MiSeq Sample Sheet Quick Reference Guide ®
Transcription
MiSeq Sample Sheet Quick Reference Guide ®
MiSeq® Sample Sheet Quick Reference Guide FOR RESEARCH USE ONLY Revision History 3 Introduction 4 Sample Sheet Parameters 5 Sample Sheet Settings 10 Manifests 14 Analysis Workflows 16 Editing the Sample Sheet for Custom Primers 18 Naming the Sample Sheet 19 Technical Assistance ILLUMINA PROPRIETARY Part # 15028392 Rev. E November 2012 This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and are intended solely for the contractual use of its customer in connection with the use of the product(s) described herein and for no other purpose. This document and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed, or reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does not convey any license under its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this document. The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure the proper and safe use of the product(s) described herein. All of the contents of this document must be fully read and understood prior to using such product(s). FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND DAMAGE TO OTHER PROPERTY. ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S) DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE) OR ANY USE OF SUCH PRODUCT(S) OUTSIDE THE SCOPE OF THE EXPRESS WRITTEN LICENSES OR PERMISSIONS GRANTED BY ILLUMINA IN CONNECTION WITH CUSTOMER'S ACQUISITION OF SUCH PRODUCT(S). © 2011–2012 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray, BeadXpress, cBot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic Energy, Genome Analyzer, GenomeStudio, GoldenGate, HiScan, HiSeq, Infinium, iSelect, MiSeq, Nextera, NuPCR, SeqMonitor, Solexa, TruSeq, VeraCode, the pumpkin orange color, and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners. Part # Revision Date 15028392 E November 2012 15028392 D July 2012 Added the following information: • Added the PCR Amplicon analysis workflow for Nextera XT libraries and information about the manifest file • Noted that adapter trimming is recommended for longer read lengths up to 250 cycles • Added descriptions of sample sheet settings for PercentTilesToScan and StrandBiasFilter • Changed Setup Options screen to Run Options screen per MCS v1.2 15028392 C April 2012 Updated the following information: • Updated name of Amplicon workflow to Custom Amplicon • Updated name of DenovoAssembly workflow to Assembly • Added GenerateFASTQ workflow • Listed genome folder as required for amplicon sequencing in Sample Sheet Parameters 15028392 B December 2011 Updated the steps in Setting Up the Sample Sheet. Listed manifest files as required for TruSeq Custom Amplicon libraries. 15028392 A September 2011 Initial release MiSeq Sample Sheet Quick Reference Guide Description of Change Added the following information: • Description of Enrichment workflow, manifest, and data section requirements • Data section requirements for PCR Amplicon workflow • Descriptions of sample sheet settings AdapterRead2 and QualityScoreTrim • Note about supported option for listing genome references for multiple species in the same sample sheet when using MiSeq Reporter v2.1 Updated the following information: • Organized sample sheet settings into settings for sequencing, analysis, and variant calling • Updated Small RNA workflow to list the genome folder as required in the sample sheet • Updated sample sheet settings for variant calling to add VariantMinimumGQCutoff, and to update StandBiasFilter and MinumumCoverageDepth for the Enrichment workflow 3 Revision History Revision History Introduction The sample sheet is a comma separated values (*.csv) file that stores information needed to set up, perform, and analyze a sequencing run. Illumina recommends that you create your sample sheet prior to preparing your sample libraries. You can create your sample sheet using the Illumina Experiment Manager or create it manually using a text editor, such as Excel or Notepad. Before starting the run, make sure that the sample sheet is accessible to the instrument by copying the sample sheet to a network location accessible from the instrument computer, or copy the sample sheet from a USB flash drive to the instrument computer using the Manage Files feature in MiSeq Control Software. When the run begins, the software copies the sample sheet from the designated sample sheet folder to the root of the output folder, and then copies it to the root of the analysis folder. At the end of the run, the sample sheet is used for secondary analysis by the MiSeq Reporter software. For more information, see the MiSeq System User Guide, Part # 