African Journal of Microbiology Research Volume 8 Number 8, 19 February, 2014

African Journal of
Microbiology Research
Volume 8 Number 8, 19 February, 2014
ISSN 1996-0808
ABOUT AJMR
The African Journal of Microbiology Research (AJMR) (ISSN 1996-0808) is published Weekly (one volume per
year) by Academic Journals.
African Journal of Microbiology Research (AJMR) provides rapid publication (weekly) of articles in all areas of
Microbiology such as: Environmental Microbiology, Clinical Microbiology, Immunology, Virology, Bacteriology,
Phycology, Mycology and Parasitology, Protozoology, Microbial Ecology, Probiotics and Prebiotics, Molecular
Microbiology, Biotechnology, Food Microbiology, Industrial Microbiology, Cell Physiology, Environmental
Biotechnology, Genetics, Enzymology, Molecular and Cellular Biology, Plant Pathology, Entomology, Biomedical
Sciences, Botany and Plant Sciences, Soil and Environmental Sciences, Zoology, Endocrinology, Toxicology. The
Journal welcomes the submission of manuscripts that meet the general criteria of significance and scientific
excellence. Papers will be published shortly after acceptance. All articles are peer-reviewed.
Submission of Manuscript
Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given
the last name of the first author
Click here to Submit manuscripts online
If you have any difficulty using the online submission system, kindly submit via this email
ajmr@academicjournals.org.
With questions or concerns, please contact the Editorial Office at ajmr@academicjournals.org.
Editors
Prof. Dr. Stefan Schmidt,
Applied and Environmental Microbiology
School of Biochemistry, Genetics and Microbiology
University of KwaZulu-Natal
Private Bag X01
Scottsville, Pietermaritzburg 3209
South Africa.
Dr. Thaddeus Ezeji
Assistant Professor
Fermentation and Biotechnology Unit
Department of Animal Sciences
The Ohio State University
1680 Madison Avenue
USA.
Prof. Fukai Bao
Department of Microbiology and Immunology
Kunming Medical University
Kunming 650031,
China
Associate Editors
Dr. Jianfeng Wu
Dept. of Environmental Health Sciences,
School of Public Health,
University of Michigan
USA
Dr. Ahmet Yilmaz Coban
OMU Medical School,
Department of Medical Microbiology,
Samsun,
Turkey
Dr. Seyed Davar Siadat
Pasteur Institute of Iran,
Pasteur Square, Pasteur Avenue,
Tehran,
Iran.
Dr. J. Stefan Rokem
The Hebrew University of Jerusalem
Department of Microbiology and Molecular Genetics,
P.O.B. 12272, IL-91120 Jerusalem,
Israel
Prof. Long-Liu Lin
National Chiayi University
300 Syuefu Road,
Chiayi,
Taiwan
N. John Tonukari, Ph.D
Department of Biochemistry
Delta State University
PMB 1
Abraka, Nigeria
Dr. Mamadou Gueye
MIRCEN/ Laboratoire commun de microbiologie
IRD-ISRA-UCAD, BP 1386,
DAKAR, Senegal.
Dr. Caroline Mary Knox
Department of Biochemistry, Microbiology and
Biotechnology
Rhodes University
Grahamstown 6140
South Africa.
Dr. Hesham Elsayed Mostafa
Genetic Engineering and Biotechnology Research
Institute (GEBRI)
Mubarak City For Scientific Research,
Research Area, New Borg El-Arab City,
Post Code 21934, Alexandria, Egypt.
Dr. Wael Abbas El-Naggar
Head of Microbiology Department,
Faculty of Pharmacy,
Mansoura University,
Mansoura 35516, Egypt.
Dr. Abdel Nasser A. El-Moghazy
Microbiology, Molecular Biology, Genetics Engineering
and Biotechnology
Dept of Microbiology and Immunology
Faculty of Pharmacy
Al-Azhar University
Nasr city,
Cairo, Egypt
Editorial Board
Dr. Barakat S.M. Mahmoud
Food Safety/Microbiology
Experimental Seafood Processing Laboratory
Costal Research and Extension Center
Mississippi State University
3411 Frederic Street
Pascagoula, MS 39567
USA
Prof. Mohamed Mahrous Amer
Poultry Disease (Viral Diseases of poultry)
Faculty of Veterinary Medicine,
Department of Poultry Diseases
Cairo university
Giza, Egypt
Dr. Xiaohui Zhou
Molecular Microbiology, Industrial Microbiology,
Environmental Microbiology, Pathogenesis, Antibiotic
resistance, Microbial Ecology
Washington State University
Bustad Hall 402 Department of Veterinary
Microbiology and Pathology, Pullman,
USA
Dr. R. Balaji Raja
Department of Biotechnology,
School of Bioengineering,
SRM University,
Chennai
India
Dr. Aly E Abo-Amer
Division of Microbiology, Botany Department, Faculty
of Science, Sohag University.
Egypt.
Dr. Haoyu Mao
Department of Molecular Genetics and Microbiology
College of Medicine
University of Florida
Florida, Gainesville
USA.
Dr. Rachna Chandra
Environmental Impact Assessment Division
Environmental Sciences
Sálim Ali Center for Ornithology and Natural History
(SACON),
Anaikatty (PO), Coimbatore-641108, India
Dr. Yongxu Sun
Department of Medicinal Chemistry and
Biomacromolecules
Qiqihar Medical University, Qiqihar 161006
Heilongjiang Province
P.R. China
Dr. Ramesh Chand Kasana
Institute of Himalayan Bioresource Technology
Palampur, Distt. Kangra (HP),
India
Dr. S. Meena Kumari
Department of Biosciences
Faculty of Science
University of Mauritius
Reduit
Dr. T. Ramesh
Assistant Professor
Marine Microbiology
CAS in Marine Biology
Faculty of Marine Sciences
Annamalai University
Parangipettai - 608 502
Cuddalore Dist. Tamilnadu,
India
Dr. Pagano Marcela Claudia
Post doctoral fellowship at Department of Biology,
Federal University of Ceará - UFC,
Brazil.
Dr. EL-Sayed E. Habib
Associate Professor,
Dept. of Microbiology,
Faculty of Pharmacy,
Mansoura University,
Egypt.
Dr. Pongsak Rattanachaikunsopon
Department of Biological Science,
Faculty of Science,
Ubon Ratchathani University,
Warin Chamrap, Ubon Ratchathani 34190,
Thailand
Dr. Gokul Shankar Sabesan
Microbiology Unit, Faculty of Medicine,
AIMST University
Jalan Bedong, Semeling 08100,
Kedah,
Malaysia
Dr. Kwang Young Song
Department of Biological Engineering,
School of Biological and Chemical Engineering,
Yanbian Universityof Science and Technology,
Yanji,
China.
Dr. Kamel Belhamel
Faculty of Technology,
University of Bejaia
Algeria
Dr. Sladjana Jevremovic
Institute for Biological Research
Sinisa Stankovic,
Belgrade,
Serbia
Dr. Tamer Edirne
Dept. of Family Medicine, Univ. of Pamukkale
Turkey
Dr. R. Balaji Raja M.Tech (Ph.D)
Assistant Professor,
Department of Biotechnology,
School of Bioengineering,
SRM University,
Chennai.
India
Dr. Minglei Wang
University of Illinois at Urbana-Champaign,USA
Dr. Mohd Fuat ABD Razak
Institute for Medical Research
Malaysia
Dr. Davide Pacifico
Istituto di Virologia Vegetale – CNR
Italy
Prof. Dr. Akrum Hamdy
Faculty of Agriculture, Minia University, Egypt
Egypt
Dr. Ntobeko A. B. Ntusi
Cardiac Clinic, Department of Medicine,
University of Cape Town and
Department of Cardiovascular Medicine,
University of Oxford
South Africa and
United Kingdom
Prof. N. S. Alzoreky
Food Science & Nutrition Department,
College of Agricultural Sciences & Food,
King Faisal University,
Saudi Arabia
Dr. Chen Ding
College of Material Science and Engineering,
Hunan University,
China
Dr Svetlana Nikolid
Faculty of Technology and Metallurgy,
University of Belgrade,
Serbia
Dr. Sivakumar Swaminathan
Department of Agronomy,
College of Agriculture and Life Sciences,
Iowa State University,
Ames, Iowa 50011
USA
Dr. Alfredo J. Anceno
School of Environment, Resources and Development
(SERD),
Asian Institute of Technology,
Thailand
Dr. Iqbal Ahmad
Aligarh Muslim University,
Aligrah
India
Dr. Josephine Nketsia-Tabiri
Ghana Atomic Energy Commission
Ghana
Dr. Juliane Elisa Welke
UFRGS – Universidade Federal do Rio
Grande do Sul
Brazil
Dr. Mohammad Nazrul Islam
NIMR; IPH-Bangalore & NIUM
Bangladesh
Dr. Okonko, Iheanyi Omezuruike
Department of Virology,
Faculty of Basic Medical Sciences,
College of Medicine,
University of Ibadan,
University College Hospital,
Ibadan,
Nigeria
Dr. Giuliana Noratto
Texas A&M University
USA
Dr. Phanikanth Venkata Turlapati
Washington State University
USA
Dr. Khaleel I. Z. Jawasreh
National Centre for Agricultural Research and
Extension, NCARE
Jordan
Dr. Babak Mostafazadeh, MD
Shaheed Beheshty University of Medical Sciences
Iran
Dr. S. Meena Kumari
Department of Biosciences
Faculty of Science
University of Mauritius
Reduit
Mauritius
Dr. S. Anju
Department of Biotechnology,
SRM University, Chennai-603203
India
Dr. Mustafa Maroufpor
Iran
Prof. Dong Zhichun
Professor, Department of Animal Sciences and
Veterinary Medicine,
Yunnan Agriculture University,
China
Dr. Mehdi Azami
Parasitology & Mycology Dept,
Baghaeei Lab.,
Shams Abadi St.
Isfahan
Iran
Dr. Anderson de Souza Sant’Ana
University of São Paulo.
Brazil.
Dr. Juliane Elisa Welke
UFRGS – Universidade Federal do Rio Grande do Sul
Brazil
Dr. Paul Shapshak
USF Health,
Depts. Medicine (Div. Infect. Disease & Internat Med)
and Psychiatry & Beh Med.
USA
Dr. Jorge Reinheimer
Universidad Nacional del Litoral (Santa Fe)
Argentina
Dr. Qin Liu
East China University of Science
and Technology
China
Dr. Xiao-Qing Hu
State Key Lab of Food Science and Technology
Jiangnan University
P. R. China
Prof. Branislava Kocic
Specaialist of Microbiology and Parasitology
University of Nis, School of Medicine Institute
for Public Health Nis, Bul. Z. Djindjica 50, 18000 Nis
Serbia
Dr. Rafel Socias
CITA de Aragón,
Spain
Prof. Kamal I. Mohamed
State University of New York at Oswego
USA
Prof. Isidro A. T. Savillo
ISCOF
Philippines
Dr. Adriano Cruz
Faculty of Food Engineering-FEA
University of Campinas (UNICAMP)
Brazil
Dr. How-Yee Lai
Taylor’s University College
Malaysia
Dr. Mike Agenbag (Michael Hermanus Albertus)
Manager Municipal Health Services,
Joe Gqabi District Municipality
South Africa
Dr. D. V. L. Sarada
Department of Biotechnology,
SRM University, Chennai-603203
India.
Dr. Samuel K Ameyaw
Civista Medical Center
United States of America
Prof. Huaizhi Wang
Institute of Hepatopancreatobiliary
Surgery of PLA Southwest Hospital,
Third Military Medical University
Chongqing400038
P. R. China
Prof. Bakhiet AO
College of Veterinary Medicine, Sudan
University of Science and Technology
Sudan
Dr. Saba F. Hussain
Community, Orthodontics and Peadiatric Dentistry
Department
Faculty of Dentistry
Universiti Teknologi MARA
40450 Shah Alam, Selangor
Malaysia
Prof. Dr. Zohair I.F.Rahemo
State Key Lab of Food Science and Technology
Jiangnan University
P. R. China
Dr. Afework Kassu
University of Gondar
Ethiopia
Dr. Nidheesh Dadheech
MS. University of Baroda, Vadodara, Gujarat, India.
India
Dr. Omitoyin Siyanbola
Bowen University,
Iwo
Nigeria
Dr. Franco Mutinelli
Istituto Zooprofilattico Sperimentale delle Venezie
Italy
Dr. Chanpen Chanchao
Department of Biology,
Faculty of Science,
Chulalongkorn University
Thailand
Dr. Tsuyoshi Kasama
Division of Rheumatology,
Showa University
Japan
Dr. Kuender D. Yang, MD.
Chang Gung Memorial Hospital
Taiwan
Dr. Liane Raluca Stan
University Politehnica of Bucharest,
Department of Organic Chemistry “C.Nenitzescu”
Romania
Dr. Muhamed Osman
Senior Lecturer of Pathology & Consultant
Immunopathologist
Department of Pathology,
Faculty of Medicine,
Universiti Teknologi MARA,
40450 Shah Alam, Selangor
Malaysia
Dr. Mohammad Feizabadi
Tehran University of medical Sciences
Iran
Prof. Ahmed H Mitwalli
State Key Lab of Food Science and Technology
Jiangnan University
P. R. China
Dr. Mazyar Yazdani
Department of Biology,
University of Oslo,
Blindern,
Oslo,
Norway
Dr. Ms. Jemimah Gesare Onsare
Ministry of Higher, Education
Science and Technology
Kenya
Dr. Babak Khalili Hadad
Department of Biological Sciences,
Roudehen Branch,
Islamic Azad University,
Roudehen
Iran
Dr. Ehsan Sari
Department of Plan Pathology,
Iranian Research Institute of Plant Protection,
Tehran,
Iran.
Dr. Adibe Maxwell Ogochukwu
Department of Clinical Pharmacy and Pharmacy
Management,
University of Nigeria,
Nsukka.
Nigeria
Dr. William M. Shafer
Emory University School of Medicine
USA
Dr. Michelle Bull
CSIRO Food and Nutritional Sciences
Australia
Prof. Dr. Márcio Garcia Ribeiro (DVM, PhD)
School of Veterinary Medicine and Animal ScienceUNESP,
Dept. Veterinary Hygiene and Public Health,
State of Sao Paulo
Brazil
Prof. Dr. Sheila Nathan
National University of Malaysia (UKM)
Malaysia
Prof. Ebiamadon Andi Brisibe
University of Calabar,
Calabar,
Nigeria
Dr. Snjezana Zidovec Lepej
University Hospital for Infectious Diseases
Zagreb,
Croatia
Dr. Julie Wang
Burnet Institute
Australia
Dr. Dilshad Ahmad
King Saud University
Saudi Arabia
Dr. Jean-Marc Chobert
INRA- BIA, FIPL
France
Dr. Adriano Gomes da Cruz
University of Campinas (UNICAMP)
Brazil
Dr. Zhilong Yang, PhD
Laboratory of Viral Diseases
National Institute of Allergy and Infectious Diseases,
National Institutes of Health
Dr. Hsin-Mei Ku
Agronomy Dept. NCHU 250 Kuo
Kuang Rd, Taichung,
Taiwan
Dr. Dele Raheem
University of Helsinki
Finland
Dr. Fereshteh Naderi
Physical chemist,
Islamic Azad University,
Shahre Ghods Branch
Iran
Dr. Li Sun
PLA Centre for the treatment of infectious diseases,
Tangdu Hospital,
Fourth Military Medical University
China
Dr. Biljana Miljkovic-Selimovic
School of Medicine,
University in Nis,
Serbia; Referent laboratory for Campylobacter and
Helicobacter,
Center for Microbiology,
Institute for Public Health, Nis
Serbia
Dr. Pradeep Parihar
Lovely Professional University, Phagwara, Punjab.
India
Dr. Xinan Jiao
Yangzhou University
China
Dr. Kanzaki, L I B
Laboratory of Bioprospection. University of Brasilia
Brazil
Dr. Endang Sri Lestari, MD.
Department of Clinical Microbiology,
Medical Faculty,
Diponegoro University/Dr. Kariadi Teaching Hospital,
Semarang
Indonesia
Prof. Philippe Dorchies
Laboratory of Bioprospection. University of Brasilia
Brazil
Dr. Hojin Shin
Pusan National University Hospital
South Korea
Dr. Yi Wang
Center for Vector Biology, 180 Jones Avenue
Rutgers University, New Brunswick, NJ 08901-8536
USA
Dr. Heping Zhang
The Key Laboratory of Dairy Biotechnology and
Engineering,
Ministry of Education,
Inner Mongolia Agricultural University.
China
Dr. William H Roldán
Department of Medical Microbiology,
Faculty of Medicine,
Peru
Dr. C. Ganesh Kumar
Indian Institute of Chemical Technology,
Hyderabad
India
Dr. Farid Che Ghazali
Universiti Sains Malaysia (USM)
Malaysia
Dr. Samira Bouhdid
Abdelmalek Essaadi University,
Tetouan,
Morocco
Dr. Zainab Z. Ismail
Department of Environmental Engineering, University
of Baghdad.
Iraq
Prof. Natasha Potgieter
University of Venda
South Africa
Dr. Ary Fernandes Junior
Universidade Estadual Paulista (UNESP)
Brasil
Dr. Alemzadeh
Sharif University
Iran
Dr. Papaevangelou Vassiliki
Athens University Medical School
Greece
Dr. Sonia Arriaga
Instituto Potosino de Investigación Científicay
Tecnológica/División de Ciencias Ambientales
Mexico
Dr. Fangyou Yu
The first Affiliated Hospital of Wenzhou Medical
College
China
Dr. Armando Gonzalez-Sanchez
Universidad Autonoma Metropolitana Cuajimalpa
Mexico
Dr. Galba Maria de Campos Takaki
Catholic University of Pernambuco
Brazil
Dr. Kwabena Ofori-Kwakye
Department of Pharmaceutics,
Kwame Nkrumah University of Science & Technology,
KUMASI
Ghana
Dr. Hans-Jürg Monstein
Clinical Microbiology, Molecular Biology Laboratory,
University Hospital, Faculty of Health Sciences, S-581
85 Linköping
Sweden
Prof. Dr. Liesel Brenda Gende
Arthropods Laboratory, School of Natural and Exact
Sciences, National University of Mar del Plata
Buenos Aires,
Argentina.
Dr. Ajith, T. A
Associate Professor Biochemistry, Amala Institute of
Medical Sciences, Amala Nagar, Thrissur, Kerala-680
555
India
Dr. Adeshina Gbonjubola
Ahmadu Bello University,
Zaria.
Nigeria
Dr. Feng-Chia Hsieh
Biopesticides Division, Taiwan Agricultural Chemicals
and Toxic Substances Research Institute, Council of
Agriculture
Taiwan
Prof. Dr. Stylianos Chatzipanagiotou
University of Athens – Medical School
Greec
Dr. Dongqing BAI
Department of Fishery Science,
Tianjin Agricultural College,
Tianjin 300384
P. R. China
Dr. Dingqiang Lu
Nanjing University of Technology
P.R. China
Dr. L. B. Sukla
Scientist –G & Head, Biominerals Department,
IMMT, Bhubaneswar
India
Dr. Hakan Parlakpinar
MD. Inonu University, Medical Faculty, Department
of Pharmacology, Malatya
Turkey
Dr Pak-Lam Yu
Massey University
New Zealand
Dr Percy Chimwamurombe
University of Namibia
Namibia
Dr. Euclésio Simionatto
State University of Mato Grosso do Sul-UEMS
Brazil
Prof. Dra. Suzan Pantaroto de Vasconcellos
Universidade Federal de São Paulo
Rua Prof. Artur Riedel, 275 Jd. Eldorado, Diadema, SP
CEP 09972-270
Brasil
Dr. Maria Leonor Ribeiro Casimiro Lopes Assad
Universidade Federal de São Carlos - Centro de
Ciências Agrárias - CCA/UFSCar
Departamento de Recursos Naturais e Proteção
Ambiental
Rodovia Anhanguera, km 174 - SP-330
Araras - São Paulo
Brasil
Dr. Pierangeli G. Vital
Institute of Biology, College of Science, University of
the Philippines
Philippines
Prof. Roland Ndip
University of Fort Hare, Alice
South Africa
Dr. Shawn Carraher
University of Fort Hare, Alice
South Africa
Dr. José Eduardo Marques Pessanha
Observatório de Saúde Urbana de Belo
Horizonte/Faculdade de Medicina da Universidade
Federal de Minas Gerais
Brasil
Dr. Yuanshu Qian
Department of Pharmacology, Shantou University
Medical College
China
Dr. Helen Treichel
URI-Campus de Erechim
Brazil
Dr. Xiao-Qing Hu
State Key Lab of Food Science and Technology
Jiangnan University
P. R. China
Dr. Olli H. Tuovinen
Ohio State University, Columbus, Ohio
USA
Prof. Stoyan Groudev
University of Mining and Geology “Saint Ivan Rilski”
Sofia
Bulgaria
Dr. G. Thirumurugan
Research lab, GIET School of Pharmacy, NH-5,
Chaitanya nagar, Rajahmundry-533294.
India
Dr. Charu Gomber
Thapar University
India
Dr. Jan Kuever
Bremen Institute for Materials Testing,
Department of Microbiology,
Paul-Feller-Str. 1, 28199 Bremen
Germany
Dr. Nicola S. Flanagan
Universidad Javeriana, Cali
Colombia
Dr. André Luiz C. M. de A. Santiago
Universidade Federal Rural de Pernambuco
Brazil
Dr. Dhruva Kumar Jha
Microbial Ecology Laboratory,
Department of Botany,
Gauhati University,
Guwahati 781 014, Assam
India
Dr. N Saleem Basha
M. Pharm (Pharmaceutical Biotechnology)
Eritrea (North East Africa)
Prof. Dr. João Lúcio de Azevedo
Dept. Genetics-University of São Paulo-Faculty of
Agriculture- Piracicaba, 13400-970
Brasil
Dr. Julia Inés Fariña
PROIMI-CONICET
Argentina
Dr. Yutaka Ito
Kyoto University
Japan
Dr. Cheruiyot K. Ronald
Biomedical Laboratory Technologist
Kenya
Prof. Dr. Ata Akcil
S. D. University
Turkey
Dr. Adhar Manna
The University of South Dakota
USA
Dr. Cícero Flávio Soares Aragão
Federal University of Rio Grande do Norte
Brazil
Dr. Gunnar Dahlen
Institute of odontology, Sahlgrenska Academy at
University of Gothenburg
Sweden
Dr. Pankaj Kumar Mishra
Vivekananda Institute of Hill Agriculture, (I.C.A.R.),
ALMORA-263601, Uttarakhand
India
Dr. Benjamas W. Thanomsub
Srinakharinwirot University
Thailand
Dr. Maria José Borrego
National Institute of Health – Department of Infectious
Diseases
Portugal
Dr. Catherine Carrillo
Health Canada, Bureau of Microbial Hazards
Canada
Dr. Marcotty Tanguy
Institute of Tropical Medicine
Belgium
Dr. Han-Bo Zhang
Laboratory of Conservation and Utilization for Bioresources
Key Laboratory for Microbial Resources of the
Ministry of Education,
Yunnan University, Kunming 650091.
School of Life Science,
Yunnan University, Kunming,
Yunnan Province 650091.
China
Dr. Ali Mohammed Somily
King Saud University
Saudi Arabia
Dr. Nicole Wolter
National Institute for Communicable Diseases and
University of the Witwatersrand,
Johannesburg
South Africa
Dr. Marco Antonio Nogueira
Universidade Estadual de Londrina
CCB/Depto. De microbiologia
Laboratório de Microbiologia Ambiental
Caixa Postal 6001
86051-980 Londrina.
Brazil
Dr. Bruno Pavoni
Department of Environmental Sciences University of
Venice
Italy
Dr. Shih-Chieh Lee
Da-Yeh University
Taiwan
Dr. Satoru Shimizu
Horonobe Research Institute for the Subsurface
Environment,
Northern Advancement Center for Science &
Technology
Japan
Dr. Tang Ming
College of Forestry, Northwest A&F University,
Yangling
China
Dr. Olga Gortzi
Department of Food Technology, T.E.I. of Larissa
Greece
Dr. Mark Tarnopolsky
Mcmaster University
Canada
Dr. Sami A. Zabin
Al Baha University
Saudi Arabia
Dr. Julia W. Pridgeon
Aquatic Animal Health Research Unit, USDA, ARS
USA
Dr. Lim Yau Yan
Monash University Sunway Campus
Malaysia
Prof. Rosemeire C. L. R. Pietro
Faculdade de Ciências Farmacêuticas de Araraquara,
Univ Estadual Paulista, UNESP
Brazil
Dr. Nazime Mercan Dogan
PAU Faculty of Arts and Science, Denizli
Turkey
Dr Ian Edwin Cock
Biomolecular and Physical Sciences
Griffith University
Australia
Prof. N K Dubey
Banaras Hindu University
India
Dr. S. Hemalatha
Department of Pharmaceutics, Institute of
Technology,
Banaras Hindu University, Varanasi. 221005
India
Dr. J. Santos Garcia A.
Universidad A. de Nuevo Leon
Mexico India
Dr. Somboon Tanasupawat
Department of Biochemistry and Microbiology,
Faculty of Pharmaceutical Sciences,
Chulalongkorn University,
Bangkok 10330
Thailand
Dr. Vivekananda Mandal
Post Graduate Department of Botany,
Darjeeling Government College,
Darjeeling – 734101.
India
Dr. Shihua Wang
College of Life Sciences,
Fujian Agriculture and Forestry University
China
Dr. Victor Manuel Fernandes Galhano
CITAB-Centre for Research and Technology of AgroEnvironment and Biological Sciences, Integrative
Biology and Quality Research Group,
University of Trás-os-Montes and Alto Douro,
Apartado 1013, 5001-801 Vila Real
Portugal
Dr. Maria Cristina Maldonado
Instituto de Biotecnologia. Universidad Nacional de
Tucuman
Argentina
Dr. Alex Soltermann
Institute for Surgical Pathology,
University Hospital Zürich
Switzerland
Dr. Dagmara Sirova
Department of Ecosystem Biology, Faculty Of Science,
University of South Bohemia,
Branisovska 37, Ceske Budejovice, 37001
Czech Republic
Dr. Mick Bosilevac
US Meat Animal Research Center
USA
Dr. Nora Lía Padola
Imunoquímica y Biotecnología- Fac Cs Vet-UNCPBA
Argentina
Dr. Maria Madalena Vieira-Pinto
Universidade de Trás-os-Montes e Alto Douro
Portugal
Dr. Stefano Morandi
CNR-Istituto di Scienze delle Produzioni Alimentari
(ISPA), Sez. Milano
Italy
Dr Line Thorsen
Copenhagen University, Faculty of Life Sciences
Denmark
Dr. Ana Lucia Falavigna-Guilherme
Universidade Estadual de Maringá
Brazil
Dr. Baoqiang Liao
Dept. of Chem. Eng., Lakehead University, 955 Oliver
Road, Thunder Bay, Ontario
Canada
Dr. Ouyang Jinping
Patho-Physiology department,
Faculty of Medicine of Wuhan University
China
Dr. John Sorensen
University of Manitoba
Canada
Dr. Andrew Williams
University of Oxford
United Kingdom
Dr. E. O Igbinosa
Department of Microbiology,
Ambrose Alli University,
Ekpoma, Edo State,
Nigeria.
Dr. Chi-Chiang Yang
Chung Shan Medical University
Taiwan, R.O.C.
Dr. Hodaka Suzuki
National Institute of Health Sciences
Japan
Dr. Quanming Zou
Department of Clinical Microbiology and Immunology,
College of Medical Laboratory,
Third Military Medical University
China
Prof. Ashok Kumar
School of Biotechnology,
Banaras Hindu University, Varanasi
India
Dr. Guanghua Wang
Northeast Institute of Geography and Agroecology,
Chinese Academy of Sciences
China
Dr. Chung-Ming Chen
Department of Pediatrics, Taipei Medical University
Hospital, Taipei
Taiwan
Dr. Renata Vadkertiova
Institute of Chemistry, Slovak Academy of Science
Slovakia
Dr. Jennifer Furin
Harvard Medical School
USA
Dr. Julia W. Pridgeon
Aquatic Animal Health Research Unit, USDA, ARS
USA
Dr Alireza Seidavi
Islamic Azad University, Rasht Branch
Iran
Dr. Thore Rohwerder
Helmholtz Centre for Environmental Research UFZ
Germany
Dr. Daniela Billi
University of Rome Tor Vergat
Italy
Dr. Ivana Karabegovic
Faculty of Technology, Leskovac, University of Nis
Serbia
Dr. Flaviana Andrade Faria
IBILCE/UNESP
Brazil
Prof. Margareth Linde Athayde
Federal University of Santa Maria
Brazil
Dr. Guadalupe Virginia Nevarez Moorillon
Universidad Autonoma de Chihuahua
Mexico
Dr. Tatiana de Sousa Fiuza
Federal University of Goias
Brazil
Dr. Indrani B. Das Sarma
Jhulelal Institute of Technology, Nagpur
India
Dr. Charles Hocart
The Australian National University
Australia
Dr. Guoqiang Zhu
University of Yangzhou College of Veterinary Medicine
China
Dr. Guilherme Augusto Marietto Gonçalves
São Paulo State University
Brazil
Dr. Mohammad Ali Faramarzi
Tehran University of Medical Sciences
Iran
Dr. Suppasil Maneerat
Department of Industrial Biotechnology, Faculty of
Agro-Industry, Prince of Songkla University, Hat Yai
90112
Thailand
Dr. Francisco Javier Las heras Vazquez
Almeria University
Spain
Dr. Cheng-Hsun Chiu
Chang Gung memorial Hospital, Chang Gung
University
Taiwan
Dr. Ajay Singh
DDU Gorakhpur University, Gorakhpur-273009 (U.P.)
India
Dr. Karabo Shale
Central University of Technology, Free State
South Africa
Dr. Lourdes Zélia Zanoni
Department of Pediatrics, School of Medicine, Federal
University of Mato Grosso do Sul, Campo Grande,
Mato Grosso do Sul
Brazil
Dr. Tulin Askun
Balikesir University
Turkey
Dr. Marija Stankovic
Institute of Molecular Genetics and Genetic
Engineering
Republic of Serbia
Dr. Scott Weese
University of Guelph
Dept of Pathobiology, Ontario Veterinary College,
University of Guelph,
Guelph, Ontario, N1G2W1,
Canada
Dr. Sabiha Essack
School of Health Sciences
South African Committee of Health Sciences
University of KwaZulu-Natal
Private Bag X54001
Durban 4000
South Africa
Dr. Hongxiong Guo
STD and HIV/AIDS Control and Prevention,
Jiangsu provincial CDC,
China
Dr. Konstantina Tsaousi
Life and Health Sciences,
School of Biomedical Sciences,
University of Ulster
Dr. Bhavnaben Gowan Gordhan
DST/NRF Centre of Excellence for Biomedical TB
Research
University of the Witwatersrand and National Health
Laboratory Service
P.O. Box 1038, Johannesburg 2000,
South Africa
Dr. Ernest Kuchar
Pediatric Infectious Diseases,
Wroclaw Medical University,
Wroclaw Teaching Hospital,
Poland
Dr. Hare Krishna
Central Institute for Arid Horticulture,
Beechwal, Bikaner-334 006, Rajasthan,
India
Dr. Hongxiong Guo
STD and HIV/AIDS Control and Prevention,
Jiangsu provincial CDC,
China
Dr. Anna Mensuali
Dept. of Life Science,
Scuola Superiore
Sant’Anna
Dr. Mar Rodriguez Jovita
Food Hygiene and Safety, Faculty of Veterinary
Science.
University of Extremadura,
Spain
Dr. Ghada Sameh Hafez Hassan
Pharmaceutical Chemistry Department,
Faculty of Pharmacy, Mansoura University,
Egypt
Dr. Kátia Flávia Fernandes
Biochemistry and Molecular Biology
Universidade Federal de Goiás
Brasil
Dr. Abdel-Hady El-Gilany
Public Health & Community Medicine
Faculty of Medicine,
Mansoura University
Egypt
Dr. Jes Gitz Holler
Hospital Pharmacy,
Aalesund. Central Norway Pharmaceutical Trust
Professor Brochs gt. 6. 7030 Trondheim,
Norway
Prof. Chengxiang FANG
College of Life Sciences,
Wuhan University
Wuhan 430072, P.R.China
Dr. Anchalee Tungtrongchitr
Siriraj Dust Mite Center for Services and Research
Department of Parasitology,
Faculty of Medicine Siriraj Hospital,
Mahidol University
2 Prannok Road, Bangkok Noi,
Bangkok, 10700, Thailand
Instructions for Author
Electronic submission of manuscripts is strongly
encouraged, provided that the text, tables, and figures are
included in a single Microsoft Word file (preferably in Arial
font).
The cover letter should include the corresponding author's
full address and telephone/fax numbers and should be in
an e-mail message sent to the Editor, with the file, whose
name should begin with the first author's surname, as an
attachment.
Article Types
Three types of manuscripts may be submitted:
Regular articles: These should describe new and carefully
confirmed findings, and experimental procedures should
be given in sufficient detail for others to verify the work.
The length of a full paper should be the minimum required
to describe and interpret the work clearly.
Short Communications: A Short Communication is suitable
for recording the results of complete small investigations
or giving details of new models or hypotheses, innovative
methods, techniques or apparatus. The style of main
sections need not conform to that of full-length papers.
Short communications are 2 to 4 printed pages (about 6 to
12 manuscript pages) in length.
Reviews: Submissions of reviews and perspectives covering
topics of current interest are welcome and encouraged.
Reviews should be concise and no longer than 4-6 printed
pages (about 12 to 18 manuscript pages). Reviews are also
peer-reviewed.
Review Process
All manuscripts are reviewed by an editor and members of
the Editorial Board or qualified outside reviewers. Authors
cannot nominate reviewers. Only reviewers randomly
selected from our database with specialization in the
subject area will be contacted to evaluate the manuscripts.
The process will be blind review.
Decisions will be made as rapidly as possible, and the
Journal strives to return reviewers’ comments to authors as
fast as possible. The editorial board will re-review
manuscripts that are accepted pending revision. It is the
goal of the AJMR to publish manuscripts within weeks
after submission.
Regular articles
All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title
page.
The Title should be a brief phrase describing the contents
of the paper. The Title Page should include the authors'
full names and affiliations, the name of the corresponding
author along with phone, fax and E-mail information.
Present addresses of authors should appear as a footnote.
The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of
the experiments, indicate significant data, and point out
major findings and conclusions. The Abstract should be
100 to 200 words in length.. Complete sentences, active
verbs, and the third person should be used, and the
abstract should be written in the past tense. Standard
nomenclature should be used and abbreviations should
be avoided. No literature should be cited.
Following the abstract, about 3 to 10 key words that will
provide indexing references should be listed.
A list of non-standard Abbreviations should be added. In
general, non-standard abbreviations should be used only
when the full term is very long and used often. Each
abbreviation should be spelled out and introduced in
parentheses the first time it is used in the text. Only
recommended SI units should be used. Authors should
use the solidus presentation (mg/ml). Standard
abbreviations (such as ATP and DNA) need not be defined.
The Introduction should provide a clear statement of the
problem, the relevant literature on the subject, and the
proposed approach or solution. It should be
understandable to colleagues from a broad range of
scientific disciplines.
Materials and methods should be complete enough to
allow experiments to be reproduced. However, only truly
new procedures should be described in detail; previously
published procedures should be cited, and important
modifications of published procedures should be
mentioned briefly. Capitalize trade names and include the
manufacturer's name and address. Subheadings should be
used. Methods in general use need not be described in
detail.
Results should be presented with clarity and precision.
The results should be written in the past tense when
describing findings in the authors' experiments.
Previously published findings should be written in the
present tense. Results should be explained, but largely
without referring to the literature.
Discussion,
speculation and detailed interpretation of data should
not be included in the Results but should be put into the
Discussion section.
The Discussion should interpret the findings in view of
the results obtained in this and in past studies on this
topic. State the conclusions in a few sentences at the end
of the paper. The Results and Discussion sections can
include subheadings, and when appropriate, both
sections can be combined.
The Acknowledgments of people, grants, funds, etc
should be brief.
Tables should be kept to a minimum and be designed to
be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes.
Each table should be on a separate page, numbered
consecutively in Arabic numerals and supplied with a
heading and a legend. Tables should be self-explanatory
without reference to the text. The details of the methods
used in the experiments should preferably be described
in the legend instead of in the text. The same data should
not be presented in both table and graph form or
repeated in the text.
Figure legends should be typed in numerical order on a
separate sheet. Graphics should be prepared using
applications capable of generating high resolution GIF,
TIFF, JPEG or Powerpoint before pasting in the Microsoft
Word manuscript file. Tables should be prepared in
Microsoft Word. Use Arabic numerals to designate
figures and upper case letters for their parts (Figure 1).
Begin each legend with a title and include sufficient
description so that the figure is understandable without
reading the text of the manuscript. Information given in
legends should not be repeated in the text.
References: In the text, a reference identified by means
of an author‘s name should be followed by the date of
the reference in parentheses. When there are more than
two authors, only the first author‘s name should be
mentioned, followed by ’et al‘. In the event that an
author cited has had two or more works published during
the same year, the reference, both in the text and in the
reference list, should be identified by a lower case letter
like ’a‘ and ’b‘ after the date to distinguish the works.
Examples:
Abayomi (2000), Agindotan et al. (2003), (Kelebeni,
1983), (Usman and Smith, 1992), (Chege, 1998;
1987a,b; Tijani, 1993,1995), (Kumasi et al., 2001)
References should be listed at the end of the paper in
alphabetical order. Articles in preparation or articles
submitted for publication, unpublished observations,
personal communications, etc. should not be included
in the reference list but should only be mentioned in
the article text (e.g., A. Kingori, University of Nairobi,
Kenya, personal communication). Journal names are
abbreviated according to Chemical Abstracts. Authors
are fully responsible for the accuracy of the references.
Examples:
Chikere CB, Omoni VT and Chikere BO (2008).
Distribution of potential nosocomial pathogens in a
hospital environment. Afr. J. Biotechnol. 7: 3535-3539.
Moran GJ, Amii RN, Abrahamian FM, Talan DA (2005).
Methicillinresistant
Staphylococcus
aureus
in
community-acquired skin infections. Emerg. Infect. Dis.
11: 928-930.
Pitout JDD, Church DL, Gregson DB, Chow BL,
McCracken M, Mulvey M, Laupland KB (2007).
Molecular
epidemiology
of
CTXM-producing
Escherichia coli in the Calgary Health Region:
emergence of
CTX-M-15-producing isolates.
Antimicrob. Agents Chemother. 51: 1281-1286.
Pelczar JR, Harley JP, Klein DA (1993). Microbiology:
Concepts and Applications. McGraw-Hill Inc., New York,
pp. 591-603.
Short Communications
Short Communications are limited to a maximum of
two figures and one table. They should present a
complete study that is more limited in scope than is
found in full-length papers. The items of manuscript
preparation
listed
above
apply
to
Short
Communications with the following differences: (1)
Abstracts are limited to 100 words; (2) instead of a
separate Materials and Methods section, experimental
procedures may be incorporated into Figure Legends
and Table footnotes; (3) Results and Discussion should
be combined into a single section.
Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF
file. Page proofs are considered to be the final version
of the manuscript. With the exception of typographical
or minor clerical errors, no changes will be made in the
manuscript at the proof stage.
Fees and Charges: Authors are required to pay a $550 handling fee. Publication of an article in the African Journal of
Microbiology Research is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay
the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in
advance) that the editorial office waive some of the handling fee under special circumstances
Copyright: © 2014, Academic Journals.
All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use
but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary
bibliographic citation, including author attribution, date and article title.
Submission of a manuscript implies: that the work described has not been published before (except in the form of an
abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if
and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the
publisher.
Disclaimer of Warranties
In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any
kind arising out of or in connection with the use of the articles or other material derived from the AJMR, whether
or not advised of the possibility of damage, and on any theory of liability.
This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not
limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement.
Descriptions of, or references to, products or publications does not imply endorsement of that product or publication.
While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements
appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and
advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no
warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or
information in this publication or of any other publication to which it may be linked.
African Journal of Microbiology Research
International Journal of Medicine and Medical Sciences
Table of Content: Volume 8 Number 8, February 19, 2014
ARTICLES
Morphological and molecular characterization of pathogenic isolates of
Fusarium spp. obtained from gladiolus corms and their sensitivity to Jatropha
curcas L. oil
Liliana Córdova Albores, Silvia Bautista Baños, Jorge Martínez Herrera, Laura Barrera
Necha, Mónica Hernández López and Andrés Cruz Hernández
Screening phosphate solubilizing actinobacteria isolated from the rhizosphere of
wild plants from the Eastern Cordillera of the Colombian Andes
Luis Daniel Prada Salcedo, Carolina Prieto and Marcela Franco Correa
Establishment of EvaGreen qPCR for detecting bovine rotavirus based on VP7 gene
Wei Suocheng, Che Tuanjie, Wang Jingming, Li Yukong, Zhang Taojie, Song Changjun
and Tian Fengling
Nutritional requirements for the production of antimicrobial metabolites from
Streptomyces
Mariadhas Valan Arasu, Thankappan Sarasam Rejiniemon, Naif Abdullah Al-Dhabi,
Veeramuthu Duraipandiyan, Savarimuthu Ignacimuthu, Paul Agastian, Sun-Ju Kim,
V. Aldous J. Huxley, Kyung Dong Lee, Ki Choon Choi
Incidence of Aspergillus contamination of groundnut (Arachis hypogaea L.) in
Eastern Ethiopia
Abdi Mohammed and Alemayehu Chala
Microencapsulation, survival and adherence studies of indigenous probiotics
Ammara Hassan, M. Nawaz Ch and Barbara Rasco
Screening novel diagnostic marker of Mycobacterium tuberculosis
Xin Pan, Siliang Zeng, Jialin Cai, Bin Zhang, Boju Pan, Zhonglei Pan, Ying Wu,
Ying Wang, Yi Zhou, Wei Fang, Min Chen, Wanqing Liao, XiuZhen Yu, Min Tao,
Jun Zhang and Wei Song
An outbreak of ringworm caused by Trichophyton verrucosum in a group of
calves in Vom, Nigeria
Dalis, J. S., Kazeem, H. M., Kwaga, J. K. P. and Kwanashie, C. N.
African Journal of Microbiology Research
Table of Content: Volume 8 Number 8, February 19, 2014
Characteristics of nodule bacteria from Mimosa spp grown in soils of the Brazilian
semiarid region
Ana Dolores Santiago de Freitas, Wardsson Lustrino Borges, Monaliza
Mirella de Morais Andrade, Everardo Valadares de Sá Barretto Sampaio,
Carolina Etienne de Rosália e Silva Santos, Samuel Ribeiro Passos, Gustavo Ribeiro
Xavier, Bruno Mello Mulato and Maria do Carmo Catanho Pereira de Lyra
Microbiological assessment of dentists’ hands in clinical performance
Márcia Rosental da Costa CARMO, Jorge Kleber CHAVASCO, Solange de Oliveira Braga
FRANZOLIN, Luiz Alberto BEIJO, Júlia Rosental de SOUZA CRUZ and Paulo
Henrique WECKWERTH
Evaluation of marine macro alga, Ulva fasciata against bio-luminescent causing
Vibrio harveyi during Penaeus monodon larviculture
Krishnamoorthy Sivakumar, Sudalayandi Kannappan, Masilamani Dineshkumar and
Prasanna Kumar Patil
Characterization and determination of antibiotic susceptibility pattern of bacteria
isolated from some fomites in a teaching hospital in northern Nigeria
Aminu Maryam, Usman-Sani Hadiza and Usman M. Aminu
Prevalence of different enterococcal species isolated from blood and their
susceptibility to antimicrobial drugs in Vojvodina, Serbia, 2011-2013
Mihajlović-Ukropina Mira, Medić Deana, Jelesić Zora, Gusman Vera,
Milosavljević Biljana and Radosavljević Biljana
Prevalence of anti-Anaplasma phagocytophilum antibodies among dogs from
Monterrey, Mexico
J. A. Salinas-Meléndez, R. Villavicencio-Pedraza, B. V. Tamez-Hernández,
J. J. Hernández-Escareño, R. Avalos-Ramírez, J. J. Zarate-Ramos, F. J. Picón-Rubio and
V. M. Riojas-Valdés
Novel simple diagnostic methods compared to advanced ones for the diganosis of
Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasmas hominis in
patients with complicated urinary tract infections
Hala Badawi, Aisha Abu Aitta, Maisa Omar, Ahmed Ismail, Hanem Mohamed,
Manal El Said, Doaa Gamal, Samah Saad El Dine and Mohamed Ali Saber
Vol. 8(8), pp. 724-733, 19 February, 2014
DOI: 10.5897/AJMR2013.6413
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Morphological and molecular characterization of
pathogenic isolates of Fusarium spp. obtained from
gladiolus corms and their sensitivity to Jatropha
curcas L. oil
Liliana Córdova Albores1, Silvia Bautista Baños1, Jorge Martínez Herrera1,
Laura Barrera Necha1, Mónica Hernández López1 and Andrés Cruz Hernández2
1
Instituto Politécnico Nacional-Centro de Desarrollo de Productos Bióticos. Carr. Yautepec-Jojutla km. 6, San Isidro,
CEPROBI 8, Yautepec, Morelos, C. P. 62731, México.
2
Universidad Autónoma de Querétaro. Laboratorio de Microbiología, Facultad de Ciencias Naturales-Biología. Av. de las
Ciencias s/n, Juriquilla, Querétaro, Delegación Santa Rosa Jauregui. C.P. 76230. México.
Accepted 30 January, 2014
The State of Morelos is the third biggest gladiolus producer in Mexico. However, this ornamental is
affected by the disease named corm rot or fusarium yellows, characterized by leaf yellowing, epinasty
and wilting, and caused by fungi of the genus Fusarium. The first objective was to corroborate the
pathogenicity of the 45 isolates obtained. The second objective was to identify and characterize
morphologically and molecularly by polymerase chain reaction-internal transcribed spacer (PCR-ITS),
the highly pathogenic isolates and comparatively analyze the fungal species involved with the reference
strain Fusarium oxysporum f. sp. gladioli (Fog). The third objective was to quantify the phorbol esters in
Jatropha curcas oil and evaluate their antifungal potential on mycelial growth and conidial germination
of different Fusarium species. Eleven isolates were highly significant pathogenic (P < 0.001). Three
fungal species were identified in basal stems and damaged corms taken from field plants, namely F.
oxysporum, Fusarium solani and Fusarium proliferatum. Molecular analyzes corroborated the species
identified and their sequences were deposited in the National Center for Biotechnology Information
(NCBI) gene bank. The percentage of oil obtained was 61.5 %; the phorbol ester content in the oil was
-1
1.52 mg g of 12,13-phorbol myristate. All species identified and the reference strain was sensitive to
-1
the 5 mg mL oil concentration.
Key words: Corm rot, Fusarium, molecular analysis, phorbol esters, Fusarium development.
INTRODUCTION
The gladiolus is one of the main crops in the State of
Morelos, which ranks as Mexico’s third biggest producer
of this flowering plant. Corm rot is caused by Fusarium
spp. and results in losses of 60-80% during storage
(SAGARPA, 2006). Members of the genus Fusarium are
among the most important plant pathogens worldwide.
Fusarium species are widely distributed in soil and
organic substrates and are abundant in cultivated soils in
temperate and tropical regions (Booth, 1985). Some
species of this genus produce mycotoxins in stored food
*Corresponding author. E-mail: lbarrera@ipn.mx. Tel: 52 7353942020.
Albores et al.
and cause disease in animals and humans (Ortoneda et
al., 2003). Like many soil-borne fungi, the genus
Fusarium is amply endowed with means of survival, one
of its mechanisms being the ability to rapidly change both
its host and its morphology and behavior (Booth, 1985;
Alves-Santos et al., 1999; Katan and Di Primo, 1999;
Ortoneda et al., 2003). Differentiation of Fusarium spp. is
based on physiological and morphological characteristics,
such as the size and shape of macroconidia, presence or
absence of microconidia and chlamydospores, and
colony morphology. Subtle differences in a single feature
can delineate species. Characterization by molecular
techniques using polymerase chain reaction (PCR) to
amplify the internal transcribed sequences (ITS) allows
identifying organisms that cannot be distinguished
morphologically, and they can also help to understand
the mechanisms of pathogenic variation and therefore, to
develop effective management strategies (Flores-Olivas
et al., 1997; Alves-Santos et al., 1999; Baayen, 2000;
Haan et al., 2000). Management by synthetic fungicides
leads to resistance, environmental pollution, elimination
of beneficial entomofauna and operator poisoning.
Consequently, there are a large number of reports on the
development of alternatives such as the use of essential
oils (Pauli and Knobloch, 1987; Pintore et al., 2002;
Barrera-Necha and García-Barrera, 2008; Barrera-Necha
et al., 2009; Tripathi et al., 2009); however, there are few
reports on the use of vegetable oils. Jatropha curcas
belongs to the family Euforbiaceae. In Mexico, the latex
of this plant is used to treat mouth infections and
digestive problems caused by certain fungi, and to make
biodiesel, which gives it considerable economic
importance (Martínez-Herrera, 2006). The seeds contain
chemical compounds, among which tannins, saponins
and phorbol esters stand out for their possible biological
activity. J. curcas oil has insecticidal activity (Wink et al.,
1997), and it has also been tested as an antimicrobial
agent to treat infections, including sexually transmitted
ones, in humans (Aiyelaagbe et al. 2007). Based on this,
studies have focused on fungal development in in vitro
tests demonstrating that mycelial growth of several fungi,
including Alternaria alternata, Aspergillus flavus, A.
fumigans, A. niger and Fusarium chladmydosporum, is
inhibited when grown on seed oil and crude seed extracts
at concentrations of 100 and 500 µl (Srivastava et al.,
2012). In an attempt to evaluate the fungicidal effect of
different plant organs of J. curcas, it was found that
seeds followed by the fruit pulp and the whole fruit had
significant inhibition of the mycelia of the fungus
Colletrotrichum gloeosporioides isolated from papaya
fruits (Rahman et al., 2011). Therefore, it is necessary to
carry out studies to evaluate the use of different
antifungal compounds to control fungal diseases such as
phorbol esters contain in seed oil. The aims of this study
were to verify the pathogenicity of the isolates obtained
from gladiolus corms in the State of Morelos, to morphologically and molecularly characterize Fusarium isolates
725
obtained and evaluate their response to J. curcas seed
oil.
MATERIALS AND METHODS
Sampled material
Corms and plants (yellowing of leaves and corms with basal rot) of
five varieties (‘White foam’, ‘Red ewe’, ‘White ewe’, ‘Yellow’ and
‘Sancerri’) were collected in the field in seven producing
municipalities in the State of Morelos. A total of 34 plants showing
symptoms of corm rot were collected from August to October 2011
from commercial fields in Cuautla, Yautepec, Ayala, Tlanepantla,
Temixco, Yecapixtla and Totolapan.
Isolation of fungi
Soil and roots were removed from gladiolus corms by washing with
running water and then corms were immersed in an acaricide
solution (AK®20) at a concentration of 15 ml l-1 for 5 min and left to
dry. They were disinfected with a sodium hypochlorite solution at
5% for 3 min, rinsed with sterile distilled water and placed in humid
chambers for 24 h to promote fungal growth. From mycelium
developed in the corms, isolates were made on Potato Dextrose
Agar (PDA) medium and incubated at room temperature for 7 days.
Monosporic cultures were established as described by Leslie and
Summerell (2006).
Pathogenicity tests
Forty-five isolates showed differences in the color of the colonies
and initially they were selected as different species. Healthy corms
of the variety ‘White foam’, pre-peeled and pre-treated with a
contact fungicide (Captan® 2 g L-1), were planted in sterile soil
(121°C, 15 lb pressure for 3 h) under greenhouse conditions. Once
the approximately 1-cm stem emerged, 5 mL of the isolated spore
solution of each isolate to examine were added at a concentration
of 1 × 106 spores ml-1. The reference strain used was Fusarium
oxysporum f. sp. gladioli (Fog) already molecularly identified
(Garduño-Pizaña et al., 2010) and it was treated in the same way
without inoculation. Plants were assessed three weeks after
inoculation.
To statistically assess pathogenicity, a damage scale was
developed based on the corm rot symptoms observed in the plants,
assigning it numerical values: no symptoms (plant and corm) (1);
epinasty/stunting (2); yellowing (3); plant did not emerge with root
development (4); plant did not emerge (5) (Mendoza, 1977).
Data analysis
A completely randomized design with 5 replicates for each isolate
and a control treatment (reference strain, labeled as Fog) were
used. Analysis of variance of repeated means and a multiple
comparison against the control were performed with the Holm-Sidak
method (P < 0.05) using the Sigma Stat 3.5 statistical package
designed by STATCON© Witzenhausen, Germany.
Morphological characterization
For taxonomic identification of the isolates, the classification
methodology of Nelson et al. (1983) and Leslie and Summerell
(2006) was used. These authors suggest taking as references the
A] =
726
Afr. J. Microbiol. Res.
colony colors on PDA, and the length of the phialides,
chlamydospores, microconidia and macroconidia. The length of the
structures was measured using ImageTool © software for Windows
Version 3.0 Alpha 4 designed by the Center for Health Sciences,
University of Texas. Morphological observations and measurements
were made with a compound microscope at 40x.
52’ 17” North; 92° 27’ 04” West, at 26 masl. 3) Ejido la Victoria,
municipality of Mazatán, Chiapas, 14° 49’ 16” North; 92° 29’ 56”
West, at 10 masl. Location altitudes were taken with a GPS lll
(Garmin, GPS lll Plus model, Ronsey, UK).
Oil extraction
Molecular characterization
DNA extraction from 12 monosporic isolates was performed by the
method described by Doyle and Doyle (1990), with modifications.
The quality of the DNA obtained was verified by electrophoresis on
1% agarose gel stained with ethidium bromide (0.1 µg µl-1) and
observed in a gel documentation system (G Box®; Syngene,
England). DNA concentration was calculated by measuring the
optical density at 260 nm with the following formula:
[DNA] =
PCR for ITS primers
The ITS regions were amplified with the primers ITS1
(TCCGTAGGTGAACCTGCGG),
ITS2
(TCCTCCGCTTATTGATATGC)
and
ITS5
(GGAAGTAAAAGTCGTAACAAGG) (White et al., 1990; Haan et
al., 2000; Abd-Elsalam et al., 2003; Moreno-Velázquez et al., 2005;
Teixeira et al., 2005; González-Pérez et al., 2009), as well as the
specific primers for the genus Fusarium reported by Adb-Elsalam et
al. (2003): ITS-Fu-Fwd (CGCACGATTACCACTAACGA) and ITSFu-Rev (CAACTCCCAAACCCCTGTGA). The primers were synthesized by the Sigma Aldrich® Company. Each PCR reaction was
carried out in a final volume of 25 μl; 5.5 μl of nuclease-free water
were mixed with 2.0 μl of DNA of the fungus problem, 2.5 μl of each
ITS and 12.5 μl of Taq 2X Master Mix® (BioLabsInc, New England).
The amplification reaction was carried out in a Perkin Elmer ® thermocycler (GeneAmp PCR System 2400) with the following program: initial denaturation at 95°C for 5 min; 35 cycles of denaturation, alignment and extension at 95°C for 1 min and 72°C for 2
min. respectively, and a final extension at 72°C for 10 min. The
amplified fragments were verified by electrophoresis in 1% agarose
gel stained with ethidium bromide (0.1 μg μl-1). The gel was run at
85 V for 40 min and observed in a gel documentation system (G
Box®; Syngene, England).
Sequencing
The amplified PCR products were purified using the DNA Clean &
ConcentratorTM-5 Kit (Zymo Research, USA) and analyzed at the
Sequencing Laboratory of the Institute of Biotechnology, belonging
to the University National Autonomous of México, in Cuernavaca,
Morelos. The sequences were aligned and compared with sequences in the National Center for Biotechnology Information (NCBI)
database using the Basic Local Alignment Search Tool (BLAST)
(Zhang et al., 2000).
Collection of J. curcas seeds
Seeds were collected from J. curcas plants being used as a living
fence in the following locations: 1) Segunda Sección de la
Cebadilla, municipality of Tapachula, Chiapas, 14° 50’ 48” North;
92° 17’ 00” West, at 109 masl. 2) Villa de Mazatán, Chiapas, 14°
The extraction of the seed oil was performed according to the
Soxhlet method (NMX-F-089-S-1978), with petroleum ether and
hexane and 8-h reflux time. About 2 to 5 g of ground J. curcas
seeds were weighed and placed in the extraction thimble. After
extraction, the solvent was gently evaporated from the flask and the
excess petroleum ether or hexane was removed using a BÜCHI
model 114 rotary evaporator (BÜCHI® Labortechnik AG, Switzerland) at 60°C. The calculations to determine the percentage of oil
obtained was performed using the formula:
Oil (%) = (P-p/M) × 100
Where: P = mass in grams of the flask with the oil; p = mass in
grams of the flask; M = mass in grams of the sample.
Phorbol esters were quantified using the high performance liquid
chromatography (HPLC) method described by Martínez-Herrera
(2006). Specifically, 20 ml of methanol were added to a 2 g sample,
which was sonicated for 2 min. The sample was centrifuged at 3600
rpm for 10 min and the supernatant was evaporated almost to dryness in a rotary evaporator (the extraction was repeated 3 times).
The standard used was 12,13-phorbol myristate (Sigma Aldrich®),
which showed a retention time of 25 min. The results were
expressed as mg g-1 of sample equivalent to 12,13-phorbol myristate.
This analysis was performed in the food laboratory of the Institute of
Animal Production in the Tropics and Subtropics at the University of
Hohenheim in Stuttgart, Germany.
Mycelial growth
Only the 11 isolates mentioned above and the reference strain
(Fog) were used to evaluate this parameter. A 5-mm disc of the
pathogen was placed on 60 × 15 mm Petri dishes containing PDA,
Tween 20® and the oil at different concentrations (2.5, 5 and 10 mg
ml-1), as well as 4 controls: PDA, petroleum ether (10 mg ml-1),
Tween 20® (10 mg ml-1) and Captan® (2 g L-1). They were incubated
at 25°C in the dark. Diameter growth was measured daily for 5 days
with a Vernier caliper until the control treatments reached the edge
of the Petri dish. The experimental design was completely randomized and consisted of 7 treatments with 6 replicates. Analysis of
variance (ANOVA) and Tukey’s comparison of means test (P <
0.05) were performed using the Sigma Stat 3.5 software program
designed by STATCON© Witzenhausen, Germany.
Spore germination
Ten milliliters of sterile distilled water were added to Petri dishes
containing the growth of each isolate, then the surface was scraped
with a bent metal rod and the filtrate was passed through cotton
gauze. Of this suspension, 20 µl were placed on PDA discs of 10
mm in diameter and incubated for 6 to 10 h at room temperature
(26°C). Later, a few drops of lactophenol methylene blue were
added and the number of germinated spores was determined by
photo analysis with Image Tool© software for Windows version 2.01
Alpha 4, developed by the Center for Health Sciences at the
University of Texas. Germination was evaluated on nine PDA discs.
Mean percentage germination and standard deviations were
calculated.
Albores et al.
1
2
3
4
5
6
7
727
8
Figure 1. Preliminary classification of isolates according to coloring on PDA medium.
RESULTS
Number of isolates
Their morphological aspect, identified as belonging to the
genus Fusarium, obtained a total of 45 isolates. The
isolates showed different apparent morphological characteristics, mainly in the color of the culture medium. Nelson
et al. (1983) performed a morphological characterization
using the coloration on PDA as indicating that each species has a specific color. Based on the coloring obtained,
a preliminary classification was conducted, obtaining a
total of eight groups as shown in Figure 1.
in isolates T9, T11, T12, T20, T24, T30, T32, T34, T35,
T39 and T40, which were collected from the municipalities of Yautepec and Cuautla (Figure 2). Isolates that
showed highly significant differences in the pathogenicity
capacity were used for morphological and molecular
characterization and J. curcas oil sensitivity testing.
Morphological characterization
Some of the typical structures of the 11 isolates and the
reference strain (Fog) are summarized in Table 1.
Pathogenicity tests
Molecular characterization
Statistical analysis showed that when compared with the
reference strain Fog (T25), isolates T1, T15, T20, T36
and T44 were significantly different (P < 0.01), whereas
highly significant differences (P < 0.001) were observed
The DNA had a yield of 220 to 670 µg g-1 of mycelium,
the band of the PCR products containing the primers
ITS2-ITS5 was 500 base pairs (bp) and the PCR product
for the primers ITS-Fu-Fwd and ITS-Fu-Rev was from
728
Afr. J. Microbiol. Res.
Figure 2. Comparison of means against the reference strain Fog (T25) of the pathogenic capacity of
isolates of Fusarium spp. Significant difference *P < 0.01; **P < 0.001.
410 to 429 bp (Figure 3). For the multiple alignments, the
total amplified portion of the 12-nucleotide sequences is
shown in Table 2, which corresponds to the complete
sequence of both regions (ITS2 and ITS5). In Genbank,
the sequence of F. oxysporum f. sp gladioli and isolates
T30, T35 and T39 showed a similarity index of 99% with
F. oxysporum. Another five isolates showed a similarity
index of 99% with F. proliferatum. Isolates T20 and T34
showed no similarity to other sequences (Table 2).
Oil extraction
The oil percentage obtained for both solvents was 61.5%.
Phorbol esters in the kernel meal and the oil extracted
with petroleum ether were 0.94 and 1.52 mg g-1, respectively, while the oil extracted with hexane was 0.24 and
0.67 mg g-1, respectively.
Mycelium growth
Comparison of means of mycelial growth on the last day
of each treatment indicated that the eleven Fusarium
isolates and the reference strain (Fog) were more
-1
sensitive to the concentration of 5 mg ml . Isolates T9,
T11, T20, T32, T34, T35 and T40 were also sensitive to
the concentration of 2.5 mg ml-1. For isolate T9, it was
observed that the concentration of 5 mg ml-1 showed less
mycelial growth than the fungicide Captan®, while for the
isolate T11 incubated at the same concentration (5 mg
ml-1) and the control with Tween®20 there were no
significant differences. The isolate most susceptible to
the fungicide Captan® was the reference strain (Fog)
(Table 3).
Spore germination
Treatment susceptibility depended on the isolate, as no
trend was observed for any specific treatment (Table 4).
Isolate T9 presented the lowest germination rate with J.
curcas oil at concentrations of 2.5 and 10 mg ml-1 with a
percentage germination of 14.40 and 14.43%, respectively, as compared to 98.44% for the PDA treatment.
Isolate T24 also showed a low germination rate, which
was 12.62 and 17.28% for the concentrations of 2.5 and
5 mg ml-1, respectively. Isolate T24 was the most susceptible to the treatment with the fungicide Captan®, presenting a germination of 33.79% while the PDA treatment
had 99.77% germination.
DISCUSSION
The highly pathogenic isolates were characterized morphologically, identifying at least 2 species: F. oxysporum and
Fusarium solani, which had different morphological features, both gross and microscopic, and which were associated with the afore mentioned species. González-Pérez
et al. (2009) reported that these species caused rot in
gladiolus in San Martin Texmelucan, Puebla. They also
reported that these species differed in terms of colony
color and morphological characteristics, coinciding with
the results obtained in this work for descriptions of
macro- and micro-conidia, phialides and chlamydospores.
For their part, Montiel-Gonzalez et al. (2005) described
the morphological characteristics of F. oxysporum, F.
solani, Fusarium lateritium, Fusarium reticulatum, Fusarium
equiseti, Fusarium verticillioides, Fusarium culmorum,
Fusarium crookwellense, Fusarium proliferatum and
Fusarium sporotrichioides present in bean roots in five
Albores et al.
729
Table 1. Morphological characteristics of isolates of the genus Fusarium collected in gladiolus-growing areas of the state of Morelos.
Isolate
Color
Anverse
Reverse
Fog*
White
Violet
T9
White
T11
Microconidia
Macroconidia
Size (m)
Chlamydospore
Species
3
No
F. oxysporum
48.72-64.51
3-4
No
F. solani
Distinctly notched
69.63-73.19
3-4
Single and paired
verrucose
F. oxysporum
Blunt
Barely notched
55.37-82.54
3-4
No
F. solani
Oval
Oval with one septa
Papillate
Barely notched
56.35-67.68
3-4
Single verrucose
F. solani
Papillate
Barely notched
54.77-87.51
3-4
Single verrucose
Paired smoothwalled
F. solani
Apical
Basal
Oval with one septa
Oval
Hooked
Distinctly notched
50.50-67.49
Orange
Oval with one septa
Reniform
Blunt
Barely notched
White
Brown
Oval
Oval with one septa
Hooked
T12
White and
orange
Brown
Oval with one septa
Oval
T20
White
Cream
# septa
T24
Cream
Cream
Oval
Pyriform
Globose
Oval with one septa
T30
White
Cream
Obovoid with a truncate base
NO
NO
NO
NO
Single and paired
verrucose
Fusarium spp.
