofoxide (inflammatie), glycosaminoglycanen (kraakbeendestructie) uit het kraakbeen, alsmede genexpressie van matrix
metalloproteinase 1 (matrixafbrekend enzyme) waren verlaagd in de kraakbeenexplantaten die geincubeerd werden in het vetgeconditioneerd medium. Deze resultaten werden
bevestigd in experimenten waar een inflammatoire stimulus (IL1β) werd toegevoegd aan
het kraakbeen, dit om de situatie bij artrose zo goed mogelijk na te bootsen. Ook hier
vonden we gunstige effecten van de cytokines uitgescheiden door IPVL: een daling van
stikstofoxide vrijstelling, daling van de genexpressie van matrix metalloproteinase 1 en
3, en een stijging van collageen type II genexpressie. Het immunomodulatoire effect van
vetweefsel wordt voornamelijk verklaard door immuuncellen die zich in het vetweefsel
bevinden, met name macrofagen zijn verantwoordelijk voor het overgrote deel van cytokineproductie door vet. Macrofagen kunnen zowel van het pro-inflammatoire (M1) als
het anti-inflammatoire type (M2) zijn. We stelden de hypothese dat er in het IPVL bij
artrose patiënten in een eindfase, meer anti-inflammatoire macrofagen terug te vinden
zouden zijn die de gunstige effecten van IPVL op kraakbeen kunnen verklaren. Om deze
hypothese te testen, werden zowel histologische als flowcytometrische analyses uitgevoerd
op de IPVLs van patiënten. Hierin vonden we veel CD45+ en CD68+ (marker voor respectievelijk witte bloedcellen en macrofagen) cellen. Tevens vonden we inderdaad veelal
macrofagen met een anti-inflammatoir fenotype (M2 macrofagen).
In hoofdstuk 4 bestudeerden we of het IPVL onder bepaalde omstandigheiden een pro-
142
inflammatoire functie kan krijgen, wat nadelig zou kunnen zijn voor het kraakbeen. Hoewel we veel macrofagen met een anti-inflammatoir fenotype hadden teruggevonden in
het IPVL van artrose patienten, weten we dat macrofagen zowel een pro- als anti-inflammatoir fenotype kunnen vertonen, afhankelijk van de omgeving waarin ze vertoeven. De
factoren die het fenotype bepalen, kunnen systemische factoren zijn zoals obesitas, maar
ook lokale stimuli zoals pro-inflammatoire cytokines.
Eerst voerden we een analyse uit van cytokines die werden geproduceerd door IPVL
explantaten bekomen bij patienten die een totale kniearthroplastie ondergingen omwille
van artrose. Een analyse met Luminex gaf aan dat de combinatie van vetcellen en immuuncellen in het infrapatellaire vetlichaam minstens 30 verschillende inflammatoire
mediatoren produceert, zoals IL6, TNFα, IL1β, leptine, resistine, adiponectine of interferon γ (INFγ). Van deze cytokines was eerder al aangetoond dat ze inflammatie en
destructie in het kraakbeen bevorderen. Vervolgens werd nagegaan of de productie van
een aantal van deze cytokines door het IPVL wordt beïnvloed door lokale factoren, of
door systemische factoren zoals obesitas. Analyse van correlaties tussen body mass index
(BMI) en cytokineproductie toonden echter geen significante verbanden. Daarop werd
een kweekexperiment uitgevoerd waarbij we een cytokine (IL1β) toevoegden om het effect hiervan op de productie van bepaalde cytokines en adipokines door humane IPVL
explantaten na te gaan. IL1β is terug te vinden in de synoviale vloeistof van artrotische
gewrichten. Deze experimenten toonden dat het IPVL in sterke mate door IL1β kan
worden beïnvloed, aangezien er een stijging plaatsvond in productie van PTGS2 en cytokines (TNFα, IL1β, MCP1, IL6, IL10, VEGF, leptine) na toevoeging van IL1β. De
stijging van cytokineproductie in IPVL explantaten was vergelijkbaar met die in synovium explantaten, behalve voor VEGF dat omhoog ging in IPVL en niet in synovium explantaten. Op basis van deze experimenten concludeerden we dat het IPVL ook een proinflammatoir fenotype kan vertonen door de verhoogde productie van pro-inflammatoire
cytokines na stimulatie door IL1β. Deze resultaten tonen aan dat het IPVL beschouwd
kan worden als gewrichtsweefsel dat, vergelijkbaar met synovium en kraakbeen, ook mee
betrokken is in het artroseproces.
In een poging om de IL1β geinduceerde stijging van de cytokineproductie door IPVL
explantaten tegen te gaan, voegden we een substantie (Wy14643) toe dat een gelijkaardig
werkingsmechanisme heeft als een fibraat. Een fibraat is een lipidenverlagend geneesmiddel dat gebruikt wordt bij patienten met risico op hart- en vaatlijden. Fibraten hebben
ook een gekend ontstekingsremmend effect wat mee bijdraagt aan de preventie van cardiovasculaire pathologie. Fibraten en Wy14643 zijn activatoren van peroxisoom proliferator geactiveerde receptor(PPAR) α. Activatie van PPARα leidt tot verbranding van vetzuren, maar ook tot anti-inflammatoire effecten in organen zoals de lever of bloedvaten.
Een belangrijke reden voor de anti-inflammatoire effecten is de inhibitie van de nucleaire
translocatie van nuclear factor κB (NFκB), waardoor deze factor de transcriptie van cytokines in de kern niet meer kan induceren. Toevoeging van 100 μM Wy14643 zorgde
143
voor een daling in genexpressie van PTGS2, IL1β, TNFα, MCP1, VEGF en leptine, in
IPVL explantaten van donoren waar er een duidelijke stijging door IL1β was waar te nemen. We vonden vergelijkbare trends bij analyse van leptine en PGE2 in het supernatant
van de IPVL weefselkweken. Wy14643 kon in vergelijkbare kweekexperimenten ook een
aantal parameters van ontsteking (genexpressie van TNFα, MCP1, IL6 en MCP1 release
in supernatant) in humane synoviumexplantaten tegengaan.
Gezien de gunstige effecten van de PPARα agonist op synovium en IPVL, stelden we
de hypothese dat een PPARα agonist ook inflammatie en destructie in kraakbeen kon
tegengaan. Om dit na te gaan, maakten we in hoofdstuk 5 gebruik van weefselculturen
met kraakbeen afkomstig van patienten die een totale kniearthroplastie ondergingen. Het
gebruik van kraakbeenexplantaten in plaats van chondrocyten geïncubeerd in monolayer
zorgt ervoor dat de in vitro experimenten zo vergelijkbaar mogelijk worden gemaakt met
de in vivo situatie. Kraakbeenexplantaten werden bijkomend gestimuleerd met IL1β om
de situatie in het gewricht zo goed mogelijk na te bootsen. Hierbij werd de PPARα agonist Wy14643 toegevoegd. We observeerden vervolgens een daling in productie van inflammatoire markers (stikstofoxide en PGE2) en kraakbeenafbrekende enzymes (MMP1,
3 en 13) door toediening van 100 μM Wy14643 en dit in explantaten van patienten die
een duidelijke stijging vertoonden onder invloed van IL1β. Bij histologische analyse van
de locatie van NFκB in de chondrocyten zagen we duidelijk een inhibitie van de nucleaire
translocatie van NFκB, wat erop wijst dat deze pathway in chondrocyten wordt geremd
door PPARα activatie.
De gunstige in vitro effecten van PPARα agonisten op gewrichtsweefsels deden vermoeden dat fibraten een potentiële therapeutische strategie zouden kunnen zijn voor artrose.
Fibraten worden gebruikt om de plasmaspiegels van triglyceriden te verlagen, HDL-cholesterol te verhogen en in mindere mate plasma-LDL-cholesterol te verlagen. Tevens is
aangetoond dat deze PPARα agonisten anti-inflammatoire effecten hebben op verschillende organen en weefsels. Hun lipidenverlagende werking en de anti-inflammatoire effecten maken van fibraten een geschikt geneesmiddel voor de preventie van atherosclerose.
Studies omtrent de effecten van fibraten of andere PPARα-agonisten op gewrichtsweefsel
waren tot voor enkele jaren beperkt. Men observeerde in dierenmodellen voor reumatoïde arthritis dat kraakbeenschade en synovitis kunnen worden tegengegaan door de
toediening van fibraten.
Naast fibraten bestaan er andere lipidenverlagende middelen, namelijk statines. Statines
worden frequent gebruikt bij patiënten met hypercholesterolemie en een hoog cardiovasculair risicoprofiel. Deze remmers van hydroxymethylglutaryl-co-enzym A-reductase
verlagen de plasmaspiegels van low density lipoprotein-cholesterol (LDL-cholesterol) en
triglyceriden, en verhogen plasmaspiegels van high density lipoprotein-cholesterol (HDLcholesterol). Tevens is aangetoond dat zij systemische anti-inflammatoire effecten vertonen. Hun pleiotrope effecten zorgen ervoor dat statines een geschikt preventief middel
zijn voor atherosclerose. Naast hun gunstige effecten op metabole aandoeningen hebben
zij ook effecten op het gewricht. Zo is in meerdere in vitro- en dierenstudies aangetoond
144
dat statines inflammatie en daaraan gekoppelde destructieve processen kunnen tegengaan
in kraakbeen, synovium en subchondraal bot. Ten slotte toont één studie aan dat patiënten die statines nemen, ook een verbetering in lipidenprofiel vertonen van de synoviale
vloeistof. Samengevat: statines lijken in staat te zijn om de pathofysiologie van artrose in
al haar facetten te onderdrukken.
Lazzerini en collega’s duiden in hun review terecht op de gunstige effecten van statines
op gewrichtsweefsels zoals kraakbeen, synovium of subchondraal bot. Het is mogelijk
dat statines wel ook van nut zouden kunnen zijn door hun gunstig effect op atherosclerose, dyslipidemie en/of systemische inflammatie (al dan niet veroorzaakt door viscerale
adipositas). Zoals eerder vermeld, zijn er aanwijzingen dat deze afwijkingen of aandoeningen mee het artroseproces initiëren of bevorderen. Zowel statines als fibraten lijken
in aanmerking te komen als potentiële preventieve of therapeutische strategie gezien hun
gewrichtsspecifieke werking, maar tevens gezien hun systemische en metabole invloed.
