Physiological functions of mycobacterial outer membrane

Transcription

Als Dissertation genehmigt
Physiological functions of mycobacterial
outer membrane channel proteins
von der Naturwissenschaftlichen Fakultät
der Universität Erlangen-Nürnberg
Der Naturwissenschaftlichen Fakultät
der Friedrich-Alexander-Universität Erlangen-Nürnberg
zur
Erlangung des Doktorgrades
vorgelegt von
Frank Wolschendorf
aus Grobengereuth / Thüringen
(geb. in Pößneck)
Tag der mündlichen Prüfung:
12. Dezember 2008
Vorsitzender der Promotionskommission:
Prof. Dr. Eberhard Bänsch
Erstbericherstatter:
Prof. Dr. Wolfgang Hillen
Zweitberichterstatter:
Prof. Dr. Michael Niederweis
und:
Prof. Dr. Mary Jackson
Danke / Thanks
Mein besonderer Dank gilt Prof. Dr. Michael Niederweis für die Vergabe dieses
Projektes, die ausgezeichnete Betreuung, seinen wissenschaftlichen Rat, seine ständige
Diskussionsbereitschaft und die hervorragenden Arbeitsbedingungen. Insbesondere die
meinen Eltern Martin und Beate,
meinen Großeltern Paul und Annerose,
Etablierung des „mycolabs“ an der „University of Alabama at Birmingham“ war eine
großartige und bereichernde Erfahrung und ich danke ihm für sein Vertrauen.
sowie meinem Großvater Günther Wolschendorf
Ich bedanke mich auch recht herzlich bei Herrn Prof. Dr. Wolfgang Hillen, der meine
Promotion an der Naturwissenschaftlichen Fakultät der Friedrich-Alexander Universität
Erlangen-Nürnberg ermöglichte und unterstützte.
Ferner danke ich den Professoren Dr. W. Hillen, Dr. M. Niederweis, Dr. M. Jackson, Dr.
C. Koch und Dr. G. Kreimer entsprechend für die Erstellung der Gutachten und die
Übernahme der Prüfungspflichten.
I thank my former roommates and colleagues Hoffi, Jenni, Kristin, Elli and Didi for an
unforgetable experience in Sweet Home Alabama. I am very thankful to Tobi for being
so reliable in taking care of all the “dirty” things in the labratory. I have to thank
Jonathan, Yoitsna, Veneet, Shveta and Jennifer for the excellent technical support by
preparing media, buffers and countless other things. I also thank iron-Chris, attB-Jason,
nitrate-Rachel, in-your-a..(peep)-Axel, robot-Ryan, nano-Mikhail, drug-Olga, Houhui the
Great and oracle-guru Ying for making the “mycolab” the most awesome, brisky and
fittest tubercle-lab in the world. 
Von ganzem Herzen bedanke ich mich bei meinen Eltern Martin & Beate sowie meinen
Großeltern Paul & Annerose, die mich all die Jahre so großartig unterstützten und auf
die ich mich immer verlassen konnte. Mein Dank geht auch an meine Großmutter
Hermine und meinen Großvater Günther, an den ich mich gern zurückerinnere.
Inmitten der Schwierigkeiten
liegt die Möglichkeit.
(Albert Einstein)
Der ganzen Familie danke ich für die vielen schönen Stunden am Telefon und all die
Karten
und
„Hilfs“-Packete,
Überraschungseier sind der Hit!
über
die
ich
mich
immer
sehr
gefreut
habe.
Index
v
1. Zusammenfassung .........................................................................................1
1. Summary .........................................................................................................2
Index
vi
4.1.2. Plasmids .....................................................................................................................................20
4.1.3. Oligonucleotides .........................................................................................................................22
4.1.4. Antibodies...................................................................................................................................22
4.1.5. Peptide library.............................................................................................................................23
2. Introduction .....................................................................................................3
4.2. Methods ............................................................................................................... 24
2.1. The genus Mycobacterium..................................................................................... 3
4.2.1. Standard protocols .....................................................................................................................24
2.1.1. Taxonomy.................................................................................................................................... 3
4.2.2. Growth conditions.......................................................................................................................25
2.1.2. Evolutionary pathway of the tubercle bacilli ................................................................................. 3
4.2.3. Cloning of deletion vectors .........................................................................................................26
2.1.3. Medical relevance of mycobacteria ............................................................................................. 4
4.2.4. Protocol for gene deletions in mycobacteria ...............................................................................28
2.2. The mycobacterial outer membrane and its proteins ............................................. 5
2.2.1. Transport processes across mycobacterial outer membranes .................................................... 6
2.2.2. Porin mediated diffusion of hydrophilic solutes in M. smegmatis................................................. 7
4.2.5. Induction of gene expression by acetamide in M. smegmatis.....................................................29
5. Results...........................................................................................................31
5.1. Phosphates can diffuse through the MspA channel............................................. 31
2.2.3. The role of M. tuberculosis OmpA in outer membrane permeability ............................................ 8
2.2.4. A proteome-wide screen for outer membrane proteins of M. tuberculosis................................... 9
2.2.5. Rv1698 of M. tuberculosis is a channel-forming outer membrane protein ..................................10
2.3. Uptake of phosphates by mycobacteria ............................................................... 11
2.4. Copper metabolism in mycobacteria.................................................................... 12
2.4.1. Metabolic requirements for copper .............................................................................................12
2.4.2. Cytochrome c oxidase of M. tuberculosis ...................................................................................12
2.4.3. Mycobacterial superoxide dismutase..........................................................................................13
2.4.4. Copper toxicity............................................................................................................................14
2.5. Copper transport mechanisms in bacteria ........................................................... 15
5.2. Porin-mediated membrane permeability of phosphates in M. smegmatis ........... 32
5.3. A new generation of gene deletion systems for mycobacteria............................. 41
5.3.1. Construction of a new suicide deletion vector for M. smegmatis. ...............................................43
5.3.2. A new general gene deletion system for mycobacteria ..............................................................43
5.3.3. The introduction of reporter genes into conditionally-replicating deletion vectors.......................44
5.4. Rv1698 homologs in mycobacteria ...................................................................... 45
5.5. Deletion of putative outer membrane proteins in mycobacteria ........................... 46
5.5.1. Gene deletion protocol for mycobacteria ....................................................................................46
5.5.2. Deletion strategy for rv1698 / msm_3747 ...................................................................................63
2.5.1. Gram-positive bacteria................................................................................................................15
5.5.3. Deletion of msm_3747 in M. smegmatis.....................................................................................65
2.5.2. Gram-negative bacteria ..............................................................................................................15
5.5.4. Deletion of rv1698 in M. tuberculosis..........................................................................................67
2.5.3. Mycobacteria ..............................................................................................................................16
2.6. Gene deletions by allelic exchange in mycobacteria ........................................... 17
3. Aims of this thesis ........................................................................................19
Part 1: The role of MspA in uptake of inorganic ions .................................................. 19
Part 2: The physiological role of the outer membrane channel protein Rv1698 in
M. tuberculosis ............................................................................................................ 19
4. Materials and Methods .................................................................................20
5.6 The role of MctB in mycobacteria.......................................................................... 69
5.7. Surface accessibility of Rv1698 (MctB) by proteinase K...................................... 85
5.8. MctB is exported in a folded conformation ........................................................... 86
5.9. MctB in whole cells is not accessible to polyclonal antibodies............................. 87
5.10. Monoclonal antibodies against MctB.................................................................. 88
5.10.1. Specificity of monoclonal antibodies .........................................................................................89
5.10.2. Epitope mapping.......................................................................................................................90
5.10.3. Cross-reactivity of hybridoma clone 5D1.23 .............................................................................91
4.1. Material ................................................................................................................ 20
4.1.1. Bacterial strains ..........................................................................................................................20
Index
vii
6. Discussion.....................................................................................................93
6.1. The physiological function of Rv1698 and its homologs. ..................................... 93
6.2. The response of M. tuberculosis to elevated copper levels ................................. 94
6.3. Copper as a defense mechanism against M. tuberculosis in macrophages. ....... 96
6.4. Copper homeostasis in M. tuberculosis ............................................................... 97
7. Conclusions. ...............................................................................................100
8. Authors’ contribution .................................................................................101
Zusammenfassung
1
1. Zusammenfassung
Mykobakterien sind von großer Bedeutung, da Tuberkulose die weltweit verbreitetste
Infektionskrankheit mit 1.7 Millionen Todesopfern darstellt. Die außergewöhnlich
niedrige Durchlässigkeit der mykobakteriellen äußeren Membran gilt als Hauptursache
für deren Widerstandsfähigkeit gegenüber vielen Antibiotika. Äußere Membranproteine
in Gram-negativen Bakterien sind wichtig für die Nahrungsaufnahme, Sekretion und
deren Infektionsvermögen. Escherichia coli hat mehr als 60 verschiedene äußere
Membranproteine. Keines hat Ähnlichkeit mit mykobakteriellen Proteinen. Bisher sind
das Porin MspA von Mycobacterium smegmatis und das Kanal-bildende Protein OmpA
von
Mycobacterium
tuberculosis
die
einzigen
bekannten
mykobakteriellen
Membranproteine. Rv1698 von M. tuberculosis wurde von uns als Kanalprotein der
9. Outlook ........................................................................................................102
9.1. Virulence of M. tuberculosis mutants deficient in copper homeostasis.............. 102
9.2. Interaction of MctB with other proteins............................................................... 102
9.3. The role of MctA................................................................................................. 103
äußeren Membran mit unbekannter Funktion entdeckt. Zellen der entsprechenden
Mutante reicherten 100-mal mehr Kupfer an als der Wildtyp. Eine M. smegmatis Mutante
der das Homolog Msm_3747 fehlt, zeigte einen 11-mal höheren Kupfergehalt. Das
Aufnahmevermögen für Glukose blieb jedoch unverändert. Diese Ergebnisse zeigen,
dass diese Kanalproteine eine wichtige Rolle für die Ausscheidung von Kupferionen
über die mykobakterielle äußere Membran spielen. Damit wurde die Ausscheidung von
10. References.................................................................................................104
Kupfer als ein wichtiger Mechanismus identifiziert, mit dem Mykobakterien der
11. Abbreviations ............................................................................................115
Ansammlung von giftigen Kupferionen in der Zelle entgegenwirken. Rv1698 ist somit
das erste mykobakterielle äußere Membranprotein mit nachgewiesener Ausscheidungsfunktion. Rv1698 hat kein Kupferbindemotiv. Ebenso fehlen der äußeren Membran die
Energiequellen für den Transport entgegen dem Konzentrationsgefälle. Darum ist es
wahrscheinlich, dass Rv1698 mit Kupfer-spezifischen Transportproteinen der inneren
Membran interagiert. Diese sind in der Regel substratspezifisch und stellen die Energie
für den Transport bereit. Darum ist zu vermuten, dass die mykobakteriellen
Transportsysteme prinzipiell denen in Gram-negativen Bakterien ähneln. Kupfer über
einer Konzentration von 25 µM hemmt das Wachstum von M. tuberculosis auf
künstlichem Nährmedium. Ähnliche Konzentrationen wurden in Phagosomen von
Interferon-
stimulierten
Makrophagen
gemessen.
Dies
lässt
vermuten,
dass
Makrophagen das Wachstum von M. tuberculosis mit Hilfe von Kupfer eindämmen.
Aufnahmemechanismen für Kupferionen sind unbekannt. Wir haben gezeigt, dass
Porinmutanten von M. smegmatis im Gegensatz zum Wildtyp auf nahezu Kupfer-freiem
Medium kaum wachsen und eine Toleranz bei erhöhtem Kupfergehalt zeigen.
Kupferaufnahme erfolgt somit über Porine. Kanäle in der mykobakteriellen äußeren
Membran sind daher unverzichtbar für die Aufnahme und Ausscheidung überschüssiger
Kupferionen.
Diese
Ergebnisse
mykobakterielle Transportprozesse.
erweitern
dramatisch
unser
Verständnis
über
Summary
2
Introduction
3
1. Summary
2. Introduction
Mycobacterium tuberculosis is the leading cause of deaths resulting from a single
2.1. The genus Mycobacterium
infectious disease with 1.7 million victims annually. The exceptionally low permeability of
the outer membrane contributes to the intrinsic resistance of mycobacteria to many
antibiotics. Despite the well-documented importance of outer membrane proteins for
nutrient uptake, secretion, and host-pathogen interactions in Gram-negative bacteria,
only the porin MspA of M. smegmatis and the channel-forming protein OmpA of
2.1.1. Taxonomy
Mycobacteria are Gram-positive aerophilic bacteria with a high G+C content and show a
rough morphology with uneven formed branched cells. Taxonomically, mycobacteria
belong to the genus Mycobacterium which is the single genus within the family of
M. tuberculosis have been characterized as mycobacterial integral outer membrane
Mycobacteriaceae in
proteins. By contrast, E. coli uses more than 60 proteins to functionalize its outer
microorganisms, but mycobacteria and allied taxa are easily distinguished by their ability
the order
Actinomycetales. This
order includes
various
membrane, none of which has significant sequence similarity to any M. tuberculosis
to synthesize mycolic acids (Rastogi et al., 2001). Mycobacteria possess the longest
protein. Rv1698 of M. tuberculosis was discovered by us as an outer membrane channel
mycolic acids consisting of up to 90 carbon atoms (Barry et al., 1998) which confer acid-
protein with unknown function. Intracellular copper in an M. tuberculosis mutant lacking
fastness to these bacilli. The genus is divided in slow- and fast-growing mycobacteria,
Rv1698 was 100-fold increased. An M. smegmatis mutant lacking the close homolog
which corresponds to phylogenetic data derived from 16S rRNA sequences (Rogall et
Msm_3747 accumulated 11-fold more copper than the wild-type, while uptake of glucose
al., 1990). Fast-growing species with generation times of less than 5 hours are mostly
remained unchanged. These results demonstrated that Rv1698-like channel proteins are
non-pathogenic, saprophytic soil bacteria such as Mycobacterium smegmatis, M. phlei
required for copper efflux across the mycobacterial outer membrane and that secretion
and M. chelonae. Slow-growing species have generation times of 20 hours and longer
of Cu+ is a mechanism by which M. tuberculosis maintains copper homeostasis to
and are often pathogenic such as M. tuberculosis, the causative agent of tuberculosis
prevent copper toxicity. Rv1698 is the first identified mycobacterial channel protein that
(TB) and M. leprae, the pathogen causing leprosy.
is involved in efflux across the outer membrane. In addition, Rv1698 lacks a predicted
copper binding motive and there is no energy source in the outer membrane that would
support efflux trough the Rv1698 channels against the concentration gradient. Thus,
+
Rv1698 is likely recruited by Cu specific inner membrane translocases that determine
substrate specificity and provide energy for the transport. These findings indicate that
2.1.2. Evolutionary pathway of the tubercle bacilli
Speciation of recent members of the M. tuberculosis complex is estimated to have
occurred during the last 15,000 to 20,000 years (Kapur et al., 1994). The complex
mycobacteria possess multicomponent efflux systems that are functionally similar to
consists of M. tuberculosis, M. canettii, M. africanum, M. microti and M. bovis (including
those of Gram-negative bacteria. We also found that M. tuberculosis did not grow at
M. bovis BCG). All members have identical rRNA sequences (Boddinghaus et al., 1990;
Cu2+ concentrations above 25 µM. The amount of copper in phagosomes of
Brosch et al., 2001) and exceptional little sequence variation resulting in 99.9% identity
macrophages stimulated with interferon- increases to similar concentrations after
of their genomes at the nucleotide level (Sreevatsan et al., 1997; Musser et al., 2000).
infection with M. tuberculosis. Thus, macrophages appear to utilize copper to control
The subspecies can only be distinguished by a few phenotypic and genotypic
intracellular growth of M. tuberculosis. Uptake pathways for the essential micronutrient
characteristics but show great variety in terms of host range and pathogenicity (Brosch
copper are unknown in mycobacteria. However, an M. smegmatis porin mutant did not
et al., 2001; Brosch et al., 2002). Before genome sequences were available it was
grow with trace amounts of copper (<1 µM), but was more resistant than wild-type,
believed that M. tuberculosis evolved from M. bovis by adaptation of an animal pathogen
demonstrating that channel proteins are required for copper uptake across the outer
to the human host (Gonzalez-Flecha and Demple 1995). However, analysis of the
membrane. These outer membrane channels are essential components of a
genomes revealed that M. bovis has undergone numerous deletions relative to M.
considerably revised model of copper homeostasis in M. tuberculosis. The implications
tuberculosis and therefore seems to be part of a separate lineage represented by M.
of these findings for our understanding of transport mechanisms and, in particular efflux
africanum, M. microti and M. bovis. This group is defined by successive loss of DNA in
systems, in mycobacteria are profound.
Introduction
4
Introduction
5
relation to M. tuberculosis resulting in decreasing genome sizes (Garnier et al., 2003).
unavoidably to disease, since the immune system can control the bacilli in check forcing
There are 14 regions of difference (RD1-14) that are absent in M. bovis BCG relative to
them to adapt to prolonged periods of dormancy in tissues (Wayne 1994). It is
M. tuberculosis and 10 of those regions have been used as evolutionary markers to
suggested that the ability to shift down into non-replicating stages is crucial for the ability
propose the evolutionary pathway of the tubercle bacilli within the M. tuberculosis
of tubercle bacilli to be dormant in the host for years or decades (Wayne and Hayes
complex (Fig. 2.1) (Brosch et al., 2002).
1996). Immunocompetent individuals harboring latent M. tuberculosis carry a 2-23 %
lifetime risk of reactivating tuberculosis, while patients with HIV reactivate tuberculosis at
a much higher rate (Parrish et al., 1998). A problem is the rise of multi-drug resistant
(MDR) strains (Bleed et al., 2001) which are resistant against at least rifampicin and
isoniazid. Nearly 5% of all new infections are caused by MDR strains causing 500,000
tuberculosis cases per year. In addition, an extensively drug-resistance (XDR) form of
tuberculosis has been reported in 45 countries. XDR tuberculosis is virtually untreatable
and seriously threatens control efforts. Treatment of tuberculosis is difficult since only a
few antibiotics are effective against fully susceptible M. tuberculosis strains.
Chemotherapy takes up to 6 month and must be extended for up to 2 years for MDR
tuberculosis. The fact that many antibiotics do not affect M. tuberculosis can mostly be
attributed to the unique mycobacterial cell wall which shields the mycobacterial cell from
antibiotics and other toxic molecules due to its very low permeability (Brennan and
Nikaido 1995).
2.2. The mycobacterial outer membrane and its proteins
Due to its paramount importance as a pathogen, the growth and nutritional requirements
of M. tuberculosis have been intensively studied since its discovery more than a century
Figure 2.1: Scheme of the proposed evolutionary pathway of the tubercle bacilli. The scheme is based on the presence or
absence of conserved deleted regions and on sequence polymorphisms in five selected genes. Blue arrows indicate that
strains are characterized by katG463. CTG (Leu), gyrA95 ACC (Thr), typical for group 1 organisms. Green arrows indicate
that strains belong to group 2 characterized by katG463 CGG (Arg), gyrA95 ACC (Thr). The red arrow indicates that strains
belong to group 3, characterized by katG463 CGG (Arg), gyrA95 AGC (Ser), as defined by Sreevatsan et al., 1997. The
figure was taken from Brosch et al., 2002.
ago (Koch 1882). However, nutrient transport in M. tuberculosis is still poorly understood
despite a wealth of genomic data (Niederweis 2008). This is true in particular for
transport processes across the outer membrane. The outer membrane of M. bovis BCG
and of M. smegmatis was visualized by cryo-electron microscopy (Fig. 2.2) and showed
2.1.3. Medical relevance of mycobacteria
Mycobacteria are of great importance because M. tuberculosis is the leading cause of
deaths resulting from a single infectious disease with 9.2 million new cases and 1.7
million deaths in 2006 (world health organization report 2008). The world health
organization estimates that one third of the world’s population is infected and about 5 to
10% of infected people will become sick or infectious during their lifetime (WHO report,
Factsheet No 104, revised 2007). Infection with M. tuberculosis does not lead
that mycolic acids are an essential component of this unusual supported lipid bilayer
(Hoffmann et al., 2008). Mycolic acids are believed to form the inner leaflet of an
asymmetrical bilayer while lipids that are extractable by organic solvents are assumed to
form the outer leaflet (Minnikin 1982). X-ray diffraction of isolated mycobacterial cell
walls showed that the mycolic acids are oriented parallel to each other and
perpendicular to the plane of the cell envelope (Nikaido 1993). Its unique architecture
and composition raise the question of how the mycobacterial outer membrane is
Introduction
6
Introduction
7
functionalized for nutrient uptake, signal transduction, efflux of toxic compounds and
resistance against small and hydrophobic antibiotics as demonstrated for mycobacteria
secretion of material to the cell surface and to the extracellular medium.
(Danilchanka et al., 2008) and numerous Gram-negative bacteria (Farra et al., 2008;
Mammeri et al., 2008; Martinez-Martinez 2008; Raja et al., 2008). It was proposed, that
outer membrane proteins play a role in adaptation of M. tuberculosis to its slower growth
(DiGiuseppe-Champion and Cox 2007) and to its very different natural habitat.
Figure 2.2: Cryo-electron tomography of M. bovis bacillus Calmette–Guérin (A, B, D), M. smegmatis (E), and E. coli (C).
(A) Intact cell rapidly frozen (vitrified) in growth medium and imaged by using low-dose conditions at liquid nitrogen
temperature. Black dots represent gold markers. (B–E) Calculated x–y slices extracted from subvolumes of the threedimensionally reconstructed cells and corresponding density profiles of the cell envelopes. The fitted Gaussian profiles in
C (dashed curves) indicate the positions of the peptidoglycan (PG) and the outer membrane (OM). (D and E)
Subtomograms recorded at nominal 6-μm defocus and reconstructed without noise reduction. CM, cytoplasmic
membrane; L1 and L2, periplasmic layers; MOM, mycobacterial outer membrane. (Scale bars: A, 250 nm; B and C, 100
nm; D and E, 50 nm.) The picture was taken from Hoffmann et al., 2008.
Figure 2.3: Schematic representation of
diffusion
pathways
across
the
mycobacterial outer membrane (MOM).
Mycolic acids (red) are embedded in the
inner leaflet of the outer membrane. Small
molecules like H2O2 possibly cross
membranes by direct diffusion through lipid
layers (lipid pathway) while uptake of
nutrients and efflux of toxic compounds is
often mediated by outer membrane
channel proteins. Arrows mark the
direction of diffusion. Inner membrane (IM);
peptidoglycan (PG); arabinogalactan (AG);
2.2.1. Transport processes across mycobacterial outer membranes
The mycobacterial cells are surrounded by an inner and an outer membrane (Hoffmann
et al., 2008; Zuber et al., 2008) because of which it was proposed that nutrient uptake
systems in mycobacteria are functionally analogous to those of Gram-negative bacteria.
Three general pathways for transport processes across outer membranes exist (Fig. 2.3)
(Niederweis 2008). (i) Hydrophobic compounds penetrate the membrane by temporarily
dissolving in the lipid bilayer which is referred to as the lipid pathway. (ii) Polycationic
compounds are believed to mediate their own uptake possibly by disorganizing the outer
2.2.2. Porin mediated diffusion of hydrophilic solutes in M. smegmatis
membrane locally. (iii) Small and hydrophilic compounds diffuse through channel
The discovery of MspA as the main porin of M. smegmatis was proof of principle that
proteins across the outer membrane. The outer membrane represents an extraordinary
porins do exist in mycobacteria despite the lack of proteins with sequence homology to
permeability barrier that protects mycobacteria from many toxic compounds and plays
known porins (Niederweis et al., 1999). The unique goblet-like structure of the single
an essential role in virulence of M. tuberculosis (Barry et al., 1998). Therefore, the
pore forming homooctameric MspA is in strong contrast to the homotrimeric organization
contribution of porins to the permeability of the mycobacterial outer membrane is of great
of classical porins (Faller et al., 2004) such as OmpC where each subunit forms an
importance. It was shown previously that they promote the diffusion of nutrients like
independent channel by itself (Fig. 2.4). Its structural features define MspA as the first
sugars (Stahl et al., 2001; Stephan et al., 2005) and inorganic phosphates
member of a new class of channel forming outer membrane proteins (Niederweis 2008).
(Wolschendorf et al., 2007). In addition, the loss of porins generally contributes to
The chromosome of M. smegmatis encodes four very similar porins designated MspA,
Introduction
8
Introduction
9
B, C and D. The mature MspB, C and D proteins differ only at 2, 4 and 18 positions,
the structural integrity of the outer membrane (Sonntag et al., 1978), in resistance to
respectively, from MspA (Stahl et al., 2001). Porin mutants of M. smegmatis expressed
environmental stresses (Wang et al., 2002) and in pathogenesis (Mittal and Prasadarao
an up to 75-fold lower permeability for glucose and grow much slower compared to wt
2008). However, there is an ongoing debate about whether OmpA forms a pore.
demonstrating that porin-mediated influx of nutrients is a major determinant of the growth
Although the channel forming ability of OmpA is well documented (Sugawara and
rate (Stephan et al., 2005). Besides its role in nutrient acquisition, the porin pathway is also
Nikaido 1992; Arora et al., 2000; Saint et al., 2000), crystaIs (Pautsch and Schulz 1998;
utilized by many hydrophilic antibiotics such as ampicillin, fluoroquinolones and
Bond et al., 2002) did not show an open water-filled channel. Furthermore, ompA
chloramphenicol (Stephan et al., 2004; Danilchanka et al., 2008) to cross the outer
mutants of Salmonella and E. coli did not affect the outer membrane permeability (Bavoil
membrane of M. smegmatis.
et al., 1977; Nikaido et al., 1977) in contrast to many mutants lacking functional porins
(Nikaido et al., 1977; Harder et al., 1981; Sugawara and Nikaido 1994).
Fig. 2.4: Structure comparison
between the porins MspA (A, B) of
M. smegmatis and OmpC (C, D) of
E. coli. side view (A, C); top view
(B, D). MspA consists of 8 identical
subunits that form one central
channel while each subunit of
OmpC forms a channel.
Lipid bilayer experiments using OmpA of M. tuberculosis expressed in E. coli
demonstrated that the protein is able to form pores in vitro (Senaratne et al., 1998) but in
vivo uptake experiments conducted with an ompA mutant of M. tuberculosis failed to
conclusively demonstrate that OmpA is a major general porin of M. tuberculosis (Solioz
and Stoyanov 2003). The failure of the ompA mutant to grow at low pH is likely the
cause of the virulence defect in mice, because activated macrophages are able to
override the block of phagosome acidification exerted by M. tuberculosis and to lower
the pH inside phagocytic vacuoles (Schaible et al., 1998). The strong induction of ompA
transcription at low pH (30-fold) and in macrophages (5-fold) (Raynaud et al., 2002)
suggests that acidification of the phagosome is the signal which triggers an OmpAdepending defense mechanism of M. tuberculosis in macrophages to cope with growthlimiting proton concentrations. Thus, OmpA is one of the few protein virulence factors
associated with the outer membrane of M. tuberculosis (Solioz and Stoyanov 2003).
2.2.3. The role of M. tuberculosis OmpA in outer membrane permeability
Porins are non-specific protein channels in bacterial outer membranes that enable the
influx of hydrophilic solutes (Nikaido 2003). Channel-forming proteins have been found