T32
White
Cream
Oval
Obovoid with a truncate base
Oval with one septa
Blunt
Foot shaped
57.31-69.52
3
Single verrucose
Paired smoothwalled
F. oxysporum
T34
White
Cream
Oval
Obovoid with a truncate base
NO
NO
NO
NO
Single verrucose
Paired
Fusarium spp.
T35
White
Violet
Oval
Oval with one septa
NO
NO
NO
NO
Single smooth
Fusarium spp.
T39
White and
orange
Cream
Globose oval
Oval with one septa
NO
NO
NO
NO
Chains 2,3 and 4
verrucose
Fusarium spp.
T40
Cream
Yellow
Globose
Oval
Obovoid with a truncate base
NO
NO
NO
NO
Single verrucose
Fusarium spp.
*Reference strain.
730
Afr. J. Microbiol. Res.
Figure 3. 1% agarose gel electrophoresis of the PCR products of the regions ITS-Fu-Fwd and ITS-Fu-Rev
of the isolates of Fusarium spp. Line: M) Molecular marker 100 bp (BioLabsInc, New England), 1) Fog, 2)
T9, 3) T11, 4) T12, 5) T20, 6) T24, 7) T30, 8) T32, 9) T34, 10) T35, 11) T39, 12) T40.
Table 2. Morphological and molecular characterization of highly pathogenic isolates from gladiolus corms.
Color
Isolate
Species
Similarity percentage
(%)
Morphological
Molecular
Molecular
Anverse Reverse
characterization characterization size (bp)
Accession number NCBI
FOG*
White
Violet
Fusarium
oxysporum
Fusarium
oxysporum
537
99
GU724514.1
T9
White
Orange
Fusarium solani
Fusarium solani
538
99
EU982942.1
T11
White
Brown
Fusarium
oxysporum
Fusarium
proliferatum
553
99
EU839366.1
T12
T20
T24
White
White
Cream
Brown
Cream
Cream
Fusarium solani
Fusarium solani
Fusarium solani
Fusarium solani
No identified
Fusarium solani
539
435
456
86
EU625405.1
78
GU355660.1
T30
White
Cream
Fusarium spp
Fusarium
oxysporum
526
99
GU445378.1
T32
White
Cream
Fusarium
oxysporum
Fusarium solani
541
99
FJ460589.1
T34
White
Cream
Fusarium spp
No identified
433
T35
White
Violet
Fusarium spp
Fusarium
oxysporum
516
99
GU724514.1
T39
White
Cream
Fusarium spp
Fusarium
oxysporum
515
99
GU724514.1
T40
Cream
Yellow
Fusarium spp
Fusarium solani
557
99
EU625405.1
states of central Mexico. The descriptions made for the
species isolated in this study also agreed with those
reported by these authors. Molecular taxonomic results
by PCR: ITS confirm the morphological identification of
ten isolates, which corresponded to F. oxysporum, F.
solani and F. proliferatum. The two isolates that showed
no similarity when aligning them using BLAST could be
Fusarium species, where genetic variation has occurred
due to the indiscriminate use of fungicides in the region.
Alternatively, these unidentified isolates could be species
not yet reported. The percentage of J. curcas seed oil
reported by Martínez-Herrera et al. (2010) coincides with
the values obtained in this research in seeds from the
state of Chiapas, with a value of 60.4%. The same author
reports phorbol ester values of 2.03 mg g-1 in oil and 0.16
mg g-1 in kernel meal. The differences in phorbol ester
Albores et al.
731
Table 3. Effect of J. curcas oil on mycelial growth of isolates of Fusarium spp.
Treatment
PDA
®
Tween 20
®
Captan
Petroleum ether
-1
Oil 2.5 mg mL
-1
Oil 5 mg mL
-1
Oil 10 mg mL
Isolate
Fog*
a
T9
4.08 (0.82)
a
3.45 (0.61)
b
0.78 (0.08)
a
3.91 (0.75)
a
3.61 (0.72)
b
1.28 (0.17)
a
3.39 (0.72)
a
T11
4.51 (0.82)
bc
3.10 (0.53)
d
1.31 (0.17)
bc
3.0 (0.56)
c
2.78 (0.54)
d
1.26 (0.15)
ab
3.70 (0.77)
a
4.95 (1.01)
c
2.86 (0.47)
d
1.43 (0.20)
b
3.93 (0.76)
c
2.81 (0.47)
d
1.83 (0.28)
bc
3.11 (0.61)
T12
T20
a
a
4.19 (0.87) 4.76 (0.96)
bc
d
3.55 (0.5) 2.91 (0.48)
d
e
1.43 (0.19) 1.50 (0.21)
bc
bc
3.11 (0.6) 3.78 (0.74)
bc
cd
3.23 (0.6) 3.55 (0.70)
d
e
1.92 (0.28) 2.06 (0.34)
ab
ab
3.67 ( 0.6) 4.50 (0.92)
T24
a
3.70 (0.79)
bc
2.61 (0.46)
d
1.08 (0.13)
ab
3.03 (0.53)
ab
3.33 (0.68)
cd
1.95 (0.28)
ab
3.05 (0.61)
T30
a
4.26 (0.84)
ab
3.56 (0.89)
d
1.23 (0.19)
ab
3.96 (0.81)
ab
3.60 (0.68)
c
2.61 (0.45)
bc
3.38 (0.68)
T32
a
T34
4.68 (0.96)
bc
3.0 (0.56)
e
0.90 (0.09)
b
3.66 (0.72)
cd
2.23 (0.40)
de
1.23 (0.14)
b
3.35 (0.66)
a
4.16 (0.88)
abc
3.56 (0.70)
e
0.98 (0.09)
bcd
3.31 (0.66)
cd
2.76 (0.52)
d
2.56 (0.46)
ab
3.78 (0.79)
T35
T39
a
a
4.91 (0.99) 4.23 (0.90)
bc
b
3.30 (0.59) 2.95 (0.54)
e
d
1.41 (0.23) 1.66 (0.26)
ab
ab
3.91 (0.79) 3.51 (0.74)
cd
ab
2.8 (0.49) 3.55 ( 0.70)
de
c
1.98 (0.41) 2.48 (0.42)
bc
ab
3.58 (0.73) 3.68 (0.76)
T40
a
4.80 (0.99)
b
3.76 (0.75)
d
1.33 (0.20)
b
3.63 (0.70)
b
3.51 (0.67)
c
2.33 (0.42)
b
3.55 (0.76)
-1
*Reference strain. Means followed by different letters in each column are significantly different by Tukey test at (α 0.05). Values in parenthesis indicate growth rate (mm day ).
Table 4. Effect of J. curcas oil on percentage conidial germination of isolates of Fusarium spp.
Treatment
Isolate
Fog*
T9
T11
T12
T20
T24
T30
T32
T34
T35
T39
T40
®
PDA
Tween 20
97.92 ± 3.77
98.44 ± 1.66
97.55 ± 3.95
99.55 ± 0.88
99.55 ± 0.88
99.77 ± 0.66
97.55 ± 3.97
99.55 ± 0.88
99.77 ± 0.66
100.0 ± 0.00
99.22 ± 1.16
99.77 ± 0.66
97.56 ± 5.20
68.44 ± 14.27
95.55 ± 3.12
44.44 ± 22.70
93.96 ± 6.04
86.00 ± 12.84
92.22 ± 7.03
44.44 ± 22.70
97.77 ± 2.10
98.44 ± 2.51
92.06 ± 7.67
98.20 ± 2.18
®
Captan
96.26 ± 5.15
65.35 ± 28.05
83.33 ± 17.37
83.33 ± 35.35
41.95 ± 15.71
33.79 ± 21.46
92.07 ± 4.77
83.33 ± 35.35
91.66 ± 17.67
100.00 ± 0.00
99.77 ± 0.66
89.94 ± 12.53
Petroleum ether
96.05 ± 4.68
36.44 ± 25.43
97.11 ± 2.84
97.17 ± 5.65
42.15 ± 10.42
34.25 ± 11.09
90.00 ± 7.28
97.17 ± 5.65
91.31 ± 8.52
100.00 ± 0.00
96.92 ± 4.89
98.97 ± 2.06
J. curcas oil (mg ml-1)
2.5
5
10
61.34 ± 18.52 90.06 ± 14.62 39.87 ± 20.86
14.40 ± 9.45
44.64 ± 30.46 14.43 ± 11.44
96.00 ± 3.00
96.24 ± 4.69
98.22 ± 2.90
44.44 ± 22.75 90.74 ± 18.84
97.77 ± 6.66
91.55 ± 7.46
52.41 ± 19.90
98.66 ± 1.73
12.62 ± 15.46
17.28 ± 6.03
82.66 ± 30.53
89.33 ± 5.19
91.85 ± 7.78
55.37 ± 26.10
44.44 ± 22.75 90.74 ± 18.84
97.77 ± 6.66
89.13 ± 7.54
64.53 ± 33.37
89.58 ± 6.40
98.22 ± 3.93
97.22 ± 4.39
91.15 ± 11.99
96.33 ± 4.03
60.81 ± 15.04
94.41 ± 5.29
91.00 ± 16.78 70.17 ± 20.16 90.54 ± 12.54
*Reference strain. Means and SD.
content for each solvent, obtained in this study,
could be because the two solvents have a different boiling point (68.85 for hexane and 60°C for
petroleum ether) and because the phorbol esters
in the oil are thermolabile, which means that by
applying a higher temperature to obtain the oil
with the solvents used, the phorbol esters are degraded. The greatest effect on mycelial growth for
the isolates evaluated was with the J. curcas oil
treatment at the concentration of 5 mg ml-1. Growth
-1
rates between 0.140 and 0.462 mm day were
obtained, when compared with 0.820 to 1.018 mm
day-1 for the PDA control. Some authors reported
that the effect on the mycelial growth of the compounds present in the essential oils may be due to
732
Afr. J. Microbiol. Res.
two factors: the first involves inhibition of extracellular
enzyme synthesis, and the second the alteration of the
cell wall structure (Tripathi et al., 2009). Siva et al. (2008)
evaluated the antifungal effect of aqueous, acetone and
ethanol extracts of 20 medicinal plants against F.
oxysporum f. sp. melongenae. J. curcas was one of the
plants evaluated and showed inhibition percentages of
100% for all extracts used. Donlaporn and Suntornsuk
(2010) evaluated the antifungal activity of ethanol extracts of J. curcas seeds and the importance of phorbol
esters present in the extracts on F. oxysporum, F.
semitectum, Colletotrichum capsici, C. gloeosporioides,
Pythium aphanidermatum, Lasiodiplodia theobromae and
Curvularia lunata, using concentrations of 0 to 10,000 mg
-1
-1
L . Concentrations from 6,000 mg L showed 100%
inhibition of mycelial growth for all tested pathogens.
These authors are the first to report that phorbol esters
are responsible for the fungicidal activity of the extracts,
as they note that by removing these compounds from the
extracts there were no significant differences as compared to the control. As for the germination of conidia, the
three concentrations used in this study were effective for
only two isolates (T9 and T24) with germination between
12.62 and 17.28%. Ogbebor and Adekunle (2008) assessed
the germination of Drechslera heveae conidia on PDA
with J. curcas extracts, attaining a 20% germination rate
with the 100% concentration. The three species identified
showed symptoms of the disease in the plant, such as
leaf yellowing, epinasty and some-times late flowering in
the field. It is suggested that in different parts of Morelos,
corm rot in gladiolus is caused by three fungal species,
which showed morphological, molecular and pathogenic
differences, plus different sensitivity to J. curcas oil. All
three species were capable of causing the disease. The
results of this research demonstrate the antifungal potential of J. curcas oil to control fungi that cause diseases in
ornamental plants.
ACKNOWLEDGEMENTS
This work was funded by the Secretary of Postgraduate
and Research (Projects 20090234 and 20100783) and by
the Commissions of Operation and Support to Academic
Activities from the National Polytechnic Institute.
REFERENCES
Abd-Elsalam AK, Aly IN, Abdel-Satar MA, Khalil MS, Verreet JA (2003)
PCR identification of Fusarium genus based on nuclear ribosomalDNA sequence data. Afr. J. Biotechnol. 2:82-85.
Aiyelaagbe OO, Adeniyi BA, Fatunsin OF, Arimah BD (2007) In Vitro
antimicrobial activity and phytochemical analisis of Jatropha curcas
roots. Int. J. Pharmacol. 3:106-110.
Alves-Santos FM, Benito EP, Elsava AP, Díaz-Mínguez JM. (1999)
Genetic diversity of Fusarium oxysporum strains from common bean
fields in Spain. Appl. Environ. Microbiol. 65:3335-3340.
Baayen RP (2000). Diagnosis and detection of host-specific forms of
Fusarium oxysporum. EPPO Bull. 30:489-491.
Barrera-Necha L, García-Barrera L (2008) Antifungal activity of
essential oils and their compounds on growth of Fusarium sp.
isolated from papaya (Carica papaya). Rev. UDO Agric. 8:33-41.
Barrera-Necha L, Garduño-Pizaña C, García-Barrera LJ (2009) In vitro
antifungal activity of essential oils and their compounds on mycelia
growth of Fusarium oxysporum f.sp. gladioli (Massey) Snyder and
Hansen. Plant Pathol. J. 8:17-21.
Booth C (1985) The genus Fusarium. Ed. Commonweath Mycological
Institute. p. 237.
Donlaporn S, Suntornsuk W (2010) Antifungal Activities of Ethanolic
Extract from Jatropha curcas Seed Cake. J. Microbiol. Biotechnol.
20:319-324.
Doyle JJ, Doyle JL (1990). A rapid total DNA preparation procedure for
fresh plant tissue. Focus 12:13-15.
Flores-Olivas A, Martínez-Soriano JP, Martínez-Espinoza AD (1997)
Use of technology new in detection and genetic analysis of
phytopathogens. Phytopathology 32:96-111.
Garduño-Pizaña C, Barrera-Necha LL, Ríos-Gómez MY (2010).
Evaluation of the fungicidal activity of leaves powders and extracts of
fifteen Mexican plants against Fusarium oxysporum f. sp. gladioli
(Massey) Snyder & Hansen. Plant Pathol. J. 9:79-87.
González-Pérez E, Yañez-Morales MJ, Ortega-Escobar H, VelázquezMendoza J (2009) Comparative Analysis among Pathogenic Fungal
Species that Cause Gladiolus (Gladiolus grandiflorus Hort.) Corm Rot
in Mexico. Mex. J. Phytopathol. 27:45-52.
Haan LAM, Numansen A, Roebroeck EJA, van Doorn J. (2000) PCR
detection of Fusarium oxysporum f.sp. gladioli race 1, causal agent of
Gladiolus yellows disease, from infected corms. Plant Pathol. 49:89100.
Katan T, Di Primo P (1999). Current status of vegetative compatibility
groups in Fusarium oxysporum: Supplement (1999). Phytoparasitica
27:1-5.
Leslie J, Summerell BA (2006). The Fusarium laboratory manual. Ed.
Blackwell publishing. p. 388.
Martínez-Herrera J (2006) Genetic and nutritional diversity of piñón
(Jatropha curcas L.) in México. PhD dissertation, Instituto Politécnico
Nacional, México.
Martínez-Herrera J, Martínez-Ayala AL, Makkar H, Francis H, Becker K
(2010)
Agroclimatic conditions,
Chemical
and Nutritional
Characterization of Differents provenances of Jatropha curcas L.
from Mexico. Eur. J. Sci. Res. 39:396-407.
Mendoza-Zamora C (1997). Certificación de estudios de efectividad
biológica de plaguicidas. Ed. Cecilio Mendoza Zamora-Universidad
Autonóma de Chapingo. Texcoco, Mexico. 279 p.
Montiel-González L, González-Flores F, Sánchez-García BM, GuzmánRivera S, Gámez-Vázquez FP, Acosta-Gallegos JA, RodríguezGuerra R, Simpson-Williamson J, Cabral-Enciso M, Mendoza-Elos M.
(2005). Species of Fusarium occurring on bean (Phaseolus vulgaris
L.) roots affected with rots in five states of Central México. Mex. J.
Phytopathol. 23:1-7.
Moreno-Velázquez M, Yáñez-Morales MJ, Rojas-Martínez RI, ZavaletaMejía E, Trinidad-Santos A, Arellano-Vazquez JL (2005). Diversity of
fungi of amaranthus (Amaranthus hypochondriacus L.) seed and their
molecular characterization. Mex. J. Phytopathol. 23:111-118.
Nelson P E, Toussoun T A, Marasas WFO (1983) Fusarium species: an
illustration manual for identification. University Park, Pennsylvania
State University Press, Pensylvania, USA. p. 193.
Ogbebor ON, Adekunle AT (2008). Inhibition of Drechslera heveae
(Petch) M. B. Ellis, causal organism of Bird’s eye spot disease of
rubber (Hevea brasiliensis Muell Arg.) using plant extracts. Afr. J.
Gen. Agric. 4:19-26.
Ortoneda M, Guarro J, Madrid M, Caracuel Z, Roncero MI, Mayayo E,
Di Pietro A. (2003). Fusarium oxysporum as a Multihost Model for the
Genetic Dissection of Fungal Virulence in Plants and Mammals.
Infect. Immun. 72:1760–1766.
Pauli A, Knobloch K (1987) Inhibitory effects of essential oil components
on growth of food-contamining fungi. Z. Leb.-Unt. und-For. 185:1013.
Pintore G, Chessa M, Boatto GP, Cerri G, Usai M, Trillini B (2002)
Essential oil Hypericum perforatum L. var. angustifolium DC growing
wild in Sardinia (Italy). J. Essential Oil Res. 17:533-535.
Rahman M, Ahmad SH, Mohamed MTM, Rahman MZA (2011). Extraction of Jatropha curcas fruits for antifungal activity against
anthracnose (Colletotrichum gloeosporioides) of papaya. Afr. J.
Biotechnol. 10:9796-9799.
Albores et al.
SAGARPA (2006). Manual Técnico fitosanitario del cultivo de gladiolo.
Ed. Comité Estatal de Sanidad Vegetal del Estado de Morelos. p. 13.
Siva N, Ganesan S, Banumathy N, Muthuchelia (2008). Antifungal
Effect of Leaf Extract of Some Medicinal Plants Against Fusarium
oxysporum Causing Wilt Disease of Solanum melogena L. Ethnobot.
Leaflets 12:156-163.
Srivastava S, Kumar R, Sinha A. (2012). Antifungal Activity of Oil
Against Some Seed-borne Fungi. Plant Pathol. J. 11:120-123.
Teixeira M, Figueira G, Sartoratto A, Garcia V, Delarmelina C (2005).
Anti-Candida
activity
of
Brazilian
medicinal
plants.
J.
Ethnopharmacol. 97:305-311
Tripathi A, Sharma N, Sharma V (2009). In vitro efficacy of Hyptis
suaveolens L. (Poit.) essential oil on growth and morphogenesis of
Fusarium oxysporum f.sp. gladioli (Massey) Snyder & Hansen. World
J. Microbiol. Biotechnol. 25:503-512.
733
White TJ, Bruns T, Lee S, Taylor J (1990). Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics.
Chapter 38. PCR protocols: A guide to methods and applications. Ed.
Academic Press Inc, pp. 315-323.
Wink M, Koshmieder C, Saverwein M, Sporer F (1997). Phorbol esters
of Jatropha curcas. In G.M. Gübitz, M. Mittelbach, & M. Trabi (Eds.),
Biofuels and Industrial products from Jatropha curcas Austria, DbvVerlag Univ. pp.160-166.
Zhang Z, Schwartz S, Wagner L, Miller W (2000) A greedy algorithm for
aligning DNA sequences. J. Comput. Biol. 7:203-14.
Vol. 8(8), pp. 734-742, 19 February, 2014
DOI: 10.5897/AJMR2013.5940
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Screening phosphate solubilizing actinobacteria
isolated from the rhizosphere of wild plants from the
Eastern Cordillera of the Colombian Andes
Luis Daniel Prada Salcedo1*, Carolina Prieto2 and Marcela Franco Correa3
1
Luis Daniel Prada Salcedo: Unidad de investigaciones agropecuarias. Facultad de Ciencias. Pontificia Universidad
Javeriana, Department of Microbiology Carrera 7ª 43-82 Edificio Félix Restrepo, S. J. 3° Piso Bogotá - Colombia.
2
Centro de investigación de la caña de azucar, Cenicaña. Cali - Colombia.
3
Marcela Franco Correa: Grupo de Biotecnología ambiental e industrial. Facultad de Ciencias. Pontificia Universidad
Javeriana, Department of Microbiology Carrera 7ª 43-82 Edificio Félix Restrepo, S. J. 3° Piso Bogotá - Colombia.
Accepted 20 January, 2014
Colombia is a tropical country with high diversity and an agricultural economy, yet their soils are
characterized by low pHs and poor phosphorus concentrations. Soil supplementation with chemical
fertilizers containing soluble phosphorus is a costly and contaminating practice and for this reason, the
aim of this study was to isolate actinobacteria that are able to release soluble phosphate from wild
plants of the Eastern Cordillera of Colombia and select strains with high phosphorus solubilizing
activity. To screen the isolates of actinobacteria, we used two qualitative assays to determine the
efficiency of solubilization by measuring the halo of hydrolysis in a Pikovskaya’s agar plate (PVK). A
second assay was performed on broth with National Botanical Research Institute's phosphate growth
(NBRIP) medium containing bromophenol blue (BPB). Finally, the released soluble phosphate by
actinobacteria was quantified using insoluble Ca3(PO4)2 or AlPO4 as sole sources of P. Only five of the
tested strains were the best solubilizing strains in the two qualitative assays. The strains T1C, T1H, T3A,
T3C, P3E, F1A, F2A and V2B solubilized significantly more phosphorus than the other strains, which
was shown for the quantitative assay. Strains T1C, T3A, T3C and F1A are candidates for future studies
and to evaluate other plant growth promoting activities.
Key words: Screening, phosphate solubilizing, actinobacteria, Colombia.
INTRODUCTION
Colombia is one of the five countries in the world with the
largest diversity of genes, species, and ecosystems. The
Colombian Andes are located in one of the world biodiversity hotspots and the savannahs of the Llanos are
listed as one of the world eco-regions with rare, rich and
biologically important habitats (Myers et al., 2000; Herzog
et al., 2011). Soils within these areas are characterized
by low pHs and low phosphorus concentrations (Rao et
al., 2004; Fassbender and Bornemisza, 1994; Malagon et
al., 2003). Soil phosphorus dynamics is characterized by
physicochemical (sorption-desorption) and biological
(immobilization-mineralization) processes. Phosphate
anions can be immobilized by precipitation with cations
such as Ca2+, Mg2+, Fe3+ and Al3+ providing a high phosphorus fixation capacity to soils (Oliveira et al., 2009;
Khan et al., 2009). In Colombia’s agricultural tradition, to
prepare soils by adding manure, chemical fertilizers or
organic amendments, any of them is supplemented with
phosphate in order to compensate the phosphorus deficiency is a common practice (León, 1991; Guimaraeset
*Corresponding author. E-mail: lprada@javeriana.edu.co. Tel: 5701 3208320 ext: 4150 – 4069. Fax: 3208320 ext. 4047.
Salcedo et al.
735
et al., 2001). Soil supplementation with chemical
fertilizers containing soluble phosphorus is thus a costly
and conta-minating practice, not only because of their
way of use but because of the highly polluting mode in
which they are industrially produced, requiring the use of
sulphuric acid at high temperatures. Furthermore, wrong
fertilizer applications can cause problems of eutrophication and erosion (Whitelaw, 2000; Vassilev et al., 2006).
Many studies have been done on phosphate solubilizing
micro-organisms (PSM) as an alternative in the prevention of environmental and agricultural issues mentioned above (Rodriguez and Fraga, 1999; Krishnaraj and
Goldstein, 2001; Kumar et al,. 2010; Bhattacharyya and
Jha, 2012).
There are reports on studies with microorganisms
capable of solubilizing phosphate, especially bacteria and
some fungi, which have experimentally demonstrated
their capacity to improve phosphorus availability to plants
in laboratory, greenhouse and field experiments (Rudresh
et al., 2005; Deubel et al., 2005; Pandey et al., 2008;
Hamdali et al., 2012). To a lesser extent, actinobacteria
have been reported as microorganisms with the capacity
to release phosphorus into the soil (Mba, 1994, 1997;
Hamdali et al., 2008, El-Tarabily et al., 2006). Actinobacteria
have special interest because these filamentous sporulating bacteria are able to thrive in extremely different soils,
play important ecological roles in soil nutrient cycling and
are recently being regarded as plant growth promoting
rhizobacteria (Jiang et al., 2005; Pathom-Aree et al.,
2006; Franco-Correa et al., 2010). The selection of PSM
is carried out by rapid qualitative methods. The most common method is to determine the efficiency of solubilization by measuring the halo of hydrolysis in a Pikovskaya’s
agar plate (1948), but results are not always consistent
and in some cases this method is insufficient to detect all
the PSM (Nautiyal 1999; Mehta and Nautiyal, 2001;
Rashid et al., 2004). Mehta and Nautiyal (2001) developed a system that includes a broth - the National Botanical
Research Institute's phosphate growth medium (NBRIP)
medium and a qualitative assay in liquid medium, which
is more accurate and reliable in the selection of PSM and
therefore makes the screening process more quick, efficient and with low cost (Khan et al., 2009).
The aim of this study was to isolate actinobacteria able
to release soluble phosphate from wild plants of the
Eastern Cordillera of Colombia and to select strains with
high phosphorus solubilizing activity with the purpose of
suggesting those microorganisms as potential biofertilizers and hence help to use less chemical fertilizers in
agricultural practices.
(Figure 1). These habitats included the rhizospheres of wild plants
growing in natural protected areas and forests; samples were taken
from forest species associated with Vallea, Weinmannia, Vaccinium,
Drimys, Rosmarinus, plus samples from legumes grasses (Rye
Grass or Bromus) and clovers (Trifolium repens and Trifoliumpratense).
Soil pH, total P, available P, and organic matter were characterized
(Table 1). The samples were taken at a depth of 15-30 cm and
were placed in polyethylene bags, closed tightly and stored in a
refrigerator at 4°C. Actinobacteria were isolated by dilution plate
method using oat-meal agar. These media were supplemented with
nistatin (0.1 % V/V). Plates were incubated at 26°C, and monitored
daily. Subcultures led to purified bacterial colonies that’s howed an
actinobacteria-like appearance. Gram staining indicated that they
were Gram positive mycelia sporulating bacteria. A classical approximation was used for the characterization like aerial mass colour,
reverse side pigments, melanoid pigments, soluble pigments. We
did determination of micro morpho-logical characteristics of the
spore-bearing hyphae, the number of spores at the end of mature
hyphae and the spore chain Morphology. The strains were stored in
20% sterile glycerol at -20°C.
MATERIALS AND METHODS
Statistical analysis
Soil samples and isolation of Actinobacteria
All of the experiments were performed with four replicates. The data
were analyzed with a One Way Analysis of Variance (ANOVA) and
a Duncan’s multiple range test to determine any significant differences between groups at p < 0.05. All the statistical analyses were
performed using the SPSS 11.0 for Windows® software.
Soil samples were collected from various localities from the Eastern
Cordillera between 2010 and 2011. Diverse habitats at different
altitudes were selected for the isolation of actinobacteria strains
Screening of phosphate-solubilizing actinobacteria
The solid plate assay was done to measure the halo zone formed
surrounding the bacteria after being inoculated on agar and
incubated for 72 h at 26°C on PVK growth medium containing 5 g of
tricalcium phosphate as sole phosphorus source and pH 7.2
(Pikovskaya 1948). Halo-forming colonies were recorded as positive. The solubilization index was calculated as the ratio between
the total diameter (colony + halo) and the colony diameter (Kumar
and Narula, 1999). A second assay was performed on broth with
NBRIP medium containing BPB following the protocol of Mehta and
Nautiyal (2001). In brief, 5 ml of NBRIP-BPB medium in a 30-ml test
tube was inoculated with the actinobacterial strain (50 ml inoculum
with approximately 3 X 107cfu/ml), and the isolates were grown for
4 days at 26°C with continuous agitation at 120 rpm. At the end of
the incubation period, the final OD-600 values were subtracted from
the initial values. The medium pH was measured by immersing a
glass electrode into the culture broth.
Release soluble phosphate
Solubilization of P by Actinobacteria was quantified using insoluble
5 g/L of Ca3(PO4)2 or 1 g/L of AlPO4 as sole sources of P in the
NBRIP broth medium. In each autoclaved flask, 2 ml of bacterial
suspension (approximately 3 X 107cfu/ml) were transferred to 100
ml Erlenmeyer flask containing 20 ml of NBRIP broth medium. The
actinobacteria cultures were placed on a rotary shaker at 120 rpm
for 4 days and pH was measured after incubation with a pH meter.
Suspensions were centrifuged to remove bacterial cells and other
insoluble materials. The resulting supernatants were passed through
a 0.45 μm filter and the inorganic phosphate content of the culture
filtrate was determined by the molybdenum blue method (Murphy
and Riley, 1962). The available phosphorous was determined using
a spectrophotometer at 880 nm and calibrated with a standard
KH2 PO4 curve.
736
Afr. J. Microbiol. Res.
Figure 1. Map of Colombia with coordinates, altitude, humidity and temperature of the localities sampled.
Table 1. Characteristics of the soil from the different regions in Colombia.
Region
Tota*
Paipa*
Mani*
Fusagasuga*
La vega*
Villleta*
Andina
Caribe
Pacific
Orinoquia
Amazonica
Soil pH
5.06 ± 0.3
5.52 ± 1.0
4.8 ± 0.5
5.1 ± 1.4
4.06 ± 0.6
5.9 ± 1.6
5.5 ± 0.2
6 ± 1.1
4.5 ± 2.1
7 ± 2.4
5 ± 0.8
Total P (mg/kg)
360 ± 283.6
614 ± 311.1
407.2 ± 408.6
2830.6 ± 1554.0
1504.4 ± 417.7
949.25 ± 880.8
922 ± 1143
1343 ± 1143
315 ± 456
541 ± 626
815 ± 717
Available P (mg/kg)
118.4 ± 126.5
8 ± 2.6
17.04 ± 31.3
55.52 ± 56.8
86.52 ± 171.4
8.725 ± 7.6
83 ± 83
101 ± 123
37 ± 28
116 ± 84
43 ± 86
Organic matter %
13 ± 16.9
5.96 ± 5.3
2.2 ± 1.3
13.52 ± 13.5
4.6 ± 0.6
2.95 ± 1.7
8 ± 3.2
9 ± 1.8
8.5 ± 5.5
2.8 ± 4.5
3 ± 4.6
*Data of this work. 30 soil cores from random location. Values are Average ±standard deviation.
RESULTS
Soil samples and isolation of Actinobacteria
We isolated 57 strains of actinobacteria from six different
sampling areas from October 2010 to July 2011. Soil
characterization showed pH ranges from 4.0 to 5.9, total
P from 360 to 2830 mg/kg, available P from 8.7 to 118.4
mg/kg, and organic matter from 2.95 to 13.52% (Table 1).
Figure 2 shows a greater abundance of actinobacteria in
localities at the highest elevations: 56% of the isolates
belong to Tota and Paipa, 40% to the towns of
Fusagasuga, La Vega and Villeta; and the remaining 4%
of the isolates were from Mani, a locality at a lower elevation that is located on tropical plains. The use of oatmeal agar allowed the recovery of large numbers of
actinobacteria that showed growth and sporulation results
after 7 days of culture. Preliminary morphological characterization of the isolates showed typical structures, like
aerial and substrate mycelium, conidia chains, some
Salcedo et al.
737
Figure 2. Efficiency of solubilization of the isolates. A clear zone around a growing colony indicate phosphate
solubilization and was measured as phosphate solubilazation index.
mycelium with coccoid elements, and spore chain morphologies namely Rectiflexibiles, Retinaculiaperti and
Spirales. In addition, other characteristics as melanoid
pigments, reverse side pigments and soluble pigments
were observed. Macroscopically, all have a dry appearance
granular, powdery or velvety, characteristic of the actinobacteria. Additionally, there were several colors: white
(T1B, T3B, P2R, L4C and M2A), heavy or light gray (T3A,
T3C, T3D, L3A, P3E, F2A), beige (F1A, F2C), blue-green
(V1B) and pink (V2B and V1E), and diffusible pigment
production (F1A, F2C). Finally, we recognized the smell
of wet soil, representative characteristic of this group of
microorganisms for the production of geosmina. Some
genera of actinobacteria were identified as Streptomyces,
Nocardia and Actinomadura, among unidentified isolates.
obtained with the test, the pH present in the culture
medium was low for the majority of the strains selected.
The best solubilizing strains with low pH are from the
town of Tota, which was the sampling zone with highest
elevation and lowest temperature in addition to a relatively low moisture percentage. In this area, a large number of actinobacteria were isolated from five samples
collected in the surroundings of the lake, near an area
known as Playa Blanca where the few remnants of wild
forests are influenced by agriculture and tourism. The
town Fusagasuga has strains with high activity but not a
decrease in pH; this locality has a lower humidity and
higher temperatures.
Release soluble phosphate
Screening of phosphate-solubilizing actinobacteria
Figures 2 and 3 show which isolates belong to strains
with the best phosphorus solubilizing capacity as well as
two control strains deposited at the Pontificia Universidad
Javeriana: Streptomyces sp. MCR26 labelled as negative
control and Streptomyces sp. MCR24 as positive control.
These control strains were characterized as Plant growthpromoting rhizobacteria (PGPR) (Franco-Correa et al.,
2010). The plate assay revealed that strains with the
highest values of phosphorus solubilization are F2A, F1A,
F1B, F1C, F4C, T3F, T1A, T1D, and T3A. These strains
have the same activity as that of the control strain
Streptomyces sp. MCR24. On the other hand, the liquid
evaluation exhibited that isolates with higher solubilizing
capacity are those that produce changes greater than 1.5
optical density units at 600 nm, which were F1A, F1B,
F1C, F2D, F4B, F4D, M2A, M4B, T1B, T1C, T1D, T1G,
T1H, T3A, T3B and T3C. In addition to the activity results
The results of the two qualitative assessments are not
totally consistent. Seven of the tested strains F1A, F1B,
F1C, F4C, T1A, T1D and T3A were the best solubilizing
strains in both the solid and liquid evaluation media. We
made a quantitative assessment to find which of the
strains has the highest solubilizing capacity and which of
the two methods is more reliable. Figure 4 shows that the
strains T1C, T1H, T3A, T3C,P3E, F1A, F2A and V2B are
as good as Streptomyces sp. MCR24 for Ca3(PO4)2 and
that these strains solubilized significantly more phosphorus than the other strains. Strains T1H, T1C, T3A,
T3C and F1A are present only in the selection obtained
with the methodology reported by Mehta and Nautiyal
(2001) suggesting that this test can choose more strains
with true solubilizing ability and for this reason, it is more
reliable. These strains also lowered pH at around 4 or
less with exception of F1A. This result is supported by the
change in coloration in the medium caused by the presence of BPB pH indicator,which turns from purple to
Afr. J. Microbiol. Res.
3.0
6.5
2.5
6.0
2.0
5.5
1.5
5.0
1.0
4.5
0.5
4.0
0.0
3.5
pH of activity in the medium
Optical density shift at 600 nm+/- standard deviation
738
Figure 3. Change in optical density at 600 nm. The dotted line indicates the cut-off for the selection of microorganisms with high tricalcium
phosphate solubilizing capacity.
500.00
2
Ca3(PO4)
600.00
400.00
300.00
200.00
100.00
0.00
0.00
5.00
10.00
15.00
20.00
25.00
ALPO4
Figure 4. Released soluble phosphate. Activity with Ca3(PO4)2 5g·L-1 source is shown in Y and activity with
AlPO4 1g·L-1 source is shown in X.
Salcedo et al.
green, a fact related to the secretion of organic acids by
actinobacteria. No tests were made with aluminum phosphate because Mehta and Nautiyal (2001) evaluation
methodology was designed for tricalcium phosphate. We
observed that only in the quantitative assessment strains
T1J and T3A can solubilize phosphorus significantly from
AlPO4. In addition, the control strain Streptomyces sp.
MRC24 had a very low activity with this source of
phosphorus.
DISCUSSION
Soil samples and isolation of Actinobacteria
The abundance of the isolates in the locality of Tota can
be explained by the environmental conditions of this area,
such as an average temperature of 18°C, sandy soils
with low water content, and pH of 5.0 to 7.2; characteristics that facilitate growth and colonization of actinobacteria. On the other hand, the towns of Mani and La
Vega have clay soils with low organic matter content, low
oxygen tension and pH below 5.0 (Table 1). These soil
characteristics can decrease the abundance of actinobacteria (Goodfellow and Williams, 1983; Alexander
1977; El-Tarabily and Sivasithamparam, 2006). Actinobacteria occurs in a wide range of environments, but soil
is the most common ecological niche because the role of
these microorganisms is to recycles oil nutrients. Isolates
reflect abundant numbers and variety of morphologies in
each of the localities sampled, but due to the isolation
methodology used, the predominant genus was
Streptomyces spp. (Xu et al., 1996; Ghodhbane-Gtari et
al., 2010). Actinobacteria isolates show that fertile soils
with high concentrations of nitrogen and carbon are not
always necessary to isolate these microorganisms. Although
growth of these microorganisms is optimum with pH close
to neutrality; our findings show that they can be isolated
from sandy soils with low pH and high aluminum concentrations; results that are consistent with those of Shirokikh
et al. (2002) and Norovsuren et al. (2007).
Screening of phosphate-solubilizing actinobacteria
In order to perform the screening for an adequate
selection of phosphorus solubilizing actinobacteria from
Colombian native soils, the isolates were subjected to the
traditional test used by PVK and the test reported by
Mehta and Nautiyal (2001). Although both qualitative
tests use different measurement units, there is a slight
correlation pattern between them. Figure 2 shows high
bars for the locality of Tota and locality of Fusagasuga,
respectively. These results are similar to those in Figure
3, where the highest strain bars belong to the same
localities with the greatest activity strains shown in Figure
2. The two methodologies are used, but the assay by
Mehta and Nautiyal (2001) is currently more reported,
because it reveals strains with good phosphorus-solubilizing capacity which is not detected in the plate assay
739
(Leyval and Barthelin, 1989; Louw and Webley, 1959;
Gupta et al., 1994; Mehta and Nautiyal, 2001; Liu et al., 2011).
In our work, the advantage of the liquid assay methodology was observed with strains Tota, Fusagasuga, La
Vega and Villeta, which showed a major shift in the
NBRIP-BPB broth decolorization and a high release of
soluble phosphorus in the quantitative assessment.
Figures 2, 3 and 4 show these strains are not equally distributed in all the six sampled localities; on the contrary,
they are found mostly in the locality of Tota. This locality
is a lake of 56.2 km2 surrounded by crop fields of onions,
potatoes, beans, peas and carrots, and a few small high
Andean forests. The constantly chemically fertilized crops
are affecting forests and causing eutrophication in water
bodies. The soil analysis of the Tota locality showed a
13% of organic matter, a cation-exchange capacity of 6
cmol/kg, a pH around 5 or less, and a total phosphorus
concentration of 360 mg/kg with only 118 mg/kg available
phosphorus. These results suggest that only 33% of
phosphorus applied to the soil may be taken up by plants,
on the other hand the remaining 67% is not used and can
cause environmental problems. The latter phosphorus
parameters reveal excessive chemical fertilization. Probably, excess phosphorus is adsorbed or precipitated
and organic matter is removed as the crop itself, so
microorganisms are forced to use mainly inorganic forms
of phosphorus.
Release soluble phosphate
Perez et al. (2007) propose that isolates causing a shift of
> 1.5 units be selected for further studies. In order to
confirm the usefulness of this cut-off point proposed by
Perez et al. (2007) and therefore to select the best strains,
we implemented the quantitative assay measuring the
release of soluble phosphorus in the NBRIP broth (Baig
et al., 2010). Figure 4 shows that strains T1C, T1H, T3C,
P3E, and V2B have a significantly higher activity to other
isolates, a result that was not observed in the plate assay
possibly because one or more acids involved in the
process did not diffuse into the agar so that there was no
presence of a solubilization halo. The evaluation in
NBRIP-BPB broth revealed that isolates decolorizing the
broth more than 1.5 units were also more efficient in the
quantitative assay. Also, the assay by Mehta and Nautiyal
(2001) contribute to reduce costs and efforts in the search
of microorganisms with biofertilizing potential. Studies
based on physiology of actinobacteria in Colombia are
scarce, especially those focused on agriculture (Joaquín
et al., 2006; Cardona et al., 2009; Franco-Correa et al.,
2010); in addition, there has been little research on biofertilizer-based clean technologies as a valuable input for
agricultural development (Burbano and Silva, 2010).
Developing native biofertilizers contributes to the management of tropical soils with high absorption and fixation
of phosphorus due to their high cation concentrations,
usually low pH and clay texture, characteristics that have
traditionally been amended with an increased use of che-
740
Afr. J. Microbiol. Res.
mical fertilizers resulting in a negative impact on
ecosystems. Strains T1C, T1H, T3A, T3C, P3E, F1A,
F2A and V2B have phosphorus solubilizing capacities
between 396 and 520 μg/ml with tricalcium phosphate;
these results are good when compared with other bacteria from similar soils reported as phosphorus solubilizers,s uch as Bacillus spp., and Azotobacter spp (Narula
et al., 2000; Chatli et al., 2008; Saharan and Nehra,
2011). Using similar soil isolates, Perez and co-workers
reported an activity with tricalcium phosphate as high as
97 μg/ml by Burkholderia and with iron phosphate of 42
μg/ml by Serratia. Regarding actinobacteria, El-Tarabily
(2008) reported that Micromonospora has an activity of
218 μg/ml with phosphate rock and Gupta (2010) reported that Streptomyces has an activity of 46 μg/ml with
tricalcium phosphate. The values obtained are similar to
the results of Chen et al. (2006) that evaluated this activity in actinobacteria belonging to the genera Rhodococcus
sp. and Arthrobacter sp. which had 186 and 519 activities
μg/ml, respectively. Those activities reported show that
our isolates have a great potential and an acceptable
activity.
Differences in the reported values by other authors may
be due to the measurement techniques employed or to
the source of phosphorus evaluated. Occasionally, the
measurements with rock phosphate may overestimate
the values of in vitro solubilization because this source of
phosphorus is composed of several insoluble as well as
soluble forms of phosphorus (Zapata and Roy, 2007).
One of the most valuable achievements of our research
is having isolated an actinobacteria with the ability to
solubilize both tricalcium phosphate and aluminum phosphate; the latter is a source difficult to solubilize because
aluminum phosphate is rapidly absorbed in acid soils. Its
fixation rate per unit area is twice the rate in neutral or
calcareous soils. Aluminum is also the leading cause of
phosphorus precipitation in acid soils (Olsen and Watanabe,
1957; Holford, 1983). The source of phosphorus in the
AlPO4 test had a concentration of 1 g/L in NBRIP broth
because this compound is highly toxic to many microorganisms. The greatest in vitro resistance to aluminum
by actinobacteria reported in the scientific literature is of 5
g/L AlPO4 (Sayed et al., 2000); therefore, several authors
have been working with lower concentrations (Illmer,
1995; Prijambada et al., 2009). In addition, it is known
that AlPO4 toxicity varies by the complexity of the soils
and that actinobacteria have good resistance to aluminum thus their soil colonization is facilitated in presence
of this element (Shirokikh et al., 2002; Rueda et al.,
2009). Strains with improved phos-phorus solubilizing
activity lowered the pH probably due to the production of
organic acids, which is one of the phosphorus releasing
mechanisms reported in scientific literature (Khan et al.,
2009; Saharan and Nehra 2011). Soils with these characteristics predominate in the Colombian tropics, hence
strain T3A is important because it can release phosphorus from different sources. All the facts mentioned above,
render these strains good candidates for the production
of new bio-fertilizers with the ability of colonizing crop
rhizospheres in tropical soils.
Strains T1C, T3A, T3C and F1A are candidates for
future studies. These strains have similar activity to the
positive control strain Streptomyces sp. MCR24, which
was previously characterized by Franco-Correa et al.
(2010) who reported a broad variety PGPR activities
besides phosphorus solubilizing capacity. Prior studies
have reported that strain swith good phosphorus solubilizing capacity have also a variety of mechanisms to promote plant growth like the strain Streptomyces sp.
MCR24. For this reason, further studies with these strains
designed to evaluate other plant growth promoting activeties, like nitrogen fixation, degradation of complex carbohydrates, synergistic activities, antagonisms and production of plant growth promoting hormones, can make an
important contribution to agriculture.
ACKNOWLEDGEMENTS
This study was partially supported by the Internal Financial (Vicerrectoria Academica - Pontificia Universidad
Javeriana - Colombia). The authors would like to thank
the Dra. Sandra Constantino Chuaire for her contribution
on the translation of this paper.
REFERENCES
Alexander M (1977). Introduction to soil Microbiology.2nd edn. John
wiley and sons. ISBN0-85226-013X. New York Baig KA, M, Zahir ZA,
Cheema MA (2010).Comparative efficacy of qualitative and
quantitative methods for rock phosphate solubilization with phosphate
solubilizing rhizobacteria. Soil Environ. 29:82-86.
Baig KS, Arshad M, Zahir ZA, Cheema MA (2010). Comparative
efficacy of qualitative and quantitative methods for rock phosphate
solubilization with phosphate solubilizing rhizobacteria. Soil Environ.
29(1):82-86.
Bhattacharyya PN, Jha DK (2012). Plant growth-promoting rhizobacteria (PGPR): emergence in agriculture. World J. Microbiol.
Biotechnol. 28:1327-1350.
Burbano H, Silva F (2010). Ciencia del suelo: principios básicos.
Sociedad Colombiana de la Ciencia del suelo., Bogotá, D.C.,
Colombia. 594. Cardona G, Peña.
Cardona G, Venegas CP, Ruiz-Garcia M (2009). Comunidades de
hongos actinomicetos en tres tipos de vegetación de la Amazonia
colombiana: abundancia, morfotipos y el gen 16s ADNr. Rev. Biol.
Trop. 57:1119-1139.
Chatli A, Beri V, Sidhu B (2008). Isolation and characterisation of
phosphate solubilizing microorganisms from the cold desert habitat of
Salix alba Linn. in trans Himalayan region of Himachal Pradesh.
Indian J. Microbiol. 48:267-273.
Chen YP, Rekha PD, Arun AB, Shen FT, Lai WA, Young CC (2006).
Phosphate solubilizing bacteria from subtropical soil and their
tricalcium phosphate solubilizing abilities. Appl. Soil Ecol. 34:33-41.
Deubel A, Merbach W, Varma A, Buscot F (2005). Influence of
Microorganisms on Phosphorus Bioavailability in Soils Microorganisms
in Soils: Roles in Genesis and Functions. In. Springer Berlin
Heidelberg, pp. 177-191.
El-Tarabily KA, Nassar AH, Sivasithamparam K (2008).Promotion of
growth of bean (Phaseolus vulgaris L.) in a calcareous soil by a
phosphate-solubilizing,
rhizosphere-competent
isolate
of
Micromonospora endolithica. Appl. Soil Ecol. 39:161-171.
El-Tarabily KA, Sivasithamparam K (2006). Non-streptomycete actino-
Salcedo et al.
mycetes as biocontrol agents of soil-borne fungal plant pathogens
and as plant growth promoters.Soil Biol. Biochem. 38:1505-1520.
Fassbender H, Bornemisza E (1994). Química de suelos, con énfasis
en suelos de América Latina, San José, Costa Rica. Colección de
libros y materiales educativos/ IICA n 81. 420.
Franco-Correa M, Quintana A, Duque C, Suarez C, Rodriguez MX,
Barea J-M (2010).Evaluation of actinomycete strains for key traits
related with plant growth promotion and mycorrhiza helping activities.
Appl. Soil Ecol. 45:209-217.
Ghodhbane-Gtari F, Essoussi I, Chattaoui M, Chouaia B, Jaouani A,
Daffonchio D, Boudabous A, Gtari M (2010). Isolation and
characterization of non-Frankia actinobacteria from root nodules of
Alnus glutinosa, Casuarina glauca and Elaeagnus angustifolia.
Symbiosis 50:51-57.
Goodfellow M, Williams S (1983).Ecology of Actinomycetes. Annu. Rev.
Microbiol. 37:189-216.
Guimaraes ES, Rao Y, Amezquita MC, Amezquita E (2001). Sistemas
agropastoriles en sabanas tropicales de América Latina.CIAT: Cali,
Colombia and EMBRAPA: Brasilia, Brasil p. 328.
Gupta N, Sahoo D, Basak U (2010). Evaluation of in vitro solubilization
potential of phosphate solubilising Streptomyces isolated from
phyllosphere of Heritiera fomes (mangrove). Afr. J. Microbiol. Res.
4:136-142.
Gupta R, Singal R, Shankar A, Kuhad RC, Saxena RK(1994).A
modified plate assay for screening phosphate solubilizing
microorganisms. J. Gen. Appl. Microbiol. 40:255-260.
Hamdali H, Bouizgarne B, Hafidi M, Lebrihi A, Virolle MJ, Ouhdouch Y
(2008). Screening for rock phosphate solubilizing Actinomycetes from
Moroccan phosphate mines. Appl. Soil Ecol. 38:12-19.
Hamdali H, Moursalou K, Tchangbedji G, Ouhdouch Y, Hafidi M (2012).
Isolation and characterization of rock phosphate solubilizing
actinobacteria from a Togolese phosphate mine. Afr. J.
Biotechnol.11: 312-320.
Herzog SK, Martinez R, Jørgensen PM, Tiesse H (2011). Climate
change and biodiversity in the tropical Andes. Inter-American Institute
for Global Change Research (IAI) and Scientific Committee on
Problems of the Environment (SCOPE), 348 pp. ISBN: 978-8599875-05-6.
Holford I (1983). Differences in the efficiency of various soil phosphate
tests for white clover between very acidic and more alkaline soils.
Austr. J. Soil Res. 21:173-182.
Illmer P, Barbato A, Schinner F (1995). Solubilization of hardly-soluble
AlPO4 with P solubilizing microorganisms.Soil Biol. Biochem. 27:265270.
Jiang Y, Li WJ, Xu P, Tang SK, Xu LH (2005). Study on diversity of
Actinomycetes saltand alkaline environments. WeiShengWuXueBae.
46(2):191-195.
Joaquín L, Benavides L, Gladys M, Quintero O, Ostos O (2006).
Aislamiento eidentificación de diez cepas bacterianas desnitrificantes
a partir de un suelo agrícolacontaminado con abonos nitrogenados
proveniente de una finca productora decebolla en la Laguna de Tota,
Boyacá, Colombia nova - publicación científica.4(6):50-54.
Khan A, Ajgam S, Naqvi SM, Rasheed M (2009). Phosphorus
solubilizing bacteria:occurrence, mechanisms and their role in crop
production. J. Agric. Biol. Sci. 1:48-58.
Krishnaraj PU, Goldstein AH (2001). Cloning of a Serratia marcescens
DNA fragment thatinduces quinoprotein glucose dehydrogenasemediated gluconic acid production inEscherichia coli in the presence
of stationary phase Serratia marcescens. FEMS Microbiol. Lett.
205:215-220.
Kumar A, Bhargava P, Rai L (2010). Isolation and molecular characterrization of phosphatesolubilizing Enterobacter and Exiguobacterium
species from paddy fields of EasternUttar Pradesh. Afr. J. Biotechnol.
4:820-829.
Kumar V, Narula N (1999).Solubilization of inorganic phosphates and
growth emergenceof wheat as affected by Azotobacter chroococcum
mutants.Biol. Fert. Soils 28:301-305.
León LA (1991). La experiencia La experiencia del centro internacional
para el desarrollode fertilizantes en el uso de rocas fosfóricas en
América Latina. Rev. Fac. Agron. 17:49-66.
Leyval C, Berthelin J (1989). Interactions betweenLaccarialaccata,
Agrobacteriumradiobacterand beech roots: Influence on P, K, Mg,
741
and Fe mobilization fromminerals and plant growth. Plant Soil
117:103-110.
Liu H, Wu X-Q, Ren J-H, Ye J-R (2011). Isolation and Identification of
Phosphobacteria inPoplar Rhizosphere from Different Regions of
China. Pedosphere 21:90-97.
Louw HA, Webley DM (1959).A study of soil bacteria dissolving certain
mineral phosphatefertilizers and related compounds.J. Appl.
Microbiol. 22:227-233.
Malagon DC (2003). Ensayo sobre tipología de suelos colombianos.
Énfasis en génesis yensayos ambientales Revista de la Academia
Colombiana de Ciencias Exactas, Físicas y Naturales 27: 319 - 341.
Mba C (1994). Field studies on two rock phosphate solubilizing
actinomycete isolates asbiofertilizer sources. Environ. Manage.
18:263-269.
Mba C (1997). Rock phosphate solubilizing Streptosporangium isolates
from casts oftropical earthworms. Soil Biol. Biochem. 29:381-385.
Mehta S, Nautiyal CS (2001). An Efficient Method for Qualitative
Screening of Phosphate-Solubilizing Bacteria. Curr. Microbiol. 43:5156.
Murphy J, Riley JP (1962).A modified single solution method for the
determination ofphosphate in natural waters. Anal. Chim. Acta.
27:31-36.
Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GA, Kent J
(2000).Biodiversityhotspots for conservation priorities. Nature 403:
853-858.
Narula N, Kumar V, Behl RK, Deubel A, Gransee A, Merbach W
(2000).Effect of PsolubilizingAzotobacter chroococcum on N, P, K
uptake in P-responsive wheatgenotypes grown under greenhouse
conditions.J. Plant Nutr. Soil Sci. 163:393-398.
Nautiyal CS (1999).An efficient microbiological growth medium for
screening phosphatesolubilizing microorganisms.FEMS Microbiol.
Lett.170:265-270.
Norovsuren Z, Zenova G, Mosina L (2007). Actinomycetes in the
rhizosphere of semidesertsoils of Mongolia.Eurasian Soil Sci. 40:415418.
Oliveira CA, Alves VMC, Marriel IE, Gomes EA, Scotti MR, Carneiro
NP, Guimarães CT, Schaffert RE, Sá NMH (2009). Phosphate solubilizing microorganisms isolated from rhizosphereof maize cultivated
in an oxisol of the Brazilian Cerrado Biome. Soil Biol. Biochem.
41:1782-1787.
Olsen S, Watanabe F (1957). A method to determine a phosphorus
absorption maximum ofsoils as measured by the Langmuir isotherm.
Soil Sci. Soc. Am. J. 21:144-149.
Pandey A, Das N, Kumar B, Rinu K, Trivedi P (2008). Phosphate
solubilization byPenicillium spp. isolated from soil samples of Indian
Himalayan region. World J. Microbiol. Biotechnol. 24:97-102.
Pathom-aree W, Stach J, Ward A, Horikoshi K, Bull A, Goodfellow M
(2006). Diversity ofactinomycetes isolated from Challenger Deep
sediment (10,898 m) from the Mariana Trench. Extremophiles.
10:181-189.
Pérez E, Sulbarán M, Ball MM, Yarzábal LA (2007).Isolation and
characterization of mineral phosphate-solubilizing bacterianaturally
colonizing a limonitic crust in the south-eastern Venezuelan region.
Soil Biol. Biochem. 39(11):2905-2914.
Pikovskaya R (1948). Mobilization of phosphorus in soil in connection
with vital activity ofsome microbial species. Microbiol. 17: 362-370.
Prijambada I, Widada J, Kabirun S, Widianto D (2009). Secretion of
organic acids by phosphate solubilizing bacteria isolated from Oxisols
J. Tanah Trop.14(3):245-251.
Rao IM, Barrios E, Amézquita E, Friesen DK (2004).Soil phosphorus
dynamics, acquisition and cycling in crop-pasture fallow systems in
low fertility tropical soils: A review from Latin America CentroInternacional de Agricultura Tropical (CIAT), Canberra. Modelling nutrient
management in tropical cropping systems. ACIAR proceedings. pp.
126-134.
Rashid M, Khalil S, Ayub N, Alam S, Latif F (2004).Organic acids
production andphosphate solubilization by phosphate solubilizing
microorganisms (PSM) under invitro conditions. Pakistan J. Biol. Sci.
7:187-196.
Rodriguez H, Fraga R (1999). Phosphate solubilizing bacteria and their
role in plant growth promotion. Biotech. Adv.17:319-339.
Rudresh DL, Shivaprakash MK, Prasad RD (2005).Effect of combined
742
Afr. J. Microbiol. Res.
application ofRhizobium, phosphate solubilizing bacterium and
Trichoderma spp. on growth, nutrient uptake and yield of chickpea
(Cicer aritenium L.). Appl. Soil Ecol. 28:139-146.
Rueda C, Aikawa M, Prada LD, Franco-Correa M, Martinez MA, Padilla
G (2009). Evaluación de la presencia del gen mer A implicado en la
detoxificacion demercurio a partir de actinomicetos nativos del
humedal de La Conejera. Revista Colombiana de Biotecnología
11:105-113.
Saharan B, Nehra V (2011). Plant Growth Promoting Rhizobacteria: A
Critical Review. Life Sci. Med. Res. 2011:LSMR-21.
Sayed W, Mohaowad S, Abd El-Karim M (2000). Effect of Al, Co, and
Pb ions on growthof Frankia spp. in a mineral medium. Folia
Microbiol. 45:153-156.
Shirokikh IG, Zenova GM, Zvyagintsev DG (2002). Actinomycetes in the
Rhizosphere of Barley Grown on Acid Soddy Podzolic Soil. Microbiol.
71:455-459.
Vassilev N, Vassileva M, Nikolaeva I (2006). Simultaneous Psolubilizing and biocontrolactivity of microorganisms: potentials and
future trends. Appl. Microbiol. Biotechnol. 71:137-144.
Whitelaw M (2000). Growth promotion of plants inoculated with
phosphate-solubilizingfungi. Adv. Agron. 69:99-151.
Xu L, Li Q, Jiang C (1996). Diversity of soil actinomycetes in Yunnan,
china. Appl. Environ. Microbiol. 62:244-248.
Zapata F, Roy R (2007).Utilización de rocas fosfóricas para agricultura
sostenible. Boletin FAO No 13, Roma. 156.
Vol. 8(8), pp. 743-749, 19 February, 2014
DOI: 10.5897/AJMR2013.5953
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Establishment of EvaGreen qPCR for detecting bovine
rotavirus based on VP7 gene
Wei Suocheng1*, Che Tuanjie2, Wang Jingming3, Li Yukong3, Zhang Taojie1, Song Changjun1
and Tian Fengling1
1
Life Science and Engineering College, Northwest University for Nationalities, Lanzhou 730030, China.
2
Lanzhou Baiyuan Company for Gene Technology, Lanzhou 730000, China.
3
Lanzhou Veterinary Research Institute of Chinese Academy of Agricultural Sciences, Lanzhou 730030, China.
4
Agriculture Bureau of Yuzhong County, Lanzhou 730100, China.
Accepted 20 January, 2014
The aim of the present study was to establish a method of EvaGreen real time fluorescence quantitative
polymerase chain reaction (qPCR) for detecting quickly bovine rotavirus (BRV) in fecal samples from
calves with diarrhea. The specific primers were designed and synthesized according to BRV VP7 gene in
Genbank. VP7 gene was cloned into the pMD18-T vector. The bovine viral diarrhea virus, bovine
coronavirus, porcine epidemic diarrhea virus, bovine mycobacterium tuberculosis and negative control
were detected with qPCR. Plasmids in five 10-fold gradients were detected using qPCR. The results
show that a EvaGreen qPCR was established in the present study. Only BRV displayed amplification
curve; cross-reactivity between BRV and the other viruses or bacteria was not observed. The
amplification curve of pMD18-T vector plasmid (diluted in 10-1 to 103 gradient) was typical S shape. The
detection limit of qPCR was 8.0 copies/μL, namely 100 plasmid concentrations. The coefficients of
variation in both intra-assay and inter-assay was less than 2%. The established EvaGreen qPCR had a
high specificity, sensitivity and reproducibility. It can be applied to clinical diagnosis and
epidemiological surveys of BRV.
Key words: Rotavirus, VP7 gene, evagreen, real-time quantitative PCR, bovine.
INTRODUCTION
Neonatal calf diarrhea is a common disease affecting the
newborn calf worldwide, threatening the cattle production
along with significant morbidity and mortality and inducing
severe economic losses (Wei, 2011). Group A rotaviruses
(RVA) are known to be important viral diarrheal agents in
infants and young animals, including calves.
The numbers of the rotavirus-associated mortality are
estimated to be 453,000 in 2008 (Tate, 2012; 2013). The
numbers of deaths is particularly high in developing
countries (Abe et al., 2009). Even in developed countries,
rotavirus remains an important cause of morbidity.
Rotaviruses possess 11 segments of double-stranded
ribonucleic acid (dsRNA) and two outer capsid proteins:
VP4 (encoded by gene segment 4) and VP7 (encoded by
gene segment 7, 8 or 9 depending on the strain), both of
which are independently responsible for virus neutralization (Estes, 2001). RVA strains are antigenically heterogeneous, and are classified in multiple G and P types de-
*Corresponding author. E-mail: weisc668@163.com. Tel: +0086-931-2937773.
744
Afr. J. Microbiol. Res.
fined by VP7 and VP4 outer capsid proteins (Papp et al.,
2013). The neutralization specificity related to VP7 is
referred to as the G serotype (for glycoprotein), and that
associated with VP4 is referred to as the P serotype (for
protease-sensitive protein) (Anthony et al. 1999).
Currently, group A rotavirus has been classified into at
least 15 G serotypes (G1-G15) and 21 P genotypes
(P1-P24) (Ram, 2004). With regard to bovine, at least
nine G serotypes (G1-4, 6-8, 10, 11) and three P
genotypes have been found so far (Santos and Hoshino,
2005; Papp et al., 2013). Feray et al. (2010) reported G6
was the predominant G-type, detected in 40/53 samples
(75.4%), while P[11] was the predominant P-type, detected
in 52/53 samples (98.1%). The most common VP7/VP4
combinations were G6P[11] (60.3%) and G10P[11]
(24.5%). A similar finding was reported by Swiatek et al.
(2010). Our study found that G6 and G10 serotypes were
29 (54.7%) and 8 (15.1%) in positive samples for VP7.
The main combinations of BRV G serotype and P
genotype were G6P[5] (28.3%) (Wei et al., 2013).
VP7 and VP4 proteins elicit the production of neutralizing
antibodies, define the antigenic specificities, referred to as
G type and P type, respectively, and are the major
antigens neutralizing immune responses during rotavirus
infections (Aminu et al., 2010). Rotavirus VP7 gene is
highly conservative at both ends of open reading frame
(ORF), such it is feasible to detect rotavirus serotypes
utilizing the rotavirus specific primers. VP7 has been shown
to be involved in the early interactions with cell-surface
molecules, during the rotavirus entry process (Lopez and
Arias, 2006; Martha et al., 2012). Moreover, PCR can be
used to detect rotavirus VP7 not only stool specimens
also cerebrospinal fluids and sera (Hiroshi et al., 1994).
Currently many methods (including polymerase chain
reaction, PCR) are available for detecting rotavirus, especially VP6 antigen (Luan et al., 2006; Gutierrez-Aguirre et al.,
2008; Zhu et al., 2011; Fan et al., 2011). Unfortunately, PCR
assays require sophisticated equipment, which is costly to
maintain, and must be performed in specialized laboratories (Xie et al., 2012). So far, little information regarding
real-time quantitative PCR (qPCR) utilized to detect RV
VP7 antigen has been known. The real-time quantitative
PCR (qPCR) methods are not only fast and accurate, and
also can test against different target sequences. Its specificity is very high (Okada and Matsumoto, 2002; Santos and
Hoshino, 2005). Quantitative PCR (qPCR), also known as
real-time PCR, has become a powerful tool for the amplification, identification and quantification of nucleic acids.
Its ability to quantitatively and specifically detect genes
has been invaluable for both research and diagnostic
applications (Schweitzer and Kingsmore, 2001). The qPCR
using a simple DNA dye is a popular choice among
academic laboratories for PCR experiments (Bustin,
2002). Compared to conventional reverse transcript PCR
(RT-PCR), qPCR has been shown to be more rapid and
more sensitive for the detection and quantification of
rotavirus (Mackay et al., 2002; Kang et al., 2004; Pang et
al., 2004). EvaGreen (EG) is a novel DNA-binding dye. It
has been reported to be used for DNA quantification, DNA
conformation detection quantitative PCR (Ihrig et al., 2006).