Om na te gaan of statines artrose kunnen voorkomen of tegengaan, stelden we als hypothese dat statinegebruik geassocieerd is met een verminderde incidentie en/of progressie
van knie/heupartrose in de Rotterdam Studie (Hoofdstuk 6), een grootschalig prospectieve cohorte studie. Voor fibraten was dit geen optie, aangezien het gebruik van fibraten
minder frequent was in deze studiepopulatie. Uit de Rotterdam Studie werden 2.921
participanten geïncludeerd. Bij aanvang van de studie en bij follow-up (na gemiddeld
6,5 jaar) werden radiologische opnames van de knie en de heup genomen. Participanten werden geëxcludeerd indien zij fracturen ter hoogte van de knie of de heup hadden
doorgemaakt of een reumatologische voorgeschiedenis rapporteerden. Data omtrent geneesmiddelengebruik werden verkregen vanuit een gedigitaliseerde apothekersdatabase.
Gegevens omtrent klinisch onderzoek en bloedafnames, en alle mogelijke klinische en
socio-economische confounders of beïnvloedende variabelen die op basis van de literatuur bekend zijn, waren bekend in deze studie. Op basis hiervan werd een multivariate
logistische regressie analyse uitgevoerd om de associatie tussen statinegebruik en artrose
incidentie/progressie na te gaan. De statistische modellen werden gecorrigeerd voor confounders en beïnvloedende factoren, alsmede voor het feit dat zowel het linker als rechter
gewricht van participanten mee werden geïncludeerd in de analyse (GEE; generalized
estimated equations). De resultaten toonden een correlatie tussen gebruik van statines en
een verminderde progressie van artrose in de knie (odds ratio: 0,46; 95%-betrouwbaarheidsinterval: 0,26 – 0,80; p = 0,01) en geen correlatie voor de heup.
145
Conclusies en toekomstperspectieven
Het kraakbeen, synovium en subchondraal bot zijn betrokken bij artrose. Deze thesis
bevat bewijzen voor een rol van het IPVL in het verloop van knie-artrose. Het IPFP
produceert pro- en anti-inflammatoire cytokines die het kraakbeenmetabolisme kunnen
beïnvloeden. Bijkomende studies zijn nodig om het effect van deze cytokines op het volledige artroseproces na te gaan, en om na te gaan of de geobserveerde effecten specifiek
zijn voor de eindfase van artrose, of een algemeen fenomeen zijn bij artrose. De rol van
afzonderlijke cytokines kan tevens nog verder worden onderzocht. Verdere studies zijn
nodig om na te gaan in welke mate IPVL van patiënten met knie-artrose verschilt met
IPVLs van mensen zonder knie-artrose of van patiënten met reumatoide arthritis. Tevens
dient onderzocht te worden wat de rol van het IPVL is bij pijnsensatie bij artrose, aangezien studies aantonen dat het een belangrijke hoeveelheid zenuwcellen bevat. Dit zou
argumenten kunnen bieden om na te gaan of het nuttig is om IPVL te verwijderen bij
mensen met vroegtijdige artrose of bij patiënten die een totale knieprothese krijgen.
Deze thesis beschrijft dat het IPVL een pro-inflammatoir fenotype kan vertonen onder
invloed van intra-articulaire stimuli, zoals het cytokine interleukine 1β. Het IPVL fenotype kan ook beïnvloed worden door een PPARα ligand. Deze middelen blijken in
staat het IPVL in een minder pro-inflammatoire status te brengen. Naast hun effecten
op IPVL, konden we aantonen dat PPARα activatoren eveneens anti-inflammatoire en
anti-destructieve effecten vertonen op kraakbeen en synovium. We beschreven de eerste
observationele studie die aantoont dat statinegebruikers een verminderde kans hebben
om radiologische knie-artrose te ontwikkelen. Een dierenstudie zou een causaal verband
en een dosis-respons relatie kunnen onderzoeken bij het gebruik van statines of fibraten
ter preventie of behandeling van artrose.
Het is niet duidelijk of de farmacodynamische eigenschappen van statines en fibraten
toelaten om in vivo dezelfde effecten te vertonen op gewrichtsweefsels zoals deze in vitro
werden waargenomen. Gezien het belangrijke first pass-effect van statines ter hoogte van
de lever (tot 90%), is het niet duidelijk of statines daadwerkelijk het gewricht bereiken.
Mogelijk zijn de gunstige effecten van statines op knie-artrose in de observationele studie
die wordt beschreven in deze thesis grotendeels te verklaren door de gunstige systemische
of metabole effecten, en zou een betere distributie naar musculoskeletale weefsels van
eenzelfde soort geneesmiddel een additioneel gunstig effect kunnen geven. Ook voor
fibraten is er nog niet voldoende bewijs dat ze het gewricht bereiken in een concentratie
die voldoende hoog is om een anti-inflammatoir en anti-destructief effect te verkrijgen
op gewrichtsweefsels.
Gezien de vele processen en weefsels die betrokken zijn bij artrose, is het vreemd dat
het onderzoek naar een medicamenteuze behandeling van artrose zich bijna uitsluitend
heeft gericht op kraakbeen alleen. De kans bestaat dat een therapie voor artrose zich niet
uitsluitend dient te beperken tot behandeling van het kraakbeen, maar tevens ook van
het IPVL, synovium en systemische aandoeningen zoals atherosclerose en dyslipidemie.
146
Ter ondersteuning van dit concept, dienen de systemische metabole aspecten van artrose
nog verder te worden uitgeklaard. De rol van atherosclerose, dyslipidemie en diabetes
mellitus in de pathofysiologie van artrose zijn slechts beperkt onderzocht. Studies dienen
na te gaan wat de exacte effecten zijn van vetzuren op kraakbeen en synovium en wat de
celfysiologische mechanismen hiervan zijn.
De mogelijkheid om lipidenverlagende middelen te gebruiken ter preventie of behandeling van artrose lijkt erg beloftvol. De resultaten van al deze studies kunnen inzicht bieden
in de ontstaansmechanismen van artrose en de mogelijkheid om lipidenverlagende middelen als therapeutische of preventieve strategie bij artrose verder onderbouwen. Deze
studies kunnen informatie bieden voor een juiste patiëntenselectie bij de start van gerandomiseerde gecontroleerde klinische studies omtrent lipidenverlagende middelen en
artrose.
147
148
Referenties
Referenties
1.
Murray CJL, Lopez A. The Global Burden of Disease: A comprehensive assessment of
mortality and disability from diseases, injuries and risk factors in 1990 and projected to 2020.
Cambridge, MA: Harvard University Press on behalf of the World Health Organization and the
World Bank 1996.
2.
Woolf AD, Pfleger B. Burden of major musculoskeletal conditions. Bull World Health
Organ 2003;81(9):646-56.
3.
Press Release: POP/952. United Nations. URL: http://www.un.org/News/press/
docs/2007/pop952.doc.htm. Accessed 2008.
4.
Gabriel SE, Crowson CS, O’Fallon WM. Costs of osteoarthritis: estimates from a geographically defined population. J Rheumatol Suppl 1995;43:23-5.
5.
NINDS/NIH 1999 (Migraine).
6.
Rabenda V, Manette C, Lemmens R, et a. Direct and indirect costs attributable to
osteoarthritis in active subjects. J Rheumatol 2006;33(6):1152-8.
7.
Ghosh P, Smith M. Osteoarthritis, genetic and molecular mechanisms. Biogerontology
2002;3(1-2):85-8.
8.
Goldring MB, Goldring SR. Osteoarthritis. J Cell Physiol 2007;213(3):626-34.
9.
Guilak F, Fermor B, Keefe FJ, et al. The role of biomechanics and inflammation in
cartilage injury and repair. Clin Orthop Relat Res 2004(423):17-26.
10.
Spector TD, MacGregor AJ. Risk factors for osteoarthritis: genetics. Osteoarthritis
Cartilage 2004;12 Suppl A:S39-44.
11.
Englund M, Paradowski PT, Lohmander LS. Association of radiographic hand
osteoarthritis with radiographic knee osteoarthritis after meniscectomy. Arthritis Rheum
2004;50(2):469-75.
12.
Berenbaum F, Sellam J. Obesity and osteoarthritis: what are the links? Joint Bone Spine
2008;75(6):667-8.
149
13.
Chowdhury TT, Salter DM, Bader DL, et al. Signal transduction pathways involving
p38 MAPK, JNK, NFkappaB and AP-1 influences the response of chondrocytes cultured in
agarose constructs to IL-1beta and dynamic compression. Inflamm Res 2008;57(7):306-13.
14.
Gosset M, Berenbaum F, Levy A, et al. Prostaglandin E2 synthesis in cartilage explants
under compression: mPGES-1 is a mechanosensitive gene. Arthritis Res Ther 2006;8(4):R135.
15.
McGlashan SR, Cluett EC, Jensen CG, et al. Primary cilia in osteoarthritic chondrocytes: from chondrons to clusters. Dev Dyn 2008;237(8):2013-20.
16.
Felson DT. Clinical practice. Osteoarthritis of the knee. N Engl J Med
2006;354(8):841-8.
17.
Valdes AM, Spector TD. Genetic epidemiology of hip and knee osteoarthritis. Nat Rev
Rheumatol 2011;7(1):23-32.
18.
Hill CL, Hunter DJ, Niu J, et al. Synovitis detected on magnetic resonance imaging and its relation to pain and cartilage loss in knee osteoarthritis. Ann Rheum Dis
2007;66(12):1599-603.
19.
Scanzello CR, Plaas A, Crow MK. Innate immune system activation in osteoarthritis: is
osteoarthritis a chronic wound? Curr Opin Rheumatol 2008;20(5):565-72.
20.
Bondeson J, Wainwright SD, Lauder S, et al. The role of synovial macrophages and
macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other
destructive and inflammatory responses in osteoarthritis. Arthritis Res Ther 2006;8(6):R187.
21.
Botter SM, Glasson SS, Hopkins B, et al. ADAMTS5-/- mice have less subchondral
bone changes after induction of osteoarthritis through surgical instability: implications for a link
between cartilage and subchondral bone changes. Osteoarthritis Cartilage 2009;17(5):636-45.
22.
Sniekers YH, Intema F, Lafeber FP, et al. A role for subchondral bone changes in the
process of osteoarthritis; a micro-CT study of two canine models. BMC Musculoskelet Disord
2008;9:20.
23.
Andriacchi TP, Mundermann A. The role of ambulatory mechanics in the initiation
and progression of knee osteoarthritis. Curr Opin Rheumatol 2006;18(5):514-8.
24.
Andriacchi TP, Mundermann A, Smith RL, et al. A framework for the in vivo pathomechanics of osteoarthritis at the knee. Ann Biomed Eng 2004;32(3):447-57.
150
Referenties
25.
Cicuttini FM, Baker JR, Spector TD. The association of obesity with osteoarthritis of
the hand and knee in women: a twin study. J Rheumatol 1996;23(7):1221-6.
26.
Grotle M, Hagen KB, Natvig B, et al. Obesity and osteoarthritis in knee, hip and/or
hand: an epidemiological study in the general population with 10 years follow-up. BMC Musculoskelet Disord 2008;9:132.
