Involvement of CaV3.1 T-type calcium channels in

Transcription

Am J Physiol Cell Physiol 298: C1414–C1423, 2010.
First published March 24, 2010; doi:10.1152/ajpcell.00488.2009.
Involvement of CaV3.1 T-type calcium channels in cell proliferation
in mouse preadipocytes
Atsushi Oguri,1 Tomofumi Tanaka,1 Haruko Iida,2 Kentarou Meguro,2 Haruhito Takano,2
Hitoshi Oonuma,3 Satoshi Nishimura,1,4,5 Toshihiro Morita,2 Tatsuya Yamasoba,6 Ryozo Nagai,1
and Toshiaki Nakajima2
1
Department of Cardiovascular Medicine, 2Department of Ischemic Circulatory Physiology, 3Department of Respiratory
Medicine, and 4Translational Systems Biology and Medicine Initiative, University of Tokyo, 5PRESTO, Japan Science and
Technology Agency, and 6Department of Otolaryngology, University of Tokyo, Tokyo, Japan
Submitted 3 November 2009; accepted in final form 18 March 2010
3T3-L1; adipose; ␣1G; cell cycle
a continuing toll on public health and is an
established risk factor for diabetes, hypertension, hyperlipidemia, and cardiovascular disease (2, 6, 25, 33). It is evident that
not only hypertrophy of adipocytes and increase of fat deposit
but also proliferation of preadipocytes and differentiation from
preadipocytes to adipocytes have important roles in forming
obesity. In particular, proliferation of preadipocytes (hyperplasia) is a key process in body fat mass development in obesity
since it conditions the number of potential new adipocytes in
adipose tissues. Hypertrophy of adipocytes often precedes an
OBESITY EXACTS
Address for reprint requests and other correspondence: T. Nakajima, Dept.
of Ischemic Circulatory Physiology, Univ. of Tokyo, 7-3-1 Hongo, Bunkyoku, Tokyo, Japan 113-8655 (e-mail: masamasa@pb4.so-net.ne.jp).
C1414
increase in adipocyte cell number (17), but the development of
hyperplasia is associated with the severe form of obesity and
associated diseases (19). Preadipocytes also contribute to the
obesity-associated increase in circulating IL-6 (15). In light of
these observations, drugs for the control of preadipocyte proliferation may represent a novel approach to the treatment of
obesity and associated diseases.
Ionic channels, e.g., K⫹ channels, play vital roles in regulating intracellular Ca2⫹ concentration ([Ca2⫹]i) and subsequently cellular processes such as proliferation and differentiation in various cells. Especially in proliferative cells such as
cultured vascular smooth muscle cells and cancer cells, ion
channel activities largely participate in cell proliferation (26,
29, 31, 34, 40). Preadipocytes are also a type of highly
proliferating cell, and several studies have shown that K⫹
channels regulate cell proliferation (20, 30). Hu et al. (20)
showed that transient outward current (Ito) encoded by voltagedependent K⫹ channel (KV 4.2) and large-conductance Ca2⫹activated K⫹ current (KCa1.1) participate in regulating proliferation of human preadipocytes. On the other hand, voltagegated Ca2⫹ channels (CaV) are ubiquitously expressed in
various cell types, and they also play roles in regulation of
cellular functions including proliferation (26, 29). So far, at
least 10 genes that encode ␣-subunit of CaV have been described (3). The channels are classified in three broad families distinguished by the cell membrane potential at which
they are active: Cav1 encoding high-voltage-activated
(HVA) L-type CaV; Cav2 encoding HVA P/Q-type, N-type,
and R-type CaV; and Cav3 encoding low-voltage-activated
(LVA) T-type CaV. In adipocytes, the existence of L-type
CaV has been shown by experimental and clinical studies.
Gaur et al. (9, 10) reported that growth hormone regulates
the distribution of L-type CaV in rat adipocyte membrane
and then basal levels of [Ca2⫹]i. Nitrendipine, an L-type
Ca2⫹ channel blocker, enhances insulin sensitivity in obese
and glucose-intolerant subjects (4). In addition, LVA Ca2⫹
channel was first described in 3T3 fibroblasts, with the use
of patch-clamp techniques (5, 32). Diaz-Velasquez et al. (8)
showed the presence of ␣1G-subtype T-type CaV in 3T3F442A preadipocytes, a subclone of 3T3 Swiss mouse
embryo fibroblasts (11, 12), by using RT-PCR analysis and
immunohistochemical studies. Recent studies have reported
that mice lacking Cav3.1 T-type CaV or mice treated with
TTA-A2, a selective T-type CaV blocker, are resistant to
high-fat diet-induced weight gain and fat increase and exhibit improved body composition (39). Additionally,
TTA-A2 reduces body weight and fat mass of obese rodents
0363-6143/10 Copyright © 2010 the American Physiological Society
http://www.ajpcell.org
Downloaded from http://ajpcell.physiology.org/ by 10.220.33.2 on October 25, 2016
Oguri A, Tanaka T, Iida H, Meguro K, Takano H, Oonuma H,
Nishimura S, Morita T, Yamasoba T, Nagai R, Nakajima T.
Involvement of CaV3.1 T-type calcium channels in cell proliferation
in mouse preadipocytes. Am J Physiol Cell Physiol 298: C1414–C1423,
2010. First published March 24, 2010; doi:10.1152/ajpcell.00488.2009.—
Voltage-gated Ca2⫹ channels (CaV) are ubiquitously expressed in
various cell types and play vital roles in regulation of cellular
functions including proliferation. However, the molecular identities and function of CaV remained unexplored in preadipocytes.
Therefore, whole cell voltage-clamp technique, conventional/
quantitative real-time RT-PCR, Western blot, small interfering
RNA (siRNA) experiments, and immunohistochemical analysis
were applied in mouse primary cultured preadipocytes as well as
mouse 3T3-L1 preadipocytes. The effects of CaV blockers on cell
proliferation and cell cycle were also investigated. Whole cell
recordings of 3T3-L1 preadipocytes showed low-threshold CaV,
which could be inhibited by mibefradil, Ni2⫹ (IC50 of 200 ␮M),
and NNC55-0396. Dominant expression of ␣1G mRNA was detected among CaV transcripts (␣1A–␣1I), supported by expression
of CaV3.1 protein encoded by ␣1G gene, with immunohistochemical studies and Western blot analysis. siRNA targeted for ␣1G
markedly inhibited CaV. Dominant expression of ␣1G mRNA and
expression of CaV3.1 protein were also observed in mouse primary
cultured preadipocytes. Expression level of ␣1G mRNA and
CaV3.1 protein significantly decreased in differentiated adipocytes.
Mibefradil, NNC55-0396, a selective T-type CaV blocker, but not
diltiazem, inhibited cell proliferation in response to serum.
NNC55-0396 and siRNA targeted for ␣1G also prevented cell cycle
entry/progression. The present study demonstrates that the CaV3.1
T-type Ca2⫹ channel encoded by ␣1G subtype is the dominant CaV
in mouse preadipocytes and may play a role in regulating preadipocyte proliferation, a key step in adipose tissue development.
