Compuestos azufrados volátiles en vinos

Transcription

Organizan:
Seminario Técnico
Compuestos azufrados
volátiles en vinos
Problemas de reducción
y aromas varietales
Tarragona, 23 de abril de 2009
Madrid, 24 de abril de 2009
Colaboran:
Índice
Ponencias
01. Relación entre el contenido nitrogenado
4
Artículos relacionados
41 Influence of the Timing of Nitrogen Additions
en mosto/uva y la síntesis de aromas: efecto
sobre la producción de sulfhídrico
Prof. Gemma Beltran
Universidad Rovira i Virgili
Prof. Jose Manuel Guillamón
Instituto de Agroquímica y Tecnología de Alimentos IATA-CSIC
18
02. Los nuevos retos en microbiología del
vino. Levaduras no productoras de SH2
Isak S. Pretorius
The Australian Wine Research Institute, PO
Box 197, Glen Osmond, Adelaide, SA 5064,
Australia
30
03. La micro-oxigenación de vinos tintos:
Control de la reducción y estabilización del
color
Prof. Encarna Gómez Plaza
Universidad de Murcia
36
04. ¡Los compuestos volátiles no son todos
perjudiciales!
Rémi GUERIN-SCHNEIDER
Institut Français de la Vigne et du Vin
ENTAV-ITV France
during Synthetic Grape Must Fermentations
on Fermentation Kinetics and Nitrogen
Consumption
51
Formación de compuestos volátiles azufrados
por levaduras vinicas.
59
59
Una revolución en el sector enólogico:
63
Nitrogen management is critical for wine
Managing Director, flavour and style
73
77
Unravelling the genetic blueprint of wine yeast
83
87
91
Taking control of alcohol
103
Efectos de la microoxigenación en vino tinto
Levaduras de vinificación que no producen
Sulfuro de hidrógeno (H2S)
When the heat is on, yeast fermentation runs
out of puff
A la recerca del codi digital dels llevats del vi
Effect of Micro-oxygenation on Color and
Anthocyanin-Related Compounds of Wines
with Different Phenolic Contents
3
01. Relación entre
el contenido
nitrogenado en
mosto/uva y la
síntesis de aromas:
efecto sobre la
producción de
sulfhídrico
Prof. Gemma Beltran
Prof. Jose Manuel Guillamón
Instituto de Agroquímica y Tecnología de
Alimentos IATA-CSIC
Contenido
Resumen
6
6
1. Introducción
7
2. Efecto de la concentración y tipo de
nitrógeno sobre el crecimiento de las
levaduras y su cinética fermentativa.
9
nitrógeno sobre la cinética fermentativa
10
4. Relación entre el contenido en nitrógeno y
la síntesis de compuestos aromáticos
15
Bibliografía
Seminario Técnico
José M. Guillamón Navarro
Gemma Beltran Casellas
Requena, 6 de julio de 1967.
e-mail: guillamon@iata.csic.es
31 de octubre de 1975
Investigación:
Coautor de 50 artículos científicos en revistas internacionales de las áreas de Tecnología de Alimentos, Biotecnología y Microbiología. Coautor de 20 artículos en
revistas de divulgación del sector agroalimentario y vitivinícola. 80 comunicaciones a Congresos nacionales
e internacionales, 24 de ellas como ponente invitado o
comunicación oral. Autor de 5 capítulos de libros especializados y 37 capítulos en libros de congresos. Autor
de 3 patentes de levaduras vínicas en explotación. Director de 3 tesis doctorales (2 de ellas con formato de
doctorado europeo)
Líneas de Investigación
•
Estudio del metabolismo de las levaduras en
condiciones de fermentación vínica. Efecto de las
bajas temperaturas de fermentación y del metabolismo del nitrógeno.
•
Estudio de las poblaciones de levaduras y bacterias acéticas durante los procesos de elaboración
de vino. Utilización de marcadores moleculares
para la caracterización e identificación de los microorganismos del vino.
Estancias en Centros Extranjeros:
•
Estancia post-doctoral en la Universidad de Utrecht (junio del 1998 a mayo del 1999).
•
Estancia post-doctoral en el “Institute for Wine
Biotechnology (Stellenbosch University)” en
Stellenbosch (Sudáfrica) (septiembre del 2004 a
marzo del 2005).
Posición actual:
•
Profesora ayudante doctor del Departamento de
Bioquímica y Biotecnología de la Universidad Rovira i Virgili, Facultad de Enología, desde diciembre del 2007.
•
Miembro del grupo de investigación de Biotecnología Enológica de la Facultad de Enología de
la URV, dentro de la línea de estudio de las levaduras vínicas.
Ponencias
A lo largo de su carrera investigadora Gemma Beltran
ha colaborado en proyectos sobre el estudio las levaduras y sus requerimientos nutricionales, analizando
los factores que pueden condicionar a una mejora en
la fermentación alcohólica, tanto los que se derivan
del mosto (niveles de nitrógeno disponible) como de
varias prácticas enológicas (fermentaciones a bajas
temperaturas, rehidratación). Sus investigaciones predoctorales se centraron principalmente en el estudio
la represión catabólica por nitrógeno a lo largo de la
fermentación (Beltran et. al. 2004, 2005), así cómo en
el efecto de las bajas temperaturas de fermentación
sobre los cambios en la expresión génica global y el
metabolismo de la levadura vínica (Beltran et al. 2006,
2007, 2008). Además, en su estancia post-doctoral realizada en el grupo de Biología Molecular de levaduras
del profesor Stefan Hohmann (Suecia), estuvo involucrada en estudios de señalización de nutrientes, en
concreto estudiando el metabolismo de la tiamina y la
ruta de la represión catabólica por glucosa, como parte de un proyecto europeo de investigación.
Gemma Beltran es autora o co-autora de un total de
15 publicaciones internacionales y 9 publicaciones nacionales, ha participado en un total de 12 proyectos
investigación o contratos de transferencia, asistido a
22 congresos científicos, dirigido tesis de master y está
actualmente dirigiendo una tesis doctoral.
Actualmente es profesora de Bioquímica y Microbiologia Enológica en la Facultad de Enología, y desde su
reincorporación al grupo de Biotecnología Enológica
de la URV en diciembre de 2007 ha estado colaborado en proyectos de investigación y transferencia con
el sector vitivinícola, centrándose nuevamente en el
estudio de los requerimientos nitrogenados de las levaduras vínicas de primera y segunda fermentación.
5
Capítulo
Resumen:
La cantidad y calidad del componente nitrogenado
de los mostos no determina únicamente un buen
crecimiento de la levadura y una buena capacidad
fermentativa, sino que influye directamente sobre la
síntesis de un buen número de compuestos volátiles
o aromas. En un trabajo de nuestro grupo (Beltran et
al., 2005) comprobamos que las adiciones de nitrógeno asimilable en forma de aminoácidos, y después de
la fase exponencial de crecimiento, aumentaban los
niveles de alcoholes superiores y de algunos ésteres.
En un estudio similar, Vilanova y cols. (2007) observaron también incremento en la síntesis de alcoholes
superiores y en ésteres de acetato cuando los mostos
eran suplementados con concentraciones de amonio
no superiores a los 300 mg/l. Sin embargo, la concentración y fuente nitrogenada no solo tiene influencia
en la síntesis de compuestos con impacto positivo
en las calidades organolépticas de los vinos, sino que
también varios trabajos han señalado una relación
directa entre el nitrógeno asimilable y la síntesis de
sulfhídrico. Otros factores nutricionales y ambientales
relacionados con la síntesis de este compuesto han
sido: la concentración de sulfatos y sulfitos (en forma
de SO2) y la deficiencia en vitaminas (en concreto el
ácido pantoténico y la tiamina).
1. Introducción:
La transformación de la uva en vino es un proceso
biotecnológico donde los microorganismos presentes, fundamentalmente las levaduras, utilizan los nutrientes del mosto para su crecimiento, produciendo
toda una gama de metabolitos que convierten un
líquido empalagoso en una solución hidroalcohólica
de sabor y aroma más agradable. La principal reacción
bioquímica durante la fermentación alcohólica es la
conversión de los azúcares en etanol. Sin embargo, no
es la única. Un pequeño porcentaje de los azúcares
van destinados a la síntesis de metabolitos secundarios (glicerol, succínico, láctico, acético, alcoholes superiores, ésteres, etc), de menor concentración que el
etanol pero que son los determinantes de la calidad
del vino. También hay una pequeña parte de los azúcares del mosto que va destinada a la síntesis de componentes celulares, es decir, a la síntesis de biomasa.
En esta síntesis de biomasa no solo intervienen los
azúcares sino que es imprescindible el componente
nitrogenado.
Aunque el componente nitrogenado es cuantitativamente el segundo nutriente más abundante en
el mosto, presenta una gran desproporción con el
componente carbonatado (azúcares). Mientras que la
suma de glucosa y fructosa se encuentra del orden
de 200 a 300 g/litro, concentraciones de mil veces
menores (200-300 mg/litro) suelen ser valores muy
habituales para el nitrógeno asimilable. Por tanto, son
6
muy frecuentes las situaciones industriales en las que
el nitrógeno se convierte en un factor limitante para
el desarrollo de las levaduras y para la finalización de
la fermentación alcohólica. Son varios los autores que
han tratado de establecer una concentración mínima
donde se pone en peligro la fermentación alcohólica.
Estos valores no coinciden entre los distintos trabajos,
fluctuando de los 120-140 g Nitrógeno asimilable/l
(Bely et al, 1990) hasta los 200 o 267 (Mendes-Ferreira
et al, 2004), es decir más del doble. Dichas diferencias
pueden ser debidas a varios factores, pero entre los
más importantes podemos destacar dos: la cepa de
levadura, perfectamente conocido por los productores de levaduras que incluso las catalogan como con
elevado o bajo requerimiento nitrogenado o nutritivo
y la forma química en que el nitrógeno está disponible en el mosto. Evidentemente otros factores como
la forma de vinificación, variedad de uva, etc. también
son relevantes, pero su efecto se puede considerar
como incluido en la forma química y cantidad de nitrógeno en el medio.
El nitrógeno en el mosto puede estar presente en dos
formas claramente diferenciadas: la inorgánica, básicamente como amonio, y la orgánica, formada por
aminoácidos, péptidos y proteínas. No todas estas formas son igualmente disponibles, ya que, por ejemplo,
los péptidos y las proteínas no se suelen considerar
como auténticas fuentes de nitrógeno, y los aminoácidos son muy variables como fuentes nitrogenadas,
ya que mientras algunos son consumidos ávidamente
(glutamina, por ejemplo), otros no lo son en absoluto
en condiciones anaerobias como la prolina. Curiosamente la prolina, junto con la arginina, son los dos
aminoácidos mayoritarios en mostos. La levadura
necesita la presencia de oxígeno para llevar a cabo
la utilización de la prolina, además este proceso de
metabolización de la prolina se lleva a cabo principalmente en la mitocondria, que se encuentra muy poco
funcional en condiciones fermentativas. Sin embargo,
no se ha estudiado si en condiciones de fermentaciones más aireadas, tales como durante la maceración
en tintos, puede haber un consumo mayor de este
aminoácido. El nitrógeno en forma de amonio suele
ser altamente disponible para las levaduras, por lo que
es una forma química que se suele utilizar de forma
abundante en la industria enológica. La presencia de
nitrógeno en cualquiera de estas formas químicas es
fuertemente variable, dependiendo de diversos factores, entre ellos la variedad, grado de maduración de
la uva, características edafo-climáticas en las que se
desarrolla ésta y diversos aspectos tecnológicos (tipo
de vinificación, prensado, etc).
En resumen, debemos considerar como nitrógeno
asimilable (NA) por las levaduras en las condiciones
de vinificación al amonio como fuente inorgánica
(representa hasta el 40% del NA), y todos los aminoácidos excepto la prolina. Sin embargo, la levadura
vínica Saccharomyces cerevisiae no consume este ni-
Seminario Técnico
Sin embargo, la importancia del nitrógeno no reside
exclusivamente en ser necesario para la formación de
biomasa. El contenido en nitrógeno también tiene
una influencia clara sobre la velocidad fermentativa
(Taillandier et al., 2007). La mayor parte de la fermentación alcohólica se produce en una fase de no proliferación celular o estacionaria. En este punto el nitrógeno del medio es utilizado para el recambio proteico
de los diferentes enzimas celulares. Por último, este
contenido en nitrógeno tiene una influencia manifiesta en los diferentes metabolitos producidos durante la
fermentación, muchos de ellos con un impacto muy
claro en el aroma del vino. A continuación trataremos
en mayor profundidad los diferentes aspectos de la
fisiología y metabolismo celular que se ven afectados
tanto por la cantidad como por la calidad del nitró-
geno del mosto. Especial hincapié dedicaremos a la
síntesis de aromas de reducción o producción de SH2
y otros compuestos derivados del metabolismo del
azufre.
nitrógeno sobre el crecimiento de las
levaduras y su cinética fermentativa.
Varela y cols. (2004) propusieron que la velocidad de
fermentación depende por un lado del estado metabólico de las células y por otro del número de células
alcanzados durante la fermentación alcohólica. Dicho
de otro modo, de la viabilidad (número de células
fermentando) y la vitalidad de cada una de estas células. Ambos componentes tienen una dependencia
importante del nitrógeno disponible en el mosto. En
este punto nos vamos a centrar en como afecta el nitrógeno a la división celular o producción de biomasa
y en el siguiente apartado abordaremos como afecta
a la vitalidad o actividad celular.
Ponencias
trógeno asimilable de manera aleatoria, sino que tiene un orden de preferencia por los distintas fuentes
de nitrógeno. S. cerevisiae ha desarrollado diferentes
mecanismos moleculares que le permiten utilizar preferentemente aquellas fuentes que le permiten crecer
mejor. Este mecanismo de selección de la fuente de
nitrógeno se conoce como “Represión Catabólica por
Nitrógeno (NCR). El NCR se caracteriza porque la célula es capaz de detectar la presencia de las fuentes de
nitrógeno más ricas. Esto desencadena una cadena
de señales, que culmina con la activación de los genes
implicados en el transporte y metabolismo de estas
fuentes ricas y en la represión de aquellos genes implicados en el transporte y utilización de fuentes más
pobres. Una vez consumida las fuentes de nitrógeno
más ricas (amonio, glutamina y asparagina), la levadura activa la maquinaria metabólica para la utilización
de las más pobres (arginina, glutamato, alanina, etc.)
(Figura 1).
En un trabajo reciente de nuestro grupo hemos comprobado como el nitrógeno es el substrato limitante
del crecimiento celular hasta alcanzar valores cercanos a los 200 mg/l, aunque esto depende de la fuente
de nitrógeno utilizada. Para ello hacíamos crecer las
levaduras en un mosto sintético (similar al natural)
donde iba cambiando únicamente la concentración
de N y el tipo de fuente de N. Como puede verse en la
figura 2, el número de células o biomasa (medido por
la densidad óptica (O.D.) a 595 nm) iba aumentando
conforme aumentaba la concentración de nitrógeno,
en este caso en forma de arginina como única fuente
de nitrógeno. Esto fue así hasta niveles de 180 mg de
Figura 1. Representación gráfica del mecanismo de
“Represión Catabólica por Nitrógeno (NCR)” según Cooper (2002)
7
01. Relación entre el contenido nitrogenado en mosto/uva y la síntesis de aromas: efecto sobre la producción de sulfhídrico
Figura 2. Evolución de la OD de la cepa PDM en mosto sintético con arginina como única fuente de
nitrógeno y con concentraciones crecientes entre 20 y 140 mg N/l.
N/l (en la gráfica solo se representa hasta 140 mg de
N/l), por encima de esta cantidad ya no determinamos diferencias en la biomasa obtenida.
Como se comenta anteriormente, no solo tiene importancia la cantidad sino la calidad o tipo de nitrógeno.
En un experimento similar determinamos la biomasa
producida para la misma concentración de diferentes
fuentes de nitrógeno. Como puede verse en la figura
3, la glutamina permite un mayor crecimiento celular
que la arginina, y resulta sorprendente que la menor
cantidad de biomasa producida se obtiene con la utilización de amonio, teóricamente una de las fuentes
de nitrógeno más interesante para la levadura.
Varela y cols (2004) determinaron el efecto que tenía
la cantidad de células en un mosto deficiente en N
(50 mg/l) sobre la velocidad y tiempo de fermentación. Para ello añadían dos y 5 veces más de la dosis
recomendable de levadura seca activa a los mostos. El
resultado fue que en estas fermentaciones, con mayor
concentración de células, se alcanzaban velocidades
de fermentación similares a las obtenidas en un mosto
rico en nitrógeno (300 mg/l). De esta manera mostraban una relación directa entre mayor concentración
de biomasa y mayor velocidad fermentativa en mostos
pobres en nitrógeno. Desde un punto de vista aplicado
para la industria enológica, esto sugiere dos posibles
soluciones frente a un mosto pobre en nitrógeno. La
primera y más habitual solución consiste en la suplementación de los mostos con nitrógeno, fundamentalmente en forma de sales de amonio. Como posible
alternativa, sería la adición de una mayor cantidad de
levadura seca activa o la adición de biomasa de otros
Figura 3. Comparativa de crecimiento en las tres fuentes de nitrógeno
para una cantidad idéntica de 140 mg N/l.
— Amonio
— Arginina
— Glutamina
8
Seminario Técnico
Mendes-Ferreira y col. (2004) también estudiaron
el efecto de diferentes concentraciones de amonio
sobre el crecimiento y la velocidad fermentativa. En
este estudio, y para la cepa PYCC 4072, estos autores
determinaron la producción máxima de biomasa (7,8
g/l) para una concentración de 402,5 mg de N/l. En
concentraciones limitantes de N (66 mg de N/l) la
cantidad de biomasa producida era 3,5 veces menor
(2,2 g/l). Las concentraciones crecientes en N no solo
afectaban a la producción de biomasa, sino a la velocidad de fermentación. Mientras la fermentación con
una cantidad suficiente de N acabo la fermentación
en 5 días, la fermentación limitante en N (66 mg de
N/l) requirió 28 días para su finalización.
En nuestro grupo, para comprobar el efecto que tenía
la adición de nitrógeno durante la fermentación alcohólica, llevamos a cabo un trabajo donde adicionábamos una mezcla de amonio y aminoácidos a mostos
deficientes en N (60 mg/l) en diferentes fases de la
fermentación (Beltran et al., 2005). En concreto, estas
adiciones se hicieron en fermentaciones que estaban
a densidades de 1080 (inicio de una fermentación),
1060 y 1040 (mitad de fermentación) y 1020 y 1000
(final de fermentación). Cuando la adición se realizaba
al principio y mitad de fermentación (hasta 1040 de
densidad), ésta tenía un efecto claro sobre el aumento
de la biomasa (Figura 4). Si se realizaba en las fases
finales (1020 y 1000 de densidad) ya no se registraba
un aumento de la biomasa, pero si que se producía un
aumento de la velocidad de fermentación (Figura 5).
De hecho, la fermentación suplementada a una densidad de 1020 finalizaba la fermentación 5 días antes
que la fermentación no suplementada con N. Estos
resultados mostraban que el mejor momento para la
adición de N era durante el crecimiento exponencial
de la levadura (primeros días de fermentación). En
esta fase tenía un efecto sobre el crecimiento celular y
sobre la velocidad de fermentación.
En este trabajo también determinamos la cantidad
de nitrógeno consumido en las diferentes fermentaciones. Como es de esperar, esta cantidad era mayor
cuanto más temprano en el proceso se adicionaba el
N (Figura 6). En esta misma figura, podemos ver la preferencia de la levadura por el N inorgánico (amonio)
o el orgánico (aminoácidos) en las diferentes fases.
Resultó muy curioso comprobar que el amonio parece ser la fuente de N preferida para la producción de
biomasa (mayor consumo durante las primeras fases)
mientras que apenas era consumida en las últimas
fases de fermentación. Estas diferencias en la proporción de consumo de amonio o aminoácidos también
produjeron diferencias en los perfiles organolépticos
de los distintos vinos, como se explica en los siguientes apartados.
Figura 4. Efecto de la adición de una mezcla de
amonio y aminoácidos (240 mg de N/l) sobre la
producción de biomasa medida como densidad
óptica (O.D. a 600 nm). La densidad a que se
realizaba la adición viene reflejada en el pie de la
figura.
Figura 5. Efecto de la adición de una mezcla de
amonio y aminoácidos (240 mg de N/l) sobre la
velocidad fermentativa, medida como reducción
de la densidad del mosto. La densidad a que se
realizaba la adición viene reflejada en el pie de la
figura.
Ponencias
tanques de fermentación. Aunque un aumento de la
biomasa añadida podría tener efectos sobre el aroma y
sabor del vino (excesivo sabor a levadura).
Figura 6. Consumo de N total, amonio y
aminoácidos (expresados como mg de N/l) en las
distintas fermentaciones.
nitrógeno sobre la cinética fermentativa
Resulta evidente de nuestro anterior trabajo (Beltran
et al., 2005) que el enriquecimiento en N del medio
de fermentación tenía un efecto sobre la cinética
fermentativa, independiente del crecimiento celular.
Algunos autores (Taillandier et al., 2007) confirman
que este efecto estimulador del consumo de azúcares es incluso más importante que el efecto sobre el
crecimiento. Este hecho resulta muy interesante desde el punto de vista industrial si tenemos en cuenta
9
que la mayor parte de la fermentación alcohólica se
produce en la fase estacionaria o de no proliferación
celular. A pesar de que durante este periodo no hay
multiplicación celular, las levaduras necesitan nitrógeno para mantener su metabolismo activo. El medio de
fermentación es un ambiente cambiante y hostil que
requiere una readaptación continua para las nuevas
condiciones. Esta readaptación al medio supone un
recambio proteico continuo en la maquinaria enzimática celular. Para este recambio de proteínas celulares, es necesaria la disponibilidad de nitrógeno en
el medio de fermentación. Taillandier y col. (2007) establecieron la cantidad de nitrógeno consumido por
la levadura por gramo de azúcar consumido (mg N/g
de glucosa o fructosa). Como siempre hay que contar
con las diferentes necesidades de las distintas cepas,
esta cantidad tenía un rango de 0,61 a 0,91 mg de N
por gramo de azúcar. Es decir, una relación mg N/g
azúcar prácticamente asegura cubiertas las necesidades nitrogenadas y es una relación muy sencilla para el
enólogo poder calcular las diferentes necesidades de
sus mostos. Una relación similar establecieron Bisson
y Butzke (2000), pero en este caso, entre necesidad de
N asimilable frente a grado alcohólico probable (GAP)
(figura 7).
Figura 7. Relación entre grado alcohólico probable
(GAP) y cantidad necesaria de N asimilable (mg de
N/l) para alcanzar dicha cantidad (Bisson y Butzke,
2000).