Currently, very little research of Evagreen Real-time
Quantitative PCR (qPCR) is performed for detection of
BRV (Ihrig et al., 2006). Currently, very little research of
Evagreen Real-time Quantitative PCR (qPCR) has been
performed for detection of bovine rotavirus (BRV) (Gouvea
et al., 1990; Mohan et al., 2006). It has not been applied in
detecting bovine rotavirus in China. The aim of the present study was to establish EvaGreen Real-time Quantitative PCR (qPCR) for detecting BRV VP7 gene in fecal
samples.
MATERIALS AND METHODS
Fecal samples
Fecal samples were collected from 62 calves with diarrhea that were
one to thirty days old and located on dairy farms in Lanzhou (26
samples), Qingyang cities (19 samples) and Gannan autonomous
prefecture (17 samples) of Gansu province of China, from November 2010 to April 2011. TRIzol (a nucleic acid extraction reagent;
Invitrogen, Beijing, China) was added to the collection tube in
advance. All fecal specimens were stored at -20°C until further use.
A 10% suspension of each fecal sample was prepared in phosphate
buffered saline (PBS), pH 7.2 and centrifuged at 4,000 g for 15 min
at 4°C. The supernatants of 62 fecal samples were subjected to
ELISA for detecting the presence of RV with commercially rotavirus
detection kits (Lanzhou Institute of Biological Products Company,
Lanzhou, China) and following the protocol of the manufacture
instructions. The results were interpreted by using the OD values
obtained at 450 nm with ELISA reader (BioTec, Dresden, Germany).
All positive samples from ELISA were used for the subsequent
experiments. Fecal supernatants were stored at 4°C.
Primers designs and synthesis
For qPCR, based on the deposited genome sequences of BRV VP7
in GenBank (accession number No. GQ433985), specific primers
were designed using Primer Premier 5.0 software according to the
highly
conserved
regions:
Forward:
5’-GTATGGTATTGAATATACCAC-3’ (nts 51-71 of GQ433985).
Reverse: 5’-GATCCTGTTGGCCATCC-3’ (nts 376-392
of
GQ433985). The length of predicting product is 342 bp. The concentrations of primers (100, 200, 300 and 500 nM) were evaluated. The
formation of primer-dimers was assessed by melting curve analysis.
Thus, only those concentrations of primers that showed
dimer-free reactions were used for the final analysis. Primers were
synthesized from Takara Bio, Dalian, China.
Cell cultures
The neonatal calf diarrhea virus (NCDV) strain (AV-51, purchased
from Chinese Veterinary Drugs Supervisor Institute, Beijing, China)
and ELISA positive fecal samples were inoculated to single layer
MA-104 cells as described previously (Wei et al., 2010). The cells
Suocheng et al.
were cultured for 3-4 days at 37°C. The process ended when the
cytopathogenic effect (CPE) was higher than 90%. Then, the cells
were frozen and thawed 2 to 3 times. The viral supernatant was
collected for RNA extraction or stored at -80°C until processed.
RNA extraction and cDNA synthesis
According to the manufacturer’s instructions, total RNA was extracted from the viral supernatants of the neonatal calf diarrhea virus
(NCDV) strain (AV-51) and fecal samples using the TRIzol RNA
extraction kit (Invitrogen, Beijing, China).
Briefly, PCR was performed in a 25 μL volumes that included 15.5
μL diethylpyrocarbonate (DEPC) water, 0.5 μL (10 mM) deoxyribonucleotide triphosphate (dNTPs), 2.5 μL 10×PCR buffer, 0.5 μL Tag
enzyme. 0.5 μL BRVF primer, 0.5 μL BRVR and 5 μL cDNA. The
PCR products were electrophoresed on 1.5% agarose gel (Amresco,
USA) containing 1×Gel Red (BIOTIUM, Hayward, CA, U.S.A.) and
subsequently analyzed with the software CS Analyzer Ver 3.0
(ATTO, Tokyo, Japan).
The cDNA was synthesized from the NCDV strain and extracted
viral RNA by reverse transcription reaction and used for PCR
amplification of the VP7 gene. The expected amplicons were 342 bp
sizes.
Preparation of plasmid standard template
The amplified VP7 cDNA fragments were cloned into pMD18-T
vectors. Then, pMD18-T vectors were sequenced and validated.
The positive plasmids were quantitatively measured using the
optimized reaction conditions to establish a standard curve with the
logarithm values of template starting copy number as the horizontal
axis and Ct values as the vertical axis. The positive plasmids were
used as standards (pMD-VP7), which were serially diluted 10-fold
gradient to 4.0×10-1, 4.0×100, 4.0×101, 4.0×102 and 4.0×103 (copies/μL).
745
(PEDV) and bovine mycobacterium tuberculosis (provided by
Lanzhou Veterinary Research Institute, Chinese Academy of
agricultural sciences, Lanzhou, China), respectively. RNA was
reverse transcribed. RNA templates were amplified with the
established qPCR. Meanwhile, the negative control was detected.
Meanwhile, the negative control was set.
Sensitivity tests
The plasmids were diluted on the serial 10-fold dilutions (103, 102,
101, 100 and 10-1 gradients) and detected with the established qPCR
to evaluate the sensitivity of qPCR.
Stability
For the intra-assay variability, the plasmids in 5 dilution gradients
(10-4, 10-3, 10-2 and 10-1) were detected using qPCR. The test was
repeated thrice. The copy numbers, mean, standard deviation and
variation coefficient (CV) were calculated from the standard curve
for each dilution gradients.
For inter-assay variability, the plasmids in 5 dilution gradients
were detected with the qPCR for three times every three days. The
copy numbers, average, standard deviation and variation coefficient
were also calculated as the methods mentioned above.
Fecal sample detection
To evaluate the diagnostic efficacy of qPCR assay, cDNAs of 62
fecal samples were detected using the established qPCR. The
findings were compared with that of ELISA method to verify the
coincidence rate of two methods.
RESULTS
EvaGreen Real-time Quantitative PCR (qPCR)
The qPCR was performed in a 50 μL reaction systems, which
consisted of 25 μL EvaGreen qPCR Master Mix (Chaoshi
biotechnology company, Shanghai, China), 1 μL BRVF Primer (10
μM), 1 μL BRVR primers (10 μM), 5 μL cDNA and 18 μL deionized
water. The experiment Detector was set to SYBR, and the Quencher
was set to None. The conditions for qPCR were as follows: initial
denaturation at 95°C for 15 min followed by 40 cycles of 94°C for 15
s, 55°C for 30 s and 72°C for 40 s, and a final extension at 72°C for
10 min. The qPCR was done in ABI quantitative PCR instrument
(ABI PRISM 7300 type, Applied Biosystems incorporation, USA).
Screening of fecal samples by ELISA
The screening of 10% suspension of 62 fecal samples
indicated that 12 fecal samples were positive for BRV,
with a prevalence rate of 19.36%.
Amplification of BRV VP7 gene
As shown in Figure 1, a predicted 342 bp band was found
in agarose gel electrophoresis. The result testified they
are group A BRV.
Establishment of the standard curve for qPCR
The 10-fold diluted plasmid standards (4.0×10-1, 4.0×100, 4.0×101,
4.0×102 and 4.0×103 copies/μL) were detected quantitatively using
qPCR assay. Such the standard curve had been established with
the logarithmic values of the starting copies as the horizontal axis (X)
and Ct values as the vertical axis (Y).
Specificity tests
To examine the analytical sensitivity, the RNA was extracted from
the viral supernatants of BRV stools, bovine viral diarrhea virus
(BVDV), bovine coronavirus (BCV), porcine epidemic diarrhea virus
Dynamics curve and the standard curve of qPCR
The reaction conditions of qPCR were optimized. The
optimum reaction conditions were as follows: initial
denaturation for 15 min at 95°C, denaturation for 15 s at
95°C, annealing for 30 s at 55°C, elongation for 40 sat
72°C, by 40 cycles, and a final elongation of 10 min at 72°C.
The dynamics curve of qPCR was acquired (Figure 2).
The recombinant plasmids (pMD-VP7) in five 10-fold
gradients from 4.0×10-1 to 4.0×103 were detected using
the optimized qPCR reactions, respectively. Ct values were
746
Afr. J. Microbiol. Res.
had an excellent specificity. It can be applied to detect
diarrhea sample clinically.
Sensitivity test results
The plasmids in five dilution gradients were detected with
the established qPCR (Figure 5).
The amplification curve of pMD-VP7 plasmid (diluted in
10-1～103 gradient) was typical S shape with an excellent
appearance. Ct values were 28.55, 24.42, 2.067, 17.42 and
14.48, respectively. The corresponding copy numbers
-3
2
1
0
were 1.80×10 , 4.11×10 , 6.21×10 , 8.03×10 and
-1
9.68×10 , respectively. Therefore, the detection limit of
qPCR was 8.0 copies/μL, namely 10-0 plasmid concentration.
Figure 1. Amplification of BRV in agarose gel
electrophoresis. The predicted 342 bp band was
found. 1: blank control; 2 and 3: extracted total RNA
from fecal samples; 4: marker.
Stability test results
As shown in Table 1, the variation coefficients (CV) of
intra-assay reproducibility and inter-assay reproducibility
were 1.0-1.1 and 1.7-2.0, respectively, which demonstrated the qPCR assay was stable and reliable.
Detection results of fecal samples
Detection results of fecal samples showed that 10 (all of
which were positive for ELISA) out of 62 fecal samples
were found positive for BRV by qPCR. The coincidence
rate of qPCR and ELISA was 83.3%. qPCR had a higher
sensitivity and specificity.
DISCUSSION
Figure 2. The dynamics curve of qPCR.
28.55, 24.42, 20.67, 17.42 and 14.48 respectively. Such,
the standard curve was established (Figure 3). The slope,
2
intercept and correlation coefficient (R ) of the standard
curve were -3.574, 31.77 and 0.997 respectively,
indicating a strong linear relationship. Gene amplification
efficiency (E) equalled to (1.91-1) x100%=91%. Such, the
regression equation was expressed as Y=-3.574 LogX
+31.77. It can be calculated that Ct value equated to
31.77-3.574X.
Specificity test results
As can be seen from Figure 4, the optimized rotavirus
qPCR assay was tested against other viruses and
bacteria, which included BCoV, PEDV and MB, in order to
demonstrate the specificity of the assay. The results show
only BRV displayed amplification curve, the crossreactivity between BRV and other viruses or bacteria was
not observed. It indicated the established qPCR assay
Real-time PCR can be carried out using either probes or
DNA dyes (Higuchi et al., 1993; Wilhelm and Pingoud,
2003; Anne, 2011). SYBR Green exhibits a very strong
fluorescent signal, but it has been shown to inhibit the
PCR reaction and has a narrow dynamic range and lower
reproducibility than other detection chemistries (Gudnason
et al., 2007). EvaGreen is another DNA dye which is less
inhibitory to PCR than SYBR Green and is marketed as
an alternative. EvaGreen dye performed better than
SYBR Green in general, and high reaction efficiencies
can be achieved using the dye. In cases where template
sequence tends to vary, dye-based detection helps
prevent false negatives that might result from base pair
mismatches in a sequence-specific probe binding region
(Anderson et al., 2003; Papin et al., 2004). It has recently
been used for quantitative real-time PCR (qPCR),
post-PCR DNA melt curve analysis and several other
applications (Mao et al., 2007). So far, it has not been
reported that qPCR is utilized to detect bovine rotavirus in
China. The present study was to develop a higher
specificity and sensitivity method for detecting BRV VP7
gene in fecal samples using EvaGreen dye.
Suocheng et al.
Figure 3. The standard curve of qPCR. The slope, intercept and correlation coefficient (R2)
of the standard curve were -3.574, 31.77 and 0.997 respectively, indicating a strong linear
relationship.
Figure 4. Specificity of qPCR assay. BRV displayed amplification curve, the
cross-reactions between bovine rotavirus and other viruses: BVDV, bovine viral
diarrhea virus; BcoV, bovine coronavirus; PEDVPEDV, porcine epidemic diarrhea
virus or bacteria bovine; MB, mycobacterium tuberculosis and negative control were
not observed, indicating a high specificity for qPCR assay.
Figure 5. Sensitivity of qPCR assay. M, 100bp DNA Marker; 1-2, padding
and negativie control; 3-7, the 10-fold serial plasmid dilutions (103 , 102, 101,
100 and 10-1 gradients).
747
748
Afr. J. Microbiol. Res.
Table 1. Intra-assay and Inter-assay reproducibility test of qRT-PCR.
Dilution gradient of
Standard plasmid*
n
Intra-assay reproducibility
CV(%)
X  SD
Inter-assay reproducibility
CV(%)
X  SD
10-1
-2
10
-3
10
10-4
3
3
3
3
15.1±0.6
18.4±0.7
21.5±0.6
26.1±0.7
16.3±0.7
19.4±0.9
21.1±0.9
26.0±0.9
1.0
1.0
1.1
1.0
1.7
2.0
1.9
2.0
Note: * Copy /μL
In the present research, a 342 bp VP7 gene of BRV was
amplified from fecal samples with RT-PCR. qPCR has
been developed for determining BRV VP7 gene. The
quantities of RNA in qPCR ranged between 8.03×100 and
-3
1.80×10 copies per reaction. The established qPCR was
high specificity, sensitivity and stability. However, because
of inadequate conditions and detection of small samples,
the specificity of the experimental methods and result
repetition need to be improved in the future. In addition,
BRV Kit has not been developed (Luan et al., 2006; Wei
et al., 2010). The human ELISA Kit was used in this study.
The coincidence rate of qPCR and ELISA in our findings
needs to be investigated further.
It is concluded that the qPCR using EvaGreen dye is a
rapid, sensitive and stable method for the detection of
BRV VP7 gene. The qPCR has a low risk of contamination
and is less time and manpower consuming than conventional RT-PCR. It could be used for clinical diagnosis
and epidemiological survey of bovine rotavirus.
ACKNOWLEDGEMENTS
The work was supported by the science and technology
program project in Gansu province of China in 2007
(Grant No: 0708NKCA079 and the research and
application project of agricultural biotechnology in Gansu
province (Grant No: GNSW-2010-10).
REFERENCES
Abe M, Ito N, Morikaw S, Takasu M, Murase T, Kawashima T, Kawai Y,
Kohara J, Sugiyama M (2009) Molecular epidemiology of rotaviruses
among healthy calves in of a novel bovine rotavirus bearing new P
and G genotypes. Virus Res. 144: 250-257
Aminu M, Page N A, Ahmad AA, Umoh JU, Dewar J, Steele AD (2010).
Diversity of Rotavirus VP7 and VP4 Genotypes in Northwestern
Nigeria. JID. 202 (Suppl 1): S198-S204.
Anderson TP, Werno AM, Beynon KA, Murdoch DR (2003). Failure to
genotype herpes simplex virus by real-time PCR assay and melting
curve analysis due to sequence variation within probe binding sites. J.
Clin. Microbiol. 41(5): 2135-2137.
Anne CE (2011). SYTO dyes and EvaGreen outperform SYBR Green in
real-time PCR. BMC Res. Notes. 4: 263-271.
Anthony HC, Choi MB, Monica MM (1999). Antibody-Independent
Protection against Rotavirus Infection of Mice Stimulated by
Intranasal Immunization with Chimeric VP4 or VP6 Protein. J. Virol.
73(9): 7574-7581.
Bustin SA (2002). Quantification of mRNA using real-time reverse
transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol.
29(1): 23-39.
Estes MK (2001). Rotaviruses and their replication. In Fields virology
Knipe DM, Howley PM eds). Lippincott-Roven Publishers,
Philadelphia, 1747-1785.
Fan Q, Xie ZX, Lie JB, Peng YS, Deng XW, Xie ZQ, Xie LJ, Peng Y
(2011). Detection of bovine rotavirus by TaqMan based Real-time
reverse transcription polymerase chain reaction assay. China Anim.
Husbandry Vet. Med. 38:105–108.
Feray A, Aykut O, Tuba CO, Mehmet OT, Elvin C, Vito M, Ibrahim B
(2010). Distribution of G (VP7) and P (VP4) genotypes of group A
bovine rotaviruses from Turkish calves with diarrhea, 1997–2008. Vet.
Microbiol. 141:231–237.
Gouvea V, Glass RI, Woods P, Taniguchi K, Clarke HF, Forrester B,
Fang ZY (1990). Polymerase chain reaction amplification and typing
of rotavirus nucleic acid from stool specimens. J. Clin. Microbiol.
28:276-282.
Gudnason H, Dufva M, Bang DD, W olff A (2007). Comparison of multiple
dyes for real-time PCR: effects of dye concentration and sequence
composition on DNA amplification and melting temperature. Nucleic
Acids Res. 35(19): e127
Gutierrez-Aguirre I, Steyer A, Boben J, Gruden K, Poljsak-Prijatelj M,
Ravnikar M (2008). Sensitive detection of multiple rotavirus genotypes
with a single reverse transcriptionreal-time quantitative PCR assay. J.
Clin. Microbiol. 46:2547–2554.
Higuchi R, Fockler C, Dollinger G, Watson R (1993). Kinetic PCR
analysis: real-time monitoring of DNA amplification reactions. Bio.
Technol. 11:1026-1030.
Hiroshi U, Keqin X, Shuichi N, Shigeru M, Toshiaki A (1994). Detection
and Sequencing of Rotavirus VP7 Gene from Human Materials
(Stools, Sera, Cerebrospinal Fluids, and Throat Swabs) by Reverse
Transcription and PCR. J. Clin. Microbiol. 32(12): 2893-2897.
Ihrig J, Lill R, Muhlenhoff U (2006). Application of the DNA-specific dye
EvaGreen for the routine quantification of DNA in microplates. Anal.
Biochem. 359(2):265-267.
Kang G, Iturriza-Gomara M, Wheeler JG, Crystal P, Monica B, Ramani S,
Primrose B, Moses PD, Gallimore CI, Brown DW, Gray J (2004).
Quantitation
of
group
A
rotavirus
by
real-time
reverse-transcription-polymerase chain reaction: correlation with
clinical severity in children in South India. J. Med. Virol. 73, 118-122.
Lopez S, Arias CF. (2006) Early steps in rotavirus cell entry. Curr Top
Microbiol Immunol 309:39–66.
Luan J, Yang S, Zang W, Gao Y, Zhong J, Zhao H (2006). Rapid
detection of bovine rotavirus with semi2nested RT2PCR assay.
Chinese J. Zoonoses. 22(7): 671-674.
Mackay IM, Arden KE, Nitsche A (2002). Real-time PCR in virology.
Nucleic Acids Res. 30: 1292-1305.
Mao F, Leung WY, Xin X (2007). Characterization of EvaGreen and the
implication of its physicochemical properties for qPCR applications.
BMC Biotechnol. 7:76-82.
Martha NC, Fanny G, Orlando A, Carlos AG (2012). Rotavirus VP4 and
VP7-Derived Synthetic Peptides as Potential Substrates of Protein
Suocheng et al.
Disulfide Isomerase Lead to Inhibition of Rotavirus Infection. Int. J.
Pept. Res. Ther. 18:373–382
Mohan S, Manoharan P, Pachaikani R (2006). Genotyping of rotavirus of
neonatal calves by nested-multiplex PCR in India. Veterinarski Arhiv.
76 (6): 497-505.
Okada N, Matsumoto Y (2002). Bovine rotavirus G and P types and
sequence analysis of the VP7 gene of two G8 bovine rotaviruses from
Japan. Vet Microbiol. 84: 297-305.
Pang XL, Lee B, Boroumand N, Leblanc B, Preiksaitis JK, Yu ICC (2004).
Increased detection of rotavirus using a real time reverse transcription
polymerase chain reaction (RT-PCR) assay in stool specimens
fromchildren with diarrhea. J. Med. Virol. 72: 496-501.
Papin JF, Vahrson W, Dittmer D (2004). SYBR Green-based real-time
quantitative PCR assay for detection of West Nile virus circumvents
false-negative results due to strain variability. J. Clin. Microbiol.
42(4):1511-1518.
Papp H, László B, Jakab F, Ganesh B, De Grazia S, Matthijnssens
J, Ciarlet M, Martella V, Bányai K (2013). Review of group A rotavirus
strains reported in swine and cattle. Vet. Microbiol. 165(3-4):190-199.
Ram IG (2004). Pathogenesis of intestinal and system in rotavirus
infection. J. Virol. 78:10213-10220.
Santos N, Hoshino Y (2005). Global distribution of rotavirus serotypes/
genotypes and its implication for the development and implementation
of an effective rotavirus vaccine. Rev. Med. Virol. 15: 29-56.
Schweitzer B, Kingsmore S (2001). Combining nucleic acid amplification
and detection. Curr. Opin. Biotechnol. 12(1):21-27.
Swiatek DL, Palomboc EA, Leed A, Coventryd MJ, Britza ML, Kirkwooda
CD (2010). Detection and analysis of bovine rotavirus strains
circulating in Australian calves during 2004 and 2005. Vet. Microbiol.
140: 56–62.
749
Tate JE, Steele AD, Bines JE, Zuber PL, Parashar UD (2012). Research
priorities regarding rotavirus vaccine and intussusception: a meeting
summary.
Vaccine. 30
(Suppl
1):A179-84.doi:
10.1097/INF.0b013e31828d639c.
Tate JE, Haynes A, Payne DC, Cortese MM, Lopman BA, Patel MM,
Parashar UD (2013). Trends in national rotavirus activity before and
after introduction of rotavirus vaccine into the national immunization
program in the United States, 2000 to 2012. Pediatr Infect Dis J.
32(7):741-4.
Wei Suocheng, FENG Ruofei, GONG Zhuandi, TIAN Fengling (2010).
Researches of Isolation and Cell Cultivation of Bovine Rotavirus in
Vero and MA-104 Cells. J. Northwest University for Nationalities.
31(4):71-75.
Wei S, Gong Z, Che T, Ayimu G, Tian F (2013). Genotyping of calves
rotavirus in China by reverse transcription polymerase chain reaction.
J. Virol. Methods 189(1):36– 40
Wei Z, Jianbao D, Takeshi H, Yoshitaka G, Masuo S (2011). Rapid and
Sensitive Detection of Bovine Coronavirus and Group A Bovine
Rotavirus from Fecal Samples by Using One-Step Duplex RT-PCR
Assay. J. Vet. Med. Sci. 73(4): 531-534.
Xie Z, Fan Q, Liu J, Pang Y, Deng X, Xie Z, Xie L, Khan MI (2012).
Reverse transcription loop-mediated isothermal amplification assay
for rapid detection of Bovine Rotavirus. BMC Vet. Res. 8:133-137.
Zhu W, Dong J, Haga T, Goto Y, Sueyoshi M (2011). Rapid and
sensitive detection of bovine coronavirus and group a bovine rotavirus
from fecal samples by using one-step duplex RT-PCR assay. J. Vet.
Med. Sci. 73:531–534.
Vol. 8(8), pp. 750-758, 19 February, 2014
DOI: 10.5897/AJMR2013.6351
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Nutritional requirements for the production of
antimicrobial metabolites from Streptomyces
Mariadhas Valan Arasu1,2*, Thankappan Sarasam Rejiniemon3, Naif Abdullah Al-Dhabi4,
Veeramuthu Duraipandiyan1,4, Savarimuthu Ignacimuthu1, Paul Agastian1,5, Sun-Ju Kim6,
V. Aldous J. Huxley3, Kyung Dong Lee7, Ki Choon Choi2*
1
Division of Microbiology, Entomology Research Institute, Loyola College, Chennai, India.
Grassland and forage division, National Institute of Animal Science, RDA, Seonghwan-Eup, Cheonan-Si, Chungnam,
330-801, Republic of Korea.
3
Department of Zoology, Thiru Vika Government Arts College, Thiruvarur - 610 003, Tamil Nadu, India.
4
Department of Botany and Microbiology, Addiriyah Chair for Environmental Studies, College of Science, King Saud
University, Riyadh, Saudi Arabia.
5
Department of Plant Biology and Biotechnology, Loyola College, Chennai, India.
6
Department of Bio-environmental Chemistry, Chungnam National University, 99 Daehak-Ro, Yuseong-Gu, Daejeon
305-764, Republic of Korea.
7
Department of Oriental Medicine Materials, Dongsin University, Naju, Korea.
2
Accepted 13 January, 2014
The objective of this study was to optimize the nutritional and cultural conditions of Streptomyces
strain ERI-1, ERI-3 and ERI-26 for the production of antimicrobial metabolites under shake-flask
conditions. Effect of eight fermentation medium, different temperature, pH, incubation time, different
carbon and nitrogen sources and different concentration of sodium chloride on production of
antimicrobial metabolites were studied. Antimicrobial activity of the fermentation medium was
evaluated by cup plate method by measuring the zone of inhibition. Nutritional and cultural conditions
for the production of antimicrobial metabolites by Streptomyces strain ERI-1, ERI-3 and ERI-26 under
shake-flask conditions have been optimized. Modified nutrient medium was found to be good base for
fermentation. Glucose and ammonium nitrate were identified as best carbon and nitrogen sources,
respectively for growth and production of more antimicrobial compounds. Similarly, initial production
medium pH of 7.0, incubation temperature of 30°C and incubation time of 96 h was found to be optimal.
Optimization of medium and cultural conditions resulted in better antibacterial and antifungal activity.
The zone of inhibition of ERI-26 against Aspergillus niger was 25 and 20 mm for Curvularia lunata,
respectively. It is clear that novel Stretomyces strains ERI-1, ERI-3 and ERI-26 produced extra cellular
antimicrobial metabolites effective against pathogenic bacteria and fungi, moreover the medium and
cultural conditions for better antimicrobial metabolites production have been optimized.
Key words: Streptomyces, antimicrobial activity, nutritional requirements, cultural conditions, optimized media.
INTRODUCTION
Streptomycetes are potent producers of secondary
metabolites. Among 10000 known antibiotics, 45-55% is
produced by Streptomycetes (Demain, 2006; Lazzarini et
*Corresponding author. E-mail: choiwh@korea.kr.
al., 2000). Secondary metabolites produced by them
have a broad spectrum of biological activities such as
antibacterial (streptomycin, tetracycline, chloramphenicol),
Arasu et al.
antifungal (nystatin), antiviral (tunicamycin), antiparasitic
(avermectin), immunosuppressive (rapamycin), anticancer (actinomycin, mitomycin C, anthracyclines), enzyme
inhibitors (clavulanic acid) and diabetogenic (bafilomycin,
streptozotocin).
Secondary metabolite production in microbes is strongly
influenced by nutritional factors and growth conditions. A
common strategy, widely applied in industrial screening
programs, consists of the application of several growth
conditions (including variables such as production media,
incubation time and other factors) to different strains
which has been studied (Vilella et al., 2000). There is
strong evidence that this approach improves the chances
of finding the desired metabolites (Lauren and Yit-Heng,
2011; Arasu et al., 2013). Considering that any screening
program of microbial natural products can handle a limited number of fermentations, applying many growth
conditions to each strain may critically restrict the number
of strains and therefore the diversity of biosynthetic pathways included in the screening. As a compromise between these two requirements, a number of conditions are
usually applied to each strain (Wildmans, 1997). Furthermore, without prior knowledge about the preferred growth
conditions for a given microorganism, random assignment of media to strains may generate an inefficient
redundancy of metabolites or extracts lacking relevant
levels of secondary metabolites. The production of secondary metabolites is affected by the availability of nutrients
(Valanarasu et al., 2010). In fermentation experiments,
the production of antibiotics is increased by the presence
of a non preferred carbon source, or by other nutrients
(Mohd et al., 2012). The source and availability of nitrogen can also influence the production of secondary metabolites (Arasu et al., 2008; Arasu et al., 2009).
In our screening programme for isolation and identification of actinomycetes from Westen Ghats of Tamil
Nadu for antimicrobial metabolite production, we isolated
367 actinomycetes from different parts of the forest soil
samples. Actinomycetes recovered from Kanyakumari
showed significant activity against most of the tested bacteria and fungi (Arasu et al., 2013). Among the different
actinomycetes; ERI-1, ERI-3 and ERI-26 isolates from the
Western Ghats region of Kanyakumari District revealed
significant activity against all the tested bacteria and fungi.
This study focused on optimizing nutrition and cultural
conditions of Streptomyces strain ERI-1, ERI-3 and ERI26 for the production of antimicrobial metabolites under
the shake-flask condition.
MATERIALS AND METHODS
Fermentation medium
Fermentations were carried out using eight different antimicrobial
compound production medium; GEN medium (M-1), Streptomyces
medium (M-2), Micromonospora medium (M-3), nutrient glucose
medium (M-4), Bennett medium (M-5), starch with a mineral salt
solution medium (M-6), complex medium (M-7) and starch casein
medium (M-8). A loopful of a selected strain was inoculated into 50
751
mL fermentation broth medium and incubated on a rotary shaker at
200 rpm, 30°C for 24 h. After that 10% of inoculum was transferred
to production medium containing 100 mL of fermentation medium in
500 mL Erlenmeyer flask. Different culture conditions like temperatures (20, 25, 30, 37 and 45°C), pH (6.0, 6.5, 7.0, 7.5, 8.0 and 8.5)
and incubation time (24, 48, 72, 96, 120 and 144 h) were studied to
standardize the antibiotic production. Effect of different carbon
source and nitrogen source for growth and antimicrobial compound
production in fermentation medium were evaluated. Different concentrations of sugar for production of antimicrobial compound and
growth were also studied. Influence of different concentrations of
sodium chloride in production medium was studied.
Antibacterial assay
Test organism
The following test organisms were used for antibacterial studies:
Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis
(MTCC 3615), Bacillus subtilis (MTCC 441), Enterococcus faecalis
(ATCC 29212), Escherichia coli (ATCC 25922), Pseudomonas
aeruginosa (ATCC 27853), Klebsiella pneumoniae (ATCC 15380),
Proteus vulgaris (MTCC 1771), Erwinia sp. MTCC (2760),
Xanthomonas sp., Vibrio fischeri (MTCC 1738) and Salmonella
typhi (MTCC 733). All cultures were obtained from Department of
Microbiology, Christian Medical College, Vellore, Tamil Nadu, India.
Each bacterial strain was inoculated in 3 mL of Mueller Hinton broth
and incubated at 37°C for 24 h. After incubation period the culture
was diluted.
Fungal strains
The following fungi were used for experiments: Trichophyton
rubrum (MTCC 296), Trichophyton rubrum (57/01), Trichophyton
mentagrophytes
(66/01),
Trichophyton
simii
(110/02),
Epidermophyton floccosum (73/01), Scopulariopsis sp. (101/01)
Aspergillus niger (MTCC 1344), Botyritis cinerea, Curvularia lunata
(46/01) and Candida albicans (MTCC 227).
Preparation of fungal spore
The filamentous fungi were grown on Sabouraud dextrose sgar
(SDA) slants at 28°C for 10 days and the spores were collected
using sterile doubled distilled water and homogenized. Yeast was
grown on Sabouraud dextrose broth at 28°C for 48 h.
Cup plate method
Antibacterial assays
Antibacterial activities were assayed by the agar diffusion method
by Arasu et al. (2013). Petri plates were prepared with 20 mL of sterile Mueller Hinton Agar (MHA) (Hi-media, Mumbai). The test cultures (100 µL) of suspension containing 108 CFU/mL bacteria) were
swabbed on the top of the solidified media and allowed to dry for 10
min. 5 mm diameter well was made using sterile cork borer and
filled with 0.05 mL of supernatant of ERI-1, ERI-3 and ERI-26. The
plates were left for 30 min at room temperature for supernatant
diffusion. Negative control was prepared using the respective fermentation medium. The plates were incubated for 24 h at 37°C. A
zone of inhibition was recorded in millimeters and the experiment
was repeated twice.
Antifungal assays
Antifungal
assay was done by agar diffusion method. Petri plates
752
Afr. J. Microbiol. Res.
Table 1. Effect of production of antimicrobial metabolites on different media.
B.s
S.a
S.e
E.f
Inhibition zones in mm
E.c P.a K.p X.sp. E.sp.
S.t
V.f
P.v
C.a
ERI-1
Medium -1
Medium – 2
Medium – 3
Medium – 4
Medium – 5
Medium – 6
Medium – 7
Medium – 8
12
10
12
14
10
12
10
12
10
12
10
12
12
13
14
12
10
12
23
14
15
10
10
14
12
10
15
12
10
10
10
11
14
10
10
10
10
10
11
10
10
9
10
10
10
12
9
10
12
11
12
12
12
12
10
10
11
10
10
10
10
9
13
10
9
10
14
10
12
ERI-3
Medium - 1
Medium – 2
Medium – 3
Medium – 4
Medium – 5
Medium – 6
Medium – 7
Medium – 8
10
12
10
10
15
11
11
12
12
11
9
10
12
10
14
13
12
11
9
10
11
14
10
10
10
9
11
10
10
11
9
10
12
10
10
12
10
11
9
11
12
10
9
10
10
12
10
10
10
15
10
12
10
10
10
12
ERI-26
Medium
Medium
Medium
Medium
Medium
Medium
Medium
Medium
9
11
10
12
11
11
10
9
9
13
11
14
12
10
11
11
14
12
14
12
10
10
10
10
10
12
10
10
11
15
9
9
10
-
9
11
-
10
12
-
12
-
10
-
14
-
10
-
10
10
10
10
Fermentation medium
–1
–2
–3
–4
–5
–6
–7
–8
-: No activity, ERI: Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus; S.e-S. epidermidis; E.f- E. faecalis; E.cE. coli; P.a- P. aeruginosa; K.p- K. pneumoniae; X.sp- Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P.
vulgaris. Results were analyzed in triplicates.
were prepared with 20 mL of sterile SDA (Hi-media, Mumbai). The
test cultures (50µL of fungal spore suspension) were swabbed on
the top of the solidified media and allowed to dry for 10 min. Five
mm diameter well was made using sterile cork borer and filled with
0.05 mL of supernatant of ERI-1, ERI-3 and ERI-26. The plates
were left for 30 min at room temperature for supernatant diffusion.
Negative control was prepared using the respective fermentation
medium. The plates were incubated for 24-48 h at 28°C. A zone of
inhibition was recorded in millimeters and the experiment was
repeated twice.
pound(s) from three actinomycetes strains ERI-1, ERI-3
and ERI-26. All the twelve tested bacteria and yeast
growth was inhibited by strain ERI-1 grown in M-1 and M8 medium. M-2 did not show any activity against K.
pneumoniae, Xanthomonas sp., Erwinia, S. typhi, V.
fischeri, P. vulgaris and C. albicans, whereas M-5 exhibited activity against only B. subtilis, S. aureus and S.
epidermidis (Table 1). ERI-3 cultivated in M-3, M-5 and
M-8 inhibited the growth of all the tested bacteria; however M-4 was ideal for ERI-26
RESULTS
Selection of fermentation medium
Effect of pH on the production of antimicrobial
compounds
Eight different fermentation media named as M-1 to M-8
were used as the base to determine the optimal nutritional conditions for the production of antimicrobial com-
Optimum pH for the production of antimicrobial compounds was recorded by diameter of zone of inhibition
(Table 2). At pH 7.0, ERI-1, ERI-3 and ERI-26 exhibited
Arasu et al.
753
Table 2. Effect of pH of the medium on the growth and production of antimicrobial metabolites.
pH
Inhibition zones in mm
Strain
ERI-1
DCW
6.0
ERI-3
DCW 0.98 g/L
ERI-26
DCW 1.23 g/L
DCW 1.74 g/L
ERI-3
DCW 1.32g/L
ERI-26
DCW 1.47 g/L
ERI-1
7.0
S.a
S.e
E.f
E.c
P.a
K.p
X.sp
E.sp
S.t
V.f
P.v
C.a
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
12
9
11
10
12
-
-
-
-
-
-
-
10
9
10
10
11
9
9
9
-
-
-
-
-
-
10
11
12
10
10
9
7
-
-
-
-
-
-
15
15
14
14
14
11
10
10
12
12
12
10
12
12
9
9
11
10
9
9
9
11
-
-
-
-
13
13
16
16
13
10
11
12
12
11
13
10
12
9
10
10
9
9
10
9
10
12
10
9
9
9
12
13
15
10
11
11
10
12
14
10
12
10
11
9
10
9
9
10
8
8
12
13
14
-
-
10
13
14
10
12
12
14
12
-
-
-
-
-
-
9
10
11
9
9
9
-
-
-
-
-
-
12
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
1.5g/L
ERI-1
6.5
B.s
DCW 2.47 g/L
ERI-3
DCW 2.21 g/L
ERI-26
DCW 2.73 g/L
ERI-1
DCW 2.4 g/L
7.5
ERI-3
DCW
2.75 g/L
ERI-26
DCW 2.43 g/L
ERI-1
8.0
DCW 1.41 g/L
ERI-3
DCW 1.28 g/L
ERI-26
DCW 0.79 g/L
ERI-1
8.5
DCW 0.42 g/L
ERI-3
DCW
0.61 g/L
ERI-26
DCW 0.72 g/L
-; No activity, ERI- Entomology Research Institute, DCW- dry cell weight. B.s - B. subtilis; S.a – S. aureus ;S.e - S. epidermidis; E.f - E.
faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia;S.t - S. typhi; V.f - V. fischeri;P.v - P.
vulgaris. Results were analyzed in triplicates.
good growth and antimicrobial activity against tested
bacteria. Cell growth in terms of biomass was noted in
strain ERI-3 as 0.98, 1.32, 2.21, 2.43, 0.79 and 0.72 g/L
for pH 6.0, 6.5, 7.0, 7.5, 8.0 and 8.5, respectively.
Optimizing the incubation time and temperature for
production of antimicrobial compounds
ERI-1,
ERI- 3 and ERI- 26 showed maximum antimicro-
754
Afr. J. Microbiol. Res.
Table 3. Effect of incubation time on growth and production of antimicrobial metabolites.
Time
24
48
72
Strain
S.a
9
S.e
10
E.f
-
S.t
-
V.f
-
P.v
-
C.a
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
10
12
10
9
11
12
13
11
12
10
12
12
10
9
10
12
9
10
11
10
10
12
11
10
10
10
10
9
11
12
9
10
11
9
11
10
10
10
9
9
10
11
10
11
12
12
10
12
11
11
10
10
ERI-3
DCW 4.01 (g/L)
ERI-26
DCW 3.9 (g/L)
12
11
12
10
11
13
10
9
12
10
12
10
10
10
12
11
12
13
10
11
12
12
10
13
10
10
ERI-1
9
10
9
9
10
9
10
10
9
10
9
10
10
ERI-3
12
10
11
11
10
11
9
10
10
9
11
10
10
DCW 3.79 (g/L)
ERI-26
DCW 4.0 (g/L)
10
9
11
10
10
9
11
12
9
10
10
10
9
ERI-1
DCW 1.27 (g/L)
ERI-3
DCW 0.7 (g/L)
ERI-26
DCW 0.86 (g/L)
ERI-1
DCW 2.8
ERI-3
DCW 2.46 (g/L)
ERI-26
DCW 2.1 (g/L)
ERI-1
DCW 3.21 (g/L)
DCW
96
Inhibition zones in mm
E.c P.a K.p X.sp E.sp
-
B.s
9
3.02 (g/L)
-; No activity, ERI- Entomology Research Institute, DCW- dry cell weight; B.s - B. subtilis; S.a- S. aureus; S.e- S. epidermidis; E.f E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f - V. fischeri;
P.v - P. vulgaris. Results were analyzed in triplicates.
bial activity after 24 h. At 48 and 72 h, it exhibited maximum cell growth as well as antibacterial activity (Tables 3
and 4). ERI-1, ERI-3 and ERI-26 did not exhibit activity at
20 and 45°C. It was not suitable for growth also. 30°C
was found to be optimum temperature for antimicrobial
metabolite production (Table 4).
Effect of glucose concentration on growth and
antimicrobial activity
Different concentration of glucose on growth and antibacterial activity was studied (Table 6). For ERI-1, ERI-3 and
ERI-26, the concentration of glucose from 6 to 12 g/L
enhanced the cell growth and the antimicrobial compound
production.
Effect of different carbon sources on growth and
antimicrobial activity
Effect of different carbon source on growth and antimicrobial activity was analyzed. Optimization of antibacterial
compound production was carried out in batch culture.
Strains were able to grow in all the tested carbon sources
(Table 5). However, ERI-1 and ERI-3 exhibited maximum
antimicrobial activity in medium supplemented with glucose as a sole carbon source followed by starch and fructose. ERI-26 was able to utilize glucose for better growth
and revealed maximum antibacterial activity.
Effect of different nitrogen source on growth and
antimicrobial activity
The results of nitrogen source utilization are shown in
Table 7. The higher growth and antibacterial activity were
observed in ammonium nitrate as nitrogen source followed by sodium nitrate and potassium nitrate in case of
ERI-1 and ERI-26. ERI-3 exhibited maximum growth and
antibacterial activity by using sodium nitrate followed by
ammonium nitrate.
Arasu et al.
755
Table 4. Effect of incubation temperature on growth and production of antimicrobial metabolites.
Temperature
20°C
30°C
37°C
45°C
Strain
ERI-1
ERI-3
ERI-26
ERI-1
ERI-3
ERI-26
ERI-1
ERI-3
ERI-26
ERI-1
ERI-3
ERI-26
B.s
10
11
9
10
9
9
10
-
S.a
11
9
11
10
10
11
11
-
S.e
11
11
12
9
10
10
-
E.f
14
13
10
11
9
9
-
Inhibition zones in mm
E.c P.a K.p X.sp E.sp
10 12
10
11
10
10 13
11
12
10
9
10
10
10
11
9
11
10
9
9
9
9
9
9
9
10
10
10
-
S.t
10
10
11
9
10
-
V.f
10
10
11
10
10
-
P.v
11
10
10
11
9
-
C.a
10
12
11
9
10
9
-
-: No activity, ERI- Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus; S.e- S. epidermidis; E.f- E. faecalis;
E.c- E. coli; P.a- P. aeruginosa; K.p- K. pneumoniae; X.sp- Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri;
P.v- P. vulgaris.Results were analyzed in triplicates.
Table 5. Effect of different carbon sources on growth and antimicrobial activity against S. epidermidis.
ERI-1
ERI-3
ERI-26
Carbon
Dry cell weight Antimicrobial activity Dry cell weight Antimicrobial activity Dry cell weight Antimicrobial activity
source
(g/L)
(mm)
(g/L)
(mm)
(g/L)
(mm)
Glucose
2.9
23
3.1
20
3
23
Starch
1.7
20
1.5
18
1.7
17
Sucrose
1.8
17
1.7
15
2
16
Starch
1.5
20
1.4
15
1.8
16
Maltose
2.7
18
2.9
17
2.5
18
Fructose
2.8
20
2.7
19
2.9
19
Mannitol
0.8
15
0.4
15
0.5
16
Mannose
1.7
15
1.5
15
1.8
15
Xylose
0.6
0
0.7
13
0.4
Glycerol
2.4
18
2.7
16
2.9
16
Results were analyzed in triplicates.
Table 6. Effect of different glucose concentration on growth and antimicrobial activity (against S. epidermidis).
ERI-1
ERI-3
ERI-26
Glucose
concentration
Dry cell Antimicrobial activity Dry cell
Antimicrobial activity
Dry cell
Antimicrobial activity
(g/L)
weight (g/L)
(mm)
weight (g/L)
(mm)
weight (g/L)
(mm)
2
0.72
0.45
0.91
12
4
1.25
0.93
1.43
12
6
2.37
14
1.73
16
2.30
15
8
3.11
17
2.54
17
3.10
17
10
3.73
17
3.1
19
3.80
20
12
3.68
22
3.04
19
3.90
22
14
3.24
22
2.73
18
2.40
22
16
2.43
20
2.64
18
2.34
22
18
1.40
20
1.56
14
2.10
18
20
0.91
18
1.24
14
2.03
18
Results were analyzed in triplicates.
756
Afr. J. Microbiol. Res.
Table 7. Effect of different nitrogen sources on growth and antimicrobial activity (against S. epidermidis).
Nitrogen source
Ammonium nitrate
Ammonium sulphate
Ammonium citrate
Sodium nitrate
Potassium nitrate
Dry cell
weight (g/L)
2.78
0.87
1.04
2.45
2.40
ERI-1
Antimicrobial
activity (mm)
21
14
15
20
19
Dry cell
weight (g/L)
2.42
1.27
0.73
2.75
2.35
ERI-3
Antimicrobial activity
(mm)
17
15
12
22
17
ERI-26
Dry cell Antimicrobial activity
weight (g/L)
(mm)
2.40
17
1.70
15
0.64
1.92
15
2.29
15
Results were analyzed in triplicates.
Table 8. Effect sodium chloride concentration on growth and antimicrobial activity (against S. epidermidis).
ERI-1
Sodium chloride
concentration Dry cell weight
Antimicrobial
(g/L)
(g/L)
activity (mm)
4
1.85
17
8
3.21
18
12
4.68
23
16
3.43
20
20
1.91
18
ERI-3
Dry cell
Antimicrobial
weight (g/L)
activity (mm)
1.93
18
2.84
18
3.64
24
2.94
20
1.54
19
ERI-26
Dry cell
Antimicrobial
weight (g/L)
activity (mm)
1.93
18
3.71
21
3.53
22
2.14
22
1.33
21
Results were analyzed in triplicates.
Effect of sodium chloride on growth and antimicrobial
activity
Effect of different concentration of sodium chloride on
growth and antibacterial activity was studied. Increase in
concentration of sodium chloride in the medium influenced the growth and antimicrobial compound production
(Table 8). A concentration of 12 g/L was good for growth
as well as antimicrobial activity for the strains. There was
a decline in growth and antimicrobial activity after 20 g/L.
Optimized media on antimicrobial activity
Optimized media showed good activity as compared to
normal fermentation media. Secondary metabolites from
strain ERI-1 showed good antimicrobial activity in optimized media (M-4 media containing 12 g/L glucose, 1.2
g/L ammonium nitrate, 12 g/L sodium chloride, pH 7.0,
temperature 30°C and incubation time 72 h). It was 1.5
times more than the normal media (Table 9). ERI-3 cultivated in M-8 media containing 12 g/L glucose, 1.2 g/L
sodium nitrate, 12 g/L sodium chloride, pH 7.5, temperature 30°C and incubation time 72 h revealed good production of antimicrobial metabolite in the broth. M-4
media components with 12 g/L of glucose, 1.2 g/L ammonium nitrate, 12 g/L sodium chloride, pH 7.0, temperature
30°C and incubation time 72 h influenced ERI-26 for
better production of antimicrobial metabolites.
Effect of fermentation media on antifungal activity
Fermentation media were also checked against fungal
pathogens. It was observed that strain ERI-26 greatly
suppressed the growth of all the chosen fungal strains as
compared to strain ERI-1 and ERI-3 (Table 9). Among all
the fungi, A. niger and C. lunata showed significant inhibition.
DISCUSSION
Cultivation of different complex media signalized the ability for secondary metabolite production and the influence
of inoculum stage conditions. Arasu et al. (2008) reported
that antagonistic properties are largely influenced by the
quality of the medium. Eight different fermentation media
were used for the selection of best antimicrobial metabolite production. Medium-4 (modified nutrient glucose
agar media) was chosen as the best base for the production and antimicrobial metabolite production for ERI-1
and ERI-26. ERI-3 cultured in M-8 was the best source
for antimicrobial metabolite production. Our results indicated that MNGA was the good base for antimicrobial
metabolite production; however Augustine et al. (2005)
reported that starch casein medium was found to be good
base for antifungal metabolite production.
Optimizations of fermentation conditions are necessary
to improve secondary metabolite formation. Dissolved
oxygen tension was identified to influence the productivity
Arasu et al.
757
Table 9. Antimicrobial activity of optimized fermentation medium.
Strain
ERI-1
ERI-3
ERI-26
B.s
22
22
21
S.a
18
20
23
Antibacterial activity (Inhibition zones in mm)
S.e E.f E.c P.a
K.p
X.sp
E.sp
18
19
15
16
23
18
15
21
12
11
10
12
15
10
20
15
13
12
10
11
11
S.t
15
12
11
V.f
15
10
10
P.v
10
13
11
T.m
15
Anfungal activity (Inhibition zones in mm)
E.f
T.s
C.l
A.n B.c
T.r 296
T.r 57
15
10
20
25
10
15
18
Scro
10
C.a
18
- ; No activity, ERI- Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus ; S.e- S. epidermidis; E.f- E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.;
E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P. Vulgaris; T.m- T. mentographytes; E.f- Epidermophyton floccosum; T.s- T. simii; C.l- Curvularia lunata; A.n- Aspergillus niger; B.c- Botrytis cinerea; T.rTrichophyton rubrum; Scro- Scropulariopsis sp.; C.a- Candida albicans. Results were analyzed in triplicates. Among the fungus, only Candida albicans was used in the initial antimicrobial screening
such as effect of different medium, different temperature, different pH and different incubation time, respectively.
of several processes concerning bioactive compound (Ya-Jie et al., 2009). Possibility to enlarge
secondary metabolite formation with high oxygen
levels is a strong dependency of oxygen with the
enzymatic reactions of product formation. Kim et
al. (2000) reported a 7-fold enhancement of
kasugamycin production by pH shock in batch
culture of Streptomyces kasugaensis. It is well
known that environmental signals, including pH
shock, can stimulate and promote the biosynthesis of secondary metabolites. Kim et al. (2007)
reported that when the pH was maintained at 5,
production of geldanamycin was increased from
414 to 768 mg/L. Nadia et al. (2004) studied the
effects of temperature, pH, incubation period,
some media and different nitrogen and carbon
sources for the production of antimicrobial metabolite production. Temperature of 35°C and pH 8
were the best for growth and antimicrobial agent
production and 14 to 15 days of incubation was
found to be the best for maximum growth and
antimicrobial activity, respectively, in the medium
BG-11.
We found that medium with glucose and fructose showed maximum antimicrobial metabolite
production and cell growth. Ammonium nitrate and
sodium nitrate were found to be the best nitrogen
source for the antimicrobial metabolite production.
They influence the growth, as well as the
antimicrobial metabolite production of the
actinomycetes strains. Nadia et al. (2004) reported that leucine was the best nitrogen source for
antimicrobial activity, while maximum antimicrobial
activity was introduced by using the carbon sources, citrate and acetate. Our results indicated that
more antimicrobial activity was found when the
carbon source is glucose in combination with the
nitrogen source ammonium nitrate. The effects of
nitrogen sources on streptolydigin production and
distribution of secondary metabolites from
Streptomyces lydicus were investigated in shake
flask level (Liangzhi et al., 2007). When soybean
meal was used as the source of nitrogen, three
analogues of streptolydigin were detected. Among
the nitrogen sources glutamic acid was most
favorable for the formation of streptolydigin
(Liangzhi et al., 2007).
ERI-1, ERI-3 and ERI-26 were able to grow in all
the tested carbon sources. However maximum
growth and antimicrobial activity was obtained in
medium supplemented with glucose followed by
fructose. Fermentation medium supplemented
with glucose enhanced the growth and antimicrobial metabolite synthesis. The highest activity was
obtained in media containing ammonium nitrate as
a nitrogen source, followed by sodium nitrate and
potassium nitrate. Strains cultivated at 30°C were
optimum for good growth and antimicrobial metabolite production. The results also indicated an
incubation time of 96 h as optimal. Cruz et al.
(1999) reported that the production of antibiotic by
S. griseocarneus was increased by glucose.
Gupte and Kulkarni reported that three independent variables, namely concentration of carbon
source (glucose), nitrogen source (soybean meal)
and temperature of incubation, were found to be
the most important for the production of antimicrobial metabolites (Gupte and Kulkarni, 2000). In
general, Streptomyces sp. grew best in media
containing carbon and nitrogen sources, including
chitin, starch, glycerol, arginin, asparagine, casein
and nitrate (Locci, 1989).
Results of the present work indicated that the
selected actinomycetes possess antibacterial and
antifungal properties in liquid broth. This explains
that the antimicrobial metabolites are extra cellular
in nature. Conditions such as pH, temperature and
incubation period were optimized. Best me-dium
for growth and antimicrobial metabolite production
were selected on the basis of antimicrobial activity.
Modified nutrient medium with glucose as a carbon source was found to be good base for fermentation. Best nitrogen source was selected
based on the growth and antimicrobial activity. From
758
Afr. J. Microbiol. Res.
the present investigations, it was clear that ERI-1, ERI-3
and ERI-26 were found to produce extra cellular antimicrobial metabolites.
ACKNOWLEDGEMENTS
We thank "Cooperative Research Program for Agriculture
Science and Technology Development (Project No.
PJ008502)" Rural Development Administration, Republic
of Korea. The authors extend gratitude to The Director,
Entomology Research Institute, Loyola College, Chennai.
Authors are thankful to Addiriyah Chair for Environmental
Studies, Department of Botany and Microbiology, College
of Science, King Saud University, Saudi Arabia for financial assistance.
REFERENCES
Arasu MV, Al-Dhabi NA, Saritha V, Duraipandiyan V, Muthukumar
C, Kim SJ (2013). Antifeedant, larvicidal and growth inhibitory
bioactivities of novel polyketide metabolite isolated from
Streptomyces sp. AP-123 against Helicoverpa armigera and
Spodoptera litura BMC Microbiol. 13:105.
Arasu MV, DuraipandiyanV, Agastian P, Ignacimuthu S (2008).
Antimicrobial activity of Streptomyces spp. ERI-26 recovered
from Western Ghats of Tamil Nadu. J. Med. Mycol. 18:147-153.
Arasu MV, Duraipandiyan V, Agastian P, Ignacimuthu S (2009). In
vitro antimicrobial activity of Streptomyces spp. ERI-3 isolated
from Western Ghats rock soil (India). J. Med. Mycol. 19: 22-28.
Arasu MV, Ignacimuthu S, Agastian P (2012). Actinomycetes from
Western Ghats of Tamil Nadu with its antimicrobial properties.
Asian Pac. J. Trop. Med. S830-S837.
Augustine SK, Bhavsar OSP, Kapadnis BP (2005). Production of a
growth dependent metabolite active against dermatophytes by
Streptomyces rochei AK 39. Ind. J. Med. Res. 121:164-170.
Cruz R, Arias ME, Soliveri J (1999). Nutritional requirements for the
production of pyrazoloisoquinolinone antibiotics by Streptomyces
griseocarneus NCIMB 40447. Appl. Microbiol. Biotechnol.
53:115-119.
Demain AL (2006). From natural products discovery to commercialization: a success story. J. Ind. Microbiol. Biotechnol. 33:486-495.
Gupte MD, Kulkarni PR (2002). A study of antifungal antibiotic
production by Streptomyces chattanoogensis MTCC 3423 using
full factorial design. Lett. Appl. Microbiol. 35:220-226.
Kim CJ, Chang YK, Chun GT (2000). Enhancement of kasugamycin
production by pH shock in batch cultures of Streptomyces
kasugaensis. Biotech. Prog. 16:548-552.
Kim YJ, Song JY, Moon MH, Smith CP, Hong SK, Chang YK (2007).
pH shock induces overexpression of regulatory and biosynthetic
genes for actinorhodin production in Streptomyces coelicolor
A3(2). Appl. Microbiol. Biotechnol. 76:1119-1130.
Lauren BP, Yi T, Yit-Heng C (2011). Metabolic engineering for the
production of natural products. Annu. Rev. Chem. Biomol. 2:211236.
Lazzarini A, Cavaletti L, Toppo G, Marinelli F (2000). Rare genera of
actinomycetes as potential producers of new antibiotics. Antonie
van Leeuwenhoek 78:399-405.
Liangzhi LI, Bin Q, Yingjin Y (2007). Nitrogen sources affect streptolydigin production and related secondary metabolites distribution of Streptomyces lydicus. Chin. J. Chem. Eng. 15:403-410.
Locci R (1989). Streptomyces and related genera. In: Stanley T.
Williams, M. Elizabeth. Sharpe, and John Holt, editors. Bergey’s
manual of systematic bacteriology. Baltimore: Williams Co.
Mohd HI, Hawa ZEJ (2012). Primary, secondary metabolites, H2O2,
malondialdehyde and photosynthetic responses of Orthosiphon
stimaneus Benth. to different irradiance levels. Molecules
17:1159-1176.
Nadia HN, Abdel FM, Khaleafa SHZ (2004). Factors affecting antimicrobial activity of Synechococcus leopoliensis. Microbiol. Res.
159:395-402.
Valanarasu M, Kannan P, Ezhilvendan S, Ganesan G, Ignacimuthu
S, Agastian P (2010). Antifungal and antifeedant activities of
extracellular product of Streptomyces spp. ERI-04 isolated from
Western Ghats of Tamil Nadu. J. Med. Mycol. 20:290-297
Vilella D, Sánchez M, Platas G, Salazar O, Genilloud O, Royo I,
Cascales C, Martín I, Díez T, Silverman KC, Lingham RB, Singh
SB, Jayasuriya H, Peláez F (2000). Inhibitors of farnesylation of
ras from a natural products screening program. J. Ind. Microbiol.
Biotechnol. 25:315-327.
Wildmans H (1997). Potential of tropical microfungi within the
pharmaceutical industry. In: Hyde KD, editor. Biodiversity of
tropical microfungi. Hong Kong: Hong Kong University Press; pp.
29-46.
Ya-Jie T, Wei Z, Jian-Jiang Z (2009). Performance analyses of a
pH-shift and DOT-shift integrated fed-batch fermentation process
for the production of ganoderic acid and Ganoderma polysaccharides by medicinal mushroom Ganoderma lucidum. Bioresour
Technol 100: 1852–1859.
Vol. 8(8), pp. 759-765, 19 February, 2014
DOI: 10.5897/AJMR12.2078
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Incidence of Aspergillus contamination of groundnut
(Arachis hypogaea L.) in Eastern Ethiopia
Abdi Mohammed1 and Alemayehu Chala2*
1
Bule Hora University, P. O. Box 144, Bule Hora, Ethiopia.
2
Hawassa University, P. O. Box 05, Hawassa, Ethiopia.
Accepted 23 January, 2014
The production of groundnut is constrained by several factors, among which is Aspergillus spp. In
addition to causing quantitative losses, Aspergillus spp. produce highly toxic and carcinogenic
chemical substances known as aflatoxins. This study was conducted with the objectives to (i) identify
Aspergillus species associated with groundnuts, (ii) determine the frequency of seed contamination,
and (iii) survey agro-ecological conditions related to groundnut contamination by Aspergillus spp.
About 270 groundnut samples were collected from farmers’ storage, fields and local markets of three
districts that is, Babile, Darolabu and Gursum of Eastern Ethiopia for mycological analysis in the year
2010. Results of the mycological analysis suggested heavy infestation of groundnut samples by various
molds including Aspergillus niger, Aspergillus flavus, Aspergillus ochraceus, Aspergillus parasiticus
and Pencillium species. At the district level, the incidence of infected groundnut kernels ranged from 50
to 80%. Within the district kernel infection varied between 36.3 and 100%. The common Aspergillus
symptoms (yellowing or chlorotic leaves, wilting, drying and brown or black mass covered by yellow or
greenish spores) were also observed in groundnut fields. The current results were consistent with our
earlier report of heavy aflatoxin contamination of groundnut from the same places, suggesting the
urgent need to apply control measures against toxigenic fungi and associated mycotoxins.
Key words: Aspergillus spp., groundnut, Penicillium spp., Ethiopia.
INTRODUCTION
Groundnut (Arachis hypogaea L.) is an important food
and feed crop, which also serve as component of crop
rotation in many countries (Pande et al., 2003;
Upadhyaya et al., 2006). Groundnuts are also significant
source of cash in developing countries that contribute
significantly to food security and alleviate poverty (Smart
et al., 1990). Developing countries account for 97% of the
world’s groundnut area and 94% of the total production
(FAOSTAT, 2010). However, groundnut yield in this part
of the world and particularly in Africa is lower than the
world average due to prevailing abiotic, biotic and socioeconomic factors (Pande et al., 2003; Upadhyaya et al.,
2006; Caliskan et al., 2008).
In warm climates grains are easily infected with toxige-
nic microorganisms like Aspergillus species. Aspergillus
spp. are facultative parasites. They invade host plant
tissues directly or attack tissues that have been predisposed by environmental stresses such as dry weather or
damages caused by insects, nematodes, natural cracking, and harvest equipment (Pettit and Taber, 1968).
They are distributed worldwide, mainly in countries with
tropical climates that have extreme ranges of rainfall,
temperature and humidity (Pettit and Taber, 1968). Many
strains of this fungus are capable of producing aflatoxins
that render the seed unacceptable due to high toxicity for
human or animal consumption (Reddy et al., 1996).
Aflatoxins are highly toxic metabolites associated with
Reye’s syndrome, Kwashiorkor and acute hepatitis
*Corresponding author E-mail: alemayahuchala@yahoo.com. Tel: +251 912 163096. Fax: +251 46 2206517.
760
Afr. J. Microbiol. Res.
(Wild and Hall, 1999; Wild and Turner, 2002).
The Eastern lowland areas of Ethiopia have considerable potential for increased oil crop production including
groundnut. Particularly areas such as Babile, Darolabu
and Gursum are the major producers of groundnuts for
local and commercial consumption (Getnet and Nugussie,
1991; Chala et al., 2012). Nevertheless, the area may
also be very conducive for toxigenic fungi like Aspergillus
spp. owing to its warm and dry climate. Moreover, farmers’ practices of production and handling of groundnut
at pre- and pos-harvest stages may provide favorable
conditions for outbreaks of fungi and their mycotoxins. As
Chala et al. (2012) reported, groundnut from East Ethiopia is heavily contaminated by aflatoxins at levels much
more than international standards, and this might be
associated with infection of the crop with Apsergillus spp.,
mainly A. falvus and A. parasiticus that are known producers of aflatoxins. However, up to date information on the
prevalence of fungi, and studies on environmental factors
and farmers’ practices that promote fungal contamination,
which could be basis for the reduction of mycotoxins are
limited under Ethiopian conditions. On the other hand,
such studies are of paramount importance to give valid
recommendations for safe consumption and marketing of
groundnut. The objectives of this study were to: i) identify
Aspergillus species associated with groundnut in East
Ethiopia, ii) determine the frequency of seed contamination, and iii) survey agro-ecological conditions related to
contamination of groundnut by Aspergillus spp.
MATERIALS AND METHODS
Surveys of groundnut and sample collection
Groundnut samples were collected from three districts (Babile,
Darolabu and Gursum) of Eastern Ethiopia in the year 2010. The
samples were collected in three groups that is, from farmers’ stores,
fields and from local markets of selected locations of the three districts. Geographic description of survey locations are given in Table
1. In each district, five locations were chosen based on the groundnut productions potential. Six samples were collected from each
location and hence 30 samples were collected per district making
the total number of samples collected from all over the three districts 270 (3 districts × 5 locations per district × 6 samples per
location × 3 sample groups per district). Data were also gathered on
planting and harvesting dates of the crop, the variety, soil type,
previous crop, and types of cultural practices. The common
methods of storage structures, drying materials and grain moistures
were observed.
Fungal isolation, species identification
Fungal isolation
Fifty groundnut seeds per sample were surface sterilized with 10%
Chlorox solution for 1 min, followed by immersion in sterile distilled
water for 1 min. Surface sterilized seeds were then placed on
freshly prepared potato dextrose agar (PDA) plates (five seeds per
plate) and incubated for three days at 25°C. Pure cultures of
different out growing fungi were obtained by transferring fungal
colonies to new PDA plates using sterile toothpicks, and incubating
the plates for 5-7 days at 25°C. Pure cultures of each isolate were
then stored at 4°C in vials containing 2.5 ml of sterile distilled water
for further use.
Species identification
Isolates were identified to a species level based on morphological
(phenotypic) features as described by Cotty (1994), Egel et al.
(1994), Kurtzman et al. (1997), and Okuda et al. (2000). For this
purpose: Isolates representing each pure culture were grown on
Czapek Dox Agar (CZDA) and PDA at 25°C for 5-7 days. Fungal
colonies that grew rapidly and produced colors of white, yellow,
yellow-brown, brown to black or shades of green, mostly consisting
of a dense felt of erect conidiophores were broadly classified as
Aspergillus spp. while those that produce blue spores were
considered as Pencillium spp. (Okuda et al., 2000). Isolates with
dark green colonies and rough conidia were considered A.
parasiticus (Klich, 2002). The major distinction currently separating
A. niger from the other species of Aspergillus is the production of
carbon black or very dark brown spores from biseriate phialides
(Raper and Fennell, 1965). Those that showed brown colony with
orange and cream reverse sides were considered A. sojae and A.
oryzae, respectively (Cotty, 1994). Those, which produce conidia
with smooth surface on CZDA and colonies typical of A. flavus were
recorded as A. flavus.