C1415
T-TYPE CALCIUM CHANNELS IN MOUSE PREADIPOCYTES
Table 1. PCR primers used for amplification of voltage-gated Ca2⫹ channel genes
Channel (gene symbol)
Current
Sequence (5=–3=)
Sense CCGAGAACAGCCTTATCGT
Antisense CCACTGACCACTATGAAGTC
Sense ACAACCAGCGTAATGTCACC
Antisense CACTGACAACGATGAAGTC
Sense AGACGTGCTGTACTGGATGC
Antisense CACTTCTGTGAGCCAGTGAG
Sense AGTGATTTCATGCCTCAAGG
Antisense GGTTCTGATGTGTACCATTC
Sense GAAGGCAGCAGTGAACAAGC
Antisense AGTCCAGGATGTTCCAGAGG
Sense AAGCTGAGAACAACCCAGAAC
Antisense CAAAGCGGGAAAGAATAGAC
Sense GATGCGGGTGCTGAAGCTAG
Antisense TGACAGGCAGCTGAATACAG
Sense AGCAACATCGTGTTCACCAG
Antisense GAAGAGCATTAGCAGCATGC
Sense TGCATCCTGCACCACCAACT
Antisense AACACGGAAGGCCATGCCAG
Sense GGAAGAUCGUAGAUAGCAA
Antisense UUGCUAUCUACGAUCUUCC
CaV2.1(␣1A)
P/Q-type
544
CaV2.2(␣1B)
N-type
512
CaV1.2(␣1C)
L-type
568
CaV1.3(␣1D)
L-type
362
CaV2.3(␣1E)
R-type
604
CaV1.4(␣1F)
L-type
927
CaV3.1(␣1G)
T-type
455
CaV3.2(␣1H)
T-type
294
GAPDH
259
siRNA CaV3.1(␣1G)
Negative control
Allstars Negative Control (Qiagen,
catalog no. 1027280)
siRNA, small interfering RNA.
(39). Thus CaV appear to provide a novel therapeutic target
for the treatment of obesity. However, the molecular identities and physiological roles of CaV expressed in preadipocytes remained unexplored.
Therefore, to clarify the characteristics of expression of CaV in
preadipocytes, whole cell voltage-clamp technique, conventional/
quantitative real-time RT-PCR, Western blot, small interfering
RNA (siRNA) experiments, and immunohistochemical analysis
were applied to mouse 3T3-L1 preadipocytes, a subclone of 3T3
Swiss mouse embryo fibroblasts (11, 12), mouse primary cultured
preadipocytes, and their differentiated adipocytes. Here we provide direct evidence that the CaV3.1 T-type Ca2⫹ channel encoded by ␣1G subtype is the dominant CaV in mouse preadipocytes and plays a role in the regulation of their proliferation.
Fig. 1. Voltage-gated Ca2⫹ currents (ICa) expressed
in 3T3-L1 preadipocytes. A: cells were held at ⫺100
mV, and command voltage pulses to ⫹0 mV (400
ms in duration) were applied. The bath solution
contained 10 mM Ca2⫹ in Aa and Ab. In Ac, 10 mM
Ca2⫹ was replaced by 10 mM Ba2⫹. Effects of TTX
(10 ␮M) and mibefradil (30 ␮M) and nicardipine (1
␮M) are illustrated in Aa and Ab, respectively. Note
that the transient inward current was blocked by
mibefradil but not TTX and nicardipine. B: current
voltage (I-V) relations measured at the peak of the
transient inward current and the effects of holding
potential (Vh). The current traces at various command voltage pulses were elicited from a Vh of ⫺40
mV (Ba) or ⫺100 mV (Bb). C: I-V relations measured
at the peak. The transient inward current was elicited at a
Vh of ⫺100 mV, but not at ⫺40 mV. D: steady-state
activation (□) and inactivation (Œ) curves for ICa. Data
obtained from 4 cells were fitted by Boltzmann equation.
AJP-Cell Physiol • VOL
298 • JUNE 2010 •
www.ajpcell.org
Size, bp
C1416
MATERIALS AND METHODS
Fig. 3. A: expression of ␣-subunits of CaV genes detected by RT-PCR in
3T3-L1 preadipocytes and adult mouse brain. M, marker; 1A, ␣1A, CaV2.1; 1B,
␣1B, CaV2.2; 1C, ␣1C, CaV1.2; 1D, ␣1D, CaV1.3; 1E, ␣1E, CaV2.3; 1F, ␣1F,
CaV1.4; 1G, ␣1G, CaV3.1; 1H, ␣1H, CaV3.2; GAPDH, internal control. B and
C: real-time quantitative RT-PCR of CaV genes in 3T3-L1 and mouse primary
cultured preadipocytes. Expression levels of CaV channel genes in 3T3-L1
preadipocytes (B) and mouse primary cultured preadipocytes (C) were normalized to 18S ribosomal RNA levels. Note that ␣1G appears to mainly encode
for CaV in both 3T3-L1 preadipocytes and primary mouse preadipocytes.
Fig. 2. Effects of various types of Ca2⫹ channel blockers on ICa expressed in
3T3-L1 preadipocytes. Cells were held at ⫺100 mV, and command voltage pulses
to ⫹0 mV (400 ms in duration) were applied at 0.1 Hz. A–D: concentrationdependent inhibition of ICa by mibefradil (A and B) and Ni2⫹ (C and D). Original
current traces are shown in A and C, and the inhibitory effect of these agents on
the current amplitude measured at the peak is plotted against various concentrations of mibefradil (B) and Ni2⫹ (D). Data are shown as means ⫾ SE (n ⫽ 5) and
fit by a Michaelis-Menten simple bimolecular model: % inhibition ⫽ 100/{1 ⫹
(IC50 [mibefradil or Ni2⫹]⫺1)}, where IC50 is 50% inhibitory concentration for
drugs. The data were best fit with an IC50 value of 3 ␮M for mibefradil and 200
␮M for Ni2⫹. E: effects of NNC55-0396 (10 ␮M) on ICa. F: % inhibition of ICa
by various Ca2⫹ channel blockers: mibefradil (Mib, 10 ␮M), NNC55-0396 (NNC,
10 ␮M), SNX-482(SNX, 100 nM), ␻-agatoxin IVA (␻-agatoxin, 100 nM),
␻-conotoxin GVIA (␻-conotoxin, 500 nM), and nicardipine (10 ␮M). Note that
both mibefradil and NNC55-0396 significantly inhibited ICa. Data are shown as
means ⫾ SE (n ⫽ 5).
Isolation and culture of preadipocytes and adipocytes from mouse
white adipose tissue. Mouse primary cultured preadipocytes were
obtained from Primary Cell (Hokkaido, Japan). The isolation method
was similar to that in previous reports (1, 18). Briefly, isolated
epididymal white adipose tissue obtained from ICR mice at 2– 4 days
after birth was rinsed in collagenase solution. The mixture was then
allowed to digest with gentle shaking. The resulting cell suspension
was allowed to settle in order to separate into a supernatant containing
adipocytes and an inferior layer composed mainly of preadipocytes.
The primary cultured preadipocytes were used for later experiments.
The preadipocytes were then seeded in a plate (2.4 ⫻ 104 cells/plate)
in DMEM supplemented with 10% fetal calf serum containing penicillin (10 U/ml), streptomycin (10 ␮g/ml), (⫹)-biotin (33 ␮M),
pantothenic acid (17 ␮M), ascorbic acid (100 ␮M), octanoic acid (1
␮M), and 3,5,3=-triiodothyronine (T3; 50 nM). The medium was
replaced with differentiating medium consisting of the above medium
with dexamethasone (2.5 ␮M) and insulin (10 ␮g/ml). Under these
conditions, adipocyte differentiation occurred a few days later (7), and
differentiated adipocytes were maintained in the differentiation medium without dexamethasone. Full differentiation developed at 8 –10
days after induction of differentiation.