Sin embargo, el aumento de la cinética fermentativa
no debe ser solo entendido por la disponibilidad de
nitrógeno para facilitar el recambio proteico celular,
sino que se ha demostrado que algunas fuentes de
nitrógeno, en concreto el amonio, pueden actuar
como activadores de la actividad de enzimas glucolíticos claves. En concreto, se ha visto un incremento
importante del transporte de azúcares por activación
de las permeasas implicadas (genes HXT) (Bely et al.,
1990). Taillandier y cols (2007) también informaron
de una mayor actividad fructofílica (mayor consumo de la fructosa frente a la glucosa) de la levadura
en presencia de mayor concentración de nitrógeno,
probablemente por un cambio en la afinidad de los
transportadores de hexosas. Igualmente, Berthels y
10
cols (2004) observaron una activación del enzima fosfofructoquinasa, enzima clave de la glucolisis, con la
adición de amonio.
4. Relación entre el contenido en
nitrógeno y la síntesis de compuestos
aromáticos
Además del efecto sobre el crecimiento, la disponibilidad de nitrógeno también tiene un efecto importante
sobre el metabolismo de las levaduras, afectando la
formación de compuestos volátiles y no volátiles, los
cuales son de gran importancia para las calidades organolépticas del vino final (revisado por Alberts y col.
1998, Bell y Henkschke, 2005). La concentración de
compuestos no volátiles como son el glicerol, el ácido málico, ácido succínico o ácido alfa-cetoglutárico,
puede variar dependiendo de la cantidad y la fuente nitrogenada presente en los mostos. Alberts y col.
(1996) observaron, por ejemplo, que la concentración
de glicerol es mayor cuando la ratio nitrógeno amoniacal respecto al nitrógeno orgánico representado
por los aminoácidos. En un trabajo de nuestro grupo
(Beltran y col. 2005) observamos que la concentración
de glicerol disminuye en fermentaciones con limitación de nitrógeno. Esto demuestra que la producción
de glicerol es directamente proporcional a la producción de biomasa.
Muchos de los compuestos volátiles, que son los que
contribuirán al aroma final del vino, también están afectados por el tipo y/o concentración de nitrógeno disponible para la levadura. Los compuestos mayormente
afectados son el ácido acético, los alcoholes superiores,
los ácidos grasos de cadena media y corta y sus ésteres
etílicos, y los esteres de acetato. En la Figura 8 vemos
relación entre la acumulación de algunos compuestos volátiles y la concentración inicial de nitrógeno en
vinos producidos a partir de mosto sintético con dos
cepas Saccharomyces cerevisiae (resultados obtenidos
por Carrau y col. 2007). De este trabajo se desprende
que hay una relación inversa entre crecimiento (o disponibilidad de nitrógeno) y producción de alcoholes
superiores. Mientras que la mayor presencia de nitrógeno parece estimular una mayor producción de ésteres.
Sin embargo, los resultados de este trabajo demuestran que la concentración óptima de nitrógeno para
la síntesis de ésteres depende de la cepa en cuestión.
La cepa KU1 producía su máxima concentración de
ésteres para una concentración de nitrógeno mucho
menor que la cepa M522. Esta última tenía una mayor
producción de estos compuestos.
La carencia en nitrógeno en los mostos es generalmente subsanada mediante adiciones de sales de
amonio. En la Tabla 1 y Figura 9 observamos cómo
afecta también el momento de la suplementación de
nitrógeno a la producción de algunos de estos compuestos.
Seminario Técnico
El contenido en ácido acético varía según la concentración de nitrógeno en el medio, habiendo una relación
inversa entre la cantidad de ácido acético producido y
la disponibilidad de nitrógeno a concentraciones bajas
o moderadas de nitrógeno, pero una relación directa
a concentraciones altas (Bely y col. 2003, HernandezOrte y col. 2006). De hecho, trabajos de Beltran y col.
(2005) y de Vilanova y col. (2007) muestran que a mayor
disponibilidad y consumo de nitrógeno por parte de
la levadura, mayor producción de ácido acético (Figura
9). Esta mayor producción de acético a mayores concentraciones de nitrógeno puede estar relacionada
con una mayor tasa de crecimiento. El acético es producido por las levaduras como substrato para la síntesis
de ácidos grasos, un mayor crecimiento podría justificar una mayor síntesis de acético. Otra posibilidad es
que siempre hay una relación directa entre síntesis de
glicerol y de acético. Por tanto, a concentraciones altas
de nitrógeno se produce más glicerol y, por tanto, más
acético. Resultado similar se observó con la producción
de acetaldehído.
Los alcoholes superiores pueden aportar aromas pesados y desagradables a los vinos si se encuentran en
concentraciones muy altas (excluyendo el 2-feniletanol, que tiene aroma floral). Existe una relación inversa
entre el contenido en alcoholes superiores y la concentración inicial de nitrógeno, excepto por concentraciones muy bajas de nitrógeno (Beltran y col. 2005,
Vilanova y col. 2007, Carrau y col. 2008). Los alcoholes
superiores se pueden formar a partir de aminoácidos
(via de Ehrlich) o a partir del catabolismo de los azúcares (via anabólica) (Figura 10). Esta última es la principal
vía de producción de alcoholes superiores durante la
fermentación alcohólica. Cuando hay poco nitrógeno
disponible en el medio, hay un aumento en la síntesis
de alpha-cetoácidos a partir de azúcares. Estos alfacetoácidos son los precursores en la síntesis de aminoácidos, pero la escasez de nitrógeno alfa-amínico
necesario en la reacción de transaminación, hace que
los alfa-cetoácidos formados se acaben excretando en
el medio en forma de alcoholes superiores, sin llegar
a formar los aminoácidos necesarios. Sin embargo, en
un medio con alto contenido en nitrógeno, el nitrógeno disponible permite la biosíntesis de aminoácidos,
lo que reduce el exceso de alfa-cetoácidos y por tanto
la producción de alcoholes superiores (Oshita y col.,
1995).
Ponencias
Figura 8. Relación entre la acumulación de
algunos compuestos volátiles y la concentración
inicial de nitrógeno en vinos producidos a partir
de mosto sintético con dos cepas Saccharomyces
cerevisiae (cepa M522 () y cepa KU1 ()).
(Carrau y col., 2008)
11
Tabla 1. Relación entre el momento de la adición de nitrógeno y la producción de metabolitos secundarios
por la levadura. Las fermentaciones se realizaron con mosto sintético limitante en nitrógeno (60 mg/l
YAN), al que se añadió 240 mg/l de nitrógeno (mezcla amonio y aminoácidos) en distintos momentos de
fermentación (densidad 1080 g/l o inicio, 1060, 1040, 1020, 1000 g/l y no suplementado). (Beltran y col. 2005)
Figura 9. Relación entre la concentración de
metabolitos secundarios (normalizados con el
valor de mayor producción en cada caso) y el
momento de la suplementación de nitrógeno.
Las fermentaciones se realizaron con mosto
sintético limitante en nitrógeno (60 mg/l YAN),
al que se añadió 240 mg/l de nitrógeno (mezcla
amonio y aminoácidos) en distintos momentos
de fermentación (densidad 1080 g/l o inicio, 1060,
1040, 1020, 1000 g/l y no suplementado).
Figura 10. Ruta de síntesis de alcoholes superiores
a partir de aminoácidos (via de Ehrlich) o a partir
de los azúcares (via anabólica)
Glucosa Vía anabólica o de síntesis Piruvato COOH H C NH2 COOH H C O H C O NADH NAD+ H H C OH R R R R NH3 CO2 Aminoácido Aldehido Alcohol superior �‐
cetoácido Desaminación Descarboxilación Reducción Via de Ehrlich: via catabólica de aas 12
Seminario Técnico
Los esteres de etilo y de acetato muestran una relación más compleja con la disponibilidad de nitrógeno, debido a sus distintos orígenes de síntesis, pero,
en la mayoría de los estudios, el acetato de etilo y los
esteres de acetato están relacionados positivamente
con la concentración de nitrógeno del medio.
4.1 Relación entre el contenido en
nitrógeno y la síntesis de compuestos
azufrados
Las levaduras vínicas pueden formar H2S a partir de
compuestos de azufre inorgánicos (sulfato o sulfito), o
compuestos orgánicos azufrados (cisteína o glutatión).
Normalmente el mosto es deficiente en compuestos
orgánicos azufrados, y esto puede llevar a la levadura
a sintetizar algunos de estos compuestos a partir de
fuentes inorgánicas, normalmente abundantes en el
mosto. En Saccharomyces cerevisiae, la producción
de H2S es el producto de la ruta de la secuencia de
reducción del sulfato (SRS), y es un intermediario en la
biosíntesis de los aminoácidos azufrados (metionina,
y cisteína). (Figura 11).
Varios factores ambientales y nutricionales se han asociado con la producción de H2S en condiciones de vinificación: la cepa de levadura utilizada, la cantidad de
azufre presente en los mostos (ya sea en forma de sulfito o de sulfato), la carencia de vitaminas, y la carencia
o disponibilidad de nitrógeno. Varios estudios se han
centrado en analizar este último punto, el impacto del
nitrógeno en la formación de aromas de reducción o
azufrados.
Para la biosíntesis de los aminoácidos azufrados (cisteína y metionina) se requiere por un lado esqueletos
de carbono que contengan nitrógeno (O-AH: Oacetilhomoserina, O-AS: O-acetilserina), los cuales derivan de un pool intracelular de nitrógeno, y por otro
lado sulfito, que deriva de la ruta de reducción del
Figura 11. Ruta de síntesis de H2S a través de la
secuencia de reducción del sulfato (SRS) y la ruta
de biosíntesis de aminoácidos azufrados (metionina
y cisteína) en S. cerevisiae. Adenosyl 5’-fosfosulfato
(APS), 3’-fosfoadenosil 5’-fosfosulfato (PAPS),
O-acetilserina (O-AS), O-acetilhomoserina (O-AH).
(Swiegers y Pretorius, 2007)
Ponencias
Este efecto ha sido observado experimentalmente
por distintos trabajos. Carrau y col. (2008) muestran
claramente que la cantidad de alcoholes superiores
disminuye con el aumento de nitrógeno disponible,
aunque se observa el efecto inverso en la producción
de 1-propanol (Figura 8d, 8e). Estos hechos también
fueron observados en estudios realizados por nuestro grupo de investigación (Tabla 1, Figura 9). En ellos
vimos que la síntesis de alcoholes superiores disminuye cuando un mosto limitante en nitrógeno se suplementa durante la fase exponencial de crecimiento
de las levaduras, disminuyendo así su periodo de limitación, y lo que lleva también a un mayor consumo
total de nitrógeno que si se suplementa en fases más
tardías de la fermentación. Por otro lado, si el nitrógeno es adicionado en fase estacionaria, después de un
largo periodo de limitación, el contenido en alcoholes
superiores aumenta considerablemente.
sulfato. En carencia de nitrógeno, disminuye el pool
de nitrógeno intracelular y por tanto la síntesis de los
precursores nitrogenados O-AS y O-AH, con lo que el
sulfito producido no podrá utilizarse para la síntesis de
aminoácidos y se excretará en forma de ácido sulfhídrico (SH2). Así pues, el ratio de formación del H2S parece estar regulado por los requerimientos celulares
de aminoácidos azufrados, y por el mantenimiento de
los pools de nitrógeno intracelular.
Jiranek y col. (1995) observaron que en fermentaciones vínicas existe una relación directa entre la limitación de nitrógeno y la síntesis de sulfhídrico. Algunos
de sus resultados se muestran el la Figura 12 y Tabla
2. En la Figura 12 observamos que la producción de
sulfhídrico por parte de la levadura aumenta en el
momento en que el nitrógeno del medio se consume
(en presencia de sulfito). Este efecto es mucho más
pronunciado en fase exponencial de crecimiento,
cuando la levadura tiene más requerimientos nitrogenados, que en fase estacionaria, donde disminuyen
las necesidades nitrogenadas, y también la producción de sulfhídrico. Estos autores relacionaron también este aumento en la producción con la actividad
sulfito reductasa, la cual es mayor en fase exponencial
de crecimiento.
Por otro lado, si un medio limitante en nitrógeno se
suplementa con amonio o con la mayoría de aminoácidos, la producción de sulfhídrico disminuye. Pero
este no es el caso de los aminoácidos azufrados (principalmente Cisteína, de manera individual o en combinación con Metionina), la adición de los cuales da
lugar a un aumento incluso mayor en la producción
de H2S por parte de las levaduras (Tabla 2). Esto es debido a la liberación del sulfhídrico como subproducto
13
Tabla 2. Producción de H2S por parte de la
levadura AWRI77, 6 horas después de haber
suplementado un medio limitante en nitrógeno
con aminoácidos o amonio de manera individual.
La suplementación se realizó una hora antes de
que el nitrógeno inicial fuera consumido. Los datos
están normalizados al valor obtenido por el cultivo
suplementado con amonio (Jiranek y col. 1995)
Figura 12. Relación entre la producción de H2S
y el momento en que se produce la limitación
de nitrógeno durante la fermentación. Las
fermentaciones se realizaron con la cepa AWRI77
en mosto sintético con distintas concentraciones de
nitrógeno inicial: 3.3 (), 16.6 () o 24.9 () mM.
Las flechas indican el momento en que se añadió
sulfito (132 μM) a los medios, 1 hora antes del
consumo total de nitrógeno. (Jiranek y col. 1995)
de la degradación / transaminación de estos aminoácidos para ser utilizados como fuente de nitrógeno.
En un trabajo reciente, Mendes-Ferreira y col. (2009)
analizaron en varias cepas la relación entre la concentración de nitrógeno en el medio y la producción de
varios compuestos aromáticos, entre ellos el ácido
sulfhídrico. Los resultados obtenidos variaban entre
las distintas cepas, la Figura 13 muestra los resultados
de la cepa UCD522, considerada alta productora de
sulfhídrico. La síntesis de H2S se produce en el momento en que se consume el nitrógeno del medio,
pero curiosamente el medio con una cantidad óptima de nitrógeno (267 mg/l), el cual se consume a las
48 horas de fermentación, presenta valores mayores
que el medio muy limitante en nitrógeno (66 mg/l).
El exceso de nitrógeno disminuye la producción de
sulfhídrico, pero este exceso puede provocar por otro
lado la inestabilidad del vino y la producción de otros
compuestos indeseados.
Pero el ácido sulfhídrico no es el único compuesto
azufrado que podemos encontrar en los vinos, a partir
de este compuesto se pueden formar mercaptanos o
tioles, algunos de los cuales aportan olores desagradables a los vinos, los temidos caracteres de reducción. H2S es un compuesto altamente reactivo, y se
Figura 13. Perfil de fermentación y de liberación
de ácido sulfhídrico de la cepa UCD522 en medio
sintético y con distintas concentraciones de
nitrógeno inicial: 66 mg/l (a), 267 mg/l (b) y 402
mg/l (c). (Mendes-Ferreira y col. 2009)
14
Seminario Técnico
puede combinar con otros componentes presentes
en el vino para formar otros compuestos volátiles
azufrados (Vermeulen y col. 2005). Por ejemplo, la reacción del sulfhídrico con el etanol o el acetaldehído
da lugar a etil-mercaptano (con olor a cebolla o gas
natural), y por otro lado la formación de polisulfuros
(dimetil disulfuro, dimetil trisulfuro y dimetil tetrasulfuro) proviene de la oxidación del metantiol, producto de la degradación de la metionina (Swiegers y Pretorius, 2007). La levadura puede luego reducir estos
compuestos disulfuro y formar mercaptanos, con las
consecuencias organolépticas que esto supone.
Sin embargo, a pesar de la mala popularidad que tienen
los compuestos aromáticos azufrados, no todos ellos
aportan características negativas a los vinos, otros pueden llegar a contribuir positivamente, como es el caso
de los tioles volátiles 4-mercapto-4-metilpentanona
(4MMP), 3-mercaptohexanol (3-MH) y 3-mercaptohexilacetato (3MHA), los cuales forman parte de la identidad varietal del vino, especialmente en los vinos de la
variedad Sauvingon Blanc. Estos compuestos azufrados
varietales, se originan por la levadura en fermentación
alcohólica a partir de precursores tiolicos inodoros que
contienen moléculas de cisteína en su estructura (Swiegers y col. 2007). Thibon y col. (2008) demostraron que
en Saccharomyces cerevisiae, la represión catabólica
por nitrógeno controla también la liberación de estos
tioles volátiles a lo largo de la fermentación, reprimiendo probablemente las permeasas de aminoácidos que
permiten la entrada de estos precursores a la célula,
y reprimiendo la expresión del gen IRC7, que codifica
para el principal enzima involucrado en la bioconversión de tioles (cistationa-β-liasa).
Ponencias
Bibliografía
Alberts, E., C. Larsson, G. Liden, C. Niklasson, L.
Gustafsson (1996) Influence of the nitrogen source
on Saccharomyces cerevisiae anaerobic growth and
product formation. Appl Environ Microbiol 62: 31873195
Alberts, E., G. Lidén, C. Larsson, L. Gustafsson
(1998) Anaerobic redox balance and nitrogen metabolism in Saccharomyces cerevisiae. Recent Res. Dev.
Microbiol. 2:253-279.
Bell, S.J., P.A. Henschke (2005) Implications of nitrogen nutrition for grapes, fermentation and wine. Aust.
J. Grape Wine Res. 11:242-295.
Beltran, G., B. Esteve-Zarzoso, N. Rozes, A. Mas, y J.
M. Guillamon. Influence of the timing of nitrogen
additions during synthetic grape must fermentations on fermentation kinetics and nitrogen
consumption. J Agric. Food Chem, 53: 996-1002,
2005.
Bisson,L.F., Butzke,C.E. (2000). Diagnosis and rectifications of stuck and sluggish fermentations. Am.J.Enol.
Vitic. 51, 168-177.
Carrau, F.M., K. Medina, L. Farina, E. Biodo, P.A.
Henschke, E. Dellacassa (2008) Production of fermentation aroma compounds by Saccharomyces
cerevisiae wine yeasts: effects of yeast assimilable nitrogen on two model strains. FEMS Yeast Res. 8:11961207.
Cooper,T.G. (2002). Transmitting the signal of excess
nitrogen in Saccharomyces cerevisiae from the Tor
proteins to the GATA factors: connecting the dots.
FEMS Microbiol.Rev. 26, 223-238.
Hernández-Orte, P., J.F. Cacho, V. Ferreira (2002)
Relationship between varietal aminoacid profile of
grapes and wine aromatic composition. Experimetns
with model solutions and chemometric study. J. Agric.
Food Chem. 50: 2891-2899.
Bely,M., Sablayrolles,J.M., Barre,P. (1990). Automatic detection of assimilable nitrogen deficiencies during alcoholic fermentation in oenological conditions.
J.Ferment.Bioeng. 70, 246-252.
Jiranek V, Langridge P y Henschke PA (1995a) Regulation of hydrogen sulfide liberation in wine-producing Saccharomyces cerevisiae strains by assimilable
nitrogen. Appl Environ Microbiol 61: 461–467.
Bely, M., A. Rinaldi, D. Dubourdieu (2003) Influence
of assimilable nitrogen on volatile acidity production
by Saccharomyces cerevisiae during high sugar fermentation. J. Biosci Bioeng. 96:507-512
Mendes-Ferreira,A., Mendes-Faia,A., Leao,C.
(2004). Growth and fermentation patterns of Saccharomyces cerevisiae under different ammonium concentrations and its implications in winemaking industry. J.Appl.Microbiol. 97, 540-545.
15
Mendes-Ferreira, A., C. Barbosa, V. Falcó, C. Leao,
A. Mendes-Faia (2009) The production of hydrogen
sulphide and other aroma compounds by wine strains
of Saccharomyces cerevisiae in synthetic media with
different nitrogen concentrations. J. Ind. Microbiol.
Biotechnol. DOI 10.10007/s10295-009-0527-x
Oshita, K., M. Kubota, M. Uchida, M. Ono (1995)
Clarification of the relationship between fusel alcohol
formation and amino acid assimilation by brewing fusel alcohol formation and amino acid assimilation by
brewing yeast using 13C-labeled amino acid. Proceedings of the European Brewing Convention. Bruxelles,
387-394.
Swiegers J. H. y I. S. Pretorius (2007) Modulation of
volatile sulfur compounds by wine yeast Appl Microbiol Biotechnol 74:954–960
Thaillandier, P., Ramon-Portugal, F., Fuster, A. y
Strehaiano P. (2007) Effect of ammonium concentration on alcoholic fermentation kinetics by wine
yeasts for high sugar content. Food Microbiology 24:
95-100.
16
Thibon, C., P. Marullo, O. Claisse, C. Cullin, D. Dubourdieu, T. Tominaga (2008) Nitrogen catabolic
repression controls the release of volatile thiols by
Saccharomyces cerevisiae wine fermentation. FEMS
Yeast Res. 1-11.
Varela C, Pizarro F, Agosin E (2004) Biomass content
governs fermentation rate in nitrogen-deficient wine
musts. Appl Env Microbiol 70:3392–3400.
Vermeulen, C., L. Gijs, S. Collin (2005) Sensorial contribution and formation pathways of thiols in foods: a
review. Food Rev. Int. 21:69-137.
Vilanova, M., M. Ugliano, C. Varela, T. Siebert, I.S.
Pretorius, P.A. Henschke (2007) Assimilable nitrogen utilisation and production of volatile and on-volatile compounds in chemically defined medium by
Saccharomyces cerevisiae wine yeasts. Appl. Microbiol.
Biotechnol. 77:145-157.
Seminario Técnico
Ponencias
17
02. Los nuevos retos
en microbiología del
vino.
Levaduras no
productoras de SH2
Isak S. Pretorius
The Australian Wine Research Institute, PO
Box 197, Glen Osmond, Adelaide, SA 5064,
Australia
Contenido
19 Resumen
19 1. Introducción
20 2. Control de la dinámica de la fermentación
de la levadura para mejorar la calidad del vino
21
22
3. Optimización de la fermentación
23
5. Optimización de la calidad del vino: mejora
del aroma deseable, el sabor y el color
24
6. Aumento de las opciones de los vinicultores
mediante el desarrollo de cepas de levaduras
vinícolas mejoradas y novedosas
25
25
25
7. Conclusiones y previsiones futuras
4. Optimización de la calidad del vino: evitar la
producción de sabores y aromas indeseables
8. Agradecimientos
9. Lecturas complementarias
Seminario Técnico
Professor I.S. (Sakkie) Pretorius
Managing Director
The Australian Wine Research Institute Ltd, PO Box
197, Glen Osmond, Adelaide, SA 5064, Australia
Tel.: +61-8-83036610; Fax: +61-8-83036601
E-mail: Sakkie.Pretorius@awri.com.au
Sakkie Pretorius se licenció en la University of the
Orange Free State (Sudáfrica) y obtuvo su doctorado
en genética molecular de levaduras , bajo la dirección del Profesor Julius Marmur en el Albert Einstein
College of Medicine de New York en 1986. En la actualidad es director gerente del Australian Wine Research Institute, localizado en Adelaida. Es además
profesor asociado de la Universidad de Adelaida
Sus investigaciones están centradas en la microbiología y biotecnología del vino. Ha supervisado a 31
estudiantes de Doctorado y 56 estudiantes de Master en Ciencias. Ha publicado más de 200 artículos
de investigación y capítulos de libros, impartido más
de 500 lecciones magistrales y conferencias y es autor de 6 patentes.