in cell wall extracts of M. tuberculosis (Senaratne et al., 1998; Kartmann et al., 1999)
and M. bovis BCG (Lichtinger et al., 1999) but these studies did not identify the proteins
that actually account for the observed channels. However, a channel forming protein of
M. tuberculosis was identified by its homology to the OmpA protein family (Senaratne et
al., 1998).
OmpA-like proteins exist in all Gram-negative bacteria examined (Beher et al., 1980). In
E. coli, OmpA is involved in conjugation (Schweizer and Henning 1977), in maintaining
2.2.4. A proteome-wide screen for outer membrane proteins of M. tuberculosis
Despite the well-documented importance of outer membrane proteins for nutrient
uptake, secretion processes and host-pathogen interactions in Gram-negative bacteria
(Nikaido 2003), surprisingly few outer membrane proteins of mycobacteria are known.
The only two well characterized examples of integral outer membrane proteins are the
porin MspA of M. smegmatis and the channel-forming protein OmpA of M. tuberculosis
(Senaratne et al., 1998; Raynaud et al., 2002; Molle et al., 2006; Alahari et al., 2007). By
contrast, E. coli uses more than 60 proteins to functionalize its outer membrane (Molloy
et al., 2000), none of which has significant sequence similarity to any M. tuberculosis
protein. The channel-forming protein MspA (Fig. 2.4 A, B) was shown to be located in
the outer membrane of M. smegmatis (Stahl et al., 2001) to provide classical porin
Introduction
10
Introduction
11
function such as the uptake of small and hydrophilic solutes (Niederweis et al., 1999;
2.3. Uptake of phosphates by mycobacteria
Stephan et al., 2005; Wolschendorf et al., 2007). The structure of MspA is currently the
Phosphorous is indispensable for energy supply and for biosynthesis of nucleic acids
only structure of a mycobacterial outer membrane protein and provides the proof of
and phospholipids in any cell. Bacteria employ sophisticated transport mechanisms to
principle that these proteins have structures different from their functional analogs in
acquire phosphorous containing nutrients from the environment. In Gram-negative
Gram-negative bacteria (Faller et al., 2004). Homologs of MspA are not present in slow
bacteria, phosphates first need to cross the outer membrane. To this end, E. coli
growing mycobacteria but it is known that both M. tuberculosis and M. bovis BCG
produces the two general porins OmpF and OmpC at phosphate excess. Under
produce channel-forming proteins that were assumed to be outer membrane proteins
phosphate limiting conditions, these porins are partially replaced by the pore protein
(Senaratne et al., 1998; Kartmann et al., 1999; Lichtinger et al., 1999). Recently, a multi-
PhoE (Overbeeke and Lugtenberg 1980), which preferentially allow diffusion of anions
step bioinformatic approach led to the identification of 144 proteins in M. tuberculosis of
(Bauer et al., 1989) in contrast to the cation preference of OmpF and OmpC (Nikaido
unknown function that meet the criteria of integral outer membrane proteins (Fig. 2.5)
and Rosenberg 1983). Hence, diffusion of phosphates through PhoE pores is more
(Song et al., 2008).
efficient and is the prevalent pathway for phosphates across the outer membrane under
phosphate limiting conditions (Korteland et al., 1982). While inorganic phosphate is the
preferred source of phosphorous, many bacteria can also take up organic phosphates
and release phosphate by the action of periplasmic phosphatases such as PhoA. E. coli
possesses four transport systems, Pst, Pit, GlpT and UhpT, which translocate inorganic
phosphate across the inner membrane (van Veen 1997). Part of the Pst system is the
periplasmic protein PstS, which binds and transfers phosphate to the transmembrane
components PstA and PstC. PstB hydrolyzes ATP and delivers energy for phosphate
translocation across the inner membrane by PstA/PstC. Pst systems bind and transport
Figure 2.5: Prediction of putative outer membrane proteins of M. tuberculosis H37Rv. Out of 3991 predicted proteins, 144
putative outer membrane proteins were identified. The figure was taken from (Song et al., 2008).
2.2.5. Rv1698 of M. tuberculosis is a channel-forming outer membrane protein
A bioinformatic analysis of the proteome of M. tuberculosis identified 144 putative outer
phosphate with binding constants and apparent transport Km values in the
submicromolar range. They exist also in Gram-positive bacteria (Qi et al., 1997) and in
mycobacteria (Braibant et al., 1996).
It was conclusively shown that MspA represents the major porin of M. smegmatis (Stahl
membrane proteins (Fig. 2.5) (Song et al., 2008). These proteins were expressed in
et al., 2001) and is required for the transport of glucose, serine and hydrophilic -lactam
porin mutants of M. smegmatis looking for complementation of phenotypes that resulted
antibiotics (Stephan et al., 2004; Stephan et al., 2005). However, considering the
from the lack of porins in these mutants. Rv1698 was identified as putative outer
preference of MspA for cations (Kartmann et al., 1999) and the high density of negative
membrane protein of M. tuberculosis. Msm_3747 is an homolog of Rv1698 in
charges in the constriction zone of MspA (Faller et al., 2004) it is unknown whether
M. smegmatis. The protein is associated with membranes (Song et al., 2008), forms
MspA or a PhoE-like porin enable efficient diffusion of phosphates across the outer
channels in lipid bilayer experiments (Siroy et al., 2008), restored sensitivity to antibiotics
membrane of M. smegmatis. Importantly, phosphate transport across the inner
in porin mutants of M. smegmatis and partially complemented the permeability defect of
membrane is essential for growth of M. tuberculosis in macrophages (Rengarajan et al.,
the porin mutants for glucose (Siroy et al., 2008). These results provide evidence that
2005) and for survival in mice (Sassetti and Rubin 2003; Peirs et al., 2005). However, it
Rv1698 is a novel channel-forming outer membrane protein of M. tuberculosis.
is also unknown how phosphate is transported across the outer membrane of
M. tuberculosis.
Introduction
12
Introduction
13
2.4. Copper metabolism in mycobacteria
the enzyme is reduced (Brunori et al., 2004) which might be necessary to decrease
2.4.1. Metabolic requirements for copper
electron overload.
Copper is an important cofactor of enzymes that are involved in energy generation (Kim
et al., 2008), oxidative stress defense (Battistoni et al., 2000) and several other
metabolic processes (Kim et al., 2008). Therefore, copper is required in small amounts
by almost every living cell and as such is an essential trace element. Bacterial enzymes
that contain copper are either embedded in the inner membrane or are periplasmic
proteins. The only two known copper requiring enzymes of M. tuberculosis are
cytochrome c oxidase (Matsoso et al., 2005) and superoxide dismutase (SodC)
Figure 2.6: Schematic representation of cytochrome c
oxidase of M. tuberculosis. The cytochrome bcc complex
(orange) consecutively delivers four electrons to the
cytochrome c oxidase (yellow). The electrons pass four metal
centers (indicated by the dotted line) to finally reduce
molecular oxygen to water at the cytoplasmic side of the
complex consuming four protons (H+). Electron transport is
+
associated with the transclocation of four protons (H ) across
the membrane by cytochrome c oxidase. The CuA center has
two copper ions (red circles) and is the electron entry site.
Electrons (e-) then pass heme a and a3 which contain iron
(grey circles). CuB and heme a3 form the binuclear active site
for oxygen reduction. CuB contains one copper ion.
(D'Orazio et al., 2001). Some environmental mycobacteria also have a periplasmic
amine oxidase enabling the utilization of biogenic amines as carbon and nitrogen source
(Fontecave and Eklund 1995; Ro et al., 2006).
2.4.2. Cytochrome c oxidase of M. tuberculosis
Terminal oxidases are proton pumps that reduce oxygen to water. The difference in the
electrochemical potential of protons across the membrane is used to drive ATP
synthesis by ATP-synthase (Ostermeier et al., 1996). Two alternative terminal oxidases
have been deduced from the genome sequence of M. tuberculosis which oxidize either
cytochrome c or quinol (Megehee et al., 2006). Only the cytochrome c oxidase
possesses two copper centers (Fig. 2.6). Thus, copper availability is crucial for its
expression and activity (Johnson and Newman 2007; Zeng et al., 2007). The CuA center
is a bimetallic copper center with a [Cu2S2] core (Farrar et al., 1996). It is located near
the membrane surface and accepts electrons, one at a time, from the mycobacterial
cytochrome bcc complex which is, unlike cytochrome c in other bacteria, membrane
associated (Megehee et al., 2006). The single copper ion of the CuB center is ligated to
three histidine residues and shares a fourth ligand with the iron of heme a3 (Ostermeier
et al., 1996) forming the binuclear active site for O2 reduction. The transfer of four
electrons is required to reduce molecular oxygen to water at the CuB center which
consumes four substrate protons. Simultaneously, cytochrome c oxidase translocates
four additional protons (H+) to the periplasm. Both processes create an electrochemical
proton gradient across the inner membrane (Belevich et al., 2007) which subsequently
drives ATP synthesis. Cytochrome c oxidase is also able to scavenge and detoxify nitric
oxide (NO) (Borisov et al., 2004) which is a feature of the CuB center (Brunori et al.,
2004). Nitric oxide is released by activated macrophages. During infection, expression of
2.4.3. Mycobacterial superoxide dismutase
Superoxide dismutases (SodC) have been found in many prokaryotes and are
associated with virulence in a number of pathogens (Kroll et al., 1995; Battistoni et al.,
2000; Gee et al., 2005; Kang et al., 2007; Ammendola et al., 2008). The enzyme is
characterized by its high structural stability which can be attributed to an intrasubunit
disulfide bond (Battistoni et al., 1999). The formation of this disulfide bond is insufficient
in the reducing environment of the cytoplasm and thus inhibits SodC folding in that
compartment (Battistoni et al., 1999). In E. coli, folding in the oxidizing periplasm is
assisted by DsbA, which mediates the disulfide bond formation (Battistoni et al., 1999).
The genome of M. tuberculosis encodes no DsbA homolog, but evidence exist that DsbE
of M. tuberculosis functions similar to E. coli DsbA (Goulding et al., 2004) and thus could
be a potential SodC chaperon in M. tuberculosis. The arrangement of the redox center of
SodC is well conserved (Spagnolo et al., 2004). Usually, copper is coordinated by four
histidine residues that are embedded into a -barrel structure. However, in the
mycobacterial SodC, copper is coordinated by three histidine residues and a water
molecule. Unlike other bacterial and eukaryotic SodC’s, M. tuberculosis SodC does not
require zinc to gain enzymatic activity (Fig. 2.7). In fact, the zinc binding ligands are
missing which is a unique feature of all mycobacterial SodC’s analyzed (Spagnolo et al.,
2004). M. tuberculosis SodC is membrane-associated and favors mycobacterial survival
in macrophages (D'Orazio et al., 2001). The apoSodC protein is processed by signal
Introduction
14
Introduction
15
peptidase II which is associated with the Sec-translocation apparatus and removes the
(Balakrishnan et al., 1997). In mycobacteria it has been shown that copper alone and in
leader peptide from fatty-acid modified proteins (Sander et al., 2004). Signal peptidase II
combination with certain thioureas affects respiration and ammonia assimilation
activity is important for virulence and pathogenesis of M. tuberculosis (Sander et al.,
(Bernheim 1957). The function of the glucan branching enzyme GlgB of M. tuberculosis
2004). Lipoprotein leader sequences of SodC’s are found in Gram-positive bacteria,
which serves mainly the purpose to store surplus carbohydrates as glycogen, is
Gram-negative bacteria (D'Orazio et al., 2001) and mycobacteria. Electron leakage from
compromised by copper as well. This enzyme might be crucial for an alternative
the electron transport chain during respiration produces highly reactive superoxide
biosynthesis pathway of trehalose which is the basic component of a number of cell wall
anions (O2-) (Wallace et al., 2004) which immediately react with nearby located
glycolipids (Garg et al., 2007).
molecules. Therefore, SodC may protect membrane associated targets by scavenging
superoxide anions
from membrane associated sources like the cellular respiration
machinery (D'Orazio et al., 2001).
2.5. Copper transport mechanisms in bacteria
2.5.1. Gram-positive bacteria
Bacterial copper homeostasis is best understood in the Gram-positive organism
Figure 2.7: Schematic view of the tertiary structure of
the M. tuberculosis SodC dimer. Copper is the only
metal ion (black cirles) in all mycobacterial SodC’s.
Original was taken from (Spagnolo et al., 2004).
Enterococcus hirae (Solioz and Stoyanov 2003; Magnani and Solioz 2005) (Fig. 2.8 A).
The cop-operon of E. hirae consists of four genes that encode a repressor, CopY, a
copper chaperone, CopZ, and two P-type copper ATPases, CopA and CopB which
accomplish copper uptake and export, respectively. A reductase at the cytoplasmic
membrane reduces Cu(II) to Cu(I) which is the substrate for CopA (Magnani and Solioz
2005). The proposed direction of copper transport for CopA is unusual in comparison to
most other metal transporting ATPases (Solioz and Stoyanov 2003). However, evidence
for copper transport into cells by a heavy metal ATPase has also been obtained for CtpA
of Listeria monocytogenes (Francis and Thomas 1997) and CtaA of Synechocystis
(Tottey et al., 2002).
2.4.4. Copper toxicity
2.5.2. Gram-negative bacteria
Ionic copper is toxic due to its high redox potential but if controlled, this potential can
In Gram-negative bacteria and mycobacteria copper has to overcome the outer
also be harvested for direct oxidation of certain substrates and for electron transfer in the
membrane barrier. Unlike copper import, efflux mechanisms are well understood in
presence of oxygen (Crichton and Pierre 2001). Free copper mainly causes oxidative
E. coli (Rensing and Grass 2003) (Fig. 2.8 B). The proton-driven Cus system mediates
damage which has been generally attributed to the formation of highly reactive oxygen
the translocation of cytoplasmic copper across the inner and the outer membrane while
species like oxigen radicals, by a mechanisms analogue to the Fenton reaction (Halliwell
CopA, a P-type ATPase translocates excess cytoplasmic copper into the periplasm.
and Gutteridge 1984; Koppenol 2001). These hydroxyl radicals (*OH) then lead to (i)
CusC is a TolC-like protein embedded in the outer membrane by a contiguous -barrel
protein carbonylation (Zhu et al., 2002), (ii) lipid peroxidation (Halliwell and Gutteridge
which extends into a trans-periplasmic tunnel. The tunnel is connected to the copper
1984) and (iii) DNA damage (Lee et al., 2002). In addition, copper competes with other
translocating inner membrane protein CusA, a member of the resistance-nodulation-
metals for their binding sites as shown for the human estrogen receptor (Predki and
division (RND) protein superfamily. The membrane fusion protein CusB stabilizes the
Sarkar 1992), the human glyoxalase I (Sellin et al., 1987) or urease (Rai and Rai 1997).
tunnel in the periplasm. Copper resistance in E. coli has been in part linked to porin
Free copper also binds to the active site of RNases causing their inactivation
Introduction
16
Introduction
17
deficiency (Rensing and Grass 2003) indicating that porins might be involved in copper
2.6. Gene deletions by allelic exchange in mycobacteria
uptake across the outer membrane.
The ability to construct mutants by allelic exchange is imperative to characterize the
function of a particular gene and thus is an indispensable tool to understand
2.5.3. Mycobacteria
mycobacterial pathogenesis at the molecular level. Since homologous recombination is
The genome of M. tuberculosis encodes at least three possible inner membrane copper
a rare event in mycobacteria compared to other bacteria, gene deletions rely on efficient
efflux pumps CtpA, CtpB, and CtpV (Agranoff and Krishna 2004). CtpV is part of a
delivery systems for template DNA. Considerable progress in constructing allelic
copper-induced operon controlled by the transcriptional regulator CsoR (Liu et al., 2007)
exchange mutants in mycobacteria has been achieved using non-replicating suicide
and likely represents a copper-specific inner membrane efflux pump of M. tuberculosis
vectors (Stephan et al., 2004), conditionally replicating temperature-sensitive plasmids
(Ward et al., 2008). It is unknown how Cu2+ is taken up across the outer and inner
(Pelicic et al., 1997) or specialized transducing mycobacteriophages (Bardarov et al.,
membrane of Gram-negative bacteria and mycobacteria. However, the divalent
2002).
transition metal transporter, MntH of M. tuberculosis mediates the proton dependent
Gene deletion by allelic exchange is achieved by homolog recombination. Deletion
uptake of Zn2+ and Fe2+. Cu2+ in access inhibits that specific uptake as does Mn2+,
vectors generally carry a resistance marker for positive selection and sometimes a
suggesting that copper is competing with other metals for transport and binding
counter-selectable marker (Fig. 2.9). The resistance marker is flanked by two sequences
(Agranoff and Krishna 2004). For this reason, MntH may provide a possible entry side
which are homolog to the chromosomal upstream and downstream regions of the target
for copper ions from the periplasmic side into the cytoplasm. Since mycobacteria lack
gene.
The
resistance
marker
of
non-replicating
suicide
vectors
confers
TolC and TolC-like proteins, it is also unknown how copper efflux is facilitated across the
mycobacterial outer membrane (Fig. 2.8 C).
Figure 2.8: Schematic representation of protein mediated copper transport across membrane of Enterococcus hirae (A),
E. coli (B) and M. tuberculosis (C). A: Copper importing (CopA, orange) and exporting (CopB, green) P-type ATPases. B:
Copper exporting P-type ATPase CopA (green), resistance-nodulation-cell division protein CusA (blue), membrane fusion
protein CusB (yellow), outer membrane factor CusC (red). C: Unspecific bivalent metal ion importer MntH (orange),
copper exporting P-type ATPases CtpA, CtpB, CtpV (green). Arrows indicate direction of transport which has not been
demonstrated for dotted lines. Questionmarks indicate missing components or only indirect evidence is available. ES:
extracellular space; OM: outer membrane; PL: periplasm; CM: plasma membrane; CY: cytoplasm.
Figure 2.9: Schematic representation of gene deletion by allelic exchange. (A) Suicide vectors contain a resistance
marker (green) which is flanked by sequences (yellow) that are homolog to the chromosomal (blue) upstream (UHR) and
downstream (DHR) region of the gene to be deleted (orange). The exemplified first cross-over between the UHR’s is
indicated by the red cross. The plasmid cannot replicate within the host cell and selection for the antibiotic marker selects
for the integration of the vector (B). Recombined UHR’s are shown in mixed colors. The second cross-over between the
DHR’s led to the excision of the vector (C) leaving the resistance marker in the chromosome and taking along the gene.
Selection against the counter selectable marker (CSM) removes the plasmid (dotted lines) permanently. Direct selection
for double cross-over (dotted arrow) can be achieved by combining selection and counter selection in one step.
Introduction
18
Aims of this study
19
antibiotic resistance only when the vector integrates into the chromosome. Therefore,
3. Aims of this thesis
DNA cross-over has to occur at either the upstream or the downstream homolog regions
Outer membrane channel proteins of M. tuberculosis are of particular interest as they
(Fig. 2.9 A). However, to achieve the replacement of the target gene, recombination
may provide a pathway for drug uptake and may play a role in detoxification of heavy
must also occur at the other homolog region that was not involved in the first cross-over
metals or antibiotics. Porin-mediated diffusion has only been analyzed for a very limited
(Fig. 2.9 B). This process is associated with the excision of the plasmid backbone taking
number of nutritional solutes like glucose, serine or glycerol while efflux across the
along the gene of interest by leaving the resistance marker cassette behind (Fig. 2.9 C).
mycobacterial outer membrane has not been studied at all. Therefore, the goals of this
Due to the lack of positive selection for the excised plasmid it is forced to disappear by
study are:
counter selection. Direct selection for double cross-over is also possible. However,
recombination between the upstream and downstream homolog regions have to occur
simultaneously. Assuming that every recombination event occurs with the same
probability, the likelihood of a direct double cross-over is very low and can be calculated
by multiplying the likelihoods of the individual cross-overs.
Part 1: The role of MspA in uptake of inorganic ions
In E. coli, high affinity uptake of inorganic phosphate across the outer membrane is
mediated by the porin PhoE while the general and cation-specific porins OmpC and
OmpF are sufficient if phosphate is not limited. MspA is the major porin of M. smegmatis
and its role in nutrient acquisition is well established for carbohydrates. However, it was
unclear whether the highly negatively charged constriction zone of MspA would also
enable the translocation of phosphate. It was my goal to determine to which extent MspA
is involved in the uptake of selected essential cationic and anionic solutes.
A: Phosphate was chosen as an anionic component due to its importance for energy
transfer, nucleic acid metabolism and the synthesis of phospholipids. Phosphate-specific
porins have been identified in E. coli.
B: Copper (II) was chosen as cationic nutrient due to its importance for respiration and
radical defense. Evidence exists that copper transport across the outer membrane of E.
coli is mediated by porins.
Part 2: The physiological role of the outer membrane channel protein Rv1698 in
M. tuberculosis
Rv1698 and its homolog in M. smegmatis Msm_3747 demonstrated porin properties in
vitro by complementation of phenotypes of M. smegmatis porin mutants. My aim was to
examine their physiological role in both M. smegmatis and M. tuberculosis. To this end,
isogenic mutants were needed in order to search for a phenotype that would indicate its
function.
Materials and Methods
20
4. Materials and Methods
4.1. Material
4.1.1. Bacterial strains
Strain
Parent strain and relevant genotype
Source or reference
E. coli DH5α
recA1; endA1; gyrA96; thi; relA1; hsdR17(rK-;mK+);
supE44; 80lacZM15; lacZYA-argF; UE169
Sambrook et al., 1989
M. smegmatis SMR5
mc2155 derivative, SmR (rpsL*)
Sander et al., 1996
M. smegmatis ML75
SMR5 derivative, msm_3747::pML343, HygR
this study
M. smegmatis ML76
ML75 derivative, msm_3747::loxP-hyg-loxP, HygR
this study
M. smegmatis ML77
ML76 derivative, msm_3747::loxP
this study
M. smegmatis MN01
SMR5 derivative mspA::GmR
Stahl et al., 2001
M. smegmatis ML10
SMR5 derivative mspA / mspC
Stephan et al., 2004
M. smegmatis ML40
mc2155 derivative, attB::pML443; HygR
Wolschendorf et al., 2007
M. smegmatis ML41
ML10 derivative, attB::pML443; HygR
M. smegmatis ML42
ML10 derivative, attB::pML443, hyg
M. smegmatis ML43
MN01 derivative, attB::pML443; HygR
21
pML316
bla, pUC-ori, hyg-loxP-link2, sacR, sacB, 6218 bp
this study
pML317
bla, pUC-ori, loxP-sacR-sacB-hyg-loxP-link2, 6262 bp
this study
pML318
bla, pUC-ori,link1-loxP-sacR-sacB-hyg-loxP-link2, 6324 bp
this study
pML319
bla, pUC-ori,rv1698up,loxP-sacR-sacB-hyg-loxP-link2, 7330 bp
this study
pML320
bla, pUC-ori,rv1698up,loxP-sacR-sacB-hyg-loxP, rv1698do, 8333 bp
this study
pML330
bla, pUC-ori,rv1698up,loxP-hyg-loxP, rv1698do, 6384 bp
this study
pML331
bla, pUC-ori,rv1698up,loxP-hyg-loxP, rv1698do, sacR, sacB, 8547 bp
this study
pML337
bla, pUC-ori,rv1698up,loxP-hyg-loxP, rv1698do, sacR, sacB, 8547 bp
this study
pML343
bla, pUC-ori, msm_3747up, loxP-hyg-loxP, msm_3747do, sacR,
sacB, 8627 bp
this study
pML356
bla, pUC-ori,msm_3747up, loxP-hyg-loxP, rv1698do, sacR, sacB,
8668 bp
this study
pML380
bla, pUC-ori, loxP-hyg-loxP , 4474 bp
this study
pML440
PAL5000-ori, ColE1-ori, hyg, pimyc-phoA
pML443
ColE1-ori, bla, FRT-hyg-FRT, attP, pimyc-phoA
pML451
ColE1-ori, hyg, pAL5000-ori, psmyc-msm_3747, 6469 bp
this study
pML478
ColE1-ori, hyg, pAL5000-ori, psmyc-mycgfp2+, 6234 bp
this study
pML482
pUC-ori,rv1698up,loxP-hyg-loxP, rv1698do, sacR, sacB, 6474 bp
this study
pML484
pUC-ori,rv1698up,loxP-hyg-loxP, rv1698do, sacR, sacB, pwmyc-xylE,
7709 bp
this study
pML485
pUC-ori, pAL5000ts, rv1698up,loxP-hyg-loxP, rv1698do, sacR,
sacB, pwmyc-xylE 10697 bp
this study
this study
M. bovis BCG
Pasteur 35739
ATCC
M. bovis BCG ML44
M.bovis BCG derivative, attB::pML443
M. tuberculosis H37Rv
wild-type
ATCC# 25618
M. tuberculosis ML256
H37Rv derivative, rv1698::loxP
this study
pML513
bla, pUC-ori, loxP-psmyc mycgfp2+-hyg-loxP, 5537 bp
M. tuberculosis ML257
ML256 derivative, attB::pML955; HygR
this study
pML515
pUC-ori, pAL5000ts, sacR, sacB, xylE, rv1698up,
loxP-pimyc-mycgfp2+-hyg-loxP, rv1698do, 11859 bp
this study
pML941
pacet, pAL5000-ori, hyg, ColE1-ori, 7847 bp
this study
pML943
pacet-mycgfp2+, pAL5000-ori, hyg, ColE1-ori, 8549 bp
this study
pML946
pacet-msm_3747-HA-mycgfp2+, pAL5000-ori, hyg, ColE1-ori, 9524 bp
this study
this study
Table 4.1: Bacterial strains that were used and/or constructed in this study. Rv1698 encodes for MctB of M. tuberculosis and
msm_3747 is its homolog in M. smegmatis. SmR, HygR and GmR indicate resistant to streptomycin, hygromycin or
gentamycin, respectively. All M. smegmatis strains are resistant to streptomycin as they are derivatives of M. smegmatis
SMR5 which is streptomycin resistant. LoxP is the target sequence of Cre recombinase. The features of integrative vectors
pML343, pML443 and pML955 are listed in Tab. 4.2. MspA and mspB are porin genes of M. smegmatis. AttB is the
integration site for mycobacteriophage L5. The rpsL gene encodes a mutated ribosomal protein S12 (K43R) which confers
streptomycin resistance. The hyg gene confers resistance to hygromycin. ATCC: american type culture collection.
4.1.2. Plasmids
Plasmid
Parent vector, relevant genotype and properties
Source / reference
pBluescript KS+
bla, pUC-ori, f1(+), lacZ', 2958 bp
Stratagene
pBS346
bla, ColE1-ori, loxP-hyg-sacB-sacR-loxP , 5725 bp
gift from Dr. A.J.C. Steyn
pCG63
pAL5000ts, 8977 bp
Guilhot et al., 1992
pCreSacB
pgroEL-Cre,-oriE, pAL5000-ori, sacR, sacB, aph, 7891 bp
gift from Dr. A.J.C. Steyn
Kaps et al., 2001
pMS2
ColE1-ori, hyg, pAL5000-ori, 5229 bp
pMV361
oriE, aph, attP, int
Stover et al., 1991
pUGA61B
pacet-SPtorA-gfp, aph, attP, int
Posey et al., 2006
pML102
pAL5000-ori, ColE1-ori, aph, sacB, int
pML113
ColE1-ori, bla, FRT-hyg-FRT, attP, 4365 bp
pML118
ColE1-ori, bla, FRT-hyg-FRT, attP, phsp60-gfp+
pML311
bla, pUC-ori, loxP, 3000 bp
this study
pML312
bla, pUC-ori, loxP, 3006 bp
this study
pML313
bla, pUC-ori, link1, 3036 bp
this study
pML314
bla, pUC-ori, link2, 3000 bp
this study
pML315
bla, pUC-ori, hyg-loxP, sacR, sacB, 6188 bp
this study
pML955
ColE1-ori, hyg, int, pimyc-rv1698, attP, 6143 bp
pML977
ColE1-ori, pAL5000-ori, hyg, psmyc-msm3747-mycgfp2+, 7213 bp
this study
pMN016
ColE1-ori, hyg, pAL5000-ori, psmyc-mspA, 6164 bp
pMN035
ColE1-ori, hyg, pAL5000-ori, psmyc-rv1698, 6484 bp
Siroy et al., 2008
pMN234
pAL5000-ori, pBR322-ori, aph, rpsL
pMN252
ColE1-ori, bla, FRT-hyg-FRT, rpsL
pMN402
pAL5000-ori, ColE1-ori, hyg, phsp60-gfp+
Scholz et al., 2000
pMN437
ColE1-ori, hyg, pAL5000-ori, psmyc-mycgfp2+, 6236 bp
this study
Table 4.2: Plasmids used in this study. Up- and downstream homologous sequences of the mctB genes are subscripted
as msm_3747up and msm_3747do for M. smegmatis or rv1698up and rv1698do for M. tuberculosis. “Ori” means origin of
replication. The genes bla, hyg and aph confer resistance to ampicillin, hygromycin and kanamycin, respectively. The attP
site is required for site specific integration of plasmids into the chromosomal attB site by the mycobacteriophage L5
integrase gene, int. The site-specific recombinase Cre excises DNA fragments that are flanked by loxP recognition sites
and Flp recombinase excises FRT-flanked DNA sequences (Stephan et al., 2004). The pAL5000ts origin denotes the
temperature-sensitive origin of replication (Guilhot et al., 1992) and is a derivative of the pAL5000-ori (Labidi et al., 1985).
The constitutive mycobacterial promoters psmyc, pimyc and pwmyc have been described previously (Kaps et al., 2001;
Mailaender et al., 2004). Phsp60 is the groEL2 promoter of M. tuberculosis (Roberts et al., 2005). The sacB gene of B.
subtilis encodes the counter-selection marker levansucrase that mediates sensitivity to sucrose (Pelicic et al., 1996). Its
expression is regulated by SacR. The vectors pML331 and pML337 have the same genotype but the sacR-sacB
expression cassette is in different orientation. Pacet means that expression of the gene is inducible by acetamide. Pacet
encodes the entire ami-operon (see Fig. 4.5) except for the amiE gene which is replaced by other genes of interest. ColE1
and pUC are E. coli origins of replication. The rpsL gene encodes the ribosomal protein S12. Mycgfp2+ is a codon
optimized gene for gfp expression in mycobactria. The fragments link1 and link2 provide multiple cloning sites. SPTorA-gfp
encodes for gfp that is fused to the signal peptide of the torA (trimethylamine N-oxide reductase) gene of E. coli.
22
4.1.3. Oligonucleotides
4.1.5. Peptide library
Oligonucleotide Sequence (5’3’)
Number
CN97
CN699
CN700
CN701
CN702
CN703
CN704
CN705
CN706
CN707
CN708
CN709
CN710
CN783
CN784
CN785
CN786
CN829
CN1039
CN1048
CN1049
CN1050
CN1051
CN1054
CN1454
CN1460
CN1463
CN1464
TTACACATGACCAACTTCGATAACG
CTAGTTTAAACCAAGAAGATCCTTTGATATTTTCTACGGGGTCTGACGCTCAGTCGAGTATACGAGGC
GCGCCAGATTTAAATG
GCATGCATTCAGTCCCTTGCCGAGCGAG
GATCCATTTAAATCTGGCGCGCCTCGTATACTCGACTGAGCGTCAGACCCCGTAGAAAATATCAAAG
GATCTTCTTGGTTTAAA
AATTCGCTAGCTTTAATTAATAACTTCGTATAGCATACATTATACGAAGTTATACGCGTATCCCGG
GATCCCGATTTAAATAACTTCGTATAATGTATGCTATACGAAGTTATCCCGGGCTGCA
GATCCCGGGATACGCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTAATTAAAGCTAGCG
TCGAGTTTAAACATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCATGCATGTG
CTAGCG
GCCCGGGATAACTTCGTATAGCATACATTATACGAAGTTATTTAAATCGG
AATTCGCTAGCACATGCATGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATGT
TTAAAC
GAGGATTTAAATGCAAGCTGGACAGCAAAGTATCGGAG
GTATGGCGCGCCGTGCCAAGGTTCGCTTGTATGAAGG
CCTTAATTAATCACCGATCAGCGGGATGCAC
CTATGGCGCGCCGTGGTCAATGCCTCGCCTTCC
GAGGATTTAAATCACGCAGACCCGACAGCACG
CCTTAATTAACACCCTCACCGACGACAAGAAC
GCATGCATGTTTCGTGGCGGTTTGCGGGTG
CGTTAATTAAGCAGAAAGGAGGTTAATCTATGATAACGCTACGGGCGCACGCGATC
GTACCAATTGTCAGGTCAGCACGGTCATGAATCG
TTCTAGAGCGGCCGCTCGCTGCGCTCGGTCGTTC
ATGGGCCCAGTACTCGTTCCACTGAGCGTCAGAC
AGATCTGTAAGATATCACCAGCCCGTCATCGTCAACGCCTG
GTACGCGTTCAAGCTTTCTAGAGAATAGGAACTTCGAG
AATATTGGATTGCCGTGGTGCAG
AATTTACATATGATAACGCTACGGGCGCAC
TTTAATCATATGTCGAAGGGCGAGGAGCTGTTCAC
ATCATTTAAATAGTACTCATATGGACTCCCTTTCTCTTATCG
AAACTCTAGAGAAGTGACGCGGTCTCAAGCGTC
Table 4.3: Oligonucleotides used in this work were ordered from IDT, Inc. (USA).
4.1.4. Antibodies
Antibody
source
monoclonal
Antibody
source
monoclonal
1D1.6
mouse