Data analysis
Data on frequencies of kernel infection by Aspergillus and
Penicillium species for samples collected from different locations of
the districts were subjected to analysis of variance (ANOVA) using
the SAS computer package, version 9.11 (SAS, 2003). LSD test at
the 0.05 probability level was used for mean comparison.
RESULTS AND DISCUSSION
Identification of Aspergillus species associated with
groundnut
Four different Aspergillus spp. were found to be associated with groundnut samples collected from Eastern
Ethiopia (Figure 1). The first species isolated from the
collected samples was A. niger. The major distinction
currently separating A. niger from the other species of
Aspergillus is the production of carbon black or dark
brown spores of biseriate phialides (Raper and Fennell,
1965). The current study also confirmed the production of
black or brown-black or black conidia by this species
(Figure 1).
A. flavus was the second species identified in this
study. Colonies of this fungus were characterized by
yellow to dark, yellowish-green pigments, consisting of a
dense felt of conidiophores or mature vesicles bearing
phialides over their entire surface (Gourama and Bullerman,
1995). In general, A. flavus was known as a velvety,
yellow to green or the old colony was brown mould with a
goldish to red-brown on the reverse. The conidiophores
were variable in length; walls of A. flavus conidia were
smooth to finely roughened or moderately roughened,
pitted and spiny. These observations were consistent
with the findings of Gourama and Bullerman (1995), who
reported A. flavus colonies as being initially
Mohammed and Chala
761
Table 1. Geographic description of locations included in the survey.
District
Location
Ausharif
Shekabdi
Shekusman
Ifa
Bishan Babile
Latitude
0
09 11’933”
0
09 12”890”
0
09 12’89”
0
09 17’762”
09015’872”
Longitudes
0
042 13’080”
042013’65”
0
042 13’105”
042017’161”
042018’049”
Altitude (m)
1733
1437
1784
1500
1500
Darolabu
Sakina
Gadulo
Odalaku
Sororo
Haroadi
08035’023”
0
08 26’078”
08035’067”
08035’036”
08034’954”
040020’388”
0
040 15’732”
040019’842”
040019844”
040020’280”
2100
1400
1760
1608
1788
Gursum
Audal
Ilalam
Kassa oromiya
Oda oromiya
Harobate
09 37’297”
0
09 37’268”
09037’282”
09037’273”
09037’298”
Babile
A. niger
A. ochraceus
A. niger
A. ochraceus
0
A. flavus
A. parasiticus
Figure 1. Aspergillus spp. isolated from groundnut samples.
Figure 2. Symptoms of Aspergillus infection on groundnut.
yellow, turning to yellow-green or olive green with age
and appearing dark green with smooth shape and some
having radial wrinkles.
The third species identified in the current work, A.
ochraceoroseus, produced yellow-gold conidia (Bartoli
and Maggi, 1978). The A. ochraceus was characterized
particularly by its pale yellow conidial heads, orange-red
conidiophores with coarsely roughened walls, light
0
042 43’951”
0
042 43’758”
042043’610”
042043’633”
042043’832”
1792
1838
1650
1732
1550
colored sclerotia, and salmon-pink mycelial turf on the
reverse side of CZDA. Colonies of this species also
produced near white to light yellow pigment and were dull
yellow to dark yellow or sometimes brown on the reverse.
A. parasiticus was the fourth species isolated from
groundnut samples tested in the current study. Colonies
representing this species produced dark green and rough
conidia on CZDA at 25 and 37°C after 5-7 days of
incubation. Similar study by Peterson et al. (2001)
distinguished A. parasiticus from A. bombycis by its
typically dark green color on CZDA.
Groundnut plants infected by Aspergillus spp. showed
typical symptoms of infection as shown in (Figure 2).
These include yellowing of leaves or chlorosis and
premature death and dropping of leaves, wilting, drying
single plant and patching or drying of localized areas
within the fields. Underground grains were rotten and
distorted, and the plants were pulled out of the ground
easily. On some dried plants, brown or black mass
covered by yellow or greenish spores were observed in
infected fields. A study by Subrahmanyam and
Ravindranath (1988) stated the presence of shriveled and
dried grains covered by yellow or green spores, when
groundnut plants are infected by A. flavus (Aflaroot or
yellow mold). The same study reported highly stunted
seedlings; reduced leaf size with pale to light green;
crown rot or collar rot, with germinating seeds covered
with masses of black conidia; and rapid drying of plants
due to infection of groundnut by Aspergillus spp.
Frequency of kernel contamination
Proportion of kernel contamination by Aspergillus spp.
varied from 50% at Babile market to about 80% at farmers’
762
Afr. J. Microbiol. Res.
Figure 3. Proportion of groundnut kernels infected with Aspergillus spp. in East
Ethiopia (N= 150 seeds/samples).
fields in Gursum district and storage houses in the district
of Darolabu (Figure 3). Groundnut samples collected
from storage houses in the districts of Gursum and
Babile, and farmers’ fields at Babile had the second highest kernel contamination (70%).
When samples were analyzed at the location level
(within district), kernel contamination varied significantly
(p<0.05) from 36% at Bishan Babile market (Babile
district) to 100% in farmers’ fields of Harobate (Gursum
district) (Table 2). Samples from stores in Bishan Babile
and Shekabdi kebeles (Babile district), stores in Sororo
location of Darolabu district, farmers’ field in Kasa Oromiya
of Gursum district were infected at a proportion of 93%.
In addition, groundnut samples collected from farmers’
fields in Ausharif and Shekabdi location of Babile district,
stores of Sakina and Odalaku (Darolabu district), and
stores of Audal and Harobate in Gursum district were
found to be contaminated at a rate of 90%. On the other
hand, samples from markets at Shekusman location
(Babile district), Sororo of Darolabu district and Oda
Oromiya (Gursum district) had only 43% kernel infection.
Generally, the current results suggest heavy contamination of groundnut kernels with Aspergillus spp. Groundnut
samples collected from markets had the lowest level of
Aspergillus infection compared to samples from farmers’
fields and stores across the survey districts and locations.
This may suggest possible sorting of kernels by farmers
to avoid those with visible symptoms of infection
(discoloration) before bringing the samples to the local
markets. The results were in agreement with the study by
Pitt and Hocking (2009) in which Aspergillus spp. were
more prevalent in the field and stored foods than in the
markets.
The frequency of Aspergillus isolated from the groundnut samples analyzed in the current study is presented in
Table 3. Of the several species isolated from the ground-
nut samples, A. niger and A. flavus were the most prevalent mycotoxigenic fungi across the storage, field and
market samples in East Ethiopia. These two species
were isolated at a rate of 21-48% (A. flavus) and 35-66%
(A. niger). On the other hand, A. ochraceus accounted for
0-14%, while A. parasiticus was associated with 2-21% of
kernel infection. Pencillium spp. were also isolated from
6-13% of samples analyzed (data not shown). In another
experiment, Eshetu (2010) reported the most frequent
occurrence of Aspergillus spp. (A. flavus, A. niger and
other Aspergilli) in wet shelled one year stored peanut
sample from Gursum district of Hararghe region in East
Ethiopia.
In this study; A. flavus and A. niger were isolated at
higher frequencies from samples collected from farmers’
fields and stores than markets while A. parasiticus was
consistently isolated at higher frequencies from market
samples. In contrast to these, isolation frequency of A.
ochraceus was not consistently high or low in any of the
sample collection sites (fields, markets and stores)
across the survey districts. The current results were consistent with Chala et al. (2012), who detected 5-11,900
µg/kg total aflatoxin from same samples suggesting
heavy groundnut contamination by Aspergillus spp. and
associated aflatoxins in the region. Aspergillus flavus and
aflatoxins contamination was also prevalent in stored
groundnuts in Ghana (Awuah and Kpodo, 1996). Abdela
(2009) also reported contamination of groundnut samples
from Sudan by A. niger and A. flavus, which were isolated at frequencies of 29-60% for A. niger and 4-52% for
A. flavus. Fusarium oxysporum, A. niger, R. bataticola
and S. rolfisii were the predominant species of fungi
associated with diseased plants indicating the involvement of these fungi in pre- and post- emergence death of
groundnut plants in Babile district (Tefera and Tana,
2002).
Mohammed and Chala
763
Table 2. Proportion of groundnut seeds infected by Aspergillus spp. in different
districts of East Ethiopia.
District
Location
Babile
Ausharif
Shekusman
Shekabdi
Ifa
Bishan babile
LSD (0.05)
CV (%)
Percent kernel infection
Store
Field
Market
c
a
bc
50
90
53.3
b
b
cd
70
63
43.3
a
a
a
93.3
90
70
b
b
66.7
63
56b
a
b
93.3
70
36.3cd
12
11
21.8
14
13
20
Darolabu
Sakina
Gadulo
Odalaku
Sororo
Haroadi
LSD (0.05)
CV (%)
90a
b
73.3
a
90
a
93
66.7b
12
12
70b
b
53.3
56.7b
b
53.3
a
76
11
15
56.7ab
a
66.7
66.7a
c
43
46.7bc
11
17
Gursum
Audal
Ilalam
Kasa Oromiya
Oda Oromiya
Harobate
LSD (0.05)
CV (%)
90a
56.7c
63.3b
73.3b
90a
13.4
15
73.3b
70b
93.3a
66.7b
100a
11
11
56.7c
66ab
65bc
43.3cd
46.7cd
7
12
Means in a column followed by the same letter are not significantly different according
to LCD at p<0.05.
Table 3. Frequency of Aspergillus species isolated from groundnut seeds collected
from three districts in East Ethiopia.
Percent kernel contamination
Store
Field
Market
20.5
29
26.25
66
47.8
38.75
3.6
14
21.25
9.8
9.7
13.75
District
Fungal specie
Babile
A. flavus
A. niger
A. parasiticus
A. ochraceus
Darolabu
A. flavus
A. niger
A. parasiticus
A. ochraceus
31
56
4
9
32.6
53.6
2.1
10.5
33.7
41
10.8
8.7
Gursum
A. flavus
A. niger
A. parasiticus
A. ochraceus
48.2
34.82
4.46
9.82
41
40.5
10.74
7.43
34.5
39
14.3
0
Description of local groundnut varieties around
selected areas
Description of groundnut varieties in around Babile and
Gursum districts are different from that of Darolabu
districts. Their naming was based on the morphology
standing from the ground and leaf shape, size, color and
seed size. Around Babile and Gursum districts, the common
764
Afr. J. Microbiol. Res.
local groundnut varieties were “Oldhale”, “Sartu”, and
“Jawsi” (Data from Agricultural and Rural Develop-ment
Bureaus of the distritcs). Another similar study re-ported
that predominant groundnut local variety (Oldhale) was
commonly produced by farmers around Babile district
(Tefera and Tana, 2002). The shape and leaf size of
these three varieties were different from each other. Two
groundnut varieties that is, “Basuqa”and “Qacine” are
found to grow commonly around Darolabu district. They
are identified based on the plant morphology and seed
size. The “Basuqa” variety has larger seeds and leaves
than “Qacine”. It gives higer yield than “Qacine”. But it is
more susceptible to diseases and drought as revealed by
the Agricultural and Rural Development Bureau of the
district.
Factors
associated
with
Aspergillus
spp.
contamination of groundnuts in the study areas
Cultural practices
Across the study areas, the groundnut shell is removed
and left in farms, on the roads or water furrows then
irrigation water takes it to the farms and gardens. Such a
scenario generally favors over seasoning of plant pathogens including Aspergillus for subsequent contamination
of the next crops. Besides, groundnut in the survey districts is cultivated either as a sole crop or intercropped
with different crops like sorghum (Sorghum bicolor), maize
(Zea mays), haricot bean (Phaseolus vulgaris), and under
the shade of chat (Khata edulis), coffee (Coffea arabica)
and mango (Mangifera indica) trees. Although intercropping is generally known to decrease disease pressure in
agricultural fields, the companion crops in groundnut
fields may not be very effective against Aspergillus spp.
Mechanical damages caused during pulling and digging
out groundnuts may also have predisposed kernels to
infection by Aspergillus and associated aflatoxins. Seeds
in split pods are frequently invaded by A. flavus and
subsequently become contaminated with aflatoxin as
suggested by (Graham, 1982). Shriveled kernels contain
higher amounts of aflatoxin as a result of higher A. flavus
infection (Hill et al., 1984). Other factors, which may aid
the contamination of groundnut with Aspergillus and then
aflatoxins might be exchanging of equipment or plowing
materials and groundnut seeds between households.
Time of planting and harvesting of groundnuts
Rain fall is usually unpredictable at the time of planting
and harvesting around the study areas. The planting time
of groundnut around the study areas usually lasts from
the beginning of April to the end of May, and the harvesting time is from the end of September to the first half
of November according to the field conditions and availability of labor. However, pods may overstay in the field
after optimum maturations due to lack of labor, which
further increases Aspergillus infection. Drought stress
during late stages of pod development favors inva-sion of
groundnut by A. flavus and subsequent aflatoxin contamination. End of season drought was very critical as it
affects grain filling and pod formation in groundnut (Hill et
al., 1984).
Drying method of groundnut around the study areas
Groundnut crops harvested in the survey districts are
usually sun dried on materials such as matting. Curing of
groundnut was done for few days in the farms before
drying and removing of the seed from the hulms, to remove some moisture content from the kernels. In cases,
where the moisture content of threshed unshelled and
shelled pods was too high, the pods were sometimes
bagged and every day the bags were brought out from
the stores and left in the open. Although such practices
may help reduce Aspergillus invasion, it would have been
made more effective had it been coupled with fumigation
with burning cow dung fumes and sun drying for one day
as suggested by Gehewande et al. (1986).
Traditional groundnut storage system
Storage structures commonly found in the survey districts
are made from mud and animal dung. In mud house
there was no improved aerations in some stores and in
some rain could percolate from the top and from the
sides. Groundnuts in such houses are usually stored in
sacks from the previous years, and this may also
increase the contamination of groundnuts by Aspergillus
and aflatoxins. Dickens et al. (1973) associated moisture
condensation on roofs, improper application of insecticide
sprays or leaking hoses and application equipment,
conveyance of water from flooded elevator dump pits into
warehouse, and storage of peanuts on concrete floors
that are damp or have no vapor barriers with increased A.
flavus growth. According to Bankole and Adebanjo
(2003), traditional storage structures used for on farm
storage include containers made of plant materials
(woods, bamboo, and thratch).
Conclusion
Results of the current survey revealed heavy contamination of groundnuts by Aspegillus spp. Infection of kernels
were higher in farmers’ store and farmers’ fields than
markets with incidence of kernel infection at district level
ranging from 36% at Babile market to 100% at Gursum
field. A. niger and A. flavus were the most dominant species infecting groundnuts in East Ethiopia.
In combination with our earlier report on aflatoxin
contamination of groundnut from East Ethiopia, the current results should serve as a wakeup call to create aware-
Mohammed and Chala
ness on toxicogenic fungi and associated mycotoixns in
the country. As aflatoxins are associated with health
risks, reducing their level in food stuff to a level accepted
by international standard is paramount importance to
ensure the safety of these food stuff to consumers
thereby facilitate trade both within and between countries.
Five local groundnut varieties are found to grow in the
survey districts. These are “Sartu”, “Oldhale”, “Jawsi”,
“Basuka” and “Qacine”. Although these varieties vary in
terms of morphological features and disease resistance,
their resistance to Aspergillus and aflatoxins under differing environmental conditions is not established beyond
ambiguity. Thus future work should also focus in testing
varieties for Aspergillus resistance under different environmental conditions and management practices.
This study has identified some important factors that
may contribute for aflatoxin contamination of groundnuts
both pre- and post-harvest. These include: weather conditions, seed and equipment sharing, planting time; harvesting time and methods; curing, drying and storage
practices. The roles of additional factors that contribute to
aflatoxin contamination down in the value chain need
further investigation. In addition, the role of none chemical seeds treatments especially essential oils and that
of biological control agents in reducing groundnut
contamination should be studied to come up with a more
effective and sustainable management strategy. Farmers’
association and extension agents should also be encouraged in creating awareness about aflatoxins and management techniques.
ACKNOWLEDGEMENT
We are grateful to the Drylands Coordination Group
(DCG), Norway, for financial assistance. We also thank
Drs. Dereje Gorfu, Ferdu Azerefegne and Yibrah Beyene
for their valuable comments.
REFERENCES
Abdella MH (2009). Mycoflora of groundnut kernels from Sudan. Trans.
Br. Mycol. Soci. 63: 353-359.
Awuah RT, Kpodo KA (1996). High incidence of A. flavus and aflatoxins
in stored groundnuts in Ghana and the use of microbial assay to
assess the inhibitory effects of plant extracts on aflatoxin synthesis.
Mycopathologia 134: 109-114.
Bankole SA, Adebanjo OO (2003). Occurrence of aflatoxins and
fumonisins in preharvest maize from south-western Nigeria. Food
Add. Cont. 21: 251- 255.
Bartoli A, Maggi O (1978). Four new species of Aspergillus from Ivory
Coast soil. Trans. Br. Mycol. Soci. 71: 383-394.
Caliskan S, Arslan M, Arioglu H (2008). Effects of sowing date and
growth duration on growth and yield of groundnut in a Mediterraneantype environment in Turkey. Field Cro. Res. 105: 131-140.
Chala A, Mohammed A, Ayalew A, Skinnes H (2012). Natural
occurrence of aflatoxins in groundnut (Arachis hypogaea L.) from
eastern Ethiopia. Food Control. In press.
Cotty PJ (1994). Comparison of four groups for the isolation of A. flavus
group fungi. Mycopathologia. 125: 157-162.
765
Dickens JW, Satterwhite JB, Sneed RE (1973). Aflatoxin-contaminated
peanuts produced on North Carolina farms in 1968. J Am. Peanut
Res. Edu. Assoc. 5: 48-58.
Egel DS, Cotty PJ, Elias S (1994). Relationship among isolates of
Aspergillus sect. flavi that vary in aflatoxin production.
Phytopathology. 84: 906-912.
Eshetu L (2010). Aflatoxin content of peanut (Arachis hypogaea L.) in
relation to shelling and storage practice of Ethiopian farmers. M.Sc.
Thesis. Addis Ababa University, Ethiopia.
FAOSTAT
(2010).
Groundnut
world
production.
http://www.faostat.fao.org.
Gehewande MP, Nagaraj G, Jhala R (1986). Aflatoxin production and
detoxification in groundnut. Proceedings of the national seminar on
plant protection in field crops. 29-31 January 1986. Central plant
protection training institute. Hydrabd. India. pp. 15-26.
Getnet A, Nugussie A (1991). Production and research on oil seeds in
Ethiopia. Proceedings of the first national oil seeds workshop in
Ethiopia, 3-5 December. Institute of Agricultural Research. Addis
Ababa, Ethiopia. p.312.
Gourama H, Bullerman LB (1995). A. flavus and A. parasiticus:
Aflatoxigenic fungi of concern in food and feeds. J. Food Prot. 58:
1395-1404.
Graham J (1982). Aflatoxin in peanuts: Occurrence and control.
Queens. Agri. J. 108: 119-122.
Hill RA, Wilson DM, Burg WR, Shotwell OL (1984). Viable fungi in corn
dust. App. Environ. Microbiol. 47: 84-87.
Klich MA (2002). Identification of common Aspergillus species. Centraalbureau voor Shimmelcultures. Utrecht. The Netherlands. p.116.
Kurtzman CP, Horn BW, Hesseltine CW (1997). Aspergillus nomius, a
new aflatoxin-production species related to A. flavus and A. tamari.
Ant. Van Lee. 53: 147-158.
Okuda T, Klich MA, Seifert KA, Ando K (2000). Integration of modern
taxonomic methods for Penicillium and Aspergillus Classification. In:
Samson RA, Pitt JI Editors. Hardwood Academic Publishers:
Reading, UK. pp 83-100.
Pande N, Saxena J, Pandey H (2003). Natural occurrence of
mycotoxins in some cereals. Mycoses. 33:126-128.
Peterson SW, Ito Y, Horn BW, Goto T (2001). Aspergillus bombycis, a
new aflatoxigenic species and genetic variation in its sibling species,
A. nomius. Mycologia. 93: 689-703.
Pettit RE, Taber RA (1968). Factors influencing aflatoxin accumulation
in peanut kernels and the associated mycoflora. Appl. Microbiol. 16:
1230-1234.
rd
Pitt JI, Hocking AD (2009). Fungi and food spoilage (3 ed). Springer.
pp. 520.
Raper KB, Fennell DI (1965). The genus Aspergillus. Williams and
Wilkins. Baltimore, Maryland. pp.686.
Reddy LJ, Nigam SN, Moss JP, Singh AK, Subrahmanyam P,
McDonald D, Reddy AGS (1996). Registration of ICGV86699 peanut
germplasm line with multiple disease and insect resistance. Crop
Science 36: 821.
SAS Institute Inc (2003). SAS/STATA guide for personal computers
version 9.1 edition. Carry: SAS Institute.
Smart MG, Shotwell OL, Caldwell RW (1990). Pathogenesis in
Aspergillus ear rot of maize: aflatoxin B1 levels in grains around
wound inoculation sites. Phytopatology. 80: 1283-1286.
Subrahmanyam P, Ravindranath V (1988). Fungal and nematode
diseases. In: Reddy PS Editor: Groundnut. Indian Council of
Agricultural Research. New Delhi. India. pp. 453-523.
Tefera T, Tana T (2002). Agronomic performance of sorghum and
groundnut cultivars in sole and intercrop cultivation under semiarid
conditions. J Agron. and Crop Sci. 188: 212-218.
Upadhyaya HD, Reddy LJ, Gowda CLL, Singh S (2006). Identification of
diverse groundnut germplasm: Sources of early maturity in a core
collection. Field Cro. Res. 97: 261-271.
Wild CP, Hall AJ (1999). Hepatitis B virus and liver cancer: Unanswered
questions. Can. Surv. 33: 35-54.
Wild CP, Turner PC (2002). The toxicology of aflatoxins as basis for
public health decisions. Mutagenesis. 17: 471-481.
Vol. 8(8), pp. 766-775, 19 February, 2014
DOI: 10.5897/AJMR2013.6182
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Microencapsulation, survival and adherence studies of
indigenous probiotics
Ammara Hassan1*, M. Nawaz Ch2 and Barbara Rasco3
1
Food and Biotechnology Research Centre, Pakistan Council of Scientific and Industrial Research, Lahore. Pakistan.
2
CEES, University of the Punjab, Lahore. Pakistan.
3
School of food Sciences, Washington State University, USA.
Accepted 23 January, 2014
The aim of the study was to evaluate the adherence potential of indigenous probiotic bacteria and to
improve the gastrointestinal survival of these cultures by adopting the double microencapsulation
technique. The mean with standard deviation of triplicate experiments for the cell surface
hydrophobicity, aggregation, and Cell adhesion evaluation of indigenous probiotics revealed that there
was no significant difference in the hydrophobicity of both solvents (n- hexadecane and Xylene). A
mixed trend was observed in the estimation for hydrophobicity; the indigenous Lactobacillus
acidophilus was found with highest cell surface hydrophobicity (56.3%) and the lowest was found in
Lactobacillus reuteri (28.1%). The Ca-alginate and prebiotics amalgum was used in double treatment
and compared with control (free) and single encapsulated (Ca-alginate) cells in the stimulated gastric
juice (SGJ) and stimulated intestinal juice (SIJ). The one-way analysis of variance (ANOVA) results show
that the double microencapsulation technique has significant effects (P< 0.05) on the survival of
bacterial cells during 6 weeks storage. A negligible reduction was found on day 42 in case of double
microencapsulated cells as compared to significant adverse effects on the free cell. The loss was higher
in single microencapsulated Lactobacillus plantarum and Lactobacillus paracasei and zero loss for
Lactobacillus delbrueckii subsp. Bulgaricus. While a slight revival was observed in the free and single
encapsulated bacteria in SIJ. Thus, combination of Ca-alginate and prebiotics significantly improves the
viability and stress response of probiotics in the harsh GI conditions.
Key words: Surface-hydrophobicity, aggregation, adhesion, double- microencapsulation, stimulated gastric
Juice, stimulated intestinal juice, prebiotics, probiotics.
INTRODUCTION
Foods are no longer considered by consumers only in
terms of taste and immediate nutritional needs, but also
in terms of their ability to provide specific health benefits
beyond their basic nutritional value. Currently, the largest
segment of the functional food market is provided by the
foods targeted towards improving the balance and activity
of the intestinal microflora (Saarela et al., 2002). The
nutritional effects due to the presence of probiotics in the
*Corresponding author. E-mail: ahassan.pcsir@gmail.com.
products led Ilya Metchnikoff towards Nobel Prize in 1908
(Vasiljevic and Shah, 2008). Probiotics are live microorganisms that benefit the health of the host, if consumed
in adequate amount (Liaskovskii and Podgorskii, 2005).
Mostly probiotic bacteria are incorporated in dairy
products like milk, ice cream and yoghurt. The lactic acid
producing probiotics keep the gut at a low pH, maintains
the gut microflora and helps preserve the dairy products.
Hassan et al.
767
They also combat the growth of harmful pathogens that
cause foodborne illnesses (that is, diarrhea). The probiotics prevent the attachment of these pathogens by competing for similar binding sites on the gut epithelium
(Parvez et al., 2006). But to deliver the health benefits,
the probiotic bacteria need to be viable in the gut. The
International Dairy Foundation (IDF) has recommended a
7
minimum number of 10 CFU per gram of the product
consumed (Homayouni et al., 2008). However, the loss of
viability can happen prior to consumption, during processsing procedures such as oxygen stress, freezing and
drying or due to the harsh conditions in gastrointestinal
(GI) tract such as high pH, bile salt and gastric acid
secretion (Chávarri et al., 2010).
Therefore, providing a physical barrier to the probiotic
living cells to resist adverse environmental conditions is
therefore an approach currently receiving considerable
interest (Kailasapathy, 2009).
The microencapsulation techniques have resulted in
greatly enhanced viability of these microorganisms in
food products as well as in the gastrointestinal tract. In
this process, active agents are entrapped within a carrier
material. It is a useful tool to improve living cells into
foods, to protect (Favaro-Trindade and Grosso, 2002;
Liserre et al., 2007; Shima et al., 2009; Thantsha et al.,
2009) and to extend their storage life and to convert them
into a powder form for convenient use (O'riordan et al.,
2001; Lian et al., 2003; Oliveira et al., 2007). In addition,
microencapsulation can promote controlled release and
optimize delivery to the site of action, thereby potentiating
the efficacy of the respective probiotic strain. This process can also prevent these microorganisms from multiplying in food that would otherwise change their sensory
characteristics.
The investigations has revealed that the probiotic cell
adhesion on the gut lining is considered as an important
requirement for delivering health based benefits and the
estimation of surface hydrophobicity is the best technique
to determine this adherence and colonization potential
(Kaushik et al., 2009).
In this study, two materials of particular interest used as
capsules were the Ca-alginate and prebiotics amalgum
(containing galactooligosaccharides (GOS), mannooligosaccharide (MOS), and fructooligosaccharides
(FOS)). Alginate is a natural polysaccharide of β-Dmannuronic acid (M) and α-L-guluronic acid (G), usually
extracted from algae/seaweed and is currently the most
widely used and studied material of microencapsulation
(Chen and Walker, 2005). while Prebiotics are a group of
carbohydrates made up of functional oligosaccharides
which are non-digestible food substances that favour the
growth of other bacteria (Liaskovskii and Podgorskii,
2005).
The main objective of this research was to evaluate the
adherence potential and survival of indigenous probiotic
bacteria in gastrointestinal (GI) environment after microencapsulation.
Cell aggregation
was kept at 35°C for 2 h after that 1.0 ml of the top suspension was
taken to measure the absorbance (A final), and broth was used as
reference (Del Re et al., 2000; Tomás et al., 2005). The estimation
was performed in replicate. To calculate cellular autoaggregation
index, the difference in percentage between the initial and final
absorbance was recorded as follows:
The freshly grown probiotic bacterial cells in MRS broth at 35°C for
24 h were harvested (1) and the cell pellet washed with PBS and
resuspended in PBS. An absorbance of ~0.5 at 600 nm (A initial) was
taken. Then the suspension was centrifuged and the pellet was
resuspended in equal volume of removed broth (in 1). The mixture
MATERIALS AND METHODS
In vitro adherence studies of indigenous probiotic strains
Cell surface hydrophobicity
To determine the probiotics adhesion to hydrocarbons the method
of Rosenberg et al. (Rosenberg et al. 1980) and absorbance was
taken at 600 nm and surface hydrophobicity (%) was calculated in
replicates as percent decrease (ΔAbs×100) in the absorbance of
suspension (A Initial) and after phase separations (A final) as follows:
Caco-2 Cells Adhesion Assay
Preparation of cell suspension for microencapsulation
Adhesion of probiotic isolates was estimated using method of
Jacobsen et al. (Jacobsen et al., 1999). with Caco-2 cells (105) and
the estimation was performed in replicate.
All the previously Isolated Probiotic cultures (Hassan and
Chaudhry, 2013) were prepared, from frozen stocks stored at
−80°C, by transfering into MRS broth, then cultures were incubated,
768
Afr. J. Microbiol. Res.
Figure 1. Overview of adopted microencapsulation technique.
in anaerobic conditions, at 35°C for 18 h. After incubation, media
were centrifuged for 10 min at 4°C, and cells were washed with
sterile 0.1% (w/v) pepton water.
Microencapsulation
2008) by adding to 36 mL of the pancreatin- bile mixture (containing
1 mg/mL pancreatin and 4.5 g/mL of bile salts in phosphate buffer) ,
and pH was adjusted to 7.4. The mixture was then incubated for 4 h
at 35°C.
Statistical analysis
For microencapsulation, firstly the cells were coated with Caalginate by the emulsion method of Ortakci (Ortakci et al., 2012)
and stored in pepton-saline solution at 4°C until use. Later, the
alginate -encapsulated probiotic cells were coated with the mixture
of prebiotics, containing FOS, MOS, GOS and free cells were used
as control. The overall adopted technique for microencapsulation is
shown in Figure 1.
The data observed in in vitro adherence studies as well as the
logarithmic reductions in free (control), single encapsulated and
double encapsulated bacterial cells as a consequence of acidic
(SGJ-A and SGJ-B) and bile (SIJ) juices were analyzed by one-way
ANOVA using SPSS 17 version. Significance was declared at P ≤
0.05.
Survival evaluation in simulated gastric juice (SGJ)
RESULTS AND DSCUSSION
To investigate the effect of pH, same as that of Gastric juice, on the
survival of indigenous encapsulated probiotic bacteria, the cells
were treated (for 120 min ) with sterile stimulated Gastric Juice -A
(SGJ -A) as followed by Mainville et al. (Mainville et al., 2005)
containing 2.0 g/kg of NaCl and 0.3 g/kg of pepsin in M HCl (~pH
1.4) and sterile stimulated Gastric Juice- B (SGJ -B) containing 0.9
M H3PO4 (pH 2.0) instead of HCl.
In vitro adherence studies of potential indigenous
probiotic strains
Survival evaluation in simulated intestinal juice (SIJ)
After treatment in SGJ for 60 min, the mixture was converted to
simulated intestinal juice (Huang and Adams 2004; Annan et al.
Cell surface hydrophobicity
The investigations has revealed that the probiotic cell
adhesion on the gut lining is considered as an important
requirement for delivering health based benefits and the
estimation of surface hydrophobicity is the best technique
to determine this adherence and colonization potential
(Kaushik et al., 2009). Therefore, the indigenous probiotic
Hassan et al.
769
Table 1. Cell surface hydrophobicity, aggregation, and cell adhesion evaluation of selected
indigenous probiotic Isolates.
Isolate
L. acidophilus
L. lactis
L. casei
L. rhamnosus
L. brevis
L. lactis (b)
L. rhamnosus (b)
L. acidophilus(b)
L. brevis (b)
L. casei (b)
B. bifidus
B. infantis
B. longum
B. dentum
B. brevis
B. adoles
L. plantum
L. reteri
L. gasseri
L. fermentum
Hydrophobicity (%)
n- hexadecane
Xylene
56.3 ± 0.10
56.1 ± 0.04
49.1 ± 0.06
49.3 ± 0.08
52.7 ± 0.21
52.3 ± 0.01
47.3 ± 0.14
47.3 ± 0.09
43.1 ± 0.12
43.5 ± 0.03
37.5 ± 0.19
37.6 ± 0.13
39.1 ± 0.24
39.1 ± 0.17
34.9 ± 0.14
34.1 ± 0.74
33.4 ± 0.14
33.6 ± 0.79
36.7 ± 0.18
36.2 ± 0.18
29.1 ± 0.21
29 ± 0.06
39.7 ± 0.17
39.1 ± 0.08
51.3 ± 0.78
51.6 ± 0.07
46.7 ± 0.98
46.7 ± 0.17
31.5 ± 0.15
31.3 ± 0.04
38.4 ± 0.18
38.1 ± 0.09
36.6 ± 0.24
36.1 ± 0.13
28.1 ± 0.27
28.6 ± 0.19
35.5 ± 0.17
35.5 ± 0.19
39.6 ± 0.12
39.6 ± 0.27
isolates were also analysed for the adherence studies in
this study. The mean with standard deviation of triplicate
experiments are presented in Table 1. It has been found
that there was no significant difference in the hydrophobicity of both solvents used. All the recorded readings
found in line with Kaushik et al. (Kaushik et al., 2009). In
the present estimation, the hydrophobicity was found with
mixed trend, the indigenous Lactobacillus acidophilus
was found with highest cell surface hydrophobicity
(56.3%) and lowest was found in Lactobacillus reuteri
(28.1%). Previous research has revealed that some
lactobacillus strains show low cell surface hydrophobicity
to 2-5% (Schillinger et al., 2005; Rijnaarts et al., 1993)
but neither of the isolated strain showed such a low
hydophobicity percentage. Kaushik et al. (2009) has
clamied that hydrophobicity plays a vital role in the
cellular interaction. This great difference in the hydophobicity percentage could be due to the difference in the
cell surface protein expression that may be due to the
variation in environmental conditions(Tomás et al., 2005;
Ramiah et al., 2007).
Aggregation (%)
Adhesion ratio (%)
36.1 ± 0.13
34.9 ± 0.14
31.7 ± 0.09
41.3 ± 0.98
32.6 ± 0.01
40.9 ± 0.12
51.9 ± 0.07
37.9 ± 0.07
56.1 ± 0.03
48.0 ± 0.04
49.2 ± 0.08
32.9 ± 0.06
32.5 ± 0.02
33.3 ± 0.07
31.8 ± 0.03
40.7 ± 0.07
49.6 ± 0.05
31.9 ± 0.03
35.1 ± 0.10
31.7 ± 0.09
7.2 ± 0.10
8.3 ± 0.09
7 ± 0.12
8.1 ± 016
8.5 ± 0.32
7.9 ± 0.63
7.4 ± 0.42
7.1 ± 0.31
6.9 ± 0.17
8.6 ± 0.78
8.2 ± 0.91
7.9 ± 0.19
8.1 ± 0.17
7.6 ± 0.63
7.3 ± 0.71
7.1 ± 0.44
7.2 ± 0.19
6.1 ± 0.13
6.9 ± 0.22
7.5 ± 0.26
persistence of probiotic bacteria in the host GI tract
(Boekhorst et al., 2006b) (Boekhorst et al., 2006a). It has
also been investigated that after adherence in the gut
lining, the probiotic bacteria got the ability of aggregation
and colonization for health promoting benefits.
Vandevoorde et al. (1992) has also reported that the
cellular aggregation not only facilitates the colonization
but also provide a protection to the host by formatio of
biofilm (Vandevoorde et al., 1992) and this biofilm
formation is important for functioning of probiotics (Ocaña
and Nader-Macias, 2001; Kos et al., 2003; Cesena et al.,
2001). In the present study, the mean and standard
deviation of percentages of triplicate experiment for cell
aggregation of all indigenous isolates were recorded and
presented in Table 1. The highest percentage was
observed in L. rhamnosus (51.9%) followed by L. brevis
with the percentage of 56.1 while the least was found in
two isolates L.casei and L.fermentus with the similar
value of 31.7%. The cell aggregation study was also
concluded by Kaushik et al (Kaushik et al., 2009) but they
did not find such a high potential of self-aggregation in
their indigenous strain of Lactobacillus plantarum.
Cell auto-aggregation
Cell adhesion assay
The reports have highlighted the presence of four mucusbinding proteins genome in Lactobacillus plantarum
inclding the longest gene, ORF lp_1643 containing six
repeats. These proteins helps in the adherence and the
The mean and standard deviation of cell adhesion assay
of selected indigenous isolates are given in Table 1, the
highest percentage was observed by L. casei (8.6%)
770
Afr. J. Microbiol. Res.
Table 2. Probiotic bacterial count for Free, Single and Double Encapsulated bacteria during storage.
Time (day)
0
7
14
21
28
35
42
Control
(Mean CFU × 108/g) ±SD
2.45 ± 0.20
2.52 ± 0.14
2.68 ± 0.19
2.74 ± 0.27
2.63 ± 0.23
1.91 ± 0.20
0.71 ± 0.19
Single-encapsulated
(Mean CFU × 108/g) ±SD
2.98 ± 0.21
2.92 ± 0.18
3.12 ± 0.23
3.29 ± 0.40
3.36 ± 0.23
3.29 ± 0.16
3.14 ± 0.14
Double-encapsulated
(Mean CFU × 108/g) ±SD
3.16 ± 0.18
3.32 ± 0.09
3.41 ± 0.17
3.68 ± 0.23
3.73 ± 0.71
3.84 ± 0.20
3.83 ± 0.20
followed by isolate L. brevis with the percentage of 8.5%
while the least was found in isolates Lactobacillus lactis
with the value of 6.1%. The results of cell surface hydrophobicity, cell auto-aggregation and cell adhesion assay
for the selected indigenous probiotic isolates suggests
that these isolates have specific interaction and colonization potential in the gut that is also indicated by good
adhesion ratio while using Caco-2 cell lines, as matches
the conclusions of Kaushik on lactobacillus strains
(Kaushik et al., 2009).
This study showed significant effects on the survival of
free cultures in both SGJ-A and SGJ-B while the loss was
higher in single microencapsulated L. plantarum and
Lactobacillus paracasei while negligible loss was
observed for double- microencapsulated cells. The zero
loss was found in the mean probiotic count (cfu/g) of
Lactobacillus delbrueckii subsp. Bulgaricus and L.
paracasei. While a slight revival was observed in the free
and single encapsulated bacteria in SIJ probably
because of resuscitation of some injured cells because of
acidic conditions. The adherence studies reveal that
there is significant potential of health benefits of the
isolated indigenous probiotic cultures and the
combination of Ca-alginate and prebiotics significantly
improves the viability of probiotic cells in the harsh gastrointestinal conditions.
These microencapsulated indigenous probiotic cutlures
can be used in food technology and production as it provides
a solution to the low viability of probiotics incorporated in
local dairy products. Ideally these cultures, since have
adherence potential, can maintain the level of the beneficial probiotic bacteria at the minimum standard amount
required (Akhiar and Aqilah, 2010).
All the individual cultures of Lactobacillus and Bifidobacterium as well as the mixed culture of both showed similar response as that was investigated by Sultana et al.
(2000), Kailasapathy et al. (2002), Vivek et al. (2013) and
Chen et al. (2005), and proved the potential of microencapsulation for protecting the indigenous probiotic bacterial cells. The adopted double encapsulation technique
has presented a significant effect (P< 0.05) on the survival of probiotic indigenous cells during storage of six
weeks. In the case of free cells, which were used as a
control, the reduction in the mean count was observed on
day 28, single encapsulated on day 35 while the double
encapsulated bacterial cells was decreased from 3.84 ×
8
8
10 on day 35 to 3.83 × 10 on day 42.
The present investigation also endorsed the results of
Yeo and Liong that a significant increase in the count for
L. acidophillus FTDC 8033 and Lactobacillus sp. FTDC
2113 in soy milk when supplemented with prebiotic (FOS)
upto 7- log CFU/ml (Yeo and Liong, 2010). According to
Ding and Shah, probiotic bacteria encapsulated in alginate, xanthan gum, and carrageenan gum survived better
(P < 0.05) than free probiotic bacteria, in acidic environment (Ding and Shah, 2009), which also justifies the significance of present study. In fact, it has been investigated that prebiotics (fructooligosaccharides, iso-maltooligosaccharides and lactulose) is an emerging alternative that
can further enhance probiotic activity and they enhance
the growth of probiotics by providing carbon and nitrogen
Microencapsulation
and
survival
indigenous probiotic strains
studies
of
The mean and standard deviation experiments conducted
in triplicate for the free, single (Ca- alginate) and double
(Ca- alginate and prebiotics amagum) microencapsulation are shown in Table 2 and count was performed on
seven day interval for the period of six weeks. The rate of
reduction of probiotic bacterial count (CFU/g) was calculated by the following formula;
Hassan et al.
771
Figure 2. Mean loss in Lactobacillus count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated
bacteria in SGJ- A. Lactobacillus lactis AH-1 Lactobacillus reuteri AH-2 , Lactobacillus acidophilus AH-3, Lactobacillus
rhamnosus AH-4 Lactobacillus casei AH-5, Lactobacillus plantarum AH-6 and Lactobacillus brevis AH-7.
sources which can increase their colonization of the gut
(Annan et al., 2008).
However, the symbiotic effects of probiotics and prebiotics are strain-dependent. As Yeo Siok had reported different growth behaviours for six different strains of
lactobacilli and bifidobacteria when supplemented with
five different prebiotics. Lactobacillus spp. FTDC 2113
grew significantly when supplemented with FOS but did
not grow with pectin (Yeo and Liong, 2010). In the present study the mixture of encapsulated bacteria has
showed higher growth in the presence of prebiotics. The
survival of double microencapsulated probiotics not only
proves the statement of Rabanel et al. that both the alginate and prebiotics are compatible with probiotics (Rabanel
et al., 2009) but also justifies the claim of Chen Kun-Nan
et al. (2005) that the Survival rate of the co-encapsulated
active probiotics increases 1000 times higher than for
alginates alone.
Simulated gastric Juice
The stimulated Gastric Juice (SGJ-A) has shown a significant reduction on the free probiotic cell (Figure 2). Initial
mean count for free cells was 2.45 × 108 cfu/g which had
3
4
2
1
lost 1.09 × 10 , 1.04 × 10 , 2.01 × 10 , 2.74 × 10 , 2.56 ×
2
1
2
10 , 1.76×10 and 1.99 × 10 for L. lactis AH-1, L. reuteri
AH-2, L. acidophilus AH-3, Lactobacillus rhamnosus AH4, Lactobacillus casei AH-5, L. plantarum AH-6, and
Lactobacillus brevis AH-7, respectively.
The results of the survival evaluation of free cells,
Single encapsulated and double encapsulated probiotics
in stimulated Gastric Juice B, shown in Figure 3. The
results indicated that the pH 2.0 resulted in great loss in
count for uncoated free bacterial cells while the coated
bacterial cells, either single or double microencapsulated,
had a negligible reduction.
In the case of single microencapsulated probiotics, the
loss was high L. plantarum AH-6 and Lactobacillus brevis
AH-7 that is, 2.29 × 102 and 3.24 × 102, respectively. The
bacterial loss was negligible in the case of double- microencapsulated bacterial cells. The zero loss was found in
the mean microbiological count (cfu/g) of L. reuteri AH-2
and L. reuteri AH-7 after the incubation of 2 h in SGJ-A.
The results of bifidobacterium cultures are shown in
Figure 4 for SGJ-A.
This rapid reduction in count of free bacterial cells,
when incubated for 120 min in stimulated Gastric Juice -A
(SGJ-A), was the function of low pH (1.4) and acidic conditions, which is similar to the pH of the human stomach
before ingestion of food. the main reason of rapid loss
was that no protection was provided to free cells in such
a harsh acidic environment. The technique of double
microencapsulation, both with Ca- alginate and prebiotics
(FOS and IMO) showed amazing results in the case of L.
reuteri AH-2 and Lactobacillus brevis AH-7 as compared
to the negligible loss of bacterial count was observed in
the case of other probiotic isolates. It proves the potential
in technique of double microencapsulation. Under the
double microencapsulated probiotic cells, the survival of
bacteria was significantly greater than free and singlemicroencapsulated bacterial cells. This supports the notion
that it is prime to test the probiotics in the proper physiological conditions as bacterial survival is greatly influenced by variations in pH (Mainville et al., 2005; Pitino et
al., 2010). This agrees with the findings of Sharp (Sharp
et al., 2008) who observed a 3.8-log reduction after
two hours of incubation in SGJ.
772
Afr. J. Microbiol. Res.
Figure 3. Mean loss in Lactobacillus count (Log 10 cfu/g) for free (control), Single encapsulated and Double
Encapsulated bacteria in SGJ-B. L. lactis AH-1, Lactobacillus reuteri AH-2, Lactobacillus acidophilus AH-3 ,
Lactobacillus rhamnosus AH-4 , Lactobacillus casei AH-5 , Lactobacillus plantarum AH-6 , and Lactobacillus brevis
AH-7.
Figure 4. Mean loss in bifidobacterium and two lactobacillus strains count (Log 10 cfu/g) for free (control), Single
encapsulated and Double Encapsulated bacteria in stimulated Gastric Juice B (120 min incubation).
Again the great loss of free probiotic cells was found in
the SGJ-B as compared to single and double - microencapsulation. The in vitro test of gastric survival using
H3PO4 (SGJ-B) was useful to provide a buffering effect
when the bacteria were present in a uncoated form especially. The results of SGJ-B for the bifidobacterium isolates
Hassan et al.
773
Figure 5. Mean loss in bifidobacterium and two lactobacillus strains count (Log 10 cfu/g) for free (control), Single
encapsulated and Double Encapsulated bacteria in stimulated Gastric Juice B (120 min incubation).
Figure 6. Mean loss in Lactobacillus isolates (Log 10 cfu/g) for free (control), Single encapsulated and Double
Encapsulated bacteria in SIJ. L. lactis AH-1, Lactobacillus reuteri AH-2, Lactobacillus acidophilus AH-3,
Lactobacillus rhamnosus AH-4, Lactobacillus casei AH-5, Lactobacillus plantarum AH-6 and Lactobacillus brevis
AH-7 .
are shown in Figure 5.
Simulated intestinal juice (SIJ)
The Mean loss in probiotic count (Log 10 cfu/g) for
control, single encapsulated and double encapsulated
probiotics in stimulated Intestinal Juice (pH 7.4) are
shown in Figure 6. A slight recovery of free and single
encapsulated bacterial strains was found after the addi-
tion of bile-pancreatin mixture. The acids of the SGJ-A
and SGJ-B both were unable to provide any significant
protective effect for the control and single micro-encapsulated probiotics. A slight increase may be the resuscitation of some cells that were sublethally injured during
the 160 min of incubation of SGJ, while the zero loss was
found in the case of double microencapsulated bacterial
cells.
Bifidobacterium breve and Bifidobacterium longum
were encapsulated by Picot and Lacroix, who found
774
Afr. J. Microbiol. Res.
Figure 7. Mean loss in bifidobacterium and two lactobacillus strains count Log 10 cfu/g) for free (control), Single
encapsulated and Double Encapsulated bacteria in SIJ.
results similar to the present study. They reported that
this approach is potentially useful for delivery of viable
probiotics to the gastrointestinal tract of humans (Picot
and Lacroix 2004). After incubation in simulated gastric
(1 h) and intestinal juices (pH 7.4, 4 h), the number of
probiotic B. adolescentis the surviving cells was found
high (Annan et al. 2008) showing similarity with the present study. The results of SIJ for the bifidobacterium and
two lactobacillus isolates are shown in Figure 7.
This study showed significantly adverse effects on the
survival of free cultures in both SGJ-A and SGJ-B while
the loss was higher in single microencapsulated L.
plantarum AH-6 and Lactobacillus brevis AH-7 while
negligible for double- microencapsulated cells. The zero
loss was found in the mean microbiological count (cfu/g)
of L. reuteriAH-2 and Lactobacillus brevis AH-7. While a
slight revival was observed in the free and single encapsulated bacteria in SIJ probably because of resuscitation
of some injured cells because of acidic conditions. The
findings reveal that the combination of Ca-alginate and
prebiotics significantly improve the viability of bacterial
cells in the harsh gastrointestinal conditions and may be
of use for the food and/or pharmaceutical industries. In
the nutshell, the results of survival studies reveals that
incurporation of ca- alginate and prebiotic amalgum has
improved viability of probiotics.
REFERENCES
Akhiar M, Aqilah NS (2010). Enhancement of probiotics survival by
microencapsulation with alginate and prebiotics. MMG 445 Basic
Biotechnol. eJ. 6 (1)
Annan N, Borza A, Hansen LT (2008). Encapsulation in alginate-coated
gelatin microspheres improves survival of the probiotic< i>
Bifidobacterium adolescentis</i> 15703T during exposure to
simulated gastro-intestinal conditions. Food Res. Int. 41(2):184-193.
Boekhorst J, Helmer Q, Kleerebezem M, Siezen RJ (2006a). Comparative analysis of proteins with a mucus-binding domain found
exclusively in lactic acid bacteria. Microbiol. 152(1):273-280
Boekhorst J, Wels M, Kleerebezem M, Siezen RJ (2006b). The predicted secretome of Lactobacillus plantarum WCFS1 sheds light on
interactions with its environment. Microbiol. 152(11):3175-3183
Cesena C, Morelli L, Alander M, Siljander T, Tuomola E, Salminen S,
Mattila-Sandholm T, Vilpponen-Salmela T, Von W right A (2001). < i>
Lactobacillus crispatus</i> and its Nonaggregating Mutant in Human
Colonization Trials. J. Dairy Sci. 84(5):1001-1010
Chávarri M, Marañón I, Ares R, Ibáñez FC, Marzo F, Villarán MdC
(2010). Microencapsulation of a probiotic and prebiotic in alginatechitosan capsules improves survival in simulated gastro-intestinal
conditions. Int. J. Food Microbiol. 142(1):185-189
Chen CC, Walker WA (2005). Probiotics and prebiotics: role in clinical
disease states. Adv. Pediatr. 52:77-113
Chen KN, Chen MJ, Liu JR, Lin CW, Chiu HY (2005). Optimization of
incorporated prebiotics as coating materials for probiotic
microencapsulation. J. Food Sci. 70(5):M260-M266
Del Re B, Sgorbati B, Miglioli M, Palenzona D (2000). Adhesion,
autoaggregation and hydrophobicity of 13 strains of Bifidobacterium
longum. Lett. Appl. Microbiol. 31(6):438-442.
Favaro-Trindade C, Grosso C (2002) Microencapsulation of L.
acidophilus (La-05) and B. lactis (Bb-12) and evaluation of their
survival at the pH values of the stomach and in bile. J. Microencaps
19(4):485-494.
Hassan A, Chaudhry MN (2013) Culture-dependent and cultureindependent techniques to identify lactic acid bacteria in fermented
products. Afr. J. Microbiol. Res. 7(30):3983-3987
Homayouni AA, Ehsani A, Yarmand M, Razavi MSH (2008). Effect of
microencapsulation and resistant starch on the probiotic survival and
sensory properties of symbiotic ice cream. Food Chem. 111:50-55.
Huang Y, Adams MC (2004). In vitro assessment of the upper
gastrointestinal tolerance of potential probiotic dairy propionibacteria.
Int. J. Food Microbiol. 91(3):253-260.
Jacobsen CN, Nielsen VR, Hayford A, Møller P, Michaelsen K,
Paerregaard A, Sandström B, Tvede M, Jakobsen M (1999).
Screening of probiotic activities of forty-seven strains of Lactobacillus
spp. by in vitro techniques and evaluation of the colonization ability of
five selected strains in humans. Appl. Environ. Microbiol. 65(11):
Hassan et al.
4949-4956.
Kailasapathy K (2002). Microencapsulation of probiotic bacteria:
technology and potential applications. Curr. Issues Intestinal
Microbiol. 3(2):39-48.
Kailasapathy K (2009). Encapsulation technologies for functional foods
and nutraceutical product development. CAB Reviews: Perspectives
in agriculture, veterinary science, nutrition and natural resources
4(033):1-19.
Kaushik JK, Kumar A, Duary RK, Mohanty AK, Grover S, Batish VK
(2009). Functional and probiotic attributes of an indigenous isolate of
Lactobacillus plantarum. PloS one 4(12):e8099.
Kos B, Šušković J, Vuković S, Šimpraga M, Frece J, Matošić S (2003).
Adhesion and aggregation ability of probiotic strain Lactobacillus
acidophilus M92. J. Appl. Microbiol. 94(6):981-987.
Lian W-C, Hsiao H-C, Chou C-C (2003). Viability of microencapsulated
bifidobacteria in simulated gastric juice and bile solution. Int. J. Food
Microbiol. 86(3):293-301.
Liaskovskii TM, Podgorskii VS (2005). [Assessment of probiotics
according to the international organizations (FAO/WHO)]. Microbiol.
J. 67(6):104-112.
Liserre AM, Ré MI, Franco BD (2007). Microencapsulation of
Bifidobacterium animalis subsp. lactis in modified alginate-chitosan
beads and evaluation of survival in simulated gastrointestinal
conditions. Food Biotechnol. 21(1):1-16.
Mainville I, Arcand Y, Farnworth E (2005). A dynamic model that
simulates the human upper gastrointestinal tract for the study of
probiotics. Int. J. Food Microbiol. 99(3):287-296.
O'riordan K, Andrews D, Buckle K, Conway P (2001). Evaluation of
microencapsulation of a Bifidobacterium strain with starch as an
approach to prolonging viability during storage. J. Appl. Microbiol.
91(6):1059-1066.
Ocaña VS, Nader-Macias ME (2001). Vaginal lactobacilli: self-and coaggregating ability. Br J Biomed Sci 59 (4):183-190
Oliveira A, Moretti T, Boschini C, Baliero J, Freitas L, Freitas O, FavaroTrindade C (2007). Microencapsulation of B. lactis (BI 01) and L.
acidophilus (LAC 4) by complex coacervation followed by spoutedbed drying. Drying Technol. 25(10):1687-1693.
Ortakci F, Broadbent J, McManus W, McMahon D (2012). Survival of
microencapsulated probiotic< i> Lactobacillus paracasei</i> LBC-1e
during manufacture of Mozzarella cheese and simulated gastric
digestion. J. Dairy Sci. pp. 6274-6281.
Parvez S, Malik K, Ah Kang S, Kim HY (2006). Probiotics and their
fermented food products are beneficial for health. J. Appl. Microbiol.
100(6):1171-1185.
Picot A, Lacroix C (2004). Encapsulation of bifidobacteria in whey
protein-based
microcapsules
and
survival
in
simulated
gastrointestinal conditions and in yoghurt. Int. Dairy J. 14(6):505-515.
Pitino I, Randazzo CL, Mandalari G, Lo Curto A, Faulks RM, Le Marc Y,
Bisignano C, Caggia C, Wickham MSJ (2010). Survival of< i>
Lactobacillus rhamnosus</i> strains in the upper gastrointestinal
tract. Food Microbiol. 27(8):1121-1127.
Rabanel JM, Banquy X, Zouaoui H, Mokhtar M, Hildgen P (2009).
Progress technology in microencapsulation methods for cell therapy.
Biotechnol. Prog. 25(4):946-963.
Ramiah K, Van Reenen C, Dicks L (2007). Expression of the mucus
adhesion genes< i> Mub</i> and< i> MapA</i>, adhesion-like factor<
i> EF-Tu</i> and bacteriocin gene< i> plaA</i> of< i> Lactobacillus
plantarum</i> 423, monitored with real-time PCR. Int. J. Food
Microbiol. 116(3):405-409.
775
Rijnaarts HH, Norde W, Bouwer EJ, Lyklema J, Zehnder AJ (1993).
Bacterial adhesion under static and dynamic conditions. Appl.
Environ. Microbiol. 59(10):3255-3265.
Rosenberg M, Gutnick D, Rosenberg E (1980). Adherence of bacteria
to hydrocarbons: a simple method for measuring cell‐surface
hydrophobicity. FEMS Microbiol. Lett. 9(1):29-33.
Saarela M, Lähteenmäki L, Crittenden R, Salminen S, Mattila-Sandholm
T (2002). Gut bacteria and health foods - the European perspective.
Int. J. Food Microbiol. 78(1):99-117.
Schillinger U, Guigas C, Heinrich Holzapfel W (2005). < i> In vitro</i>
adherence and other properties of lactobacilli used in probiotic
yoghurt-like products. Int. Dairy J. 15(12):1289-1297.
Sharp M, McMahon DJ, Broadbent J (2008). Comparative Evaluation of
Yogurt and Low‐Fat Cheddar Cheese as Delivery Media for Probiotic
Lactobacillus casei. J. Food Sci. 73(7):M375-M377.
Shima M, Matsuo T, Yamashita M, Adachi S (2009). Protection of< i>
Lactobacillus acidophilus</i> from bile salts in a model intestinal juice
by incorporation into the inner-water phase of a W/O/W emulsion.
Food Hydrocolloids 23(2):281-285.
Sultana K, Godward G, Reynolds N, Arumugaswamy R, Peiris P,
Kailasapathy K (2000). Encapsulation of probiotic bacteria with
alginate-starch and evaluation of survival in simulated gastrointestinal
conditions and in yoghurt. Int. J. Food Microbiol. 62(1):47-55.
Thantsha MS, Cloete TE, Moolman FS, Labuschagne PW (2009).
Supercritical carbon dioxide interpolymer complexes improve survival
of< i> B</i>.< i> longum</i> Bb-46 in simulated gastrointestinal fluids.
Int. J. Food Microbiol. 12(1):88-92.
Tomás J, Wiese B, Nader‐Macías M (2005). Effects of culture
conditions on the growth and auto‐aggregation ability of vaginal
Lactobacillus johnsonii CRL 1294. J. Appl. Microbiol. 99(6):13831391.
Vandevoorde L, Christiaens H, Verstraete W (1992). Prevalence of
coaggregation reactions among chicken lactobacilli. J. Appl.
Microbiol. 72(3):214-219.
Vasiljevic T, Shah NP (2008). Probiotics - from Metchnikoff to
bioactives. Int. Dairy J. 18(7):714-728.
Vivek K (2013). Use of encapsulated probiotics in dairy based foods.
Int. J. Food Agric. Vet. Sci. 3(1):188-199
Yeo SK, Liong MT (2010). Effect of prebiotics on viability and growth
characteristics of probiotics in soymilk. J. Sci. Food Agric. 90(2):267275. doi:10.1002/jsfa.3808
Vol. 8(8), pp. 776-782, 19 February, 2014
DOI: 10.5897/AJMR2013.6576
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research paper
Screening novel diagnostic marker of Mycobacterium
tuberculosis
Xin Pan1,2*, Siliang Zeng1, Jialin Cai2, Bin Zhang3*, Boju Pan2, Zhonglei Pan2, Ying Wu2, Ying
Wang4, Yi Zhou1, Wei Fang2, Min Chen2, Wanqing Liao2, XiuZhen Yu1, Min Tao1, Jun Zhang1
and Wei Song1
1
Shanghai Junwei Fine Medical Club，58 Bao Tou Road, Shanghai 200433, China.
Second Military Medical University，800 Xiang Yin Road, Shanghai, 200433, China.
3
Qingpu Branch of Zhongshan Hospital, Fudan University, 1158 Gong Yuan Dong Road, Shanghai 201700, China.
4
Shanghai Jiao Tong University School of Medicine, 280 Chongqing South Road, Shanghai, 200025, China.
2
Accepted 23 January, 2014
The aim of present study was to screen and evaluate the serodiagnostic value of the purified fusion
antigens of Mycobacterium tuberculosis (Mtb) by enzyme-linked immunosorbent assay (ELISA). A group
of vector system which was constructed by cloning Rv1908c, Rv0733, Rv0899, Rv1411c and Rv3914
gene of Mtb into the prokaryotic expression plasmid pET-32b was transformed into E. coli for induction
and expression fusion antigens to determine their potentiality in diagnostic application. Following
purification with the His-select nickel magnetic agarose beads, the expressed fusion proteins showed
purity via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot
technique. The ELISA plates were coated with these fusion antigens. Through ELISA, the antigen
binding with specific IgG levels between active TB patients and healthy controls was compared. The
purity and the size of the expressed fusion antigens were confirmed by the Western blot. The ELISA
results indicated that IgG levels against Rv1411c-6His, Rv3914-6His and Rv2031c-6His were significantly
higher in serum of active TB patients than in that of healthy controls. More interesting, the AUC value of
Rv3914-6His (0.7867) was higher than that of Rv2031c-6His (0.754) which was widely used in clinic. The
results implied that Rv3914-6His might be a useful candidate antigen in the diagnosis of Mtb infection,
especially for active pulmonary TB diagnosis. Its role in serodiagnosis of extra-pulmonary TB is still
needed to be validated.
Key words: Mycobacterium tuberculosis, expression and purification, antigen, serodiagnosis, tuberculosis.
INTRODUCTION
Tuberculosis (TB) is a chronic infectious disease mainly
caused by Mycobacterium tuberculosis (Mtb). The
bacteria typically attack the lung parenchyma which
named pulmonary TB (PTB) by the clinical manifestations
(Walzl et al., 2011). Mtb also can attack other part of the
body such as lymph nodes, the central nervous system,
liver, spleen, kidney, spine, bone and skin which named
extrapulmonary TB (EPTB) (Ireton et al., 2010). TB is
currently the second-largest killer infectious agent after
human immunodeficiency virus (HIV). According to the
World Health Organization (WHO) statistics, China has
the world's second largest tuberculosis epidemic
*Corresponding authors. E-mail: xinpanpx@163.com and zhxy2010@163.com.
Pan et al.
(Wang et al., 2007). Therefore, it is very important to
develop new convenient, fast, high sensitivity and
specificity diagnosis methods to control the prevalence
and spread of tuberculosis．
Although currently bacteriological culture is still considered as the gold standard in clinical laboratory confirmation of TB disease, the laboratory may need more time (46 weeks), and the rates of false-positive cultures are too
high, which are not suitable for clinical application
(Kashyap et al., 2010). The newly developed GeneXpert
MTB/RIF assay is a novel nucleic acid amplification
diagnostic technique for the diagnosis of tuberculosis and
rapid detection of rifampicin (RIF) resistance in clinical
specimens (Steingart et al., 2013). But this assay
determined the presence or absence of Mtb or rifampicin
resistance, the activity of TB bacillus cannot be determined. The QuantiFERON®-TB gold in-tube or T-Spot TB
test is an indirect test for measuring the release of
interferon-gamma (INF-γ) from the patient's viable T
lymphocytes stimulated by a few Mtb-specific antigens
(early secreted antigenic target-6 and culture filtrate
protein-10) (Rose et al., 2012) . INF-γ release assays
have excellent sensitivity and specificity with minimizing
subjective interpretation and operator bias. However, the
assays require expensive instrument, reagents and well
trained operators. These requirements restrict their use in
China. Serodiagnosis has a long history and is characterized by convenient specimens, low costs, and commonly used in clinical laboratories to test numerous TB
serum samples in a short time (Steingart et al., 2011).
The antibody response to the 88 kDa, 65 kDa Hsp, 45
kDa, 38 kDa lipoprotein (He et al., 2011), 16 kDa HSP
(Senol et al., 2009), ESAT-6, CFP-10, and
lipoarabinomannan (LAM) (Ben Selma et al., 2010)
antigens of Mtb was extensively studied by diagnostic
companies and used in the commercial serological tests
of TB infection (Flores et al., 2011). However, currently
available commercial serodiagnostic tests provided inconsistent and imprecise findings, the WHO issued a policy
statement against the use of commercial serological tests
for the diagnosis of active PTB (WHO, 2011). Therefore,
accurate, rapid and inexpensive antibody-based tests for
TB diagnosis are needed urgently (Flores et al., 2011).
The Mtb immunoproteome analyses revealed sera from
TB mainly recognized membrane associated and extracellular proteins of the bacterial (Kunnath-Velayudhan et
al., 2010). In the study, the successful cloned genes of
Mycobacterium tuberculosis envelope proteins Rv1908c,
Rv0733, Rv0899, Rv1411c and Rv3914 were selected for
expression and purification and screening serodiagnosis
antigens. Rv1908c gene name is KatG, antigen name is
catalase-peroxidase- peroxynitritase T, molecular mass is
about 80.57 kDa, it may play a role in the intracellular
survival of mycobacteria within macrophages. Rv0733
gene name is adk, antigen name is adenylate kinase,
molecular mass is about 20.09 kDa, it is essential for the
777
bacteria in intracellular nucleotide metabolism. Rv0899
gene name is ompA，antigen name is outer membrane
protein A, molecular mass is about 33.54 kDa, it may
protect the integrity of the bacterium. Rv1411c gene
name is lprG, antigen name is conserved lipoprotein,
molecular mass is about 24.55 kDa, the function is still
unknown. Rv3914 gene name is trxC, antigen name is
thioredoxin, molecular mass is about 12.54 kDa, Thioredoxin participates in various redox reactions. Enzymelinked immunosorbent assay (ELISA) plates were coated
with prokaryotic expression and purification of the five
antigens, respectively. An indirect ELISA was established
for rapid comparison serum IgG responses to the five
antigens respectively between patients with active tuberculosis (TB group) and healthy physical examinees with
non-tuberculosis (control group). Anti-Rv3914 IgG may
become a potential important new serum marker for
active tuberculosis diagnosis.