Defiende como principio que la investigación del
vino debe perseguir en primer lugar el conocimiento, pero también responder a las necesidades de
productores y consumidores, tanto en la selección
del tema de investigación como en el diseño experimental. Cree que la investigación inspirada en la
búsqueda de conocimiento de los principios fundamentales y en las consideraciones de una aplicación futura es la más poderosa dinamo del progreso
tecnológico y que con una mínima inyección de recursos obtiene una sustancial calidad mejorada del
producto, beneficios en la salud del consumidor y
escaso impacto ambiental.
Un mundo sin levaduras, esos humildes hongos unicelulares que nos ayudan a confeccionar alimentos y
bebidas, también nos negaría la capacidad de hacer
avanzar las fronteras de la ciencia y de la tecnología.
La mayor parte de todo el abanico de funciones desempeñadas por las levaduras es realizada por una sola
especie, la Saccharomyces cerevisiae. De todas sus funciones, esta levadura es bien conocida por su capacidad para impulsar la transformación del mosto en
vino. Si bien la Saccharomyces cerevisiae es conocida
como la levadura vinica, no se pueden considerar todas sus cepas iguales, dadas sus diferencias en el desarrollo de la fermentación y atributos organolépticos.
En la enología moderna, donde es esencial disponer
de fermentaciones rápidas y fiables para producir vinos estables en el tiempo y con estilo predeterminado y una calidad predecible, se prefiere la inoculación
en el mosto de cepas seleccionadas de Saccharomyces cerevisiae. Actualmente seguimos profundizando
en el conocimiento de las interacciones asociadas con
el vino que se producen entre nutrientes, precursores de sabores derivados de la uva, condiciones de la
fermentación y cepas específicas de levaduras. El presente documento aborda cómo los enologos pueden
gestionar correctamente la fermentación a través de
la dinámica de las levaduras en los mostos con el fin
de optimizar su rendimiento y evitar el desarrollo de
sabores y aromas indeseables, y sacar partido de cepas especializadas de levaduras de nuevo desarrollo
y de las estrategias de inoculación para mejorar la generación de sabores.
Ponencias
Resumen
1. Introducción
Imagínese, si puede, un mundo sin levaduras. Imagínese que se encuentra entre las muchas personas
que asumen la comida y la bebida que hay en sus
mesas sin preguntarse cómo ha llegado hasta allí, tan
sana y rica. Imagínese un mundo sin nada para subir la masa al cocer el pan, sin nada con lo que hacer
cerveza, vino o bebidas de alta graduación. Imagínese también un mundo en el que nuestra capacidad
para hacer avanzar las fronteras de la ciencia y de la
tecnología en varios frentes de manera sana y relativamente barata estuviera muy limitada. Y por último
imagínese un mundo con muy pocas alternativas con
las que convertir los residuos agrícolas ricos en azúcar
en bioetanol para el uso como fuentes de energía renovables. Si puede imaginarse todo eso, estará viendo un mundo en el que nuestro avance tecnológico
y nuestro patrón de utilización de energía, nuestra
gastronomía, jovialidad y buen estilo de vida se verían
afectados considerablemente.
Lo que necesitamos y explotamos parar evitar tal
mundo inimaginable es un humilde hongo unicelular
que durante milenios nos ha ayudado a confeccionar
19
02. Los nuevos retos en microbiología del vino. Levaduras no productoras de SH2
alimentos y bebidas, y que en los últimos tiempos ha
sido moldeado por selección artificial para realizar una
más vasta, si cabe, variedad de funciones — primero
como agente de fermentación vital en panificadoras,
fábricas de cerveza, bodegas de vino y destilerías y,
en los tiempos más recientes, como herramienta
científica en los laboratorios de investigación y como
minifábricas para la producción de productos biotecnológicos de “bajo volumen y gran valor” tales como
enzimas, productos químicos, proteínas terapéuticas
y otros productos farmacéuticos importantes comercialmente. Lo que es aún más increíble es que la mayoría de esta gama de diversas funciones es realizada
por una única especie de levadura, la Saccharomyces
cerevisiae. No obstante, de todas estas funciones y
productos, esta extraordinaria levadura es probablemente mejor conocida por su capacidad para transformar la dulce, azucarada y poco sabrosa uva en el
producto distintivo y rico en sabor que conocemos
como vino.
Los términos levadura y fermentación provienen etimológicamente de palabras que se refieren al efecto
de “hervir” o “burbujear” producido cuando el azúcar
se convierte bioquímicamente en alcohol etílico y
dióxido de carbono, pero la fermentación producida
por las levaduras es mucho más que eso. De hecho,
es la responsable de la mayoría de los cambios asociados con la biotransformación del mosto en vino – el
aroma, el sabor, la sensación en el paladar, el color y la
complejidad química son producidos por la levadura
conforme diversifica y amplía su mundo con los productos de su metabolismo.
Tradicionalmente el vino se elaboraba con las de levaduras ambientales que realizaban una fermentación
espontánea; la inoculación deliberada de cultivos de
levaduras puras es una técnica relativamente reciente.
En la fermentación espontánea, existe una sucesión
de levaduras indígenas provcedentes del viñedo y de
la bodega, pero las etapas finales están dominadas de
manera invariable por cepas de Saccharomyces cerevisiae tolerantes al alcohol. Hace mucho tiempo esta
importante especie conocida universalmente como
la levadura del vino, evolucionó su capacidad para fabricar, acumular, tolerar y, bajo ciertas condiciones de
crecimiento, incluso consumir alcohol, mientras que
simultáneamente produce metabolitos que mejoran
el sabor y el aroma, tan importantes en nuestra apreciación sensorial del vino. No obstante no todos los
miembros de la “tribu” Saccharomyces cerevisiae pueden considerarse “iguales”, dado que existen diferencias en su robustez, rendimiento de la fermentación y
en los atributos sensoriales que introducen en el vino
que las hacen únicas.
En la vinicultura moderna, donde es esencial disponer de fermentaciones rápidas y fiables para producir
homogéneamente vino según unas especificaciones
definibles de sabor, unos estilos predeterminados y
20
una calidad predecible, se prefiere la inoculación de
cepas seleccionadas de Saccharomyces cerevisiae en
el mosto. Las funciones principales de estas cepas
seleccionadas son establecer un dominio numérico
y metabólico en la fase temprana de la fermentación
del vino y catalizar la conversión completa y eficiente
de los componentes de la uva a alcohol, dióxido de
carbono y metabolitos que mejoran su sabor y aroma
sin desarrollar sabores y aromas indeseables.
La elección de la cepa de levadura a inocular en el caldo y la gestión eficaz de las interacciones entre la levadura, el mosto y las condiciones de fermentación son
factores importantes que determinan la duración de
la fermentación y la composición química y las propiedades organolépticas de un vino. En los apartados
siguientes se aborda brevemente cómo los enólogos
pueden controlar la dinámica de la levadura en los caldos para optimizar el desempeño de la fermentación
y por tanto evitar el desarrollo de muchos sabores y
aromas indeseables y cómo pueden aprovecharse de
cepas especializadas de reciente desarrollado para
gestionar correctamente la fermentación del vino.
2. Control de la dinámica de la
fermentación de la levadura para mejorar
la calidad del vino
A diferencia de las prácticas microbiológicas en otros
sectores de la industria agroalimentaria, en enología
los microorganismos asociados con las uvas, otras
materias primas y la maquinaria de procesamiento
pueden entrar en el proceso de fermentación e influir
en su eficacia y en la calidad del producto. Las uvas
albergan una gran variedad de levaduras y bacterias
epifíticas y, dependiendo de la adición de sulfitos,
la temperatura de la uva, el tiempo empleado en el
transporte a la bodega, el estado higiénico de las maquinaria de procesamiento de la uvas y los procedimientos de premaceración, prensado y clarificación,
así será la proporción de levaduras que sobreviven en
el zumo o mosto. Estas levaduras pueden proliferar en
el zumo o mosto junto con los microorganismos asociados al equipo de procesamiento dependiendo de
las condiciones fisicoquímicas y de nutrientes.
Las etapas tempranas de la fermentación son dominadas habitualmente por especies poco fermentativas
como la Hanseniaspora uvarum (anamorfo de Kloeckera apiculate), debido a su gran tamaño poblacional
inicial. Con una prevalencia numéricamente inferior a
estas levaduras existen especies de Candida, Cryptococcus, Debaryomyces, Dekkera (anamorfo de Brettanomyces), Issatchenkia, Kluyveromyces, Metschnikowia,
Pichia, Rhodotorula, Saccharomycodes, SchizoSaccharomyces, Torulaspora y ZygoSaccharomyces. Algunas
de las levaduras mejor adaptadas no pertenecientes
al género Saccharomyces tienden a reemplazar a las
especies débilmente fermentativas, pero finalmente
Seminario Técnico
Los tratamientos de clarificación y la aplicación de sulfitos habitualmente reducen el número de levaduras
indígenas y, si inocula un cultivo vigoroso activador,
éste dominará a la microflora indígena. Sin perjuicio
de lo anterior, el uso subóptimo de sulfitos antes de la
fermentación puede, por ejemplo, afectar a la eficacia
de la fermentación y a la calidad del vino. Si las condiciones lo permiten, la Hanseniaspora uvarum indígena
puede desarrollarse rápidamente y eliminar nutrientes
importantes del mosto. Por ejemplo, la tiamina, la cual
es esencial para que las Saccharomyces produzcan
etanol eficazmente, puede consumirse rápidamente. La Hanseniaspora uvarum puede también generar
sabores y aromas no deseables, especialmente ácido
acético y acetato de etilo. Los lactobacilos también
se pueden multiplicar rápidamente y producir ácido
acético junto con otros compuestos antagonistas de
las levaduras, de modo que ralentizan o paran la fermentación. Con el reciente descubrimiento de que
la Dekkera bruxellensis puede estar presente en las
uvas, al menos en la región de Burdeos, la entrada de
esta levadura contaminante en la corriente del vino
ahora es más obvia. Además, el uso de sulfitos aparentemente no afecta a su establecimiento durante la
fermentación dado que posee una tolerancia relativamente alta a este agente antimicrobiano.
A pesar de que los caldos en fermentación espontáneos (levaduras “naturales”, “salvajes” o “silvestres”) habitualmente tardan más en fermentar que los inoculados (y habitualmente más de lo que la mayoría de los
vinicultores están dispuestos a aceptar) y a pesar de
que el resultado de un mosto en fermentación espontánea no siempre es predecible, no existe consenso
entre los vinicultores del mundo sobre si es mejor usar
cultivos iniciales o dejar la fermentación espontánea.
En un extremo se encuentran aquellos que continúan
utilizando levaduras indígenas exclusivamente, dado
que creen que la contribución única de diversas especies de levaduras confiere una complejidad al vino no
vista en fermentaciones inoculadas o guiadas. Otros
prefieren empezar con levaduras nativas y posteriormente inocular un cultivo activador. Otros inician la
fermentación con activadores pero a un nivel de inoculación inferior al recomendado. En la producción
vinícola a gran escala, donde es esencial disponer de
fermentaciones rápidas y fiables para conseguir un
sabor homogéneo y una calidad predecible, se prefiere utilizar cultivos seleccionados de levaduras puras
con una capacidad, un conteo de células viables y una
vitalidad conocidos. Con el fin de obtener los beneficios de la fermentación espontánea y guiada, cada
vez más vinicultores están co-inoculando dos o más
cepas diferentes pero compatibles de Saccharomyces
cerevisiae, o mezclas de cultivos compuestas de una
cepa de Saccharomyces cerevisiae y otra especie de
Saccharomyces o no perteneciente a este género. Se
debe optimizar la proporción de las cepas o especies
seleccionadas en los cultivos de siembra con el fin de
obtener los mejores resultados previstos.
3. Optimización de la fermentación
Cuando se prepara el mosto a partir de uvas sanas y
maduras, con una población baja de microorganismo
indígenas y un buen equilibro de nutrientes, si a este
mosto se inocula un cultivo de levaduras vigoroso,
la fermentación empieza y finaliza rápidamente, dejando una pequeña cantidad de azúcar residual. Bajo
estas condiciones ideales, las fermentaciones subóptimas son relativamente infrecuentes. No obstante,
cuando se producen, es necesario recuperar recursos
considerables y pueden conducir a la pérdida de la
calidad del vino por un deterioro oxidativo, microbiológico o autolítico de las levaduras.
Ponencias
son también reemplazadas por las Saccharomyces, ya
que éstas últimas están mejor adaptadas al elevado
contenido etílico y las condiciones anaeróbicas del
mosto o zumo en fermentación. Saccharomyces cerevisiae es habitualmente la levadura dominante en la
mayoría de las regiones vinícolas del mundo, si bien
la especie criotolerante Saccharomyces bayanus es la
dominante más frecuente en las regiones más frías.
Saccharomyces paradoxus se encuentra en varias regiones frías de Europa del Este.
Se pueden producir fermentaciones subóptimas en
cualquier tipo de vino o producto en fermentación,
y éstas pueden ocurrir incluso cuando se utilizan las
cepas más robustas fisiológicamente hablando. Si
bien las levaduras son enormemente adaptativas al
ambiente del mosto, las condiciones fisicoquímicas
y nutritivas no siempre son favorables para una actividad fisiológica vigorosa y, a menos que la levadura
se pueda adaptar a condiciones cambiantes durante
la fermentación, una reducción del estado fisiológico
puede conducir a una fermentación incompleta.
Habitualmente se observan cuatro tipos de fermentaciones subóptimas: (i) inicio con retraso; (ii) fermentación continuamente lenta; (iii) fermentación ralentizada; y (iv) fermentación incompleta o interrumpida. Las
fermentaciones que comienzan después de un tiempo, pero que a menudo finalizan por ellas mismas de
manera normal, son habitualmente el resultado de la
utilización de un cultivo activador con una calidad deficiente. Las fermentaciones que constantemente son
lentas, que pueden llegar a su finalización, habitualmente son el resultado de una cantidad reducida de
nitrógeno asimilable. Las fermentaciones ralentizadas
e interrumpidas, sin embargo, parecen ser causadas
por varios factores relacionados con las interacciones
entre la fisiología de las levaduras, el estado de los
nutrientes del mosto, la presencia de inhibidores y las
condiciones de fermentación.
Concentraciones elevadas de azúcar en el mosto, lo
cual viene determinado principalmente por la ma-
21
durez de la uva en su vendimia, es probablemente la
causa principal de fermentaciones ralentizadas e interrumpidas, y esto se debe a su vez primordialmente a
la relación entre la concentración inicial de azúcar y la
producción final de etanol; cuanto más azúcar hay en
la uva, más alcohol habrá en el vino. Este problema se
magnifica por la tendencia a utilizar uvas muy maduras o demasiado maduras en las bodegas. Por tanto,
cada vez es más importante elegir cepas de levaduras
con alta tolerancia al etanol.
el aporte de nutrientes. Después de dos a cuatro ciclos
de adaptación al vino en fermentación interrumpida,
el cultivo de rescate altamente adaptado puede finalizar la fermentación en presencia de concentraciones
de etanol y de ácidos grasos volátiles normalmente
inhibidoras. Los procedimientos que mantienen la levadura en suspensión hasta que vuelve a comenzar la
producción de CO2 mejoran más la tasa y la probabilidad de que se complete la fermentación.
El riesgo de que aparezcan problemas de fermentación aumenta cuando el mosto tiene un contenido
subóptimo de nutrientes, especialmente de nitrógeno asimilable y vitaminas. Es importante saber que
estas últimas se pueden perder durante la vendimia
y el procesamiento del mosto. Un elevado índice de
azúcar con respecto a otros nutrientes puede provocar una reducción de la cantidad de biomasa y una
bajada de la velocidad de fermentación, así como el
inicio precoz de la inactivación del transporte de azúcar en las levaduras.
4. Optimización de la calidad del vino:
evitar la producción de sabores y aromas
indeseables
La clarificación del mosto es un factor importante en
la fermentación de vinos blancos debido al profundo
efecto que la disminución de los sólidos de las uvas
tiene sobre la definición de la variedad de la uva, sobre el sabor y aroma del vino y sobre la aparición de
aromas fenólicos indeseables. No obstante, el exceso
de clarificación elimina lípidos importantes necesarios para que las levaduras puedan tolerar el etanol; en
la práctica se adquiere una solución de compromiso
determinada por la experimentación para establecer
el nivel de sólidos de la uva que favorecen una tasa
satisfactoria de fermentación manteniendo la calidad
del vino en un nivel aceptable. La incapacidad de finalizar la fermentación de mostos demasiado clarificados, con una elevada cantidad de azúcar y una fermentación anaeróbica, pueden evitarse parcialmente
introduciendo un paso de aireación breve durante la
fermentación. La aireación, unida a la adición de nitrógeno asimilable después de que haya finalizado la
fase de crecimiento de las levaduras, revigoriza considerablemente la fermentación. Este paso de aireación no tiene un impacto detectable sobre el sabor
del vino e incluso es beneficioso ya que minimiza el
riesgo del desarrollo de sabores y aromas indeseables
que podrían originarse a partir de una fermentación
incompleta.
No obstante, cuando la fermentación se frena debido
a una cantidad elevada de azúcar, el procedimiento
de rescate más exitoso depende de la adaptación secuencial de un cultivo fresco de levaduras a los inhibidores del vino en fermentación interrumpida. Este
procedimiento, que comienza preparando un cultivo
activador de una levadura altamente tolerante al etanol, implica multiplicar sucesivamente por dos el volumen de cultivo, por adición al vino en fermentación
interrumpida, a la vez que se mantienen la aireación y
22
Es importante gestionar los nutrientes de la fermentación con el fin de mantener una tasa de fermentación
vigorosa, alcanzar un punto final de bajo contenido de
azúcar residual y disminuir la producción de sabores y
aromas indeseables. Las uvas cultivadas en regiones
con suelos de bajo contenido orgánico y pocas lluvias
en la temporada de crecimiento pueden contener un
nivel de nutrientes inferior al óptimo, especialmente
de nitrógeno asimilable, el cual es necesario para el
crecimiento de las levaduras y su función metabólica.
Se conoce bien cómo afecta la nutrición del nitrógeno sobre la producción de compuestos volátiles de
azufre. Durante la fermentación de mostos con pocos
nutrientes, la cantidad de nitrógeno asimilable baja
precozmente e induce la producción de sulfuro de
hidrógeno (H2S) debido a la ausencia de compuestos
que capten el sulfuro. En muchos casos se puede controlar la producción de H2S mediante la adición de sales nitrogenadas como el fosfato de diamonio. Otros
estudios sugieren que es necesaria una concentración
de 200 – 250 mg/L de nitrógeno asimilable para minimizar el riesgo de producción de H2S. No obstante,
no todas las cepas comerciales responden a la mejora
del mosto por la adición de fosfato de diamonio, y el
fallo en la respuesta habitualmente indica una deficiencia en el mosto de una o más vitaminas, de ácido
pantoténico, de piridoxina o biotina, los cuales están
implicados en el metabolismo del H2S. La persistencia de problemas por producción de H2S, aún con la
suplementación de nutrientes, requiere la selección
de una levadura de baja producción de H2S en tales
mostos. La ausencia de respuesta sobre el H2S también puede venir originada por la presencia de azufre
elemental residual que no se ha utilizado en la viña
según las recomendaciones del fabricante o cuando
la vendimia se ha realizado prematuramente debido a
condiciones meteorológicas adversas.
El exceso de algunos nutrientes también puede provocar la aparición de sabores y aromas indeseables.
La utilización excesiva de ácido nicotínico, presente
en algunos suplementos nutritivos, se asocia con la
producción de ácido acético. La utilización excesiva
de fosfato de diamonio también puede provocar la
aparición de sabores indeseables. El fosfato de dia-
Seminario Técnico
monio estimula la producción de ésteres, los cuales
en cantidades moderadas pueden ser beneficiosos,
pero cuando la concentración total de ión amonio se
acerca al nitrógeno máximo que la levadura puede
consumir (aprox. 400 – 500 mg/L de nitrógeno asimilable), la producción de acetato de etilo es excesiva
provocando un sabor indeseable debido a este éster
volátil. Como una posible alternativa, existen algunos
datos sobre productos de levaduras inactivadas que
al utilizarse cuando se rehidrata la levadura seca activa
pueden reducir el riesgo de producción de H2S. Dado
que el nitrógeno asimilable afecta tanto sobre la producción de sabores indeseables durante la fermentación, es importante medir el nitrógeno asimilable en
los zumos o mostos antes de la fermentación con el
fin de optimizarlo. En los viñedos con historia de problemas de fermentación, se deben llevar a cabo análisis de nitrógeno en varias temporadas.
A menos que existan condiciones higiénicas deficientes en la bodega, normalmente no se puede detectar
la contaminación por “Brettanomyces” durante la fermentación. Sin embargo, cuando la Dekkera bruxellensis está presente, incluso en un número relativamente
bajo, si el inicio o la terminación de la fermentación
maloláctica tarda mucho, el riesgo de crecimiento
de la D. bruxellensis y la producción de etil fenoles aumenta considerablemente. Las condiciones fisicoquímicas y nutritivas existentes durante la fermentación
maloláctica son favorables para el desarrollo de esta
levadura contaminante, y toda condición que perjudique el desarrollo de la Dekkera bruxellensis también
retrasará el desarrollo de bacterias malolácticas. Por
tanto, para controlar esta levadura contaminante es
obligatorio mantener su tamaño poblacional en un
mínimo inmediatamente después de la fermentación
alcohólica y antes de la inducción de la fermentación
maloláctica. Minimizar los nutrientes residuales, especialmente fructosa y nitrógeno asimilable puede ser
beneficioso para este fin, y la compatibilidad entre la
levadura y las bacterias malolácticas utilizadas para las
fermentaciones primaria y secundaria está resultando
ser un factor importante para el éxito de las fermentaciones malolácticas.
5. Optimización de la calidad del vino:
mejora del aroma deseable, el sabor y el
color
De lo anterior se desprende claramente que existen
muchas herramientas para minimizar el riesgo de desarrollar sabores y aromas indeseables durante la fermentación, pero debemos considerar qué estrategias
podemos emplear para que las fermentaciones proporcionen características positivas al vino.
La rehidratación de la levadura con nutrientes de levaduras inactivas puede estimular la producción de
aromas afrutados. De manera similar, niveles modera-
dos de nitrógeno asimilable, ca. 200 – 350 mg/L, mejora el equilibrio de los ésteres florales con respecto
a los alcoholes de fusel, dotando al vinos de sabores
más frescos y limpios. El fosfato de diamonio estimula la producción de ésteres de acetato especialmente, pero también de etil estéres afrutados, e impide
la producción de alcoholes superiores, los cuales
tienden a afectar negativamente al aroma del vino.
No obstante, se debe tener cuidado de no sobredimensionar la adición de nitrógeno a partir de fuentes como el fosfato de diamonio, ya que, como se ha
indicado anteriormente, esto puede conducir a una
producción excesiva de ésteres de acetato. Es más,
investigaciones recientes indican que la adición de
fosfato de diamonio puede reducir la respuesta de los
precursores responsables de los aromas a frutas tropicales en Sauvignon Blanc y otras variedades similares;
ya que se desfavorece la hidrólisis de conjugados de la
cisteína, por lo que disminuye la producción de tioles
polifuncionales de cadena larga.