27.
Kalichman L, Li L, Kobyliansky E. Prevalence, pattern and determinants of radiographic hand osteoarthritis in Turkmen community-based sample. Rheumatol Int
2009;29(10):1143-9.
28.
Oliveria SA, Felson DT, Cirillo PA, et al. Body weight, body mass index, and incident
symptomatic osteoarthritis of the hand, hip, and knee. Epidemiology 1999;10(2):161-6.
29.
Wang Y, Simpson JA, Wluka AE, et al. Relationship between body adiposity measures
and risk of primary knee and hip replacement for osteoarthritis: a prospective cohort study.
Arthritis Res Ther 2009;11(2):R31.
30.
Conaghan PG, Vanharanta H, Dieppe PA. Is progressive osteoarthritis an atheromatous
vascular disease? Ann Rheum Dis 2005;64(11):1539-41.
31.
Davies-Tuck ML, Hanna F, Davis SR, et al. Total cholesterol and triglycerides are associated with the development of new bone marrow lesions in asymptomatic middle-aged women
- a prospective cohort study. Arthritis Res Ther 2009;11(6):R181.
32.
Findlay DM. Vascular pathology and osteoarthritis. Rheumatology (Oxford)
2007;46(12):1763-8.
33.
Plumb MS, Aspden RM. High levels of fat and (n-6) fatty acids in cancellous bone in
osteoarthritis. Lipids Health Dis 2004;3:12.
34.
Hurst S, Zainal Z, Caterson B, Hughes CE, Harwood JL. Dietary fatty acids and
arthritis. Prostaglandins Leukot Essent Fatty Acids 2010;82(4-6):315-8.
35.
Zainal Z, Longman AJ, Hurst S, et al. Relative efficacies of omega-3 polyunsaturated
fatty acids in reducing expression of key proteins in a model system for studying osteoarthritis.
Osteoarthritis Cartilage 2009;17(7):896-905.
151
36.
Henrotin Y, Lambert C, Couchourel D, et al. Nutraceuticals: do they represent a new
era in the management of osteoarthritis? - a narrative review from the lessons taken with five
products. Osteoarthritis Cartilage. 2011 Jan;19(1):1-21. doi: 10.1016/j.joca.2010.10.017. Epub
2010 Oct 28. Review.
37.
Katz JD, Agrawal S, Velasquez M. Getting to the heart of the matter: osteoarthritis
takes its place as part of the metabolic syndrome. Curr Opin Rheumatol 2010;22(5):512-9.
38.
Gore M, Tai KS, Sadosky A, Leslie D, et al. Clinical comorbidities, treatment patterns,
and direct medical costs of patients with osteoarthritis in usual care: a retrospective claims database analysis. J Med Econ 2011;14(4):497-507.
39.
Patra D, Sandell LJ. Evolving biomarkers in osteoarthritis. J Knee Surg
2011;24(4):241-9.
40.
Zhang W, Nuki G, Moskowitz RW, et al. OARSI recommendations for the management of hip and knee osteoarthritis: part III: Changes in evidence following systematic
cumulative update of research published through January 2009. Osteoarthritis Cartilage
2010;18(4):476-99.
41.
Pelletier JP, Martel-Pelletier J. DMOAD developments: present and future. Bull NYU
Hosp Jt Dis 2007;65(3):242-8.
42.
March LM, Cross MJ, Lapsley H, et al. Outcomes after hip or knee replacement surgery for osteoarthritis. A prospective cohort study comparing patients’ quality of life before and
after surgery with age-related population norms. Med J Aust 1999;171(5):235-8.
43.
Hunter DJ, Felson DT. Osteoarthritis. BMJ 2006;332(7542):639-42.
44.
Bijlsma JW, Berenbaum F, Lafeber FP. Osteoarthritis: an update with relevance for
clinical practice. Lancet 2011;377(9783):2115-26.
45.
Yusuf E, Nelissen RG, Ioan-Facsinay A, et al. Association between weight or body mass
index and hand osteoarthritis: a systematic review. Ann Rheum Dis 2010;69(4):761-5.
46.
Gallagher J, Tierney P, Murray P, et al. The infrapatellar fat pad: anatomy and clinical
correlations. Knee Surg Sports Traumatol Arthrosc 2005;13(4):268-72.
47.
Toussirot E, Streit G, Wendling D. The contribution of adipose tissue and adipokines
to inflammation in joint diseases. Curr Med Chem 2007;14(10):1095-100.
152
Referenties
48.
Goldring MB, Berenbaum F. The regulation of chondrocyte function by proinflammatory mediators: prostaglandins and nitric oxide. Clin Orthop Relat Res 2004(427S):S37-46.
49.
Goldring MB. Osteoarthritis and cartilage: the role of cytokines. Curr Rheumatol Rep
2000;2(6):459-65.
50.
Blom AB, van Lent PL, Holthuysen AE, et al. Synovial lining macrophages mediate osteophyte formation during experimental osteoarthritis. Osteoarthritis Cartilage 2004;12(8):62735.
51.
van Lent PL, Blom AB, van der Kraan P, et al. Crucial role of synovial lining macrophages in the promotion of transforming growth factor beta-mediated osteophyte formation.
Arthritis Rheum 2004;50(1):103-11.
52.
Guevremont M, Martel-Pelletier J, Massicotte F, et al. Human adult chondrocytes express hepatocyte growth factor (HGF) isoforms but not HgF: potential implication of osteoblasts
on the presence of HGF in cartilage. J Bone Miner Res 2003;18(6):1073-81.
53.
Sanchez C, Deberg MA, Piccardi N, et al. Osteoblasts from the sclerotic subchondral
bone downregulate aggrecan but upregulate metalloproteinases expression by chondrocytes. This
effect is mimicked by interleukin-6, -1beta and oncostatin M pre-treated non-sclerotic osteoblasts. Osteoarthritis Cartilage 2005;13(11):979-87.
54.
Sanchez C, Deberg MA, Piccardi N, et al. Subchondral bone osteoblasts induce phenotypic changes in human osteoarthritic chondrocytes. Osteoarthritis Cartilage 2005;13(11):98897.
55.
Felson DT, Anderson JJ, Naimark A, et al. Obesity and knee osteoarthritis. Ann Intern
Med 1988;109:18–24.
56.
Mainnen P, Riihimaki H, Heliovaara M, et al. Overweight, gender and knee osteoarthritis. Int J Obes Relat Metab Discord 1996;20:595–7.
57.
Speaker KJ, Fleshner M. Interleukin-1 beta: a potential link between stress and the
development of visceral obesity. BMC Physiol. 2012 Jun 27;12:8.
58.
Toda Y, Toda T, Takemura S, Wada T, Morimoto T, Ogawa R. Change in body fat, but
not body weight or metabolic correlates of obesity, is related to symptomatic relief of obese patients with knee osteoarthritis after a weight control program. J Rheumatol 1998;25(11):2181-6.
153
59.
Hoffa A. The influence of the adipose tissue with regard to the pathology of the knee
joint. Journal of the American medical Association 1904;43:795-6.
60.
Jacobson JA, Lenchik L, Ruhoy MK, Schweitzer ME, Resnick D. MR imaging of the
infrapatellar fat pad of Hoffa. Radiographics 1997;17(3):675-91.
61.
Vahlensieck M, Linneborn G, Schild H, et al. Hoffa’s recess: incidence, morphology
and differential diagnosis of the globular-shaped cleft in the infrapatellar fat pad of the knee on
MRI and cadaver dissections. Eur Radiol 2002;12(1):90-3.
62.
Kohn D, Deiler S, Rudert M. Arterial blood supply of the infrapatellar fat pad.
Anatomy and clinical consequences. Arch Orthop Trauma Surg 1995;114(2):72-5.
63.
Davies DV, Edwards DA. The blood supply of the synovial membrane and intra-articular structures. Ann R Coll Surg Engl 1948;2(3):142-46.
64.
McDougall JJ, Bray RC. Vascular volume determination of articular tissues in normal
and anterior cruciate ligament-deficient rabbit knees. Anat Rec 1998;251(2):207-13.
65.
Bennell K, Hodges P, Mellor R, et al. The nature of anterior knee pain following injection of hypertonic saline into the infrapatellar fat pad. J Orthop Res 2004;22(1):116-21.
66.
Clements KM, Ball AD, Jones HB, et al. Cellular and histopathological changes in the
infrapatellar fat pad in the monoiodoacetate model of osteoarthritis pain. Osteoarthritis Cartilage 2009;17(6):805-12.
67.
Kennedy JC, Alexander IJ, Hayes KC. Nerve supply of the human knee and its functional importance. Am J Sports Med 1982;10(6):329-35.
68.
Gardner E. The innervation of the knee joint. Anat Rec 1948;101(1):109-30.
69.
Platzer W. Atlas van de anatomie. 7 ed. Baarn: Intro; 1999.
70.
Fain JN. Release of interleukins and other inflammatory cytokines by human adipose
tissue is enhanced in obesity and primarily due to the nonfat cells. Vitamins and hormones
2006;74:443-77.
71.
Zhang Y, Proenca R, Maffei M, et al. Positional cloning of the mouse obese gene and
its human homologue. Nature 1994;372(6505):425-32.
154
Referenties
72.
Dye SF, Vaupel GL, Dye CC. Conscious neurosensory mapping of the internal structures of the human knee without intraarticular anesthesia. Am J Sports Med 1998;26(6):773-7.
73.
Bohnsack M, Meier F, Walter GF, et al. Distribution of substance-P nerves inside the
infrapatellar fat pad and the adjacent synovial tissue: a neurohistological approach to anterior
knee pain syndrome. Arch Orthop Trauma Surg 2005;125(9):592-7.
74.
Lehner B, Koeck FX, Capellino S, Schubert TE, Hofbauer R, Straub RH. Preponderance of sensory versus sympathetic nerve fibers and increased cellularity in the infrapatellar fat
pad in anterior knee pain patients after primary arthroplasty. J Orthop Res 2008;26(3):342-50.
75.
Lawson JP, Steere AC. Lyme arthritis: radiologic findings.
Radiology 1985;154(1):37-43.
76.
O’Shaughnessy MCp, Carleson Jp, Haigh Rp, Kidd BLp, Winyard PGp. The effect of substance P on nitric oxide release in a rheumatoid arthritis model. Inflamm Res
2006;55(6):236-40.
77.
Weidler C, Holzer C, Harbuz M, et al. Low density of sympathetic nerve fibres and increased density of brain derived neurotrophic factor positive cells in RA synovium. Ann Rheum
Dis 2005;64(1):13-20.
78.
Magi M, Branca A, Bucca C, Langerame V. Hoffa disease. Ital J Orthop Traumatol
1991;17(2):211-6.
79.