Solutions and drugs. The composition of control Tyrode solution
was as follows (in mM): 136.5 NaCl, 5.4 KCl, 1.8 CaCl2, 0.53 MgCl2,
5.5 glucose, and 5.5 HEPES-NaOH buffer (pH 7.4). To block K⫹
currents, the patch pipette contained (in mM) 140 CsCl, 10 EGTA, 2
MgCl2, 3 Na2ATP, 0.1 guanosine-5=-triphosphate (GTP, sodium salt;
Sigma), and 5 HEPES-CsOH buffer (pH 7.2). To increase the current
amplitude of voltage-gated Ca2⫹ current (ICa), 10 mM Ca2⫹ or 10
mM Ba2⫹ was applied to the bath solution. 4-Aminopyridine (4-AP,
4 mM), a KV blocker, and tetraethylammonium (2 mM), a Ca2⫹activated K⫹ current blocker, were added to the control Tyrode
solution. Various types of CaV blockers (mibefradil, NNC55-0396,
298 • JUNE 2010 •
www.ajpcell.org
The Animal Care and Use Committee of the University of Tokyo
approved the present study.
Cell culture of 3T3-L1 preadipocytes and adipocyte differentiation
method. 3T3-L1 preadipocytes were obtained from the Japanese
Collection of Research Bioresources (JCRB) Bank (Osaka, Japan) as
previously described (35). Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine
serum (FBS) containing 100 ␮g/ml penicillin and 100 ␮g/ml streptomycin. Cells were plated and grown until 2 days after confluence
and then induced to differentiate into adipocytes by change of the
culture medium to DMEM containing 0.5 mM methylisobutylxanthine, 0.25 ␮M dexamethasone, and 10 ␮g/ml insulin for 48 h (36).
With this protocol, ⬎95% of the cells were differentiated into the
adipocyte phenotype 3– 4 days after initiating differentiation. The
differentiated 3T3-L1 adipocytes were switched to fresh DMEM
containing 10% FBS.
Ca2⫹ equilibrium potential. ECa was obtained from the I-V curve,
where the I-V curve crossed over the zero line.
RNA extraction, reverse transcriptase-polymerase chain reaction,
and real-time quantitative reverse transcriptase-polymerase chain
reaction. Total cellular RNA was extracted from preadipocytes and
differentiated adipocytes with the RNeasy mini kit (Qiagen, Cambridge, MA). For reverse transcriptase-polymerase chain reaction
(RT-PCR), complementary DNA (cDNA) was synthesized from 1 ␮g
of total RNA with reverse transcriptase and random primers (Toyobo,
Osaka, Japan). The reaction mixture was then subjected to PCR
amplification with specific forward and reverse oligonucleotide primers for 35 cycles consisting of heat denaturation, annealing, and
extension. PCR products were size-fractionated on 2% agarose gels
and visualized under UV light. Primers were chosen on the basis of
the sequence of mouse ␣-subunit genes of CaV (␣1A–␣1H) as shown
in Table 1. Table 1 also shows the CaV protein created by each gene.
Fig. 4. CaV3.1 T-type CaV expression in 3T3-L1 preadipocytes, mouse primary cultured preadipocytes, and differentiated adipocytes. Aa: microscopic image of
3T3-L1 preadipocytes. Ab: staining (green) for CaV3.1 in 3T3-L1 preadipocyte. Double staining of nuclei with Hoechst 33258 to visualize nuclei and anti-CaV3.1
is illustrated. Ac: negative controls without the antibody (anti-␣1G) in 3T3-L1 preadipocytes. Cells were counterstained with Hoechst 33258 to visualize nuclei.
Ad: transfection of small interfering RNA (siRNA) for ␣1G mRNA. The transfected siRNA conjugated with rhodamine is visualized under fluorescent
microscopy. Ae: Oil Red O staining of differentiated 3T3-L1 adipocytes. Ba: staining (green) for CaV3.1 in mouse primary cultured preadipocyte. Bb: differential
interference contrast (DIC) image of mouse differentiated adipocytes. The differentiated adipocytes have lipid deposits. Af and Bc: staining (green) for CaV3.1
in differentiated 3T3-L1 adipocytes (Af) and mouse differentiated adipocytes (Bc). Scale bars, 50 ␮m.
298 • JUNE 2010 •
www.ajpcell.org
SNX-482, ␻-agatoxin IVA, ␻-conotoxin GVIA, diltiazem, and nicardipine) were obtained from Sigma. All experiments were performed at
room temperature (20 –25°C).
Recording technique and data analysis. Membrane currents were
recorded with tight-seal whole cell clamp techniques and a patchclamp amplifier (EPC-7, List Electronics, Darmstadt, Germany) as
previously described (14, 38). Steady-state inactivation was estimated
with a double-pulse protocol. Conditioning voltage pulses (500 ms in
duration) of various membrane potentials were applied from a holding
potential of ⫺100 mV. At 10 ms after the end of each conditioning
pulse, a test pulse of ⫹0 mV was applied. The ratio of ICa amplitude
with and without conditioning pulses was plotted against each conditioning voltage. From current-voltage (I-V) data, the steady-state
activation curve was derived by using the following equation: gCa ⫽
ICa/[(Vm ⫺ ECa)], where ICa is the peak current amplitude at each
membrane potential (Vm), gCa is the chord conductance, and ECa is the
C1417
C1418
and color development was allowed to proceed for 3 h at 37°C and 5%
CO2. Each plate was then read at an absorbance of 490 nm.
Flow cytometry. 3T3-L1 preadipocytes were plated at ⬃5,000
cells/cm2 onto 10-cm plates and allowed to sit for 2 nights in FBS-free
medium, and then cells were perfused into 5% FBS-containing medium in the presence or absence of CaV blockers. In siRNA experiments, cells treated with ␣1G siRNA and nonsilencing (negative
control) siRNAs were plated at ⬃5,000 cells/cm2 onto 10-cm plates
and allowed to sit for 24 h in FBS-free medium, and then cells were
perfused into 5% FBS-containing medium. Cell cycle data were
determined after 24-h treatment by flow cytometry in propidium
iodide-stained mouse 3T3-L1 preadipocytes.
Data analysis. All values are expressed as means ⫾ SE. Differences between multiple groups were compared by ANOVA. Twogroup analysis was performed with a Student’s t-test. Differences
were considered significant if P ⬍ 0.05.
RESULTS
T-type CaV in 3T3-L1 preadipocytes. Figure 1, A–C, show
ICa expressed in 3T3-L1 preadipocytes where the bath solution
contained 10 mM Ca2⫹. The cells were held at ⫺100 mV, and
command voltage pulses (400 ms in duration) were applied to
⫹0 mV. A fast transient inward current was elicited during the
depolarizing pulse. TTX (10 ␮M, Fig. 1Aa) or replacement of
extracellular Na⫹ with N-methyl-D-glucamine⫹ (data not
shown), an impermeant cation, did not affect the transient
inward current at all. However, mibefradil (30 ␮M, Fig. 1Aa),
a potent inhibitor of T- and L-type currents (24), but not
Fig. 5. Comparison of CaV3.1 protein expression between preadipocytes and
differentiated adipocytes. Western blot analysis shows the marked difference
of CaV3.1 protein expression between 3T3-L1 preadipocytes and differentiated
adipocytes (Aa) and between mouse primary cultured preadipocytes and
differentiated adipocytes (Ba). In Ab and Bb, the relative abundance of CaV3.1
protein between preadipocytes and differentiated adipocytes is compared. The
expression level of CaV3.1 protein was compared with that of ␤-actin, and the
expression level in 3T3-L1 and mouse primary cultured preadipocytes is
considered as 100%. Note that the expression level of CaV3.1 protein in
differentiated adipocytes significantly decreased compared with 3T3-L1 preadipocytes and mouse primary cultured preadipocytes. **P ⬍ 0.01 vs.
preadipocytes.