Ponencias
Otra herramienta importante que puede ayudar a los
vinicultores a producir vinos con perfiles sensoriales
específicos y según las especificaciones del mercado
es la elección de la cepa de levadura y la estrategia
de inoculación. Por ejemplo, ahora sabemos que la levadura desempeña un papel esencial en la evolución
de moléculas responsables del aroma provenientes
de la propia levadura y de la uva. Las primeras son las
grandes responsables del carácter del vino, e incluyen
metabolitos volátiles de la levadura como ésteres, alcoholes superiores, ácidos, carbonilos y compuestos
de azufre, mientras que las últimas contribuyen a los
caracteres específicos de las variedades. Existen dos
clases importantes de compuestos derivados de la
uva que son precursores del sabor y el aroma: los conjugados de la cisteína y los conjugados con grupo de
enlace de azúcar (o grupo gluco-). Los conjugados de
la cisteína, que están presentes en la variedad Sauvignon Blanc y en variedades relacionadas, son hidrolizados durante la fermentación por la acción de enzimas
carbono-azufre-lasas. Esta hidrólisis libera potentes
tioles volátiles como 4-mercapto-4-metilpentan-2ona (4MMP) y 3-mercaptohexanol (3MH), los cuales
son responsables de aromas a maracuyá, boje, pomelo y grosella negra. Además, el 3MH es esterificado por una alcohol acetiltransferasa codificada por
el gen ATF1 para producir el más potente acetato de
3-mercaptohexilo (3MHA). En unos recientes estudios
de co-fermentación se inocularon dos cepas de levaduras vinícolas en zumo de uva Sauvignon Blanc. Una
cepa hidrolizó el conjugado y la otra esterificó el producto, por lo que las dos se complementaban entre
sí y mejoraban los sabores y aromas de la Sauvignon
Blanc.
Los glucoconjugados no volátiles de las uvas son especialmente importantes para el desarrollo del aroma
de los vinos a partir de variedades de uvas muy aromáticas como la Muscat y la Riesling, y también de al-
23
gunas variedades no aromáticas como la Chardonnay,
la Semillon y la Sauvignon Blanc. Entre los ejemplos de
compuestos derivados de la fruta con sabor y aroma
potenciales se encuentran los alcoholes monoterpenos florales linalool y geraniol, así como los norisoprenoides tales como la β-damascenona. En variedades
no aromáticas, estos sabores y aromas se desarrollan
durante la fermentación, y la acidez del vino, la cual
permite una hidrólisis química de los precursores no
volátiles de aromas lenta, se ha considerando durante
mucho tiempo una ruta importante de la formación
de estos compuestos. No obstante, trabajos recientes
demuestran la existencia de al menos otras cuatros
rutas (en las que están implicadas las levaduras). De
estas, la hidrólisis de glucoconjugados por glucósidos
extracelulares de las levaduras parece ser la más importante cuantitativamente durante la fermentación.
El color es otro atributo sensorial del vino muy importante y, en el vino tino, éste está ampliamente determinado por los antocianinos y pigmentos derivados
de la antocianina. Existen numerosos factores viticulturales y viniculturales implicados en la formación y
en la estabilización del color del vino tinto, no obstante el papel de la levadura solamente se ha estudiado
recientemente. La elección de la cepa de levadura
no sólo afecta a la profundidad del color, sino que
también a su matiz; los tonos rojo-morados. Existe
un estudio en curso para comprender el mecanismo
bioquímico que afecta al desarrollo del color del vino.
Los conocimientos extraídos de este estudió permitirán desarrollar estrategias genéticas para personalizar
cepas de levadura con el fin de ofrecer a los consumidores vinos de un aspecto excepcional.
6. Aumento de las opciones de los
vinicultores mediante el desarrollo de
cepas de levaduras vinícolas mejoradas y
novedosas
Actualmente es indudable que las levaduras desempeñan un papel esencial a la hora de dotar al vino de
sus propiedades sensoriales. Durante siglos de vinicultura se han aislado y utilizado, accidental o deliberadamente, cepas de Saccharomyces cerevisiae por
su capacidad para convertir eficazmente el mosto de
uva en vino a pesar de su exposición a un esfuerzo
osmótico, de nutrientes y etílico. Estas levaduras han
desarrollado una serie de características específicas de
cada cepa, como la producción de diversos sabores y
aromas y diferentes perfiles de utilización de nutrientes, lo cual es reflejo de su historia y ahora puede emplearse para adecuar cepas específicas a las condiciones y estilos concretos de cada vino. Además de esta
diversidad de opciones disponibles en la actualidad,
se han mejorado muchas cepas de levadura vinícola
utilizando métodos genéticos clásicos (mutagénesis,
hibridación, evolución adaptativa), y en los últimos
tiempos mediante ADN recombinate (también cono-
24
cida como tecnología de modificación genética).
A este respecto, el desarrollo de cepas de levaduras
de vino es una fuente importante de una nueva diversidad genética para mejorar las opciones disponibles de los vinicultores. Por ejemplo, la producción de
híbridos intra- e inter-específicos del género Saccharomyces permite la generación de cepas novedosas
de levaduras con las propiedades de fermentación
robusta de la levadura vinícola comercial y las diversas
propiedades sensoriales ofrecidas por otras especies.
El sector está actualmente evaluando desde un punto
de vista vinícola los híbridos interespecíficos de Saccharomyces kudriavzevii y Saccharomyces cariocanus
con Saccharomyces cerevisiae. Se espera que estos híbridos aporten aromas multicapa diferenciadores en
ciertos estilos de vinos.
Otro ejemplo de aplicación satisfactoria de estrategias
sin modificación genética en nuestro programa de
desarrollo de cepas es la producción y la comercialización de cepas novedosas de Saccharomyces cerevisiae con la capacidad de fermentar robustamente y de
producir simultáneamente niveles óptimos de tioles
afrutados deseables y cantidades mínimas de H2S. En
primer lugar, la investigación de los beneficios de las
estrategias de co-inoculación ha contribuido al desarrollo de dos productos comercializados mixtos (una
mezcla de cepas de un proporción específica) que
mejoran los aromas afrutados provenientes de tioles.
En segundo lugar, se han utilizado estrategias sin modificación genética para desarrollar cepas de vino que
fermentan excepcionalmente bien sin producir cantidades detectables de H2S. Estas cepas comerciales
que producen menos H2S obtuvieron resultados excelentes a escala industrial.
Con el fin de empezar a investigar las bases genéticas
de las diferencias entre cepas de la levadura vínica, el
Australian Wine Research Institute (Instituto de Investigación Enológica de Australia) obtuvo el genoma de
una cepa de levadura vinícola y lo comparó con el de
la cepa de Saccharomyces cerevisiae de laboratorio. La
cepa de vino resultó ser muy diferente a su homóloga
de laboratorio. La secuenciación del genoma de otras
cepas industriales proporcionará una visión más profunda de las variaciones presentes en las cepas vinícolas y debería resaltar variaciones comunes y específicas de cepas que puedan asociarse con características
industriales importantes.
Así como las investigaciones fundamentales sobre levaduras pasaron de estrategias clásicas reduccionista
a estudios que implican todo el genoma, estos últimos
pasarán también al siguiente nivel de investigación
biológica conocido como la biología de sistemas. La
denominada revolución -ómica promete, con la ayuda de modelos matemáticos, la consecución de una
comprensión total de las células de la levadura vínica
en toda su complejidad. Esta metodología permitirá el
Seminario Técnico
desarrollo de cepas con una precisión y velocidad sin
rival, y facilitará la utilización a medida del metabolismo de la levadura para satisfacer las cada vez mayores
demandas de los vinicultores y las preferencias siempre cambiantes de los consumidores en un mercado
masificado y sobre-abastecido.
das del mercado en el futuro — y reducir o eliminar
sabores y aromas indeseables.
7. Conclusiones y previsiones futuras
El Australian Wine Research Institute Ltd (AWRI, Instituto de Investigación Enológica de Australia), un
miembro del Wine Innovation Cluster (Grupo de Innovación del Vino) de Adelaida, recibe el apoyo de
viticultores y vinicultores australianos a través de su
agencia de inversiones, la Grape and Wine Research
and Development Corporation (Corporación para la
Investigación y el Desarrollo de la Uva y el Vino), la
cual lo financia según una metodología “matching
funds” con el Gobierno australiano. Me gustaría agradecer la contribución investigadora indicada en este
documento a todos los miembros actuales y pasados
del departamento de biociencia del AWRI: Caroline
Abrahamse, Eveline Bartowsky, Jenny Bellon, Etjen Bizaj, Paul Chambers, Anthony Borneman, Antonio Cordente, Peter Costello, Chris Curtin, Angus Forgan, Paul
Henschke, Wanphen Jitjaroen, Robyn Kievit, Ellie King,
Dariusz Kutyna, Jane McCarthy, Jean Macintyre, Simon
Schmidt, Tina Tran, Hentie Swiegers, Maurizio Ugliano,
Cristian Varela y Gal Winter.
Ponencias
En conclusión, el sector enológico y sus organismos
de investigación están continuamente profundizando
en el conocimiento de las interacciones entre nutrientes, los precursores de sabores derivados de la uva, las
condiciones de fermentación y las cepas específicas
de levaduras para la producción del vino. Existen muchas oportunidades innovadoras abiertas para investigaciones futuras. El sector del vino se centrará en el
desarrollo de la evaluación de nutrientes rápidos y el
control de la fermentación a través de técnicas anteriormente inimaginables como la tecnología del infrarrojo cercano en línea. También mejorarán las cepas
especializadas de la levadura vinícola y las estrategias
de inoculación que puedan potenciar los caracteres
deseables – los vinicultores ahora buscan cepas de
bajo alcohol, tolerantes al etanol y potenciadoras de
sabores deseables, con capacidades bioconservantes
y biosaludables para satisfacer las demandas espera-
8. Agradecimientos
9. Lecturas complementarias
6.
Bellon, J., A. Heinrich & P. Chambers. 2006. Yeast
research increases choice for winemakers and
consumers. Australian & New Zealand Grapegrower & Winemaker (514):102-103.
7.
Bellon, J., L. Rose, B. Currie, J. Ottawa, S. Bell, H.
Mclean, C. Rayment, C. Treacher & P. Henschke.
2008 Summary from the winemaking with nonconventional yeasts workshops, 13th AWITC.
Australian & New Zealand Grapegrower & Winemaker (528):72-77.
8.
Berthels, N.J., R.R. Cordero Otero, F.F. Bauer, I.S.
Pretorius and J.M. Thevelein. 2008. Correlation
between glucose/fructose discrepancy and
hexokinase kinetic properties in different Saccharomyces cerevisiae wine yeast strains. Applied
Microbiology and Biotechnology 77:1083-1091.
Bauer, F.F. & I.S. Pretorius. 2000. Yeast stress response and fermentation efficiency: how to survive the making of wine – A review. South African
Journal of Enology and Viticulture 21:27-51.
9.
Bisson, L.F. & C.E. Butzke. 2000. Diagnosis and
rectification of stuck and sluggish fermentations.
American Journal of Enology and Viticulture
51:168-177.
Bell, S.J. & P.A. Henschke. 2005. Implications of
nitrogen management for grapes and wine.
Australian Journal of Grape and Wine Research
11:242-295.
10. Bisson, L.F. 1999. Stuck and sluggish fermentations. American Journal of Enology and Viticulture 50:107-119.
1.
Alexandre, H., P.J. Costello, F. Remize, J. Guzzo, &
M. Guilloux-Benatier. 2004. Saccharomyces cerevisiae–Oenococcus oeni interactions in wine: current knowledge and perspectives. International
Journal of Food Microbiology 93:141–154.
2.
Bartowsky, E.J. & I.S. Pretorius. 2009. Microbial formation and modification of flavour and off-flavour compounds in wine. In: H. König, G. Unden
& J. Frölich (eds.), Biology of Microorganisms on
grapes, in must and wine. Springer, Heidelberg,
Alemania. Capítulo 11, pp. 209-231.
3.
Bataillon, M., A. Rico, J.-M. Sablayrolles, J. -M. Salmon & P. Barre. 1996. Early thiamin assimilation
by yeasts under enological conditions: impact of
alcoholic fermentation kinetics. Journal of Fermentation and Bioengineering 82:145–150.
4.
5.
25
11. Bohlscheid, J.C., J.K. Fellman, X.D. Wand, D. Ansen
& C.G. Edwards. 2007. The influence of nitrogen
and biotin interactions on the performance of
Saccharomyces in alcoholic fermentation. Journal of Applied Microbiology 102:390–400.
12. Borneman, A.R., P.J. Chambers & I.S. Pretorius.
2007. Yeast Systems Biology: modelling the
winemaker’s art. Trends in Biotechnology 25:349355.
13. Borneman, A.R, P.J. Chambers & I.S. Pretorius.
2009. Systems biology as a platform for wine
yeast strain development. In: H. König, G. Unden
& J. Frölich (eds.), Biology of Microorganisms on
grapes, in must and wine. Springer, Heidelberg,
Alemania. Capítulo 22, pp. 395-414.
14. Borneman, A.R., A.H. Forgan, P.J. Chambers & I.S.
Pretorius. 2008. Unravelling the genetic blueprint
of wine yeast. Australian and New Zealand Wine
Industry Journal 23:21-23.
15. Borneman, A.R., A. Forgan, P.J. Chambers & I.S.
Pretorius. 2008. Comparative genome analysis
of a Saccharomyces cerevisiae wine strain. FEMS
Yeast Research 8:1185-1195.
16. Borneman, A.R, P.J. Chambers & I.S. Pretorius. 2009.
The way forward: modelling the winemaker’s art
using yeast systems biology. In: P. Romano & G.H.
Fleet (eds.), Yeast in Wine Fermentation. Springer,
Heidelberg, Alemania (en prensa).
17. Boulton, R.B., V.L. Singleton, L.F. Bisson & R.E.
Kunkee. 1998. Principles and Practices of Winemaking. USA: Aspen Publishers, Inc.
18. Chambers, P.J., Bellon, J.R., Schmidt, S.A., Varela,
C. & Pretorius, I.S. 2008. Non-genetic engineering
approaches to isolating and generating novel
yeasts for industrial applications. In: G. Kunze & T.
Satyanarayana (eds.), Diversity and Potential Biotechnological Applications of Yeasts. Elsevier (en
prensa).
19. Cordente, A.G., A. Heinrich, I.S. Pretorius & J.H.
Swiegers. 2009. Isolation of sulfite reductase
variants of a commercial wine yeast with significantly reduced hydrogen sulfide production.
FEMS Yeast Research (en prensa).
20. Curtin, C.D., J.R. Bellon, A.D. Coulter, G.D. Cowey,
E.M.C. Robinson, M.A. de Barros Lopes, P. W. Godden, P.A. Henschke & I.S. Pretorius. 2005. The
six tribes of ‘Brett’ in Australia: Distribution of genetically divergent Dekkera bruxellensis strains
across Australian winemaking regions. Australian
and New Zealand Wine Industry Journal 20:2835.267:159-166.
26
21. De Barros Lopes, M., J.R. Bellon, N.J. Shirley & P.F.
Ganter. 2002. Evidence for multiple interspecific hybridization in Saccharomyces sensu stricto
species. FEMS Yeast Research 1:323-331.
22. Edwards, C. & J.C. Bohlscheid. 2007. Impact of
pantothenic acid addition on H2S production
by Saccharomyces cerevisiae under fermentative conditions. Enzyme & Microbial Technology
41:1–4.
23. Eglinton, J.M. & P.A. Henschke. 1993. Can the
addition of vitamins during fermentation be justified? Australian Grapegrower and Winemaker
(352):47–49,51–52.
24. Eglinton, J.M. & P.A. Henschke. 1999. Restarting
incomplete fermentations: the effect of high
concentrations of acetic acid. Australian Journal
of Grape and Wine Research. 5:71–78.
25. Fleet, G.H. 2003. Yeast interactions and wine flavour. International Journal of Food Microbiology
86:11-22.
26. Gockowiak, H. & P.A. Henschke. 1992. Nitrogen
composition of grape juice and implications for
fermentation: results of a survey made in N-E Victoria. Australian & New Zealand Grapegrower&
Winemaker (340):131, 133–138.
27. Henschke, P.A. 1997. Stuck fermentation: causes,
prevention and cure. Allen, M.; Leske, P.; Baldwin,
G., eds. Advances in juice clarification and yeast
inoculation: proceedings of a seminar; 15 August
1996; Melbourne, Vic. Adelaide S.A: Australian Society of Viticulture and Oenology; 1997: 30–38,
41.
28. Henschke, P.A. & V. Jiranek. 1991. Hydrogen sulfide formation during fermentation: effect of nitrogen composition in model grape must. Rantz,
J.M., ed. Proceedings of the international symposium on nitrogen in grapes and wine; 18-19
June 1991; Seattle, Washington, USA. Davis, CA:
American Society for Enology and Viticulture; pp.
172-184.
29. Houtman, A.C. & C.S. Du Plessis. 1981. The effect
of juice clarity and several conditions promoting
yeast growth on fermentation rate, the production of aroma components and wine quality.
South African Journal of Enology and Viticulture
2:71–81.
30. Howell, K.S., J.H. Swiegers, G.M. Elsey, T.E. Siebert,
E.J. Bartowsky, G.H. Fleet, I.S. Pretorius, & M.A. de
Barros Lopes. 2004. Variation in 4-mercapto-4methyl-pentan-2-one release by Saccharomyces
cerevisiae commercial wine strains under diffe-
Seminario Técnico
31. Jolly, N.P., O.P.H. Augustyn & I.S. Pretorius. 2006.
The role and use of non-Saccharomyces yeasts in
wine production. South African Journal of Enology and Viticulture 27:15-39.
32. King, E.S., J.H. Swiegers, B. Travis, I.L. Francis, S. Bastian & I.S Pretorius. 2008. Coinoculated fermentations using Saccharomyces yeasts affect the volatile aroma composition and sensory properties
of Vitis vinifera L. cv. Sauvignon Blanc wines. Journal of Agricultural and Food Chemistry 56:1082910837.
41. Pretorius, I.S. & P.B. Høj. 2005. Grape and Wine
Biotechnology: Challenges, opportunities and
potential benefits. Australian Journal of Grape
and Wine Research 11:83-108.
42. Renouf, V., A. Lonvaud-Funel & J. Coulon. 2007.
The origin of Brettanomyces bruxellensis in wines: A review. Journal International des Sciences
de la Vigne et du Vin. 41:161-173.
43. Sablayrolles, J.M., C. Dubois, C. Manginot, J.L.
Roustan & P. Barre. 1996. Effectiveness of combined ammoniacal nitrogen and oxygen additions
for completion of sluggish and stuck fermentations. Journal of Fermentation and Bioengineering 82:377-381.
33. Le Jeune, C., M. Lollier, C. Demuyter, C. Erny, J.L.
Legras, M. Aigle & I. Masneuf-Pomarede. 2007.
Characterization of natural hybrids of Saccharomyces cerevisiae and Saccharomyces bayanus
var. uvarum. FEMS Yeast Research 7:540–549
44. Salmon, J.M. 1989. Effect of sugar transport inactivation in on sluggish and stuck oenological
fermentations. Applied and Environmental Microbiology 55:953-958.
34. Lilly, M., M.G. Lambrechts & I.S. Pretorius. 2000.
The effect of increased yeast alcohol acetyltransferase activity on the sensorial quality of wine
and brandy. Applied and Environmental Microbiology 66: 744-753.
45. Schmidt, S.A., T. Tran, P.J. Chambers, M.J. Herderich & I.S. Pretorius. 2006. Developing indicators
of wine yeast performance: an overview of the
impact of ethanol stress. Australian and New
Zealand Wine Industry Journal 21:24-30.
35. Lilly, M., G. Styger, F.F. Bauer, M.G. Lambrechts &
I.S. Pretorius. 2006. The effect of increased yeast
branched-chain amino acid transaminase activity and the production of higher alcohols on the
flavor profiles of wine and distillates. FEMS Yeast
Research 6:726-743.
46. Subileau, M., R. Schneider, J.-M. Salmon & E.
Degryse. 2008. Nitrogen catabolite repression
modulates the production of aromatic thiols
characteristic of Sauvignon Blanc at the level of
precursor transport. FEMS Yeast Research (en
prensa).
36. Lilly, M., F.F. Bauer, M.G. Lambrechts, J.H. Swiegers,
D. Cozzolino & I.S. Pretorius. 2006. The effect of
increased alcohol acetyl transferase and esterase
activity on flavor profiles of wine and distillates.
Yeast 23:641-659.
47. Swiegers, J.H., E.J. Bartowsky, P.A. Henschke & I.S.
Pretorius. 2005. Yeast and bacterial modulation
of wine aroma and flavour. Australian Journal of
Grape and Wine Research 11:139-173.
37. Molina, A.M, J.H. Swiegers J.H, C. Varela, I.S. Pretorius & E. Agosin. 2007. Influence of wine fermentation temperature on the synthesis of yeastderived volatile aroma compounds. Applied
Microbiology and Biotechnology
38. Monk, P.R. 1986. Rehydration and propagation of
active dry wine yeast. Australian Wine Industry
Journal 1:3-5.
39. Pretorius, I.S. 2000. Tailoring wine yeast for the
new millennium: novel approaches to the ancient art of winemaking. Yeast 16: 675-729.
40. Pretorius, I.S. & F.F. Bauer. 2002. Meeting the consumer challenge through genetically customised wine yeast strains. Trends in Biotechnology
20:426-432.
Ponencias
rent wine fermentation conditions. FEMS Microbiology Letters 240: 125-129.
48. Swiegers, J.H., D. Capone, G. Elsey, M.A. Sefton, I.L.
Francis, & I.S. Pretorius. 2007. Engineering volatile
thiol release in Saccharomyces cerevisiae for improved wine aroma. Yeast 24:561-574.
49. Swiegers, J.H., I.L. Francis, M.J. Herderich, & I.S.
Pretorius. 2006. Meeting consumer expectations
through management in vineyard and winery:
The choice of yeast for fermentation offers great
potential to adjust the aroma of Sauvignon Blanc
wine. Australian and New Zealand Wine Industry
Journal 21:34-42.
50. Swiegers, J.H. & I.S. Pretorius. 2007. Modulation of
volatile sulfur compounds by wine yeast. Applied
Microbiology and Biotechnology 74:954-960.
51. Swiegers, H., M. Ugliano, T. van der Westhuizen
& P. Bowyer. 2008. Impact of yeast rehydration
on the aroma of Sauvignon Blanc wine. Austra-
27
lian & New Zealand. Grapegrower Winemaker 54. Torrea, D., & P.A. Henschke. 2004. Ammonium su(528):68–71.
pplementation of grape juice-effect on the aroma
profile of a Chardonnay wine. Technical Review
52. Swiegers, J.H, S.M.G. Saerens & I.S. Pretorius I.S.
150:59–63.