Caulfield JP, Hein A, Helfgott SM, Brahn E, Dynesius-Trentham RA, Trentham DE.
Intraarticular injection of arthritogenic factor causes mast cell degranulation, inflammation, fat
necrosis, and synovial hyperplasia. Lab Invest 1988;59(1):82-95.
80.
Checkley D, Johnstone D, Taylor K, Waterton JC. High-resolution NMR imaging of
an antigen-induced arthritis in the rabbit knee. Magn Reson Med 1989;11(2):221-35.
81.
DeJoy SQ, Ferguson KM, Oronsky AL, Kerwar SS. Studies on the synergy between
collagen and adjuvant arthritis in rats. Cell Immunol 1988;113(1):117-29.
82.
Macule F, Sastre S, Lasurt S, Sala P, Segur JM, Mallofre C. Hoffa’s fat pad resection in
total knee arthroplasty. Acta Orthop Belg 2005;71(6):714-7.
83.
Jedrzejczyk T. The infrapatellar adipose body in humans of various age groups. Folia
morphologica 1996;55(1):51-5.
155
84.
Blom AB, van Lent PL, Libregts S, et al. Crucial role of macrophages in matrix
metalloproteinase-mediated cartilage destruction during experimental osteoarthritis: involvement
of matrix metalloproteinase 3. Arthritis Rheum 2007;56(1):147-57.
85.
Haynes MK, Hume EL, Smith JB. Phenotypic characterization of inflammatory cells
from osteoarthritic synovium and synovial fluids. Clin Immunol 2002;105(3):315-25.
86.
Kaisho T, Akira S. Toll-like receptors and their signaling mechanism in innate immunity. Acta Odontol Scand 2001;59(3):124-30.
87.
Abbink JJ, Kamp AM, Nieuwenhuys EJ, Nuijens JH, Swaak AJ, Hack CE. Predominant role of neutrophils in the inactivation of alpha 2-macroglobulin in arthritic joints. Arthritis
Rheum 1991;34(9):1139-50.
88.
Tetlow LC, Woolley DE. Effect of histamine on the production of matrix metalloproteinases-1, -3, -8 and -13, and TNFalpha and PGE(2) by human articular chondrocytes and
synovial fibroblasts in vitro: a comparative study. Virchows Arch 2004;445(5):485-90.
89.
Sakkas LI, Platsoucas CD. The role of T cells in the pathogenesis of osteoarthritis.
Arthritis Rheum 2007;56(2):409-24.
90.
Dumond H, Presle N, Terlain B, et al. Evidence for a key role of leptin in osteoarthritis.
Arthritis Rheum 2003;48(11):3118-29.
91.
Schaffler A, Ehling A, Neumann E, et al. Adipocytokines in synovial fluid. Jama
2003;290(13):1709-10.
92.
Lago R, Gomez R, Otero M, et al. A new player in cartilage homeostasis: adiponectin
induces nitric oxide synthase type II and pro-inflammatory cytokines in chondrocytes. Osteoarthritis Cartilage 2008;16(9):1101-9.
93.
Iliopoulos D, Malizos KN, Tsezou A. Epigenetic regulation of leptin affects MMP-13
expression in osteoarthritic chondrocytes: possible molecular target for osteoarthritis therapeutic
intervention. Ann Rheum Dis 2007;66(12):1616-21.
94.
Otero M, Gomez Reino JJ, Gualillo O. Synergistic induction of nitric oxide synthase
type II: in vitro effect of leptin and interferon-gamma in human chondrocytes and ATDC5
chondrogenic cells. Arthritis Rheum 2003;48(2):404-9.
156
Referenties
95.
Presle N, Pottie P, Dumond H, et al. Differential distribution of adipokines between
serum and synovial fluid in patients with osteoarthritis. Contribution of joint tissues to their
articular production. Osteoarthritis Cartilage 2006;14(7):690-5.
96.
Simopoulou T, Malizos KN, Iliopoulos D, et al. Differential expression of leptin and
leptin’s receptor isoform (Ob-Rb) mRNA between advanced and minimally affected osteoarthritic cartilage; effect on cartilage metabolism. Osteoarthritis Cartilage 2007;15(8):872-83.
97.
Vuolteenaho K, Koskinen A, Kukkonen M, et al. Leptin enhances synthesis of proinflammatory mediators in human osteoarthritic cartilage--mediator role of NO in leptin-induced
PGE2, IL-6, and IL-8 production. Mediators Inflamm 2009:345838.
98.
Matarese G, Leiter EH, La Cava A. Leptin in autoimmunity: many questions, some
answers. Tissue Antigens 2007;70(2):87-95.
99.
Gomez R, Lago F, Gomez-Reino J, et al. Adipokines in the skeleton: influence on cartilage function and joint degenerative diseases. J Mol Endocrinol 2009;43(1):11-8.
100.
Tang CH, Chiu YC, Tan TW, et al. Adiponectin enhances IL-6 production in human
synovial fibroblast via an AdipoR1 receptor, AMPK, p38, and NF-kappa B pathway. J Immunol
2007;179(8):5483-92.
101.
Ehling A, Schaffler A, Herfarth H, et al. The potential of adiponectin in driving arthritis. J Immunol 2006;176(7):4468-78.
102.
Lee JH, Ort T, Ma K, et al. Resistin is elevated following traumatic joint injury and
causes matrix degradation and release of inflammatory cytokines from articular cartilage in vitro.
103.
Brentano F, Schorr O, Ospelt C, et al. Pre-B cell colony-enhancing factor/visfatin, a
new marker of inflammation in rheumatoid arthritis with proinflammatory and matrix-degrading activities. Arthritis Rheum 2007;56(9):2829-39.
104.
Gosset M, Berenbaum F, Salvat C, et al. Crucial role of visfatin/pre-B cell colonyenhancing factor in matrix degradation and prostaglandin E2 synthesis in chondrocytes: possible
influence on osteoarthritis. Arthritis Rheum 2008;58(5):1399-409.
105.
Reid IR. Relationships between fat and bone. Osteoporos Int 2008;19(5):595-606.
106.
Chen TH, Chen L, Hsieh MS, et al. Evidence for a protective role for adiponectin in
osteoarthritis. Biochim Biophys Acta 2006;1762(8):711-8.
157
107.
Ku JH, Lee CK, Joo BS, et al. Correlation of synovial fluid leptin concentrations with
the severity of osteoarthritis. Clin Rheumatol 2009.
108.
Shine B, Bourne JT, Begum Baig F, et al. C reactive protein and immunoglobulin G in
synovial fluid and serum in joint disease. Ann Rheum Dis 1991;50(1):32-5.
109.
Wallis WJ, Simkin PA, Nelp WB. Protein traffic in human synovial effusions. Arthritis
Rheum 1987;30(1):57-63.
110.
Ushiyama T, Chano T, Inoue K, et al. Cytokine production in the infrapatellar fat pad:
another source of cytokines in knee synovial fluids. Ann Rheum Dis 2003;62(2):108-12.
111.
Distel E, Cadoudal T, Durant S, et al. The infrapatellar fat pad in knee osteoarthritis: an important source of interleukin-6 and its soluble receptor. Arthritis and rheumatism
2009;60(11):3374-7.
112.
Reijman M, Pols HA, Bergink AP, et al. Body mass index associated with onset and
progression of osteoarthritis of the knee but not of the hip: the Rotterdam Study. Ann Rheum
Dis 2007;66(2):158-62.
113.
Bondeson J, Blom AB, Wainwright S, et al. The role of synovial macrophages and
macrophage-produced mediators in driving inflammatory and destructive responses in osteoarthritis. Arthritis Rheum 2010 Mar;62(3):647-57.
114.
Fantuzzi G. Adipose tissue, adipokines, and inflammation. The Journal of allergy and
clinical immunology 2005;115(5):911-9
115.
Kershaw EE, Flier JS. Adipose tissue as an endocrine organ. The Journal of clinical
endocrinology and metabolism 2004;89(6):2548-56.
116.
Clockaerts S, Bastiaansen-Jenniskens YM, Runhaar J, et al. The infrapatellar fat pad
should be considered as an active osteoarthritic joint tissue: a narrative review. Osteoarthritis
Cartilage 2010;18(7):876-82.
117.
Chen WP, Bao JP, Feng J, et al. Increased serum concentrations of visfatin and its
production by different joint tissues in patients with osteoarthritis. Clin Chem Lab Med
2010;48(8):1141-5.
118.
Klein-Wieringa IR, Kloppenburg M, Bastiaansen-Jenniskens YM, et al. Extended
report: the infrapatellar fat pad of patients with osteoarthritis has an inflammatory phenotype.
Annals of the rheumatic diseases 2011;70(5):851-7.
158
Referenties
119.
Lumeng CN, Maillard I, Saltiel AR. T-ing up inflammation in fat. Nat Med
2009;15(8):846-7.
120.
Anderson EK, Gutierrez DA, Hasty AH. Adipose tissue recruitment of leukocytes. Current opinion in lipidology;21(3):172-7.
121.
Nishimura S, Manabe I, Nagasaki M, et al. CD8+ effector T cells contribute to macrophage recruitment and adipose tissue inflammation in obesity. Nat Med 2009;15(8):914-20.
122.
Ohmura K, Ishimori N, Ohmura Y, et al. Natural killer T cells are involved in adipose
tissues inflammation and glucose intolerance in diet-induced obese mice. Arteriosclerosis, thrombosis, and vascular biology;30(2):193-9.
123.
Liu J, Divoux A, Sun J, et al. Genetic deficiency and pharmacological stabilization of
mast cells reduce diet-induced obesity and diabetes in mice. Nat Med 2009;15(8):940-5.
124.
Fain JN, Madan AK, Hiler ML, et al. Comparison of the release of adipokines by
adipose tissue, adipose tissue matrix, and adipocytes from visceral and subcutaneous abdominal
adipose tissues of obese humans. Endocrinology 2004;145(5):2273-82.
125.
Fain JN, Tichansky DS, Madan AK. Most of the interleukin 1 receptor antagonist,
cathepsin S, macrophage migration inhibitory factor, nerve growth factor, and interleukin 18 release by explants of human adipose tissue is by the non-fat cells, not by the adipocytes. Metabolism 2006;55(8):1113-21.
126.
Galic S, Oakhill JS, Steinberg GR. Adipose tissue as an endocrine organ. Molecular and
cellular endocrinology;316(2):129-39.
127.
Aron-Wisnewsky J, Tordjman J, Poitou C, et al. Human adipose tissue macrophages:
m1 and m2 cell surface markers in subcutaneous and omental depots and after weight loss. The
Journal of clinical endocrinology and metabolism 2009;94(11):4619-23.
128.
