Book of Abstracts Albany 2009 - JBSD taken Over by Taylor and

Transcription

Book of Abstracts
Albany 2009: The 16th Conversation
June 16-20 2009
Journal of Biomolecular Structure &
Dynamics
Volume 26, Issue # 6 June 2009
Schedule of 16th Conversation ......................................................................... ii-iv
Book of Abstracts: The 16th Conversation ................................................ 787- 928
Index to Authors ........................................................................................ 929 - 932
Registration form: The 16th Conversation ............................................... 933 - 934
Sponsored by:
University at Albany
Department of Chemistry
Department of Biology
Office of the Dean, Arts and Sciences
Vice President for Research
National Institutes of Health (pending)
JBSD
Adenine Press
Detailed Configuration: Albany 2009. The 16th Conversation
Thursday, June 18
6:00-7:45 am
Breakfast, Cafeteria, Campus Center
Tuesday, June 16: You are arriving Today
1:00-11pm
Mount your posters
5:30-8:30
Dinner, Patroon Rm, Campus Center
6:00-8:00 JBSD + Organizing Cmte Dinner, Sitar
8:30-11:30
Wine & Cheese Reception, Community Room, Empire Commons
Wednesday, June 17
6:00-7:45 am
8:00-8:10 am
8:10-10:25
8:10-8:15
8:15-8:35
8:35-8:45
8:45-8:55
8:55-9:05
9:05-9:25
9:25-9:45
9:45-9:55 9:55-10:05
10:05-10:25
Welcome by Dean Edelgard Wulfert, and Chairs
Paul Toscano & Richard Zitomer
Session 1: Ribosome & Protein Synthesis
Chair: Joachim Frank, Columbia Univ.
Remarks by the Chair.
Ada Yonath, Weizmann, Israel, 4*
Suparna Sanyal, Uppsala Univ. Sweden, 12
Jie Fu, Columbia Univ., 11
Magnus Johansson, Uppsala Univ., Sweden, 7
Alexander Mankin, Univ. of Illinois, Chicago, 3
Marina Rodnina, MPI Goettingen, Germany, 6
Vasili Hauryliuk, Univ. of Tartu, Estonia, 5
Jeff Coller, Case Western Reserv. Univ., 1
Mark Safro, Weizmann, Israel, 8
10:25-11:25
Coffee and Poster Session I
11:25-12:30
11:25-11:30
11:30-11:50
11:50-12:10
12:10-12:30
Session 2. DNA Nanotechnology
Chair: Ned Seeman, NYU
Remarks by the Chair
Hanadi Sleiman, McGill Univ., 22
Yamuna Krishnan, NCBS, Bangalore, India, 19
William Shih, Harvard, 17
12:30-1:45
Lunch, Campus Center Cafeteria
1:45-4:20
1:45-2:05
2:05-2:25
2:25-2:35
2:35-2:55
2:55-3:15
3:15-3:30
3:30-3;50
3:50-4:10
4;10-4:20
Session 3: Single Molecules, Cryo EM, Tomo
Chair: Maxim Frank Kamenetskii, Boston Univ.
Sunney Xie, Harvard Univ., 23
Taekjip Ha, Univ. of Illinois U-C, 30
Micah McCauley, Northeastern Univ., 27
Bruno Samori, Univ. of Bologna, Italy, 24
Mark Williams, Northeastern Univ., 28
Liviu Movileanu, Syracuse Univ., 26
Chair: Tali Haran, Technion, Israel
Ohad Medalla, Ben Gurion Univ., Israel, 93
Martin Beck, ETH, Switzerland, 92
Junjie Zhang, Baylor College of Medicine, 90
4:20-5:20
Coffee & Poster Session II
5:20-6:30
5:20-5:40
5:40-6:00
6:00-6:20
6:20-6:30
Session 4: Alternative Splicing & Stem Cells
Chair: Volodya Uversky, IUPUI
Mikhail Gelfand, IITP, Moscow, Russia, 32
Gene Yeo, UCSD, 35
Keith Dunker, IUPUI, 34
Chris Oldfield, IUPUI, 31
6:30-8:00
Dinner, Patroon Room, Campus Center
8:00-9:10
8:00-8:05
8:05-9:05
Session 5: Nobel Laureate Evening Lecture
Chair & Introduction: Edward Trifonov, Haifa, Israel
Andrew Fire, Stanford Univ., 41
9:30- ?
Reception for Andrew Fire: Indian Party,
Community Center, Empire Commons
8:00-9:55
8:00-8:05
8:05-8:25
8:25-8:35
8:35-8:45
8:45-9:05
9:05-9:25
9:25-9:35 9:35-9:55 Session 6: RNA: Catalysis, Folding
Chair: David Lilley, Dundee, UK
Dan Herschlag, Stanford, 44
Subha Das, Carnegie Mellon Univ., 46
Paval Banas, Palacky Univ., Czech Republic, 50
Anna Marie Pyle, Yale, 45
Chair: Ishita Mukerji, Wesleyan
Hong Li, Florida State Univ, Tallahasse, 51
David Rueda, Wayne State Univ. 48
Saba Valdkhan, Case Western Reserv Univ., 52
9:55-11:00
Coffee and Poster Session III
11:00-12:20
11:00-11:20
11:20-11:30
11:30-11:40
11:40-12:00
12:00-12:20
Session 7: RNA: Silencing of the Genome
Chair: Hiroshi Sugiyama, Kyoto Univ., Japan
Brenda Bass, Univ. of Utah, 42
Alain Laederach, Wadsworth Labs, 37
Atsushi Ogura, Ochanomizu Univ., Japan, 36
Chair: Michael Waring, Cambridge, UK
David Corey, UTSW Medical Center, Dallas, 39
Gerhart Wagner, Uppsala Univ., Sweden, 40
12:20-1:45
1:45-3:15
1:45-2:05
2:05-2:15
2:15-2:35
2:35-2:55
2:55-3:05
3:05-3:15
Session 8: RNA: Structural Informatics
Chair: S.Wijmenga, Radboud Univ., The Netherlands
Neocles Leontis, Bowling Green Univ., 59
Y. Dalyan, Yerevan State Univ., Armenia, 63
Bruce Shapiro, NIH, 56
Chair: Krystyna Zakrzewska, IBCP, Lyon, France
Jiri Sponer, IBP, Brno, Czech Republic, 61
Yuri Vorobjev, ICB, Novosibirsk, Russia, 60
Yaser Hashem, Univ. Louis Pateur, Paris, France, 68
3:15-4:15
Coffee & Poster Session IV
4:15-6:00
4:15-4:20
4:20-4:40
4:40-4:50
4:50-5:10
5:10-5:30
5:30-5:40
5:40-6:00
Session 9: Toxic RNA & Sefish DNA
Chair: Sergei Mirkin, Tufts Univ.
Kirill Lobachev, Georgia Tech, 76
Sarah Delaney, Brown Univ., 78
Karen Vasquez, M D Anderson Cancer Center, 75
Galina Filippova, Fred Hutchinson Cancer Center, 73
M. R. Rajeswari, AIIMS, New Delhi, India, 77
W. Krzyzoslak, Polish Acad. of Sci., Poland, 74
6:00-7:30
Dinner, Patroon Room, Campus Center
7:30-9:05
7:30-7:35
7:35-7:55
7:55-8:05
8:05-8:25
8:25-8:35
8:35-8:45
8:45-9:05
Session 10: Genomics & System Biology
Chair: Samir Brahmachari, CSIR, New Delhi, India
Takashi Gojobori, NIG, Mishima, Japan, 84
Ikuo Suzuki, NIG, Mishima, Japan, 87
Masaru Tomita, Keio Univ., Fujisawa, Japan, 86
Vijay Reddy, Queens College, CUNY, 113
Gemma Atkinson, Univ. of Uppsala, Sweden, 85
L. Aravind, NCBI, NIH, 88
9:05- ?
Trifonov & Maxim host their Russian Party
in their apartments
* indicates abstract # in the book of abstracts
-ii-
Detailed Configuration: Albany 2009. The 16th Conversation (Continued)
Friday, June 19
6:00-7:45 am
Saturday, June 20: You are going home today after lunch
7:00-8:45 am
8:00-9:50
8:00-8:05
8:05-8:30
8:30-8:40
8:40-9:05
9:05-9:15
9:15-9:25
9:25-9:50
Session 11: Chromatin & Epigenetics 1
Chair: Jordanka Zlatanova, Univ. of Wyoming
Daniela Rhodes, MRC, Cambridge, UK, 181
Julien Mozziconacci, Univ. P et M Curie, France, 184
Andrew Travers, FPGG, ENS de Cachan, France, 179
M. Vijayalakshmi, NCBS, Bangalore, India, 191
Gaurav Arya, UCSD, 187
Sergei Grigoryev, Penn. State Univ., Hershey, 186
9:00-10:15
9:00-9:05
9:05-9:25
9:25-9:35
9:35-9:45
9:45-9:55
9:55-10:05
10:05-10:25
Session 15: The DNA Session 1
Chair: Robert Jernigan, Iowa State
Alison Hickman, NIH, 170
Geoff Baldwin, Imperial College, London UK, 143
Youri Timsit, IBPC, Paris, France, 168
Danith Ly, Carnegie Mellon Univ., 178
Jie Zhai, Wesleyan Univ., 148
Phoebe Rice, Univ. of Chicago, 160
9:50-10:50
Coffee & Poster Session V
10:25-10:45
Coffee
10:50-12:35
10:50-11:15
11:15-11:25
11:25-11:35
11:35-11:45
11:45-12:10
12:10-12:35
Session 12: Chromatin & Epigenetics 2
Chair: Wolfram Saenger, Frie Univ. Berlin, Germany
Jeffrey C. Hansen, Colorado State Univ., 182
S K Pradhan, Saha Inst of Nuclear Physics, India, 193
H. Van Ingen, Univ. of Toronto, Canada, 189
Mariusz Nowacki, Princeton, 190
Chair: Udo Heinemann, MDC, Berlin, Germany
Stephen Baylin, Johns Hopkins Schl of Medicine, 183
Cynthia Wolberger, Johns Hopkins Schl of Med., 192
10:45-12:25
10:45-11:05
11:05-11:15
11:15-11:25
11:25-11:45
11:45-11:55
11:55-12:05
12:05-12:25
Session 16: The DNA Session 2
Chair: Zippi Shakked, Weizmann, Israel
Tom Tullius, Boston Univ., 146
Irena Artamonova, Vavilov Inst, Moscow, Russia, 147
Mrinalini Puranik, NCBS, Bangalore, India, 177
Akinori Sarai, KIT, Iizuka, Japan, 159
Padmavathi P, Univ. of Hyderabad, India, 162
Marc Gueroult, Univ Paris Diderot-Paris, France, 156
Barry Honing, Columbia, 157
12:35-1:45
12:25-12:30
Zippi Shakked Closes the Conversation
1:45-3:15
1:45-2:05
2:05-2:15
2:15-2:35
2:35-2:45
2:45-2:55
2:55-3:15
Session 13: Innovation
Chair: Olga Fedorova, ICB, Novosibirsk, Russia
Jan Liphardt, UC Berkeley, 97
Huiyi Chen, Harvard, 95
Elena Bichenkova, Univ. of Manchester, UK, 96
Chair: Luis Marky, Univ. of Nebraska Medical Center
Kumkum Jain, IIT Delhi, India, 119
Danny Hsu, Univ. of Cambridge, UK, 94
Marius Clore, NIH, 98
12:30-2:00
Big Farewell Lunch, Patroon Rm, Campus Center:
Go Home After Lunch
3:15-4:40
Coffee & Poster Session VI
4:40-7:00
4:40-5:00
5:00-5:10
5:10-5:30
5:30-5:40
5:40-5:50
5:50-6:10
6:10-6:30
6:30-6:40
6:40-7:00
Session 14: Proteins: Allostery, Structure & Design
Chair: Neville Kallenbach, NYU
Saraswathi Vishveshwara, IISc, Bagalore, India, 100
Susan Pieniazek, Wesleyan Univ., 122
Antonio del Sol, Fujirebio Inc, Tokyo, Japan,, 116
Ke Xia, RPI, 114
Brian Callahan, Wadsworth Center, 102
Gino Cingolani, Upstate SUNY, 130
Chair: Manju Bansal, IISc, Bangalore, India
Andrew Lee, Univ. of N. Carolina, Chapel Hill, 124
Poonam Singh, CDRI, Lucknow, India,118
Brian Kuhlman, Univ of N. Carolina, Chapel Hill, 106
7:30-10:00
Big Feast, Campus Center Ball Room
10:00- ?
Cash Bar in Ball Room
Nucleosome Positioning Workshop: 2:00-5:30 pm,
Chair: Victor Zhurkin, NIH
Workshop Presentation by:
Manju Bansal, IISc, Bangalore, India, 212
Tom Bishop, Tulane University, 208
Gregory Bowman, Johns Hopkins, 196
David Clark, NIH, 214
Feng Cui, NIH, 197
Pasquale De Santis, Univ. of Rome, Italy, 195
Yair Field, Weizmann, Israel, 202
Haran, Tali, Technion, Haifa, Israel, 213
Cizhong Jiang, Pennsylvania State Univ., 207
Steve Johnson, Stanford University, 205
Alexandre Morozov, Rutgers, 203
Wilma Olson, Rutgers, 198
Remo Rohs, Columbia, 209
Eran Segal, Weizmann Institute, Israel, 204
Michael Tolstorukov, Harvard, 200
Edward Trifonov, Haifa, Israel, 210
All the above participants are expected to present poster discussion papers
on Friday afternoon Poster Session #6. The oral presentations during the
workshop will be short, and are designed to evoke extensive discussion.
-iii-
Albany 2009
The 16th Conversation
State University of New York
Albany NY USA
June 16-20 2009
Director
Prof. Dr. Ramaswamy H. Sarma
Chemistry Department
Albany NY 12222 USA
ph: 518-456-9362; fx: 518-452-4955
email: rhs07@albany.edu
Organizing Committee
David. L. Beveridge, Wesleyan
Maxim Frank-Kamenetskii, Boston U.
Robert Jernigan. Iowa State Univ.
Thomas Cheatham, Utah
Udo Heinemann, Berlin, Germany
David Lilley, Dundee, UK
Dino Moras, Strasbourg, France
Bengt Norden, Nobel Cmte, Sweden
Ruth Nussinov, Tel Aviv Univ.
Wilma Olson, Rutgers
Alex Rich, MIT
Wolfram Saenger, Berlin, Germany
Mukti Sarma, SUNY at Albany
Ned Seeman, New York Univ.
Zippi Shakked , Weizmann, Israel
Jiri Sponer, Czech Republic
Ed Trifonov , Uni. of Haifa, Israel
Sybren Wijmenga, The Netherlands
Victor Zhurkin, NIH
Hi Folks:
In behalf of the University at Albany, State University of New York, I have the great pleasure of
welcoming all of you to our uptown Albany campus.
Have a great time, enjoy your stay, above all let us have a memorable Conversation in biological
structure, dynamics, interactions and expression.
Sincerely yours
Prof. Dr. Ramaswamy H. Sarma
Chemistry, SUNY at Albany
Albany NY 12222
Ph: 518-456-9362; fx: 518-452-4955
Email: rhs07@albany.edu
April 21 2009
Dynamics, ISSN 0739-1102
Volume 26, Issue Number 6, (2009)
©Adenine Press (2009)
Book of Abstracts
Albany 2009: 16th Conversation
Eukaryotic mRNA Decapping
Occurs on Polyribosomes
The regulated turnover of mRNA is recognized as a vital aspect of gene expression. The importance of maintaining appropriate mRNA decay is exemplified by
the complexity of the decay process; there are three distinct steps (deadenylation,
decapping, and exonucleolytic decay) and over 20 protein factors are involved. An
additional layer of complexity is manifest by the observation that the process of
mRNA degradation is intertwined with mRNA translation, exhibiting an inverse
relationship. Specifically, alterations in the rate translational initiation lead to dramatic destabilization of mRNAs. Additionally, translational initiation defects can
be suppressed by mutations a component of the mRNA decapping factor. Lastly,
decapping is postulated to require dissociation of the mRNA from ribosomes
and packaging into sub-cellular, ribosome-free granules termed P-bodies. These
findings have lead to a well accepted model in which the cessation of mRNA
translation and packaging into P-bodies is thought to be an initial and necessary
step in the regulated destruction of cytoplasmic mRNA transcripts. Despite these
long-standing observations, the precise and detailed mechanism of how mRNA
translation and mRNA decay are couple remains ambiguous. We will highlight
our recent work focused on understanding the connection between mRNA decay
and translation. We demonstrate that mRNA decapping and exonucleolytic decay
occurs while mRNA is still engaged with ribosomes. Specifically, the substrate for
decapping, deadenylated mRNA, is found associated with ribosomes. Moreover,
decapped mRNA can be detected bound to polyribosomes indicating deadenylation
and decapping occurs concurrently with translation. Additionally, we show that
products of 5ʹ exonucleolytic degradation are polyribosome associated. These data
demonstrate that removal of mRNA from ribosomes is not a prerequisite for degradation and that mRNA decapping and 5ʹ-3ʹ decay occur co-translationally under
normal conditions. Considering this finding, we propose the polarity of mRNA
decay (i.e., decapping and 5ʹ-3ʹ decay) has evolved to ensure degradation does not
impede the last translocating ribosome.
Homology Modeling and Molecular
Dynamics Simulations of RNA Polymerases
Although transcription is of central importance to cell survival, only few antimicrobial agents have been directed towards the RNA polymerase (RNAP) enzyme.
Rifampicin, one of the most potent and broad spectrum antibiotics and a key component of anti-tuberculosis therapy, binds in a pocket of the RNAP deep within the
DNA/RNA channel, but more than 12 Å away from the active site. Unfortunately,
binding of Rifampicin can be easily disturbed by enzyme mutations. Therefore,
we are interested in blocking of active sites of bacterial RNAPs directly – using
analogs of NTPs. Such approach was found as very potent in the case of viral
infections. Here, we present results of homology modeling (using the MODELLER
software package), ab initio calculations (GAUSSIAN03), classical (AMBER
Wenqian Hu
Thomas Sweet
Kristian Baker
Jeff Coller*
1
Center for RNA Molecular Biology
Case Western Reserve University
Cleveland OH 44106, USA
jmc71@case.edu
*
Ivan Barvik*
Kamil Malac
2
Charles University, Faculty of
Mathematics and Physics, Institute of
Physics, Ke Karlovu 5, Prague 2, 121 16,
Czech Republic
ibarvik@karlov.mff.cuni.cz
*
787
788
and NAMD software packages), and ab initio molecular dynamics simulations
(CPMD). RNAPs in complex with nucleic acids (template DNA strand, RNA transcript, NTP – either natural or chemically modified) were investigated.
Support from the Ministry of Education, Youth and Sports of the Czech
Republic (Project No. MSM 0021620835 and Project No. NPVII 2B06065) is
gratefully acknowledged.
3
Nora Vazquez-Laslop
Blanca Martinez-Garriga
Haripriya Ramu
Dorota Klepacki
Alexander Mankin*
Center for Pharmaceutical Biotech.
University of Illinois at Chicago
Chicago, IL
shura@uic.edu
*
Functional Interactions Between
the Ribosome and the Nascent Peptide
Functional interactions between the ribosome and the nascent peptide play an
important role in regulation of expression of some bacterial genes. The molecular
mechanisms of the nascent peptide recognition are unclear and the extent to which
this type of gene regulation is utilized by the cell is unknown. We are interested
in identifying the nascent peptide sensors in the ribosome and delineating features
of the nascent peptide recognized by these sensors. We investigated programmed
drug-dependent ribosome stalling used for regulation of expression of certain antibiotic-resistance genes. Such stalling is controlled by the sequence of the nascent
peptide and an antibiotic molecule that binds in the ribosome exit tunnel. We identified the sites of the ribosome stalling and the critical sequences of the nascent
peptides required for the erythromycin-dependent stalled complex formation at the
regulatory open reading frames of a number of macrolide resistance genes. The
results indicate that a variety of nascent peptide sequences can be recognized by the
ribosome as stalling signals. We further tested several nucleotides in the ribosome
exit tunnel for their potential role in recognition of the nascent peptide. Besides the
previously identified nucleotide A2062, a conserved adenine residue at position
2503 appears to play a critical role in sensing the nature of the nascent peptide.
Several other nucleotides in the exit tunnel are also involved in either sensing the
nascent peptide or forming the stalled translation complex.
In order to determine the extent to which cellular gene regulation is controlled by
ribosome-nascent peptide interactions, we compared the proteome of wild type E.
coli cells to that of a strain carrying a ribosomal mutation A2058G that affects the
nascent peptide recognition. We could obtain conclusive quantitative data from 239
identified proteins. The steady-state levels of at least 13% of the proteins were significantly different (more than 2-fold) between the mutant and wild type. This result
suggests that specific interactions between the nascent peptide and the ribosome
controls expression of a considerable number of cellular genes. Bioinformatics
analysis is currently being carried out to specifically identify cistrons encoding
nascent peptides potentially involved in functional interactions with the ribosome.
4
Ada Yonath
Department of Structural Biology
Weizmann Institute
Rehovot 76100, Israel
ada.yonath@weizmann.ac.il
*
Identification of the Evolving RNA
Nano-machine for Protein Biosynthesis
Within the Contemporary Ribosome
Ribosomes, the universal cellular nano-machines, act as polymerases that translate
the genetic code into proteins with high efficiency. The ribosome’s active site, the
peptidyl transferase center (PTC), resides within a highly conserved region of the
contemporary large ribosomal subunit. Comprised of 180 nucleotides arranged
as a pseudo symmetrical two-fold region in all known ribosome structures, this
region confines a void that provides the space required for the production of the
nascent proteins and contains all of the structural elements required for navigating
the formation of nascent proteins.
The elaborate architecture of this region is capable of positioning both the amino
acylated and peptidyl tRNA substrates in stereochemistry required for peptide
bond formation, for substrate-mediated catalysis, and for substrate translocation.
Hence, enabling the repetition of peptide bond formation and facilitating amino
acid polymerization.
789
The overall fold of the RNA backbone of this region resembles motifs identified in ancient as well as in contemporary RNA molecules of comparable size.
Consistently, the extremely high conservation of this region throughout all known
kingdoms of life implies its existence beyond environmental conditions. The universality of the three dimensional structure of this region and its central location
within the ribosome indicate that this region may represent the proto-ribosome
and support the hypothesis that the proto-ribosome evolved by gene duplication
or gene fusion. This could have been performed by the RNA since it can act as an
enzyme and replicate its own template.
Although the proto-ribosome can act as a ribozyme, on its own it provides only a
modest level of activity, mainly owing to its seemingly limited structural stability and rather loose substrate accommodation. A substantial increase in the catalytic rate could have been generated by peripheral RNA elements and proteins or
peptides. Appearance of polypeptides that can perform required functions more
efficient than ribozymes triggered the emergence of peptide bond formation associated by decoding of genetic information.
Experimental results and conceptual issues will be presented and discussed.
5
Investigations of Translational GTPases
using Isothermal Titration Calorimetry Reveal
G-nulceotide Dependent Structural Rearrangements
GTPases oscillate between their GTP- and GDP-bound states via regulated cycles
of GTP hydrolysis and exchange of GDP for GTP. The interaction between the
GTPase and the G nucleotide is mediated by switch 1 and 2 (sw 1 and sw 2) regions
of the GTPase domain. The nature of the bound nucleotide is believed to be the
main factor regulating the functional state of the protein, regulating its on / off
modes: off in the apo and GDP-bound state, and on in the GTP-bound state.
We used isothermal titration calorimetry to investigate the GTPase cycle of a
number of GTPases involved in translation (trGTPases): IF2, EF-G, and eRF3.
For these we determined Kd and thus Gibbs energy (ΔGo), enthalpy (ΔHo), entropy
(ΔSo) and change in heat capacity (ΔCp = d(ΔH)/dT) of the interaction between the
protein and the G nucleotides. The last parameter (ΔCp) is directly proportional to
change in the solvent accessible area of the protein and thus reflects the extent of
the structural rearrangement, bridging the gap between the physical chemistry and
structural biology descriptions of the system.
Our ΔCp data suggest that in the case of EF-G, GTP binding promotes ordering of
the sw 1 and sw 2 regions, but GDP does not (1) (Fig. 1) as indicated by the 250
cal·mol-1·K-1 ΔCp difference in GDP and GTP binding. In the IF2 case, in addition
to the GTP-mediated ordering of the sw 1 and sw 2 regions that cause the 290
cal·mol-1·K-1 difference between GDP and GTP binding, both GTP and GDP promote a large-scale rearrangement in the protein, suggested by the large ΔCp that
binding of either nucleotide causes (Fig. 1). Finally, in the eRF3 case, binding of
eRF1 is necessary for GTP binding (2), which promotes a large-scale rearrangement of the eRF1:eRF3 complex (Fig. 1).
Vladimir A. Mitkevich1
Alexander A. Makarov1
Artem Kononenko1
Tanel Tenson2
Mans Ehrenberg3
Vasili Hauryliuk2,*
Engelhardt Institute of Molecular
1
Biology
Vavilov str. 32
Moscow 119991, Russia
University of Tartu
2
Institute of Technology
Nooruse St. 1, 50411 Tartu, Estonia
Dept. of Cell and Molecular Biology
3
Uppsala University, Sweden
vasili.hauryliuk@ut.ee
*
790
The results presented here demonstrate that despite the common functional cycle,
different trGTPases do have significant differences in the way they are regulated
by G nucleotides.
Figure 1: Enthalpy of binding of GDP (empty circles)
and GTP (filled circles) to trGTPases as a function of
the temperature (ªC) at pH 7.5.
References and Footnotes
6
Marina V. Rodnina
Dept. of Physical Biochemistry
Max Planck Institute for
Biophysical Chemistry
Am Fassberg 11
37077 Goettingen, Germany
rodnina@mpibpc.mpg.de
1. Hauryliuk, V. et al. Proc Natl Acad Sci USA 105, 15678-15683 (2008).
2. Hauryliuk, V. et al. Biochimie 88, 747-757 (2006).
Kinetics of mRNA and tRNA
Selection by the Ribosome
Ribosomes are molecular machines that synthesize proteins in the cell. The translation initiation efficiency of a given mRNA is determined by its translation initiation
region (TIR). Recent kinetic data reveal the order of initiation factor binding to the
30S subunit and the adjustments within the complex in response to mRNA selection.
At the stage of the 30S initiation complex formation mRNAs that lack extensive
secondary structures at the AUG start codon bind to the ribosome proportionally
to their cellular concentrations, while folded mRNAs form unproductive stand-by
complexes that dissociate quickly. The conversion of the 30S initiation complex
into the translating 70S ribosome constitutes another important mRNA control
checkpoint for the stereochemical fitness of mRNA TIR, including the strength of
the Shine-Dalgarno interaction, the length of the mRNA spacer from the ShineDalgarno sequence to the AUG codon, and the codon-anticodon interaction between
the start codon and the initiator tRNA. The efficiency with which an mRNA enters
the pool of translating ribosomes is controlled by the conformation of the 30S initiation complex, while the 50S subunit appears to be a sensor of the 30S initiation
complex structure that provides the irreversibility of the reaction. Ribosomes take
an active part in aminoacyl-tRNA selection by distinguishing correct and incorrect
codon-anticodon pairs. Correct codon-anticodon complexes are recognized by a network of ribosome contacts that are specific for each position of the codon- anticodon
duplex and involve A-minor RNA interactions. Recognition relies on the geometry
of the codon-anticodon complexes and enables the ribosome to accept different
cognate tRNAs with similar efficiency, irrespective of differences in sequence and
structure. Single mismatches at any position of the codon-anticodon complex result
in slower forward reactions and a uniformly 1000-fold faster dissociation of the
tRNA from the ribosome, regardless of the thermodynamic stability of the respective codon-anticodon complexes or their docking partners at the decoding site.
Kinetics of the rRNA-Catalyzed
Peptidyl-Transfer to Native aa-tRNAs
High levels of accuracy in transcription, aminoacylation, and mRNA translation
are essential for all life forms. However, a very high accuracy level may be incompatible with a high rate of protein synthesis. For maximal rate of cell growth there
is therefore an optimal balance between accuracy and rate of protein elongation.
We have used an in vitro system, optimized for high rate and accuracy in protein
elongation, to characterize the reaction between wild-type E. coli ribosomes in
post-translocation state and cognate as well as near-cognate ternary complexes (1).
At 37 ºC, we estimate the maximal rate (kcat) of fMet-Phe dipeptide formation as
130 s-1. Under the same condition, we estimate the near-cognate missense error as
3·10-7. The kcat-value is compatible with the average in vivo protein elongation rate,
including the translocation step, estimated as 22 amino acids per second per ribosome for E. coli bacteria growing in rich medium at 37 ºC. Our in vitro estimate for
the missense error level is, at the same time, on the lower side of the “consensus”
estimate of about one missense substitution per three thousand incorporated amino
acids. By determining the temperature dependence of the rate limiting step subsequent to GTP hydrolysis we estimated the activation enthalpy (ΔH‡) and entropy
(TΔS‡) of this step as 17 kcal·mol-1 and 2 kcal·mol-1, respectively. These values
are in good agreement with previous theoretical as well as experimental estimates
of the activation free energy of the ribosome-catalyzed peptidyl-transfer reaction.
Therefore our data suggest, but do not prove, that under optimal experimental conditions peptidyl-transfer itself, rather than tRNA accommodation, is rate limiting
in the sequence of chemical events that leads from ternary complex association
with the A site to peptide bond formation. Our more recent data show a clear pH
dependence of the overall rate of peptidyl transfer for several different aa-tRNAs,
in line with the prevailing model for RNA catalyzed peptidyl-transfer.
791
Magnus Johansson
Kaweng Ieong1
Elli Bouakaz1
Martin Lovmar1
Peter Strazewski2
Michael Pavlov1
Måns Ehrenberg1,*
1
7
Dept of Cell and Molecular Biology
1
BMC, Uppsala University
Box 596, S-751 24 Uppsala, Sweden
Lab de Synthèse de Biomolécules
2
Institut de Chimie et Biochimie
Moléculaires et Supramoléculaires (UMR
5246), Université Claude Bernard
Lyon 1, France
*ehrenberg@xray.bmc.uu.se
1. Johansson, et al. Mol Cell 30, 589-598 (2008).
8
Structural Diversity and Functional Versatility Among
Phenylalanyl-tRNA Synthetases in Primary Kingdoms
The aminoacyl-tRNA synthetases (aaRSs) ensure the fidelity of the genetic code
translation, covalently attaching appropriate amino acids to the corresponding
nucleic acid adaptor molecules – tRNA. Phenylalanyl-tRNA synthetase (PheRS)
is the enzyme responsible for specific incorporation of amino acid phenylalanine
into protein sequence and structure. PheRS – the largest and complex enzyme
among the 19 other members of aaRS family, has (αβ)2 subunit organization and
its structure was first solved for the T. thermophilus enzyme (1). Phylogenetic and
structural analysis suggest that there are three major forms of PheRS: (i) heterodimeric (αβ)2 bacterial; (ii) heterodimeric (αβ)2 archaeal/eukaryotic-cytosolic; and
(iii) monomeric mitochondrial.
Two crystal structures of PheRS from different compartments of eukaryotic cell
have been determined very recently. While the total length of the (αβ)2 human
cytosolic enzyme is made up of 2194 residues, the mature mitochondrial PheRS
is the smallest known monomeric aminoacylation system consisting of 415 amino
acids only and, in fact it is a chimera of the catalytic α-subunit and the anticodonbinding domain from β-subunit of the bacterial enzyme. All three enzymes catalyzing the same enzymatic reaction demonstrate, however, remarkable diversity in
their structural organization (see Figure 1) (2, 3). Although basic architecture of
the core domains (A1 and A2 from α-subunit and B6 and B7 from β-subunit) that
have been implicated in formation of four-helix bundle interface of the heterodi-
Mark Safro1,*
Nina Moor2
Igal Finarov1
Liron Klipcan1
Department of Structural Biology
1
Weizmann Institute of Science
76100 Rehovot, Israel
Institute of Chemical Biology and
2
Fundamental Medicine
630090 Novosibirsk, Russia
mark.safro@weizmann.ac.il
*
792
mer is well conserved in cytosolic enzymes, the unique peptide extensions and
shortenings have been found at the N- and C-terminal ends of the human enzyme.
These features suggest a subsidiary and essential changes in the structure of human
enzyme as compared to the Th. thermophilus one and lead us to conclusion that
modes of binding and recognition of cognate tRNAPhe are different in prokaryotes
and eukaryotes. This, in turn, testifies that PheRS holds a unique position among
the other 20 aaRSs. Moreover, as regards to proofreading activity associated with
a distinct active site, where misactivated tyrosyl-adenylate or misaminoacylated
Tyr-tRNAPhe have to be hydrolyzed, PheRSs from different compartments also
differ widely. Thus, eukaryotic and prokaryotic cytosolic enzymes are capable to
deacylate Tyr-tRNAPhe while mitochondrial PheRS is unable to do this due to the
absence of the editing module. Transition from heterodimeric subunit organization
of PheRSs in cytoplasm to monomeric in mitochondria most likely is accompanied
by changes in dynamic characteristics of PheRS-tRNAPhe complex formation. We
hypothesize that during the transfer to the tRNA-free state, mitochondrial enzyme
exhibits both ‘‘open’’ and ‘‘closed’’ conformations. Contrary to cytoplasmic
enzymes that retain their 3D-structure upon tRNA binding, complex formation in
mitochondria must be accompanied by considerable rearrangement (hinge-type
rotation through 160º) of the anticodon-binding domain. We also show that PheRSs
demonstrate a marked degree of natural plasticity within the active site: the amino
acid binding pocket is capable of binding both the noncognate tyrosine and its
unnatural derivatives, i.e., substrates of larger size than cognate phenylalanine.
Figure 1
1. Goldgur, Y., Mosyak, L., Reshetnikova, L., Ankilova, V., Lavrik, O., Khodyreva, S., Safro,
M. Structure 5, 59-69 (1997).
2. Klipcan, L. Levin, I., Moor N., Finarov, I., Safro M. Structure 16, 1095-1104 (2008).
3. Finarov, I., Moor, N., Klipcan, L., Kessler, N., Safro M. Submitted for publication (2009).
Structural Dynamics of Elbow Segment of
E. coli Ribosomal A-site Finger. Comparison of
Simulations with Cryo-EM Data and with
Equivalent Segments in Other Species
Helix 38 (H38) of the large ribosomal subunit is a long, bent structure connecting with the small subunit through intersubunit bridge B1a. Its elbow segment,
known as a kink-turn (Kt-38) in the Haloarcula marismortui ribosome, is the
likely source of its dynamical properties, important for translational fidelity. The
archaeal and bacterial crystal structures reveal similar topologies of the elbow segment across species, even though the sequences, 2D structures and local interactions in the region are very diverse. We have carried out explicit solvent molecular
dynamics simulations of the H38 elbows of four different species. The directional
flexibility of the E.coli H38 elbow inferred from the simulations is consistent with
the conformational changes observed by cryo-EM of the ribosome in several functional states. We suggest that the simulations properly capture intrinsic thermal
fluctuations of this rRNA segment which are of functional importance. Further,
the H38 elbows of all four studied species possess similar stochastic fluctuations
and directional intrinsic flexibilities. The elbows in three bacterial ribosomes can
be considered as structural analogs of Kt-38 present in archaea. Thus, the elbow of
H38 illustrates how large RNAs can utilize diverse sequences to achieve equivalent or similar topologies and dynamics properties.
793
Kamila Reblova
Filip Razga1,2
Wen Li3
Haixiao Gao3
Joachim Frank4
Jiri Sponer1
9
1,*
Institute of Biophysics, Academy
1
of Sciences of the Czech Republic,
Kralovopolska 135, 61265 Brno
Czech Republic
National Centre for Biomolecular
2
Research, Faculty of Science, Masaryk
University, Kamenice 5, 62500 Brno,
Czech Republic
Wadsworth Center, Albany, NY 12201,
3
Dept. of Biochemistry and Molecular
4
Biophysics and Dept of Biological
Sciences, Columbia University
New York, NY 10032, USA
kristina@physics.muni.cz
*
The Mechanism of aa-tRNA Entry into the Ribosome
The selection process of aminoacyl-tRNAs (aa-tRNAs) starts with the entry of the
ternary complex formed by aa-tRNA, elongation factor Tu (EF-Tu) and GDP into
the ribosome, placing the aa-tRNA in the A/T position, with a distorted conformation compared to the A-site tRNA (1-6). The distortion, visible by cryo-EM in a
kirromycin-stalled E. coli A/T ribosome complex after GTP hydrolysis, has been
recognized as essential for probing initial codon-anticodon recognition (5, 7).
However, the origin of the conformational deformation was interpreted differently
in different studies. Valle et al. (5) modeled the distortion as a kink at the junction between the D and anticodon stems (later confirmed by molecular dynamics
flexible fitting MDFF) (3, 6), and proposed that it was triggered by the interaction
of aa-tRNA with helix 69 of the 23S rRNA, but this proposal was weakened by
the discovery that ribosomes with helix 69 deleted still translate with virtually
unchanged fidelity (8, R. Greene, personal communication). Recently, Schuette
et al. (1), analyzing a kirromycin-stalled T. Thermophilus A/T ribosome complex
by rigid-body fitting, described the observed distortion of the aa-tRNA as a twist
between the T and acceptor stems, as well as opening between the T-acceptor arm
and D stem. These authors postulated that there is no ribosome-induced conformational change prior to codon-anticodon interaction, and suggested that a nearly
correct steric engagement in the initial approach might result from conformational
fluctuations of the tRNA. We now address this question by molecular dynamics
simulations on a free Phe-tRNA·EF-Tu complex. These simulations show that aa-
Wen Li1
Elizabeth Villa2
Joachim Frank1,3,4,*
10
Howard Hughes Medical Institute
3
Department of Biochemistry and
1
Molecular Biophysics
Columbia University
650 W. 168th Street, BB2-221
Max Planck Institute of Biochemistry
2
D-82152 Martinsried, Germany
Department of Biological Sciences
4
Columbia University
jf2192@columbia.edu
*
794
tRNA in the context of the ternary complex has a dynamic behavior distinct from a
free aa-tRNA. The conformational distortion in the D loop and the anticodon stem
loop occurs in a much larger and diverse range, compared with free aa-tRNA,
when the aa-tRNA is bound with EF-Tu. It includes a pronounced mode of bending/twisting in the region identified by Valle et al. (5), toward a conformation that
readily facilitates codon-anticodon contact. Our present results demonstrate that
EF-Tu-bound aa-tRNA may spontaneously (within a time frame commensurate
with physiological requirements) form a geometry permitting codon-anticodon
interaction, in agreement with Schuette et al.’s hypothesis.
1.
2.
3.
4.
5.
6.
7.
8.
11
Jie Fu1,4
Drew Kennedy4
James B. Munro2
Jianlin Lei4
Scott C. Blanchard2
Joachim Frank3,4,*
Department of Biomedical Sciences
1
State University of New York at Albany
Dept. of Physiology and Biophysics
2
Weill Medical College
of Cornell University
3
Department of Biochemistry and
4
Molecular Biophysics
Columbia University
jf2192@columbia.edu
*
Figure 1: The different states of the G2252C complex
obtained by single particle reconstruction and unsupervised classification. Upper panels: the cryo-EM maps
of the 70S ribosome in different states. Lower panels:
the cryo-EM maps of the corresponding 50S subunit
and the inter-subunit ligands. (A) The classical state of
the ribosome. (B) The first intermediate state. (C) The
second intermediate state.
Schuette, J. C., et al. EMBO J. 28, 755-765 (2009).
Stark, H., et al. Nat Struct Biol 9, 849-854 (2002).
Trabucco, L., et al. Structure 16, 673-683 (2008).
Valle, et al. EMBO J. 21, 3557-3567 (2002).
Valle, M., et al. Nat Struct Biol 10, 899-906 (2003).
Villa, E., et al. Proc Natl Acad Sci USA 106, 1063-1068 (2009).
Frank, J. et al. FEBS Lett 579, 959-962 (2005).
Ali, I. K., et al. Molecular Cell 23, 865-874 (2006).
The P-site tRNA Reaches the P/E
Position Through Intermediate Positions
While it has been widely accepted that the tRNAs are in A/P and P/E hybrid
positions before translocation to the P/P and E/E sites, a recent sm-FRET study
suggested that, prior to the binding of EF-G, the ribosome oscillates between
three states characterized by three configurations of the tRNAs: (i) the classical
state (A/A and P/P), (ii) the hybrid state (A/P and P/E), and (iii) a previously
unidentified hybrid state (A/A and P/E), in which the A- and P-site tRNAs have
moved independently (Munro et al., Mol Cell 2007). Here, using cryo-EM and
single-particle reconstruction, we studied a pre-translocational ribosome complex
that carries a point mutation on the P-loop (G2252C). This complex is known to
favor the A/A-P/E hybrid state (Dorner et al., NSMB 2006; Munro et al., Mol Cell
2007). By employing classification, we obtained several distinct structures of the
complex, which confirms the existence of an additional hybrid state of the ribosome (A/A and P/E) suggested by the sm-FRET study. In addition, we have now
discovered a transitional position of the tRNA, in which the A-site tRNA remains
in its A/A configuration, while the acceptor arm of the P-site tRNA has flipped to
make contact with the L1 stalk (Figure 1). Based on these findings, we propose
that tRNA moves from the P/P to the P/E hybrid site though intermediate posi-
tions, and that the movement is coupled with the ratchet motion of the ribosome:
after the peptidyl-transfer reaction, the P-site tRNA apparently oscillates between
the classical and the “flipped” position. As the ribosome starts to ratchet, the L1
stalk moves in toward the inter-subunit space and interacts with the acceptor arm
of the P-site tRNA, which temporarily stabilizes the flipped position. Only when
the ribosome reaches the fully ratcheted conformation, the tRNA moves from
the flipped position to the P/E hybrid site. Our preliminary study on a wild-type
pre-transloctional ribosome, in which the hybrid state was stabilized by antibiotic
viomycin, also shows the existence of the flipped position. We believe that the
intermediate states can be observed since both the point mutation and viomycin
slows down the progress of the tRNA through the ribosome.
795
12
The Ribosomal Stalk Plays a Key-role
in the Translation Initiation in Bacteria
Fast association of the ribosomal subunits during translation initiation requires the
presence of initiation factor 2 (IF2) on the 30S-preinitiation complex (30S-preI) containing mRNA and the initiator tRNA. But how the 50S recognizes the IF2 bound
30S-preI is not known. Our results from the parallel fast kinetic measurements of
the different steps of initiation show that the ribosomal ‘stalk’, composed of the L12
proteins, constitutes the key component on the 50S subunit for IF2 recognition.
Chenhui Huang
Chandra Sekhar Mandava
Suparna Sanyal*
Depletion of the L12 proteins from 50S has no effect on the association of the
naked subunits, suggesting that the L12 protein is not a structural element on the
50S essential for the subunit association. Also, L12 depletion does not alter the rates
of the subunit association when all other components of the pre-initiation complex
except IF2 are present on the 30S. When IF2 is added on the 30S-preI a very fast
rate of subunit association is obtained with normal 50S (ka = 130 μM-1s-1), which
decreases significantly (30-40 fold) upon removal of L12 from it. These data clearly
suggest that IF2 and L12 are two recognition markers on the 30S-preI and the 50S
subunits, respectively; the absence of any of the two results in a rather inefficient
association of the subunits. In parallel, we have studied the role of the L12 protein
in the stimulation of the GTPase activity of IF2. L12 depleted 50S when associated
with the 30S-PreI showed essentially same rates of GTP hydrolysis and Pi release as
with normal 50S. Also, there is no direct effect of L12 depletion on the rate of IF2
release. These results, in contrast to the earlier studied cases of EF-G and EF-Tu,
suggest that the L12 protein is not involved in the GTPase activation on IF2. We
also confirm that the GTP hydrolysis and Pi release are not essential for the association step, but crucial for the release of IF2-GDP from the 70S initiation complex.
Uppsala University, Box-596
In summary, it is evident from our data that the main role of the ribosomal stalk
in translation initiation is the recognition and recruitment of IF2, which in turn
brings the 30S-PreI to the 50S and results in a fast subunit association. When L12
is removed from the 50S the subunit association becomes slower. As a consequence
of the slow subunit association the subsequent steps such as GTP hydrolysis and Pi
release by IF2 and IF2 release from the 70S-initiation complex become apparently
slower but their individual rates remain unaffected. So, for IF2-GTPase L12 does
not work as a GTPase activator protein (GAP).
Dept. of Cell and Molecular Biology
BMC, 75124, Uppsala
Suparna.sanyal@icm.uu.se
*
796
13
Wenyan Liu
Xing Wang
Tong Wang
Ruojie Sha
Nadrian C. Seeman*
Dept of Chemistry
New York University
A PX DNA Triangle Oligomerized
Using a Novel Three-Domain Motif
Structural DNA nanotechnology is directed at building objects, lattices, and arrays
from cohesive interactions between DNA molecules. The predominant means of
doing this takes advantage of the information inherent in Watson-Crick base pairing in duplex formation and in sticky-ended cohesion. Nevertheless, other forms
of nucleic acid cohesion are also known, particularly paranemic edge-sharing
interactions (PX). Here we report the formation of a triangular species that has
four strands per edge, held together by PX interactions. We demonstrate by nondenaturing gel electrophoresis and by atomic force microscopy (AFM) that we can
combine a partial triangle with other strands to form a four-stranded molecule that
is robust. By combining them with a new mixed-fusion type of three-domain (TX)
molecule called PATX, we demonstrate by AFM that these triangles can be selfassembled into a linear array.
New York NY 10003
ned.seeman@nyu.edu
*
Schematic Drawings of the motifs used in this work.
(a) The PX motif. The four strands are colored red,
purple, green and blue; base pairs and helix axes are
indicated. (b) Top and side views of the PX triangle
are shown, using the same colors as in (a). Only the
blue strand is a cyclic molecule. (c) The formation of a
linear array. The left side of the upper panel shows the
sticky ends on the triangle as A and B; the right side
shows the PATX motif (base pairs and helix axes indicated); complementary sticky ends, A' B' are shown;
the top two domains are parallel, the bottom two antiparallel. The array incorporating both motifs is shown
at the bottom of the panel.
14
Tanashaya Ciengshin
Ruojie Sha
Nadrian C. Seeman*
Dept of Chemistry
New York University
New York NY 10003
ned.seeman@nyu.edu
*
This research supported by NIGMS, NSF, ARO, ONR and the W.M. Keck
Foundation.
Braided DNA
On the macroscopic scale, braided materials are regarded as stronger than materials that are just wrapped together. It is not very hard to braid various strands on
this scale, where the operations needed to produce braids are readily performed.
However, on the molecular scale it is difficult to perform such an operation. The
key issue is that braiding requires the use of both positive and negative nodes, as
indicated in the image on the left. If one chooses to work with DNA, it turns out
that B-DNA, which is right-handed, provides negative nodes, and Z-DNA, which is
left-handed, provides positive nodes. Mixed B-DNA and Z-DNA species have been
made in the past, including knots, Borromean rings, and a nanomechanical device.
However, it is more convenient to be able to work with any sequence, rather than
to work with the set of sequences that can be induced to form Z-DNA. To that end,
we have sought to make a braided structure that contains both conventional DNA
made from D-nucleosides and its mirror image, which is made from L-nucleosides.
One minor complication of using that approach to making braided materials, unless
they are wrapped into a cylindrical tube, is that one must use 5ʹ,5ʹ and 3ʹ,3ʹ linkages to make the constituent strands. We have synthesized the appropriate strands,
both out of conventional DNA and out of DNA containing strategically placed
L-nucleosides. The design is shown on the right of the figure. Whereas the complex
is stable when made from conventional DNA, the circular strands separate upon
denaturation. In contrast, the structure containing the L-nucleotides is stable under
denaturing conditions. We show by restriction analysis that the braided structure
consists of the two circles, in agreement with the design.
797
The drawing on the left shows the design of the denatured braided complex. The signs of its nodes are indicated. The drawing on the right illustrates the design
of the same complex from DNA in its native state.
Nucleotides containing D-deoxyribose are drawn in
black and those containing L-deoxyribose are drawn in
red. The signs of the nodes are indicated. Double filled
circles indicate 5ʹ,5ʹ linkages and double arrowheads
indicate 3ʹ,3ʹ linkages.
Foundation.
Dynamic Patterning Programmed by DNA
Tiles Captured on a DNA Origami Substrate
The aim of nanotechnology is to put specific atomic and molecular species where
we want them, when we want them there. Achieving such dynamic and functional
capabilities could lead to nanoelectronics, nanorobotics, programmable chemical
synthesis, and nanoscale systems responsive to their environments. Structural
DNA nanotechnology offers a powerful route to this goal by combining stable
15
Hongzhou Gu
Jie Chao
Shou-Jun Xiao
Nadrian C. Seeman*
Dept of Chemistry
New York University
New York NY 10003
ned.seeman@nyu.edu
*
The figure shows schematic drawings of the four different capture molecules. In each of the four cases, two
PX-JX2 two-state robust nanomechanical DNA devices
embedded in cassettes face each other. They are shown
anchored in a blue origami array beneath them by two
green domains. The sticky ends are indicated as A and
B (left), or C and D (right). Their relative positions are
established by the state (PX or JX2) of the cassettes.
The four different capture molecules are shown to have
sticky ends with primed labels that are complementary
to the pairs of sticky ends on the cassettes. The pattern is
established by the top domain of the capture molecules.
798
16
Tong Wang
Sergio Martinez
Deborah Kuchnir Fygenson*
Nadrian C. Seeman*
Dept of Chemistry
New York University
New York NY 10003
ned.seeman@nyu.edu
*
branched DNA motifs with cohesive ends to produce objects, programmed nanomechanical devices and fixed or modified patterned lattices. Here, we demonstrate
a dynamic form of patterning wherein a pattern component is captured between
two independently programmed DNA devices, tailed with cohesive ends that face
each other (See Figure). A simple and robust error-correction protocol has been
developed that yields programmed targets in all cases. This capture system can
lead to dynamic control either on patterns or on programmed elements; this capability enables computation or a change of structural state as a function of information in the surroundings of the system.
Foundation.
Exploring the Rigidity of DNA Nanotubes
DNA nanotubes are cyclic arrangements of DNA motifs that form cylinders. It is
possible to design cyclic species with a specific number of helices, most prominently the six-helix bundle (6HB) (1). In this case, a series of six DNA double
helices are joined together laterally, so that the dihedral angle between any adjacent pairs is 120º. This is an easy angle to achieve for 10.5-fold DNA, because
crossover separations of 7 or 14 nucleotide pairs correspond to 2/3 or 4/3 of a
turn, respectively. In addition to the direct formation of the 6HB molecule from a
group of strands, we have recently reported the formation of 6HB molecules from
the lateral cohesion of pairs of bent three-helix (BTX) molecules, thus potentially
facilitating the sheathing of a nanorod (2).
It is easy to make long tubes from 6HB molecules, by adding sticky ends to both
ends of each helix. Such long DNA nanotubes are expected to have structural
applications in DNA nanotechnology. It is therefore important to characterize
their physical properties. Prominent among these is their rigidity, described by
the persistence length. Here, we report on the rigidity of 6HB tubes and two
variations, in which the 6HB motif is flanked with either two or three more DNA
helices. The 6HB molecule flanked by two helices is pictured below (left) alongside a fluorescence snapshot of a corresponding nanotube (right). The snapshot
was taken as the nanotube diffused freely while confined to the focal plane of a
microscope by two polymer-coated pieces of glass. Comparison of the average
end-to-end distance of a dozen such nanotubes, with contour lengths ranging from
3 to 16 μm, indicates that the persistence length of the 6HB+2 tube is around 7
μm, consistent with a mechanical model based on rigidly linked dsDNA (known
persistence length ~50 nm). We find that the relative placement of sticky ends is
a key factor in the rigidity of the motif.
This research has been supported by a grant from NSF to DKF, and grants from
NIGMS, NSF, ARO, ONR and the W.M. Keck Foundation to NCS.
799
1. Mathieu, F., Liao, S., Mao, C., Kopatsch, J., Wang, T., Seeman, N. C. NanoLett 5, 661665 (2005).
2. Kuzuya, A., Wang, R., Sha, R., Seeman, N. C. NanoLett 7, 1757-1763 (2007).
Self-assembly of DNA into Nanoscale
Three-Dimensional Shapes
Molecular self-assembly offers a ‘bottom-up’ route to fabrication with subnanometre precision of complex structures from simple components. DNA is an
attractive building block for self-assembly in general due to the specific bonding between base pairs and for templated self-assembly in particular due to the
enzymatic capability for faithful reproduction of long sequences. Templated selfassembly of DNA into custom two-dimensional shapes on the megadalton scale
has been demonstrated previously with a multiple-kilobase ‘scaffold strand’ that
is folded into a flat array of antiparallel helices by interactions with hundreds
of oligonucleotide ‘staple strands’. Here we extend this DNA-based method to
nanoconstruction of custom three-dimensional shapes by staple-directed folding
of a scaffold into layers of antiparallel helices constrained to a honeycomb lattice.
Scaffold and staples assemble together in a single step after mixing to produce
shapes that have precise proportions ranging from 10-100 nm per dimension
and profiles resembling structures such as a square nut, a slotted cross, and a
railed bridge. Individual objects can be directed to polymerize into higher-order
structures such as linear tracks displaying a feature with 36 nm periodicity or
wireframe icosahedra with a diameter of 100 nm.
17
William M. Shih*
Shawn M. Douglas
Hendrik Dietz
Tim Liedl
Bjorn Hogberg
Franziska Graf
Dept. of Cancer Biology
Dana-Farber Cancer Inst. & Dept. of
Biological Chemistry and Molecular
Pharmacology
Harvard Medical School
Boston, MA 02115
William_Shih@dfci.harvard.edu
*
18
The Rational Design and Structural Analysis of a
Self-Assembled Three-Dimensional DNA Crystal
The precise control of the 3D structure of matter is a central concern of the natural sciences. To this end, numerous investigators have developed self-assembling
systems to produce targets of interest (1). Taking its cue from biological systems,
structural DNA nanotechnology has used branched DNA motifs combined with
the molecular recognition properties of cohesive ends to produce objects (2),
nanomechanical devices (3), and designed 2D lattices (4). The details of these
2D lattices have been characterized primarily by atomic force microscopy, whose
resolution is typically >4 nm. The criteria for 3D lattices (crystals) are stricter,
because they are analyzed by x-ray crystallography, which can provide atomic
resolution. Previous efforts to generate designed self-assembled 3D lattices
have produced crystals that conformed to the design, but whose resolution was
no better than 10 Å. Here, we report the crystal structure at 4 Å resolution of a
Jianping Zheng
Jens J. Birktoft
Yi Chen
Ruojie Sha
Tong Wang
Pamela E. Constantinou
Chengde Mao
Stephan L. Ginell
Nadrian C. Seeman*
Dept of Chemistry
New York University
New York NY 10003
ned.seeman@nyu.edu
*
800
designed, self-assembled, 3D crystal based on the tensegrity triangle (5). This
motif contains three helices that propagate in three linearly independent directions, producing a rhombohedral crystalline motif, with a = b = c = 68.3 Å; α =
β = γ =102.4º. The stereoscopic image below shows the environment of a central
tensegrity triangle and its six nearest neighbors. The resulting structure contains
rhombohedral cavities with a volume of about 100 nm3 and a cross-sectional area
of 19 nm2. The data demonstrate clearly that it is possible to design a 3D lattice
using the techniques of self-assembly based on molecular recognition.
This research has been supported by grants from NIGMS, NSF, ARO, ONR and
the W.M. Keck Foundation.
19
Yamuna Krishnan
The Chemical Biology Group
National Centre for Biological Sciences,
TIFR, UAS-GKVK Campus, Bellary
Road Bangalore 560 065, India
yamuna@ncbs.res.in
1.
2.
3.
4.
5.
Whitesides, G. M., Mathias, J. P., Seto, C. T. Science 254, 1312-1319 (1991).
Chen, J., Seeman, N. C. Nature 350, 631-633 (1991).
Yan, H., Zhang, X., Shen, Z., Seeman, N. C. Nature 415, 62-65 (2002).
Winfree, E., Liu, F., Wenzler, L. A., Seeman, N. C. Nature 394, 539-544 (1998).
Liu, D., Wang, W., Deng, Z., Walulu, R., Mao, C. J Am Chem Soc 126, 2324-2325 (2004).
Wires, Reporters and Information Capsules:
Cellular Journalism with DNA
DNA has attractive physicochemical characteristics such as robust thermal and
hydrolytic stability. It also has desirable structural characteristics stemming from
predictable and specific recognition properties that give rise to a highly regular
helical structure which behaves as a rigid rod on length scales upto ~50 nm. Since
these rigid rods may be welded together by complementary base-pairing, DNA is
now taking on a new aspect where it is finding use as a construction element for
architecture on the nanoscale. This field is called structural DNA nanotechnology.
I describe approaches adopted by my lab where we demonstrate promising new
assembly strategies that use unusual forms of DNA in structural DNA nanotechnology to make chemically responsive DNA scaffolds. I will then go on to show the
application of these chemically responsive DNA scaffolds in living systems.
20
Karina M. M. Carneiro*
Faisal A. Aldaye
Hanadi F. Sleiman
Deparment of Chemistry
801 Sherbrooke St. W.
Montreal, QC, Canada H3A 2K6
karina.carneiro@mail.mcgill.ca
*
1. Ghodke, H. B., Krishnan, R., Vignesh, K., Kumar, G. V. P., Narayana, C., Krishnan, Y.
Angew Chem Int Ed 46, 2646-2649 (2007).
2. Bhatia, D., Mehtab, S., Krishnan, R., Indi, S. S., Basu, A., Krishnan, Y. Angew Chem Int
Ed in press.
3. Modi, S., Swetha, M. G., Goswami, D., Gupta, G., Mayor, S., Krishnan, Y. Nature
Nanotechnology, accepted.
4. Chakraborty, S., Sharma, S., Maiti, P., Krishnan, Y. Nucleic Acids Res, in press.
Dendritic DNA Molecules:
Towards Controllable Nanomaterials
DNA has been widely used as a building block in nanoscience to construct selfassembled structures due to its ease of functionalization, programmability and
molecular recognition properties. Although discrete 2D and 3D nanostructures
have been assembled from DNA building blocks, long range assembly is still
problematic.
On the other hand, block copolymers achieve long range morphology control
often by using amphiphilic building blocks that microphase separate under various
conditions. However, block copolymers cannot achieve the molecular control and
recognition properties of DNA nanostructures.
We herein report the synthesis of a building block that combines the programmability of DNA with the long range morphologies achieved by block copolymers. Specifically, we have synthesized a dendritic DNA (D-DNA) molecule
containing oligethylene glycol (PEG) dendrons that self-assembles into fibers
with microns in length.
801
21
Modular Construction of DNA Nanotubes of
Tunable Geometry, Alternating Size, and
Single- or Double-stranded Character
DNA nanotubes can template the growth of nanowires, orient transmembrane proteins for NMR determination, and can potentially act as stiff interconnects, tracks
for molecular motors, and drug nanocarriers. All current methods for the construction of DNA nanotubes result in symmetrical and cylindrical assemblies that are
entirely double-stranded (1). Here we offer a modular approach to DNA nanotube
synthesis, that provides access to geometrically well-defined triangular and square
DNA nanotubes which can be existed in alternating large-small features. We also
construct the first DNA nanotubes that can exist in double- and single-stranded
forms with dramatically different stiffness (2). As well, we found that the largesmall DNA nanotubes can be used to encapsulate gold nanoparticles in a specific
precise position. This method provides a new set of parameters to tune DNA nanotube construction, such as geometry, stiffness, and single- or double-stranded character, and promises to facilitate access to designer nanotubes with applications for
the growth of nanowires of controlled shape, the loading and release of cargo, and
the real-time modulation of stiffness and persistence length in interconnects.
1. (a) Douglas, S. M., Chou, J. J., and Shih, W. M. Proc Natl Acad Sci USA 104, 6644-6648
(2007). (b) Kuzuya, A., Wang, R., Sha, R., and Seeman, N. C. Nano Lett 7, 1757-1763
(2007). (c) Park, S. H., et al. Nano Lett 5, 693-696 (2005).
2. Aldaye, F. A., Lo, P. K., Karam, P., McLaughlin, C. K., Cosa, G., and Sleiman, H. F. Nature
Nanotechnology, in press (2009).
Pik Kwan Lo
Faisal A. Aldaye
Hanadi F. Sleiman*
McGill University
801 Sherbrooke Street West
Montreal, QC H3A 2K6, Canada
hanadi.sleiman@mcgill.ca
*
Supramolecular DNA Nanotechnology
802
22
Hanadi Sleiman*
Faisal Aldaye
Peggy Lo
Hua Yang
Chris McLaughlin
Karina Carneiro
McGill University
801 Sherbrooke Street West
Montreal, QC H3A 2K6 Canada
hanadi.sleiman@mcgill.ca
*
A central challenge in nanoscience is the organization of functional components
into deliberately designed patterns, and the ability to modify these patterns at will.
Because of its molecular recognition specificity and structural features, DNA presents a unique opportunity to address this problem. Our research group has been
examining a new approach to build DNA nanostructures, in which synthetic molecules are used to control DNA self-assembly. This approach results in combining
the diverse structural features of synthetic organic or inorganic molecules, as well
as their multiple functionalities, with the programmable character of DNA. Specifically, we will describe (a) the modular, quantitative and simplified synthesis
of 3D-DNA structures, such as DNA nanocages and nanotubes. These are created
with deliberate variation of geometry, size, single- and double-stranded forms,
and persistence lengths. Their internal volume can be readily switched with added
DNA strands. These architectures are important for encapsulation and delivery of
biomolecules, as interconnects and as templates for materials growth; (b) the use
of DNA to precisely position gold nanoparticles, as well as transition metals, into
well-defined, discrete 2D- and 3D-structures. These materials are fundamentally
important to nanoelectronic, nanooptics, and catalysis; (c) the use of small molecules to effect profound changes in DNA nanostructures. Small molecules can
correct ‘errors’ in DNA organization, and can also completely reprogram DNA
self-assembly, thus expanding the DNA code into new unnatural forms; (d) the
hierarchical assembly of dendritic DNA ‘block copolymers’ into well-defined onedimensional structures. Thus, bringing the toolbox and concepts of supramolecular
chemistry into DNA nanotechnology can enrich this field with new structures and
new applications in biology and materials science.