2008. The development of yeast strains as tools
to adjust the flavour of fermented beverages to 55. Ugliano, M., P.A. Henschke & I.S. Pretorius. 2007.
market specifications. In: D.H. Frenkel & F. BelanNitrogen management is critical for wine flavour
ger (eds.), Biotechnology in Flavour Production.
and style. Australian and New Zealand Wine InBlackwell Publishing, Oxford, Reino Unido. Capídustry Journal 22:24-30.
tulo 1, pp.1-55.
56. Vilanova, M., M. Ugliano, C. Varela, T. Siebert, I.S.
Pretorius & P.A. Henschke. 2007. Assimilable ni53. Swiegers J.H., R.L. Willmott, T.E. Siebert, K. Lattey,
trogen utilisation and production of volatile and
B.R. Bramley, I.L. Francis, E.S. King & I.S. Pretorius.
non-volatile compounds in chemically defined
2009. The influence of yeast on the aroma of Saumedium by Saccharomyces cerevisiae wine yeasts.
vignon Blanc wine. Food Microbiology 26:204Applied Microbiology and Biotechnology 77:145211.
157.
28
Seminario Técnico
Ponencias
29
03. La microoxigenación
de vinos tintos:
Control de la
reducción y
estabilización
del color
Prof. Encarna Gómez Plaza
Universidad de Murcia
Contenido
31 La reactividad del oxígeno en los vinos
32 La técnica de la micro-oxigenación
35 Bibliografía
Seminario Técnico
Dra. Encarna Gómez Plaza
Doctora por la Universidad de Murcia (1992). Fue becaria predoctoral en el Departamento de Viticultura
y Enología del CIDA (actual Instituto Murciano de
Investigación y Desarrollo Agroalimentario) siendo
el tema de la tesis doctoral el estudio de los componentes volátiles de uvas y vinos. Realizó su estancia
post-doctoral en Fresno (Califormia, EE.UU.), contratada por el Agricultural Research Service y la California Raisin Advisory Board para realizar un proyecto
de investigación sobre la presencia de tricloroanisoles en uvas pasas. Volvió a España con un contrato de
reincorporación de Doctores y Tecnólogos incorporándose de nuevo al CIDA donde durante tres años
continuó trabajando en uvas y vinos, centrándose en
la caracterización polifenólica y cromática de éstos
(1994-1996). Se incorporó a la Universidad de Murcia
en 1997, primero como Profesor Ayudante, posteriormente como Profesor Titular del área de Tecnología de Alimentos y desde el 2007 como Catedrática
de Universidad. Ha dirigido numerosos proyectos de
investigación con financiación regional y nacional,
relacionados con el estudio de uvas y vinos. Es autora de un alto número de publicaciones científicas en
revistas tanto de divulgación como de alto impacto
científico y revisora de algunas de las mejores revistas científicas de tecnología de alimentos.
Actualmente, su área de investigación se centra sobre todo en el estudio de las características cromáticas de uvas y vinos. Los dos últimos proyectos en
los que se encuentra trabajando son el estudio del
efecto de la micro-oxigenación de vinos y la crianza
de estos (barrica y virutas) sobre la evolución y estabilidad del color y en el diseño de nuevas estrategias
para la extracción de compuestos fenólicos de las
uvas durante la vinificación.
El oxigeno juega un papel importante en diversos
procesos bioquímicos en los mostos y en los vinos,
tanto durante la fermentación alcohólica como en
postfermentación, e incluso durante el embotellado.
Su presencia modifica el estado redox de los vinos, lo
que conlleva cambios que pueden afectar positiva o
negativamente a la calidad de los vinos. Para una correcta gestión del oxígeno es necesario conocer como
éste actúa en el vino, particularmente en el control de
la actividad de las levaduras, manejo de los olores azufrados y estabilización del color de los vinos tintos.
La presencia de oxígeno en el vino provoca una oxidación, un proceso donde hay una transferencia de
electrones. En el vino, el oxígeno es reducido a ciertos
intermedios y finalmente a H2O2 y a H2O Considerando la cantidad de oxígeno que un vino puede tomar
(de 60 a 600 ml/l, de acuerdo con Singleton, 1986),
está claro que no hay otros compuestos oxidables en
el vino en cantidad suficiente que no sean los compuestos fenólicos. Por lo tanto, éstos serán los principales implicados en los fenómenos de oxidación de
los vinos.
Ponencias
La reactividad del oxígeno en los vinos
El oxigeno tiene una limitada reactividad en su forma
molecular. El potencial oxidante del oxigeno se debe
a la generación de especies reactivas del oxígeno. Así,
la transferencia inicial de un electrón lleva a la formación de O2- que al pH del vino existe como radical hidroxiperóxido. Este paso requiere un catalizador, preferentemente un metal como Fe. La transferencia de
un segundo electrón producirá un peróxido (en vino
H2O2). La siguiente reducción crea un agente oxidante incluso más reactivo que los anteriores, el radical
hidroxilo. La última reacción produce agua como producto final de la reducción del oxígeno
Adaptado de Waterhouse y Laurie, 2006
Los radicales formados durante este proceso intermedio pueden ser directamente reducidos por los fenoles y son mejores oxidantes que el oxígeno (Waterhouse y Laurie, 2006).
Los principales productos secundarios de la reducción
del oxígeno en el vino serán quinonas y aldehídos, fundamentalmente el acetaldehído. Las quinonas pueden participar en reacciones de polimerización que
llevarán a la formación de grandes polímeros, normal-
31
03. La micro-oxigenación de vinos tintos: Control de la reducción y estabilización del color
La técnica de la micro-oxigenación
Adaptado de Waterhouse y Laurie, 2006
mente de color pardo, responsables del pardeamiento. Pero también, las quinonas pueden reaccionar y
formar aductos con otros compuestos del vino, como
los tioles, contribuyendo al control del problema de
reducción en los vinos (Waterhouse y Laurie, 2006; Vidal y Aagaard, 2008). Los aldehídos, en el caso del vino
tinto sobre todo, pueden participar en reacciones que
serán de interés pues favorecen la estabilización del
color de los vinos (Timberlake y Bridle, 1976).
Ya se había observado desde hace tiempo una diferencia importante entre los resultados en el vino de
una oxidación lenta frente a una oxidación rápida,
que sugiere la existencia de unas reacciones adicionales, que ocurren de forma lenta y que aumentan el
conjunto de sustratos oxidables en el vino (Singleton,
1986). Así, lentamente, dos semiquinonas radicales se
pueden unir covalentemente. Este proceso se llama
polimerización regenerativa y lleva a la generación de
una hidroquinona reoxidable. Tiene un potencial de
reducción menor que sus constituyentes originales e
incrementará la capacidad de tomar oxígeno del vino.
Es decir, la polimerización regenerativa lenta lleva a
unidades no oxidables (quinonas) a incorporarse en
hidroquinonas reoxidables lo que incrementará los
sustratos oxidables del vino y protegerá a los sustratos
originales. Si el oxigeno se añade rápidamente, esta
reacción no ocurre, se agotan también rápidamente
los fenoles para reaccionar, con formación de muchas
quinonas y, por tanto, el pardeamiento de los vinos.
Estas observaciones pueden ser la base científica que
explica los resultados de la micro-oxigenación, técnica que nació en la década de los 90. Está basada en el
aporte controlado de pequeñas cantidades de oxígeno al vino mediante un microdifusor poroso, de forma
continua y lenta, siendo la velocidad de aporte de oxigeno inferior a la velocidad de consumo, evitando la
acumulación de éste en el vino. Los efectos positivos
de la micro-oxigenación sobre los vinos tintos se pueden resumir en:
•
Estabilización del color
•
Reducción de olores a reducción y sabores herbáceos
•
Suavización del vino por disminución de astringencia
Estos efectos se deben a la formación de esos productos finales de la oxidación en los vinos. Así, las quinonas formadas pueden fijar compuestos azufrados y
contribuir a la disminución de los “olores a reducción”
en los vinos. Además, las quinonas formadas pueden
comenzar un proceso de polimerización de compuestos fenólicos, lo que puede modificar el sabor y
la astringencia de los vinos. De igual forma, otro de
los productos que aparecen, el acetaldehído, participa en las reacciones de estabilización de color de los
vinos tintos a través de la formación de compuestos
fenólicos unidos por puente de etilo (tanino-tanino y
antociano-tanino fundamentalmente) y favoreciendo
la formación de piranoantocianos, compuestos más
estables que los antocianos nativos de los vinos.
a) Control de la reducción
Uno de los motivos por los que a este defecto se le llama olor a reducción es por que normalmente aparece
Compuestos azufrados de bajo Pm
Descripción del olor
Umbral olfatorio
(ppb)
Sulfuro de hidrógeno (H2S)
Huevos podridos
1
Metanotiol (MeSH)
Goma quemada, putrefacción
1,5
Etanotiol (EtSH)
Cebolla, goma, terroso
1,5
Sulfuro de dimetilo (DMS)
Col cocida, esparragos
25
Sulfuro de dietilo (DES)
Ajo, goma
1
Disulfuro de carbono (CS2)
Dulce, goma, azufrado
5
Disulfuro de dimetilo (DMDS)
Vegetal, col, cebolla
(a alta concentración)
10
Disulfuro de dietilo (DEDS)
Olor desagradable, cebolla
4
Metil tioacetato (MeSAc)
Azufrado, huevo, queso
40
Etil tioacetato (EtSAc)
Azufrado, cebolla, ajo
70
Metionol
Col cocida
1200
Adaptado de Vidal y Aagaard, 2008
32
Seminario Técnico
El azufre tiene varias formas reducidas en el vino:
- H2S, que se produce naturalmente durante la fermentación alcohólica y cuya formación se debe intentar controlar, sobre todo al final de la fermentación
alcohólica o formará otros compuestos azufrados,
- los tioles, que se forman normalmente al final del
fermentación alcohólica y en postfermentación y poseen un umbral de percepción bastante bajo y,
- sulfuros y disulfuros, que se forman durante todo el
proceso de vinificación y por la oxidación de tioles en
vinos terminados, tienen los umbrales de percepción
mas altos por lo que son menos problemáticos pero
son más difíciles de eliminar y en botella pueden revertir a tioles.
El H2S es un intermediario en la biosíntesis de compuestos azufrados requeridos por las células para el
crecimiento celular y su funcionamiento. El azufre en
forma de SO42-, S, SO32- entra en la célula y se reduce a sulfuro a través de dos pasos activados por ATP.
En este momento el sulfuro se combina enzimaticamente con precursores que contienen nitrógeno para
formar cisteina y metionina. En ausencia de nitrógeno
intracelular lo que se forma es un exceso de H2S que
no se incorpora a los aminoácidos sino que se libera
al vino (Zoecklein, 2006). En otros casos, un suministro
suficiente de nitrógeno también puede llevar a altas
cantidades de H2S, debido a la carencia de otros nutrientes y otros efectos no tan conocidos.
Hay una serie de medidas que se pueden tomar para
intentar controlar la formación de estos compuestos
azufrados, tanto antes de la fermentación alcohólica
(evitar uvas tratadas con S o Cu en fechas cercanas
a vendimia, añadir cantidades justas de SO2), como
en las primeras etapas de la fermentación alcohólica
(utilizar nutrientes para las levaduras y cepas seguras,
temperaturas moderadas de fermentación) y en las
últimas etapas de fermentación (evitar el uso de SO2,
mantener la sanidad de las levaduras..).
También el oxígeno puede tener un papel importante
en este control. El oxigeno añadido al mosto en fermentación (como macro-oxigenación o micro-oxigenación) limita el impacto de compuestos azufrados
volátiles de dos formas: a) permitiendo que la levadura sintetice ácidos grasos y esteroles y así soporta
mejor el estrés y b) incrementando el potencial redox
y reduciendo la presencia de azufrados volátiles. Otro
efecto del oxígeno es que puede reaccionar con el
H2S y formar S y agua. El azufre se eliminará después
por medio de los trasiegos.
En postfermentación también se puede utilizar el oxígeno para controlar los problemas de reducción y los
compuestos azufrados volátiles. Los compuestos azufrados son sensibles al oxígeno y el aporte de oxígeno
reducirá su concentración. Comúnmente se acepta
que la reacción que ocurre es (Zoecklein, 2007):
CH3-SH
0.2 ppb
O2
H3C-S-S-CH3
12 ppb
Como se observa, los compuestos azufrados no desaparecen sino cambian a otras formas con umbrales
de percepción más altos. Pero esta reacción es reversible y en ambiente reductor se puede volver a formar
tioles.
Ponencias
cuando el potencial redox del vino es bajo y se debe
normalmente a la aparición de compuestos azufrados
volátiles, generalmente descritos como olor a goma
quemada, pútridos, huevos podridos, cebolla, col,
ajo..... aunque no hay que olvidar que entre los compuestos azufrados volatiles existen algunos como el
3-mercaptohexanol o 3-mercaptohexil acetato que
imparten aromas afrutado positivos al vino (Zoecklein, 2006).
Pero no hay que olvidar que otra reacción es posible
en presencia de oxígeno y es la reacción entre las quinonas formadas por oxidación de fenoles con los grupos –SH de los compuestos azufrados (Waterhouse y
Laurie, 2006).
Así, estudios realizados micro-oxigenando vinos tintos
han mostrado que los vinos con micro-oxigenación
tenían menos niveles de metanotiol y etanotiol que
los vinos testigo, disminuyendo su concentración por
debajo de su umbral aromático y además no se detectó acumulación de disulfuros (McCord, 2003).
Es muy importante mantener el suficiente aporte de
oxigeno para producir continuamente quinonas que
atrapen las nuevas moléculas azufradas que se pueden ir formando durante el envejecimiento del vino,
tanto por hidrólisis de tioésteres o por condiciones
anaerobias.
b) Mejora de la estabilidad del color
La importancia del oxígeno en la evolución del color
del vino tinto ya se conoce desde hace tiempo, tanto con respecto a la oxidación de polifenoles como
la la formación de nuevos compuestos más estables
derivados de los antocianos. Entre las reacciones que
ocurren como consecuencia de la presencia de oxígeno hay que incluir los cambios en la longitud de las
cadenas de taninos, que afecta a la astringencia, y la
formación de piranantocianos y compuestos unidos
por puente de etilo (por la presencia de acetaldehído)
33
03. La micro-oxigenación de vinos tintos: Control de la reducción y estabilización del color
Figura. Comparación de la concentración de
etanotiol, metanotiol y dimetilsulfuro en vinos
control, micro-oxigenados, micro-oxigenados
y con aplicación de duelas de roble y microoxigenados y con aplicación de segmentos de
roble (adaptado de McCord, 2003).
antocianos-taninos sea correcta y haya una cantidad
importante de antocianos libres. Si no hay suficientes
antocianos libres en el vino para reaccionar se puede
acumular acetaldehído y verse favorecida la polimerización de taninos, hasta que las moléculas formadas
sean tan grandes que precipiten. Los diversos ensayos
realizados han puesto de manifiesto que la etapa comprendida entre fermentación alcohólica y fermentación
maloláctica es la que mejores resultados suele dar por
una alta presencia de antocianos libres, ácido pirúvico
y ausencia de SO2. Esto se observa en los trabajos de
Cano-López et al. (2006), donde se ha puesto de manifiesto que se observa un incremento en la intensidad
de color fundamentalmente en el primer periodo de
microoxigenación (entre la fermentación alcohólica y
el inicio de la fermentación maloláctica) en los vinos
microoxigenados. Al finalizar la fermentación maloláctica se observó en todos ellos un descenso, probablemente consecuencia de la variación del pH y la
precipitación de materia coloidal que arrastra materia
colorante. Aunque el aporte de oxigeno durante el segundo periodo (se comenzó cuando la fermentación
alcohólica ya esta finalizada) fue menor, se observó de
nuevo un aumento de intensidad de color en los vinos
microoxigenados, diferenciándose todos los vinos en
color, y observándose también el efecto de la dosis de
oxígeno aplicada. El incremento de color se adscribió a
una mayor concentración de piranoantocianos y com-
que son mas estables que los antocianos originales,
dando lugar a una mayor estabilidad e intensidad del
color de los vinos micro-oxigenados (Timberlake y Bridle, 1976; Francia-Aricha et al., 1997; Salas et al., 2004).
La correcta aplicación de la técnica para conseguir
los mayores beneficios va a depender del periodo de
aplicación y el tipo de vino a micro-oxigenar. Fundamentalmente, las mayores ventajas las vamos a encontrar cuando el vino esté equilibrado, la proporción de
Figura. Evolución del grado medio de polimerización de los taninos en vinos micro-oxigenados y sus
correspondientes testigos (W1: vino de bajo contenido polifenólico, W2: vino de contenido polifenólico
medio, W3: vino de alto contenido polifenólico). Adaptado de Cano-López et al. 2008
Concentración de las principales familias de antocianos y compuestos derivados en vinos de Monastrell
micro-oxigenados (Cano-López et al., 2006).
Compuestos identificados
34
t0
tf
Control
Control
Dosis 1
Dosis 2
Antocianos monoméricos (mg L-1)
277.9±4.2c
185±0.9b
178±7.4b
159±16.1a
Aductos directos (µg L-1)
1900±87a
2121±51b
1945±84a
1858±110a
Suma de Piranoantocianos
14872±374b
9974±225a
14524±99b
14091±16b
Compuestos unidos por etilo (µg L-1)
5008±46a
5503±14a
5883±18b
6262±145c
Pico polimérico (mg L-1)
19.7±0.2a
19.2±0.7a
21.6±2ab
23.4±1.1b
Seminario Técnico
Evolución desde final de fermentación alcohólica
hasta la finalización del proceso de microoxigenación de la intensidad de color en vinos
(no se aplicó la micro-oxigenación durante la
fermentación maloláctica)
puestos unidos por puente de etilo en los vinos microoxigenados (Cano-López et al., 2006).
También los efectos de la micro-oxigenación sobre
los taninos del vino han sido estudiados (Cano-López
et al., 2008). Se han observado diferentes comportamientos con respecto a la evolución del grado medio de polimerización. Este parámetro siempre se incrementa en el primer periodo (fin de fermentación
alcohólica-inicio de fermentación maloláctica) para
todos los vinos y después cae, excepto para el vino de
contenido fenólico bajo. Este incremento se corresponde a la fase estructurante descrita en las observaciones empíricas y suele ocurrir incluso cuando no se
está aplicando oxigeno al vino. La reducción que se
observa después, principalmente en los vinos de contenido fenólico medio y alto micro-oxigenados puede
ser debido a un rearreglo estructural de los taninos
a formas mas cortas, y ésto se asocia a un descenso
en astringencia. También la reacción de estas cadenas
mas cortas con antocianos reducirá la astringencia. El
comportamiento diferente del vino de contenido fenólico bajo microoxigenado puede estar relacionado
con una sobre-oxigenación del vino, debido a su bajo
contenido en antocianos libres.
El conjunto de observaciones realizadas en el trabajo
de Cano-López et al. (2008) pone de manifiesto como
la micro-oxigenación mejora las características de los
vinos de mas alto contenido fenólico por tener altas
cantidades de antocianos libres, incrementándose su
color y mejorando notablemente su estructura.
Ponencias
Todas estas observaciones nos llevan a concluir que la
micro-oxigenación es una técnica de aplicación muy
interesante en vinos tintos, sobre todo en vinos con
potencial fenólico. No acelera el envejecimiento pero
si lo puede optimizar y ayudar a controlar problemas
de reducción en los vinos.
Bibliografía
Cano-López, M.; Pardo-Mínguez, F.; López-Roca,
J.M.; Gómez-Plaza, E. (2006). Effect of microoxygenation on anthocyanin and derived pigment content
and chromatic characteristics of red wines. American
Journal of Enology and Viticulture 57, 325-331.
Cano-López, M.; Pardo-Mínguez, F.; Schmauch, G.;
Saucier, C.; Teissedre, C.; López-Roca, J.M.; GómezPlaza, E. (2008). Effect of Micro-oxygenation on Color
and Anthocyanin-Related Compounds of Wines with
Different Phenolic Contents. Journal of Agricultural and
Food Chemistry, 56, 5932-5941
Francia-Aricha, E.; Guerra, M.T.; Rivas-Gonzalo,
J.; Santos-Buelga, C. (1997). New anthocyanin pigments formed after condensation with flavanols. Journal of Agricultural and Food Chemistry, 45, 2262-2266.
Rauhut. D (2002). Volatile sulfur compounds. Impact
on reduced sulfur flavor defects and atypical aging in
wine. 31st Annual New York Wine Industry Conference.
Salas, E.; Atanasova, V.; Poncet-Legrand, E.; Meudec, E.; Mazauriz, J.; Cheynier, V. (2004). Demostration of occurrence of flavanol-anthocyanin adducts in
wine and model solutions. Analytica Chimica Acta, 213,
367-370.
Singleton, V. (1987). Oxygen with phenols and related reactions in musts, wines and model systems. Observations and practical implications. American Journal
of Enology and Viticulture, 38, 69-77.
Timberlake, C.; Bridle, P. (1976). Interaction between anthocyanins, phenolic compounds and acetaldehyde and their significance in red wines. American
Journal of Enology and Viticulture, 27, 97-105.
Vidal, S., Aagaard, O. (2008). Oxygen management
during vinification and storage of Shiraz wine. Wine
Industry Journal, 23, www. Winebiz.com.au
Waterhousse, A.; Laurie, F. (2006). Oxidation of wine
phenolics. A critical evaluation and hypothesis. American Journal of Enology and Viticulture, 57, 306-312.
Zoecklein, B. (2006). Sulfur compounds: impact on
aroma, flavor and texture and practical management.
Enology notes, 113
Zoecklein, B. (2007). Factors impacting sulfur-like off
odors in wine and winery options. 8th Annual Enology and Viticulture British Columbia Wine Grape Council
Conference.
35
04. ¡Los compuestos
volátiles no son
todos perjudiciales!
Los tioles varietales
y el sulfuro de
dimetilo
Rémi GUERIN-SCHNEIDER
Institut Français de la Vigne et du Vin
ENTAV-ITV France
Contenido
38 1. Los tioles varietales
39 2. El sulfuro de dimetilo
40 Conclusión
Seminario Técnico
Ingeniero Agrónomo y Enólogo,
Schneider, completa su formación con una Tesis Doctoral, en el
año 2001, sobre el potencial aromático de los vinos de Muscadet.
Ingeniero de Investigación y Desarrollo el Instituto francés de la
Viña y del Vino desde 2001, está
encargado del Proyecto “Útiles y
métodos de caracterización de la
calidad de uvas y vinos”
Particularmente especializado
en el análisis de compuestos
aromáticos de vinos y de sus
precursores, Remi Schneider, es
autor de numerosas publicaciones científicas centradas en la
puesta apunto de metodologías
analíticas sensibles y fiables,
particularmente empleando dilución isotópica, así como métodos de estimación del potencial
aromático de uvas procedentes
de viñedos de alta producción.
Desde el año 2006, coordina un
programa de investigación (UMT
« Qualinnov ») agrupando equipos de el INRA y del IFV.
Publicaciones principales
R. SCHNEIDER, A. RAZUNGLES, C. AUGIER, R. BAUMES, 2001. Monoterpenic and Norisoprenoidic Glycoconjugates of Vitis vinifera L. cv. Melon B. as
Precursors of Odorants in Muscadet Wines. J. Chromatogr., 936, 145-147.