5C3.23
mouse

2C6.1
mouse

5C3.25
mouse

4B2.3
mouse

5D1.9
mouse

4B2.5
mouse

5D1.23
mouse

4B2.10
mouse

7B1.31
mouse

4B2.13
mouse

7B1.32
mouse

5A3.21
mouse

7C2.33
mouse

5B2.9
mouse

7C2.38
mouse

5C2.1
mouse

8A6.6
mouse

5C2.10
mouse

8A6.14
mouse

5C2.6
mouse

1
pAB_Rv1698
rabbit
polyclonal
anti-mouse-HRP
goat
polyclonal
anti-rabbit-HRP
goat
polyclonal
5C3.15
mouse

2
5C3.17
mouse

2
Table 4.4: Monoclonal antibodies were generated by the Epitope Recognition and Immunoreagent Core Facility (ERIC) at
1
2
the University of Alabama. produced by Abgent, Inc. (USA); obtained from Sigma (USA).
Sequence (N- to C-terminus)
23
Solubility Number Sequence (N- to C-terminus)
Solubility
1
MISLRQHAVSLAAVFLALAMC

16
CLVDQGSQAGDLLGIALLSNA
2
CLAAVFLALAMGVVLGSGFFS

17
CLLGIALLSNADPAAPTVEQA
poor
3
CGVVLGSGFFSDTLLSSLRSE

18
CDPAAPTVEQAQRDTVLAALR
poor
4
CDTLLSSLRSEKRDLYTQIDR

19
CQRDTVLAALRETGFITYQPR

5
CKRDLYTQIDRLTDQRDALRE

20
CETGFITYQPRDRIGTANATV

6
CLTDQRDALREKLSAADNFDI

21
CDRIGTANATVVVTGGALSTD

7
CKLSAADNFDIQVGSRIVHDA

22
CVVTGGALSTDAGNQGVSVAR

8
CQVGSRIVHDALVGKSVVIFR

23
CAGNQGVSVARFAAALAPRGS

9
CLVGKSVVIFRTPDAHDDDIA

24
CFAAALAPRGSGTLLAGRDGS

10
CTPDAHDDDIAAVSKIVGQAG

25
CGTLLAGRDGSANRPAAVAVT

11
CAVSKIVGQAGGAVTATVSLT
poor
26
CANRPAAVAVTRADADMAAEI

12
CGAVTATVSLTQEFVEANSAE
poor
27
CRADADMAAEISTVDDIDAEP
poor
13
CQEFVEANSAEKLRSVVNSSI

28
CSTVDDIDAEPGRITVILALH

14
CKLRSVVNSSILPAGSQLSTK

29
CGRITVILALHDLINGGHVGH

15
CLPAGSQLSTKLVDQGSQAGD

30
CDLINGGHVGHYGTGHGAMSVTVSQ

poor
Table 4.5: Peptide library of Rv1698 of M. tuberculosis. Fmoc solid-phase peptide synthesis was employed to build linear
peptides. Peptides were synthesized from its C-terminus by stepwise addition of amino acids. Initially, the first Fmoc-amino
acid is attached to an insoluble support resin via an acid labile linker. After deprotection of Fmoc by treatment with
piperidine, the second Fmoc-amino acid is coupled utilizing a pre-activated species or in situ activation. After the desired
peptide is synthesized, the resin bound peptide is deprotected and detached from the resin via TFA cleavage. HPLC was
used for purification. The peptides 2 to 30 were modified by adding a cysteine residue to their N-terminus and to the Cterminus of peptide one. The C-terminus of each peptide overlaps with the N-terminus of the following peptide by 10 amino
acids (excluding the cystein). Peptide number 30 is 25 amino acids long, all others contain 21 amino acids. Rv1698 of M.
tuberculosis does not contain cystein. It was added to the peptides to make them suitable for other applications. Peptides
were synthesized by BIOMATIC, Inc. (USA).
24
25
4.2. Methods
4.2.2. Growth conditions
4.2.1. Standard protocols
Standard media
Composition per liter
Notes
LB broth
10 g NaCl
5 g Yeast extract
10 g Tryptone
E.coli
LB agar
same as LB broth
15 g Agar
E.coli
7H9 broth
4.7 g Middlebrook 7H9 broth
0.2% Glycerol
0.05% Tyloxapol
M. smegmatis
M. tuberculosis (OADC required)
7H9 broth (copper free)
0.5 g (NH4)2SO4
1.0 g KH2PO4
2.5 g Na2HPO4
0.1 g Sodium citrate
50 mg MgSO4
0.5 mg CaCl2
1 mg ZnSO4
0.5 mg L-Glutamic acid
40 mg Ammonium iron (III)-citrate
1.0 mg Pyridoxine hydrochloride
0.5 mg Biotin
0.2% Glycerol
0.05% Tyloxapol (add after outoclaving)
M. smegmatis
7H10 agar
9.5 g Middlebrook 7H10 agar
0.2% Glycerol
M. smegmatis
7H10 agar (copper free)
0.5 g (NH4)2SO4
1.5 g KH2PO4
1.5 g Na2HPO4
0.4 g Sodium citrate
25 mg MgSO4
0.5 mg CaCl2
1 mg ZnSO4
0.5 mg L-Glutamic acid
40 mg Ammonium iron (III)-citrate
1.0 mg Pyridoxine hydrochloride
0.5 mg Biotin
0.2% Glycerol
12.6 g Agar Noble
M. smegmatis
Standard methods
Enzyme / Kit
Source / Protocol
PCR
Native Pfu
New England Biolabs (see manual), www.neb.com
PuReTaq, PCR beads
GE Healthcare (see manual),
www.gehealthcare.com/illustra
AccuPrime
Pfx Supermix
Overexpression of MctB in E. coli and
purification
Dephosphorylation
Invitrogen (see manual), www.invitrogen.com
Song et al., 2008
Antarctic phosphatase New England Biolabs (see manual), www.neb.com
Ligation
T4 DNA-ligase
Invitrogen (see manual), www.invitrogen.com
Phosphorylation
T4 Kinase
Digestion of DNA
Restriction
endonucleases
Blunt-ending of DNA
T4 DNA-Polymerase
Plasmid preparation from E. coli
FastPlasmid
Mini Kit
Eppendorf (see manual), www.eppendorf.com
Plasmid Midi Kit
Quiagen (see manual), www.quiagen.com
Chromosomal DNA from mycobacteria
-
Jacobs and Hatfull 2000
Recovery of DNA from gels and solutes
GFX DNA purification
Kit
GE Healthcare (see manual),
www.gehealthcare.com/illustra
Protein concentration
BCA assay
Pierce, Inc. (see manual), www.piercenet.com
Western Blot
-
Southern Blot
-
Polyacrylamide gel electrophoresis
-
DNA gelelectrophoresis
-
ELISA (whole cells, lysed cells, protein)
-
Song et al., 2008
Surface accessibility assay
-
Siroy et al., 2008
Transformation of mycobacteria
-
Parish and Stoker 2001
Preparation of E. coli calcium chloride
competent cells
Transformation of E. coli
-
Copper sensitivity plate assay
-
Gold et al., 2008
Monoclonal antibody production
-
Epitope Recognition and Immunoreagent core
facility (ERIC) at UAB
Polyclonal antibody production
-
Song et al., 2008
Table 4.6: Standard methods.
2.0 g (NH4)2SO4
1.45 g K2HPO4 · 3H2O
0.85 g NaH2PO4 · H2O
0.01 g EDTA · 2H2O
0.1 g MgCl2 · 6H2O
1.0 mg CaCl2 · 2H2O
Hartman deBond (HdB) medium (copper
2.0 mg NaMoO4 · 2H2O
free) (Hartmans and De Bont 1992)
0.4 mg CoCl2 · 6H2O
1.0 mg MnCl2 · 4H2O
2.0 mg ZnSO4 · 7H2O
5.0 mg FeSO4 · 7H2O
0.5 % Glycerol
12.6 g Agar Noble (for solid media only)
M63 medium with acetamide
prepared as described in
(Posey et al., 2006)
M. tuberculosis (no OADC)
M. smegmatis
Supplements
26
Composition per liter
27
Notes / Concentrations
0.5 g Oleic acid
20 g Dextrose
OADC (Oleic acid-albumine-dextrose8.5 g NaCl
catalase additive for Middlebrook media)
40 mg Catalase
50 g BSA fraction V
required at 10% in Middlebrook 7H9
and 7H10 media for growth of
M. tuberculosis
Hygromycin
-
50 µg/ml for mycobacteria
200 µg/ml for E. coli
Kanamycin
-
30 µg/ml for mycobacteria
Ampicillin
-
Bathocuproine disulfonate (BCS)
-
1M (7-fold access to copper sulfate)
Sucrose
-
2% for M. tuberculosis
10% for M. smegmatis
Copper sulfate
-
at various concentrations for
mycobacteria
Table 4.7: Media and supplements. E. coli and M. smegmatis were grown at 37 C while shaking at 200 rpm.
M. tuberculosis was grown in 30 ml inkwell bottles at 37 C and at 40 C when indicated always shaking at 80 rpm. Larger
cultures were kept in roller bottles with a capacity of 200 ml on a roller incubator. Agar plates with M. tuberculosis were
wrapped in aluminum foil and sealed in a zip-log bag to keep them moist for several weeks.
4.2.3. Cloning of deletion vectors
The deletion vectors were cloned following standard methods (Tab. 4.6). The
construction of the suicide deletion vector pML343 and of the temperature-sensitive
Figure 4.2: Cloning strategy II. Plasmids are represented by cornered boxes. Yellow indicates parental, green newly
constructed and red final vectors. Light blue boxes indicate the treatment with restriction endonucleases and the size
of the obtained DNA fragment that has been used for further cloning. Orange boxes indicate the template DNA and
name of oligonucleotides used in PCR. Phosphorylation by T4 Kinase and dephosphorylation by alkaline
phosphatase are indicated by “+P” and “–P”, respectively. Mtb: M. tuberculosis; Msm: M. smegmatis; chrDNA:
chromosomal DNA. See Tab. 4.3 for primer sequences, Tab. 4.2 for plasmid features and Tab. 4.6 for methods.
deletion vector pML515 is shown in Figs. 4.1 to 4.3, respectively.
Figure 4.1: Cloning strategy I. Plasmids are represented by cornered boxes. Yellow indicates parental and green
newly constructed vectors. Light blue boxes indicate the treatment with restriction endonucleases and the size of the
obtained DNA fragment that has been used for further cloning. Complementary oligonucleotides were hybridized to
obtain double-stranded DNA-fragments (grey boxes). Phosphorylation of oligonucleotides by T4 Kinase prior
hybridization is indicated by “+P”. See Tab. 4.3 for oligonucleotide sequences and Tab. 4.6 for methods.
Figure 4.3: Cloning strategy III. Color scheme and treatments are according to Fig. 4.2. The temperature-sensitive
deletion vector pML515 is shown in red. Blund-ending of DNA fragments was achieved by T4 DNA-Polymerase (T4Pol) (see Tab. 4.6). XylE encodes catechol oxidase from E. coli. Hyg engodes the hygromycin resistance gene and
pUC-ori is an E. coli origin of replication.
28
29
4.2.4. Protocol for gene deletions in mycobacteria
A schematic outline of the protocol is shown in Fig. 4.4. Suicide vectors are transformed
into M. smegmatis SMR5 by electroporation (see Tab. 4.6) and plated on Middlebrook
7H10/hygromycin medium and incubated at 37°C. Chromosomal DNA was isolated from
several colonies. The integration of the suicide vector into the chromosome by a single
cross-over event was analysed by Southern blot and/or PCR (see Tab. 4.6 for
protocols). A confirmed candidate was then grown in Middlebrook 7H9/hygromycin
broth. The culture was pressed through a 5 µm-filter and plated on Middlebrook
7H10/hygromycin plates containing 10% sucrose to select for the double cross-over.
Candidates were analyzed by Southern blot and PCR. A verified double cross-over
candidate was then transformed with pCreSacB to excise the loxP-flanked hyg cassette.
A transformant was picked from Middlebrook 7H10/kanamycin plates and grown in
Middlebrook 7H9/kanamycin broth for 24 h to allow expression of Cre recombinase and
excision of the hyg cassette. The culture was pressed through a 5 µm filter and plated on
Middlebrook 7H10 plates containing 10% sucrose to counter-select against pCreSacB.
Several colonies were picked and grown on Middlebrook 7H10 plates containing
hygromycin, kanamycin or no antibiotics. Susceptibility to both antibiotics indicated the
loss of both the hyg cassette and the vector pCreSacB. Excision of the hyg cassette was
confirmed by Southern blot, PCR and/or sequencing of the chromosomal region of
interest. Deletion of genes in M. tuberculosis using temperature-sensitive deletion
vectors was done using a similar protocol. However, a clone carrying the replicating
temperature-sensitive deletion vector was isolated first. Selection for single and double
cross-over was similar as described for M. smegmatis but was carried out at 40 C
instead of 37 C to circumvent replication of the deletion vector. Sucrose was used at
2 % for counter-selection and OADC was added to all media prior inoculation with M.
tuberculosis. Direct selection for a double cross-over can also be achieved in both
organisms by plating the original culture on 7H10/hygromycin media plates containing
the appropriate concentration of sucrose. This selection step has to be carried out at
40 C for M. tuberculosis.
Figure 4.4: Schematic representation of the general protocol for gene deletions in mycobacteria. The temperaturesensitive deletion vector pML515 must be transformed and a clone of M. tuberculosis carrying the vector must be
obtained (white arrow) before any selection can be performed. Selection for double cross-over (DCO) can be
performed directly (orange arrow) or indirectly by selecting first for a single cross-over (SCO) (green arrow) and then
for a double cross-over (blue arrow). Hyg: Hygromycin; Kan: Kanamycin; Suc: sucrose. SCO, DCO and unmarked
mutant are confirmed by Southern blot and/or PCR (see Tab. 4.6). Reporter genes differentiate between SCO, DCO
and unmarked mutant as indicated by the circles. Circles filled in green or yellow indicate the presence of the
indicated reporter gene, while a white circle indicates its absence. G; Gfp; X: XylE.
4.2.5. Induction of gene expression by acetamide in M. smegmatis
The inducible acetamidase (AmiE) of M. smegmatis is highly expressed in the presence
of the inducer acetamide (Parish et al., 1997; Triccas et al., 1998). The regulatory region
upstream of amiE includes amiC, amiA, amiD and amiS (Fig. 4.5 A). AmiA encodes a
negative regulatory protein that binds to the promoter sequences within that region and
30
Results
prevents transcription of amiE. AmiC, another regulatory protein, binds to both
5. Results
acetamide and AmiA. When AmiA is captured by AmiC expression of amiE is increased
5.1. Phosphates can diffuse through the MspA channel
by 100-fold (Parish et al., 2001). The system has been used to achieve high level
expression of proteins (Triccas et al., 1998) and for conditionally gene expression
(Greendyke et al., 2002) in M. smegmatis. To construct an inducible expression cassette
for fluorescent proteins the entire regulatory-region was cloned from the genome of M.
smegmatis without the amiE gene and put into the mycobacterial shuttle vector pMS2.
Fluorescent protein genes like mycgfp2+ or mctB-mycgfp2+ were placed exactly at the
position of the amiE gene (Fig. 4.5 B). The cloning procedure is outlined in Fig. 4.6. A
Zeiss Axiovert 200 inverted epifluorescence microscope and an AxioCam CCD camera
(Zeiss; Germany) were used to visualize fluorescence in cells. Filter sets for Gfp were
obtained from Chroma Technology Corp. (Brattleboro, VT). Gene induction was induced
exactly as described previously (Posey et al., 2006).
31
Size, hydrophobicity and the charge of a molecule determine if it can utilize a particular
porin channel to cross the outer membrane (Nikaido et al., 1990; Nikaido 2003). The
narrowest part of the channel is usually referred to as constriction zone and as such
restricts the size of molecules that can pass through the pore (Cowan et al., 1992). A
preference for the passage of cations or anions is likely determined by net charges of
amino acid residues located at or near the constriction zone of the channel. The
preference for negatively charged substrates of the phosphate-starvation inducible PhoE
porin of E. coli was attributed to several lysine residues spread along the primary
sequence of the polypeptide chain (Benz et al., 1989). Likewise, the negatively charged
aspartic residues that form the restriction zone of MspA may contribute to the observed
preference for positively charged ions (Niederweis et al., 1999). The diffusion of
uncharged molecules through pores of similar sizes decreases as the substrate
becomes larger (Nikaido and Rosenberg 1983). Therefore, I wanted to examine if
computer modeling supports the uptake of phosphates through MspA. To this end, the
structures of PO43-, p-nitrophenylphosphate (pNPP) and 5-bromo-4-chloro-3-indolyl
phosphate (BCIP) were energy-minimized and displayed as surface representations that
Figure 4.5: Acetamide inducible acetamidase operon of M. smegmatis (A). The acetamide inducible amiE gene can
be replaced by other genes like mctB-mycgfp2+ (green box) which then can be expressed conditionally in the
presence of acetamide (B). The genes amiC, amiA, amiD and amiS (yellow box) are required for induced expression
of the amiE gene. Mycgfp2+ was fused to the mctB gene of M. smegmatis msm_3747.
Figure 4.6: Cloning of acetamide inducible expression vectors. Color scheme and treatments are according to Fig.
4.2. See Tab. 4.7 for media, Tab. 4.4 for oligonucleotide sequences and Tab. 4.2 for plasmid description. MctB:
msm_3747 of M. smegmatis, mycgfp2+: codon obtimized gfp for expression in mycobacteria.
showed both surface-accessible and solvent excluded areas (Fig. 5.1 A-C). The
computer modeling indicates that all three phosphates can fit through the pore of MspA
proteins.
Figure 5.1: Projection of inorganic phosphate (A), 5-bromo-4-chloro-3-indolyl phosphate (B) and p-nitrophenylphosphate
(C) within the channel of MspA. Note that aspartic residues of the constriction zone are negatively charged (shown in red).
All molecules and MspA are drawn to scale. Images were made using the Chimera software.
Results
32
5.2. Porin-mediated membrane permeability of phosphates in M. smegmatis
Gram-negative organisms such as E. coli have porins in the outer membrane through
which phosphate can diffuse. Although inorganic phosphate is the preferred source of
phosphorus, bacteria can also take up organic phosphates and release phosphate by
the action of periplasmic phosphatases such as PhoA (Wolschendorf et al., 2007).
Phosphatase activity has been demonstrated for M. smegmatis (Ahmed et al., 1978;
Kriakov et al., 2003), M. bovis BCG (Braibant and Content 2001) and M. tuberculosis
(Saleh and Belisle 2000).
Phosphate uptake systems of the inner membrane are induced during infection and are
essential for the growth of M. tuberculosis in macrophages. Since the diffusion of
phosphates through lipid membranes is extremely low (Chakrabarti and Deamer 1992),
it appears likely that slow-growing mycobacteria also use porins for that purpose. Indeed
the existence of a porin with specificity for anions has been demonstrated but the
encoding gene is still unknown (Lichtinger et al., 1999).
This project was set to develop a screening system based on the mycobacterial model
strain M. smegmatis. The system is intended to be used to identify novel porin genes of
M. tuberculosis that are involved in phosphate uptake across the outer membrane. To
this end, the uptake pathway for organic and inorganic phosphates was studied in porin
mutants of M. smegmatis. Msp porins were identified as the only outer membrane
channels for the diffusion of phosphates in that organism. The results are described and
discussed in detail in the following publication (Wolschendorf et al., 2007):
Wolschendorf F., Mahfoud M., Niederweis M. (2007). Porins are required for uptake of
phosphates by Mycobacterium smegmatis. J. Bacteriol. 189(6): 2435-42
Results
33
Results
34
Results
35
Results
36
Results
37
Results
38
Results
39
Results
40
Results
41
5.3. A new generation of gene deletion systems for mycobacteria
Gene deletions in bacteria are often achieved by allelic exchange by which the gene is
replaced or interrupted by a resistance marker. Only two reliable resistance markers
exist in mycobacteria conferring resistance to either hygromycin or kanamycin (Stephan
et al., 2004). Therefore, it is crucial to obtain unmarked deletion mutants when
consecutive gene deletions are required. To this end, a FRT-flanked hygromycin marker
was introduced by Stephan and coworkers (Stephan et al., 2004) into the deletion
cassette of suicide vectors (Fig. 5.2 A). The hygromycin marker was removed from the
chromosome by expressing Flp recombinase in the final deletion mutants which
recognizes and excises DNA fragments that are flanked by FRT-sites. This method was
used to generate double and triple porin mutants of M. smegmatis (Stephan et al.,
2005). Unfortunately, the FRT/Flp system did not work in M. tuberculosis (Stephan et al.,
2004) because the flp gene was not expressed in slow growing mycobacteria
Features
Resistance marker
Recombination identification sites
(RIS)
Previous system
(Stephan et al., 2004)
New system
hyg
Hyg
FRT
loxP
Upstream cloning sites (UCS)
PmeI, SpeI
AscI, SwaI
Downstream cloning sites (DCS)
PacI, SwaI
PacI, BfrBI
Counter-selectable marker
used in
rpsL
sacB
M. smegmatis
M. smegmatis
Additional features in
temperature-sensitive plasmids
Mycobacterial origin of replication
-
pAL5000ts
Reporter I
-
psmyc mycgfp2+
Reporter II
-
pwmyc xylE
-
M. smegmatis,
M. bovis BCG,
M. tuberculosis
used in
Table 5.1: Comparison between previous and new designed deletion vector
systems. hyg: hygromycin resistance marker; FRT: identification sites for the site
specific recombinase Flp; loxP: identification site for the site specific recombinase
Cre; PmeI, SpeI, AscI, SwaI, PacI, BfrBI are restriction sites recognized by the
corresponding restriction endonucleases; rpsL: ribosomal protein (reconstitutes
streptomycin resistance in streptomycin sensitive strains that carry the mutated
rpsL* gene); sacB: gene for levansucrase; mycgfp2+: encodes a codon optimized
green fluorescent protein for expression in mycobacteria; xylE: encodes catechol
oxidase; psmyc: strong mycobacterial promoter for constitutive gene expression;
pwmyc: weak mycobacterial promoter for constitutive gene expression; pAL5000ts:
temperature-sensitive mycobacterial origin of replication
Results
42
Results
43
(Song and Niederweis 2007). In addition, Stephan and coworkers used the rpsL gene as
5.3.1. Construction of a new suicide deletion vector for M. smegmatis.
counter-selectable marker on all their deletion vectors. This marker requires a prior point
Only two reliable antibiotic markers are available for mycobateria which confer either
mutation in the chromosomal rpsL gene of the host strain which confers resistance to
resistance to hygromycin or kanamycin. We chose the hygromycin marker for gene
streptomycin. Since we intended to study the importance of putative porin genes for
deletions since the kanamycin resistance cassette was already used in other plasmids
virulence of M. tuberculosis, we wanted to create unmarked gene deletions in wild-type
needed to further manipulate mutant strains. The previous FRT/Flp system was not
M. tuberculosis. To this end, I redesigned and constructed a series of new deletion
functional in M. bovis BCG (Stephan et al., 2004) or M. tuberculosis. The low G + C
vectors. Firstly, a new suicide deletion vector was created that carries sacB and not rpsL
content of 38% of the S. cerevisiae flpe gene impaired its expression in mycobacteria
as counter-selectable marker and the FRT sites were replaced by loxP sites, the
which have an average G + C content of greater than 65% (Song and Niederweis 2007).
substrate for Cre recombinase (Fig. 5.2 B). Secondly, the new suicide vector was
Therefore, I replaced the FRT sites by loxP sites by constructing a new loxP-flanked
converted into a conditionally replicating deletion vector by introducing the temperature-
hygromycin cassette. Since the rpsL marker requires a prior point mutation in the
sensitive mycobacterial origin of replication pAL5000ts (Fig. 5.2 C). Lastly, the reporter
chromosomal rpsL gene it was replaced by the counter-selectable marker sacB from
genes mycgfp2+ and xylE were introduced into the deletion cassette and the plasmid
Bacillus subtilis.
backbone, respectively (Fig. 5.2 D). The features of the previous (Stephan et al., 2004)
synthesizes high-molecular-weight levans that accumulate within the periplasm which is
and new deletion vector systems are listed in Tab. 5.1. The cloning strategy is described
lethal for most Gram-negative bacteria and mycobacteria (Pelicic et al., 1996). SacB was
in section 4.2.3 (Figs. 4.1-4.3).
used before to generate mutants of fast and slow growing mycobacteria by counter-
The
encoded
enzyme
levansucrase
hydrolyses
sucrose
and
selection on sucrose-containing agar plates (Pelicic et al., 1996). The cloning sites
flanking the loxP-hyg-loxP cassette were optimized by using mainly restriction sites that
are rare in the chromosome of M. tuberculosi. AscI / SwaI represent the upstream and
PacI / BfrBI the downstream cloning sites which are intended to be used for the
integration of up- and downstream homolog regions that flank the target gene. Two PmeI
restriction sites were introduced that allow the convenient exchange of the deletion
cassette between different deletion vectors. PmeI does not cut within the chromosome of
M. tuberculosis. Based on this new suicide vector, I constructed the vector pML343 (Fig.
5.6 A, see section 4.2.3 for cloning strategy) which was used to inactivate the
msm_3747 gene of M. smegmatis (see section 5.5.3).
5.3.2. A new general gene deletion system for mycobacteria
Suicide deletion vectors do not replicate and thus must integrate into the chromosome
after transformation to confer resistance. Since homolog recombination is a rare event in
mycobacteria, the success of suicide vectors depends solely on the transformation
Figure 5.2: Schematic representation of mycobacterial deletion vectors. A: previous suicide vector (Stephan et al., 2004),
B: enhanced suicide vector; C: temperature-sensitive deletion vector; D: temperature-sensitive deletion vector with
reporter genes. Features are described in Tab. 5.1.
efficiency which may be one reason why suicide vectors are not frequently used in slow
growing mycobacteria (Pelicic et al., 1996; Stephan et al., 2004). The available vectors
were also difficult to modify. Therefore, I designed new conditionally replicating deletion
vectors (see section 5.3.1) suitable for fast and slow growing mycobacteria (Fig. 5.2 C,
Results
44
Results
45
D). By introducing the temperature-sensitive mycobacterial origin of replication
indicates that the plasmid backbone was not removed from the chromosome and
pAL5000ts into the suicide vector, a new generation of deletion vectors was created that
colonies turn yellow when sprayed on with catechol solution. Mycgfp2+, a codon
no longer depend on high transformation efficiencies. In M. tuberculosis, these vectors
optimized gfp for expression in mycobacteria, was introduced into the deletion cassette
replicate at 37 C and generate 3 to 5 copies per cell (Stover et al., 1991) providing
for two reasons. (i) Its presence indicates that resistance to hygromycin is not
sufficient amounts of template DNA in each cell. However, replication of the plasmid
spontaneous but plasmid-mediated, and (ii) it indicates the excision of the hygromycin
would interfere with selection. The pAL5000ts origin is not able to replicate in M.
resistance cassette in order to unmark the deletion mutant. By using the temperature-
tuberculosis at 40C and both selection steps must be carried out at that temperature in
sensitive deletion vector pML515 (Fig. 5.6 B) which carries both reporter genes, the
order to achieve allelic exchange. A derivative of this vector, pML563, was used to
rv1698 deletion mutant of M. tuberculosis was obtained by direct selection for the double
delete the outer membrane protein ompA from the chromosome of M. tuberculosis. The
cross-over (see. 5.5.4)
complete procedure describing the construction of an unmarked deletion mutant of M.
Figure 5.3: Temperature-sensitive deletion vector for
rv1698. BfrBI, SwaI, AscI, PacI and PmeI are restriction
sites recognized by the corresponding restriction
endonucleases. Uprv1698 and dorv1698 mark the upstream
and downstream homolog regions of rv1698. hyg:
hygromycin resistance gene; sacB: encodes levansucrase
enzyme; pUC-origin: E. coli origin of replication;
pAL5000ts: mycobacterial temperature-sensitive origin of
replication; loxP: Cre recombinase recognition sites.
tuberculosis has been published as book chapter in “Mycobacteria Protocols” (see
section 5.5.1)(Song et al., 2008b).
5.3.3. The introduction of reporter genes into conditionally-replicating deletion
vectors
The creation of unmarked deletion mutants in M. tuberculosis is tedious, since the
generation time of M. tuberculosis is 24 h. Our goal was to develop a protocol that allows
the construction of unmarked deletion mutants in less than 6 month. Allelic exchange is
achieved by two consecutive steps each selecting for a specific DNA cross-over
achieved by homolog recombination (Fig 2.9). These two steps can be combined into
one selection process which would save up to six weeks. The rv1698 homolog of M.
bovis BCG is identical to rv1698 of M. tuberculosis. Therefore, it was attempted to delete
the gene in M. bovis BCG by direct selection for the double cross-over. More than 50
candidates were analyzed by Southern blot and/or PCR but none of them had lost the