15027617. Illumina Experiment Manager The Illumina Experiment Manager is a wizard-based application that guides you through the steps to create your sample sheet. Using the Illumina Experiment Manager not only reduces syntax errors, but also prompts you to provide information for sections that apply to your sample type and analysis workflow. It provides a feature for recording parameters for your sample plate, such as sample ID, project name, dual indices, and barcode information. Using the Illumina Experiment Manager, you can import sample plate parameters to your sample sheet. The Illumina Experiment Manager can be run on any Windows platform. You can download a copy from the Illumina website at www.illumina.com. Go to the MiSeq support page and click Downloads. A MyIllumina login is required. For more information, see the Illumina Experiment Manager User Guide, Part # 15031335. Sample Sheet Workflow 4 1 Create your sample sheet using one of the following methods: • Illumina Experiment Manager—See the Illumina Experiment Manager User Guide, Part # 15031335. • Excel or Notepad—See Sample Sheet Parameters on page 5. 2 Name your sample sheet with the reagent cartridge barcode number that you will use for your run followed by *.csv. This enables the software to automatically associate your sample sheet with the run. For more information, see Naming the Sample Sheet on page 19. 3 Copy the sample sheet to the network location specified in Run Options in MCS, or copy it to the instrument computer using a USB flash drive and the Manage Files feature. For more information, see the MiSeq System User Guide. Part # 15028392 Rev. E The following sections describe the anatomy of a sample sheet and list requirements for different analysis workflows. Many of these descriptions and requirements are automated in Illumina Experiment Manager. If you are using Illumina Experiment Manager to create your sample sheet, see the Illumina Experiment Manager User Guide, Part # 15031335. The sample sheet is organized by sections titled Header, Reads, Manifests, Data, and Settings. Section headings, which are case-sensitive, are shown in brackets [ ] in following example: Figure 1 Sample Sheet Example in Excel Not all sections of the sample sheet apply to every analysis workflow. Some sections are required, while others are optional or do not apply at all. } The Manifests section is required for the Custom Amplicon and PCR Amplicon workflows only. For more information, see Manifests on page 14. } The Data section is arranged in columns, and each analysis workflow requires specific columns. For more information, see Data Section on page 6. } The Settings section is optional for all workflows. For more information, see Sample Sheet Settings on page 10. Header Section Parameter Description Investigator Name Your name. Project Name Project name of your preference. Experiment Name Experiment name of your preference. Date Date of your experiment. Workflow Required The workflow field must contain one of the following options: Resequencing, Custom Amplicon, PCR Amplicon, Assembly, SmallRNA, GenerateFASTQ, Metagenomics, or LibraryQC. For more information, see Analysis Workflows on page 16. MiSeq Sample Sheet Quick Reference Guide 5 Sample Sheet Parameters Sample Sheet Parameters Parameter Description Assay The name of the assay used to prepare your samples. Chemistry This field identifies the recipe fragments used to build the runspecific recipe. If this field is blank, the system uses the default recipe fragments. Optional—For TruSeq RNA or TruSeq DNA libraries, this field can be blank or use the default setting. Required—For any workflows that use dual indexing, specifically Nextera and TruSeq Custom Amplicon, the chemistry field is required. Enter amplicon in this field. Reads Section Parameter Description Number of cycles in Read 1 Required Number of cycles in Read 2 Required for paired-end runs. NOTE The number of cycles for the index read is indicated by the index sequence defined in the Data section. Data Section Column Heading Description SampleID Required Every sample must have a unique sample ID. This is usually a barcode but can have any value. At least one sample must be listed. List one sample per line. Sample_Name Optional The sample name is used in reporting and file naming. Index Required for multi-sample assays with single or dual indexing. Nucleotide sequence—Valid characters are A, C, G, T, and N, where N matches any base. Enter the index sequence of i7. Index2 Required for multi-sample assays with dual indexing. Nucleotide sequence—Valid characters are A, C, G, T, and N, where N matches any base. Enter the index sequence of i5. NOTE For the appropriate index sequences, see the user guide for your sample preparation kit. The following tables summarizes the required Data section columns for each analysis workflow. Column order is not important. 