R. SCHNEIDER, A. RAZUNGLES, F. CHARRIER, R. BAUMES, 2002. Effet du
site, de la maturité, et de l’éclairement des grappes sur la composition aromatique des baies de Vitis vinifera L. cv. Melon B. dans le vignoble du Muscadet. Bulletin de l’OIV,855-856, 269-283.
Ponencias
Rémi Guerin-Schneider
A. BELANCIC-MAJCENOVIC, R. SCHNEIDER, J.P. LEPOUTRE, V. LEMPEREUR, R. BAUMES, 2002. Synthesis and Stable Isotope Dilution Assay of
Ethanethiol and Diethyl Sulfide in Wine using Solid Phase Microextraction.
Effect of Aging on their Levels in Wine. J. Agric. Food Chem., 50, 6653-6658.
R. SCHNEIDER, Y. KOTSERIDIS, J.L. RAY, C. AUGIER, R. BAUMES, 2003.
Quantitative Determination of Sulfur-Containing Wine Odorants at sub-ppb
Levels. Part II : Development and Application of a Stable Isotope Dilution
Assay. J. Agric. Food Chem., 51, 3243-3248.
R. SCHNEIDER, F. CHARRIER, M. MOUTOUNET, R. BAUMES, 2004. Rapid
Analysis of Grape Aroma Glycoconjugates using Fourrier-Transform Infrared
Spectrometry and Chemometric Techniques. Analytica Chimica Acta, 513,
91-96.
C. PROUTEAU, R. SCHNEIDER, Y. LUCCHESE, F. NEPVEU, R. RENARD, C.
VACA-GARCIA, 2004. Improving Headspace Solid phase Microextraction of
3-Isobutyl-2-methoxypyrazine by Experimental Design with Regard to Stable Isotope Dilution Gas Chromatography- Mass Spectrometry Analysis of
Wine. Analytica Chimica Acta, 513, 223-227.
DÍAZ-MAROTO M.C., SCHNEIDER R., BAUMES R., 2005. Formation pathways of ethyl esters of branched short-chain fatty acids during wine aging.
J. Agric. Food Chem., 53, 3503-3509.
DAGAN L., SCHNEIDER R., LEPOUTRE J.P., BAUMES R., 2006. Stability of
sotolon in acidic and basic aqueous solutions. Application to the synthesis
of a deuterated analogue for its quantitative determination in wine. Analytica Chimica Acta, 563, 365-374.
SCHNEIDER R., CHARRIER F.,RAZUNGLES A., BAUMES R., 2006. Evidence
for an alternative biogenetic pathway leading to 3-mercaptohexanol and
4-mercapto-4-methylpentan-2-one in wines. Analytica Chimica Acta, 563,
58-64.
M. SUBILEAU, R. SCHNEIDER, JM. SALMON, E. DEGRYSE, 2008 Nitrogen
catabolite repression modulates the production of aromatic thiols characteristicof SauvignonBlanc at the level of precursor transport, FEMS Yeast Res,
8, 771–780
37
04. ¡Los compuestos volátiles no son todos perjudiciales! Los tioles varietales y el sulfuro de dimetilo
Los compuestos azufrados volátiles están presentes
en gran número en los vinos. Se acostumbra a separarlos en dos clases distintas, los compuestos sulfurosos ligeros, cuyo punto de ebullición es inferior a 90ºC,
y los compuestos sulfurosos pesados que presentan
un punto de ebullición más elevado. Esta clasificación,
práctica por su simplicidad, aporta sin embargo escasa información acerca de la naturaleza de los compuestos y de su origen.
Si nos adentramos con más detalle en el tema, encontramos tres grandes familias de compuestos en
términos de estructura química: los tioles, los mono-o
polisulfuros y los tiol-éster.
De manera general, las funciones químicas azufradas
confieren a estos compuestos olores desagradables,
intensos, que son percibidos negativamente. No obstante, cuando su peso molecular aumenta, el efecto
negativo del grupo funcional sulfuroso se atenúa y
las percepciones olfativas de los compuestos son más
agradables. Así pues, la mayor parte de los compuestos
sulfurosos ligeros, principalmente en productos en curso de fermentación son perjudiciales para la calidad del
aroma, mientras que los compuestos sulfurados más
pesados, pueden contribuir de manera favorable a mejorar el perfil aromático de los vinos. Es concretamente
el caso de los tioles varietales (Tominaga et al. 1998) y
del sulfuro de dimetilo (Ségurel, 2005).
1. Los tioles varietales
Los compuestos sulfurosos varietales se forman durante la fermentación a partir de los S- conjugados a la
cisteina de la uva. Estos S-conjugados a la L-cisteina o
precursores cisteinicos han sido evidenciados e identificados directamente en la uva recientemente (Darriet et al., 1993; Tominaga et al., 1995; Tominaga et al.,
1998b). Únicamente 3 de estos precursores han sido
identificados formalmente en la uva : la S-(1-hidroxihex-3-yl)-L-cisteina (P3MH), el S-(4-metil-2-oxopent-4yl)-L-cisteina (P4MMP) y el S-(4-metill-2-hidroxipent4-yl)-L-cisteina (P4MMPOH ; (Tominaga et al., 1995;
Tominaga et al., 1998b). Este último interviene raramente en el aroma del futuro vino.
Debido a las dificultades analíticas han sido publicados
pocos datos cuantitativos acerca de los S-conjugados
a la cisteina. Sus contenidos son reducidos y no superan la centena de ug/L en caso del P3MH, el más abundante, en el mosto del Sauvignon Blanc, (Peyrot des
Gachons et al., 2000; Peyrot des Gachons et al., 2002a;
Peyrot des Gachons et al., 2005 Dagan, 2006). En cuanto a sus evoluciones durante la maduración de la uva,
se muestran variables en función del precursor y de la
añada (Peyrot des Gachons et al., 2000, Dagan, 2006).
En la baya de la uva, la P4MMP se reparte por igual en
la piel y en la pulpa mientras que el P3MH está mayo-
38
ritariamente presente en la piel (Murat et al., 2001b;
Peyrot des Gachons et al., 2002a). Así pues, la maceración pelicular afecta principalmente al P3MH, cuyas
cantidades recuperadas en el mosto son más importantes en relación a una vinificación clásica (Murat et
al., 2001b; Peyrot des Gachons et al., 2002a).
Cabe señalar igualmente la presencia en los mostos
de Sauvignon Blanc de un conjugado del 3 mercaptohexanol o glutathion que será el precursor biogenético del conjugado a la cisteina correspondiente,
por hidrólisis de los dos aminoácidos asociados a la
cisteina del glutation (Peyrot des Gachons et al., 2001).
Más recientemente (Fedrizzi et al, 2009) un conjugado
de la 4MMP al glutathion, ha sido formalmente identificado en un mosto de Sauvignon.
Aún que poco abundantes y poco numerosos, estos precursores cisteinicos contribuyen sin embargo
en gran manera al aroma del vino. Son en efecto el
origen de cuatro tioles extremadamente olorosos,
ausentes en la uva, pero responsables en el vino de
notas olfativas reconocibles cuando sus contenidos
son los suficientes el 3-sulfanilhexan-1-ol (3MH), el
acetato de 3-sulfanylhexyle (ac3MH), el 4-metil-4-sulfanilpentan-2-one (4MMP), presentando umbrales de
percepción olfativa muy bajos, respectivamente de 60
ng/L, 4,2 ng/L y 0,8 ng/L en solución hidroalcohólica
(Tominaga et al., 2000). Estos presentan respectivamente olores de pomelo, de corteza de cítricos y de
boj, que participan de manera importante en el afrutado de numerosos vinos blancos y rosados.
Si la 4MMP parece específica de un reducido número de variedades (Sauvignon, Bacchus, Scheurebe), el
3-sulfanyl-hexanol y su acetato han sido observados
en un gran número de variedades. Estos participan
no solamente en el aroma de los vinos de numerosas
variedades blancas como pueden ser la Gewürztraminer, Scheurebe, Colombard, Petit Manseng, Melon
Blanc sino igualmente en tintas, como en la Garnacha,
Merlot, Cabernet franc, Cabernet Sauvignon, Syrah,
Mourvèdre, Cinsault (Darriet et al., 1993; Darriet et al.,
1995; Güth, 1997a; Tominaga et al., 2000; Tominaga et
al., 1996; Güth, 1997a; Bouchilloux et al., 1998; Kotseridis et Baumes, 2000; Lopez et al., 2003; Murat et al.,
2003; Schneider et al., 2003; Fretz et al., 2005, Ferreira et al., 2002, Schneider et Masson, 2009). Estudios
recientes (Ferreira et al 2002; Masson et Schneider,
2009), han demostrado que el mercaptohexanol era
por otra parte un aroma clave en los vinos rosados de
Garnacha, y más concretamente en los Rosados de
Provence (Masson et Schneider, 2009).
Esta ubicuidad del 3MH es en parte debida a una
segunda vía de formación de este tiol durante la fermentación, no proveniente de S-conjugados a la cisteina de la uva, sino al añadido de fuentes sulfurosas al
(E)-2-hexenal en un mosto en fermentación (Schneider et al., 2006). Esta vía de formación ha sido por otra
Seminario Técnico
Es durante la fermentación cuando la levadura, por
intervención de las enzimas de tipo liasa, libera los
tioles olorosos por ruptura de la asociación C-S de la
parte cisteina de los precursores cisteinicos de la uva
(Tominaga et al., 1998b). Los rendimientos de transformación de los precursores cisteinicos al final de la
fermentación en diferentes cepas de levadura Saccharomyces cerevisiae son débiles y variables, independientemente de cual sea el precursor estudiado en el
medio de muestra o natural, aunque la mayor parte
de los precursores iniciales se hayan degradado : de
0,06% a 0,6% para la P4MMP (Murat et al., 2001a), y
de 0,6% a 10,2 % para el P3MH ( Murat et al., 2001b).
En lo relativo al ac3MH que no tiene en la uva ningún
S-conjugado a la cisteina, es igualmente la levadura
quien lo forma mediante acetilación del 3MH, al igual
que ésta acetila los alcoholes de su metabolismo nitrogenado. Así pues, la formación de estos tioles por la
levadura depende mucho de la cepa de levadura, del
mosto y de las condiciones de fermentación e incluso
de algunas cepas salvajes de Saccharomyces bayanus
var. Uvarum eran especialmente activas (Murat et al.,
2001a; Masneuf et al., 2002; Howell et al., 2004; Dubourdieu et al., 2006 ; Masneuf-Pomarede et al., 2006,
Subileau, 2008).
En lo relativo a la evolución de estos tioles olorosos
durante la conservación del vino, sus contenidos
disminuyen generalmente, pero esta disminución
depende en gran parte de los fenómenos de oxidación ligados a esta conservación. Así los factores que
previenen la alteración del potencial reductor del vino
(contacto limitado con el oxigeno, dióxido de azufre,
lías, glutathion, antocianos) limitan estas pérdidas en
tioles olorosos (Murat et al., 2003).
2. El sulfuro de dimetilo
El sulfuro de dimetilo (DMS) es un compuesto sulfuroso ligero evidenciado por Du Plessis et Loubster (1974)
en el vino, en el que sus umbrales de percepción olfativa eran del orden de 25 µg/l. Sus contenidos en los
vinos jóvenes eran más bien inferiores a este umbral,
pero podían alcanzar los 900 µg/l en vinos más evolucionados (Dagan 2006 y referencia mencionada). El
DMS es uno de los constituyentes importantes del
aroma de trufas, una nota olfativa a menudo citada
para el bouquet de reducción de los grandes vinos
tintos y de los vinos de vendimia tardía (Du Plessis e
t Loubster, 1974; Spedding et Raut, 1982; AnocibarBeloqui, 1998). En los vinos tintos, de débil concentración parece amplificar las notas de frutas rojas, mientras que en fuertes concentraciones, contribuye a las
notas de garriga, olivas y trufas (Ségurel, 2005; Escudro
et al, 2007). Contrariamente sería percibido más bien
de manera negativa en los vinos blancos (Goniak et
Noble, 1987).
Durante la fermentación, el DMS es liberado por la
acción de las levaduras a partir de aminoácidos azufrados, en especial la cisteina, el glutation, la S-adenosilmetionina (Schreier et al., 1974; De Mora et al., 1986;
Anocibar Beloqui, 1998). Sin embargo, el DMS producido por las fermentaciones es en gran medida eliminado por arrastre por el CO2, ya que es muy volátil
(punto de ebullición 37°C/1 atm). Así pues, sus contenidos en los vinos en proceso de finalizar su fermentación son generalmente muy inferiores a su umbral de
percepción, pero pueden producirse en cantidades
elevadas, asociados a otros compuestos azufrados
ligeros nauseabundos, en los vinos que presentan el
defecto de olor a reducción (Park et al., 1994).
Ponencias
parte demostrada en las mismas condiciones para el
4-metil-4-sulfanil-pentan-2-one vía oxido de mesitilo,
pero este último o su hidrato no ha sido jamás encontrado en la uva. Vías análogas han sido por otra parte
evidenciadas para el 2-furanmetanetiol (umbral de
percepción olfativa de 5ng/l en el vino tinto), responsable de las notas de café tostado de los vinos elaborados en barricas de roble (Blanchard, 2001), y podrían
explicar la formación de otros tioles olorosos del vino,
como el 3-mercapto-3-metilbutan-1-ol.
No obstante, algunos trabajos han mostrado que los
contenidos en DMS se incrementan con el tiempo y
la temperatura durante el proceso de envejecimiento en botella, hasta llegar ha alcanzar contenidos del
orden de mg/L, (Marais, 1979; De Mora et al., 1986; De
Mora et al., 1993; Anocibar Beloqui, 1998; Ségurel et
al., 2004; Dagan, 2006). El DMS así producido durante
en el envejecimiento, sería percibido de manera favorable en la génesis del bouquet de reducción de los
grandes vinos tintos y de los vinos de vendimia tardía,
contrariamente a su percepción en los vinos blancos
jóvenes (ver más arriba). Estas informaciones sensoriales son sin embargo bastante limitadas y deberán ser
completadas para el conjunto de las variedades y de
sus diferentes tipos de vino.
Por otra parte, un método de mediad de los precursores del DMS en el vino ha sido recientemente desarrollado, (Ségurel et al., 2005), el cual realiza una estimación correcta del DMS susceptible de ser liberado
en el vino durante el envejecimiento (Ségurel et al.,
2005). Además, estos trabajos han demostrado que
la uva posee igualmente un PDMS. Entre los derivados del metil-sulfonium a día de hoy conocido en
las plantas (Howard et Russell, 1997), únicamente el
SMM podría ser el precursor del DMS, presente en la
uva, la SMM sería transmitida al vino, donde liberaría
DMS por medio de una reacción de degradación química durante su conservación. La formación de DMS
seguiría un proceso químico lento, dependiendo de
la duración y de las condiciones de conservación. De
esta manera, las diferencias en las concentraciones de
DMS para vinos de edades equivalentes, se explicarían esencialmente por las diferencias de PDMS inicial
en el embotellado.
39
04. ¡Los compuestos volátiles no son todos perjudiciales! Los tioles varietales y el sulfuro de dimetilo
Los análisis de uvas efectuados a día de hoy han revelado un potencial en DMS extremadamente heterogéneo, y a veces muy elevado en algunas muestras de
uva de la variedad Petit y Gros Manseng en estado de
sobremaduración, de hasta 4,5 mg/L (Dagan, 2006),
mucho más elevado que los contenidos encontrados
en la Garnacha y el Syrah en maduración tecnológica
(Ségurel et al., 2004). Para las muestras de estas cuatro variedades, las únicas estudiadas a día de hoy, el
PDMS es dependiente de la variedad, del terreno y de
la añada, y sus contenidos aumentan de manera muy
importante en estado de sobremaduración en el caso
de la variedad Manseng, los únicos estudios realizados a día de hoy para este parámetro. Sin embargo, en
algunas de las muestras de estas cuatro variedades, el
PDMS de las uvas, quizás mucho más elevado que en
los vinos correspondientes, la simple degradación química no puede explicar estas pérdidas a veces considerables de transmisión de PDMS. Las causas de estas
pérdidas son a día de hoy desconocidas, pero existen
varias hipótesis que podrían explicarlas. La hipótesis
de la degradación de la SMM por las levaduras es muy
plausible, ya que ha sido descubierta recientemente
una nueva permeasa, capaz de transportar de manera
específica la SMM, que permitiría a la Saccharomyces cerevisiae utilizar la SMM como fuente de azufre
(Rouillon et al., 1999), pero la evolución de la SMM en
la levadura no ha sido todavía estudiada. Sea cual sea,
el DMS formado sería casi enteramente eliminado por
arrastre por el gas carbónico durante la fermentación
40
alcohólica o mediante simple vaporización mientras
el vino no esté en un medio cerrado.
Conclusión
Los compuestos sulfurados juegan un papel importante en el aroma de los vinos. Si los compuestos sulfurados ligeros, excepto el DMS, son sistemáticamente
vectores de defectos organolépticos cuando superan
sus umbrales de detección olfativa, los compuestos
sulfurados más pesados pueden conferir notas olfativas muy interesantes y refinadas. Es especialmente el
caso de los tioles varietales, caracterizados por sus notas de cítricos y de boj de los Sauvignon, que de una
manera general aportan frescor y afrutado a los vinos.
El caso del DMS se muestra mucho más complejo si
cabe, por una parte su efecto realzante en bajas concentraciones, pero que en elevadas concentraciones
puede ser percibido negativamente en algunos tipos
de vinos blancos.
Así pues, disponemos a día de hoy de numerosos
elementos tecnológicos para controlar y dominar los
contenidos de estos compuestos en los vinos, no hay
que olvidar que el aroma de un vino es un conjunto
complejo, y que al exacerbar uno u otro de sus componentes, nos arriesgamos a desequilibrar el perfil
aromático y ofrecer simplemente una caricatura.
Seminario Técnico
Beltran, G.; Esteve-Zarzoso, B.; Rozès, N.; Mas, A. And
Guillamón J.M.
Unitat d’Enologia del Centre de Referència de
Tecnologia d’Aliments, Department Bioquímica i
Biotecnologia, Facultat d’Enologia de Tarragona,
Universitat Rovira i Virgili, Ramón y Cajal, 70, 43005
Tarragona, Spain, and Bodegas Miguel Torres, Miquel
Torres i Carbó 6, 08720 Vilafranca del Penedès,
Barcelona, Spain
Nitrogen deficiencies in grape musts are one of the main
causes of stuck or sluggish wine fermentations. In the
present study, we have supplemented nitrogen-deficient
fermentations with a mixture of ammonium and amino
acids at various stages throughout the alcoholic fermentation. The timing of the nitrogen additions influenced
the biomass yield, the fermentation performance, the
patterns of ammonium and amino acid consumption,
and the production of secondary metabolites. These nitrogen additions induced a nitrogen-repressed situation
in the cells, and this situation determined which nitrogen
sources were selected. Glutamine and tryptophan were
the main amino acids consumed in all the fermentations.
Ammonium is the preferred nitrogen source for biomass
production but was hardly consumed when it was added
in the final stages of the fermentation. The higher ammonium consumption in some fermentations correlated
with a greater synthesis of glycerol, acetate, and acetaldehyde but with a lower synthesis of higher alcohols.
KEYWORDS: Saccharomyces cerevisiae; Alcoholic
Fermentation; Amino acids; Ammonium; GAP1;
MEP2
INTRODUCTION
The nitrogen composition of grape musts affects the
growth and metabolism of yeast, the fermentation
rate, and the completion of fermentation (1). Nitrogen deficiencies are one of the main causes of stuck
or sluggish fermentations. One way of avoiding these
problems is to add nutritional supplements, usually
inorganic forms of nitrogen such as ammonium salts,
to grape must prior to fermentation (2-4). These additions are generally made empirically in wine cellars,
and the initial nitrogen concentration in the must or
the nitrogen requirements of the usual yeast strain
used in the cellar are not determined. Yeasts respond
metabolically to differences in nitrogen availability, so
this lack of control of nitrogen leads to differences in
wine composition.
Nitrogen affects yeast cells in two ways: it increases
biomass production and stimulates the rate of sugar
utilization. Nitrogen additions during the period of cell
growth have resulted in maximum cell populations.
Later additions during the stationary phase have had
no effect on the cell population but have increased
the specific fermentation rate, thus reducing the length of the fermentation (2, 5, 6).
Nitrogen supplementation affects the pattern of nitrogen uptake. Ammonium is a preferred yeast nitrogen
source, and when plentiful, it represses the expression
of catabolic pathways by degrading other nitrogenous
compounds (7, 8). This mechanism, called nitrogen
catabolite repression (NCR), has recently been studied
during wine fermentations (9). It inhibits the uptake of
arginine and alanine and stimulates the consumption
of branched-chain and aromatic amino acids. Changes
in the nitrogen uptake patterns influence the production of aroma and spoilage compounds (particularly
hydrogen sulfide) and the amount of urea, the major
precursor of the carcinogen ethyl carbamate (10-13).
The volatiles identified in wines are usually dominated by fermentation products. Organic acids, higher
alcohols, and esters are the main group of flavor compounds coming from yeast metabolism (12). Higher
alcohols can be produced either by the catabolic
conversion of the branched-chain amino acids (via
Ehrlich) or by the anabolic formation of these amino
acids de novo from a sugar substrate (14). An excess of
higher alcohols (above 400 mg L-1) can be regarded as
a negative influence on the quality of wine, but at the
concentrations generally found in wines (below 300
mg L-1), they usually contribute to the desirable complexity of wine. Furthermore, these alcohols, together
with the acids in wine, are substrates for ester formation. Most esters, with the exception of ethyl acetate,
impart a pleasant smell of fruits and flower notes in
the wine (15).
J. Agric. Food Chem. 2005, 53, 996-1002
Textos asociados
Influence of the
Timing of Nitrogen
Additions during
Synthetic Grape
Must Fermentations
on Fermentation
Kinetics and
Nitrogen
Consumption
41
Influence of the Timing of Nitrogen Additions during Synthetic Grape Must Fermentations on Fermentation Kinetics and Nitrogen Consumption
As mentioned, in winemaking, most of the nitrogen
additions are made empirically and do not take into
account the different nitrogen needs of the cell during wine fermentation, the proper timing of these
additions, or the nitrogen source added. In this study, we supplemented nitrogen-deficient fermentations with a mixture of ammonium and amino acids
at different stages of the alcoholic fermentation. We
then studied the effect of these additions on the fermentation kinetics, the consumption of organic and
inorganic nitrogen throughout the fermentation, and
the influence of this consumption on the organoleptic profile of the wines. We also monitored the effect
of the nitrogen supplementations on the NCR system
and the effect of the nitrogen-repressed situation on
nitrogen uptake.
MATERIALS AND METHODS
Strain, Fermentations, and Sampling. A commercial Saccharomyces cereVisiae Var. bayanus wine strain
QA23 (Lallemand S. A., Toulouse, France) was used in
this study. Fermentations were carried out in a synthetic grape must (pH 3.3) as described by Riou et al. (16)
but with 200 g L-1 of reducing sugars (100 g L-1 Glucose
and 100 g L-1 Fructose) and without anaerobic factors.