Science 2008, 321, 1795; Angew Chem. 2006, 45, 2204; J. Am. Chem. Soc. 2007, 129, 4130;
J. Am. Chem. Soc. 2007, 129, 10070; and J. Am. Chem. Soc. 2007, 129, 13376; Angew
Chem. 2008, 47, 2443; Nature Nanotech., in press.
23
X. Sunney Xie
Harvard University
Dept. of Chemistry and Chemical Biology
12 Oxford Street
Cambridge, MA 02138
xie@chemistry.harvard.edu
A Stochastic Single-Molecule Event Triggers
Phenotype Switching of a Bacterial Cell
By monitoring fluorescently labeled lactose permease with single-molecule sensitivity, we investigated the molecular mechanism of how an Escherichia coli
cell with the lac operon switches from one phenotype to another. At intermediate inducer concentrations, a population of genetically identical cells exhibits
two phenotypes: induced cells with highly fluorescent membranes and uninduced
cells with a small number of membrane-bound permeases. We found that this
basal-level expression results from partial dissociation of the tetrameric lactose
repressor from one of its operators on looped DNA. In contrast, infrequent events
of complete dissociation of the repressor from DNA result in large bursts of permease expression that trigger induction of the lac operon. Hence, a stochastic
single-molecule event determines a cell’s phenotype.
Conformational Equilibria of Intrinsically Disordered
Proteins Probed by Single Molecule Methodologies
The structural disorder of the intrinsically-unstructured-proteins is the outcome
of a complex ensemble of conformers driven by a rugged energy landscape. Many
of these proteins are involved, through their aggregation into amyloid fibrils, in
neuro-degenerative pathologies like Parkinson’s, Alzheimer’s, and prion diseases.
Significant progress has been made recently in characterizing these fibrils at the
molecular level. However, the process of aggregation is still poorly understood
because traditional bulk methods can only provide ensemble-averaged information for monomers and oligomers alike. We recently demonstrated that by means
of single-molecule studies these limitations can be circumvented (1, 2).
We applied the AFM-based Single Molecule Force Spectroscopy (AFM-SMFS)
methodology to human alpha-synuclein. This methodology proved very effective
in characterizing the conformational diversity of wild type (WT) alpha-synuclein
and we observed that in several unrelated conditions linked to the pathogenicity of Parkinson’s disease the conformational equilibrium of this protein shifts
toward beta-sheet-containing structures (1). The direct relationship of these betastructures to alpha-synuclein toxicity was confirmed by our single-molecule study
of the conformational heterogeneity of its pathologic mutants A30P, A53T, and
E46K. We found that those mutated sequences have a strongly higher propensity
to acquire a monomeric beta-structure with respect to the WT one, and we identified significant differences in their conformational equilibria. These differences
were related to the marked differences in the WT and mutant aggregation behaviors, with regard to both fibrillization and oligomerization (2).
The capability of single-molecule approaches to resolve the properties of individual protein molecules and quantify their sub-populations is most likely going
to play a crucial role in studies of the conformational equilibria of intrinsically
disordered proteins involved in neurodegenerative diseases.
1. M. Sandal, F. Valle, I. Tessari, S. Mammi, E. Bergantino, F. Musiani, M. Brucale, L.
Bubacco, B. Samori. Plos Biology 6, 99 (2008).
2. M. Brucale, M. Sandal, S. Di Maio, A. Rampioni, I. Tessari, L. Tosatto, M. Bisaglia, L.
Bubacco, and B. Samori. Chem Bio Chem 1, 176-183 (2009).
803
Bruno Samori
Dept. of Biochemistry
University of Bologna
Italy
bruno.samori@unibo.it
24
804
25
Kathy Chaurasiya1
Fei Wang1
Gael Cristofari2
Jean-Luc Darlix2
Sandra L. Martin3
Mark C. Williams1,*
Dept of Physics
1
Northeastern University
Boston, MA
LaboRetro INSERM #758
2
Ecole Normale Supérieure de Lyon
IFR 128 Biosciences Lyon-Gerland
69364 Lyon Cedex 07, France
DNA Interaction Properties of Nucleic Acid
Chaperone Proteins From Retrotransposons
Nucleic acid chaperone activity is an essential component of reverse transcription
in retroviruses and retrotransposons. Using DNA stretching with optical tweezers,
we have developed a method for detailed characterization of nucleic acid chaperone
proteins, which facilitate the rearrangement of nucleic acid secondary structure.
The nucleic acid chaperone properties of the human immunodeficiency virus type-1
(HIV-1) nucleocapsid protein (NC) have been extensively studied, and duplex destabilization, nucleic acid aggregation, and rapid protein binding kinetics have been
identified as major components of its activity. The chaperone properties of other
nucleic acid chaperone proteins, such as those from the retrotransposons LINE-1
and Ty3, ORF1p and Ty3 NC, are not well understood. We used single molecule
DNA stretching to characterize the activity of wild type and mutant ORF1p and Ty3
NC. ORF1p binds both double-stranded DNA (dsDNA) and single-stranded DNA
(ssDNA) with high affinity, and strongly aggregates both forms. It is therefore an
excellent chaperone, and altering certain residues has dramatic effects on chaperone activity. Wild type Ty3 also strongly aggregates both dsDNA and ssDNA, and
melted DNA exhibits more rapid reannealing in the presence of Ty3 NC, relative
to that observed in the presence of ORF1p. We examine several Ty3 NC mutants to
identify the roles of functional regions of the protein in its chaperone activity.
This research was supported in part by funding from INSERM and ANRS (France).
Department of Cell and
3
Developmental Biology and
Program in Molecular Biology
University of Colorado
School of Medicine, Aurora, CO
kathy84usa@gmail.com
*
26
Liviu Movileanu
Syracuse University
Syracuse, New York
lmovilea@physics.syr.edu
Interrogating Single Nucleic Acid and
Protein Molecules with a Nanopore
Advances in rational protein design and single-molecule technology allow for biochemical sampling at high temporal and spatial resolution and for the detection,
manipulation, and exploration of individual molecules. We have developed a methodology for examining single biopolymer dynamics within a protein nanopore, a
simple system that is highly pertinent to several more complex biological processes
such as the translocation of DNA and proteins through transmembrane pores. The
ionic current through a single protein nanopore was determined by single-channel
electrical recordings in lipid bilayers. The results revealed the stochastic dynamics of biopolymers, such as their conformational fluctuations and interactions with
other molecules, as well as the energetic requirements for their transition from one
state to another. I will discuss various examples that demonstrate an accurate control of single proteins and protein pore-based nanostructures by using simple principles learned from physics and modern biology.
Kinetics of DNA Force-Induced Melting
Force spectroscopy studies probe nucleic acid structures by exerting tension along
the molecule. As it is stretched, double-stranded DNA reveals a sudden increase
in length at a constant force, a transition referred to as overstretching. Thermodynamic and chemical evidence have demonstrated that overstretching is actually
force induced melting, a transition to single-stranded DNA as base pairing and base
stacking are disrupted. We present a predictive model of force induced melting in
which thermal fluctuations induce local melting and re-annealing of DNA. These
fluctuations are stabilized by the application of tension during the overstretching
transition, favoring the conversion to single stranded DNA as the applied force is
increased, analogous to the thermal melting of DNA. This model quantitatively
predicts small changes in the melting force as the pulling rate is varied. We then
test our model for force-induced melting by systematically measuring the midpoint
of the transition as a function of pulling rate. Our results suggest that DNA forceinduced melting occurs cooperatively with a domain size of 100-200 base pairs.
805
Micah J. McCauley1,*
Leila Shokri1
Ioulia Rouzina2
Mark C.Williams1
27
Department of Physics
1
Boston, MA USA
Dept of Biochemistry
2
Molecular Biology and Biophysics
University of Minnesota
Minneapolis, MN USA
m.mccauley@neu.edu
*
Nucleic Acid Interaction Kinetics Modulate the
Chaperone Activity of Retroviral Nucleocapsid Proteins
Retroviral nucleocapsid (NC) proteins are essential for several viral replication processes including specific genomic RNA packaging and reverse transcription. The
nucleic acid chaperone activity of NC facilitates the latter process. In this study,
we use bulk and single molecule methods to quantify the chaperone activity of
NC proteins from human immunodeficiency virus type 1 (HIV-1), Moloney murine
leukemia virus, Rous sarcoma virus, and human T-cell leukemia virus type one
(HTLV-1). We find that the nucleic acid interaction properties of these proteins vary
significantly depending on the virus, with HIV-1 NC showing rapid protein binding
kinetics, significant duplex destabilization, and strong DNA aggregation, all properties that are believed to be critical components of nucleic acid chaperone activity.
In contrast, HTLV-1 NC exhibits significant destabilization activity but extremely
slow DNA interaction kinetics and poor aggregating capability. This result explains
why HTLV-1 NC is a poor nucleic acid chaperone. However, removal of HTLV-1
NC’s anionic C-terminal domain (CTD) results in a protein with chaperone activity
comparable to that of other retroviral NCs. Removal of the CTD also dramatically
increases the protein-DNA interaction kinetics. These results suggest that HTLV-1
NC’s anionic CTD interacts with its cationic N-terminal domain (NTD), either intra- or intermolecularly, which in turn slows down the protein’s nucleic acid binding
kinetics. This electrostatic attraction between bound molecules leads to polymerization of HTLV-1 NC on the nucleic acid, which inhibits nucleic acid aggregation,
as well as rapid protein dissociation from single-stranded DNA. These results may
also help to explain the mechanism by which the CTD of HTLV-1 NC prevents
packaging of human APOBEC3G. This work was funded in part by Federal Funds
from NCI, NIH under contract N01-CO-12400 (RJG).
28
Fei Wang1
Kristen M. Stewart-Maynard2
Margareta Cruceanu1
Dominic F. Qualley3
Mithun Mitra3
Robert J. Gorelick4
Ioulia Rouzina5
Karin Musier-Forsyth3
Mark C. Williams1,*
Dept of Physics, Boston, MA 02115, USA
2
Univ. of Minnesota, Dept of Chemistry
and Inst for Molecular Virology
Minneapolis, MN 55455, USA
3
The Ohio State University
Depts of Chemistry and Biochemistry
Columbus, OH 43210, USA
4
AIDS Vaccine Program, Basic Research
Program, SAIC-Frederick, Inc., NCIFrederick, Frederick, MD 21702, USA
5
Univ. of Minnesota, Dept. of
Biochemistry, Molecular Biology, and
Biophysics, Minneapolis, MN 55455
*
mark@neu.edu
1
806
29
Thayaparan Paramanathan1,*
Ioana D Vladescu2
Micah J. McCauley1
Ioulia Rouzina3
Mark C.Williams1
Department of Physics, Northeastern
1
University, Boston, MA, USA
Harvard FAS Center for Systems
2
Biology, Harvard University
Cambridge, MA, USA
3
Molecular Biology and Biophysics
University of Minnesota
Quantifying Multiple DNA Binding Modes of
Actinomycin D Using Optical Tweezers
Actinomycin D (Act D) is an antibiotic and antineoplastic compound that has
been shown to have significant biological activity, including the ability to inhibit
HIV-1 reverse transcription. It is therefore essential to understand the mechanism
by which it interacts with nucleic acids. Act D exhibits strong binding to specific
sequences of double stranded DNA (dsDNA) and single stranded DNA (ssDNA).
However, even after 50 years of research it is not clear which binding mode is
strongest. ssDNA binding can be extremely important in inhibiting replication
of viruses that replicate through ssDNA templates such as HIV and intercalation
can be important in therapeutic application for cancer. DNA stretching studies
using optical tweezers can precisely quantify these binding modes. Because both
intercalation and ssDNA binding can cause an increase in DNA length observed in
these experiments, we have developed a method that combines the measured increase in DNA length with the overall DNA melting free energy change, allowing
us to distinguish these binding modes. We determined that the ssDNA binding of
ActD (Kss ~ 108 M-1) is 100 fold stronger than its binding to dsDNA (Kds ~ 106 M-1)
for long polymeric DNA. The stretching relaxation curve and its hysteresis behavior suggest three different ssDNA binding modes for ActD. In addition, these
results suggest a model in which ActD binds to premelted dsDNA and cross stacks
with the opposite strand bases. Thus, at saturated binding dsDNA intercalation and
ssDNA binding occur simultaneously.
Minneapolis, MN USA
t.paramanathan@neu.edu
*
30
Taekjip Ha
Department of Physics &
Center for the Physics of Living Cells
University of Illinois at
Urbana-Champaign
Urbana, Illinois 61801
tjha@illinois.edu
Single Molecule Analysis of Motors Moving on RNA
We are using single molecule fluorescence techniques to monitor movements
of molecular motors moving on RNA. First, I will present our recent finding
that a cytosolic viral RNA sensor RIG-I (Retinoic acid-Inducible Gene 1) is a
translocase on double stranded RNA. Its RNA translocation activity is severely
inhibited by the N-terminal domains of RIG-I but is restored fully when RIG-I
recognizes 5ʹ triphosphate on the same RNA. Because double stranded RNA and
5ʹ triphophates are viral signatures known to be recognized by RIG-I, our results
suggest an integrated sensing mechanism that can be more specific to the viral
RNA. In the second part of the talk, I will discuss the internal structural dynamics
of ribosome during its translocation on mRNA. We found that the inter-subunit
rotation of the ribosome which is believed to be a key feature of translocation
once thought to be driven by elongation factor G is actually driven thermally.
This suggests that ribosome is an inchworming Brownian ratchet and the parallels with helicase translocation mechanism will be discussed.
Analysis of the Role of Intrinsic Disorder
in Multiple Specificity
Several lines of evidence suggest that intrinsically disordered proteins (IDPs) are
a common mechanism used by nature to mediate protein-protein interactions. It
is thought that IDPs can facilitate protein interactions through an ability to mediate binding diversity, where one of the proposed mechanisms for this is multiple
specificity – i.e., recognition of multiple molecular partners through use of the same
binding residues – through contextual folding of IDPs. We are examining the role of
IDPs and protein flexibility in multiple specificity. In previous work, three contrasting examples of protein regions with multiple binding specificity were examined:
14-3-3ζ, p53 C-terminal regulatory domain, and p53 DNA binding domain (DBD).
The 14-3-3ζ and p53 C-terminal domains exemplify the potential of intrinsic disorder for mediating protein interactions. The 14-3-3ζ domain is structured with a
single binging pocket that is responsible for the binding of various protein partners
through interaction with sequence divergent, intrinsically disordered segments in
these partners. In contrast, the intrinsically disordered C-terminus of p53 contains a
discrete regions that is involved in many interactions with different protein partners
(Figure 1), where these interactions regulate p53 function. The common theme in
both of these examples is structural variability in the bound state that is enabled by
intrinsic disorder in one of the partners in the unbound state. The final example, the
p53 DBD, is a folded domain and the experimental structures of it complexed with
four distinct, ordered partners have
been determined. Our analysis of
these structures indicates that flexibility in the DBD is an important
element in the DBD's ability to
bind multiple partners. In current
work, the previous analysis is expanded to many other examples of
proteins that interact with multiple
partners using a common binding
site. Both the ordered and disordered regions of these structures
are examined and these data are
interpreted in terms of the role of
intrinsic disorder and flexibility in Figure 1: Comparison of the experimentally determined
structures of the same region of the C-terminus of p53.
multiple specificity.
807
31
Christopher J. Oldfield1,*
Vladimir N. Uversky1,2
A. Keith Dunker1
Ctr for Computational Biology
1
and Bioinformatics
Indiana Univ Schools of
Medicine and Informatics
410 W. 10th Street
Indianapolis, IN 46202, USA
Inst. for Biological Instrumentation
2
Russian Academy of Sciences
142290 Pushchino
Moscow Region, Russia
cjoldfie@iupui.edu
*
32
Comparative Genomics of Alternative Splicing
Alternative splicing is one of the major mechanisms for generation of protein
diversity both in an organism and in evolution. Availability of many sequenced
genomes of related organisms creates new opportunities for comparative analysis of exon-intron structure, alternative splicing and its regulation. Alternatively
spliced exons tend to be less conserved than constitutive ones both in terms of
gain and loss, and in terms of substitution rate. The rate of synonymous and nonsynonymous substitutions strongly depends on the type of alternative (cassette
and mutually exclusive exons, regions between alternative splice sites, retained
introns). In particular, minor isoform exons evolve under a considerable positive
selection pressure. Recent comparative genomic analysis of fruit flies, nematodes,
and mammals (separately for each group) revealed that introns often contain conserved base-paired regions at intron ends. Such regions may form RNA structures
with large loops, and they are often associated with alternative splicing.
Mikhail Gelfand
A.A.Kharkevich Institute for Information
Transmission Problems RAS
Bolshoi Karetny pereulok 19
Moscow, 127994, Russia
gelfand@iitp.ru
808
33
James Thomson
The Morgridge Institute for Research
University of Wisconsin School of
Medicine and Public Health
The Genome Center of Wisconsin
Human Induced Pluripotent Stem
Cells Derived with Episomal Vectors
Human Embryonic Stem (ES) cell lines are capable of unlimited undifferentiated
proliferation and yet maintain the ability to contribute to advanced derivatives of
all three embryonic germ layers. Human induced pluripotent stem (iPS) cells share
these defining characteristics of human ES cells, but are derived from somatic
cells, not from early embryos. This talk will describe our initial screens that identified four factors (Oct4, Sox2, Nanog, Lin28) as sufficient to reprogram human
fibroblasts to iPS cells, describe the use of iPS cells in a particular model of neural
degenerative disease, and describe new methods for deriving human iPS cells with
episomal vectors that do not require integration of the reprogramming transgenes
into the genome.
425 Henry Mall, Madison, WI 53706
thomson@primate.wisc.edu
34
A. Keith Dunker
Center for Computational
Biology and Bioinformatics
Indiana University School of Medicine
Indianapolis, Indiana 46202
kedunker@iupui.edu
Hypothesis: Signaling Diversification Is Enabled by
Alternative Splicing, Posttranslational Modification,
and Multiple Partner Binding at Loci Within
Intrinsically Disordered Protein Regions
As a cell divides with differentiation, diversified signaling networks necessarily
develop within the two daughter cells. The common term that describes this process
is gene regulation. The mechanisms by which gene regulation leads to signaling
diversification remain unclear. Here we would like to propose a scenario that could
possibly provide the mechanisms that underlie cell differentiation. First, we noticed
that signaling proteins are abundant in regions that fail to form 3-D structure under
physiological conditions but that rather remain as flexible ensembles. Intrinsically
disordered is the term we use for such flexible regions of protein. Some signaling
proteins are entirely disordered. Second, experiments indicate that such flexible,
intrinsically disordered regions contain the sites for binding to protein or DNA or
RNA partners. Third, these partner-binding sites often use their flexibility to adapt
to multiple, differently shaped partners. Alternatively, sites within different disordered sequences can use their flexibility to adapt to a common binding site. By
these mechanisms intrinsic disorder is very important in signaling networks and,
for example, both transcription factors and hub proteins are highly enriched in disordered protein. Fourth, these flexible binding sites often contain residues that undergo posttranslational modification; evidently because the flexibility facilitates enzyme binding. Such posttranslational modifications are commonly observed to alter
the binding specificity of the flexible site. Fifth, disordered regions often contain
multiple binding sites in tandem, and both single binding sites and multiple sites
in tandem are subject to modification via alternative splicing. The lack of structure
in these regions facilitates alternative splicing, and indeed allows the possibility of
multiple splicing events. Furthermore, the lack of structural constraints in disordered regions also facilitates the occurrence of point mutations. We are currently
studying embryonic stem-cell associated developmental pathways to determine
whether the coordinated combination of the features indicated above could provide
an underlying mechanism for cell differentiation.
RNA-Protein Interactions Reveal Alternative
Splicing Networks in Human Embryonic Stem Cells
Understanding regulated gene expression is vital to providing insights into disease
and development. While much effort has been placed on deciphering transcriptional
regulation by more than a thousand transcription factors and their interactions with
functional DNA elements encoded in mammalian genomes, little is known about an
equally sizable number of RNA binding proteins and their involvement in diverse
aspects of RNA metabolism. A dominant function of these RNA binding proteins
is to regulate alternative splicing, a major form of post-transcriptional regulation of
gene expression that is thought to contribute to the structural and functional diversity
of the proteome of the cell. One of the ultimate goals in the RNA field is to deduce
a set of rules that govern the control of splice site selection to produce the “splicing
code”. Human embryonic stem cells (hESCs) are pluripotent cells with the capacity
to self renew and differentiate into the three germ layers. Neuronal progenitor cells
(NP) are multipotent cells that can theoretically generate all lineages in the central
nervous system. Both are excellent models that recapitulate early neuronal development in vitro, and have motivated studies to identify gene regulatory programs
that control neuronal specification. Using a combination of splicing-sensitive arrays
and comparative genomics, we revealed candidate intronic cis-regulatory elements
such as the Fox2 binding site GCAUG proximal to candidate alternative exons that
may participate in the regulation of alternative splicing during neural differentiation
of hESCs. This motivated our application of a general strategy for decoding functional RNA elements in vivo by constructing an RNA map for the cell type-specific
splicing regulator Fox2 via CrossLinking-ImmunoPrecipitation coupled with high
throughput sequencing (CLIP-seq) in hESCs. The map reveals that Fox2 binds to a
cohort of specific RNA targets, many of which are themselves splicing regulators,
and induces position-dependent exon inclusion or skipping. This finding suggests
that Fox2 functions as a regulator of a network of splicing factors, and we show that
Fox2 is important for the survival of human embryonic stem cells.
809
Gene W. Yeo*
Nicole G. Coufal
Tiffany Liang
Grace Peng
Xiang-dong Fu
Fred H. Gage
Cellular and Molecular Medicine
University of California San Diego
9500 Gilman Drive mail code 0695
La Jolla, CA 92093-0695
geneyeo@ucsd.edu
*
36
Contribution of miRNA-mediated Gene
Regulation to the Evolution of Animal Eye
The acquisition of elaborate system of gene regulation should have been required
for evolution of complicated animal eye. Even though there might be many players
involved in the evolution of gene regulation system in the eye, miRNA-mediated
gene regulation could be the main player of the eye evolution. To verify this idea,
we studied the evolution of miRNA target genes that were expressed in human eye
and estimated their orthologs by comparative genome analyses. We found that the
number of miRNA targets expressed in human eye was well conserved in vertebrates but not in invertebrates. In fact, some miRNA-mediated genes are commonly
regulated by the same miRNA together with genes known to be required for the
eye formation such as Pax6. It suggests that miRNA-mediated gene regulation may
have contributed to evolutionary formation of vertebrate eye.
35
Atsushi Ogura
Ochanomizu University
2-1-1 Ohtsuka, Bunkyo-ku
Tokyo 112-8610, Japan
aogu@whelix.info
810
37
Matthew Halvorsen1
Abhinab Ray2
Katrina Simmons1
Joshua Martin1
Alain Laederach1,*
Computational and Structural Biology
1
Wadsworth Center, Albany, NY 12208
Computer Science, Rensellear
2
Polytechnique Institute, Troy, NY 12180
Effects of Human Genetic Variation
on the Structure of mRNA UTRs
The 5ʹ and 3ʹ untranslated regions (UTRs) of genes play a central regulatory role
in the cell. Although generally not considered to contain highly structured RNA,
the accessibility of specific regions in the mRNA UTRs is a critical component
of the cell’s regulatory machinery. To assess the potential of Single Nucleotide
Polymorphisms (SNPs) to affect the structure of UTRs we used an RNA partition
function calculation approach to scan all known SNPs within human UTRs. We
identified in particular 5 SNPs in the PTEN promoter that cause a significant change
in UTR structure, which we confirmed using chemical mapping with the CAFA
(Capillary Automated Footprinting Analysis) approach. These SNPs are associated
with Cowden Syndrome (multiple hamartoma) and lead to increased risk of cancer.
We also identified the subset human SNPs that cause the largest changes in RNA
structure, including a SNP in the 3ʹ UTR of the OAS1 gene that is associated with
weakened innate immunity. This approach allows us to identify SNPs that have the
potential to significantly affect RNA structure. In turn we are able to evaluate the
potential molecular causes of particular genetic associations.
alain@wadsworth.org
*
38
Samit Shah
Piyush Jain
Dipu Karunakaran
Ashish Kala
Subhashree Rangarajan
Simon H. Friedman*
Division of Pharmaceutical Sciences
University of Missouri, Kansas City
Kansas City, MO 64110
friedmans@umkc.edu
*
Light Activated RNA Interference
Using Photo-cleavable siRNA
My lab is bringing RNA interference under the control of light, by modifying
siRNA and double stranded siRNA precursors (dsRNA) with photo-labile groups.
The long term goal of this work is to allow the control of the spacing, timing, and
amount of expression of endogenous genes by varying the spacing, timing, and
amount of irradiation. The rationale behind the attachment of these photo-labile
groups is that they will block the interaction of siRNA with RISC or dsRNA with
Dicer prior to irradiation, thereby blocking RNA interference. Upon irradiation,
native siRNA/dsRNA is released and RNA interference is induced. We have previously demonstrated that siRNA modified with the di-methoxy nitro-phenyl ethyl
group (DMNPE) allows for modulation of RNA interference in a light dependent
fashion. (See Angewandte Chemie 2005, Oligonucleotides 2007, Nature Protocols
2008) Because these groups do not completely block RNA interference prior to
irradiation, we have extensively examined other systems with improved efficacy.
Using MS/MS and other analytical techniques we have found that dsRNAs are
preferentially modified with the DMNPE group on their terminal phosphates (as
opposed to internal phosphates). In addition we have found that this allows for a
more significant block of RNA interference prior to irradiation and makes modified
dsRNA precursors much more effective at modulating RNA interference in a light
dependent manner. The work that I will discuss combines an in-depth exploration
of the chemistry of modification of nucleic acids by photolabile groups as well as
the biological consequences of those modifications.
Modulation of Gene Expression
by Synthetic Nucleic Acids
Agents that activate expression of specific genes to probe cellular pathways or
alleviate disease would go beyond existing approaches for controlling gene expression. Duplex RNAs complementary to promoter regions can repress or activate gene expression. The mechanism of these promoter-directed antigene RNAs
(agRNAs) has been obscure. Other work has revealed non-coding transcripts
that overlap mRNAs. The function of these non-coding transcripts is also not
understood. Here we link these two sets of enigmatic results. We find that antisense transcripts are the target for agRNAs that activate or repress expression of
progesterone receptor (PR). agRNAs recruit argonaute proteins to PR antisense
transcripts and shift localization of the heterogeneous nuclear ribonucleoprotein-k
(hnRNP-k), RNA polymerase II, and heterochromatin protein 1 (HP1γ). Our data
demonstrate that antisense transcripts play a central role in recognition of the PR
promoter by both activating and inhibitory agRNAs.
811
David Corey
Masayuki Matsui
Jiaxin Hu
Bethany Janowski
Scott Younger
Jacob Schwartz
39
Department of Pharmacology
Univ. of Texas, Southwestern Medical
Center at Dallas, Dallas, TX 75390-9041
david.corey@utsouthwestern.edu
*
40
Regulatory RNAs in Bacteria:
Biological Roles and Mechanisms
Small non-coding RNAs play central regulatory roles in all kingdoms of life. My lab
is concerned with such RNAs (here called small RNAs/sRNAs) in the enterobacterium Escherichia coli. Most bacterial sRNAs whose biological roles have been
elucidated appear to be stress-related [membrane stress (1), oxidative stress, SOS/
DNA damage, sugar stress, cold shock, iron stress, etc.], and some are involved in
pathogenesis. The emerging picture suggests that many adaptive responses involve
a complex interplay of transcriptional and post-transcriptional regulation, the latter
being predominantly carried out by sRNAs. This is strongly supported by sRNA
dependent remodeling of the cell surface and outer membrane.
In terms of mechanisms, a few sRNAs carry out their regulatory activity by protein
sequestration whereas the majority acts by base-pairing (antisense mechanism) to
target mRNAs. For these antisense sRNAs, inhibition of translational initiation appears to be the predominant mode. Many sRNAs bind to translation initation regions
and thereby compete with ribosome access. A second mode of action is translational
activation. Here, sRNAs bind to an upstream RNA segment to unmask an otherwise inhibitory structure sequestering the ribosome binding site. Other more exotic
mechanisms have been elucidated, such as antisense RNA competing for sequence
non-specific “ribosome standby” binding (2, 3) (so-called ribosome standby).
This talk will summarize some of the biological roles that sRNAs play in enterobacteria and will give examples of mechanisms of regulation.
1. Udekwu, K., Darfeuille, F., Vogel, J., Reimegård, J., Holmqvist, E., and Wagner, E. G. H.
Genes & Dev 19, 2355-2366 (2005).
2. Vogel, J., Argaman, L., Wagner, E. G. H., and Altuvia, S. Curr Biol 14, 2271-2276 (2004).
3. Darfeuille, F., Unoson, C., Vogel, J., and Wagner, E. G. H. Mol Cell 26, 381-392 (2007).
E. Gerhart H. Wagner
Dept. of Cell & Molecular Biology
Biomedical Center, Uppsala University
75124 Uppsala, Sweden
gerhart.wagner@icm.uu.se
812
41
Structure-based Genetic Surveillance Mechanisms
This talk will describe some recent applications of high thruput DNA sequencing
toward understanding of the structure-based mechanisms we use to protect ourselves and our genomes.
Andrew Fire
Departments of Pathology & Genetics
Stanford Univ. School of Medicine
300 Pasteur Drive, Room L235
Stanford, CA 94305-5324
afire@stanford.edu
42
Noah C. Welker
Tuhin S. Maity
P. Joe Aruscavage
Brenda L. Bass*
Department of Biochemistry
University of Utah
Salt Lake City, UT 84112
bbass@biochem.utah.edu
*
What is the Function of Dicer's Helicase Domain?
We are exploring the role of Dicer's helicase domain in C. elegans. We find that
the germline defects of C. elegans lacking Dicer (dcr-1(-/-)) are rescued by a
transgene encoding wildtype Dicer, as well as by transgenes encoding Dicer
with point mutations in the helicase domain. Further, all strains are wildtype in
their ability to mount an RNAi response following feeding of exogenous doublestranded RNA (dsRNA).
The finding that the helicase mutants were not deficient for exogenous RNAi led us
to assay for defects in endogenous small RNA processing. We assayed piRNAs, 4
miRNAs, and 5 endo-siRNAs by northern blot and saw no noticeable defects in processing either piRNAs or miRNAs. However, helicase mutant lines were completely devoid of endo-siRNAs. We also assayed changes in cognate mRNA levels for
four of the missing endo-siRNAs, and observed a corresponding increase in mRNA
level. To get a more complete picture of the endogenous small RNA defects in our
Dicer helicase mutants, we performed high throughput sequencing of small RNAs
from wildtype and helicase mutant rescue strains, using a protocol designed to look
specifically at primary endo-siRNAs. Preliminary analyses of these data indicate
that the helicase domain is required for the accumulation of many, but not all primary endo-siRNAs. We are currently performing analyses to determine the defining
features of endo-siRNA loci that require a functional helicase domain versus those
loci that accumulate endo-siRNAs in both wildtype and helicase-defective strains.
Our model is that Dicer's helicase domain allows the enzyme to act processively,
binding long dsRNA and cleaving along its length before release. A single double-stranded cleavage is sufficient to generate a miRNA from its short precursor
dsRNA, explaining why the helicase domain is not required for miRNA processing. This model is based on in vivo data, and we are now attempting to prove the
model with in vitro biochemical studies.
Analysis of Reprogramming of Cellular
Fate Induced by a Large Non-coding RNA
Large non-coding RNAs, are thought to form a vast and complex layer of regulatory
mechanisms that have so far remained almost completely unknown. In order to gain
insight into the function of this novel class of RNAs, we chose a large mRNA-like
transcript that lacked protein-coding potential for analysis. We initially determined
the expression pattern of this RNA in different tissues in mouse, which showed significant expression in neuroal tissues of both adult and fetal mouse, including forebrain, brainstem, and cerebellum. The expression of this RNA in other tissues was
either barely detectable or completely absent. Analysis of primary cultured cells
derived from forebrain indicated that the RNA was highly expressed in neurons,
but not in glial cells. Thus, the expression of the RNA was highly restricted to neurons, suggesting that it might play a role in neuronal differentiation or maintenance.
Intriguingly, over-expression of this RNA in a number of cell lines, including the
C2C12 mouse myoblasts and C3H10T1/2 fibroblasts, resulted in reprogramming
of the differentiation pathway of these cells from muscle or adipocyte cells into
neurons. In order to gain insight into the mechanism of this drastic cell fate switch,
we have started to determine the point at which the myogenic or adipogenic programs are diverted into a neurogenic pathway. To this end, we have analyzed the
gene expression pattern of stable cell lines that overexpress the noncoding RNA
at different stages before and during differentiation. Our preliminary analysis suggests that while embryonic and neuronal stem cell markers are not expressed in
these cells, genes upregulated in Neural Progenitor Cells and mature neurons are
highly expressed in stable cell lines that overexpress the large RNA. This was not
observed in control cells, or vector transfected cells. Experiments are underway to
further characterize the mechanism of this cell fate switch. These data indicate that
large non-coding RNAs can function as master regulatory molecules in cells, and
underscore the critical role of RNAs in cellular function.
813
Fereshteh Jahaniani
Farshad Niazi
Bing Zhang
Saba Valadkhan*
10900 Euclid Ave
Cleveland, OH 44106
saba.valadkhan@case.edu
*
44
Force and Form in RNA Folding
The importance of structured RNAs in extant biological processes has become increasing clear in the past decades. RNAs identified to function as structured elements
have been scrutinized by a variety of techniques that have characterized folding processes and intermediates. Nevertheless, we are left with an unsatisfying view of RNA
folding, as few generalities have emerged with clarity from such studies. We have
therefore embarked on a distinct course of action, building on seminal work from
Draper, Lilley, Westhof and others. Structured RNAs are dissected into components,
and the forces responsible for the behavior of each component are investigated. The
long term goal is to develop an energetic description of underlying forces and interactions that allows accurate thermodynamic and kinetic descriptions of complex
folded RNAs. I will describe some of our initial progress toward this goal.
43
Dan Herschlag
Stanford University
Stanford, CA 94305-5307
herschla@stanford.edu
814
45
Anna Marie Pyle
Department of Molecular
Biophysics and Biochemistry
Yale University
New Haven, CT 06520
anna.pyle@yale.edu
Group II Intron Structure and Function:
The Accidental Architects of Biological Diversity
Group II introns are an ancient class of ribozymes that can catalyze a striking diversity of chemical reactions on RNA and DNA. They are large molecules (~450-1000
nucleotides) with a distinctive secondary structure and a reactive tertiary structure
that forms in the presence of magnesium ions. Group II introns can cut themselves
out of a strand of RNA and ligate the pieces back together again. The liberated
intron molecules are also highly reactive, and they are capable of targeting and reacting with complementary pieces of RNA and DNA. Through cutting and pasting
reactions, free introns can insert themselves into new target sequences, thereby hopping from one genomic location to another within a host, or between species. Thus,
group II introns are mobile genetic elements that inhabit and shape the genomes of
bacteria, fungi, diverse microeukaryotes, plants, and some animals (for reviews, see
Pyle, Ribozymes, RSC Publishing, 2008; Pyle & Lambowitz, RNA World 3, 2007;
Lehmann & Schmidt, Crit Rev Biochem Mol, 2003).
Although they continue to exert a major influence on the metabolism of these modern organisms, group II introns are also of great historical importance, as they are believed to share a common ancestor with the original introns that proliferated throughout all eukaryotic genomes. By breaking eukaryotic coding sequences into pieces that
can rejoin or “splice” in different combinations, group II introns may have enabled
eukaryotes to encode hundreds of different proteins within a single gene. By helping
us break the “one gene one protein barrier”, group II introns may have contributed
to the great diversity that we observe in life today. The catalytic machinery for group
II intron splicing probably evolved into the eukaryotic “spliceosome”, which is the
large ribonucleoprotein machine that catalyzes splicing in higher eukaryotes, and
which has active-site components that are similar to modern group II introns.
46
Subha Das
Eduardo Paredes
Carnegie Mellon University
Pittsburgh, PA 15213 USA
srdas@andrew.cmu.edu
A glimpse of the earliest eukaryotic splicing machine is provided by the high-resolution crystal structure of an intact group IIC intron, which was recently solved by our
group (Toor et al., Science (2008). This elaborate structure is a rich trove of new information on RNA structural elements and ribozyme catalytic strategies. The group
IIC structure reveals a complex scaffold (comprised of intron Domain 1) that enfolds
the active-site, which is comprised of a bulge motif that is integrated within a majorgroove triple helix on the surface of intron Domain 5. The resulting structure forms
a site for the binding of two divalent metal ions that are spaced 3.9 Å apart, which
is the ideal distance for metals that participate directly in phosphodiester cleavage
reactions (the classical two-metal ion mechanism). The crystal structure also reveals
that structural motifs known to be similar to spliceosomal domains are closely clustered in space, suggesting that the two systems share a common ancestor.
Investigation of Natural and Selected Nucleic
Acid Enzymes that Depend on Coenzymes
The glmS riboswitch occurs in all gram-positive bacteria exerting feedback control
over production of glucosamine-6-phosphate (GlcN6P) that is used towards cell-wall
synthesis. Recent biochemical and structural analyses suggest that the GlcN6P cofactor acts as a coenzyme; GlcN6P binds to the RNA and acts directly to catalyze RNA
cleavage. Through analyses of the cleavage reaction with normal and hyperactivated
5ʹ-S-phosphorothiolate substrates as well as GlcN6P analogues, we investigate the
mechanistic role of the putative GlcN6P coenzyme. In addition, to determine the effectiveness of a GlcN6P cofactor in catalysis of RNA cleavage we are using in vitro
selection methods to identify GlcN6P-dependent DNAzymes. We seek to compare
the cleavage mechanism of the GlcN6P-dependent DNAzyme to that of the natural
glmS ribozyme as well as other selected DNAzymes that putatively use a coenzyme.
While protein enzymes are well known to use coenzymes, the use of coenzymes
maybe a hitherto underestimated catalytic strategy among nucleic acid enzymes
815
Reversible Backbone Linkages and Intercalators
as Key Components of the Proto-RNA World
47
The nonenzymatic synthesis of RNA-like polymers is crucial to current proposals
for an early stage of life in which nucleic acid polymers were responsible for catalysis before the advent of coded proteins. However, model prebiotic synthetic routes
to these polymers are fraught with difficulty. The chemical activation of oligo- and
mono-nucleotides with functional groups such as phosphorimidazolides and iodide/
phosphorothioate pairs, or condensing agents such as N-cyanoimidazole and watersoluble carbodiimide, allows for the nonenzymatic synthesis of oligonucleotides,
but the yields of linear oligonucleotides from these reactions are low. In large part,
polymerization is limited by the irreversible formation of small cyclic products. We
have proposed two ways by which strand cyclization can be circumvented during
polymerization: the use of small intercalative molecules that shift the chemical equilibria to favor base-paired linear polymers; and the use of reversible thermodynamically controlled linkages, such as those formed between amines and aldehydes (1).
Experimental results to be presented demonstrate how these complementary strategies dramatically increase the proportion of nucleic acid oligomers that are available
for incorporation into higher-order polymers. These results support our hypothesis
that intercalators and reversible backbone linkages could have been of extraordinary
utility in the synthesis of the earliest proto-RNA polymers on a prebiotic Earth.
Aaron E. Engelhart1,2
Eric D. Horowitz1,2
David Lynn1,3
Nicholas V. Hud1,2,*
Center for Fundamental and Applied
1
Molecular Evolution
School of Chemistry and Biochemistry
2
Georgia Institute of Technology
Atlanta, Georgia 30332
Departments of Chemistry and Biology
3
Emory University, Atlanta, GA 30322
hud@gatech.edu
1. Hud, N.V., Jain, S.S., Li, X., Lynn, D. G. Chem Biodiver 4, 768-783 (2007).
48
Splicing Mechanisms: Lessons from
Single-Molecule Spectroscopy
Splicing is an essential step in the maturation reaction of eukaryotic pre-mRNA
in which intervening sequences (introns) are removed from the coding sequences
(exons). The spliceosome is a dynamic assembly of five snRNAs and numerous
proteins that catalyzes splicing. U2 and U6 are two snRNAs that form an RNA
complex strictly required for both steps of splicing. Major conformational changes
are expected to take place during the assembly and catalysis of the spliceosome.
We have developed a single-molecule fluorescence assay to study the structural
dynamics of a protein free U2-U6 complex from yeast. Our data clearly show a
Mg2+-induced large amplitude conformation change of the U2-U6 complex. In the
absence of Mg2+ helix I and the U6-ISL are in close proximity, while in the presence of Mg2+ these two helices are far from each other. This conformational change
consists of a two-step process with a previously unobserved obligatory folding intermediate. The first step is Mg2+-dependent, while the second step corresponds to a
junction migration that results in the formation the genetically conserved Helix IB.
Point mutations in highly conserved regions indicate that the observed dynamics
in vitro correlate with spliceosomal activation in vivo. Furthermore, deletion of the
highly conserved nucleotide U80, which has been involved in catalysis, shows that
this nucleotide plays an important role in stabilizing one of the observed conformations, implicating that this conformation may be important for catalysis.
David Rueda*
Zhuojun Guo
Krishanthi Karunatilaka
Wayne State University
Detroit, MI 48202
rueda@chem.wayne.edu
*
816
49
William E. Stumph*
Ko-Hsuan Hung
Hsien-Tsung Lai
Nermeen H. Barakat
Mitchell Titus
Shu-Chi Chiang
Chemistry and Biochemistry and
Molecular Biology Institute
San Diego State University
5500 Campanile Dr
San Diego, CA 92182-1030
wstumph@sciences.sdsu.edu
*
50
Pavel Banas1,*
Nils G. Walter2
Jiri Sponer1,3
Michal Otyepka1,3
Department of Physical Chemistry and
1
Center for Biomolecules and Complex
Molecular Systems, Palacky University
tr. Svobody 26, 771 46
Olomouc, Czech Republic
2
Single Molecule Analysis Group
University of Michigan
930 N. University Avenue
Ann Arbor, MI 48109-1055, USA
Institute of Biophysics
3
Academy of Science of the Czech
Republic, Kralovopolska 135
61265 Brno, Czech Republic
ribicka.neonka@email.cz
*
Structural and Functional Studies of the
Drosophila Melanogaster Small Nuclear RNA
Activating Protein Complex (DmSNAPc)
The small nuclear RNA activating protein complex (SNAPc) is an evolutionarily
conserved multi-subunit factor required for transcription of the spliceosomal small
nuclear RNA (snRNA) genes by both RNA polymerase II (U1, U2, U4, and U5) and
RNA polymerase III (U6). Three distinct polypeptides have been identified as subunits of D. melanogaster SNAPc; however, the stoichiometry of these three subunits
in DmSNAPc had not been investigated. By co-expressing each subunit with two
different tags and by doing band-shift and super-shift analyses, we have determined
that DmSNAPc is a heterotrimer with a 1:1:1 subunit stoichiometry. DmSNAPc recognizes an ~21 bp long DNA sequence denoted the PSEA about 40-60 bp upstream
of the transcription start site. Interestingly, the PSEAs of the U1 and U6 genes are not
interchangeable even though they are identical at 16 of 21 nucleotide positions. In
fact, changing the U1 PSEA to a U6 PSEA inactivated the U1 promoter in vivo. We
have now found that this substitution does not affect the association of DmSNAPc
with the promoter; instead, it disrupts the recruitment of TBP. This finding is consistent with a model in which DmSNAPc binds in different conformations to the U1
and U6 PSEAs and that these conformational differences in DmSNAPc lead to differential RNA polymerase selectivity at the U1 and U6 promoters. All three subunits
of DmSNAPc contact DNA and are required for its sequence-specific DNA binding
activity, but only one of the subunits contains a canonical DNA-binding domain. We
have recently identified domains in each of the three subunits that are required for
assembly of the DmSNAP complex and for its DNA-binding activity. This work was
supported by NSF and in part by the California Metabolic Research Foundation.
Structural Insight into RNA Catalysis Revealed
by Molecular Dynamics Simulations and
QM/MM Calculation
The hepatitis delta virus (HDV) ribozyme is a representative example of RNA catalyst. This functional RNA segment is embedded in human pathogenic HDV RNA.
Previous experimental studies have established that the active-site nucleotide C75
is essential for self-cleavage of the HDV ribozyme, although its exact catalytic
role in the process remains debated. Based on the available structural data, we
have carried out extensive explicit solvent molecular dynamics (MD) simulations
of HDV ribozyme, followed by hybrid quantum/classical (QM/MM) analysis of
the possible reaction mechanisms. Combination of long-scale MD simulations and
robust electronic structure QM/MM techniques can provide new structural insight
into mechanism of RNA catalysis, including direct atomic-level analysis of the
reaction mechanism. Our QM/MM calculations of the C75 general base pathway
utilize the available structural data for the wild type HDV genomic ribozyme as a
starting point. We found that C75 is readily capable of acting as the general base,
in concert with the hydrated magnesium ion as the general acid. On the other hand,
even during long scale MD simulations we were not able to identify any plausible
arrangements of the active site with protonated C75H+ positioned in a proper orientation for general acid catalysis. Thus general acid pathway seems to be inconsistent with available crystal structures of HDV ribozyme. Since most biochemical
studies rather suggest that the catalytic mechanism of HDV ribozyme stems from
C75 acting as general acid, we have an interesting case of possible nontrivial conflict between structural and mechanistic data, which will be discussed.
Reference and Footnotes
1. Banas, P., Rulisek, L., Hanosova, V., Svozil, D., Walter, N. G., Sponer, J., and Otypeka, M.
J Phys Chem B 112, 11177-11187 (2008).
Structural Insights into Ribonucleoprotein Enzymes
Small nucleolar ribonucleoprotein particles (snoRNPs) comprise a unique class of
enzymes that modify and process functional RNAs. The RNP enzymes contain a
conserved core of protein subunits and a RNA subunit of varying sequences. The
RNA subunit directs binding of the RNP enzyme to substrate RNA through simultaneous interactions with both the substrate and core proteins. The protein components are believed to catalyze the actual modification or cleavage reaction. The
processes mediated by the RNP enzymes face challenges in enzyme assembly and
in topological arrangement. The large and complex substrate RNA (ribosomal or
spliceosomal RNA) must be able to bind reversibly to the multi-component RNP
without being trapped topologically. Box H/ACA snoRNPs comprise the most
complex pseudouridine synthases and are essential for ribosome and spliceosome
maturation. Vertebrate telomerase is known to harbor a box H/ACA RNP subdomain that is critical to its biogenesis and stability. Significantly, mutations in each
subunit of the human box H/ACA RNP have all been linked to the rare genetic
disorder dyskeratosis congenita. We have obtained a substrate-bound archaeal H/
ACA RNP that reveals detailed information about the protein-only active site.
Comparison of currently available subcomplex structures reveals a unique mechanism of substrate docking
that involves all subunits.
Mutational analysis supports structural observations and further reveals
the importance of a conserved protein loop and
a guide-substrate RNA
pocket in binding the
substrate. The observed
mechanisms of proteinmediated catalysis and
substrate placement may
be a theme among RNAguided enzymes.
817
Bo Liang1
Jing Zhou2
Elliot Kahen2
Rebecca M. Terns3
Michael P. Terns3
Hong Li1,2,*
Institute of Molecular Biophysics
1
Dept. of Chemistry and Biochemistry
2
Florida State University
Tallahassee, Florida.
3
and Molecular Biology
University of Georgia at Athens
Athens, Georgia
hong.li@fsu.edu
*
52
The Role of Noncoding RNAs in
Splicing and Neurogenesis
The result of the ENCODE project has indicated that while over 90% of the human
genome is transcribed into RNA, protein-coding genes occupy only 2% of the human genome, with the rest of the genome transcribed into RNAs that will not be
translated into proteins. It is likely that a significant percentage of such RNAs play
functional roles in the cell. A number of non-coding RNAs are highly abundant
and have been known for a long time to play critical roles in processes that sustain
cellular life, including the ribosomal RNAs, RNase P, tRNAs, and snRNAs. A less
understood group of non-coding RNAs, the small regulatory RNAs and large mRNA-like non-coding transcripts, seem to play regulatory roles in the cells. While
recent studies have shed light on several aspects of the function of small RNAs,
the function of large non-coding transcripts has remained almost completely unknown. In our efforts to understand the function of non-coding RNAs, we have
selected snRNAs as representatives of housekeeping RNAs for analysis. Also, we
have chosen a mRNA-like large RNA in an attempt to understand the mode and
scope of the function of this novel class of RNAs in vivo.
Mechanistic and structural similarities between spliceosomal snRNAs and selfsplicing group II introns, ribozymes found in both pro- and eukaryotes, have led to
51
Saba Valadkhan
Cleveland, OH
saba.valadkhan@case.edu
818
53
Matthew G. Seetin*
David H. Mathews
Dept of Biochemistry and Biophysics
University of Rochester Medical Center
601 Elmwood Ave. Box 712
Rochester, NY 14642
matthew_seetin@urmc.rochester.edu
*
the hypothesis that snRNAs are descendents of these ribozymes and thus might play
a catalytic role in the spliceosome. To determine if this might indeed be the case, we
attempted to determine if the snRNAs can catalyze the chemistry of the splicing reaction. Interestingly, upon incubation with short RNA oligonucleotides, a basepaired
complex formed by two of the spliceosomal snRNAs could catalyze a two step reaction chemically identical to group II intron-catalyzed splicing and the second step of
the spliceosomal splicing. This reaction was dependent on and occurred in proximity of sequences in the two snRNAs that are known to be involved in splicing. The
ability of spliceosomal snRNAs to catalyze splicing in the absence of spliceosomal
proteins indicates that despite the presence of ~200 proteins in the spliceosome, the
catalytic function of snRNAs has been conserved during the evolution of eukaryotic
splicing machines and is likely harnessed during spliceosomal catalysis.
To gain insight into the function of the other major class of non-coding RNAs,
the regulatory RNAs, we analyzed the cellular function of a pre-mRNA-like large
RNA by first determining its tissue expression pattern. Interestingly, it showed a
highly specific expression pattern which was largely restricted to neuronal tissues.
Overexpression of the RNA in cell types as diverse as myoblasts and fibroblasts
blocked their normal differentiation pathway, and instead led to their differentiation into neurons. This surprising result suggested that this RNA may play a key
regulatory role in neuronal differentiation and reprogramming of cellular fate and
proves the power of RNAs as cellular regulators.
All-Atom RNA Tertiary Structure Prediction
We used steered molecular dynamics and simulated annealing to predict the complete tertiary structure of several different RNAs. Our restraints are derived only
from secondary structure, covariation analysis, ideal A-form values, multibranch
coaxial stacking predictions, and, when necessary for larger systems, biochemical
data (1, 2). The calculations are performed using the AMBER molecular dynamics
package and the AMBER 99 forcefield. We applied this methodology to the Alu domain of the mammalian SRP RNA, yeast tRNAPhe, the full hammerhead ribozyme,
the hairpin ribozyme, the group I intron, and the group IIc intron (3-7). We accelerated these calculations by running without non-bonded forces while restraints were
being applied, followed by their restoration using a novel application of “soft core”
van der Waals potentials (8). We compare our results both with current crystal structures and with past modeling attempts and find that our simple ab initio approach is
sufficient to make good predictions of the global topology of the molecules (9).
1.
2.
3.
4.
5.
6.
7.
8.
9.
Tyagi, R., Mathews, D. H. RNA 13, 939-951 (2007).
Heckman, J. E., Lambert, D., Burke, J. M. Biochemistry 44, 4148-4156 (2005).
Weichenrieder, O., Wild, K., Strub, K., Cusack, S. Nature 408, 167-173 (2000).
Shi, H., Moore, P. B. RNA 6, 1091-1105 (2000).
Martick, M., Scott, W. G. Cell 126, 309-320 (2006).
Guo, F., Gooding, A. R., Cech, T. R. Mol Cell 16, 351-362 (2004).
Toor, N., Keating, K. S., Taylor, S. D., Pyle, A. M. Science 320, 77-82 (2008).
Steinbrecher, T., Mobley, D. L., Case, D. A. J Chem Phys 127, 214108 (2007).
Michel, F., Westhof, E. J Mol Biol 216, 585-610 (1990).
Carbocyclic Sugars Constrained to North and
South Conformations Stabilize and Control
RNA Conformations
Carbocyclic sugars, which are constrained to north/south (C2ʹ/C3ʹ exo) conformations have A/B form that can alter the helical properties of RNA duplexes and rigidify nucleotides due to their locked sugar puckers. Two RNA structures, a RNA
dodecamer and an HIV kissing loop complex where several nucleotides are replaced
with north and south constrained sugars, are studied by Molecular dynamics (MD)
simulations. The overall helical properties of a modified RNA dodecamer where
nucleotides are replaced by north constrained sugars did not show any critical deviation from canonical A-form helix. However, a modified RNA dodecamer where
nucleotides are replaced with south carbocyclic sugars shows a mixture of A- and
B-form helical properties. In addition, this modified dodecamer shows total length
extension due to the south constrained sugars. In the HIV kissing loop complex,
north and south constrained sugars are substituted into flanking bases that an x-ray
structure of the kissing loop complex showed contained C2ʹ endo south sugar conformations. The overall RMSD of the modified HIV kissing loop complex was decreased compared to that of the normal kissing loop complex. The reduced RMSD in
the modified kissing loop complex depends on both type of substituted constrained
sugar conformations and substituted locations. The overall RMSD decrease is also
obtained by substituting north constrained sugars into both kissing loop complex
stems. In addition, it is found that the axial twisting along the HIV kissing loop complex can be controlled by substituting constrained sugars. These results suggest that
the proper use of specific north or south carbocyclic sugars at specified locations in
an RNA structure can stabilize and deform RNA structures to obtain defined RNA
conformations with specific chemical properties and shapes for RNA nano-design.
819
Taejin Kim1
Victor E. Marquez2
Bruce A. Shapiro1,*
Center for Cancer Research
1
Nanobiology Program (CCRNP)
National Cancer Institute at Frederick
Frederick, MD 21702
Laboratory of Medicinal Chemistry
2
Frederick, MD 21702
bshapiro@ncifcrf.gov
*
55
Classification and Energetics of the
Base-Phosphate Interactions in RNA
Structured RNA molecules form complex 3D architectures stabilized by multiple
interactions involving the nucleotide base, sugar, and phosphate moieties. A significant percentage of the bases in the 3D structures of 16S and 23S rRNA hydrogenbond with phosphates of other nucleotides. By extracting and superimposing basephosphate (BPh) interactions from a reduced-redundancy subset of 3D structures
from the Protein Data Bank (PDB), we identified recurrent phosphate binding sites
on the RNA bases. Quantum chemical calculations were carried out on model systems representing each BPh interaction. The calculations show that the centers of
each cluster correspond to energy minima on the potential energy hypersurface.
We modified the “Find RNA 3D” (FR3D) software suite to automatically find and
classify these interactions. The 3D structures of the 16S and 23S rRNAs of E.coli
and T.thermophilus were compared to identify conserved BPh interactions. Most
conserved BPh interactions occur in hairpin, internal, or junction loops or as part of
tertiary interactions. Bases which form BPh interactions that are conserved in the
3D structures are also conserved in rRNA sequence alignments. In addition, bases
involved in BPh interactions show a higher degree of conservation than those not
involved, even after adjusting the analysis for the other types of molecular interactions. In summary, we identified BPh interactions as important extension of base
pairing of structured RNAs with selective effect on RNA sequences. Thus consideration of BPh interactions in RNA bioinformatics is very vital.
54
Craig L. Zirbel1,4
Judit E. Sponer5
Jiri Sponer5
Jesse Stombaugh2,4
Neocles B. Leontis3,4,*
Dept of Mathematics and Statistics
1
Dept of Biological Sciences
2
Dept of Chemistry
3
Ctr for Biomolecular Sciences
4
Bowling Green State Univ.
Bowling Green, OH 43403
Inst of Biophysics
5
Academy of Sci. of the Czech Rep.
Kralovopolska 135
612 65 Brno, Czech Republic
leontis@bgnet.bgsu.edu
*
Computational Design Strategies
for RNA Nanostructures
820
56
Bruce A. Shapiro
Nanobiology Program
National Cancer Institute
Frederick, MD 21702
Recent developments in the field of nanobiology have significantly expanded the
possibilities for new materials in the treatment of many diseases including cancer.
The field of nanobiology, which is essentially defined as the control and design of
biological materials that have dimensions commonly less than 100 nm, holds great
promise in the therapeutic arena due to the ability to design nanoparticles with specific properties. RNA represents a relatively new molecular material for the development of these biologically oriented nano devices. We have created various computational strategies that permit a user to design RNA based nanoparticles (1-6). These
strategies ultimately provide a means to determine a set of nucleotide sequences that
can assemble into a desired RNA nano complex. Examples include our RNAJunction database, which forms one of the foundations for our RNA nanodesign. The
database contains structural and sequence information for RNA helical junctions
and kissing loop interactions. These junctions were extracted automatically from
the PDB database by a special scanning algorithm. The database also contains the
results from applying molecular mechanics and structural clustering techniques to
the motifs. These motifs can be searched for in a variety of ways, providing a source
for RNA nano building blocks. Another computational tool, NanoTiler, permits a
user to interactively and automatically construct RNA-based nanoscale shapes.
NanoTiler provides a 3D graphical view of the objects to be designed. NanoTiler
provides the means to work interactively, or with a scripting language, on the design
process even though the precise RNA sequences may not yet be specified. NanoTiler can use the 3D motifs found in the RNAJunction database with those derived
from specified RNA secondary structure patterns to build the defined RNA nano
shape. Then, with the aid of special sequence design algorithms a set of sequences
can be predicted that can potentially self-assemble into a structure with the desired
shape and functionality. Finally, another computational tool, RNA2D3D, permits
the modeling of RNA 3D structures based upon RNA secondary structure input.
RNA nanoshapes can be modeled using this paradigm. Examples will be shown that
illustrate the use of these various design strategies and issues related to characterizing the ability of these RNA nanostructures to self-assemble.
1. Bindewald, E., Grunewald, C., Boyle, B., O'Connor, M., Shapiro, B. A. J Mol Graph Model
27, 299-308 (2008).
2. Shapiro, B., Bindewald, E., Kasprzak, W., Yingling, Y. Protocols for the In Silico Design
of RNA Danostructures. In: Nanostructure Design Methods and Protocols, p. 93-115. Eds.,
Gazit, E., Nussinov, R. Totowa, NJ: Humana Press (2008).
3. Martinez, H. M., Maizel, J. V., Shapiro, B. A. J Biomol Struct Dyn 25, 669-683, (2008).
4. Severcan, I., Geary, C., Jaeger, L., Bindewald, E., Kasprzak, W., Shapiro, B. Computational
and Experimental RNA Nanoparticle Design. In: Automation in Genomics and Proteomics:
An Engineering Case-Based Approach, p. 193-220. Eds., Alterovitz, G., Benson, R., Ramoni, M. Hoboken: Wiley Publishing (2009).
5. Bindewald, E., Hayes, R., Yingling, Y. G., Kasprzak, W., Shapiro, B. A. Nucleic Acids Res
36, D392-397 (2008).
6. Yingling, Y. G., Shapiro, B. A. Nano Lett 7, 2328-2334 (2007).
Conformation Change of the Loop Adenine
of Avian Leukosis Virus RNA Upon Antibiotic
Binding Revealed by 2-Aminopurine Fluorescence
Structural dynamics and local changes in the dimerization site of avian retroviral
RNA were studied. Our task was to identify the state of adenine located in the
loop of RNA hairpin under the dimerization and understand the effects of various factors on the local RNA conformation. To this end we replaced the unpaired
adenine in the hairpin loop of avian leukosis virus RNA with a fluorescent probe
2-aminopurine (2-AP). This approach permitted us to discriminate between the
local conformation of the unpaired adenine in several RNA states during dimerization dimerization: hairpin, a kissing loop dimer (KD), and an extended duplex
dimer (ED). It was shown that fluorescence intensity of 2-AP in the monomer
hairpin RNA has higher than that of the both RNA dimers. Observed fluorescence
quenching on RNA dimerization can be explained by interaction of unpaired adenine to neighboring bases of the RNA loop upon dimerization. It has also been
found that the intensity of 2-AP fluorescence for the two RNA dimers is different.
Significantly lower intensity of fluorescence for extended dimer can be attributed
to its more overall compact RNA structure.
It is known that kissing loop dimers of retroviral RNA are unstable intermediates in
the process of retroviral RNA dimerization. The study the KD to ED transition of
the RNA is important since it is an extended stable dimer to be packed in the viral
particle. Effect of RNA ligands, including aminoglycoside antibiotics, on the KD
structure applies to this task. We studied the conformational change of the unpaired
loop adenine of kissing loop dimer RNA upon the interaction with aminoglycoside antibiotics (AMG): paromomycin, neomycin, tobramycin, and kanamycin B.
It turned out that only tobramycin increases nearly three times the intensity of fluorescence 2-AP of kissing loop dimer. This result implies that 2-AP loses the initial
intra-loop interactions in the structure KD on interaction with tobramycin, becoming more exposed into the solution that is reflected in its fluorescence increase.
Probably, the fluorescence of 2-aminopurine can be successfully used to detect the
binding of ligands to different structures of RNA.
Exploration of Structural Building
Block Properties for RNA Nanostructures
Our group is pursuing computer-aided strategies for designing RNA-based nanostructures. As part of this effort we have developed an RNAJunction database,
which provides a large set of RNA junctions (internal loops and loop-loop interactions). These can be used as building blocks for larger, biologically functionalized nanostructures. Our programs, NanoTiler and RNA2D3D, can utilize
them, together with idealized fragments of A-form helices, to produce the desired
3D shapes. Up to this stage the building blocks are treated as rigid or near-rigid
objects. However, experimental data shows that RNA structures are flexible and
capable of accommodating their shape to the constraints of larger structural contexts. Here we present examples of the RNA-based nanostructure designs, stressing the characterization of the structural flexibility of the building blocks and
potential strategies for controlling these characteristics. We present examples of
the characterization of various reprogrammed (edited) kissing loops (KL) based
on the HIV-1 KL complex, as well as the use of modified nucleotides to change
its characteristics. We contrast them with the dynamic behavior of other kissing loops. Larger characterized structures include tectosquare building blocks, in
which the flexible KLs appear to be necessary for the assembly, and a triangle and
its individual large building block monomers.