Verreck FA, de Boer T, Langenberg DM, et al. Phenotypic and functional profiling
of human proinflammatory type-1 and anti-inflammatory type-2 macrophages in response to
microbial antigens and IFN-gamma- and CD40L-mediated costimulation. Journal of leukocyte
biology 2006;79(2):285-93.
129.
Gordon S. Alternative activation of macrophages. Nature reviews 2003;3(1):23-35.
159
130.
Stein M, Keshav S, Harris N, et al. Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation.
The Journal of experimental medicine 1992;176(1):287-92.
131.
Frayn KN, Karpe F, Fielding BA, et al. Integrative physiology of human adipose tissue.
Int J Obes Relat Metab Disord 2003;27(8):875-88.
132.
Bastiaansen-Jenniskens YM, de Bart ACW, Koevoet W, et al. Elevated Levels of Cartilage Oligomeric Matrix Protein during In Vitro Cartilage Matrix Generation Decrease Collagen
Fibril Diameter. Cartilage 2010;1(3):200-10.
133.
Bastiaansen-Jenniskens YM, Koevoet W, Feijt C, et al. Proteoglycan production is required in initial stages of new cartilage matrix formation but inhibits integrative cartilage repair.
Journal of tissue engineering and regenerative medicine 2009;3(2):117-23.
134.
Green LC, Wagner DA, Glogowski J, et al. Analysis of nitrate, nitrite, and [15N]nitrate
in biological fluids. Analytical biochemistry 1982;126(1):131-8.
135.
Pelletier JP, Martel-Pelletier J, Abramson SB. Osteoarthritis, an inflammatory disease:
potential implication for the selection of new therapeutic targets. Arthritis and rheumatism
2001;44(6):1237-47.
136.
Fosang AJ, Rogerson FM. Identifying the human aggrecanase. Osteoarthritis Cartilage
2010;18(9):1109-16.
137.
Barter MJ, Hui W, Lakey RL, et al. Lipophilic statins prevent matrix metalloproteinasemediated cartilage collagen breakdown by inhibiting protein geranylgeranylation. Annals of the
rheumatic diseases 2010;69(12):2189-98.
138.
Hui W, Cawston T, Rowan AD. Transforming growth factor beta 1 and insulinlike growth factor 1 block collagen degradation induced by oncostatin M in combination
with tumour necrosis factor alpha from bovine cartilage. Annals of the rheumatic diseases
2003;62(2):172-4.
139.
Jenniskens YM, Koevoet W, de Bart AC, et al. Biochemical and functional modulation of the cartilage collagen network by IGF1, TGFbeta2 and FGF2. Osteoarthritis Cartilage
2006;14(11):1136-46.
140.
Wynn TA, Barron L. Macrophages: master regulators of inflammation and fibrosis.
Semin Liver Dis 2010;30(3):245-57.
160
Referenties
141.
Hesse M, Modolell M, La Flamme AC, et al. Differential regulation of nitric oxide
synthase-2 and arginase-1 by type 1/type 2 cytokines in vivo: granulomatous pathology is shaped
by the pattern of L-arginine metabolism. J Immunol 2001;167(11):6533-44.
142.
Zeyda M, Farmer D, Todoric J, et al. Human adipose tissue macrophages are of an
anti-inflammatory phenotype but capable of excessive pro-inflammatory mediator production.
International journal of obesity (2005) 2007;31(9):1420-8.
143.
Zeyda M, Stulnig TM. Adipose tissue macrophages. Immunol Lett 2007;112(2):61-7.
144.
Lumeng CN, Bodzin JL, Saltiel AR. Obesity induces a phenotypic switch in adipose
tissue macrophage polarization. J Clin Invest 2007;117(1):175-84.
145.
Lumeng CN, DelProposto JB, Westcott DJ, et al. Phenotypic switching of adipose
tissue macrophages with obesity is generated by spatiotemporal differences in macrophage subtypes. Diabetes 2008;57(12):3239-46.
146.
Benito MJ, Veale DJ, FitzGerald O, van den Berg WB, Bresnihan B. Synovial tissue inflammation in early and late osteoarthritis. Annals of the rheumatic diseases 2005;64(9):1263-7.
147.
Martinez FO, Gordon S, Locati M, Mantovani A. Transcriptional profiling of the human monocyte-to-macrophage differentiation and polarization: new molecules and patterns of
gene expression. J Immunol 2006;177(10):7303-11.
148.
Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nature
reviews 2008;8(12):958-69.
149.
Bastiaansen-Jenniskens YM, Clockaerts S, Feijt C, et al. Infrapatellar fat pad of patients with end-stage osteoarthritis inhibits catabolic mediators in cartilage. Ann Rheum Dis
2011;Feb;71(2):288-94.
150.
Klein-Wieringa IR, Kloppenburg M, Bastiaansen-Jenniskens YM, et al. Extended
report: the infrapatellar fat pad of patients with osteoarthritis has an inflammatory phenotype.
Ann Rheum Dis 2010;70(5):851-7.
151.
Clockaerts S, Bastiaansen-Jenniskens YM, Feijt C, et al. Peroxisome proliferator activated receptor alpha activation decreases inflammatory and destructive responses in osteoarthritic
cartilage. Osteoarthritis Cartilage 2011;19(7):895-902.
161
152.
Francois M, Richette P, Tsagris L, et al. Activation of the peroxisome proliferatoractivated receptor alpha pathway potentiates interleukin-1 receptor antagonist production in
cytokine-treated chondrocytes. Arthritis Rheum 2006;54(4):1233-45.
153.
Delerive P, De Bosscher K, Besnard S, et al. Peroxisome proliferator-activated receptor
alpha negatively regulates the vascular inflammatory gene response by negative cross-talk with
transcription factors NF-kappaB and AP-1. J Biol Chem 1999;274(45):32048-54.
154.
Okamoto H, Iwamoto T, Kotake S, Momohara S, Yamanaka H, Kamatani N. Inhibition of NF-kappaB signaling by fenofibrate, a peroxisome proliferator-activated receptoralpha ligand, presents a therapeutic strategy for rheumatoid arthritis. Clin Exp Rheumatol
2005;23(3):323-30.
155.
Crisafulli C, Cuzzocrea S. The role of endogenous and exogenous ligands for the peroxisome proliferatior-activated receptor alpha(PPAR-alpha) in the regulation of inflammation in
macrophages. 2009 Jul;32(1):62-73.
156.
Benito MJ, Veale DJ, FitzGerald O, et al. Synovial tissue inflammation in early and late
osteoarthritis. Ann Rheum Dis 2005;64:1263–1267.
157.
Westacott CI, Whicher JT, Barnes IC, et al. Synovial fluid concentration of five different cytokines in rheumatic diseases. Ann Rheum Dis 1990;49(9):676-81.
158.
Goldring SR, Goldring MB. The role of cytokines in cartilage matrix degeneration in
osteoarthritis. Clin Orthop Relat Res 2004(427 Suppl):S27-36.
159.
Schulze-Tanzil G, Zreiqat H, Sabat R, et al. Interleukin-10 and Articular Cartilage:
Experimental Therapeutical Approaches in Cartilage Disorders. Curr Gene Ther 2009.
160.
Poleni PE, Bianchi A, Etienne S, et al. Agonists of peroxisome proliferators-activated
receptors (PPAR) alpha, beta/delta or gamma reduce transforming growth factor (TGF)-beta-induced proteoglycans’ production in chondrocytes. Osteoarthritis Cartilage 2007;15(5):493-505.
161.
van Eekeren ICM, Clockaerts S, Bastiaansen-Jenniskens YM, et al. Fibrates as therapy
for osteoarthritis and rheumatoid arthritis? A systematic review. Accepted for publication in
Therapeutic Advances in Musculoskeletal Disease 2012.
162.
Bordji K, Grillasca JP, Gouze JN, et al. Evidence for the presence of peroxisome
proliferator-activated receptor (PPAR) alpha and gamma and retinoid Z receptor in cartilage.
PPARgamma activation modulates the effects of interleukin-1beta on rat chondrocytes. J Biol
Chem 2000;275(16):12243-50.
162
Referenties
163.
Stienstra R, Joosten LA, Koenen T, et al. The inflammasome-mediated caspase-1 activation controls adipocyte differentiation and insulin sensitivity. Cell Metab 2010;12(6):593-605.
164.
Farahat MN, Yanni G, Poston R, et al. Cytokine expression in synovial membranes of
patients with rheumatoid arthritis and osteoarthritis. Ann Rheum Dis 1993;52(12):870-5.
165.
Clockaerts S, Bierma-Zeinstra SM. Comment on: Statins and the Joint: Multiple Target for a Global Protection? Semin Arthritis Rheum 2011;Jun;40(6):588.
166.
Alagona P, Jr. Fenofibric acid: a new fibrate approved for use in combination with statin
for the treatment of mixed dyslipidemia. Vasc Health Risk Manag 2010;6:351-62.
167.
Remick J, Weintraub H, Setton R, Offenbacher J, Fisher E, Schwartzbard A. Fibrate
therapy: an update. Cardiol Rev 2008;16(3):129-41.
168.
Harvey WF, Hunter DJ. The role of analgesics and intra-articular injections in disease
management. Rheum Dis Clin North Am 2008;34(3):777-88.
169.
Issemann I, Green S. Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 1990;347(6294):645-50.
170.
Devchand PR, Keller H, Peters JM, Vazquez M, Gonzalez FJ, Wahli W. The PPARalpha-leukotriene B4 pathway to inflammation control. Nature 1996;384(6604):39-43.
171.
Ziouzenkova O, Perrey S, Marx N, Bacqueville D, Plutzky J. Peroxisome proliferatoractivated receptors. Curr Atheroscler Rep 2002;4(1):59-64.
172.
Lemberger T, Desvergne B, Wahli W. Peroxisome proliferator-activated receptors: a
nuclear receptor signaling pathway in lipid physiology.
Annu Rev Cell Dev Biol 1996;12:335-63.
173.
Zandbergen F, Plutzky J. PPARalpha in atherosclerosis and inflammation.
Biochim Biophys Acta 2007;1771(8):972-82.
174.
Bay-Jensen AC, Slagboom E, Chen-An P, et al. Role of hormones in cartilage and joint
metabolism: understanding an unhealthy metabolic phenotype in osteoarthritis. Menopause.
2012 Dec 10. [Epub ahead of print]
163
175.
Delerive P, Martin-Nizard F, Chinetti G, et al. Peroxisome proliferator-activated receptor activators inhibit thrombin-induced endothelin-1 production in human vascular endothelial
cells by inhibiting the activator protein-1 signaling pathway. Circ Res 1999;85(5):394-402.
176.
Kono K, Kamijo Y, Hora K, et al. PPAR{alpha} attenuates the proinflammatory response in activated mesangial cells. Am J Physiol Renal Physiol 2009;296(2):F328-36.