298 • JUNE 2010 •
www.ajpcell.org
Total RNA of mouse adult brain was used for positive control.
Real-time quantitative RT-PCR was performed with the use of realtime TaqMan technology and a sequence detector (ABI PRISM 7000,
Applied Biosystems, Foster City, CA) (22). Gene-specific primers and
TaqMan probes were used to analyze transcript abundance. The 18S
ribosomal RNA level was analyzed as an internal control and used to
normalize the values for transcript abundance of CaV family genes. The
probes used in this study were purchased as Assay-on-Demand from
Applied Biosystems: assay ID Mm00432190_ml for ␣1A ,
Mm00432226_ml for ␣1B, Mm00437917_ml for ␣1C, Mm00494444_ml
for ␣1E, Mm01299131_ml for ␣1G, Mm00445369_ml for ␣1H,
Mm01299033_ml for ␣1I, Mm01295675_ml for adipose protein 2 (aP2),
Mm00494477_ml for Pref-1, and 4310893E for 18S rRNA endogenous
control. We performed six independent experiments.
Oil Red O staining. Differentiated 3T3-L1 adipocytes were rinsed
in PBS before being fixed with 10% formaldehyde. Approximately 15
min after the fixation, Oil Red O stain was used to stain for lipid
accumulation (20 min). After being rinsed with distilled water, photomicrographs were taken with a digital camera to document staining.
Immunocytochemistry. Immunocytochemical analyses were performed on preadipocytes and differentiated adipocytes of 3T3-L1 and
mouse primary cultured preadipocytes with anti-CaV3.1 (Santa Cruz
Biotechnology, Santa Cruz, CA), a rabbit polyclonal antibody against
channel isoforms diluted to 1:100. The cells were cultured on Lab-Tek
Chamber Slide Glass (Nalge Nunc International, Naperville, IL), fixed
with 2% paraformaldehyde in PBS for 30 min, and then blocked for
10 min with 2% horse serum in PBS. The cells were incubated
overnight with the primary antibodies diluted with 0.1% Triton X-100
and 0.01% NaN3 in PBS. For negative controls, cells were treated
without antibody. Alexa Fluor 488-labeled donkey anti-rabbit IgG
antibody diluted 1:1,000 (Molecular Probes, A21206) was used to
visualize channel expression. The cells were also stained with Hoechst
33258 (Sigma Aldrich) to visualize nuclei. A confocal laser scanning
microscope (Olympus FluoView FV300, Olympus, Tokyo, Japan)
was used for observations.
Transfection of synthetic small interfering RNA. ␣1G siRNA and
nonsilencing (negative control) siRNAs as described in Table 1 were
purchased from Qiagen (Cambridge, MA). They were transfected into
3T3-L1 preadipocytes to a final concentration of 5 nM with Lipofectamine 2000 (5 ␮l/ml culture; Invitrogen) according to the instructions of the manufacturer. Transfected cells were incubated for 48 h in
an atmosphere of 5% CO2 and 95% air at 37°C before each experiment. Analysis of mRNA and protein by real-time RT-PCR and
Western blot was then performed. Rhodamine-conjugated siRNA was
used to confirm the transfection of siRNA with Nikon ECLIPSE
TE2000-u. The density of ICa and the effects of siRNA on cell cycle
were also investigated in the transfected cells.
Western blotting. Proteins were separated on a 7.5% polyacrylamide gel for 70 min at 200 V and then transferred to Amersham
Hybond-P (GE Healthcare UK, Little Chalfont, UK) for 75 min at 72
mA. The membrane was blocked with 3% skim milk in PBS (0.01 M
phosphate buffer, 0.138 M NaCl, 0.0027 M KCl, pH 7.4) with 0.1%
Tween 20 (PBS-T) for 1 h. It was probed with anti-CaV3.1 polyclonal
antibody diluted to 1:200 (Santa Cruz Biotechnology) and anti-␤-actin
monoclonal antibody (1:10,000; Sigma) overnight at 4°C, washed
three times in PBS-T for 15 min each, and subsequently incubated
with anti-rabbit IgG linked to peroxidase (Millipore) diluted to
1:1,000 with blocking buffer for 1 h at room temperature. After three
additional washes, bound antibodies were detected with Amersham
ECL-plus (GE Healthcare UK) and analyzed with an LAS-3000 mini
image analyzer (Fuji-Film, Tokyo, Japan).
Proliferation assay. Cell proliferation was assessed with the Cell
Titer 96 Aqueous kit (Promega, Madison, WI). The preadipocytes
were plated in 96-well plates (Becton Dickinson Labware, Franklin
Lakes, NJ) at a density of 8 ⫻ 104 cells/well with experimental media
with or without Ca2⫹ channel blockers. These plates were incubated
for 24 h, after which the tetrazolium salt and dye solution were added
Fig. 6. Effects of treatment with siRNA targeted for ␣1G on ICa expressed in
3T3-L1 preadipocytes. A: effects of siRNA targeted for ␣1G on expression
level of ␣1G mRNA. 3T3-L1 preadipocytes were treated with siRNA targeted
for ␣1G or control siRNA. Ba: Western blot analysis showing the effects of
siRNA on CaV3.1 protein expression. In Bb, the relative abundance of CaV3.1
protein in cells transfected with siRNA is compared with cells treated with
control siRNA. The expression level of CaV3.1 protein was compared with that
of ␤-actin. The expression level in cells transfected with control siRNA is
considered as 100%. Note that siRNA targeted for ␣1G decreased CaV3.1
protein expression in 3T3-L1 preadipocytes. C: current density of ICa in cells
transfected with noncoding control and ␣1G siRNA. Note that the current
density of ICa significantly decreased in siRNA-treated cells. **P ⬍ 0.01 vs.
control siRNA.
Fig. 7. A: comparison of the expression level of ␣1G, adipose protein 2 (aP2),
and Pref-1 mRNA between 3T3-L1 preadipocytes and differentiated adipocytes. B: comparison of the expression level of ␣1G, aP2, and Pref-1 mRNA
between mouse primary cultured preadipocytes and differentiated adipocytes.
Data are means ⫾ SE from 6 independent samples in A and B. The expression
level of aP2 mRNA notably increased in 3T3-L1 adipocytes and mouse
adipocytes, while the expression level of ␣1G and Pref-1 mRNA significantly
decreased during the differentiation. **P ⬍ 0.01 vs. preadipocytes.
obtained from the conductance and also fitted by Boltzmann
equation. The values of Vh and k were ⫺30.0 ⫾ 0.3 and
⫺7.3 ⫾ 0.3 (n ⫽ 5), respectively. The overlap of the steadystate activation and inactivation curves at potentials more
positive than ⫺50 mV determines the window currents.
Figure 2, A and B, shows the concentration-dependent effects of mibefradil on ICa. Mibefradil inhibited ICa with an IC50
value of 3 ␮M (Fig. 2B), and mibefradil at concentrations ⬎10
␮M nearly completely abolished ICa. Next, we investigated the
Ni2⫹ sensitivity of ICa (Fig. 2, C and D). Ni2⫹ concentrationdependently inhibited ICa, with an IC50 value of 200 ␮M, and
1 mM Ni2⫹ almost completely abolished it. Inhibitory effects
were also observed with NNC55-0396 (10 ␮M; Fig. 2E), a
selective inhibitor of T-type CaV (21, 37).