821
E.E. Minyat1,*
I.Z. Shukshina2
57
Engelhardt Institute
1
of Molecular Biology
Moscow, 119991 Russia
Moscow Institute
2
of Physics and Technology
141700 Moscow Region
Dolgoprudny, Russia
eminyat@gmail.com
*
58
Wojciech Kasprzak1
Eckart Bindewald1
Tae-Jin Kim2
Bruce A. Shapiro2,*
Basic Science Program
1
SAIC-Frederick, Inc.
NCI at Frederick, Frederick, MD, 21702
2
Nanobiology Program
Frederick, MD, 21702
*
822
59
Neocles B. Leontis
Bowling Green State University
Bowling Green, OH 43403
leontis@bgnet.bgsu.edu
60
Y.N. Vorobjev
Fundamental Medicine of Siberian
Branch of Russian Academy of Sciences
Novosibirsk 630090, Russia
ynvorob@niboch.nsc.ru
Funded in part by NCI contract N01-CO-12400. This research was supported by
the Intramural Research Program of the NIH, National Cancer Institute, Center
for Cancer Research.
From RNA Bioinformatics to RNA Ontology
Biomedical Ontologies integrate diverse biomedical data to enable intelligent datamining and to translate basic research into useful knowledge. I will discuss the first
version of the RNA Ontology (RNAO), an ontology for integrating databases pertaining to RNA structures, homologous sequences, and RNA functions. Each RNA
3D atomic coordinate file represents the structure of a specific molecule, but such
data have broader significance by representing a class of homologous molecules
that differ in sequence but share core structural features of functional importance.
3D structural data thus gain value by being linked to homologous sequences in
genomic data or to databases of sequence alignments. Similarly, genomic data gain
value when shared structural features are annotated and linked to specific functions.
The RNAO contains the definitions and the concepts of nucleic acid stereochemistry, base pairing families, base stacking, base-backbone hydrogen bonding, and
backbone connectivity and conformations, and enables their logical manipulation.
The RNA is intended to serve as a core, orthogonal ontology of the Open Biomedical Ontologies (OBO) Consortium and is a companion to the Sequence Ontology
(SO). It is available as an OWL or OBO file. The RNAO will provide logically
rigorous ways of linking genomic and structural databases.
Modeling of Structure and Dynamics of Eukaryotic
Ribosomal Termination Complex of eRF1-mRNA-tRNA
Translation is terminated when the ribosomal A-site is occupied by one of the three
stop codons: UAA, UAG, or UGA, which are recognized by the class 1 release factor RF. In eukaryotes, all three stop codons are recognized by the only RF, eRF1,
which does not have a sequence and structure similarity with two factors, RF1 and
RF2 of prokaryotes. The crystal structure of eRF1 (1) and ribosomal complexes of
prokaryotic Thermus thermophilus including 70S ribosome, mRNA, and tRNA in
the A-, P-, and E-sites (2) as well the structure of 70S ribosome in complex with
RF1 and RF2 (3) are known. The structural data on eukaryotic ribosomal translation termination complexes are indirect and restricted to the result of biochemical
studies, crosslinking of the stop codon nucleotides to the eRF1 residues and lowresolution, ~14 Å, cryoelectron microscopy, because stable eukaryotic ribosomal
termination complexes are difficult to obtain in vitro.
3D model of ribosomal triple molecular complex of eRF1-mRNA-tRNA
in P-site is reconstructed by computational modeling based on structure
of individual molecules, i.e., eRF1, mRNA, tRNA, taking into account
essential conformational dynamics of involved molecules and all indirect
experimental structural data. In translation termination complex the Asite tRNA is replaced by the eRF1. Therefore, the spatial dimension and
general shape of eRF1 molecule in the ribosomal complex should fit the
respective dimensions of A-site tRNA. There are two major functional
fragment that local structural organization are thought to be similar in
prokaryotic and eukaryotic ribosomes: (i) positions of mRNA stop codon
and tRNA anticodon triplet and respective position of stop codon binding
Figure 1 (A) Conformational dynamics of eRF1 domains, a set of instantaneous structures
with interval 500ps. (B) Movement of M-domain. (C) Movement of C-domain. (D) Fit of
eRF1 on the tRNAphe in A-site by virtual fit of GGQ with CCA and of NIKS with AC
loop.
site of the eRF1, (ii) position of the GGQ tripeptide of eRF1 in eukaryotic complex
should fit the position of that tripeptide in the prokaryotic ribosome complex. The
stop codon binding site of eRF1 is located around NIKS fragment of eRF1 N-domain
according to biochemical data. Exact localization of the stop codon binding site of
eRF1 are unknown. Models of stop codon binding sites of eRF1 were calculated
by docking of stop codon UAA on the eRF1. Two models of the stop codon binding sites have been obtained. The reference position of GGQ tripeptide of RF1 was
taken from the prokaryotic complex RF1-mRNA-tRNA, which is solved to 5.9 Å
resolution (PDB ID 2B64) (3). Having in hand the positions of reference fragments
of the eRF1, the reference structure of prokaryotic complex RF1-mRNA-tRNA, the
computational modeling of the eukaryotic complex eRF1-mRNA-tRNA has been
done by the following procedure. (I) the essential conformational movements of
eRF1 domains has been determined to perform deformation of the crystal Y-shaped
form of N-, M-, and C-domains to the L-shaped, to fit the cavity of ribosomal A-site
and to move the distance between GGQ tripeptide and NIKS motif, from ~110 Å
in crystal to ~75 Å in ribosomal complex, as it is shown in Figure 1; (II) substitute
the A-site tRNA in the T. thermophilus 70S ribosome by the eRF1 in the tRNAlike conformation. (III) The mRNA with P-site tRNA was redocked to the eRF1 in
the tRNA-like conformation taking into account all atom-atom interactions in the
triple complex eRF1-mRNA-tRNA(P-site). (IV) the model of triple complex eRF1mRNA-tRNA has been relaxed by the MD simulated annealing with constraint for
the GQQ tripeptide position. The final two models of the triple ribosomal complex
are shown in Figure 2. The main difference between two models is that the mRNA
strand interacts with grooves at different sides of N-domain surface of eRF1. Models 1 and 2 are structurally similar in the M-domain GGQ tripeptide region that is
responsible for peptidyl transferase activity. To choose between two models, the
chemical crosslinks between nucleotides of mRNA in triple complex eRF1-mRNAtRNA and atoms of eRF1 has been modeled for the both models of triple complex.
A computer model of complex with twelve different analogs of mRNA containing
a modified nucleotides in positions from +4 to +9, carrying the reactive groups
have been build. Free molecular dynamics of each modified mRNA analog was
simulated for 10 ns by simulated annealing at T = 250 – 500 K. The number of short
contacts < 7 Å between reactive azido group of mRNA analogs with eRF1 heavy
atoms has been analyzed for every 10 ps and statistics of contacts have been accumulated. Since the photoactiable azido group is highly reactive, the probability of
crosslinking is proportional to probability of its collision with eRF1 atoms. It was
found that the distribution of the crosslinks calculated for the model 1 of the triple
complex eRF1-mRNA-tRNA for 12 mRNA analogs and eRF1 residues coincides
with the experimental crosslinks distribution. The model 2 has calculated croslinks
distribution which is incompatible with experimental data.
823
Figure 2: (a) Model 1 of the eRF1-mRNA-tRNA ribosomal complex. The eRF1 molecule is shown in ribbons: thin ribbon is N-domain (NIKS motif is indicated),
medium ribbon is M domain (GGQ tripeptide is shown),
thick ribbon is C-domain. The mRNA is shown as thick
tube. The P-site tRNA is shown as smooth thin tube. (b)
Model 2 of the eRF1-mRNA-tRNA ribosomal complex.
824
Thus, molecular modeling allowed us to construct a model of the eukaryotic translation termination ribosomal complex eRF1-mRNA-tRNA. The arrangement of
eRF1 domains is substantially changes upon eRF1 binding in A-site from Y- to
L-shaped to mimic tRNA (4).
The work is supported by RFFI projects No. 05-04-48322, 09-04-00136.
61
Jiri Sponer
Acad. of Sciences
Kralovopolska 135
61265 Brno, Czech Republic
sponer@ncbr.chemi.muni.cz
1. Song, H., Mugnier, P., Webb, H. M., Evans, D. R., Tuite, M. F.,Hammings, B. A., Barford,
D. Cell 100, 311-321 (2000).
2. Yusupova, G. Z., Yusupov, M. M., Cate, J. H., Noller, H. F. Cell 106, 233-241 (2001).
3. Petry, S., Brodersen, D. E., Murphy, IV, F. V., Dunham, C. M., Selmer, M., Tarry, M. J., Kelley, A. C., Ramakrishnan, V. Cell 123, 1255-1266 (2005).
4. Vorobjev, Yu. N., and Kiselev, L. L. Molecular Biology 42, 341-351 (2008).
Molecular Dynamics Simulations and Quantum
Chemistry as Useful Complements to
RNA Structural Bioinformatics
RNA molecules are characterized by astonishing variability of molecular interactions. RNA structural bioinformatics is a powerful tool to understand the connection
between RNA sequences and their topologies and functions. However, the world
of RNA molecules is so complex that the experimental techniques are not capable
to provide all information needed for a full understanding of RNA molecules. Advance computational techniques such as explicit solvent molecular dynamics (MD)
and quantum chemistry (QM) can fill some of the gaps in our knowledge (1-3). It
is obvious that computational techniques have numerous major limitations and are
notoriously prone to misuse (1). Nevertheless, when properly applied, computations
can provide data that cannot be harvested by other techniques. For example, MD
can classify intrinsic structural flexibilities of RNA building blocks, which are strikingly variable and of functional importance (4, 5). Thus simulations can complement the primarily static and averaged structural data. MD can be instrumental in
studies of long-residency hydration that can be of structural, dynamical, or even
catalytic relevance (4, 6). Simulations can also map major binding sites of (monovalent) cations including those that are delocalized (fluctuating). MD is in addition
efficient in testing effects of base substitutions and modifications, including variable
protonation states. QM techniques are primarily designed to investigate the nature
and magnitude of all kinds of molecular interactions in nucleic acids and provide
link between the molecular structures and energies (2, 3). Proper application of
computational methods requires close cooperation with bioinformatics and experiment, and mutual understanding. I will briefly summarize advantages, limitations
and areas of application of these methods, and illustrate their close relation with
structural bioinformatics on several systems/problems: the dynamics of GTP-ase
associated center RNA (5) and A-site finger of the large ribosomal subunit, nature
of base stacking (one of the frequently misinterpreted interactions) (7) and classification of base-phosphate interactions. Molecular interactions in RNAs result in
a complex jumble of competing forces and often a given interaction can play multiple roles in different contexts. Computations have a potential to give qualitative
insights into the balance of forces in RNAs and complement experiments. While the
biology of RNA is being rapidly discovered, the understanding of physics or physical chemistry of RNA is lagging behind, and in this area computations can help.
1. S. E. McDowell, N. Spackova, J. Sponer, N. G. Walter. Biopolymers 85, 169-184 (2007).
2. J. Sponer, J. Leszczynski, P. Hobza. Biopolymers 61, 3-36 (2001).
3. J. Sponer, F. Lankas, Eds. Computational studies of RNA and DNA. Dordrecht: Springer, (2006).
4. F. Razga, J. Koca, J. Sponer, N. B. Leontin. Biophys J 88, 3466-348 (2005).
5. F. Razga, J. Koca, A. Mokdad, J. Sponer. Nucl Acids Res 35, 4007-4017 (2007).
6. M. M Rhodes, K. Reblova, J. Sponer, N. G. Walter. Proc Natl Acad Sci USA 103, 1338013385 (2006).
7. J. Sponer, P. Jurecka, I. Marchan, F. J. Luque, M. Orozco, P. Hobza. Chem Eur J 12, 28542865 (2006).
825
62
Molecular Mechanics Analysis of Minimal
Energy RNA Conformational Change Pathways
Conformation changes are important in RNA for both binding and catalysis. We are
developing computational methods for exploring and understanding pathways for
defined conformational changes.
One system of study is the conformational change of a non-canonical pair. In an
NMR structure of an AA mismatch in the sequence:
Keith Van Nostrand*
Scott D. Kennedy
David H. Mathews
Dept. of Biochemistry and Biophysics
[Chen, G., et al. Biochemistry 45, 6889-6903 (2006)] (P = purine), the AA noncanonical pair is in conformational exchange between a minor and major conformations. The conversion of the major trans Hoogsteen-sugar to the minor trans sugarHoogsteen non-canonical pair occurs on the NMR timescale.
We used the AMBER molecular mechanics software package to model conformational change pathways. Initial modeling was done with Targeted Molecular Dynamics (TMD), which applies a biasing potential based on RMSd to a target structure in
MD simulations. This provides a forced approximation of possible pathways with
dynamics. We further used Nudged Elastic Band (NEB), which predicts minimal
potential energy paths using a series of all atom images of the system along the path.
Both TMD and NEB provide insight into conformational change pathway. TMD
provides a rough approximation of pathways undergoing dynamics in time, while
NEB provides a time-independent and discrete low potential energy pathway.
Predicted pathways from NEB were analyzed and a reaction coordinate determined
for the conformational change. This reaction coordinate involves an improper dihedral angle defined by C8, C4, and N1 on one adenine and C5 on the second adenine
in the non-canonical pair. The minor state has an improper dihedral value of about 0
degrees, while the major state has a value of about +/- 180 degrees. Umbrella sampling was then used to predict the free energy profile along the 360 degree reaction
coordinate. Umbrella sampling was done using 36 windows of 10 degrees each with
12 ns of sampling per window for 6 different random number seeds. Total sampling
involved about 2.6 microseconds of MD spanning about 7 total years of CPU time.
The free energy profile suggests errors in the AMBER force field because there is a
reversal in the relative free energies of the major and minor structures.
601 Elmwood Ave. Box 712
Rochester, NY 14642
keith_vannostrand@umrc.rochester.edu
*
826
63
Y. Dalyan*
I. Vardanyan
A. Chavushyan
Yerevan State University
Faculty of Physics
Molecular Physics Department
Peculiarities of Interaction of Porphyrins with tRNA
The interaction of meso-tetra-(4N-oxyethylpyridyl)porphyrin (TOEPyP4) and its
Zn(II), Cu(II), Mn(III)-metallocomplexes with DNA and RNA duplexes are well
investigated (1, 2). It was established that the binding mode of porphyrins and
metalloporphyrins with nucleic acids duplexes depend both on the type of central
metal, and of peripheral substituent of porphyrins. In this work the interaction of
these porphyrins with single stranded tRNA from E.Coli was studied using UV/Vis
spectrophotometry and Circular Dichroism (CD) methods.
All measurements were performed in 0.1 BPSE buffer (1BPSE = 6 mM Na2HPO4 +
2 mM NaH2PO4 + 185 mM NaCl + 1 mM Na2EDTA), μ = 0.02.
The binding parameters were calculated using the absorption data and the equation (3):
1, A.Manoogian St.
0025, Yerevan, Armenia
yeva@ysu.am
*
where Cf is the free porphyrins concentration in solution, r = Cb/CN, Cb is the concentration of bound porphyrins, CN is the concentration of nucleotides, Kb is the
binding constant and n is the number of binding sites per nucleotide.
General conclusion: these porphyrins interact stronger with single stranded tRNA
than double stranded DNA or RNA.
The following peculiarities of the interaction of different porphyrins with tRNA
were observed:
• For the values of induced CD spectra (at 400-470 nm) for complexes
tRNA with TOEPyP4 and CuTOEPyP4 there is an optimum concentration of porphyrins (r = 0.2 – 0.25) at which the anisotropy of system is
maximal. Increase of concentration leads to decrease of anisotropy of system, may be as a result of aggregations. At r = 0.4 the visible aggregation
of a solution takes place.
• For complexes of ZnTOEPyP4 with tRNA the induced CD spectra are essentially different. The induced CD spectra of complex change a sign and
continue to grow (remaining negative) starting from a certain relative concentration. It is possible that at high relative concentration of porphyrins
the liquid crystal form may be generated from the solution.
• The binding constant of ZnTOEPyP4 with tRNA is 10 times greater than
with DNA. The number of nucleotides, which become inaccessible as a
result of binding of one porphyrin molecule (n = 4) is higher for tRNA,
than for DNA. We assume that on tRNA there are specific places for porphyrin binding.
1. Y. B. Dalyan, S. G. Haroutiunian, G. V. Ananyan, V. I. Vardanyan, D. Y. Lando, V. N. Madakyan, R. K. Kazaryan, L. Messori, P.-L. Orioli, A. S. Benight. J of Biomol Structure &
Dynamics 18, 677-687 (2001).
2. A. Ghazaryan, Y. Dalyan, S. Haroutiunian, A. Tikhomirova, N. Taulier, J. W. Wells, T. V.
Chalikian. J Amer Chem Soc 128, 6, 1914-1921 (2006).
3. Correia, J. J., Chaires, J. B. Methods in Enzymology 240, 593-614 (1994).
RNA Binding Aspects of Isoquinoline Alkaloids:
Affinity, Specificity, and Energetics
Alkaloids of plant origin have the potential of use in therapeutic applications.
Berberine, palmatine, and coralyne represent alkaloids of the isoquinoline group
that were shown previously to have excellent DNA binding activities. Since the
current focus of therapeutic targeting is RNA we studied their interaction with
double and single stranded ribonucleic acids, poly(A)·poly(U), poly(I)·poly(C)
and poly(C)·poly(G), poly(G), poly(I), poly(U), and poly(C) using various biophysical techniques. Absorbance and fluorescence studies showed that the alkaloids bound cooperatively to the ds RNAs with binding affinities of the order 104
M-1 while with single stranded RNAs non-cooperative binding was seen with affinity in the order 105 M-1 to poly(G) and poly(I) and in the order 103 M-1 with
poly(C) and poly(U). Circular dichroic results suggested that the conformation of
poly(A)·poly(U) was perturbed by all the three alkaloids, that of poly(I)·poly(C)
by coralyne only and that of poly(C)·poly(G) by none. Similarly with the single
stranded RNAs, the perturbation was more in poly(I) and poly(U) compared to
poly(G) and none with poly(C). Fluorescence quenching studies gave evidence
for partial intercalation of berberine and palmatine and complete intercalation of
coralyne to the RNA duplexes. Partial intercalation was observed with ploy(G)
and poly(I). Isothermal titration calorimetric studies revealed that the binding with
these RNAs was characterized by negative enthalpy and positive entropy changes
and the affinity constants derived were in agreement with the overall binding affinity from spectral data. The binding of all the three alkaloids considerably stabilized
the melting of poly(A)·poly(U) and poly(I)·poly(C) and the binding data evaluated
from the melting data was in agreement with that obtained from other techniques.
The overall binding affinity of the alkaloids to the double and single stranded
RNAs varied in the order, berberine = palmatine < coralyne. The temperature dependence of the enthalpy changes afforded large negative values of heat capacity
changes for the binding of berberine, palmatine, and coralyne to poly(A)·poly(U),
poly(I)·poly(C), poly(G), poly(I), and of palmatine and coralyne to poly(I)·poly(C)
suggesting substantial hydrophobic contribution in the binding process. Further,
enthalpy-entropy compensation to different extents was also seen in almost all the
systems that showed binding. These results further advance our understanding on
the binding of small molecules that are specific binders to RNA sequences.
827
64
Md. Maidul Islam*
Gopinatha Suresh Kumar
Biophysical Chemistry Laboratory
Indian Institute of Chemical Biology
Council of Scientific and Industrial
Research, Kolkata 700 032, India
maidulforjob@gmail.com
*
65
RNA Sequence Design by Reconstruction
from Shape and Guiding Observables
The process of designing novel RNA sequences by inverse RNA folding, as implemented in RNAinverse (1), can be thought of as a reconstruction of RNA sequences
from secondary structure. To link between the inverse RNA folding problem and
physical and evolutionary perspectives (2), taking into consideration possible observables such as thermodynamic stability, mutational robustness, and linguistic
complexity as constraints, an extension of the reconstruction problem was suggested in (3) by which the starting point is an RNA shape. Such an extension is justified,
for example, in cases where a functional stem-loop structure of a natural sequence
should be strictly kept in the designed sequences but a distant motif in the rest of the
structure may contain one more or less nucleotide at the expense of another as long
as the global shape is preserved. This allows the insertion of physical observables as
constraints to the problem, in addition to local sequence and structure rigid ones. In
(3), the problem was solved by a parallel evolutionary algorithm without considering computational cost. In practice, an efficient method should be developed for a
uniprocessor server that solves this problem using an RNAinverse-like approach.
A.A. is partially supported by the Lynn and William Frankel Center for Computer
Sciences at Ben-Gurion University.
Assaf Avihoo1
Nir Dromi2
Danny Barash1,*
Department of Computer Science
1
Ben-Gurion University
Beer-Sheva 84105, Israel
Rosetta Genomics
2
Weizmann Science Park
Rehovot 76706, Israel
dbarash@cs.bgu.ac.il
*
828
1. I. L. Hofacker, W. Fontana, P. F. Stadler, L. S. Bonhoeffer, M. Tacker, P. Schuster. Monatsh
Chem 125, 167-188 (1994).
2. P. G. Higgs. Quarterly Review of Biophysics 33, 199-253 (2000).
3. N. Dromi, A. Avihoo, D. Barash. Journal of Biomolecular Structure and Dynamics 26, 147162 (2008).
66
Yaser Hashem
Pascal Auffinger
IBMC/CNRS – UPR9002
ARN:Architecture et Reactivite des ARN
15 rue Rene Descartes
67084 Strasbourg Cedex, France
y.hashem@ibmc.u-strasbg.fr
p.auffinger@ibmc.u-strasbg.fr
RNA Simulation – Part I: SwS: Solvation Web
Service for Nucleic Acids, a New Tool Dedicated
to the Analysis of Nucleic Acids Solvation
The solvent (ions and water) is implicated in almost all molecular recognition phenomena involving biomolecules and, more specifically, nucleic acids. For instance,
ligands approaching nucleic acid binding sites perceive the first solvation shell
molecules before replacing some of them in order to establish direct contacts with
the solute. Moreover, water molecules establish sometimes important solute/ligand
bridges. Thus, a comprehensive knowledge of the first solvation shell structure is
necessary in order to improve current drug design strategies.
We have developed a web service, called SwS (Solvation web Service for nucleic
acids), which aims at providing a statistical overview of the first solvation shell
structure around nucleic acid molecules based on available RNA and DNA crystallographic structures. The current version of SwS analyses the solvation (water,
cations, and anions) around the 33 DNA and RNA canonical and non-canonical
base pair types linked by two or three hydrogen bonds. Solvent molecules composing their first solvation shell are extracted, “pseudo-electron-density” maps are
calculated. The most probable solvent binding sites are highlighted by using colors
corresponding to their respective peak heights (from red/highest to blue/lowest; see
figure). Data generated by SwS can be exploited at many levels. They can be used:
(i) as reference data for validating molecular dynamics simulations; (ii) for helping crystallographers in the interpretation of solvent electron density maps; (iii) for
drug design investigations involving nucleic acids; (iv) for pedagogic purpose; (v)
but also by all those interested in nucleic acid structural aspects.
1. Auffinger, P. and Hashem, Y. Bioinformatics 23, 1035 (2007);
http://www-ibmc.u-strasbg.fr/arn/sws.html
2. Schneider, B. and Berman, H. M. Biophys J 69, 2661 (1995).
RNA Simulations - Part 2: Molecular Dynamics
Simulations of RNA Fragments at Hydrogen Resolution
Hydrogen atoms (H) represent about 35% of the total number of nucleic acids atoms.
They play an active role in most molecular recognition phenomena, through the formation of intra and inter-molecular H bonds often involving solvent molecules. Unfortunately, experimental methods rarely allow localizing hydrogen atom positions.
Here, we propose to fill such experimental gaps by extracting hydrogen atom positions from nucleic acid molecular dynamics (MD) simulations. By using several MD simulations of a regular RNA duplex containing G=C and G·U pairs, we
mapped first hydration shell hydrogen atom positions around each base pair following SwS protocols (see reference). The most probable hydrogen atom positions
can be deduced from calculated nuclear-density maps analogous to high-resolution
neutron diffraction maps (see figure). For example, such maps reveal most of the
direct solute-solvent and some solvent-solvent H bonds. They show also an unexpected level of H-bond dynamics for the highly conserved shallow groove water
molecule that links the two bases of a G·U pair. Hence, calculated nuclear-density
maps allow reconstructing H-bond networks around nucleic acid fragments involved or not in the binding of other RNA or DNA fragments, proteins or small
ligands. The precise knowledge of these H bond networks can lead to improved
“rational” drug design strategies in which ligand functional groups can be more
efficiently fitted into solvent atom density maps.
829
Yaser Hashem
Pascal Auffinger
67
ARN : Architecture et
Reactivite des ARN
1. Auffinger, P. and Hashem, Y. Bioinformatics 23, 1035 (2007);
http://www-ibmc.u-strasbg.fr/arn/sws.html
RNA Simulations - Part 3: Mapping Solvent
Binding Sites of the Aminoglycoside
Bacterial rRNA A-site Target
Aminoglycosides antibiotics provoke lethal translation errors by specifically
binding to the bacterial ribosomal A-site. Yet, due to serious side effects, they are
often considered to be the last resort treatment in case of severe bacterial infections. Hence, in order to improve the efficiency of these drugs, we still need to
better understand their binding features that are largely but not solely governed
by electrostatic complementarity.
Here, we use explicit solvent molecular dynamics (MD) simulations to map ions
(NH4+, K+) and water binding sites of a free bacterial A-site and their aminoglycoside complexes. Solvent binding maps are presented as neutron-diffraction-like
densities revealing, besides heavy atom positions, the most favorable locations of
NH4+ and H2O hydrogen atoms (see figure). It was found that the main NH4+ cation
binding site matches the key –NH3+ anchor point of the conserved neamine cycle
68
Yaser Hashem
Pascal Auffinger
ARN : Architecture et
Reactivite des ARN
830
II. Moreover, this site appears specific to NH4+ over K+ cations that, even though
they carry a similar charge, differ in their ability to form H-bond networks. Besides
cation recognition sites, water binding sites overlap as well with some aminoglycoside direct contacts. Hence, we showed that explicit solvent MD simulations are
able to efficiently locate major drug binding sites. As an outcome, the characterization of solvent binding sites (including hydrogen atom positions) and associated
H-bond networks should be included in “rational” drug design strategies involving
aminoglycosides and related drugs.
References and Footntoes
1. Auffinger, P., Bielecki, L., and Westhof, E. J Mol Biol 335, 555 (2004).
69
Ivana Besseova1,2
Kamila Reblova1
Neocles B. Leontis3,*
Jiri Sponer1,*
1
Acad. of Sciences
Brno, Czech Republic
Gilead Sciences&IOCB Res. Ctr
2
Acad. of Sciences
166 10, Prague 6, Czech Republic.
Dept of Chemistry
3
Bowling Green State Univ.
Bowling Green, OH, USA
sponer@ncbr.chemi.muni.cz
*
Figure 1: Overlay of 5S 3WJ structures with maximal
and minimal amplitudes of the (A) breathing- like motion and (B, C) hinge- like motion.
RNA Three-Way Junctions Can Act as Flexible RNA
Structural Elements in Large RNA Molecules:
A Molecular Simulation Analysis
Ribosome is a large stochastic biomolecular machine that resembles a brick-box
composed of molecular building blocks – RNA motifs having different shapes,
flexibilities, and capabilities to interact with ribosomal surrounding elements. For
example K-turns can act as flexible elbows (1), other segments can act as isotropic
elastic rods with sequence-dependent flexibility (2). and many others can be rather
stiff with reduced thermal fluctuations (3). Molecular dynamics (MD) simulation is
a suitable method to reveal intrinsic flexibilities of individual RNA segments.
This research is focused on dynamics of one of the important ribosomal building block – RNA three-way junction (3WJ) family C (4). These structures are
composed of three helices P1, P2, and P3 diverging from one point, while P1 and
P2 helices are coaxially stacked (4). There are also tertiary interactions between
stems P1 and P3, which are characteristic especially for the family C (4). We have
analyzed three ribosomal junctions – Peptidyl Transferase Center 3WJ (helices 9092), GTP-ase associated center 3WJ (helices 40-42), and 3WJ from the 5S rRNA.
Crystallographic structures from archea Haloarcula Marismortui and bacteria Escherichia coli ribosomes were used.
831
Extensive MD simulations of total length more than 0.6 μs showed two dominant
structural motions that are very similar for all three 3WJs. The first one consists
of anisotropic hinge-like fluctuations between the coaxially stacked stems P1/P3
(forming the compact upper part of the structure) and P2 (Figure 1 B-C). The second one is internal dynamics of stems P1 and P3 called breathing-like motion (Figure 1 A). All three studied junctions are associated with extended regions of negative electrostatic potentials, which are in many cases major binders of monovalent
cations with 100% occupancy and very slow exchange of ions.
To sum up, 3WJs belong to RNA building blocks with specific elasticity signatures
that can be relevant to function.
1. F. Razga, J. Koca, A. Mokdad, and J. Sponer. Nucleic Acids Research 35, 4007-4017 (2007).
2. K. Reblova, F. Lankas, F. Razga, M. V. Krasovska, J. Koca, and J. Sponer. Biopolymers 82,
504-520 (2006).
3. N. Spackova and J. Sponer. Nucleic Acids Research 34, 697-708 (2006).
4. A. Lescoute and E. Westhof. RNA-a Publication of the RNA Society 12, 83-93 (2006).
70
RNAstructure: Software for RNA
Secondary Structure Prediction and Analysis
RNAstructure is a software package for RNA secondary structure prediction and
analysis. It predicts lowest free energy structures and low free energy structures
either by using a heuristic or by determining all possible low free energy structures. These calculations can be performed for unimolecular secondary structures
or for bimolecular secondary structures. Stochastic sampling of secondary structures from the Boltzmann ensemble is also implemented. Base pair probabilities
are predicted using a partition function. For these structure prediction methods,
facilities are included for utilizing mapping data from wet lab experiments, including enzymatic cleavage, chemical modification, and SHAPE. For a given RNA
target, regions accessible to hybridization can be predicted. This is important for
antisense deoxynucleotide or siRNA design. Secondary structures common to two
sequences can be predicted using the Dynalign algorithm. Finally, a tool for removing pseudoknots is included. The latest nearest neighbor parameters for RNA,
DNA, and RNA-DNA hybrids are utilized.
RNAstructure has been distributed with a graphical user interface (GUI) for Microsoft Windows and is known to function with the Linux Windows Emulator
(WINE). Here we report significant expansions to the package to address portability. A new JAVA GUI has been designed and implemented. Executables are now
provided for using this GUI in Windows, Linux, or Macintosh OS X. This GUI
is linked to the C++ backend code using SWIG. Furthermore, text interfaces are
provided to each component and these are available with standard Unix Makefiles,
allowing local compilation and use of the tools. The tools are tested and known
to run with the Linux GNU compiler, Linux Intel C compiler, Cygwin GNU compiler, Intel C compiler for Windows, and Macintosh OS X GNU compiler. Finally,
a new object-oriented library of tools is made available. This compiles as a shared
library that can be linked into C++ programs.
Jessica Reuter*
David H. Mathews
Dept. of Biochemistry & Biophysics
601 Elmwood Avenue, Box 712
Rochester, NY 14642
Jessica_Reuter@URMC.Rochester.edu
*
832
71
Mauricio Esguerra
Wilma K. Olson
Dept. of Chemistry & Chemical Biology
BioMaPS Institute for
Quantitative Biology
Rutgers, the State University of New
Jersey, Piscataway, NJ 08854
esguerra@eden.rutgers.edu
wilma.olson@rutgers.edu
The new interfaces added to the RNAstructure package allow it to be used by a
wider audience. It also will improve its utility by making the functions available
to developers.
Sequence-dependent Deformability of RNA
Helical Regions. What We Have Learned So Far
A decade ago it was still not conceivable that knowledge-based potentials could
be obtained for RNA helical regions due to the small amount of crystallographic
data available. With the turn of the century and the successful elucidation of the
structure of the large ribosomal subunit at 2.4 Å resolution (1), the number of
high-resolution X-ray crystal structures of RNA has increased by two orders of
magnitude, providing enough information to develop a dimeric model of doublehelical RNA with the 21 unique base-pair steps formed by the canonical G·C
and A·U Watson-Crick pairs and the wobble G·U base pair. Using information
derived from a 3.5 Å parsed subset of the BPS (Base Pair Structure) database (2)
and so-called “inverse harmonic analysis” (3), we have derived the elastic force
constants for the 21 unique base-pair steps, and are using this simple scoring potential model to simulate the fluctuations of RNA helical structures.
1. Ban, N., Nissen, P., Hansen, J., Moore, P. B., Steitz, T. A. Science 289, 905-920 (2000).
2. The BPS database can be found at :http://bps..rutgers.edu
3. Olson, W. K., Gorin, A. A., Lu, X. J., Hock, L. M., Zhurkin, V. B. Proc Natl Acad Sci 95,
11163-11168 (1998).
72
Dmitry N. Kaluzhny
Artemy D. Beniaminov
Elvira E. Minyat*
Engelhardt Inst. of Molecular Biology
Moscow 119991, Russia
eminyat@gmail.com
Thermal Behavior of Retrovirus RNA Dimers
and Its Stabilization by Paromomycin Using
Fluorescence Melting
Retroviral RNA undergoes a series of structural rearrangements, comprising dimerization of two strands RNA in the course of packaging in a virus particle. The
dimerization includes the formation of kissing loop (KD) and extended (ED) RNA
dimers. The fluorescence-based melting is used in this study to determine thermodynamic characteristics of the RNA dimers. For this purpose 2-aminopurine
(2-AP) was incorporated in the loop of short fragment HIV-1 RNA and the loop
hairpin of avian leukosis virus RNA (ALV).
The fluorescence melting of the loop-loop region reveals dramatic difference between the two types of dimer structures, KD and ED, for both HIV-1 and ALV
RNAs. The temperature curve for the KD RNA is biphasic while ED RNA dimer
is characterized by single temperature transition. We suggest that the first transition in the melting curves of KD RNA (temperature range 20 ºC to 55 ºC for HIV-1
RNA and 30 ºC to 55 ºC for ALV RNA) corresponds to disruption of the loop-loop
interaction. The refolding to the extended RNA dimers occurs at 55 ºC to 65 ºC.
Further melting of the newly formed extended dimers (HIV-1 and ALV) is observed in the temperature range from 65 ºC to 75 ºC.
It is known that the structure of the kissing loop RNA dimer is stabilized by aminoglycoside antibiotic paromomycin. Using the fluorescence melting, we also investigated the effect of the aminoglycoside antibiotic paromomycin on the stability of the
kissing loop RNA dimer. The melting temperature of the kissing loop dimer HIV-1
RNA is increased by approximately 6 ºC upon interaction with paromomycin. The
influence of paromomycin on stability of the kissing loop dimer of ALV RNA by was
not significant. Our study also showed that 2-aminopurine fluorescence can be useful
in testing novel ligands, which influence the dimerization of retroviral RNA.
Bidirectional Expression of Trinucleotide Repeats:
Studies of the DM1 and FMR1 loci Suggest that
Trinucleotide Repeats are Associated with an RNAmediated Heterochromatin Modification
and Insulator Function
Instability of trinucleotide repeats is associated with numerous human diseases, yet
we have little understanding of the normal role of the repeats in chromatin organization and the alteration of this organization following repeat expansion. Studies
of the DM1 locus demonstrated that the CTG repeat is flanked by binding sites for
the insulator factor CTCF and that the bidirectional transcripts through the repeat
are converted to small RNA fragments and are associated with the local repressive
H3K9 methylation and HP1 recruitment that is imbedded within a region of euchromatin-associated H3K4 methylation. Current model for heterochromatin formation
at repetitive elements involves the processing of bidirectional RNA transcripts into
small RNAs, which then recruit repressive chromatin marks and DNA methylation
to the region. Indeed, while at the wild type DM1 locus this RNA-mediated local
heterochromatin modification is restricted by CTCF insulators, the expansion of the
repeats in congenital DM is accompanied by the loss of chromatin insulation function in the region, spreading of heterochromatin and DNA methylation.
Recent studies indicate that several other trinucleotide repeats in the genome, including the CGG repeat at the FMR1 locus, are bidirectionally transcribed and
flanked by CTCF binding sites. These findings suggest a conserved mechanism of
RNA-mediated chromatin silencing at these repeats where bidirectional transcripts
across the repeats may play a role of a primary trigger for a stable repeat-associated
repressive chromatin modification that is normally restricted by flanking chromatin
insulators, and may lead to heterochromatin spreading upon repeat expansion and
loss of chromatin insulator function in the region.
In this context it is also important to emphasize that bidirectional expression of
the expanded repeats, in addition to accumulation of mutant sense transcripts,
may result in accumulation of mutant antisense transcripts and in some cases mutant proteins as demonstrated by recent studies of the FMR1 locus. This in turn
opens the possibility that relative contribution of the bidirectional expression of
the expanded repeats may account for variable phenotypes associated with several
repeat-associated genetic disorders.
833
Paula Ladd
Diane Cho
Stephen Tapscott
Galina Filippova*
73
Fred Hutchinson Cancer Research Center
1100 Fairview Ave N, C2-023
Seattle, WA 98109
gfilippo@fhcrc.org
*
834
74
Agnieszka Mykowska
Mateusz deMezer
Agnieszka Fiszer
Marta Olejniczak
Krzysztof Sobczak
Piotr Kozlowski
Maciej Figiel
Pawel Switonski
Wlodzimierz J. Krzyzosiak*
Institute of Bioorganic Chemistry
Polish Academy of Sciences
Noskowskiego 12/14, 61-704 Poznan,
Poland
wlodkrzy@ibch.poznan.pl
*
75
Guliang Wang
Karen M. Vasquez*
Department of Carcinogenesis
University of Texas MD Anderson
Cancer Center
Science Park-Research Division
SmithvilleTexas, USA, 78957
kvasquez@mdanderson.org
*
CAG Repeat Hairpins as Potential Triggers of
RNA-mediated Pathogenesis and Therapeutic
Targets in Polyglutamine Diseases
The tandem repeats of various trinucleotide motifs are abundant in human genes
and many of the repeats are retained in mature transcripts. The repeats are present
in the translated and untranslated regions of mRNAs, some of them are polymorphic in length and may play regulatory roles in gene expression. The CAG repeats,
which are the focus of our present research, belong to the most frequent triplet repeats and nearly 200 mRNAs contain their tracts composed of at least six repeated
units. These repeats are often translated to polyglutamine tracts in proteins and their
expansion beyond the normal range in some genes result in incurable neurodegenerative disorders known as “polyglutamine diseases”. Examples of such disorders
are Huntington’s disease (HD) and a number of spinocerebellar ataxias (SCA).
Considerable information has been gathered regarding the length polymorphism
and structures formed by the CAG repeat tracts in human transcripts. The CAG
repeat as compared to other CNG repeats forms the least stable hairpins due to
the A-A mismatches separating every two G-C and C-G base pairs in the CAG repeat hairpin stem. These hairpins are further destabilized by the repeat interruptions
present in many normal alleles of the SCA1, SCA2, and SCA17 related transcripts.
Other CAG repeat containing transcripts such as FOXP2 also contain repeat interruptions. The formation of split hairpins in these mRNAs which are translated to
proteins having long polyglutamine tracts (>40Q) but not giving rise to any diseases
may be considered a good argument for the contribution of CAG repeat hairpin
toxicity in polyglutamine diseases. We provide experimental data showing that the
impaired alternative splicing of some transcripts may be involved in such toxicity.
We also studied the process of RNA interference between the CAG repeats present in the endogenous transcripts of polyglutamine disease genes and exogenous
reagents containing complementary CUG repeats. These reagents were either double-stranded or single-stranded siRNAs or vector-based shRNAs releasing reagents
composed of repeats. We analyzed the silencing effects from various perspectives:
that of silencing reagents and their targets as well as from the perspectives of the silencing reactions and their products. We intended to learn more about the efficiency
and specificity of these processes and investigate the possible interplay between
RNA interference and antisense mechanisms. We also wanted to explore the potential of the repeat targeting strategies for the therapy of polyglutamine diseases. The
results of these studies will be presented and discussed.
DNA Structure-induced Genetic Instability
Naturally occurring DNA repeat sequences can form non-canonical DNA structures
such as H-DNA and Z-DNA, which are abundant in mammalian genomes. Here
we show that both H-DNA and Z-DNA structures are intrinsically mutagenic in
mammalian cells. We found that the endogenous H-DNA-forming sequence in the
human c-MYC promoter induced mutation frequencies ~20-fold over background,
largely in the form of double-strand breaks (DSBs). In mammalian cells, Z-DNAforming CG(14) repeats also lead to DSBs, resulting in deletions. We found that
the non-B DNA-induced deletions were, in part, replication-independent, and were
likely initiated by “repair processing” cleavages surrounding the non-B-DNA structures (Wang & Vasquez, PNAS, 2004; Wang et al., PNAS, 2006). We are performing
studies to determine the role of repair enzymes in H-DNA and Z-DNA-induced
genetic instability in mammalian cells. Our findings suggest that both H-DNA and
Z-DNA, which have been reported to correlate with chromosomal breakpoints in
human tumors, are sources of genetic instability, and demonstrate that naturally oc-
curring DNA sequences are mutagenic in mammalian cells and may contribute to
evolution and disease. We have constructed novel transgenic mutation-reporter mice
containing the H-DNA sequence from the human c-MYC promoter, or a Z-DNAforming sequence from the human BCL-2 gene, both of which map to chromosomal
breakpoints in human cancers (Wang et al., JNCI, 2008). We have detected genetic
instability induced by these DNA structures in ~20% of the offspring, suggesting
that these structures are mutagenic in a chromosomal context in a living organism.
835
Genome-wide Screen to Identify Genes Involved in
Inverted Repeat and GAA/TTC-mediated Fragility
Previously, we have found that inverted Alu repeats and long GAA/TTC tracts trigger gross chromosomal rearrangements (GCRs) in yeast, Saccharomyces cerevisiae. Chromosomal aberrations result from double strand break (DSB) formation at
the site of unstable sequences. However, mode of breakage and consequences for
the genome integrity are different for these two types of repeats.
We have developed experimental system that allows to carry out systematic analysis of the complete set of deletion mutations and 800 essential genes for which
expression is regulated by doxycycline or compromised due to mRNA perturbation,
to get better insights into the mechanism of palindrome and/or GAA/TTC-mediated breakage. This experimental approach is based on the method developed by C.
Boone’s laboratory with further modification by K. Myung’s laboratory. The query
strains contain modified chromosome V that carries LYS2 cassette with 100% and
94% homologous Alu-IRs or 230 copies of GAA/TTC repeats inserted centromereproximal to CAN1 gene. The hygromycin resistance cassette (hphMX) was placed
centromere proximal to LYS2. The cassette allows for the selection of diploids as
well haploids that have both the GCR construct and tester ORF marked with G418resistant cassette (kanMX) from the yeast collection. In addition, query strains carry
a reporter mfa1::MFA1pr-HIS3 and the recessive cyh2-1 mutation. Following sporulation, the reporters allow for the growth of only Mata cells that have the GCR
construct on media lacking histidine and containing cyclohexamide. GCR level was
tested by plating isolates on media containing canavanine. In the preliminary screen
we have identified 3 groups of mutants exhibiting increased level of GCRs: (i) affecting only IR-mediated fragility; (ii) affecting only GAA/TTC –mediated breakage and (iii) affecting fragility induced by both sequence motifs.
Interaction of Triplex Forming Oligonucleotides
(TFOs) and Various Anti-cancer Drugs with a
Promoter Regions of c-met and c-myc
Triplex forming oligonucleotides (TFO) targeted at cancer-promoting genes to
achieve transcriptional gene silencing is one of the promising strategies in cancer therapy. A major advantage of TFOs resides in the possibility of a persistent
down-regulation of transcription preventing the re-synthesis of RNA and protein.
Besides the antigene approach, minor/major groove binding ligands, intercalating
agents as competitors for DNA-binding proteins, also selectively cause inhibition
at the promoter level. In general, proto-oncogenes share a common feature of having a promoter with high GC content which lacks TATA and CAAT boxes. This
property of them is being e utilized by DNA binding antitumor drugs as well as
TFOs. Various antitumor drugs have been shown to bind preferentially to GC rich
sequences of DNA and inhibit their transcription.
Keeping this in mind, we have selected two very important members of cancer
Yu Zhang*
Vidhya Narayanan
Kirill S. Lobachev
76
School of Biology and Institute for
Bioengineering and Biosciences
Atlanta, Georgia, 30332
yzhang301@gatech.edu
*
77
Moganty R. Rajeswari*
Garima Singhal
Akanchha
Department of Biochemistry,
All India Institute of Medical Sciences,
New Delhi-110029, India
*
mrraji@hotmail.com
836
progression, c-myc and c-met, which are implicated in various physiological processes-cell growth, proliferation, loss of differentiation, and apoptosis and overexpression has been implicated in the pathogenesis of most types of human cancer.
Met is a growth factor receptor with tyrosine kinase activity which gained a lot of
attention very recently because of its role in cell signaling.
We have selected two short GC rich DNA sequences from c-met and c-myc. The
sequences were selected on the basis of their importance in the transcription process. Designing of TFOs were done against these sequences. Detailed sequence
analysis of c-met promoter revealed that the major positive regulatory region is
located at -233 to -68 within the promoter. We have selected a short guanine rich
sequence (5ʹ-GGGGCAGAGGCGGGAGGAAACGCG-3ʹ) which is a part of this
strong positive regulatory region at locations -142 to -119. A 15mer TFO was designed against this sequence (5ʹ-AGGAGGGGGAGAGG-3ʹ). Similarly a short
defined 21bp long oligonucleotide (5ʹ-TAAAGGGCCGGTGGGCGGAGA-3ʹ)
upstream to P1 and 178-bp upstream to P2 of c-Myc was selected. The TFO selected against this sequence is 5ʹ-AGGAGGGGGGAGAGG-3ʹ).
Interaction of DNA was also studied using the conventional anti-cancer drugs, Cisplatin, a DNA cross linking agent and Adriamycin and Actinomycin D, which are
groove cum intercalators. The interaction of drugs/TFO with dDNAs has been undertaken in this study by using UV-Vis absorption, UV melting, fluorescence, circular dichroism spectroscopy and molecular modeling. The biophysical results are
further corroborated with the cell cytotoxic data in HepG2 and HeLa cell lines.
78
Amalia Avila-Figueroa
Daniel Jarem
Nicole Wilson
Sarah Delaney*
Brown University
324 Brook St., Box H
Providence, RI 02912
sarah_delaney@brown.edu
*
Role of Oxidative DNA Damage and
Repair in Triplet Repeat Expansion
Triplet repeat sequences, such as CAG/CTG, expand in the human genome to
cause several neurological disorders. The overall objective of our research is to
define the molecular mechanism of CAG/CTG triplet repeat expansion. Previous
work from other laboratories, using mouse models of triplet repeat diseases, have
implicated DNA repair enzymes in the repeat expansion. We have found that the
repetitive sequences adopt kinetically-trapped non-B conformations and, furthermore, that these non-B conformations are hyper-susceptible to oxidative damage
relative to DNA duplex. Interestingly, despite the presence of hot spots for damage within the non-B conformations we find that base excision repair enzymes are
catalytically inactive on these DNA substrates. The implications of these results on
triplet repeat expansion will be discussed.
Small Molecules that Enhance GAA/TTC Fragility
Expansion of triplex-forming GAA/TTC repeats in the first intron of FXN gene
results in Friedreich’s ataxia. Besides FXN, there are a number of other polymorphic GAA/TTC loci in the human genome where the size variations thus far have
been considered to be a neutral event. Using yeast as a model system, we have
previously demonstrated that expanded GAA/TTC repeats represent a threat to
eukaryotic genome integrity by triggering double-strand breaks and gross chromosomal rearrangements. The fragility potential strongly depends on the length
of the tract and orientation of the repeats relative to the replication origin, which
correlates with their propensity to adopt secondary structure and to block replication progression. The fragility is mediated by mismatch repair machinery and
requires the MutSβ and endonuclease activity of MutLα.
In this study, we investigate the effect of the triplex-specific small molecules on
GAA-mediated fragility using the chromosomal arm loss assay. It has been shown
previously that synthetic coralyne and azacyanine ligands promote and stabilize
triplex DNA secondary structures and have low binding affinity to duplex DNA in
vitro. We have found that in vivo, azacyanines 3, 4, and 5 but not coralyne stimulate
(TTC)230 and (GAA)230-mediated arm loss in a dose dependent manner. Azacyanines at concentrations that induced fragility also inhibit cell growth. Over 60% of
the yeast cells are arrested at G2/M stage of cell cycle indicative of DNA-damage
activated checkpoint response. Moreover, mutants defective in DSB repair show
hyper sensitivity to the azacyanines. These data indicate that azacyanines stabilize
triplex DNA in vivo and this might trigger multiple DSBs during the S-phase, which
are sensed by the checkpoint surveillance system. We propose that these small molecules can be the basis for the development of novel antitumor drugs that act via
the inhibition of the cellular proliferation. We also propose that azacyanines can be
used to highlight triplex-containing regions in the human cells.
837
K. S. Lobachev1,*
H-M. Kim1
V. Narayanan1
O. Persil2
N. V. Hud2
School of Biology and Institute for
1
Bioengineering and Bioscience
School of Chemistry and Biochemistry
2
and Institute for Bioengineering and
Bioscience
kirill.lobachev@biology.gatech.edu
*
80
Triplex-Forming Oligonucleotides (TFO-s) as
Probes for Promoter Region of Cancer
Relevant Human mdr1 Gene
The over-expression of human mdr1 (multidrug resistant) gene leads to intensive
efflux of cytotoxic anticancer drugs out of malignant cells and aggressive tumor
behavior. Rational mdr1 gene targeting by TFO-s within the promoter region represents a perspective way to evaluate and regulate mdr1 gene expression. Gene
targeting is based on the highly sequence-specific recognition of oligopurine-oligopyrimidine DNA-duplex tract by synthetic oligopyrimidine third strand.
Anna Gabrielian
Two target tracts (15 and 17 base pairs) for in vitro binding assay have been chosen from Genbank database and synthesized. Both sequences were located within
the promoter region of human mdr1 gene. TFO-s were synthesized as third-strand
probes with a psoralen moiety at the 5ʹ-terminus and 5mC residues in place of cytosines. The degree of local triplex formation by each TFO-probe with corresponding target duplex was assessed based upon band shift and intensity data in nondenaturing PAGE. The probes’ binding ability was analyzed to determine apparent
dissociation constant (Kd) values. High affinity TFO binding makes the designed
probes highly suitable for ex/in vivo applications.
Armenia
1. The developed TFO-probes could be exploited for cytogenetic quantitative
detection of valuable TISH-technology (third strand in situ hybridization).
This is very sensitive ex vivo procedure for timely clinical diagnosis of
MDR-phenomenon.
2. The same oligopurine-oligopyrimidine stretches in gene promoter region
79
Inst. of Fine Organic Chemistry of
Armenian National Academy of Sciences
26 Azatutian Avenue, Yerevan, 0014
anna.gabrielian@yahoo.com
838
serve as target sites also for transcription factors. TFO’s competitive binding
leads to blocking of transcription initiation. Thus the over-expression of human mdr1 gene can be artificially down-regulated by TFO-s at the transcriptional level in vivo (“antigene” therapy).
Acknowledgements
This work was performed at the Department of Molecular Biology (Prof. J.R. Fresco) of Princeton University, New Jersey, USA. Supported by NIH grant CA88547.
81
Alexander A. Shishkin1,*
Irina Voineagu2
Robert Matera1
Nicole Cherng1
Brook T. Chernet1
Maria M. Krasilnikova3
Vidhya Narayanan4
Kirill S. Lobachev4
Sergei M. Mirkin1
1
Tufts University
Medford, MA 02155
UCLA Neurogenetics Program
2
Los Angeles, CA 90095-1761
Dept. of Biochemistry and
3
Molecular Biology
Penn State University
University Park, PA 16802
School of Biology and
4
Institute for Bioengineering and Bioscience
Alexander.Shishkin@tufts.edu
*
Yeast System to Study Expansions of DNA Repeats
Expansions of tandem DNA repeats, which are responsible for numerous hereditary disorders in humans, are often large-scale events wherein multiple repeat units
are acquired in a single step. Our studies were concentrated on the mechanisms
and consequences of expansions of (GAA)n repeats, which are responsible for the
disease, Friedreich’s ataxia. We have developed a unique experimental system to
analyze large-scale repeat expansions in yeast, which allowed us to monitor expansions of the premutation range (78-to-150 copies) of (GAA)n repeats well into
the disease range (200-to-450 copies). Figure 1A shows our system, based on the
URA3 reporter split by an actin intron carrying various number of (GAA)n repeats.
These cassettes were integrated into chromosome III in two orientations relative to
the ARS306 replication origin. Large-scale expansions of GAA repeats led to the
reporter’s inactivation allowing expanded clones to grow in the presence of 5-FOA
(Fig. 1B). Remarkably, the rates of expansion events per replication in our system
increased exponentially with the repeat’s length (Fig. 1C), which is quite similar
to what was observed in human pedigrees suggesting that mechanisms of repeat
expansions are similar for all eukaryotes.
The analysis of the lengths of expansions in the case of (GAA)150 revealed the
selection cutoff of the experimental system to be 170-180 repeats (Fig. 1D). For
150 copies of the GAA repeat, we detected a normal length distribution of the expanded repeats with a mean length of 220 copies, which is significantly longer than
the selection threshold (Fig. 1D). You can see from Figure 1D, that expansions are
large-scale in their nature. These observations gave us the existence of a preferential expansion increment corresponding to approximately 1.5-times of the repeat’s
length. The existence of this bias in the expansion size explains the dramatic (three
orders of magnitude) difference in the expansion rates between the shortest and
longest GAA repeats presented in Figure 1C, as more than one expansion step
would be necessary to reach the selection cutoff for the shorter repeats. To gain
a better insight into the mechanisms of GAA repeat instability, we conducted a
preliminary screen for mutants in various aspects of DNA metabolism, such as
DNA replication, repair and recombination, which could affect the expansion rates
in our system. The rate of expansions was elevated four- to six-fold in the Tof1
or Csm3 knockouts and decreased three- to four-fold in the Sgs1, Rad5, or Rad6
knockouts. Knockouts of the Rad50, Rad51, Rad52, Srs2, Rrm3, Pif1, Rad26,
Msh2, Mus81 genes had little, if any, effect on the expansion rate. Since all the
proteins that had a significant effect on expansion rate play a role in the replication
fork stabilization, stalling, and restart, we believe that expansion happens either in
front or immediately behind the replication fork. Based on these data, we propose
a new model for large-scale repeat expansions based on the template switching
during the replication fork progression through repetitive DNA.
Also, this system allows us to monitor large-scale contractions of the expanded
repeats, since those contractions should restore the functionality of the URA3 cassette, making cells URA+. The rates of such contractions are roughly 10-4 per replication, corresponding to a mutation frequency of 0.1%.
839
Figure 1: A. Scheme of genetic cassette located on
chromosome III. The ACT1 intron, carrying the GAA/
TTC repetitive tract, was inserted into the StuI site of
the URA3 gene. B. Large-scale expansions of (GAA)n
repeats. C. Dependence of rates of expansion on repeat
length in log-scale. D. Distribution of expansion lengths
for GAA150 repeats.
Analysis of Hydrogen Bonds Involving
Backbone Atoms in Ribosomal RNA
High-resolution crystal structures of ribosomal particles solved in the past decade
provide a wealth of information for understanding principles of organization of
complex RNA structures. Indeed, the availability of such information has spurred
in-depth analyses of base-centered RNA structural motifs and backbone conformations, see, e.g., (1-4). Less appreciated remain hydrogen bonds involving backbone acceptor atoms of RNA; nevertheless, such hydrogen bonds are common in
tertiary interactions. We have analyzed hydrogen bonds in rRNA from the 2.20 Å
resolution structure of the large ribosomal subunit of Haloarcula marismortui (5).
In 2426 pairs of RNA residues connected with at least one hydrogen bond, there
are 509 hydrogen bonds involving phosphorus oxygens OP1/OP2, and 120 and 28
hydrogen bonds involving phosphodiester oxygens O3’ and O5’, respectively. The
most common donor atoms for such hydrogen bonds are the hydroxyl proton of
riboses and amino and imino protons of guanines, although the amino protons of
adenines and cytosines and imino protons of uracils are also observed. Geometric
parameters of such hydrogen bonds will be presented.
1.
2.
3.
4.
S. R. Holbrook. Annu Rev Biophys 37, 445-464 (2008).
Y. Xin, C. Laing, N. B. Leontis, T. Schlick. RNA 14, 2465-2477 (2008).
W. K. Olson, M. Esguerra, Y. Xin, X-J. Lu. Methods 47, 177-186 (2009).
J. S. Richardson, B. Schneider, L. W. Murray, G. J. Kapral, R. M. Immormino, L. D. Williams,
K. S. Keating, A. M. Pyle, D. Micaliff, J. Westbrook, H. M. Berman. RNA 14, 465-81 (2008).
5. T. M. Schmeing, K. S. Huang, D. E. Kitchen, S. A. Strobel, T. A. Steitz. Mol Cell 20, 437448 (2005).
Nikolai B. Ulyanov*
Thomas L. James
University of California
82
San Francisco, CA 94158-2517 USA
ulyanov@picasso.ucsf.edu
*
840
83
Chia-Ho Cheng1,*
Kenneth A. Marx1
John Sharko2
Georges G. Grinstein2
Shannon Odelberg3
Hans-Georg Simon4
Dept. of Chemistry
1
Computer Science
2
University of MA Lowell
Lowell, MA 01854
Dept of Internal Medicine
3
Univ. of Utah School of Medicine
Salt Lake City, UT 84132
Children's Memorial Research Ctr
4
Feinberg School of Medicine
Northwestern University
Chicago, IL 60614
ChiaHo_Cheng@student.uml.edu
*
84
Takashi Gojobori
Center for Information Biology and
DDBJ (DNA Data Bank of Japan)
National Institute of Genetics
1,111 Yata, Mishima 411-8540, Japan
tgojobor@genes.nig.ac.jp
Evidence for Proximal to Distal Appendage
Amputation Site Effects from Global Gene
Expression Correlations Found in Newt Microarrays
Limb regeneration is a well studied field in developmental biology and amphibians
such as the newt provide classic model systems for investigators. However, there is
a major gap in our understanding of the signal control networks and critical control
proteins responsible for orchestrating tissue regeneration in the growing limb following amputation. In this study, we have measured newt (N. viridescens) gene expression levels for ~1200 selected genes important in tissue regeneration at various
times post-amputation (days 1,3,6,12 and 21) at 6 different limb amputation sites
[proximal (upper) and distal (lower) positions of forelimb, hindlimb, and tail]. Custom designed Agilent chips were used containing 23 replicates per gene allowing
for high statistical significance in the individual measured gene expression levels.
Here we provide analyses of the microarray data that demonstrate a global gene
expression correlation decrease on going from proximal to distal amputation sites
of either limb or tail appendages. Also, the proximal (upper) forelimb and hindlimb
regenerates have by far the most highly pairwise correlated gene expression levels
of all sites. In contrast, the distal (lower) forelimb and hindlimb and tail regenerates
reveal the least pairwise correlated gene expression levels. In the case of many individual genes (e.g., MMP3), similar amputation site position correlation results are
exhibited to that of the global gene view. These data support the idea that limb loss at
a proximal site produces a far more robust response as compared to a more distal site
and requires a greater level of gene regulation to properly rebuild the lost structure.
Project support is acknowledged from DARPA.
1. K. A. Marx, J. Sharko, G. G. Grinstein, S. Odelberg, and H. G. Simon. IEEE Proceedings
7th BIBE, 456-463 (2007).
2. J. Sharko, G. G. Grinstein K. A. Marx, J. Zhou, C. H. Cheng, S. Odelberg, and H. G. Simon. 11th
Int’l Conf. Information Visualization, IEEE Computer Society, Wash, D.C. 521-526 (2007).
Evolution of the Central Nervous System:
Comparative Gene Expressionics Approach
With the aim of the elucidating the evolutionary origin and process of the Central
Nervous System (CNS) and the brain, we take both approaches of comparative
genomics and gene expressionics.
In practice, we first obtained about 400 protein-coding genes whose level of the
mRNA expression is more than 50% in a human brain or CNS compared with
those in other tissues or organs in the H-ANGEL (Human-Anatomical Gene Expression Library) section of the H-Invitational integrated database of human genes.
We now call those genes operationally as “human nervous system-specific genes
(human NS-specific genes).” We compared these human NS-specific genes with
the protein-coding genes that were contained in each of the complete genomes of
the species examined, in order to estimate when each of the human NS-specific
genes emerged during evolution. As a result, we found that about one thirds of the
human NS-specific genes evolutionarily emerged just before the outbreak of bony
fish. It follows that there was a kind of explosive emergence of NS-specific genes
just before evolutionary appearance of bony fish, leading to initial formation of a
complex and integrated brain and CNS.
Moreover, we examined the genes expressed in a planarian head by use of the EST
analysis of about 25,000 gene clones and the so-called “gene expression chip”,
because the planarian is known as having the most primitive brain. As a result, we
obtained about 120 genes that were specifically expressed in a planarian head. We,
then, found that a majority of those genes had shared strong sequence homologies
with human genes, suggesting that the genes potentially forming the human brain
have already existed as the ancestral genes.
841
We also identified about 250 genes specifically expressed in the neural cells and
motion-controlling cells (nematocytes) of hydra by making a chip of about 6,500
hydra genes, because hydra does not have any central nervous system and have only
a dispersed neural system. We found that a half of those 250 genes in hydra shared
the known functions with higher organisms including human.
Thus, I would discuss the evolutionary origin and process of the brain and central
nervous system, taking into account those genes that are expressed specifically
in the neural systems of those primitive organisms. In particular, I would make
emphasis on usefulness of the comparative gene expressionics approach of hydra
and planarian for understanding the evolutionary process of CNS and the brain of
vertebrates including human.
85
Evolution of the Translational GTPase Superfamily
The ancient translational GTPase (trGTPase) superfamily includes a number of essential proteins, some of which originated before the last common ancestor of all
life (LUCA). These GTP hydrolyzing enzymes function in a variety of cellular processes including core roles in the four stages of protein synthesis: initiation, elongation, termination, and ribosome recycling. Bioinformatic analyses of trGTPases
have shed light on their evolution at a variety of levels, providing a framework for
understanding the functional evolution of these proteins.