177.
Patel NS, di Paola R, Mazzon E, et al. Peroxisome proliferator-activated receptor-alpha
contributes to the resolution of inflammation after renal ischemia/reperfusion injury. J Pharmacol Exp Ther 2009;328(2):635-43.
178.
Stienstra R, Mandard S, Patsouris D, et al. Peroxisome proliferator-activated receptor
alpha protects against obesity-induced hepatic inflammation. Endocrinology 2007;148(6):275363.
179.
Poleni PE, Etienne S, Velot E, et al. Activation of PPARs alpha, beta/delta, and gamma
Impairs TGF-beta1-Induced Collagens’ Production and Modulates the TIMP-1/MMPs Balance
in Three-Dimensional Cultured Chondrocytes. PPAR Res 2010:635912.
180.
Henrotin Y, Lambert C, Couchourel D, et al. Nutraceuticals: do they represent a new
era in the management of osteoarthritis? - a narrative review from the lessons taken with five
products. Osteoarthritis Cartilage 2011;Jan;19(1):1-21. Epub 2010 Oct 28.
181.
Martel-Pelletier J, Welsch DJ, Pelletier JP. Metalloproteases and inhibitors in arthritic
diseases. Best Pract Res Clin Rheumatol 2001;15(5):805-29.
182.
Martel-Pelletier J, Boileau C, Pelletier JP, Roughley PJ. Cartilage in normal and osteoarthritis conditions. Best Pract Res Clin Rheumatol 2008;22(2):351-84.
183.
Abramson SB. Nitric oxide in inflammation and pain associated with osteoarthritis.
Arthritis Res Ther 2008;10 Suppl 2:S2.
184.
McCoy JM, Wicks JR, Audoly LP. The role of prostaglandin E2 receptors in the pathogenesis of rheumatoid arthritis. J Clin Invest 2002;110(5):651-8.
185.
Kamei D, Yamakawa K, Takegoshi Y, et al. Reduced pain hypersensitivity and
inflammation in mice lacking microsomal prostaglandin e synthase-1. J Biol Chem
2004;279(32):33684-95.
164
Referenties
186.
Farndale RW, Buttle DJ, Barrett AJ. Improved quantitation and discrimination
of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim Biophys Acta
1986;883(2):173-7.
187.
Largo R, Alvarez-Soria MA, Diez-Ortego I, et al. Glucosamine inhibits IL-1betainduced NFkappaB activation in human osteoarthritic chondrocytes. Osteoarthritis Cartilage
2003;11(4):290-8.
188.
Zwerina J, Redlich K, Polzer K, et al. TNF-induced structural joint damage is mediated
by IL-1. Proc Natl Acad Sci U S A 2007;104(28):11742-7.
189.
Goldring MB, Berenbaum F. Human chondrocyte culture models for studying cyclooxygenase expression and prostaglandin regulation of collagen gene expression. Osteoarthritis
Cartilage 1999;7(4):386-8.
190.
Van Offel JF, Dombrecht EJ, Bridts CH, et al. Influence of bisphosphonates on the
production of pro-inflammatory cytokines by activated human articular chondrocytes. Cytokine
2005;31(4):298-304.
191.
Forsyth CB, Cole A, Murphy G, Bienias JL, Im HJ, Loeser RF, Jr. Increased matrix
metalloproteinase-13 production with aging by human articular chondrocytes in response to
catabolic stimuli. J Gerontol A Biol Sci Med Sci 2005;60(9):1118-24.
192.
Fukui N, Ikeda Y, Ohnuki T, et al. Regional differences in chondrocyte metabolism in osteoarthritis: a detailed analysis by laser capture microdissection. Arthritis Rheum
2008;58(1):154-63.
193.
Mankin HJ, Dorfman H, Lippiello L, Zarins A. Biochemical and metabolic abnormalities in articular cartilage from osteo-arthritic human hips. II. Correlation of morphology with
biochemical and metabolic data. J Bone Joint Surg Am 1971;53(3):523-37.
194.
Afif H, Benderdour M, Mfuna-Endam L, et al. Peroxisome proliferator-activated receptor gamma1 expression is diminished in human osteoarthritic cartilage and is downregulated by
interleukin-1beta in articular chondrocytes. Arthritis Res Ther 2007;9(2):R31.
195.
Krey G, Braissant O, L’Horset F, et al. Fatty acids, eicosanoids, and hypolipidemic
agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Mol Endocrinol 1997;11(6):779-91.
165
196.
Lehmann JM, Lenhard JM, Oliver BB, Ringold GM, Kliewer SA. Peroxisome proliferator-activated receptors alpha and gamma are activated by indomethacin and other non-steroidal
anti-inflammatory drugs. J Biol Chem 1997;272(6):3406-10.
197.
Lin Q, Ruuska SE, Shaw NS, Dong D, Noy N. Ligand selectivity of the peroxisome
proliferator-activated receptor alpha. Biochemistry 1999;38(1):185-90.
198.
Cheng S, Afif H, Martel-Pelletier J, et al. Activation of peroxisome proliferator-activated receptor gamma inhibits interleukin-1beta-induced membrane-associated prostaglandin
E2 synthase-1 expression in human synovial fibroblasts by interfering with Egr-1. J Biol Chem
2004;279(21):22057-65.
199.
Ghosh P, Cheras PA. Vascular mechanisms in osteoarthritis. Best Pract Res Clin Rheumatol 2001;15(5):693-709.
200.
237.
Jouzeau JY, Moulin D, Koufany M, et al. [Pathophysiological relevance of
peroxisome proliferators activated receptors (PPAR) to joint diseases - the pro and con of agonists]. J Soc Biol 2008;202(4):289-312.
201.
Lovett-Racke AE, Hussain RZ, Northrop S, et al. Peroxisome proliferator-activated
receptor alpha agonists as therapy for autoimmune disease. J Immunol 2004;172(9):5790-8.
202.
Brooks PM. The burden of musculoskeletal disease--a global perspective. Clin Rheumatol 2006;25(6):778-81.
203.
Goldring SR. Role of bone in osteoarthritis pathogenesis.
Med Clin North Am 2009;93(1):25-35.
204.
Masuko K, Murata M, Suematsu N, et al. A metabolic aspect of osteoarthritis: lipid
as a possible contributor to the pathogenesis of cartilage degradation. Clin Exp Rheumatol
2009;27(2):347-53.
205.
Zhang W, Moskowitz RW, Nuki G, et al. OARSI recommendations for the management of hip and knee osteoarthritis, Part II: OARSI evidence-based, expert consensus guidelines.
206.
Lazzerini PE, Capecchi PL, Selvi E, et al. Statins and the joint: multiple targets for a
global protection? Semin Arthritis Rheum 2010;40(5):430-46.
207.
Bauer DC. HMG CoA reductase inhibitors and the skeleton: a comprehensive review.
Osteoporos Int 2003;14(4):273-82.
166
Referenties
208.
81.
Björntorp P. Adipose tissue distribution and function. Int J Obes 1991; 15 Suppl 2:67-
209.
Nissen SE, Tuzcu EM, Schoenhagen P, et al. Statin therapy, LDL cholesterol, C-reactive
protein, and coronary artery disease. N Engl J Med 2005;352(1):29-38.
210.
Akasaki Y, Matsuda S, Nakayama K, Fukagawa S, Miura H, Iwamoto Y. Mevastatin
reduces cartilage degradation in rabbit experimental osteoarthritis through inhibition of synovial
inflammation. Osteoarthritis Cartilage 2009;17(2):235-43.
211.
Wu YS, Hu YY, Yang RF, Wang Z, Wei YY. The matrix metalloproteinases as pharmacological target in osteoarthritis: statins may be of therapeutic benefit. Med Hypotheses
2007;69(3):557-9.
212.
Hofman A, Breteler MM, van Duijn CM, et al. The Rotterdam Study: 2010 objectives
and design update. Eur J Epidemiol 2009;24(9):553-72.
213.
WHO. Anatomical Therapeutic Classification (ATC) Index: Including Defined Daily
Doses (DDD) for Plain Substances. In; 1992.
214.
Schachter M. Chemical, pharmacokinetic and pharmacodynamic properties of statins:
an update. Fundam Clin Pharmacol 2005;19(1):117-25.
215.
Kellgren JH, Jeffrey MR, Ball J. The epidemiology of chronic rheumatism. Atlas of
standard radiographs of arthritis. In: Oxford, UK: Blackwell Scientific Publications; 1963:vii-11.
216.
Kellgren JH, Lawrence JS. Radiological assessment of osteo-arthrosis. Ann Rheum Dis
1957;16(4):494-502.
217.
Reijman M, Hazes JM, Pols HA, et al. Validity and reliability of three definitions of hip
osteoarthritis: cross sectional and longitudinal approach. Ann Rheum Dis 2004;63(11):1427-33.
218.
Schiphof D, Boers M, Bierma-Zeinstra SM. Differences in descriptions of Kellgren and
Lawrence grades of knee osteoarthritis. Ann Rheum Dis 2008;67(7):1034-6.
219.
Spector TD, Hart DJ, Byrne J, et al. Definition of osteoarthritis of the knee for epidemiological studies. Ann Rheum Dis 1993;52(11):790-4.
220.
Auleley GR, Giraudeau B, Dougados M, Ravaud P. Radiographic assessment of hip
osteoarthritis progression: impact of reading procedures for longitudinal studies. Ann Rheum
Dis 2000;59(6):422-7.
167
221.
Reijman M, Hazes JM, Koes BW, et al. Validity, reliability, and applicability of seven
definitions of hip osteoarthritis used in epidemiological studies: a systematic appraisal. Ann
Rheum Dis 2004;63(3):226-32.
222.
Brouwer GM, van Tol AW, Bergink AP, et al. Association between valgus and varus
alignment and the development and progression of radiographic osteoarthritis of the knee. Arthritis Rheum 2007;56(4):1204-11.
223.
Zhang Y, Niu J, Felson DT, et al. Methodologic challenges in studying risk factors for
progression of knee osteoarthritis. Arthritis Care Res (Hoboken) 2010;62(11):1527-32.
224.
Runhaar J, Koes BW, Bierma-Zeinstra SM. Obesity and biomechanics of every day
movements; a systematic review. Osteoarthritis Cartilage 2009;17, Supplement 1:S91.
225.
Bierma-Zeinstra SM, Koes BW. Risk factors and prognostic factors of hip and knee
osteoarthritis. Nat Clin Pract Rheumatol 2007;3(2):78-85.
226.
Beattie MS, Lane NE, Hung YY, et al. Association of statin use and development and
progression of hip osteoarthritis in elderly women. J Rheumatol 2005;32(1):106-10.
227.
Chodick G, Amital H, Shalem Y, et al. Persistence with statins and onset of rheumatoid
arthritis: a population-based cohort study. PLoS Med 2010;7(9):e1000336.