6 Part # 15028392 Rev. E Data Columns Assembly Required: SampleID Optional: Index, Index 2, GenomeFolder Custom Amplicon Required: SampleID, Manifest, GenomeFolder Optional: Index, Index 2 Enrichment Required: SampleID, Manifest, GenomeFolder Optional: Index, Index 2 GenerateFASTQ Required: SampleID Optional: Index, Index 2 LibraryQC Required: SampleID, GenomeFolder Optional: Index, Index 2 Metagenomics Required: SampleID Optional: Index, Index 2 PCR Amplicon Required: SampleID, Manifest, GenomeFolder Optional: Index, Index 2 Resequencing Required: SampleID, GenomeFolder Optional: Index, Index 2 SmallRNA Required: SampleID, GenomeFolder, Contaminants, miRNA, RNA Optional: Index, Index 2 Sample Sheet Parameters Analysis Workflow NOTE You must enter the full path (UNC path) to the GenomeFolder in the sample sheet. Do not enter the path using a mapped drive. NOTE Introduced in MiSeq Reporter v2.1, you can specify genome references for multiple species in the same sample sheet for all workflows except the Small RNA workflow. Data Columns for Assembly Workflow Column Heading Description GenomeFolder Optional If provided, MiSeq Reporter compares the de novo assembly against the reference genome, and generates a dot-plot that graphically summarizing the results. • If the folder listed does not exist, Illumina Experiment Manager combines the GenomePath configuration setting with the genome string. • If the path does not exist, Illumina Experiment Manager stops processing. MiSeq Sample Sheet Quick Reference Guide 7 Data Columns for Custom Amplicon Workflow Column Heading Description GenomeFolder Required The reference genome folder containing the FASTA files to be used in the alignment step. Must be the same genome used to generate the manifest file. This is used to provide variant annotations and set the chromosome sizes in the *.bam file output. Manifest Required Specify the manifest key for this sample, which is located in the first column of the Manifests section of the sample sheet. Data Columns for Enrichment Workflow Column Heading Description GenomeFolder Required The reference genome folder containing the FASTA files to be used in the alignment step. Manifest Required Specify the manifest key for this sample, which is located in the first column of the Manifests section of the sample sheet. Data Columns for Library QC Workflow Column Heading Description GenomeFolder Required The reference genome folder containing the FASTA files to be used in the alignment step. Data Columns for PCR Amplicon Workflow 8 Column Heading Description GenomeFolder Required The reference genome folder containing the FASTA files to be used in the alignment step. Manifest Required Specify the manifest key for this sample, which is located in the first column of the Manifests section of the sample sheet. Part # 15028392 Rev. E Sample Sheet Parameters Data Columns for Resequencing Workflow Column Heading Description GenomeFolder Required The reference genome folder containing the FASTA files to be used in the alignment step. The GenomeFolder can be a network location or the MiSeq local drive. For optimal results store Genomes on the local drive or use BaseSpace. The GenomeFolder location should be the folder containing the FASTA files. An example file path: D:\Illumina\MiSeq Reporter\Genomes\PhiX\Illumina\RTA\Sequence\Chromosomes Data Columns for Small RNA Workflow Column Heading Description GenomeFolder Required If provided, reads are aligned against the full reference genome. Contaminants Required The path to the folder containing the FASTA files of contaminants. miRNA Required The path to the folder containing FASTA files of mature miRNAs. RNA Required The path to the folder containing FASTA files of small RNAs. MiSeq Sample Sheet Quick Reference Guide 9 Sample Sheet Settings You can specify settings in the Settings section of the sample sheet to control various sequencing and analysis parameters. Each line in the Settings section contains a setting name in the first column and a value in the second column. Sample Sheet Settings for Sequencing You can specify settings in the Settings section of the sample sheet to control various analysis parameters. Each line in the Settings section contains a setting name in the first column and a value in the second column. Parameter Description CustomRead1PrimerMix CustomIndexPrimerMix CustomRead2PrimerMix Create one line for each custom primer used and indicate C1 for the Read 1 