gene. We could think of three reasons that would explain the high number of falsepositive candidates. The high selective pressure created i) spontaneous hygromycin
resistant mutants, ii) caused the integration of the deletion vector pML336 (Fig. 5.3)
elsewhere in the chromosome by illegitimate recombination or iii) the vector integrated
correctly by a single cross-over event but the counter-selectable marker failed to be
functional. The high number of incorrect candidates indicates that the above mentioned
illegitimate processes occur more frequently than the correct double cross-over.
Therefore, we introduced two reporter genes into the conditionally replicating deletion
vectors. The reporter gene encoding catechol oxidase, xylE, was introduced into the
backbone of the conditionally replicating deletion vector (Fig. 5.2 D). XylE activity
5.4. Rv1698 homologs in mycobacteria
Rv1698 of M. tuberculosis was annotated as a protein of unknown function due to the
lack of significant homology to any characterized protein (www.tigr.org). However, the
gene was identified as a potential outer membrane protein (Song et al., 2008). Bilayer
experiments demonstrated that Rv1698 forms pores in artificial membranes and,
overexpression of rv1698 in porin mutants of M. smegmatis partially restored glucose
uptake and sensitivity to ampicillin (Siroy et al., 2008). A homology search revealed that
the gene is present in mycobacteria and some distant relatives only. The rv1698 locus is
conserved among mycobacteria (Fig. 5.4) including M. leprae indicating that its function
is likely important. The upstream located gene rv1697 is co-transcribed with rv1698
(personal communication, O. Danilchanka). Both genes are 21 bp apart in M.
tuberculosis. No function has yet been assigned for Rv1697. High density mutagenesis
experiments indicate that rv1697 but not rv1698 are essential for the growth of M.
Results
46
tuberculosis in vitro (Sassetti et al., 2003). The gene encoding CTP sythetase (pyrG) is
located approximately 140 bp downstream of rv1698 which was also found to be
essential for growth of M. tuberculosis in vitro (Sassetti et al., 2003). The promoter of
pyrG has not yet been identified.
Figure 5.4 Organization of the chromosomal rv1698 homolog regions in Corynebacteriaceae. Sequence data and
annotations were obtained from www.tigr.org. Identity values were calculated using VNTI software (Invitrogen) and relate
to the Rv1698 protein of M. tuberculosis. Genes are drawn to scale.
5.5. Deletion of putative outer membrane proteins in mycobacteria
5.5.1. Gene deletion protocol for mycobacteria
We have constructed new vectors for gene deletions in mycobacteria. The vectors and
the protocol for the creation of gene deletion mutants in slowly growing mycobacteria
such as M. tuberculosis or M. bovis BCG have been published. The relevant book
chapter is presented here.
Song, H., F. Wolschendorf and M. Niederweis (2008). Construction of unmarked
deletion mutants in mycobacteria. Mycobacteria protocols. T. Parish and A. C. Brown.
Totowa, NY, Humana Press: p.279-95.
Results
47
Results
48
Results
49
Results
50
Results
51
Results
52
Results
53
Results
54
Results
55
Results
56
Results
57
Results
58
Results
59
Results
60
Results
61
Results
62
Results
63
5.5.2. Deletion strategy for rv1698 / msm_3747
Rv1698 of M. tuberculosis was identified as a potential outer membrane protein (Song et
al., 2008). It demonstrated porin properties in vitro and in vivo (Siroy et al., 2008). We
therefore wanted to determine its physiological function in M. smegmatis and
M. tuberculosis. Earlier attempts to delete the complete msm_3747 gene from the
genome of M. smegmatis failed (personal communication, Claudia Mailaender and
Michael Niederweis). The gene is flanked upstream by msm_3748, a gene of unknown
function, and downstream by pyrG which encodes CTP-synthase. The homologs of both
genes are essential for the growth of M. tuberculosis in vitro (Sassetti et al., 2003). In
order to preserve the C-terminal coding region of rv1698 which may contain elements
important for the expression of the pyrG gene, it was decided to only interrupt the gene
near the N-terminal coding region (Fig. 5.5). Subsequently, 45 bp from the deletion
vector remain in the unmarked mutant and destroy expression of rv1698 or msm_3747
by introducing several stop codons (Fig. 5.5 B). This short sequence will replace 39 bp
and 29 bp of the N-terminal coding region of the genes, respectively (Fig. 5.4 A),
keeping most of rv1698 and the surrounding genes intact.
The suicide deletion vector pML343 (Fig. 5.6 A) was constructed to delete msm_3747 in
M. smegmatis (section 5.5.3) and the temperature sensitive deletion vector pML515 (Fig.
5.6 B) for rv1698 in M. tuberculosis (5.5.4). Previously published protocols using suicide
vectors in M. smegmatis (Stephan et al., 2004) and temperature-sensitive deletion
vectors in M. tuberculosis (Song et al., 2008) were modified to be compatible with
features of the new deletion vectors (Tab. 5.1).
Results
64
Results
65
5.5.3. Deletion of msm_3747 in M. smegmatis
The procedure to obtain unmarked deletion mutants of M. smegmatis using suicide
vectors is outlined in section 4.2.4 (Fig. 4.4). Two single cross-over candidates were
obtained
after
M.
smegmatis
was
transformed with the suicide deletion
vector
for
msm_3747,
pML343.
The
deletion vector harbors two regions that
are also present in the chromosome.
Homolog recombination can occur either
between the upstream or the downstream
homolog
regions
integration
of
the
and
leads
plasmid
to
the
into
the
chromosome (Fig. 2.9). Chromosomal
DNA of both candidates and wild-type
were digested with PstI and the DNA was
Figure 5.5: Chromosomal inactivation of rv1698 / msm_37476. A: Strategy for deletion of rv1698 / msm_3747. Only 39
and 29 bp (yellow) are subsequently deleted in M. tuberculosis and M. smegmatis, respectively. B: A short sequence of
45 bp (green) remains in the unmarked mutant replacing or interrupting the gene of interest. This sequence consists of
loxP and the flanking restriction sites SwaI and PmeI (green). Stop codons are indicated by red asterisks.
probed with the downstream region of
msm_3747 by Southern blot (see Tab. 4.6
for protocols). The correct integration of
Figure 5.7: Double cross-over selection of M. smegmatis.
Small, compact (red arrow) and big, dispersed (black
arrow) colonies were obtained by double cross-over
selection on Middlebrook 7H10 agar supplemented with
hygromycin and 10 % sucrose. The scale bar equals 1
mm. Picture was taken with a microscope (Stemi 2000-C,
Zeiss) and an AxioCam MRc camera (Zeiss).
Magnification: 10 fold
the deletion vector was confirmed for both
candidates (data not shown). Double
cross-over candidates were obtained on
solid medium containing hygromycin and
10% sucrose. Candidates grew either as
small compact or big and dispersed
colonies (Fig. 5.7) with a ratio of 1:3,
respectively. Colonies of each kind were
analyzed in Southern blot experiments
which confirmed that the msm_3747 was
Figure 5.6: Mycobacterial deletion vectors. A: The suicide deletion vector pML343 was used to delete msm_3747 of
M. smegmatis. B: The vector pML515 is replicative at 37 ºC and was used to inactivate rv1698 of M. tuberculosis. BfrBI,
SwaI, AscI, PacI and PmeI are restriction sites recognized by the corresponding restriction endonucleases. The upstream
(up) and downstream (do) homolog regions for msm_3747 (A) and rv1698 (B) flanking the deletion cassette. bla: lactamase, hyg: hygromycin resistance gene, sacB: encodes levansucrase enzyme, pUC-origin: E. coli origin of
replication, pAL5000ts: mycobacterial temperature-sensitive origin of replication, loxP: Cre recombinase recognition sites,
mycgfp2+: codon-optimized green fluorescent protein gene for mycobacteria, xylE: gene for catechol oxidase
successfully
inactivated
in
all
small
colonies while all big colonies turned out
to be single cross-overs, which indicates
inactivation of the sacB counter-selectable
marker gene. To remove the hygromycin
Figure 5.8: Colony morphology of M. smegmatis mutants.
A-D: Colony morphology of wild-type (A), the unmarked
msm_3747 deletion mutant of M. smegmatis ML77 (B),
ML77 complemented with msm_3747 (pML450) (C) and
rv1698 (pMN035) (D). Colony diameters were quantified
in (E). Pictures were taken using a microscope (Stemi
2000-C, Zeiss) and an AxioCam MRc camera (Zeiss).
Magnification: 10-fold.
Results
66
Results
67
marker, the double cross-over clone number one was transformed with pCreSacB. The
M. smegmatis and the msm_3747 mutant ML77 on Luria-Bertani medium on which both
plasmid carries the Cre recombinase which mediates the excision of the loxP flanked
strains grew equally well (Fig. 5.9 D, E). From these experiments we concluded that
hygromycin cassette. The final unmarked mutant was confirmed by Southern blot
ML77 may be more susceptible to a compound present in Middlebrook 7H10 medium.
analysis and sequencing of the genome (see section 5.6 for details). The unmarked
This compound was identified as copper which is present at 6.3 µM in Middlebrook
msm_3747 mutant of M. smegmatis was named ML77 and complemented with the
media. The growth defect of mutant colonies was fully restored on copper free 7H10
msm_3747 and rv1698 expression plasmids pML450 and pMN035, respectively. Growth
medium or by adding the copper complexing agent beast serum albumin to Middlebrook
of ML77 on solid Middlebrook 7H10 medium was very slow. Expression of msm_3747 or
7H10 medium (Fig. 5.9 F-I). This phenotype is described and further analysed in section
rv1698 restored the diameter of single colonies to wild-type level (Fig. 5.8 A-D) indicating
5.6.
that this phenotype was caused by the loss of Msm_3747 function and that both proteins
have the same function. The widest area of colonies was measured using photographs
showing that the diameter of mutant colonies was reduced by 4-fold in relation to wildtype or the complemented strains (Fig. 5.8). It was concluded that deletion of msm_3747
in M. smegmatis inhibits growth on regular Middlebrook 7H10 media plates. The
observed 4-fold smaller diameter of mutant colonies grown on Middlebrook 7H10
standard medium (Fig. 5.8) indicated a growth defect. A similar phenotype was observed
for the mspA/mspC double porin mutant ML10 of M. smegmatis (Fig. 5.9 A-C). However,
the lack of Msm_3747 did not reduce the permeability of M. smegmatis to glucose,
which serves as a model solute for testing porin activity in M. smegmatis (Stahl et al.,
2001;
Stephan
et al.,
2005). We then compared the
growth
of wild-type
Figure 5.9: Growth defect of M. smegmatis and
mutants on different media. strains: M.
smegmatis wild-type (A, D-F), M. smegmatis
ML10 (mspA / mspC) (B), M. smegmatis
ML77 (msm_3747) (C, G-I); growth media:
Middlebrook 7H10 medium (A-C, E, H)
supplemented with beast serum albumine (F, I),
Luria-Bertani medium (D, G); Magnifications:
12.5-fold (A-C), 20-fold (D-I); incubation time: 6
days (A-C), 5-days (D-I). Scale bars are 1 mm.
Pictures A to C are digitally magnified. The
copper concentration in Middlebrook 7H10
media is 6.3 µM.
5.5.4. Deletion of rv1698 in M. tuberculosis
Previous attempts to delete rv1698 in M. bovis BCG failed (see section 5.3.3).
Consequently, I further improved the deletion vectors by introducing the reporter genes
xylE and mycgfp2+. The temperature-sensitive deletion vector pML515 (Fig. 5.6 B) was
constructed to inactivate rv1698 of M. tuberculosis according to sections 4.2.3 and 5.5.2.
Double cross-over candidates are usually obtained by two consecutive selections that
first generate a single cross-over and then the double cross-over (Fig. 4.4). However,
direct selection is also possible but very inefficient as the probability of two
simultaneously occurring DNA cross-over events is very small and the number of falsepositive candidates was overwhelming in M. bovis BCG (see section 5.3.3). However,
the reporter gene profile of colonies can help to distinguish between false-positive and
correct double cross-over candidates. The double cross-over for rv1698 was obtained by
direct selection (Fig. 4.4) for double cross-over candidates. Only 12 colonies grew on
plates that contained hygromycin and
2% sucrose. The correct reporter gene
profile (Gfp positive and XylE negative)
was found in only two colonies while the
other 10 were tested positive for both
indicating that the counter-selectable
marker sacB was inactivated (Fig. 5.10).
The two positive clones were analyzed
by PCR confirming the correct double
cross-over in both candidates. The loxPmycgfp2+-hyg-loxP
cassette
was
Figure 5.10: Reporter gene analysis of double cross-over
candidates of M. tuberculosis. Clones that grew in the
presence of 2% sucrose (A) were tested for XylE activity by
adding 1% catechol solution directly onto the colonies (B).
Mycgfp2+ was excited using UV light (366 nm). Pictures
were taken with a fluorescence microscope (Stemi 2000-C,
Zeiss). DNA cross-over by homolog recombination removes
sacB and xylE from the chromosome allowing growth in the
presence of sucrose. This process is associated with the
loss of XylE activity (white arrows). Yellow colonies (yellow
arrows) indicate that xylE is still present and that sacB was
inactivated.
Results
68
Results
69
removed in one clone as described in section 4.2.4 and the final candidate was sensitive
to hygromycin and kanamycin (Fig. 5.11 A-C). The digestion pattern of the mutated
rv1698 gene, which was amplified from chromosomal DNA by PCR (Fig. 5.11 D)
confirmed the presence of two new restriction sites SwaI and PacI, indicating the
inactivation of rv1698 as it was shown in Fig. 5.5 B and the correct removal of the
resistance marker cassette. Sequencing of the mutated gene also confirmed the
presence of the loxP site (data not shown). To examine the role of Rv1698 for the
resistance of M. tuberculosis to copper, we used dilutions of M. tuberculosis culture in a
drop assay as described previously (Gold et al., 2008). Wild-type M. tuberculosis and the
rv1698 mutant ML256 grew with the same rate on Middlebrook 7H11 agar plates
containing OADC. Addition of 150 µM CuSO4 severely reduced the growth of the rv1698
mutant in contrast to wild-type (Fig. 5.12) which also indicates that the copper
concentration exceeds the binding capacity of albumin, a component of OADC
Figure 5.12: Copper dependent growth defect of the rv1698 mutant of M. tuberculosis. The growth defect of the rv1698
mutant (B) is more pronounced at 150 µM copper than for wild-type (F). The toxicity of access copper can be neutralized
by the Cu+-binding agent bathocuproine disulfonate (BCS) (D, H) which by itself does not influence growth (C, G). Strains:
M. tuberculosis H37Rv (wild-type) (A-D) and M. tuberculosis ML256 (rv1698) (E-H); Media: 7H11 supplemented with
10% OADC (A-H) and 150 µM CuSO4 (B, F) or 1 M BCS (C, G) or both (D, H); Magnification: 10-fold; Incubation time: 28
supplement (Tab. 4.7). OADC is required for the growth of M. tuberculosis on
Middlebrook 7H11 medium. To neutralize surplus copper, we added the Cu+-binding
5.6 The role of MctB in mycobacteria
agent bathocuproine disulfonate (BCS) which protected M. tuberculosis from the toxic
Our study describes the discovery of the first outer membrane component of an efflux
effects of CuSO4. This indicates that Cu+ is more toxic for the rv1698 mutant than for
system in mycobacteria. The finding that channel proteins are required for both uptake
wild-type M. tuberculosis. A similar effect was observed for an M. tuberculosis mutant
and efflux of the essential micronutrient copper across the outer membrane of
with a defect in production of the metallothionine MymT (Gold et al., 2008)
M. tuberculosis
demonstrating that M. tuberculosis has at least two effective mechanisms to maintain
M. tuberculosis. The implications of these findings for our understanding of transport
copper homeostasis.
mechanisms and, in particular efflux systems, in mycobacteria are profound.
considerably
revises
the
model
of
copper
homeostasis
in
We discovered that M. tuberculosis is extraordinarily susceptible to copper (10-20 mM).
Figure 5.11: analysis of the unmarked rv1698 deletion mutant ML256 of
M. tuberculosis. Sensitivity to hygromycin (B) indicates the successful excision
of the hygromycin marker from the chromosome by the action of Cre
recombinase which is encoded on the vector pCreSacB. This vector was
removed since resistance to kanamycin was lost (C). A short sequence
marked by the restriction sites PacI and SwaI is created when Cre
recombinase removes the loxP flanked hygromycin marker from the
chromosome. This sequence interrupts and inactivates rv1698. Both restriction
sites are present within the rv1698 gene of the unmarked deletion mutant (D).
Importantly, similar copper concentrations were determined in M. tuberculosis-containing
phagosomes of macrophages. Further, phagosomal copper concentrations appeared to
increase upon stimulation of the macrophages with interferon-. Thus, activated
macrophages appear to deliver copper at concentrations sufficient to inhibit or kill
M. tuberculosis. These findings suggest that macrophages may utilize copper as a
defensive weapon against M. tuberculosis and perhaps other bacterial pathogens. This
study changes our paradigm of how molecules are transported in M. tuberculosis and
has also revealed copper susceptibility as an Achilles heel of this important pathogen.
The following manuscript has been submitted to the Journal Proceedings of the National
Academie of Science of the United States of America:
Results
70
Frank Wolschendorf, Tej B. Shrestha, Stefan H. Bossmann, and Michael Niederweis
(2008) Outer membrane channel proteins are required for copper homeostasis in
Mycobacterium tuberculosis. Proc.Natl.Acad.Sci., submitted
Results
71
Results
72
Results
73
Results
74
Results
75
Results
76
Results
77
Results
78
Results
79
Results
80
Results
81
Results
82
Results
83
Results
84
Results
85
5.7. Surface accessibility of Rv1698 (MctB) by proteinase K
Insertion of large, open, water-filled channel proteins such as porins (Guilvout et al.,
2006) or colicins (Cascales et al., 2007) into the inner membrane of bacteria is a lethal
event, most likely because of the immediate breakdown of the proton gradient.
Considering its channel characteristics, we therefore assumed that Rv1698 is an outer
membrane protein. To determine the subcellular localization of Rv1698 and to examine
whether the Rv1698 protein has surface-exposed loops, we employed protease
accessibility as previously described for the surface protein PE_PGRS33 encoded by the
rv1818c gene of M. tuberculosis (Delogu et al., 2004). Proteinase K cleaves
Msmeg_3747 in 160 and Rv1698 in 158 positions evenly distributed along the entire
protein molecule. Thus, in principle, even small surface-exposed loops should be
cleaved if Rv1698 is accessible to the protease in whole cells. Green fluorescent protein
and PE_PGRS33HA were used as controls for a cytoplasmic protein and as a surfaceexposed protein (Delogu et al., 2004), respectively. The signal for green fluorescent
protein is identical in both samples, indicating that the cell envelope was intact during
proteinase K treatment (Fig. 5.13). By contrast, the PE_PGRS33HA protein disappeared,
demonstrating that PE_PGRS33HA is surface-accessible consistent with previous results
(Delogu et al., 2004; Cascioferro et al., 2007). Importantly, the intensities of the bands of
the full-length Msmeg_3747 and Rv1698 was reduced by 60% upon proteinase K
treatment, demonstrating that both proteins are surface-exposed. It should be noted that
the detection of smaller fragments of Msmeg_3747 and Rv1698 was only possible
because of the use of an Rv1698-specific antiserum. This is in contrast to the reference
protein PE_PGRS33HA, which disappears completely most likely because of the removal
of the hemagglutinin tag from the protein by proteinase K (Fig. 5.13). Further, the
observation of shorter peptides also indicates that some parts of Msmeg_3747 and
Rv1698 are protected from proteinase K cleavage, probably because of domains buried
in the outer membrane.
This paragraph was my contribution to the following publication:
Siroy A., Mailaender C., Harder D., Koerber S., Wolschendorf F., Danilchanka O.,
Wang Y., Heinz C., Niederweis M. (2008). Rv1698 of Mycobacterium tuberculosis
represents a new class of channel-forming outer membrane proteins. J.Biol.Chem.
283(26): 17827-37
Results
86
Figure 5.13: Surface accessibility of Rv1698
in M. smegmatis by digestion with
proteinase K. Whole cells of M. smegmatis
were treated with proteinase K (+) or with PBS
as a control (–). After adding protease inhibitors,
the cells were washed in PBS buffer, and
proteins were extracted with SDS by boiling.
The solubilized proteins were analyzed in a
10% polyacrylamide gel and transferred to a
polyvinylidene difluoride membrane. The
proteins on these blots were specifically
detected using the appropriate antibodies. The
samples were extracts from M. smegmatis
containing the plasmids pMN437 (green
fluorescent
protein
(Gfp)),
pMV61015.1
(PE_PGRS33HA), pML451 (Msmeg_3747His),
and pML911 (Rv1698His). M: molecular mass
marker. Figure was taken from (Siroy et al.,
2008).
Results
87
MctB translocated as folded protein. However, the predicted signal peptide of MctB lacks
a twin-arginine motive and thus is likely not a substrate for the TAT system. Hence we
postulate that MctB is translocated by another yet unknown translocation system.
5.8. MctB is exported in a folded conformation
It has been shown in E. coli that Gfp has to be translocated in its folded and active
conformation across the inner membrane in order to be functional in the periplasm.
Thus, Gfp can be used for cellular localization studies (Feilmeier et al., 2000; Thomas et
al., 2001). Previously, Gfp was used to study the twin-argine translocation system in M.
smegmatis (Posey et al., 2006). In order to demonstrate the translocation of MctB, an
Figure 5.14: Translocation and localization of MctB-Gfp fusion protein in M. smegmatis. Cells were brought in focus under
bright light (A-C) and fluorescent proteins were excited with UV light using a Gfp-filterset from Chroma, Inc. (USA).
SPTorAGfp: gfp fused to the TAT-dependent signal peptide of the trimethylamin N-oxide reductase gene torA (A, D); MctBGfp: C-terminal fusion of Msm_3747 (MctB) of M. smegmatis to Gfp (B, E); Gfp: green fluorescent protein (D, F). Gfp in
(E) and (F) is encoded by the codon-optimized mycgfp2+ gene for expression in mycobacteria.
inducible fusion protein MctB-Gfp was constructed using the acatamide inducible
acetamidase operon from M. smegmatis (Parish et al., 1997). Gene expression was
5.9. MctB in whole cells is not accessible to polyclonal antibodies
stopped by washing cells in acetamide-free medium followed by a short outgrowth
The MctB-Gfp fusion protein is translocated across the inner membrane in its folded and
period of 3 h giving the cells enough time to translocate the already synthesized fusion
active conformation. The translocation of fully folded and activated proteins is usually
proteins and thereby decreasing background fluorescence of the cytosol. The plasmid
accomplished by the twin-arginine translocation (TAT) system which is also functional in
pUGA61B was obtained from the Posey lab (Posey et al., 2006) which carries a gfp
mycobacteria (McDonough et al., 2005). However, the predicted signal peptide of MctB
gene fused to the signal sequence of the torA gene (SPtorAgfp) which is recognized by
does not contain a twin-arginine motive and thus, is likely not a substrate of the TAT
the twin-arginine translocation (TAT) machinery. It was confirmed by fluorescence
system. Hence, we propose that MctB is translocated by a novel secretion system
microscopy that SPTorAGfp fluorescence accumulates in the periphery of cells indicating
capable of translocating fully folded proteins. In order to explore the translocation
its translocation (Fig. 5.14 A, D). By contrast, the fluorescence of Gfp expressed by the
machinery of MctB, tools are needed to detect MctB in the outer membrane. Therefore,
same acetamide inducible system is evenly distributed throughout the entire cell lumen
we wanted to know if polyclonal antibodies can be used to detect and quantify MctB
(Fig. 5.13 C, F) indicating its localization in the cytoplasm. However, the MctB-Gfp fusion
proteins in whole cells by ELISA. The presence of surface-exposed loops was shown by
protein accumulated in the periphery of the cell indicating its translocation (Fig. 5.14 B,
proteinase K accessibility experiments (see section 5.7) (Siroy et al., 2008). The
E). Since Gfp is only functional outside the cytoplasm when translocated as fully folded
polyclonal antibodies (Song et al., 2008) were raised in rabbits against recombinant
and active protein (Feilmeier et al., 2000; Thomas et al., 2001) it was concluded that
Results
88
Results
89
MctB protein from E. coli. The MctB genes of M. bovis BCG and M. tuberculosis are
antibodies were subcloned to achieve homogeneous isolates and the resulting library of
identical. Therefore, we used whole cells of M. bovis BCG for this study. In order to
monoclonal antibodies was analyzed by ELISA (see section 5.10.1.) and epitope
amplify the signal we overexpressed MctB by the vector pMN035 (Siroy et al., 2008) in
mapping (see section 5.10.2). Hybridomas were generated and subcloned by the
M. bovis BCG giving a 3.5-fold stronger signal by ELISA experiments (Fig. 5.15). The
Epitope Recognition and Immunoreagent Core Facility (ERIC) at the University of
polyclonal antibody did not detect MctB in whole cells but gave a strong signal for the
Alabama at Birmingham.
cell lysate. After ultra centrifugation of the cellular lysate, MctB was only detectable in
the pellet not in the supernatant confirming its association with the membrane (Song et
5.10.1. Specificity of monoclonal antibodies
al., 2008). The results indicate that MctB is not surface-accessible to antibodies.
The library of monoclonal antibodies was analyzed as follows: i) recognition of 1 ng M.
Possible surface-exposed loops may thus be protected by other outer membrane
tuberculosis MctB protein by ELISA, recognition of MctB in ii) whole and iii) lysed cells of
proteins and lipids which hinders antibodies from binding. A similar scenario has been
M. smegmatis expressing M. tuberculosis MctB and iv) cross-reactivity with MctB of M.
proposed for the porin Oms66 of B. burgdorferi (Bunikis and Barbour 1999; Exner et al.,
smegmatis. We also mapped the epitope of each monoclonal antibody (see 5.10.2). The
2000). It was concluded that polyclonal antibodies are not suitable to detect surface
data are summarized in Tab. 5.2. We analyzed 23 monoclonal antibodies that
exposed loops of MctB proteins in whole cells although they are accessible to
proteinase K.
Clone/mAb
Figure 5.15: Detection of MctB in subcellular fractions of M. bovis BCG by Enzyme-Linked ImmunoSorbent Assay
(ELISA). MctB was overexpressed in wild-type (wt) M. bovis BCG using the expression vector pMN035. Whole cells were
lysed by sonification. Soluble proteins and insoluble particles were separated by ultracentrifugation (100.000xg for 1 h)
into supernatant and pellet.
1 ng rRv1698
M. smegmatis expressing MctB
recognized peptides
10 ng MctB protein of
of M. tuberculosis
of synthetic MctB
M. smegmatis
library
Whole cells
Lysed cells
1D1.6