MATERIALS AND METHODS
Plasmids and antigens
The recombinant prokaryotic expressive plasmids pET-32b-Rv0733,
pET-32b-Rv1411c, pET-32b-Rv1908c, pET-32b-Rv0899, pET-32bRv3914 and Rv2031c-6His fusion antigen were kept in our
laboratory.
Main Reagents and instruments
Mouse monoclonal to 6×His tag antibody was purchased from
Abcam, USA. Prestained protein molecular weight marker was
purchased from Fermentas, Canada. IRDye 800CW goat antimouse IgG (H+L) was purchased from Licor Biosciences, USA.
Plasmid preparation kit and DNA gel extraction kit were purchased
from Axygen, USA. Isopropyl-β-D-thiogalactopyranoside (IPTG) and
His-select nickel magnetic agarose beads were purchased from
Sigma, USA. Alkaline phosphatase (AP)-affinipure goat anti-human
IgG (H+L) was purchased from Jackson ImmunoResearch, USA.
BL21 (DE3) PLySs competent cells was purchased from Takara,
Japan. Amicon ultra-2 centrifugal filter unit with ultracel-3 membrane was purchased from Millipore, USA. Odyssey infrared imaging system was purchased from Licor Biosciences, USA. ELISA
plate reader was purchased from Corning Incorporated, USA.
Prokaryotic expression and purification of His-Mtb fusion
antigens
Escherichia coli (E.coli) BL21 (DE3) PLySs was transformed with
the recombinant plasmid pET-32b-Rv0733, pET-32b-Rv1411c, pET32b-Rv1908c, pET-32b-Rv0899, pET-32b-Rv3914 and pET-32bRv2031c, respectively. Positive colonies were confirmed by DNA
sequencing and performed to verify antigen expression.
Two hundred (200) mL medium LB containing 50 μg/mL ampicillin
was inoculated and incubated at 37°C with 200 rpm shaking to the
optical density (OD) value approximately 0.4～0.6 at 600 nm. IPTG
was added to a final concentration of 0.1 mmol/L for inducing
expression. Shaking incubation was continued at 30°C for 6 h.
Bacterial cells were precipitated by centrifugation (7000 g for 3 min
at 4°C) and resuspended in 20 mL lysis buffer containing 50 mmol/L
778
Afr. J. Microbiol. Res.
NaH2PO4，300 mmol/L NaCl and 10mmol/L imidazole pH 8.0. The
mixture was sonicated and centrifuged (8000 g for 30 min at 4°C).
The supernatant containing recombinant Mtb antigens named crude
extracts were filtered through a 0.45 μm prefilter. His-select nickel
magnetic agarose beads were uniformly suspended and added 1
mL to the filtrate protein. The mixture gently shaked overnight at
4°C and the affinity gel washed with plenty of wash buffer
containing 50 mmol/L NaH2 PO4, 300 mmol/L NaCl and 20 mmol/L
imidazole pH 8.0. The sample was centrifuged and the supernatant
containing unbinding contaminating proteins was removed. The HisTag-C-terminal protein was eluted from the beads with elution buffer
(50 mmol/L NaH2 PO4, 300 mmol/L NaCl, 300 mmol/L imidazole, pH
8.0). Eluted fractions were transferred to Amicon Ultra-2 centrifugal
filter unit with ultracel-3 membrane and centrifuged to remove the
imidazole and other small molecules. The ultrafiltered samples were
sterilized through 0.22 μm filter. The purified proteins were stored in
40% glycerin at -80°C.
SDS-PAGE and Western blotting
The protein concentration of the crude extracts and the purified
protein was measured respectively using the Bradford method. An
equal amount of total protein content was loaded on each lane and
separated by 10% sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE), followed by staining at 37°C using
Coomassie brilliant blue R-250. Rv3914 was used as a given
example for assessing the purity effect before and after purification.
For Western blot analysis, five purified antigens were separated
by 12% SDS-PAGE and transferred to polyvinylidene difluoride
(PVDF) membranes by semi-dry apparatus and nonspecific binding
was blocked with PBS containing 3% bovine serum albumin (BSA).
The blots were probed with anti-6-His antibodies diluted 1:1000,
and the immune complexes were visualized using goat anti-mouse
IgG（H+L）IRDye 800 conjugate secondary antibody, according to
the manufacturer’s instructions. Blots were digitally photographed
using the Odyssey infrared imaging system.
Human serum collection
The research proposal was approved by the ethics committee of
Shanghai Junwei Fine Medical Club, China and all participants at
Shanghai pulmonary hospital, China provided written informed
consents. Thirty-four serum samples were collected from patients
with confirmed diagnosis active pulmonary tuberculosis and thirtyfive serum samples were obtained from healthy physical examinees. The patients had clinical symptoms，radiological signs of TB,
acid-fast stain test of sputum smear, as well as positive culture for
Mycobacterium tuberculosis. Serum samples as healthy controls
were obtained from healthy physical examinees with no apparent
signs of any disease and tuberculosis diagnoses ruled out.
Detection the relative antibody in serum by indirect enzymelinked immunosorbent assay
Flat-bottom 96-well Costar plates were coated with 100 μL/well of
each purified antigen at a concentration of 1μg/mL in carbonate
buffer (15mM Na2CO3, 35mM NaHCO3, pH9.6). The positive control
was Rv2031c (16 kDa HSP) -6His antigen, the negative control was
serum of healthy physical examinees and blank control was
phosphate-buffered saline (PBS). After overnight incubation at 4°C,
these antigen-coated wells were washed 3 times with PBS,
containing 0.05% Tween 20 (PBST), blocked with blocking buffer of
1% gelatin in PBST for an hour at 37°C and followed by three
washings. Subsequently, 100 μL of diluted serum samples (1:100 in
blocking buffer) was added. Following an incubation period of 1 h at
37°C, the wells were again washed and filled with 100 μL of a
1:2000 dilution of alkaline phosphatase-conjugated goat anti-human
immunoglobulin G. After incubation for 1 hr at 37°C, the plates were
again washed with PBST. The wells were filled with 100 μL of
substrate solution (1 mg/mL p-nitrophenylphosphate in 10% diethanolamine buffer containing 0.5 mM MgCl2, pH 9.8). After 30 min
incubation at room temperature in darkness, the reaction was stopped by adding 50 μL /well of 2 M Na2CO3. The optical density (OD)
of each well was measured at a wavelength of 405 nm in ELISA
plate reader. Immunogenic properties of the purified antigens identification were done in ten-fold serial dilutions of serum samples.
Statistical analysis
Data were presented as means and standard errors (mean ± SD).
The cut-off value for the optical density (OD) of an ELISA was
determined by the mean value of healthy controls plus 3SD.
Comparisons between two groups were performed with GraphPad
Prism 5 statistical analysis software using the Mann Whitney test,
and the level P < 0.05 was considered statistically significant.
RESULTS
Prokaryotic
expression,
purification
and
identification of five recombinant antigens of
Mycobacterium tuberculosis
Single colonies of BL21 (DE3) PlySs bacteria
transformed respectively by pET-32b-Rv0733, pET-32bRv 1411c, pET-32b-Rv1908c, pET-32b-Rv0899 and pET32b-Rv3914 were picked up from cultured plates and
confirmed by DNA sequencing analysis. Recombinant
antigens expressed as COOH-terminally polyhistidinetagged fusion proteins were induced with IPTG and
purified using His-select nickel magnetic agarose beads.
SDS-PAGE gels for Rv3914-6His given representative
sample visualization the level of purity required was
stained with Coomassie brilliant blue R-250. Taking the
molecular weight of the 6×His tag (0.84kDa) and that of
Rv3914 antigen (12.54 kDa) into account, the size of the
purified protein showed an expected size of protein band
of 13.38 kDa (Figure 1).
Based on the Western blot assay, all of the five purified
native fusion proteins could be recognized by His
monocolonal antibodies and the expected bands were
present respectively (Figure 2). These fusion proteins
were Rv0899-6His (34.38 kDa), Rv0733-6His (20.93
kDa), Rv1908c-6His (81.41 kDa), Rv1411c-6His (25.39
kDa) and Rv3914-6His (13.38 kDa), respectively.
Reactivities evaluation of recombinant antigens to
human serum specimens
A total of 34 serum samples were collected from 34 patients
with a confirmed diagnosis of pulmonary tuberculosis at
Shanghai pulmonary hospital between 2009 and 2010.
Pan et al.
Figure 1. Expression and purification
of Rv3914-6His fusion protein detected
with SDS-PAGE
1:Protein marker; 2:Lysates of pET32b-Rv3914/BL21(DE3) PlySs with
IPTG induction; 3: Purified native
Rv3914-6His fusion protein.
Figure 2. The identification of five kinds of Mtb fusion
antigens by two-color infrared fluorescence
1:Protein marker; 2: Purified Rv0899c-6His fusion
protein; 3: Purified Rv0733-6His fusion protein; 4:
Purified Rv1908c-6His fusion protein；5: Purified
Rv1411c-6His fusion protein; 6: Purified Rv3914-6His
fusion protein.
The clinical and laboratory characteristics of the TB patients and healthy controls were summarized in Table 1.
Serum samples as control group were obtained from
healthy individuals (n=35) with tuberculosis diagnoses
ruled out.
The reactivities of recombinant antigens to human serum
779
serum specimens were interpreted based on the ELISA
assays. For ELISA the positive control antigen Rv2031c6His (Figure 3) and the representative antigens Rv39146His (Figure 4) were used. Rv2031c, the 16 kDa heat
shock protein (HSP), one of the three well known diagnostic antigen (Senol et al., 2009), was shown to be
specific and sensitive for detecting antibodies against M.
tuberculosis. The antigens were coated onto 96-well microplates. A total of 7 human sera were used in this assay,
of which 6 serum specimens were from active TB
patients, whereas 1 was from healthy individual. Ten-fold
serial dilutions of the sera were examined, all reactions
were run three times. The results revealed that the purified native Rv3914-6His antigen showed substantial reactivity to active-TB specimens. The OD value of active-TB
specimens was significantly increased (0.88-fold for
Rv2031c-6His, t=-15.433, P=0.0001; 0.72-fold for
Rv3914-6His, t =-8.513, P=0.0004) in microwell plate
coated with the antigens at the concentration of 1μg/mL
as compared with the concentration of 0.1 μg/mL. The
recombinant antigens concentration of 1 μg/mL for ELISA
studies was selected as working coated concentration in
the following studies.
ELISA screening of purified recombinant antigens for
TB diagnosis
After confirming the reactivity of purified fusion antigen, a
total of 69 human serum samples were assayed by
ELISA using the five recombinant antigens, respectively.
The Rv2031c-6His (16 kDa antigen) fusion protein was
included in the assay system as a positive control for
specificity and sensitivity. Each assay was repeated three
times. These sera consisted of 34 samples from active
TB patients, and 35 samples from healthy physical examinees. The profiles of IgG antibodies against of these
purified fusion Mtb antigens were estimated by indirect
ELISA in these human serum samples collected (Figure
5). The ELISA with Rv3914-6His, Rv1411c-6His and
Rv2031c-6His fusion antigens were useful to discriminate
positive and negative TB, a statistically significant difference in IgG level were found between healthy controls
and TB patients (PRv3914c-6His=0.0001, PRv1411c-6His=0.0043
and PRv2031c-6His=0.0004, respectively). There was no
significant difference in the levels of anti-Mycobacterium
tuberculosis antibody IgG from those of serum specimens
from healthy controls and from active TB individuals by
ELISA with Rv0899-6His, Rv0733-6His and Rv1908c-6His
fusion antigens (PRv0899-6His=0.1398, PRv0733-6His=0.3060
and PRv1908c-6His = 0.0691, respectively).
Receiver operating characteristic (ROC) curves is a
graph of sensitivity on the y-axis against 100-specificity
on the x-axis. It is an excellent way to evaluate the
clinical diagnostic value of given biomarker. ROC curves
were plotted using GraphPad Prism 5. The areas under
the summary ROC curve (AUC) of Rv3914-6His,
780
Afr. J. Microbiol. Res.
Table 1. Clinical and experimental parameters of research cohort.
Clinical and laboratory characteristic
Age (years ±SD)
Sex (male/female)
Duration of symptoms (months ±SD)
Active tuberculosis patients (n=34)
45.4 ± 18.6
12/22
19.18 ± 2.61
Treatment (months ±SD)
2.45 ± 0.12
Smear positive
Sputum culture positive
20
25
Purified protein derivative (PPD) positive
Cavity positive
16
13
Healthy controls (n=35)
42.8 ± 16.2
24/11
－
－
－
－
－
－
Concentration of Rv2031c-6His antigen (μg/mL)
Figure 3. Detection of serum IgG against with Rv2031c-6His
fusion protein by indirect ELISA. TB: tuberculosis patients;
HC: protein by indirect ELISA. TB: tuberculosis patients；HC:
healthy physical examinees.
Figure 5. Detection of serum IgG against with Mtb
antigen-6His fusion protein by indirect ELISA. TB: tuberculosis patients (n=34)；HC: healthy physical examinees
(n=35).
Rv1411c-6His and Rv2031c-6His ROC were 0.7867,
0.5867 and 0.754, respectively (Figure 6). An AUC of
0.75 or greater is generally considered a good biomarker.
Antibody response to the 16 kDa heat shock protein in
active TB has been used in assist diagnosis of infectious
Mtb (Senol et al., 2009). It was suggested that Rv3914
recombinant protein could be potentially used for the
diagnosis of tuberculosis and as a candidate antigen.
DISCUSSION
Concentration of Rv3914-6His antigen (μg/mL)
Figure 4. Detection of serum IgG against with Rv3914-6His
fusion protein by indirect ELISA. TB: tuberculosis patients;
HC: protein by indirect ELISA.
In recent years，due to movement of population, problems of multi-drug resistant TB and TB-HIV co-infection,
tuberculosis continues to be one of major public health
burden in China．Rapid and effective diagnosis of infectious cases is crucial to facilitate earlier treatment initiation
Pan et al.
781
TB: tuberculosis patients (n=34)；HC: healthy physical examinees (n=35)
150 Rv2031c-6His
100
50
100
50
0
0
0
20
40
60
80
100% - Specificity%
100
150 Rv3914-6His
Sensitivity%
Sensitivity%
Sensitivity%
150 Rv1411c-6His
0
20
40
60
80
100
100
50
0
0
100% - Specificity%
20
40
60
80
100
100% - Specificity%
Figure 6. ROC curves of Mtb 6His fusion antigens in the diagnosis of TB.
and reducing disease transmission and preventing emergence of resistant strains (Kaushik et al., 2012).
The aim of this study was to screen a specific diagnostic marker from five envelope protein of Mtb which identified by proteomic studies (de Souza et al., 2011; Forrellad
et al., 2013). The envelop antigens，such as Rv1908c
(Escalante et al., 2013), Rv0899 (Marassi (2011) and
Rv3914 (Akif et al., 2008), may play essential roles in the
intracellular growth and survival of Mtb within the host.
The expression and purification system of five fusion
proteins was successfully established and recombinant
fusion proteins with high purity and high yield was
obtained. The recombinant antigen’s native conformation
with antibody binding activity may be lost due to prokaryotic expression system, so the ELISA plates were
coated with gradient dilution antigens, and the collected
serums (dilution, 1:100) were used as primary antibodies.
The result showed the representative Rv3914-6His antigen retained antibody-binding activity. The purified fusion
antigens were potentially used as coated antigens in
ELISA assays.
Serum specimens (including 34 cases of active TB
patients and 35 healthy physical examinees) were tested
for the presence of IgG antibodies against these five
antigens of Mtb using a quantitative ELISA. The results of
ELISA test showed good sensitivity for purified Rv39146His and Rv1411c-6His antigen. The levels of antibodies
against the two antigens were significantly higher in TB
patients than in healthy individuals (PRv3914c-6His = 0.0001,
PRv1411c-6His = 0.0043), respectively. Rv3914 could be
selected as an adjunct for TB serodiagnostic assay
according to the ROC analysis, the AUC value for
Rv3914-6His is 0.7867 and similar to the value for
Rv2031c (AUC Rv2031c-6His=0.754 ). It would be of interest
to further study how the Rv3914 and Rv2031c antigens
perform in combination.
There were no statistically significant differences between the optical density values obtained with sera from
TB patients and healthy controls with Rv1908c-6His,
Rv0899-6His or Rv0733-6His antigens-coated ELISA
plates, respectively. It has been reported previously that
mutations in the three antigens’ gene lead to reduce
virulence and may cause reduced survival of Mtb in host
tissues (Pym et al., 2002; Raynaud et al., 2002;
Bellinzoni et al., 2006). These antigens might really begin
their work when Mtb were engulfed by macrophages.
Therefore, these antigens might be helpful for screening
intracellular antibodies of Mtb.
Authors’ contributions
XP designed the research and wrote the paper; XP, SLZ,
JLC, BZ, BJP, ZLP, YW, YW, YZ, WF, MC, WQL, XZY,
MT, JZ, WS performed research.
ACKNOWLEDGMENT
This work was supported by National Key Basic Research
Program of China Grants (Contract No. 2013CB531601)
and National Natural Science Foundation of China Grants
(Contract No. 30972633).
REFERENCES
Akif M, Khare G, Tyagi AK, Mande SC, Sardesai AA (2008). Functional
studies of multiple thioredoxins from Mycobacterium tuberculosis. J.
Bacteriol. 190(21):7087-7095.
Bellinzoni M, Haouz A, Graña M, Munier-Lehmann H, Shepard W, Alzari
PM (2006). The crystal structure of Mycobacterium tuberculosis
2+
adenylate kinase in complex with two molecules of ADP and Mg
supports an associative mechanism for phosphoryl transfer. Protein
Sci. 15(6):1489-1493.
Ben Selma W, Harizi H, Marzouk M, Ben Kahla I, Ben Lazreg F, Ferjeni
A, Harrabi I, Abdelghani A, Ben Said M, Boukadida J (2010). Rapid
detection of immunoglobulin G against Mycobacterium tuberculosis
antigens by two commercial ELISA kits. Int. J. Tuberc. Lung. Dis.
14(7):841-846.
de Souza GA, Leversen NA, Malen H, Wiker HG (2011). Bacterial
proteins with cleaved or uncleaved signal peptides of the general
secretory pathway. J. Proteomics 75(2):502-510.
Escalante P, McKean-Cowdin R, Ramaswamy SV, Williams-Bouyer N,
Teeter LD, Jones BE, Graviss EA (2013). Can mycobacterial katG
genetic changes in isoniazid-resistant tuberculosis influence human
disease features? Int. J. Tuberc. Lung Dis. 17(5):644-651.
782
Afr. J. Microbiol. Res.
Flores LL, Steingart KR, Dendukuri N, Schiller I, Minion J, Pai M,
Ramsay A, Henry M, Laal S (2011). Systematic review and metaanalysis of antigen detection tests for the diagnosis of tuberculosis.
Clin. Vaccine Immunol. 8(10):1616-1627.
Forrellad MA, Klepp LI, Gioffré A, Sabio y García J, Morbidoni HR, de la
Paz Santangelo M, Cataldi AA, Bigi F (2013). Virulence factors of the
Mycobacterium tuberculosis complex. Virulence 4(1):3-66.
He XY, Li J, Hao J, Chen HB, Zhao YZ, Huang XY, He K, Xiao L, Ye LP,
Qu YM, Ge LH (2011). Assessment of five antigens from
Mycobacterium tuberculosis for serodiagnosis of tuberculosis. Clin.
Vaccine Immunol.18(4):565-570.
Ireton GC, Greenwald R, Liang H, Esfandiari J, Lyashchenko KP, Reed
SG (2010). Identification of Mycobacterium tuberculosis antigens of
high serodiagnostic value. Clin. Vaccine Immunol. 17(10):1539-1547.
Kashyap RS, Ramteke SS, Gaherwar HM, Deshpande PS, Purohit HJ,
Taori GM, Daginawala H (2010). Evaluation of BioFM liquid medium
for culture of cerebrospinal fluid in tuberculous meningitis to identify
Mycobacterium tuberculosis. Indian. J. Med. Microbiol. 28(4):366369.
Kaushik A, Singh UB, Porwal C, Venugopal SJ, Mohan A, Krishnan A,
Goyal V, Banavaliker JN (2012). Diagnostic potential of 16 kDa
(HspX, α-crystalline) antigen for serodiagnosis of tuberculosis. Indian.
J. Med. Res. 135(5):771-777.
Kunnath-Velayudhan S, Salamon H, Wang HY, Davidow AL, Molina DM,
Huynh VT, Cirillo DM, Michel G, Talbot EA, Perkins MD, Felgner PL,
Liang XW, Gennaro ML (2010). Dynamic antibody responses to the
Mycobacterium tuberculosis proteome. Proc. Natl. Acad. Sci. U. S. A.
107(33):14703-14708.
Marassi FM (2011). Mycobacterium tuberculosis Rv0899 defines a
family of membrane proteins widespread in nitrogen-fixing bacteria.
Proteins.79(10):2946-2955.
Pym AS, Saint-Joanis B, Saint-Joanis B, Cole ST (2002). Effect of katG
mutations on the virulence of Mycobacterium tuberculosis and the
implication for transmission in humans. Infect. Immun. 70(9):49554960.
Raynaud C, Papavinasasundaram KG, Speight RA, Springer B, Sander
P, Bottger EC, Colston MJ, Draper P (2002). The functions of
OmpATb, a pore-forming protein of Mycobacterium tuberculosis. Mol.
Microbiol. 46(1):191-201.
Rose MV, Kimaro G, Nissen TN, Kroidl I, Hoelscher M, Bygbjerg IC,
Mfinanga SG, Ravn P (2012). QuantiFERON®-TB gold in-tube
performance for diagnosing active tuberculosis in children and adults
in a high burden setting. PLoS. One.7(7):e37851.
Senol G, Ecevit C, Oztürk A (2009). Humoral immune response against
38- and 16-kDa mycobacterial antigens in childhood tuberculosis.
Pediatr. Pulmonol.44(9):839-844.
Steingart KR, Flores LL, Dendukuri N, Schiller I, Laal S, Ramsay A,
Hopewell PC, Pai M (2011). Commercial serological tests for the
diagnosis of active pulmonary and extrapulmonary tuberculosis: an
updated systematic review and meta-analysis. PLoS. Med. 8(8):
e1001062.
Steingart KR, Sohn H, Schiller I, Kloda LA, Boehme CC, Pai M,
Dendukuri N (2013). Xpert® MTB/RIF assay for pulmonary tuberculosis and rifampicin resistance in adults. Cochrane. Database. Syst.
Rev.1:CD009593.
Walzl G, Ronacher K, Hanekom W, Scriba TJ, Zumla A (2011). Immunological biomarkers of tuberculosis. Nat. Rev. Immunol. 11(5):343-354.
Wang L, Liu J, Chin DP (2007). Progress in tuberculosis control and the
evolving public-health system in China. Lancet. 369(9562):691-696.
World Health Organization (WHO) (2011). Policy statement: commercial
serodiagnostic
tests
for
diagnosis
of
tuberculosis.
WHO/HTM/TB/2011.5.WHO,
Geneva,
Switzerland.
http://whqlibdoc.who.int/publications/2011/9789241502054_eng.pdf.
Accessed 29 July 2011.
Vol. 8(8), pp. 783-787, 19 February, 2014
DOI: 10.5897/AJMR2013.6186
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
An outbreak of ringworm caused by Trichophyton
verrucosum in a group of calves in Vom, Nigeria
Dalis, J. S.1*, Kazeem, H. M.2, Kwaga, J. K. P.3 and Kwanashie, C. N.2
1
Bacterial Research Division, National Veterinary Research Institute, Vom, Plateau State, Nigeria.
Department of Microbiology, Faculty of Veterinary Medicine, Ahmadu Bello University, Zaria, Kaduna State, Nigeria.
3
Department of Veterinary Public Health and Preventive Medicine, Ahmadu Bello University, Zaria, Kaduna State,
Nigeria.
2
Accepted 5 February, 2014
An outbreak of ringworm in young calves is reported from Vom in Nigeria. Twelve out of fourteen calves
were observed to have skin lesions consistent with dermatophytosis. Lesions were seen mostly around
the eyes and neck. Skin scrapings were collected from the affected areas and processed for mycology.
Trichophyton verrucosum was isolated from all the affected calves. This study has shown that T.
verrucosum can be a problem to watch for in calves in this particular environment, both as a zoonosis
and economic importance as a result of damage to hides and skin. The need to study the prevalence of
the disease among the cattle population in the state and country with a view to instituting preventive
and control measures was emphasized.
Key words: Dermatophytosis, outbreak, calves, Nigeria.
INTRODUCTION
Ringworm (dermatophytosis) is an infection of the
superficial, keratinized structures of the skin and hair of
man and animals. The disease is caused by a group of
keratinophilic filamentous fungi called dermatophytes in
the
Genera
Trichophyton,
Microsporum
and
Epidermophyton (Gudding and Lund, 1995).
Animals are infected by contact with arthrospores
(asexual spores formed in the hyphae of the parasitic
stage) or conidia (sexual or asexual spores formed in the
“free living” environmental stage). Transmission between
hosts usually occurs by direct contact with a symptomatic
or asymptomatic host (Murray et al., 2005). It had been
reported that housing animals in close proximity to each
other for long periods in the presence of infected debris
was responsible for the high incidence of the disease in
winter (Al-Ani et al., 2002). However, the disease
appears to be more common in tropical than temperate
*Corresponding author. E-mail: dalisjames280@yahoo.com.
climates, and particularly in countries or areas having hot
and humid climatic conditions (Radostits et al., 1997).
The typical lesion in cattle is a heavy, grayish-white
crust that is raised perceptibly above the skin, affecting
young calves’ more than adult cattle (Cam et al., 2007;
Akbarmehr, 2011). Dermatophytosis had been considered the most common zoonosis worldwide, affecting
more children than adults (Achterman and White, 2012).
Studies on human skin infections revealed that dermatophytosis and other superficial fungal infections constitute
a major public health problem in Nigeria (Adeleke et al.,
2008).
Whereas the literature is replete with information on
human dermatophytoses (Ameh and Okolo, 2004;
Adeleke et al., 2008; Nweze, 2010), very little information on animal ringworm have been documented in
Nigeria. While there are some information on dermato-
784
Afr. J. Microbiol. Res.
phytosis of goats (Chineme et al., 1980) and pet animals
(Adekeye et al., 1989), to our knowledge, no studies on
ringworm infection in cattle have been published from this
country.
This paper focuses on the outbreak of ringworm in a
group of calves in Vom, Nigeria.
MATERIALS AND METHODS
Twelve out of fourteen (85.7%) calves aged between four and eight
months were observed to have skin lesions consistent with
dermatophytosis. The calves were kept indoors and in close contact
with each other. They were fed concentrate and hay and allowed to
suckle from their dams in the morning during milking. The dams
and other adult cattle in the herd were physically examined for the
presence of skin lesions. Skin samples were collected from infected
animals by first disinfecting the affected area by cleaning it with
cotton wool soaked in 70% ethyl alcohol. Skin scrapings were
collected by scraping the margin of the lesions using sterile scalpel
blade into sterile Petri dishes. Hair pullouts and crusts were also
collected from the margin of the lesions as described by Robert and
Pihet (2008). Each sample was divided into two parts. One part was
used for direct microscopic examination while the second part was
used for fungal isolation by culture.
Direct microscopic examination
A portion of each sample was placed on a clean glass slide
containing a drop of 10% potassium hydroxide solution and covered
with a cover slip. The slides were gently heated over a flame from a
Bunsen burner and examined for the presence of arthrospores and
hyphae under a light microscope.
Fungal isolation and identification
Each sample was inoculated onto Dermasel agar (OXOID) containing: Mycological peptone, 10.0 g/L; glucose, 20.0g/L; agar,
14.5g/L; cyclohexamide, 0.4g/L and chloramphenicol, 0.05g/L, pH
6.9, incubated at 37°C for 2-4 weeks and examined for fungal
growth.
Identification of fungal isolates was carried out by both
macroscopic and microscopic examination which included growth
rate, general topography, surface and reverse pigmentation.
Microscopic identification of positive fungal cultures was carried out
using the method described by Murray et al. (2005). Briefly, a drop
of lactophenol cotton blue stain was placed on a clean glass slide.
A portion of mycelium was transferred into the lactophenol cotton
blue stain and teased with a 22 gauge nichrome needle to separate
the filaments. Cover slip was placed on the preparation and
examined under low and high power magnification using a much
reduced light for identification.
RESULTS
The skin of affected calves showed circular, circumscribed, grayish-white, thick, hairless, crusty raised
lesions (Figure 1). The lesions were mostly seen on the
head, face, around the eyes, neck and dewlap. No visible
skin lesions were observed on the dams or other animals
in the herd. All the 12 samples were positive for fungal
elements (ectothrix spores and endothrix hyphae) by
direct microscopic examination. The fungus grew slowly
on Dermarsel agar producing white, cottony, heaped and
slightly folded colonies with some submerge growth and
yellow reverse pigment (Figure 2). Microscopic examination of isolates stained with lactophenol cotton blue
revealed septate hyphae with numerous clavate microconidia borne laterally from the hyphae (Figure 3b), and
many clamydospores arranged in chains (chains of
pearls) characteristic of T. verrucosum (Figure 3b)
DISCUSSION
T. verrucosum was found to be responsible for the
ringworm seen on 12 of the 14 calves in this study. Our
report is significant as it suggests that dermatophytosis
could be a major problem in cattle farms especially in
young animals. This report agrees with previous findings
(Cam et al., 2007; Shams-Gahfarokhi et al., 2009), that
young animals are particularly susceptible to infection by
ringworm fungi. This could be as a result of the poorly
developed immune system and the high pH of the skin in
young animals (Radostits et al., 1997).
The diagnosis of ringworm in this study was based on
clinical signs, demonstration of fungal elements in samples by direct microscopic examination and the isolation
of causative agent by culture. T. verrucosum had been
implicated in ringworm of cattle (Swai and Sanka, 2012;
Cam et al., 2007). The main clinical signs observed
among the affected calves were circular, circumscribed,
grayish-white, thick crusty lesions perceptibly raised
above the skin. The lesions were most frequently found
on the head and neck especially around the eyes and
face. These observations were in agreement with other
reports (Cam et al., 2007; Akbarmehr, 2011). The reason
for the occurrence of more lesions around the eyes and
face in young animals is not well understood. However,
the habit of licking and grooming by calves could predispose this part of the animal to infection.
Our results showed that all the samples examined by
direct microscopy were positive for fungi. Other researchers found out that direct microscopic examination could
provide a positive diagnosis in 60-71% of samples from
which dermatophytes were isolated (Sparkes et al., 1993;
Al-Ani et al., 2002). In this study, the dermatophyte was
isolated in pure culture suggesting that dermasel agar is
a suitable selective medium for the isolation of pathogenic fungi.
Colonies of T. verrucosum in this report were slow growing, white, cottony, heaped and slightly folded with
some submerged growth and yellow reverse pigment.
This observation is consistent with the findings of Forbes
et al. (2002). In our investigation, microscopic examination revealed septated hyphae and microconidia that
were attached laterally to the hyphae. There were numerous chlamydospores mostly in chains (chains of pearls).
Dalis et al.
785
Figure 1. Ringworm lesions in a 4 month-old calf. Note thick, crusty, grayish-white lesions around the eye, face,
ear and neck (arrow).
This agrees with the report of Shams-Gahfarokhi et al.
(2009) who observed chains of chlamydospores as predominant microscopic feature of the fungus in slide
culture. Adult cattle had been reported to be less susceptible to the ringworm (Cam et al., 2007) and some of the
dams could perhaps be carrying the infection without
showing clinical sign and might be a source of infection
for the calves. The soil, infected installations and even
the house were the animals were kept could be other
sources through which the animal could acquire infection
since T. verrucosum is known to persist in the environment for 5-7 years and had been isolated from the soil
(Gudding and Lund, 1995; Mahmoudabadi and Zarrin,
2008; Singh and Kushwaha, 2010). We do not know the
actual source of infection for these animals because neither neither the healthy dams nor any of these materials
were sampled and investigated in this study.
The warm and humid climate of our environment could
have favored the growth and development of fungal
spores thereby predisposing the animals to infection and
hence the outbreak in this highly susceptible population.
Cattle ringworm causes high economic losses especially in the livestock and leather industries due to
downgrading of hides and skin and decrease in meat and
milk production (Gudding and Lund, 1995). In a survey of
bovine dermatophytoses in major dairy farms of Mashhad
City, Eastern Iran, T. verrucosum was the predominant
dermatophyte isolated (Shams-Gahfarokhi et al., 2009).
A large scale outbreak of the disease involving a dairy
herd has recently been reported in Arusha region,
Tanzania (Swai and Sanka, 2012). Several other outbreaks of ringworm affecting cattle herds and especially
young calves had been documented in Australia
(Maslem, 2000), China (Ming and Ti, 2006) and Italy
(Papini et al., 2009).
The major problem with T. verrucosum infection in
cattle farms is that, once the disease is introduced into a
farm, it spreads rapidly among susceptible animals. The
organism is difficult to eradicate from the environment
because of the peculiarity in composition of its spores.
Treatment of cattle ringworm is expensive and cumbersome
especially on a herd level (Gudding and Lund, 1995).
This concern has prompted the need for effective prophylaxis against the disease as hygienic and other preventive measures were often inadequate (Rybnikar, 1992).
Vaccination against bovine dermatophytosis had been
786
Afr. J. Microbiol. Res.
Figure 2. Colonial morphology of T. verrucosum. Note:
white, cottony, heaped and folded colony.
a
b
Figure 3. Microscopic morphology of T. verrucosum showing microconidia borne laterally from the hyphae (a) and
clamydoconidia in chains referred to as “chains of pearls” (b).
considered the most effective way of controlling the
infection (Rybnikar, 1992). Immunization of calves with
live T. verrucosum was found to protect 90% of the vaccinated animals against T. verrucosum infection (Mikaili
et al., 2012). A nationwide immunization program carried
out in Norway where all cattle including none infected
animals of all ages followed by vaccination of all calves
and purchased animals reduced the prevalence of ringworm from 70% in the year the program started to 0%
eight years later (Gudding and Lund, 1995; Mikaili et al.,
2012).
Ringworm is enzootic in Nigeria. However, the national
prevalence of the disease in the cattle population in this
country is yet to be determined.
This study has revealed that T. verrucosum could be an
important health problem in calves in this particular environment, both as a zoonosis and economic importance
as a result of esthetic and damage to hides and skin.
There is need to study and understand the disease among
the cattle population in this country with a view to Instituting
Dalis et al.
prevention and control measures.
ACKNOWLEDGEMENT
We thank the Executive Director, National Veterinary
Research Institute, Vom, Nigeria for permission to publish
this work
REFERENCES
Achterman RR, White TC (2012). Dermatophyte virulence factors:
identifying and analyzing genes that may contribute to chronic or
acute infections. Int. J. Microbiol. 2012. pp. 1-8
Adekeye J, Ado P, Kwanashie CN, Adeyanju J, Abdullahi S (1989).
Prevalence of animal dermatophytes in Zaria. Zariya Veterinarian,
4(1):84-86.
Adeleke SI, Usman B, Ihesiulor G (2008). Dermatophytosis among
itinerant Quranic scholars in Kano (Northwest) Nigeria. Nig. Med.
Pract. 53(3):33-35.
Akbarmehr J (2011). The prevalence of cattle ringworm in native dairy
farms of Sarab city (East Azarbayjan Province) in Iran. Afr. J.
Microbiol. Res. 5(11): 1268-1271.
Al-Ani FK, Younes FA, Al-Rawashdeh OF (2002). Ringworm Infection in
Cattle and Horses in Jordan. Acta. Vet. Brno. 71: 55-60.
Ameh IG, Okolo RU (2004). Dermatophytosis among school children:
domestic animals as predisposing factor in Sokoto, Nigeria. Pak. J.
Biol. Sci. 7(7):1109-1112.
Cam Y, Gümüssoy KS, Kibar M, Apaydin N, Atalay Ö (2007). Efficacy
of ethylenediamine dihydriodise for the treatment of ringworm in
young cattle. Vet. Rec. 160: 408-410.
Chineme CN, Adekeye JO, Bida SA (1980). Trichophyton verrucosum
in young goats. Bull. Anim. Hlth. Prod. 29: 75-78.
Forbes BA, Sahm DF Weissfeld AS (2002). Laboratory Methods in
th
Basic Mycology. In Bailey and Scott’s Diagnostic Microbiology 11
edition, Mosby Inc, 11830 West line Industrial Drive St. Louis,
Missouri 63146, U S A.
Gudding R, Lund A (1995). Immunoprophylaxis of bovine dermatophytosis. Can. Vet. J. 36:302-306
Mahmoudabadi AZ, Zarrin M (2008). Isolation of dermatophytes and
related kerationophilic fungi from the two Public Parks in Ahvaz.
Jundishapur J. Microbiol. 1(1):20-23.
Maslen MM (2000). Human cases of cattle ringworm due to
Trichophyton verrucosum in Victoria, Australia. Australian J.
Dermatol. 42: 1-4.
Mikaili A, Chalabi M, Ghashghaie A, Mostafaie A (2012). Immunization
against bovine dermatophytosis with live Trichophyton verrucosum.
Afr. J. Microbiol. Res. 6 (23):4950-4953.
Ming PX, Ti YL, Bulmer GS (2006). Outbreak of Trichophyton
verrucosum in China transmitted from cows to humans. Mycopath.
161: 225-228.
Murray PR, Rosenthal KS, Pfaller MA (2005). Superficial and cutaneous
th
mycosis. In: Medical Microbiology, 5 edition. Philadelphia, USA, pp.
745-751.
Nweze EI (2010). Dermatophytosis among children of Fulani/Hausa
herdsmen living in Southeastern Nigeria. Rev. Iberoam. Micol.
27(4):191-194.
787
Papini R, Nardoni S, Fanelli A, Mancianti F (2009). High infection rate of
Trichophyton verrucosum in calves from Central Italy. Zoonoses Pub.
Hlth. 56(2): 59-64.
Radostits OM, Blood DC, Gay CC (1997). Veterinary Medicine, 8th Ed,
Bailliere Tindall, London,pp. 381-39.
Robert R, Pihet M (2008). Conventional methods for the diagnosis of
dermatophytosis. Mycopath. 166: 295-306.
Rybnikar A (1992). Cross-immunity in calves after vaccination against
trichophytosis. Acta Vet. Brno. 61:189-194.
Shams-Gahfarokhi M, Mosleh TF, Ranjbar BS, Razzaghi AM (2009). An
epidemiological survey on cattle ringworm in major dairy farms of
Mashad city, Eastern Iran. I. J, M. 1(3): 31-36
Singh I, Kushwaha RKS (2010). Dermatophyte and related keratinophlic
fungi in soil of Parks and Agricultural Fields of Uttar Pradesh, India.
Indian J. Dermatol. 53(3):306-308.
Sparkes AH, Gruffy TJ, Shaw SE, Wright AI, Stokes CR (1993).
Epidemiological and diagnostic features of canine and feline
dermatophytosis in the United Kingdom from 1956 to 1991. Vet. Rec .
133: 57-61.
Swai ES, Sanka PN (2012). Bovine dermatophytosis caused by
Trichophyton verrucosum: a case report. Vet. World 5(5):297-300
Vol. 8(8), pp. 788-796, 19 February, 2014
DOI: 10.5897/AJMR2013.6518
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Characteristics of nodule bacteria from Mimosa spp
grown in soils of the Brazilian semiarid region
Ana Dolores Santiago de Freitas1*, Wardsson Lustrino Borges2, Monaliza Mirella de Morais
Andrade1, Everardo Valadares de Sá Barretto Sampaio 3,Carolina Etienne de Rosália e Silva
Santos1, Samuel Ribeiro Passos4, Gustavo Ribeiro Xavier4, Bruno Mello Mulato4
and Maria do Carmo Catanho Pereira de Lyra5
1
Universidade Federal Rural de Pernambuco (UFRPE), Recife-PE, Brazil.
2
Embrapa Amapá, Macapá-AP, Brazil.
3
Universidade Federal de Pernambuco (UFPE), Recife-PE, Brazil.
4
Embrapa Agrobiologia, Seropédica-RJ, Brazil.
5
Instituto Agronômico de Pernambuco (IPA), Recife-PE, Brazil.
Accepted 13 January, 2014
The Brazilian Northeastern dry forest (Caatinga) is one of the diversification centers of Mimosa species.
We determined the characteristics of native rhizobia isolates from nodules of Mimosa tenuiflora and
Mimosa paraibana grown in pots with soils collected under Caatinga vegetation and compared the
restriction ribosomal DNA profiles of the isolates with those of 16 reference strains. All plants formed
abundant indeterminate nodules and all nodule isolates formed fast growing colonies. No colony altered
the medium to an alkaline reaction and most of them produced low or medium amounts of extracellular
polysaccharides. White and creamy colonies predominated among the isolates but orange and green
colonies were present. Differences among the isolates from the Mimosa species tested are indicated by
the greater phenotypic diversity of those obtained from M. tenuiflora. The analysis of the 16S rDNA gene
suggests that the isolates from M. tenuiflora and M. paraibana are closely related and closer to rhizobia than to α-rhizobia. However, the similarity with all the tested -rhizobia reference strains was
relatively low suggesting that the isolates may belong to different bacteria species.
Key words: Biological nitrogen fixation, diversity, rhizobia, wild tree legumes.
INTRODUCTION
Legume species belonging to the genus Mimosa have
received considerable attention in recent years because
of their potential to fix large proportions of their nitrogen
from the atmosphere (Freitas et al., 2010) and because
of their preferential association with -rhizobia (Chen et
al., 2005; Barrett and Parker, 2006; Bontemps et al.,
2010; Elliott et al., 2009; Reis Jr et al., 2010; Liu et al.,
2012). Mimosa is one of the richest Leguminosae genera,
with over 500 species, mostly neotropical, occupying
diverse habitats, including lowland tropical rainforest,
savanna, tropical and subtropical dry forest and thorn
scrub, mid-elevation subtropical forest, desert, grassland,
and wetland (Simon et al., 2011).
One of the diversification centers of Mimosa is the
Brazilian Northeastern dry forest (Simon et al., 2011),
locally called Caatinga. The Caatinga represents the
largest and most isolated of the South American dry
2
forests. It covers more than 850,000 km (Albuquerque et
*Corresponding author. E-mail: ana.freitas@depa.ufrpe.br. Tel: 55-81-32692660, 55-81-33206237. Fax: 55-81-33206200.
de Freitas et al.
al., 2012), from 02°50’S at its northern limits, to 17°20’S
with a variety of different types of vegetation (Queiroz
2006). Caatinga occurs under a prevailing semi-arid
climate, with a high evapotranspiration potential (1500 to
-1
2000 mm year ) and a low precipitation (300 - 1000 mm
-1
year ) that is usually concentrated within 3 to 5 months
(Queiroz 2006). The region is rich in legume species, with
more than 293 speies in 77 genera, many of them endemic ones (Queiroz et al., 2009). Few of these species
were studied in relation to their potential to fix nitrogen
and to their microsymbionts (Freitas et al., 2010; Teixeira
et al., 2010).
Mimosa paraibana Barneby and Mimosa tenuiflora
(Willd.) Poir. are leguminous tree species with great
nitrogen fixation capacity mean contributions of biological
fixation for plant nitrogen reaching up to 50% in Caatinga
(Freitas et al., 2010). M. tenuiflora is a species of wide
distribution, occupying dry areas of Brazil to Mexico,
Honduras and El Savador (Queiroz et al., 2009). This
species is the main pioneer species in areas of caatinga
with few years of regeneration (Souza et al., 2012). Its
preferred symbionts are apparently β-proteobacteria,
belonging to the genus Burkholderia (Bontemps et al.,
2010; Reis Jr et al., 2010). Moreover, M. paraiba is a
species endemic to Northeast Brazil (Queiroz et al.,
2009) and there is no studies on bacteria capable of
forming symbiotic nodules on their roots.
Research on Mimosa rhizobia have been conducted in
several regions of Brazil (Chen et al., 2005; Barrett and
Parker, 2006; Elliott et al., 2009; Liu et al., 2012).
Isolation of rhizobia populations from Caatinga soils has
been relatively rare (Bontemps et al., 2010; Reis Jr et al.,
2010; Teixeira et al., 2010), mainly considering the diversity of environmental conditions in the region, that can
affect the structure of rhizobia populations (Mishra et al.,
2012). Moreover, most of this research centered on genetic characteristics and only Teixeira et al. (2010) described cultural characteristics of the rhizobia. Therefore,
the diversity of bacteria able to nodulate Mimosa species
in the region is little known.
Considering this scarcity of information, we characterized Caatinga native rhizobia associated to two
Mimosa species in relation to their cultural traits and
compared the restriction profiles of their amplified ribosomal DNA (16S rDNA-ARDRA) with those of 16
reference strains.
MATERIALS AND METHODS
Soil sampling and Mimosa spp. cultivation
Composite soil samples from the 0 to 20 cm superficial layer were
collected in areas of preserved Caatinga vegetation in three
municipalities, with different climate conditions (Table 1): 1) Santa
Terezinha, in the sertão zone of Paraíba state; 2) Remígio, in the
agreste zone of this same state; and 3) Serra Talhada, in the sertão
zone of Pernambuco state. The composition and structure of the
vegetation in the three areas were described by Ferraz et al.
789
(2003), Souza (2010) and Pereira et al. (2003), respectively.
Number of species and tree heights and stem diameters are higher
in the agreste zone than in the sertão zone and in this last zone
higher in Serra Talhada than in Santa Terezinha, probably reflecting higher water availability.
Soil subsamples were analyzed for some chemical and physical
characteristics (Table 2), following the methodology described by
Embrapa (1997). The samples were dried, passed through a 6 mm
mesh sieve and portions of 1 kg were placed in pots maintained
under greenhouse conditions. Seeds of two Mimosa species
(Mimosa tenuiflora (Willd.) Poir. and Mimosa paraibana Barneby)
were collected from a single mother tree in Remígio caatinga. The
seeds were surface disinfected in etanol (70% v/v - 3 min) and
sodium hypochlorite (1 % v/v - 3 min), rinsed five times with sterile
distilled water, rolled onto YMA plates to test for surface sterility and
then were sown in the pots. Each legume species was sown in
triplicate for each soil sample. The pots received 100 ml of nutrient
solution without nitrogen (Hoagland and Arnon, 1939) every week
until harvest, 120 days after seed germination. At harvest the root
nodules were separated, dehydrated in silica gel and stored.
Isolation and phenotypic characterization of rhizobia
Rhizobia were isolated from the nodules in yeast mannitol agar
medium (YMA, pH 6.8) (Vincent, 1970) with 25 mg kg-1 (w/v) of
Congo red. The typical rhizobia colonies were purified and stored at
-20°C, in microtubes with 1 ml YM medium(YMA without agar) plus
15% sterilized glycerol. Isolates colonies in YMA with 25 mg kg-1
(w/v) bromethymol blue as pH indicator (Fred and Waksman, 1958)
were observed for the following characteristics: growth period, pH
alteration of growth medium, colony morphology (shape, size,
border, transparency, surface) and amount of extracellular polysaccharides (EPS) (Xavier et al., 1998). These characteristics were
converted to binary data employed in a cluster analysis using the
UPGMA (Unweighted Pair Group Method Using Arithmetic Averages) algorithmand the Jaccard similarity index.
The results of the cluster analysis were used to calculate
richness (Taxa S and Margalef), diversity (Shannon H), dominance
(Simpson 1-D) and uniformity (Equitability J) indices for the soils
and species, where each morphological group, at 60% of the
similarity (Jesus et al., 2005), was considered as one operational
taxonomic unit. The Past (palaeontological statistics) program was
used to perform cluster analysis and diversity indices calculation
(Hammer et al., 2001).
Restriction analysis (ARDRA) and reference strains
DNA isolation, 16S rDNA gene amplification and restriction analysis
of ribosomal DNA (ARDRA) using HinfI, MspI and DdeI endonucleases were prepared according to Teixeira et al. (2010).
Twenty eight new strains were randomly selected (19 from M.
paraibana and 9 from M. tenuiflora) and compared with 16 strains
from Embrapa Agrobiologia bacterial diazotrophic collection: BR
7801 (Mesorhizobium loti), BR 527 (Sinorhizobium terangae), BR
7606 (Rhizobium leguminosarum bv trifoli), BR 2811
(Bradyrhizobium elkani), BR 114 (Bradyrhizobium japonicum), BR
5401
(Azospirilum
doberaneae),
BR5410
(Azorhizobium
caulinodans), BR 2006 (Methylobacterium nodulans), BR 3407
(Burkholderia sabiae), BR 3437 (Burkholderia nodosa), BR 3454
(Burkholderia mimosarum), BR 3467 (Burkholderia mimosarum),
BR 3471 (Cupriavidus taiwanensis), BR 3486 (Burkholderia
phymatum), BR 3487 (Burkholderia tuberum) and BR 3498
(Burkholderia caribensis). The restriction fragment profiles were
used to perform a cluster analysis using the Jaccard index, the
UPMGA algorithm and the GelCompar II (Applied Maths) program.
790
Afr. J. Microbiol. Res.
Table 1. General characteristics of preserved Caatinga areas in three municipalities, in the States of Paraíba (PB)
and Pernambuco (PE), Brazil.
Characteristic
Coordinates
Altitude (m)
Annual rainfall (mm)
Months with water deficit
Average temperature (◦C)
Santa Teresinha (PB)
07º03'S and 37º29'W
380
824
9 - 10
26
Municipality (state)
Remígio (PB)
6°52’S and 35°47’W
596
700
4-5
22
Serra Talhada (PE)
07º59'S and 38º18'W
500
768
6-7
24
Table 2. Soil characteristics of preserved Caatinga areas in three municipalities, in the States of Paraíba (PB) and
Pernambuco (PE), Brazil.
Soil characteristic
Classification
pH (water)
P (mg dm -3)
N (%)
C (%)
Sand (g kg-1)
Silt (g kg-1)
Clay (g kg-1)
Santa Teresinha (PB)
Litholic Neosol
8.8
7.3
0.07
0.73
623
224
153
(A)
Municipality (state)
Remígio (PB)
Regolithic Neosol
4.4
8.4
0.08
0.96
725
122
153
Serra Talhada (PE)
Luvisol
6.8
4.9
0.10
1.09
651
227
122
(B)
Figure 1. Shape of nodules found in Mimosa paraibana (A) and M. tenuiflora (B) roots from plants grown in soils
collected under mature Caatinga vegetation.
RESULTS
Mimosa spp. nodulation
All harvested plants, cultivated in all three soils, had
nodules of indeterminate growth with dark red interior and
sizes up to 3 cm in diameter (Figure 1). Sixty one isolates
were obtained from the nodules of M. paraibana and 62
from the nodules of M. tenuiflora. All isolates developed
very fast, in less than 24 h, and formed circular colonies
in the YMA medium.
Phenotypic characteristics of rhizobia isolates
No isolate changed the medium pH to an alkaline reaction. Most of the isolates obtained from M. tenuiflora
changed the medium pH to an acid reaction: 96% when
de Freitas et al.
Isolates (%)
Acid
A
Neutral
100
90
80
70
60
50
40
30
20
10
0
MT
MP
MT
Santa Teresinha
Isolates (%)
791
None
100
90
80
70
60
50
40
30
20
10
0
MT
MP
MP
Remígio
Low
Moderate
MT
Santa Teresinha
MP
Remígio
MT
MP
Serra Talhada
B
Copious
MT
MP
Serra Talhada
Figure 2. pH change (A) and amount of extracellular polysaccharides (EPS) production (B) in
YMA medium of bacterial nodule isolates from Mimosa tenuiflora (MT) and M. paraibana (MP)
grown in soils collected under mature Caatinga vegetation.
when grown in the soil from Santa Terezinha, 75% in the
soil from Remígio and 68% in the soil from Serra Talhada
(Figure 2). Most of the isolates from M. paraibana grown
in the soil from Serra Talhada (62%) also changed the pH
to an acid reaction but the proportions were lower in the
soils from Santa Terezinha (48%) and Remígio (35%).
Most of the colonies had a cream color (74% of those
from M. tenuiflora and 67% from M. paraibana) but there
were also white, orange and green colonies. At 48 h in
YMA, the most common diameters of colonies from M.
tenuiflora were punctiform (29%), 3 mm (19%) and 4 mm
(16%) while those from M. paraibana were 2 mm (31%),
punctiform (23%) and 1 mm (21%). Among the isolates
from M. tenuiflora, the highest proportion (30 to 40% in
the three soils) produced colonies with moderate
amounts of extracellular polysaccharides (EPS), 26%
were dry colonies and only in the colonies originating
from the Santa Terezinha soil the proportion of high EPS
producers (46%) surpassed the proportion of moderate
producers (Figure 2). Among the isolates from M.
paraibana most (30 to 95%) produced low amounts of
EPS, except in the Santa Terezinha soil where the
proportion of colonies with copious amounts of EPS was
also high (48%).
The isolates from M. tenuiflora were classified into 19
phenotypic groups and those of M. paraibana into 16
792
Afr. J. Microbiol. Res.
Figure 3. Phenotipic similarity dendrogram among M. tenuiflora (A) and M. paraibana (B) nodule isolates froms oils of preserved Caatinga.
The letters MT and MP indicates the isolates from M. Tenuiflora and M. Paraibana respectively. The letters M P, R and S indicates isolates
native from soils of Santa Terezinha, Remígio and Serra Talhada (municipalities in the States of Paraíba (PB) and Pernambuco (PE),
Brazil.), respectively.
groups (Figure 3). Eight groups from each plant species
were composed of a single isolate which can be considered to belong to different or rare types. The isolates
from M. paraibana had a tendency to group according to
the soil, mainly the isolates originating from the soil of
Santa Terezinha, 23 of them clustering into four groups
exclusive of isolates from the soil of this area (Figure 3B).
On the other hand, the isolates from M. tenuiflora had no
clear tendency to group according to the soil.
Richness, diversity and equitability were higher among
de Freitas et al.
793
Figure 4. Taxa S, Margalef, Shannon H, Simpson 1-D and Equitability J indices for bacterial nodule
isolates from Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under Mature
Caatinga vegetation.
the isolates from M. tenuiflora than from M. paraibana
(Figure 4). For the first species, the order of isolate
diversity for the soils was Santa Terezinha, Remígio and
Serra Talhada while for the second species it was the
inverse order.
Restriction analysis (ARDRA) cluster
Four large groups (Figure 5) were formed in the cluster
analysis based on the restriction analysis of ribosomal
DNA (ARDRA). One group was composed of 26 out of 28
of the new isolates, both from M. paraibana (17 out of 19
total new isolates) and from M. tenuiflora (9 new
isolates). The second group was somewhat related to the
first group and was composed mostly of strains typical of
-rhizobia genera. The third group was composed of
strains of the type typical of α-rhizobia genera. The fourth
group included only two isolates from M. paraibana
(MPS5 and MPS10) and had a low similarity with both the
-rhizobia and the α-rhizobia groups. Two pairs of
isolates (MPS 19 and MTP 16-2; MPS 17 and MPS 12)
and one groups of five isolates (MPS1, MPS6, MPS7,
MPS8 and MPS9) from M. paraibana had 100%
similarity.
DISCUSSION
Mimosa spp. nodulation
The spontaneous nodulation of M. paraibana and M.
tenuiflora indicates the presence, in the three soils, of
native populations of bacteria able to colonize the roots of
both plant species. Ample populations of nodulating
bacteria are common in the soils of the regions where the
legume species are native. On the other hand, nodulation
frequently fails when a legume species is planted outside
its original region (Bala et al., 2003; Souza et al., 2007).
M. tenuiflora has a large distribution in tropical dry
forests, from Brazil to Mexico (Queiroz et al., 2009) and
naturally occurs in the three Caatinga fragments where
the soils were collected (Ferraz et al., 2003; Pereira et
al., 2003; Souza, 2010). M. paraibana has a more
restricted distribution, being endemic to the Caatinga,
and spontaneously occurs only in the Caatinga fragment
of Remígio (Pereira et al., 2003). In spite of that, it also
nodulated when planted in the soil of the two other areas.
There is no information on the natural occurrence of
rhizobia populations able to form symbiosis with the
several Mimosa species growing in soils of the Brazilian
semiarid, but the spontaneous nodulation of M. paraibana
indicates that this occurrence may be quite general.
These species may also be very promiscuous, nodulating
with a large spectrum of microsymbionts, as observed for
M. pudica (Bontemps et al., 2010).
The nodules of M. tenuiflora and M. paraibana were
indeterminate, as has been described for those of other
Mimosoideae legumes. Indeterminate nodules, with a
wide range of size, formats and ramifications are usually
attributed to species of Mimosoideae (Sprent et al.,
2007), without influence of the microsymbionts (Lammel
et al., 2007).However, some of the nodules grew more
than usually reported (Patreze and Cordeiro, 2004),
reaching more than 20 mm in their longest axis (Figure
1). M. paraibana is one of the endemic species of
794
Afr. J. Microbiol. Res.
Figure 5. Genetic similarity dendrogram among 28 bacterial nodule isolates from
Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under mature
Caatinga vegetation and 16 α- and -reference rhizobia strains based on PCR-ARDRA
of the 16S rDNA gene.
de Freitas et al.
caatinga that only recently was identified as capable of
fixing nitrogen (Freitas et al., 2010) and the description of
its nodules is being reported for the first time.
Phenotypic characteristics of rhizobia isolates
The growing interest on microsymbionts associated to
Mimosa spp. has resulted in a large number of articles on
the subject (Chen et al., 2005; Barrett and Parker, 2006;
Bontemps et al., 2010; Elliott et al., 2009; Reis Jr et al.,
2010; Liu et al., 2012). However, few of these articles
describe the characteristics of the culture colonies formed
by these symbionts. Recently, Teixeira et al. (2010)
observed that all the isolates obtained from nodules of M.
tenuiflora grown in a soil from a Caatinga area (Petrolina,
Pernambuco State, Brazil) had a rapid development and
acidified the medium and that most of them produced a
large quantity of EPS. Fast-growing acid-producing rhizobia
are the most common symbionts of several African and
Asian wild tree legumes (Wolde-Meskel et al., 2004;
Shetta et al., 2011). The isolates obtained from M.
paraibana and M. tenuiflora cultivated in the soils from
Serra Talhada, Santa Terezinha and Remígio also had
rapid development but, contrasting with the African
isolates, some of them did not modify the YMA culture
medium (51% of the M. paraibana isolates and 19% of
the M. tenuiflora isolates). Large production of EPS was
only observed in 17 isolates (20% of all the M. paraibana
isolates and 8% of the M. tenuiflora isolates). Rapid
growth is a common characteristic of native isolates from
the Brazilian semiarid region obtained from nodules of
several species (Teixeira et al., 2010; Medeiros et al.,
2009). Usually, isolates of rapid development do not form
dry colonies (Teixeira et al., 2010) but this was the case
in 16% of the isolates from M. tenuiflora and 6% of the
isolates from M. paraibana (Figure 2).
White, creamy or translucent colonies are commonly
formed by bacteria associated with wild tree legumes
such as Acacia spp. (Wolde-Meskel et al., 2004), Millettia
pinatta (Rasul et al., 2012) and Mimosa tenuiflora
(Teixeira et al., 2010). White and creamy colonies also
predominated among the isolates from M. tenuiflora and
M. paraibana but orange and green colonies were also
present. Considering that descriptions of colonies formed
by rhizobia associated to Mimosa spp. are scarce (Chen
et al., 2005; Bontemps et al., 2010; Reis Jr et al., 2010;
Teixeira et al., 2010), it is difficult to evaluate the
frequency of these phenotypes.
Medeiros et al. (2009) reported that punctiform colonies
are commonly formed by isolates from nodules of Vigna
unguiculata cultivated in soils from Caatinga areas.
Cowpea associates with a large diversity of rhizobia and
due to this characteristic it is frequently used as a trap
culture (Melloni et al., 2006; Medeiros et al., 2009).
However, only 29 and 23% of the isolates from the
nodules of M. tenuiflora and M. paraibana formed this
795
type of colony. Therefore, the bacteria associated with M.
paraibana and M. tenuiflora seem to differ, from a certain
extent, from those described in native rhizobia collections
obtained from soils of the region using cowpea as a trap
culture. Mishra et al. (2012) demonstrated that different
legume species can form associations with different
rhizobia populations, in spite of being cultivated in the
same soils. The wide phylogenetic distance from cowpea
and Mimosa species, belonging to two distinct legume
subfamilies (Papilionoidea and Mimosoidea), may explain
part of the difference in their microsymbionts.
Differences among the isolates from the two Mimosa
species tested are indicated by the greater phenotypic
diversity of those obtained from M. tenuiflora (Figure 4).
This species may establish symbiosis with a larger array
of rhizobia species, and this could be explained by its
larger spatial distribution which may determine different
patterns of co-evolution with the microsymbionts.
Analysis of the 16S rDNA gene
The analysis of the 16S rDNA gene suggests that the
isolates from M. tenuiflora and M. paraibana are closely
related, independently from the soil of cultivation, clustering in the first group of the dendrogram (Figure 5). All
isolates show the same phenotypic characteristics of
mucus production, acid or neutral reaction and homogeneous and circular colonies. Other characteristics such
as differences in color of colonies and amount of mucus
generated clustering on phenotypic dendrograms that
cannot be observed in the genetic analysis. They were
also closer related to -rhizobia than to α-rhizobia, corroborating previous reports of prevalence of this group
among species of the Mimosoideae subfamily (Chen et
al., 2005; Reis Jr et al., 2010). However, the similarity with
all the tested -rhizobia reference strains was relatively
low.
Two isolates (MPS5 and MPS10) are clustered apart
these two groups. According to their position they could
be alpha that were not well resolved by the analysis, or
another class of proteobacteria.
Conclusion
The results demonstrate that the bacteria populations
from the nodules of Mimosa spp. species native from the
soils of the semiarid Brazilian region have cultural characteristics different from those obtained from the same
soils but using other legume species as trap plants. In
spite of fast growth, the isolates can form from dry colonies to colonies with large production of EPS. The isolates are more related to -rhizobia than to α-rhizobia, but
the low similarity with the strains from the Embrapa
collection suggests that the rhizobia isolated from the
nodules of M. tenuiflora and M. paraibana are different
bacteria species.
796
Afr. J. Microbiol. Res.
REFERENCES
Albuquerque UP, Araújo EL, El-Deir ACA, et al. (2012) Caatinga
revisited: ecology and conservation of an important seasonal dry
forest, The Scientific World Journal: 18 p.
Bala A, Murphy PJ, Osunde AO, Giller KE (2003).Nodulation of tree
legumes and the ecology of their native rhizobial populations in
tropical soils. Appl. Soil Ecol. 22:211-223.
Barrett CF, Parker MA (2006). Coexistence of Burkholderia,
Cupriavidus, and Rhizobium sp. nodule bacteria on two Mimosa spp.
in Costa Rica. Appl. Environ. Microbiol. 77:1198-1206.
Bontemps C, Elliott GN, Simon MF, Reis Jr FB, Gross E, Lawton RC,
Elias Neto N, Loureiro MF, Faria SM, Sprent JI, James EK, Young
JPW (2010). Burkholderia species are ancient symbionts of legumes.
Mol. Ecol. 19:44-52.
Chen WM, Faria SM, Straliotto R, Pitard RM, Araújo JLS, Chou JH,
Chou YJ, Barrios E, Prescott AR, Elliott GN, Sprent JI, Young JPW,
James EK (2005). Proof that Burkholderia strains form effective
symbioses with legumes: a study of novel Mimosa-nodulating strains
from South America. Appl. Environ. Microbiol. 71:7461-7471.
Elliott GN, Chou JH, Chen WM, Bloemberg GV, Bontemps C, MartínezRomero E, Velázquez E, Young JPW, Sprent JI, James EK
(2009).Burkholderia spp. are the most competitive symbionts of
Mimosa, particularly under N-limited conditions. Environ. Microbiol.
11(4):762-778.
EMBRAPA - Embrapa Brasileira de Pesquisa Agropecuária (1997).