228.
Mazzuca SA, Brandt KD, Buckwalter KA. Detection of radiographic joint space narrowing in subjects with knee osteoarthritis: longitudinal comparison of the metatarsophalangeal
and semiflexed anteroposterior views. Arthritis Rheum 2003;48(2):385-90.
229.
Abe M, Matsuda M, Kobayashi H, et al. Effects of statins on adipose tissue inflammation: their inhibitory effect on MyD88-independent IRF3/IFN-beta pathway in macrophages.
Arterioscler Thromb Vasc Biol 2008;28(5):871-7.
230.
Dollery CM, McEwan JR, Henney AM. Matrix metalloproteinases and cardiovascular
disease. Circ Res 1995;77(5):863-8.
231.
Nissen SE. Effect of intensive lipid lowering on progression of coronary atherosclerosis:
evidence for an early benefit from the Reversal of Atherosclerosis with Aggressive Lipid Lowering
(REVERSAL) trial. Am J Cardiol 2005;96(5A):61F-8F.
232.
Palmer G, Chobaz V, Talabot-Ayer D, et al. Assessment of the efficacy of different
statins in murine collagen-induced arthritis. Arthritis Rheum 2004;50(12):4051-9.
168
Referenties
233.
Schoofs MW, Sturkenboom MC, van der Klift M, Hofman A, Pols HA, Stricker
BH. HMG-CoA reductase inhibitors and the risk of vertebral fracture. J Bone Miner Res
2004;19(9):1525-30.
234.
Dahaghin S, Bierma-Zeinstra SM, Koes BW, Hazes JM, Pols HA. Do metabolic factors
add to the effect of overweight on hand osteoarthritis? The Rotterdam Study. Ann Rheum Dis
2007;66(7):916-20.
235.
Hui W, Litherland GJ, Elias MS, et al. Leptin produced by joint white adipose tissue
induces cartilage degradation via upregulation and activation of matrix metalloproteinases. Ann
Rheum Dis;71(3):455-62.
236.
Huang XS, Zhao SP, Bai L, Hu M, Zhao W, Zhang Q. Atorvastatin and fenofibrate
increase apolipoprotein AV and decrease triglycerides by up-regulating peroxisome proliferatoractivated receptor-alpha. Br J Pharmacol 2009;158(3):706-12.
169
170
Lekensamenvatting
171
172
Lekensamenvatting
Artrose is de meest voorkomende gewrichtsaandoening die primair gekenmerkt wordt
door een aantasting van het kraakbeen. De belangrijkste risicofactor voor het ontwikkelen
van artrose is ouderdom. Obesitas, vrouwelijk geslacht, standafwijkingen of traumatische
beschadiging van het gewricht zijn ook bekende risicofactoren. Artrose is één van de
meeste frequente oorzaken van chronische pijn en immobiliteit bij ouderen. Dit brengt
een grote maatschappelijke kostprijs met zich mee. Gezien de stijgende gemiddelde leeftijd van de bevolking en de toename van obesitas in de Westerse wereld wordt verwacht
dat artrose in de toekomst nog vaker zal voorkomen.
Artrose tast het volledige gewricht aan. Naast het kraakbeen zijn het onderliggend bot,
het gewrichtskapsel, menisci en ligamenten mee betrokken in het ziekteproces. Enerzijds
ontstaat er bij artrose kraakbeenschade ten gevolge van repetitieve belastingen. Ouderdom
of genetisch voorbeschiktheid kunnen ertoe leiden dat het kraakbeen minder bestand is
tegen deze herhaalde belasting, resulterend in ‘slijtage’ van het kraakbeen. Anderzijds zijn
er duidelijke aanwijzingen dat ontstekingsprocessen het kraakbeen verder afbreken en
andere gewrichtsweefsels (o.a. bot onder het kraakbeen, gewrichtskapsel) aantasten, waardoor deze weefsels zelf ontstekingsbevorderende factoren beginnen te produceren. Dit
alles resulteert in pijn en een verminderde beweeglijkheid van het aangetaste gewricht.
Er is op dit moment geen geneesmiddel beschikbaar waarover consensus bestaat dat het
artrose voorkomt of geneest. De enige behandelingsopties voor patienten met artrose zijn
het verstrekken van informatie omtrent de aandoening, fysiotherapie, hulpmiddelen zoals
braces of krukken, en pijnstillers zoals paracetamol of ontstekingsremmers. Bij patienten
met ernstige artrose, waarbij pijnbestrijding of hulpmiddelen geen verbetering van de
klachten bieden, rest er als enige optie een gewrichtsvervangende ingreep. Voor de knie
en de heup is deze ingreep één van de meest succesvolle bestaande chirurgische procedures door een belangrijke verbetering in pijn en functie. Deze ingrepen hebben echter als
nadelen een lange revalidatie, kans op complicaties en hoge kostprijs. Bijkomende kennis
omtrent het ziekteproces artrose kan bijdragen tot het vinden van nieuwe mogelijkheden
om deze gewrichtsaandoening te behandelen.
Obesitas is geassocieerd met artrose van gewichtsdragende gewrichten zoals de knie en
in mindere mate de heup. Recent werd duidelijk dat obesitas tevens een relatie heeft met
handartrose. De associatie tussen obesitas en artrose wordt daarom wellicht niet alleen
verklaard door de verhoogde mechanische belasting op het gewricht ten gevolge van een
hoog lichaamsgewicht, maar ook door ontstekingsprocessen en andere invloeden die aanwezig zijn bij een te grote hoeveelheid (buik)vet. Het doel van deze thesis is het nagaan
van de invloed van vetweefsel dat zich in het gewricht bevindt, op het artroseproces. Op
basis van de nieuwe mechanismen die we hierbij terugvonden en recente literatuur omtrent de relatie tussen obesitas en artrose, onderzochten we cholesterolverlagende geneesmiddelen als potentieel preventief of therapeutisch middel voor artrose.
173
Eerst zijn we gestart met een literatuuroverzicht (Hoofdstuk 2), waarbij we studies beschrijven die informatie geven over het vetweefsel dat zich in de knie bevindt (knievet) en
de potentiële rol hiervan bij het ontstaan van knieartrose. Er zijn aanwijzingen terug te
vinden in bestaande wetenschappelijke literatuur dat knievet in staat is om ontstekingsstoffen uit te scheiden die in het kniegewricht terechtkomen en die kunnen inwerken op
kraakbeen, gewrichtskapsel en op het bot dat zich net onder kraakbeen bevindt.
In hoofdstuk 3 trachtten we deze hypothese te bevestigen. In dit hoofdstuk beschrijven
we kweekexperimenten waaruit blijkt dat de combinatie van ontstekingsfactoren die door
knievet worden uitgescheiden geen toename van ontsteking en schade in het kraakbeen
geeft, maar eerder een beschermend effect lijkt te hebben. Als mogelijke verklaring hiervoor vonden we een bepaald type van ontstekingscellen, genaamd macrofagen, in het
knievet die eerder een ontstekingswerende functie hebben. We weten echter dat deze
macrofagen ook een ontstekingsbevorderende functie kunnen krijgen onder invloed van
systemische factoren zoals obesitas of ten gevolge van lokale ontstekingsfactoren. Daarom
onderzochten we beide mogelijkheden verder. Eerst keken we of er een verband was tussen type en hoeveelheid geproduceerde ontstekingsfactoren enerzijds, en body mass index
(BMI) bij de patienten van wie de weefsels afkomstig waren anderzijds. Zoals beschreven
in hoofdstuk 4, vonden we geen verband tussen ontstekingsfactoren en BMI. Echter, in
dit hoofdstuk beschrijven we kweekexperimenten waarbij we een ontstekingsinducerende
molecule, interleukine 1β, toevoegden aan stukjes knievet. Interleukine 1β is ook aanwezig in een gewricht dat is aangetast door artrose. Door de toediening van interleukine
1β was er een belangrijke toename van ontstekingsfactoren geproduceerd door knievet,
die ontsteking en beschadiging in het kraakbeen, synovium en bot kunnen induceren.
Het knievet produceert dus meer ontstekingsfactoren wanneer het in een omgeving van
ontsteking terecht komt, zoals dat het geval is bij beginnende artrose.
In een poging om deze verhoogde productie van ontstekingsfactoren tegen te gaan, voegden we een substantie toe die een gelijkaardig werkingsmechanisme heeft als een fibraat.
Een fibraat is een lipidenverlagend geneesmiddel dat gebruikt wordt bij patienten met
risico op hart- en vaatlijden en dit geneesmiddel heeft ook een gekend ontstekingsremmend effect. Hiermee konden we de stijging in productie van ontstekingsfactoren tegengaan. Datzelfde middel kon in vergelijkbare kweekexperimenten ook ontsteking in het
gewrichtskapsel tegengaan.
Omdat uit deze experimenten bleek dat dit middel gunstige effecten had op gewrichtskapsel en knievet, wilden we weten of het ook gunstige invloeden kon uitoefenen op
het kraakbeen. Om dit na te gaan voerden we gelijkaardige kweekexperimenten uit met
kraakbeen, en ook hier vonden we dat ditzelfde middel een ontstekingswerend en antidestructief effect bleek te hebben (Hoofdstuk 5). Onze kweekexperimenten toonden
dus dat middelen met eenzelfde werking als fibraten een gunstige invloed hadden op drie
belangrijke gewrichtsweefsels betrokken bij artrose.
174
Lekensamenvatting
Naast aanwijzingen voor gunstige effecten op het gewricht zelf, zijn er aanwijzingen dat
fibraten andere nadelige systemische effecten op artrose, zoals aderverkalking, verstoord
lipidenmetabolisme of systemisch verhoogde ontsteking (zoals aanwezig bij obesen), kunnen tegengaan. Meer en meer aanwijzigen geven immers aan dat deze al deze afwijkingen
mee het ziekteproces van artrose bepalen. Statines zijn net als fibraten lipidenverlagende
middelen en vertonen ongeveer gelijkaardige systemische effecten en invloeden op het
gewricht. We stelden daarom de hypothese dat mensen die statines gebruiken, een verminderde kans hebben op het ontwikkelen van artrose. We verzamelden gegevens omtrent
geneesmiddelengebruik, medische voorgeschiedenis, röntgen foto’s van knieën en heupen
uit de Rotterdam Studie, een grootschalig bevolkingsonderzoek in een wijk in Rotterdam
(Hoofdstuk 6). Hierin vonden we dat mensen die statines gebruikten, een verminderde
kans hadden op het ontwikkelen van artrose in de knie of een mindere verergering van
bestaande artrose doormaakten gedurende de studieperiode van 6.5 jaar.