-

-
2C6.1

-

-
5
?
4B2.3

n.a.
n.a.
n.a.
4,5,6,7
5,7,21
4B2.5

n.a.
n.a.
n.a.
4B2.10

n.a.
n.a.
n.a.
5,7
4B2.13

n.a.
n.a.
n.a.
5,7
28
5A3.21

-

-
5B2.9

n.a.
n.a.
n.a.
28
5C2.1

n.a.
n.a.
n.a.
28
5C2.10

n.a.
n.a.
n.a.
28
5C2.6

n.a
n.a
n.a
28
5C3.15

n.a.
n.a.
n.a.
28
5C3.17

n.a.
n.a.
n.a.
28
5C3.23

n.a
n.a
n.a
28
5C3.25

n.a.
n.a.
n.a.
28
5D1.9

-

-
?
5D1.23

-


19
5.10. Monoclonal antibodies against MctB
7B1.31

n.a.
n.a.
n.a.
21, 30
The polyclonal antiserum used in section 5.9 cross-reacted with MctB of M. smegmatis
7B1.32

n.a.
n.a.
n.a.
21, 30
and failed to recognize MctB proteins in whole cells. However, monoclonal antibodies
7C2.33

n.a.
n.a.
n.a.
?
7C2.38

n.a.
n.a.
n.a.
?
might have a better potential to identify surface-accessible, periplasmic or protected
8A6.6