All trGTPases are defined by the presence of a highly conserved GTPase (G) domain
together with one or more family- and/or subfamily-specific domains. This shared
G domain allows the phylogenetic relationships among diverse GTPases to be estimated. Previous analyses of P-loop GTPases and ATPases identified four universal
and therefore pre-LUCA families in the trGTPase class: EF1, EF2, SelB, and IF2 (1).
We have conducted in depth phylogenetic analyses of these trGTPases, using a universal alignment of the G domain from a broad sampling of organisms across the tree
of life. Within this, we have identified 27 distinct trGTPase subfamilies that group
together into three major families: IF2, EF2, and EF1S (comprising EF1 and SelB)
based on phylogenies, domain architecture, and conserved indels (Fig. 1). The superfamily phylogeny has been used to organize a relational database of trGTPases and
their attributes, publicly accessible via an online interface (www.trGTPbase.org.uk).
The database and superfamily phylogeny have been used as a starting point for finer
scale analyses of various subfamilies. Phylogenetic and genomic context analyses
of the elongation factor EF-G subfamily reveal multiple forms that exist in parallel
to the slowly evolving form found in most bacteria and encoded in the str operon
(strEFG) (2). Surprisingly, the two mitochondrial EF-Gs are deep paralogs that
associate with EF-Gs from a sporadic taxonomic distribution of bacteria, being
found in spirochetes, delta-proteobacteria, and planctomycetes. This suggests that
the genes encoding these proteins may have experienced multiple lateral transfers,
including to the bacterial lineage that gave rise to mitochondria. Unusual patterns
are also found for the EF-G of the other endosymbiotic eukaryotic organelle, the
chloroplast, which apparently uses an alpha-proteobacterial derived EF-G rather
than the expected cyanobacterial form. The persistence of EF-G duplicates suggests subfunctionalization, whereby paralogs perform only partially overlapping
subsets of “canonical” EF-G activities (2).
Gemma Atkinson*
Sandra Baldauf
Department of Systematic Biology
Evolutionary Biology Centre
Uppsala University, P.O. Box 256
SE-751 05 Uppsala, Sweden
gemma.atkinson@ebc.uu.se
*
842
Figure 1: Schematic diagram of the phylogenetic relationships
among the major families of trGTPases. Subfamily names are coded by their taxonomic distribution as follows; green and underlined:
bacteria, red and italic: eukaryotes, blue with names prefixed with
e/a: subfamilies present in both eukaryotes and archaea.
86
Masaru Tomita
Institute for Advanced Biosciences
Keio University
Fujisawa, 252-8520, Japan
mt@sfc.keio.ac.jp
Other trGTPases, specifically eRF3, Hbs1p, and Ski7p, play central roles
in various mRNA surveillance mechanisms. These are nonsense mediated
decay (NMD, eRF3), no-go decay (NGD, Hbs1p) and non-stop decay
(NSD, Ski7p). We have analyzed the phylogenetic distribution and sequence conservation of these proteins and, in the case of eRF3 and Hbs1p,
their binding partners, eRF1 and Dom34p, respectively. These analyses
show that eRF1/Dom34p are universal in eukaryotes and archaea, while
eRF3 and Hbs1p are restricted to, and almost universal in eukaryotes (the
only exception being the absence of Hbs1p in some Apicomplexa). The
Hbs1p paralog Ski7p appears to be limited to a subset of Saccharomyces
species, derived from a duplication of Hbs1p in the Ascomycete lineage.
This has allowed reconstruction of the evolution of these novel eukaryotic mRNA decay processes from translation termination mechanisms that
were present in the common ancestor of eukaryotes and archaea (3).
1. Leipe, D. D., Wolf, Y. I., Koonin, E. V., and Aravind, L. J Mol Biol 317, 41-72 (2002).
2. Atkinson, G. C. and Baldauf, S. L. (submitted).
3. Atkinson, G. C., Baldauf, S. L., and Hauryliuk, V. BMC Evolutionary Biology 8,
290 (2008).
Metabolome Analysis and Systems Biology
Institute for Advanced Biosciences of Keio University has recently developed a
novel technology for high-throughput metabolome analysis. The technology is
based on capillary electrophoresis time-of-flight mass spectrometry (CE/TOFMS)
and it can simultaneously quantify a large amount of cellular metabolites ranged
from 70 to 1,000 molecular weights (1). Metabolome analysis is applicable to various fields of biotechnology in the post-genomic era, such as medical diagnosis
(blood, urine, tissue), food production (farm products, fermentation), and systems
biology of model organisms (E.coli and other bacteria).
The metabolome technology has made “multi-omics” analysis possible. We systematically obtained multi-omics data sets for Escherichia coli BW25113 and its single
gene deletion mutants. Our data covers the metabolome (CE-TOFMS), proteome
(western blot, shotgun proteomics, and 2D-DIGE), fluxome (GC-MS and NMR)
and transcriptome (real time RT-PCR and DNA?microarray) (4).
In the area of medical diagnosis, we recently discovered a biomarker of acetaminophen-induced hepatotoxicity, ophthalmate being a sensitive?biomarker of glutathione depletion (2). In addition, Metabolome data have?been used to confirm simulation results of red blood cell metabolism (3).
1.
2.
3.
4.
J Proteome Res 2, 488-494 (2003).
J Biol Chem 281, 16768-16776 (2006).
J Biol Chem 282, 10731-107341(2007).
Science 316, 593-597 (2007).
On the Evolutionary Origin of Mammalian
Specific Features of the Neocortex
The mammalian brain is known to have some unique features, one of which is the
layer structure of the neocortex. Although the functional and developmental aspects of the research has been actively done, the evolutionary origin of the neocortical layer structure have not been enough studied so far. With the aim of elucidating the evolutionary origin of layer structure of the neocortex, we studied a chick
brain from the viewpoint of the comparative developmental biology. We found
the following four points. (I) The chick pallium possesses the similar neuronal
repertoire of the mammalian neocortex, according to the expression patterns of
marker genes, but spatial distribution of a variety of neurons is divergent between
the mammalian neocortex and the chick pallium. (II) BrdU labeling experiment
showed that the chick shares with mammals the temporal order of the neuronal differentiation. (III) Our fate-mapping experiment demonstrated that the generation
site of a particular type of neuron is distinct from that of another type of neuron in
the chick pallium. However, the stem cell in all the regions of the mammalian neocortex can generate all types of cortical neurons. (IV) Several lines of evidences
showed that, compared with the uniform neurogenesis in the mammalian neocortex, the chick pallial neurogenesis is biased along the medio-lateral axis, mediallow and lateral-high. We concluded that the divergent neurogenetic pattern makes
the difference of pallial organization between the layer structure of the mammalian
neocortex and the chick non-layered pallium. This suggests the possibility that an
evolutionary novel feature, the layer structure of the mammalian neocortex, may
have arisen after bird-mammal divergence caused by the changes in the differentiation process from the neural stem cell.
843
Ikuo Suzuki1,*
Tatsumi Hirata2
Takashi Gojobori1
Laboratory for DNA Data Analysis
1
Center for Information Biology and
DNA Data Bank of Japan
Yata 1111, Mishima-shi, Shizuoka-ken,
411-8540, Japan
Division of Brain Function
2
Yata 1111, Mishima-shi, Shizuoka-ken,
411-8540, Japan
iksuzuki@lab.nig.ac.jp
*
88
The “Protein-scape” of Eukaryotic Chromatin
A quintessential feature of eukaryotes is their unique complement of chromatin proteins. While these have been the focus of intense investigation over the past two
decades, we are still left with several open questions. The most prominent of these
concern the origins of the eukaryote-specific chromatin proteins and the full diversity of nucleic acid and protein modifications occurring in eukaryotic chromatin.
We have tackled both these issues using a slew of computational methods. As consequence we have identified several novel DNA-binding domains, chromatin protein domains, and DNA and protein modification enzymes. Taking advantage of the
genomic data from early-branching eukaryotes we have also performed a comprehensive analysis of chromatin proteins from these lineages and compared them with
those from well-studied model organisms. As a result we were able reconstruct in
depth the origin and subsequent evolution of eukaryotic chromatin proteins. We also
discerned certain “syntactical patterns” in the domain architectures of histone modifying enzymes and ATP-dependent chromatin remodeling molecules. These syntactical patterns help in understanding the cross-talk between different modifications
and predict the degree of contextual specificity likely to be exhibited by different
chromatin protein modifying enzymes. Our identification of novel protein domains
in chromatin proteins have also lead to the discovery of previously unknown DNA
modifications and small-molecule-dependent regulatory networks in that could have
considerable implications for epigenetics and chromosomal dynamics.
87
L. Aravind
Computational Biology Branch
National Institutes of Heath/NLM, NCBI
Bethesda MD 20894
aravind@ncbi.nlm.nih.gov
844
89
E. Aharonovsky
E.N. Trifonov*
Genome Diversity Center
Institute of Evolution
University of Haifa
Haifa 31905, Israel
Unique Correlation Patterns of Sequence Repeats and
Splice Junctions in Eukaryotic Protein Sequences
Analysis of eukaryotic protein sequences demonstrates that short sequence repeats
(homopeptides) are not distributed evenly along eukaryotic genes, but rather display unique correlation patterns relative to the splice junctions of those genes. This
phenomenon sheds new light on the evolution of eukaryotic genes and the splicing
patterns. Interestingly, the most frequent repeats involve the most ancient amino
acid residues, according to temporal order of appearance of various amino acids in
early evolution (1).
1. Trifonov, E. N. J Biomolec Str Dyn 22, 1-11 (2004).
trifonov@research.haifa.ac.il
*
90
Junjie Zhang1,2,*
Matthew L. Baker2
Gunnar Schröder3
Nick R. Douglas4
Joanita Jakana2
Caroline J. Fu2
Michael Levitt3
Steven J. Ludtke1,2
Judith Frydman4
Wah Chiu1,2
Graduate Program in Structural and
1
Computational Biology and Molecular
Biophysics
National Ctr for Molecular Imaging
2
Verna and Marrs McLean
and Molecular Biology
Dept. of Structural Biology
3
Stanford Medical School
Dept. of Biology
4
Stanford University
jz147980@bcm.edu
Conformational Change of a Group II Chaperonin in
Different States Revealed by Single-particle Cryo-EM
Methanococcus maripaludis chaperonin (Mm-cpn) is a type II archael chaperonin
that has a built-in lid. It is a 16-subunit homo-oligomer of ~1 MDa arranged in a
two back-to-back rings that is structurally similar to the mammalian chaperonin
such as TRiC. The substrate folding is accompanied by a conformational change
triggered by nucleotide binding and hydrolysis. Using single particle cryo-EM and
image reconstruction, we solve both the wild type and lidless mutant Mm-cpn in
open and closed states respectively at resolutions between 10 and 4.3 Å. The open
state is a nucleotide-free state while the closed state corresponds to the transition
state of ATP hydrolysis. Cα backbone models of these four 3-D reconstructions
have been hand traced or flexibly fitted depending on their resolutions. The models
show clearly the subunits’ equatorial domain rotation between the open and closed
states, which is unique and dramatically different from the well-studied type I
chaperonin (GroE) found in E.Coli.
Research is supported by NIH grants from Nanomedicine Roadmap Initiative
(PN2EY016525) and NCRR Biomedical Technology Research Center for Structural Biology (P41RR02250).
Electron Cryo-microscopy of
Molecular Nanomachines and Cells
Electron cryomicroscopy (cryo-EM) is an emerging biophysical tool that can be
used to determine structures of molecular nanomachines in fully solvated conformations at subnanometer resolutions (<1 nm). Such cryo-EM maps can reveal long
α-helices and large β-sheets. In the highest resolution cryo-EM density maps, it is
possible to see side- chains and trace the Cα backbone of protein subunits within
a multi-component nanomachine. Electron cryo-tomography (cryo-ET) is equally
powerful because of the unique cellular context in which it can capture and reveal
cellular nanomachines. Despite reaching only 4-10 nm resolution, cryo-ET reconstructions are capable of imaging whole cells and distinguishing their molecular
components. Both of these methods are complementary to conventional methods of
structure determination, including X-ray crystallography and NMR spectroscopy.
Hybrid methods that combine these structural techniques with cryo-EM and cryoET result in a complete view of nanomachines from atomic detail to their spatial and
temporal location within a cell. I will describe the experimental and computational
pipeline in cryo-EM and cryo-ET and illustrate their effectiveness with biological
examples. Research has been supported by grants from NIH and NSF.
Molecular Anatomy Of The Human
Pathogen Leptospira interrogans
Systems biology conceptualizes biological systems as dynamic networks of interacting molecules, whereby functionally important properties are thought to emerge
from the structure of such networks. Due to the ubiquitous role of complexes of
interacting proteins in biological systems, their subunit composition and temporal
and spatial arrangement within the cell are of particular interest. While cellular proteomics provides an average picture of the protein expression for all the cells used
in a particular study, visual proteomics resembles a bridge to the observation of individual macromolecules within the context of single cells. Although, the structural
signature of large protein complexes can in principle be recognized within cryo
electron tomograms of intact cells, this concept has so far only been applied unambiguously for ribosomes. A major difficulty is the proteome wide determination of
the cellular protein concentration and its variability from cell to cell.
We have tackled this problem for the human pathogen Leptospira interrogans by
a combined strategy of cryo electron tomography and quantitative mass spectrometry. We used cryo-electron tomography and template matching to observe
several protein complexes involved in bacterial stress response in the cytoplasm
of intact cells. Target-driven mass spectrometry, in particular inclusion list based
LTQ-FT experiments and multi reaction monitoring served for relative and absolute quantification of the same protein complexes and further proteins involved
in the same biological processes. To localize protein complexes within the cytoplasm, we employed statistical concepts used for peptide matching in proteomics to template matching within tomograms of intact L. interrogans cells. We
investigated stress response in a heat-shocked (fever), antibiotics-treatment and
starved condition by targeted and visual proteomics.
845
Wah Chiu
91
National Ctr for Macromolecular Imaging
Verna and Marrs McLean Dept
of Biochemistry and Molecular Biology
Baylor College of Medicine
Houston, TX 77030
wah@bcm.edu
Martin Beck
92
Institute of Molecular Systems Biology
ETH Zurich, HPT E 53
Wolfgang Pauli-Str. 16
CH-8093 Zürich Switzerland
beck@imsb.biol.ethz.ch
846
93
Ohad Medalia
Dept of Life Sciences and the NIBN
Ben Gurion University of the Negev
Beer Sheva, Israel
omedalia@bgu.ac.il
94
Shang-Te Danny Hsu1,*
Lisa D. Cabrita1,2
Paola Fucini3,4
Christopher M. Dobson1
John Christodoulou1,2
1
University of Cambridge
Lensfield Road, Cambridge CB2 1EW
United Kingdom
Dept. of Structural & Molecular Biology
2
University College London, Gower Street
London and School of Crystallography
Birkbeck College, Malet Street
London WC1E 6TB, United Kingdom
AG-Ribosome, Max-Planck-Institute for
3
Molecular Genetics, Ihnestrasse 73
D-14195 Berlin, Germany
Institut für Organische Chemie und
4
Chemische Biologie, Johann Wolfgang
Goethe-Universitaet Frankfurt am Main
D-60438 Frankfurt am Main, Germany
stdh2@cam.ac.uk
*
The Molecular Architecture of Integrin-Mediated
Focal Adhesion by Cryo-Electron Tomography
Cell adhesions play an important role in the organization, growth, maturation, and
function of living cells. Interaction of cells with the extracellular matrix (ECM) is
curtail for a variety of disease states including tumour formation and metastasis,
inflammation and repair of wounded tissues. At the cellular level, many of the
biological responses to external stimuli originate at adhesion loci, such as focal
adhesions (FAs), which link cells, to the ECM or to their neighbors. Cell adhesion
is mediated by receptor proteins such as cadherins and integrins. The accurate
molecular composition, dynamics, and signaling activity of these adhesion assemblies determine the specificity of adhesion-induced signals and their effects on
the cell. However, characterization of the molecular architecture of FA is highly
challenging, due to its complexity and technical aspects. Here we present the first
3D analysis of integrin-mediated cell adhesion using cryo-electron tomography of
intact cells. By means of correlating fluorescent signal and electron microscopy,
we identify FAs and acquired insight into their molecular architecture. This analysis revealed detailed information on the organization of filamentous actin, such as
directionality, position, and partial occupancy, at these loci. In addition, our data
suggest that the cytoplasmic plaque of the adhesion machinery is composed of
large number of macromolecular assemblies, spaced by a short distance.
Probing Protein Folding on the Ribosome
by Solution State NMR Spectroscopy
The means by which a polypeptide chain acquires its unique three dimensional
structure is a fundamental question in biology. During its synthesis on the ribosome, a nascent chain emerges in a vectorial manner and will begin to fold in a cotranslational fashion (1, 2). Our current knowledge of protein folding at the level
of individual residues has come overwhelmingly from a combination of computer
simulations and experimental studies of protein denaturation and renaturation in
vitro, using biochemical and biophysical methods.
To account for the contribution of the protein translation machinery, namely the
ribosome, to the de novo folding of a nascent polypeptide chain, we have recently
developed a protocol combining cell-free synthesis, selectively isotope labeling
and rapid multidimensional heteronuclear NMR spectroscopy to identify the presence of a well-folded protein domain structure in part of the nascent chain as a ternary peptido-tRNA, ribosome complex (3). This has demonstrated the feasibility
of NMR studies on supra-biomolecular complexes such as the ribosome-nascent
chain complex at its functional states. Residue-specific analysis shows that the
dynamics of a co-localized region in the folded domain of the nascent chain is
strongly affected in the ternary complex, suggesting transient interactions between
the ribosome and this part of the folded domain.
Intriguingly, our recent data suggest that the ribosome attachment has different effects on the internal dynamics of the folded domain at the backbone and side-chain
levels. These findings represent a first step towards a description in atomic detail of
the process of protein folding coupled to translation of the genetic code. Recent developments in further systematic characterization of the chain length-dependent nascent
chain folding will also be discussed, including some evidence of the existence of a distinct folding intermediate of a ribosome bound nascent chain in contrast to the highly
cooperative urea-induced unfolding process of the same construct in isolation.
1. Fedorov, A. N. and Baldwin, T. O. JMB 272, 32715-32718 (1997).
2. Clark, P. L. TiBS 29, 527-534 (2004).
3. Hsu et al. PNAS 104, 16516-16521 (2007).
RNA Sequencing: A Deeper Look into
Persisters, Drug Tolerant Bacteria
When a population of genetically identical bacterial cells encounters antibiotics,
cells exhibit two phenotypic responses. The majority of the cells die rapidly, but a
small fraction of cells survive and they are called persisters. Unlike the well-known
phenomenon of drug resistance, persisters are a population of cells with a rare phenotype, the biology of which is poorly understood but is key for combating bacterial
diseases such as that caused by Mycobacterium tuberculosis. The gene expression
profiling of persisters by conventional DNA microarray has been difficult because
the small population of persisters falls below the sensitivity limit. With the advent
of next generation sequencing technology, RNA-seq in particular, it is now possible
to get a dynamic range and sensitivity at least 100-fold higher than microarrays. We
carried out quantitative genome-wide studies of mRNA from persisters in Escherichia coli and M. tuberculosis. This has allowed us to probe deeper into the transcriptome of persisters yielding quantitative information that did not exist before.
847
Huiyi Chen
Paul J. Choi2
Eric J. Rubin3
X.Sunney Xie2
1,2,*
95
Dept. of Molecular and Cellular Biology
1
2
12 Oxford St, Cambridge, MA 02138
Harvard School of Public Health
3
Dept. of Immunology & Infectious
Diseases, Armenise 439
200 Longwood Ave
Structural Aspects of Oligonucleotidemediated Artificial Ribonucleases
The development of novel biocatalytic supramolecular structures mimicking the
active center of natural ribonucleases and capable of cleaving RNA targets can provide a basis for generating new useful biological tools and powerful therapeutics,
affecting specific messenger RNAs and viral genomic RNAs. Recently, a new type
of chemical nuclease (1-4), showing very unusual catalytic and structural properties, was discovered. These novel oligonucleotide-mediated chemical nucleases
were constructed by chemical conjugation of short, catalytically inactive oligopeptides containing alternating basic and hydrophobic amino acids with an oligonucleotide component (1-4). The most remarkable feature of these novel biocatalysts was
that the conjugation of peptide and oligonucleotide seems to produce a new, hybrid
type of molecule that can synergistically combine the individual properties of the
two components to yield a new and unusual catalytic ability.
In this research we present structural aspects of a new type of catalytic artificial
ribonucleases with high catalytic turnover and efficiency, using 2D NMR spectroscopy and molecular modelling. Our structural studies of these oligonucleotide-mediated chemical nucleases revealed a clear Structure-Function correlation in terms
of their ability to cleave single-stranded regions of an RNA target. Spectroscopic
and computational data obtained so far provides sufficient evidence that both oligonucleotide and peptide cross-modulate each other’s conformations leading to a
formation of a new entity with unique structural and functional properties. The
oligonucleotide component seems to induce an ‘active’ conformation of the peptide
and hence significantly enhance its catalytic performance. The manipulation of the
structural properties of these catalytic nucleases may lead to a creation of new types
of synthetic ribonucleases of high activity and desired base-specificity.
1. Pyshnyi, D., Repkova, M., Lokhov, S., Ivanova, E., Venyaminova, A., Zarytova, V. Nucleosides & Nucleotides 16, 1571-1574 (1997).
2. Mironova, N. L., Pyshnyi, D. V., Ivanova, E. M., Zenkova, M. A., Gross, H. J., Vlassov, V. V.
Nucl Acids Res 32, 1928-1936 (2004).
3. Mironova, N. L., Pyshnyi, D. V., Stadler, D. V., Prokudin, I. V. Boutorine, Y. I., Ivanova, E.
M., Zenkova, M. A., Gross, H. J., Vlassov, V. V. J Biomol Struct Dyn 23, 591-602 (2006).
4. Mironova, N. L., Pyshnyi, D. V., Shtadler, D. V., Fedorova, A. A., Vlassov, V. V., Zenkova,
M. A. Nucl Acids Res 35, 2356-2367 (2007).
Boston, MA 02115
hchen@fas.harvard.edu
*
96
Steven M. Miles1
Mengisteab B. Gebrezgiabher1
Dmitrii V. Pyshnyi2
Nadezhda L. Mironova2
Marina A. Zenkova2
Valentin V. Vlassov2
Elena V. Bichenkova1,*
School of Pharmacy
1
University of Manchester
Oxford Road, M13 9PT, UK
2
Fundamental Medicine SB RAS
Novosibirsk, Russia
Elena.V.Bichenkova@manchester.ac.uk
*
Using Photoactivation Light Microscopy (PALM)
to Construct Comprehensive, Nanometer
Precision Atlases of Signaling Complexes
848
97
Jan Liphardt
Department of Physics
University of California
Berkeley, CA 94720-7300
Liphardt@berkeley.edu
98
G. Marius Clore
Laboratory of Chemical Physics
NIDDK, National Institutes of Health
Bethesda, MD 20892-0520
mariusc@mail.nih.gov
The E. coli chemotaxis network is a model system for biological signal processing.
In E. coli, transmembrane receptors responsible for signal transduction assemble
into large clusters containing several thousand proteins. These sensory clusters have
been observed at cell poles and future division sites. Despite extensive study, it
remains unclear how chemotaxis clusters form, what controls cluster size and density, and how the cellular location of clusters is robustly maintained in growing
and dividing cells. Here we use photoactivated localization microscopy (PALM) to
map the cellular locations of three proteins central to bacterial chemotaxis (the Tar
receptor, CheY, and CheW) with a precision of 15 nanometers. We find that cluster sizes are approximately exponentially distributed, with no characteristic cluster
size. One third of Tar receptors are part of smaller lateral clusters and not the large
polar clusters. Analysis of the relative cellular locations of 1.1 million individual
proteins (from 326 cells) suggests that clusters form via stochastic self-assembly.
The super-resolution PALM maps of E. coli receptors support the notion that stochastic self-assembly can create and maintain approximately periodic structures in
biological membranes, without direct cytoskeletal involvement or active transport.
Visualizing Lowly-populated Regions of the Free
Energy Landscape of Macromolecular Complexes
by Paramagnetic Relaxation Enhancement
Many biological macromolecular interactions proceed via lowly-populated, highly
transient species that arise from rare excursions between the minimum free energy
configuration and other local minima of the free energy landscape. Little is known
about the structural properties of such lowly-occupied states since they are difficult to trap and hence inaccessible to conventional structural and biophysical
techniques. Yet these states play a crucial role in a variety of dynamical processes including molecular recognition and binding, allostery, induced-fit, and selfassembly. Here we highlight recent progress in paramagnetic nuclear magnetic
resonance to detect, visualize, and characterize lowly-populated transient species
at equilibrium. We have used the PRE (a) to detect and characterize the stochastic target search process whereby a sequence-specific transcription factor binds to
non-cognate DNA sites as a means of enhancing the rate of specific association
via intramolecular sliding and intermolecular translocation (1); (b) to directly visualize the distribution of non-specific transient encounter complexes involved in
the formation of stereospecific protein-protein complexes (2); (c) to determine the
structure of a minor species for a multidomain protein (maltose binding protein)
where large interdomain motions are associated with ligand binding (3); and (d)
to characterize early transient events involved in N-terminal auto-processing of
HIV-1 protease (4). The PRE offers unique opportunities to directly probe and explore in structural terms lowly-populated regions of the free energy landscape and
promises to yield fundamental new insights into biophysical processes.
1.
2.
3.
4.
Iwahara, J. and Clore, G. M. Nature 440, 1227-1230 (2006).
Tang, C., Iwahara, J., and Clore, G. M. Nature 444, 383-386 (2006)
Tang, C., Schwieters, C. D., and Clore, G. M. Nature 449, 1078-1082 (2007).
Tang, C., Louis, J. M., Aniana, A., Suh, J.-Y., and Clore, G. M. Nature 455, 693-696 (2008).
Allosteric Mechanism of Hexameric
E. coli Arginine Repressor
Molecular dynamics simulations with ArgRC, the ~50 kDa C-terminal hexamerization and L-arginine-binding domain of E. coli arginine repressor, reveal the
protein’s range of motions with and without bound L-arg. Simulations starting
from the nearly identical apo- and holo-ArgRC X-ray crystal structures evolve distinctly during 20 ns. The two trimers of apoArgRC rotate freely with respect to one
another between two limiting ensembles, one essentially like the starting state derived from the crystal structure and the other rotated in one direction by a mean of
~13 degrees. Simulations with holoArgRC having six L-arg ligands bound reveal
essentially no rotational motion. The crystal-like ensemble of apoArgRC states is
visited much less frequently than the rotated ensemble, consistent with bond occupancies and entropies in the two ensembles that likewise imply the crystal traps
a high-energy state. Detailed analysis of the trajectories reveals that the motion of
apoArgRC is unidirectional because the single arginine residue of each polypeptide chain faces one side of the L-arg-binding pocket and extends its sidechain into
the pocket, mimicking the ligand. Simulations with the apoArgRC hexamer after
adding six L-arg ligands confirm that, as in holoArgRC, rotational dynamics are
suppressed and the most populated states are more crystal-like. Simulations with
incremental additions of individual L-arg ligands reveal that a single bound L-arg
is sufficient to suppress rotation and favor a more crystal-like ensemble. The proposed mechanism is corroborated by recent crystals of Mycobacterium tuberculosis ArgR, which present an arginine sidechain on the opposite side of the pocket
and which trap a state that is rotated in the opposite direction. The results enable
structure-based interpretation of the multiphasic thermodynamic profile of L-arg
binding and predict its long-range structural consequences in intact ArgR.
849
Rebecca Strawn
Milan Melichercik2
Michael Green3
Thomas Stockner4
Jannette Carey1,*
Rudiger Ettrich2
1
99
Chemistry Dept., Princeton University
1
Princeton NJ 08544-1009, USA
Dept of Structure & Function of Proteins
2
Inst. of Systems Biology & Ecology
Academy of Sciences of the Czech
Republic and Inst. of Physical Biology
Univ. of South Bohemia, Zamek 136,
37333, Nove Hrady, Czech Republic
Biology Dept, The College of New
3
Jersey, 2000 Pennington Road
Ewing, NJ 08628-0718, USA
Dept. of Health & Environment
4
Austrian Research Centers
GmbH-ARC, Vienna, Austria
jcarey@Princeton.edu
Allostery in tRNA Synthetases Elucidated from
MD Simulations and Protein Structure Networks
tRNA synthetases (aaRS) are enzymes crucial in the translation of genetic code.
The enzyme accylates the acceptor stem of tRNA by the congnate amino acid bound
at the active site, when the anti-codon is recognized by the anti-codon site of aaRS.
In a typical aaRS, the distance between the anti-codon region and the amino accylation site is approximately 70 Å. We have investigated this allosteric phenomenon
at molecular level by MD simulations followed by the analysis of protein structure
networks (PSN) of non-covalent interactions. Specifically, we have generated conformational ensembles by performing MD simulations on different liganded states
of methionyl tRNA synthetase (MetRS) from Escherichia coli and tryptophenyl
tRNA synthetase (TrpRS) from Human. The correlated residues during the MD
simulations are identified by cross correlation maps. We have identified the amino
acids connecting the correlated residues by the shortest path between the two selected members of the PSN. The frequencies of paths have been evaluated from the
MD snapshots (1). The conformational populations in different liganded states of
the protein have been beautifully captured in terms of network parameters such as
hubs, cliques and communities (2). These parameters have been associated with the
rigidity and plasticity of the protein conformations and can be associated with free
energy landscape. A comparison of allosteric communication in MetRS and TrpRS
100
Amit Ghosh1,§
Priti Hansia1
Saraswathi Vishveshwara1,*
Molecular Biophysics Unit
1
Indian Institute of Science
Bangalore, 560012, India
§Current address:
Institute for Genomic Biology
UIUC, Urbana, IL
sv@mbu.iisc.ernet.in
*
850
(3) elucidated in this study highlights diverse means adopted by different enzymes
to perform a similar function. The computational method described for these two
enzymes can be applied to the investigation of allostery in other systems.
1. A. Ghosh and S. Vishveshwara. PNAS 104, 15711-15716 (2007).
2. A. Ghosh and S. Vishveshwara. Biochemistry 47, 11398-11407 (2008)
3. P. Hansia, A. Ghosh, and S. Vishveshwara. Ligand dependent Intra and Inter subunit Communication in Human Tryptophanyl tRNA Synthetase as Deduced from the Dynamics of
Structure Networks (submitted for publication) (2009).
101
Swapna Ravikumar
R. Malathi*
Dept. of Genetics
Dr. ALMPGIBMS
University of Madras
Chennai-600113, India
r_malathi@hotmail.com
*
102
Gil Amitai1
Brian P. Callahan1,*
Matt Stanger1
Georges Belfort3
Marlene Belfort1,2
Wadsworth Center, New York State Dept
1
of Health, Center for Medical Sciences
Albany, New York 12208
School of Public Health, State
2
University of New York at Albany
Albany, New York 12201-2002
Howard P. Isermann Dept of Chemical
3
and Biological Engineering
Rensselaer Polytechnic Institute
Troy, New York 12180
callahan@wadsworth.org
*
Analysis of Structure-Functional
Relationships of Adenosine Receptor A2a
Extra-cellular adenosine plays an important role in physiology and initiates
most of its effects through activation of its receptors especially during hypoxia
and in diseases. Adenosine receptors, members of the super-family of G-protein
coupled receptors [GPCR] are of four subtypes [A1,A2a,A2b,A3] and understanding their structure and function gains significance in view of their importance in therapeutics.
In order to understand the structure-functional relationship, we have examined the
aminoacid sequences of A2a receptor from a wide range of species including mammals, insects, Zebrafish and also computed the secondary structure, phylogenetic
tree, etc. The analysis is suggestive of a strong relationship between mammalian
species with subtle difference in Drosophila and Anopheles and interesting similarity between human and Zebrafish. The aminoacids cysteines, histidines in the
extracellular loops of A2a are highly conserved suggesting their importance during
ligand binding, the details of which will be discussed.
Catalytic Partnership Between
Inteins and Their Extein Neighbors
Here we describe the development and use of a FRET-based reporter assay for
tracking intein activity in vitro and in living cells. As shown below, the native
“extein” substrates of a self-splicing intein were replaced with the naturally
FRET-active cyan and yellow fluorescent proteins. Native extein residues near
the splice junction that might influence intein activity were maintained. In vitro
and in vivo analysis of the resulting protein showed high FRET signal associated
with the spliced product and the unspliced precursor. Low FRET was affiliated
with the products of N-extein cleavage.
We have used this FRET-active intein to test the hypothesis that non-reacting extein residues influence protein splicing. Extein residues that perturb the stability of
high-energy intermediates formed during splicing were searched for and identified
in mutant expression libraries on the basis of deviant in vivo FRET readings. Once
selected by in vivo screening and cell sorting, variants were characterized by an
analogous FRET-based assay that allowed for continuous, parallel, kinetic monitoring of intein activity in crude cell extracts.
Results of this screen indicate that mutations in non-reacting extein residues can
have pronounced effects on the stability of splicing intermediates, with consequent
changes in the yield of spliced product and the rate at which it is formed. These observations seem to contrast with the generally held notion that an intein can excise
itself from “virtually anywhere” within a host extein sequence. The existence of
these extein effects and their magnitude further implies that intein integration sites
may be selected, both in nature and in the biotechnological uses of inteins, in a manner more judicious than presently appreciated.
851
CoMFA and CoMSIA – A 3D Quantitative Structure
Activity Relationship Prediction on Benzodipyrazoles
Series as Cyclin Dependent Kinase 2 (CDK2) Inhibitors
103
Protein phosphorylation and dephosphorylation are important processes in the control of protein functions. Phosphorylation occurs on serine, threonine, and tyrosine
residues and is catalyzed by protein kinases whose number transcends 800 in the
human genome. Because of the importance of protein phosphorylation as a main
post-translational mechanism used by cells to regulate enzymes and other proteins
and the association of many maladies with its aberrations, kinases have increasingly
become important targets and the hunt for kinase inhibitors has been intensified
and attracted a great attention in drug discovery over the years. Cyclin dependent
kinases have appeared as important drug target over the years with a multitude of
therapeutic potentials. Cyclin dependent kinase 2 (CDK2) belongs to this class of
protein kinases and plays a key role in the cell cycle regulation. With the intention
of designing compounds with enhanced inhibitory potencies against CDK2, the 3DQSAR CoMFA and CoMSIA study on benzodipyrazoles series is presented here.
Sanjeev K. Singh1,*
Sunil Tripathi1
Nigus Dessalew2
Center of Excellence in Bioinformatics
1
School of Biotechnology
Madurai Kamaraj University
Madurai 625 021, Tamil Nadu, India
Dept. of Pharmaceutical Chemistry
2
School of Pharmacy Addis Ababa University, P.O.Box 1176, Addis Ababa, Ethiopia
sanjeev@mrna.tn.nic.in
*
skysanjeev@gmail.com
The developed models showed a strong correlative and predictive capability having
a cross validated correlation co-efficient of (r2cv) 0.699 for CoMFA and 0.794 for
CoMSIA models. A very good conventional and predicted correlation co-efficient
852
were also obtained: CoMFA (r2ncv, r2pred: 0.883, 0.754), CoMSIA (0.937, 0.815).
The models were found to be statistically robust and are expected to be of an aid to
design and/or prioritize drug likes for synthesis.
1. R. D. Cramer, III, D. E. Patterson, J. D. Bunce. J Am Chem Soc 110, 5959-5967 (1988).
2. M. Rarey, B. Kramer, T. Lengauer, G. Klebe. J Mol Biol 261, 470-489 (1996).
3. M. J. S. Dewar, E. G. Zoebisch, E. F. Healy, J. J. P Stewart. J Am Chem Soc 107, 39023909 (1985).
4. R. D'Alessio, A. Bargiotti, S. Metz, M. G. Brasca, A. Cameron, A. Ermoli, A. Marsiglio, P.
Polucci, F. Roletto, M. Tibolla, M. L. Vazquez, A. Vulpetti, P. Pevarello. Bioorg Med Chem
Lett 15, 1315-1319 (2005).
104
Alexander M. Andrianov1,*
Ivan V. Anishchenko2
Inst. of Bioorganic Chemistry
1
Nat'l Academy of Sciences of Belarus
Kuprevich Street 5/2
220141 Minsk, Rep. of Belarus
United Inst. of Informatics Problems
2
Surganov Street 6
220012 Minsk, Rep. of Belarus
andrianov@iboch.bas-net.by
*
Common Structural Motifs of the HIV-1 V3 Variable
Loops As the Weak Units in the Virus Protection System
The computational approaches that combined the NMR-based protein structure
modeling with the mathematical statistics methods were used to define the locally
accurate 3D structures of the HIV-1 gp120 V3 loops from Minnesota, Haiti, RF, and
Thailand isolates in water solution as well as from Minnesota and Haiti isolates in a
water/trifluoroethanol mixed solvent. To specify the structural motifs of V3 giving
rise to the close spatial folds regardless of the sequence and environment variability,
the simulated structures and their individual segments of different length were collated between themselves and with those derived previously from homology modeling (1) and X-ray crystallography (2). As a result, the sequence and environment
changes were found to trigger the considerable structural rearrangements of the V3
loop, but, at the same time, some of the functionally crucial V3 stretches were shown
to keep the 3D shapes in all the cases in question. In the first place, it concerns core
V3 sequence 15-20 as well as its N- and C-terminal sites 3-7 and 28-32 comprising
the residues, which contribute significantly to the virus immunogenicity and cell
tropism. In addition, structurally rigid V3 stretch 3-7 includes the highly conservative glycolysation site of gp120 utilized by the virus for defense against neutralizing antibodies and elevation of its infectivity. In the context of these findings, the
inflexible V3 motifs identified in the present study may present the Achilles' heel in
the HIV-1 protection system and, therefore, their detection is of great importance to
successful design of the V3-based anti-AIDS drugs able to stop the HIV's spread.
Acknowledgment
This study was supported by grants from the Union State of Russia and Belarus
(scientific program SKIF-GRID; No. 4U-S/07-111) as well as from the Belarusian
Foundation for Basic Research (project X08-003).
1. I. V. Anishchenko and A. M. Andrianov. Proceedings of II International Conference “Advanced
Information and Telemedicine Technologies for Health” (Minsk, 2008), 12-16 (2008).
2. C. C. Huang, M. Tang, M. Y. Zhang, S. Majeed, E. Montabana, R. L. Stanfield, D. S. Dimitrov, B. Korber, J. Sodroski, I. A. Wilson, R. Wyatt, and P. D. Kwong. Science 310, 10251028 (2005).
Computational Anti-AIDS Drug Development Based on
the Evidence For a Strong Attraction of the HIV-1 V3
Loop to Immunophilins
In the light of study (1), whereby the HIV-1 V3 loop is a high-affinity ligand for
immunophilins present in human blood, the model of the structural complex of
cyclophilin A (CycA) with the HIV-MN V3 domain was generated, and the computational design of the peptide able to mask the biologically crucial V3 segments
was implemented.
To this end, the following problems were solved: (i) the NMR-based conformational analysis of the HIV-MN V3 loop was put into effect, and its low energy
structure fitting the input experimental observations was determined; (ii) molecular
docking of this V3 structure with the X-ray conformation of CycA was carried out,
and the energy refining the simulated structural complex was performed; (iii) the
inter-atomic contacts for the amino acids of the molecules forming part of the built
over-molecular ensemble were specified, the types of interactions responsible for
its stabilization were analyzed, and the CycA stretch that accounts for the binding to V3 was identified; (iv) the most probable 3D structure for this stretch in the
unbound state was predicted, and its collation with the X-ray structure for the corresponding site of CycA was performed; (v) the potential energy function and its
constituents were studied for the structural complex generated by molecular docking of the V3 loop with the CycA peptide offering the virtual molecule, which
imitates the CycA segment making a key contribution to the interactions of the
native protein with the HIV-1 principal neutralizing determinant; (vi) as a result of
the studies above, the designed peptide was shown to be capable of the efficacious
blockading the functionally crucial V3 sites; and (vii) based on the joint analysis of
the evidence obtained in the present study and previously (2), the composition of
the peptide cocktail presenting the promising anti-AIDS pharmacological substance
was developed.
The molecules simulated here and earlier (2) by molecular modeling methods may
become the first representatives of a new class of the chemicals (immunophilinderived peptides) offering the forward-looking basic structures for the design of
efficacious antiviral agents.
Acknowledgment
1. M. M. Endrich and H. Gehring. Eur J Biochem 252, 441-446 (1998).
2. A. M. Andrianov. J Biomol Struct Dynam 26, 49-56 (2008).
853
105
Alexander M. Andrianov
Inst. of Bioorganic Chemistry
Kuprevich Street 5/2
220141 Minsk, Republic of Belarus
854
Computer-based Design of Protein-Protein Interactions
Gurkan Guntas
Carrie Purbeck
Deanne Sammond
Ziad Eletr
Ramesh Jha
Brian Kuhlman*
Strategies have been developed for three problems in protein interface design:
(i) increasing the affinity of naturally occurring interactions, (ii) redesigning protein-protein binding specificities, and (iii) designing interactions from scratch. All
three approaches make use of the sequence and backbone optimization protocols
in the molecular modeling program Rosetta. In general, designs that make use
of hydrophobic interactions have been more successful than designs that rely on
novel hydrogen bonding networks. This is not ideal as incorporating hydrophobic
residues on to the surface of proteins can result in non-specific binding and aggregation. To design more polar interfaces we have developed a protocol that combines molecular modeling with combinatorial screening. Independent sequence
optimization trajectories are performed on a large set of perturbed interfaces, and
then used to generate amino acid profiles for each residue at the interface. Libraries based on these profiles are experimentally screened for binding. This strategy
has been used in one case to design a hydrogen bonding network around a novel
histidine residue placed at the center of an interface. The designed interaction has
an equilibrium dissociation constant of 30 nM.
106
University of North Carolina
Chapel Hill, NC, 27599-7260
bkuhlman@email.unc.edu
*
107
I. R. Chandrashekaran1
Anjali Dike1
R. Christy Rani Grace2
Lea Pagett3
Sudha M. Cowsik1,*
Allyn C. Howlett3
School of Life Sciences
1
Jawaharlal Nehru Univ.
New Delhi - 110 067, India
The Salk Institute
2
10010, N.Torrey Pines Rd
La Jolla, CA 92037
Dept of Physiology and Pharmacology
3
Wake Forest University
School of Medicine
Winston-Salem, NC 27157-1083
*scowsik@yahoo.com
Conformation of a Peptide Mimetic of the Fourth
Cytoplasmic Loop of the CB1 Cannabinoid Receptor
The CB1 cannabinoid receptor is a G-protein coupled receptor that regulates multiple
signal transduction pathways, including inhibition of adenyl cyclase and regulation
of ion channels.The intracellular surface of the CB1 receptor interacts directly with
selective G-proteins. The juxtamembrane C-terminal region is critical for G-protein
and signal transduction regulation. Thus, the determination of structural changes in
this domain can provide insight into the mechanisms for efficacy in signal transduction. A synthetic peptide fragment of the C-terminal region of CB1 (residues 401-417)
has been shown to activate Go and Gi proteins in a pertussis toxin-sensitive manner.
This receptor domain is expected to be palmitoylated at cysteine 416, and the structure imposed by this membrane anchor is believed to be influential in the interactions between receptor and G-protein. Circular dichroism (CD) studies of the peptide
in water, sodium phosphate buffer, and methanol are characteristic of random coil
structures, whereas the addition of sodium dodecyl sulfate (SDS) or dipalmitoylphosphatidylglycerol induces helical structure. The addition of trifluoroethanol (TFE) to
provide a hydrophobic environment does not induce helical structure in this peptide.
Structural investigations using 2D-NMR in water show extended coil conformation
and in SDS micelles show the formation of helical structure. The distance constraints
from the NMR data have been used in a torsion angle dynamics algorithm and molecular dynamics simulations to produce a model of the peptide as a helix with cationic
clusters largely oriented toward the cytoplasm. This structure appears to be modified
by the environment, such as might be imposed by protein-protein interactions.
Phosphorylation is an important regulatory mechanism in signal transduction. Structural investigations were made on the CB1 peptide fragment with each serine phosphorylated. CD spectrophotometry on the S402-phosphorylated peptide showed the
presence of no secondary structure in phosphate buffer and a shift toward helicity in
50% methanol. A solution of SDS induced helicity, but to a lesser degree than TFE,
which began to exhibit helical structure at concentrations as low as 20% TFE and
exhibited a significant number of residues in a helical conformation at 90% TFE.
Initial NMR data confirm that the degree of helical structure increases as the concentration of TFE increases. 2D-NMR data show no ordered structure in water or
low concentrations of TFE. The induction of helicity in TFE for the phosphorylated
peptide but not the native fragment suggests a conformational shift in this region
upon phosphorylation that may play a role in signal transduction.
Conserved Water Mediated Inter-Domain
Recognition in IMPDH-II (human)
The inosine monophosphate dehydrogenase is a key enzyme in the de novo biosynthesis pathway and controls the guanine nucleotides pools (1). Two isoforms of
human IMPDH have been identified and designated as type I (house-keeping role),
which is found in normal resting cells, whereas the type II is selectively up regulated
during cellular proliferation, thus, considering it an excellent target for the development and designing the anti cancer and immunosuppressive drugs (2). Interestingly,
IMPDH II has two highly stereospecific conserved domains that recognized the
mononucleotide ligands (the IMP or its structural analogs CPR, RVP can bind) and
dinucleotide ligands (NAD or its structural analogs SAE and MAD), respectively
(3). However, only three X-ray structures of human IMPDH-II enzymes (1B3O,
1NFB, and 1NF7) (4, 5) are available in the Protein Databank with partial disorder
at ~25% of the total 514 residues. So, the modeling and water dynamic studies are
essential to investigate the detail interdomain recognition in the protein. Our computational results revealed that both the (mono- and di-nucleotide) ligand binding
domains are recognized by conserved water molecule (WM) (6). To anchor these
two domain, nature placed the Arg 322 in such a steoreochemical orientation that
the NH1 atom (of Arg 322) is recognized the di-nucleotide binding domain via the
conserved water molecule (WC), whereas the NH2 nitrogen atom has also played
a key role to recognize the mono-nucleotide binding domain through the another
conserved water molecule (WL). The conserved water molecule (WM) bridged these
two domains through the eight center H-bonding patterns. These water mediated
interactinal patterns may suggest the new structural insight of human IMPDH II
proteins which may obsolete in non-human IMPDH.
So both the mono and di-nucleotide ligand binding domains of human IMPDH II
may thought to be stabilized by the R 322 through a conserved water molecular
triad (WC, WM, and WL). The proposed water molecular triad in the protein is
shown in the given figure.
Reference and Footnotes
1. V. Nair, Q. Shu. Antivir Chem Chemother 18, 245-258 (2007).
2. A. J. Ratcliffe. Current opinion in Drug Disc and Devil 9, 595-605 (2006).
3. C. Branden, J. Tooze. Introduction to Protein Structure. Garland Publishing, New York and
London (1991).
4. T. D. Colby, K. Vanderveen, M. D. Stricker, G. D. Markham, B. M. Goldstein. Proc Nat Acad
Sci-Biochemistry 96, 3531-3536 (1999).
5. D. Risal, M. D. Stricker, B. M. Goldstein. Structure deposited RCSB (2004).
6. H. R. Bairagya, B. P. Mukhopadhyay, K. Sekar. J Biomol Struct Dyn 26, 497-508 (2009).
855
108
Hridoy R. Bairagya*
Bishnu P. Mukhopadhyay
National Institute of Technology
Durgapur – 713209 , India
bpmk2@yahoo.com
*
Digestion of the λ cI Repressor with Various
Serine Proteases and Correlation with its
Three Dimensional Structure
856
109
Atasi Pal
Rajagopal Chattopadhyaya*
Bose Institute, P-1/12, C.I.T.
Scheme VII M, Calcutta 700054, India
raja@boseinst.ernet.in
*
Partial proteolysis of the λ cI repressor has been carried out systematically with
trypsin, chymotrypsin, elastase, endoproteinase Glu-C, kallikrein, and thrombin.
The cleavage sites have been determined by (i) comparison of fragments produced
and observed in SDS-polyacrylamide gel with known fragments and plots of distance migrated versus log (molecular weight of fragment), (ii) partial Edman sequencing of the stable C-terminal fragments to identify cleavage points, and (iii)
electrospray mass spectrometry of fragments produced. Most cleavage points are
found to occur in the region 86-137, saving some in the N-terminal domain observed for trypsin and Glu-C. Region 86-137 can be further subdivided into three
regions 86-91, 114-121, and 128-137 prone to cleavage, with intermediate regions
resistant to cleavage to all six proteases (1). These resistant regions show that much
of the region 93-131 previously called a ‘linker’ is actually part of the C-domain
as first proposed in all models from our laboratory (4). Region 92-114 includes the
cleavage site Ala-Gly, which must be buried in the intact repressor. The observed
cleavage points in region 114-137 can be used to judge the best among three previously proposed models (4) since they differ from each other in the structure of
region 93-131. Model 1j5g is adjudged to be better than model 1lwq (which is based
on 1kca, a crystal structure) as susceptible residues are more exposed in the former
and lack of cleavages at six sites is better explained (1). Likewise, the models 1j5g
and 1lwq are compared with a recent crystal structure of fragment 101-229 in 2ho0
(5) and another low resolution crystal structure in 3bdn (6).
110
Armen T. Karapetian1,*
Artak V. Grigoryan1
Andranik M. Muradyan1
Grigor A. Manukyan1
Ara P. Antonyan2
Kristine A. Pirumyan2
Physics Department
1
Yerevan State University of
Architecture and Construction
Yerevan, 0009, Armenia
Dept. of Biophysics, Yerevan State
2
University, Yerevan, 0025, Armenia
Akarapetian@ysuac.am
*
1.
2.
3.
4.
5.
6.
A. Pal, R. Chattopadhyaya. J Biol Str Dyn 26, 339-354 (2008).
L. J. Beamer, C. O. Pabo. J Mol Biol 227, 177-196 (1992).
C. E. Bell, P. Frescura, A. Hochschild, M. Lewis. Cell 101, 801-811 (2000).
R. Chattopadhyaya, K. Ghosh. J Struct Biol 141, 103-114 (2003).
D. Ndjonka, C. E. Bell. J Mol Biol 362, 479-489 (2006).
S. Staybrook et al. Nature 452, 1022-1026 (2008).
Effect of the Nonthermal Extra High Frequency
Electromagnetic Waves on the Thermostability
of Ligand-DNA Complexes
Dominant driving forces of the DNA minor groove binding ligands to A/T rich
sites are the favorable increase in entropy due to the release of ordered water molecules from the spine of hydration and/or release of Na+ ions from the regions of
higher ion density near the polyionic DNA molecules. Recently we have shown
that irradiation of water-salt solutions by the nonthermal millimeter waves (ntMMW), referred to extremely high frequency (30-300 GHz) electromagnetic waves
leads to the significant changes of spatial structure of water molecules. Therefore
we assumed that the irradiation of ligand-DNA solution by the resonant of water
structure frequency (50.3 GHz) will have the similar effect on the bulk solvent
which will change the thermal stability of DNA-ligand complexes. To determine
the effect on DNA-Hoechst 33258 stability caused by ntMMW, thermal denaturation experiments were performed to find out the changes of the melting temperature (Tm) values of investigated samples. It was shown that Tm of irradiated water
solutions of DNA-H33258 complexes by ~5 ºC greater than that of nonradiated
complexes at the 2mM Na+, pH 6.9. We suggest that the registrated difference
in thermal stability of the irradiated complexes is likely due to the disruption of
the water network that run across the surface and the minor groove of DNA. The
increase binding strength of the ligand with DNA is the result of significant contribution water network to binding partly through the enthalpy contribution of hydrating bonds and partly through entropic effects associated with desolvation of
the reactants and salvation of the resulting complex.
857
111
Expression of M. tuberculosis Fatty Acid
Synthase I in M. smegmatis
We have previously shown that an analog of antitubercular agent pyrazinamide
(PZA), 5-chloropyrazinamide (5-Cl-PZA) inhibits fatty acid synthase I (FASI) in
Mycobacterium tuberculosis (Mtb). FASI has been purified from Mycobacterium
smegmatis mc2 2700, a recombinant strain where the native fas1 gene has been
deleted and replaced with Mtb fas1 gene. To further prove that 5-Cl-PZA and PZA
bind to FASI, we used saturation transfer difference (STD) NMR experiment. NMR
shows that PZA and 5ClPZA not only bind to FASI but they also compete for the
same binding sites of FASI. Based on STD competition titration, 5-Cl-PZA binds to
FASI with dissociation binding constant KD of 90 μM, which is significantly lower
than the PZA binding constant KI of 2.5 mM. However, FASI isolated from mc2
2700 yields natural expression levels that make further testing by (STD) NMR not
viable. To overcome this problem FASI was successfully overexpressed in E.coli but
yielded inactive protein. Since the expression of FASI in E.coli results in inactive
enzyme, we are currently working to move fas1 into an E.coli-Mycobacterial shuttle
vector, pVV16, which has been used to overexpress mycobacterial protein in M.
smegmatis. Expressing FASI in M. smegmatis should allow overexpression of the
protein and minimize any protein folding issues that may have occurred in E.coli.
Halimah Sayahi1,*
Kim DeWeerd1
Swamy S. Puttamadappa1
Silvana. C. Ngo2
William R. Jacobs, Jr2
Alexander Shekhtman1
John T. Welch1
Dept of Chemistry, University at
1
Albany-SUNY, 1400 Washington Ave
Albany, NY USA 12203
Albert Einstein, College of Medicine
2
Bronx, NY 10461 USA
hs3331@albany.edu
*
Heat Shock Affects Functioning of the Yeast
Plasma-membrane Pma1 H+-ATPase
The yeast Pma1 H+-ATPase belongs to the subfamily of P2-type ATPases, a part of
large and wide-spread family of P-type ATPases found throughout pro- and eukaryotes, which also includes mammalian K+, Na+, H+, K+, and Ca2+-ATPases (1). These
pumps couple ATP hydrolysis to transport of different cations across plasma membrane thus generating electrochemical gradient of ions and maintaining cell homeostasis. Structurally, the P2-ATPases share a common topology in which a large
cytosolic catalytic domain is connected with a small extracellular part through 10
hydrophobic segments embedding the protein in the lipid bilayer. This transmembrane domain forms translocation pathway and contains sites for cation binding.
Cryoelectron microscopic studies that had defined the number of transmembrane
α-helices and site-directed mutagenesis had clearly implicated M4, M5, M6, and
M8 in high-affinity cation binding (2). Of these segments, M8 has been less characterized and its role is not yet clear. Recently we have described a set of mutants
made by Ala-scanning mutagenesis to examine the functional role of amino acid
residues throughout M8 of the yeast Pma1 H+-ATPase (3). Initially, these mutant
proteins were expressed from a centromeric plasmid in the yeast strain SY4 where
secretory vesicles containing ATPase become arrested due to a temperature-sensitive block preventing vesicle fusion with the plasma membrane under heat shock.
At this step, we found that 4 of 21 alanine substitution (I794A, F796A, Q798A,
and I799A) could not overcome quality control points under stress condition and
appeared to be retained in an early stage of biogenesis due to impaired folding (3).
To understand better the role of these residues, these four mutations were integrated
into the chromosomal copy of PMA1 gene. Two alleles (Q798A and I799A) were
unable to support growth at non-restrictive temperatures, 23 ºC and 30 ºC (3), while
112
Valery V. Petrov
Institute of Biochemistry and
Physiology of Microorganisms
142290 Pushchino, Russia
vpetrov06@mail.ru
858
I794A and F796A strains grew slower than the wild-type (WT) even at 30 ºC. These
mutants, especially I794A, showed signs of temperature sensitivity.
The expression of the ATPase gene (PMA1) is regulated by glucose (4) and the
enzyme itself shows the phenomenon known as glucose activation (5): the Pma1
ATPase isolated from glucose-metabolized and starved cells has different activity
and kinetic parameters. To study further the effect of these substitutions on the
ATPase and influence of heat shock on the enzyme function and regulation, we isolated plasma membranes from cells that were starved and re-fed at permissive (30
ºC) and restrictive (37 ºC) temperatures. WT tolerated heat shock well showing just
slight reduction in growth and the amount of ATPase protein. I794A strain showed
two-fold reduction in the amount of the mutant ATPase to that seen in WT even during growth at 30 ºC. The difference became more profound at 37 ºC: the amount of
the I794A enzyme from metabolizing cells was about one third of the control and in
starved cells heat shock led to almost eight-fold drop suggesting that heat shock under starved conditions decreases stability of the I794A enzyme. The expression of
the F796A ATPase was insignificantly affected by the cultivation temperature. Influence of heat shock on activity of ATPase and its activation by glucose was more
noticeable both in the WT and mutant strains. For WT, activity dropped three fold in
glucose-starved and two fold in glucose-metabolizing membranes compared with
that in the membranes isolated from cells grown at 30 ºC. The changes in the mutant
activities were more visible. Under glucose-metabolizing conditions the activity
lowered by a half of the control for I794A and by a quarter of that for F796A. The
ability of the F796A ATPase to be activated by glucose was significantly impaired,
while for I794A it was almost abolished. Cultivation at 37 ºC caused a substantial decrease of the WT ATPase activity compared with the enzyme activity during
growth at 30 ºC: to almost one third in the membranes isolated from starved and to
a half in those isolated from metabolizing cells. For the I794A mutant, increasing
temperature to 37 ºC also led to decrease of specific ATPase activity; however, the
effect of high temperature was less dramatic. F796A mutant was less affected at 37
ºC. At the same time, the apparent ratio of the ATPase activation by glucose at 37 ºC
was higher for the WT and, to a lesser degree, for the F796A mutant.
Figure 1: Homology model of the yeast Pma1 H+ATPase showing membrane domain from the extracytoplasmic surface of the membrane. Numbers indicate
transmembrane segments 1 to 10.
Figure 1 shows a 3D model of the membrane domain of Pma1 H+-ATPase, built using the E1Ca structure of SERCA1a Ca2+-ATPase as a template (3). In this view, M8
is surrounded by five other transmembrane helices, with the M8 residues important
for folding and biogenesis reaching out towards M4-M6 (I799), in between M6
and M9 (F796), M7 and M10 (I794 and Q798). Since Q798 is in close proximity
to M7 and M10 and I799 is facing transport pathway formed by M4, M5, M6, and
M8, these residues seem well positioned to play a structural and functional role by
contributing to the proper assembly of helices within the M domain. F796 seems to
be less important. I794 occupies intermediate position: it is important for the functioning and regulation of the enzyme, especially under stress conditions.
Acknowledgement
The author is grateful to Prof. C. W. Slayman (Yale University) for support and
scientific advising. This study was supported in part by the RFFI grant 07-0400419, and Grant of the President of Russian Federation for the Leading Scientific
Schools SS-1004.2008.4.
1. Lutsenko, S. and Kaplan, J. H. Biochemistry 34, 15607-15613 (1995).
2. Toyoshima, C. and Inesi, G. Ann Rev Biochem 73, 269-292 (2004).
3. Guerra, G., Petrov, V. V., Allen, K. E., Miranda, M., Pardo, J. P., and Slayman, C. W. Biochim
Biophys Acta 1768, 2383-2392 (2007).
4. Rao, R., Drummond-Barbosa, D., and Slayman, C. W. Yeast 9, 1075-1084 (1993).
5. Serrano, R. FEBS Lett 156, 11-14 (1983).
How the Protein Sequences Adapt to Function in Varied
Temperatures? A Comparative Proteome Analyses of
Microorganisms that Live in Varied Temperatures
In order to understand how protein sequences have adapted to optimal growth
temperatures of their respective microorganisms, we have carried out a comparative sequence analysis of proteomes of four groups of microorganisms that live at a
wide range of temperatures (sub-zero to higher than hundred ºC) namely, psychrophilic (P), mesophilic (M), thermophilic (T), and hyperthermophilic (HT), organisms. We have used 24 bacterial proteomes, 6 each of P, M, T, and HT. Orthologous
pairs of all available proteins were identified between proteomes using BLASTP
search tool with < 10-5 expectation value > 40 bit scores. We have picked up alignments of all best possible single top hit for every protein sequence in a query proteome that has an ortholog in the subject proteome. The alignments were parsed to
calculate amino acid substitution counts between the two orthologous proteins of
respective proteomes. The substitution counts were normalized with respect to the
composition of total amino acids in their respective proteomes.
For example, in the case of psychrophiles versus mesophiles, the frequency of
substitutions was further used to calculate two types of likelihood log odd substitution scores (LOS):
The mutual substitution scores (LOS) of amino acids clearly show that the substitutions that lead to adaptation to cold temperatures are either overrepresented or
avoided. In psychrophilic bacteria, serine, aspartic acid, threonine, and alanine are
overrepresented in the coil regions of secondary structures, while glutamic acid and
leucine are underrepresented in the helical regions. Compared to mesophiles, psychrophiles comprise a significantly higher proportion of amino acids that contribute
to higher protein flexibility in the coil regions of proteins, such as those with tiny/
small or neutral side chains. Amino acids with aliphatic, basic, aromatic, and hydrophilic side chains are underrepresented in the helical regions of proteins of psychrophiles. The patterns of amino acid substitutions between the orthologous proteins of
psychrophiles versus mesophiles are significantly different for several amino acids
when compared to their substitutions in orthologous proteins of within the mesophiles or psychrophiles. These findings would help future efforts in rationally designing and selecting mutations for psychrophilic properties in proteins of interest.
The observations from such analyses carried out for all pair-wise proteome comparisons such as Meso vs Thermo, Psychro vs Thermo, etc., will be discussed.
859
113
Boojala Vijay B. Reddy*
Raghu P. Metpally
The Laboratory of Bioinformatics and In
Silico Drug Design
Queens College and Graduate Center of
City University of New York
65-30 Kissena Blvd.,
Flushing, NY 11367, USA
vijay@velgonda.cs.qc.cuny.edu
*
860
114
Ke Xia
Songjie Zhang
Wilfredo Colón
Rensselaer Polytechnic Institute
Troy, NY, 12180
xiak@rpi.edu
115
Ivan V. Anishchenko1
Alexander M. Andrianov2,*
United Inst of Informatics Problems
1
Surganov Street 6, 220012 Minsk
Republic of Belarus
Inst of Bioorganic Chemistry
2
Kuprevich Street 5/2, 220141 Minsk
Republic of Belarus
*
Identifying Kinetically Stable Proteins
via Electrophoresis Methods
Most proteins are in equilibrium with partially and globally unfolded conformations. In contrast, kinetically stable proteins (KSPs) are trapped by an energy barrier
in a specific state, unable to transiently sample other conformations. Among many
potential roles, it appears that kinetic stability (KS) is a feature used by nature
to allow proteins to maintain activity under harsh conditions, and to preserve the
structure of proteins that are prone to misfolding. The biological and pathological
significance of KS remain poorly understood due to the lack of simple experimental
methods to identify this property, and its infrequent occurrence in proteins. Based
on our previous correlation between KS and a protein's resistance to the denaturing
detergent sodium dodecyl sulfate (SDS), we show here two electrophoresis methods to indentify KSPs. Diagonal two-dimensional (D2D) SDS-polyacrylamide gel
electrophoresis (PAGE) is a simple assay to identify KSPs in complex mixtures, and
allows the proteomics-level identification of KSPs in different systems. The other
simple and quick method to probe KSPs is capillary electrophoresis (CE). Different
KSPs have their own characteristic charge-to-mass ratio that results in different CE
mobility, thereby revealing the extent of SDS binding, and consequently, its KS.