Furthermore, to determine which types of CaV are involved
in ICa expressed in 3T3-L1 preadipocytes, we examined responses to a test stimulus applied in the absence or presence of
various agents. The Ca2⫹ channel blockers used here were as
follows: mibefradil (10 ␮M), NNC55-0396 (10 ␮M), SNX-482
(a R-type Ca2⫹ channel blocker; 100 nM), ␻-agatoxin IVA (a
P-type Ca2⫹ channel blocker; 100 nM), ␻-conotoxin GVIA (a
N-type Ca2⫹ channel blocker; 500 nM), and nicardipine (10
␮M). The percent inhibition of various Ca2⫹ channel blockers
is illustrated in Fig. 2F. Mibefradil and NNC55-0396 inhibited
ICa by 91 ⫾ 3% and 67.7 ⫾ 4.6%, respectively, but nicardipine
inhibited it only by 3 ⫾ 1%. SNX-482, ␻-agatoxin IVA, and
␻-conotoxin GVIA were ineffective.
Dominant expression of CaV3.1 encoded by ␣1G mRNA in
3T3-L1 preadipocytes. We investigated the expression of
␣-subunit genes of CaV family members (␣1A–␣1H mRNA).
298 • JUNE 2010 •
www.ajpcell.org
nicardipine (1 ␮M, Fig. 1Ab), a potent L-type Ca2⫹ channel
blocker, completely abolished it. With replacement with 10
mM Ba2⫹ instead of Ca2⫹, the amplitude of the inward current
slightly decreased (Fig. 1Ac). In addition, 1 ␮M BAY K 8644
did not enhance it (data not shown), suggesting that highthreshold L-type CaV or voltage-gated Na⫹ channels do not
contribute to form the inward current expressed in 3T3-L1
preadipocytes but non-L-type CaV do form it.
Typical current data recorded at each membrane potential
and I-V relations measured at the peak of ICa are shown in Fig.
1, B and C. Cells were held at ⫺40 mV (Fig. 1Ba) or ⫺100 mV
(Fig. 1Bb) in the same cell. When the cell was held at ⫺100
mV, the transient inward currents were elicited at potentials
more positive than ⫺50 mV. The peak amplitude of ICa was
observed at approximately ⫺20 mV and reached zero at
potentials of approximately ⫹50 to ⫹60 mV. On the other
hand, ICa was not elicited during the depolarizing pulses at a
holding potential of ⫺40 mV. Figure 1D shows the steadystate inactivation curve for ICa. The inactivation data were
fitted to the following equation (Boltzmann equation) by using
least-squares methods: I(V)/Imax ⫽ 1/{1 ⫹ exp[(V ⫺ Vh)k⫺1]},
where V is the membrane potential in millivolts, Vh is the
membrane potential at half-maximum, and k is the slope factor.
The values of Vh and k were ⫺51.7 ⫾ 0.9 mV and 8.4 ⫾ 0.8
(n ⫽ 5), respectively. The steady-state activation curves were
C1419
C1420
(Fig. 6C; P ⬍ 0.01), compared with nonsilencing (negative
control) siRNA.
CaV in mouse primary cultured preadipocytes. Expression of
␣-subunit genes of CaV family members (␣1A–␣1I) was also
investigated by real-time quantitative RT-PCR (Fig. 3C) in
mouse primary cultured preadipocytes, and ␣1G appeared to
encode for ␣-subunit gene of CaV in a similar way to that in
mouse 3T3-L1 preadipocytes. Expression of CaV protein was
confirmed by immunostaining (Fig. 4Ba) and Western blot
analysis using anti-CaV3.1 (Fig. 5, Ba and Bb), which was
similar to 3T3-L1 preadipocytes. The cells were also counterstained with Hoechst 33258 to visualize nuclei, and the double
staining of nucleus and CaV3.1 is shown in Fig. 4Ba.
Comparison of ␣1G mRNA expression between preadipocytes and differentiated adipocytes. We examined the effects of
differentiation on ␣1G mRNA expression in both 3T-L1 preadipocytes and mouse primary cultured preadipocytes. After
differentiation, lipid accumulation stained by Oil Red O stain
could be observed in 3T3-L1 cells (Fig. 4Ae). Similarly, lipid
accumulation was observed in differentiated mouse adipocytes
(Fig. 4Bb). Figure 7 compares the expression levels of ␣1G and
aP2 mRNA, a differentiated marker gene of adipocyte, in both
cell types. The expression level of aP2 mRNA was notably
increased in 3T3-L1 adipocytes and mouse adipocytes, while
the expression level of ␣1G mRNA was significantly decreased
during the differentiation. In addition, the mRNA expression
level of Pref-1 (also known as DLK-1), a marker of preadipocytes, was significantly high in both preadipocytes (Fig. 7).
Similarly, Western blot analyses showed that the protein expression level of CaV3.1 in adipocytes was significantly decreased compared with 3T3-L1 preadipocytes (P ⬍ 0.01, n ⫽
4; Fig. 5, Aa and Ab) and mouse preadipocytes (P ⬍ 0.01, n ⫽
Fig. 8. Effects of Ca2⫹ channel blockers on
cell proliferation and cell cycle in 3T3-L1
preadipocytes. Aa and Ab: effects of diltiazem,
nicardipine, and mibefradil (10 ␮M; Aa), and
NNC55-0396 (1–10 ␮M; Ab) on cell proliferation. Note that cell proliferation was significantly inhibited by mibefradil and NNC550396, but not diltiazem and nicardipine. Data
were obtained from 5–7 experiments. *P ⬍
0.05 vs. control. B and C: effects of NNC550396 and diltiazem on cell cycle analyzed by
flow cytometry. Serum-deprived cells were
again treated with 5% FBS culture medium in
the absence or presence of these drugs for 24 h
and analyzed by flow cytometry. Representative data obtained from 3 experiments are
shown in the absence and presence of
NNC55– 039 (10 ␮M; B) and diltiazem (10
␮M; C). D: summary data showing % of cells
in G0/G1, S, and G2/M. Groups: 5% FBS
(control), 5% FBS with NNC55-0396 10 ␮M,
5% FBS with 10 ␮M diltiazem. Treatment
with NNC55-0396 showed a much smaller
proportion of cells entering S and G2/M and a
much higher proportion arrested in G0/G1,
while diltiazem did not mimic the effects of
NNC55-0396. **P ⬍ 0.01.
298 • JUNE 2010 •
www.ajpcell.org
By RT-PCR analysis, the transcripts of ␣1A, ␣1B, ␣1C, ␣1E,
␣1G, and ␣1H were detected (Fig. 3A) and the transcripts of ␣1D
and ␣1F were not detected compared with control mouse brain.
The amplitude of cDNA fragments was of predicted molecular
size, identical to cDNA fragments amplified from reversely
transcripted mRNA. Expression of CaV family members was
also investigated by real-time quantitative RT-PCR (Fig. 3B).
Transcript levels were normalized to 18S ribosomal housekeeping gene. Thus ␣1G appeared to dominantly encode for
␣-subunit gene of CaV in 3T3-L1 preadipocytes.