Manual de métodos de análise de solos, Embrapa, Rio de Janeiro.
Ferraz EMN, Rodal MJ, Sampaio EVSB (2003).Physiognomy and
structure of vegetation along an altitudinal gradient in the semi-arid
region of northeastern Brazil. Phytocoenologia 33:71-92.
Fred EB, Waksman SA (1958) Laboratory manual of general
microbiology. Mc Grow Hill, New York.
Freitas ADS, Sampaio EVSB, Fernandes AR, Santos CERS (2010).
Biological nitrogen fixation in legume trees of the Brazilian Caatinga.
J. Arid Environ. 74:344-349.
Hammer Ø, Harper DAT, Ryan PD (2001). Past: paleontological
statistics software package for education and data analysis.
Palaeontologia Electronica 4:1-9
Hoagland DR, Arnon DI (1939). The water culture method growing
plants without soil. U Calif Agric Exp Sta, California.
Jesus EC, Moreira FMS, Florentino LA, Rodrigues MID, Oliveira MS
(2005). Diversidade de bactérias que nodulam siratro em três
sistemas de uso da terra da Amazônia Ocidental. Pesq. Agropecu.
Bras. 40:769-776.
Lammel DR, Brancalion PHS, Dias CTS, Cardoso EJBN (2007).
Rhizobia and other legume nodule bacteria richness in brazilian
Araucaria angustifolia forest. Sci. Agric. 64(4):400-408.
Liu XY, Wei1 S, Wang F, James EK, Guo XY, Zagar C, Xia LG, Dong X,
Wang YP (2012).Burkholderia and Cupriavidus spp. are the preferred
symbionts of Mimosa spp. in Southern China. FEMS Microbiol. Ecol.
80:417-426.
Medeiros EV, Martins CM, Lima JAM, Fernandes YTD, Oliveira VR,
Borges WL (2009). Diversidade morfológica de rizóbios isolados de
caupi cultivado em solos do Estado do Rio Grande do Norte. Acta.
Sci. Agron. 31(3):529-535.
Melloni R, Moreira FMS, Nóbrega RSA, Siqueira JO (2006). Eficiência e
diversidade fenotípica de bactérias diazotróficas que nodulam caupi
(Vigna unguiculata (L.) Walp) e feijoeiro (Phaseolus vulgaris L.) em
solos de mineração de bauxita em reabilitação R. Bras. Ci. Solo.
30:235-246.
Mishra RPN, Tisseyre P, Melkonian R, Chaintreuil C, Miché L,
Klonowska A, Gonzalez S, Bena G, Laguerre G, Moulin L. (2012).
Genetic diversity of Mimosa pudica rhizobial symbionts in soils of
French Guiana: investigating the origin and diversity of Burkholderia
phymatum and other beta-rhizobia. FEMS Microbiol. Ecol. 79:487503.
Patreze CM, Cordeiro L (2004). Nitrogen-fixing and vesicular arbuscular mycorrhizal symbioses in some tropical legume trees of
tribe Mimoseae. Forest Ecology and Management. 196: 275-285.
Pereira IM, Andrade LA, Sampaio EVSB, Barbosa MRV (2003). Usehistory effects on structure and flora of Caatinga. Biotropica. 35:154165.
Queiroz LP (2006). The Brazilian Caatinga: phytogeografical patterns
inferred from distribution data of the Leguminosae. In: Pennington T,
Lewis GP, Ratter JA (eds) Neotropical Savannas and Seasonally Dry
Forests Plant Diversity, Biogeography and Conservation, CRC
Press,New York, pp 121-157.
Queiroz LP (2009). Leguminosas da Caatinga, Universidade Estadual
de Feira de Santana, Royal Botanic Gardens Kew, Associação
Plantas do Nordeste, Feira de Santana.
Rasul A, Amalraj ELD, Kumar GP, Grover M, Venkateswarlu B (2012).
Characterization of rhizobial isolates nodulating Millettia pinnata in
India. FEMS Microbiol. Lett. 336:148-158.
Reis Jr FB, Simon MF, Gross E, Boddey RM, Elliott GN, Neto NE,
Loureiro MF, Queiroz LP, Scotti MR, Chen WM, Norén A, Rubio MC,
Faria SM, Bontemps C, Goi SR, Young JPW, Sprent JI, James EK
(2010). Nodulation and nitrogen fixation by Mimosa spp. in the
Cerrado and Caatinga biomes of Brazil. New Phytol. 186:934-946.
Shetta ND, Al-Shaharani TS, Abdel-Aal M (2011). Identification and
characterization of Rhizobium associated with woody legume trees
grown under Saudi Arabia condition. Am. Eurasian J. Agric. Environ.
Sci. 10:410-418.
Simon MF, Grether R, Queiroz LP, Särkinen TE, Dutra VF, Hughes CE
(2011). The evolutionary history of Mimosa (Leguminosae): toward a
phylogeny of the sensitive plants. Am. J. Bot. 98(7):1201-1221.
Souza LAG, Bezerra Neto E, Santos CERS, Stamford NP (2007).
Desenvolvimento e nodulação natural de leguminosas arbóreas em
solos de Pernambuco. Pesq Agropec Bras. 42(2):207-217.
Souza LQ (2010). Fitossociologia em áreas com diferentes históricos
de uso e fixação biológica de nitrogênio em Caatinga madura na
Paraíba. M.Sc. dissertation, Universidade Federal de Pernambuco,
Brazil.
Souza LQ, Freitas, ADS, Sampaio EVSB, Moura PM, Menezes RSC
(2012). How much nitrogen is fixed by biological symbiosis in tropical
dry forests? 1. Trees and shrubs. Nutr. Cycl. Agroecosist. 94:171179.
Sprent JI (2007). Evolving ideas of legume evolution and diversity: a
taxonomic perspective on the occurrence of nodulation. New Phytol.
174:11-25.
Teixeira FCP, Borges WL, Xavier GR, Rumjanek NG (2010).
Characterization of indigenous rhizobia from caatinga. Braz J
Microbiol. 41:201-208.
Vincent JM (1970). A manual for the practical study of root nodule
bacteria, Blackkwell Scientific, Oxford.
Wolde-Meskel E, Berg T, Peters NK, Frostegard A (2004) Nodulation
status of native woody legumes and phenotypic characteristics of
associated rhizobia in soils of southern Ethiopia. Biol. Fertil. Soils.
40:55-66.
Xavier GR, Martins LMV, Neves MCP, Rumjanek NG (1998). Edaphic
factors as determinants for the distribution of intrinsic antibiotic
resistance in a cowpea rhizobia population. Biol. Fertil. Soils. 27:386392.
Vol. 8(8), pp. 797-802, 19 February, 2014
DOI: 10.5897/AJMR2013.6527
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Microbiological assessment of dentists’ hands in
clinical performance
Márcia Rosental da Costa CARMO1*, Jorge Kleber CHAVASCO1, Solange de Oliveira Braga
FRANZOLIN2, Luiz Alberto BEIJO1, Júlia Rosental de SOUZA CRUZ3 and
Paulo Henrique WECKWERTH2
1
Universidade Federal de Alfenas – Unifal-MG, Rua Gabriel Monteiro da Silva, 700. Centro. 37.130-000 Alfenas- MG.
Brazil.
2
Universidade Sagrado Coração – USC-Bauru, São Paulo, Brazil.
3
Acadêmica da Universidade Federal de Alfenas – Unifal-MG, Alfenas-MG, Brazil.
Accepted 30 January, 2014
This study verified the presence of opportunist pathogenic bacteria in the hands of Surgeons Dentists.
Biological materials were collected from the hands of 41 professionals, randomly selected. The
professional washed his/her hands for around 30 s in a sterile plastic bag, filled with 250 mL of
physiologic serum, in three distinct times: Timing 1 (T1), hands without wearing gloves, before
attending to the patient; Timing 2 (T2), wearing gloves, right after the patient treatment, when the glove
was contaminated with the patients’ biological material; and Timing 3 (T3), collected after removing the
gloves. The material obtained was inoculated in culture mediums such as: Brain Heart Infusion Agar
(BHI), Manitol Salt Agar (MSA), Eosin Methylene Blue (EMB) and Bile Esculin Agar (BEA). There were
identified Staphylococcus aureus and not aureus strains, besides Gram-negative bacteria, suggesting
deficient hygiene of the hands. An antibiogram was made for all the Gram-positive and Gram-negative
bacteria found. The result shows a high number of strains resistant to the most common used
antibiotics. The microbiological count was higher in the T1 for all the culture mediums, suggesting that
the act of washing the hands for 30 s decreases the microbiota resident in the hands.
Key words: Antimicrobial agents, hands washing, infection control, odontology, risk due to biological agents.
INTRODUCTION
Infection control has become one of the most discussed
topics in odontology, being very important during the
practice, so that professionals no longer question its
importance. The knowledge about occupational hazards
has been largely developed, but unfortunately it has been
short to strengthen awareness and change behaviors, as
policies of infection control are not being fully applied
(Moraes, 2008).
According to Lehotsky et al. (2010) the failure in hand
disinfection before surgical procedures is considered the
major cause of nasocomiais infections worldwide,
contributing for the spread of multiresistant pathogens,
besides playing an important role in the development of
post operatory complications. Lately, multiresistant bacterial strains are responsible for outbreaks all over the
world and the therapeutic arsenal has become more and
more scarce, increasing costs and time expending on
treatment. The Staphylococcus aureaus resistant to
methicillin (MRSA) is responsible for important infections
and hands are the most common way of transmission
(Custódio et al., 2009).
According to Myers et al. (2008) Odontology profes-
*Corresponding author. E-mail: marosental@gmail.com. Tel: 55 (35)3291-1852.
798
Afr. J. Microbiol. Res.
sionals must be bound to principles scientifically accepted and based on evidences of infection control, considering that hands hygiene is one of the most important
processes to reduce the transmission of microorganisms
between professional and patient.
Thus, the ethical responsibility of health professionals
in reducing the risks of contamination is expected. According to Dejours (1995), the Health Area may be a health
provider or a pathogenic producer. This study aimed to
isolate and identify bacterial strains in the collected material extracted from hands of dentists during clinical procedures, being a helpful matter in the awareness about the
possibility of transmission of pathogenic microorganisms
through hands. It also intends to determinate the profile
of sensibility of microorganisms to antibiotics, building up
consciousness and a reasonable use of antimicrobials.
MATERIALS AND METHODS
The research was developed starting with a list of 120 names,
provided by the Odontology Regional Council from Minas Gerais
(CRO-MG), and intermediated by the Regional Office from Alfenas.
Later, based on the names enrolled in the list, 41 participants were
randomly selected and invited to participate in the survey.
Professionals were sought after in their workplaces and they
were informed about the attribute of the study. The participation
was linked to a consent form. On the research, dentists from both
genders, specialists and general clinical dentist, who perform their
activities in private and public offices, participated.
The study was developed starting with the collection of biological
material on the active hand of the dentist. On each sample an sterile
bag measuring 15x32 centimeters containing 250 mL of sterile physiologic serum was used, where the professional washed their hands
for about 30 s, over three different times: Timing 1 (T1), bare hands
before seeing the patient; Timing 2 (T2), gloved hands right after
the patient treatment, when the glove was contaminated with the
patients’ biological material; and Timing 3 (T3), collected after glove
removal looking forward to verify microbiota present within the glove.
Expecting to obtain standardization during the material collection,
sterile Descarpack® latex gloves were provided to all participants
(sample) in the research. The material collection did not interfere
with the professional routine, in other words, the dentist was told to
act just like his/her would normally do, which means that the dentist
had full choice to wash hands before starting treatments and wear
sterile gloves in the manner they judged more suitable.
Right after the three collecting timings in the physiologic serum,
the obtained material was sent to the Microbiology Laboratory at
the Universidade Federal de Alfenas, together with the glove used
by the professional. The glove was filled with methylene blue and
observed after 24 h in order to verify the presence of perforations.
Overall, samples were collected 123 from the hands of 41
professionals. At the laboratory, 100 microliters (µL) of physiologic
serum withdrew from hand washing was inoculated in the culture
media: Brain Heart Infusion Agar (BHI - Himedia), Manitol Salt Agar
(MSA), Eosin Methylene Blue (EMB) and Bile Esculin Agar (BEA),
for each one of the timing (T1, T2, T3), in concentrations: undiluted
and 1/10, in each one of the three times, and each sample for each
one of the four culture medium, totaling 984 samples.
The culture media were incubated at 37°C (98.6°F) in a bacteriological incubator for 48 h. The colonies quantification was made
using a colony counter, and the results were obtained in CFU/mL
(Colony-Forming Unit per Milliliters).
Strains which were grown in MSA underwent the Gram Method,
Catalase Test, DNase and Coagulase Test. Strains which were
grown in BEA underwent the Gram Method and Catalase Test.
Finally, the ones grown in EMB Agar underwent the Gram Method
and were identified using Bactray® Kit, for biochemical identification
of Gram Negative bacilli with Negative or Positive Oxidase.
The antibiogram using the Agar Disc Diffusion Technique (also
known as Agar Diffusion Method or Kirby- Bauer Test), according to
CLSI (CLSI document, 2009), using antibiotics discs made by
DME® Sensidisc . There were made the following antibiotics for
Gram positive bacteria: Amoxicillin/Clavulanic Ac. (AMC 30 - 20/10
µg), Azithromycin (AZI 15 - 15 µg), Ciplofloxacin (CIP 05 - 5µg),
Clindamycin (CLI 02 - 2 µg), Doxycycline (DOX 30 - 30 µg),
Norfloxacin (NOR 10 - 10 µg), Oxacillin (OXA 01 - 1 µg),
Vancomycin (VAN 30 - 30 µg), Linezolid (LNZ 30 - 30 µg), Table 4.
For the Gram negative were used: Cephalotin (30 µg), Sulfazotrin
(25µg), Tobramycin (10µg), Chloramphenicol (30µg), Gentamicin
(10µg), Doxycycline (30µg), Ciprofloxacin (05µg), Azithromycin
(15µg), Norfloxacin (10µg), Table 6.
The analysis of variance was used to evaluate the factors significance and the Scott-Knott test was applied at 5% level of significance to get the average difference.
This research was carried out after the Committee of Ethics in
Research had authorized the realization of the project on Protocol
No 216/10 in November, 25th, 2010.
RESULTS
The timing 1 (T1) which represents the first collection of
the material from professional hands, always presented
the highest number of Colony-Forming Unit (CFU/ml), when
compared to the others timing (T2 and T3) from the
research (Table 2). T2 presented the lowest count of
CFU/ml when compared to T1 and T3, with statistical significance for the media used, according to Scott-Knott Test
(Table 1).
41 pairs of Descarpack® sterile gloves were used,
which did not show any damage during the collection,
except one glove that had a perforation on the middle
finger. The glove that presented the perforation was used
in a long duration surgical procedure.
The material inoculation in the culture medium (BHI)
was used to count the total bacteria, in each one of the
three timing used in this research, totaling 246 samples.
The results show that the T1 relative to the time when
the professional gets ready to start the clinical procedure,
in other words, before wearing gloves, presented the
highest count of total bacteria, reaching up to more than
double of the CFU/ml count in the three media used.
The colonies count in the MSA was used to isolate the
Gram positive cocci in the samples, specifically
Staphylococcus sp. The colonies counting in this media
followed the trend observed in BHI. In the same way,
there was a reduction from T1 to T3, indicating that the
act of washing hands in physiologic serum removes part
of the microorganisms, thereby, reducing the number of
CFU/ml (Table 3).
In T2, 27 samples had zero count. So, the unfolding of
the significance for all the variable T presented a statistical three timing used in this research.
The results indicate the presence of 26 samples of S.
aureus and 44 Coagulase-negative Staphylococci (CoNS),
from analysis of the 246 samples distributed over the
Carmo et al.
799
Table 1. Colonies’ counting average in the culture media BHI, MSA and EMB in CFU/ml.
Culture media
BHI
MAS
BEM
T1 (CFU/mL)
a
2624,27
1837,93a
a
89,27
T2 (CFU/mL)
c
701,83
c
48,66
a
0
T3 (CFU/mL)
b
1074,32
b
807,93
a
20,49
T1= Bare hands before seeing the patient; T2= Gloved Hands, right after the patient treatment,
when the glove was contaminated with the patients’ biological material; T3= collected after glove
removal. BHI= Brain Heart Infusion Agar; MSA= Manitol Salt Agar; EMB= Eosin Methylene Blue
Note 1: it was not possible to calculate the statistics for the BEA medium, because only one was
collected in T1; of all the 246 made showed positive result. The values are means. The means
followed by the same lower case letter in the line do not have difference between then by ScottKnott test, at level 5% of significance.
Table 2. Minimum and Maximum CFU/ml counting in the 4 culture media used.
Culture Media
BHI
MAS
BEM
BEA
T1 (CFU/ml)
Minimum Maximum
0
Countless
0
6,000
0
1,530
0
Countless
T2(CFU/ml)
Minimum Maximum
0
9,400
0
920
0
0
0
0
T3 (CFU/ml)
Minimum Maximum
0
6,010
0
5,320
0
830
0
0
T1= Bare Hands before seeing the patient; T2= Gloved hands right after the patient treatment, when the
glove was contaminated with the patients’ biological material; T3= collected after glove removal. BHI=
Brain Heart Infusion Agar; MSA= Manitol Salt Agar; EMB= Eosin Methylene Blue; BEA= Bile Esculin
Agar.
Table 3. Identification of the strains of Staphylococcus aureus and CNS - Coagulase
negative Staphylococcus, obtained in T1, T2 and T3.
Timing
T1
T2
T3
Total
Staphylococcus aureus
13
03
10
26
CNS - Coagulase negative Staphylococcus
19
07
18
44
T1= Bare hand before seeing the patient; T2= Gloved hand right after the patient treatment,
when the glove was contaminated with the patients’ biological material; T3= collected after
glove removal.
three timings established in this research, although, with
a higher colonies concentration in T1, for both identifications (Table 3).
Both S. aureus and Coagulase-negative Staphylococci
strains isolated and identified in this study underwent an
antibiogram, being totally, sensitive to Amoxicillin/
Clavulanic Acid and Norfloxacin. Also, they presented a
high resistance to Azitromicin, Clindamicin and Vancomycin, according to Table 4.
The culture medium EMB is used to differentiate and
isolate Gram negative bacilli (Enterobacteriaceae and
others Gram negative bacilli). Following up the tendencies of the others culture media, T1 in EMB presented the
highest concentration of CFU/mL, resulting to positive in
six cases with minimum counting as 90 CFU/ml and the
highest counting as 1,530 CFU/ml. In T3, results were
positive for two samples, and they were: 10 and 830
CFU/ml. The T2 was equal to zero and for 100% of the
samples, indicating that those bacteria are not common
in the oral cavity (Table 2). 246 samples were analyzed in
the EMB culture medium, and for the three timings used
in the research; there were no statistical significance in
the results (Table 1).
The presence of Escherichia coli in 8 samples was
verified, Citrobacter freundii in 7 samples, and one sample presented Enterobacter cloacae, totaling 16 samples
with positive results for Gram negative bacteria, for a total
of 86 samples.
After identification of the 16 samples positive for Gram
negative bacteria, the antibiogram was done, and the strains
were sensitive in 100% of the cases to Cephalotin, Gentamicin and Norfloxacin. It is important to point out the
800
Afr. J. Microbiol. Res.
Table 4. Susceptibility profile of 26 strains of Staphylococcus aureus and 44 strains of CNS - coagulase negative
Staphylococcus, in response to 9 clinical drugs.
Antibiotic/Strain
S. aureus
SCNS
AMC 30
R
S
0
26
0
44
AZI
R
10
26
15
S
16
18
CIP 05
R
S
0
26
4
40
CLI
R
9
26
02
S
17
18
DOX 30
R
S
0
26
14 30
NOR 10
R
S
0
26
0
44
OXA 01
R
S
7
19
13 31
VAN 30
R
S
12 14
25 19
LNZ 30
R
S
0
26
1
43
AMC 30µg: Amoxicilin/Clavulanic Acid; AZI 15µg: Azitromicin; CIP 05µg: Ciprofloxacin; CLI 02µg: Clindamicin; DOX 30µg: Doxycycline;
NOR 10µg: Norfloxacin; OXA 01µg: Oxacilin; VAN 30µg: Vancomycin; LNZ 30µg: Linezolid.
Table 5. Distribution of the Gram negative strains (Enterobacteriaceae)
isolated in the culture media.
Gram negative Bacilli
Escherichia coli
Citrobacter freundii
Enterobacter cloacae
Total
elevated number of strains resistant to Chloramphenicol,
Sulfazotrin, Azithromycin, Ciprofloxacin (Table 6).
The BEA is used to isolate and used as presumptive
identification of Enterococo faecalis. This bacterium was
found in only one sample in T1 (with formation of
bacterial biofilm) for a total of 246 samples.
DISCUSSION
Professional’s choice of washing or not of hands before
wearing gloves, was determinant to the highest CFU/ml
counting found in all culture media used. It was so
because T1 had the highest count of CFU/ml, when
compared to T2 and T3. And, besides, in some cases in
T1, the formation of biofilm could be noticed. This topic
was also studied by Agbor and Azodo (2010), when only
63.4% of the interviewed reported the practice of hand
washing.
Poor hand hygiene (HH) among professionals on the
health area has motivated a lot of researches. And,
although this practice is a simple act, its interdependence
with the behavior sciences makes them complex and it
depends on a set of factors and attitudes, beliefs and
knowledge (Pessoa-Silva et al., 2005). For researchers,
although professionals valorized and recognize the
importance of the HH, the inadequate habit results in the
non adhesion and only the divulgation is not enough to
change behavior (Larson et al., 2007).
For the culture media EMB and BEA, where T2 was
equal to zero, no result in T3 was higher than in T1;
relevant fact considered is that Gram negative bacteria
(EMB culture) and Enterococcus (BEA culture) are not
usually found in the oral cavity, being found, most times
in places poorly sanitized. The Gram negative bacilli are
normally found in the environment and make part of the
intestinal flora of humans and other animals, and may be
N (%)
08 (50.0)
07 (43.75)
01(6.25)
16 (100)
associated to diarrhea and pyogenic infections (Custódio
et al., 2009).
In this study, in the MSA culture were found values that
range from zero to 6,000 CFU/ml. Also isolated in the
MSA, in T1 was the presence of 13 S. aureus and 19
other Staphylococcus; not aureus, from a total of 26 and
44 colonies, respectively (Table 3); totaling 86 samples in
the MSA. In the same way Silva et al. (2003) found a high
rate of contamination for Staphylococcus and a lower
number of Gram negative bacilli, in a study that verified
the microbiological contamination on surfaces, including
the operator hands’ and the places touched by him.
S. aureus is responsible for several types of infection in
human body, and hands are the main way of
transmission. In this way, MRSA can be transmitted from
one patient to another if hands hygiene is neglected.
Lately, MRSA has become an important topic, but it is not
more aggressive than Staphylococcus not aureus, and
the actual challenge is a shortage of antibiotics that can
combat the bacterium and not its virulence (Johnston and
Bryce, 2009). Due to the increasingly frequent and
unnecessary use of antibiotics, infections for MRSA have
become more frequent. The infections caused by S.
aureus are usually treated with penicillin derivates such
as Oxacilin, Cefazolin and Cefalotin; all of them were
used in this study.
The S. aureus strains were sensitive, in all cases to
Amoxicilin and Clavulanic acid, Ciprofloxacin, Doxycycline, Norfloxacin and Linezolid, according to Table 4,
and were resistant to Azitromicin, Clindamicin, Oxacilin
and Vancomycin. The occurrence of bacteria resistance
to antibiotics is a critical point, affecting sharply morbidmortality rate and treatment costs (Oliveira et al., 2010).
MRSA rates clinical isolated from S. aureus vary from
less than 1% in Norway and Sweden, from 5% to 10% in
Canada, 25% to 50% in USA, reaching up to more than
Carmo et al.
801
Table 6. Sensitivity profile of the 16 strains of Enterobacteriaceae in response to 9 clinical drugs.
Antibiotic (µg)
Cefalotin (30)
Sulfazotrin (25)
Tobramycin (10)
Chloraphenicol (30)
Gentamicin (10)
Doxycycline (30)
Ciprofloxacin (05)
Azitromicin (15)
Norfloxacin (10)
Sensitive strain
16
8
13
5
16
14
10
5
16
50% in Hong Kong and Singapore (Michael and Martin,
2010). MRSA are not only resistant to all the regular
antibiotics, but also to a combination of them.
In this study 44 strains of Staphylococcus coagulase
negative were found, for a total of 70 Staphylococcus sp.
Until the last couple of years, the Staphylococcus coagulase negative, were seen as reduced risk in causing
infections, due to presence in the skin of microbiota.
However, the Negative Coagulase Staphylococcus begin
to be identified as a pathogenic agent, being considered
the main cause of bacteremia in the USA; caused by the
increase in the incidence of infections (Grundman et al.,
2006). The highest concentration of this pathogen was
collected on the professionals’ hands in T1 and T3,
according to Table 3. Due to similar finding, warning on
how easy it is to transport the bacterium from one place
to another, completing the circle of microbial infection
should be done.
The antibiogram for Coagulase Negative Staphylococcus
was found in this study; 29.5% of strains were resistant to
Oxacilin, 9% to Ciprofloxacin and 56.8% to Vancomycin.
What makes the Staphylococcus a pathogen with the
highest resistant rate to antibiotics is shown in Table 4.
The World Health Organization (2007) has made
reference to the excessive using of antibiotics worldwide,
and shows that the resistance to them is one of the three
biggest threats to human health. Odontology overuses
antibiotics, and most of the time with no justification. This
alert must be considered, because this study found 2.27%
of strains resistant to Linezolid, 56.8% to Vancomycin,
29.5% to Oxacilin, 31.8% to Doxycycline, 59% to Clindamicin,
9% to Ciprofloxacin and 59% to Azitromicin. Only the
Amoxicilin associated to the Clavulanic acid and the
Norfloxacin, was shown to be effective in 100% to the
cases in this study (Table 4).
Nowadays, the main concern is also applied to the
specific treatments for infections caused by Gram negative bacteria and multidrug resistant to E. coli, just like the
ones that were isolated in this study, and are indicated in
Table 5. These bacteria can survive for around 48 h after
being deposited on surfaces (Rodrigues et al., 2008).
The presence of those bacteria in T1 and T3, in other
words on dentists’ hands indicate fecal contamination.
Resistant strain
0
8
3
11
0
2
6
11
0
This situation is unacceptable in clinical offices. This
Gram negative bacilli, was also found and it is the main
cause of infections in the urinary tract and neonatal
meningitis, causing 80% of mortality. It can also cause
infections in wounded skin, peritonitis and septicemia
(Fraser and Cunha, 2012)
Strains of Citrobacter freundii (Gran Negative) identified
in this study, (Table 5), usually can be found in human
and other animals feces. Fraser and Cunha (2012) had
already isolated strains in clinical samples of urine, throat
swabs, expectorations, blood and wound swabs, with
characteristics of opportunist pathogen. The presence of
this bacterium on the hands and in the clinical offices
environment is critical, and not only increases the risk of
infection, but also chances of one be infected by a
resistant bacterium. Besides epidemiological vigilance,
this issue also needs prioritization of health programs,
effective health education, and aiming a reasonable use
of antibiotics (Oliveira et al., 2010).
The strains of E. cloacae, also isolated in this study,
are enterotoxigenic, and showed resistance to antibiotics,
according to Table 6. Enterobacter can infect any surgical
wounds, and these infections are clinically indistinguishable from infections caused by others bacteria (Fraser and
Cunha, 2012).
The antibiogram for Gram negative bacilli was made
(Table 6). Most of the strains were resistant to most of
the antibiotics tested, with exception to Cefalotin,
Gentamicin and Norfloxacin.
Among the samples analyzed in T1, a strain of E.
faecalis was identified, commensal of human digestive
tract, causing over 90% of the enterococci human infections (Johnston and Bryce, 2009). The strain isolated was
resistant to Clindamicin, Cefalotin, Chloraphenicol and
Oxacilin, with no inhibition, and with Norfloxacin, there
was the formation of a ring of 14 mm. Although, it was
sensitive to the others antibiotics used, including
Vancomycin. A multinational study (including countries
such as South Africa, Egypt, Saudi Arabia and Lebanon)
on nosocomial pathogens has found a similar result,
because none of the Enterococcus found in the study
were resistant to Vancomycin. However, 7% of the
Enterococcus isolated in Germany and 16.7% of the ones
802
Afr. J. Microbiol. Res.
isolated in Switzerland and Greece were resistant to
Vancomycin. Other studies show that environments frequented by patients with MRSA and Enterococcus resistant to Vancomycin is often contaminated by MRSA and
Enterococcus, just like the same contamination found on
hands, coats and equipments used by service providers
(Johnston and Bryce, 2009).
The scene is very critical, because in the late years the
pharmaceutical industry did not invest on new antibiotics.
According to Piddock (2011), this has occurred due to
merging pharmaceutical companies, small profit rates,
high costs and regulatory barriers. Besides all these barriers, when the new drug has been finally approved, it is
will not be effective in a long term, for the bacterium will
soon develop resistance mechanism.
ACKNOWLEDGEMENTS
Part of the financial resources was personal and the
other part of the financial resources was donated by the
Universidade Federal de Alfenas, Alfenas, Minas Gerais,
Brazil.
Conclusion
This study found the presence of Gram negative and
Gram positive bacteria, based on the collection of
biological material on hands of Surgeons Dentists, during
clinical procedures, showing deficiency in hand hygiene
procedures. The CFU/ml count from hands of professionals before starting the procedure (Timing 1) was the
highest for all the culture media used, suggesting that
hand washing was neglected or was made improperly.
The antibiogram showed the existence of strains resistant
to most used antibiotics in the office. Thus, this press the
recommendable need for effective programs in orienting
professionals to a reasonable use of antibiotics.
REFERENCES
Agbor MA, Azodo CC (2010). Handwashing and barrier practices
among Cameroonian dental professionals. Tanzan. Dent. J. 16(2):3538.
CLSI (2009). Performance Standards for antimicrobial disk susceptibility
tests. Approved standard – Tenth edition. CLSI document M02-A10.
29(1):3-34.
Custódio J, Alves JF, Silva, FM, Dolinger EJO, Santos JGS; Brito DD
(2009). Avaliação microbiológica das mãos de profissionais da saúde
de um hospital particular de Itumbiara, Goiás. Rev Cien Med.
18(1):7-11.
Dejours C (1995). Com ment formuler une problématque de la santé en
ergonomie et en médicine du travail ? Trav. Hum. 58:1-16.
Fraser SL, Cunha BA (2012). Enterobacter Infections Clinical
Presentation. Medscape J Med (periódico na Internet) May 30
(acessado
2012
jul
12);
Disponível
em:
http://emedicine.medscape.com/article/216845-clinical.
Grundman H, Aires SM, Boyce J, Tiemersma E (2006). Emergence and
resurgence of meticilin-resistant Staphylococcus aureus as a public
health threat. Lancet Infect Dis. 368:874-885.
Johnston BL, Bryce E (2009). Hospital infection control strategies for
vancomycin-resistant
Enterococcus,
methicillin-resistant
Staphylococcus aureus and Clostridium difficile. CMAJ 180(6):627631.
Larson EL, Quiros D, Lin SX (2007). Dissemination of the CDC's Hand
Hygiene Guideline and impact on infection rates. Am. J. Infect.
Control 35(10):666-675.
Lehotsky Á, Nagy M, Haidegger T (2010). Towards the Objective
Evaluation of Hand Disinfection. In: 26th Southerm Biomedical
Engineering Conference. 32:92-96.
Michael V, Martin MBE (2010). Antimicrobials and dentistry: Are we
over prescribing? J. Marmara Univ. Dent. 1(1):15-19.
Moraes MS (2008). Em ambiente de risco, conhecimento é
fundamental. J. Glob. Infect. Dis. Ano XX; 65:3.
Myers R, Larson E, Cheng B, Schwartz A, Silva K, Kunzel C (2008).
Hand hygiene among general practice dentists. JADA 139(7): 948957.
Oliveira DGM, Souza PR, Watanabe E, Andrade D (2010). Avaliação da
higiene das mãos na perspectiva microbiológica. Rev. Panam.
Infectol. 12(3):28-32.
Pessoa-Silva CL, Posfay-Barbe MD, Touveneau S, Perneger TV, Pittet
D (2005). Attitudes and perceptions toward hand hygiene among
healthcare workers caring for critically ill neonates. Cienc Enferm.
26(3):305-311.
Piddock LJ (2011). The crisis of no new antibiotics--what is the way
forward? Lancet Infect. Dis. 12(3):249-253.
Rodrigues MVP, Fusco-Almeida AM, Nogueira NGP, Bertoni BW,
Torres SCZ, Pietro RCLR (2008). Evaluation of the spreading of
isolated bacteria from dental consulting-room using RAPD technique.
Lat. Am. J. Pharm. 27(6):805-811.
Silva FC, Antoniazzi MCC, Rosa LP, Jorge AOC (2003). Estudo da
contaminação microbiológica em equipamentos radiográficos. Rev.
Bras. Biocienc. 9(2):35-43.
World Health Organization (2007). The selection and use of essential
medicines- Interventions for improvement of antimicrobial use.
Geneva.
(Accessed
em
2012
abril
9);
Avalible
in:
http://whqlibdoc.who.int/trs/WHO_TRS_946_eng.pdf
Vol. 8(8), pp. 803-813, 19 February, 2014
DOI: 10.5897/AJMR2013.6233
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Evaluation of marine macro alga, Ulva fasciata
against bio-luminescent causing Vibrio harveyi during
Penaeus monodon larviculture
Krishnamoorthy Sivakumar, Sudalayandi Kannappan*, Masilamani Dineshkumar and
Prasanna Kumar Patil
Genetics and Biotechnology Unit, Central Institute of Brackishwater Aquaculture (Indian Council of Agricultural
Research), 75, Santhome High Road, Raja Annamalai Puram, Chennai - 600 028, Tamilnadu, India.
Accepted 23 January, 2014
Vibrio harveyi is one of the major disease causing bacterium in shrimp larviculture and grow-out
practices. V. harveyi produces many virulence cum pathogenic factors. Application of antibiotics
against luminescence causes development of antibiotic resistance among V. harveyi. Therefore, it is
obligatory to develop bio-inhibitory agents as substitute in lieu of antibiotics. Under this study, Ulva
fasciata was collected and extracted for crude compounds, 300 µg extract showed 12.3 mm of bioinhibition against V. harveyi through “agar well diffusion assay”. Further, U. fasciata extract at 300 µg/ml
was treated against V. harveyi in LB broth and showed reductions on phospholipase and proteolysis.
Production of bio-luminescence was reduced to 7.3, 7.7, 13.0, 17.0 counts per second (CPS) and growth
also reduced to 24.91%. Further, U. fasciata extract at 200 g/ml was tested against V. harveyi during
Penaeus monodon larviculture and showed 32.40% reduction in the cumulative percentage mortality on
postlarvae due to V. harveyi. Chemical constituents of U. fasciata was characterized by FTIR and GCMS.
GC-MS analysis, reported to contain organic compounds such as Bis(2-ethylhexyl) phthalate was
highest (88.42%), followed by 1,2- benzenedicarboxylic acid- butyl (2.47%). Therefore, it was concluded
that U. fasciata may be a better bio-inhibitory agent against V. harveyi in shrimp larviculture.
Key words: Ulva fasciata extracts, antagonism, virulence factors, Vibrio harveyi, challenging shrimp postlarvae,
cumulative mortality reduction.
INTRODUCTION
Penaeid shrimp farming have become a momentous
aquaculture activity in many countries in the tropics.
However, this grow-out practice is constantly under threat
due to the outbreak of infectious diseases. Among the
infectious diseases the luminescent disease causing
Vibrio harveyi is one of the most important bacterial
pathogen, capable of causing higher mortality among the
marine invertebrates (Vezzulli et al., 2010). In the last two
decades, mass mortalities (80-100%) among Penaeid
shrimps resulting from V. harveyi infections were fre-
quently reported in hatcheries (Raissy et al., 2011) and
grow-out ponds (Zhou et al., 2012). V. harveyi has been
established as well-known bacterium to produce extra
cellular products indicating its virulence factors such as
luminescence, proteases, phospholipases, lipases, siderophores, chitinases and hemolysins (Soto-Rodriguez et
al., 2012). The applications of antimicrobial chemicals,
especially antibiotics, led to the emergence of more
virulent as well as resistant among the bacterial
pathogens (Rahman et al., 2010). Under this condition, it
*Corresponding author. E-mail: sudalikanna@gmail.com. Tel: +91-44-24616948 or +91-96770 39103. Fax: +91-44-24610311.
804
Afr. J. Microbiol. Res.
Figure 1. Marine macro alga U. fasciata.
is indispensible to develop an alternative agent in place
of antibiotics that are commendably biodegradable and
eco-friendly too.
Marine resources are an unmatched reservoir of
biologically active natural products, many of which exhibit
structural features that has not been found in terrestrial
organism (Saritha et al., 2013). There are numerous
reports on compounds derived from macro algae with a
broad range of biological activities such as the antimicrobial, antiviral, anti-tumor and anti-inflammatory as
well as neurotoxins (Osman et al., 2013). In addition, the
macro algae derived polysaccharides for example alginate, carrageenan was capable of improving the healthiness of marine candidate fish species in aquaculture,
when they were added to the diets (Peso-Echarri et al.,
2012).
Current studies reported that the solvent extracts of the
red seaweed Gracilaria fisheri prevent V. harveyi
infections in Penaeus monodon postlarvae (Kanjana et
al., 2011). The crude extract obtained from Sargassum
hemiphyllum var. Chinense, show increased immunity
and resistance against Vibrio alginolyticus and white spot
syndrome virus (WSSV) infection on Litopenaeus
vannamei (Huynh et al., 2011). Ulva fasciata is a green
marine macro alga (Chlorophyceae), which grows
abundantly in both intertidal and deep water regions of
sea, and documented to be the potential sources of
bioactive compounds (Paul and Devi, 2013). Furthermore, various extracts from U. reticulata and U. lactuca
were tested for antagonism against human pathogens
(Kolanjinathan and Stella, 2011). Aqueous extract of U.
fasciata show inhibition against aquatic bacterial
pathogens (Priyadharshini et al., 2012). Antimicrobial
efficiency of U. fasciata, Chaetomorpha antennina was
studied against many pathogenic bacteria (Premalatha,
2011). The efficacy of U. fasciata harveyi and
Aeromonas spp. challenged with P.monodon tested
against shrimp pathogens such as Vibrio fischeri,
postlarvae (Selvin et al., 2011). incorporated diet was
Vibrio alginolyticus, Vibrio
The bio-potential of marine algae such as Skeletonema
costatum, U. fasciata and Kappaphycus alvarezii were
studied against luciferase and luminescence producing V.
harveyi (Sivakumar and Kannappan, 2013). However,
numerous studies showed the biological activity of U.
fasciata against many aquatic pathogens, but not closely
determined against luminescent disease causing V.
harveyi and its virulence factors. Thus, this study was
under taken to discover the antagonistic effect of crude
U. fasciata extract against luminescent disease causing
V. harveyi during P. monodon larviculture with the,
description of functional compounds by FTIR and
quantification of phytochemicals by GC-MS.
MATERIALS AND METHODS
Isolation of V. harveyi
V. harveyi strains were isolated from the P. monodon larviculture
tanks. The isolates were identified using standard biochemical tests
and further confirmed by polymerase chain reaction (PCR)
(Sivakumar and Kannappan, 2013). The pathogenicity of V. harveyi
cells were ascertained by spotting in 3% blood agar (Hi-media,
India). The isolates were re-confirmed by V. harveyi selective agar
(VHSA) (Harris et al., 1996) and then stored in Luria-Bertani (LB)
broth with sterile glycerol (15% v/v) (Hi-media, India).
Macro alga collection
The marine macro alga U. fasciata was collected with a knife from
all over the substrate (rock, plant, wood, etc.) (Figure 1) from
intertidal region of Tuticorin (Latitude 8.7874°N; Longitude
78.1983°E), Tamilnadu, India (Figure 2). The alga was washed in
permanganate solution [1% KMnO4 (w/v)] to remove the epiphytes,
sand and other extraneous matters and then shadow dried. The
dried alga was weighed, pulverised using mechanical grinder and
Sivakumar et al.
805
Figure 2. Map showing Tuticorin region (Latitude 8.7874°N; Longitude 78.1983°E), India where macro
alga U. fasciata was collected.
used for extracting crude fatty acids.
Solvent extraction
Ethyl acetate was used for extracting the crude compounds from
alga at 30°C called “cold extraction method”. The U. fasciata extract
was prepared by taking 1.0 g of shadow dried powder, and then
mixed with 10.0 ml of ethyl acetate and shaker incubated at 30°C
for 96 h at 50 rpm. Then the extract was filtered by Whatman filter
paper No. 1, rotary evaporated (30°C) under vacuum and stored at
4°C for additional use. The resultant extract was liquefied with 5
mg/ml of 30% (v/v) dimethyl sulfoxide (DMSO) and used for testing
antagonism against V. harveyi (Sivakumar and Kannappan, 2013).
Estimation of MIC
The minimum inhibitory concentration (MIC) of U. fasciata against
V. harveyi was evaluated (Islam et al., 2008).
Active 24 h old V. harveyi of 500 µl (1.8 OD) was inoculated into LB
broth and shaker incubated at 28°C/100 rpm/5 days. The growth
with various virulence factors such as luminescence, proteolytic,
lipolytic,
phospholipase,
thermonuclease
activities,
crude
bacteriocin production, exopolysaccharide (EPS) and protease
produced by V. harveyi were estimated. Cell surface hydrophobicity
was examined by salt aggregations test (SAT) and cell adhesion
was examined by bacterial adhesion to hydrocarbons test (BATH)
(Soto-Rodriguez et al., 2012). Each test was performed in triplicates
and values were expressed in average with SD.
Fourier transform infra red spectroscopy (FTIR) analysis
The shadow dried U. fasciata was ground to powder by pestle and
mortar. The FTIR spectra was recorded using BRUKER IFS 66
model FTIR spectrometer in the region 4000-400 cm-1 by employing
standard KBr pellet technique (D‟Souza et al., 2008).
Gas chromatography and mass spectrometry analysis
Antibacterial assay
Antibacterial activity was ascertained against V. harveyi using the
“agar well diffusion assay” (Sivakumar and Kannappan, 2013).
Effect of crude U. fasciata extract against the growth and
virulence of V. harveyi
U. fasciata extract at 300 g/ml was added in 100 ml of LB medium.
Gas chromatography-mass spectrometry (GC-MS) analysis was
performed by using Agilent GC-MS-5975C with the Triple-Axis
Detector equipped with an auto sampler. The GC column used was
fused with silica capillary column (length 30 m × diameter 0.25 mm
× film thickness 0.25 m) with helium at 1.51 ml for 1 min as a
carrier gas. The mass spectrometer was operated in the electron
impact (EI) mode at 70 eV in the scan range of 40-700 m/z. The
split ratio was adjusted to 1:10 and injection volume was 1 μl. The
injector temperature was 250°C; the oven temperature was kept at
806
Afr. J. Microbiol. Res.
70°C for 3 min, rose to 250°C at 14°C min-1 (total run time 34 min).
The temperature of the transfer line and of the ion source was set
to a value of 230°C and the interface temperature at 240°C,
respectively. Full mass data was recorded between 50-400 Dalton
per second and scan speed 2000. Mass start time is at 5 min and
end time at 35 min. Peak identification of crude U. fasciata extract
was performed by comparison with retention times of standards and
the mass spectra obtained was compared with those available in
the NIST libraries (NIST 11- Mass Spectral Library 2011 version)
with an acceptance criterion of a match above a critical factor of
80% (Musharraf et al., 2012).
Challenge of crude U. fasciata extract against V. harveyi during
larviculture of P. monodon
The plastic tubs were washed with 1% KMnO4 solution. Tubs were
filled with 20 L of saline water at 20 Practical Salinity Units-PSU.
Disease free postlarvae (PL 10) of P. monodon, procured from
shrimp hatchery were acclimatized at 20 PSU for 5 days under
laboratory conditions at 28 ± 1°C with continuous aeration. The
average body weight of PL ranged from 17 to 18 mg and stocked at
1000 numbers per each tub. The control tub was inoculated with V.
harveyi (10 ml of 1.80 OD) alone. Second tub was considered as
treatment inoculated with V. harveyi and 200 µg (2 gm/10L) of
crude U. fasciata extract per ml. Third tub was considered as
control where crude U. fasciata extract was added at 200 µg per ml
alone with PL. The fourth tub was a control for PL, where neither V.
harveyi nor extract was added. The aeration was given for each tub
to provide oxygen level not more than 4 ppm. The PL feed was
given twice at 15% of their body weight. The water quality
parameters such as temperature, salinity and pH were measured
once in 5 days. The mortality of PL was counted daily. No water
exchange was given for all the tubs till 30 days. The water samples
were collected once in 5 days by sterile water bottles. The total
heterotrophic and V. harveyi bacterial counts were enumerated
using LB medium and V. harveyi selective agar medium under
spread plate method. All the experimental tubs were top covered to
avoid any external contaminations. For each experiment, triplicates
were maintained and the values are average of three
determinations (Traifalgar et al., 2009; Kannappan et al., 2013).
RESULTS
Minimum inhibitory concentration (MIC) of U. fasciata
The MIC of crude extracts of U. fasciata was established
at 30 µg concentration. The zone of inhibition was 12.3
mm, established at 300 µg level of extract of U. fasciata
whereas, the 200 and 100 µg level of concentrations
showed 8.3 and 3.3 mm zones, respectively, against the
growth of V. harveyi.
Effect of crude extract of U. fasciata against the
changes in growth and virulence factors produced by
V. harveyi
The treatment reduced the growth of V. harveyi (1.8 OD)
st
th
from 1 to 5 day. The highest growth differences was
rd
st
th
observed on 3 day (0.532 OD) and lowest on 1 and 5
day (0.468 OD) as compare to the control (Figure 3a).
The maximum reduction on bacteriocin production (OD)
was on 4th and 5th day (0.177 and 0.184) and minimum
st
(0.064) observed on 1 day as compared to the control
(OD 1.986 and 1.978 on 4th and 5th, and 2.082 on 1st
days). Although, reductions of crude extra cellular protein
released was noticed in all the treatment days (Figure
3b). The EPS production in the treatment was reduced to
st
th
0.525, 0.556, 0.585, 0.551 and 0.507 from 1 to 5 days
as compared to the control (OD 2.026, 2.408, 2.242,
2.262 and 2.250) (Figure 3c). The protease level was
reduced from 0.047 and 0.051 as compared to the control
(OD 0.146 and 0.171) (Figure 3d).
Further, the treated V. harveyi cells were subjected to
phospholipase, proteolysis, lipolysis and thermonuclease
activities, determined based on the hydrolysis of medium
in the plate assay (Table 1). The activities were coded
with qualitative parameters like weak, moderate, high and
very high. In treatment, the moderate level of
phospholipase and proteolysis activity was noticed on 1st,
2nd and 3rd days. Weak activities were noticed on 4th and
5th days (very high). But moderate level of lipolysis and
thermonuclease activities was shown on 1st to 5th day as
compared to the control (very high).
Cell surface hydrophobicity was examined using SAT
and BATH tests (Table 1). SAT test was determined as
the lowest molarity of ammonium sulphate (0.05-4.0 M)
that caused visible agglutination of a test organism. In
SAT test, the control V. harveyi revealed strong hydrophobic activity for 1st to 5th day whereas, the treated
showed moderate hydrophobic activity for 1st to 5th day.
Similar way, BATH test also exhibited strong level of
hydrophobic activity for control from 1st to 5th day. When
crude extract of macro alga of U. fasciata was treated
with V. harveyi, the production on luminescence was
reduced to 7.3, 7.7, 13.0 and 17.0 CPS (counts per
second) for the 4 days period (Figure 3e). The maximum
reduction on luminescence was reported on 4thday (17.0
CPS) and minimum was observed on the 1st day (7.3
CPS) when compared with the control (39.6, 50.3, 59.3,
63.6 CPS).
FTIR of U. fasciata
The FTIR spectrum of dried powder of U. fasciata is
shown in Figure 4 and functional groups identified were
compared from the FTIR standard library data. FTIR
spectrum showed the presence of significant functional
groups such as alcohols, phenols, esters, ethers,
alkanes, alkenes, primary amines, nitro compounds,
aromatics and carboxylic acids, alkyl halides and aliphatic
amines, etc (Table 2).
GC-MS of U. fasciata
GC-MS analysis of crude ethyl acetate extract of U.
Sivakumar et al.
807
Figure 3. Crude extract of U. fasciata against the changes of growth and virulences produced
by V. harveyi in LB broth for 5 days.
fasciata was found to have mixture of volatile
compounds. A total of 36 peaks were observed with retention times as shown in Figure 5. Chemical constituents
were identified using spectrum data base NIST 11
software installed in GC-MS.
The GC-MS analysis of the crude extract revealed that
the main chemical-constituent was organic compound
Bis(2-ethylhexyl) phthalate (tR = 23.21 min) (88.42 %)
followed by 1,2-benzenedicarboxylic acid- butyl (tR =
18.14 min) (2.47%) (Figure 6a and b). It is possible that
bioactive compounds primarily consisting of Bis(2ethylhexyl)phthalate (tR =23.21 min) (88.42%) may be
involved in biological activity (Table 3) with other
compounds.
Challenge of crude U. fasciata extract against V.
harveyi during P. monodon larviculture
When U. fasciata extract was tested against V. harveyi in
P. monodon postlarvae for 30 days, the reduction on
cumulative percentage of mortality on postlarvae was
noticed as 32.40% as compared to the control (76.30%).
Two trails were maintained under larviculture as negative
controls to distinguish any influence of U. fasciata extract
on PL. However, it was noticed that treatment does not
affect PL as compared to the control (76.30%) which
showed less reduction on cumulative percentage mortality
with extract and PL (29.56%) and with PL alone (28.39%).
The weight of the PL was measured for both the control
and treatments. There was no much weight difference
observed both in the treatment and control. On 30th day,
the average weight of the PL was 269.3 and 266.5 mg for
control and treatment, respectively (initial weight of the
PL for control was 17.7 and 18.1 mg for treatment,
respectively).
The maximum decrease on V. harveyi counts were
observed on 5th, 10th, 15th and 20th days and mean values
4
4
3
for treatment were 2.38 x 10 , 1.56 x 10 , 4.30 x 10 and
808
Afr. J. Microbiol. Res.
Table 1. Effect of U. fasciata extract against the changes of virulences produced by V. harveyi.
Virulence studied
Day
1
2
3
4
5
Proteolysis
Control
++++
++++
++++
++++
++++
Treated
++
++
++
+
+
Phospholipase
Control
++++
++++
++++
++++
++++
Treated
++
++
++
+
+
Lipolysis
Control
++++
++++
++++
++++
++++
Treated
++
++
++
++
++
Thermonuclease
Control
++++
++++
++++
++++
++++
Treated
++
++
++
++
++
Cell surface hydrophobicity
SAT (M)
BATH (%)
Control
Treated
Control
Treated
0.86± 0.02
1.29± 0.04
86.78±4.11
46.33±2.13
0.89± 0.03
1.35± 0.05
85.66±3.91
43.11 ±1.65
0.91± 0.04
1.44± 0.06
82.33± 3.03
39.56± 1.33
0.91± 0.03
1.49± 0.04
76.31±3.13
36.81± 1.29
0.99± 0.04
1.55± 0.06
73.46± 2.96
36.31± 1.19
Control- V. harveyi untreated with crude extract; Treated- V. harveyi treated with crude extract of U. fasciata; Activity of V. harveyi + = weak; ++ = moderate; +++ = high; ++++ = very high; SAT test
(0.0 to 1.0 molarity (M) = strongly hydrophobic, 1.0 to 2.0 M = moderately hydrophobic; 2.0 to 4.0 M = weakly hydrophobic, and >4.0 M = n ot hydrophobic); BATH-test (>50% partitioning = strongly
hydrophobic, 20 to 50% partitioning = moderately hydrophobic; and <20 % partitioning = not hydrophobic).
-1
Transmission/wavelength (cm )
Figure 4. FTIR spectrum of shadow dried powder of U. fasciata.
Sivakumar et al.
809
Table 2. The wave number (cm-1) of dominant peak obtained from the FTIR absorption spectra
of U. fasciata.
Frequency (cm -1)
3425.4
Bond
O-H stretch, H-bonded
O-H stretch
C-H stretch
Functional groups
Alcohols, phenols
Carboxylic acids
Alkanes
1647.7
-C=C- stretch
N-H bend
Alkenes
Primary amines
1541.8
N-O asymmetric stretch
Nitro compounds
1419.9
C-C stretch (in-ring)
Aromatics
1256.1
C-N stretchC-O stretch
C-H wag (-CH2X)
Aromatic amines
Alcohols, carboxylic acids, esters, ethers
Alkyl halides
1154.9
C-O stretch
C-H wag (-CH2X)
C-N stretch
Alcohols, carboxylic acids, esters, ethers
Alkyl halides
Aliphatic amines
1054.2
C-N stretch
Aliphatic amines
897.65
=C-H bend
C-H "oop"
N-H wag
Alkenes
Aromatics
Primary, secondary amines
848.08
=C-H bend
N-H wag
C-H "oop"
C-Cl stretch
Alkenes
Primary, secondary amines
Aromatics
Alkyl halides
791.88
=C-H bend
N-H wag
C-H "oop"
C-Cl stretch
Alkenes
Primary, secondary amines
Aromatics
Alkyl halides
2926.1
3.40 x 103 cfu/ml as compared to control which is 3.40 x
105, 1.44 x 105, 1.45 x 105 and 2.49 x 104 cfu/ml,
respectively. Various water quality parameters like
temperature, salinity and pH were observed in every
sampling are presented in Table 4. There were not much
changes of water quality parameters both in the treatment and control. Although, in the treatment, and with
extract alone, light greenish coloration was observed
when compared with control due to the crude nature of
extract.
DISCUSSION
In the present study, U. fasciata extract reduced the
growth of V. harveyi. The preliminary phytochemical
characterization and antimicrobial efficacy of macro algae
U. fasciata and Chaetomorpha antennina were studied
against pathogenic bacteria (Premalatha, 2011).
Priyadharshini et al. (2012) observed that aqueous and
solvent based extracts of U. fasciata showed inhibition
against fish-borne bacteria and fungal pathogens.
Kolanjinathan and Stella (2011) reported that crude
extracts of U. reticulata and U. lactuca are inhibitory to
human pathogenic bacteria and fungi. The dietary
administration of U. fasciata extracts controlled marine V.
harveyi in shrimp grow-out system (Selvin et al., 2011).
In a recent study, reductions on crude bacteriocin were
noticed in all the days by U. fasciata extract on V. harveyi.
The moderate and weak levels of reduction on
proteolysis, phospholipase, lipolysis and thermonuclease
of V. harveyi were observed treating against U. fasciata
extract. Silva et al. (2013a) has observed that U. fascita
extract exhibited antagonism against V. parahaemolyticus.
In this study, the cell surface hydrophobicity of V. harveyi
exhibit moderate hydro-phobicity by U. fasciata treatment
when compared with the control. This was corroborated
with the values reported by Sivakumar and Kannappan
810
Afr. J. Microbiol. Res.
Figure 5. GC-MS chromatogram of the crude ethyl acetate extract of U. fasciata.
Figure 6. Major compounds isolated from U. fasciata. (a) Structure of Bis(2-ethylhexyl)phthalate
(C24H38O4) extracted and detected by GC-MS from U. fasciata (b) Structure of 1,2-benzenedicarboxylic
acid, butyl 2-ethylhexyl ester (C20H30O4), extracted and detected by GC-MS from U. fasciata.
(2013) from the marine algae such as S. costatum and K.
alvarezii.
The FTIR spectra of U. fasciata showed various
functional groups of compounds which agreed with the
FTIR values reported for marine macro algae Laminaria
digitata (Dittert et al., 2012). Similarly, Azizi et al. (2013)
observed various functional compounds like water,
protein, polysaccharide and lipids from marine algae
Sargassum muticum using FTIR. Though the GC-MS
analysis of crude extract of U. fasciata revealed many
components, the main chemical constituents observed in
high percentage were Bis(2-ethylhexyl) phthalate and
1,2-benzenedicarboxylic acid-butyl which may also be
involved in antagonism against V. harveyi.
Challenge against V. harveyi during P. monodon postlarvae revealed that U. fasciata extract showed 32.40%
Sivakumar et al.
811
Table 3. GC-MS profile of U. fasciata.
Retention
time (min)
4.03
5.29
8.75
8.88
9.37
11.67
11.77
13.15
14.21
14.29
15.21
15.44
15.70
16.46
16.53
16.91
16.97
17.18
17.36
17.66
17.84
18.14
18.32
18.51
18.56
19.89
20.36
20.87
21.70
22.08
22.24
22.37
22.80
23.02
23.21
26.89
Compound’s name
Anisole
1-Decene
5-Tetradecene, (E)Dodecane
Benzothiazole
1-Tetradecene
Tetradecane
Phenol, 2,4-bis(1,1-dimethylethyl)
Cetene
Hentriacontane
8-Heptadecene
Heptadecane
Phenol, 2-(1-phenylethyl)1-Octadecene
Octadecane
Bicyclo[3.1.1]heptanes, 2,6,6-trimethyl,(1.alpha.,2.beta.,5.alpha)
2-Undecanone, 6,10-dimethylDibutyl phthalate
Phytol, acetate
Phthalic acid, butyl isohexyl ester
Phthalic acid, 2-ethylhexyl pentyl ester
1,2-Benzenedicarboxylic acid, butyl
Phthalic acid, butyl isohexyl ester
5-Eicosene, (E)Dodecane, 1,1'-oxybisSilanetriamine,1-azido-N,N,N',N', N'',N''hexamethylBehenic alcohol
1,2-Benzenedicarboxylic acid, butyl 2ethylhexyl ester
Methyl dehydroabietate
Octacosanol
Phenol, 2,4-bis(1-phenylethyl)Phenol, 2,4-bis(1-phenylethyl)Bis(2-ethylhexyl) phthalate
Naphthalene, 6-chloro-1-nitroBis(2-ethylhexyl) phthalate
Benzo[h]quinoline, 2,4-dimethyl-
reduction in the cumulative percentage of mortality as
compared to control; but, Saptiani et al. (2011) has reported that ethyl acetate, n-butanol fractions of crude
Acanthus ilicifolius extract controlled P. monodon postlarvae from V. harveyi infections. The supplementation of
Undaria pinnatifida and fucoidon incorporated diet proved
to enhance growth with reduced mortalities among P.
monodon postlarvae caused by V. harveyi (Traifalgar et
Peak area
(%)
0.80
0.09
0.34
0.05
0.14
0.52
0.07
0.34
0.60
0.10
0.23
0.06
0.19
0.47
0.06
Molecular
formula
C7H8O
C10H20
C12H28
C12H26
C7H5NS
C14H28
C14H30
C14H22O
C16H32
C31H64
C17H34
C17H36
C14H14O
C18H36
C18H38
Molecular
weight
108.13
140.26
196.37
170.33
135.18
196.37
198.38
206.32
224.42
436.83
238.45
240.46
198.26
252.48
254.49
0.32
C10H18
138.24
0.13
0.30
0.11
0.45
0.09
2.47
1.12
0.66
0.10
C13H26O
C16H22O4
C22H42O2
C18H26O4
C21H32O4
C20H30O4
C18H26O4
C20H40
C24H50O
198.34
278.34
338.56
306.39
348.47
334.44
306.39
280.53
354.65
0.21
C6H18N6Si
202.33
0.26
C22H46O
326.60
0.27
C20H30O4
334.44
0.10
0.12
0.25
0.49
0.45
0.13
88.42
0.22
C21H30O2
C28H58O
C30H29N3O3
C30H29N3O3
C24H38O4
C10H6ClNO2
C24H38O4
C15H13N
314.46
410.75
479.56
479.56
390.55
207.61
390.55
207.27
al., 2009). Marine algae are impending source for owning
extensive range of polyunsaturated fatty acids (PUFA),
carotenoids, phycobiliproteins, polysaccharides and phycotoxins, etc (Chu, 2012). It was reported that lipids obstruct microbesby distracting cellular membrane (Bergsson
et al., 2011) of bacteria, fungi and yeasts. These fatty
acids may further distress the expression of bacterial
virulence which was significant for establishing infections.
812
Afr. J. Microbiol. Res.
Table 4. Challenging of crude extracts of U. fasciata against V. harveyi during P. monodon larviculture with the cumulative percentage mortality reduction.
Cumulative percentage mortality
Day
0
5th
10th
15th
20th
25th
30th
Control
tubs with
V. harveyi
0.00
13.66±0.3
26.05±0.9
35.63±1.1
47.33±1.5
62.13±2.3
76.30±2.9
Treatment
tubs extract
with V. harveyi
0.00
06.96±0.2
14.36±0.3
21.33±0.6
27.81±1.1
36.63±1.3
43.90±1.3
Tubs with
extract and
PL alone
0.00
2.390.1
6.190.2
12.050.5
18.130.6
24.690.9
29.561.0
Tubs with
PL alone
0.00
3.230.1
6.030.2
13.330.5
17.430.5
23.861.0
28.391.0
Treatment tubs
(cfu/ml)
Total
plate
V. harveyi
count
1.24106
1.15106
2.42104
2.38104
2.15104
1.56104
4
7.4010
4.30103
4
1.2910
3.40103
9.40104
5.40103
4
8.2010
4.10103
Control tubs (cfu/ml)
Average weight of
postlarvae (mg)
Total plate
count
V.
harveyi
Treatment
tubs
Control
tubs
1.18106
3.18105
2.94105
1.51105
2.66104
1.80104
1.74104
2.41106
3.40105
1.44105
1.45105
2.49104
1.74104
1.51104
17.7 ± 3
60.9 ± 4
121.1 ± 4
156.3 ± 5
201.5 ± 9
236.9 ± 8
269.3 ± 9
18.1±2
63.6±3
127.5±5
157.5±5
197.9±7
240.1±9
266.5±8
Water quality parameters for treatment and control
tubs
pH in
pH in
Temperature
Salinity
control
treatment
(°C)
(PSU)
tubs
tubs
29.0±1.0
20±0.5
8.40±0.2
8.30±0.2
29.5±1.0
20±0.5
8.50±0.2
8.40±0.2
29.0±1.0
20±0.5
8.20±0.2
8.30±0.2
30.0±1.0
20±0.5
8.40±0.2
8.50±0.2
30.0±1.0
21±0.5
8.10±0.2
8.30±0.2
31.0±1.0
21±0.5
8.40±0.2
8.20±0.2
30.0±1.0
21±0.5
8.10±0.2
8.00±0.2
Values of average of three determinations with standard deviation (SD)
It has been demonstrated that fatty acids of chain
length more than 10 carbon atoms would induce
lysis of bacterial protoplasts. Due to the tough
environments in which many macro algae exists,
effective defense mechanisms have been
established and consequently, amusing source of
bioactive compounds, including polysaccharides,
polyphenols, fatty acids and peptides, with
dissimilar structures and activities than those
found in terrestrial plants (Tierney et al., 2010).
Many species of macro algae had foremost
constituentslike tetradecanoic acid, hexadecanoic
acid, octadecanoic acid methyl esters etc
(Balamurugan et al., 2013) which may reveal
antagonism against marine bacteria (Al-Saif et al.,
2013). Lately, the secondary metabolites and
organic extracts obtained from U. fasciata has
potential applications (Silva et al., 2013b) and the
diverse derivatives of diterpenoids extracted from
U. fasciata exhibited antagonism against Vibrio
parahaemolyticus and V. harveyi (Chakraborty et
al., 2010). Thus, in the present study, biological
activity of U. fasciata against V. harveyi was due to
the presence of various chemical constituents as
described. Hence, macro algae U. fasciata extract
will have immense applications in aquaculture.
Conclusion
Results from this study proved that the crude
extract of U. fasciata at 300 µg/ml inhibited the
growth and modulated the virulences produced by
V. harveyi. U. fasciata extract at 200 µg/ml also
controlled the mortality caused by V. harveyi
during shrimp larviculture. Based on this study,
the U. fasciata extract can be used as alternative
bio-inhibitors for the aquaculture practices.
Application of such bio-products would moderate
the undesirable contamination from applying the
synthetic compounds with reduced cost and ecofriendly nature.
ACKNOWLEDGEMENTS
The authors greatly acknowledge the Department
of Biotechnology (DBT), Government of India for
sponsoring the project entitled “Development of
inhibitors for controlling quorum sensing
luminescence disease causing Vibrio harveyi in
shrimp larviculture system” during 2010. This work
was
a
component
under
this
project
(BT/PR/13383/AAQ/03/501/2009).