primer, C2 for the Index primer, or C3 for the Read 2 primer. Custom primers are supported for Read 1, Index 1 Read, and Read 2 only. For more information, see Editing the Sample Sheet for Custom Primers on page 18. PercentTilesToScan If set to the default value of 1, 100% of the tiles are scanned. Valid values are 0 through 1. • If set to 0, the software will round up to one tile. • For all other settings, the software will round down. For example, a value of 0.99 results in 27 tiles (dual-surface) or 13 tiles (single-surface). For more information about dual-surface scanning, see the MiSeq System User Guide, Part # 15027617. Sample Sheet Settings for Analysis 10 Parameter Description Adapter Specify the 5' portion of the adapter sequence to prevent reporting sequence beyond the sample DNA. For more information about adapter settings, see the MiSeq Reporter User Guide, Part # 15028784. • Nextera libraries—Illumina recommends adapter trimming using BWA for Nextera libraries (adapter sequence CTGTCTCTTATACACATCT). • Small RNA libraries—Adapter masking is performed by default using Eland (adapter sequence TGGAATTCTCGGGTGCCAAGGC). This adapter is masked if nothing is specified in the sample sheet. For other libraries, see the associated sample prep documentation. Part # 15028392 Rev. E Description AdapterRead2 Specify the 5' portion of the Read 2 adapter sequence to prevent reporting sequence beyond the sample DNA. Use this setting to specify a different adapter other than the one specified in the Adapter setting. Aligner For Resequencing and Library QC workflows—Specify the method for aligning reads against the reference genome. Options are BWA (default) or Eland. The BWA aligner provides improved speed, accuracy, and throughput relative to Eland. When BWA is specified, GATK is used for variant calling, by default. CustomAmpliconAlignerMaxIndelSize For Custom Amplicon workflow—The maximum detectable indel size using the Custom Amplicon workflow. The default is 10. Setting this to a larger value increases the sensitivity to larger indels, but requires more time to complete alignment. FilterPCRDuplicates Settings are 0 or 1. Default is 1, filtering. If set to 1, PCR duplicates are flagged in the BAM files and not used for variant calling. PCR duplicates are defined as two clusters from a paired-end run where both clusters have the exact same alignment positions for each read. Kmer For the Assembly workflow—Use this setting to override the k-mer size used by Velvet. Default is 31; odd-numbered values up to 63 are supported. QualityScoreTrim If set to a value > 0, then the 3' ends of nonindexed reads with low quality scores are trimmed. Trimming is automatically applied by default for a cutoff of 15 when using BWA for alignment. TaxonomyFile For the Metagenomics workflow—Use this setting to override the taxonomy database (default is taxonomy.dat). VariantCaller For the Custom Amplicon workflow—Specify one of the following variant caller settings: • GATK (default) • Somatic (for tumor samples) • Starling (legacy variant caller) • None (no variant calling) Sample Sheet Settings for Variant Calling Some sample sheet settings specify parameters for variant calling. Most settings and default values are specific to a variant caller. MiSeq Sample Sheet Quick Reference Guide 11 Sample Sheet Settings Parameter 12 Setting Name Description FilterOutSingleStrandVariants This setting filters variants if they are only found in one read-direction. This setting applies to the Resequencing and PCR Amplicon workflows only; it does not apply to the Custom Amplicon workflow. Default value and variant caller: • On—Somatic Variant Caller IndelRepeatFilterCutoff This setting filters indels if the reference has a 1base or 2-base motif over eight times (by default) next to the variant. Default value and variant caller: • 8—Somatic Variant Caller • 8—GATK • 8—Starling MinimumCoverageDepth This setting does not report variants if the coverage depth at that location is less than the specified threshold. Default value and variant caller: • 10—Somatic Variant Caller • 20—GATK (Enrichment workflow only; 0 otherwise) MinQScore This setting specifies the minimum base Q-score to use as input to variant calling. Default value and variant caller: • 20—Somatic Variant Caller • 0—Starling StrandBiasFilter This setting filters variants with a significant bias in read-direction. Variants filtered out in this way will have sb in the filter column of the VCF file, instead of PASS. Default value and variant caller: • 0.5—Somatic Variant Caller • -10—GATK (Enrichment workflow only; no filter otherwise) VariantFilterQualityCutoff This setting filters variants