The study of KS using these methods may eventually lead to a better understanding
of KS and its biological and pathological significance.
Insight into the Conformational Features of the HIV-1
Subtype A V3 Loop for Providing Informational
Support to Structure-Based Anti-AIDS Drug Projects
The V3 loop of the HIV-1gp120 glycoprotein presenting 35-residue-long, frequently
glycosylated, highly variable, and disulfide bonded structure plays the central role
in the virus biology and forms the principal target for neutralizing antibodies and
the major viral determinant for co-receptor binding. Here we present the computeraided studies on the 3D structure of the HIV-1 subtype A V3 loop [SA-V3 loop] in
which its structurally inflexible regions and individual amino acids were identified
and the structure-function analysis of V3 aimed at the informational support for
anti-AIDS drug researches was put into practice.
To this end, the following successive steps were carried out: (i) using the methods
of comparative modeling and simulated annealing, the ensemble of the low-energy structures was generated for the consensus amino acid sequence of the SA-V3
loop and its most probable conformation was defined basing on the general criteria
widely adopted as a measure of the quality of protein structures in terms of their 3D
folds and local geometry; (ii) the elements of secondary V3 structures in the built
conformations were characterized and careful analysis of the corresponding data
arising from experimental observations for the V3 loops in various HIV-1 strains
was made; (iii) to reveal common structural motifs in the HIV-1 V3 loops regardless of their sequence variability and medium inconstancy, the simulated structures
were collated with each other as well as with those of V3 deciphered by NMR
spectroscopy and X-ray studies for diverse virus isolates in different environments;
(iv) with the object of delving into the conformational features of the SA-V3 loop,
molecular dynamics trajectory was computed from its static 3D structure followed
by determining the structurally rigid V3 segments and comparing the findings obtained with the ones derived hereinbefore; and (v) to evaluate the masking effect
that can occur due to interaction of the SA-V3 loop with the two virtual molecules
constructed previously (1, 2) by tools of computational modeling and named FKBP
and CycA peptides, molecular docking of V3 with these molecules was implemented and inter-atomic contacts appearing in the simulated complexes were analyzed
to specify the V3 stretches keeping in touch with the ligands.
861
As a matter of record, V3 segments 3-7, 15-20, and 28-32 containing the highly
conserved and biologically meaningful residues of gp120 were shown to retain their
3D main chain shapes in all the cases of interest, presenting the forward-looking targets for anti-AIDS drug researches. From the data on molecular docking, synthetic
analogs of the CycA and FKBP peptides were suggested being suitable frameworks
for making a reality of the V3-based anti-HIV-1 drug projects.
Acknowledgment
116
Network Robustness and Modularity of Protein
Structures in the Identification of Key Residues
for Allosteric Communications
Here, we represent protein structures as residue interacting networks, which are assumed to involve a permanent flow of information between amino acids. By removal of nodes from the protein network, we identify fold centrally-conserved residues,
which are crucial for sustaining the shortest pathways and thus play key roles in
long-range interactions. The agreement between the fold centrally conserved residues and residues experimentally suggested to mediate signaling, further illustrates
that topology plays an important role in network communication. Protein folds have
evolved under constraints imposed by function. To maintain function, protein structures need to be robust to mutational events. On the other hand, robustness is accompanied by an extreme sensitivity at some crucial sites. Thus, here we propose
that centrally conserved residues whose removal increases the characteristic path
length in protein networks, may relate to the system fragility.
Further results show that protein domains consist of modules interconnected by
fold-centrally conserved residues. Modules characterize experimentally identified
functional regions and based on our results we propose that high modularity modules include functional sites and are the basic functional units. We provide examples
(the Gαs subunit and P450 Cytochromes) illustrating that the modular architecture
of active sites is linked to their functional specialization.
Antonio del Sol1,*
Marcos J. Araúzo-Bravo1
Ruth Nussinov2,3
Bioinformatics Research Unit
1
Research and Development Division
Fujirebio Inc.
51 Komiya-cho, Hachioji-shi
Tokyo 192-0031, Japan
Basic Research Program
2
SAIC-Frederick, Inc., Center for Cancer
Research, Nanobiology Program
National Cancer Institute
Frederick, MD 21702, USA
Sackler Inst. of Molecular
3
Medicine, Department of Human
Genetics and Molecular Medicine
Tel Aviv University
Tel Aviv 69978, Israel
antdelsol@gmail.com
*
On the Nature of the Protein-Protein
Interactions in Cataract
862
117
Priya R. Banerjee
Ajay Pande
Jayanti Pande*
Dept. of Chemistry, University at Albany
1400 Washington Avenue
Albany, NY 12222 USA
jpande@albany.edu
*
Several mutations in the human γD-crystallin (HGD) gene have been associated
with childhood cataract. We have been examining these mutant proteins in order
to understand the molecular mechanisms underlying the pathology. We find that
mutations (a) alter the interactions among mutant protein molecules (i.e., like-like,
homologous interactions) such that protein solubility is compromised, or (b) change
the interactions with other crystallins (i.e., like-unlike, heterologous interactions),
with both effects leading to increased light scattering and opacity. The common
theme that emerges however, is that the global protein fold of the mutant crystallins
remains largely intact but some ‘sticky’ patches are created on the protein surface.
We have published several examples of homologous interactions (1-3), the latest being the P23T mutation in which protein aggregates are formed, held together by net
hydrophobic interactions. In this case we have now defined the sticky patches on the
surface of the protein that are likely to promote aggregation. In contrast, we find that
in other mutations, for example, the E107A mutation, such homologous interactions
are not observed. This raises the question as to how such mutations lead to increased
light scattering. To address this problem we examined the heterologous interactions
between E107A and the molecular chaperone, α-crystallin, and found that the mechanism of light scattering in this case is more complex. Phase diagrams of E107A
with α-crystallin at protein concentrations and compositions approaching that in the
lens, show clear differences compared to similar mixtures of HGD and α-crystallin.
Due to the loss of a negative charge in the protein as a result of the mutation, the net
attractive interactions between E107A and α-crystallin increase. These in turn lead
to an altered phase diagram. Based on molecular dynamics calculations, Stradner et
al. (4) predicted that increased attractive interactions such as those between E107A
and α-crystallin, would lead to an altered phase-diagram and increased light-scattering, due to the thermodynamic instability of these protein mixtures.
Our studies reveal that subtle changes in protein-protein interactions due to genetic mutations rather than global protein unfolding can clearly lead to serious
pathological effects.
1. A. Pande, J. Pande, N. Asherie, A. Lomakin, O. Ogun, J. A. King, N. H. Lubsen, D. Walton,
and G. B. Benedek. Proc Natl Acad Sci USA 97, 1993-1998 (2000).
2. A. Pande, J. Pande, N. Asherie, A. Lomakin, O. Ogun, J. King, and G. B. Benedek. Proc Natl
Acad Sci USA 98, 6116-6120 (2001).
3. A. Pande, O. Annunziata, N. Asherie, O. Ogun, G. B. Benedek, and J. Pande. Biochemistry
44, 2491-2500 (2005).
4. A. Stradner, G. Foffi, N. Dorsaz, G. Thurston, and P. Schurtenberger. Phys Rev Lett 99,
198103 (2007).
Pharmacophoric Analysis and Molecular Docking
Studies on Selective Cyclooxygenase-2(COX-2)
Inhibitors and Their Hits
The cellular targets or receptors of many drugs used for medical treatment are proteins. Drugs can either enhance or inhibit its activity by binding to the receptor.
Basically there are two major groups of receptor proteins: (a) proteins that "float"
around in the cytoplasm of the cell, (b) proteins that are incorporated into the cell
membrane. In the latter case, a drug does not even need to enter the cell; it can bind
simply to an extracellular binding site of the protein and control intracellular reactions from the outside. Specificity is an important criterion to determine the medical
value of a drug. Drug has to bind specifically to the target protein in order to minimize undesired side-effects. On the molecular level specificity includes two more
or less independent mechanisms, first the drug has to bind to its receptor site with a
suitable affinity and second it has to either stimulate or inhibit certain movements of
the receptor protein in order to regulate its activity. Both mechanisms are mediated
by a variety of interactions between the drug and its receptor site.
In 1971, Vane showed that the anti-inflammatory action of nonsteroidal anti-inflammatory drugs (NSAIDs) rests in their ability to inhibit the activity of the cyclooxygenase (COX) enzyme, which in turn results in a diminished synthesis of
proinflammatory prostaglandins (1). This action is considered to be not the sole
but a major factor of the mode of action of NSAIDs. The pathway leading to the
generation of prostaglandins has been elucidated. Within this process, the COX
enzyme (also referred to as prostaglandin H synthase) catalyzes the first step of
the synthesis of prostanoids by converting arachidonic acid into prostaglandin H2,
which is the common substrate for specific prostaglandin synthases. The enzyme is
bifunctional, with fatty acid COX activity (catalyzing the conversion of arachidonic
acid to prostaglandin G2) and prostaglandin hydroperoxidase activity (catalyzing
the conversion of prostaglandin G2 to prostaglandin H2). In the early 1990s, COX
was demonstrated to exist as two distinct isoforms (2, 3). COX-1 is constitutively
expressed as a housekeeping enzyme in nearly all tissues, and mediates physiological responses. Recent studies have further indicated that COX-2 over expression
is not necessarily unique to cancer of the colon, but may be a common feature of
other epithelial cells. Increased COX-2 levels have been identified in lung, breast,
gastric, and prostate cancer, as well as in pancreatic adenocarcinomas (4). On the
118
863
Poonam Singh1,*
Yamuna Devi S.2
Sanjeev. K. Singh2
Division of Toxicology
1
Central Drug Research Institute
Lucknow-226001, Uttar Pradesh India
Centre of Excellence in Bioinformatics
2
School of Biotechnology
Madurai Kamaraj University
Madurai-625021
singhpoonam3012@yahoo.co.in
*
poonamsinghcdri@gmail.com
basis of these data, it is conceivable that specific COX-2 inhibitors might be used as
adjuvant in the treatment of tumors, as well as in cancer prevention.
864
In this work we have find out common pharmacophoric feature required by COX-2
inhibitors to bind with receptor efficiently and then searched this common pharmacophore in Cambridge crystallographic database (CCDC) and performed molecular
docking on hits and known inhibitors. we have also correlated the docking score
and experimental data and suggested few refinement in existing COX-2 inhibitors.
Our Pharmacophoric studies suggests that, there will be a specific arrangement
of functional group required for molecule to work as COX-2 inhibitors, i.e., hydrophobic group, hydrogen bond acceptor, negative region, and aromatic rings
in specific manner as mentioned in figure, our molecular docking study also supports this pharmacophoric requirement and shows very good interaction with the
receptor for compounds with derived pharmacophore, hydrogen bond interaction
shown in figure with unknown hits searched in CCDC database. So if we have
these functional group according to the derived pharmacophoric features it enhances the activity of COX-2 inhibitors.
119
Kumkum Jain
Priyanka Dhingra
Sandhya Shenoy
B. Jayaram**
*
Dept of Chemistry & Supercomputing
Facility for Bioinformatics and
Computational Biology
Indian Inst. of Technology Delhi
Hauz Khas, New Delhi 110016, India
kumkum@scfbio-iitd.res.in
*
**
bjayaram@chemistry.iitd.res.in
1. J. R. Vane. Nat New Biol 231, 232-235 (1971).
2. J. Y. Fu, J. L. Masferrer, K. Seibert, A. Raz, and P. Needleman. J Biol Chem 265, 1673716740 (1990).
3. W. Xie, J. G. Chipman, D. L. Robertson, R. L. Eriksonm, and D. L. Simmons. Proc Natl
Acad Sci USA 88, 2692-2696 (1991).
4. S. M. Prescott. J Clin Invest 105, 1511-1513 (2000).
Pushing the Frontiers of Atomic
Models for Protein Structure Prediction
Protein folding considered as the holy grail of molecular biology continues to remain elusive even after six decades of the discovery of secondary structures. While
significant advances have been made in tertiary structure prediction via knowledge-base driven Bioinformatics methodologies, all atom models, which promise
a physico-chemical understanding of the folding and detection of new folds, have
yet to mature to be predictive.
We describe here an energy based computer software suite for narrowing down the
search space of tertiary structures of small globular proteins. The protocol comprises eight different computational modules that form an automated pipeline. The
software suite initially predicts the secondary structure starting from the sequence
and generates multiple trial structures by varying the dihedrals of the residues in the
loops. It combines biophysical filters (1) with physics based potentials (2) to arrive
at five plausible candidate structures. The methodology has been validated here on
50 small globular proteins (< 100 amino acids) consisting of 2-3 helices and strands
with known tertiary structures. For each of these proteins, a structure within 3-7
Å RMSD (root mean square deviation) of the native has been obtained in the five
lowest energy structures within 1-3 hours on a 64 processor cluster. The protocol
has been web enabled and is accessible at http://www.scfbio-iitd.res.in/bhageerath
(3). Further developments in the trial structure generation protocol are in progress
at present to reduce the computational times involved and to improve the prediction
accuracy for proteins with higher complexity both in terms of sequence length as
well as number of secondary structure units. The accuracies and limitations of the
server along with some new developments will be presented and discussed.
1. Narang, P., Bhushan, K., Bose, S., Jayaram, B. Phys Chem Chem Phys 7, 2364-2375 (2005).
2. Narang, P., Bhushan, K., Bose, S., Jayaram, B. J Biomol Str Dyn 23, 385-406 (2006).
3. Jayaram, B., Bhushan, K., Shenoy, S. R., Narang, P., Bose, S., Agrawal, P., Sahu, D., Pandey,
V. S. Nucl Acids Res 34, 6195-6204 (2006).
Quinones, Lipids, Channels, and Chloride Ion – New
Insights Based on the Structure of Cyanobacterial
Photosystem II at 2.9 Å Resolution
Photosystem II (PSII) is a large homodimeric protein-cofactor complex that acts
as light-driven water:plastoquinone oxidoreductase and is located in the photosynthetic thylakoid membrane of plants, green algae, and cyanobacteria. The principal
function of PSII is to oxidize two water molecules at the unique Mn4Ca cluster to
molecular (atmospheric) oxygen, 4 protons and 4 electrons. The protons serve to
drive ATP synthetase and the electrons reduce plastoquinone (QB) to plastoquinol
(QBH2) that is exported and delivers the electrons (through the cytochrome b6f
complex) to photosystem I. Here the electrons gain a high reducing potential and
serve at NADP reductase to generate NADPH that together with ATP reduces CO2
to carbohydrates in the Calvin cycle.
The crystal structure of PSII from Thermosynechococcus elongatus at 2.9 Å resolution allowed the unambiguous assignment of all 20 protein subunits and complete
modeling of all 35 chlorophyll a molecules and 12 carotenoid molecules, 25 integral
lipids and 1 chloride ion per PSII monomer. The presence of a third plastoquinone QC
and a second plastoquinone-transfer channel, which were not observed before, suggest mechanisms for plastoquinol-plastoquinone exchange, and we calculated other
possible water or dioxygen and proton channels. Putative oxygen positions obtained
from Xenon derivative crystals indicate a role for lipids in oxygen diffusion to the
cytoplasmic side of PSII. The chloride position suggests a role in proton-transfer
reactions because it is bound through a putative water molecule to the Mn4Ca cluster
at a distance of 6.5Å and is close to two possible proton transfer channels.
865
120
Albert Guskov1
Azat Gabdulkhakov1
Matthias Broser2
Jan Kern2
Athina Zouni2
Wolfram Saenger1,*
Freie Universität Berlin
1
Institut für Chemie und Biochemie
Kristallographie, Takustr. 6,
D-14195, Berlin, Germany
Technische Universität Berlin
2
Institut für Chemie
Strasse des 17. Juni 135
D-10623 Berlin, Germany
saenger@chemie.fu-berlin.de
*
1. Guskov, A., et al. Nature Structural and Molecular Biology, February 2009.
RecA-mediated Cleavage of λ cI Repressor Accepts
Repressor Dimers: Probable Role of Prolyl cis-trans
Isomerization and Catalytic Involvement
of H163, K177, and K232 of RecA
The λ cI repressor is found to be cleaved in the presence of activated RecA in
its DNA-bound dimeric form at a rate similar to that in the absence of operator
DNA in contrast to previous studies inferring repressor monomer
as a preferred substrate. Though
activated RecA does not possess
any measurable isomerase activity against a standard peptide substrate, prolyl isomerase inhibitors
cyclosporin A and rapamycin do
inhibit RecA-mediated cleavage.
Histidine and lysine to a smaller
extent, are shown to cleave cI repressor in a non-enzymatic fashion
whereas arginine and glutamate do
not. When activated RecA filament
is covalently modified by using an
excess of diethyl pyrocarbonate or
maleic anhydride, RecA-mediated
121
Atasi Pal
Rajagopal Chattopadhyaya*
Bose Institute, P-1/12, C.I.T.
Scheme VIIM, Calcutta 700054, India
raja@boseinst.ernet.in
*
866
122
Susan N. Pieniazek1,*
Manju Hingorani2
David L. Beveridge1,**
Chemistry
1
Molecular Biology and Biochemistry
2
Wesleyan University
Hall-Atwater Laboratories
237 Church Street
Middletown, CT 06459-0180, USA
spieniazek@wesleyan.edu
*
**
dbeveridge@wesleyan.edu
123
Manuel Miranda-Arango1
Juan Pablo Pardo2
Valery V. Petrov3,*
Department of Biological Sciences and
1
Border Biomedical Research Center
University of Texas at El Paso
El Paso, TX 79968
Departamento de Bioquimica, Facultad
2
de Medicina, UNAM, Ap. Postal 70159,
Mexico D.F. 04510, Mexico
Institute of Biochemistry and Physiology
3
of Microorganisms, Russian Academy of
Sciences, 142290 Pushchino, Russia
vpetrov06@mail.ru
*
cleavage of cI repressor is inhibited. Combining our chemical modification data
with model building and earlier mutagenesis data, it is argued that H163, K177,
and K232 in RecA are crucial residues involved in cI repressor cleavage by combining with the catalytic Ser149 and K192 in the repressor. It is suggested by
model building that subunits n, n + 4, and n + 5 in the RecA filament contribute
one loop each for holding the C-terminal domain of the repressor during cleavage
within the RecA helical groove, explaining why its ADP-form is inactive and its
ATP-form is active regarding repressor cleavage.
Recognition and Allosteric Signaling in DNA
Mismatch Repair: MD and GNM Studies on
MutS Complexes with DNA and ATP
The MutS family of DNA binding proteins has been reported to play a critical
role in mismatch repair (MMR). Crystal structures of MutS (Escherichia coli and
Thermus aquaticus) as well MSH homologs including human MutSα reveal intricate and complex multi-domain protein structures comprised of greater than 1,500
residues. The DNA binding domain of these proteins recognizes mispaired or unpaired bases. It has been proposed that this recognition event results in the release
of a signal that travels from the DNA binding domain over a distance of 70 Å
the ATPase site. While much has been learned from previous binding studies of
MutS, the contribution of the protein dynamics on MutS complex formation and
intra- and inter-domain communication events are not fully resolved at the atomic
level. In this study, 50 ns molecular dynamics (MD) simulations are used to investigate the dynamical processes that occur during the interactions with DNA and ATP
substrates. In particular, we are interested in how the DNA mismatch recognition/
binding event is signaled, triggering the initiation of DNA repair. The longer time
frame aspect of the process is treated by a Gaussian Network Model normal mode
analysis. The results for the free and bound forms of the protein are analyzed to
determine which model of allostery – conformational pathway, energy landscape,
or vibrational coupling – best describes the process. The computational challenge
represented by the size and complexity of MutS-DNA complexes provides an opportunity to develop multi-scale modeling approaches for the study of allostery in
large, complex multi-component biological systems.
Role of Transmembrane Segment M6
in the Biogenesis and Function of the Yeast
Plasma-Membrane Pma1 H+-ATPase
P-type ATPases, which are found throughout prokaryotic and eukaryotic cells, use
the energy from ATP hydrolysis to pump cations across biological membranes. Recently, crystal structures of the mammalian Ca2+- and K+, Na+-ATPases and fungal and plant H+-ATPase, have appeared, providing a valuable framework to study
the molecular mechanism of P-type ATPases. The structure includes a cytoplasmic
headpiece that is folded into three discrete domains connected by a thick stalk to
the membrane domain, consisting of 10 α-helices with varying lengths and inclinations. Site-directed mutagenesis of Ca2+-ATPase had located residues essential for
Ca2+ transport in four of them: M4 (E309), M5 (N768 and E771), M6 (N796, T799,
and D800), and M8 (E908). The crystal structure showed that side-chain oxygen
atoms from these residues contribute to two Ca2+-binding sites (I and II), situated
in a pocket near the middle of the membrane; three additional M4 residues (V304,
A305, and I307) also furnish main-chain carbonyl oxygens to site II.
P-ATPases are noteworthy for their ability to pump a wide range of cations, includ-
ing H+, Na+, K+, Mg2+, Ca2+, Cu2+, Cd2+, Mn2+. There are also major differences
in cation stoichiometry, ranging from 1 H+/ATP in the plasma-membrane H+-ATPase of yeast and other fungi to 3 Na+/2 K+/ATP in the Na+,K+-ATPase of animal
cells. Based on sequence alignments and cryoelectron microscopic images of the
Neurospora and Arabidopsis plasma-membrane H+-ATPases and the mammalian
Na+, K+-ATPase, it seems likely that a common folding pattern has been conserved
throughout the P-ATPases. Thus, a reasonable guess is that the determinants of
cation specificity and cation stoichiometry lie in a core of membrane segments M4,
M5, M6, and M8 of these enzymes. Indeed, mutagenesis of the Na+, K+-ATPase
has identified at least 8 residues in M4, M5, and M6 that are essential for cation
occlusion and/or transport, and mutagenesis of the yeast Pma1 H+-ATPase has located positions in M5 and M8 at which amino acid substitutions alter the coupling
between ATP hydrolysis and H+ transport (1, 2).
M6 forms part of the Ca2+-binding pocket in the sarcoplasmic reticulum ATPase,
contributing T799 to site I, N796 to site II, and D800 to both. In Pma1, these
residues correspond to A729, A726, and D730, respectively. It therefore seemed
worthwhile to carry out Ala/Ser-scanning mutagenesis along M6 of the yeast H+ATPase, searching for residues that may play a role in the enzyme functioning.
Each mutant allele was cloned into the expression vector Ycp-2HSE and expressed
in secretory vesicles (SV), as described (1, 2). The Saccharomyces cerevisiae strain
SY4 used in this study carries the temperature-sensitive sec6-4 mutation which,
upon incubation at 37 ºC, blocks the last step in plasma membrane biogenesis and
leads to the SV accumulation in the cell; SV could readily be isolated and used to
assay the ATPase activity and expression.
Of the 19 mutations studied, only two (D730A and D739A) led to complete blocks
in membrane trafficking that prevented the ATPase from reaching SV. Other mutations of the same residues (D730N, D730V, D739N, and D739V) gave similar
results (1). This kind of behavior can be traced to a severe defect in protein folding, causing the abnormal ATPase to be retained by quality control mechanisms
in the endoplasmic reticulum; consistent with misfolding, direct assays of metabolically labeled D730N, D730V, and D739V ATPases have shown that they are
highly sensitive to trypsin (1). Mutations L721A, I722A, I725A, and I727A were
expressed not very well (18 to 35% of the wild-type control) in SV and, accordingly, displayed ATPase activities that were very low. The remaining mutations
were expressed at 46 to 100% of the wild-type level and had ATPase activities,
ranging from 7 to 71% of the control. Worth noting is the stretch of 7 almost successive positions (L721, I722, F724, I725, I727, F728, and D730), starting from
the extracytoplasmic end of M6, at which Ala substitutions interfered markedly
with ATPase activity, biogenesis, or both; by contrast, only three (L734, Y738,
and D739) of the nine Ala replacements towards the cytoplasmic end of M6 led
to pronounced effects on biogenesis and/or activity. Two mutants, V723A and
I736A, also had altered kinetics. Both were strikingly resistant to orthovanadate,
with Ki values 20-fold higher compared to the wild-type control, also displaying
2.5- to 15-fold decreases in Km for MgATP and, in the case of V723A, an alkaline
shift in pH optimum. Such changes can be accounted for by a shift in equilibrium
from the vanadate-sensitive E2 conformation towards E1, which has a much lower
affinity for orthovanadate but a higher affinity for MgATP.
Given the known contribution of M6 to the transport pathway of Ca2+-ATPase, it
was of particular interest to ask whether any of the mutations affected H+ pumping by the Pma1 ATPase. For most of the mutants, including V723A and A729S
towards the extracytoplasmic end of M6 and V731A, A735S, I736A, and A737S
towards the cytoplasmic end, the pumping slope was close to that seen in the wild
type. The mutants A726S (A726 corresponded to N796 of Ca2+-ATPase), A732S,
and T733A, however, gave slopes significantly lower than the wild-type value, consistent with a partial uncoupling between ATP hydrolysis and H+ transport.
867
868
Figure 1: H+ binding sites of the yeast Pma1 H+-ATPase.
Residues I331, I332, V334 in M4 correspond to V304,
A305, and I307 of the site II in Ca2+-ATPase; D730
(M6) corresponds to D800 and E803 (M8) corresponds
to E908 of the sites I and II in Ca2+-ATPase. Coordinated
hydrated H+ are represented by circles in spheres. The
homology model was built based on crystallographic
structures of Ca2+-ATPase as described in (2).
Thus, mutagenesis of the M6 residues gave different results compared to M8 of the
Pma1 H+-ATPase (2). In M8, four of 21 substitutions were not expressed; two others were poorly expressed and were non-active. By contrast, only two M6 mutants
(D730A and D739A) were not expressed (2-6%); another (I725A) was expressed
poorly (18%); and the rest was well (100%) to reasonably (29%) expressed. However, among 16 expressed mutants only half was active enough to measure the
ATPase activity; two of them have kinetics significantly altered. Three M6 mutants
showed undercoupling, but the differences were not as dramatic as in M8 where
substitutions at 5 positions led to strong or even severe uncoupling while two others
caused significant overcoupling (2). Therefore, one can suggest that M6 plays an
important role in H+-ATPase functioning, being probably responsible for cation selectivity similar to pmr1 ATPase (3), while M8 is mostly responsible for stoichiometry (2). Based on crystallographic structures of Ca2+-ATPase, we built a homology
model showing H+ site(s) in the Pma1 H+-ATPase (Fig. 1): like Ca2+-ATPase the
yeast H+-ATPase may also have two binding sites for H+ (hydroniums). This model
can explain change in stoichiometry reported earlier (1, 2).
Acknowledgement
The authors are grateful to Prof. C. W. Slayman (Yale University) who was a scientific adviser of this project. This study was supported in part by the Grant Number
5G12RR008124 (to the Border Biomedical Research Center (BBRC)/University of
Texas at El Paso) from the National Center for Research Resources (NCRR, NIH)
(MMA) and by the RFFI grant 07-04-00419, and Grant of the President of Russian
Federation for the Leading Scientific Schools SS-1004.2008.4 (VVP).
124
Chad M. Petit
Anthony B. Law2
Jun Zhang2
Ernesto J. Fuentes3
Andrew L. Lee1,2,*
1
Eshelman School of Pharmacy
1
Division of Medicinal Chemistry and
Natural Products
2
University of North Carolina at Chapel
Hill, Chapel Hill, NC 27599
3
University of Iowa, Iowa City, IA 52242
drewlee@unc.edu
*
1. Petrov, V. V., Padmanabha, K. P., Nakamoto, R. K., Allen, K. E., and Slayman, C. W. J Biol
Chem 275, 15709-15716 (2000).
2. Guerra, G., Petrov, V. V., Allen, K. E., Miranda, M., Pardo, J. P., and Slayman, C. W. Biochim
Biophys Acta 1768, 2383-2392 (2007).
3. Mandal, D., Woolf, T. B., and Rao, R. J Biol Chem 275, 23933-23938 (2000).
Side-Chain Dynamics in PDZ
Domain Structure and Function
PDZ (post synaptic density-95, discs large, zo-1) domains are small, protein-protein
binding modules that typically recognize C-terminal tail residues of target proteins.
They are commonly found in multidomain signaling proteins and play a role in providing a scaffold for recruitment of multiple factors. We are using PDZ domains as
models for the study of protein dynamics in function. NMR spectroscopy is ideally
suited for characterizing molecular dynamics over a wide range of motional timescales. Analysis of 15N and 2H relaxation rates in several PDZ domains is beginning
to reveal a role for picosecond-nanosecond motions in ligand binding. In particular,
methyl containing side-chain motions can be quite sensitive to various perturbations to the domain. The dynamics are affected near and far from the perturbation
and can result in significant changes in conformational entropy, which can result in
significant modulation of binding affinity. These findings underscore the potential
importance of dynamic allosteric regulation in proteins. Finally, comparison of the
side-chain dynamics in multiple PDZ domains indicate that their dynamics are significantly conserved, suggesting further that nature uses dynamics, in addition to
structure, as a means to achieve protein function.
Stability of Bilayer Lipid Membrane Under a Combined
Effect of Electric Field and Hydrostatic Pressure
The issue of stability of cell membranes is central in membranology. The extreme
complexity of cell membranes makes is reasonable to study this problem through
a model – a bilayer lipid membrane (BLM). The overwhelming majority of works
focuses on studying BLM stability in electric field. However, it is well known that
often the membrane is impacted by both electric force and hydrostatic pressure.
Experimental and theoretical studies have been carried out to investigate the combined effect of hydrostatic pressure and trans-membrane difference of potentials on
BLM stability. As a parameter characterizing the BLM stability level, assumed is
average lifetime of BLM at given values of electrostatic field and hydrostatic pressure. As demonstrated experimentally, the combined action of electrostatic field
and hydrostatic pressure results in a drastic decrease of average lifetime of BLM.
A theoretical description of the BLM stability loss has been given analogously to
the theory of thin membrane stability based on the concepts on formation and extracritical growth of through hydrophile pores. Pores in BLM form spontaneously, and
then – as result of randomized changes in their dimensions – reach some critical
size, after which BLM looses its stability. We have calculated the energetic barrier
of hydrophile pore formation in the presence of both trans-membrane difference of
potentials and hydrostatic pressure on BLM. As demonstrated, the height of the barrier and critical radius of the pore drastically decreases depending on the growth of
both trans-membrane difference of potentials and the value of hydrostatic pressure.
The analytical expression has been derived for average lifetime of BLM under a
combined impact of electrostatic field and hydrostatic pressure. It is demonstrated,
too, that average lifetime of BLM exponentially reduces depending on the growth
of trans-membrane difference of potentials and hydrostatic pressure.
Structural and Functional Significance
of Polypeptide phi, psi outliers
High-resolution X-ray crystal structures in the Protein Data Base typically present one or more residues with dihedral angles phi and psi of the polypeptide
backbone that deviate from sterically allowed and energetically favored regions
of the Ramachandran map. Previous analyses (1, 2) indicated that the deviations
cluster in phi, psi space and that certain small polar residue types are overrepresented among these outliers. These findings suggest that local interactions may
compensate for unfavorable backbone energies. Some outliers are preserved in
independently solved structures deposited in the database, suggesting functional
relevance. The substantial expansion of the database since the time of the previous
analyses prompted renewed evaluation of phi, psi outliers. Preliminary results of
this analysis will be presented together with an evaluation of whether the dataset is
currently large enough to address the following questions. What is the frequency
of outlier residue types? Do local interactions define structural motifs? Is there a
relationship between structural motifs and residue type? Do enzymes differ from
non-enzyme proteins in frequency, identity, or local interactions of outliers? Are
local interactions energetically compensatory?
1. Gunasekaran, K., Ramakrishnan C., Balaram P. J Mol Biol 264, 191-198 (1996).
2. Pal, D., Chakrabarti, P. Biopolymers 63, 195-206 (2002).
869
125
V. B. Arakelyan1,*
H. K. Gevorgyan1
G. H. Potikyan2
1
Physics Department
Chair of Molecular Physics
Yerevan State Medical Univ.
2
Chair of Medical Physics
v.arakelyan@ysu.am
*
126
Harish Balasubramanian1
Kenneth Gunasekera2
Jannette Carey1,*
1
Princeton University
Princeton NJ 08544-1009
Mount Sinai High School
2
Long Island, NY
jcarey@princeton.edu
*
870
127
Seetharama D. Satyanarayanajois*
Sharon Ronald
College of Pharmacy
University of Louisiana at Monroe
Monroe LA 71201, USA
jois@ulm.edu
*
Targeting HER2 Protein for Breast Cancer:
Exploring the Chemical Space of Peptidomimetics
for HER2 Binding Using Docking Method
Growth factors are important mediators of cell proliferation. The interaction of
growth factors with their receptors generates signal transduction. The intracellular
domains of these receptor proteins are protein tyrosine kinases. The overexpression
or activation of these receptors results in uncontrolled cell proliferation. Epidermal
growth factor receptor (EGFR) kinase and the related human epidermal growth factor receptor-2 (HER2, ErbB-2) are two growth factor receptors that have implications in cancer. The overexpression or activation of HER2 protein occurs frequently
in breast, ovarian, and lung cancers. Blocking of HER2-mediated signaling with antibodies has shown to be effective in inhibiting cell growth. By analyzing the crystal
structure of the HER2 and its antibody (herceptin) complex, we have designed several peptidomimetics to inhibit HER2-mediated signaling for cell growth. Two of
the compounds, HERP5 and HERP7, exhibited antiproliferative activity with IC50
values of 0.390 μM and 0.143 μM, respectively, against breast cancer cell lines.
To increase the potency of HERP5 and HERP7, we have modified these molecules
structurally. Computational docking methods were used to explore the interactions
of various analogs of HERP5 and HERP7 with the HER2 protein extracellular domain. A total of 51 compounds were docked to the HER2 protein, and their binding
modes were analyzed. Compounds that exhibited low docking energy were chosen
for chemical synthesis and their biological activity was assessed. The anticancer
effect of these compounds was evaluated in cell culture assays using BT474 and
SKBR3 cell lines that overexpress HER2 protein and MCF-7 breast cancer cell
lines that do not overexpress HER2 protein. The results indicated that peptidomimetics with a phenyl group in the C-terminal of the peptidomimetic exhibit potential antiproliferative activity. These results will be useful to extend our studies on
the structure-activity correlation of novel anticancer agents and to understand the
modulation of signals mediated by HER2 protein to target breast cancer.
The project described was supported by Grant Number P20RR016456 from the
National Center For Research Resources. The content is solely the responsibility
of the authors and does not necessarily represent the official views of the National
Center for Research Resources or the National Institutes of Health.
128
Igor G. Morgunov*
Svetlana V. Kamzolova
G. K. Skryabin Institute of Biochemistry
and Physiology of Microorganisms
pr-t Nauki 5, Pushchino
Moscow Region 142290, Russia
morgunovs@rambler.ru
*
The Binding of Citrate Synthase and
Malate Dehydrogenase with the Inner
Mitochondrial Membrane
In the last twenty years it has been demonstrated that sequential enzymes which
operate within metabolic pathway interact with each other to form highly organized
complexes. The term “metabolon” was introduced by Paul Srere to describe such
enzyme-enzyme complexes (1). In a series of previous studies with use of various
methodological approaches it has been shown that interaction occur between two
sequential enzymes of Tricarboxylic acid cycle – mitochondrial citrate synthase and
mitochondrial malate dehydrogenase (mMDH) (2-4) but no interaction between
citrate synthase and cytosolic malate dehydrogenase (cMDH).
Channeling of oxaloacetate in the malate dehydrogenase and citrate synthase-coupled systems was tested using polyethylene glycol precipitates of CS and mMDH,
and citrate synthase and cMDH. The effectiveness of large amounts of aspartate
aminotransferase and oxaloacetate decarboxylase, as competing enzymes for the
intermediate oxaloacetate, was examined. Aspartate aminotransferase and oxaloacetate decarboxylase were less effective competitors for oxaloacetate when pre-
cipitated citrate synthase and mMDH in polyethylene glycol was used at low ionic
strength compared with free enzymes in the absence of polyethylene glycol or with
a co-precipitate of citrate synthase and cMDH. Substrate channeling of oxaloacetate with citrate synthase-mMDH precipitate was inefficient at high ionic strength.
These effects could be explained through electrostatic interactions of mMDH but
not cMDH with citrate synthase.
871
Also, the specific binding of the enzymes studied to the inner surface of the mitochondrial inner membrane was demonstrated by absorbtion experiments (Table) and
using immunochemical method with gold colloids labelling antibodies (Figure).
Table
The binding of CS and MDH with the various mitochondrial membranes.
Enzymes/membranes
CS + mitoplasts
CS + inside-out mitochondrial vesicles
mMDH + mitoplasts
mMDH + inside-out mitochondrial vesicles
cMDH + mitoplasts
cMDH + inside-out mitochondrial vesicles
Binding of
enzyme (%)
12 ± 3
61 ± 2
6 ± 1
89 ± 3
0
0
No binding of
enzyme (%)
88 ± 5
39 ± 3
95 ± 6
12 ± 3
100
100
Gold colloids labelling second antibody
First
antibody
Figure: The schematic image of procedure of labelling
of CS and mMDH by colloid gold.
Enzyme(CS/mMDH)
inside-out
mitochondrial vesicles
1.
2.
3.
4.
Srere, P. A. Trends Biochem Sci 10, 109-110 (1985).
Shatalin, K., Morgunov, I., Srere, P. A. FASEB J 11, 928 (1997).
Morgunov, I., Srere, P. A. J Biol Chem 27, 29540-29544 (1998).
Velot, Ch., Lebreton, S., Morgunov, I., Usher, K., Srere, P. Biochemistry 38, 1619516204 (1999).
872
129
Dmitry Kurouski
Igor K. Lednev
Chemistry Faculty, SUNY Albany
1400 Washington Ave.
Albany, NY, 12222
Dk451915@albany.edu
lednev@albany.edu
130
Tom Duncan
Gino Cingolani*
SUNY Upstate Medical University
Biology, 750 E. Adams Street
Syracuse, NY 13210
cingolag@upstate.edu
*
The Structure and Morphology of Amyloid
Fibrils Depend on Protein Disulfide Bonds
Disulfide bonds play an important role in stabilizing proteins in its native physiologically active conformation. The integrity of protein disulfide bonds could be
compromised in cell environment due to the presence of free transitional metals
like cupper and iron, hydrogen peroxide and reactive oxygen species, etc. Reduced
or disrupted disulfide bonds could lead to the misfolding and aggregation of protein
molecules, including formation of fibrillar aggregates associated with neurodegenerative diseases such as Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s diseases (HD), prion disease, and type II diabetes. We hypothesized that
the presence or absence of disulfide bonds in proteins is an important factor that
determines the structure and morphology of amyloid fibrils, insoluble aggregates
with regular cross-β-structure founded in organs and tissues of patients with neurodegenerative diseases. Amyloid fibrils are noncrystalline and insoluble that limits
the application of classical tools of structural biology such as X-ray crystallography
and solution NMR. Deep ultraviolet resonance Raman (DUVRR) spectroscopy has
been proven to be an efficient technique for characterizing structure of amyloid
fibrils. It exhibits unique sensitivity to protein secondary structures and confidently
distinguishes main structural elements including α-helix, β-sheet, and random coil
conformations. In this study, we used DUVRR spectroscopy, atomic force microscopy (AFM), and CD spectrocopy for comparing the structure of amyloid fibrils
formed from apo-α-lactalbumin, a small milk whey protein of most mammals species, with four intact disulfide bonds and 1-SS-carboxymethillactalbumin, in which
just one disulfide bond is preserved. We found that both proteins formed fibrils
after prolonged incubation in acidic medium, but the morphology of the resulting
fibril polymorphs is different. By combining DUVRR spectroscopy with hydrogen
deuterium exchange we also demonstrated that the fibril core of the polymorphs
had different structure. The obtained results might have an important biomedical
meaning because different fibril polymorphs could have different toxicity and accordingly play different roles in pathological processes of degenerative diseases.
Three-Dimensional Structure of the Escherichia coli
F1-ATPase in a Self-inhibited Conformation
We report the crystal structure of the E. coli F1-ATPase (EcF1) depleted of the
δ-subunit, at 3.3 Å resolution. The structure was solved by a combination of molecular replacement and 4-fold non-crystallographic symmetry averaging, which
yielded an electron density map of excellent quality. The sequences of the entire
α3β3γε subunits (M.W. ~375kDa) were unambiguously interpreted using selenomethionine-labeled protein. The general architecture of the α3β3γ ‘core’ is similar to
that of the bovine mitochondrial F1 (MF1), but with greater asymmetry between
pairs of αβ subunits. The conformation of ε (δ in MF1) is the most striking feature.
Unlike δ in MF1, ε’s C-terminal domain (CTD) adopts a highly extended state: helix-1 extends up to pack on one side of γ’s ‘foot’ domain, the following loop packs
below the ‘DELSEED’ motif of subunit βDP, and helix-2 inserts into the central cavity of EcF1 to form an antiparallel trimeric coiled-coil with part of γ’s N-terminal
helix. This interaction blocks specific contacts between γ and the CTDs of αDP/βDP
subunits, which are shifted away from γ’s central rotary shaft. Terminal residues of
the ε-subunit adopt a non-helical conformation that embrace both γ-subunit helices
and extend across the central cavity to contact βTP near the inner surface of its catalytic nucleotide-binding site. Overall, intrusion of ε’s CTD into the central cavity
is likely to block subunit motions involved in the rotary catalytic cycle of F1 or the
intact ATP synthase (FOF1). This structure sheds light on an inhibitory mechanism
that is unique to bacterial and chloroplast ATP synthases.
Modeling Protein-Protein Interface Interactions
as a Means for Predicting Protein-Protein
Interaction Partners
We report a novel 3D structure-based method of predicting protein-protein interaction (PPI) partners. The method involves screening for pairs of tetrahedra representing interacting amino acids at the interface of the protein-protein (PP) complex. Hbonds and VDW interactions at the protein interface in the complex are determined,
and interacting tetrahedral motifs (Reyes, V. M., 2008a) -- one from each protein -representing backbone or side chain centroids of the interacting amino acids, are then
built. Using the method, a collection of 801 functionally unannotated protein structures in the PDB were then screened for pairs of tetrahedral motifs characteristic of
9 binary complexes, namely: (I) RAP-Gmppnp – c-RAF1 Ras-binding domain; (II)
RHOA – protein kinase PKN/PRK1 effector domain; (III) RAC – RHOGD1; (IV)
RAC – P67PHOX; (V) kinase-associated phosphatase (KAP) – phospho-CDK2;
(VI) Ig Fc – protein A fragment B; (VII) Ig light chain dimers; (VIII) beta-catenin –
HTCF-4; and (IX) IL-2 homodimers, of which the algorithm found 45, 192, 27, 48,
120, 0, 72, 90, and 276 putative complexes, respectively. Negative and positive controls test indicate that the screening algorithm has at least acceptable specificity and
sensitivity. The results were further validated and narrowed down by applying the
“Cutting Plane” and “Tangent Sphere methods”. (Reyes, V. M., 2008d) for quantitative determination of interface burial, which is indicative of monomer overlap in the
complex. One advantage of our method besides its simplicity, speed and scalability,
is its protein docking nature, a property that we demonstrate here.
Pharmacophore Modeling Using a Reduced
Protein Representation as a Tool for
Srtucture-Based Protein Function Prediction
Using the double centroid reduced representation (DCRR) of proteins, we have
modeled the pharamacophores for ATP and GTP in ser/thr protein kinases (stPK)
and small Ras-type G-proteins (RtGP). In DCRR, each amino acid in the protein
is represented by two points, namely, the centroids of its backbone and sidechain
atoms. The pharmacophore model, which we call the ‘3D search motif’ (3D SM),
is a tetrahedron with a unique root node, R, and three branch nodes, n1, n2, and n3;
it also has three root-branch edges, Rn1, Rn2, and Rn3, and three branch-branch
edges, n1n2, n1n3, and n2n3, all of specific lengths. These four nodes correspond
to the four amino acids with the most dominant interactions (hydrogen bonds and
van der Waals interactions) with the ligand atoms. We next developed an analytical algorithm (written in Fortran 90) for screening protein 3D structures for the
3D SM. The ATP and GTP 3D SMs were determined from sets of experimentally
solved training structures, all of which contain the bound ligand. Validation tests
performed on ‘unseen’ positive and negative structures reveal that the specificity of
the method is nearly 100% for both protein families, and a sensitivity of 60% for the
stPK family and approximately 93% for the RtGP family. Further tests reveal that
our algorithm can distinguish effectively between GTP and GTP-like ligands, and
between ATP- and ATP-like ligands. It is also shown that the method, which is local
structure-based, works successfully in cases where global structure-based methods
fail. These results show that the combined modeling and screening methods might
be effective for the prediction of proteins belonging to the RtGP and stPK families.
Finally, as a benchmark experiment, the method was applied to a set of protein 3D
structures predicted by 123D threading and partially refined by Modeller v6.2 from
the proteome of Dictyostelium discoideum, with promising results.
873
131
Vicente M. Reyes
Dept. of Biological Sciences
Rochester Institute of Technology
Rochester, NY 14623
vmrsbi@rit.edu
132
Vicente M. Reyes
Rochester, NY 14623
vmrsbi@rit.edu
874
133
Vicente M. Reyes
Rochester, NY 14623
vmrsbi@rit.edu
134
Vicente M. Reyes
Rochester, NY 14623
vmrsbi@rit.edu
Pharmacophore Modeling Using a Reduced Protein
Representation: Application to the Prediction of ATP,
GTP, Sialic Acid, Retinoic Acid, and Heme-Bound
and -Unbound Nitric Oxide Binding Proteins
Due to increased activity in high-throughput structural genomics efforts around
the globe, there has been a steady accumulation of experimentally solved protein
3D structures lacking functional annotation, thus generating a need for structurebased protein function assignment methods. Prediction of ligand binding sites is a
well-established protein function assignment method. Here we apply the specific
ligand binding site (LBS) detection algorithm we recently described (Reyes, V.
M., 2008a) to 801 functionally unannotated experimental structures in the PDB,
screening for the binding sites of 6 biologically important ligands: GTP in small
Ras-type G-proteins, ATP in ser/thr protein kinases, sialic acid, retinoic acid, and
heme-bound and unbound nitric oxide. Validation of the algorithm for the GTPand ATP-binding sites has been previously described; here, validation for the binding sites of the 4 other ligands showed acceptable specificity and sensitivity as
well. Of the 801 structures screened, 1.0% tested positive for GTP binding, 7.6%
for ATP binding, 4.4% for sialic acid binding, 16.5% for retinoic acid binding,
4.1% for heme-bound nitric oxide binding, and 1.2% for unbound nitric oxide
binding. Using the ‘Cutting Plane’ and the ‘Tangent Sphere’ methods described
previously, (Reyes, V. M., 2008d), we also determined the degree of burial of the
ligand binding sites detected. These ligand burial measures were compared with
those in the respective training structures, and the degree of similarity between the
two values as taken as a further validation of the predicted LBSs.
Representing Protein 3D Structures in Spherical
Coordinates – Two Applications: 1. Detection of
Invaginations, Protrusions, and Potential
Ligand Binding Sites; and 2. Separation of Protein
Hydrophilic Outer Layer from the Hydrophobic Core
A Fortran 90 program was written to convert a protein 3D structure PDB file in
Cartesian coordinates to spherical coordinates (rho, phi, theta), with the centroid
(center of mass) of the protein molecule as origin. We investigated the utility of
this representation in the (I) detection of invaginations, protrusions, and potential
ligand binding sites (LBSs) on the protein surface, and (II) separation of the hydrophilic outer layer (HOL) from the hydrophobic inner core (HIC) of protein molecules. The dataset of Laskowski et al., (Prot Sci, 1996), composed of 67 singlechain protein structures, was used as test set in evaluating both applications. Both
phi and theta are partitioned into suitable intervals (e.g., 6- and 8-degree intervals,
respectively), giving rise to 1,350 phi-theta bins partitioning all of 3D space. The
atom with maximum rho in each phi-theta bin is sequestered. In the first application, this step is done in both the liganded and unliganded form of the query protein
and the frequency distribution of the maximum rho values from both forms are
plotted superimposed on each other. Invaginations on the protein surface give rise
to subpeaks or shoulders on the lagging side of the main peak, while protrusions
give rise to similar shoulders, but on the leading side of the main peak. We find
that most LBSs are associated with such subpeaks and therefore propose that such
subpeaks are potential LBSs. In the second application, a suitable cutoff value
for rho, e.g., 0.95rho, is adopted for each phi-theta bin: all atoms with rho values
less than this cutoff value are considered part of the HIC, and those with equal or
greater rho values part of the HOL. Except for a very few special cases, we show
that all of the proteins in the Laskowski dataset, after undergoing our HOL-HIC
separation procedure, give rise to an outer layer that is significantly more enriched
in hydrophilic amino acid residues, an an inner core that is significantly more enriched in hydrophobic amino acid residues. In addition, a quick but effective way
of determining active sites in the HIC and protein-protein interaction (PPI) interfaces in the HOL was derived. Once the HIC and the HOL are separated, the HIC
may be searched for His, Glu, Asp, or Cys residues as potential active sites, and
the HOL searched for clusters of hydrophobic amino acid residues as potential PPI
interfaces (data not shown). We conclude that spherical coordinate representation
of protein structures is a useful alternative to Cartesian coordinate representation,
and may well find other useful applications beyond the ones described here.
Two Complementary Methods for Quantifying Ligand
Binding Site Burial Depth in Proteins: The “Cutting
Plane” and the “Tangent Sphere Methods”
We describe two complementary methods to quantify the degree of burial of ligand
and/or ligand binding site (LBS) in a protein-ligand complex, namely, the ‘cutting
plane’ (CP) and the ‘tangent sphere’ (TS) methods. To construct the CP and TS,
two centroids are required: the protein molecular centroid (global centroid, GC),
and the LBS centroid (local centroid, LC). The CP is defined as the plane passing
through the LBS centroid (LC) and normal to the line passing through the LC and
the protein molecular centroid (GC). The “exterior side” of the CP is the side opposite GC. The TS is defined as the sphere with center at GC and tangent to the CP at
LC. The percentage of protein atoms (a) inside the TS, and (b) on the exterior side
of the CP, are two complementary measures of ligand or LBS burial depth since
the latter is directly proportional to (b) and inversely proportional to (a). We tested
the CP and TS methods using a test set of 67 well characterized protein-ligand
structures (Laskowski, et al., 1996), as well as the theoretical case of an artificial
protein in the form of a cubic lattice grid of points in the overall shape of a sphere
and in which LBS of any depth can be specified. Results from both the CP and TS
methods agree very well with data reported by Laskowski et al., and results from
the theoretical case further confirm that that both methods are suitable measures of
ligand or LBS burial. Prior to this study, there were no such numerical measures
of LBS burial available, and hence no way to directly and objectively compare
LBS depths in different proteins. LBS burial depth is an important parameter as
it is usually directly related to the amount of conformational change a protein
undergoes upon ligand binding, and ability to quantify it could allow meaningful
comparison of protein dynamics and flexibility.
875
135
Vicente M. Reyes
Rochester, NY 14623
vmrsbi@rit.edu
136
A Low-Temperature Thermal Transition
for Quadruplex DNAs
It is often assumed that the G-quartet structure that dominates near room temperature is the only low-temperature form of these DNAs. Here we present evidence
for additional low-temperature structures of two G-quartet sequences that dominate below 12 ºC at moderate salt concentrations. Using analytical ultracentrifugation, we found that the sedimentation coefficients of G-quadruplex DNAs have
minimum values near 12 ºC while that of a representative single-stranded DNA
increases monotonically with temperature. The minimum in S20w observed with Gquadruplex indicates that at lower temperatures, G-quadruplexes are less compact
than they are at ~12 ºC. Circular dichroism and fluorescence anisotropy data are
also consistent with thermal transition near 12 ºC. We interpret this as evidence in
the presence of a conformation that is more stable at low temperature than the dominant conformation that is observed at 20 ºC. In protein systems, cold denaturation
Lance M. Hellman*
Whitney Tackett
Emily Lawson
Michael G. Fried
Dept. of Molecular & Cellular
Biochemistry, Center for Structural
Biology, University of Kentucky College
of Medicine, Lexington, KY 40536
lmhell2@uky.edu
*
876
is a characteristic of unfolding transitions with ΔCp>0; the contrasting behaviors of
quadruplex and single-stranded DNAs suggests that the magnitude and possibly the
sign of ΔCp may depend on the secondary structures of initial and final states.
137
This work was supported by the National Institutes of Health [GM070662].
A. A. Ghazaryan1,*
S. A. A. Sulyman1,2
Y. B. Dalyan1
The water-soluble porphyrins and their derivatives comprise an important class of
compounds whose chemical and photochemical properties are widely exploited in
both medical and biological applications. Therefore, many researchers attempt to
study their interaction with DNA and create drugs on basis of porphyrins.
Yerevan State University,
1
Yerevan, Armenia
Mosul University,
2
Mosul, Iraq
ghazaryan@gmail.com
*
138
Yu. S. Babayan*
G. L. Kanaryan
S. Yu. Babayan
P. S. Khazaryan
L. R. Grigoryan
2 Korjun Str., Yerevan 0025
Armenia
ysbaba@ysmu.am
*
Binding of new Ag-containing Porphyrins
with DNA. The influence of pH
The interaction of three new cationic meso-tetra(4N-allylpyridyl)porphyrin [AgTAlPyP4], meso-tetra(4N-butylpyridyl)prophyrin [AgTButPyP4] and meso-tetra(4Noxyethylpyridyl)porphyrin [AgTOEtPyP4] with Calf Thymus DNA at different pH
has been investigated by Circular Dichroism (CD) and UV/visible-spectrophotometric methods. The changes in absorption spectra of porphyrins (at Soret region) in the
presence of DNA at different temperatures were measured. From these dependence
the binding constant, K, and stoichiometry, n, were calculated using McGhee and
von Hippel equation. Further based on temperature dependence of K thermodynamic
parameters of binding (free energy, enthalpy and entropy) were calculated.
The investigations of obtained data shows that the decrease of pH from 7.3 to 5
leads to changes of the sign of binding enthalpy from positive (unfavorable) to
negative (favorable). These changes can account for the binding mode change affected by pH. The favorable enthalpy and the sign on induced CD spectra registered
at lower pH lets us to conclude that under the low pH buffer conditions these porphyrins tend to bind with DNA via intercalation.
Binding of Some Antitumour Compounds with the
DNA-radiated Millimeter Electromagnetic Waves
In water-salt solution the molecules of water form definite spatial structures the
reverberatory absorption frequency of which is the millimeter range of electromagnetic waves. In the given work the thermodynamic parameters of the binding
of intercalating compounds of mitoxantrone, ametantrone, and nonintercalatingnitropsin with the calf thymus DNA, previously radiated by the millimeter coherent electromagnetic waves of nonthermal intensity, are studied. The water solutions of the DNA, prepared for the spectrophotometric titration, were radiated for
90 minutes. The DNA solutions were radiated at resonant (64,5 and 50,3 GHz)
and nonresonant 48,3 GHz for water structures frequencies. The VHF generators
were applied for radiation. The density of the stream power at the sample was ~50
microwatt/sm2. The experiments show that both for the radiated nonradiated DNA
the same pattern of the changes of DNA solution absorption which is a results
of the binding with antitumour compounds is observed. Consequently, under the
investigated conditions they interact both with the radiated and nonradiated DNA
in the same means. The binding constant (K) and the stoichiometry of antitumour
compounds with the radiated DNA are calculated from the stoichiometry titration
spectrum. Using the value of (K) it is possible to define the changes of Gibbs free
energy and enthropy at the binding of investegated compounds with the radiated
DNA. Calculations show that they form a more stable complex (K inereases) with
the DNA ratiated at resonant for water structures 64,5 and 50,3 GHz frequencies.
This leads to more significant changes of the complexes enthropy. When the same
DNA solutions are radiated at 48,3 GHz frequency, the thermodynamic parameters
of antitumour compounds binding with the radiated DNA change insignificantly
as compared with nonradiated DNA and are within the range of experiment error. Consequently, as a result of DNA radiation at resonant for water structures
frequencies, such changes in the hydrate shell of the DNA occur, that antitumour
compounds form more stable complex with them.
877
139
Cisplatin Action on Content of Neutral
Lipids of Rat Liver and Brain Nuclei
Cisplatin (Cis-diaminedichloroplatinum) is an effective antitumor agent commonly
used in chemotherapy. Although DNA was considered primary target of cisplatin,
many aspects of its action at the cellular level still remain unknown.
The plasmatic membrane constitutes the first cellular barrier that encounters cisplatin and other drugs. Many anticancer drugs show membrane effects via binding to
membrane phospholipids before entering the cytoplasm. Cisplatin has been shown
to decrease fatty acid synthase activity, which causes changes in cell membrane
fluidity and function. Cisplatin induces apoptosis also by increase in membrane
fluidity via sphingomyelinase activation.
At present a number of additional properties of cisplatin emerge including activation of signal transduction pathways leading to apoptosis. How cisplatin passed
through nuclear membrane and how it penetrated into the nuclei still remains unknown. It is possible that lipids may be involved in mechanisms of cisplatin induced apoptosis as second messengers of nuclear autonomous signaling pathway,
or as intranuclear structure components. It is of interest to establish to what extent
cisplatin alters lipid metabolism in nuclei.
Hakobyan N. R.
Yavroyan Zh. V.
Hovhannisyan A. G.
Gevorgyan E. S.
Yerevan State Univ.
1 Alex Manoogyan
St. Yerevan, 0025, Armenia
gevorgyan_emil@yahoo.com
*
The in vivo effect of cisplatin (after 24 hour) on neutral lipids content of rat liver
and brain nuclei was investigated. Neutral lipids were fractionated by microTLC
technique. The quantitative valuation of fractionated neutral lipids was established
by computer software FUGIFILM Science Lab. 2001 Image Gauge V 4.0. The results of our study confirm that neutral lipids of rat liver and brain nuclei exhibit
diversity in content and in sensitivity to cisplatin action. These changes may be
resulted from cisplatin antitumor action.
140
Cooperative Effect of EtBr on DNA-cis-DDPt Complexes
In the current series of investigations the effects of EtBr on cis-DDP-DNA complexes was studied. The experiments were conducted within the relative cis-DDP/DNA
concentration ranging between 1·10-5 to 5·10-2. The concentrations of EtBr were
chosen in the lowers range to insure low levels of DNA saturation. The conditions
were optimized to obtain isotherm of adsorption of EtBr with cis-DDP-DNA complexes within the linear region in the Sketchard’s coordinates. The linear isotherm
of DNA-ligand binding allow to determine characteristic parameters of binding such
as the binding constant (K) and the number of biding sites (n) on DNA for a ligand
(e.g., EtBr) (1, 2). Experimental results show that both binding constant and number
of biding sites change with the relative concentration of cis-DDP/DNA complex.
Poghos O. Vardevanyan1,*
Anush V. Arakelyan1
Ara P. Antonyan1
Lilit S. Baghdasaryan1
Gor S. Sarkisyan2
At low cis-DDP/DNA relative concentration, the molecule of DNA undergoes
fundamental changes in which cis-DDP forms pseudo circular structure in DNA,
which, in turn, allows EtBr to intercalation into the dsDNA with greater ease in the
circular regions of DNA. As a result the value of K increases. Simultaneously the
value of n is readily reduced. At high cis-DDP/DNA relative concentration value of
2
Dept. of Biophysics, Yerevan State
1
University, Yerevan, 0025, Armenia
The Scripps Research Inst.
10550 N. Torrey Pines Rd.
La Jolla, CA 92037
biophys_dep@mail.ru
*
878
K deceases as a result of single and double strand brakes in DNA. With decrease in
dsDNA, predominating mode of interaction of EtBr with DNA becomes semi intercalation. Farther increase in cis-DDP/DNA relative concentration, values of both
K and n increase because with increase in concentration of cis-DDP the amount
of double strand brake increases which results in formation of short dsDNA fragments. Under such conditions (high cis-DDP concentrations) interaction of EtBr
with cis-DDP/DNA complex mainly occurs via the intercalation mode.
141
Poghos O.Vardevanyan*
Ara P. Antonyan
Ruzanna A. Karapetian
Marine A. Parsadanyan
Mariam A. Shahinyan
Dept. of Biophysics
Yerevan State Univeristy
Yerevan 0025, Armenia
biophys_dep@mail.ru
1. Bloomfield, V. A., Crothers, D. M., Tinoco I. Nucleic Acids. Structures, Properties and Functions. University Science Books, Sausalito, California, (1999). (ISBN 0-935702-49-0).
2. Arakelyan, V. B., Babayan, Yu. S., Tairyan, V. I., Arakelyan, A. V., Parsadanyan, M. A.,
Vardevanyan, P. O. J Biomol Str Dyn 23, 479-483 (2006).