REFERENCES
Al-Saif SSAL, Abdel-Raouf N, El-Wazanani HA, Aref IA (2013).
Antibacterial substances from marine algae isolated from
Jeddah coast of Red Sea, Saudi Arabia. Saudi J. Biological
Sci. (article in press).
Azizi S, Namvar F, Mahdavi M, Ahmad MB, Mohamad R
(2013). Biosynthesis of silver nanoparticles using brown
marine macro alga, Sargassum muticum aqueous extract.
Materials 6:5942-5950.
Balamurugan M, Selvam GG, Thinakaran T, Sivakumar K
(2013). Biochemical Study and GC-MS Analysis of Hypnea
musciformis (Wulf) Lamouroux. American-Eurasian J. Sci.
Res. 8(3):117-123.
Bergsson G, Hilmarsson H, Thormar H (2011). Antibacterial,
antiviral and antifungal activities of lipids. In: Thormar H.
(eds), Lipids and essential oils as antimicrobial agents. John
Wiley and Sons Limited, Chichester, United Kingdom. pp.
47-80.
Sivakumar et al.
Chakraborty K, Lipton AP, Paulraj R, Vijayan KK (2010). Antibacterial
labdanediterpenoidsof Ulva fasciata Delile from southwestern coast
of the Indian Peninsula. Food Chem. 119(4):1399-1408.
Chu WL (2012). Biotechnological applications of microalgae. IeJSME
6(1):S24-S37.
Dittert I M, Vilar VJP, da Silva EAB, de Souza SMAGU, de Souza AAU,
Botelho CMS, Boaventura RA (2012). Adding value to marine macro
algae Laminaria digitata through its use in the separation and
recovery of trivalent chromium ions from aqueous solution. Chem.
Eng. J. 193:348-357.
D'Souza L, Devi P, Shridhar DM, Naik CG (2008). Use of Fourier
Transform Infrared (FTIR) spectroscopy to study cadmium-induced
changes in Padina tetrastromatica (Hauck). Anal. Chem. Insights
3:135-143.
Harris L, Owens L, Smith S (1996). A selective and differential
medium for Vibrio harveyi. Appl. Enviorn. Microbiol. 62(9):3548-3550.
Huynh TG, Yeh ST, Lin YC, Shyu JF, Chen LL, Chen JC (2011).
White shrimp
Litopenaeus
vannamei
immersed
in seawater containing Sargassum hemiphyllum
var.
Chinense
powder and its extract showed increased immunity and resistance
against Vibrio alginolyticus and white spot syndrome virus. Fish
Shellfish Immunol. 31(2):286-93.
Islam MA, Alam MM, Choudhury ME, Kobayashi N, Ahmed MU (2008).
Determination of minimum inhibitory concentration of cloxacillin for
selected isolates of methicillin-resistant Staphylococcus aureus
(MRSA) with their antibiogram. Bangl. J. Vet. Med. 6(1):121-126.
Kanjana K, Radtanatip T, Asuvapongpatana S, Withyachumnarnkul B,
Wongprasert K (2011). Solvent extracts of the red seaweed
Gracilaria fisheri prevent V. harveyi infections in the black tiger
shrimp Penaeus monodon. Fish Shellfish Immunol. 30(1):389-396.
Kannappan S, Sivakumar K, Patil PK (2013). Effect of garlic extract on
the luciferase, bio-luminescence, virulence factors produced by V.
harveyi with a challenge during Penaeus monodon larviculture. Afr. J.
Microbiol. Res. 7(18):1766-1779.
Kolanjinathan K, Stella D (2011). Comparative studies on antimicrobial
activity of Ulva reticulata and Ulva lactuca against human pathogens.
Int. J. Pharma. Biol. Archives 2(6):1738-1744.
Musharraf SG, Ahmed MA, Zehra N, Kabir N, Choudhary MI, Rahman
AU (2012). Biodiesel production from micro algal isolates of southern
Pakistan and quantification of FAMEs by GC-MS/MS analysis. Chem.
Cent. J. 6(1):1-10.
Osman MEH, Aboshady AM, Elshobary ME (2013). Production and
characterization of antimicrobial active substance from some macro
algae collected from Abu- Qir bay (Alexandria) Egypt. Afr. J.
Biotechnol. 12(49):6847-6858.
Paul JJP, Devi SDKS (2013). Seasonal variability of Ulva species
(Green seaweed) in Tirunelveli region, the southeast coast of Tamil
Nadu, India. Res. J. Marine Sci. 1(1):14-17.
Peso-Echarri P, Frontela-Saseta C, Gonzalez-Bermudez CA, RosBerruezo GF, Martinez-Gracia C (2012). Polysaccharides from
seaweed as ingredients in marine aquaculture feeding: alginate,
carrageenan and ulvan. Revista de Biologia Marina y
Oceanografia 47(3):373-381.
Premalatha M (2011). Phytochemical characterization and antimicrobial
efficiency of seaweed samples, Ulva fasciata and Chaetomorpha
antennina. Int. J. Pharma Bio Sci. 2(1):P288-293.
Priyadharshini S, Bragadeeswaran S, Prabhu K, Sophia Rani S (2012).
Antimicrobial and hemolytic activity of seaweed extracts Ulva fasciata
(Delile 1813) from Mandapam, Southeast coast of India. Asian Pac.
J. Trop. Biomed. S38-S39.
Rahman S, Khan SN, Naser MN, Karim MM (2010). Isolation of Vibrio
spp. from Penaeidshrimp hatcheries and coastal waters of Cox‟s
Bazar, Bangladesh. Asian J. Exp. Biol. Sci. 1(2):288-293.
813
Raissy M, Momtaz H, Moumeni M, Ansari M, Rahimi E (2011).
Molecular detection of Vibrio spp. in lobster haemolymph. Afri. J.
Microbiol. Res. 5(13):1697-1700.
Saptiani G, Prayitno SB, Anggoro S (2011). Inhibition test of jeruju
(Acanthus ilicifolius) leaf extracts on the in vitro growth of the Vibrio
harveyi. Paper. Simposium Nasional Kimia Bahan Alam XIX. Simnas
KBA. Samarinda 11-12 p October (In Indonesian).
Saritha K, Mani AE, Priyalaxmi M, Patterson J (2013). Antibacterial
activity and biochemical constituents of seaweed Ulva lactuca. Global
J. Pharmacol. 7(3):276-282.
Selvin J, Manilal A, Sujith S, Kiran GS, Lipton AP (2011). Efficacy of
marine green alga Ulva fasciata extracts on the management of
shrimp bacterial diseases. Lat. Am. J. Aquat. Res. 39(2):197-204.
Silva GC, Albuquerque-Costa R, Oliveira-Peixoto JR, Macedo-Carneiro
PBD, Fernandes-Vieira RHSD (2013a).Tropical Atlantic marine
macro algae with bioactivity against virulent and antibiotic resistant
Vibrio. Lat. Am. J. Aquat. Res. 41(1):183-188.
Silva M, Vieira L, Almeida AP, Kijjoa A (2013b). The marine macro
algae of the genus Ulva: chemistry, biological activities and potential
applications. Oceanography 1:101. doi:10.4172/ocn.1000101.
Sivakumar K, Kannappan S (2013). Inhibitory effect of marine algae
collected from the East and West coast of India against luciferase
and luminescence producing Vibrio harveyi. Afri. J. Biotechnol.
12(22):3493- 3502.
Soto-Rodriguez SA, Gomez-Gil B, Lozano R, del Rio-Rodriguez R,
Dieguez AL, Romalde JL (2012). Virulence of Vibrio harveyi
responsible for the "Bright-red" Syndrome in the Pacific white shrimp
Litopenaeus vannamei. J. Invertebrate Pathol. 109(3):307-317.
Tierney MS, Croft AK, Hayes M (2010). A review of antihypertensive
and antioxidant activities in macro algae. Botanica Marina 53(5):387408.
Traifalgar RF, Serrano AE, Corre V, Kira H, Tung HT, Fady RM, Kader
Md. A, Laining A, Yokoyama S, Ishikawa M, Koshio S (2009).
Evaluation of dietary fucoidan supplementation effects on growth
performance and Vibriosis resistance of Peneaus monodon
postlarvae. Aquaculture Sci. 57:167-174.
Vezzulli L, Previati M, Pruzzo C, Marchese A, Bourne DG, Cerrano C
(2010). Vibrio infections triggering mass mortality events in a
warming Mediterranean Sea. Environ. Microbiol. 12:2007-2019.
Zhou J, Fang W, Yang X, Zhou S, Hu L, Li X, Qi X, Su H, Xie L (2012).
A non-luminescent and highly virulent V. harveyi strain is associated
with „„bacterial white tail disease‟‟ of Litopenaeus vannamei shrimp.
PLoS One 7(2): e29961.
Vol. 8(8), pp. 814-818, 19 February, 2014
DOI: 10.5897/AJMR2013.6512
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Characterization and determination of antibiotic
susceptibility pattern of bacteria isolated from some
fomites in a teaching hospital in northern Nigeria
Aminu Maryam1*, Usman-Sani Hadiza1 and Usman M. Aminu2
1
Department of Microbiology, Faculty of Science, Ahmadu Bello University, Zaria, Kaduna State, Nigeria.
2
University Health Services, Ahmadu Bello University, Main Campus, Zaria, Kaduna State, Nigeria.
Accepted 30 January, 2014
Fomites are inanimate objects that can serve as vehicles for pathogens transfer. This study was
conducted to determine the antibiogram of bacteria isolated from fomites in a teaching hospital in
Nigeria. Exactly 35 samples were used for the study. Twenty three (65.7%) isolates were obtained; the
ratio of Gram positive to Gram negative organisms was 12 to 11. The bacteria isolated were
Staphylococcus aureus (21.7%), Staphylococcus epidermidis (8.7%), Streptococcus spp. (8.7%),
Bacillus spp. (13.0%), Escherichia coli (26.1%), Pseudomonas spp. (8.7%) and Klebsiella spp. (13.0%).
The isolated bacteria showed varying susceptibility pattern to the antibiotics used and were all
susceptible to erythromycin and streptomycin.
Key words: Bacteria, fomites, antibiotics, susceptibility, teaching hospital, Nigeria.
INTRODUCTION
Fomites consist of either porous or nonporous surfaces
or inanimate objects that whencontaminated with pathogenic microorganisms can transfer them to a new host
thereby serving as vehicles in transmission (Greene,
2009; Cramer, 2013). Fomites are associated particularly
with hospital acquired infections (HAIs) that remain a
major cause of patient morbidity and mortality (Weber et
al., 2010; Nwankiti et al., 2012). An estimated 20 to 40%
of HAIs have been attributed to cross infection via the
hands of health care workers (HCWs), who have become
contaminated from direct contact with the patient or
indirectly by touching contaminated hospital environmental surfaces (Kelly, 2002; Christensen et al., 2007;
Mangicaro, 2012). Fomites can therefore serve as reservoir with pathogens being spread from the inanimate
environment to an animate (patient) environment via the
hands of HCWs (Bhalla et al., 2004; Kramer et al., 2006;
Ikeh and Isamade, 2011; Nwankiti et al., 2012).
Stethoscopes, neckties (Merlin et al., 2009; Williams
and Davis, 2009), skin cells, hair, food, computer
keyboards, pens, tables, artificial acrylic fingernails
(McNeil et al., 2001), bedding and clothing are common
hospital sources of pathogens (Boyce et al., 1997;
Cramer, 2013). Up to 60% of hospital staff’s uniforms are
usually colonized with potentially pathogenic bacteria,
including drug-resistant organisms (Munoz-Price et al.,
2012). Intravenous fluid (IVF) tubes/stands, catheters,
water systems and life support equipment can also be
carriers, when the pathogens form biofilms on the
surfaces (Willey et al., 2011; Cramer, 2013).
Identification of common fomites and associated
pathogens in any hospital settings is important because
the most important factor in prevention of a disease is to
simply identify what has been transferring the disease in
the first place (Cramer, 2013). Fomites are therefore an
opportunity to interrupt the spread of infection.
*Corresponding author. E-mail: maryamaminu@yahoo.com. Tel: +234 803 328 7031.
Maryam et al.
815
Table 1. Distribution of growth and organisms isolated from fomites in the A&E ward of ABUTH, Zaria-Nigeria.
Fomite
Table
Stethoscope
Uniform
Pen
Total no. of sample
5
5
5
5
Number with growth (%)
3 (60)
3 (60)
4 (80)
3 (60)
IVF Stand
5
4 (80)
Door knob
Chair
Total
5
5
35
3 (60)
3 (60)
23 (65.7)
By recognizing them, avoiding them, disinfecting them, or
cleansing the hands after touching them, the spread of
many infections can be halted (Greene, 2009; Cramer,
2013). This study was therefore conducted to isolate
bacteria from fomites in the Accident and Emergency
(A&E) ward of Ahmadu Bello University Teaching
Hospital, Zaria, Nigeria and to determine their antibiotic
susceptibility pattern.
METHODOLOGY
A total of thirty-five (35) samples were collected from fomites
(tables, chairs, stethoscopes, pens, uniforms, doorknobs and IVF
stands) after the early morning cleaning and disinfection process in
the A&E ward of Ahmadu Bello University Teaching Hospital, Zaria
between the months of July and October 2010. The samples were
collected using sterile swab sticks, transported immediately to the
laboratory and cultured using the streak plate method on nutrient
agar, MacConkey agar, Eosin methylene blue, mannitol salt agar,
blood agar and centrimide agar as described by Cheesbrough
(2006). The plates were incubated at 37°C for 24 h; the isolates
were sub-cultured, maintained on Nutrient Agar slants and
identified based on their cultural morphology, Gram and biochemical reactions (Cheesbrough, 2006).
Antibiotic sensitivity testing was performed using Mueller-Hinton
agar. Inoculums were prepared by standardizing using the
McFarland’s standard. Standard antibiotic discs containing
augmentin, ampiclox, septrin, ceftriaxone, ampicillin, ciprofloxacin,
erythromycin, lincomycin, nitrofurantoin, ofloxacin, streptomycin,
tetracycline and gentamycin with concentrations of 30, 3, 250, 30,
15, 25, 10 m, 30, 200, 10, 10, 25, 10 mcg, respectively were used.
The discs were placed on the plates which were inverted and kept
in the refrigerator for 30 min and then incubated at 37°C for 24 h. A
clear zone of growth inhibition around a disc determined the relative
susceptibility of each isolate to the antibiotics.
RESULTS AND DISCUSSION
A total of 23 (65.7%) bacterial growths were obtained
from the culture with uniforms and IVF stands showing
highest number of growth each (80%: 4/5), followed by
tables, stethoscopes, pens, door knobs and chairs each
having 60% (3/5) (Table 1). The percentage of growth
obtained was lower than the 99% obtained in a previous
Organism(s) isolated
S. aureus, Bacillus spp.
S. epidermidis, E. coli Klebsiella spp.
S. aureus, E. coli, Streptococcus spp.,
S. aureus, Bacillus spp, E. coli
Streptococcus spp., S. epidermidis, Klebsiella
spp. Pseudomonas spp.
S. aureus, E. coli
S. aureus, E. coli, Bacillus spp.
study in Nigeria (Ikeh and Isamade, 2011). Majority of the
isolates were Gram positives organisms (52.2%: 12/23)
as compared to the Gram negative (47.8%: 11/23).
Staphylococci were isolated from all the fomites; S.
epidermidis (8.7%: 2/23) from IVF stand and stethoscope
and S. aureus (21.7%: 5/23) from the other fomites
(Table 2).
Isolation of more Gram positive organisms is consistent
with previous reports (Neely and Maley, 2000; Chikere et
al., 2008) and agree with the statement that Grampositive bacteria have overtaken the Gram-negative as
the predominant bacteria isolated from fomites
(Inweregbu et al., 2005). Gram-positive organism have
earlier been noted to be causing more serious infections
than ever before in surgical patients, who are increasingly
aged, ill and debilitated (Barie, 1998). In a more recent
study, only Gram positive organisms were isolated (Ikeh
and Isamade, 2011).
Isolation of more Gram positive organisms is probably
because they are members of the body flora of both
asymptomatic carriers and sick persons. These
organisms can be spread by the hand, expelled from the
respiratory tract or transmitted by animate or inanimate
objects (Chikere et al., 2008). Their main source(s) of
colonization on the fomites might likely be nasal carriage
by hospital personnel (Graham et al., 2006), likely
facilitated by hand-to-mouth or hand-to-nose contact
while using these fomites, and/or by poor hand-washing
habits (ASM, 2005).
Isolation of Staphylococcus aureus from almost all the
fomites show their ubiquitous nature and that they can be
sources of infection to patients as previously noted
(Hartmann et al., 2004; Inweregbu et al., 2005; Ikeh and
Isamade, 2011). Although the strains of the isolated S.
aureus were not determined in this study, methicillin
resistant Staphylococcus aureus (MRSA) strains have
been shown to be transmissible from many fomites to
skin (Desai et al., 2011). For example, an earlier
study showed that one in three stethoscopes tested to
harbour Staphylococcus aureus and that 15% of all
stethoscopes tested were contaminated with MRSA
(Williams and Davis, 2009). Staphylococcus epidermidis
816
Afr. J. Microbiol. Res.
Table 2. Frequency of isolation of bacteria from fomites in the A&E
Ward of ABUTH, Zaria-Nigeria (N = 23).
Bacteria Isolated
Staphylococcus aureus
Staphylococcus epidermidis
Streptococcus spp.
Bacillus spp.
Escherichia coli
Pseudomonas spp.
Klebsiella spp.
Frequency
5
2
2
3
6
2
3
Percentage (%)
21.7
8.7
8.7
13.0
26.1
8.7
13.0
Table 3. Parentage susceptibility of bacterial isolates to common antibiotic.
Organism
S. aureus
S. epidermidis
Streptococcus spp.
Bacillus spp.
E. coli
Pseudomonas spp.
Klebsiella spp.
CN
40
50
50
33.3
100
100
100
OFX
40
50
50
33.3
50
100
33.3
CPX
60
100
100
66.7
83.3
50
-
CRO
60
100
50
100
66.7
50
100
SXT
60
50
100
100
16.7
50
10
E
100
100
100
100
-
L
80
50
100
100
-
S
100
100
100
66.7
-
APX
80
100
50
66.7
-
AG
20
50
50
-
COX
100
66.7
C
100
50
100
N
83.3
66.7
PM
50
100
T
50
50
66.7
CN = Gentamycin; OFX = ofloxacin; CPX = ciprofloxacin; CRO = ceftriazone; SXT = cotrimozazole; E = erythromycin; L = lincomycin; S =
streptomycin; APX = ampiclox; AG = augmentin; COX = cephalexin ; C = chloramphenicol; N = nitrifurantoin; PM = ampicillin; T= tetracyclin.
was isolated with the lowest frequency in this study.
Though these strains of staphylococci are known to be
non-pathogenic on the body, when they harbor antimicrobial resistance genes they constitute serious health
hazard. This coagulase negative Staphylococci have
been isolated from keyboards on multiple user computers
(Hartmann et al., 2004) and increased virulence of this
organism resulting from the acquisition of methicillin
resistance has been recognized (Ben-Saida et al., 2006).
Other bacteria isolated were Streptococcus spp. (8.7%:
2/23) from IVF stand and uniforms, Bacillus spp. (13.0%:
3/23) from pens, tables and chairs, Escherichia coli
(26.1%: 6/23) from all the fomites except table and IVF
stand, Klebsiella spp. (13.0%: 3/23) from IVF stand and
stethoscopes and Pseudomonas spp. (8.7%: 2/23) from
only IVF stand.
Bacillus spp., the only Gram positive bacilli
encountered in this study has been isolated with the
highest frequency in some studies in Nigeria: 84
(Nwankiti et al., 2012) and 90% (Ikeh and Isamade,
2011). This organism forms endospores, which, probably
from the air can settle on the surface of fomites in the
hospital, explaining why they were isolated mainly from
tables and chairs.
Although, Gram positive organisms were more
frequently isolated in this study, the Gram negative
bacterium Escherichia coli was the most prevalent. E. coli
were isolated from almost all the fomites except IVF
stands and tables probably due to fecal contamination as
a result of improper hand washing after the use of toilet.
This is evident in its isolation from pens, stethoscopes
and doorknobs which are usually held and touched by
hands.
As previously reported (Williams and Davis, 2009), the
Gram
negative
bacteria
Klebsiella
spp.
and
Pseudomonas spp. were isolated from stethoscopes and
IVF stand in this study. Gram-negative bacteria are
responsible for a high proportion of HAIs, particularly
among the critically ill and those in hospital for long
periods (Gould and Chamberlain, 1994).
The isolated bacteria showed varying susceptibility
pattern to the antibiotics used (Table 3). All the S. aureus
and S. epidermidis isolates were sensitive to erythromycin and streptomycin (100%). Streptococcus spp. were
most sensitivity (100%) to ciprofloxacin, septrin,
erythromycin, streptomycin and ampiclox. All the isolated
E. coli were susceptible to gentamycin, cephalexin and
chloramphenicol while all the isolated Pseudomonas spp.
were susceptible to gentamycin and ofloxacine. Similarly,
all the Klebsiella spp. isolates were susceptible to
gentamycin, ceftriazone, chloramphenicol and ampicillin.
Susceptibility of all the organisms isolated to
Erythromycin and Streptomycin does not necessary imply
that these antibiotics may represent therapeutic options
for infections caused by these organisms. S. aureus and
S. epidermidis showed similar susceptibility pattern being
Maryam et al.
highly susceptible to Streptomycin and resistant to
Augmentin. Augmentin may therefore not be a drug of
choice for treatment of infections caused by these
organisms. The Gram positive isolates were resistant to
gentamycin and ofloxacin while the Gram negative isolates were resistant to Cotrimozazole, indicating that
these antibiotics might not be very effective in the treatment of HAIs that might results from infection with these
pathogens. Similar weakness and susceptibility in activity
of antibiotics against bacteria from clinical specimens
have been shown (Chikere et al., 2008). As more
bacteria become resistant to antibiotics, the ability to
control the spread of these bacteria with antibiotic treatments decreases.
The isolation of potential pathogens such as S. aureus
and Streptococcus spp. from IVF stands and uniforms of
HCWs in the A&E ward confirms the possibility of cross
infections from workers to patients. This implies that
these fomites might act as vehicles for transfer of these
pathogens hence etiologic agents for infectious
pathogens. Many studies have shown uniforms to be
potential reservoirs for hospital organisms, potentially reinfecting the hands of HCWs (Boyce et al., 1997; Snyder
et al., 2008; Munoz-Price et al., 2012). Treakle et al.
(2009) showed a large proportion of HCWs' white coats
to be contaminated with S. aureus, including MRSA and
postulated that white coats may be an important vector
for patient-to-patient transmission of S. aureus. Potential
pathogens such as S. aureus, Acinetobacter spp. and
enterococci have been recently isolated from hands that
were used to touch uniforms (Munoz-Price et al., 2012).
Similarly, isolation of E. coli from door knobs simply
implies that they can be easily transmitted to anybody
that opened the door to the A&E ward. One can therefore
easily postulate how these fomites could become vectors
for the spread of pathogenic organisms in the A&E ward
as a HCW moves from one patient to another and these
fomites contacts different patients.
In the A&E Ward of ABUTH, we observed that reusable
cleaning cloths soaked in bucket of water containing
OmoR detergent are used irregularly to clean door knobs
and tables; while methylated spirit is used to clean the IV
stands once or twice a week. Floors are cleaned with
mops dipped in diluted SalvonR every morning and evening while JikR is used only when there is contamination
with blood. The cloths and mops used in cleaning are
however not adequately cleaned and disinfected, as most
often, the water containing the disinfectant is not changed
until the cleaning is completed. It has been shown that if
water-disinfectant mixture used in cleaning is not
changed regularly, the mopping procedure actually can
spread heavy microbial contamination throughout the
health-care facility (Mangicaro, 2012).
Irregular cleaning and effective disinfection of door
knobs to the A&E ward, tables, chairs and IV stands in
the ward may allow pathogens that contaminate them by
817
settling on them or by hand, to survive and be transmitted
to patient or HCWs. Although surface cleaners play a role
in reducing the spread of infections, not all disinfectants
work equally well at killing all pathogens (Boskey, 2011).
Some pathogens are more susceptible to specific
detergents than others. Therefore, the need for regular
cleaning and effective disinfection of fomites identified to
be easily contaminated with specific pathogens is very
crucial. The effective use of disinfectants constitutes an
important factor in preventing HAIs and improved
cleaning/disinfection of environmental surfaces and hand
hygiene have been shown to reduce the spread of
hospital acquired pathogens (Rutala and Weber, 2001;
Nicolle, 2002; Christensen et al., 2007; Weber et al.,
2010; Boskey, 2011).
Conclusion and recommendation
The isolation of pathogenic bacteria from fomites in this
study indicates that they can be vehicles for disease
transmission. In the light of this, there is need therefore
for thorough disinfection and conscientious contact
control procedures to minimize the spread of these
pathogens in the A&E ward where interaction between
patients, HCWs and caregivers is very common and
frequent. It is also necessary to encourage the effective
use of disposable hand gloves between patients and to
avoid touching fomites with gloved hands, which may be
acting as sources of infection.
Limitation of study
Small sample size and inability to determine if the S.
aureus isolated were MRSA.
ACKNOWLEDGEMENTS
We acknowledge all the personnel at the Accident and
Emergency ward of ABUTH for their cooperation during
sample collection.
REFERENCES
American Society for Microbiology (ASM) (2005). Women better at hand
hygiene habits, hands down. ASM Press Releases: 2005. Available
from: http://www.asm.org/Media/index.asp. Cited 2013 July 9.
Barie PS (1998). Antibiotic-resistant Gram-positive cocci: implications
for surgical practice. Wld. J. Surg. 22(2):118-126.
Ben-Saida N, Ferjeni A, Benhadjtaher N, Monastiri K, Boukadida J
(2006). Clonality of clinical methicillin resistant Staphylococcus
epidermidis isolates in a neonatal intensive care unit. Patholo. Biol.
54:337-342.
Bhalla A, Pultz NJ, Gries DM, Ray AJ, Eckstein EC, Aron DC, Donskey
CJ (2004). Acquisition of nosocomial pathogens on hands after
contact with environmental surfaces near hospitalized patients. Infect.
Control Hosp. Epidemiol. 25:164-167.
818
Afr. J. Microbiol. Res.
Boskey E (2011). What is Fomite Transmission. Updated April 06, 2011.
th
Accessed
13
Nov
2013.
Available
from:
http://std.about.com/od/glossary/g/What-Is-Fomite-Transmission.htm.
Boyce JM, Potter-Bynoe G, Chenevert C, King T (1997). Environmental
contamination due to methicillin-resistant Staphylococcus aureus:
possible infection control implications. Infect. Control Hosp.
Epidemiol. 18:622-627.
Cheesbrough M (2006). District Laboratory Practice in Tropical
Countries. Part 2. Cambridge University Press, United Kingdom.
Chikere, CB, Omoni VT, Chikere BO (2008). Distribution of potential
nosocomial pathogens in a hospital environment. Afri J. Biotech.
7(20):3535 -3538.
Christensen TE, Jørgensen JS, Kolmos HJ (2007). The importance of
hygiene for hospital infections. Ugeskr Laeger. 169(49):4249-4251.
Cramer L (2013). Fomites, fomite, fomite! Available from:
http://www.microbiology.com//p=961. Accessed 19 Nov 2013.
Desai R, Pannaraj PS, Agopian J, Sugar CA, Liu GY, Miller LG (2011).
Survival and transmission of community-associated methicillinresistant Staphylococcus aureus from fomites. Am. J. Infect. Contrl.
39(3):219-225.
Gould D, Chamberlain A (1994). Gram-negative bacteria: the challenge
of preventing cross-infection in hospital wards: a review of the
literature. J. Clin. Nurs. 3(6):339-345.
Graham P, Lin S, Larson EA (2006). US population based survey of
Staphylococcus aureus colonization. Ann. Internal Med. 144:318-325.
Greene
A
(2009).
Fomites.
Available
from:
http://www.drgreene.com/articles/fomites/. Reviewed by Le-Bucklin
K-V, Hicks R January 12, 2009. Accessed 4 Nov 2013.
Hartmann B, Benson M, Junger A, Quinzio L, Röhrig R, Fengler B,
Färber UW, Wille B, Hempelmann G (2004). Computer keyboard and
mouse as a reservoir of pathogens in an intensive care unit. J. Clin.
Monitor Comput.18 (1):7-12.
Ikeh EI, Isamade ES (2011). Bacterial flora of fomites in a Nigerian
multi-disciplinary intensive care unit. Lab. Med. 42:411-413.
Inweregbu K, Dave J, Pittard (2005). Nosocomial infections. Contin.
Educ. Anaesth, Crit. Care Pain 5(1):4-17.
Kelly MP (2002). Fomites role in disease transmission is still up for
debate.
Cited
2012
August
12.
Available
from:
http://www/infectioncontroltoday.com.
Kramer A, Scwebke I, Kampf G (2006). How long do nosocomial
pathogens persist on inanimate surfaces? A systematic review. BMC
Infect. Dis 6:130.
Mangicaro S (2012). Fomites: a vector for infection transmission.
Updated March 20, 2012; cited July 9 2013. Available from:
http://www.gnyhaservices.com/801/File.aspx.
McNeil SA, Foster CL, Hedderwick SA, Kauffman CA (2001). Effect of
hand cleansing with antimicrobial soap or alcohol-based gel on
microbial colonization of artificial fingernails worn by health care
workers. Clin. Infect. Dis. 32(3):367-372.
Merlin MA, Wong ML, Pryor PW, Rynn K, Marques-Baptista A, Perritt R,
Stanescu CG, Fallon T (2009). Prevalence of methicillin-resistant
Staphylococcus aureus on the stethoscopes of emergency medical
services providers. Prehosp. Emerg. Care. 13(1):71-74.
Munoz-Price LS, Arheart KL, Mills JP (2012). Associations between
bacterial contamination of health care workers' hands and
contamination of white coats and scrubs. Am. J. Infect. Contrl.
40(9):e245-8. doi: 10.1016/j.ajic.2012.03.032.
Neely AN, Maley MP (2000). Survival of enterococci and staphylococci
on hospital fabrics and plastic. J. Clin. Microbiol. 38(2):724-726.
Nicolle EL (2002). Nosocomial infections. Available from:
http://www.sciencedirect.com/. Accessed 7 August 2012.
Nwankiti OO, Ndako JA, Nwankiti AJ, Okeke OI, Uzoechina AR, Agada
GO (2012). Computer keyboard and mouse: etiologic agents for
microbial infections. Nat. Sci. 10(10):162-166.
Rutala WA, Weber DJ (2001). Surface disinfection: should we do it? J.
Hosp. Infect. 48 Suppl A:S64-68.
Snyder GM, Thom KA, Furuno JP, Perencevich EN, Roghmann MC,
Strauss SM, Netzer G, Harris AD (2008). Detection of methicillinresistant Staphylococcus aureus and vancomycin-resistant
enterococci on the gowns and gloves of healthcare workers. Infect.
Control Hosp. Epidemiol. (7):583-9.
Treakle AM, Thom KA, Furuno JP, Strauss SM, Harris AD, Perencevich
EN (2009). Bacterial contamination of health care workers' white
coats. Am. J. Infect. Control 37(2):101-5.
Weber DJ, Rutala WA, Miller MB, Huslage K, Sickbert-Bennett E
(2010). Role of hospital surfaces in the transmission of emerging
health care-associated pathogens: norovirus, Clostridium difficile, and
Acinetobacter species. Am. J. Infect. Control 38(5 Suppl 1):S25-33.
Willey JM, Sherwood LM, Woolverton CJ. (2011). Epidemiology and
public health microbiology: Nosocomial infections. In: Willey JM,
Sherwood LM and Woolverton CJ. edited Prescott’s Microbiology.8th
Edition, New York. The McGraw Hill Companies. International
Edition. pp. 873,884-886.
Williams C, Davis DL (2009). Methicillin-resistant Staphylococcus
aureus fomite survival. Clin. Lab. Sci. 22(1):34-38.
Vol. 8(8), pp. 819-824, 19 February, 2014
DOI: 10.5897/AJMR2013.6517
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research paper
Prevalence of different enterococcal species isolated
from blood and their susceptibility to antimicrobial
drugs in Vojvodina, Serbia, 2011-2013
Mihajlović-Ukropina Mira*, Medić Deana, Jelesić Zora, Gusman Vera, Milosavljević Biljana
and Radosavljević Biljana
Institute of Public Health of Vojvodina, Centre for Microbiology, University of Novi Sad, Faculty of Medicine, Serbia.
Accepted 20 January, 2014
Enterococci are one of the leading causes of nosocomial infections worldwide. Enterococcus faecalis
and Enterococcus faecium are the most commonly isolated. The aim of this study was to determine
prevalence of these species isolated from blood samples of hospitalized patients and their susceptibility
to antibiotics particularly to vancomycin and high concentrations of aminoglycosides. A total of 89
enterococcal strains isolated from blood samples between January 1st 2011 and August 31st 2013 were
tested. The species identification and susceptibility to antimicrobial drugs were performed using
automated VITEK 2 system. The most common species was E. faecalis (55.05%), followed by E. faecium
(41.57%). The enterococcal isolates were multidrug resistant with E. faecium resistance to vancomycin
of 54.05%, while resistance in E. faecalis was not found. All vancomycin resistant enterococci had VanA
phenotype of resistance. Thirty three (89.18%) isolates of E. faecium were high-level gentamycin
resistant and 32 (91.4%) were resistant to high concentration of streptomycin, whereas frequency of
resistant E. faecalis was 61.2 and 63.04%, respectively. This study shows that resistance in
enterococcal species is a serious clinical problem in our hospital and suggests the need for regular
susceptibility test and species level identification of enterococcal isolates.
Key words: Enterococci, blood culture, antimicrobial resistance.
INTRODUCTION
Enterococci are part of normal flora of gastrointestinal
tract of humans and animals, but they have also emerged
as significant cause of serious infection such as endocarditis, urinary and blood stream infections, intraabdominal end intra-pelvic abscesses (Moellering, 1992;
Teixeira and Facklan, 2003). Among enterococci,
Enterococcus faecalis (E. faecalis) and Enterococcus
faecium (E. humans. Over the last two decades, they
became one of faecium) are responsible for the majority
of infections in the most frequent causes of intrahospital
infections particularly because of increasing resistance to
a wide range of antibiotics (Schaberg et al., 1991; Low et
al., 2001; Chou, 2008; Hidron et al., 2008; Bereket, 2012;
Sievert et al., 2013).
Enterococci have both an intrinsic and acquired
resistance (Murray, 1990, 2000; Leclercq, 1997). They
*Corresponding author. E-mail: mmukropina@gmail.com. Tel: +381638657743. Fax: +381216613989.
Abbreviations: E. faecalis, Enterococcus faecalis; E. faecium, Enterococcus faecium; ATCC, American Type Culture Collection;
PBP, penicillin binding protein; HLAR, high-level aminoglycoside resistance; VRE, vancomycin resistant enterococci; SPSS,
statistical package for the social sciences; ICU, intensive care unit.
820
Afr. J. Microbiol. Res.
are intrinsically resistant to penicillinase-susceptible
penicillins (low level), penicillinase-resistant penicillins,
cephalosporins, sulphonamides, clindamycin and lowlevel concentrations of aminoglycosides. Acquired
resistance to penicillins, chloramphenicol, tetracyclins,
aminoglycosides (high-level) and vancomycin develops
either by mutation or transfer of plasmids and transposons. Resistance of many beta-lactams is as a result
of overproduction and modification of penicilin-bindingproteins (PBPs), particularly PBP5, with low affinity for
antibiotics.
High-level aminoglycoside resistance (HLAR) can be
mediated by single mutation within a protein of the 30S
ribosome subunit or by production of amino-glycosidemodifying enzymes. Acquired resistance to glycopeptides
occurs because of synthesis of modified cell wall
precursors with decreased affinity for these drugs. Nine
phenotypes of glycopeptide resistance (VanA, B, C, D, E,
G, L, M, N) have been detected (Arthur, 1993; Perichon
et al., 1997; Fines et al., 1999; Xu et al., 2010; Lebreton
et al., 2011). The most common and clinically significant
are VanA, that determine high-level resistance to both
vancomycin and teicoplanin, and VanB with variable
resistance to vancomycin only.
Resistance to wide range of antibiotics is a great
problem to clinicians because it has seriously affected the
treatment of enterococcal infections leaving limited
therapeutic options.
Keeping in mind that antimicrobial susceptibility of
enterococci is not predictable and that it differs by
enterococcal species and changes rapidly over time,
species identification and its susceptibility to antimicrobial
drugs are important for clinicians for choosing the most
effective drug and also useful for epidemiological
investigations.
The aim of this study was to determine prevalence of E.
faecalis and E. faecium isolated from blood and their
susceptibility to antibiotics particularly, vancomycin and
high concentration of aminoglycosides.
MATERIALS AND METHODS
This study was conducted at the Centre for Microbiology of Institute
of Public Health, Vojvodina. A total of 89 enterococcal strains that
were isolated from blood samples of hospitalized patients between
January 1st 2011 and August 31st 2013 were included in the study.
All blood samples were routinely cultured in blood culture bottles
(Bio Merieux, France) using semi-automated blood culture system
(Bact/Alert, Bio Merieux, Marcyl’ Etoile, France). The positive
samples were inoculated onto blood and MacConkey agar plate
(HiMedia, India) that were incubated aerobically for 24 h at 37°C.
Enteococcal genus identification was based on colony
morphology, Gram staining results, catalase reaction, growth on
bile-esculin agar and tolerance to 6.5% NaCl. The species
identification was done using automated VITEC 2 system
(BioMerieux). Susceptibility to ampicillin, gentamycin (high-level),
streptomycin (high-level), ciprofloxacin, vancomycin, teicoplanin,
linezolid, tigecycline, chloramphenicol and quinopristin/ dalfopristin
was determined using VITEK 2 system according to Clinical
Laboratory Standards Institute guideline (2010, 2011, 2012). E.
faecalis American Type Culture Collection (ATCC) 29212 was used
as control.
Statistical analysis
The statistical differences were analyzed using x2 test. The test was
performed using SPSS (statistical package for the social sciences).
A p-value of < 0.05 was considered significant .
RESULTS
Among 89 enterococci isolated from blood samples, the
most common species was E. faecalis (55.05%), followed
by E. faecium (41.57%). There was no significant
difference between prevalence of these two species (p
value = 0.196). Prevalence of all enterococcal species
isolated from blood is given in Table 1. Susceptibility of E.
faecium and E. faecalis to antibiotics is shown in Table 2.
Resistance of E. faecium isolates to all antibiotic tested,
except to chloramphenicol, was higher as compared to E.
faecalis strains. A high percentage of E. facium resistant
to vancomycin (54.05%) was detected, while resistance
in E. faecalis was not found. All vancomycin resistant
enterococci (VRE) were resistant to teicoplanin also,
belonging to VanA phenotype of resistance. Thirty three
(89.18%) isolates of E. faecium were high-level
gentamycin resistant and 32 (91.4%) were high-level
streptomycin, whereas the number of resistant E. faecalis
was 30 (61.2%) and 29 (63.04%), respectively. The
difference in resistance to gentamycin and streptomycin
in these two species was statistically significant (p =
0.004 and p = 0.003, respectively). The most effective
antibiotics were linezolid and tigecycline against all
isolates tested. Unlike E. faecium, all isolates of E.
faecalis were susceptible to vancomycin and teicoplanin
also. E. faecium isolates were susceptible to quinopristin/dalfopristin. Resistance to other antibiotics range
from 37.2% for chloramphenicol to 83.3% for
ciprofloxacin in E. faecalis isolates. In E. faecium it was
between 9.3% for chloramphenicol and 97.2% for
ampicillin. All E. faecium 89.7% isolates of E. faecalis
were resistant to three or more groups of antibiotics and
the most common multidrug resistant profile in E. faecium
was resistance to ampicillin, high-level concentrations of
aminoglycosides,
vancomycin,
and
ciprofloxacin.
Resistance to ampicillin, high-level concentrations of
aminoglycosides,
quinipristin/
dalfopristin
and
ciprofloxacin was the most commonly found pattern in
isolates of E. faecalis. The rates of VRE isolates from
different wards are given in Table 3.
Enterococcal species and VRE were most commonly
found in patients from intensive care unit (ICU), followed
by those from haematology/oncology ward.
There was no significant difference between proportion
of enterococcal isolates and VRE found in different
hospital wards (p value=0.068 and p value=0.894,
respectively). Demographic characteristics of patients with
Mira et al.
821
Table 1. Prevalence of enterococcal
species isolated from blood.
Species
E. faecalis
E. faecium
E. gallinarum
E. caseiflavus
Total
No. (%) of isolates
49 (55.05%)
37 (41.57%)
2 (2.24%)
1 (1.12%)
89 (100%)
Table 2. Susceptibility of E. faecium and E. faecium to antibiotics.
Antibiotic
Ampicillin
Gentamycin (hl)
Streptomycin
(hl)
Ciprofloxacin
Vancomycin
Teicoplanin
Linezolid
Tigecycline
Chloramphenicol
Quinopristin/
dalfopristin
No. of isolates
tested
37
37
E. faecium
No. (%) of resistant
isolates
36 (97.2)
33 (89.1)
No. of isolates
tested
49
49
E. faecalis
No. (%) of resistant
isolates
28 (57.1)
30 (61.2)
35
32 (91.4)
46
29 (63.0)
26
37
37
37
37
32
25 (96.1)
20 (54.05)
19 (53.1)
0 (0)
0 (0)
3 (9.37)
36
49
49
49
46
43
30 (83.3)
0 (0)
0 (0)
0 (0)
0 (0)
16 (37.2)
29
0 (0)
30
30 (100)
hl- High-level.
Table 3. Distribution of E. faecium, E. faecalis and VRE within hospital ward.
Ward
Intensive care unit (ICU)
Haematology/oncology
Internal
Other
Total
No. of E. faecium and E. faecalis
32
20
17
17
86
positive blood cultures and VRE are showed in Table 4.
Proportion of E. faecalis and E. faecium isolates in
males (62.7%) was higher than in females (32.2%), (p =
0.018). Prevalence of VRE also was higher in males
(25.9%) than in females (18.8%), but the difference was
not statistically significant (p = 0.619). The number of
enterococcal isolates found in patients above 60 years of
age was higher than in other age groups (p = 0.004).
There was no significant difference in proportion of VRE
between different age groups (p = 0.737).
DISCUSSION
Enterococci are one of the leading causes of nosocomial
infections worldwide because of increasing resistance to
No. (%) of VRE
8(25)
5(25)
4(23)
3(17)
20
a wide range of antibiotics. Until 1990s, glycopeptides
were antibiotics of choice in treating serious infections
caused by enterococci, but occurrence of strains resistant
to these drugs significantly decreased their efficiency.
VRE were first detected in France and United Kingdom in
1986, a year later similar strains were isolated in
hospitals in United States and since then VRE have been
discovered throughout the world (Uttley, 1988; Murray,
2000; Edmond et al., 1999; Treitman et al., 2005; Goossens,
1998). The main reason for emergence of resistant isolates
is widespread use of vancomycin. Broad spectrum
antibiotics, such as third-generation cephalosporins and
fluoroquinolons, also contributed to the selection of
resistant isolates (Sood et al., 2008; Heath et al., 1996).
In some European countries the outbreaks of VRE were
related to the extensive use of avoparcin, as growth
822
Afr. J. Microbiol. Res.
Table 4. Demographic characteristics of patients.
Variable
Sex
Male
Female
Age group
0-19
20-39
40-59
≥60
No. (%) of E. fecium and E. faecalis
No. (%) of VRE
54 (62.7)
32 (37.2)
14 (25.9)
6 (18.8)
23 (26.7)
11 (12.7)
18 (20.9)
34 (39.5)
0 (0)
3 (27.3)
7 (38.9)
10 (29.4)
promoter in farm animals (McDonald et al., 1997; Bates,
1997; Bager et al., 1997). Avoparcin causes bacterial crossresistance to vancomycin and teicoplanin.
Resistant enterococcal isolates are reported all over the
world, but prevalence of enterococcal species and their
resistance vary widely in different geographic regions.
In this study, E. faecalis (55.04%) was the most common
enterococcal species isolated from blood samples, followed
by E. faecium (41.57%). E. faecalis was predominant isolate
in studies from India (62.2% by Ajay et al. (2012), 76% by
Sreeja et al. (2012) and 82% by Bose et al. (2012), UK
(62% by Brown et al. (2008) and 63% by Fisher and
Phillips (2009) and Turkey (76% by Shah et al. (2012).
Until the early to mid-1990s this species was the most
frequent isolated enterococci in US hospitals (Treitman et
al., 2005). Since then there has been an important increase
in the incidence of E. faecium as a cause of nosocomial
infections (Hidron et al., 2008).
Prevalence of vancomycin resistant E. faecium (50.05%)
in this study was very high, much higher than that
reported in most of the other countries. Some European
countries (Bulgaria, Cyprus, Estonia, Iceland, Malta,
Slovenia and Sweden) reported an absence or very low
prevalence (Denmark-1.3%, Norvey-1.8%, Netherland-1%
and France-1.4%) of vancomycin resistance (European
Centre for Disease Prevention and Control, 2012).
Similar results were reported from India (Sreeja et al.,
2012) and Turkey (Shah et al., 2012). Among European
countries, the highest rates of VRE were obtained from
Ireland (34.9%), Greece (23.1%) and Portugal (20.2%).
In other parts of the world the highest frequency of
vancomycin resistant E. faecium was found in US (60%
by Bearman et al (2005), 67% by Forrest (2008), 80% by
Arias et al. (2010).
Resistance to vancomycin is still very rare in E. faecalis
isolates. In this study all E. faecalis were susceptible to
vancomycin. Bose et al. (2012), Sunilkumar and Karthika
(2012) and Bearman and Wenzel (2005) also reported
low prevalence of resistant isolates (0, 1 and 2%,
respectively). All E. faecium in this study had VanA
phenotype of resistance. This type is widely distributed
and predominant type of resistance in Iran (Talebi et al.,
2007), Czech Republic (Kolar et al., 2006), Poland
(Sadowy et al., 2013), Serbia (Mihajlovic-Ukropina et al.,
2011) and other European countries (Werner et al.,
2008).
Enterococcal infections develop usually in patients with
some risk factors, such as severe underlying disease,
long hospital stay, particularly in ICU, immune-suppression
and haematological malignance. The largest number of
vancomycin resistant E. faecium in this study was found
in samples of patients from ICU and haematology/oncology
ward that is in agreement with results of other authors
(Kolar et al., 2006; Brown et al., 2008).
In addition to intrinsic resistance to low-level resistance
to aminoglycosides, enterococci can acquire resistance
to high concentrations of aminoglycosides. Very high
percentages of HLAR in E. faecium (~90%) and E.
faecalis (~60%) were found in this study, similar to the
results reported in India (Sood et al., 2008; Jain et al.,
2011), Iran (Talebi et al., 2007) and Turkey (Baldir et al.,
2013). HLAR in E. faecalis was reported from all
European counties except Iceland. The majority of
countries reported frequency of resistant isolates
between 25 and 50%. The highest percentages were
detected in Italy (50%), Slovakia (49.5%), Hungary
(48.6%) and Poland (48.4%). (European Centre for
Disease Prevention and Control, 2012).
Combinations of aminoglycosides with beta-lactam antibiotics or glycopeptides are the treatment of choice for
serious enterococcal infections, such as endocarditis,
due to their synergistic activity. Occurrence of resistance
to these antibiotics and loss of their synergistic
bactericidal activity significantly limited therapeutic
options.
Newer antibiotics, such as linezolid, tygecyclin,
daptomycin and quinopristin/dalfopristin have been
suggested as an alternative option for treating infections
caused by multidrug resistant enterococci (Aksoy and
Unal, 2008; Yemisen et al., 2009, Arias et al., 2010; Tsai
et al., 2012). The results obtained in this study confirmed
good activity of linezolid and tygecyclin against both
enterococcal species tested and quinopristin/dalfopristin
against E. faecium only. Unfortunately, their clinical use
Mira et al.
may be limited by emergence of resistance that is
reported in several studies (Werner et al., 2008; Berdal
and Eskesen, 2008; Bonora et al., 2006; Kainer et al.,
2007).
In conclusion, this study shows a very high prevalence
of multi drug resistant enterococci isolated from blood
samples. These results suggest that regular susceptibility
test and species level identification of enterococcal
isolates are important in order to treat enterococcal
infections effectively and implement appropriate infection
control measures to limit the spread in nosocomial
settings.
REFERENCES
Ajay KO, Rajeshwari H, Nagaveni S, Kelmani CR (2012). Antimicrobial
susceptibility pattern of Enterococcus species isolated from clinical
samples in South India. JRAAS. 27:5-10.
Aksoy DY, Unal S (2008). New antimicrobial agents for the treatment of
Gram-positive bacterial infections. Clin. Microbial. Infect. 14:411-420.
Arias CA, Conreras GA, Murray BE (2010). Management of multidrugresistant enterococcal infections. Clin. Microbiol. Infect. 16(6):555562.
Arthur M, Courvalin P (1993). Genetics and mechanisms of
glycopeptides resistance in enteroocci. Antimicrob. Agents
Chemother. 37:1563-1571.
Bager F, Madsen M, Christensen J, Aarestrup FM (1997). Avoparcin
used as a growth promoter is associated with the occurrence of
vancomycin-resistant Enterococcus faecium in Danish poultry and pig
farms. Prev. Vet. Med. 31:95-112.
Baldir G, Engin DO, Kucukercan M, Inan A, Akcay S, Ozyuker S,
Asaray S (2013). High-level resistance to aminoglycoside,
vancomycin and linezolid in enterococci strains. J. Microbiol. Infect.
Dis. 3(3):100-103.
Bates J (1997). Epidemiology of vancomycin-resistant enteroccoci in
the community and the relevance of farm animals to human jnfection.
J. Hosp. Infect. 37:89-101.
Bearman GML, Wenzel RP (2005). Bacteriemias: a leading cause of
death. Arch. Med. Res. 36(6):646-659.
Berdal JE, Eskesen A (2008). Short-term success, but long-term
treatment failure with linezolid for enterococcal endocarditis. Scand.
J. Infect. Dis. 40:765-766.
Bereket W, Hemalatha K, Getener B, Wondwossen T, Solomon A,
Zeynudin A, Kannan S (2012). Update on bacterial nosocomial
infections. Eur. Rev. Med. Pharmacol. Sci. 16(8):1039-1044.
Bonora MG, Solbiati M, Stepan E, Zorzi A, Luzzani A, Catania MR,
Fontana R (2006). Emergence of linezolid resistance in the
vancomycin-resistant Enterococcus faecium multilocus sequence
typing C1 epidemic lineage. J. Clin. Microbiol. 44(3):1153-1155.
Bose S, Ghosh AK, Barapatre R (2012). Prevalence of drug resistance
among Enterococcus spp from a tertiary care hospital. Int. J. Med.
Health. Sci. 1(3):38-44.
Brown DFJ, Hope R, Livermore DM, Brick G, Broughton K, George RC,
Reynolds R (2008). Non-susceptibility trends among enterococcci
and non-pneumococcal streptococci from bacteraemias in UK and
Ireland, 2001-06. J. Antimicrob. Chemother. 62(2):ii75-ii85.
Chou Y, Lin T, Lin J, Wang N, Peng M, Chang F (2008). Vancomycinresistant enterococcal bacteremia: comparison of clinical features
and outcome between Enterococcus faecium and Enterococcus
faecalis. J. Immunol. Infect. 41(2):124-129.
Edmond MB, Wallace SE, McClish DK, Pfaller MA, Jones RN, Wenzel
RP (1999). Nosocomial bloodstream infections in United States
hospitals: A three-year analysis. Clin. Infect. Dis. 29(2):239-244.
European Centre for Disease Prevention and Control (2012).
Antimicrobial resistance surveillance in Europe 2011. Annual Report
of the European Antimicrobial Resistance Network (EARS-Net).
Stockholm; ECDC:59-63.
Fines M, Perichon B, Reynolds P, Sahm DF, Courvalin P (1999). Van E,
823
a new type of acquired glycopeptides resistance in Enterococcus
faecalis. BM4405. Antimicrob. Agents Chemother. 42(9):2161-2164.
Fisher K, Phillips C (2009). The ecology, epidemiology and virulence of
Enterococcus. Microbiology 155(6):1749-1757.
Forrest (2008). Enterococcal Bacteremia. Antimicrob. Agents.
Chemother. 52(10):3558-2563.
Goossens H (1998). Spread of vancomycin-resistant enterococci:
Differences between the United States and Europe. Infect. Control.
Hosp. Epidemiol. 19(8):546-551.
Heath CH, Blackmore TK, Gordon DL (1996). Emerging resistance in
Enterococcus spp. Med. J. Aust. 164(2):116-120.
Hidron AL, Edwards JR, Patel J, Horan TC, Sievert DM, Pollock DA,
Fridkin SK (2008). NHSN annual update: antimicrobial-resistant
pathogens associated with healthcare-associated infections: annual
summary of data reported to the National Healthcare Safety Network
at the Centre for Disease Control and Prevention, 2006-2007. Infect.
Control Hosp. Epidemiol. 20(11):996-1011.
Jain S, Kumar A, Kashyap B, Kaur JR (2011). Clinico-epidemiological
profile and high-level aminoglycoside resistance in enterococcal
septicemia fro tertiary care hospital in Delhi. Int. J. App. Basic. Med.
Res.1:80-83.
Kainer MA, Devasia RA, Jones TF, Simmons BP, Melton K, Chow S,
Broyler J, Moore KL, Craig AS, Schaffners W (2007). Response to
emerging infection leading to outbreak of linezolid-resistant
enterococci. Emerg. Infect. Dis. J. 13(7):1024-1030.
Kolar M, Pantucek R, Vagnerova I, Sauer P, Kesselova M, Cekanova L,
Koukalova D, Doskar J, Ruzickova V (2006). Prevalence of
vancomycin-resistant enterococci in hospitalized patients and those
living in the community in the Czeech Republic, New Microbiologica
29:121-125.
Lebreton F, Depardieu F, Bourdon N, Fines-Guyon M, Berger P,
Camiade S (2011). VanN-type transferable vancomycin resistance in
Enterococcus faecium. Antimicrob. Agents Chemother. 55:46064612.
Leclercq R (1997). Enterococci acquire new kinds of resistance. Clin.
Infect. Dis. 24(1):s80-84.
Low DE, Keller N, Barth A, Jones RN (2001). Clinical prevalence,
antimicrobial susceptibility,and geographic resistance patterns of
enterococci: Results from the SENTRY Antimicrobial Surveillence
program, 1997-1999. Clin. Infect. Dis. 32:S133-145.
McDonald LC, Kuehnert MJ, Tenover FC, Jarvis WR (1977).
Vancomycin- resistant enteroccoci outside the health-care
setting:prevalence,source
and
public
health
implications.Emerg.Infect.Dis.3:311-317.
Mihajlovic-Ukropina M, Medic D, Jelesic Z, Gusman V, Milosavljevic B
(2011). Frequency of vancomycin-resistant enterococci isolated from
blood cultures from 2008 to 2010, Med. Preg. 64(9-10):481-485,
Moellering RC Jr. (1992). Emergence of Enterococcus as a significant
pathogen. Clin. Infect. Dis. 14(6):1173-1176.
Murray BE (1990). The life and times of enterococcus. Clin. Microbiol.
Rev. 3:45-65.
Murray BE (2000). Vancomycin-resistant enterococcal infections. N.
Engl. J. Med. 10:710-721.
Perichon B, Reynolds P, Courvalin (1997). VanD-type glycopeptides
resistant Enterococcus faecium BM4339. Antimicrob. Agents
Chemother 41(9):2016-2018.
Sadowy E, Sienko A, Gawryszewska J, Bojarska A, Malinowska K,
Hryniewicz W (2013). High abundance and diversity of antimicrobial
resistance determinants
among
early vancomycin-resistant
Enterococcus faecalis in Poland.Eur.J. Clin. Microbiol. Infect. Dis.
32(9):1193-1203.
Schaberg DR, Culver DH, Gaynes RP (1991). Major trends in the
microbial etiology of nosocomial infection. Am. J. Med. 91(3B):72S75S.
Shah L, Mulla S, Patel KG, Rewadiwala S (2012). Prevalence of
enterococci with higher resistance level in a tertiary care hospital: a
matter of concern. Natl. J. Med. Res. 291:25-27.
Sievert DM, Ricks P, Edwards JR, Schneider A, Patel J, Srinivasen A,
Kallen A, Limbago B, Fridkun S (2013). Antimicrobial-resistant
pathogens associated with healthcare-associated infections:
Summary of data reported to the National Healthcare Safety Network
at the Centres for Disease Control and Prevention, 2009-2010, Infect.
824
Afr. J. Microbiol. Res.
Control Hosp. Epidemiol. 34(1):1-14.
Sood S, Malhotra M, Das BK, Kapil A (2008). Enterococcal infection
and antimicrobial resistance. Indian J. Med. Res.128:111-121.
Sreeja S, Babu PRS, Prathab AG (2012). The prevalence and the
characterization of the enterococcus species from various clinical
samples in the tertiary care hospital. J. Clin. Diagn. Res. 6(9):14861488.
Sunilkumar J, Karthika J (2012). Prevalence of Enteroccocus species
from various clinical specimens in Shri Sathya Sai Medical College
and Research Institute with special reference to speciation and their
resistance to vancomycin.Int. J. Med. Clin. Res. 3:154-160.
Talebi M, Eshraghi SS, Pourshafle MR, Pourmand MR, Eshraghian MR
(2007). Characterization of vancomycin resistant Enterococcus
faecium. Iranian. J. Publ. Health 36(4):20-25.
Teixeira LM, Facklan RR (2003). Enterococcus In: Murray PR, Baron
EJ, Jorgensen JH,Pealler MA, Yolken RH (2003). Mannual of clinical
th
microbiology.8 ed. Washington. AMS Press č423-433.
Treitman AN, Yarnold PR, Warren J, Noskin G (2005). Emerging
incidence of Enterococcus faecium among hospital isolates 19932002. J. Clin. Microbiol. 43:462-463.
Tsai HY, Liao CH, Chen YH, Lu PL, Huang CH, Lu CT, Chuang YC,
Tsao SM, Chen YS, Lui YC, Chen WY, Jang TN, Lin HC, Chen CM,
Shi ZY, Pan SC, Yang JL, Kung CE, Liu CE, Cheng YJ, Liu JW, Sun
W, Wang LS, Ko WC, Yu KW, Chiang PC, Lee MH, Lee CM, Hsu GJ,
Hsueh PR (2012). Trends in susceptibility of vancomycin-resistant
Enterococcus faecium to tigecyclin, daptomycin and linezolid and
molecular epidemiology of the isolates: results from the tigecyclin in
vitro surveillance in Taiwan study, 2006 to 2010. Antimicrob. Agents
Chemother. 56(6):3402-3405.
Uttley AH, Collins CH, Naidoo J, George R (1988). Vancomycin
resistant enteroccoci. Lancet.1:57-58.
Werner G, Coque TM, Hammerum AM, Hope R, Hryniewicz W,
Johnson A, Klare I, Kristinsson KG (2008). Emergence and spread of
vancomycin
resistance
among
enterococci
in
Europe.
Eurosurvailance,13:8-18.
Werner G, Gfrorer S, Fleige C, Witte W, Klare I (2008). Tigecyclinresistant Enreococcus faecium strain isolated from a German
intensive care unit patient. J. Antimicrob. Chemother. 61(5):11821183.
Xu X, Lin D, Yan G, Ye X, Wu S, Guo Y, Zhu D, Hu F Zhang Y, Wang M
(2010). VanM, a new glyopeptide resistance gene cluster found in
Enterococcus faecium. Antimicrob. Agents Chemother. 54:46434647.
Yemisen M, Demirel A, Mete B, Kaygusuz A, Mert A, Tabak F, Ozturk R
(2009). Comparative in vitro antimicrobial activity of tigecyclin against
clinical isolates of vancomycin-resistant enterooccus. Indian. J. Med.
Microbiol. 27:373-374.
Vol. 8(8), pp. 825-829, 19 February, 2014
DOI: 10.5897/AJMR2013.6128
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research paper
Prevalence of anti-Anaplasma phagocytophilum
antibodies among dogs from Monterrey, Mexico
J. A. Salinas-Meléndez, R. Villavicencio-Pedraza, B. V. Tamez-Hernández, J. J. HernándezEscareño, R. Avalos-Ramírez, J. J. Zarate-Ramos, F. J. Picón-Rubio and V. M. Riojas-Valdés*
Universidad Autónoma de Nuevo León, UANL. Facultad de Medicina Veterinaria y Zootecnia. Av. Universidad S/N,
Ciudad Universitaria, San Nicolás de los Garza, Nuevo León, CP 66451, México.
Accepted 23 January, 2014
Infection with Anaplasma phagocytophilum is of importance in dogs. It is called canine
anaplasmosmosis and causes persistent clinical signs for long periods of time. Its main vector is a tick
of the genus Ixodes. Diagnosis of anaplasmosis can be achieved either by serological or molecular
methods. Presence of the disease has been reported in the U.S.A., Europe and Asia, but little is known
about its prevalence in Mexico. In the present study, the enzyme-linked immunosorbent assay (ELISA)
diagnostic method was used to determine the prevalence of antibodies against A. phagocytophilum at
the city of Monterrey, Mexico. A total of 391 dogs were tested using a commercial kit. A 3% prevalence
was found that included dogs of the breeds Doberman, French Puddle and Maltese, as well as mixed
breed.
Key words: Anaplasma phagocytophilum, dogs, Mexico.
INTRODUCTION
Anaplasma phagocytophilum produces infection in some
animal species including man. It has been informed that
this disease can cause fever, anorexia, pain, neutropenia,
thrombocytopenia, as well as the formation of cytoplasmatic
inclusion bodies in granulocytic neutrophiles (Rikihisa,
1991; Greig et al., 1996; Engvall et al., 1997; Engvall and
Engvall, 2002). The genus Anaplasma was previously
known as the Ehrlichia phagocytophila group (Dumler et
al., 2001).
Infection with A. phagocytophilum was first reported in
canines at Minnesota and Wisconsin states in 1996 (Greig
et al., 1996). It is a zoonotic disease transmitted by vectors
and apparently its presence in dogs is related to its presence
in humans (Bakken et al., 1994). Confirmed clinical cases
by A. phagocytophilum in humans have been informed in
the U.S.A. (Chen et al., 1994; Demma et al., 2005), as well
as in Europe (Petrovec et al., 1997; Arnež et al., 2001;
Walder et al., 2003).
Studies in dogs have shown seroprevalence ranging from
17 to 50% at European countries (Barutzki et al., 2006;
Liebisch et al., 2006; Jensen et al., 2007; Krupka et al.,
2007; Schaarschmidt-Kiener and Miller, 2007). The clinical
disease in dogs is often associated to the acute infection.
Development of clinical signs during the acute phase can
vary, lasting from one to several days (Engvall et al.
1998). Persistent infection, either clinical or subclinical, in
dogs experimentally inoculated with A. phagocytophilum
has been documented for time lapses of more than six
months (Engvall et al., 2000; Alleman et al., 2006).
This pathogen has been reported in 8 years old dogs or
older, and is more common in certain breeds (Greig et
al,. 1996; Engvall et al., 1997; Beall et al., 2008).
*Corresponding author. E-mail: vriojas@hotmail.com. Tel.: 83294000, Ext. 3610.
826
Afr. J. Microbiol. Res.
Clinical signs more often found in dogs infected with A.
phagocytophilum are articular pain and lameness
resulting from poli-artritis; other less often observed signs
can be gastrointestinal such as vomit and diarrhea, and
some respiratory clinical signs like coughing and disnea.
In some cases the central nervous system can be
affected causing meningitis, leading to neurologic manifestations like ataxia and convulsions. Infection with A.
phagocytophilum is often unapparent, but after eight to
15 days incubation period it can cause fever, generalized
adenopathy, leucopenia, moderate anemia, moderate
hypogammaglobulinemia,
hypoalbuminemia,
hypocalcaemia and specially thrombocytopenia (Engvall
et al. 1998; Engvall et al., 2000; Alleman et al., 2006).
The main vector for A. phagocytophilum in Europe is
Ixodes ricinus (Parola and Raoult, 2001, Strle, 2004). In
the U.S.A. it is associated to Ixodes scapularis and
Ixodes pacificus (Barlough et al., 1997a; Chang et al.,
1998). Other authors indicate that the main vector is I.
scapularis in the east coast and I. pacificus in the west
coast (Parola et al., 2005). There are also reports about
its detection in Ixodes spinipalis and Ixodes dentatus in
the U.S.A. (Zeidner et al., 2000; Goethert and Telfort,
2003).