Deze thesis geeft bewijs voor een rol van knievet in het ontstaan van artrose in de knie en
tevens belangrijke aanwijzingen dat lipidenverlagende middelen zoals fibraten ontsteking
en destructie in een gewricht kunnen tegengaan. Op basis van bestaande literatuur stelden we de hypothese dat lipidenverlagende middelen niet alleen via hun gunstige invloeden op het gewricht zelf, maar ook door de preventie van systemische aandoeningen zoals
aderverkalking, een verstoord lipidenprofiel of algemeen verhoogde ontsteking, artrose
kunnen voorkomen of genezen. In een epidemiologische studie vonden wij alvast dat statinegebruikers een verminderde kans hadden op ontwikkeling en verergering van artrose.
De mogelijkheid om lipidenverlagende middelen te gebruiken ter preventie of genezing
van artrose lijkt erg beloftvol en dient verder te worden onderzocht.
175
176
Dankwoord
Dankwoord
Beste Prof. dr. Van Osch, promotor van dit werk, en dr. Bastiaansen-Jenniskens, postdoctoraal onderzoeker en directe begeleidster, beste Gerjo en Yvonne,
Als een geoliede tandem hebben jullie dit project op gang getrokken en verdedigd, stonden jullie beiden steeds klaar om problemen aan te pakken, een kritische blik te bieden
op teksten en experimenten, of praktische problemen op te lossen. Mijn respect en appreciatie is groot voor de ‘open deur’ politiek die jullie hanteren en de persoonlijke manier
van werken die jullie kenmerkt. Dankzij jullie is deze thesis tot een goed einde kunnen
komen, waarvoor alleen maar dank.
Meteen wil ik graag prof. dr. Sita Bierma-Zeinstra vermelden. Beste Sita, ik heb erg veel
geleerd van onze discussies en vond het erg leuk de epidemiologische studies met jou te
kunnen uitwerken.
Dank aan prof. dr. ir. Harrie Weinans, om me samen met Gerjo al in 2007 als geheel
onbekende ‘Belg uit Antwerpen’ de kans te bieden om me gedurende drie maanden te
bewijzen als potentieel doctoraatstudent. Onder de deskundige dagelijkse begeleiding van
dr. Sander Botter heb ik toen mijn eerste wetenschappelijke stappen gezet, die me steeds
zijn bijgebleven.
Mijn welgemeende dank om onder jullie hoede te hebben mogen werken. Ik hoop dat
onze samenwerking hierna nog een vervolg zal kennen.
Prof. dr. Johan Somville, promotor van deze thesis, bedankt voor mijn selectie tot de
opleiding orthopedische chirurgie, het vertrouwen dat u in mij stelde door mij de kans
te geven dit onderzoeksproject aan te vatten en mij de tijd te gunnen het werk te kunnen voltooien. Professor dr. Francis Van Glabbeek, uw enthousiasme voor onderzoek
werkte van meet af aan erg aanstekelijk en heeft er mee toe geleid dat ik aan dit project
ben kunnen beginnen. Dank aan dr. Dossche, dr. Van Gestel, dr. Nuyts en dr. D’Anvers,
en ook aan de verpleegkundige staf van het operatiekwartier en de polikliniek, voor jullie
welwillendheid en behulpzaamheid om telkens opnieuw restweefsels van ingrepen opzij
te houden.
Tevens wil ik graag alle medewerkers van SPM Orthopedie, AZ Monica Deurne bedanken voor de tijd en ondersteuning die ik heb gekregen gedurende de laatste maanden voor
de verdediging, broodnodig om de laatste wetenschappelijke loodjes te dragen, maar ook
om de praktische kant van mijn doctoraatsverdediging voor te bereiden.
De realisatie van de flowcytometrische analyse van het vetweefsel is te danken aan de
expertise van Chris Bridts en Christel Mertens van het laboratorium Reumatologie in
Antwerpen, die met veel geduld en behulpzaamheid steeds al mijn vragen en problemen
wisten op te lossen. Ik dank prof. dr. Van Offel en prof. dr. Ebo voor hun interesse in mijn
onderzoeksproject, maar vooral prof. dr. Luc De Clerck, co-promotor, voor de praktische
ondersteuning en kritische wetenschappelijke ingesteldheid bij deze thesis. Aan alle col-
177
lega’s op het laboratorium reumatologie, ik vond het erg leuk met jullie samen te werken
en wens jullie nog heel veel succes met jullie verdere loopbaan en familie.
Toegegeven, aan de directheid en spontaniteit van mijn Nederlandse collega’s op de dienst
Orthopedie van het Erasmus MC ben ik zelfs na drie jaar niet helemaal gewend kunnen geraken. Het acclimatiseren op maandagochtend voor de werkbespreking kostte me
meestal enkele ‘bakkies koffie’… Toch alleen maar positieve dingen over mijn verblijf in
Rotterdam! De samenwerking in het lab, de discussies tijdens werkbesprekingen, het ‘borrelen’ na het werk waren altijd leuke momenten, en niet te vergeten het schitterende concept van ‘cake van de week’. Ik wil al mijn collega’s bedanken voor de leuke tijd op het lab,
maar ook zeker de collega’s van Huisartengeneeskunde en de klinische onderzoeksafdeling
Orthopedie.
De experimenten in dit proefschrift zouden nooit gelukt zijn zonder de immer geduldige,
vriendelijke en behulpzame aanpak van analisten Carola, Nicole, Wendy en Esther. Sandra, bedankt voor al je hulp, ook nog toen ik al een tijdje uit zicht was in Rotterdam.
Een deel van mijn werk bestond in de begeleiding van studenten. Inge, Annelies en Murid, ik vond het leuk met jullie samen te werken, bedankt voor jullie harde werk. Theun
en Wu, ik ben blij dat dit onderzoek onder jullie deskundigheid een vervolg heeft gekregen.
Dank aan alle medewerkers van de kliniek voor de wetenschappelijk feedback en ook voor
het consequent afleveren van verse stalen. Ik wil in het bijzonder dr. Max Reijman en dr.
Koen Bos bedanken voor de aangename samenwerking, waarvan ik ook hoop dat we dit
in de toekomst kunnen verderzetten.
Ik dank tot slot, en niet in het minst, prof. dr. Jan Verhaar, hoofd van de dienst Orthopedie van het Erasmus MC, voor de kundige wetenschappelijke feedback, motiverende
woorden bij elke verwezenlijking in dit proefschrift en voor het enthousiasme omtrent de
samenwerking met Antwerpen.
178
Dankwoord
Ik wil tot slot graag mijn altijd enthousiaste en lieve grootmoeders vermelden, alsmede
mijn broers Jochen en Peter, en ook Liesbeth, Maxim en Hannelore. Irene en Greg, bedankt voor de vele steun en behulpzaamheid die jullie altijd tonen en voor jullie enthousiasme en zorgzaamheid voor Mathis en Lisa. Dank aan André, Lars en Maaike (en
natuurlijk Kyan en Ghita!), Katleen en Marcin (en Noam!) en mijn ganse schoonfamilie
voor de interesse, het enthousiasme en steun de voorbije jaren.
Niet in het minst wil ik mijn vader en moeder bedanken. Bedankt voor jullie harde werken de voorbije jaren, dat ervoor gezorgd heeft dat ik steeds in optimale omstandigheden
heb kunnen studeren. Jullie gezond verstand en realiteitszin, maar vooral, jullie enorme
weerbarstigheid en veerkracht bij tegenslagen hebben als voorbeeld gediend om te kunnen omgaan met de obstakels die dit doctoraat met zich meebracht.
Een significante reductie in slaap buiten beschouwing gelaten, blijven mijn schitterende
kindjes, Mathis en Lisa, een onuitputtelijke bron van energie en motivatie om dagelijks
aan het werk te gaan!
Liefste Katia, de voorbije 4 jaren waren erg zwaar. (Te) grootse verbouwingswerken, twee
zwangerschappen, de zorg voor de kindjes als fantastische mama, het opbouwen van je
logopedische praktijk, het regelen van het huishouden, en de emotioneel moeilijke periode voor en na het overlijden van je mama, hebben je er niet van weerhouden altijd
met veel enthousiasme en ondersteuning mijn opleiding en mijn onderzoekswerk aan te
moedigen. Je bent een fantastische vrouw! Ik kijk uit naar het moment dat we onze relatie
kunnen bezegelen met onze trouw in Toscane en naar alle mooie jaren die nadien zullen
volgen.
179
180
181
Het kraakbeen, synovium en subchondraal bot zijn betrokken bij artrose. Deze thesis bevat bewijzen voor een rol
van het infrapatellaire vetlichaam in het ziekteproces van knie-artrose. Het infrapatellaire vetlichaam produceert
pro- en an-inflammatoire cytokines die het kraakbeenmetabolisme kunnen beïnvloeden.
Het infrapatellaire vetlichaam vertoont verschillende fenotypes, die aankelijk zijn van intra-arculaire smuli.
Het fenotype kan ook beïnvloed worden door een zogenaamde PPARα acvator. Dit is een lipidenverlagend geneesmiddel dat in staat blijkt om het infrapatellaire vetlichaam in een minder pro-inflammatoire status te brengen. Naast hun effecten op het infrapatellaire vetlichaam, konden we aantonen dat PPARα acvatoren eveneens
an-inflammatoire en an-destruceve effecten hebben op kraakbeen en synovium.
Er bestaan andere lipidenverlagende middelen zoals stanes, waarvan werkingsmechanismen zijn aangetoond
vergelijkbaar zijn met die van PPARα acvatoren. In deze thesis onderzoeken we de associae tussen stanegebruik en artrose, en beschrijven we de eerste observaonele studie die aantoont dat stanegebruikers een
verminderde kans hebben om radiologische knie-artrose te ontwikkelen.
ONTWERP KAFT: NATACHA HOEVENAEGEL - NIEUWE MEDIA D IENST
De mogelijkheid om lipidenverlagende middelen te gebruiken ter prevene of behandeling van artrose lijkt erg
beloevol. De resultaten van de studies in deze thesis bieden inzicht in de ontstaansmechanismen van artrose
en onderbouwen de potene van lipidenverlagende middelen als therapeusche of preveneve strategie bij artrose. Deze studies kunnen informae bieden voor een juiste paëntenselece bij de start van gerandomiseerde
gecontroleerde klinische studies omtrent lipidenverlagende middelen en artrose.

Role of infrapatellar fat pad in knee osteoarthritis

Transcription

Similar documents

November - December 2009

Hogeschool van AmsterdamOpleiding Fysiotherapie

Dit PDF bestand downloaden

Abstract - Maastricht University Research Portal

MALANDO

Crash - Bekegem

Abstract

Enkele aandachtspunten op het vlak van voetbal en

Who knew Ghent, Belgium was the prettiest city in the