-

-
5
8A6.14

-
-
-
n.a.
loops of MctB. To this end, hybridomas were generated by fusing B-cells that were
obtained from mice immunized with purified recombinant M. tuberculosis MctB protein
from E. coli, with myeloma tumor cells. Hybridoma clones that produced monoclonal
Table 5.2: Characterization of monoclonal antibodies against MctB of M. tuberculosis. See Tab. 4.5 for synthetic
MctB peptide library. “n.a.” means “not analyzed”.
Results
90
Results
91
recognized 1 ng MctB protein in ELISA experiments which was the selection criteria for
peptides number 4, 6, 7, 21 and 30. About 30% of the MctB protein would then be
positive hybridoma clones. MctB was not detectable in whole cells by any antibody but
covered.
was recognized in cell lysates. However, there was one exception. The antibody 8A6.14,
recognized purified MctB protein but did not recognize MctB in both whole and lysed
cells indicating that its epitope may be embedded in the outer membrane. Its epitope
could not be determined because it may be on the peptides that were excluded from the
screen (see 5.10.2). Only the antibody 5D1.23 showed cross-reactivity with MctB of M.
smegmatis despite the 62% identity between the MctB proteins of M. smegmatis and M.
tuberculosis (see section 5.4). All other antibodies were specific for the M. tuberculosis
protein. The characterization of antibody 5D1.23 will be described in section 5.10.3. The
epitopes of 22 monoclonal antibodies were mapped using a synthetic MctB peptide
library (see section 5.10.2)
5.10.2. Epitope mapping
We ordered a synthetic peptide library (Biomatic Corp., USA) consisting of 30 peptides
covering the entire length of the MctB protein of M. tuberculosis (Tab. 4.5, Fig. 5.16).
Each peptide overlaps with the previous and the following peptide by ten amino acids.
Thus, it is possible to map epitopes with an accuracy of 10 amino acids. The epitopes of
22 monoclonal antibodies were identified by Western Blot spotting 10 ng of each
synthetic MctB peptide onto a polyvinylidene fluoride membrane. The peptides 11, 12,
Figure 5.16: MctB (Rv1698) peptide library for epitope mapping. Peptides #1 to #29 consist of 20 and #30 of 24 amino
acids. Peptides in solid gray were excluded from the assay due to their poor solubility. Peptides #5 (red), #19 (blue) and
#28 (green) were recognized by sublones 1D1.6, 5D1.23 and 5A3.21, respectively. Yellow indicates potential peptides for
which monoclonal antibodies could be obtained by further subcloning of hybridomas.
16, 17, 18 and 27 were excluded from the screen due to their poor solubility (Tab. 4.5).
The synthetic MctB peptides 4, 5, 6, 7, 19, 21, 28 and 30 were recognized by antibodies
in the screen (see Tab. 5.2). The corresponding sequences are highlighted in Fig. 5.16
5.10.3. Cross-reactivity of hybridoma clone 5D1.23
(yellow). Several candidates recognized more than one peptide indicating that they are
In order to map the epitope of antibody 5D1.23 we used our MctB peptide library as
not homogenous clones and would need further subcloning. Pure clones were obtained
described above (see section 5.10.1.). The antibody from hybridoma clone 5D1.23
only for peptides 5 (1D1.6, 8A6.6), 19 (5D1.23) and 28 (5A3.21 and eight others). The
recognized peptide number 19 (Fig. 5.17 A). This peptide covers the amino acids 180 to
peptides are highlighted in Fig. 5.16 with red, blue and green, respectively. These pure
200 of the MctB protein. Since peptide number 20 was not recognized by the antibody,
monoclonal antibodies cover the middle and both termini of the protein. Interestingly, all
which overlaps with number 19, we conclude that its epitope lies within the first 10 amino
of these candidates recognized MctB only in lysed but not in whole cells indicating that
acids of peptide number 19. Unfortunately, peptide number 18 had to be excluded from
the corresponding epitopes are not surface accessible. Since only three monoclonal
that study due to its very poor solubility. However, comparison of that region between
antibodies proved to be useful for protein mapping we concluded that additional
the MctB proteins of M. smegmatis and M. tuberculosis revealed a short stretch of six
hybridoma clones have to be screened to increase coverage of the protein. Subcloning
identical amino acids (Fig. 5.17 B). It is not unusual for monoclonal antibodies to
of existing hybridoma clones could yield in homogeneous isolates that recognize
recognize hexapeptides (Wei et al., 1998). The most popular example is the
hexahistidine tag. Therefore, we conclude that the hypridoma clone 5D1.23 produces
Results
92
Discussion
antibodies that recognize the hexapeptide QRDTVL. Since this sequence is present in
6. Discussion
both MctB proteins it is likely the reason for the observed cross-reactivity.
6.1. The physiological function of Rv1698 and its homologs.
93
Due to its paramount importance as a pathogen, the growth and nutritional requirements
Figure 5.17: Epitope mapping. Antibodies
produced by hybridoma clone 5D1.23
recognized peptide number 19 of the MctB
peptide library (A). Peptide 19 covers
amino acids number 180 to 200 of the
MctB protein. Sequence comparison
between the MctB proteins of M.
tuberculosis (Rv1698) and M. smegmatis
(Msm_3747) revealed that both proteins
have a common hexapeptide (QRDTVL)
which is likely the recognized epitope of
5D1.23 (B).
of Mycobacterium tuberculosis have been intensively studied since its discovery more
than a century ago (Koch 1882). However, nutrient transport in M. tuberculosis is still
poorly understood despite a wealth of genomic data (Niederweis 2008). In mycobacteria
copper is cofactor of cytochrome c oxidase (Matsoso et al., 2005) and the superoxide
dismutase SodC (D'Orazio et al., 2001). It is therefore an essential trace element. On the
other side, Cu+ catalyzes the formation of hydroxyl radicals from hydrogen peroxide
causing oxidative stress and binds to proteins inhibiting enzymatic activities (Halliwell
and Gutteridge 1984; Kim et al., 2008; Ward et al., 2008). Hence, copper-specific
chaperones, storage proteins and efflux systems are employed to avoid any free copper
ions within cells (Rae et al., 1999). We have demonstrated that mutants of M. smegmatis
and M. tuberculosis deficient in Rv1698-like outer membrane channel proteins are
hypersensitive to copper due to copper accumulation. It was concluded that Rv1698 is
involved in copper efflux. Functionally similar outer membrane proteins of Gram-negative
bacteria are involved in copper homeostasis and resistance (Cha and Cooksey 1991;
Brown et al., 1995). For example, the Cus-system is required for resistance of E. coli to
copper and silver and consists of the inner membrane pump CusA, the outer membrane
factor CusC, and the periplasmic membrane fusion protein CusB (Fig. 2.9 B) (Franke et
al., 2003). Deletion of any of the genes in E. coli decreased the minimal inhibitor
concentration (MIC) by 2-fold and colonies appeared small at concentrations well below
the MIC (Franke et al., 2003). We observed the same phenotype for M. smegmatis. The
msm_3747 mutant grew in smaller colonies at 4-fold lower copper concentration as the
parental strain and the MIC for copper was reduced by 2-fold on 7H10 agar (see section
5.6, Fig. S4). CusC is related to the well characterized outer membrane channel TolC
which is part of the architecturally very similar tripartite drug efflux systems (Nies 2003).
TolC is involved in the secretion of very different compounds such as protein toxins
(Wandersman and Delepelaire 1990; Bleuel et al., 2005), drugs (Tikhonova and
Zgurskaya 2004) and heavy metals (Paulsen et al., 1997) because it is recruited by inner
membrane translocases with very different substrate specificities (Koronakis et al.,
2004). There is no energy source in the outer membrane (Braun and Endriss 2007).
Thus, the energy for TolC mediated transport processes is provided by the inner
membrane transporters derived either from the proton-motive force (Fernandez-Recio et
Discussion
94
Discussion
95
al., 2004) or ATP-hydrolysis at the cytoplasmic side of the inner membrane (Gentschev
Ishihama 2005). In yeast, components of the copper-specific uptake system, FRE1 and
et al., 2002). Although cross-complementation of TolC-like proteins has been observed,
CTR1 are down-regulated, while CCC2, an ATPase involved in copper export from the
TolC was not able to substitute for missing CusC proteins (Franke et al., 2003). It is
cytosol into intracellular, secretory compartments, was slightly up-regulated. The
currently not known if Rv1698 interacts with other proteins that are involved in copper
recently discovered csoR-operon of M. tuberculosis, is part of the copper homeostasis
efflux across the inner membrane but it could explain its specificity for Cu+ and Ag+. It is
system in mycobacteria (Liu et al., 2007). It includes the putative ATPase CtpV,
tempting to speculate that Rv1698 is associated with at least one of the putative copper
predicted to pump cytoplasmic copper across the inner membrane (Agranoff and
efflux ATPases CtpA, CtpB or CtpV (Ward et al., 2008) of M. tuberculosis (Fig. 2.9). Not
Krishna 2004). The entire csoR-operon is induced in response to copper stress (Ward et
only would these pumps determine the specificity for substrates, they would also provide
al., 2008). Induction of rv0846c, a putative multicopper oxidase, was confirmed by qRT-
the energy to transport copper against the concentration gradient across the outer
PCR (Ward et al., 2008) indicating its possible role in mycobacterial copper
membrane. We have not found additional MctB-homologs encoded in the genome of M.
homeostasis.
tuberculosis or M. smegmatis. Therefore, substitution by other proteins seems unlikely,
The cytoplasmic Cu/Zn superoxide dismutase, SOD1, is also induced in yeast. Besides
which is supported by the high level of copper accumulation in mutants lacking Rv1698
its role in oxidative stress protection it was also considered to serve as copper buffering
or Msm_3747 proteins. However, we found that rv1698 of M. tuberculosis can substitute
protein in the cytosol (Culotta et al., 1995). This double function might also apply for the
for msm_3747 in M. smegmatis (Fig. 5.8) indicating that Rv1698-like proteins have the
highly induced yeast metallothioneins CUP1-1 and CUP1-2. Just recently, a novel
same function. Further, an excess of open channels upon overexpression of rv1698 in
metallothionein, MymT, was discovered in M. tuberculosis (Gold et al., 2008) which has
an M. smegmatis porin mutant without adequate numbers of inner membrane pumps
been shown to play a role in copper homeostasis as the mutant is hypersensitive to
would also explain the observed increase in outer membrane permeability for glucose
copper. In addition, transcription of mymT was 1000-fold increased by copper. Since the
and the increased sensitivity to ampicillin and chloramphenicol (Siroy et al., 2008).
gene is not annotated in the genome of M. tuberculosis H37Rv (www.tigr.org) it was not
6.2. The response of M. tuberculosis to elevated copper levels
is found in millimolar concentrations in many bacteria (Helbig et al., 2008) and
Copper induced oxidative stress has been generally attributed to the formation of highly
eukaryotes (Miras et al., 2008). Glutathione and thioredoxin synthesis, which is induced
reactive oxygen species such as hydroxyl radicals (*OH) which is driven by a
by copper in M. tuberculosis (Ward et al., 2008), are essential for the maintenance of a
mechanism similar to the Fenton reaction (Halliwell and Gutteridge 1984; Koppenol
reduced environment in the cytoplasm (Carmel-Harel and Storz 2000). Glutathione is
2001). The rate constants for these reactions indicate that this process can occur at
also involved in copper homeostasis in E. coli and yeast (Helbig et al., 2008; Miras et al.,
physiologically relevant rates (Macomber et al., 2007). The transcriptional response to
2008). Mycobacteria do not have glutathione but possess a functional analog called
elevated copper levels has recently been studied in E. coli (Yamamoto and Ishihama
mycothiol (Newton and Fahey 2002) which is essential for mycobacterial growth (Sareen
2005), M. tuberculosis (Ward et al., 2008), S. cerevisiae (Yasokawa et al., 2008),
et al., 2003). Metallothioneins are small cysteine-rich proteins. Cysteine is also a
Chlamydomonas reinhardtii (Jamers et al., 2006) and Drosophila melanogaster (Norgate
precursor for the synthesis of glutathione and mycothiols. Interestingly, genes involved in
et al., 2007). The above studies also indicate that elevated copper levels induce
sulfate and/or cysteine metabolism are found to be induced under copper stress in E.
included in previous microarrays (Ward et al., 2008). The cellular antioxidant glutathione
oxidative stress supporting the relevance of copper-mediated formation of *OH radicals
coli (cysK, cysN, cysP) (Yamamoto and Ishihama 2005), M. tuberculosis (rv0815c,
in vivo. Another group of induced genes includes components of species specific copper
rv0848, rv2398c) (Ward et al., 2008) and yeast (MET17, MET6, MHT1, MET3, SAM2,
homeostasis and efflux systems. In E. coli, the three major copper homeostasis
CYS3) (Yasokawa et al., 2008).
systems, the proton-driven CusCBFA copper efflux system, the multicopper oxidase
DNA microarrays also indicate the kind of damage that copper is causing to the cell.
CueO and the inner membrane ATPase CopA are highly up-regulated (Yamamoto and
Since proteins that are involved in folding assistance (chaperons) and/or degradation of
Discussion
96
Discussion
97
proteins (proteases) are induced in yeast (HSP31, HSP26, HSP6, UBC5) (Yasokawa et
tuberculosis due to copper binding (Naik et al., 1975; Suzuki et al., 1989). This
al., 2008) and M. tuberculosis (dnaK) (Ward et al., 2008) it seems obvious that copper
susceptibility was exploited early in TB chemotherapy and might contribute to the
toxicity includes protein damage. In E.coli, the CpxR-regulon is activated under copper
enhanced activity of TB drugs when complexed with copper (Sandbhor et al., 2002).
stress possibly by the outer membrane protein NlpE (Yamamoto and Ishihama 2005)
Importantly, copper concentrations of 17 to 25 µM have been determined in M.
that is either detecting membrane stress and/or the copper ions itself (Hirano et al.,
tuberculosis-containing phagosomes of macrophages by microprobe X-ray fluorescence
2007). The periplasmic protease CpxP and the membrane protease HtpX of E. coli are
(Wagner et al., 2005). Further, phagosomal copper concentrations appeared to increase
also induced (Yamamoto and Ishihama 2005), indicating that copper overload in E. coli
upon stimulation of the macrophages with interferon-. Thus, activated macrophages
affects also targets outside the cytoplasm (Macomber et al., 2007). DNA damage is
appear to deliver copper at concentrations sufficient to inhibit or kill M. tuberculosis.
another effect of copper toxicity caused by the metal-mediated formation of *OH in close
These findings suggest that macrophages may utilize copper as a defensive weapon
proximity to DNA molecules (Macomber et al., 2007). In yeast, three genes (HSP12,
against M. tuberculosis and possibly other bacterial pathogens. The mechanism of
SML1, SOH1) categorized in “DNA repair” were induced by copper (Yasokawa et al.,
copper delivery to the phagosome and its control in macrophages is unknown and
2008). However, no significant copper-mediated DNA damage was observed in E. coli.
certainly merits further research.
Surprisingly, copper even appeared to protect DNA from iron-mediated oxidative
damage by a yet unknown mechanism (Macomber et al., 2007). Cosistent with these
6.4. Copper homeostasis in M. tuberculosis
results, neither the DNA microarray of E. coli (Yamamoto and Ishihama 2005) nor of M.
We
tuberculosis (Ward et al., 2008) show increased transcription of genes involved in DNA
concentrations in M. tuberculosis constant at a low level to support growth of
repair. Copper toxicity in yeast also includes membrane damage and membrane
M. tuberculosis while preventing the toxic effects of copper. The requirement for copper
have
identified
a
molecular
mechanism
that
keeps
intracellular
copper
permeabilization appears to be a common mechanism of heavy-metal toxicity (Soares et
by M. tuberculosis is consistent with the importance of a copper-containing superoxide
al., 2003). The induction of lipid metabolism genes as observed in DNA microarrays
dismutase that contributes to the survival in activated macrophages (Piddington et al.,
provide indirect evidence that copper indeed compromises the integrity of the plasma
2001), and of a copper-containing cytochrome c oxidase that is critical for exponential
membrane in yeast. No such evidence, however, has been found in E. coli (Yamamoto
growth under aerobic conditions (Megehee et al., 2006; Megehee and Lundrigan 2007).
and Ishihama 2005) or M. tuberculosis (Ward et al., 2008). In summary, the microarray
As a consequence of its high susceptibility to copper, the range of viable external copper
data suggest that copper toxicity in M. tuberculosis is mainly caused by oxidative stress
concentrations for M. tuberculosis is very small. This demands a tight control of probably
possibly leading to enzyme inhibition and degradation (Ward et al., 2008).
several resistance mechanisms to balance the requirement for copper as an essential
nutrient and the protection against its toxic effects. Indeed, the copper-induced
6.3. Copper as a defense mechanism against M. tuberculosis in macrophages.
transcriptome hinted at two putative copper resistance mechanisms of M. tuberculosis
The minimal inhibitory concentration of copper for M. tuberculosis on Hartmans deBond
(Ward et al., 2008). Rv0846c is similar to periplasmic multi-copper oxidases that
medium (see section 3.2.2) is less than 24 µM and, therefore, much lower than that of
contribute to the resistance of Gram-negative bacteria to Cu+ (Grass and Rensing 2001).
E. coli ( 3 mM) or other bacteria (Franke et al., 2003). The extraordinary susceptibility
Considering the recent visualization of an outer membrane and, consequently, a
of M. tuberculosis to copper appears surprising considering the extreme resistance of
periplasm in mycobacteria (Hoffmann et al., 2008), we propose that Rv0846c fulfills a
M. tuberculosis to many toxic solutes (Brennan and Nikaido 1995). The high
similar role in M. tuberculosis in contrast to previous assumptions (Ward et al., 2008).
susceptibility of M. tuberculosis to copper has been overlooked because of the use of
Rv0969 (ctpV) is part of a copper-induced operon and was proposed to encode an inner
albumin in culture media in previous experiments (Ward et al., 2008) which sequesters
membrane copper efflux pump (Liu et al., 2007; Ward et al., 2008). In this study, we
copper ions and thereby strongly increases the tolerance of M. smegmatis and M.
have discovered outer membrane channel proteins as another layer of control both for
Discussion
98
Discussion
99
the uptake and efflux of copper by mycobacteria. These findings require to considerably
revise the previous model of copper homeostasis in M. tuberculosis (Ward et al., 2008).
Some components of the new model (Fig. 5.1) such as the outer membrane copper
influx channel (porin), the inner membrane importer, and putative cytoplasmic copper
chaperones and storage proteins as known in other organisms (Rosenzweig and
O'Halloran 2000), have not been identified yet for M. tuberculosis. The recently
discovered copper-sensing regulator CsoR (Liu et al., 2007) may play a key role in
adjusting the multiple resistance mechanisms of M. tuberculosis to elevated external
copper concentrations. It may also regulate the expression of the newly discovered
mycobacterial metallothionein MymT which is found in most pathogenic mycobacteria
(Gold et al., 2008). The function of MymT is binding Cu+ and protecting the cells from
copper toxicity. However, expression of the MctB channel in M. tuberculosis is not
copper-dependent and may be recruited by CtpV for efficient copper efflux across the
two membranes of M. tuberculosis similar to the Cus system in E. coli (Rensing and
Grass 2003).
Figure 6.1: Model of copper homeostasis of M. tuberculosis. Copper likely utilizes porins to enter the cell and crosses the
inner membrane by metal transporters like the bivalent metal-ion transport protein, MntH. Inside cells copper is captured
by metallothionein (MymT) and possibly by mycothiols (MSH) and/or copper chaperons. Copper bind to the copper-sensor
CsoR the transcription regulator of the csoR-operon. Chaperons possibly guard copper to the superoxide dismutase
(SodC) and to the cytochrome c oxidase (IV). Expression of ctpV, an inner membrane P-type ATPase encoded within the
csoR-operon and other putative P-type ATPases (CtpA-J) may detoxify copper from the cytoplasm. The putative
multicopper oxidase Rv0846c is secreted by the twin-arginin translocation (TAT) system and may detoxify cytoplasmic
copper by taking it to the periplasm. Copper efflux across the outer membrane is then mediated by MctB (Rv1698).
Conclusion
100
Authors’ contribution
7. Conclusions.
8. Authors’ contribution
This study revealed that copper efflux is required by M. tuberculosis to maintain low
1.
intracellular copper levels. The finding that channel proteins are required for both
101
Wolschendorf F., Mahfoud M., Niederweis M. (2007). Porins are required for
uptake of phosphates by M. smegmatis. J. Bacteriol. 189(6): 2435-42
copper uptake and efflux across the outer membrane represents a major revision of
 M. Mahfoud constructed the plasmid pML440 and some mutant strains.
our understanding of copper homeostasis in M. tuberculosis. The high susceptibility of
M. tuberculosis to copper presents an Achilles heel which appears to be exploited in
2.
macrophages. Furthermore, as the model of the mycobacterial cell wall was recently
revised by direct visualization of the outer membrane (Hoffmann et al., 2008), transport
tuberculosis represents a new class of channel-forming outer membrane
processes in M. tuberculosis must be re-evaluated. TolC-like outer membrane proteins
proteins. J.Biol.Chem. 283(26): 17827-37
of efflux systems in E. coli bind to periplasmic and inner membrane effectors for both
 I contributed the proteinase K accessibility for Rv1698, see section 5.7 of this
substrate specificity and energy for transport (Sharff et al., 2001). Because efficient
thesis.
efflux against a concentration gradient requires energy (Braun and Endriss 2007), the
same principle must also apply to M. tuberculosis. Yet knowledge of how M. tuberculosis
extrudes wastes, drugs, metals and other noxious compounds or components of such
Siroy A., Mailaender C., Harder D., Koerber S., Wolschendorf F., Danilchanka
O., Wang Y., Heinz C., Niederweis M. (2008). Rv1698 of Mycobacterium
3.
Frank Wolschendorf, Tej B. Shrestha, Stefan H. Bossmann, and Michael
Niederweis (2008) Outer membrane channel proteins are required for copper
systems is scarce. The fuction of Rv1698 (MctB) is copper efflux across the outer
homeostasis in Mycobacterium tuberculosis. Proc.Natl.Acad.Sci., submitted
membrane. Thus, it is the first outer membrane component of any efflux system in
 T. Shrestha and S. Bossmann analysed the copper content of samples.
mycobacteria and, hence, presents a paradigm for efflux processes in mycobacteria.
The implications of these findings for our understanding of transport mechanisms across
the outer membrane of M. tuberculosis are profound. These transport processes must
4.