Different Modes of Hoechst 33258 Binding
with Different GC-content DNAs
The thermal stability of different GC-content DNA double helixes (ds-DNA) in the
presence of Hoechst 33258 (H33258) was investigated using thermal denaturation
monitored by UV absorbance. It was found that the H33258 displayed a marked
effect on thermal stability of ds-DNA: melting temperature (Tm) of the ligand-DNA
complexes are greater than that of naked DNA. H33258 is well-known to have a
primary preference for A/T stretches suggesting that the width of the helix-coil
transition for DNA in the absence of the ligand (Δ0T) must be greater than that for
complexes (ΔT). Our experimental results show that the dependences of δ(ΔT/Tm2)
= ΔT/Tm2 – Δ0T/T02 on ligand to nucleotides molar ratios (rb) for the complexes of
H33258 with Cl. perfr. (31% of GC content) and for M.lysod. (72% of GC content)
coincide very closely at μμ = 2 mM Na+. This result suggests that the minor groove
structure and hydration, which play the dominant role for optimization of van der
Waals’ contacts and hydrogen bonding for the ligand interaction with DNA are quite
different from the preferential binding sites for the ligand at low ionic strength. The
binding preference of H33258 for AT-rich regions of ds-DNA becomes obvious
when the salt concentration increases μ > 10mM Na+. The dependences of δ(ΔT/
Tm2) on rb become negative expressing the AT specificity of the ligand. The great
difference in the shape of dependences of δ(ΔT/Tm2) at low (μ = 2 mM Na+) and
high (μ = 20 mM Na+) demonstrate the influence of environment, detailed nature of
binding sites and different hydration of the minor groove of different GC-content
DNAs playing an important role in ligand interaction (1, 2).
1. S. Y. Breusogen, et al. JMB 315, 1049-1061 (2002).
2. A. N. Lane and T. C. Jenkins. Quar Revews of Biophysics 33, 255-306 (2000).
Dinuclear Ruthenium(II) Complexes
as G-Quadruplex DNA
Telomerase is an essential factor in cellular immortalization and tumorigenesis,
it has been detected in some 80-90% of all human cancers but in relatively few
normal cell types (1). Thus, the inhibition of telomerase activity by inducing/stabilizing G-quadruplex formation is an important approach for developing new anticancer drugs (2). During the past decade many studies have been devoted to the
G-quadruplex recognition, and a number of small molecules are found to be able to
selectively promote the formation and/or stabilization of G-quadruplex (3). In the
present work, a series of dinuclear Ru(II) complexes [(bpy)2Ru(BL)Ru(bpy)2]4+
(BL = mbpibH2, hbibH3, and ebipcH2) were designed and synthesized. CD and
FRET melting results indicated that dinuclear Ru(II) complexes selectively promote the formation of antiparallel G-quadruplex structures and induce positive Tm
shifts in K+ and Na+ buffer. The Ru(II) complexes as telomerase inhibitors were
also examined through the utilization of modified telomerase repeat amplification
protocol (TRAP). Ru(II) complexes show high activity for telomerase inhibition.
The properties of these Ru(II) complexes make them promising candidates to explore the biological function of G-quadruplexes and form the basis for developing
a new class of telomerase inhibitors.
Acknowledgments
We are grateful to the supports of 973 Program of China, NSFC and the Ministry of Education.
1. Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, M. D., Ho, P. L., Coviello,
G. M., Wright, W. E., Weinrich, S. L., Shay, J. W. Science 266, 2011 (1994).
2. Ma, D.-L., Lai, T.-S., Chan, F.-Y., Chung, W.-H., Abagyan, R., Leung, Y.-C., Wong, K.-Y.
Chem Med Chem 3, 881 (2008).
3. (a) Huppert, J. L. Chem. Soc. Rev. 37, 1375 (2008). (b) Kieltyka, R., Englebienne, P., Fakhoury, Autexier, C., Moitessier, N., Sleiman, H. F. J Am Chem Soc 130, 10040 (2008). (c)
Shi, S., Liu, J., Yao, T., Geng, X., Jiang, L., Yang, Q. Y., Cheng, L., Ji, L. N. Inorg Chem 47,
2910 (2008).
879
Li Xu
Hui Chao
Liangnian Ji*
142
MOE Lab of Bioinorganic and
Synthetic Chemistry, MOE Lab of
Gene Engineering, State Key Lab
of Optoelectronic Materials and
Technologies, Sun Yat–Sen University
Guangzhou 510275, China
cesjln@mail.sysu.edu.cn
*
DNA Double Helices Recognize Mutual Sequence
Homology in a Protein Free Environment
880
143
2
Organization, processing, and repair of genetic material involves direct interactions
between DNA double helices at small distances. These interactions are believed to
be independent of the base pair sequence because the nucleotides are buried inside
the double helix and shielded by the charged sugar-phosphate backbone. A recent
theory challenged this concept, predicting that DNA-DNA interactions depend on
the backbone structure and that the sequence dependence of the backbone structure
may be sufficiently strong to affect the interactions. However, the latter hypothesis
has not been experimentally verified. Here we demonstrate sequence homology recognition between duplex DNAs without unzipping of the double helix and without
proteins or other ligands. We imaged a mixture of two fluorescently tagged DNAs
with identical nucleotide composition and length, but different sequences. Their segregation within liquid crystalline spherulites reveals not only the recognition without
any single-strand fragments but also the recognition between duplexes separated by
more than a nanometre of water. Although cells tightly regulate interactions between
DNA through a variety of proteins, the underlying DNA-DNA forces may still be
utilized in some form for the observed pairing of homologous duplexes. The ability
of these forces to recognize only large-scale (> 50-100 bp) sequence homology may
be crucial and it may not be a coincidence that it matches the minimal 50-100 bp
homology requirement essential for avoiding mistakes in genetic recombination.
Imperial College London
Geoff S. Baldwin1,*
Nicholas J. Brooks2
Rebecca E. Robson2
Aaron Wynveen2
Arach Goldar2
Sergey Leikin3
John M. Seddon2
Alexei A. Kornyshev2
Division of Molecular Biosciences
1
SW7 2AZ London, UK
SW7 2AZ London, UK
Section on Physical Biochemistry
3
National Institute of Child Health and
Human Development
National Institutes of Health, DHHS
Bethesda, MD 20892, USA
g.baldwin@imperial.ac.uk
*
144
Claire Adams*
Michael Fried
Dept of Molecular and Cellular
Biochemistry
Center for Structural Biology
University of Kentucky
Lexington, KY 40536
cadams@uky.edu
*
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
A. Minsky. Ann Rev Biophys Biomol Struct 33, 317-342 (2004).
W. Gelbart, R. Bruinsma, P. Pincus, and V. Parsegian. Physics Today 53, 38-44 (2000).
A. A. Kornyshev, D. J. Lee, S. Leikin, and A. Wynveen. Rev Mod Phys 79, 943-996 (2007).
W. K. Olson, A. A. Gorin, X. J. Lu, L. M. Hock, and V. B. Zhurkin. Proc Natl Acad Sci USA
95, 11163-1168 (1998).
A. A. Gorin, V. B. Zhurkin, and W. K. Olson. J Mol Biol 247, 34-48 (1995).
R. E. Dickerson. Methods Enzymol 211, 67-111 (1992).
A. G. Cherstvy, A. A. Kornyshev, and S. Leikin. J Phys Chem B 108, 6508-6518 (2004).
A. A. Kornyshev and S. Leikin. Phys Rev Lett 86, 3666-3669 (2001).
S. M. Burgess, N. Kleckner, and B. M. Weiner. Genes Dev 13, 1627-1641 (1999).
B. M. Weiner and N. Kleckner. Cell 77, 977-991 (1994).
P. Shen and H. V. Huang. Genetics 112, 441-457 (1986).
J. Rubnitz and S. Subramani. Mol Cell Biol 4, 2253-2258 (1984).
DNA Repair Mutants Of O6-alkylguanine-DNA
Alkyltransferase (AGT) that affect DNA Binding
Affinity, Cooperativity, and Repair
The O6-alkylguanine-DNA alkyltransferase (AGT) catalyzes the repair of promutagenic O6-alkylguanine and O4-alkylthymine residues in eukaryotic cells by transferring alkyl groups to residue C145 in its active site. Although one molecule of AGT
occupies ~8bp along the minor groove surface of double stranded DNA, cooperative
binding to double stranded and single stranded DNAs can reach densities as high as
1 protein/4 bp (or nt). To account for these facts, we have proposed a model in which
protein molecules overlap along the DNA contour. This model identifies protein surfaces that are likely to be juxtaposed in the cooperative complex. Chemical crosslinking followed by proteolysis and mass spectrometry was one method used to test
the model. Consistent with predictions, the results define two protein surfaces that
are adjacent in the cooperative complex but not in the free protein. Mutagenesis of
residues in these surfaces has resulted in six mutant proteins to date, all of which fold
to compact forms as measured by analytical ultracentrifugation. CD spectroscopy
reveals that three are indistinguishable from wild-type AGT and three have altered
secondary structure compositions. All mutant proteins have significantly reduced
DNA binding constants when compared to wild type AGT in vitro. Cooperativity
of DNA binding varied among the six mutants giving lower, similar, or increased
values when compared to wild type AGT. In vivo DNA repair studies using an E.
coli model system showed that three mutants exhibit a compromised DNA repair
process due to change of function rather than change in expression, while one mutant
enhances repair due to protein over-expression. Work to correlate binding and repair
activities of these mutants is under way. Supported by NIH grant GM 070662.
Electrostatic Properties of Promoter and
Nonpromoter Sites in T7 Bacteriophage Genome
The entire T7 bacteriophage genome contains 39937 base pairs (Database NCBI
RefSeq N1001604). Here, electrostatic potential distribution around double – helical T7 DNA was calculated by Coulomb method (1) using the computer program of Sorokin A.A. (lptolik@icb.psn.ru). Electrostatic profiles of 17 promoters
recognized by T7 phage specific RNA-polymerase were localized on T7 DNA
electrostatic map.
Comparative analysis of electrostatic properties of T7 DNA promoter and nonpromoter sites was carried out. Electrostatic profiles of all T7 RNA-polymerase specific promoters are shown in Figure 1. Although electrostatic profiles of the individual
promoters differ by their details, they have some common features. When superimposed, they reveal a well-defined wave-shaped design with minimum at – 10bp and
a higher potential at the start point of transcription. By contrast, no common specific
elements were found in electrostatic profiles of T7 DNA nonpromoter sites (Fig. 2).
Electrostatic pattern of superimposed profiles of these sites can be characterized by
a rather homogeneous distribution of electrostatic potential.
881
145
S. G. Kamzolova1
P. M. Beskaravainy1,*
A. A. Sorokin1,2
Inst of Cell Biophysics of RAS
1
Pushchino Moscow Region 142290,
Russia
The Univ of Edinburgh
2
Kings Buildings
Edinburgh, EH93JR, UK
beskaravainy@gmail.com
*
asorokin@inf.ed.ac.uk
It is interesting that electrostatic profiles of promoters recognized by E. coli or T7
phage specific RNA-polymerases differ in their size and design. Electrostatic profile
of E. coli RNA-polymerase specific promoters embraces 200 base pairs (-150 - +50)
(2). The most noticeable electrostatic signals involved in recognition of this enzyme
were found in far upstream region of promoter DNA(-70 – -120) (3, 4). By contrast,
there are no specific electrostatic elements in this region of T7 RNA-polymerase
specific promoters. All electrostatic signals recognized by T7 RNA-polymerase are
located in the region from -35 bp to + 15 bp of promoter DNA (Fig. 1).
Figure 1: Distribution of electrostatic potential around
T7 RNA-polymerase specific promoters.
882
Figure 2: Distribution of electrostatic potential around
T7 DNA nonpromoter sites (random sequences).
Thus, electrostatic potential distribution around DNA provides an effective means
for identification of promoter sites in genome and their differentiation by different
RNA-polymerases.
1. Polozov, R. V., Dzhelyadin, T. R., Sorokin, A. A., Ivanova, N. N., Sivozhelezov, V. S., Kamzolova, S. G. J Biomol Struct Dyn 16, 1135-1143 (1999).
2. Kamzolova, S. G., Sorokin, A. A., Dzhelyadin, T. D., Beskaravainy, P. M., Osypov, A. A. J
Biomol Struct Dyn 23, 341-346 (2005).
3. Kamzolova, S. G., Sivozhelezov, V. S., Sorokin, A. A.,. Dzhelyadin, T. R, Ivanova, N. N.,
Polozov, R. V. J Biomol Struct Dyn 18, 325-334 (2000).
4. Sorokin, A. A., Osypov, A. A., Dzhelyadin, T. R., Beskaravainy, P. M., Kamzolova, S. G. J
Bioinform Comput Biol 4, 455-467 (2006).
146
Thomas D. Tullius1,2,*
Stephen C. J. Parker2
Loren Hansen2,3
Hatice Ozel Abaan4
Elliott H. Margulies4
1
Program in Bioinformatics
2
Boston University, Boston, MA 02215
National Center for Biotechnology Info.
3
National Human Genome Research
4
Institute, National Institutes of Health
Bethesda, MD
tullius@bu.edu
*
Evolutionary Constraint on DNA Structure
in the Human Genome
Computational algorithms that assess evolutionary constraint on the sequence
of the human genome do not account for the possibility that some nucleotide
substitutions have little or no effect on the three-dimensional structure of the
DNA molecule. Since DNA-binding proteins recognize structural features of
DNA as well as nucleotide sequence, we suggest that natural selection may act
to preserve the local shape and structure of DNA without maintaining the primary order of nucleotides. To investigate this hypothesis we developed a new
computational algorithm, called Chai, to detect evolutionary constraint on DNA
structure. Chai uses hydroxyl radical cleavage patterns as a measure of DNA
structure, and compares cleavage patterns among genomes of different species to
detect evolutionary constraint on structure.
We applied Chai to multi-species sequence alignments from the ENCODE pilot
project regions of the human genome, and identified 12% of the bases as constrained
– nearly twice as much constrained genomic territory as is found by nucleotide
sequence-based constraint algorithms. We found that Chai regions correlate better
with experimentally-determined non-coding functional elements. We used reporter
assays in cultured cells to experimentally test the function of genomic regions that
are uniquely identified by Chai, and found that some structure-constrained regions
in the human genome act as transcriptional enhancers.
Our results support the hypothesis that the three-dimensional structure of DNA can
be a substrate for natural selection. To understand genome evolution and function we
suggest that it is critical to consider DNA structure as well as nucleotide sequence.
883
147
Evolutionary Dynamics of CRISPR-Cassettes
in the Metagenome Sorcerer II
CRISPR systems constitute a new type of the prokaryotic anti-phage immunity.
It was recently discovered in a half of all known bacteria and almost all known
archaea. A typical CRISPR system consists of a set of CRISPR-associated (cas)
genes, a CRISPR-cassette, which is a group of short direct repeats separated by
short unique spacers. The spacers represent fragments of foreign DNA previously
encountered by the host. They allow the host to trigger a specific DNA degradation
mechanism if the source DNA invades the cell once again.
There are no effective tools for detection of CRISPR-cassettes applicable for analysis of huge volumes of data, like, e.g., metagenomic samples. Applications of three
publicly available programs produce drastically different outputs, clearly overloaded with false positives. To search for CRISPR-cassettes in metagenomes we developed a technique based on a combination of all three programs.
The application of this technique to the Sorcerer II metagenome data produced
192 cassettes with 1908 unique spacers. The identified CRISPR-cassettes were
collected in a special database. Families of related cassettes were constructed by
the analysis of similarity between repeat units. Additional analysis of flanking
regions allowed us to distinguish between the lateral transfer and the parallel
evolution of cassettes in related strains. The similarity between related cassettes
varied from a single shared spacer up to almost identical cassettes in different genomic locations. For every case we reconstructed the evolutionary history using
a limited vocabulary of elementary events.
Irena I. Artamonova1,2,*
Valery A. Sorokin3
Mikhail S. Gelfand2,3
Vavilov Inst of General Genetics
1
RAS, Gubkina 3, 119991 Moscow
Russia
Kharkevich Inst for Information
2
Transmission Problems
RAS, Bolshoi Karetny pereulok 19
127994 Moscow, Russia
Lomonosov Moscow State Univ
3
Faculty of Bioengineering and
Bioinformatics
Vorobyevy Gory 1-73, Moscow, Russia
irenart@gmail.com
*
Both types of similarity hits, those with phage-related spacers and those representing lateral transfers of cassettes, were significantly enriched in metagenome contigs from the same geographical locations. This shows that on-going phage-host
encounters in specific ocean locations involves the CRISPR-mediated response
and imprints the host genome.
Acknowledgments
This work is partially supported by the Russian Academy of Sciences (programs
“Molecular and Cellular Biology” and “Fundamental problems of Oceanology”).
Finding Faults in DNA Mismatch Repair:
Kinetic Analysis of MutS Actions on DNA
DNA Mismatch Repair is an evolutionarily conserved process that corrects base
pair mismatches and small insertion/deletion loops (IDL) generated during DNA
replication and recombination. MutS proteins initiate DNA mismatch repair by
recognizing such errors, and trigger a series of events that result in excision of the
incorrect DNA strand and DNA re-synthesis. Our goal is to understand how the S.
cerevisiae MutS homolog, Msh2-Msh6 recognizes mismatches/IDLs and signals
DNA repair in a reaction fueled by ATP. Our approach is to measure the DNA binding and ATPase activities of Msh2-Msh6 under pre-steady state or single turnover
conditions, and thus determine its mechanism of action.
148
Jie Zhai
Manju M Hingorani
Dept of Molecular Biology and
Biochemistry, Wesleyan University
205 Hall-Atwater Laboratories
Middletown, CT 06459-0180, USA
jzhai01@wesleyan.edu
mhingorani@wesleyan.edu
884
149
S. A. Streltsov
Engelhardt Institute of Molecular Biology
32 Vavilov St.,
Moscow, 119991, Russian Federation
strelcov@eimb.ru
Recent data reveal that Msh2-Msh6 scans DNA for errors and, surprisingly, pauses at
not only base pair mismatches/IDLs but also at alternate sites that may be characterized by local distortions or increased flexibility in the double helix. A key difference is
that the half-life of Msh2-Msh6 at a mismatch/IDL is about 40-fold longer than at an
alternate site (t1/2 = 20 sec at a G:T mismatch versus 0.5 sec at a 2-Aminopurine(2Ap):T
base pair, respectively). ATP binds rapidly to Msh2-Msh6 trapped at the G:T mismatch, facilitating its interaction with proteins downstream in the repair pathway. We
propose that Msh2-Msh6 makes weak initial contacts with base pairs when scanning
for errors, and distinguishes bona fide mismatches/IDLs by forming long-lived complexes specifically at these sites. Stabilization of Msh2-Msh6·mismatch complexes
allows ATP binding to the protein, which in turn initiates DNA repair.
Hoechst 33258 Dimers Bind Mainly
to dsDNA GC Pairs
It is known that Hoechst 33258 can form not only monomeric, but also dimeric
complexes on dsDNA (1). A specific feature of the formation of dimeric complexes is the appearance of excitonic circular dichroism (CD) spectra. The excitonic
spectrum of Hoechst 33258 dimeric complex with poly(dA-dT)·poly(dA-dT) is
characterized the positive long wavelength band and the negative short wavelength
band (2). Both dimeric and monomeric complexes of Hoechst 33258 with poly(dAdT)·poly(dA-dT) have positive linear dichroism values at 360 nm (LD360) (3). On
the contrary, in dimeric complexes of Hoechst 33258 with poly(dG-dC)·poly(dGdC), long-wavelength bands of excitonic CD have negative values and short wavelength bands, positive ones (4, 5), whereas both dimeric (4) and monomeric (3)
Hoechst 33258-poly(dG-dC)·poly(dG-dC) complexes are described by negative
LD360 values. Thereby spectral measurements provide identification of Hoechst
33258 complexes of four types: monomeric or dimeric with binding on AT or GC
sites. For example, the lack of a CD excitonic spectrum of the monomeric complex
of Hoechst 33258 with calf thymus dsDNA and positive LD360 (6) indicate binding
at AT-enriched dsDNA regions. With an increase in dsDNA filling with Hoechst
33258 molecules the complex acquires a CD excitonic spectrum (dimerization),
whose long wavelength band is negative (6), and the LD360 value varies from positive to negative magnitudes (1, 6). Hence, with an increase of the number of Hoechst
33258 molecules on dsDNA the binding of its monomers to AT pairs is displaced by
its dimers binding to GC pairs. Thus, we experimentally conformed the assumption
made as early as in 1996 (7) on the change of binding specificity from AT to CG as
the ligand occupies more and more space on dsDNA.
1.
2.
3.
4.
5.
6.
Bontemps, J., Houssier, C., Fredericq, E. Nucleic Acids Res 2, 971-984 (1975).
Moon, J. H., Kim, S. K., Sehlstedt, U., Rodger, A., Nordén, B. Biopolymers 38, 593-606 (1996).
Bailly, C., Hénichart, J. P., Colson, P., Houssier, C. J Mol Recognit 5, 155-171 (1992).
Streltsov, S. A., Zhuze, A. L. J Biomol Struct Dyn 26, 99-113 (2008).
Buurma, N. J., Haq, I. J Mol Biol 381, 607-621 (2008).
Strelrsov, S. A., Gromyko, A. V., Oleinikov, V. A., and Zhuze, A. L. J Biomol Struct Dyn 24,
285-302 (2006).
7. Matesoi, D., Kittler, L., Bell, A., Unger, E., Lober, G. Biochem Mol Biol Int 38, 123-132 (1996).
Influence of Coherent Nonthermal Electromagnetic
Radiation on Water and DNA Solution Densities
Millimetric electromagnetic waves (MEMW) of nonthermal intensities are successfully used in clinical medicine and in biology in spite of the fact that mechanisms of
their influence on biological objects are yet not quite understood.
The purpose of the given work was to investigate water and DNA water solution
densities irradiated by MEMW of 64.5 GHz and 50.3 GHz frequencies, which coincide with the resonant frequencies of oscillations of molecular fractions of water
structures, and with frequency of 48.3 GHz not being a resonant one.
For the irradiation of samples generators Γ4-142 and Γ4-141 (Russia) were used.
The irradiation of the samples was conducted at room temperatures in the mode
of amplitude modulation with frequency 1Hz, the flux intensity on sample being
approximately 50 mcW/cm2. The sample density was determined by the densitometer DMA 4500 Anton Paar (Austria).
The studies revealed that at irradiation of pure water with the specified frequencies,
the density of the twice distillated water practically didn’t change while densities
of the buffer and DNA solution increased at irradiation with frequencies of 64.5
GHz and 50.3 GHz coinciding with the resonant frequencies of oscillations of the
hexagonal and triad structures of water and didn’t change at irradiation with the
frequency of 48.3 GHz. The increase in the DNA and buffer densities (on about 10-4
gr/cm3) in consequence of the irradiation of solutions with MEMW most likely was
caused by the change of the water structure in consequence of the irradiation since
resonant frequencies of the DNA absorption are found in the range of 2 to 9 GHz.
Investigated was also the temperature dependence of DNA solution density at
irradiation with frequencies of 64,5 and 50,3 GHz of 90 minutes duration. It was
observed that at increase in temperature, the densities of irradiated and not irradiated DNA were decreasing, however there was an essential difference between
the courses of the temperature dependencies of solution densities for irradiated
and not irradiated DNA.
Having the values of density of the not irradiated and irradiated (64,5 and 50,3
GHz) solutions (of the twice distillated water, buffer and water-saline solution of
DNA) in the temperature range of 20 ÷ 85 ºC, the coefficient of the thermal expansion α can be calculated with formula
Calculations showed that in the interval of 20 ÷ 50 ºC, solution irradiation with
resonant frequencies of oscillations didn’t affect the value of α. At temperatures
50 ºC and above, the coefficient α was less for the irradiated samples as compared
to the not irradiated ones. Thus, the data we obtained allow expecting that MEMW
coinciding with frequencies of the resonant oscillations of water structures give
a certain effect under “in vitro” conditions and can have influence on biosystems
through the water component of the medium.
885
150
Yu S. Babayan*
V. P. Kalantaryan
A. A. Tadevosyan
G. L. Kanaryan
G. R. Ulikhanyan
S. V. Harutyunyan
Dept of Medical and Biological Physics
2. Koryun St, Yerevan, 0025 Armenia
ysbaba@ysmu.am
*
gretau7@mail.ru
886
151
Dmitri Y. Lando1,2,*
Alexander S. Fridman1
Elena N. Galyuk1
Chin-Kun Hu2,3,*
1
National Academy of Sciences of Belarus
5/2, Kuprevich St., 220141, Minsk, Belarus
Institute of Physics, Academia Sinica
2
Nankang, Taipei 11529, Taiwan
Center for Nonlinear and Complex
3
Systems and Department of Physics
Chung-Yuan Christian University
Chungli 32023, Taiwan
Influence of the Location of a Single Stabilizing
Chemical Modification on DNA Internal
Melting and Strand Dissociation
Usually, with an increase in temperature, long DNAs are melted in the two steps.
First, an intramolecular melting starts at a temperature several degrees lower than
the melting temperature (Tm). The number of melted base pairs increases with temperature without strand dissociation. Second, strand dissociation arises at a temperature higher than Tm when almost all base pairs are melted. We have considered
the influence of stabilizing chemical modifications with and without interstrand
crosslinking on both internal melting and strand dissociation. Using experimental data found in literatures and results of our calculations, we have demonstrated
that chemical modifications caused by some platinum and ruthenium compounds
strongly stabilize the double helix. They increase the free energy of helix-coil transition at sites of their location by more than 10 kcal per mole of modifications. Then
we have studied the influence of a single modification of this type on both steps of
melting in DNA of 5000 bp. It was found that the influence was strongly dependent
on its position along DNA. In general, a single site of stabilization influences both
processes. However, a modification located at most unstable AT-rich sites changes
differential melting curve without a change in temperature of strand dissociation
Td. A modification that locates at the most stable site only slightly influences differential melting curve but strongly increases Td. Both effects are strengthened if
interstrand crosslinking occurs besides stabilization at a site of modification.
lando@phys.sinica.edu.tw
huck@phys.sinica.edu.tw
152
Kakali Bhadra*
Gopinatha Suresh Kumar
Biophysical Chemistry Laboratory
Indian Institute of Chemical Biology
CSIR, Kolkata 700032, India
kakalibhadra_rs@iicb.res.in
*
Isoquinoline Alkaloids as Natural Products
with Unique DNA Binding Properties
Natural products of plant origin are a traditional source of medicinal compounds
from time immemorial and up to forty percent of all modern drugs are essentially
directly or indirectly related to natural products. Natural product drug development
includes several distinct and painstaking steps like evaluation of the biological activity of plant extracts, isolation and chemical characterization of the various fractions of the extract, analysis of their structure-activity relationships, as well as elucidation of the mode and mechanism of action. One of the most important steps in
these multistep processes is the elucidation of the binding of natural products to
the bio-targets, like DNA/RNA/enzymes. Our laboratory has been in the forefront
of elucidating the structure-activity aspects of isoquinoline alkaloids. We have successfully elucidated the mode, mechanism, base specificity and thermodynamics of
DNA binding of berberine, palmatine, coralyne (protoberberine) and sanguinarine
(benzophenanthridine). Berberine and palmatine showed partial intercalative mode
of binding to DNA with AT base pair specificity where as coralyne and sangunarine
showed intercalative binding with GC base pair specificity. Cooperativity was observed in the binding of all these alkaloids to DNA but the degree of cooperativity
varied. Thermodynamically, berberine and palmatine showed entropically favorable
reaction with AT rich DNA and AT polymers, while coralyne and sangunarine revealed enthalpically driven reaction in all the DNAs. These differences in the binding and energetics are probably due to the structural variations among the alkaloids
as berberine and palmatine are tilted molecules while coralyne and sangunarine are
planar. Parsing of the free energy change of the interaction observed into polyelectrolytic and non-polyelectrolytic components suggested that although these alkaloids
are charged, the major contributor of the binding free energy arises from the nonpolyelectrolytes forces. The molecular aspects on the various DNA binding properties of these alkaloids will be discussed in detail in relation to their known biological
activities to give an overview of their utility for futuristic drug development.
Kinetics of DNA Stability in the
Presence of Cisplatin and Transplatin
It has been shown in an earlier study that a negative shift of DNA melting temperature (Tm) caused by cisplatin is strongly increased if melting experiment is carried
out in alkaline medium [E. N. Galyuk et al. J Biomol Struct Dynam 25, 407-418
(2008)]. Transplatin also decreases Tm at pH>10 but the decrease is lower than that
for cisplatin. This result allows us to increase sensitivity of melting measurements
for DNA complexes with platinum compounds. Using it, we have demonstrated in
the present study that the development of platination is stopped in alkaline medium
(0.1 M NaCl, pH 10.5-10.8). All these findings gave an opportunity to measure kinetics of DNA stability under platination in 0.01M NaClO4 at various temperatures
and compare these results with other properties of DNA complexes with platinum
compounds. We have found that, in the presence of cisplatin, DNA stability is monotonously decreased with the time of incubation in 0.01 M NaClO4. The beginning
of the effect of cisplatin on the melting temperature was registered in 2 minutes. At
37 ºC, the time of a half of the maximal decrease of Tm is ~1 h. The reaction is fourfold slower and four-fold faster at 25 ºC and 50 ºC, respectively. At 25 and 37 ºC,
the maximal decrease in the melting temperature is almost the same but the maximal shift value is lower under a 50 ºC incubation. In contrast to cisplatin, kinetics is
not monotonous for transplatin. A decrease in Tm during 3 h incubation at 37 ºC is
changed by an increase. However, the melting temperature does not reach the value
corresponding to control unplatinated DNA even after a 48 hour incubation. To
evaluate kinetics of DNA interstrand crosslinking by cis- and transplatin, platination was stopped after various time interval of incubation, and then DNA was subjected to denaturation by heating
to 100 ºC followed by quick cooling or by freeze-thaw procedure
in alkaline medium. The second
type of denaturation was found
recently [E. N. Galyuk et al. J
Biomol Struct Dynam 26, 517-524
(2009)]. It was shown that a weak
interstrand crosslinking appears
after a 15 minute incubation but it
becomes sufficiently effective to
restore the double helix after a 24
hour incubation.
887
153
Dmitri Y. Lando1,2
Elena N. Galyuk1
Alexander S. Fridman1
Chin-Kun Hu2,3
1
National Academy of Sciences of Belarus
5/2, Kuprevich St., 220141, Minsk, Belarus
Institute of Physics, Academia Sinica
2
Nankang, Taipei 11529, Taiwan
Center for Nonlinear and Complex
3
Systems and Department of Physics
Chung-Yuan Christian University
Chungli 32023, Taiwan
lando@phys.sinica.edu.tw
huck@phys.sinica.edu.tw
888
154
Remo Rohs*
Sean M. West
Peng Liu
Barry Honig**
Howard Hughes Medical Inst,
Department of Biochemistry &
Molecular Biophysics and the Center
for Computational Biology and
Bioinformatics, Columbia University
1130 St Nicholas Avenue
*rr2213@columbia.edu
**bh6@columbia.edu
Minor Groove Shape and Electrostatics Provide
a Molecular Origin for Protein-DNA Specificity
The molecular basis for protein-DNA recognition and its specificity is still widely
unknown. Complexes of proteins from various families bound to DNA have been
solved by means of X-ray crystallography and NMR spectroscopy. However, the molecular mechanisms through which proteins specifically recognize their DNA binding
sites are only partially understood. Direct readout through specific contacts between
amino acids and bases dominates recognition within the DNA major groove. Different base pairs account for specific patterns of hydrogen bond donors and acceptors in
the major groove with thymine additionally offering a methyl group for hydrophobic
contacts. Direct readout in the minor groove is limited because there is no differentiation in terms of the location of hydrogen bond donors or acceptors between A-T and
T-A or between G-C and C-G base pairs. Indirect readout accounts for the recognition
of the overall shape of a DNA binding site by proteins. Overall shape is a function of
base sequence and comprises global deformation effects such as DNA bending (1).
In a recent study of the Hox family of transcription factors, we have identified a
third mode of protein-DNA recognition that involves recognition of minor groove
shape (2, 3). Hox proteins bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, depends on extended and unstructured regions that link Hox homeodomains to
their cofactors. Crystal structures were determined for one of the eight Drosophila
Hox proteins, Scr, bound to its specific DNA sequence (fkh250) and a consensus
Hox site (fkh250con*). The structures of these two Hox-Exd-DNA ternary complexes
only differ by an Arg3/His-12 pair that inserts into a narrow region of the fkh250
minor groove whereas these residues are disordered when presented with the fkh250con* sequence. For both the fkh250 and fkh250con* sequences, minor groove width
and the magnitude of the negative electrostatic potential are strongly correlated.
All-atom Monte Carlo simulations of the free DNA binding sites predict that the
DNA conformation being recognized is an intrinsic property of the base sequence,
and thus, already prevalent in unbound DNA rather than induced by protein binding (2). Our results on Hox-DNA recognition indicate that the intrinsically narrow
minor groove of fkh250 induces an enhanced negative electrostatic potential, which
in turn attracts the positively charged Arg/His pair.
In current studies we ask if the local shape recognition that we found for Hox proteins
is of a more general nature (4). Electrostatics calculations along with MC structure
predictions of DNA binding sites indicate that several protein families employ this
readout mechanism. Homeodomains, as an example of such a family, often bind to
A-tracts, which are rigid AT-rich DNA regions of three or more consecutive ApT or
ApA (TpT) base pair steps. Narrow minor grooves are a common structural feature
of A-tracts. TpA steps break A-tract structure since they act as flexible hinges due to
unfavorable stacking interactions. Our studies on Hox proteins have proven that the
location of a TpA step is key for the intrinsic structure of a binding site. Strikingly, our
data shows a correlation of A-tract sequence and structure with electrostatic potential
in the DNA minor groove as a result of shape-induced electrostatic focusing. Our
observation of the causal relationship between minor groove structure and enhanced
negative electrostatic potentials reveals the biological function of A-tract motifs. In
addition, our results suggest recognition of local DNA shape as a novel readout mechanism crucial for proteins that bind DNA with narrow minor groove regions.
1. R. Rohs, H. Sklenar, and Z. Shakked. Structure 13, 1499-1509 (2005).
2. R. Joshi, J. M. Passner, R. Rohs, R. Jain, A. Sosinsky, M. A. Crickmore, V. Jacob, A. K. Aggarwal, B. Honig, and R. S. Mann. Cell 131, 530-543 (2007).
3. S. C. Harrison. Nat Struct Mol Biol 14, 1118-1119 (2007).
4. R. Rohs, S. M. West, P. Liu, and B. Honig. Curr Opin Struct Biol 19-2 (2009), in press.
Monovalent Cation Binding by DNA Hairpins
The binding of monovalent cations to DNA hairpins has been studied by capillary
electrophoresis, using a variation of affinity electrophoresis called the Variable Ionic
Strength method. A 16-residue oligonucleotide with the sequence ATCCTATTTTTAGGAT, which is known to form a stable hairpin with a 6 bp stem and 4 residue
loop, was used as a model hairpin. A 26-residue nucleotide with the sequence CGGTGCGGAAAAACGAGCTTTTTGCG, which is predicted to form an imperfect
hairpin with a 7 bp stem, a 5 residue loop and a 5’ dangling end, was also studied.
Unstructured oligomers containing similar numbers of nucleotides were used as reference analytes. The hairpins migrate faster than their unstructured counterparts because the hairpins are more compact and experience less friction with the solvent. Li+,
Na+, K+, NH4+, and Tris+ ions form saturable complexes with the model hairpin, with
average apparent KDs of ~80 mM at 20 °C. The decrease in mobility with increasing
cation concentration indicates that about 4 cations bind to the model hairpin upon
saturation of the binding site(s). Cation binding appears to decrease with increasing
temperature, suggesting that cation binding does not contribute to increased hairpin
stability at high ionic strengths. Alkylammonium ions with small substituents, such
as the tetramethylammonium or monopropylammonium ion, bind to the model hairpin in a manner similar to that observed for NH4+. However, as the hydrogen atoms in
the ammonium ion are replaced by alkyl groups, or as the alkyl groups in the tetraalkylammonium ion become larger, binding to the model hairpin becomes significantly
weaker. Similar results are observed with the imperfect hairpin, although the binding
affinities are somewhat weaker. Supported in part by grant CHE-0748271 from the
Analytical and Surface Chemistry Program of the National Science Foundation.
889
155
Nancy C. Stellwagen*
Joseph Muse
Paul Barnard
Earle Stellwagen
University of Iowa
Iowa City, IA
nancy-stellwagen@uiowa.edu
*
156
New Insights on Non-specific Protein-DNA
Interactions: the DNase I Model
In the cell, DNA interacts almost continuously with proteins in order to ensure its
biological functions. Specific and non-specific protein-DNA interactions imply the
formation of intermolecular interfaces requiring electrostatic and structural complementarity of the related partners. Nevertheless, the mechanisms underlying the formation of non-specific protein-DNA complexes remain particularly obscure.
In this context, we chose to study the DNase I/DNA system as a representative and
rather simple model of non-specific complex. DNase I is a glycoprotein which hydrolyzes the DNA phosphodiester linkages in presence of divalent cations, Ca2+ and
Mg2+, and its activity depends on the DNA sequence.
Combining various experimental and theoretical techniques, we study DNA oligomers and DNase I, free and bound. We demonstrate that Ca2+ and Mg2+ are crucial
for optimizing the electrostatic fit between DNA and enzyme. Preferential DNase I
cleavages are found to be correlated to enhanced DNA dynamics that allow to minimize the cost of DNA deformation upon binding. Overall, this work highlights that
the structure/function relationship in non-specific DNA-protein interaction parallels many features observed for specific DNA-protein recognition mechanisms.
Marc Guéroult1,2,*
Josephine Abi Ghanem1,2
Brahim Heddi2,§
Chantal Prévost2
Pierre Poulain1
Marc Baaden2
Brigitte Hartmann1,2
UMR-S 665, Inserm/Univ. Paris
1
Diderot-Paris 7 INTS, 6 rue Alexandre
Cabanel, 75015 Paris, France
CNRS/Univ. Paris Diderot-Paris 7
2
IBPC, 13 rue Pierre et Marie Curie
75005 Paris, France
Present address:
§
School of Physical & Mathematical
Sciences, Nanyang Technological
University, 21 Nanyang Link
SPMS PAP 05-08, Singapore 637371
marc.gueroult@univ-paris-diderot.fr
*
890
157
Remo Rohs
Barry Honig
Department of Biochemistry & Molecular
Biophysics, Center for Computational
Biology and Bioinformatics, Columbia
University, 1130 St Nicholas Avenue,
New York, NY 10032
rr2213@columbia.edu
bh6@columbia.edu
Nucleotide Sequence-Dependent Shape Effects
and their Role in Protein-DNA Recognition
Recent work on Hox proteins has revealed that subtle sequence-dependent local
variations in minor groove geometry provide a mechanism through which different
proteins in the same family can recognize small differences in nucleotide sequence.
Crystal structures were determined for ternary complexes involving the homeodomains of one of the eight Drosophila Hox proteins, Scr, and its Exd co-factor, and
DNA. One complex contained a DNA binding site, fkh250, that was specific for
Scr, while the other contained a consensus DNA site, fkh250con*, that binds other
Hox proteins as well. Both complexes have the homeodomain recognition helices
of the Scr protein and its Exd co-factor bound in the major groove. However, additional basic amino acids are seen in the crystal structure of the complex with the
fkh250 site whereas they are disordered when presented with the fkh250con* site. In
vitro binding studies and probes of embryonic development suggest that these basic
residues play a key role in determining in vivo specificity. The specific recognition
of the fkh250 sequence appears to be related to the narrow minor groove whereas
the groove is much wider in the equivalent region of the fkh250con* sequence. MC
simulations indicate that this difference in shape is a property of the free DNA.
Calculations using the DelPhi program indicate that the effect of minor groove width
on binding can be traced to the electrostatic potential of the DNA. Narrow grooves
produce enhanced electrostatic potentials due to electrostatic focusing effects originally discovered for enzyme active sites. The effect of minor groove shape on
electrostatic potential offers a new mode of protein-DNA recognition. Specifically,
sequence-dependent variations in DNA shape can exploit corresponding variations
in electrostatic potential to tune binding affinities, even among closely related members of the same protein family. It will also be shown that minor groove narrowing
can often be traced to the presence of A-tracts in the DNA sequence thus defining
a distinct biological role for this motif. On the protein side, shape is recognized
by the specific placement of basic amino acids in conformations that enable them
to interact optimally with subtle changes in electrostatic potential. Results will be
presented for different protein families which suggest that this mechanism is widely
used, and may also play a role in nucleosome positioning.
2. R. Rohs, S. M. West, P. Liu, and B. Honig. Biol 19-2 (2009), in press.
158
Andrew Moreno*
Ishita Mukerji
Knee
Chemistry Dept
Hall-Atwater Labs Wesleyan Univ.
Lawn Ave Middletown CT 06459
amoreno@wesleyan.edu
*
Observation of Oligonucleotide Dynamics By
Means of Fluorescent Nucleoside Analog 6MI
To improve current understanding of the structural recognition mechanism of architectural DNA binding proteins, such as HU and IHF, we are investigating the structure and dynamics of different DNA substrates. At the single residue level through
incorporation of a fluorescent probe we are able to observe structure and dynamics
of DNA. Specifically, the fluorescent guanosine nucleoside analog 6-methylisoxanthopterin (6-MI), which H-bonds with cytosine similar to guanosine, is used to probe
global and local DNA dynamics. We have previously shown that this class of probes
does not significantly perturb the global structures of duplex DNA molecules. 6-MI
was systematically incorporated into a 34 base oligonucleotide. Initial characterization of local DNA environment included time resolved fluorescence and rotational
correlation measurements of the duplex oligomers relative to 6-MI monomer and
single stranded DNA. Analysis of time-resolved fluorescence decay yields 3 life-
time components of 0.4 ns, 4 ns and 6.5 ns. The largest lived component is similar to
that of 6-MI monomer, 7 ns. The position of the probe shifts the fluorescent populations from 0.4 ns to 6.5 ns upon formation of duplex, which implies that 6-MI local environment in these positions resembles that of the solvent exposed monomer.
However, no direct correlation between adjacent base sequence and the fluorescent
properties of 6MI was observed. To further investigate the increase in fluorescence
upon duplex formation, we characterized the local and global structure of several
oligonucleotides through temperature melts, quantum yield calculations, quenching
assays, and Raman spectroscopy. The results suggest that, the position of 6-MI in
the duplex sequence, helical turn, and surrounding base sequence determines the dynamics of 6-MI. This potentially leads to the formation of a fixed geometry of 6-MI
which stacks poorly with adjacent bases. The lack of stacking interactions causes
6-MI to exhibit fluorescent properties of the monomer. Future work will examine
now the structure and dynamics of oligonucleotides influences the fluorescent properties of 6-MI through MD simulations and ab initio calculations.
891
159
Protein-DNA Recognition Mechanism and Prediction
Protein-DNA interactions play a central role in gene regulation. DNA-binding
proteins recognize their targets by direct base-amino acid interactions and indirect conformational energy contribution from DNA deformations and elasticity.
In order to understand the recognition mechanism, it is important to analyze the
relationship between the structure and specificity of protein-DNA recognition.
Knowledge-based approach based on the statistical analysis of protein-DNA complex structures has been successfully used to calculate interaction energies and
specificities of direct and indirect readouts in protein-DNA recognition. The quantification of specificity has enabled us to analyze the structure-specificity relationship in protein-DNA recognition. By using this method, it has been shown that
both the direct and indirect readouts make important contributions to the specificity of protein-DNA recognition. We have also examined the cooperativity in protein-DNA recognition. In order to complement the knowledge-based approach, we
have performed various kinds of computer simulations to derive energy potentials,
which are equivalent to the statistical potentials, for direct and indirect readouts
in protein-DNA recognition. These analyses provided insight into the molecular
mechanism of protein-DNA recognition. By combining these methods, we have
made some applications to drug-DNA interactions, chromosome positioning, and
genome-scale target prediction of transcription factors.
Akinori Sarai
Dept. Biochemical Engineering and
Science, Iizuka, 820-8502 Japan
sarai@bio.kyutech.ac.jp
160
Regulation of Sin-Mediated DNA Recombination
Sin is a serine resolvase from S. aureus that catalyzes site-specific DNA rearrangements in a topologically regulated manner. Regulation is mediated by a conformational switch: the WT protein remains in an inactive conformation unless it is
incorporated into a large complex termed the synaptosome. This complex traps 3
negative nodes in the DNA and includes a DNA bending protein and additional
copies of the recombinase. Regulation can be circumvented, however, by certain
mutations that favor the active form of the protein in the absence of cofactors.
Using a combination of structural, biochemical, and genetic tools, we have constructed a model for the full synaptosome. We have also shown that catalytic
activation correlates directly with tetramerization of the recombinase, which
otherwise exists in solution as dimers and/or monomers. Finally, we are beginning to address how well our model applies to related serine recombinases such
as the resolvase from Tn3.
Kent W. Mouw1
Sherwin Montano1
Ross Keenholtz1
Martin R. Boocock2
Sally-J. Rowland2
W. Marshall Stark2
Phoebe A. Rice1,*
The University of Chicago,
1
Chicago, IL, USA
University of Glasgow, Glasgow, UK
2
price@uchicago.edu
*
892
161
Aaron E. Engelhart*
Özgül Persil Çetinkol
Rupesh K. Nanjunda
W. David Wilson
Nicholas V. Hud.
Department of Chemistry and
Biochemistry, Georgia Institute of
Technology, 315 Ferst Dr.
Atlanta, GA 30332
aaron.engelhart@gmail.com
*
162
Padmavathi Putta
Chanchal K. Mitra*
Univ of Hyderabad
Hyderabad- 500 046, India
padma_bioinfo@yahoo.co.in
c_mitra@yahoo.com
*
Selective, High-affinity, Synthetically
Accessible Ligands for G-quadruplex DNA:
Thermodynamic and Structural Studies of Azacyanines
G-quadruplex ligands have attracted substantial interest recently as potential antineoplastics. The G quadruplex is an appealing nucleic acid drug target, as the G tetrad
is structurally distinct from the Watson-Crick base pair. Additionally, the backbone
geometries and groove widths differ between G quadruplexes and dsDNA. Highaffinity G-quadruplex ligands have begun to show medicinal promise, although the
connection between G-quadruplex binding and in vivo activity might not always
be obvious. Here, we report novel, high-affinity, high-selectivity G-quadruplex ligands: the azacyanines. We present data comparing the G-quadruplex and WatsonCrick dsDNA binding affinities of these molecules (1). Additionally, we present
data related to the binding site for these ligands on the G quadruplex formed by the
human telomeric DNA repeat in potassium containing solution.
1. Çetinkol, Ö. P., Engelhart, A. E., Nanjunda, R. K., Wilson, W. D., Hud, N. V. ChemBioChem
9, 1889-1892 (2008).
Sequence Studies of Promoter
Regions in Human Genome
Recognition of promoter elements by the transcription factors is one of the initial
and crucial steps in gene expression. In prokaryotes, there are clear signals to
identify the promoter regions like TATAAT at -10 and TTGACA at -35 positions
from transcription start site (TSS). However, in eukaryotes the promoter regions
are structurally more complex and there are no conserved or consensus sequences
similar to the ones found in prokaryotic promoters.
From sequence studies, we located a set of GC rich short sequences (>5 nt) that
are relatively common in human promoter sequences around the TSS (±100 wrt
TSS). These sequences were sorted based on their frequency and the top most common 50 sequences were used for further studies. The sigmoidal behvaior of the
frequency distribution of these short sequences suggest presence of some internal
co-operativity. These short sequences are distributed on both sides of TSS, suggesting that probably the transcription factors recognize these sequences on both
upstream and downstream of TSS as an essential requirement during initial stages
of the transcription. As eukaryotic promoters lack any conserved sequences, we
expect that these short sequences may help in recognition of promoter regions by
relevant transcription factors prior to the initiation of transcription process. Similarity, studies within these short sequences suggest that a set of sequences can be
clustered together based on their match and mismatch score values. We suggest that
a cluster of genes with common short sequences can be recognized by a perticular
transcription factor. We also found that these short sequences occur within miRNA,
both mature and stem-loop sequences. The distributions of the same set of short sequences within the miRNA dataset are under active investigation. We presume that
miRNAs are playing some significant role in recognition of the promoter regions
during initial stages of transcription, via the transcription factors. We have attempted to correlate the promoter sequences and miRNAs based on these common short
sequences. We hope to show/establish a simple relation about the role of miRNA in
recognition of promoter elements during initial stages of transcription.
Our studies indicate that eukaryotic transcription is more complex than currently
believed. Further studies on promoter regions and transcription factors will bring
new insights about the promoter architecture and complex events in transcriptional
mechanism of eukaryotes. The short sequences present on both sides of the TSS,
can be used as targets for gene therapy.
893
163
Sequence- And Structure-Specific
DNA Base-Flipping By AGT
Human O6-alkylguanine-DNA alkyltransferase (AGT) repairs DNA by transfer
of alkyl-groups from the O6 positions of guanine residues and O4 positions of
thymine residues to residue C145 in its active site. This process involves a conformation change in which a DNA base becomes extrahelical and is bound within
the active site of the protein. To characterize this conformational change, we have
carried out hydroxyl radical (·OH) footprinting on oligonucleotide substrates of
different length, base-composition and secondary structures. In AGT complexes
with single-stranded DNAs, one AGT molecule protects at least three bases from
·OH, but potential cleavage sites flanking Guanine residues were hypersensitive
to attack. Duplex DNAs, including sequences containing Guanine, were far less
susceptible to attack by ·OH. We propose that this reflects the 2-fold degeneracy
of duplex DNA and the corresponding AGT complexes but also a reduction in
base un-stacking in duplex DNA. Changes in DNA circular dichroism and in the
fluorescence of 2-amino purine labeled DNA support these conclusions. EMSA
results with the same DNAs show that AGT binds preferentially to double-stranded DNAs and that the binding site sizes are slightly smaller and binding cooperativity higher on binding to duplex DNAs than on binding ssDNAs. These results
suggest mechanisms by which AGT may search and access alkylated DNA bases
for repair. Supported by NIH grant GM070662.
Sequence-specific Labeling of Duplex DNA Using
Nicking Enzymes and Oligonucleotide Probes
Labeling of specific target sites on genomic, double-stranded DNA (dsDNA) in
combination with ultra-sensitive detection technologies may result in valuable diagnostic assays for pathogen detection and identification. In particular, such methods
may offer rapid time-to-results and decreased probability for error as amplification
steps are avoided. We propose a method, in which dsDNA labeling is accomplished
through strand exchange with oligonucleotide probes at sites of vicinal nicks. Such
sites are generated by treatment of genomic DNA with nicking endonucleases. Following probe hybridization, probes are covalently linked to the target DNA by ligation (Fig. 1). So far, we have successfully labeled sites that contained two nicks on
the same DNA strand at distances between 13 nt and 24 nt (1). On DNA fragments
we have shown that target sites with significant homology could be labeled with
Manana Melikishvili*
Michael G. Fried
Department of Molecular and
Cellular Biochemistry
University of Kentucky
Lexington, KY 40536-0509
mmeli2@uky.edu
*
164
Heiko Kuhn1
Katya Protozanova2
Gary Jaworski2
Rhea Mahabir2
Maxim Frank-Kamenetskii1,*
Centrer of Advanced Biotechnology
1
Dept of Biomedical Engineering
Boston University, Boston, MA 02215
US Genomics, Woburn, MA 01801
2
mfk@bu.edu
*
Figure 1: Sequence-specific labeling at sites of vicinal nicks in dsDNA. In the initial step, sitespecific nicks are introduced into dsDNA. Regions between vicinal nicks serve in our procedure
as target sites for probe oligonucleotide binding. Through subsequent ligation, a hybridized probe,
which may carry a fluorescence label (blue pentagon), becomes covalently linked to the dsDNA at
the selected target sites. In our preliminary data, we have shown that probes with different design,
resulting in either linkage at one terminus (structure I) or at both termini (structure II), performed
equally well in site-specific labeling reactions.
894
very high sequence specificity. As a result, our approach offered the possibility to
directly label and detect unique target sites in genomic DNA.
Previously, we used a signal amplification step for the final detection (1). However,
the general approach carries the potential for single-molecule detection. We have
therefore begun to explore this possibility by performing genomic DNA labeling reactions with fluorophore-tagged probes with subsequent analysis of labeled DNA on
US Genomic’s single-molecule detection platform (2). This technology allows accurate determination of labeling locations through measurement of fluorescent signals
in individual, stretched DNA molecules. Data will be presented that show remarkable agreement between calculated and measured label positions in genomic DNA.
165
Klaas E.A. Max
Udo Heinemann*
Macromolecular Structure and Interac-
tions, Max-Delbrück Center for Molecular Medicine, Robert-Rössle-Str. 10
13125 Berlin, Germany
heinemann@mdc-berlin.de
*
1. Kuhn, H. and Frank-Kamenetskii, M. D. Nucleic Acids Res 36, e40 (2008).
2. Phillips, K. M., Larson, J. W., Yantz, G. R., D’Antoni, C. M., Gallo, M. V., Gillis, K. A.,
Goncalves, N. M., Neely, L. A., Gullans, S. R., and Gilmanshin. Nucleic Acids Res 33, 58295837 (2005).
Single-stranded DNA and RNA Binds to
a Conserved Surface of Cold-shock Domains
Cold-shock domains occur ubiquitously in proteins from all kingdoms of life. They
occur in proteins that function in transcriptional and/or translational control of gene
expression. Bacterial cold shock domains are autonomous, small proteins, whereas their eukaryal orthologs usually occur as structural modules in larger proteins.
Some, but not all bacterial cold-shock proteins are upregulated under cold-shock
conditions and are thought to mediate cold-stress-response functions.
Already the first crystal structure of a bacterial cold-shock protein suggested a possible mode of DNA or RNA single-strand binding to a basic protein surface with
conspicuously exposed aromatic side chains (1). It was not until recently, however,
that this binding mode was proven by crystal structure analysis of oligothymidine
strands bound to the major cold shock proteins Bs-CspB of Bacillus subtilis and
Bc-Csp of Bacillus caldolyticus (2, 3). These structures identified seven subsites
for nucleotide binding and, combined with fluorescence-based binding DNA studies, suggested the consensus sequence NTCTTTN for DNA binding to the Bacillus
cold-shock domains, which was confirmed by DNA microarray studies (4).
The crystal structure of the Bc-Csp:dT7 complex showed a domain-swapped dimeric structure of the cold-shock domain (3). Domain swapping has never been observed before in a series of crystal structures of bacterial cold-shock proteins (5-9).
Recently, we have extended the structural characterization of cold-shock domains
by studying the binding of ribooligonucleotides to bacterial cold-shock proteins
and cold-shock domains from human Y-box factors. We find a conservation of the
general binding mode observed before, but there is significant variation in subsite
interactions that may be functionally relevant.
1.
2.
3.
4.
5
6.
7.
8.
9.
Schindelin, H. et al. Nature 364, 164-168 (1993).
Max, K. E. A. et al. J Mol Biol 360, 702-714 (2006).
Max, K. E. A. et al. FEBS J 274, 1265-1279 (2007).
Morgan, H. P. et al. Nucleic Acids Res 35, e75 (2007).
Schindelin, H. et al. Proteins: Struct Funct Genet 14, 120-124 (1992).
Schindelin, H. et al. Proc Natl Acad Sci USA 91, 5119-5123 (1994).
Mueller, U. et al. J Mol Biol 297, 975-988 (2000).
Perl, D. et al. Nature Struct Biol 7, 380-383 (2000).
Delbrück, H. et al. J Mol Biol 313, 359-369 (2001).
Specific Protein-DNA Complexes as Platforms
for Design of New Types of Antiviral Drugs
A new design strategy is developed for synthesis of sequence specific DNA binding
ligands. It is based on modular assembly of pyrrole(imidazole) carboxamides and
isohelical pseudopeptides of the form (XY)n where Y is a glycine residue. n is the
degree of polymerization, X is an unusual aminoacid residue containing five-membered aromatic ring (such as 4-aminomethylthiazole-2-carboxylic acid residue).
The herpes simplex virus type 1 origin-binding protein is a DNA helicase encoded
by the UL9 gene. The protein binds in a sequence-specific manner to the viral origin
of replication OriS or OriL. In order to to search for efficient inhibitors of the UL9
activity we have obtained a recombinant UL9 protein expressed in E. coli cells. The
UL9 gene has been amplified by PCR and inserted into a modified plasmid pET14
(Novagen) between NdeI and KpnI sites. We have found that purified recombinant UL9 protein binds to Boxes I and II in OriS and possesses DNA helicase and
ATPase activities. In the presence of ATP and another viral protein ICP8 (singlestranded DNA binding protein) the initiator protein induces unwinding of the minimal OriS duplex (80 bp). The protein also binds strongly to a single-stranded DNA
(OriS*) containing a stable Box I-Box III hairpin and disordered tail at the 3ʹ-end,
as observed for the first time by Aslani et al. (4).
Until now, nucleosides related to acyclovir were the only compound class available
for systematic treatments of herpes disease. In the present work, new minor groove
895
166
G. V. Gursky1
S. L. Grokhovsky1
A. N. Surovaya1
Y. G. Gursky2,*
V. L. Andronova3
N. P. Bazhulina1
V. S. Archipova1
A. M. Nikitin1
G. A. Galegov3
Engelhardt Institute
1
of Molecular Biology
Vavilov ul. 32
Scientific and Technological
2
Cardiology Complex
3-d Cherepanoskya ul, 15a
Ivanovsky Institute of Virology
3
Gamaleya ul. 16, 123098 Moscow
Russia
gursky@eimb.ru
*
Figure: Sequence of the minimal OriS duplex (A). Indicated are the positions of two palindromes and the
interaction sites for UL9 dimers (boxes I, II, and III).
Intermediate active and inactive forms of OriS* suggested by Aslani et al. are shown (B and C). An inactive form (C) is stabilized upon binding of the ligand to
the AT-rich hairpin in OriS*.
896
binding ligands have been synthesized, which selectively inhibit development of
virus-induced cytopathogenic effect in Vero cell culture infected with herpes simplex virus type 1 and vacinia virus. Studies on binding of these compounds to DNA
and synthetic poly- and oligonucleotides have been performed by UV and CD spectroscopy, gel mobility shift assays, and DNase I footprinting. Footprinting studies
reveal that some of them exhibit strong preferences for binding to the AT-cluster in
OriS and protect it from cleavage by DNase I.
The observed antiviral activity of the minor groove binding ligands can be attributed
to their abilities to inhibit fluctuation opening of AT-base pairs and DNA bending,
which is induced upon binding of UL9 protein to the Boxes I and II. We have found
that in the presence of bis-linked netropsin derivatives the rate of DNA unwinding
by the UL9 protein is reduced. Some of the drugs binds strongly to the intermediate
conformation (OriS*) represented by a single-stranded tail at the 3ʹ-end and stable
Box I-Box III hairpin. We have compared the DNA-binding properties and antiviral
activities of two bis-netropsins containing cis-diammine Pt(II) groups attached to
each netropsin-like fragment via one (Pt-bis-Nt) or two (Pt*-bis-Nt) glycine residues. Our experiments show that Pt-bis-Nt and Pt*-bis-Nt bind strongly and selectively to AT-rich regions on DNA. However, Pt*-bis-Nt exhibits practically no
antiviral activity in cell culture experiments, whereas Pt-bis-Nt inhibits reproduction
of herpes simplex virus type 1 with the selectivity index equal to 60. The CD spectroscopy studies and UV melting experiments show that there are substantial differences in the mode of binding of these ligands to OriS* and the thermostability of the
corresponding complexes that can be correlated with their antiviral activities.
References and Foonotes
1. V. L. Andronova, S. L. Grokhovsky, A. N. Surovaya, V. S. Archipova, G. V. Gursky, G. A.
Galegov. Doklady Biochem Biophys 422, 296-301 (2008).
2. S. L. Grokhovsky, A. N. Surovaya, G. Burckhardt, V. F. Pismensky, B. K. Chernov, Ch Zimmer, G. V. Gursky. FEBS Letters 439, 346-350 (1998).
3. A. N. Surovaya, G. Burckhardt, S. L. Grokhovsky, E. Birch-Hirschfeld, A. M. Nikitin, H.
Fritzsche, Ch. Zimmer, G. V. Gursky. J Biomol Struct Dyn 18, 689-701 (2001).
4. A. Aslani, R. Macao, S. Simonsson, P. Elias. Proc Natl Acad Sci 98, 7194-7199 (2001).
5 A. Aslani, M. Olsson, P. Elias. J Biol Chem 43, 41204-41212 (2002).
6. A. N. Surovaya, S. L. Grokhovsky, N. P. Bazhulina, G. V. Gursky. Biophysics 53, 344351 (2008).
167
Nina Sidorova*
Shakir Muradymov
Donald C. Rau
Laboratory of Physical and Structural
Biology, PPB, NICHD
National Institute of Health
Bld.9, Rm.1E108
Bethesda, MD 20892
sidorova@mail.nih.gov
*
Specific versus Nonspecific DNA Binding
of the Restriction Endonuclease EcoRV
Measured by Self-Cleavage Assay
The type II restriction endonucleases binding to DNA is a paradigm for the specific
recognition. Usually restriction endonucleases can distinguish between cognate
and nonspecific DNA sequences quite efficiently in the absence of divalent cofactor that is required for cleavage. There are, however, many conflicting results in
literature regarding ability of the EcoRV restriction endonuclease to distinguish
between specific and nonspecific DNA sequences in the absence of divalent ions.
One group only has demonstrated significant specificity. The majority of researchers do not see meaningful preferential binding, typically less than a 10-fold difference between the recognition sequence and nonspecific DNA. The x-ray structures
for specific and non-cognate DNA-EcoRV complexes are, however, noticeably
different in the absence of metal co-factors suggesting it is probable that EcoRV
specific and nonspecific binding free energies should differ substantially. The total
surface area buried on complex formation is about 1800 square angstroms larger
in the case of cognate DNA binding suggesting that there should be also significant
difference in hydration between two complexes. We have applied the self-cleavage
assay developed by us previously to measure EcoRV-DNA solution binding. This
technique does not have the limitations of more commonly used assays as gel mobility shift, filter binding, and anisotropy of fluorescently labeled complexes. Our
results indicate significant EcoRV binding specificity in the absence of divalent
ions. We confirm that EcoRV binding specificity is strongly pH dependent. We
have also uncovered an unusual slow transition between specific binding modes
that may account for the discrepancies seen in the literature.
897
Additionally, using the osmotic stress technique combined with a self-cleavage assay we measure differences in hydration between specific and nonspecific DNAEcoRV complexes. We find that specificity of the EcoRV binding to DNA is strongly promoted by the presence of neutral solutes used to set water activity.