Only the nitrogen content changed in the different
fermentations.
The yeast assimilable nitrogen (YAN) content in the
control synthetic grape must was 300 mg N L-1, ammoniacal nitrogen (NH4Cl) 120 mg N L-1, and amino
acids 180 mg N L-1 (Table 2). This medium also contained 426 mg L-1 of Proline, but it should not be considered as assimilable nitrogen (17). The proportions
of the different amino acids and ammonium were
maintained in all the fermentations. Nitrogenlimited
fermentations were carried out with 60 mg L-1 of YAN
(24 mg L-1 of ammoniacal nitrogen and 36 mg L-1 of
amino acid nitrogen), and 240 mg L-1 of YAN nitrogen
was added at different fermentation points (96 mg L-1
of ammoniacal nitrogen and 144 mg L-1 of amino acid
nitrogen).
The supplementation points were chosen by monitoring the decrease in density of the media. Density was
measured throughout the fermentation by weighing
5 mL, and nitrogen was added when the density of
the must was 1060 g L-1 (30 h after inoculation), 1040 g
L-1 (72 h), 1020 g L-1 (144 h), and 1000 g L-1 (240 h). Fermentations took place at room temperature (22-28 °C)
in laboratory-scale fermenters: 2 L bottles filled with
1.8 L of medium and fitted with closures that enabled
the carbon dioxide to escape and the samples to be
removed. Fermentations were in semi-anaerobic conditions since limited aeration was necessary in order
to harvest samples for the subsequent analysis. The
population inoculated in every flask was 2 106 cell
mL-1 from dry yeast rehydrated in water at 37 °C.
42
In the latter stages of the fermentation, the sugar
consumption was assayed by enzymatic kits (Roche
Applied Science, Germany). Fermentation was considered to be complete when the residual sugars were
below 2 g L-1. Cell growth was determined by absorbance at 600 nm. Absorbance values were corrected
for the initial absorbance reading obtained for juice.
Cells were harvested at different points during the
fermentation so that mRNA could be analyzed. Flasks
were magnetically stirred to resuspend settled biomass, transferred to centrifuge tubes, and centrifuged
at 5000 rpm for 5 min at room temperature to prevent
temperature shock. Cell pellets were transferred to 1.5
mL Eppendorf tubes and frozen immediately in liquid
nitrogen. They were kept at -80 °C until they were
analyzed. The supernatant of these samples was stored at -20 °C for extracellular metabolites and nitrogen
content analysis.
Nitrogen Content Analysis. YAN was analyzed by
the formol index method (18), and the ammonium
content was quantified using an enzymatic method
(Roche Applied Science, Germany). The individual
amino and imino acids were analyzed by OPA and
FMOC derivatizations, respectively, using the Agilent
1100 Series HPLC equipped with a low-pressure gradient quaternary pump, a thermostated autosampler,
a DAD ultraviolet detector, and a fluorescence detector (Agilent Technologies, Germany). The sample (2 íL)
was injected into a 4.6 mm 250 mm 5 ím Hypersil
ODS column (Agilent Technologies, Germany). The
gradient solvent system was: solvent A (16 mM sodium acetate and 0.022% triethylamine, adjusted to
pH 7.2 with 1-2% acetic acid, and 0.6% tetrahydrofuran) from 100% at t ) 0 to 0% at t ) 18 min, and solvent B (20% of 66 mM sodium acetate, adjusted to pH
7.2 with 1-2% acetic acid, 40% acetonitrile and 40%
methanol) from 0% at t ) 0 to 100% at t ) 18 min. The
analysis temperature was 40 °C, and the flow rate was
1.5 mL min-1. Several dilutions of each sample were
analyzed and averaged using the analysis software.
The concentration of each amino acid was calculated
using external and internal standards and expressed
as mg L-1. The software used was Agilent ChemStation
Plus (Agilent Technologies, Germany).
Ethanol, Glycerol, and Organic Acid Analysis. Ethanol, glycerol, and organic acids were analyzed in all
the samples at the end of the fermentation process.
Analytical HPLC was carried out on a Hewlett- Packard
HP 1050 connected to a Hewlett-Packard Integrator
3395 equipped with an HP 1047 RI detector (Agilent
Technologies, Wilmington, DE) (19). The wine sample
(450 íL) was mixed with 50 íL of formic acid (internal
standard), and 25 íL was injected into a 300 mm 7.8
mm AMINEX HPX-87H column (BioRad, Hercules, CA).
The solvent used was sulfuric acid 2.5 mM at 0.5 mL
min-1. The analysis temperature was 60 °C. The con-
Seminario Técnico
Fatty Acid Analysis. Fatty acids were extracted using
the method published by Lo´pez et al. (20). Analytical
GC was carried out on a Hewlett-Packard 6890N connected to a computer with the ChemStation software
(Agilent Technologies, Wilmington, DE). The extract
(2 íL) was injected (splitless, 0.75 min) into a Tracer TR
column of 60 m 250 ím and 0.25 ím phase thickness
with an HP automatic injector (Agilent). The temperature program was 40 °C for 5 min followed by 2 °C
min-1 to 240 °C (15 min). Injector and detector temperatures were 220 and 240 °C, respectively. The carrier
gas was hydrogen at 60 mL min-1. 2-Ethylphenol (0.2
mg L-1) was added as internal standard. Internal patterns were used to estimate the quantity of the different compounds.
Analysis of Higher Alcohols and Esters. Higher
alcohols and esters were extracted by liquid/liquid
extraction (wine 10 mL, 200 íL 1,1,2- trichlorotrifluoroethane, 0.5 g NaCl), with n-decanol (0.2 mg L-1) as
internal standard (21). After agitation for 2 min and
centrifugation, the organic phase was extracted and 2
íL was injected. The chromatographic program used is
the same as that used for the fatty acid analysis.
Quantification was conducted by comparison with
known quantities of different products in a hydro alcoholic solution.
RNA Extraction and cDNA Synthesis. Total RNA was
isolated from yeast samples as described by Sierkstra
et al. (22) and resuspended in 50 íL of DEPC-treated
water. Total RNA suspensions were purified using the
High Pure Isolation kit (Roche Applied Science, Germany) following the protocol provided by the manufacturer. RNA concentrations were determined using
a GenQuant spectrophotometer (Pharmacia, Canada),
and the quality of RNA was verified electrophoretically
on 0.8% agarose gels. Solutions and equipment were
treated so that they were RNase free, as outlined in
Sambrook et al. (23).
Total RNA was reverse-transcripted with Superscript
II RNase Hreverse transcriptase (Invitrogen, Carlsbad,
CA) in a GenAmp PCR System 2700 (Applied Biosystems, Foster City, CA). Oligo (dT)12-18 primer ( 0.5 íg,
Invitrogen) was used with 0.8 íg of total RNA as template in a reaction volume of 20 íL. Following the protocol provided by the manufacturer, after denaturation at 70 °C for 10 min, cDNA was synthesized at 42
°C for 50 min. Finally, the reaction was inactivated at
70 °C for 15 min.
Real-Time Quantitative PCR. The PCR primers used
in this study are ACT-F, TGGATTCCGGTGATGGTGTT,
and ACT-R, CGGCCAAATCGATTCTCAA (ACT, for actine gene); GAP1-F, CTGTGGATGCTGCTGCTTCA, and
GAP1-R, CAACACTTGGCAAACCCTTGA (GAP1, for general amino acid permease gene); and MEP2- F, GGTATCATCGCTGGCCTAGTG, and MEP2-R, ACAACGGCTGACCAGATTGG (MEP2, for ammonium permease
gene) (9).They were all designed with the available
GenBank sequence data and the Primer Express software (Applied Biosystems) in accordance with the
Applied Biosystems guidelines for designing PCR primers for quantitative PCR. All amplicons were short,
which ensured maximal PCR efficiency and, therefore,
the most precise quantification.
For each gene, a standard curve was made with yeast
genomic DNA. DNA extraction was performed as described by Querol et al. (24), digested by RNase, and
isolated by 2-fold phenol-chloroform extractions and
ethanol precipitation. Concentration was determined
using a GeneQuant spectrophotometer (Pharmacia,
Canada). Serial 10-fold dilutions of DNA were carried
out to yield DNA concentrations from 4 to 4 10-5 ng
íL-1. These dilution series were amplified (in duplicate)
by SYBR PCR for each gene to obtain standard curves
(see above). The standard curve displays the Ct value
vs log10 of each standard’s starting quantity. The starting quantity of the unknown samples was calculated
against the standard curve by interpolation, and gene
expression levels are shown as the concentration of
the studied gene normalized with the concentration
of the housekeeping ACT gene.
The real-time quantitative PCR reaction was performed using SYBR Green I PCR (Applied Biosystems).
In SYBR PCR, amplification is monitored by the gain
in fluorescence of the double-strand-specific DNAbinding dye SYBR green. The 25 íL SYBR PCR reactions
contained 300 nM of each PCR primer, together with
1 íL cDNA (or 5 íL of each DNA serial dilution for standard tubes) and one time SYBR master mix (Applied
Biosystems).
All PCR reactions were mixed in 96-well optical plates (Applied Biosystems) and cycled in a PE Applied
Biosystems 5700 thermal cycler under the following
conditions: 50°C for 2 min, 95°C for 10 min, and 40 cycles at 95°C for 15 s and at 60 °C for 60 s.
The PE5700 cycler provided cycle-by-cycle measurement of the fluorescence emission from each PCR
reaction. Analysis resulted in the assignation of a
threshold cycle (Ct) value to each PCR reaction.
Textos asociados
centration of each metabolite was calculated using
external and internal standards.
The Ct value is the cycle number at which an increase
in reporter fluorescence above a baseline signal can
first be detected. The threshold was positioned to intersect the exponential part of the amplification curve of positive reactions, as recommended by Applied
Biosystems.
The Ct value is inversely proportional to the log of the
amount of template in the PCR reaction; the lower the
43
Ct value, the higher the concentration of template in
the PCR reaction. Assuming a 100% effective PCR amplification, a difference of one Ct value corresponds to
a 21 ) 2-fold difference in the amount of template. All
samples were analyzed in duplicate, and the expression values were averaged by the analysis software
(Applied Biosystems). The coefficient of variation in all
samples analyzed was less than 10%.
RESULTS
Effect of Nitrogen Addition on Fermentation Kinetics and Nitrogen Consumption. Five fermentations
started with a nitrogen content of 60 mg L-1, which
is low enough for a fermentation to be sluggish but
high enough for it to finish.
Four of these nitrogen-deficient fermentations were
supplemented at different points with 240 mg L-1 of
YAN; the first one at a density of 1060 g L-1, and the
second, third, and fourth at 1040, 1020, and 1000 g
L-1, respectively. The remaining fermentation was not
supplemented, but subjected to nitrogen deficiency
throughout the process. As a fermentation control, we
used the same medium with a nondeficient amount
of nitrogen (300 mgN L-1) (9).
Figure 1 shows the effect of nitrogen additions on O.
D. measures throughout the fermentations studied.
The nitrogendeficient fermentations had lower O. D.
values than the control fermentation. When nitrogen was added in the first half of the fermentations
(density of 1060 and 1040), these effects were almost
overcome, and the O. D. values were similar to those
of the control fermentation. Additions at densities of
1020 and 1000, however, had minimal effects on O. D.
measures.
and amino acid nitrogen. Unlike their effect on the O.
D. values, the nitrogen additions clearly stimulated the
fermentation regardless of when they were made. In
the nitrogen-deficient fermentation, yeast consumed
the total YAN after the first day (data not shown).
However, nitrogen was not completely consumed in
the control fermentation. The nitrogen additions were
all carried out when the initial YAN had already been
depleted, and the later the nitrogen was added, the
lower the amount of YAN was consumed (Table 2).
The ammonium consumed was 54% of the total YAN
consumed in the control fermentation (Table 2), but
this proportion decreased when nitrogen was added
later in the fermentation. Ammonium was proportionally preferred as the nitrogen source when the additions were made in the first half of the fermentations
(N1060 and N1040). In later additions (N1020 and
N1000), the small amount of nitrogen consumed was
mostly from amino acids.
The consumption of amino acids was monitored at
different points during the fermentations. The yeast’s
pattern of amino acid utilization changes with the
time of YAN supplementation (Table 2). The amino
Figure 1. Effect of nitrogen additions on O. D.
measures (λ = 600 nm) throughout synthetic grape
must fermentations. The arrows indicate the time
of addition.
Table 1 summarizes the evolution of the fermentation
and nitrogen consumption, measured as ammonium
Table 1. Determination of Yeast Assimilable Nitrogen (YAN) in the Fermentation Media, Represented by
the Amino Acid Fraction (YAN aas) and bythe Ammonium fraction (YAN NH4+)
control fermentation
N addition at F ) 1060
time
(h)
YAN NH4+
(mg N L- 1)
YAN aas
(mg N L- 1)
time
(h)
YAN NH4+
(mg N L- 1)
YAN aas
(mg N L- 1)
time
(h)
YAN NH42+
(mg N L- 1)
YAN aas
(mg N L- 1)
1080
1060
1040
1020
1000
990 (endb)
0
30
56
96
168
312
120
70
52
36
35
41
168
98
95
98
98
102
0
36
62
96
168
312
25
0.5 (90a)
50
45
42
50
41
4 (145a)
105
104
108
110
0
36
78
120
192
336
25
0.1
0.1 (92a)
68
65
66
40
4
4 (136a)
104
110
114
density
(ρ)
time
(h)
YAN NH4+
(mg N L- 1)
YAN aas
(mg N L- 1)
time
(h)
YAN NH4+
(mg N L- 1)
YAN aas
(mg N L- 1)
time
(h)
YAN NH4+
(mg N L- 1)
YAN aas
(mg N L- 1)
1080
1060
1040
1020
1000
990 (endb)
0
36
78
150
240
408
25
0
0
0 (92a)
81
88
41
7
7
4 (143a)
109
118
0
36
78
150
264
456
26
0
0
0
0 (99a)
100
40
7
4
4
2 (147a)
130
0
36
78
150
264
504
26
0
0
0
1
1
40
5
2
1
1
1
N addition at ρ =1020
a
44
N addition at ρ = 1040
density
(ρ)
N addition at ρ = 1000
NH4+ and aas YAN content just after the nitrogen addition. b End of fermentation.
no N addition
Seminario Técnico
Table 2. Total Consumption of Amino Acids and Ammonia at the End of Each Fermentation
Expressed as mg N L-1a
a
amino
acids
full N
media
content
Gln
Trp
Thr
His
Leu
Ile
Phe
Val
Ser
Met
Lys
Arg
Tyr
Glu
Gly
Ala
Asp
YAN aas
YAN NH4+
47.4
10.3
9.9
3.8
4.7
3.8
2.8
5.1
7.5
1.8
1.9
47.9
1.4
11.8
3.1
12.1
4.2
179.5
120.0
control
consumption
N1060
consumption
N1040
consumption
N1020
consumption
N1000
consumption
no N
consumption
total
total
post-add
total
post-add
total
post-add
total
post-add
total
25.5
6.6
9.4
3.7
4.2
3.2
2.4
3.0
2.8
1.8
1.1
0.6
0.4
0.5
0.2
−
−
65.5
79.2
34.9
6.8
3.6
1.5
2.6
1.8
1.2
1.6
2.9
1.1
0.7
5.9
0.2
2.3
−
1.2
−
68.4
64.9
22.1
4.2
1.4
1.5
1.1
0.6
0.4
0.4
0.8
0.5
−
−
−
−
−
−
−
34.5
39.5
24.5
7.7
2.6
1.2
1.8
1.4
1.3
1.1
1.7
1.0
1.0
9.0
0.3
2.0
−
1.7
−
58.2
51.4
11.8
4.1
0.7
1.2
0.8
0.7
0.5
0.1
−
0.6
0.9
0.9
−
−
−
−
−
22.2
26.0
29.0
8.1
2.0
0.8
1.4
0.8
1.2
1.0
1.7
0.6
1.0
8.8
0.3
2.7
−
2.7
−
62.1
29.5
16.2
4.5
0.2
0.8
0.4
0.2
0.4
−
−
0.3
0.9
0.7
−
0.2
−
−
−
24.6
4.1
23.1
7.8
1.9
0.4
1.2
0.7
0.9
1.1
1.9
0.5
0.1
8.2
0.3
2.5
0.3
3.1
−
53.9
25.4
10.3
4.1
0.1
0.4
0.2
0.1
0.1
−
0.1
0.2
−
−
−
−
−
−
−
15.7
−
12.8
3.6
1.8
−
1.0
0.6
0.8
1.0
1.8
0.3
0.2
8.2
0.3
2.5
0.4
3.2
0.1
38.6
25.4
In the fermentations with nitrogen additions, post-add represents the nitrogen taken up after this addition.
acids can be grouped in different sets according to
the preference of the cell in the different conditions.
The amino acids that are most consumed are glutamine and tryptophan. Together they represented 32% of
the total assimilable amino acids of the synthetic grape must (Table 2), and regardless of the fermentation
conditions, their consumption accounted for 50% to
65% of the total amino acids consumed.
Figure 2. Gene expression of ammonium permease
(MEP2) and general amino acid permease (GAP1) at
time zero (before inoculation) and at different points
during the control fermentation and the nitrogendeficient fermentation (without nitrogen addition). The
data were quantified by calculating the ratio between
the concentration of the studied genes normalized with
the concentration of the housekeeping ACT gene, and
expressed as a percentage (the quantity ratio 1 was set
as 100%). YAN and ammonia consumption throughout
the fermentations are also indicated.
GAP1 and MEP2 Gene Expression. The expression of
the nitrogen transporters GAP1 and MEP2 was analyzed and quantified relative to the expression of the
housekeeping actine gene. Time zero was the expression of yeast before inoculation (and after rehydration). Both genes were repressed in the first hours
after inoculation in the must-like medium (Figure 2).
In the nitrogen-deficient fermentation, these genes
started to be activated/de-repressed after 30 h, when
nitrogen was almost depleted. The expression of both
genes increased continuously during the first days of
fermentation and peaked after 4 and 6 days for GAP1
Textos asociados
On the other hand, the consumption of arginine, glutamate, glycine, alanine, and aspartate, which were
approximately 44% of the total assimilable amino
acids in the medium (Table 2), was together hardly
2% of the total amino acids consumed in the control
fermentation. The consumption of these amino acids
was much higher in the fermentations supplemented
with nitrogen. However, yeast cells only consumed
these amino acids before the nitrogen addition: that
is, when the fermentations were nitrogen-deficient.
Last, there is one other set of amino acids, consisting
of threonine, histidine, leucine, isoleucine, phenylalanine, valine, and methionine, which was consumed
proportionally more in the control fermentation than
in the supplemented fermentations.
and MEP2, respectively. The expression of the genes
decreased in the last days of fermentation, after several days without a nitrogen source. On the other hand,
the presence of residual nitrogen in the control fermentation repressed these genes throughout.
45
Figure 3. Relative gene expression of GAP1 and
MEP2 at different points in the first 24 h after the
nitrogen addition. Time zero represents the point
just before this addition. The data were calculated
as in Figure 2.
Table 3. Secondary Metabolites Produced by Yeasts
during the Different Fermentationsa
control
ferm.
ethanol
glycerol
acetate
acetaldehyde
citrate
succinate
lactate
n-propanol
isobutanol
isoamylic alcohol
phenyl-2-ethanol
isobutyric acid
butyric acid
isovaleric acid
valeric acid
hexanoic acid
octanoic acid
decanoic acid
dodecanoic acid
Figure 3 shows the gene expression of GAP1 and
MEP2 in the first 24 h after the nitrogen addition. They
were both repressed in all the fermentations. However, the later the addition took place in the fermentation process, the longer it took for the genes to be repressed. When nitrogen was added at the end of the
fermentation (density 1000), the effect was negligible
because of the low expression at this point.
Analytical Profile. We analyzed the residual sugars,
ethanol, glycerol, and acids in the wines obtained
from the different fermentations and such flavor compounds as higher alcohols, volatile fatty acids, and esters, which arose from yeast metabolism (Table 3). The
later the nitrogen addition was, the lower the concentration of glycerol, acetic acid, and acetaldehyde was.
The higher alcohol content was lower when excess
nitrogen was available at the beginning of the fermentation (control fermentation and N1060). These
different concentrations were accounted for by the
increase in isoamyl alcohol and 2-phenylethanol.
The concentration of these compounds increased
considerably in the fermentations with nitrogen additions in the later phases (or no addition), and were
approximately 2 and 5 times higher than in the control fermentation. The increase in isoamyl alcohol did
not lead to a corresponding clear increase in its ester (isoamyl acetate) in these fermentations, and the
phenyl-2-ethanol acetate ester only increased slightly.
In fact, the differences in the concentration of the
total acetate esters between the fermentations were
due to the concentration of ethyl acetate, which was
more than 95% of the total acetate esters.
46
N1060
N1040
N1020
Alcohols and Acids (g L 1)
98.7
97.2
98.0
98.0
6.56
6.57
6.32
6.11
1.17
1.22
0.98
0.80
0.33
0.28
0.26
0.25
0.41
0.41
0.38
0.41
0.13
0.21
0.27
0.26
0.04
0.05
0.04
0.03
Higher Alcohols (mg L 1)
37
33
28
20
11
13
16
16
50
48
81
97
11
21
42
46
109
115
167
179
Fatty Acids (mg L 1)
0.39
0.40
0.43
0.63
0.73
0.67
0.63
0.37
0.30
0.12
0.09
0.09
2.06
1.58
1.40
2.30
1.95
1.84
0.39
0.37
0.21
0.16
0.14
0.09
6.70
5.63
5.02
0.39
0.72
0.44
0.10
1.53
2.34
0.19
0.16
5.87
no N
N1000 addition
98.7 101.1
5.78
6.12
0.89
0.81
0.24
0.22
0.39
0.41
0.23
0.23
0.02
0.02
13
16
94
53
176
0.50
0.59
0.80
0.18
1.90
2.43
0.14
0.32
6.86
12
16
94
43
165
0.41
0.60
0.60
0.15
1.85
2.49
0.46
0.28
6.83
Acetate Esters (mg L 1)
ethyl acetate
35
35
32
25
19
28
isobutyl acetate
0.023 0.024 0.012 0.016 0.011 0.011
isoamyl acetate
0.49
0.46
0.39
0.69
0.39
0.29
hexyl acetate
0.006 0.005 −
−
−
−
phenyl-2-ethanol acetate 0.21
0.37
0.41
0.47
0.41
0.29
35.73 35.86 32.81 26.18 19.81 28.59
ethyl butyrate
ethyl isobutyrate
ethyl hexanoate
ethyl octanoate
ethyl decanoate
Fatty Acid Esters (mg L 1)
0.224 0.220 0.163
0.006 0.005 0.006
0.089 0.071 0.23
0.022 0.022 0.060
0.002 0.004 0.019
0.343 0.322 0.478
0.232
0.005
0.31
0.081
0.024
0.652
0.164
0.004
0.23
0.059
0.019
0.446
0.124
0.007
0.085
0.020
0.004
0.240
Values are the average of two determinations and the
coefficient of variation in all the compounds analyzed
was less than 10% with the exception of decanoic acid
(18%), dodecanoic acid (38%), ethyl octanoate (16%),
and ethyl decanoate (29%).
a
Its concentration was higher in the control fermentation and the N1060 and 1040 fermentations, which
correlated with a higher acetate concentration. The
differences in the concentration of fatty acids and
their esters were smaller in the final products of the
fermentations.