Song H., Wolschendorf F., Niederweis M. (2008) Construction of unmarked
be examined to understand how M. tuberculosis functionalizes its highly impermeable
deletion mutants in mycobacteria. Mycobacteria Protocols, pp. 279-95, Humana
outer membrane, tolerates the harsh environment of the macrophage phagosome, and
Press, Totowa (NY)
extrudes drugs.
 I designed and constructed the parental deletion vectors for gene deletions in
slow growing mycobacteria and developed/established the gene deletion
protocol.
Outlook
102
Outlook
103
9. Outlook
9.3. The role of MctA
9.1. Virulence of M. tuberculosis mutants deficient in copper homeostasis.
All MctB proteins including rv1698 of M. tuberculosis and msm_3747 of M. smegmatis
Copper concentrations of 17 to 25 µM have been determined in M. tuberculosis-
(Fig. 5.4), are in close proximity to an open reading frame located immediately upstream
containing phagosomes of macrophages by microprobe X-ray fluorescence (Wagner et
of MctB. Preliminary data demonstrate that both genes are co-transcribed (personal
al., 2005). Considering that M. tuberculosis tolerates only less than 24 µM copper in
communication, Olga Danilchanka) in an operon, hence we named it mctA. The gene is
albumin free Hartmanns de Bond (HdB) medium it is intriguing to investigate the
essential for growth of M. tuberculosis in vitro (Sassetti et al., 2003) but no function has
virulence of rv1698 M. tuberculosis mutants in macrophages and mice. Deletion of
yet been assigned due to the lack of homology to known proteins (www.tigr.org).
mymT did not cause a virulence defect of M. tuberculosis in the murine model (Gold et
Bacterial copper efflux systems are often organized in operons such as the cus-operon
al., 2008). However, other copper binding proteins exist in M. tuberculosis (Gold et al.,
of E. coli (Grass and Rensing 2001) or the cop-operon of Pseudomonas aeroginosa
2008) whose binding capacity may be still sufficient to counteract an increased influx of
(Adaikkalam and Swarup 2005). In addition, operons often consist of genes encoding
copper within phagosomes. The extent to which rv1698 enhances the survival of M.
proteins that are functionally connected. Therefore, we like to explore the function of
tuberculosis in macrophages and mice is currently under investigation. However, since
MctA by characterizing mutant phenotypes. We are in particular interested in a possible
the copper dependent growth defect of the rv1698 mutant is not very pronounced on
function of MctA in copper homeostasis.
albumin free HdB medium, it seems likely that other copper homeostasis or oxidative
stress defense mechanisms can compensate for the loss of rv1698. Therefore, a double
deletion mutant of M. tuberculosis, deficient in mymT and rv1698, may produce a more
severe virulence and copper dependent growth defect.
9.2. Interaction of MctB with other proteins
We have shown that Rv1698 is specific for Cu+ and Ag+. Transport (efflux) and
specificity for Cu+ and the very similar Ag+ are unlikely to be achieved by a protein that
forms a water-filled channel across the outer membrane which operates independently
on cytoplasmic energy sources. The concentration gradient would rather push ions
through the channel than allow their export. Indeed, overexpression of Rv1698 mediated
the entry of substrates such as glucose or antibiotics (Siroy et al., 2008). Therefore, we
propose that at least one inner membrane transporter associates with Rv1698-like
proteins. The inner membrane component of this complex determines substrate
specificity and provides energy for the transport to the extracellular space against the
concentration gradient. To examine this hypothesis, we will do in vivo cross-linking
experiments. The possible interaction partners of Rv1698 could then be isolated and
identified by mass-spectrometry.
References
104
10. References
Adaikkalam, V. and S. Swarup (2005). "Characterization of copABCD operon from a copper-sensitive
Pseudomonas putida strain." Can J Microbiol 51(3): 209-16.
Agranoff, D. and S. Krishna (2004). "Metal ion transport and regulation in Mycobacterium tuberculosis."
Front Biosci 9: 2996-3006.
Ahmed, N., A. K. Tyagi, H. Padh and T. A. Venkitasubramanian (1978). "Alkaline phosphatase activity in
Mycobacterium smegmatis." Indian J Chest Dis Allied Sci 20(1): 11-20.
Alahari, A., N. Saint, S. Campagna, V. Molle, G. Molle and L. Kremer (2007). "The N-terminal domain of
OmpATb is required for membrane translocation and pore-forming activity in mycobacteria." J Bacteriol
189(17): 6351-8.
References
105
Bleed, D., C. Watt and C. Dye (2001). Global Tuberculosis Control. WHO Report 2001. Geneva,
Switzerland, World Health Organization.
Bleuel, C., C. Grosse, N. Taudte, J. Scherer, D. Wesenberg, G. J. Krauss, D. H. Nies and G. Grass
(2005). "TolC is involved in enterobactin efflux across the outer membrane of Escherichia coli." J Bacteriol
187(19): 6701-7.
Boddinghaus, B., T. Rogall, T. Flohr, H. Blocker and E. C. Bottger (1990). "Detection and identification
of mycobacteria by amplification of rRNA." J Clin Microbiol 28(8): 1751-9.
Bond, P. J., J. D. Faraldo-Gomez and M. S. Sansom (2002). "OmpA: A pore or not a pore? Simulation
and modeling studies." Biophys J 83(2): 763-75.
Borisov, V. B., E. Forte, A. A. Konstantinov, R. K. Poole, P. Sarti and A. Giuffre (2004). "Interaction of
the bacterial terminal oxidase cytochrome bd with nitric oxide." FEBS Lett 576(1-2): 201-4.
Ammendola, S., P. Pasquali, F. Pacello, G. Rotilio, M. Castor, S. J. Libby, N. Figueroa-Bossi, L. Bossi,
F. C. Fang and A. Battistoni (2008). "Regulatory and structural differences in the Cu,Zn-superoxide
dismutases of Salmonella enterica and their significance for virulence." J Biol Chem 283(20): 13688-99.
Braibant, M. and J. Content (2001). "The cell surface associated phosphatase activity of Mycobacterium
bovis BCG is not regulated by environmental inorganic phosphate." FEMS Microbiol Lett 195(2): 121-6.
Arora, A., D. Rinehart, G. Szabo and L. K. Tamm (2000). "Refolded outer membrane protein A of
Escherichia coli forms ion channels with two conductance states in planar lipid bilayers." J. Biol. Chem.
275(3): 1594-1600.
Braibant, M., P. Lefevre, L. de Wit, P. Peirs, J. Ooms, K. Huygen, A. B. Andersen and J. Content
(1996). "A Mycobacterium tuberculosis gene cluster encoding proteins of a phosphate transporter
homologous to the Escherichia coli Pst system." Gene 176(1-2): 171-6.
Balakrishnan, R., N. Ramasubbu, K. I. Varughese and R. Parthasarathy (1997). "Crystal structures of
the copper and nickel complexes of RNase A: metal-induced interprotein interactions and identification of a
novel copper binding motif." Proc Natl Acad Sci U S A 94(18): 9620-5.
Braun, V. and F. Endriss (2007). "Energy-coupled outer membrane transport proteins and regulatory
proteins." Biometals 20(3-4): 219-31.
Bardarov, S., S. Bardarov Jr, Jr., M. S. Pavelka Jr, Jr., V. Sambandamurthy, M. Larsen, J. Tufariello, J.
Chan, G. Hatfull and W. R. Jacobs Jr, Jr. (2002). "Specialized transduction: an efficient method for
generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis, M. bovis BCG
and M. smegmatis." Microbiology 148(Pt 10): 3007-17.
Brosch, R., S. V. Gordon, M. Marmiesse, P. Brodin, C. Buchrieser, K. Eiglmeier, T. Garnier, C.
Gutierrez, G. Hewinson, K. Kremer, L. M. Parsons, A. S. Pym, S. Samper, D. van Soolingen and S. T.
Cole (2002). "A new evolutionary scenario for the Mycobacterium tuberculosis complex." Proc Natl Acad Sci
U S A 99(6): 3684-9.
Barry, C. E., 3rd, R. E. Lee, K. Mdluli, A. E. Sampson, B. G. Schroeder, R. A. Slayden and Y. Yuan
(1998). "Mycolic acids: structure, biosynthesis and physiological functions." Prog. Lipid Res. 37(2-3): 143-79.
Brosch, R., A. S. Pym, S. V. Gordon and S. T. Cole (2001). "The evolution of mycobacterial pathogenicity:
clues from comparative genomics." Trends Microbiol 9(9): 452-8.
Battistoni, A., A. P. Mazzetti and G. Rotilio (1999). "In vivo formation of Cu,Zn superoxide dismutase
disulfide bond in Escherichia coli." FEBS Lett 443(3): 313-6.
Brown, N. L., S. R. Barrett, J. Camakaris, B. T. Lee and D. A. Rouch (1995). "Molecular genetics and
transport analysis of the copper-resistance determinant (pco) from Escherichia coli plasmid pRJ1004." Mol
Microbiol 17(6): 1153-66.
Battistoni, A., F. Pacello, S. Folcarelli, M. Ajello, G. Donnarumma, R. Greco, M. G. Ammendolia, D.
Touati, G. Rotilio and P. Valenti (2000). "Increased expression of periplasmic Cu,Zn superoxide dismutase
enhances survival of Escherichia coli invasive strains within nonphagocytic cells." Infect Immun 68(1): 30-7.
Bauer, K., M. Struyve, D. Bosch, R. Benz and J. Tommassen (1989). "One single lysine residue is
responsible for the special interaction between polyphosphate and the outer membrane porin PhoE of
Escherichia coli." J. Biol. Chem. 264(28): 16393-8.
Brennan, P. J. and H. Nikaido (1995). "The envelope of mycobacteria." Annu Rev Biochem 64: 29-63.
Brunori, M., A. Giuffre, E. Forte, D. Mastronicola, M. C. Barone and P. Sarti (2004). "Control of
cytochrome c oxidase activity by nitric oxide." Biochim Biophys Acta 1655(1-3): 365-71.
Bunikis, J. and A. G. Barbour (1999). "Access of antibody or trypsin to an integral outer membrane protein
(P66) of Borrelia burgdorferi is hindered by Osp lipoproteins." Infect Immun 67(6): 2874-83.
Bavoil, P., H. Nikaido and K. von Meyenburg (1977). "Pleiotropic transport mutants of Escherichia coli
lack porin, a major outer membrane protein." Mol. Gen. Genet. 158(1): 23-33.
Carmel-Harel, O. and G. Storz (2000). "Roles of the glutathione- and thioredoxin-dependent reduction
systems in the Escherichia coli and Saccharomyces cerevisiae responses to oxidative stress." Annu Rev
Microbiol 54: 439-61.
Beher, M. G., C. A. Schnaitman and A. P. Pugsley (1980). "Major heat-modifiable outer membrane protein
in gram-negative bacteria: comparison with the OmpA protein of Escherichia coli." J Bacteriol 143(2): 90613.
Cascales, E., S. K. Buchanan, D. Duche, C. Kleanthous, R. Lloubes, K. Postle, M. Riley, S. Slatin and
D. Cavard (2007). "Colicin biology." Microbiol Mol Biol Rev 71(1): 158-229.
Belevich, I., D. A. Bloch, N. Belevich, M. Wikstrom and M. I. Verkhovsky (2007). "Exploring the proton
pump mechanism of cytochrome c oxidase in real time." Proc Natl Acad Sci U S A 104(8): 2685-90.
Cascioferro, A., G. Delogu, M. Colone, M. Sali, A. Stringaro, G. Arancia, G. Fadda, G. Palu and R.
Manganelli (2007). "PE is a functional domain responsible for protein translocation and localization on
mycobacterial cell wall." Mol Microbiol 66(6): 1536-47.
Benz, R., A. Schmid, P. Van der Ley and J. Tommassen (1989). "Molecular basis of porin selectivity:
membrane experiments with OmpC-PhoE and OmpF-PhoE hybrid proteins of Escherichia coli K-12."
Biochim Biophys Acta 981(1): 8-14.
Cha, J. S. and D. A. Cooksey (1991). "Copper resistance in Pseudomonas syringae mediated by
periplasmic and outer membrane proteins." Proc Natl Acad Sci U S A 88(20): 8915-9.
Bernheim, F. (1957). "The effect of copper ions and certain thioureas on enzyme induction and ammonia
assimilation in a Mycobacterium." J Pharmacol Exp Ther 119(1): 93-8.
Chakrabarti, A. C. and D. W. Deamer (1992). "Permeability of lipid bilayers to amino acids and phosphate."
Biochim Biophys Acta 1111(2): 171-7.
References
106
Cowan, S. W., T. Schirmer, G. Rummel, M. Steiert, R. Ghosh, R. A. Pauptit, J. N. Jansonius and J. P.
Rosenbusch (1992). "Crystal structures explain functional properties of two E. coli porins." Nature
358(6389): 727-33.
Crichton, R. R. and J. L. Pierre (2001). "Old iron, young copper: from Mars to Venus." Biometals 14(2): 99112.
Culotta, V. C., H. D. Joh, S. J. Lin, K. H. Slekar and J. Strain (1995). "A physiological role for
Saccharomyces cerevisiae copper/zinc superoxide dismutase in copper buffering." J Biol Chem 270(50):
29991-7.
D'Orazio, M., S. Folcarelli, F. Mariani, V. Colizzi, G. Rotilio and A. Battistoni (2001). "Lipid modification
of the Cu,Zn superoxide dismutase from Mycobacterium tuberculosis." Biochem J 359(Pt 1): 17-22.
Danilchanka, O., M. Pavlenok and M. Niederweis (2008). "Role of porins for uptake of antibiotics by
Mycobacterium smegmatis." Antimicrob Agents Chemother.
Delogu, G., C. Pusceddu, A. Bua, G. Fadda, M. J. Brennan and S. Zanetti (2004). "Rv1818c-encoded
PE_PGRS protein of Mycobacterium tuberculosis is surface exposed and influences bacterial cell structure."
Mol Microbiol 52(3): 725-33.
DiGiuseppe Champion, P. A. and J. S. Cox (2007). "Protein secretion systems in Mycobacteria." Cell
Microbiol 9(6): 1376-84.
Exner, M. M., X. Wu, D. R. Blanco, J. N. Miller and M. A. Lovett (2000). "Protection elicited by native outer
membrane protein Oms66 (p66) against host-adapted Borrelia burgdorferi: conformational nature of
bactericidal epitopes." Infect Immun 68(5): 2647-54.
References
107
J. Parkhill, B. G. Barrell, S. T. Cole, S. V. Gordon and R. G. Hewinson (2003). "The complete genome
sequence of Mycobacterium bovis." Proc Natl Acad Sci U S A 100(13): 7877-82.
Gee, J. M., M. W. Valderas, M. E. Kovach, V. K. Grippe, G. T. Robertson, W. L. Ng, J. M. Richardson,
M. E. Winkler and R. M. Roop, 2nd (2005). "The Brucella abortus Cu,Zn superoxide dismutase is required
for optimal resistance to oxidative killing by murine macrophages and wild-type virulence in experimentally
infected mice." Infect Immun 73(5): 2873-80.
Gentschev, I., G. Dietrich and W. Goebel (2002). "The E. coli alpha-hemolysin secretion system and its
use in vaccine development." Trends Microbiol 10(1): 39-45.
Gold, B., H. Deng, R. Bryk, D. Vargas, D. Eliezer, J. Roberts, X. Jiang and C. Nathan (2008).
"Identification of a copper-binding metallothionein in pathogenic mycobacteria." Nat Chem Biol 4(10): 60916.
Gonzalez-Flecha, B. and B. Demple (1995). "Metabolic sources of hydrogen peroxide in aerobically
growing Escherichia coli." J Biol Chem 270(23): 13681-7.
Goulding, C. W., M. I. Apostol, S. Gleiter, A. Parseghian, J. Bardwell, M. Gennaro and D. Eisenberg
(2004). "Gram-positive DsbE proteins function differently from Gram-negative DsbE homologs. A structure to
function analysis of DsbE from Mycobacterium tuberculosis." J Biol Chem 279(5): 3516-24.
Grass, G. and C. Rensing (2001). "CueO is a multi-copper oxidase that confers copper tolerance in
Escherichia coli." Biochem Biophys Res Commun 286(5): 902-8.
Grass, G. and C. Rensing (2001). "Genes involved in copper homeostasis in Escherichia coli." J Bacteriol
183(6): 2145-7.
Faller, M., M. Niederweis and G. E. Schulz (2004). "The structure of a mycobacterial outer-membrane
channel." Science 303(5661): 1189-92.
Greendyke, R., M. Rajagopalan, T. Parish and M. V. Madiraju (2002). "Conditional expression of
Mycobacterium smegmatis dnaA, an essential DNA replication gene." Microbiology 148(Pt 12): 3887-900.
Farra, A., S. Islam, A. Stralfors, M. Sorberg and B. Wretlind (2008). "Role of outer membrane protein
OprD and penicillin-binding proteins in resistance of Pseudomonas aeruginosa to imipenem and
meropenem." Int J Antimicrob Agents 31(5): 427-33.
Guilhot, C., B. Gicquel and C. Martin (1992). "Temperature-sensitive mutants of the Mycobacterium
plasmid pAL5000." FEMS Microbiol Lett 77(1-3): 181-6.
Farrar, J. A., F. Neese, P. Lappalainen, P. M. H. Kroneck, M. Saraste, W. G. Zumft and A. J. Thomson
(1996). "The Electronic Structure of CuA: A Novel Mixed-Valence Dinuclear Copper Electron-Transfer
Center." J Am Chem Soc 118: 11501-14.
Feilmeier, B. J., G. Iseminger, D. Schroeder, H. Webber and G. J. Phillips (2000). "Green fluorescent
protein functions as a reporter for protein localization in Escherichia coli." J Bacteriol 182(14): 4068-76.
Fernandez-Recio, J., F. Walas, L. Federici, J. Venkatesh Pratap, V. N. Bavro, R. N. Miguel, K.
Mizuguchi and B. Luisi (2004). "A model of a transmembrane drug-efflux pump from Gram-negative
bacteria." FEBS Lett 578(1-2): 5-9.
Fontecave, M. and H. Eklund (1995). "Copper amine oxidase: a novel use for a tyrosine." Structure 3(11):
1127-9.
Francis, M. S. and C. J. Thomas (1997). "The Listeria monocytogenes gene ctpA encodes a putative Ptype ATPase involved in copper transport." Mol Gen Genet 253(4): 484-91.
Franke, S., G. Grass, C. Rensing and D. H. Nies (2003). "Molecular analysis of the copper-transporting
efflux system CusCFBA of Escherichia coli." J Bacteriol 185(13): 3804-12.
Garg, S. K., M. S. Alam, K. V. Kishan and P. Agrawal (2007). "Expression and characterization of alpha(1,4)-glucan branching enzyme Rv1326c of Mycobacterium tuberculosis H37Rv." Protein Expr Purif 51(2):
198-208.
Garnier, T., K. Eiglmeier, J. C. Camus, N. Medina, H. Mansoor, M. Pryor, S. Duthoy, S. Grondin, C.
Lacroix, C. Monsempe, S. Simon, B. Harris, R. Atkin, J. Doggett, R. Mayes, L. Keating, P. R. Wheeler,
Guilvout, I., M. Chami, A. Engel, A. P. Pugsley and N. Bayan (2006). "Bacterial outer membrane secretin
PulD assembles and inserts into the inner membrane in the absence of its pilotin." Embo J 25(22): 5241-9.
Halliwell, B. and J. M. Gutteridge (1984). "Oxygen toxicity, oxygen radicals, transition metals and disease."
Biochem J 219(1): 1-14.
Harder, K. J., H. Nikaido and M. Matsuhashi (1981). "Mutants of Escherichia coli that are resistant to
certain beta-lactam compounds lack the OmpF porin." Antimicrob. Agents Chemother. 20(4): 549-52.
Hartmans, S. and J. A. De Bont (1992). "Aerobic vinyl chloride metabolism in Mycobacterium aurum L1."
Appl Environ Microbiol 58(4): 1220-6.
Helbig, K., C. Bleuel, G. J. Krauss and D. H. Nies (2008). "Glutathione and transition-metal homeostasis
in Escherichia coli." J Bacteriol 190(15): 5431-8.
Hirano, Y., M. M. Hossain, K. Takeda, H. Tokuda and K. Miki (2007). "Structural studies of the Cpx
pathway activator NlpE on the outer membrane of Escherichia coli." Structure 15(8): 963-76.
Hoffmann, C., A. Leis, M. Niederweis, J. M. Plitzko and H. Engelhardt (2008). "Disclosure of the
mycobacterial outer membrane: cryo-electron tomography and vitreous sections reveal the lipid bilayer
structure." Proc Natl Acad Sci U S A 105(10): 3963-7.
Jacobs, W. R. and G. F. Hatfull (2000). Molecular genetics of mycobacteria. Washington, DC, ASM Press.
Jamers, A., K. Van der Ven, L. Moens, J. Robbens, G. Potters, Y. Guisez, R. Blust and W. De Coen
(2006). "Effect of copper exposure on gene expression profiles in Chlamydomonas reinhardtii based on
microarray analysis." Aquat Toxicol 80(3): 249-60.
References
108
References
109
Johnson, W. T. and S. M. Newman, Jr. (2007). "Hearts in adult offspring of copper-deficient dams exhibit
decreased cytochrome c oxidase activity, increased mitochondrial hydrogen peroxide generation and
enhanced formation of intracellular residual bodies." J Nutr Biochem 18(2): 97-104.
Mammeri, H., P. Nordmann, A. Berkani and F. Eb (2008). "Contribution of extended-spectrum AmpC
(ESAC) beta-lactamases to carbapenem resistance in Escherichia coli." FEMS Microbiol Lett 282(2): 23840.
Kang, I. H., J. S. Kim and J. K. Lee (2007). "The virulence of Vibrio vulnificus is affected by the cellular
level of superoxide dismutase activity." J Microbiol Biotechnol 17(8): 1399-402.
Martinez-Martinez, L. (2008). "Extended-spectrum beta-lactamases and the permeability barrier." Clin
Microbiol Infect 14 Suppl 1: 82-9.
Kaps, I., S. Ehrt, S. Seeber, D. Schnappinger, C. Martin, L. W. Riley and M. Niederweis (2001). "Energy
transfer between fluorescent proteins using a co-expression system in Mycobacterium smegmatis." Gene
278(1-2): 115-24.
Matsoso, L. G., B. D. Kana, P. K. Crellin, D. J. Lea-Smith, A. Pelosi, D. Powell, S. S. Dawes, H. Rubin,
R. L. Coppel and V. Mizrahi (2005). "Function of the cytochrome bc1-aa3 branch of the respiratory network
in mycobacteria and network adaptation occurring in response to its disruption." J Bacteriol 187(18): 6300-8.
Kapur, V., T. S. Whittam and J. M. Musser (1994). "Is Mycobacterium tuberculosis 15,000 years old?" J
Infect Dis 170(5): 1348-9.
McDonough, J. A., K. E. Hacker, A. R. Flores, M. S. Pavelka, Jr. and M. Braunstein (2005). "The twinarginine translocation pathway of Mycobacterium smegmatis is functional and required for the export of
mycobacterial beta-lactamases." J Bacteriol 187(22): 7667-79.
Kartmann, B., S. Stenger, M. Niederweis and S. Stengler (1999). "Porins in the cell wall of
Mycobacterium tuberculosis." J Bacteriol 181(20): 6543-6.
Kim, B. E., T. Nevitt and D. J. Thiele (2008). "Mechanisms for copper acquisition, distribution and
regulation." Nat Chem Biol 4(3): 176-85.
Koch, R. (1882). "Die Aetiologie der Tuberculosis." Berliner Klinische Wochenschrift 19(15): 221-230.
Koppenol, W. H. (2001). "The Haber-Weiss cycle--70 years later." Redox Rep 6(4): 229-34.
Koronakis, V., J. Eswaran and C. Hughes (2004). "Structure and function of TolC: the bacterial exit duct
for proteins and drugs." Annu Rev Biochem 73: 467-89.
Korteland, J., J. Tommassen and B. Lugtenberg (1982). "PhoE protein pore of the outer membrane of
Escherichia coli K12 is a particularly efficient channel for organic and inorganic phosphate." Biochim Biophys
Acta 690(2): 282-9.
Kriakov, J., S. Lee and W. R. Jacobs, Jr. (2003). "Identification of a regulated alkaline phosphatase, a cell
surface-associated lipoprotein, in Mycobacterium smegmatis." J Bacteriol 185(16): 4983-91.
Kroll, J. S., P. R. Langford, K. E. Wilks and A. D. Keil (1995). "Bacterial [Cu,Zn]-superoxide dismutase:
phylogenetically distinct from the eukaryotic enzyme, and not so rare after all!" Microbiology 141 ( Pt 9):
2271-9.
Labidi, A., H. L. David and D. Roulland-Dussoix (1985). "Restriction endonuclease mapping and cloning
of Mycobacterium fortuitum var. fortuitum plasmid pAL5000." Ann Inst Pasteur Microbiol 136B(2): 209-15.
Lee, D. H., T. R. O'Connor and G. P. Pfeifer (2002). "Oxidative DNA damage induced by copper and
hydrogen peroxide promotes CG-->TT tandem mutations at methylated CpG dinucleotides in nucleotide
excision repair-deficient cells." Nucleic Acids Res 30(16): 3566-73.
Lichtinger, T., B. Heym, E. Maier, H. Eichner, S. T. Cole and R. Benz (1999). "Evidence for a small anionselective channel in the cell wall of Mycobacterium bovis BCG besides a wide cation-selective pore." FEBS
Lett 454(3): 349-55.
Liu, T., A. Ramesh, Z. Ma, S. K. Ward, L. Zhang, G. N. George, A. M. Talaat, J. C. Sacchettini and D. P.
Giedroc (2007). "CsoR is a novel Mycobacterium tuberculosis copper-sensing transcriptional regulator." Nat
Chem Biol 3(1): 60-8.
Macomber, L., C. Rensing and J. A. Imlay (2007). "Intracellular copper does not catalyze the formation of
oxidative DNA damage in Escherichia coli." J Bacteriol 189(5): 1616-26.
Magnani, D. and M. Solioz (2005). "Copper chaperone cycling and degradation in the regulation of the cop
operon of Enterococcus hirae." Biometals 18(4): 407-12.
Mailaender, C., N. Reiling, H. Engelhardt, S. Bossmann, S. Ehlers and M. Niederweis (2004). "The
MspA porin promotes growth and increases antibiotic susceptibility of both Mycobacterium bovis BCG and
Mycobacterium tuberculosis." Microbiology 150(Pt 4): 853-64.
Megehee, J. A., J. P. Hosler and M. D. Lundrigan (2006). "Evidence for a cytochrome bcc-aa3 interaction
in the respiratory chain of Mycobacterium smegmatis." Microbiology 152(Pt 3): 823-9.
Megehee, J. A. and M. D. Lundrigan (2007). "Temporal expression of Mycobacterium smegmatis
respiratory terminal oxidases." Can J Microbiol 53(3): 459-63.
Minnikin, D. E. (1982). Lipids: Complex lipids, their chemistry, biosynthesis and roles. The biology of the
mycobacteria: Physiology, identification and classification. C. Ratledge and J. Stanford. London, Academic
Press. I: 95-184.
Miras, R., I. Morin, O. Jacquin, M. Cuillel, F. Guillain and E. Mintz (2008). "Interplay between glutathione,