Studies in the Asian countries mention the presence of
A. phagocytophilum in Ixodes perseculatus and Ixodes
ovatus (Cao et al., 2000; Ohashi et al., 2005). In NorthAmerica it has been observed that certain rodents in
particular and White-tail deer can act as natural hosts of
A. phagocytophilum (Bunnell et al., 1998; Belongia et al.,
1997). Other wild animals detected as positive for the
disease include foxes, wild hogs (Petrovec et al., 2003),
bison, donkey, moose, hare and lynx (Grzeszczuk et al.,
2004, de la Fuente et al., 2005, Jenkins et al., 2001).
Canine anaplasmosis is often diagnosed directly by
microscopic identification of A. phagocytophilum morulae
in circulating neutrophyles an in some cases in synovial
fluid. These findings can be seen at the acute phase of
the disease.
Using serological tests as a diagnostic tool, the early
phases of the disease and the dogs at terminal phase
can show negative results; in the former because there
has not been enough time for the immune response and
in the latter because it is exhausted (Weisiger et al.,
1975; Waner et al., 2001; Cohn, 2003). In the blood
serum antibodies can be detected around 7-28 days after
infection (Ristic et al., 1972; Buhles et al., 1974); at 20
days almost all dogs are seropositive, reaching maximum
values of antibodies titers at 80 days (Buhles et al., 1974;
Maeda et al., 1987). Antibody detection is the most
utilized way to identify the disease, including immunofluoresence and ELISA techniques. However, some
reports exist about false-positive results due to crossreactions with Ricketsias such as Ehrlichia chafensis
(Blanco and Oteo, 2002).
Polymerase chain reaction is a fast and sensitive tool
for A. phagocytophilum detection and identification from
blood and skin samples, as well as from ticks. 16 SrRNA
gen has been used as reference for studies on the
phylogenetic classification of the bacteria (Blanco and
Oteo, 2002).
MATERIALS AND METHODS
Blood samples were obtained from 391 dogs of different breeds in
the city of Monterrey, using as inclusion factor only dogs with fixed
address, age over 6 months. It was decided to sample only one dog
per house in case of having more than one dog. The examination of
the dogs started with physical evaluation followed by blood
sampling. All dogs showed no clinical signs of any disease.
This study was carried out in the city of Monterrey, Nuevo Leon,
located in the northeast of Mexico, with a territorial extension of
451.30 km2. Location coordinates are 25°40´17´´ N, 100° 18´31´´
W. Altitude is 530 m above sea level. The climate of the region has
an average of 21°C, but because of annual thermal oscillation of
18°C, with important contrast among seasons. In summertime
temperatures above 30°C are common with an average in July and
august of 34°C. In winter, cold air arrive constantly to the region,
often accompanied of humidity from the coast, making the
temperature descend drastically, and every year at least 2 to 3 days
are recorded with 0°C or less. The average annual precipitation is
of 600 m spread mainly in summer, with September as the rainiest
month. The city was divided in quadrants in accordance with its
cartographic plan.
From this map, the 15 most urbanized quadrants were chosen,
since the others belonged to not well developed neighborhoods and
little human population. Sampling was performed according the dog
population density and owner cooperation, sampling only one dog
per city block and only one dog in each house. To determine the
sample size, calculations were made in basis of the population’s
representative sample (infinite), with precision level of 5%, confidence level of 95% and a power of statistical test of 80% in order
to ensure reliability of the results and that they could be translated
to the population under study using a 16% prevalence, according to
previous studies in the country. Sample size was determined using
Epidat 3.1. Blood was extracted from the jugular vein with
Vacutainer vacuum tubes and sterile needles, drawing close to 5 m
from each animal. No anesthetic or tranquilizer was used. The
samples were carried in a container with refrigerant material to the
laboratory and kept al 4o C until they were centrifugated at 3000
rpm for 5 min to separate the serum, after which were processed to
determine the presence of antibodies against Anaplasma
phagocytophilum. For the in vitro detection of the mentioned
antibodies in the samples, the commercial kit “canine SNAP*4Dx”
(IDEXX labs, Inc. USA) was used, according to the manufacture’s
instructions. Before starting the procedure samples must be at room
temperature. The sera, either fresh or refrigerated, were utilized
after no more than a week from the sampling. Sensibility and
specificity of the kit for the disease are reported with a minimum of
98.8 and 100%, respectively.
RESULTS
For the present work, 391 blood samples were taken
from dogs located in the city of Monterrey, Mexico;
antibodies against Anaplasma phagocytophilum were
found in 12 samples, resulting in 3% prevalence.
Regarding to sex, dogs’ samples comprised 173 males
Salinas-Meléndez et al.
827
Table 1. Seropositive dogs to Anaplasma phagocytophilum.
Breed
Sex
Place of stay
Parasite treatment
Vaccination
Presence of ticks
Yes
Yes
No
Both
Outside
Kind of floor
2 grass
1 soil
Cement
Cement
Doberman
3 Females
Outside
French Poodle
Maltese
2 Males
2 Females
No
Yes
Yes
Yes
No
No
Mixed-breed
3 Males
2 Females
5 outside
1 inside
4 cement
1 mixed*
5 Yes
1 No
5 Yes
1 No
3 Yes
3 No
*Mixed: cement and soil.
and 218 females of which five males and seven females
were positive, giving a prevalence of 3.4% and 3.2%
respectively (Table 1).
Positive dogs varied in age from 21 to 132 months old.
Only 3 positive dogs presented ticks (2 females and 1
male); however, the questionnaire applied to the dog’s
owners revealed that 11 dogs of the 13 that resulted
positive had ticks within a period of two months before
the sampling. Additionally, only three owners mentioned
the use of anti-tick baths and treatment against internal
parasites in a constant way every 3 months. Only one
among the 13 positive dogs had record of anti-rabies
vaccination (Table 1).
Regarding the place of stay, 12 of the positive dogs
were kept outside of the owner home and only one lived
in the house all the time. Among the positive dogs, 8 lived
on cement floor, 2 on grass, 2 in both and one on soil.
With regard to breed, 6 were mixed-breed, 3 dogs were
Doberman, 2 French Poodle and 2 Maltese (Table 1).
DISCUSION
Anaplasmosis is a disease that must be considered for
differential diagnosis in dogs because due to its diverse
clinical manifestations, it can be confused with other
common diseases of dogs. Currently there are not data on
the prevalence of this disease in the area studied, as well
as in many states of the country. In the present study, a
prevalence of 3% was found, whereas a work done at
Switzerland reported 7.5% prevalence (Pusterla et al.,
1998).
The disease has been reported in the following domesticated species: horse (Bjöersdorff et al., 2002; Engvall et
al., 1996, Engvall and Engvall, 2002), dog (Engvall et al.,
1996; Engvall and Engvall, 2002; Skotarczak, 2003;
Lester et al., 2005, Poitout et al., 2005), cat (Bjöersdorff
et al., 1999), cattle (Engvall et al., 1996), sheep (Steere
et al., 1998) and lama (Barlough et al., 1997b).
At some European countries, prevalence in dogs varying
from 17 to 50% have been found (Barutzki et al., 2006;
Liebisch et al., 2006; Jensen et al., 2007; Krupka et al.,
2007; Schaarschmidt-Kiener and Miller, 2007), which
represents a higher value than the one informed in the
present work.
The clinical disease has often been reported in 8 year
old and older dogs and with some breeds such as
Labrador and Golden Retriever among the most affected;
these findings are in agreement with the results presented in this study, since positive dogs having 11 years
of age were found (Greig et al., 1996; Engvall et al.,
1997; Beall et al., 2008).
Recent studies report higher frequencies of A.
phagocytophilum in dogs, from 14% in Poland
(Ryamasewka et al., 2011) to 46.9% in Germany (Kohn
et al., 2010). However, in other countries the results are
closer that the ones reported in the present work, since
absence of the bacteria was informed at Canada (Bryan
et al., 2011) and Korea (Lim et al., 2010).
Little work on this disease has been realized in Mexico
because of its relatively new presence; therefore, information in our geographical area is scarce. This is not the
case of European countries, where many cases have been
documented and much more knowledge exists about this
disease of dogs.
On the other hand, other members of the same Rickettsia
family such as Ehrlichia canis, which causes monocytic
canine ehrlichiosis, have been documented in the
metropolitan area of Monterrey by serological methods
like ELISA; this study reported a general seropositivity of
44%, which is much higher than the one informed here
for A. phagocytophilum. The results were also in
disagreement according to age, since E. canis was found
more often in four year old dogs, whereas for A.
phagocytophilum was e years old. One possible reason
for these discordances could be that in the present work
only dogs living in the urban area were sampled, whereas
it can be assume that a bigger number of ticks will be
present in the country side, outside the city.
Conclusion
The results observed in the present study allows the
828
Afr. J. Microbiol. Res.
conclusion that A. phagocytophilum is being transmitted
amongst the canine population at Monterrey county
through ticks, although at a frequency lower than the one
informed for other countries or other infectious agents of
the same family. New studies will be necessary to
confirm the presence of the bacteria in the ticks, as well
as to determine its presence in humans.
ACKNOWLEDGEMENT
We will like to thank MHICO de Mexico, S.A. de C.V.,
Monterrey, Nuevo Leon, for support with laboratory
supplies
REFERENCES
Alleman AR, Chandrashekar R, Beall M (2006). Experimental
inoculation of dogs with a human isolate (Ny18) of Anaplasma
phagocytophilum and demonstration of persistent infection following
doxycycline therapy. J. Vet. Int. Med. 20:763.
Arnež M, Petrovec M, Lotric-Furlan S, Avsic Zupanc T, Strle F (2001).
First European Pediatric Case of Human Granulocytic Ehrlichiosis. J.
Clin. Microbiol. 39:4591-4592.
Bakken JS, Dumler JS, Chen SM (1994). Human granulocytic
ehrlichiosis in the upper Midwest United States. A new species
emerging? J.A.M.A. 272:212-218.
Barlough JE, Madigan JE, Kramer VL, Clover JR (1997a). Ehrlichia
phagocytophila genogroup rickettsiae in Ixodid ticks from California
collected in 1995 and 1996. J. Clin. Microbiol. 35:2018-2021.
Barlough JE, Madigan JE, Turoff DR, Clover JR (1997b). An Ehrlichia
strain from a llama (Lama glama) and Llama-associated ticks (Ixodes
pacificus). J. Clin. Microbiol. 35:1005-1007.
Barutzki D, De Nicola A, Zeziola M, Reule M (2006). Seroprävalenz der
Anaplasma phagocytophilum-Infektion bei Hunden in Deutschland.
Berl. Münch. Tierärztl. Wochenschr. 119:342-347.
Beall MJ, Chandrashekar R, Eberts MD, Cyr KE, Diniz PP, Mainville C,
Hegarty BC, Crawford JM, Breitschwerdt EB (2008). Serological and
molecular prevalence of Borrelia burgdorferi, Anaplasma
phagocytophilum, and Ehrlichia species in dogs from Minnesota.
Vector Borne Zoonotic. Dis. 8(4):455-464.
Belongia EA, Reed KD, Mitchell PD, Kolbert CP (1997). Prevalence of
granulocytic Ehrlichia infection among white-tailed deer in Wisconsin.
J Clin Microbiol. 35:1465-1468.
Bjöersdorff A, Bagert B, Massung RF (2002).
Isolation and
characterization of two European strains of Ehrlichia phagocytophila
of equine origin. Clin. Diagn. Lab. Immunol. 9:341-343.
Bjöersdorff A, Svendenius L, Owens JH, Massung RF (1999). Feline
granulocytic ehrlichiosis- a report of a new clinical entity and
characterization of the infectious agent. J. Small. Anim. Pract. 40:2024.
Blanco JR, Oteo JA (2002). Human granulocytic ehrlichiosis in Europe.
Clin. Microbiol. Infect. 8:763-772.
Bryan HM, Darimont CT, Paquet PC, Ellis JA, Goji N, Gouix M, Smiths
JC (2011). Exposure to infectious agents in dogs in remote coastal
British Columbia: Possible sentinels of disease in wildlife and
humans. Can. J. Vet. Res. 75:11-17.
Buhles WC Jr., Huxsoll DL, Ristic M (1974). Tropical canine
pancytopenia: clinical, hematologic, and serologic responses of dogs
to Ehrlichia canis infection, tetracycline therapy, and challenge
inoculation. J. Infect. Dis. 130:357-367.
Bunnell JE, Dumler JS, Childs JE, Glass GE (1998). Retrospective
serosurvey for human granulocytic ehrlichiosis agent in urban whitefooted mice from Maryland. J. Wildl. Dis. 34:179-181.
Cao WC, Zhoa QM, Zhang PH, Dumler JS, Zhang XT, Fang L, Yang H
(2000). Granulocytic Ehrlichiae in Ixodes persulcatus Ticks from an
Area in China Where Lyme Disease is Endemic. J. Clin. Microbiol.
38:4208-4210.
Chang YF, Novosel V, Chang CF, Kim JB (1998). Detection of human
granulocytic ehrlichiosis agent and Borrelia burgdorferi in ticks by
polymerase chain reaction. J. Vet. Diagn. Invest. 10:56-59.
Chen SM, Dumler JS, Bakken JS, Walker DH (1994). Identification of a
granulocytotropic Ehrlichia species as the etiologic agent of humen
disease. J. Clin. Microbiol. 33:589-595.
Cohn LA (2003). Ehrlichiosis and related infections. Vet. Clin. North.
Am. Small Anim. Pract. 33:863-884
De La Fuente J, Torina A, Caracappa S, Tumino G (2005). Serologic
and molecular characterization of Anaplasma species infection in
farm animals and ticks from Sicily. Vet. Parasitol. 5:357-362.
Demma L J, Holman R C, McQuiston J H, Krebs J W, Swerdlow D L
(2005). Epidemiology of human Ehrlichiosis and anaplasmosis in the
United States, 2001- 2002. Am. J. Trop. Med. Hyg. 73:400-409.
Dumler J S, Barbet AF, Bekker CPJ, Dasch GA, Palmer GH, Ray SC,
Rikihisa Y, Rurangirwa FR (2001). Reorganization of genera in the
families Rickettsiaceae and Anaplasmataceae in the order
Rickettsiales: unification of some species of Ehrlichia with
Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia,
descriptions of six new species combinations and designation of
Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia
phagocytophila. Int. J. Syst. Evol. Microbiol. 51:2145-2165.
Engvall A, Bjöersdorff A, Lilliehöök I (1998). Early manifestations of
granulocytic ehrlichiosis in dogs inoculated experimentally with a
Swedish Ehrlichia species isolate. Vet. Rec. 143:412-417.
Engvall A, Lilliehöök I, Bjöersdorff A (2000). Detection of granulocytic
Ehrlichia species DNA by PCR in persistently infected dogs. Vet.
Rec. 146:186-190.
Engvall AE, Hedhammar AA, Bjöersdorff AI (1997). Clinical features
and serology of 14 dogs affected by granulocytic ehrlichiosis in
Sweden. Vet. Rec. 140:222-226.
Engvall EO, Engvall A (2002). Granulocytic ehrlichiosis in Swedish dogs
and horses. Int. J. Med. Microbiol. 291:100-103.
Engvall EO, Pettersson B, Persson M, Artursson K, Johansson KE
(1996). A 16S rRNA-based PCR assay for detection and identification
of granulocytic Ehrlichia species in dogs, horses, and cattle. J. Clin.
Microbiol. 34(9):2170-2174.
Goethert HK and Telford SR (2003). Enzootic transmission of the agent
of human granulocytic ehrlichiosis among cottontail rabbits. Am. J.
Trop. Med. Hyg. 68:633-637.
Greig B, Asanovich KM, Armstrong PJ, Dumler JS (1996). Geographic,
clinical, serologic, and molecular evidence of granulocytic
ehrlichiosis, a likely zoonotic disease, in Minnesota and Wisconsin
dogs. J. Clin. Microbiol. 34:44-48.
Grzeszczuk A, Ziarko S, Prokopowicz D, Radziwon PM (2004).
Evidence of Anaplasma phagocytophilum infection in European
Bisons in the Bialowieza Primeral Forest, Poland. Med. Weter
60:600-601.
Jenkins A, Handeland K, Stuen S, Schouls L (2001). Ehrlichiosis in a
moose calf in Norway. J. Wildl. Dis. 37:201-203.
Jensen J, Simon D, Escobar H, Soller J T, Bullerdieck J, Beelitz P,
Pfister K, Nolte I (2007). Anaplasma phagocytophilum in dogs in
Germany. Zoonoses Public Health 54:94-101.
Kohn B, Silaghi C, Galke D, Arndt G, Pfister I (2010). Infection with A.
phagocytophilum in dogs in Germany. Res. Vet. Sci. 91:71-76.
Krupka I, Pantchev N, Lorentzen L, Weise M, Straubinger RK (2007).
Durch Zecken übertragene bakterielle Infektionen bei Hunden:
Seroprävalenzen von Anaplasma phagocytophilum, Borrelia
burgdorferi sensu lato und Ehrlichia canis in Deutschland. Der
praktische Tierarzt. 88:776-788.
Lester SJ, Breitschwerdt EB, Collis CD, Hegarty BC (2005). Anaplasma
phagocytophilum infection (granulocytic anaplasmosis) in a dog from
Vancouver Island. Can. Vet. J. 46:825-827.
Liebisch G, Thiet W, Liebisch A (2006). Die canine monocytäre (CME)
und die canine granulocytäre Ehrlichiose (CGE), zwei durch Zecken
übertragene Infektionskrankheiten bei Hunden in Deutschland. Der
praktische Tierarzt. 87:342-353.
Salinas-Meléndez et al.
Lim S, Irwin PJ, Lee S, Oh M, Ahn K, Myung B, Shin S (2010).
Comparison of selected canine vector-borne disease between urban
animal shelter and rural hunting dogs in Korea. Parasit. Vectors 3:32.
Maeda K, Markowitz N, Hawley RC, Ristic M, Cox D, McDade JE
(1987). Human infection with Ehrlichia canis a leukocytic rickettsia. N.
Engl. J. Med. 316:853-856.
Ohashi N, Inayoshi M, Kitamura K, Kawamori F, Kawaguchi D,
Nishimura Y, Naitou H, Hiroi M, Masuzawa T (2005). Anaplasma
phagocytophilum-infected ticks, Japan. Emerg. Inf. Dis. 11:1780-1783.
Parola P, Davoust B, Raoult D (2005). Tick- and flea-borne rickettsial
emerging zoonoses. Vet. Res. 36:469-492.
Parola P, Raoult D (2001). Tick-borne bacterial diseases emerging in
Europe. Clin. Microbiol. Infect. 7: 80-83.
Petrovec M, Lotric-Furlan S, Avsic-Zupank T, Strle F, Brouqui P, Roux
V, Dumler S (1997). Human Disease in Europe caused by a
Granulocytic Ehrlichia Species. J. Clin. Microbiol. 35:1556-1559.
Petrovec M, Sixl W, Schweiger R, Mikulasek S (2003). Infections of
wild animals with Anaplasma phagocytophila in Austria and the
Czech Republic. Ann. N. Y. Acad. Sci. 990:103-106.
Poitout FM, Shinozaki JK, Stockwell PJ, Holland CJ (2005). Genetic
variants of Anaplasma phagocytophilum infecting dogs in Western
Washington State. J. Clin. Microbiol. 43:796-801.
Pusterla N, Berger J, Pusterla, Deplazes P, Wolfensberger C, Müller W,
Hörauf A, Reusch C, and Lutz H (1998). Seroprevalence of Ehrlichia
canis and of canine granulocytic Ehrlichia infection in dogs in
Switzerland. J. Clin. Microbiol. 36:3460 3462.
Rikihisa Y (1991). The tribe Ehrlichieae and ehrlichial diseases. Clin.
Microbiol. Rev. 4:286-308.
Ristic M, Huxsoll DL, Weedier RM, Hildebrandt PK, Nyindo, MB (1972).
Serological diagnosis of tropical canine pancytopenia by indirect
immunofluorescence. Infect. Immun. 6:226-231.
Ryamasewka A, Adamska M (2011). Molecular evidence of vectorborne pathogens coinfecting dogs from Poland. Acta Vet. Hung. 59:
215-229.
Schaarschmidt-Kiener D, Miller W (2007). Labordiagnostische und
klinische Aspekteder kaninen Anaplasmose. Tierärztl. Prax. 35:129136.
Skotarczak B (2003). Canine ehrlichiosis. Ann. Agric. Environ. Med.
100:137-141.
829
Steere AC, Sikand VK, Meurice F, Parenti DL, Fikrig E, Schoen RT,
Nowakowski J, Schmid CH, Laukamp S, Buscarino C, Krause DS
(1998). Vaccination against Lyme disease with recombinant Borrelia
burgdorferi outer-surface lipoprotein A with adjuvant. New Engl. J.
Med. 339: 209-215
Strle F (2004). Human granulocytic ehrlichiosis in Europe. Int. J. Med.
Microbiol. 293 (Suppl. 37):27-35.
Walder G, Tiwald G, Dierich M P, Würzner R (2003). Serological
Evidence for Human Granulocytic Ehrlichiosis in Western Austria.
Eur. J. Clin. Microbiol. Infect. Dis. 22:543-547.
Waner T, Harrus S, Jongejan F, Bark H, Keysary A, Cornelissen AW
(2001). Significance of serological testing for ehrlichial diseases in
dogs with special emphasis on the diagnosis of canine monocytic
ehrlichiosis caused by Ehrlichia canis. Vet. Parasitol. 95:1-15.
Weisiger RM, Ristic M, Huxsoll DL (1975). Kinetics of antibody
response to Ehrlichia canis assayed by indirect fluorescent antibody
method. Am. J. Vet. Res. 36:689-694.
Zeidner NS, Burkot TR, Massung R, Nicholson WL, Dolan MC,
Rutherford JS, Biggerstaff BJ, Maupin GO (2000). Transmission of
the agent of human granulocytic ehrlichiosis by Ixodes spinipalpis
ticks: evidence of an enzootic cycle of dual infection with Borrelia
burgdorferi in Northern Colorado. J. Infect. Dis. 182:616-619.
Vol. 8(8), pp. 830-838, 19 February, 2014
DOI: 10.5897/AJMR2013.6537
ISSN 1996-0808 ©2014 Academic Journals
http://www.academicjournals.org/AJMR
African Journal of Microbiology Research
Full Length Research Paper
Novel simple diagnostic methods compared to
advanced ones for the diganosis of Chlamydia
trachomatis, Ureaplasma urealyticum and
Mycoplasmas hominis in patients with complicated
urinary tract infections
Hala Badawi1*, Aisha Abu Aitta1, Maisa Omar1, Ahmed Ismail2, Hanem Mohamed3, Manal El
Said1, Doaa Gamal1, Samah Saad El Dine1 and Mohamed Ali Saber3
1
Microbiology Department, Theodor Bilharz Research Institute, Giza, Egypt.
Urosurgery Department, Theodor Bilharz Research Institute, Giza, Egypt.
3
Biochemistry Department, Theodor Bilharz Research Institute, Giza, Egypt.
2
Accepted 23 January, 2014
Chlamydia trachomatis is responsible for the most common sexually transmitted bacterial infection
worldwide. Infections with Ureaplasma urealyticum and genital Mycoplasma hominis have been
recognized for about a decade as common sexually transmitted infections (STIs) in developed
countries. The aim of this study was to assess the diagnostic value of novel simple diagnostic kits used
in the detection of C. trachomatis, U. urealyticum and M. hominis in urine of patients with complicated
urinary tract infections (UTIs) and to compare these simple methods to molecular and cultural ones as
gold standards. This study was conducted on two male patient’s groups; group I: 30 patients with
compilcated UTIs and Group II: 50 patients with non complicated UTIs. Twenty (20) healthy male control
subjects (Group III) were also included. The patients were chosen from those admitted to the urosurgery
department or attending the urosurgery outpatient clinic in Theodor Bilharz Research Institute (TBRI).
First voided urine (FVU) samples and mid-stream urine (MSU) were collected from patients and controls.
FVU samples were investigated for C. trachomatis plasmid DNA using polymerase chain reaction (PCR)
and for C. trachomatis antigen using Chlamyfast OIA test. MSU samples were used for inoculating of
conventional culture media and three culture kits; Mycoplasma DUO, Mycoplasma IST and Mycokit
NUM. Blood samples were investigated for the presence of C. trachomatis IgG antibodies using enzymelinked immunosorbent assay (ELISA) and ImmunoComb Chlamydia Kit and for mycoplasmal antibodies
using mycokit sero. C. trachomatis infection was found in 35% (28/80) of patients in both groups, 56.7%
(17/30) was detected in group I and 22% (11/50) in group II compared to none of the controls. C. trachomatis
infection was significantly higher in group I versus group II (P˂0.05). Chlamyfast OIA test was less sensitive
but more specific than serological assays. ImmunoComb assay had a higher sensitivity but lower specificity
than ELISA. A total of 34 cases (42.5%) were positive in a pathogenic level for U. urealyticum and or M.
hominis and 30% were positive for U. urealyticum only, 7.5% were positive for M. hominis only and 5% had
mixed infection with both organisms. Mycoplasmas infection in group I was found to be significantly higher
than in group II (P˂0.05). Mycoplasma IST has the highest sensitivity (100%) andin identification of U.
urealyticum while both mycoplasma ISTand mycoplasma DUO showed the highest sensitivity in identification of M.hominis. Serological evidence was detected in 16/24 (66.7%), 2/6 (33.3%) and 4/4 (100%) of
U. urealyticum, M. hominis and mixed infections respectively. The serological response to each infection is
significantly higher in group I than in group II (P value ˂0.05). Our study detects a high prevalence rate of C.
trachomatis, M. hominis and U. urealyticum in cases with complicated UTI. Commercially available kits
are simple and sensitive methods to use in laboratories which do not routinely test for these pathogens.
Key words: Chlamydia trachomatis, urinary tract infections (UTIs), non gonorrheal urethritis (NGU).
Badawi et al.
831
INTRODUCTION
Urinary tract infections (UTI) are frequent type of
infectious pathology treated in primary care clinics. The
participation of microorganisms associated with sexually
transmitted infection has been reported recently as
possible cause of UTI (González-Pedraza et al., 2003).
According to a World Health Organization (WHO, 2001)
report, Chlamydia trachomatis is responsible for the most
common sexually transmitted bacterial infection worldwide, affecting more than 90 million people and has been
known to have a significant effect on human reproduction
(Paavonen and Eggert-Kruse, 1999; Al-Sweih et al.,
2012). The prevalence of C. trachomatis in woman under
25 years of age is very high (up to 30%) hence, young
sexually active women are the most at risk (Mangin et al.,
2012). C. trachomatis is one of the causes of acute and
chronic urinary tract infections and acute or silent
salphingitis (Wanic-Kossowska et al., 2001) that if not
treated in an early stage can lead to severe complications, such as pelvic inflammatory disease (PID),
ectopic pregnancy and tubal infertility (Marrazo and
Stamm, 1998; Gaydos et al., 2004).
Most C. trachomatis genital tract infections in men and
women are asymptomatic, so the opportunity for
unchecked transmission is high even in countries with
advanced public health care systems (Dean et al., 2012;
Vicetti Miguel et al., 2013). Dysuria and increased
urinary frequency associated with presumed urinary tract
infection are extremely common reasons for seeking
treatment in primary care. About 10% of women suffer
from symptoms of a urinary tract infection in any year,
and seeking treatment provides a potential opportunity to
detect both symptomatic and asymptomatic infection with
C. trachomatis (Mangin et al., 2012).
C. trachomatis infection is easily treatable with
antibiotics, so detection and treatment of infected individuals is a key element of Chlamydia control programs
(Gaydos et al., 2004; Van der Helm et al., 2013).
Although there are a variety of methods for testing for C.
trachomatis, no single test is ideal (Mangin et al., 2012).
Culture, nucleic acid hybridization tests, and nucleic acid
amplification tests (NAATs) are available for the detection
of C. trachomatis. Culture and hybridization tests require
urethral swab specimens, whereas NAATs can be
performed on urine specimens. The sensitivity and
specificity of the NAATs are clearly the highest of any of
the test platforms for the diagnosis of chlamydial
infections (Lee and Lee, 2013).
Infections with Ureaplasma urealyticum and genital
mycoplasmas (M. hominis and M. genitalium) have been
recognized for about a decade as a common STD in
developed countries (Yoshida et al., 2002). Genital ureaplasmas and mycoplasmas are natural inhabitants of the
male urethra, contaminating the semen during ejaculation. However, U. urealyticum, are implicated in invasive
*Corresponding author. E-mail: Halabadawi2@yahoo.com.
diseases such as urethritis, postpartum endometritis,
chorioamnionitis, spontaneous abortion and premature
birth, as well as low birth weight, pneumonia, bacteremia,
meningitis and chronic lung disease in prematurely born
infants (Dhawan et al., 2012; Al-Sweih et al., 2012).
Mycoplasma hominis is also associated with bacterial
vaginosis, pelvic inflammatory disease, arthritis and even
neonatal meningitis (Hopfe et al., 2013).
The aim of this study was to asses diagnostic value of
novel simple diagnostic kits used in the detection of C.
trachomatis, U. urealyticum and M. hominis in urine of
patients with complicated urinary tract infections (UTIs)
and to compare these simple methods to molecular and
cultural ones as gold standards.
MATERIALS AND METHODS
Patients
This study was conducted on 80 patients that were divided into two
patient’s groups; group I: 30 male patients with clinically diagnosed
complicated UTIs complained of recurrent UTI that resist treatment
with conventional antibiotics (cystitis, prostatitis, epididymititis,
cancer bladder, urethral stricture,stone fomation, hydronephrosis
and urinary bilharziais), their Group II: 50 male patients with non
complicated UTIs. Twenty male healthy control subjects (Group III)
were also included. The patients were chosen from those admitted
to urosurgery department or attending the urosurgery outpatient
clinic in TBRI. The controls were selected from those admitted,
during the same period, for Surgery Department with normal urine
analysis. The patients diagnosis was based on complete history
taking including increased frequency of micturation, dysuria,
haematuria, uretheral discharge, antischistosomal treatment,
instrumentation or any previous pelvic troubles. Complete clinical
assessment, radiological investigation, cystoscopy and histopathological examination, urine analysis and culture were also
performed. The patients or controls did not receive antibiotics two
weeks before the study.
Sample collection
Early morning first voided urine (FVU) samples and mid-stream
urine (MSU) were collected from patients and controls. FVU
samples were stored at -70°C untill investigated for C. trachomatis
antigen using enzyme immunoassay (EIA) and C. trachomatis
plasmid DNA using PCR. MSU samples were centrifuged and the
pellets were then used for inoculating of three culture kits;
Mycoplasma DUO, Mycoplasma IST and Mycokit NUM and
conventional culture media. Blood samples were collected and sera
were stored at -70°C to be investigated for the presence of C.
trachomatis antibodies and mycoplasmal antibodies using ELISA
and ImmunoComb Chlamydia Kit and Mycokit Sero respectively.
Detection of Chlamydia trachomatis
PCR analysis of C. trachomatis plasmid DNA in urine specimens
Eight (8) ml of FVU samples were mixed thoroughly and centrifuged
832
Afr. J. Microbiol. Res.
at 3000 rpm for 30 min at room temperature. The precipitate was
transferred to 1.5 ml microcentrifuge tube and centrifuged at 14000
rpm for 30 min. The pellets were stored at -20°C until DNA
extraction. DNA extraction was performed using QIA amp Viral RNA
Mini kit (Qiagen GmbH, Germany) because the AVL buffer used in
this kit, inactivates the numerous unidentified PCR inhibitors found
in urine. The extraction was done following the QIA amp using spincolumn protocol with slight modification as follows: The urine pelet
was dissolved in 1ml PBS. 250 μl of urine solution were added to
560 μl of the buffer AVL/carrier RNA followed by vortexing and
incubation for 15 min at room temperature. 750 μl of absolute
ethanol were then added and mixed by pulse-vortex for 20 s. The
mixture was then applied to the QIA amp spin column and
centrifuged at 8000 rpm for 2 min followed by washing with buffer
AW1 then AW2. DNA adsorbed onto the QIA amp silica gel
membrane was eluted by adding 60 μl buffer AVE followed by
incubation for 5 min and centrifugation for 5 min at 8000 rpm. The
elution step was repeated to increase the yield of DNA. The eluted
solution was stored in aliquots at -20oC untill performance of
amplification. PCR amplification: performed with PCR kit (DiaSorin,
Italy-UAS). Primers set used : It delineated PCR amplification
product of 207 bp within the cryptic plasmid of C. trachomatis : PC24
: 5`GGG ATT CTT GTA ACA ACA AGT CAGG 3` and PC 27 :
5`CCT CTT CCC CAG AAC AAT AAG AAC AC 3`. The 207 bp
product obtained with primers PC24 and PC27.
Reaction mixture: The reaction volume was 100 μl containing 1 ×
PCR buffer, 2.5 mM MgCl2, 0.2 mM each deoxynucleoside
triphosphate, 2.5U Taq DNA polymerase (Promega, Madison WI,
USA), 50 P mole of each primer. Ten microliters of extracted DNA
were added to 100 μl of the PCR mixture in the reaction tube.
Enzymatic amplification was performed using a programmable
thermal cycler 480 version (Perkin Elmer Ceteus, Norwalk, Conn).
Amplification started with an initial denaturation step at 94°C for 5
min followed by 35 cycles. Each cycle consisted of denaturation at
94°C for 1 min, annealing at 60°C for 1 min and primer extension at
72°C for 1 min. The reaction was stopped by cooling at 4°C.
Detection of amplification product: Fifteen microliters of the PCR
product were electrophoresed through 2% agarose gel containing
ethidium promide (0.5 mg/ml) at constant current 100 volt for 45
min. Bands were observed under UVR light and photographed.
Optical immunoassay (Chlamyfast OIA, International Microbio,
France) in urine
Optical immunoassay is a two-step procedure involving antigen
extraction and detection. The test surface is a silicon water
reflecting white light into a predominant gold color. The sample was
placed on the test surface. If it contains the antigen, binding would
occur between the antigen and the water surface and it was then
recognized by the anti-LPS conjugate. After washing to remove
unbound components, an optical enhancer was applied to the test
surface. Its precipitation leads to an increased thickness in the
molecular thin film with subsequent change in the color of the
reflected light from gold to blue/purple. If chlamydial antigen was
not present in the sample, there would be no change in color.
EIA ImmunoComb Chlamydia Kit for
determination of Chlamydia IgG in serum
semi-quantitative
The ImmunoComb Chlamydia Bivalent IgG Kit (ImmunoComb,
PBS, Orgenics, France) is an EIA test intended for the semiquantitative of IgG antibodies to C trachomatis in serum.
ImmunoComb consist of a solid-phase EIA. The solid phase is a
comb with 12 projections. Each tooth is sensitized at two positions;
upper spot: goat antibodies to human immunoglobulin (Internal
Control), lower spot: inactivated antigens of C. trachomatis. The
developing plate has 6 rows (A-F) of 12 wells, each row containing
a reagent solution ready for use at a different step in the assay. The
test was performed stepwise, by moving the comb from row to row,
with incubation at each step. Serum specimens were added to the
diluent in the wells of row A of developing plate. The comb was
then inserted in the wells of row A. Anti-C. trachomatis antibodies, if
present in the specimens, will specifically bind to the respective
chlamydial antigens on the lower spot of each tooth of the comb.
Simultaneously, immunoglobulins present in the specimens would
be captured by the anti-human immunoglobulin on the upper spot
(Internal Control). Unbound components would be washed away in
row B. In row C, the human IgG captured on the teeth will react with
alkaline phosphatase-labeled anti-human IgG. In the next two rows,
unbound components were removed by washing. In row F, the
bound alkaline phosphatase will react with chromogenic
components. The results were visible as gray-blue spots on the
surface of the teeth of the comb. A positive control (anti- C.
trachomatis IgG) and a negative control were included in each
assay run. Upon completion of the test, the tooth used with the
positive control should show 2 gray-blue spots. The tooth used with
the negative control should show the upper spot and either no other
spot or a faint lower spot. The upper spot should also appear on all
other teeth, to confirm the addition of the specimen, proper
functioning of the kit and correct performance of the test.
Detection of mycoplasmas
Conventional Culture for Mycoplasmas
Urine sediment was cultured for M.hominis by direct plating on
enriched heart infusion (HN) mycoplasma agar and indirect
inoculation of HN mycoplasma broth, which were then incubated at
37°C in a candle Jar. It was also cultured for U. urealyticum on U9
broth and A7 agar (Int-mycolpasma-France) and incubated
anaerobically according to El-Mishad et al. (1992). The plates were
then examined under a dissecting microscope for up to 10 days.
The results have been determined in terms of identification and
quantification of U. urealyticum and M. hominis. For quantification;
two different levels have been determined for both U. urealyticum
and M. hominis: a non-pathogenic level which was determined as
<104 colour changing units (CCUs)/ml and a pathogenic level which
was determined as ≥104 CCU/ml.
Detection and Antibiotic Susceptibility Testing of Urogenital
Mycoplasmas
The centrifuged pellets were resuspended in sterile saline and then
processed with the following 3 kits:
Enzyme-linked immunosorbent
Chlamydia IgG in serum
assay
for
detection
of
Enzyme-linked immunosorbent assay (ELISA) (DRG Diagnostics,
Germany) was performed and interpreted according to manufacturer’s instractions. IgG titer greater than 1:512 was a criterion for
serodiagnosis of acute or current infection.
Mycoplasma DUO (Sanofi, Diagnostics Pasteur, France): The
kit composed of microplates, each of 6 wells containing substrates
and growth factors for mycoplasma to ensure optimal sensitivity,
besides inhibitors for polymorphic flora to ensure optimal selectivity.
It was designed for identification and enumeration of mycoplasmas.
Identification was based on specific metabolic properties; hydrolysis
Badawi et al.
of urea by U. urealyticum or arginine by M.hominis which was
indicated, after 24 or 48 h of incubation, by a change in colour of
the well containing the relevant substrate without clouding of the
medium. Titration was based on applying successive dilutions of
the specimens to the lower three wells. The titer was expressed as
the number of CCUs/ml specimen. The technique allowed titration
around the level of 103 and 104/ml which were the accepted
pathogenicity levels
Mycoplasma IST (bioMerieux, France): The principle and
components were similar to those of DUO with the addition of
eleven more wells for determining the susceptibility of the strain to
six antibiotics including doxycycline, josamycine, ofloxacine,
erythromycine, tetracycline and pristinamycin.
Mycokit-NUM (PBS-Orgenics, france): Serial tenfold dilutions
were made from the urine and inoculated into the transport
medium; urea broth (U9) for U. urealyticum in the first column and
into arginine broth (M42) for M. hominis in the second column; in
presence of appropriate PH indicator. After 48 h incubation, the titer
was estimated in CCU/ml as the reciprocal of the highest dilution
revealing a colour change.
Serological assessment for mycoplasmas (Mycokit-SERO,
PBS-Orgenics, France)
For detection of mycoplasmal antibodies; anti-U.urealyticum and
anti-M.hominis; in sera. The principle and components of the kit
were similar to those of Mycokit-NUM, except that lyophlized
U.urealyticum and M.hominis were added to U9 and M42 columns
respectively. After incubation for 48 h at 37°C, growth of
mycoplasma induced a pH change of the medium, turning its colour
from yellow to blue. If serum contained specific antibodies,
inhibition of multiplication of mycoplasma would occur preventing
the colour change (metabolic inhibition test). The antibody titer was
the least dilution showing no colour change (remained yellow).
Statistical analysis
The statistical analysis was performed using SPSS version 10.0
statistical software (SPSS Inc, Chicago, IL). Data were presented
as mean ± SD and range or as an absolute number and
percentage. Sensitivity, specificity and predective values were
calculated. Chi-square tests were used for the analysis of the
categorical variables and Quantitative data with uneven distribution
were analyzed with the Mann-Whitney U test. P < 0.05 was
considered statistically significant.
RESULTS
Two groups of patients were included in the present
study; Group (I): consists of 30 male patients with clinical
diagnosis of complicated UTIs. Their ages were ranged
from 29 to 54 years with a mean of 30 ± 9.8 years
(average ± SD) (Table 1). Group (II): consists of 50
patients with simple non complicated UTIs. Their ages
were ranged from 32 to 59 years with a mean of 32 ± 8.7
years (average ± SD). Using amplified PCR assay, C.
trachomatis infection was found in 35% (28/80) of
patients in both groups, 56.7% (17/30) was detected in
group I and 22% (11/50) in group II compared to none of
833
Table 1. Distribution of 30 patients Group I among different
complicated clinical condition.
Complicated
Clinical Status*
Cystitis
Prostatitis
Epididymitis
Cancer bladder
Urethra stricture
Stone formation
Hydronephrosis
Urinary
Bilharzial
No.
%
8
15
13
9
6
11
4
27
50
43
30
20
37
13
16
53
*One patient may have more than one clinical status
the controls. Serological evidence was detected in 76%
(13/17) and in 27% (3/11) of positive cases of group I and
group II respectively. C. trachomatis infection was
significantly higher in group I versus group II (P˂0.05).
Table 2 shows the diagnostic performance of different
tests used for the detection of C. trachomatis infection
among all studied patients using PCR assay (Figure 1) as
reference standard. It was noticed that Chlamyfast OIA
test which detects chlamydial antigen in urine specimens
was less sensitive but more specific than serological
assays that detect IgG antibodies in serum.
ImmunoComb assay had a higher sensitivity but lower
specificity than ELISA.
In this study, out of 80 urine specimens of infected
groups, a total of 34 cases (42.5%) were positive in a
pathogenic level for U. urealyticum and or M. hominis
by at least one of the diagnostic procedures used. It was
found that 30% were positive for U. urealyticum only and
7.5% were positive for M. hominis only and 5 % had
mixed infection with both organisms. In the control group,
U. urealyticum and M. hominis were isolated from 5 and
2.5% of normal subjects respectively in a non-pathogenic
level. The distribution of different types of mycoplasma
among the studied groups are shown in Table 3.
Mycoplasmas infection in group I was found to be
significantly higher than in group II (P˂0.05).
The diagnostic value of different identification procedures for U. urealyticum and M. hominis among studied
groups were shown in Table 4. It was observed that
Mycoplasma IST has the highest sensitivity (100%) and
absolute negative predictive value (NPV) in identification
of U. urealyticum while both Mycoplasma ISTand
Mycoplasma DUO showed the highest sensitivity and
absolute NPV in identification of M. hominis.
The serologic reactivity to U. urealyticum and M.
hominis infection among positive cases was illustrated in
Table 5. Serological evedince was detected in 16/24
(66.7%), 2/6 (33.3%) and 4/4 (100%) of U. urealyticum,
M. hominis and mixed infections respectively.
Serologic reactivity to C. trachomatis, U. urealyticum,
834
Afr. J. Microbiol. Res.
Table 2. Diagnostic performance of recent tests used for detection of C. trachomatis among all studied patients
with UTI.
C. trachomatis PCR
On urine sediment
Pos. (No=28)
Neg. (No=52)
Test result
Sensitivity
Specificity
PNV*
NPV**
Chlamyfast OIA
Pos
Neg
17
11
9
43
61
83
65
80
ELISA IgG
Pos
Neg
16
12
11
41
57
79
59.5
77.4
ImmunoComb IgG
Pos
Neg
26
2
14
38
93
67
61
95
*NPV: Negative predictive value. **Positive predictive value.
Figure 1. PCR Results for FVU specimens from male patients with recurrent
urogenital infections. The 207 bp product obtained with primers PC 24 and PC27.
Lane 1: molecular weight marker, Lanes 2-5: amplification products of four
Chlamydia trachomatis positive specimens, Lane 6: a positive control and Lane
7: negative control.
M. hominis among studied groups are shown in Table 6.
It was noted that the serological respond to each infection
is significantly higher in group I than in group II (P value
˂0.05).
DISCUSSION
Chlamydia trachomatis is one of the most common
sexually transmitted pathogens of humans. According to
the Centers for Disease Control (CDC), C.
trachomatis infection is among the most prevalent of all
STDs, and since 1994, has comprised the largest
proportion of all STDs reported to CDC (CDC, 2010).
Since most of infected men and women are
asymptomatic, this high number of unrecognized infected
individuals may provide the reservoir for spreading the
infection to other men and women via sexual intercourse
Badawi et al.
835
Table 3. Distribution of different types of mycoplasmas among disease groups.
Group isolates
Group I (No=30)
Group II (No=50)
Total
(No=80)
M. hominis
No.
%
4
13.3
2
4
6
7.5
U. urealyticum
No.
%
18
60
6
12
24
30
Mixed
No.
%
2
6.7
2
4
4
5
Total
No.
24*
10
34
%
80
20
42.5
*P value ˂0.05 versus group II.
Table 4. Diagnostic value of different identification for U. urealyticum and M. hominis in disease groups.
Culture system
Sensitivity (%)
Diagnostic performance
Specificity (%)
PPV (%)
NPV (%)
Mycoplasma IST
U. urealyticum
M. hominis
100
100
89.7
98.6
78.6
90
100
100
Mycoplasma DUO
U. urealyticum
M. hominis
90.9
100
89.7
97.2
76.9
80
96.3
100
Mycokit - NUM
U. urealyticum
M. hominis
80
70
90
100
72.7
100
93.1
95.9
Table 5. Serologic Reactivity to U.urealyticum and M.hominis among positive cases using
Mycokit-NUM.
Positive case
U. urealyticum (No. = 24)
M. hominis
(No = 6)
Mixed infection (No.= 4)
Total (No. =34)
Positive
No.
16
2
4
22
(Nassar, 2007).
Reported rates of chlamydial infection have increased
dramatically over the past decade, reflecting expansion of
chlamydial screening activities, highly sensitive nucleic
acid amplification tests and improvements in information
systems used for reporting rather than a true increase in
disease burden (Workowski and Berman 2007 ; Geisler,
2010). However, screening and treatment are focused on
females, with the burden of this infection and infertility
sequelae considered to be a predominantly female
problem, although the prevalence of chlamydial infection
is similar in males and females (Cunningham and
Beagley 2008; Fernández-Benítez et al., 2013). Prevalence of C. trachomatis varies according to geographic
area, age and status of patients (Ghazvini et al., 2012;
Fernández-Benítez et al., 2013). In developing countries,
infections caused by Chlamydia and Mycoplasma have
Negative
%
66.7
33.3
100
64.7
No.
8
4
0
12
%
33.3
66.7
0
35.3
not been adequately studied and the prevalence of C.
trachomatis, genital ureaplasmas and genital mycoplasmas has not been determined so infections by these
pathogens may be higher than those reported (Gdoura et
al., 2008; Ghanaat et al., 2008).
In our study C. trachomatis infection was found in 35%
(28/80) of patients in both groups, 56.7% (17/30) was
detected in group I and 22% (11/50) in group II compared
to none of the controls. These results were similar to a
study done by Vasic et al. (2004) who reported that
Chlamydia infection has been determined in 35.55%
(128/360) of male patients with urethritis symptoms. Our
results was comparable to a previous study in Egypt by
El Sayed et al. (2006) where C. trachomatis was detected
in 25 out of 50 (50%) of examined urine samples. In a
Japanese study, 47.7% (73/153) of FVU specimens in
men with urethritis were positive for C. trachomatis
836
Afr. J. Microbiol. Res.
Table 6. Serologic reactivity to C. trachomatis, U. urealyticum, M. hominis among studied groups.
Test result
Group I (No. = 30)
No.
%
Group II (No. = 50)
No.
%
Total (No. = 80)
No.
%
C. trachomatis
Positive
Negative
18
12
60
40
9
41
18
82
27
53
33.8
66.2
U. urealyticum
Positive
Negative
17
13
56.7
43.3
3
47
6
94
20
60
25
75
M. hominis
Positive
Negative
4
26
13.3
86.7
2
48
4
96
6
74
7.5
92.5
(Maeda et al., 2004). Wiggins et al. (2006) reported that
up to 30% of urethritis cases were due to a C.
trachomatis infection, compared to only 4% in healthy
control subjects.
C. trachomatis is a frequent pathogen associated with
upper and lower urinary tract infections (El-Sayed et al.,
2006). Chlamydial infection in the male urethra can be
complicated by urethritis, epididymitis and prostatitis
(Gdoura et al., 2008), Although the role of Chlamydia in
the development of prostatitis is controversial, it is highly
suggested that Chlamydia is considered to be an etiological agent, with incidences of up to 39.5% reported in
patients with prostatitis (Cunningham and Beagley,
2008). This may explain the higher prevalence of C.
trachomatis in the group of complicated UTI, as 50% of
our patients suffer from prostatitis, 43% suffer from
epididymitis and 30% had urethral stricture.
In this study, the diagnostic performance of different
tests used for the detection of C. trachomatis infection
among all studied patients was compared using PCR as
a reference standard. Chlamyfast OIA test which detects
chlamydial antigen in urine specimens was less sensitive
but more specific than ImmunoComb assay that detect
IgG antibodies in serum. ImmunoComb IgG had a higher
sensitivity but lower specificity than ELISA IgG. Vasic et
al. (2004) reported that Chlamyfast OIA test detected
significant percentage of the Chlamydia infections in
patients, which emphasizes the diagnostic importance in
diagnosing STIs. Chernesky et al. (1998) concluded that
supplemental to the C. trachomatis antigen detection, the
easily performed ImmunoComb IgG is of great value in
routine diagnosis of genital chlamydial infections. However, Bakardzhie et al (2011) noted a lack of specificity of
the ImmunoComb IgG compared to PCR. In an Egyptian
study performed by El-Sayed et al. (2006), ELISA IgG
showed high level of specificity (100%) and low level of
sensitivity (40%) when compared to the cell culture
method. As sensitivity of the ELISA test is low, this can
assist but cannot replace direct antigen detection or
isolation of the organism by the culture technique (Kamel,
2013).
Mycoplasma pathogens have been discovered in the
urogenital tract of patients suffering from PID, urethritis
and other urinary tract diseases (Goulet et al., 1995). M.
hominis is frequently recovered from the genitourinary
tract. In addition, M. hominis causing bacterial vaginosis
in women, has been proposed as one cause of NGU in
men (Workowski and Berman, 2007).
In our study pathogenic level for U. urealyticum and or
M. hominis was found in 42.5% of our patients; 30% were
positive for U. urealyticum only and 7.5% were positive
for M. hominis only and 5 % had mixed infection with both
organisms. U. urealyticum and M. hominis were isolated
in a non-pathogenic level from 5% and 2.5% of normal
subjects respectively. Our results were comparable to
those in a previous study from Turkey in which U.
urealyticum was found in 48% of patients (24/50) with
non-gonococcal urethritis. Thirteen (13) of these patients
had only U. urealyticum, and the rest had mixed
pathogenic organisms; 14% (7/50) U. urealyticum with M.
hominis; 6% (3/50) U. urealyticum with C. trachomatis
and 2% (1/50) U. urealyticum with M. hominis and C.
trachomatis (Kılıç et al., 2004). Also Takahashi et al.
(2006) in Japan detected Mycoplasma and Ureaplasma
in FVU of young men at comparable rates of 4% for M.
hominis and 12% for U. urealyticum. Whereas in Tunisia
genital M. huminis and genital ureaplasmas affected a
large number of infertile male patients, reaching 10.6%
and 15.4% respectively (Gdoura et al., 2008).
Mycoplasma IST and Mycoplasma DUO showed high
sensitivity compared to culture as gold standard method
of detection. This finding was similar to previous studies
which found no difference between Mycoplasma IST and
culture regarding isolation of Mycoplasma (Kılıç et al.,
2004) and considered Mycoplasma Duo assay as a
simple and a sensitive method comparable to culture and
Badawi et al.
PCR for the detection of Ureaplasma spp. (Cheah et al.,
2005; Ekiel et al., 2009). Biernat-Sudolska et al. (2013)
reported that the sensitivity and specificity of the
Mycoplasma IST test when compared to the culture
method as a “gold standard” were determined as 91 and
96%, respectively, while the positive and negative
predictive value of the commercial test was 27 and 99%,
respectively for detection of M. hominis in clinical
samples. Clegg et al. (1997) demonstrated sensitivity of
93% and specificity of 87% of Mycoplasma IST kit
compared to the culture of M. hominis. These findings
make the current tests suitable for use in diagnostic
laboratories that do not currently test for Ureaplasma spp.
or Mycoplasma.
It is interesting that 53% of our patients were suffering
from urinary bilharziasis. This coexistence between
urogenital schistosomiasis and sexually transmitted
infection
including
Chlamydia
trachomatis
and
Mycoplasma genitalium has been previously reported in
the area of Madagascar, where Schistosoma
haematobium is endemic. Authors in that study suggested that similar situation can be anticipated in most
other schistosoma-endemic areas in sub-Saharan Africa
presenting the two disease entities as a diagnostic
challenge for the local health care providers in these
areas (Leutscher et al., 2008).
Conclusion
Our study detects a high prevalence rate of C.
trachomatis, M. hominis and U. urealyticum in cases with
complicated UTI. Patients with urinary symptoms should
be evaluated for three pathogens as common causes of
NGU. Commercially available kits are simple and
sensitive methods to use in laboratories which do not
routinely test for these pathogens. The association
between STD and S. haematobium requires further
studies.
REFERENCES
Al-Sweih NA, Al-Fadli AH, Omu AE, Rotimi VO (2012). Prevalence of
Chlamydia trachomatis, Mycoplasma hominis, Mycoplasma
genitalium, and Ureaplasma urealyticum infections and seminal
quality in infertile and fertile men in Kuwait. J. Androl. 33(6):13231329.
Bakardzhie I, Pehlivanov G, Kovachev E (2011). Correlations between
Contemporary Methods in the Diagnosis of Chlamydia Trachomatis
urogenital
infections.
J.
IMAB
17(1):158-160.
/DOI:
10.5272/jimab.2011171.158
Biernat-Sudolska M, Rojek-Zakrzewska D, Zawilińska B, Magdalena KV (2013). The need to verify of positive Mycoplasma hominis results
obtained using the Mycoplasma IST2 tests. J of Lab Diag, 49 (1):5-8.
Centers for Disease Control (CDC) (2010). Sexually transmitted
diseases surveillance, 2010.
Cheah F-C, Anderson TP, Darlow BA, Murdoch DR (2005). Comparison
of the mycoplasma duo test with PCR for detection of Ureaplasma
species in endotracheal aspirates from premature infants. J Clin
Microbiol, 43(1):509. DOI: 10.1128/JCM.43.1.509-510.2005.
Chernesky M, Luinstra K, Sellors J, Schachter J, Moncada J, Caul O,
Paul I, Mikaelian L, Toye B, Paavonen J, Mahony J (1998). Can
837
Serology diagnose upper genital tract Chlamydia trachomatis
infection? Studies on women with pelvic pain, with or without
chlamydial plasmid dna in endometrial biopsy tissue. Sex. Transm.
Dis. 25(1):14-19.
Clegg A, Passey M, Yoannes M, Michael A (1997). High rates of genital
mycoplasma infection in the highlands of Papua New Guinea
determined both by culture and by a commercial detection kit. J. Clin.
Microbiol. 35:197-200.
Cunningham KA, Beagley KW (2008). Male genital tract chlamydial
infection: Implications for pathology and infertility. Biol. Reprod.
79(2):180-189.
Dean D, Turingan RS, Thomann H-U, Zolotova A, Rothschild J, Joseph
SJ, Read TD, Tan E, Selden RF (2012). A multiplexed microfluidic
PCR assay for sensitive and specific point-of-care detection of
Chlamydia trachomatis. PLoS ONE 7(12): e51685. doi:10.1371/
journal.pone.0051685.
Ekiel AM, Friedek DA, Romanik MK, Jozwiak J, Martirosian G (2009).
Occurrence of Ureaplasma parvum and Ureaplasma urealyticum in
women with cervical dysplasia in Katowice, Poland. J. Korean Med.
Sci. 24(6):1177-1181.
El-Mishad AM, Mokhtar S, Adu Aitta AM, Ahmed A (1992). Ocurrence of
U. urealyticum, M. hominis and anaerobic bacteria in urine of patients
with UTI and haematobiasis. Med. J. Cairo Univ. 60(1):167-176.
El-Sayed M, Badwy W, Bakr A (2006). Rapid hybridization probe assay
and PCR for detection of Chlamydia trachomatis in urinary tract
infections: a prospective study, Curr. Microbiol., 53(5):379-383.
Fernández-Benítez C, Mejuto-López P, Otero-Guerra L, MargollesMartins MJ, Suárez-Leiva P, Vazquez F, Chlamydial Primary Care
Group (2013). Prevalence of genital Chlamydia trachomatis infection
among young men and women in Spain. BMC Infect. Dis. 13:388.
Gaydos CA, Theodore M, Dalesio N, Wood BJ, Quinn TC (2004).
Comparison of three nucleic acid amplification tests for detection of
Chlamydia trachomatis in urine specimens. J. Clin. Microbiol.
42(7):3041-3045.
Gdoura R, Kchaou W, Chaari C, Znazen A, Keskes L, Rebai T,
Hammami A (2008). Assessment of Chlamydia trachomatis,
Ureaplasma urealyticum, Ureaplasma parvum, Mycoplasma hominis,
and Mycoplasma genitalium in semen and first void urine specimens
of asymptomatic male partners of infertile couples. J. Androl.
29(2):198-206.
Geisler WM (2010). Duration of untreated, uncomplicated Chlamydia
trachomatis genital infection and factors associated with chlamydia
resolution: a review of human studies. J. Infect. Dis. 201(2):S104113.
Ghanaat J, Afshari JT, Ghazvini K, Malvandi M (2008). Prevalence of
genital chlamydia in Iranian males with urethritis attending clinics in
Mashhad. Eastern Mediterranean Health J. 14(6):1333-1337.
Ghazvini K, Ahmadnia H, Ghanaat J (2012). Frequency of Chlamydia
trachomatis among male patients with urethritis in northeast of iran
detected by polymerase chain reaction. Saudi J. Kidney Dis. Transpl.
23(2):316-320.
González-Pedraza A, Ortiz C, Mota R, Dávila R, Dickinson E (2003).
Role of bacteria associated with sexually transmitted infections in the
etiology of lower urinary tract infection in primary care. Enferm Infecc.
Microbiol. Clin. 21(2):89-92.
Goulet M, Dular R, Tully JG, Billowes G, Kasatiya S (1995). Isolation of
Mycoplasma pneumoniae from the human urogenital tract. J Clin
Microbiol, 33(11):2823-2825.
Hopfe M, Deenen R, Degrandi D, Ko¨hrer K, Henrich B (2013). Host
Cell Responses to Persistent Mycoplasmas - Different Stages in
Infection of HeLa Cells with Mycoplasma hominis. PLoS ONE 8(1):
e54219. doi:10.1371/journal.pone. 0054219.
Kamel RM (2013). Screening for Chlamydia trachomatis infection
among infertile women in Saudi Arabia. Int J Women’s Health, 5:
277-284.
Kılıç D, Basar MM, kaygusuz S,Yilmaz E, Basar H, Batislam E (2004).
Prevelance and treatment of chlamydia trachomatis, Ureaplasma
urealyticum and Mycoplasma hominis in patients with nongonococcal urethritis. Jpn. J. Infect Dis. (8):17-20.
Lee Y-S, Lee K-S (2013). Chlamydia and Male Lower Urinary Tract
Diseases. Korean J. Urol. 54:73-77.
Leutscher PDC, Ramarokoto C-E, Hoffmann S, Jensen JS, Ramaniraka
838
Afr. J. Microbiol. Res.
V, Randrianasolo B, Raharisolo C, Migliani, R, Christensen N
(2008).Coexistence of urogenital schistosomiasis and sexually
transmitted infection in women and men living in an area where
Schistosoma haematobium is endemic. Clin. Infect. Dis. 47(6):775.
Maeda S-I, Deguchi T, Ishiko H, Matsumoto T, Naito S, Kumon H,
Tsukamoto T, Onodera S, Kamidono S (2004). Detection of
Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum
(biovar 1) and Ureaplasma urealyticum (biovar 2) in patients with
non-gonococcal urethritis using polymerase chain reaction-microtiter
plate hybridization. Int. J. Urol. 11(9):750-754.
Mangin D, Murdoch D, Wells JE, Coughlan E, Bagshaw S, Corwin P,
Chambers S, Toop L (2012). Chlamydia trachomatis testing
sensitivity in midstream compared with first-void urine specimens.
Ann. Fam. Med. 10:50-53. doi:10.1370/afm.1323.
Marrazo J, Stamm WE (1998). New approaches of chlamydial infection.
Curr. Top Clin. Infect. Dis.18:37-59.
Nassar F (2007). Chlamydia trachomatis, Mycoplasma hominis,
Mycoplasma genitalium, and Ureaplasma urealyticum in Patients with
Sterile Pyuria in Gaza-Palestine. Master thesis in Microbiology,
Biological Sciences, Faculty of Science, The islamic University-Gaza.
Paavonen J, Eggert-Kruse W (1999). Chlamydia trachomatis: impact on
human reproduction. Hum. Reprod. Update 5(5):433-447.
Sethi S, Singh G, Samanta P, Sharma M (2012). Mycoplasma
genitalium: An emerging sexually transmitted pathogen. Indian J.
Med. Res. 136(6):942-955.
Takahashi S, Takeyama K, Miyamoto S, Ichihara K, Maeda T,
Kunishima Y, Matsukawa M, Tsukamoto T (2006). Detection of
Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma
urealyticum, and Ureaplasma parvum DNAs in urine from
asymptomatic healthy young Japanese men. J. Infect. Chemother.
12(5): 269-271.
Van der Helm JJ, Bom RJM, Gru¨nberg AW, Bruisten SM, Schim van
der Loeff MF, Sabajo LOA, de Vries HJC (2013). Urogenital
Chlamydia trachomatis Infections among Ethnic Groups in
Paramaribo, Suriname; Determinants and Ethnic Sexual Mixing
Patterns.
PLoS
ONE
8(7):
e68698.
doi:10.1371/
journal.pone.0068698
Vasic A, Tasic NM, Zdravkovic D, Tasic S (2004). Chlamyfast-OIA test
in the genital chlamydia male infection diagnosis. Acta Medica
Medianae 43:33-36.
Vicetti Miguel RD, Harvey SAK, LaFramboise WA, Reighard SD,
Matthews DB, Cherpes TL (2013). Human Female Genital Tract
Infection by the Obligate. Intracellular bacterium Chlamydia
trachomatis elicits robust type 2 immunity. PLoS ONE 8(3): e58565.
doi:10.1371/journal.pone.0058565.
Wanic-Kossowska M, Kozioł L, Bajew L, Czekalski S (2001). Acute and
chronic urinary tract infections caused by Chlamydia trachomatis. Int.
Urol. Nephrol. 32(3):437-438.
Wiggins RC, Holmes CH, Andersson M, Ibrahim F, Low N, Horner PJ
(2006). Quantifying leukocytes in first catch urine provides new
insights into our understanding of symptomatic and asymptomatic
urethritis. Int. J. STD AIDS 17(5):289-295.
Workowski KA, Berman SM (2007). Centers for Disease Control and
Prevention sexually transmitted diseases treatment guidelines. Clin.
Infect. Dis. 44 (3):S73-76.
World Health Organization (WHO) (2001). Global prevalence and
incidence of selected curable sexually transmitted infections.
overviews and estimates. Geneva, Switzerland: WHO.
Yoshida T, Maeda S, Deguchi T, Ishiko H (2002). Phylogeny-based
rapid identification of mycoplasmas and ureaplasmas from urethritis
patients. J. Clin. Microbiol. 40(1):105-110.
UPCOMING CONFERENCES
7th Asia-Pacific Organization for Cell Biology Congress, Biopolis, Singapore, 24
February 2014
18th Annual International Conference on Research in Computational Molecular
Biology Pittsburgh, Pennsylvania April 2-5, 2014
Conferences and Advert
February 2014
7th Asia-Pacific Organization for Cell Biology Congress, Biopolis, Singapore, 24
February 2014
March 2014
VIII International Symposium on Antimicrobial Resistance, Cartegena, Colombia,
March 5- 7, 2014
April 2014
Annual Meeting of the Association of Medical Microbiology and Infectious Disease
Canada, Victoria, Canada, April 2-5, 2014
18th Annual International Conference on Research in Computational Molecular
Biology Pittsburgh, Pennsylvania April 2-5, 2014
African Journal of
Microbiology Research
Related Journals Published by Academic Journals
African Journal of Biotechnology
African Journal of Biochemistry Research
Journal of Bacteriology Research
Journal of Evolutionary Biology Research
Journal of Yeast and Fungal Research
Journal of Brewing and Distilling