if the variant quality score is less than the specified threshold. Default value and variant caller: • 30—Somatic Variant Caller • 30—GATK • 20—Starling VariantFrequencyEmitCutoff This setting does not report variants with a frequency less than the specified threshold. Default value and variant caller: • 0.01—Somatic Variant Caller Part # 15028392 Rev. E Description VariantFrequencyFilterCutoff This setting filters variants with a frequency less than the specified threshold. Default value and variant caller: • 0.01—Somatic Variant Caller • 0.20—GATK • 0.20—Starling VariantMinimumGQCutoff This setting filters sites if the genotype quality (GQ) is less than the threshold. Default value and variant caller: • 30—Somatic Variant Caller • 30—GATK • 20—Starling MiSeq Sample Sheet Quick Reference Guide 13 Sample Sheet Settings Setting Name Manifests A manifest is a file that specifies the alignments to a reference and the targeted reference regions used in the workflow. A manifest file is required for the following analysis workflows: } Custom Amplicon—The manifest file for the Custom Amplicon workflow is provided by Illumina with your custom assay (CAT) and uses a *.txt file format. You can obtain a manifest file for your TruSeq Custom Amplicon experiment from the Illumina website. Log in to MyIllumina, and click Custom Products. From the options for TruSeq Custom Amplicon, click Product Files. } PCR Amplicon—The manifest file for the PCR Amplicon workflow is generated using the Illumina Experiment Manager and uses a *.AmpliconManifest file format. The genome reference must be specified in the manifest file. For more information see the Illumina Experiment Manager User Guide, Part # 15031335. } Enrichment—Like the PCR Amplicon workflow, the manifest file for the Enrichment workflow is generated using the Illumina Experiment Manager and uses a *.AmpliconManifest file format. For more information see the Illumina Experiment Manager User Guide, Part # 15031335. 14 Parameter Description Name of manifest file Name of your manifest file. More than one manifest can be specified. Multiple manifests are defined as keys in the first column in the Manifest section of the sample sheet, such as A and B. Two types of manifest formats are used for sequencing and analysis depending on the analysis workflow specified in the sample sheet: • Custom Amplicon workflow—Requires the format *.txt. Including the file extension (*.txt) in the sample sheet is optional. • PCR Amplicon or Enrichment workflow—Requires the format *.AmpliconManifest. Including the file extension (*.AmpliconManifest) in the sample sheet is recommended. Part # 15028392 Rev. E Manifests Figure 2 Sample Sheet Example with Two Manifests Specified Load your manifest file onto the instrument using the Manage Files feature to the specified location. For more information see the MiSeq System User Guide, Part # 15027617. MiSeq Sample Sheet Quick Reference Guide 15 Analysis Workflows The analysis workflow is a procedure performed by MiSeq Reporter. One analysis workflow must be specified in the sample sheet for each sequencing run. When the run is complete, MiSeq Reporter performs secondary analysis according to that workflow. 16 Analysis Workflow Applications Output Assembly Assembles small genomes from reads without the use of a genomic reference. If a genomic reference is specified, a dot-plot is generated with respect to the reference of genome position vs assembled contigs. Contigs in FASTA format. Custom Amplicon Sequences TruSeq Custom amplicon from probes targeting particular genome positions (up to approx. 384 loci from up to approx. 96 samples). Aligns reads against a manifest file specified in the sample sheet. Two manifests can be specified: one for the control and one for the sample. Aligned reads in BAM format. Variant calls in VCF format. Enrichment Analyzes DNA that has been enriched for particular target sequences using a pulldown assay. Aligns reads against the whole genome reference, and performs variant analysis for the regions of interest specified in the manifest file. Reporting accumulates coverage and other statistics for each amplicon. Generate FASTQ Generates intermediate analysis files in FASTQ format and then exits the workflow. Enables the use of thirdparty tools to analyze sequencing data. Sequence files in FASTQ format. Library QC Aligns reads against reference genomes specified in the sample sheet, and then generates a sample report in LibraryQC.html. Per-sample summary statistics. Metagenomics Classifies bacteria from a metagenomic sample by amplifying specific regions in 16S ribosomal RNA. No genomic reference is required for the metagenomics