Expression of CaV3.1 protein was confirmed by immunostaining (Fig. 4Ab) and Western blots using anti-CaV3.1 (Fig. 5, Aa and
Ab) in 3T3-L1 preadipocytes. The cells were also counterstained
with Hoechst 33258 to visualize nuclei, and the double staining of
nucleus and CaV3.1 is shown in Fig. 4Ab. No expression was
detected in negative controls without the antibody (Fig. 4Ac).
We next investigated the effects of siRNA for ␣1G. Transfection of siRNA conjugated with rhodamine was confirmed by
fluorescent microscopy (Fig. 4Ad). After siRNA treatment the
inhibitory effect on ␣1G mRNA expression was analyzed by
real-time RT-PCR. The expression level of ␣1G mRNA in
3T3-L1 preadipocytes transfected with siRNA was significantly decreased compared with nonsilencing (negative control) siRNA (Fig. 6A; P ⬍ 0.01, n ⫽ 6). Western blot analysis
showed that the protein expression level of CaV3.1 in 3T3-L1
preadipocytes transfected with siRNA was also decreased compared with nonsilencing (negative control) siRNA (P ⬍ 0.01,
n ⫽ 3; Fig. 6, Ba and Bb). Next, ICa was recorded with
tight-seal whole cell clamp techniques in the transfected cells
(20 cells, siRNA for ␣1G and negative control, respectively).
The current density of ICa adjusted by cell capacitance was
significantly reduced in cells transfected with siRNA for ␣1G
Fig. 9. Effects of siRNA targeted for ␣1G mRNA on cell proliferation and cell
cycle in 3T3-L1 preadipocytes. A: effects of siRNA targeted for ␣1G on cell
proliferation. Note that cell proliferation was significantly inhibited by siRNA.
Data were obtained from 5–7 experiments. *P ⬍ 0.05 vs. control siRNA.
B: effects of siRNA targeted for ␣1G mRNA on cell cycle analyzed by flow
cytometry in 3T3-L1 preadipocytes. In B, siRNA-loaded cells were serum
deprived for 24 h, and cells were again treated with 5% FBS-containing culture
medium for 24 h and analyzed by flow cytometry. Representative data obtained
from 3 experiments are shown for cells treated with siRNA targeted for ␣1G
and control siRNA. C: summary data showing % of cells in G0/G1, S, and
G2/M. *P ⬍ 0.05, **P ⬍ 0.01 vs. control siRNA.
ative control) siRNA-treated cells (Fig. 9, Bb and C), cells
treated with siRNA targeted for ␣1G mRNA showed a much
smaller proportion of cells entering G2/M and a much higher
proportion arrested in G0/G1 in the presence of FBS (Fig. 9, Ba
and C). On the other hand, siRNA did not affect the cell cycle
in the absence of FBS (data not shown). Thus it is likely that
siRNA targeted for ␣1G mRNA inhibited cell cycle entry/
progression, but not because of toxic effects.
DISCUSSION
The major findings of the present study are as follows. 1) T-type
Ca2⫹ channel encoded by ␣1G subtype, blocked by mibefradil,
Ni2⫹, NNC55-0396, and siRNA for ␣1G, was the dominant
CaV in mouse 3T3-L1 preadipocytes. 2) RT-PCR, Western
blot, and immunohistochemical analysis also showed the dominant expression of CaV3.1 T-type CaV in mouse primary cultured
preadipocytes as well as 3T3-L1 preadipocytes. 3) The expression level of CaV3.1 encoded by ␣1G was significantly downregulated in differentiated adipocytes by decreasing the transcription level. 4) Mibefradil, NNC55-0396, but not diltiazem,
and siRNA for ␣1G inhibited cell proliferation in response to
serum. NNC55-0396 and siRNA for ␣1G inhibited cell cycle
entry/progression. These results demonstrate for the first
time that the T-type Ca2⫹ channel encoded by ␣1G subtype
is the dominant CaV in mouse preadipocytes and plays a role
in the regulation of their proliferation.
CaV are ubiquitously expressed in various cell types and
play vital roles in regulation of cellular functions such as
proliferation. The existence of CaV has also been described in
preadipocytes and adipocytes (4, 5, 10, 32), but the molecular
identities and function of CaV remained quite unexplored.
Recently, Diaz-Velasquez et al. (8) showed the presence of
␣1G-subtype T-type CaV in 3T3-F442A preadipocytes, a subclone of 3T3 Swiss mouse embryo fibroblasts (11, 12), by
using RT-PCR analysis and immunohistochemical studies. The
present study showed the presence of CaV in mouse 3T3-L1
preadipocytes by using patch-clamp experiments. Mibefradil, a
T- and L-type Ca2⫹ channel blocker (24), inhibited it with an
IC50 value of 3 ␮M, and NNC55-0396, a selective T-type Ca2⫹
channel blocker (21, 37), also inhibited it. Also, the other Ca2⫹
channel blockers, SNX-482, ␻-agatoxin IVA, ␻-conotoxin
GVIA, and nicardipine, were less or only a little effective to
inhibit CaV, compared with mibefradil or NNC55-0396. Ni2⫹
inhibited it with an IC50 value of 200 ␮M. In a heterologous
expression system, the ␣1H subtype has been reported to
exhibit a greater sensitivity to inhibition by NiCl2 (IC50 ⬃10
␮M) than either the ␣1G or ␣1I subtype (IC50 ⬃200 –300 ␮M)
(23, 27). Thus, from the sensitivity to Ni2⫹ and the other Ca2⫹
channel blockers, it is likely that T-type Ca2⫹ channel encoded
by ␣1G subtype was the dominant CaV in 3T3-L1 preadipocytes. These results were supported by RT-PCR analysis,
immunohistochemical studies, and Western blot analysis. The
dominant expression of ␣1G mRNA was detected by conventional/quantitative real-time RT-PCR among ␣-subunits of CaV
transcripts (␣1A–␣1I), and the expression of CaV3.1 protein
encoded by ␣1G gene was detected by immunohistochemical
studies and Western blot analysis. In addition, siRNA targeted
for ␣1G markedly inhibited CaV expressed in 3T3-L1 preadipocytes.
298 • JUNE 2010 •
www.ajpcell.org
4; Fig. 5, Ba and Bb). Immunohistochemical staining using
anti-CaV3.1 showed the expression of ␣1G in both differentiated 3T3-L1 adipocytes (Fig. 4Af) and mouse differentiated
adipocytes (Fig. 4Bc), but compared with preadipocytes, weak
staining or no staining was observed in both differentiated
adipocytes.
T-type CaV blockers and siRNA for ␣1G mRNA inhibit cell
proliferation in 3T3-L1 preadipocytes. Figure 8 shows the
effects of various Ca2⫹ channel blockers on cell proliferation
and cell cycle in 3T3-L1 preadipocytes. Mibefradil (10 ␮M;
Fig. 8Aa) and NNC55-0396 (1–10 ␮M; Fig. 8Ab) significantly
inhibited cell proliferation in response to FBS, while diltiazem
and nicardipine (10 ␮M; Fig. 8Aa) had little effect. In addition,
we investigated the effects of NNC55-0396 (Fig. 8B) and
diltiazem (Fig. 8C) on cell cycle. Cells were treated in the
absence or presence of these drugs for 24 h and analyzed by
flow cytometry. Treatment with NNC55-0396 (10 ␮M; Fig. 8,
B and D) showed a smaller proportion of cells entering S and
G2/M and a higher proportion arrested in G0/G1, while diltiazem [10 ␮M (Fig. 8, C and D) and 30 ␮M (data not shown)]
did not mimic the effects of NNC55-0396. The effects of
siRNA targeted for ␣1G mRNA on cell proliferation and cell
cycle in the response to serum were also investigated. As
shown in Fig. 9A, siRNA targeted for ␣1G mRNA significantly
inhibited cell proliferation in response to FBS compared with
control siRNA. In addition, compared with nonsilencing (neg-
C1421
C1422
thereby promoting a steady-state calcium entry. Consistent
with a role for CaV3.1 in controlling the cell cycle, similar
effects on proliferation have been reported in cultured human
pulmonary arterial cells and also in nonexcitable cells such as
tumor cells (28, 34). Thus it is very likely that T-type Ca2⫹
channels play a role in regulating [Ca2⫹]i, and subsequently
preadipocyte proliferation.