Atx1 and copper. 1. Copper(I) glutathionate induced dimerization of Atx1." J Biol Inorg Chem 13(2): 195-205.
Mittal, R. and N. V. Prasadarao (2008). "Outer membrane protein A expression in Escherichia coli K1 is
required to prevent the maturation of myeloid dendritic cells and the induction of IL-10 and TGF-beta." J
Immunol 181(4): 2672-82.
Molle, V., N. Saint, S. Campagna, L. Kremer, E. Lea, P. Draper and G. Molle (2006). "pH-dependent
pore-forming activity of OmpATb from Mycobacterium tuberculosis and characterization of the channel by
peptidic dissection." Mol Microbiol 61(3): 826-37.
Molloy, M. P., B. R. Herbert, M. B. Slade, T. Rabilloud, A. S. Nouwens, K. L. Williams and A. A. Gooley
(2000). "Proteomic analysis of the Escherichia coli outer membrane." Eur J Biochem 267(10): 2871-81.
Musser, J. M., A. Amin and S. Ramaswamy (2000). "Negligible genetic diversity of Mycobacterium
tuberculosis host immune system protein targets: evidence of limited selective pressure." Genetics 155(1):
7-16.
Naik, D. V., C. F. Jewell, Jr. and S. G. Schulman (1975). "Binding of cupric ions to bovine serum albumin."
J Pharm Sci 64(7): 1243-5.
Newton, G. L. and R. C. Fahey (2002). "Mycothiol biochemistry." Arch Microbiol 178(6): 388-94.
Niederweis, M. (2008). "Nutrient acquisition by mycobacteria." Microbiology 154(Pt 3): 679-92.
Niederweis, M., S. Ehrt, C. Heinz, U. Klocker, S. Karosi, K. M. Swiderek, L. W. Riley and R. Benz
(1999). "Cloning of the mspA gene encoding a porin from Mycobacterium smegmatis." Mol Microbiol 33(5):
933-45.
Nies, D. H. (2003). "Efflux-mediated heavy metal resistance in prokaryotes." FEMS Microbiol Rev 27(2-3):
313-39.
Nikaido, H. (1993). "Transport across the bacterial outer membrane." J Bioenerg Biomembr 25(6): 581-9.
Nikaido, H. (2003). "Molecular basis of bacterial outer membrane permeability revisited." Microbiol Mol Biol
Rev 67(4): 593-656.
References
110
References
111
Nikaido, H., P. Bavoil and Y. Hirota (1977). "Outer membranes of gram-negative bacteria. XV.
Transmembrane diffusion rates in lipoprotein-deficient mutants of Escherichia coli." J Bacteriol 132(3): 10457.
Qi, Y., Y. Kobayashi and F. M. Hulett (1997). "The pst operon of Bacillus subtilis has a phosphateregulated promoter and is involved in phosphate transport but not in regulation of the pho regulon." J
Bacteriol 179(8): 2534-9.
Nikaido, H., W. Liu and E. Y. Rosenberg (1990). "Outer membrane permeability and beta-lactamase
stability of dipolar ionic cephalosporins containing methoxyimino substituents." Antimicrob Agents
Chemother 34(2): 337-42.
Rae, T. D., P. J. Schmidt, R. A. Pufahl, V. C. Culotta and T. V. O'Halloran (1999). "Undetectable
intracellular free copper: the requirement of a copper chaperone for superoxide dismutase." Science
284(5415): 805-8.
Nikaido, H. and E. Y. Rosenberg (1983). "Porin channels in Escherichia coli: studies with liposomes
reconstituted from purified proteins." J Bacteriol 153(1): 241-52.
Rai, P. K. and L. C. Rai (1997). "Interactive effects of UV-B and Cu on photosynthesis, uptake and
metabolism of nutrients in a green alga Chlorella vulgaris under simulated ozone column." J Gen Appl
Microbiol 43(5): 281-288.
Norgate, M., A. Southon, S. Zou, M. Zhan, Y. Sun, P. Batterham and J. Camakaris (2007). "Copper
homeostasis gene discovery in Drosophila melanogaster." Biometals 20(3-4): 683-97.
Ostermeier, C., S. Iwata and H. Michel (1996). "Cytochrome c oxidase." Curr Opin Struct Biol 6(4): 460-6.
Overbeeke, N. and B. Lugtenberg (1980). "Expression of outer membrane protein E of Escherichia coli
K12 by phosphate limitation." FEBS Lett 112(2): 229-32.
Parish, T., E. Mahenthiralingam, P. Draper, E. O. Davis and M. J. Colston (1997). "Regulation of the
inducible acetamidase gene of Mycobacterium smegmatis." Microbiology 143 ( Pt 7): 2267-76.
Parish, T. and N. G. Stoker, Eds. (2001). Mycobacterium tuberculosis protocols. Methods in molecular
medicine. Totowa, Humana Press.
Parish, T., J. Turner and N. G. Stoker (2001). "amiA is a negative regulator of acetamidase expression in
Mycobacterium smegmatis." BMC Microbiol 1: 19.
Parrish, N. M., J. D. Dick and W. R. Bishai (1998). "Mechanisms of latency in Mycobacterium
tuberculosis." Trends Microbiol 6(3): 107-12.
Paulsen, I. T., J. H. Park, P. S. Choi and M. H. Saier, Jr. (1997). "A family of Gram-negative bacterial outer
membrane factors that function in the export of proteins, carbohydrates, drugs and heavy metals from Gramnegative bacteria." FEMS Microbiol Lett 156(1): 1-8.
Pautsch, A. and G. E. Schulz (1998). "Structure of the outer membrane protein A transmembrane domain."
Nat. Struct. Biol. 5(11): 1013-7.
Peirs, P., P. Lefevre, S. Boarbi, X. M. Wang, O. Denis, M. Braibant, K. Pethe, C. Locht, K. Huygen and
J. Content (2005). "Mycobacterium tuberculosis with disruption in genes encoding the phosphate binding
proteins PstS1 and PstS2 is deficient in phosphate uptake and demonstrates reduced in vivo virulence."
Infect Immun 73(3): 1898-902.
Pelicic, V., M. Jackson, J. M. Reyrat, W. R. Jacobs, Jr., B. Gicquel and C. Guilhot (1997). "Efficient
allelic exchange and transposon mutagenesis in Mycobacterium tuberculosis." Proc Natl Acad Sci U S A
94(20): 10955-60.
Pelicic, V., J. M. Reyrat and B. Gicquel (1996). "Expression of the Bacillus subtilis sacB gene confers
sucrose sensitivity on mycobacteria." J Bacteriol 178(4): 1197-9.
Pelicic, V., J. M. Reyrat and B. Gicquel (1996). "Generation of unmarked directed mutations in
mycobacteria, using sucrose counter-selectable suicide vectors." Mol Microbiol 20(5): 919-25.
Piddington, D. L., F. C. Fang, T. Laessig, A. M. Cooper, I. M. Orme and N. A. Buchmeier (2001). "Cu,Zn
superoxide dismutase of Mycobacterium tuberculosis contributes to survival in activated macrophages that
are generating an oxidative burst." Infect Immun 69(8): 4980-7.
Posey, J. E., T. M. Shinnick and F. D. Quinn (2006). "Characterization of the twin-arginine translocase
secretion system of Mycobacterium smegmatis." J Bacteriol 188(4): 1332-40.
Predki, P. F. and B. Sarkar (1992). "Effect of replacement of "zinc finger" zinc on estrogen receptor DNA
interactions." J Biol Chem 267(9): 5842-6.
Raja, S. B., M. R. Murali and S. N. Devaraj (2008). "Differential expression of ompC and ompF in
multidrug-resistant Shigella dysenteriae and Shigella flexneri by aqueous extract of Aegle marmelos, altering
its susceptibility toward beta-lactam antibiotics." Diagn Microbiol Infect Dis 61(3): 321-8.
Rastogi, N., E. Legrand and C. Sola (2001). "The mycobacteria: an introduction to nomenclature and
pathogenesis." Rev Sci Tech 20(1): 21-54.
Raynaud, C., K. G. Papavinasasundaram, R. A. Speight, B. Springer, P. Sander, E. C. Bottger, M. J.
Colston and P. Draper (2002). "The functions of OmpATb, a pore-forming protein of Mycobacterium
tuberculosis." Mol Microbiol 46(1): 191-201.
Rengarajan, J., B. R. Bloom and E. J. Rubin (2005). "Genome-wide requirements for Mycobacterium
tuberculosis adaptation and survival in macrophages." Proc Natl Acad Sci U S A 102(23): 8327-32.
Rensing, C. and G. Grass (2003). "Escherichia coli mechanisms of copper homeostasis in a changing
environment." FEMS Microbiol Rev 27(2-3): 197-213.
Ro, Y. T., H. I. Lee and Y. M. Kim (2006). "Presence of an inducible semicarbazide-sensitive amine oxidase
in Mycobacterium sp. Strain JC1 DSM 3803 grown on benzylamine." J Microbiol 44(2): 243-7.
Roberts, E. A., A. Clark and R. L. Friedman (2005). "Bacterial luciferase is naturally destabilized in
Mycobacterium tuberculosis and can be used to monitor changes in gene expression." FEMS Microbiol Lett
243(1): 243-9.
Rogall, T., J. Wolters, T. Flohr and E. C. Bottger (1990). "Towards a phylogeny and definition of species
at the molecular level within the genus Mycobacterium." Int J Syst Bacteriol 40(4): 323-30.
Rosenzweig, A. C. and T. V. O'Halloran (2000). "Structure and chemistry of the copper chaperone
proteins." Curr Opin Chem Biol 4(2): 140-7.
Saint, N., C. El Hamel, E. De and G. Molle (2000). "Ion channel formation by N-terminal domain: a
common feature of OprFs of Pseudomonas and OmpA of Escherichia coli." FEMS Microbiol Lett 190(2):
261-5.
Saleh, M. T. and J. T. Belisle (2000). "Secretion of an acid phosphatase (SapM) by Mycobacterium
tuberculosis that is similar to eukaryotic acid phosphatases." J Bacteriol 182(23): 6850-3.
Sambrook, J., E. F. Fritsch and T. Maniatis (1989). Molecular cloning: a laboratory manual. Cold Spring
Harbor, N. Y., Cold Spring Harbor Laboratory Press.
Sandbhor, U., S. Padhye, D. Billington, D. Rathbone, S. Franzblau, C. E. Anson and A. K. Powell
(2002). "Metal complexes of carboxamidrazone analogs as antitubercular agents. 1. Synthesis, X-ray
crystal-structures, spectroscopic properties and antimycobacterial activity against Mycobacterium
tuberculosis H(37)Rv." J Inorg Biochem 90(3-4): 127-36.
Sander, P., A. Meier and E. C. Bottger (1996). "Ribosomal drug resistance in mycobacteria." Res Microbiol
147(1-2): 59-67.
References
112
References
113
Sander, P., M. Rezwan, B. Walker, S. K. Rampini, R. M. Kroppenstedt, S. Ehlers, C. Keller, J. R.
Keeble, M. Hagemeier, M. J. Colston, B. Springer and E. C. Bottger (2004). "Lipoprotein processing is
required for virulence of Mycobacterium tuberculosis." Mol Microbiol 52(6): 1543-52.
Sreevatsan, S., X. Pan, K. E. Stockbauer, N. D. Connell, B. N. Kreiswirth, T. S. Whittam and J. M.
Musser (1997). "Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex
indicates evolutionarily recent global dissemination." Proc Natl Acad Sci U S A 94(18): 9869-74.
Sareen, D., G. L. Newton, R. C. Fahey and N. A. Buchmeier (2003). "Mycothiol is essential for growth of
Mycobacterium tuberculosis Erdman." J Bacteriol 185(22): 6736-40.
Stahl, C., S. Kubetzko, I. Kaps, S. Seeber, H. Engelhardt and M. Niederweis (2001). "MspA provides the
main hydrophilic pathway through the cell wall of Mycobacterium smegmatis." Mol Microbiol 40(2): 451-64.
Sassetti, C. M., D. H. Boyd and E. J. Rubin (2003). "Genes required for mycobacterial growth defined by
high density mutagenesis." Mol Microbiol 48(1): 77-84.
Stephan, J., J. Bender, F. Wolschendorf, C. Hoffmann, E. Roth, C. Mailander, H. Engelhardt and M.
Niederweis (2005). "The growth rate of Mycobacterium smegmatis depends on sufficient porin-mediated
influx of nutrients." Mol Microbiol 58(3): 714-30.
Sassetti, C. M. and E. J. Rubin (2003). "Genetic requirements for mycobacterial survival during infection."
Proc Natl Acad Sci U S A 100(22): 12989-94.
Schaible, U. E., S. Sturgill-Koszycki, P. H. Schlesinger and D. G. Russell (1998). "Cytokine activation
leads to acidification and increases maturation of Mycobacterium avium-containing phagosomes in murine
macrophages." J Immunol 160(3): 1290-6.
Scholz, O., A. Thiel, W. Hillen and M. Niederweis (2000). "Quantitative analysis of gene expression with
an improved green fluorescent protein." Eur. J. Biochem. 267(6): 1565-1570.
Schweizer, M. and U. Henning (1977). "Action of a major outer cell envelope membrane protein in
conjugation of Escherichia coli K-12." J Bacteriol 129(3): 1651-2.
Sellin, S., L. E. Eriksson and B. Mannervik (1987). "Electron paramagnetic resonance study of the active
site of copper-substituted human glyoxalase I." Biochemistry 26(21): 6779-84.
Senaratne, R. H., H. Mobasheri, K. G. Papavinasasundaram, P. Jenner, E. J. Lea and P. Draper (1998).
"Expression of a gene for a porin-like protein of the OmpA family from Mycobacterium tuberculosis H37Rv."
J Bacteriol 180(14): 3541-7.
Stephan, J., C. Mailaender, G. Etienne, M. Daffe and M. Niederweis (2004). "Multidrug resistance of a
porin deletion mutant of Mycobacterium smegmatis." Antimicrob Agents Chemother 48(11): 4163-70.
Stephan, J., V. Stemmer and M. Niederweis (2004). "Consecutive gene deletions in Mycobacterium
smegmatis using the yeast FLP recombinase." Gene 343(1): 181-90.
Stover, C. K., V. F. de la Cruz, T. R. Fuerst, J. E. Burlein, L. A. Benson, L. T. Bennett, G. P. Bansal, J.
F. Young, M. H. Lee, G. F. Hatfull and et al. (1991). "New use of BCG for recombinant vaccines." Nature
351(6326): 456-60.
Sugawara, E. and H. Nikaido (1992). "Pore-forming activity of OmpA protein of Escherichia coli." J. Biol.
Chem. 267(4): 2507-2511.
Sugawara, E. and H. Nikaido (1994). "OmpA protein of Escherichia coli outer membrane occurs in open
and closed channel forms." J. Biol. Chem. 269(27): 17981-7.
Suzuki, K. T., A. Karasawa and K. Yamanaka (1989). "Binding of copper to albumin and participation of
cysteine in vivo and in vitro." Arch Biochem Biophys 273(2): 572-7.
Sharff, A., C. Fanutti, J. Shi, C. Calladine and B. Luisi (2001). "The role of the TolC family in protein
transport and multidrug efflux. From stereochemical certainty to mechanistic hypothesis." Eur J Biochem
268(19): 5011-26.
Thomas, J. D., R. A. Daniel, J. Errington and C. Robinson (2001). "Export of active green fluorescent
protein to the periplasm by the twin-arginine translocase (Tat) pathway in Escherichia coli." Mol Microbiol
39(1): 47-53.
Siroy, A., C. Mailaender, D. Harder, S. Koerber, F. Wolschendorf, O. Danilchanka, Y. Wang, C. Heinz
and M. Niederweis (2008). "Rv1698 of Mycobacterium tuberculosis represents a new class of channelforming outer membrane proteins." J Biol Chem 283(26): 17827-37.
Tikhonova, E. B. and H. I. Zgurskaya (2004). "AcrA, AcrB, and TolC of Escherichia coli Form a Stable
Intermembrane Multidrug Efflux Complex." J Biol Chem 279(31): 32116-24.
Soares, E. V., K. Hebbelinck and H. M. Soares (2003). "Toxic effects caused by heavy metals in the yeast
Saccharomyces cerevisiae: a comparative study." Can J Microbiol 49(5): 336-43.
Solioz, M. and J. V. Stoyanov (2003). "Copper homeostasis in Enterococcus hirae." FEMS Microbiol Rev
27(2-3): 183-95.
Song, H. and M. Niederweis (2007). "Functional expression of the Flp recombinase in Mycobacterium
bovis BCG." Gene 399(2): 112-9.
Song, H., R. Sandie, Y. Wang, M. A. Andrade-Navarro and M. Niederweis (2008). "Identification of outer
membrane proteins of Mycobacterium tuberculosis." Tuberculosis (Edinb).
Song, H., F. Wolschendorf and M. Niederweis (2008b). Construction of unmarked deletion mutants in
mycobacteria. Mycobacteria protocols. T. Parish and A. C. Brown. Totowa, NY, Humana Press: 279-95.
Sonntag, I., H. Schwarz, Y. Hirota and U. Henning (1978). "Cell envelope and shape of Escherichia coli:
multiple mutants missing the outer membrane lipoprotein and other major outer membrane proteins." J
Bacteriol 136(1): 280-5.
Spagnolo, L., I. Toro, M. D'Orazio, P. O'Neill, J. Z. Pedersen, O. Carugo, G. Rotilio, A. Battistoni and
K. Djinovic-Carugo (2004). "Unique features of the sodC-encoded superoxide dismutase from
Mycobacterium tuberculosis, a fully functional copper-containing enzyme lacking zinc in the active site." J
Biol Chem 279(32): 33447-55.
Tottey, S., S. A. Rondet, G. P. Borrelly, P. J. Robinson, P. R. Rich and N. J. Robinson (2002). "A
copper metallochaperone for photosynthesis and respiration reveals metal-specific targets, interaction with
an importer, and alternative sites for copper acquisition." J Biol Chem 277(7): 5490-7.
Triccas, J. A., T. Parish, W. J. Britton and B. Gicquel (1998). "An inducible expression system permitting
the efficient purification of a recombinant antigen from Mycobacterium smegmatis." FEMS Microbiol Lett
167(2): 151-6.
van Veen, H. W. (1997). "Phosphate transport in prokaryotes: molecules, mediators and mechanisms."
Antonie Van Leeuwenhoek 72(4): 299-315.
Wagner, D., J. Maser, B. Lai, Z. Cai, C. E. Barry, 3rd, K. Honer Zu Bentrup, D. G. Russell and L. E.
Bermudez (2005). "Elemental analysis of Mycobacterium avium-, Mycobacterium tuberculosis-, and
Mycobacterium smegmatis-containing phagosomes indicates pathogen-induced microenvironments within
the host cell's endosomal system." J Immunol 174(3): 1491-500.
Wallace, M. A., L. L. Liou, J. Martins, M. H. Clement, S. Bailey, V. D. Longo, J. S. Valentine and E. B.
Gralla (2004). "Superoxide inhibits 4Fe-4S cluster enzymes involved in amino acid biosynthesis. Crosscompartment protection by CuZn-superoxide dismutase." J Biol Chem 279(31): 32055-62.
Wandersman, C. and P. Delepelaire (1990). "TolC, an Escherichia coli outer membrane protein required
for hemolysin secretion." Proc Natl Acad Sci U S A 87(12): 4776-80.
Ward, S. K., E. A. Hoye and A. M. Talaat (2008). "The global responses of Mycobacterium tuberculosis to
physiological levels of copper." J Bacteriol 190(8): 2939-46.
References
114
Wayne, L. G. (1994). "Dormancy of Mycobacterium tuberculosis and latency of disease." Eur J Clin
Microbiol Infect Dis 13(11): 908-14.
Wayne, L. G. and L. G. Hayes (1996). "An in vitro model for sequential study of shiftdown of
Mycobacterium tuberculosis through two stages of nonreplicating persistence." Infect Immun 64(6): 20622069.
Wei, S. M., E. Katona, J. Fachet, T. Fulop, Jr., L. Robert and M. P. Jacob (1998). "Epitope specificity of
monoclonal and polyclonal antibodies to human elastin." Int Arch Allergy Immunol 115(1): 33-41.
Wolschendorf, F., M. Mahfoud and M. Niederweis (2007). "Porins are required for uptake of phosphates
by Mycobacterium smegmatis." J Bacteriol 189(6): 2435-42.
Yamamoto, K. and A. Ishihama (2005). "Transcriptional response of Escherichia coli to external copper."
Mol Microbiol 56(1): 215-27.
Yasokawa, D., S. Murata, E. Kitagawa, Y. Iwahashi, R. Nakagawa, T. Hashido and H. Iwahashi (2008).
"Mechanisms of copper toxicity in Saccharomyces cerevisiae determined by microarray analysis." Environ
Toxicol.
Zeng, H., J. T. Saari and W. T. Johnson (2007). "Copper deficiency decreases complex IV but not complex
I, II, III, or V in the mitochondrial respiratory chain in rat heart." J Nutr 137(1): 14-8.
Zhu, B. Z., W. E. Antholine and B. Frei (2002). "Thiourea protects against copper-induced oxidative
damage by formation of a redox-inactive thiourea-copper complex." Free Radic Biol Med 32(12): 1333-8.
Zuber, B., M. Chami, C. Houssin, J. Dubochet, G. Griffiths and M. Daffe (2008). "Direct visualization of
the outer membrane of mycobacteria and corynebacteria in their native state." J Bacteriol 190(16): 5672-80.
Abbreviations
115
11. Abbreviations
Appreviation
*OH
µg
µM
µm
7H10
7H9
ADP
AG
AmiA
AmiC
AmiD
AmiE
AmiS
Amp
ApaI
Aph
AscI
ATCC
ATP
attB
B. burgdoferi
BamHI
BCIP
BCS
BfrBI
bla
bp
BSA
C. glutamicum
C+G
chrDNA
CM
ColE1
CopA
CopB
Cre
CSM
CsoR
CtpA
CtpB
CtpV
Cu
+
Cu
2+
Cu
CuA
CuB
CueO
CusA
CusB
CusC
CY
Cyt bcc
DCO
DCS
DHR
DNA
do
E. coli
EcoRV
ELISA
Fig.
Flp
Fmoc
FRT
FseI
Gfp
Description
hydroxyl radical
microgram
micromolar
micrometer
agar base medium for mycobacteria
base medium for mycobacterial
adenosine diphosphate
arabinogalactan
negative regulator of acetamidase expression
positive regulator of acetamidase expression
positive regulator of acetamidase expression
acetamidase
component of a putative ABC-transporter
ampicillin
restriction endonuclease
American type culture collection
adenosine triphosphate
chromosomal integration site of mycobacterial phage L5
Borrelia burgdoferi
5-Bromo-4-chloro-3-indolyl phosphate
bathocuproine disulfonate
beta-lactamase gene
basepair
beast serum albumin
Corynebacterium glutamicum
Cytosine and guanine content of DNA
chromosomal DNA
cytoplasma membrane
E. coli origin of replication
copper specific P-type ATPase
copper specific P-type ATPase
site specific recombinase
counter-selectable marker
copper sensor
predicted mycobacterial bivalent metal transporting P-type ATPase
predicted mycobacterial bivalent metal transporting P-type ATPase
predicted mycobacterial copper specific P-type ATPase
copper
copper (I)
copper (II)
binuclear copper center of cytochrome c oxidase
mononuclear copper center of cytochrome c oxidase
multicopper oxidase from E. coli
RND-protein, copper efflux
membrane fusion protein
outer membrane channel protein, TolC-like protein
cytoplasm
cytochrome bcc complex
double cross-over
downstream cloning sites
downstream homologe region
deoxyribonucleic acid
downstream region
Escherichia coli
Enzyme-Linked ImmunoSorbent Assay
figure
site specific recombinase
9H-fluoren-9-yl-methoxycarbanyl
recombination recognition sites for Flp recombinase
green fluorescent protein
Abbreviations
h
H+
H2O
HdB
HpaI
Hyg
IM
Int
Kan
kDa
LB
Link1
Link2
loxP
M
M. bovis BCG
M. leprae
M. smegmatis
M. tuberculosis
M63
MctB
MheI
min
ml
MluI
mM
MntH
MOM
Msm
Msm_3747
Mtb
mycgfp2+
MymT
N. farcinica
ng
nm
O2
OADC
ºC
OM
OmpA
OmpC
OmpF
pacet
PacI
pAL5000
pAL5000ts
PCR
PG
PhoA
PhoE
phsp60
Pi
pimyc
PL
PmeI
p-NPP
psmyc
PstI
pUC
pwmyc
PyrG
QRDTVL
RD
RIS
RNA
RND
rpm
RpsL
RpsL*
116
hour
proton, hydrogen (I)
water
Hartmans deBond medium for mycobacteria
hygromycin
inner membrane
integrase
kanamycin
kilodalton
Luria-Bertani medium for E. coli
linker sequence 1
linker sequence 2
recombination recognition sites for Cre recombinase
molar
Mycobacterium bovis BCG
Mycobacterium leprae
Mycobacterium smegmatis
Mycobacterium tuberculosis
minimal medium for mycobacteria
mycobacterial copper transport proteins (Rv1698 or Msm_3747)
minute
milliliter
millimolar
natural resistance associated macrophage protein orthologue of M. tuberculosis
mycobacterial outer membrane
M. smegmatis
MctB of M. smegmatis
M. tuberculosis
codon optimized gene for gfp expression in mycobacteria
copper-binding, mycobacterial metallothionein
Nocardia farcinica
nanogram
nanometer
molecular oxygen
oleic acid albumin dextrose catalase supplement for mycobacterial media
degree celsius
outer membrane
outer membrane protein A
outer membrane porin C
outer membrane porin F
acetamide inducible promoter
mycobacterial origin of replication
temperature-sensitive mycobacterial origin of replication (pAL5000 derivative)
polymerase chain reaction
peptidoglycan
alkaline phosphatase
phosphate specific outer membrane porin of E. coli
constitutive mycobacterial promoter for high yield gene expression
inorganic phosphate
intermediate constitutive mycobacterial promoter
periplasma
p-nitrophenyl phosphate
strong constitutive mycobacterial promoter
E. coli origin of replication
weak constitutive mycobacterial promoter
CTP-synthetase
hexapeptide (Glutamine-Arginine-Aspartate-Threonine-Valine-Leucine)
mycobacterial reagions of difference
recombination integration sites
ribonucleic acid
resistance nodulation cell divission
rounds per minute
small ribosomal protein
mutated ribosomal protein confers resistance to streptomycin
Abbreviations
Rv0846c
Rv1697
Rv1698
s
S. cerevisea
SacB
SCO
SmaI
SodC
TB
MDR
XDR
Km
O2
HA
His
Figs.
SP
sp.
SpeI
Suc
SwaI
Tab.
TAT
TolC
TorA
UCS
UHR
up
WHO
XhoI
XylE
yeast
117
putative multicopper oxidase of M. tuberculosis
operonic protein of rv1698 with unknown function in M. tuberculosis
MctB protein of M. tuberculosis
second
Saccharomyces cerevisea
levan sucrase
single cross-over
superoxide dismutase
tuberculosis
multi-drug resistant
extensively drug resistant
Kanamycin
superoxide anion
hemagglutinin-tag
6x histidine tag
figures
signal peptide
species
succrose
table
twin-arginine translocation system
outer membrane channel protein of E. coli
molybdenum containing trimethylamine n-oxide reductase
upstream cloning region
upstream homologe region
upstream
World Health Organization
catechol oxidase
Saccharomyces cerevisea

Physiological functions of mycobacterial outer membrane

Transcription

Similar documents

DATE VENUE EVENT June 7 Marquee Theater TECH N9NE June 7

Read more... - Stop TB Partnership

1-Mycobacteria 2-Chlamydia 3-Mycoplasam 4

The fascinating germ theories on cancer pathogenesis

U.S. Department ofLabor Matm`hd Safety Data Sbcet Manufacturer`s

ikatan dokter indonesia

Interview with an amoeba - ACCESS

MEMBRANA BACTERIAS ARQUEAS

135 TUBERCULOSIS OF STERNOCLAVICULAR JOINT: A RARE

Full text - Acta Medica Medianae