workflow. Reads are classified using a database of 16S rRNA data. For paired-end runs, each cluster is classified using base calls from both reads. Read classifications by taxonomic group from kingdom through genus. Aligned reads in BAM format. Variant calls in VCF format. Part # 15028392 Rev. E Applications Output PCR Amplicon Sequences any number of PCR amplicons that have been fragmented using Nextera tagmentation. Aligns reads against the reference genomes specified in the sample sheet. Performs variant analysis for the regions of interest specified in the manifest file. Aligned reads in BAM format. Variant calls in VCF format. Resequencing Sequences a small genome, such as E. coli. Aligns reads against the reference genomes specified in the sample sheet and performs variant analysis. Aligned reads in BAM format. Variant calls in VCF format. Small RNA Sequences miRNA. Aligns reads against databases for contaminants, mature miRNA, small RNA, and a genomic reference, in that order. Reports on the relative abundance of each record. MiSeq Sample Sheet Quick Reference Guide 17 Analysis Workflows Analysis Workflow Editing the Sample Sheet for Custom Primers You can set up your sample sheet for custom primers using the Illumina Experiment Manager v1.2, or later. For more information, see the Illumina Experiment Manager User Guide, Part # 15031335. If you edit your sample sheet manually, list the custom primers in the Settings section of the sample sheet, as follows: 1 Open your sample sheet for editing in Excel or Notepad. 2 Locate the Settings section. If your sample sheet does not have a Settings section, create one after the Reads section and before the Data section. Figure 3 Example of Custom Primers in Settings Section 3 In the Settings section, add a line for each of your custom primers using the following example: Settings CustomRead1PrimerMix CustomIndexPrimerMix CustomRead2PrimerMix C1 C2 C3 Make sure that you enter C1 for the Read 1 primer, C2 for the Index Read primer, and C3 for the Read 2 primer. You only need to add an entry for the custom primers you are using. For example, if you are using Illumina primers for Read 1 and Read 2, and a custom primer for the Index Read, edit the Settings section to list only one custom primer, as follows: Settings CustomIndexPrimerMix C2 For information about preparing and loading custom primers, see the MiSeq System User Guide, Part # 15027617. 18 Part # 15028392 Rev. E During the run setup steps using MCS, the software automatically looks for a sample sheet with a name that matches the barcode number of the reagent cartridge loaded on the instrument. Therefore, Illumina recommends that you name your sample sheet with the barcode number of the reagent cartridge that you will use for your run, followed by *.csv extension. The barcode number is located on the reagent cartridge label directly below the barcode. In the following example, the sample sheet name is MS2000006-500.csv. You do not need to include the kit version in the sample sheet name. Figure 4 Reagent Cartridge Label If you do not know which reagent cartridge you will use for your run, name your sample sheet according to your preference followed by *.csv. When the software cannot locate your sample sheet during the run setup steps, you can browse to the appropriate sample sheet. MiSeq Sample Sheet Quick Reference Guide 19 Naming the Sample Sheet Naming the Sample Sheet Notes For technical assistance, contact Illumina Technical Support. Table 1 Illumina General Contact Information www.illumina.com Illumina Website techsupport@illumina.com Email Table 2 Illumina Customer Support Telephone Numbers Region Contact Number Region Contact Number North America 1.800.809.4566 Italy 800.874909 Austria 0800.296575 Netherlands 0800.0223859 Belgium 0800.81102 Norway 800.16836 Denmark 80882346 Spain 900.812168 Finland 0800.918363 Sweden 020790181 France 0800.911850 Switzerland 0800.563118 Germany 0800.180.8994 United Kingdom 0800.917.0041 Ireland 1.800.812949 Other countries +44.1799.534000 MSDSs Material safety data sheets (MSDSs) are available on the Illumina website at www.illumina.com/msds. Product Documentation Additional product documentation in PDF is available for download from the Illumina website. Go to www.illumina.com/support and select a product. A MyIllumina login is required. To register for a MyIllumina account, please visit my.illumina.com/Account/Register. MiSeq Sample Sheet Quick Reference Guide Technical Assistance Technical Assistance Illumina Headquartered in San Diego, California, U.S.A. +1.800.809.ILMN (4566) +1.858.202.4566 (outside North America) techsupport@illumina.com www.illumina.com