Recent in vivo studies have shown that mice lacking Cav3.1
T-type CaV or mice treated with TTA-A2, a selective T-type
CaV blockade, are resistant to high-fat diet-induced weight
gain and fat increase and exhibit improved body composition
(39). These effects likely result from better alignment of
diurnal feeding patterns with daily changes in circadian physiology, although the involvement of T-type CaV on adipose
tissues has not been investigated. The present study showed
that the T-type Ca2⫹ channel plays a role in the regulation of
cell proliferation in mouse preadipocytes. Thus T-type Ca2⫹
channel blockers appear to be interesting new drugs for obesity.
In conclusion, the present study demonstrates that the T-type
Ca2⫹ channel encoded by ␣1G subtype is the dominant CaV in
mouse preadipocytes and plays a role in the regulation of their
proliferation, a key step in adipose tissue development.
ACKNOWLEDGMENTS
We thank Hiroyuki Imuta and Takaaki Hasegawa for help with the experiments.
GRANTS
This study was supported by Grants-in-Aid for Scientific Research of Japan
to T. Nakajima.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the author(s).
REFERENCES
1. Ailhaud G, Grimaldi P, Négrel R. Cellular and molecular aspects of
adipose tissue development. Annu Rev Nutr 12: 207–233, 1992.
2. Bays HE. “Sick fat,” metabolic disease, atherosclerosis. Am J Med 122:
S26 –S37, 2009.
3. Bootman MD, Lipp P, Berridge MJ. The organization and functions of
local Ca2⫹ signals. J Cell Sci 114: 2213–2222, 2001.
4. Byyny RL, LoVerde M, Lloyd S, Mitchell W, Draznin B. Cytosolic
calcium and insulin resistance in elderly patients with essential hypertension. Am J Hypertens 5: 459 –464, 1992.
5. Chen CF, Corbley MJ, Roberts TM, Hess P. Voltage-sensitive calcium
channels in normal and transformed 3T3 fibroblasts. Science 239: 1024 –
1026, 1988.
6. Cho E, Manson JE, Stampfer MJ, Solomon CG, Colditz GA, Speizer
FE, Willett WC, Hu FB. A prospective study of obesity and risk of
coronary heart disease among diabetic women. Diabetes Care 25: 1142–
1148, 2002.
7. Deslex S, Negrel R, Ailhaud G. Development of a chemically defined
serum-free medium for differentiation of rat adipose precursor cells. Exp
Cell Res 168: 15–30, 1987.
8. Diaz-Velasquez CE, Castro-Muñozledo F, Kuri-Harcuch W. Staurosporine rapidly commits 3T3-F442A cells to the formation of adipocytes
by activation of GSK-3beta and mobilization of calcium. J Cell Biochem
105: 147–157, 2008.
9. Gaur S, Morton ME, Frick GP, Goodman HM. Growth hormone
regulates the distribution of L-type calcium channels in rat adipocyte
membranes. Am J Physiol Cell Physiol 275: C505–C514, 1998.
10. Gaur S, Yamaguchi H, Goodman HM. Growth hormone regulates
cytosolic free calcium in rat fat cells by maintaining L-type calcium
channels. Am J Physiol Cell Physiol 270: C1478 –C1484, 1996.
11. Green H, Kehinde O. Spontaneous heritable changes leading to increased
adipose conversion in 3T3 cells. Cell 7: 105–113, 1976.
298 • JUNE 2010 •
www.ajpcell.org
The present study also provides the first evidence showing
the expression of CaV transcripts in mouse primary cultured
preadipocytes as well as 3T3-L1 preadipocytes. The dominant
expression of ␣1G mRNA was detected by conventional/quantitative real-time RT-PCR among CaV transcripts (␣1A–␣1I),
and the expression of CaV3.1 protein encoded by ␣1G gene was
detected by immunohistochemical studies and Western blot
analysis in both mouse preadipocytes. In addition, the protein
level of Cav3.1 encoded by ␣1G mRNA was significantly
downregulated in differentiated adipocytes by decreasing the
transcription level. Thus T-type Ca2⫹ channel encoded by ␣1G
subtype does not appear to function in mature white adipocytes, but alternatively it seems to play a vital role in the
function of mouse preadipocytes. However, in contrast with the
data of immunohistochemical studies and Western blot analysis, we have not been able to detect the obvious T-type CaV by
patch-clamp experiments. Probably T-type CaV in mouse primary cultured preadipocytes may be very small for detection.
Alternatively, it may be quickly decreased or run down under
the culture conditions. Therefore, further studies using freshly
isolated preadipocytes are needed to clarify the existence of
T-type CaV in mouse preadipocytes.
Diaz-Velasquez et al. (8) reported that T-type CaV may be
involved in adipocyte differentiation, where mibefradil and
Ni2⫹ partially inhibited staurosporine-induced preadipocyte
conversion to adipocytes. They proposed that Ca2⫹ mobilization by at least T-type CaV is involved in adipocyte differentiation, where GSK3␤ activation depends on transient increase
in [Ca2⫹]i (13, 16). Proliferation of preadipocytes is also an
important key step in adipose tissue development since it
conditions the number of potential new adipocytes in the
adipose tissue. Electrophysiological studies have shown the
expression of K⫹ channels in isolated cultured brown fat cells
from neonatal rats and human preadipocytes, which may control membrane potential and then cellular proliferation and
differentiation of preadipocytes. Hu et al. (20) reported that K⫹
channel blockers inhibited human preadipocyte proliferation
by accumulating cells at G0/G1 and reducing S-phase population. In the present study, we showed that mibefradil inhibited
3T3-L1 proliferation in response to serum, while diltiazem and
nicardipine were less effective. We also investigated the effects
of NNC55-0396, a selective T-type Ca2⫹ channel blocker (21,
37), on cell proliferation and cell cycle. NNC55-0396 inhibited
T-type CaV expressed in 3T3-L1 preadipocytes and significantly suppressed cell proliferation, by inhibiting cell cycle
entry with accumulating cells at G0/G1 and reducing S- and
G2/M-phase population. Similarly, siRNA targeted for ␣1G
inhibited cell proliferation and reduced G0/G1-phase population in response to serum. However, siRNA also appears to
inhibit progression of S phase into G2/M phase. The reason for
the difference between NNC55-0396 and siRNA remains unclear, but the additional, nonspecific action of NNC55-0396 or
the toxic effects of siRNA cannot be ruled out in this study.
Further studies are needed to clarify the involvement of T-type
CaV in the cell cycle. However, the present study showed that
T-type CaV encoded by ␣1G subtype appears to play a role in
the regulation of cell cycle entry/progression, and subsequently
cell proliferation, in mouse preadipocytes. T-type Ca2⫹ channels may play a vital role in proliferation when activated by
transient membrane depolarization or when they are open at
resting membrane potentials as judged from window current,
26. Lory P, Bidaud I, Chemin J. T-type calcium channels in differentiation
and proliferation. Cell Calcium 40: 135–146, 2006.