168
Stability of Right-handed DNA Crossovers
Mediated by Divalent Cations in Solution
The assembly of DNA duplexes into higher-order structures plays a major role in
many vital cellular functions such as recombination, chromatin packaging and gene
regulation. However, little is currently known about the molecular structure and stability of direct DNA-DNA interactions that are required for such functions. Although
the close approach of DNA segments is usually considered repulsive, recent experimental and theoretical studies have indicated that short-range attraction may exist
between DNA double helices in the presence of divalent cations. DNA helices have
found natural ways to minimize electrostatic repulsion between double helices in
crystal structures of DNA. Within crystals, B-DNA can form either tight right-handed crossovers self-fitted by groove-backbone interaction or left-handed crossovers
assembled by groove-groove juxtaposition. In the present work, molecular dynamics simulations are used to evaluate the stability of such crossovers in various ionic
conditions. Our results show, for the first time, that right-handed DNA crossovers
are thermodynamically stable in a solution environment that contains at least one
Mg2+ per four phosphate groups. A structural analysis highlights the importance of
sequence-specific phosphate-cytosine interactions in the major groove, reinforced
by preferential Mg2+ binding at these anchor sites. Free-energy calculations reveal
an attractive force at short-range that stabilises such crossover structures with interaxial separation of helices within 20 Å. Right-handed crossovers, however, dissociate swiftly in the presence of monovalent ions only, even at 1M concentration.
Left-handed crossovers are assembled by sequence-independent juxtaposition of the
helices which appeared unstable even at the highest concentration of Mg2+ studied
here. Our study provides new molecular insights into chiral association of DNA duplexes and highlights the unique role divalent cations play in stabilization, in agreement with recently published experimental data. These results may serve as a rational basis to understand the role DNA crossovers play in many biological processes.
Stereoselectivelly Deuterated
Nucleosides for NMR Studies of DNA
In nucleic acids, 5’-protons of desoxyribose moiety form numerous inter- and intranucloetide nOe contacts that carry valuable information about the sugar pucker,
glycosidic, and sugar-phosphate torsion angles. However, impossibility to unambiguously assign 5’ and 5” protons makes the extraction of these important
structural parameters problematic. A stereoselective substitution of one nucleotide
5”-proton with deuterium has been proposed as the most straightforward solution of the assignment problem (1-3). Using Alpine-Borane chemistry (4), we introduced deuterium at 5”-position of ribonucleosides with stereoselectivity of ca
20:1 (1). Recently, we applied the same approach to the synthesis of deuterated
2’-deoxynucleoside phosphoramidites suitable for chemical incorporation of the
Peter Varnai1
Youri Timsit2
Dept. of Chemistry and Biochemistry
1
University of Sussex
Brighton, BN19QJ, UK
Laboratoire de Cristallographie et de
2
Biochimie Théorique, CNRS UPR9080
Institut de Biologie Physico-Chimique
13, rue Pierre et Marie Curie
Paris 75005 France
p.varnai@sussex.ac.uk
timsit@ibpc.fr
169
Mark Lukin*
Tanya Zaliznyak
Carlos de los Santos
Department of Pharmacological Sciences
SUNY at Stony Brook,
Stony Brook NY 11794-8651
lukin@pharm.stonybrook.edu
898
deuterated moieties into DNA. We utilized selective deuteration to establish the
structure of the DNA adduct formed by one of the most powerful naturally occurring mutagens and carcinogens – aristolochic acid (AA). The AA lesion disrupts
the normal Watson-Crick structure of the damaged base pair and causes extrusion of the complementary thymidine out of the helix, so canonical internucleotide
nOe contacts are insufficient for structure refinement. In that case the information
extracted from stereospecifically assigned 5’ and 5” resonances appeared to be
extremely helpful in obtaining the precise structure of the lesion site.
Left: Fragments of 300 ms NOESY spectra of 5”-deuterated (Ia, IIa) and non-deuterated (Ib, IIb) DNA duplex with single AA-dA damage site. Resonances corresponding to H5” are absent on the panels Ia and IIa.
Right: 3D structure of the lesion site (only the aristolochic acid residue and opposing thymidine are shown).
Interproton distances corresponding to T17H5’ crosspeaks are shown as dashed lines.
170
Orsolya Barabas1
Catherine Guynet2
Adeline Achard2
Bao Ton-Hoang2
Michael Chandler2
Fred Dyda1
Alison B. Hickman1,*
Laboratory of Molecular Biology
1
NIDDK, NIH, Bethesda MD 20892
Laboratoire de Microbiologie et Gene-
2
tique Moleculaires, Centre National de
la Recherche Scientifique, 118 Route de
Narbonne, 3102, Toulouse Cedex, France.
ahickman@helix.nih.gov
*
1. Lukin, M. A., Bushuev, V. N. Nucleosides & Nucleotides 18, 1255-1256 (1999).
2. Oogo, Yu, Ono, A. (M)., Ono, A., Kainosho, M. Tetr Lett 38, 395-398 (1997).
3. Cromsigt, J., Schleucher, J., Gustafsson, T., Kihlberg, J., Wijmenga, S. Nucl Acids Res 30,
1639-1645 (2002).
4. Midland, M. M., Asirwatham, G., Cheng, J. C., Miller, J. A., Morell, L. J Org Chem 59,
4438-4442 (1994).
Structural and Mechanistic Insights into
Single-stranded DNA Transposition
DNA transposition is a process in which discrete segments of DNA are moved
from one genomic location to another, accomplished through a series of DNA
strand cutting and joining reactions catalyzed by a transposase. There are a surprisingly large number of mechanistically different ways how DNA transposition
is carried out and regulated. Our recent mechanistic and structural studies into
the transposition pathway of IS608, an insertion sequence originally identified in
Helicobacter pylori, have provided the first insights into a pathway that acts asymmetrically on single-stranded DNA.
IS608 always inserts just 3ʹ of a TTAC tetranucleotide. We have established that
the mode of target site recognition relies on interactions between an internal sequence of the transposon and the target sequence, opening up an unexpected approach to site-specific targeting of transposition. We have recently demonstrated
that we can direct insertions in a predictable way into a variety of chosen target
sequences, both in vitro and in vivo.
Structural Changes and Reaction Intermediates in the
Catalytic Cycles of DNA Repair Enzymes
One of the main ways to repair damage to individual DNA bases is the base-excision repair (BER) pathway. The key enzymes in BER are DNA glycosylases,
which recognize a variety of modified or mismatched bases and catalyze cleavage
of the N-glycosidic bond to release the inappropriate base from the deoxyribose
ring. Many glycosylases also catalyze a β-elimination (or lyase) reaction to effect
strand scission after the base removal. Subsequent action of apurinic-apyrimidinic
(AP) endonucleases and 3’-phosphodiesterases remove the remaining sugar fragment to produce a single-nucleotide gap with the proper 3’-OH and 5’-phosphate
termini, a substrate for DNA polymerases. After the DNA polymerase adds the correct nucleotide, DNA ligase completes the BER process.
Bacterial Fpg and eukaryotic OGG1 are two proteins that share no sequence homology nor are they structurally similar. In spite of this, they both are able to remove 8-oxoguanine (oxoG), an abundant pre-mutagenic oxidized nucleobase, from
DNA. Recently we have investigated conformational dynamics in several DNA
repair enzymes, including E. coli Fpg and human OGG1, and in their DNA substrates by stopped-flow detection of tryptophan (Trp) and 2-aminopurine (2-aPu)
fluorescence (1-5). In all cases, multiple transient changes in the fluorescence intensities of the enzymes and their DNA substrates were observed, indicating sequential
conformational transitions in both macromolecules during the catalytic cycle. In
this study, we have performed pre-steady-state quench-flow measurements of DNA
cleavage by Fpg for substrates containing 8-oxoguanine or an AP site. There was a
fast burst phase of product accumulation followed by a linear part, characteristic of
the overall reaction rate limited by a post-incision step. The reaction progress was
followed by ESI/MS after a reduction of the Schiff base intermediate with NaBH4,
capturing the formation of two covalent enzyme-DNA intermediates: a cross-link
between Fpg and C1’ of the damaged nucleoside before the β-elimination step and
a final conjugate of 4-oxo-2-pentenal with Fpg after the δ-elimination step. A comparison of the kinetics of DNA cleavage and covalent intermediate formation with
the Trp fluorescence traces indicated that the regeneration of the free enzyme from
its conjugate with 4-oxo-2-pentenal most likely occurs after the dissociation of the
enzyme-product complex and limits the reaction under multiple-turnover conditions. The analysis of the Trp and 2-aPu fluorescence traces obtained for wild-type
Fpg and its mutant forms F110W and F110A suggests that the search for damaged
bases in DNA proceeds through intercalation of Phe-110 residue into the DNA helix. This step could initiate the eversion of the damaged deoxynucleoside into the
catalytic center of enzyme. The fluorescence kinetics for Fpg interaction with DNA
substrates containing a FRET donor/emitter or emitter/quencher pair (Cy3/Cy5 or
fluorescein/dabcyl) shows that the eversion of damaged deoxynucleoside is combined with the introduction of a kink into the DNA helix.
The interaction of OGG1, the human functional counterpart of Fpg, with a 8-oxoguanine-containing substrate carrying a pair of FRET labels, Cy3/Cy5, led to a
scission of the damaged DNA strand followed by separation of the donor/emitter
pair and a resulting decrease in the fluorescence. The rate of this reaction coincides with the rate of the conformational transition in the OGG1 molecule detected
through Trp fluorescence. Therefore, in contrast to Fpg, the release of OGG1 from
the enzyme-product complex does not limit the overall rate of the process. In human cells, the repair of AP sites, either formed spontaneously or products of the
glycosylase reaction, is initiated by a special AP endonuclease, APE1. This enzyme recognizes the AP sites in double-stranded DNA and makes a single nick in
the phosphodiester backbone 5’ to the AP site. We found that the rate of the AP site
scission obtained for interaction with FRET-labeled DNA substrates was the same
as the rate of the conformational transition in APE1 corresponding to the product
release step. The data obtained for the APE1-N211A mutant indicated that the Asn-
899
171
N. A. Kuznetsov
L. Yu. Kanazhevskaya
V. V. Koval
D. O. Zharkov
O. S. Fedorova*
Inst. of Chemical Biology
and Fundamental Medicine
Novosibirsk State University
Novosibirsk 630090, Russia
fedorova@niboch.nsc.ru
*
900
211 residue is not essential for AP site recognition and binding but specifically
required for the efficient catalysis.
Acknowledgements
This work was supported by grants from the RFBR (07-04-00191) and Siberian
Division of the Russian Academy of Sciences (28, 48).
172
Yuegao Huang
Congju Chen
Irina M. Russu*
Department of Chemistry and Molecular
Biophysics Program
Wesleyan University
Middletown CT 06459
irussu@wesleyan.edu
*
1. Fedorova, O. S., Nevinsky, G. A., Koval, V. V., Ishchenko, A. A., Vasilenko, N. L., Douglas,
K. T. Biochemistry 41, 1520-1528 (2002).
2. Koval, V. V., Kuznetsov, N. A., Zharkov, D. O., Ishchenko, A. A., Douglas, K. T., Nevinsky,
G. A., Fedorova, O. S. Nucleic Acids Res 32, 926-935 (2004).
3. Kuznetsov, N. A., Koval, V. V., Zharkov, D. O., Nevinsky, G. A., Douglas, K. T., Fedorova,
O. S. Nucleic Acids Res 33, 3919-3931 (2005).
4. Kuznetsov, N. A., Koval, Nevinsky, G. A., Douglas, K. T., Zharkov, D. O., Fedorova, O. S. J
Biol Chem 282, 1029-1038 (2007).
5. Kuznetsov, N. A., Koval, V. V., Zharkov, D. O., Vorobiev, Y. N., Nevinsky, G. A., Douglas,
K. T., Fedorova, O. S. Biochemistry 47, 424-435 (2007).
Structural Energetics of a DNA-RNA Hybrid
Containing a Tract of dA-rU Base Pairs
The presence of tracts of A-T/U base pairs has a profound effect on the structural
and functional properties of nucleic acid duplexes. For the DNA-RNA hybrid duplexes formed in transcription, the presence of a tract of dA-rU base pairs often
provides a signal for the release of messenger RNA. The structural and dynamic
properties of the tract, which are responsible for termination of transcription at
these sites, are not yet known. To address this question, in the present work, we
investigated a DNA-RNA hybrid from the intrinsic transcription terminator site tR2
of phage λ. The hybrid contains a tract of five dA-rU base pairs in the following
base sequence: 5’-dGCGATAAAAAGGCC-3’/5’-rGGCCUUUUUAUCGC-3’.
The stability of individual base pairs in the DNA-RNA hybrid was characterized
from the exchange of the hybrid’s imino protons with solvent protons using nuclear
magnetic resonance (NMR) spectroscopy. The NMR resonances of the imino protons were assigned in 1H-1H NOESY and 15N-editing experiments on samples of
the DNA-RNA hybrid in which the imino group of single uracil bases was labeled
with 15N. The rates of exchange of imino protons were measured as a function of
the concentration of a proton acceptor (ammonia base) to obtain the free energy
change in the opening reaction for each base pair in the hybrid duplex. The results
demonstrate that the stabilities of dA-rU base pairs in the tract are lower than that
of an isolated dA-rU base pair. Furthermore, the stability depends on the location
of the dA-rU base pair within the tract. The relationship between these findings and
the energetic properties of other nucleic acid duplexes of similar base sequence will
be discussed. (Supported by a grant from the NIH).
Temperature-induced Unfolding of Unusual DNA
Structures: Correlation of Optical and DSC Melting
Curves with Fluorescence Melts Using 2-Aminopurine.
One focus of our research is to investigate the melting behavior of unusual DNA
structures and to determine their unfolding thermodynamic profiles. In this work,
we used a combination of UV, CD and fluorescence spectroscopies, and differential scanning calorimetric (DSC) techniques to investigate the temperature unfolding of a variety of DNA structures. The main objectives were to correlate optical
and calorimetric melting curves with fluorescence melts obtained by observing the
fluorescence changes of 2-aminopurine (2-AP) when incorporated into DNA, and
to determine the specific thermodynamic contributions for the single incorporation
of 2-AP. Specifically, we have investigated the following: (a) a dodecamer duplex,
5’
-CGCGAXTTCCGG/5’-CCGGAATTCGCG; (b) a hairpin, 5’-GTXACGCAAGTTAC, “GCAA” is the loop; (c) an intramolecular pyrimidine triplex, 5’-A3XA3C5T7C5T7; and (d) a G-quadruplex, 5’-G2T2G2TXTG2T2G2; where “X” is 2-AP.
The UV, CD, Fluorescence and DSC melting curves for each of these four molecules show monophasic transitions with similar transition temperatures, TMs, and
van’t Hoff enthalpies. This indicates that the fluorescence changes for the unstacking of 2-AP follow the unfolding of the whole molecule. Comparison of the DSC
thermodynamic profiles of each 2-AP modified molecule with its corresponding unmodified oligonucleotide shows that the single placement of 2-AP is destabilizing;
the differential free energy term, ΔΔGº, ranged from 2.0 kcal (duplex) to 3.1 kcal
(hairpin), due to lower TMs of 3.9-8.1 ºC and lower formation enthalpies, 5 kcal/
mol (duplex) to 14.6 kcal/mol (hairpin). The one exception is the G-quadruplex that
was stabilized with the incorporation of 2-AP (ΔΔGº of -0.9 kcal/mol), and due to a
higher TM (by 6.1 ºC) and more favorable enthalpy contribution of -4 kcal/mol.
901
173
Hui-Ting Lee
Lela Waters
Chris Olsen
Irine Khutsishvili
Luis A. Marky*
Dept of Pharmaceutical Sciences
Univ. of Nebraska Medical Center
986025 Nebraska Medical Center
Omaha, NE 68198-6025
lmarky@unmc.edu
*
The overall results indicate that on appropriately placed 2-AP can be used as
a probe to monitor the temperature unfolding of a nucleic acid molecule. Furthermore, the destabilizing effect for the incorporation of a 2-AP-dT base pair
between two dA-dT base pairs is due to lower stacking contributions; while the
stabilizing effect of the TXT loop of the G-quadruplex is due to additional stacking contributions of this loop with the G-quartet at the top of this molecule. Supported by Grant MCB-0616005 from NSF.
The Comparative Study of CuTAlPyP(4)
and CoTAlPyP(4) Porphyrins with DNA
A comparative study of water-soluble Cu (II) and Co (II)-containing cationic
tetrakis(N-Alyl-4-pyridiniumyl) porphyrin [CuTAlPyP(4) and CoTAlPyP(4)] and
its metal free form H2TAlPyP(4) with calf thymus DNA (ct DNA) complexes have
been studied by optical absorption, CD (circular dichroism) and melting methods.
The studied porphyrins contain a long aliphatic strand with double bind in their
peripheral radicals. The absorbance spectra at Soret band show a high hypochromic effect (65,2%) for interaction of H2TAlPyP(4) and CuTAlPyP(4) porphyrins
with DNA and red shift, in the case of DNA-CoTAlPyP(4) complexes there are
some blue shift and less hypochrom (31.4%). These effects are more appear at high
ionic strength (μ=0.2). The binding parameters (Kb and n) were calculated using
McGhee and von Hippel equation. The results indicated that the presence of Co(II)
in porphyrin ring was decreasing binding parameters as against to H2TAlPyP(4)
and CuTAlPyP(4) porphyrins. Binding mode with DNA was determined by sign
of ICD spectra. It was shown, that the square planar complexes such as free bases
and CuTAlPyP(4) intercalate between DNA base pairs (negative ICD band). For
174
G. Ananyan*
A. Avetisyan
Y. Dalyan
Yerevan, Armenia
angay@ysu.am
*
902
175
Lusine Abgaryan
Faculty of Physics
Al.Manoogian Str.1
Yerevan 375025 Armenia
Current Address:
The Scripps Research Institute
10550 N Torrey Pines Rd
MEM L51 La Jolla, CA 92037
lusine@scripps.edu
*
176
Jason S. Leith*
M. Slutsky
L. A. Mirny
MIT E25-526C
77 Mass. Avenue
Cambridge MA 02139
jleith@fas.harvard.edu
*
leonid@mit.edu
the porphyrin-metal complex, having axially bound ligands such as CoTAlPyP(4),
intercalation is blocked and outside binding occurs (positive ICD band). Hence, determination of thermodynamic parameters governing DNA-porphyrin complex formation makes deeper insight into molecular basis of DNA-porphyrin interactions.
Ionic strength of solution was changed by Mn2+ ions, small concentrations of which
interacte with the phosphate groups of DNA leaving the grooves free and may generate or inhibit intercalation of porphyrin molecules. The measurements were done
in 1 mM NaCl, pH 6.8, concentrations of Mn2+ ions are 0.001 M/P and 0.01M/P. It
was shown, that both metalloporphyrins stabilized the double helix of DNA. According to the experimental results, it can be inferred that the interaction model of
Cu(II)TAlPyP(4) with ctDNA is intercalative binding, while Co(II)TAlPyP(4) is the
long-range assembly on the surface of ctDNA molecule.
The Effect of UV Radiation on DNA-cis-DDP Complex
The current work was carried out to investigate the cooperative effects of UV
radiation and cis-DDP (cis-diamminedichloroplatinum) on DNA helix-coil transition thermodynamics. The antineoplastic agent cis-DDP has been used to successfully treat tumors since 1978, nevertheless there is little known about the nature
of cis-DDP’s interaction with nucleic acids. Cis-DDP has stabilizing effects on
DNA double helix within the relative concentrations on cis-DDP and DNA which
result in specific interactions with GC rich blocks on DNA. Higher concentrations
destabilize the DNA double helix due to the saturation of DNA with cis-DDP. This
results in overall weakening of base pair interactions at the sites of cis-DDP binding to DNA due to the mechanical strain on DNA backbone. Microcalorimetric
studies have shown that the complete effects of cis-DDP on DNA stability are
achieved within 48 hours after treating DNA with cis-DDP at 4 ºC; after this, no
significant changes are observed. UV radiation of cis-DDP-DNA solution reverses
the stabilizing effects of cis-DDP, which are comparable to that of untreated DNA
solution. In order to confirm that the reversal of cis-DDP’s stabilization of DNA
under UV radiation is due to the cis-DDP-DNA complex dissociation, the irradiated cis-DDP-DNA complex was left for over 120 minutes to equilibrate. Equilibration of the irradiated complex results in the recovery of considerable fraction of
the stabilization properties of cis-DDP on DNA double helix.
The Role of Conformational Flexibility in
Proteins’ Search for their Recognition Sites
Many DNA-binding proteins (DBPs) undergo a conformational transition upon
binding to cognate sites. In some cases this transition is accomplished by folding of
a natively unfolded region. What is the role of this conformational transition?
The recently proposed “fly-casting” mechanism suggests that this conformational
transition facilitates binding by increasing the cross-section of the binding reaction
due to the proteins partial unfolding. Here we propose an alternative mechanism – kinetic pre-selection – which allows rapid translocation along DNA while ensuring that
protein that are near their target sites recognize it before they dissociate from DNA.
DBPs are believed to reach their target sites by alternating between 3D diffusion
in solution and 1D diffusion along DNA. We seek to understand the importance of
conformational flexibility in the context of the entire search process – from induction into the nucleus or nucleoid up to the final binding event on a target site. We
previously found that if a DBP-DNA complex is limited to a single conformation,
the protein can either slide efficiently, on a smooth, largely sequence-independent
energy landscape, or bind tightly, on a rugged, highly sequence-dependent land-
scape, but not both. We suggested that distinct conformations of the complex
could allow access to both landscapes.
903
Here we use simulations of the 3D/1D search process by a DBP that undergoes
spontaneous conformational transition between a partially unstructured search conformation that allows rapid sliding and a folded recognition conformation in which
it binds DNA tightly. We demonstrate (i) that there is an optimal rate of the conformational transition; and (ii) that partial destabilization of the recognition conformation is necessary for the mechanism to work. We examine the role of coupling
between folding and binding, find conditions for such coupling to take place, and
show how it facilitates the 3D/1D search process by increasing the probability of
folding on the correct site (kinetic pre-selection). We find that this preselection of
target sites allows proteins with experimentally estimated folding rates to recognize
their target sites before translocating away and dissociating from DNA.
We demonstrate that kinetic pre-selection mechanism is consistent with available
NMR and single-molecule measurements and provides a much more significant acceleration (~100 fold) that the earlier proposed fly-casting (~1.5-2 fold).
Uncovering Subtle Effects on Structures
of Nucleic Acids in Solution and Protein-bound
Forms Through Vibrational Spectroscopy
Nucleobase structures in solution are difficult to determine due to the possible existence of many tautomeric forms and protonation states. Determination of the precise solution state structures is important to understand the several protein-nucleic
acid interactions that are central to cellular function. Vibrational spectra can provide
valuable information beyond that obtained from crystal structures alone because of
higher sensitivity of the spectra to hydrogen bonding and non-covalent interactions.
We have exploited the potential of vibrational spectra to determine the solution and
protein-bound structures of nucleic acids, viz. hypoxanthine, xanthine, guanine, and
their corresponding nucleotides in solution and bound to protein. Ultraviolet resonance Raman spectroscopy was used to specifically obtain spectra from the nucleic
acids without interference from the solution or protein environment. To further understand the effect of environment quantitatively, we have employed high-level ab
intio and density functional theoretical calculations. I will demonstrate from our results that this combination of experimental and computational techniques provides
unprecedented, detailed information on nucleic acids. We have used this combination of techniques to understand the differences in the binding of nucleotides to the
human and P. falciparum enzyme, hypoxanthine guanine phosphoribosyl transferase
(HGPRT). Our data show that subtle interactions of the ring substituents with the
enzyme can explain the differences in the binding of hypoxanthine and guanine.
177
Spriha Gogia1
Hemalatha Balaram2
Mrinalini Puranik1,*
National Centre for Biological Sciences,
1
GKVK Campus, Bellary Road
Bangalore– 560065, India
Jawaharlal Nehru Centre for
2
Advanced Scientific Research,
Jakkur, Bangalore, India
mpuranik@ncbs.res.in
*
178
Watson-Crick Recognition of Double-Stranded B-DNA
Nature has settled on double helical DNA as the storehouse of genetic information
because of its ability to protect the genetic codes from reactive chemical species.
While this strategy may confer evolutionary advantage to organisms by preserving the integrity and safe transfer of their genetic information, it presents a major
challenge for chemists and biologists trying to develop means to recognize this
natural biopolymer. Pursuit of this goal has in the past generally been focused on
the minor and major groove because of their ease of accessibility. Now we show
that sequence-specific recognition of double helical B-form DNA (B-DNA) can
be established through direct Watson-Crick base-pairing by using conformationally-preorganized γ-peptide nucleic acids (γ-PNAs). Binding occurs in a highly
Danith H. Ly
Associate Professor
Carnegie Mellon, University Pittsburgh
Pittsburgh, PA 15213, USA
dly@andrew.cmu.edu
sequence-specific manner through
a strand-invasion mechanism. Unlike other approaches that have
been developed to date, only a
single strand of γ-PNA is required
for binding and it can be applied to
any sequence or target length.
904
179
A Translational Signature for
Nucleosome Positioning In vivo
Micaela Caserta
Eleonora Agricola2
Mark Churcher3
Edwige Hiriart3
Loredana Verdone1
Ernesto Di Mauro1,2
Andrew Travers3,4,*
1
Fondazione Istituto Pasteur-Fondazione
1
Cenci Bolognetti, c/o Dipartimento di
Genetica e Biologia Molecolare
Università La Sapienza
00185 Rome, Italy
Istituto Biologia e Patologia Molecolari
2
del Consiglio Nazionale delle Ricerche
Università La Sapienza,
00185 Rome, Italy
MRC Laboratory of Molecular Biology
3
Hills Road, Cambridge CB2 0QH, UK
Fondation Pierre-Gilles de Gennes
4
c/o LBPA, École Normale Supérieure de
Cachan, 94230 Cachan, France
aat@mrc-lmb.cam.ac.uk
*
In vivo nucleosomes often occupy well-defined preferred positions on genomic
DNA. An important question is to what extent, these preferred positions are directly
encoded by the DNA sequence itself. We derive here from accurately mapped in
vivo positions identified by partial micrococcal nuclease digestion a translational
positioning signal that identifies the approximate midpoint of DNA bound by a
histone octamer. This signal corresponds well to the averaged sequence organisation of cloned ‘in vivo’ octamer binding sequences and occurs in ~70% of sampled
accurately mapped positions in yeast but differs substantially from the sequence
organisation of octamer binding sites selected in vitro. In particular this signal is
enriched in preferred microcccal nuclease cleavage sites relative to positioning sequences identified on the basis of limit micrococcal nuclease digestion to core nucleosomes. On the basis of these results we propose a modified sequence code for
protein-induced DNA bending and hence for nucleosome positioning.
The translational signature comprises two components: a region of high sequence
periodicity flanking the midpoint on one or both sides and a region of low average
sequence periodicity spanning the midpoint itself. We suggest that in the latter position the DNA sequence could act as a torsional sink to facilitate octamer binding.
Since the translational signature is associated with more than one nucleosome in an
array and also occurs at a frequency greater than that of nucleosomes we infer that
nucleosome positioning in yeast is neither completely statistical as proposed by
Kornberg, but nor is it completely specified by the DNA sequence. We suggest that
positioning of nucleosomes in an array in vivo requires an ‘organiser’.
We further show that under more ‘physiological’ reconstitution conditions the
same octamer-binding sequences identified ‘in vivo’ bind the octamer with a substantially higher affinity than a DNA sequence selected for octamer binding by
salt dilution protocols. The change in the relative affinity for natural and selected
sequences as determined by the different protocols can be up to 300-fold. The
sequence associated with -1 nucleosome at the 5’ end of the ADY2 array binds
the octamer with a higher affinity than sequences associated with downstream nucleosomes and thus could act in part as an ‘organiser’.
Changes in Chromatin Conformation and PARP-1
Activity Induced by Cisplatin in Rat Liver
The formation of ladder configuration of the nucleosomal DNA fragmentation is
a biochemical hallmark of apoptosis in different cell types. To date, the regulation of apoptotic DNA fragmentation has been well explained by the CAD/ICAD
system operating in dying cells. Nevertheless, in some cases the internucleosomal
DNA fragmentation in apoptosis is mediated by Ca2+/Mg2+ endonuclease. It was
suggested that suppression of Ca2+/Mg2+ endonuclease activity contribute to formation of resistance of cancer cells to chemotherapeutic drugs by inhibition of
non-random DNA degradation in nuclei.
Coming from the knowledge that the character and intensity of DNA degradation
in chromatin are determined by its accessibility for cleaving endonucleases, we
suppose that DNA internucleosomal fragmentation in apoptosis could be modulated by definite epigenetic changes in chromatin structure and architecture caused
by chemotherapeutic drug cisplatin.
905
180
I. G. Artsruni
K. S. Matinyan
L. H. Demirkhanyan
E. S. Gevorgyan
Faculty of Biology, Dept of Biophysics
Yerevan State Univ., Alex Manoogian 1
Yerevan, Armenia 0049
GANA@ysu.am
To assess the ability of cisplatin to alter chromatin structure in a manner that recapitulates inhibition of internucleosomal DNA fragmentation, we assessed whether
the drug is capable to affect the accessibility of liver chromatin to endogenous Ca2+/
Mg2+ endonuclease activity. Taking into the account that poly-ADP-ribosylation
plays a prominent role in determination of chromatin architecture and regulation of
basic chromatin-associated functions we examined the effect of cisplatin administration on rat liver nuclei poly(ADP-ribose)polymerase-1 (PARP-1) activity.
As it was shown in our previous study, the addition of Ca2+ and Mg2+ ions into
incubation media of naked rat liver nuclei caused rapid activation of Ca2+/Mg2+
endonuclease and eventually internucleosomal cleavage of nuclear DNA. In present study we revealed that in 24 hour of cisplatin administration to out-breed
white rats (intraperitonial, 10 mg/1kg weight) the internucleosomal DNA ladder
generated by endogenous Ca2+/Mg2+ endonuclease in liver nuclei loses its characteristic sharpness. We detect so called “smearing” of corresponding DNA bands,
visualized by agarose gel electrophoresis. Importantly, changes in DNA ladder
configuration were accompanied by suppression of PARP-1 activity in the liver
nuclei of cisplatin treated animals.
These data suggest that cytotoxic effect of cisplatin can be mediated by DNA-cisplatin interactions that occur in linker regions of chromatin.
Chromatin Higher Order Structure
and Regulation of its Compaction
During the past decade it has become evident that histone and DNA modifications
are key regulators of all nuclear processes whose substrate is DNA. While the effects of, for instance, histone post-translational modification on transcription are
well-documented, there is no mechanistic understanding of how such modification
regulate chromatin condensation directly, or indirectly. Such an understanding is
dependent on knowledge of the three-dimensional structure of chromatin. Although
the structure of the first level of DNA folding, the nucleosome core, is known at
atomic resolution, the structure of the second level of folding, whereby a string of
nucleosomes folds into a fiber with an approximate diameter of 30 nm – the ‘30nm’ chromatin fiber, remains undetermined. I will describe our studies on the higher
orders structure of chromatin with two primary aims:
1.) Determination of the structure of the ‘30nm’ chromatin fiber to provide an
understanding of fiber topology and nucleosome-nucleosome interactions.
Daniela Rhodes*
Sara Sandin
Andrew Routh
Philip Robinson
181
MRC Laboratory of Molecular Biology
Hills Road, Cambridge, CB2 0QH, UK
rhodes@mrc-lmb.cam.ac.uk
*
906
2.) Biophysical characterization of the effects of the linker histone and histone modifications on the compaction and stability of chromatin higher
order structure.
1. Robinson, J. J. P., Fairall, L., Huynh, V. A. T., and Rhodes, D. Proc Natl Acad Sci USA 103,
6506-6511 (2006).
2. Robinson, P. J., An, W., Routh, A., Martino, F., Chapman, L., Roeder, R. G., and Rhodes D.
J Mol Biol 12, 816-825 (2008).
3. Routh, A., Sandin, S., and Rhodes, D. Proc Natl Acad Sci USA 105, 8872-8877 (2008).
182
Jeffrey C. Hansen*
Steven J. McBryant
Xu Lu
Biology, Mail Code 1870
Colorado State University
Fort Collins, CO 80523
jeffrey.c.hansen@colostate.edu
*
183
Stephen B. Baylin
The Sidney Kimmel Comprehensive
Cancer Center at Johns Hopkins
Bunting Blaustein Cancer Research
Building, Baltimore, Maryland
sbaylin@jhmi.edu
Determinants of Histone Tail Function during Chromatin Condensation
Eukaryotic DNA is bound to octamers of core histones to form nucleosomal arrays.
Nucleosomal arrays complexed with linker histones or other chromosomal proteins
are called chromatin fibers. Model nucleosomal arrays and chromatin fibers have
been used to probe the determinants of core histone NTD and linker histone CTD
function during salt-dependent array/fiber condensation. Previously we have shown
that the core histone N-terminal “tail” domains are essential mediators of the nucleosome-nucleosome interactions involved in fiber condensation, while the linker
histone C-terminal domain is needed to stabilize condensed chromatin. Both the
core histone NTDs and the linker histone CTD are intrinsically disordered protein
domains. In the present work, site directed mutagenesis has been used to create
novel core and linker histone proteins with specifically altered N- and C-terminal
domains, respectively. These mutant histones have then been assembled with defined DNA templates into model nucleosomal arrays and chromatin fibers. Analytical hydrodynamic analyses of the mutant nucleosomal arrays and chromatin fibers
in the presence of salts indicate have helped dissect the molecular determinants of
core and linker histone tail domain function during chromatin condensation.
Epigenetic Silencing in the Initiation
and Progression of Human Cancer
DNA hypermethylation of gene promoters and associated transcriptional silencing
can serve as an alternative to mutation for producing loss of tumor suppressor gene
function. Some of the classic genes involved and approaches to randomly screen the
cancer genome for such gene will be descried, demonstrating their functional role
in cancer progression. The study has helped to begin unravel the molecular mechanisms responsible for the initiation and maintenance of the gene silencing, and we
plan to utilize all of our findings for translational purposes.
Graphical Modeling of the
Beta-Globin Transcription Factory
Biology provides more and more 3D representations of molecules at work in
cells. Those fundamental units of life most often work together to achieve the
specific task they are assigned to. In this context, the huge amount of structural
data available has now to be integrated into a unified view of the macromolecular complexes they form. We would like to propose here a structure of the machinery designed to transcribe our genes into messenger RNA. This structure has
been termed “transcription factory”. The structure of most of its parts is now
resolved at different resolutions using a broad array of techniques such as X-rays
diffraction patterns of proteins/nucleic-acids crystals and electron microscopy of
complexes. Transcription factories are ~100 nm diameter protein-rich units from
which loops of DNA emanates. Three to eight polymerase II are estimated to reside on their surface. We propose here a unified plausible structure of one of this
unit located within the 11nth of our chromosomes.
907
184
H. Wong1
J. Mozziconacci2,*
Laboratoire de Physique Théorique de la
1
Matière Condensée, Université Pierre et
Marie Curie, Paris, France
Computer Lab, Cambridge University
2
Cambridge, UK
pipo@lptl.jussieu.fr
*
185
Individualization of Chromatids in Higher Eukaryotes
Coordination between eukaryotic origins of replication (ORIs) is not understood.
ORIs are not defined by sequence; however, unspecified structural mechanism
of their definition is indicated. The temporal aspects of ORIs coordination were
studied and it was shown that chromatin, depending on its structural status, replicate at different times. However, the mechanism of spatial separation of the
replication’s products, particularly the problem of avoiding mixing between sister
chromatids, remains unexplained.
There is strong evolutionary pressure resulting in semi-conservative replication as
indicated by extremely low level of sister chromatid exchange errors (SCE). The
reason for such strong evolutionary pressure is not obvious, but it indicates that
the DNA strands are differentiated from each other along the whole length of the
chromsome. Observations of diplochromosomes show that this mechanism is not
based on sequence but rather on epigenetic memory of generation when each of the
strands in the DNA duplex was synthesized.
The plausible mechanism explaining this phenomenon is based on formation of
Zbyszek Otwinowski
Dominika Borek
UT Southwestern Medical Ctr.
5323 Harry Hines Boulevard
Room ND10.214
Dallas, TX 75390-8816
dominika@work.swmed.edu
zbyszek@work.swmed.edu
908
186
Sergei A. Grigoryev1,*
Sarah Correll1
Christopher L. Woodcock2
Penn State University
1
Dept Biochemistry & Molecular Biology
Hershey, PA 17033
Biology Department
2
University of Massachusetts
Amherst, MA 01003
sag17@psu.edu
*
187
Gaurav Arya*
Sergei Grigoryev
Tamar Schlick
Department of Nanoengineering
University of California - San Diego
9500 Gilman Drive, Mail code 0411
La Jolla, CA 92093-0411
garya@ucsd.edu
*
asymmetric hemicatenene during DNA synthesis. The details of the mechanism
as well as its possible involvement in other aspects of chromatin organization and
epigenetic memory will be discussed.
Internucleosome Interactions
in Chromatin Higher-order Fibers
The architecture of the chromatin fiber, which determines DNA accessibility for
transcription and other template-directed biological processes, remains unknown.
We examined the internal organization of the 30 nm chromatin fiber with a new EMassisted nucleosome interaction capture (EMANIC). This experimental technique
uses formaldehyde crosslinking to fix a limited number of internucleosome contacts
in the condensed state, after which the chromatin is decondensed at low salt, and
transmission EM is used to provide a quantitative assessment of nucleosome-to-nucleosome contacts. We constructed biochemically defined nucleosome arrays with
either uniform or variable nucleosome positioning and examined these arrays as well
as native chromatin using EMANIC. For chromatin condensed at physiological salt
concentration of monovalent cation (Na+), our experiments revealed a nucleosome
interaction pattern consistent with predominantly straight linkers and a two-start helical arrangement of nucleosome cores and showed that nucleosomal arrays containing irregularly positioned nucleosomes are compacted as tightly as regular chromatin.
However, the nucleosome fibers also contained a detectable amount of nucleosome
interactions resulting from bent DNA linkers and the number of such interactions
was significantly increased when chromatin condensation was promoted by a physiological divalent cation (Mg2+). 3D chromatin fiber modeling suggests that linker
DNA crossed in the middle of the fiber hinders its longitudinal compaction. Remarkably, bending of one linker per 5-6 nucleosomes promotes a significant longitudinal
compaction of the chromatin fiber and allows the nucleosomes to form tighter interactions between adjacent nucleosomes. Our data are in an excellent agreement with
results of Monte Carlo simulations of a coarse-grained “mesoscale” chromatin fiber
model by G. Arya and T. Schlick. Taken together, our results reconcile the two-start
zigzag topology with the type of linker DNA bending that defines solenoid models
in a single polymorphic chromatin fiber structure. We discuss our findings in relation
to the mechanism(s) that regulate chromatin fiber packing towards either dynamic
folding in proliferating cells or global self-association that underlie the condensed
heterochromatin of terminally differentiated and senescent cells.
Mesoscale Modeling Predicts New
Polymorphic Structure of Chromatin
Our genomic DNA achieves cellular compaction through several hierarchical levels
of organization. First, DNA wraps around certain protein spools called nucleosomes
that comprise of positively charged proteins called histones. The resulting “beadon-a-string” nucleoprotein complex folds further into a 30-nm chromatin fiber at
physiological conditions in the presence of another protein called the linker histone.
The thermodynamic and structural details of how histone proteins and magnesium
ions critically compact and modulate chromatin structure as well as regulate gene
transcription are not well understood. In this talk, I will present the development
of a new mesoscopic model of chromatin that reproduces experimental data, elucidates the physical role of each histone in chromatin folding, and proposes a new
polymorphic structure of chromatin. Specifically, we show that the linker histone
promotes a two-start zigzag structure of chromatin dominated by interactions between alternate nucleosomes. Divalent ions like Mg2+ further compact the fiber
by significantly screening the repulsion among linker DNAs and promoting their
bending, thus allowing them to better accommodate at the fiber axis. Our results
thus reconcile the zigzag topology with linker DNA bending characteristic of the
solenoid topology in a single polymorphic chromatin fiber structure. Development
of this model now opens up new avenues for studying the formation of higher-order
structures of chromatin for studying epigenetic silencing, and the role of posttranslational modifications and variants of histones in gene regulation.
909
188
On the Structure of The 30 nm Chromatin Fiber
DNA is packed as chromatin on several levels in the eukaryotic nucleus. Dissection of chromatin with nucleases produces three stable substructures: the nucleosome core particle, the chromatosome, and the 30 nm fiber. While the first two
allow transcription, the 30 nm fiber is taken to be the first level of transcriptionally
dormant chromatin and it has an important functional role in cell differentiation
and epigenetic regulation. Its structure has been a subject of continuing discussion since native fibers cannot readily be crystallized. This problem has recently
been addressed by reconstitution of fibers on repeats of DNA sequences having
nucleosome-positioning properties and two different structures were reported (1,
2). The reconstitution results and their interpretations are compared with experimental data from native chromatin and it is shown that the results of Robinson et
al. (2) conform well with the known structural features of native fibers and are a
good first step towards understanding the structure of the fiber.
D. Staynov
Guy Scadding Building
Dovehouse St.
London SW3 6LY UK
d.staynov@imperial.ac.uk
donchyana@btinternet.com
1. Dorigo, B., Schalch, T., Kulangara, A., Duda, S., Schroeder, R. R., et al. Science 306, 15711573 (2004).
2. Robinson, P. J., Fairall, L., Huynh, V. A., Rhodes, D. Proc Natl Acad Sci USA 103, 65066511 (2006).
189
Recognition of Trimethylated K4 of
Histone H3 by the TFIID Subunit TAF3
Post-translational modifications of residues in the N-terminal tails of the histone
proteins play an important role in the regulation of gene expression by enabling or
disabling interaction with chromatin regulatory proteins.
Methylation of lysine 4 of histone H3 (H3K4Me3) is a hallmark of active genes.
Recently, it was discovered that trimethylated K4 is specifically recognized by PHD
finger domains (2, 3). Interestingly, a direct link between the basal transcription
factor TFIID and H3K4me3 has been established (4). The PHD finger of the TFIIDsubunit TAF3 specifically binds H4K4Me3, which might potentiate the recruitment
of the RNA polymerase II complex to active genes.
Here, we investigate the molecular basis of the TAF3-H3K4me3 interaction using NMR spectroscopy, mutational analysis and affinity measurements. We present the solution structure of the PHD finger of the TAF3 subunit in its free state
and when bound to the histone tail of histone H3 trimethylated at lysine 4 (1)
(Figure 1A). The structures of the free and bound form are nearly identical, suggesting that the predefined interaction surface has an important role as a ‘folding
template’ for the H3 tail.
We will discuss the importance of the cation-pi interaction between K4me3 and
the PHD domain as the main determinant of affinity and specificity. The K4me3binding pocket of TAF3A contains a unique local structure rearrangement due to a
conserved sequence insertion to allow the presence of two tryptophan residues close
to the trimethylated amino group of K4. Detailed analysis of several trimethylated
H. van Ingen1,2,*
F. M. A. van Schaik3
H. Wienk1
H. Rehmann3
J. Kruijzer1
R. M. J. Liskamp1
H. Th. M. Timmers3
R. Boelens1
Bijvoet Centre for Biomolecular Re-
1
search, Utrecht University,
The Netherlands
Department of Medical Genetics,
2
University of Toronto, 1 King’s College
Circle, Toronto M5S 1A8 Canada
Dept of Physiological Chemistry Universi-
3
ty Medical Centre Utrecht The Netherlands
hugo@pound.med.utoronto.ca
*
910
lysine complexes reveals that two aromatic residues are required to bind Kme3, one
of which is a tryptophan in a parallel orientation to the lysine side chain.
The TAF3 PHD domain has a high affinity for the H3K4me3 peptide (0.3 µM).
This affinity likely results from the combination of: (i) two tryptophans in the binding pocket that can generate strong cation-pi interaction; (ii) deep burial of the Nterminus and A1; and (iii) a large network of electrostatic interactions. The TAF3
PHD domain binds specifically to trimethylated K4, although the discrimination
against dimethylated K4 is limited and seems to be conferred solely by alterations
in the cation-pi strength. Interestingly, the potential hydrogen bond acceptor D887
in the K4 pocket is too remote to influence this specificity by hydrogen bonding to
the dimethylated amino group.
Finally, we show that the H3K4me3 interaction is sensitive to crosstalk by other histone modifications (Figure 1B). Both chemical shift and mutation data suggest that
the methylated R2 is too bulky to fit in its pocket on the TAF3 surface. Interference
by asymmetric dimethylation of arginine 2 suggests that a H3R2/K4 ‘‘methyl-methyl’’ switch in the histone ‘code’ dynamically regulates TFIID-promoter association.
Figure 1: (A) Solution structure of TAF3-PHDH3K4me3 complex, showing residues 1-6 of the
H3K4me3 peptide in stick representation and the interaction surface of the PHD domain. The K4, T3, and R2
interaction pockets are shown in cyan, brown, and orange, respectively. (B) Overlay of NMR spectra of free
(black) TAF3, bound to H3K4me3 (red), and bound to
H3R2me2aK4me3 (green), showing significant chemical shift perturbation for R2 pocket residues.
1.
2.
3.
4.
5.
6.
van Ingen, et al. Structure 16, 1245-1256 (2008).
Li, et al. Nature 442, 91-95 (2006).
Pena, et al. Nature 442, 100-103 (2006).
Vermeulen, et al. Cell 131, 58-69 (2007).
Bienz. TiBS 31, 35-40 (2006).
Ruthenburg, et al. Mol. Cell 25, 15-30 (2007).
RNA-mediated Epigenetic Mechanism
of Genome Rearrangement
RNA, normally thought of as a conduit in gene expression, has a novel mode of
action in ciliates, where maternal RNA templates provide both an organizing guide
for DNA rearrangements and a template that can transmit spontaneous point substitutions that may arise during somatic growth to the next generation [Nowacki
et al. Nature 451, 153-158 (2008)]. This opportunity for RNA-guided DNA repair
is profound in its regulation of global DNA rearrangements in Oxytricha, involving loss of 95% of its germline genome, through a process that severely fragments
its chromosomes and then sorts and reorders the hundreds of thousands of pieces
remaining. Information for reordering comes from transiently-expressed maternal
RNAs. A complete RNA cache of the maternal somatic genome may be available
at a specific stage during development to provide a template for correct and precise
DNA rearrangement. Furthermore, the occasional transfer of point mutations in
these RNA templates to the rearranged molecules provides a mechanism for stable
inheritance of acquired, spontaneous somatic mutations (in either DNA sequence or
alternative splicing pattern) without altering the germline genome. This mechanism
for inheritance beyond the conventional DNA genome can epigenetically transfer
information across multiple generations, hinting at the power of RNA molecules to
shape genome information. The evolutionary consequences of a viable mechanism
in ciliates to transmit acquired characters may contribute to their cosmopolitan success, as well as high substitution rates in somatic sequence comparisons.
911
190
Mariusz Nowacki1,*
Vikram Vijayan2
Yi Zhou1
Thomas G. Doak1
Keerthi Shetty1
Klaas Schotanus1
Laura F. Landweber1,**
Dept of Ecology & Evolutionary Biology
1
Department of Electrical Engineering
2
Princeton University
Princeton, New Jersey 08544, USA
mnowacki@Princeton.edu
*
lfl@Princeton.edu
**
Simulations of Core Histone Modifications on Human
Mono Nucleosomes Reveal Alterations in Stability
The organization of chromatin within the eukaryotic cell nucleus is critical to its
gene regulation pattern. The efficient packing of the metre long DNA within the
nuclear confines follows a structural hierarchy, the fundamental unit of which is a
nucleosome. Subtle but powerful mechanisms like histone modifications effect local or global structural alterations at the nucleosomal level or at the level of linker
histones and orchestrate the accessibility to the DNA sequestered in chromatin.
This work reports our investigations on the structural role of histone modifications
in tuning the stability of the chromatin fiber at the mononucleosome level. The high
degree of sequence conservation of core histones with the available high resolution
crystal structure of a nucleosome was utilized to derive homology models of a human mono nucleosome. Local perturbations to a human mono nucleosome, which
modulate the energy of the nucleosome complex, have also been analyzed. The
variations in energies of the modified nucleosome with the wild type nucleosome
were used as a probe to estimate nucleosome stability. The observations revealed
that mutations around the DNA interacting regions of the core histones H3 and
H4 induce local structural changes causing substantial changes in the nucleosomal
energy and hence stability. The overall structure of the nucleosome remained unaltered as evidenced by the rms deviation, which compared well with those observed
experimentally for the crystal structures of 11 mutants in Xenopus laevis. Experimentally established DNA binding estimates perceived as a probable relaxation of
the DNA octamer contact and causing instability in the nucleosome were found to
correlate well with the energies obtained by modeling.
At the level of epigenetic modifications, our work demonstrates that the nucleosomal
stability is affected by the alterations of certain critical lysine residues like K14 on
the H3 tail. The observed destabilizing effects of tail acetylation may be due to elimination of certain key DNA – tail interactions in the nucleosome. The incorporation of
variants H2A.Z or H3.3 lower nucleosome stability as evidenced by changes in energy between nucleosome models derived from canonical and variant histones. It is
191
M. Vijayalakshmi1,2
R. Sowdhamini1,*
G. V. Shivashankar1,*
National Centre for Biological Sciences
1
GKVK Campus, Bellary Road
Bangalore 560065, India
SASTRA University
2
Thanjavur 613402, India
mini@ncbs.res.in
912
found that the enhancement of the acidic patch in the nucleosome on replacement of
canonical H2A with H2A.Z alters interactions of the H2A-H2B dimer with histone
H4. The variation in stability caused by the H3.3 variant is attributed to the changes
in electrostatic potential caused by the difference in four amino acids between the
H3.3 and the canonical H3. Our work hypothesizes that variant nucleosomes may
function by modulating the stability of the nucleosome or chromatin fiber, or through
changes in the surface residues at interacting regions. Further, ortholog substitution
did not alter the structural stability of the nucleosome implying that the formation of
the histone octamer is probably conserved despite species specific expansion.
Structural consequences of amino acid substitutions on
H3 tails on Lysines at positions 14. The left panel (a)
shows the wild type structure and the right panel (b)
shows the structural changes in the mutant nucleosome.
192
Cynthia Wolberger*
William Hawse
Kamau Fahie
Kevin Hoff
Dept of Biophysics
and Biophysical Chemistry
Howard Hughes Medical Inst
Johns Hopkins Univ., School of Medicine
725 N. Wolfe St. ,Baltimore, MD 21205
cwolberg@jhmi.edu
*
Structural Insights into the Unusual
Chemistry of Sir2 Enzymes
Sir2-like enzymes, also known as sirtuins, comprise a universally conserved family of NAD+-dependent protein deacetylases that play important roles in transcriptional silencing, fat mobilization, metabolic regulation, and lifespan extension. NAD+ is cleaved during the deacetylation reaction, yielding nicotinamide,
deacetylated peptide, and O-acetyl ADP-ribose products. In some cases, sirtuins
catalyze mono-ADP ribosylation of their substrates rather than deacetylation. In
an effort to determine the enzymatic mechanism of the NAD+-dependent deacetylation reaction, we have determined structures of sirtuins bound to a variety of
substrates and products, as well as to a transition state analogue. In addition, we
have trapped a key covalent reaction intermediate in complex with the enzyme
and solved its structure. These structures provide insights into the structure-based
mechanism of NAD+ cleavage and deacetylation. These mechanistic insights have
been extended to explain the second reaction, ADP-ribosylation, that is catalyzed
by some sirtuins. In solution studies of a trypanosomal sirtuin, we have identified
the side chains that are ADP-ribosylated by TbSir2 and present a plausible mechanism for the dual activity based on our structural studies.
Gesteland,
R. and
Atkins, J. F. (Eds.)
RNA World,by
Second
Ed. Alkaloid
Cold Spring
Structural
Perturbation
of The
Chromatin
Plant
Harbor, NY: Cold Spring Harbor Laboratory Press (1999).
Sanguinarine
andBiol.
Its205,
Functional
Consequences
Hud, N. V. and
Anet, F. A. L. J. Theor.
543-562 (2000).
Jain, S. S., Anet, F. A. L., Stahle, C. J., and
The
of chromatin
its dyHud,hallmark
N. V. Angew.
Chem. Int.lies
Ed.inEng.
43,
namic
alteration
of
epigenetic
marks,
which
2004-2008 (2004).
regulates
theAnet,
gene F.expression
andI.thereby,
Bean, H. D.,
A. L., Gould,
R., and
cellular
homeostasis.
Any
small
molecule
Hud, N. V. Origins Life Evol. B. 36,
39-63
compound
(2006). that perturbs the chromatin structure could potentially alter the epigenetic
state and hence, could be used for therapeutic purposes. Here, we report the structural perturbation of chromatin at different levels by DNA-binding plant alkaloid, Sanguinarine with potential as anticancer agent.
Association of Sanguinarine with different levels of chromatin structure (chromatin,
mononucleosome, and chromosomal DNA) was found to be enthalpically driven
with micromolar dissociation constant. Comparative analysis of heat capacity change
(ΔCp) accompanying sanguinarine-polymer interactions, results from dynamic light
scattering studies, confocal and atomic force microscopic studies, and other biochemical studies indicate chromatin aggregation and nucleosomal instability with
DNA release. Also, we are able to show that Sanguinarine modulates the epigenetic
marks leading to the repression of histone modifications. It occurs via association
of Sanguinarine with core histone. Sanguinarine inhibits histone acetylation both in
vitro as well as in vivo. Remarkably, it does not affect the in vitro transcription from
DNA template, but represses acetylation dependent chromatin transcription. These
data establish for the first time that an anticancer DNA binding intercalator might
play dual roles as inhibitor of transcription in chromatin and a modulator of chromatin modifying enzymes via perturbation of chromatin structure.
913
193
Suman Kalyan Pradhan1,*
Ruthrotha Selvi B2
Jayasha Shandilya2
Chandrima Das2
Tapas K. Kundu2
Dipak Dasgupta1
Biophysics Division, Saha Institute of
1
Nuclear Physics, Block-AF, Sector-I
Bidhannagar, Kolkata – 700 064, India
Transcription and Disease Laboratory
2
Molecular Biology and Genetics Unit
Jawaharlal Nehru Centre for Advanced
Scientific Research, Jakkur
Bangalore- 560064, India
sumankalyan.pradhan@saha.ac.in
*
194
Topology of Eukaryotic Chromatin
Little is known about how nucleosomes are arranged into higher-order structures
in vivo, even though the efficiency and precision of cell division imply a high level
of structural organization. The current view of eukaryotic chromatin organization
assumes that nucleosomal particles self-organize by association into higher-order
structures in a hierarchical manner. The so-called 30-nm fiber structure plays a
prominent role in these models. These assumptions do not agree, among others,
with the observed mechanical properties of chromatin, or with microscopic in situ,
and in vitro, observations of chromatin in its native state and also with the distributive character of chromatids’ individualization.
We have re-analyzed published observations and experimental data from the last 50
years of work on eukaryotic chromatin for consistency between them and basic laws
of physics and evolution. Following this work, we propose to abandon the associative paradigm for eukaryotic chromatin organization. Instead we propose organization involving a group of DNA-based, recursive topological restraints. These are
created by ATP-dependent remodeling complexes in kinetically controlled processes. Nucleosomal particles play an important role in this model serving as memory
markers for remodeling complexes. An outline of the theory is presented at preprint
server. We will discuss the novel paradigm of eukaryotic chromatin organization,
its agreement with experimental data, its role in explaining the action of distant-cis
acting elements in transcription and other consequences for biology.
Dominika Borek
Zbyszek Otwinowski
The University of Texas
SW Medical Center at Dallas
5323 Harry Hines Blvd.
Dallas TX 75390
dominika@work.swmed.edu
zbyszek@work.swmed.edu
914
195
P. De Santis*
A. Scipioni
Dipartimento di Chimica
P.le A. Moro, 5 00185, Roma, Italy
pasquale.desantis@uniroma1.it
*
A Statistical Thermodynamic Approach
for Predicting The Sequence-Dependent
Nucleosome Positioning along Genomes
Eukaryotic DNAs are organized as linear arrays of nucleosomes that mutually interact giving rise to the chromatin architecture, which is the substrate for the regulation of nuclear processes. Positioning of the nucleosomes along DNA is the main
determinant of their compaction in chromatin. However, although the structure of
the nucleosome is known in its molecular details, the basic knowledge about the
positioning along genomes is still debated.
Assuming that inter-nucleosomal forces are not effective in perturbing the distribution of nucleosomes along DNA, we tried to predict the nucleosome positioning
along genomes extending the theoretical model based on a statistical mechanical approach we early proposed. It allowed the calculation of the free energies involved in
nucleosome formation for about hundred single nucleosome DNA tracts in satisfactory agreement with those experimentally obtained in different laboratories with the
nucleosome competitive reconstitution (see Figure A). To test the model, the theoretical free energy profile was compared with the experimental positioning data of
yeast chromosomes available in literature (see Figure B as an example). The results
are comparable with those obtained by different authors adopting models based on
identifying of some recurrent sequence signals obtained from the statistical analysis
of a very large pool of nucleosomal DNA sequences provided by the positioning
maps of genomes. Aside its effectiveness in predicting the nucleosome positioning
along genomes, our model provides the basic physical knowledge of the main determinants of the nucleosome thermodynamic stability along genomic DNAs.
Architecture and Regulation of the
CHD1 Chromatin Remodeler
Chromatin remodelers use a core ATPase motor in conjunction with auxiliary domains to assemble, move, and evict nucleosomes from DNA. In order to better
understand how remodeler domains communicate, we solved the crystal structure of
the ATPase module from the yeast CHD1 remodeler coupled to the N-terminal double chromodomains. Both lobes of the ATPase module, which must close together
to engage their double-stranded DNA substrate and hydrolyze ATP, interact with the
double chromodomains and appear to be stabilized in an opened, catalytically inactive conformation. In addition to being unable to hydrolyze ATP, the opened conformation prevents the two ATPase lobes from simultaneously interacting with duplex
DNA. Interestingly, one of the contact surfaces between the chromodomains and
ATPase module corresponds to the predicted DNA-binding surface of the second
ATPase lobe. The structure suggests that the chromodomains directly compete with
DNA for binding to the ATPase motor, and thus inhibit ATP hydrolysis. Site-directed
mutagenesis and deletion analysis indicates that the chromodomain/ATPase interface is required for nucleosome-specific activation of the ATPase motor, and disruption of this interface allows the ATPase motor to be stimulated by naked DNA. We
discuss implications for ATPase regulation during chromatin remodeling.
915
196
G. Hauk1
J. Mcknight1,2
I. M. Nodelman1
G. D. Bowman1,2,*
TC Jenkins Department of Biophysics
1
2
Johns Hopkins University
Baltimore MD 21218
gdbowman@jhu.edu
*
197
AT-rich Fragments at the Nucleosome Ends May be Related to
Linker Histone Binding: Implications for Nucleosome Positioning
Linker histones (LHs) bind to linker DNA, protecting ~20-bp DNA at nucleosome
entry/exit points and promoting formation of the 30 nm fiber. Earlier studies showed
that LHs exhibit relatively weak preference for AT-rich DNA (1). However, it was
unclear whether there are any sequence patterns facilitating LH binding. These patterns (if they exist) are expected to be more pronounced in metazoan nucleosomes
with abundant LHs, compared to yeast nucleosomes with few LHs.
To test this hypothesis, we compared the nucleosome core particle (NCP) sequences
with single-nucleotide resolution from chicken (2), Drosophila (3), and yeast (4, 5),
extending them by the flanking sequences extracted from the corresponding genomes. We found that the known ~10 bp periodic oscillation of AT-rich elements goes
beyond the ends of yeast nucleosomes, but is distorted in the chicken and Drosophila
sequences where the ‘out-of-phase’ AT-peaks appear at the NCP ends. We, therefore,
suggest that the observed difference in the occurrence of AT-rich fragments at the
ends of metazoan and yeast nucleosomes may reflect distinctive spatial trajectories
of DNA at the entry/exit points, which could be related to LH binding.
Based on these findings, we propose a new structural model for LH binding to metazoan nucleosomes based on the X-ray structure of chicken H5 globular domain (GH5),
postulating that the highly conserved non-polar ‘wing’ region of the LH globular
domain (tetrapeptide GVGA) recognizes AT-rich fragments through hydrophobic interactions with the thymine methyl groups. These interactions lead to DNA bending
at the NCP ends and formation of a ‘stem-like’ structure. The detailed energy minimization of the GH5-NCP complex suggests that the valine in the ‘wing’ domain can
favorably interact with thymines in both DNA strands at the ends of nucleosomes.
Preliminary experimental results (in collaboration with Dr. Sergei Grigoryev at Pennsylvania State University) are consistent with our model, showing that the AT-rich
fragments at the nucleosome ends are indeed critical for strong LH binding.
Our model explains and links together several key observations made earlier:
(i) additional deformation of nucleosomal DNA caused by linker histone
binding;
Feng Cui*
Difei Wang
Victor B. Zhurkin
Laboratory of Cell Biology
National Cancer Institute, NIH
Bethesda, MD 20892, USA
cuif@mail.nih.gov
*
916
(ii) formation of the stem-like structure in the presence of LH;
(iii) preferential LH binding to AT-rich DNA;
(iv) stronger binding of H10/H5 histones compared to somatic H1a, b, c…
variants;
(v) preferential LH binding to methylated DNA and stabilization of ‘epigenetic’ heterochromatin.
Finally, we found that AT-rich fragments frequently occur near the ends of wellpositioned nucleosomes in higher eukaryotes, for example, in human Alu repeats
and in African Green Monkey α-satellite DNA. We suggest that these structurallyrigid, nucleosome-excluding fragments may be recognized by LHs. These LHrelated sequence patterns could provide additional information for predicting nucleosome positioning in vivo.
198
Wilma K. Olson
BioMaPS Institute for Quantitative Biol-
ogy, Rutgers, the State University of New
Jersey, Piscataway, NJ 08854
wilma.olson@rutgers.edu
199
V. B. Fedoseyeva*
A. A. Alexandrov
Institute of Molecular Genetics of
Russian Academy of Science
Kurchatov Sq., 2. Moscow, 123182, Russia
fvb@img.ras.ru
*
1. Zlatanova, J. and van Holde, K. Prog Nucleic Acid Res Mol Biol 52, 217-259 (1996).
2. Satchwell, S. C., Drew, H. R., and Travers, A. A. J Mol Biol 191, 659-675 (1986).
3. Mavrich, T. N., Jiang, C., Ioshikhes, I. P., Li, X., Venters, B. J., Zanton, S. J., Tomsho, L. P.,
Qi, J., Glaser, R. L., Schuster, S. C., Gilmour, D. S., Albert, I., and Pugh, B. F. Nature 453,
358-362 (2008).
4. Segal, E., Fondufe-Mittendorf, Y., Chen, L, Thastrom, A., Field, Y., Moore, I. K., Wang, J. P.,
and Widom, J. Nature 442, 772-778 (2006).