27. Monteil A, Chemin J, Bourinet E, Mennessier G, Lory P, Nargeot J.
Molecular and functional properties of the human alpha1G subunit that
forms T-type calcium channels. J Biol Chem 275: 6090 –6100, 2000.
28. Panner A, Cribbs LL, Zainelli GM, Origitano TC, Singh S, Wurster
RD. Variation of T-type calcium channel protein expression affects cell
division of cultured tumor cells. Cell Calcium 37: 105–119, 2005.
29. Panner A, Wurster RD. T-type calcium channels and tumor proliferation. Cell Calcium 40: 253–259, 2006.
30. Pappone PA, Ortiz-Miranda SI. Blockers of voltage-gated K channels
inhibit proliferation of cultured brown fat cells. Am J Physiol Cell Physiol
264: C1014 –C1019, 1993.
31. Pardo LA. Voltage-gated potassium channels in cell proliferation. Physiology (Bethesda) 19: 285–292, 2004.
32. Peres A, Sturani E, Zippel R. Voltage-dependent calcium current in
adherent mouse 3T3 fibroblasts. Exp Cell Res 180: 585–590, 1989.
33. Rexrode KM, Carey VJ, Hennekens CH, Walters EE, Colditz GA,
Stampfer MJ, Willett WC, Manson JE. Abdominal adiposity and
coronary heart disease in women. JAMA 280: 1843–1848, 1998.
34. Rodman DM, Reese K, Harral J, Fouty B, Wu S, West J, Hoedt-Miller
M, Tada Y, Li KX, Cool C, Fagan K, Cribbs L. Low-voltage-activated
(T-type) calcium channels control proliferation of human pulmonary
artery myocytes. Circ Res 96: 864 –872, 2005.
35. Shi H, Halvorsen YD, Ellis PN, Wilkison WO, Zemel MB. Role of
intracellular calcium in human adipocyte differentiation. Physiol Genomics 3: 75–82, 2000.
36. Student AK, Hsu RY, Lane MD. Induction of fatty acid synthetase
synthesis in differentiating 3T3-L1 preadipocytes. J Biol Chem 255:
4745–4750, 1980.
37. Taylor JT, Huang L, Pottle JE, Liu K, Yang Y, Zeng X, Keyser BM,
Agrawal KC, Hansen JB, Li M. Selective blockade of T-type Ca2⫹
channels suppresses human breast cancer cell proliferation. Cancer Lett
267: 116 –124, 2008.
38. Terasawa K, Nakajima T, Iida H, Iwasawa K, Oonuma H, Jo T,
Morita T, Nakamura F, Fujimori Y, Toyo-oka T, Nagai R. Nonselective cation currents regulate membrane potential of rabbit coronary arterial
cell: modulation by lysophosphatidylcholine. Circulation 106: 3111–
3119, 2002.
39. Uebele VN, Gotter AL, Nuss CE, Kraus RL, Doran SM, Garson SL,
Reiss DR, Li Y, Barrow JC, Reger TS, Yang ZQ, Ballard JE, Tang C,
Metzger JM, Wang SP, Koblan KS, Renger JJ. Antagonism of T-type
calcium channels inhibits high-fat diet-induced weight gain in mice. J Clin
Invest 119: 1659 –1667, 2009.
40. Wonderlin WF, Strobl JS. Potassium channels, proliferation and G1
progression. J Membr Biol 154: 91–107, 1996.
298 • JUNE 2010 •
www.ajpcell.org
12. Green H, Kehinde O. Formation of normally differentiated subcutaneous
fat pads by an established preadipose cell line. J Cell Physiol 101:
169 –171, 1979.
13. Grimes CA, Jope RS. The multifaceted roles of glycogen synthase kinase
3beta in cellular signaling. Prog Neurobiol 65: 391–426, 2001.
14. Hamill P, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved
patch-clamp techniques for high-resolution current recording from cells
and cell-free membrane patches. Pflügers Arch 391: 85–100, 1981.
15. Harkins JM, Moustaid-Moussa N, Chung YJ, Penner KM, Pestka JJ,
North CM, Claycombe KJ. Expression of interleukin-6 is greater in
preadipocytes than in adipocytes of 3T3-L1 cells and C57BL/6J and ob/ob
mice. J Nutr 134: 2673–2677, 2004.
16. Hartigan JA, Johnson GV. Transient increases in intracellular calcium
result in prolonged site-selective increases in Tau phosphorylation through
a glycogen synthase kinase 3beta-dependent pathway. J Biol Chem 274:
21395–21401, 1999.
17. Hausman DB, DiGirolamo M, Bartness TJ, Hausman GJ, Martin RJ.
The biology of white adipocyte proliferation. Obes Rev 2: 239 –254, 2001.
18. Hausman DB, Park HJ, Hausman GJ. Isolation and culture of preadipocytes from rodent white adipose tissue. Methods Mol Biol 456: 201–
219, 2008.
19. Hirsch J, Fried SK, Edens NK, Leibel RL. The fat cell. Med Clin North
Am 73: 83–96, 1989.
20. Hu H, He ML, Tao R, Sun HY, Hu R, Zang WJ, Yuan BX, Lau CP,
Tse HF, Li GR. Characterization of ion channels in human preadipocytes.
J Cell Physiol 218: 427–435, 2009.
21. Huang L, Keyser BM, Tagmose TM, Hansen JB, Taylor JT, Zhuang
H, Zhang M, Ragsdale DS, Li M. NNC 55-0396 [(1S,2S)-2-(2-(N-[(3benzimidazol-2-yl)propyl]-N-methylamino)ethyl)-6-fluoro-1,2,3,4tetrahydro-1-isopropyl-2-naphtyl cyclopropanecarboxylate dihydrochloride]: a new selective inhibitor of T-type calcium channels. J Pharmacol
Exp Ther 309: 193–199, 2004.
22. Jo T, Nagata T, Iida H, Imuta H, Iwasawa K, Ma J, Hara K, Omata
M, Nagai R, Takizawa H, Nagase T, Nakajima T. Voltage-gated
sodium channel expressed in cultured human smooth muscle cells: involvement of SCN9A. FEBS Lett 567: 339 –343, 2004.
23. Lee JH, Gomora JC, Cribbs LL, Perez-Reyes E. Nickel block of three
cloned T-type calcium channels: low concentrations selectively block
alpha1H. Biophys J 77: 3034 –3042, 1999.
24. Leuranguer V, Mangoni ME, Nargeot J, Richard S. Inhibition of
T-type and L-type calcium channels by mibefradil: physiologic and
pharmacologic bases of cardiovascular effects. J Cardiovasc Pharmacol
37: 649 –661, 2001.
25. Li TY, Rana JS, Manson JE, Willett WC, Stampfer MJ, Colditz GA,
Rexrode KM, Hu FB. Obesity as compared with physical activity in
predicting risk of coronary heart disease in women. Circulation 113:
499 –506, 2006.
C1423

Involvement of CaV3.1 T-type calcium channels in

Transcription

Similar documents

Connected infrastructure for the transportation of the future

pdf brochure setup.cdr

1st Air Cav`s 2-227 `Lobos` host cancer awareness run

On-post lifeguards test skills, compete

Will you make it past February 18?

newsletter-2016-june - Cavendish Road State High School

airmobile - 5th Battalion 7th Cavalry Association

Differential Expression of gas and gadd Genes at