5. Albert, I., Mavrich, T. N., Tomsho, L. P., Qi, J., Zanton, S. J., Schuster, S. C., and Pugh, B.
F. Nature 446, 572-576 (2007).
Base Sequence and the Architecture
of Nucleosomal DNA
In order to understand the mechanisms by which DNA base sequence and tightly
bound proteins control the biophysical properties of the long, threadlike molecule,
we have developed a coarse-grained model, in which the DNA base pairs are treated as rigid bodies subject to realistic, knowledge-based energy constraints, and
computational techniques to determine the configuration-dependent propensities
of these molecules. The presentation will highlight some of the unique, sequencedependent spatial information that has been gleaned from analyses of the highresolution structures of DNA and its complexes with other molecules, including
nucleosomes, and illustrate how this information can be used to gain new insights
into the positioning of non-specific proteins on DNA.
Comparative Analysis of Nucleosome Positioning
Potential for light Gene Orthologs from
Different drosophilidae species
The subject of specific interest is the comparison of the characteristics of gene orthologs belonging to the species that transferred ourselves from euchromatin to heterochromatin localization in the evolutional process. It is well known, that this gene
is actively expressed and involved in some biological processes. We used the nucleotide sequences of different orthologs of light (lt) gene presented in data bases to
obtain the nucleosome positioning characteristics. For a series of lt gene orthologs
(Drosophila melanogaster, virilis, pseudoobscura, erecta, yakuba, ananassae) the
nucleosome positioning potential (NPP) was calculated for 17 kbp fragments in
each case. The size distribution of peaks or peak clusters, presented in NPP was
characterized by using the calculations of Fourier coefficients. Each coefficient corresponds to the certain nucleosome cluster size and as a whole this calculation may
give rise to the formation of the specter of cluster sizes.
As it is revealed by the calculations with program, published earlier, for those lt
orthologs, which localization corresponds to the heterochromatin region predominantly the size of peak clusters is up to 500 bp long, the majority localizes in the
introns and has the high coefficient values. In the case of lt gene each ortholog has
intron-exon structure, the longer ones (~17 kbp) have longer introns. Maximum
length of introns is of ~11 kbp and these long introns comprise the repeats of different kind, e.g., LINE, LTR, DNA type. For the orthologs, which localization corresponds to the euchromatin region the clusterization is purely expressed, the Fourier coefficients are of the discernibly lower values and predominantly correspond
to the cluster sizes of ~1 and ~2 kbp long. Also we compared these observations
with the other genes incorporating introns of the same length as, for example, the
long intron of lt gene D.melanogaster. In the latter case the pattern of nucleosome
clusters may be presented by different cluster sizes in the interval 0.5-2.5 kbp (at
half wide level) in each gene individually, and the long introns are predominantly
enriched by these clusters compared with the exon portion.
917
200
Comparative Analysis of Nucleosome Sequence
Organization in Human and Yeast Genomes
Eukaryotic DNA is tightly wrapped around a histone protein core constituting the
fundamental repeating units of chromatin. The affinity of the histones for DNA
depends on the nucleotide se-quence; however, it is unclear to what extent DNA
sequence determines nucleosome positioning in vivo, and if the same rules of sequence-directed positioning apply to genomes of varying complexity.
We have developed computational methods to detect stable nucleosome positions
from the data obtained with high-throughput DNA sequencing combined with chromatin immunoprecipitation. These methods were applied to determine positions of
nucleosomes containing the H2A.Z his-tone variant, histone H3 tri-methylated at
lysine 4 (H3K4me3), and nucleosomes not selected for any specific histone variant
or modification in human CD4+ T cells.
We observe characteristic patterns of nucleosome distribution around transcription
starts of hu-man genes and compare them to the patterns reported for the yeast genome. The results of se-quence analysis show that the 10-bp periodicity in dinucleotide distributions, which is pro-nounced in yeast and other organisms, is not a general feature of human nucleosome sequences. The GC-content of the DNA sequences
of bulk human nucleosomes is sharply increased com-pared to the GC-content of the
linkers. Calculations of the DNA deformation energy provide ra-tionale for such a
sequence organization showing that GC-rich sequences require less energy to wrap
around histone core than AT-rich sequences. We also find that human H2A.Z nucleosomes protect shorter DNA fragments from MNase digestion compared with the
H3K4me3-enriched nucleosomes and exhibit different sequence preferences, suggesting a novel mechanism of nu-cleosome organization for the H2A.Z variant.
Michael Y. Tolstorukov1,2,*
Peter V. Kharchenko1,2,3
Joseph A. Goldman4
Robert E. Kingston4
Peter J. Park1,2,3,**
Center for Biomedical Informatics
1
Harvard Medical School
10 Shattuck St., Boston, MA 02115, USA
Harvard Partners Center for Genetics and
2
Genomics, New Research Building
77 Avenue Louis Pasteur
Boston, MA 02115, USA
Children’s Hospital Informatics Program
3
300 Longwood Ave., Boston, MA 02115
Department of Molecular Biology
4
Massachusetts General Hospital
Boston, MA 02114, USA
tolstorukov@gmail.com
*
peter_park@harvard.edu
**
918
201
I. Gabdank1
D. Barash1
E. N. Trifonov2,3,*
Dept of Computer Science
1
Ben Gurion Univ. of the Negev
P.O.B 653, Be’er Sheva 84105, Israel
2
Institute of Evolution, University of Haifa
Mount Carmel, Haifa 31905, Israel
Division of Functional Genomics and
3
Proteomics, Faculty of Science
Masaryk University, Kamenice 5
Brno CZ-62500, Czech Republic
*
Complete Nucleosome DNA Bendability Matrix and
Sequence-Directed Nucleosome Mapping (C. elegans)
Signal regeneration procedure described in our previous work (1) was used to derive
the complete nucleosome DNA bendability matrix of C. elegans, by using a database
of nucleosome core DNA sequences from C. elegans (2).The length of the matrix
was set to be 116 nucleotides on the basis of crystallographical data (3), according to
which there are 12 contact sites between DNA minor grooves and arginine residues
of the histones in nucleosome core particle. The matrix 8x115 displays periodical
variation of eight major dinucleotides (CG, AT, CC, GG, AA, TT, GA, and TC) along
the nucleosome DNA. It consists, essentially, of 11 repeats of the previously established 8×10 matrix of bendability (1). Symmetrical modulation of the amplitudes is
observed along the nucleosome DNA. The derived DNA bendability matrix can be
used for the sequence-directed mapping of nucleosome positions in the genome of
C. elegans and, as a reasonable approximation – in other species.
I.G. is partially supported by the Lynn and William Frankel Center for Computer
Sciences at Ben-Gurion University.
1. Gabdank, et al. Journal of Biomolecular Structure and Dynamics 26, 403-412 (2009).
2. S. M. Johnson, et al. Genome Research 16, 1505-1516 (2006).
3. G. Arents, E. N. Moudrianakis. Proc Natl Acad Sci USA 90, 10489-10493 (1993).
Distinct Modes of Regulation by Chromatin Encoded
through Nucleosome Positioning Signals
The detailed positions of nucleosomes profoundly impact gene regulation and are
partly encoded by the genomic DNA sequence. However, less is known about the
functional consequences of this encoding.
We first address this question using a genome-wide map of nucleosomes in the
yeast S. cerevisiae that we sequenced in their entirety. Utilizing the high resolution
of our map, we refine our understanding of how nucleosome organizations are encoded by the DNA sequence, and demonstrate that the genomic sequence is highly
predictive of the in vivo nucleosome organization, even across new nucleosomebound sequences that we isolated from fly and human. We find that Poly(dA:dT)
tracts are an important component of these nucleosome positioning signals, and
that their nucleosome-disfavoring action results in large nucleosome-depletion
over them and over their flanking regions, and enhances the accessibility of transcription factors to their cognate sites. These results suggest that the yeast genome
may utilize these nucleosome positioning signals to regulate gene expression with
different transcriptional noise and activation kinetics, and DNA replication with
different origin efficiency. These distinct functions may be achieved by encoding
both relatively closed (nucleosome-covered) chromatin organizations over some
factor binding sites, where factors must compete with nucleosomes for DNA access, and relatively open (nucleosome-depleted) organizations over other factor
sites, where factors bind without competition.
In further work we have investigated the DNA-encoded nucleosome organization
of promoters in the two related yeast species S. cerevisiae and C. albicans. For that
we have measured in vivo nucleosome positions in both species, and further have
measured the in vitro nucleosome positions of purified histone octamers assembled
on purified genomic DNA from both species. The latter is thus the direct measurement of the DNA sequence contribution to the nucleosome positioning and is independent of transcription and replication states, and of the action and binding of
chromatin remodelers and transcription factors. We first show that most changes in
the nucleosome organization of promoters between these species (measured in vivo)
are attributed to changes in the DNA sequence (measured in vitro and predicted by
our model). We then show a global relationship between transcriptional programs
of genes (based on microarray expression profiles of genes along different conditions and cellular states) and the DNA-encoded nucleosome organizations of their
promoters that is remarkably conserved across these yeast species, even in the presence of expression divergence. Growth related genes that are by ‘default’ on, tend to
have the open DNA-encoded nucleosome organization for their promoters, which
presumably facilitates for them a default accessible promoter state. Inducible genes
(condition or cellular state specific genes) that are by default off tend to have the
closed DNA-encoded nucleosome organization, which presumably facilitates for
them a default inaccessible promoter state.
In summary, in these work we report on progress in understanding the way in
which nucleosome organization is encoded in the DNA, and in identifying functional consequences of the DNA-encoded nucleosome organization in both replication and transcription regulation.
919
202
Yair Field1,§
Noam Kaplan1,§
Yvonne Fondufe-Mittendorf2,§
Irene K. Moore2
Eilon Sharon1
Yaniv Lubling1
Piotr Mieczkowski3
Jason D. Lieb3,*
Jonathan Widom2,*
Eran Segal1,4,*
Dept. of Computer Science and Applied
1
Mathematics, Weizmann Institute of Science, Rehovot, 76100, Israel
Dept. of Biochemistry, Molecular
2
Biology, and Cell Biology
2153 Sheridan Road
Evanston, IL 60208 USA
Dept. of Biology and the Carolina Center
3
for Genome Sciences, Univ. of North
Carolina at Chapel Hill
Chapel Hill, NC 27599, USA
Dept. of. Molecular Cell Biology
4
Weizmann Institute of Science
Rehovot, 76100, Israel
These authors contributed equally
§
to this work.
eran.segal@weizmann.ac.il
*
j-widom@northwestern.edu
*
jlieb@bio.unc.edu
*
920
203
George Locke
Alexandre V. Morozov*
Department of Physics & Astronomy
and BioMaPS Institute for Quantitative
Biology, 136 Frelinghuysen Rd
Piscataway, NJ 08854-8019
morozov@physics.rutgers.edu
*
204
Eran Segal
Department of Computer Science
and Applied Mathematics
Weizmann Institute
Rehovot 76100 Israel
eran.segal@weizmann.ac.il
Does DNA Sequence Matter
for Nucleosome Positioning In vivo?
Nucleosome formation is a first step towards packaging genomic DNA into chromosomes. Nucleosomes are formed by wrapping 147 base pairs of DNA in a superhelix around a spool of eight histone proteins. It is reasonable to assume that formation of single nucleosomes in vitro is primarily determined by DNA sequence:
it costs less elastic energy to wrap a flexible DNA polymer around the histone octamer, and more if the polymer is rigid. However, it is unclear to which extent this
effect is important in living cells, which have evolved chromatin remodeling enzymes to actively reposition nucleosomes. In addition, nucleosome positioning on
genome-length DNA sequences is strongly affected by steric exclusion – multiple
nucleosomes have to form simultaneously without overlap, creating regular arrays.
At the same time, our recent analysis of the changes in chromatin structure that
accompany addition of glucose to starved yeast cells (in collaboration with James
Broach) reveals that correlation between nucleosome positioning and transcriptional response is fairly weak. At most promoters we observe stereotypical chromatin
structure that does not depend on glucose levels and which could in principle be determined by the DNA sequence alone. Currently available bioinformatics methods
for predicting nucleosome positions are trained on in vivo data sets and are thus unable to distinguish between extrinsic and intrinsic nucleosome positioning signals.
Furthermore, in most cases no attempt is made to explicitly de-convolute DNA
sequence specificity from steric exclusion. In order to see the relative importance of
these contributions to nucleosome positioning in vivo, we have developed a model
based on a large collection of DNA sequences from nucleosomes reconstituted in
vitro by salt dialysis (data provided by Frank Pugh). We have used these data to infer the free energy of nucleosome formation at each position along the genome. Our
method uses an exact result from the statistical mechanics of classical 1D particles
of finite size, enabling us to infer the free energy landscape while automatically
taking steric exclusion into account. We will discuss the degree to which in vitro
nucleosome occupancy profiles are predictive of in vivo nucleosome positions, and
will estimate how many nucleosomes are sequence-specific and how many are positioned through other means. Our physical approach to nucleosome energetics is
applicable to multiple organisms and genomic regions.
Function and Evolution of the Genomic
Code for Nucleosome Positioning
The detailed positions of nucleosomes along genomes have critical roles in transcriptional regulation. Consequently, it is important to understand the principles
that govern the organization of nucleosomes in vivo, and the functional consequences of this organization. I will present our progress in identifying the functional
consequences of nucleosome organization, in understanding the way in which nucleosome organization is encoded in the DNA, and in linking the two, by suggesting
that distinct transcriptional behaviors are encoded through the genome’s intrinsic
nucleosome organization. Our results thus provide insight on the broader question
of understanding how transcriptional programs are encoded in the DNA sequence.
Finally, I will also show that a major phenotypic diversity among yeast species is
accompanied by corresponding DNA sequence changes that alter the DNA-encoded nucleosome organization, suggesting that such changes may be a novel genetic
mechanism for achieving phenotypic diversity across evolution.
Genome-wide Mapping and Analysis of
Nucleosome Positions in Multiple Human Tissues
Nucleosome positioning plays a fundamental role in the regulation of the genome. To further explore the relationship between the underlying DNA sequence,
chromatin architecture and genic expression in differing tissues, we have mapped
nucleosome positions across three separate human tissue types from the same individual and analyzed these data in relation to the genic landscapes and regulation
in these distinct cell types.
921
205
Steve M. Johnson§,*
Anton Valouev
Scott Boyd
Cheryl Smith
Arend Sidow
Andrew Fire
Departments of Pathology and Genetics
Stanford University School of Medicine
Stanford, CA 94305
Current address:
§
Dept of Microbiology & Molecular Biology
Brigham Young University
Provo, Utah 84602
stevenj@stanford.edu
*
Geometrical, Conformational, and Topological
Restraints in Nucleosome Compaction
along Chromatin Fibers
Chromatin architecture is the substrate for DNA replication, recombination, transcription, and repair in eukaryotic genomes. It is the result of complex hierarchic
assembly of nucleosome arrays in a compact structure. Although the nucleosome
structure is known in its molecular details, the basic information about the pattern
of the organization of nucleosomes in the chromatin fiber is still debated.
The problem of selecting the compact architectures of the chromatin fiber for different linker lengths can be factorized in one in which only orientational parameters are taken into account and the other in which the lengths of DNA linkers
are considered. If the conformational equivalence is assumed, the best packing
of nucleosomes requires the uniformity of orientational parameters; this condition imposes that the linker lengths can differ by steps of 10bp. This produces
quasi-uniform helical conformations where the nucleosome dyad axes are almost
perpendicular to the fibre axis. Therefore, the experimental evidence that the nucleosome dyad axis in natural chromatin is nearly perpendicular to the fiber is a result of the “quasi-conformational equivalence” of the repeating units, even though
linker lengths are not strictly equal. We investigate possible molecular models of
the chromatin fiber under the condition of compact nucleosome packing suggested
by EM findings. Geometrical and topological constraints were analyzed for a large
interval of uniform helical structures imposing the minimum distortion of both
the nucleosome and DNA linker canonical structures. Compact fiber architectures
are mainly stabilized by the close packing of nucleosome cores but restricted by
topological conditions to prevent from clashing of linkers as well as entanglements of linker chain. We found that the geometrical features required for compact
nucleosomes severely limit the possible chromatin structures. Furthermore, they
require a torsional energy cost in account of changes of DNA linker twist. This is
206
A. Scipioni*
S. Morosetti
P. De Santis
Dipartimento di Chimica
P.le A. Moro, 5 00185, Roma, Italy
anita.scipioni@uniroma1.it
*
922
207
Cizhong Jiang
B. Franklin Pugh
Ctr for Eukaryotic Gene Regulation
Dept of Biochemistry and
Molecular Biology
Pennsylvania State Univ.
University Park, PA 16802, USA
bfp2@psu.edu
cuj5@psu.edu
particularly relevant in the case of short linkers as in telomers, yeast and neuronal
chromatin. Finally, increasing the nucleosome repeat length of an integral number
of 10bp introduces a torsional stress due to the slight difference with the periodicity of canonical B-DNA linker, around 10.5 bp/turn. Such a difference amplifies
with the lengthening of the DNA linkers and could justify the transition of the
chromatin fiber diameter and density as EM images demonstrate.
Identification and Nomenclature of the Consensus
Nucleosomes Across the Yeast Genome
The nucleosome particle is the basic repeating unit of eukaryotic chromatin structure. Packaging DNA into nucleosomes alters sequence accessibility. As a consequence, the positioning of nucleosome along chromatin influences a variety of
biological processes. A genome-wide map of nucleosome positions is essential to
understand the impact of nucleosome positioning on gene expression. Recently, five
high-resolution genome-wide maps of nucleosome locations in yeast have been produced by tiling array or high-throughput sequencing technology. All reveal strong
canonical positioning around the transcriptional start site (TSS). However, there
is no standard for identifying nucleosome positions relative to the TSS. This may
create confusion and inconsistencies when referring to individual nucleosomes or
canonical positions, particularly if nucleosomes have different functions at different positions. Here, we generated a complete reference position map of consensus
nucleosomes in yeast derived from six independent experimental determinations,
and introduce the first systematic scheme to label the nucleosomes. These consensus nucleosomes serve as a reference map. The distribution profile of the reference
nucleosomes around TSS is consistent with experimentally derived nucleosomes.
A nucleosome browser was constructed to view and compare the reference nucleosomes and other published nucleosomes. Applying the labeling scheme, we
reconfirm changes in nucleosome occupancy in promoter regions in response to
heat shock and in yeast mutants. In addition to this, we developed a retrieval system
for reference nucleosomes allowing users to extract the reference nucleosomes in
a given region or a list of genes. This approach can be also applied to other species
and facilitate sharing of the high-throughput data and scientific communication.
208
Thomas C. Bishop
Center for Computational Science
Tulane University,
New Orleans, LA 70118
bishop@tulane.edu
1. Lee, W., Tillo, D., Bray, N., Morse, R. H., Davis, R. W., Hughes, T. R., and Nislow, C. Nature
Genetics 39, 1235-1244 (2007).
2. Whitehouse, I., Rando, O. J., Delrow, J., and Tsukiyama, T. Nature 450, 1031-1035 (2007).
3. Mavrich, T. N., Ioshikhes, I. P., Venters, B. J., Jiang, C., Tomsho, L. P., Qi, J., Schuster, S. C.,
Albert, I., and Pugh, B. F. Genome Research 18, 1073-1083 (2008).
4. Field, Y., Kaplan, N., Fondufe-Mittendorf, Y., Moore, I. K., Sharon, E., Lubling, Y., Widom,
J., and Segal, E. PLoS Computational Biology 4, e1000216 (2008).
5. Shivaswamy, S., Bhinge, A., Zhao, Y., Jones, S., Hirst, M., and Iyer, V. R. PLoS Biology 6,
e65 (2008).
Molecular Dynamics Studies of Nucleosome Positioning
There are approximately 30 high resolution crystallographic structures of the nucleosome available in the protein data bank. All have essentially the same sequence
of DNA, nuc147. Some have specific structural modifications. We previously compared 24 of these structures to determine the necessary and sufficient distribution of
DNA helical parameters (tilt, roll, twist, shift, slide, rise) required to recreate all atom
models that are within 3 Å RMSD of the initial x-ray structure. We found that the distribution of roll, slide, and twist is highly conserved in all structures but that rise, tilt,
and shift vary. Here we use a combination of all atom molecular mechanics and elastic rod modeling techniques to investigate sequence dependencies in the structure,
dynamics, and energetics of the nucleosome. For this purpose we have constructed
several thousand all atom models of the nucleosome with different sequences of
DNA and systematically varied the folding of free DNA into a nucleosome for the
sequence nuc147. The sequences studied include the 1489nt sequence of the mouse
mammary tumor virus promoter (MMTV, genbank id V01175), which positions six
nucleosomes and nearly 100 sequences of DNA that span the range of binding free
energies. We find that threading different sequences onto the histone core is a suitable starting point for all-atom simulations for both solvent free and fully solvated
systems and that molecular mechanics energies are well correlated with an elastic
rod model that includes a screened electrostatics term for long range interactions
(Debye-Huckel approximation). Without a long range term the elastic rod model
fundamentally differs from molecular mechanics models. Yet, assuming the conformation of nucleosomal DNA is sequence invariant, this electrostatic term is constant.
Molecular dynamics simulations are being employed to assess this assumption.
923
This work supported by a grant from the NIH (R01GM76356).
Nucleosomal Minor Groove Shape and Electrostatics
Provide a Molecular Origin for Histone
Arginine Binding
We recently established local shape recognition as a new protein-DNA readout
mechanism and identified the readout of minor groove shape as the molecular
origin of Hox specificity (1, 2). A bioinformatics analysis of all protein-DNA complexes in the PDB with arginine contacts in narrow minor groove regions indicates
that this new readout mechanism is of a general nature. Narrow minor groove
geometry induces enhanced negative electrostatic potentials as a result of electrostatic ‘focusing’, which describes the enhanced magnitude of electric fields in
narrow pockets on the surface of macromolecules (3). In the case of the DNA
minor groove, field lines that originate from the bases and lead into the solvent
are compressed by the electrostatic boundary of the minor groove walls. Differences in electrostatic minor groove potential of AT vs. GC-rich sequences have
been noted earlier but the impact of the electrostatic ‘focusing’ effect is approximately an order of magnitude larger. The architecture of the nucleosome exhibits
elements of the local shape recognition mechanism. Nucleosomal DNA is highly
deformed when wrapped around histones. Due to histone binding, narrow minor
groove regions in the nucleosome are equally spaced by a helical turn with minor
groove width fluctuating between approximately 3 and 8 Å. Electrostatic potential
strongly correlates with minor groove geometry ranging from -2 to -12 kT/e.
Enhanced negative electrostatic potential attracts basic side chains into the minor
groove and is a biophysical reason for the dominance of arginine among minor
groove binding residues. For the only nucleosome structure that includes histone
tails, 1kx5 , arginine residues are frequently found to take advantage of enhanced
negative electrostatic potential in narrow minor groove regions. Many of the histone binding sites contain short A-tracts or A-tract-like trimers in their narrow
minor groove region. A narrow minor groove is a common sequence-dependent
feature of A-tracts (4, 5), which explains the correlation of these short A-tract
sequences with arginine binding sites. Monte Carlo simulations of unbound DNA
confirm the sequence-dependent tendendency of A-tract minor grooves to be narrow (1). Intrinsically pre-formed regions modulate deformations required for histone binding, release strain, and, importantly, attract arginines through electrostatic
means and stabilize the nucleosome complex. Since arginine attraction in A-tract
regions is associated with local shape readout, arginine-minor groove recognition
can be expected to play a role in nucleosome positioning.
209
Remo Rohs*
Sean M. West
Barry Honig**
Howard Hughes Medical Institute and
Dept. of Biochemistry & Molecular
Biophysics, Columbia University
1130 St Nicholas Avenue
New York, NY 10032
rr2213@columbia.edu
*
bh6@columbia.edu
**
924
210
Edward N. Trifonov1,2
1
Institute of Evolution, University of Haifa
Mount Carmel, Haifa 31905, Israel
Division of Functional Genomics
2
and Proteomics, Faculty of Science
Masaryk University, Kamenice 5,
Brno CZ-62500, Czech Republic
211
Difei Wang1,*
Nikolai B. Ulyanov2
Victor B. Zhurkin1
1 Laboratory of Cell Biology
NCI, NIH, Bethesda, MD 20892-5677
Dept of Pharmaceutical Chemistry
2
UCSF, San Francisco, CA 94158-2517
wangdi@mail.nih.gov
*
2. S. C. Harrison. Nat Struct Mol Biol 14, 1118-1119 (2007).
3. B. Honig and A. Nicholls. Science 268, 1144-1149 (1995).
4. R. Rohs, H. Sklenar, and Z. Shakked. Structure 13, 1499-1509 (2005).
5. R. Rohs, S. M. West, P. Liu, and B. Honig. Curr Opin Struct Biol 19-2 (2009), in press.
Nucleosome Positioning by Sequence, State of the Art
All major suggestions about the nucleosome-positioning sequence pattern(s) are
overviewed. In binary presentation two basic periodical patterns are well established: in purine/pyrimidine alphabet – YRRRRRYYYYYR (1,2) and in strong/
weak alphabet – SWWWWWSSSSSW (3). There are only four different four-letter
alphabet patterns that satisfy both binary forms. One of them coincides with first
ever complete matrix of nucleosome DNA bendability (in simple consensus form
CGGAAATTTCCG) derived (4) from very large database of nucleosome DNA sequences (5). Three other formally possible patterns may or may not correspond to
physical reality. Mapping of the nucleosomes by matching to the full-length nucleosome DNA size bendability matrix suggests the single-base mapping accuracy.
1.
2.
3.
4.
5.
V. B. Zhurkin. FEBS Letters 158, 293-297 (1983).
F. Salih, B. Salih, E. N. Trifonov. J Biomol Str Dyn 26, 273-282 (2008).
H.-R. Chung, M. Vingron. J Molec Biol (2008), doi: 10. 1016/j.jmb.2008.11.049 (in press).
I. Gabdank, D. Barash, E. N. Trifonov. J Biomol Str Dyn 26, 403-412 (2009).
S. M. Johnson, F. J. Tan, H. L. McCullough, D. P. Riordan, A. Z. Fire. Genome Research 16,
1505-1516 (2006).
Sequence Dependence of the ‘Kink-and-Slide’
Deformations of DNA in Nucleosome. All-atom
Simulations of DNA Nonharmonic Behavior
What are the ‘rules’ guiding sequence-dependent packing of DNA in nucleosomes?
This long-standing question still remains in the focus of interest of structural biologists. Traditionally, DNA has been considered as an elastic rod whose bending and
twisting deformabilities dictate its wrapping around the histone core. Recently,
however, it was found that the lateral displacements of the DNA axis play an important structural role (1) that cannot be ignored when analyzing the sequencedependent folding of DNA in chromatin. In particular, the Slide displacements occurring at sites of sharp DNA bending toward the minor groove make a significant
input in the energy cost of DNA deformations in nucleosome. Using the knowledge-based elastic potentials for DNA (2), Tolstorukov et al. (1) demonstrated that
these ‘Kink-and-Slide’ distortions are highly sequence-specific, the CA:TG and
TA dimeric steps being the most easily deformable.
On the other hand, the nucleosome X-ray structure (3) indicates that some DNA
deformations may exceed the limits of harmonic behavior. For example, the minorgroove Kinks mentioned above are accompanied by local BI/BII transition in the
sugar-phosphate backbone, which suggests a non-parabolic profile of DNA bending
energy. Therefore, we have undertaken a more detailed investigation in an all-atom
approximation, using DNAminiCarlo software (4) where the rotational and translational parameters of bases serve as independent degrees of freedom.
To this aim, we have analyzed multi-dimensional energy landscapes of several
double-stranded DNA hexamers containing various YR and RY steps in the cen-
ter, e.g., CTTAAG, GAATTC, etc. We compared the optimal conformations of
hexamers with the Kink-and-Slide distortions in nucleosome (3), which are dictated by histone arginines penetrating into the minor groove: Roll = -20º and Slide
= 2.5 Å. In addition, we paid attention to the inter-relationships between Roll,
Slide, and BI/BII conformational state.
925
First, we confirmed the result obtained earlier (5) that if the unrestrained DNA deformations are allowed, the central TA step bends preferably into the major-groove.
If, however, the conformational restraints are imposed on DNA trajectory, and the
Kink-and-Slide deformation is considered, the hexamers with the central TA step
are the most favorable for the minor-groove kink (compared to other sequences). In
other words, the TA step most easily accommodates strong negative Roll with concomitant positive Slide imposed by the histone arginines. We also found that the BI/
BII transition facilitates the Kink-and-Slide deformation, especially for hexamers
with the pyrimidine-purine YR steps in the center. Overall, the Kink-and-Slide deformation energy of DNA increases in the order TA < CA < CG < GC < AC < AT.
Our results are generally consistent with results of Tolstorukov et al. (1), although
there are two notable differences. First, the DNA deformation energy calculated
here is significantly lower than the estimates made earlier when the elastic energy
functions were applied (1), especially for the purine-pyrimidine steps AT and AC.
This is yet another illustration that the Kink-and-Slide deformations represent a
nonharmonic (nonlinear) behavior of the duplex. Second, TA is the easiest dimeric
step to deform according to our data, while it was the second one based on elastic
energy predictions (1). Our new results are in a better agreement with experimental
data, because this is the TA step that occurs most frequently in the minor-groove
kink positions in the most stable nucleosomes (6-7). Therefore, we expect that the
DNA deformation energy evaluated here in an all-atom approximation will help
refining the scoring functions (1) for prediction of nucleosome positioning.
1. Tolstorukov, M. Y., Colasanti, A. V., McCandlish, D., Olson, W. K., and Zhurkin, V. B. J Mol
Biol 371, 725-738 (2007).
2. Olson, W. K., Gorin, A. A., Lu, X. J., Hock, L. M., and Zhurkin, V. B. Proc. Natl. Acad. Sci.
U.S.A. 95, 11163-68 (1998).
3. Davey, C. A., Sargent, D. F., Luger, K., Maeder, A. W., and Richmond, T. J. J Mol Biol 319,
1097-1113 (2002).
4. Zhurkin, V. B., Ulyanov, N. B., Gorin, A. A., and Jernigan, R. L. Proc Natl Acad Sci USA
88, 7046-7050 (1991).
5. Ulyanov, N. B. and Zhurkin, V. B. J Biomol Struct Dyn 2, 361-385 (1984).
6. Shrader, T. and Crothers, D. M. Proc Natl Acad Sci USA 86, 7418–7422 (1989).
7. Lowary, P. and Widom, J. J Mol Biol 276, 19-42 (1998).
212
Structural Polymorphism of the Nucleosomal
DNA and Implications for Protein Binding
A nucleosome forms a basic unit of the chromosome structure. A biologically relevant question is how much of the nucleosomal conformational space is accessible
to protein-free DNA, and what proportion of the nucleosomal conformations are
induced by bound histones. To investigate this, we have analysed high resolution xray crystal structure datasets of DNA in protein-free as well as protein-bound forms,
and compared the dinucleotide step parameters for the two datasets with those for
high resolution nucleosome structures. Our analysis shows that most of the dinucleotide step parameter values for the nucleosome structures lie within the range accessible to protein-free DNA, indirectly indicating that the histone core plays more
of a stabilizing role. The nucleosome structures are observed to assume smooth
and nearly planar curvature, implying that ‘normal’ B-DNA like parameters can
give rise to a curved geometry at the gross structural level. Different nucleosome
Arvind Marathe
Manju Bansal*
Molecular Biophysics Unit
Indian Inst of Science
Bangalore – 560012, India
mb@mbu.iisc.ernet.in
*
926
213
A. B. Cohanim
T. E. Haran*
Technion, Technion City
Haifa 32000 Israel
bitali@tx.technion.ac.il
214
David J. Clark
Laboratory of Molecular Growth
Regulation, NICHHD
National Institutes of Health
Building 6 Room 2A14
Bethesda MD 20892-2426
clarkda@mail.nih.gov
structures, as well as different fragments of the same nucleosome, are observed to
assume different values of curvature, as well as out-of-plane components of curvature, reaffirming the wide ranging sequence dependent polymorphism of the double
helical B-form DNA. We have compared the curvature of different fragments in the
nucleosome structures to the curvature of highly distorted DNA fragments such as
those bound to the catabolite activator protein and the integration host factor. This
investigation throws light on the different modes of inherent and induced DNA curvature, and may lead to the prediction of DNA fragments vulnerable to the action of
different proteins of the transcription machinery.
The Coexistence of the DNA Organization Code
with the Protein Code on the DNA Double Helix
It is now known that there are several codes residing simultaneously on the DNA
double helix. The two best characterized codes are the genetic code – the code for protein production, and the code for DNA organization, or packaging into nucleosomes.
Since these codes have to co-exist simultaneously on the same DNA region, there
must be degeneracy in both codes to allow their co-existence. Adenine tracts (“Atracts”) are homopolymeric stretches of several adjacent adenosines on one strand
of the double helix, having unusual structural properties, which were shown to be
important in influencing DNA organization in nucleosomes. A-tracts were shown to
exclude nucleosomes and as such are instrumental in setting the translational positioning of DNA within nucleosomes. This enables the coding regions to be densely
packaged within nucleosomes, whereas regulatory regions are usually devoid of
nucleosomes, or packaged less densely. In our study we observe that long A-tracts
deficiency characterize only the exon regions within coding regions. Moreover we
observe, cross kingdoms, a strong codon bias towards the avoidance of long A-tracts
in coding regions, which enables the formation of high density of nucleosomes in
these regions. We show that this bias in codon usage is sufficient for enabling DNA
organization within nucleosomes without constrains on the actual protein code. Thus,
there is a co-dependency, or inter-dependency, of the two major codes within DNA to
allow their simultaneous co-existence. In addition, we will discuss a new model for
the higher order organization of nucleosomes in coding regions.
The Dynamic Chromatin Structure
of Transcriptionally Active Yeast Genes
A number of years ago, inspired by the work of Dr. Bob Simpson (1), we developed a model system in yeast to study the events that occur when a gene is
activated for transcription (2, 3). This involves the purification from yeast cells of
native plasmid chromatin containing a model gene expressed at basal or activated
levels. In essence, we isolate a gene in its basal or transcriptionally activated
native chromatin structure. We have compared these chromatin structures using
methods originally developed to elucidate reconstituted chromatin structures. Our
studies of two model genes, CUP1 and HIS3, have revealed that activation correlates with movements of nucleosomes and remodeling of nucleosomes over the
entire gene, not just at the promoter (4-6).
HIS3 encodes an enzyme required for histidine metabolism and is induced by
amino acid starvation. HIS3 is activated by Gcn4p and regulated by the Gcn5p
histone acetyltransferase (HAT) in the SAGA complex and the Esa1p HAT in the
NuA4 complex, as well as by the SWI/SNF and RSC ATP-dependent remodeling machines (7, 8). We have demonstrated that HIS3 plasmid chromatin exists in
two alternative structural states which, for simplicity, are referred to as remodelled
and unremodelled chromatin (5). HIS3 plasmid chromatin purified from uninduced
cells is predominantly composed of fully supercoiled chromatin that is generally
protected from cleavage by restriction enzymes, indicating that it has a canonical
chromatin structure. In contrast, induced chromatin is predominantly composed of
remodelled chromatin, characterised by a much reduced level of negative supercoiling, decreased compaction and increased sensitivity to restriction enzymes, indicating a highly accessible chromatin structure. The formation of remodelled chromatin
requires both the Gcn4p activator and the SWI/SNF remodeling machine.
We have addressed the roles of the SWI/SNF and Isw1 remodeling machines in determining the positions of nucleosomes in HIS3 chromatin (6). We used the “monomer extension” procedure (9) to map nucleosome positions in our yeast chromatin.
In this method, the DNA from fully trimmed nucleosome core particles prepared
from plasmid chromatin is mapped on the gene sequence using a primer extension
approach, in which the core particle DNA acts as primer. This method can resolve
complex chromatin structures, including overlapping nucleosome positions, which
appear to be the rule rather than the exception. In contrast, indirect end-labelling,
the traditional method for mapping nucleosomes in native chromatin, cannot detect overlapping positions and therefore yields only a simplified, low resolution,
nucleosome map. The presence of overlapping positions indicates that native chromatin structures are highly heterogeneous, since nucleosomes cannot physically
overlap. Although monomer extension revealed a large number of alternative, overlapping positions on the HIS3 gene, the nucleosome spacing is highly regular. We
conclude that the HIS3 gene is organized into one of several alternative overlapping
arrays of nucleosomes. In basal HIS3 chromatin, there is a dominant array, but this
array loses its dominance in activated chromatin. Disruption of the dominant array
requires both the Gcn4p activator and the SWI/SNF remodeling machine.
We propose that Gcn4p and SWI/SNF direct the mobilization of nucleosomes over
the entire HIS3 gene, apparently involving the coordinated shunting of nucleosomes
from one array of positions to another, always maintaining the nucleosome spacing
characteristic of yeast cells. We suggest that the net effect of nucleosome mobilization might be to provide windows of opportunity for transcription initiation and
elongation factors to access the underlying DNA, as the nucleosomes are shunted
back and forth. Thus, the interplay between various remodeling machines is expected to create a highly dynamic chromatin structure.
Currently, we are ascertaining whether our findings for yeast plasmid chromatin
can be extrapolated to the chromosome and to the entire yeast genome, using a high
throughput sequencing approach.
1.
2.
3.
4.
5.
6.
Thoma, F., Bergman, L. W., and Simpson, R. T. J Mol Biol 177, 715-733 (1984).
Alfieri, J. A. and Clark, D. J. Methods Enzymol 304, 35-49 (1999).
Kim, Y. J., Shen, C.-H., and Clark, D. J. Methods 33, 59-67 (2004).
Shen, C.-H., Leblanc, B. P., Alfieri, J. A., and Clark, D. J. Mol Cell Biol 21, 534-547 (2001).
Kim, Y. and Clark, D. J. Proc Natl Acad Sci USA 99, 15381-15386 (2002).
Kim, Y., McLaughlin, N. B., Lindstrom, K., Tsukiyama, T., and Clark, D. J. Mol Cell Biol
26, 8607-8622 (2006).
7. Natarajan, K., Jackson, B. M., Zhou, H., Winston, F., and Hinnebusch, A. G. Mol Cell 4,
657-664 (1999).
8. Reid, J. L., Iyer, V. R., Brown, P. O., and Struhl, K. Mol Cell 6, 1297-1307 (2000).
9. Yenidunya, A., Davey, C., Clark, D. J., Felsenfeld, G., and Allan, J. J Mol Biol 237, 401414 (1994).
927
Index to Authors
Abaan, H. O.
882
Abgaryan, L.
902
Achard, A.
898
Achary, M. S.
609
Adams, C.
880
Agricola, E.
904
Aharonovsky, E.
844
Ahmad, F.
587
Akanchha
835
Aldaye, F. A.
800, 801, 802
Alexandrov, A. A.
916
Almerico, A. M.
115
Amitai, G.
850
Ananyan, G.
901
Andreotti, N.
75
Andrianov, A. M. 49, 247, 445, 852, 853, 860
Andronova, V. L.
895
Anilkumar, G.
455
Antonyan, A. P.
856, 877, 878
Arakelyan, A. V.
877
Arakelyan, V. B.
869
Araúzo-Bravo, M. J.
861
Aravind, L.
843
Arcangeli, C.
35
Archipova, V. S.
895
Artamonova. I. I.
883
Artsruni, I. G.
905
Aruscavage, P. J.
812
Arya, G.
908
Atkinson, G.
841
Auffinger, P.
828, 829
Avetisyan, A.
901
Avihoo, A.
147, 827
Avila-Figueroa, A.
836
Baaden, M.
889
Babayan, S. Y.
876
Babayan, Y. S.
876, 885
Baghdasaryan, L. S.
877
Bairagya, H. R.
497, 855
Baker, K.
787
Baker, M. L.
844
Balaram, H.
903
Balasubramanian, H.
869
Baldauf, S.
841
Baldwin, G. S.
880
Banas, P.
816
Banerjee, P. R.
862
Bansal, M.
925
Barabas, O.
898
Barakat, N. H.
816
Barash, D.
147, 403, 827, 918
Barnard, P.
889
Barone, G.
115
Barvik, I.
787
Bass, B. L.
812
Baylin, S. B.
906
Bazhulina, N. P.
895
Beck, M.
845
Belfort, G.
850
Belfort, M.
850
Beniaminov, A. D.
832
Beskaravainy, P. M.
881
Dynamics, ISSN 0739-1102
Volume 26, Issue Number 6, (2009)
©Adenine Press (2009)
Besseova, I.
Beveridge, D. L.
Bhadra, K.
Bhak, J.
Bichenkova, E. V.
Bickelhaupt, F. M.
Bindewald, E.
Birktoft, J. J.
Bishop, T. C.
Blanchard, S. C.
Boelens, R.
Boocock, M. R.
Borek, D.
Borisova, O. F.
Bothra, A. K.
Bouakaz, E.
Bowman, G. D.
Boyd, S.
Britt, B. M.
Brooks, N. J.
Broser, M.
Burmann, B. M.
Cabrita, L. D.
Callahan, B. P.
Cantale, C.
Carey, J.
Carneiro, K. M. M.
Caserta, M.
Çetinkol, O. P.
Chakrabarti, J.
Chandler, M.
Chandrashekaran, I. R.
Chao, H.
Chao, J.
Chaparzadeh, N.
Chattopadhyay, A.
Chattopadhyaya, R.
Chaurasiya, K.
Chavushyan, A.
Chen, C. Y.-C.
Chen, C.
Chen, C.-Q.
Chen, F.
Chen, H.
Chen, J.-T.
Chen, J.-T.
Chen, Q.-X.
Chen, Y.
Chen, Y.-F.
Cheng, C.
Chernet, B. T.
Cherng, N.
Chiang, S.-C.
Chiang, Y.-W.
Chiu, W.
Cho, D.
Choi, P. J.
Choudhuri, U.
Choudhury, S. R.
Christodoulou, J.
Churcher, M.
Ciengshin, T.
830
866
886
395
847
115
821
799
922
794
909
891
907, 913
301
321
791
915
921
263
880
865
465
846
850
35
849, 860
800, 802
904
892
223
898
854
879
797
255
421
339, 856, 865
804
826
57
900
509
293
847
549
549
509
799
57
840
838
838
816
355
844, 845
833
847
421
235
846
904
796
Cingolani, G.
Clark, D. J.
Clore, G. M.
Cohanim, A. B.
Coller, J
Colón, W.
Constantinou, P. E.
Corey, D.
Correll, S.
Coufal, N. G.
Cowsik, S. M.
Cristofari, G.
Cruceanu, M.
Cui, F.
Dalyan, Y. B.
Darlix, J.
Das, B.
Das, C.
Das, S.
Dasgupta, D.
de los Santos, C.
De Santis, P.
De Waard, M.
del Sol, A.
Delaney, S.
deMezer, M.
Demirkhanyan, L. H.
Dessalew, N.
Devi S, Y.
DeWeerd, K.
Dhingra, P.
Di Luccio, E.
Dietz, H.
Dike, A.
Divsalar, A.
Doak, T. G.
Dobson, C. M.
Dosin, Y. M.
Douglas, S. M.
Douglas. N. R.
Dromi, N.
Duncan, T.
Dunker, A. K.
Dyda, F.
Ehrenberg, M.
Eletr, Z.
Engelhart, A. E.
Esguerra, M.
Ettrich, R.
Fahie, K.
Fang, H.-W.
Fang, P.-S.
Farshad Niazi, F.
Fedorova, O. S.
Fedoseyeva, V. B.
Field, Y.
Figiel, M.
Filippova, G.
Finarov, I.
Fire, A.
Fiszer, A.
Florentiev, V. L.
872
926
848
926
787
860
799
811
908
809
854
804
805
915
826, 876, 901
804
321
913
814
913
897
914, 921
75
861
836
834
905
851
863
857
864
75
799
854
575, 587
911
846
517
799
844
147, 827
872
807, 808
898
789, 791
854
815, 892
832
849
912
65, 481, 549
549
813
307, 637, 899
916
919
834
833
791
812, 921
834
301
929
930
Fondufe-Mittendorf, Y.
Frank, J.
Frank-Kamenetskii, M.
Frenkel, Z. M.
Fridman, A. S.
Fried, M. G.
Friedman, S. H.
Frydman, J.
Fu, C. J.
Fu, J.
Fu, X.-d.
Fucini, P.
Fuentes, E. J.
Fygenson, D. K.
Gabdank, I.
Gabdulkhakov, A.
Gabrielian, A.
Gage, F. H.
Galeffi, P.
Galegov, G. A.
Galyuk, E. N.
Gambino, N.
Gao, H.
Gebrezgiabher, M. B.
Gelfand, M.
Gevorgyan, E. S.
Gevorgyan, H. K.
Ghanem, J. A.
Ghazaryan, A. A.
Ghosh, A. N.
Ghosh, A.
Ghosh, T. C.
Ghosh, Z.
Gianese, G.
Ginell, S. L.
Gogia, S.
Gojobori, T.
Goldar, A.
Goldman, J. A.
Gorb, L.
Gorelick, R. J.
Gou, L.
Grace, R. C. R.
Graf, F.
Green, M.
Grigoryan, A. V.
Grigoryan, L. R.
Grigoryev, S. A.
Grinstein, G. G.
Grokhovsky, S. L.
Gu, H.
Guéroult, M.
Guerra, C. F.
Gunasekera, K.
Guntas, G.
Guo, F.-B.
Guo, Y.
Guo, Z.
Gupta, D.
Gursahani, S.
Gursky, G. V.
Gursky, Y. G.
Guskov, A.
Guynet, C.
Ha, T.
Hakimelahi, G. H.
Hakobyan, N. R.
Halvorsen, M.
Han, H.-Y.
Hansen, J. C.
Hansen, L.
Hansia, P.
919
793, 794
893
215
175, 886, 887
875, 880, 893
810
844
844
794
809
846
868
798
403, 918
865
837
809
35
895
175, 517, 886, 887
115
793
847
807, 883
877, 905
869
889
876
421
849
321
223
35
799
903
840, 843
880
917
653
805
395
854
799
849
856
876
908
840
895
797
889
115
869
854
413
367, 599
815
473
329
895
895
865
898
806
587
877
810
83
906
882
849
Haran, T. E.
Haridas, M.
Hartmann, B.
Harutyunyan, S. V.
Hashem, Y.
Hauk, G.
Hauryliuk, V.
Hawse, W.
Heddi, B.
Heinemann, U.
Hellman, L. M.
Herschlag, D.
Hickman, A. B.
Hingorani, M.
Hirata, T.
Hiriart, E.
Ho, Y.
Hoff, K.
Hogberg, B.
Honig, B.
Horowitz, E. D.
Houndonougbo, Y.
Hovhannisyan, A. G.
Howlett, A. C.
Hsu, S.-T. D.
Hu, C.-K.
Hu, J.
Hu, W.
Huang, C.
Huang, C.-H.
Huang, W.
Huang, Y.
Hud, N. V.
Hung, K.-H.
Ieong, K.
Inanami, O.
Ishchenko, A. A.
Islam, M. M.
Ivan V. Anishchenko, I. V.
Jacobs, Jr, W. R.
Jahaniani, F.
Jain, K.
Jain, P.
Jakana, J.
James, T. L.
Janowski, B.
Jarem, D.
Jas, G. S.
Jaworski, G.
Jayaram, B.
Jefferson, M.
Jha, R.
Ji, H.-F.
Ji, L.
Jiang, C.
Johansson, M.
Johnson, S. M.
Joshi, R. R.
Kahen, E.
Kala, A.
Kalantaryan, V. P.
Kaluzhny, D. N.
Kamzolova, S. G.
Kamzolova, S. V.
Kanaryan, G. L.
Kanazhevskaya, L. Y.
Kaplan, N.
Karapetian, A. T.
Karapetian, R. A.
Karmakar, P.
Karunakaran, D.
Karunatilaka, K.
926
491
889
885
828, 829
915
789
912
889
894
875
813
898
866, 883
843
904
65, 481
912
799
888, 890, 923
815
17
877
854
846
886, 887
811
787
795
549
599
900
815, 837, 892
816
791
355
637
827
852, 860
857
813
864
810
844
839
811
836
17
893
864
283
854
197
879
922
791
921
203
817
810
885
301, 832
881
870
876, 885
899
919
856
878
421
810
815
Kasprzak, W.
Keenholtz, R.
Kennedy, D.
Kennedy, S. D.
Kern, J.
Kharchenko, P. V.
Khazaryan, P. S.
Khutsishvili, I.
Kim, H. M.
Kim, T.-J.
Kingston, R. E.
Klepacki, D.
Klipcan, L.
Knake, C.
Knee
Knorre, D. G.
Kogan, S.
Kononenko, A.
Kornyshev, A. A.
Koval, V. V.
Kozlowski, P.
Krasilnikova, M. M.
Krishnan, Y.
Kruijzer, J.
Krzyzosiak, W. J.
Kuczera, K.
Kuhlman, B.
Kuhn, H.
Kumar, G. S.
Kundu, T. K.
Kurouski, D.
Kuznetsov, N. A.
Kuznetsova, A. A.
Ladd, P.
Laederach, A.
Lai, H.-T.
Lando, D. Y.
Landweber, L. F.
Lauria, A.
Law, A. B.
Lawson, E.
Lednev, I. K.
Lee, A. L.
Lee, D.-Y.
Lee, H.-T.
Lee, S. A.
Lei, J.
Leikin, S.
Leith, J. S.
Leontis, N. B.
Leszczynski, J.
Levitt, M.
Li, H.
Li, S.
Li, W.
Liang, B.
Liang, T.
Lieb, J. D.
Liedl, T.
Lin, H.-Y.
Lin, J.-C.
Lin, Y.
Liphardt, J.
Liskamp, R. M. J.
Liu, H.-L.
Liu, K.-T.
Liu, P.
Liu, T.
Liu, W.
Liu, X.
Liu, Y.-F.
Lo, P. K.
821
891
794
825
865
917
876
901
837
819, 821
917
788
791
465
890
307, 637
9
789
880
637, 899
834
838
800
909
834
17
854
893
827, 886
913
872
899
307
833
810
816
175, 187, 517, 886, 887
911
115
868
875
872
868
567
901
93
794
880
902
819, 822, 830
653
844
817
83
793
817
809
919
799
65, 481, 549
509
413
848
909
65, 481, 549
549
888
293
796
293
481
801, 802
931
Lobachev, K. S.
Locke, G.
Lovmar, M.
Lu, H.
Lu, X.
Lü, Z.-R.
Lubling, Y.
Ludtke, S. J.
Lukin, M.
Lukyanets, E. A.
Ly, D. H.
Lynn, D.
Macchion, B. N.
Mahabir, R.
Mahalakshmi, A.
Maity, T. S.
Makarov, A. A.
Malac, K.
Malathi, R.
Mallick, B.
Mandava, C. S.
Mankin, A.
Mansouri-Torshizi, H.
Manukyan, G. A.
Mao, C.
Marathe, A.
Margulies, E. H.
Marky, L. A.
Marquez, V. E.
Martin, J.
Martin, S. L.
Martinez, S.
Martinez-Garriga, B.
Marx, K. A.
Matečko, I.
Matera, R.
Mathews, D. H.
Matinyan, K. S.
Matsui, M.
Mauro, E. D.
Max, K. E. A.
McBryant, S. J.
McCauley, M. J.
Mcknight, J.
McLaughlin, C.
McNevin, S. L.
Medalia, O.
Mehrnejad, F.
Melichercik, M.
Melikishvili, M.
Metpally, R. P.
Mieczkowski, P.
Miles, S. M.
Minyat, E. E.
Miranda-Arango, M.
Mirkin, S. M.
Mirny, L. A.
Mironova, N. L.
Mitkevich, V. A.
Mitra, C. K.
Mitra, M.
Moghaddam, M. I.
Mohan S., S.
Mohmmed, A.
Mondal, U. K.
Montano, S.
Moor, N.
Moore, I. K.
Moreno, A.
Morgunov, I. G.
Morosetti, S.
Morozov, A. V.
835, 838, 837
920
791
293
906
83, 395, 567
919
844
897
307
903
815
163
893
375
812
789
787
850
223
795
788
575, 587
856
799
925
882
901
819
810
804
798
788
840
465
838
818, 825, 831
905
811
904
894
906
805, 806
915
802
263
846
255
849
893
859
919
847
821, 832
866
838
902
847
789
892
805
575, 587
455
473
321
891
791
919
890
870
921
920
Mouw, K. W.
Movileanu, L.
Mozziconacci, J.
Mukerji, I.
Mukherjea, K. K.
Mukherjee, N.
Mukhopadhyay, B. P.
Munro, J. B.
Muradyan, A. M.
Muradymov, S.
Muse, J.
Musier-Forsyth, K.
Mykowska, A.
Nagarajaram, H. A.
Nair, B. G.
Nair, D. G.
Najimudin, N.
Nanjunda, R. K.
Narayanan, V.
Nechipurenko, Y. D.
Ngo, S. C.
Nguyen, D. T.
Nikitin, A. M.
Nilsson, L.
Nodelman, I. M.
Nowacki, M.
Nussinov, R.
O’Daniel, P. I.
Odelberg, S.
Ogura, A.
Oh, S. H.
Oldfield, C. J.
Olejniczak, M.
Olsen, C.
Olson, W. K.
Otoshima, Y.
Otwinowski, Z.
Otyepka, M.
Pagett, L.
Pal, A.
Palamarchuk, G. V.
Pande, A.
Pande, J.
Paparcone, R.
Paramanathan, T.
Pardo, J. P.
Paredes, E.
Park, D.
Park, P. J.
Park, S. J.
Park, Y.-D.
Parker, S. C. J.
Parsadanyan, M. A.
Parthiban, M.
Pavlov, M.
Peng, G.
Perry, J. J. P.
Persil, O.
Petit, C. M.
Petrov, V. V.
Pieniazek, S. N.
Pirumyan, K. A.
Potikyan, G. H.
Poulain, P.
Poulose, N.
Prabhakaran, M.
Pradhan, S. K.
Prévost, C.
Protozanova, K.
Pugh, B. F.
Puranik, M.
Purbeck, C.
891
804
907
890
561
421
497, 855
794
856
896
889
805
834
609
455
387, 491
131
892
835, 838, 837
187
857
263
895
163
915
911
861
283
840
809
395
807
834
901
832, 916
355
907, 913
816
854
339, 856, 865
653
862
862
35
806
866
814
395
917
395
395, 567
882
878
535
791
809
455
837
868
857, 866
866
856
869
889
455
329
913
889
893
922
903
854
Putta, P.
Puttamadappa, S. S.
Pyle, A. M.
Pyshnyi, D. V.
Qualley, D. F.
Rajasekaran, M. B.
Rajeswari, M. R.
Ramadugu, S. K.
Ramakumar, S.
Ramu, H.
Rangarajan, S.
Rau, D. C.
Ravikumar, S.
Ray, A.
Razga, F.
Reblova, K.
Reddy, B. V. B.
Regaya, I.
Rehmann, H.
Remko, M.
Ren, Z.-L.
Reuter, J.
Reyes, V. M.
Rhodes, D.
Rice, P. A.
Robinson, P.
Robson, R. E.
Rodnina, M. V.
Rohs, R.
Ronald, S.
Rosato, V.
Rösch, P.
Routh, A.
Rouzina, I.
Rowland, S.-J.
Roy, S.
Rubin, E. J.
Rueda, D.
Russu, I. M.
Sabatier, J.-M.
Saboury, A. A.
Sadasivan, C.
Saenger, W.
Safro, M.
Salih, B.
Salih, F.
Samian, M.-R.
Sammond, D.
Samori, B.
Sandin, S.
Santra, C. R.
Sanyal, S.
Saparbaev, M. K.
Sarai, A.
Sarkisyan, G. S.
Satyanarayanajois, S. D.
Sayahi, H.
Schlick, T.
Schoephoerster, R. T.
Schotanus, K.
Schröder, G.
Schwartz, J.
Schweimer, K.
Scipioni, A.
Seddon, J. M.
Seeman, N. C.
Seetin, M. G.
Segal, E.
Sekar, K.
Seley-Radtke, K. L.
Selim, M.
Selvi B, R.
892
857
814
847
805
535
625, 835
203
535
788
810
896
850
810
793
793, 830
859
75
909
431
395
831
873, 874, 875
905
891
905
880
790
888, 890, 923
870
35
465
905
805, 806
891
235
847
815
900
75
575, 587
387, 491
865
791
9, 273, 421
9, 273
131
854
803
905
421
795
637
891
877
870
857
908
329
911
844
811
465
914, 921
880
796, 797, 798, 799
818
919, 920
497
283
561
913
932
Sen, A.
321
Sengupta, D. N.
235
Sha, R.
796, 799
Shah, S.
810
Shahinyan, M. A.
878
Shandilya, J.
913
Shanmughavel, P.
535
Shapiro, B. A.
819, 820, 821
Sharko, J.
840
Sharon, E.
919
Shchyolkina, A. K.
301
Shekhtman, A.
857
Shenbagarathai, R.
375
Shenoy, S.
864
Shetty, K.
911
Shi, L.
395
Shih, W. M.
799
Shimoyama, Y.
355
Shishkin, A. A.
838
Shishkin, O. V.
653
Shivashankar, G. V.
911
Shokri, L.
805
Shukshina, I. Z.
821
Sidorova, N.
896
Sidow, A.
921
Šille, J.
431
Silvestri, A.
115
Simmons, K.
810
Simon, H.-G.
840
Singh, P.
863
Singh, S. K.
235, 851, 863
Singhal, G.
625, 835
Skvortsov, A. N.
175
Sleiman, H. F.
800, 801, 802
Slutsky, M.
902
Smith, C.
921
Sobczak, K.
834
Solovyeva, I.
307
Sonavane, U. B.
203
Sorokin, A. A.
881
Sorokin, V. A.
883
Sowdhamini, R.
911
Sponer, J. E.
819
Sponer, J.
793, 816, 819, 824, 830
Stanger, M.
850
Stark, W. M.
891
Staynov, D.
909
Stellwagen, E.
889
Stellwagen, N. C.
889
Stewart-Maynard, K. M.
805
Stockner, T.
849
Stombaugh, J.
819
Strawn, R.
849
Strazewski, P.
791
Streltsov, S. A.
99, 884
Strömberg, R.
163
Stumph, W. E.
816
Subramaniam, S.
473
Sujatha, K.
375
Sulyman, S. A. A.
876
Sunilkumar, P. N.
387, 491
Surovaya, A. N.
895
Suzuki, I.
843
Sweet, T.
787
Switonski, P.
834
Szabó, A.
93
Tackett, W.
875
Tadevosyan, A. A.
885
Tapscott, S.
833
Tenson, T.
789
Terns, M. P.
817
Terns, R. M.
817
Thomson, J.
808
Timmers, H. T. M.
909
Timofeyeva, N. A.
637
Timoshin, V. V.
301
Timsit, Y.
897
Titus, M.
816
Tolstorukov, M. Y.
917
Tomita, M.
842
Tong Wang, T.
796, 798, 799
Ton-Hoang, B.
898
Travers, A.
904
Trifonov, E. N.
9, 273, 403, 844, 918, 924
Tripathi, S.
851
Tsai, H.-Y.
57
Tsai, W.-B.
65, 481
Tullius, T. D.
882
Ulikhanyan, G. R.
885
Ulyanov, N. B.
839, 924
Uversky, V. N.
807
Valadkhan, S.
813, 817
Valouev, A.
921
van Ingen, H.
909
Van Nostrand, K.
825
van Schaik, F. M. A.
909
Vardanyan, I.
826
Vardevanyan, P. O.
877, 878
Varnai, P.
897
Vasquez, K. M.
834
Vazquez-Laslop, N.
788
Verdone, L.
904
Vijayalakshmi, M.
911
Vijayan, V.
911
Villa, E.
793
Vishveshwara, S.
849
Vladescu, I. D.
806
Vlassov, V. V.
847
Voineagu, I.
838
Vorob’ev, V. I.
175
Vorobjev, Y. N.
822
Wagner, E. G. H.
811
Wahab, H. A.
131
Walter, N. G.
816
Wang, D.
915, 924
Wang, F.
804, 805
Wang, G.
834
Wang, Q.
509
Wang, T.-m.
367
Wang, X.
796
Wang, Y.-J.
567
Wartell, R. M.
517
Watanabe, Y.
Waters, L.
Welch, J. T.
Welker, N. C.
West, S. M.
Widom, J.
Wienk, H.
Wiest, O.
Williams, M. C.
Wilson, N.
Wilson, W. D.
Wolberger, C.
Wong, H.
Woodcock, C. L.
Wu, J. W.
Wynveen, A.
Xi, P.
Xia, K.
Xiao, S.-J.
Xie, J.
Xie, J.-J.
Xie, X. S.
Xu, L.
Xu, W.-A.
Xu, Z.
Yam, W. K.
Yan, Y.-W.
Yang, C.-T.
Yang, H.
Yavroyan, Zh. V.
Yeo, G. W.
Yonath, A.
Younger, S.
Zaliznyak, T.
Zeng, Z.
Zenkova, M. A.
Zhai, J.
Zhang, B.
Zhang, C.-T.
Zhang, H.-Y.
Zhang, J.-P.
Zhang, Jianmin
Zhang, Jun
Zhang, Junjie
Zhang, S.
Zhang, Y.
Zhao, J.-H.
Zharkov, D. O.
Zheng, J.
Zheng, W.-X.
Zhong, L.
Zhou, H.-T.
Zhou, J.
Zhou, Y.
Zhurkin, V. B.
Zhuze, A. L.
Zirbel, C. L.
Zou, F.
Zou, H.-C.
Zou, Z.-F.
Zouni, A.
355
901
857
812
888, 923
919
909
283
804, 805, 806
836
892
912
907
908
65
880
293
860
797
525
509
802, 847
879
83
293
131
509
65
802
877
809
788
811
897
293
847
883
813
1
197
509
599
868
844
860
835
65, 481, 549
637, 899
799
1
525
509
817
911
301, 915, 924
99
819
83, 395, 567
567
567
865

Book of Abstracts Albany 2009 - JBSD taken Over by Taylor and

Transcription

Similar documents

EasyPure Genomic DNA Spin Kit

The Masterof

WHY INTERNAL COMMUNICATIONS?

Presentation - Produce Marketing Association

Bell Work: 1/28/13

DNA Structure - hrsbstaff.ednet.ns.ca

Biological and non-biological nanomachines

Cell division

`CSI effect` impacts justice in Tucson