DISCUSSION
The addition of nitrogen to grape musts, especially
in the form of ammoniacal nitrogen, is a common
winemaking practice that prevents nitrogen-related
fermentation problems. Several studies, in which
grape musts were supplemented with diammonium
phosphate, have proved that nitrogen supplements
can optimize fermentation performance (2-4). In the
present study, we supplemented a nitrogen-deficient
synthetic must with a mixture of ammonium and amino acids at different stages of the alcoholic fermentation. Then we studied the effect of these additions on
Seminario Técnico
We observed a reduction in the fermentation length
regardless of the time of addition and, consequently, a
reduction in the total fermentation time. However, the
fermentation length decreased even further when nitrogen was added during the exponential phase and
yeast cells probably used this nitrogen for biomass
production. These results largely agree with those
previously reported (2-4). However, the yeast strain
QA23 used in this study seems to have low nitrogen
requirements. It used only 147 mg N L-1 in the control fermentation and finished it with only 60 mg N L-1.
Agenbach (25) established that fermentations require
a minimal amount of 140 mg N L-1 to avoid getting
stuck. In fact, nitrogen demands and preferences are
strain dependent (26-28) and, therefore, it should be
taken into account that we only used one strain.
As in previous experimental studies (2, 6), we observed that nitrogen additions during the period of cell
growth resulted in an increase in cell biomass. During
the cell growth phase of the fermentation, most carbon- and nitrogen-containing compounds are diverted to biomass production. When growth stops,
however, only small amounts of these nutrients are
required, primarily for cell maintenance (3).
The metabolism of nitrogen depends heavily on its
uptake through the different nitrogen transporters. In
this study, we monitored the activity of the genes encoding two important permeases in the transport of
amino acids (GAP1) and ammonium (MEP2) throughout fermentation. In a previous study (5), we observed that both permeases were repressed in a nitrogen-rich medium by the mechanism called nitrogen
catabolite repression (NCR). The present study confirms this repression because in the control fermentation their expressions were almost negligible and
in the limiting nitrogen condition their expressions
dropped sharply at the beginning, when nitrogen was
still available, and increased continuously when it was
not. The NCR of both transporters was fast and effective, as seen with the nitrogen additions, although the
cell response to the excess of nitrogen in the medium
was quicker when the nitrogen addition was in the
first half of fermentation. During the last stages of fermentation, ethanol content is high and it is well established that the first target of ethanol toxicity is the
plasma membrane (29, 30), which can be impaired for
a long period of anaerobic growth. Therefore, the sensing system of the cell, mainly located in the plasma
membrane, may be affected by both effects (31).
The moment of the fermentation process at which
the NCR was established (by the nitrogen addition)
determined the pattern of amino acid consumption.
As previously reported (9), arginine, alanine, aspartate,
glutamate, and glycine were the amino acids that were
most affected by the NCR because they were hardly
consumed when there was an excess of nitrogen. In
fact, they were not taken up until the medium was depleted of good nitrogen sources. These amino acids
must be transported mainly by the general amino acid
permease (Gap1p) or by other specific permeases also
subjected to NCR. A similar uptake pattern for these
amino acids was previously reported in both synthetic
and natural grape juices (1, 26). On the other hand, in
brewing conditions (32) arginine and glutamine were
rapidly consumed whereas ammonium uptake was
delayed. Branched-chain and aromatic amino acids
behaved in a completely different way.
Except for tryptophan, they were mostly consumed
in the first stages of the control fermentation: that is,
when the cells were subjected to NCR from the beginning of the fermentation process. A common feature of the genes that encode the permeases of the
branched-chain amino acids (BAP1 and BAP2) and
aromatic amino acids (TAT1 and TAT2) is that they are
induced in a nitrogen-rich medium (33, 34).
Regardless of the time of addition, glutamine and
tryptophan were the main amino acids consumed after the nitrogen additions, and therefore, they may be
very important for the yeast cell metabolism throughout the process.
Ammonium accounted for 40% of the total YAN of
the fermentation media. However, its consumption
depended on the timing of the addition. Ammonium
is the preferred nitrogen source for biomass production but was hardly consumed when it was added in
the final stages of the fermentation. These differences
in ammonium uptake are difficult to explain in terms
of permease regulation. In the present study and in
our previous one (9), we detected that, the more nitrogen there was in the fermentation media, the more
repressed the three MEP genes were. Marini et al. (35)
have proposed two possible hypotheses to explain
this paradox: either the yeast possesses additional
ammonium transport systems unrelated to the Mep
proteins, or highly concentrated ammonium is taken
up into the cells by simple diffusion.
The timing of the nitrogen additions directly determined the likely aroma characteristics of the wines.
Glycerol increased in the fermentations with higher
biomass production and higher ammonium consumption. The relationship between biomass formation and glycerol synthesis has already been reported
(36- 38). Likewise, a higher glycerol yield was also observed on a synthetic glucose-rich medium when ammonium was used as the sole nitrogen source instead
of a mixture of ammonium and amino acids (39). Michnick et al. (40) also related the production of glycerol to the accumulation of acetate and acetaldehyde.
Textos asociados
the fermentation kinetics, the consumption of organic
and inorganic nitrogen throughout the fermentation,
and the influence of this consumption on the aroma
compound profile of the wines.
47
Higher alcohols were also affected by the changes in
nitrogen utilization. These compounds can be produced either by the catabolic conversion of the branched-chain amino acids (via Ehrlich) or by the anabolic formation of these amino acids de novo from
a sugar substrate (14, 15). Our results show that the
anabolic route is of greater importance because the
increase in isoamyl alcohol and 2-phenyl ethanol was
inversely proportional to the consumption of leucine
and phenylalanine, respectively.
Furthermore, the closer the nitrogen concentration
is to the growth-limiting level, the higher the yield of
fusel alcohols is.
There is also an inverse correlation between ammonium consumption and the production of fusel alcohols (12). A greater concentration of higher alcohols
did not seem to determine an increase in esters. In
contrast, the acetate concentration seemed to determine a greater concentration of acetate esters, especially ethyl acetate.
In conclusion, our study shows the quantity and quality of the nitrogen demands of the wine strain QA23.
Although further studies should be carried out with
other wine strains, our data show that cell growth
and fermentation have different preferred nitrogen
sources. Nitrogen additions always improved fermentation performance but had a minimal effect on biomass production when added in the second half of
the fermentation. These nitrogen additions subjected
the cells to NCR and changed the profile of nitrogen
consumption. The differences in the pattern of nitrogen consumption were related to different aroma
compound compositions in the wines. In our opinion,
this study is a starting point for further investigation
into using an ammonium/amino acid mixture as nitrogen supplementation in the wine industry and the
effect that these additions have on yeast physiology,
fermentation performance, and wine quality.
ACKNOWLEDGMENT
This work was supported by grant AGL20000205-P4-03 from the Comisión Interministerial de
Ciencia y Tecnología, Spain.
The authors wish to thank the language service of the
Rovira i Virgili University for revising the manuscript.
LITERATURE CITED
(1) Bisson, L. F. Influence of nitrogen on yeast and fermentation of grapes. In Proceedings of the International Symposium on Nitrogen in Grapes and
Wine; Ranz, J. M., Ed.; American Society of Enology and Viticology: Davis, CA, 1991.
(2) Bely, M.; Sablayrolles, J. M.; Barre, P. Automatic detection of assimilable nitrogen deficiencies during alcoholic fermentation in oenological conditions. J. Ferment. Bioeng. 1990, 70, 246- 252.
(3) Jiranek, V.; Langridge, P.; Henschke, P. A. Yeast nitrogen demand: selection criterion for wine yeasts
for fermenting low nitrogen musts. In Proceedings of the International Symposium on Nitrogen in Grapes and Wine; Ranz, J. M., Ed.; American Society of Enology and Viticology: Davis, CA,
1991. (4) Monteiro, F. F.; Bisson, L. F. Nitrogen supplementation of grape juice. I. Effect on amino
acid utilization during fermentation. Am. J. Enol.
Vitic. 1992, 43, 1-10.
(5) Bely, M.; Sablayrolles, J. M.; Barre, P. Description of
alcoholic fermentation kinetics: its variability and
significance. Am. J. Enol. Vitic. 1990, 41, 319-324.
(6) Mendes-Ferreira, A.; Mendes-Faia, A.; Leao, C.
Growth and fermentation patterns of Saccharomyces cereVisiae under different ammonium
concentrations and its implications in winemaking industry. J. Appl. Microbiol. 2004, 97, 540545.
(7) Cooper, T. G. Nitrogen metabolism in Saccharomyces cereVisiae. In The molecular Biology of the
Yeast Saccharomyces; Stratherm, J. N., Jones, E.
W., Broach, J. R., Eds.; Cold Spring Harbor Laboratory: Cold Spring Harbor, New York, 1982.
(8) ter Schure, E. G.; van Riel, N. A.; Verrips, C. T. The role
of ammonia metabolism in nitrogen catabolite
repression in Saccharomyces cereVisiae. FEMS
Microbiol. ReV. 2000, 24, 67- 83.
(9) Beltran, G.; Novo, M.; Rozes, N.; Mas, A.; Guillamon,
J. M. Nitrogen catabolite repression in Saccharomyces cereVisiae during wine fermentations.
FEMS Yeast Res. 2004, 4, 625-632.
(10) Jiranek, V.; Langridge, P.; Henschke, P. A. Regulation
of hydrogen sulfide liberation in wine-producing
Saccharomyces cereVisiae strains by assimilable
nitrogen. Appl. EnViron. Microbiol. 1995, 61, 461467.
48
Seminario Técnico
(12) Rapp, A.; Versini, G. Influence of nitrogen compounds in grapes on aroma compounds of wines. In Proceedings of the International Symposium on Nitrogen in Grapes and Wine; Ranz, J. M.,
Ed.; American Society of Enology and Viticology:
Davis, CA, 1991.
(13) Marks, V. D.; van der Merwe, G. K.; van Vuuren, H.
J. Transcriptional profiling of wine yeast in fermenting grape juice: regulatory effect of diammonium phosphate. FEMS Yeast Res. 2003, 3,
269-287.
(14) Äyräpää, T. Biosynthetic formation of higher alcohols by yeast. Dependence on the nitrogenous
nutrient level of the medium. J. Inst. Brew. 1971,
77, 276.
(15) Lambrechts, M. G.; Pretorius, I. S. Yeast and its importance to wine aroma. S. Afr. J. Enol. Vitic 2000,
21, 97-129.
(16) Riou, C.; Nicaud, J. M.; Barre, P.; Gaillardin, C. Stationaryphase gene expression in Saccharomyces
cereVisiae during wine fermentation. Yeast 1997,
13, 903-915.
(17) Salmon, J. M.; Barre, P. Improvement of nitrogen
assimilation and fermentation kinetics under
enological conditions by derepression of alternative nitrogen-assimilatory pathways in an industrial Saccharomyces cereVisiae strain. Appl.
EnViron. Microbiol. 1998, 64, 3831-3837.
(18) Aerny, J. Compose´s azote´s des mouˆts et vins.
ReV. Suisse Vitic. Arboric. Hortic. 1996, 28, 1611
65.
(19) Torija, M. J.; Beltran, G.; Novo, M.; Poblet, M.; Rozes,
N.; Mas, A.; Guillamon, J. M. Effect of organic acids
and nitrogen source on alcoholic fermentation:
study of their buffering capacity. J. Agric. Food
Chem. 2003, 51, 916-922.
(20) Lopez, R.; Aznar, M.; Cacho, J.; Ferreira, V. Determination of minor and trace volatile compounds in
wine by solid-phase extraction and gas chromatography with mass spectrometric detection. J.
Chromatogr. A 2002, 966, 167-177.
(21) Ferreira, V.; Sharman, M.; Cacho, J.; Dennis, J. New
and efficient microextraction/solid-phase extraction method for the gas chromatographic analysis of wine volatiles. J. Chromatogr. A 1996, 731,
247-259.
(22) Sierkstra, L. N.; Verbakel, J. M.; Verrips, C. T. Analysis of transcription and translation of glycolytic
enzymes in glucoselimited continuous cultures
of Saccharomyces cereVisiae. J. Gen. Microbiol.
1992, 138, 2559-2566.
(23) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Methods in
Yeast Genetics: A Laboratory Manual, 2 ed.; Cold
Spring Harbor Laboratory: Cold Spring Harbor,
New York, 1989.
(24) Querol, A.; Barrio, E.; Ramon, D. A comparative study of different methods of yeast strain characterization. Syst. Appl. Microbiol. 1992, 21, 315-323.
(25) Agenbach, W. A. A study of must nitrogen content
in relation to incomplete fermentations, yeast
production and fermentation. Proc. South Afr.
Soc. Enol. Vitic. 1977, 87.
(26) Jiranek, V.; Langridge, P.; Henschke, P. A. Amino
acid and ammonium utilization by Saccharomyces cereVisiae wine yeasts from a chemical defined medium. Am. J. Enol. Vitic. 1995, 46, 75-83.
(27) Manginot, C.; Roustan, J. L.; Sablayrolles, J. M. Nitrogen demand of different yeast strains during
alcoholic fermentation. Importance of the stationary phase. Enzyme Microb. Technol. 1998, 23,
511-517.
(28) Ough, C. S.; Huang, D. A.; Stevens, D. Amino acid
uptake by four commercial yeasts at two different temperatures of growth and fermentation:
Effects on urea excretion and readsorption. Am.
J. Enol. Vitic. 1991, 41, 26-40.
(29) Alexandre, H.; Rousseaux, I.; Charpentier, C. Relationship between ethanol tolerance, lipid composition and plasma membrane fluidity in Saccharomyces cereVisiae and Kloeckera apiculata.
FEMS Microbiol. Lett. 1994, 124, 17-22.
(30) Alexandre, H.; Rousseaux, I.; Charpentier, C. Ethanol adaptation mechanisms in Saccharomyces
cereVisiae. Biotechnol. Appl. Biochem. 1994, 20,
173-183.
Textos asociados
(11) Ough, C. S. Influence of nitrogen compounds in
grapes in ethyl carbamate formation in wines.
In Proceedings of the International Symposium
on Nitrogen in Grapes and Wine; Ranz, J. M., Ed.;
American Society of Enology and Viticology: Davis, CA, 1991.
(31) Gagiano, M.; Bauer, F. F.; Pretorius, I. S. The sensing
of nutritional status and the relationship to filamentous growth in Saccharomyces cereVisiae.
FEMS Yeast Res. 2002, 2, 433-470.
49
(32) Pierce, J. S. The Margaret Jones Memorial Lecture:
Amino acids in malting and brewing. J. Inst. Brew.
1982, 88, 228-233.
(37) Radler, F.; Schu¨tz, H. Glycerol production of various strains of Saccharomyces. Am. J. Enol. Vitic.
1982, 33, 36-40.
(33) Forsberg, H.; Ljungdahl, P. O. Sensors of extracellular nutrients in Saccharomyces cereVisiae. Curr.
Genet. 2001, 40, 91-109.
(38) Watanabe, M.; Uehara, M.; Shinohara, T. Effect of
cell number on the formation of glycerol and
some volatile components by yeast. J. Brew. Soc.
Jpn. 1982, 77, 346.
(34) Regenberg, B.; During-Olsen, L.; Kielland-Brandt,
M. C.; Holmberg, S. Substrate specificity and gene
expression of the amino acid permeases in Saccharomyces cereVisiae. Curr. Genet. 1999, 36,
317-328.
(35) Marini, A. M.; Soussi-Boudekou, S.; Vissers, S.; Andre, B. A family of ammonium transporters in Saccharomyces cereVisiae. Mol. Cell Biol. 1997, 17,
4282-4293.
(36) Bakker, B. M.; Overkamp, K. M.; van Maris, A. J.;
Kotter, P.; Luttik, M. A.; van Dijken, J. P.; Pronk, J. T.
Stoichiometry and compartmentation of NADH
metabolism in Saccharomyces cereVisiae. FEMS
Microbiol. ReV. 2001, 25, 15-37.
50
(39) Albers, E.; Larsson, C.; Liden, G.; Niklasson, C.; Gustafsson, L. Influence of the nitrogen source on
Saccharomyces cereVisiae anaerobic growth
and product formation. Appl. EnViron. Microbiol.
1996, 62, 3187-3195.
(40) Michnick, S.; Roustan, J. L.; Remize, F.; Barre, P.; Dequin, S. Modulation of glycerol and ethanol yields
during alcoholic fermentation in Saccharomyces
cereVisiae strains overexpressed or disrupted for
GPD1 encoding glycerol 3-phosphate dehydrogenase. Yeast 1997, 13, 783-793.
Received for review August 2, 2004. Revised
manuscript received November 12, 2004. Accepted
November 17, 2004.
Seminario Técnico
Swigers, J. H.; Pretorius, I.S.
Australian Wine Research Institute AWRI.
El artículo íntegramente reproducido a continuación se
publico on line en Applied Microbiol Biotechnol en Enero
de 2007.
Resumen
Los compuestos de azufre en el vino constituyen
una espada de doble filo. Por una parte, ciertos compuestos volátiles que contienen azufre como el sulfuro de hidrógeno ofrecen un aroma similar a huevos
podridos, por lo que pueden afectar negativamente
a la calidad sensorial del vino pero, por otra parte,
algunos compuestos de azufre como el 3-mercaptohexanol, que proporciona notas afrutadas, puede
tener un impacto positivo sobre el sabor y el aroma
del vino. Además, estos compuestos se pueden volver
más o menos atractivos o repulsivos dependiendo de
sus concentraciones absolutas y relativas. Por consiguiente es un desafío interesante que los vinicultores
modulen las concentraciones de tales compuestos
determinantes de la calidad del vino según las preferencias de los consumidores. La levadura del vino,
Saccharomyces cerevisiae, desempeña un papel clave
en la producción de compuestos volátiles de azufre.
A través de la ruta de la secuencia de reducción del
sulfato se forma HS-, el cual puede conducir a la formación de sulfuro de hidrógeno y diversos mercaptanos. Por tanto, limitar la formación del ión HS es un
objetivo importante en la ingeniería metabólica de
esta levadura. La levadura del vino también es responsable de la transformación de precursores de azufre
no volátiles presentes en la uva, en tioles volátiles con
propiedades aromatizantes. En particular, 4-mercapto-4-metilpentan-2-ona, 3-mercaptohexanol y acetato de 3-mercaptohexilo son los tioles volátiles más
importantes que añaden aromas afrutados al vino. El
presente documento revisa brevemente el proceso
metabólico implicado en la producción de importantes compuestos volátiles de azufre y las principales
estrategias a la hora de conseguir desarrollar cepas de
levaduras como herramienta para ajustar el aroma del
vino a las especificaciones del mercado.
Palabras clave: Aroma . Sabor . Bebidas fermentadas . Tioles . Vino . Levadura
1- Introducción
El azufre es un elemento abundante en la naturaleza y
presente en muchos compuestos. Puede presentarse
en forma oxidada (sulfato) o reducida (sulfuro). El azufre es uno de los elementos más importantes necesarios para la vida, particularmente como componente
de los aminoácidos cisteína y metionina, y también es
un componente de cofactores esenciales. Los microorganismos pueden metabolizar los compuestos de
azufre a través de dos rutas. En la ruta de reducción
asimilativa del azufre se toma sulfato y se utiliza para la
biosíntesis de compuestos orgánicos como la cisteína
y la metionina. En la ruta de reducción disimilativa del
sulfato, la molécula de sulfato se reduce como parte
de una ruta respiratoria a sulfito o sulfuro. Ninguno de
estos metabolitos se vuelve a metabolizar y la mayoría
se excreta (Kappler y Dahl 2001). La ruta anterior es
realizada por bacterias reductoras de sulfato que están
ampliamente distribuidas en ambientes anaeróbicos
como el suelo, los sedimentos, agua de mar y agua
dulce y en la boca e intestino de muchos animales
(Purdy et al. 2002). Los microorganismos también son
capaces de descomponer los aminoácidos con azufre
cisteína y metionina para formar sulfuros y posteriormente otros compuestos volátiles de azufre y tioles
(Dainty et al. 1989; Russell et al. 1995; Bonnarme et al.
2000; Seefeldt y Weimer 2000; Morales et al. 2005).
La levadura de vino Saccharomyces cerevisiae es
responsable de la producción de varios compuestos
volátiles de azufre que afectan a la calidad sensorial
del vino. Estos importantes compuestos volátiles de
azufre son: (1) sulfuro de hidrógeno (aroma a huevos
podridos); (2) metanotiol (metilmercaptano; aroma a
col cocida); (3) dimetilsulfuro, dimetildisulfuro y dimetiltrisulfuro (aromas a col, coliflor y ajo); (4) metiltioesteres (tioacetato de S-metilo, tiopropanato de S-metilo y tiobutanato de S-metilo; aromas a coliflor cocida,
queso y cebolleta); y (5) los “tioles volátiles afrutados”
del vino (aromas a maracuyá, pomelo, grosella espinosa, guayaba y aromas a boje; Swiegers y Pretorius
2005; Swiegers et al. 2006). Durante la fermentación
del vino, la reducción asimilativa de sulfato por la levadura (para biosintetizar cisteína y metionina) puede
producir un exceso de iones HS-, lo que genera la formación H2S en el vino (Jiranek et al. 1995; Spiropoulos
et al. 2000; Mendes- Ferreira et al. 2002; Swiegers et al.
2005a). Esto es probablemente uno de los problemas
más comunes en una bodega y, si no se trata, el vino
resultante estará contaminado provocando una pérdida de calidad y la posibilidad de que sea rechazado
por los consumidores (Vos y Gray 1979; Henschke y Jiranek 1991; Rauhut 1993). Los vinos fermentados finalizados a menudo se tratan con sulfato de cobre con
el fin de que reaccione con los compuestos de azufre
para formar complejos estables y, por tanto, eliminar
los efectos negativos del H2S y de los mercaptanos.
No obstante no es deseable utilizar sulfato de cobre
en el vino. La concentración de H S producido durante
Applied Microbiol Biotechnol, Enero de 2007 (on line)
Textos asociados
Formación de
compuestos volátiles
azufrados por
levaduras vinicas.
51
Formación de compuestos volátiles azufrados por levaduras vinicas
la fermentación del vino depende de varios factores
como la presencia de compuestos de azufre, la cepa
de la levadura, las condiciones de fermentación y los
nutrientes del zumo de uva (Henschke y Jiranek 1991;
Rauhut 1993; Spiropoulos et al. 2000). No obstante,
algunas cepas parecen producir H2S intrínsecamente sin que les afecten las condiciones ambientales,
lo que posiblemente indica un defecto metabólico
(Jiranek et al. 1995; Spiropoulos et al. 2000; MendesFerreira et al. 2002).
Por otra parte, las levaduras de vino pueden producir compuestos volátiles de azufre beneficiosos para
la calidad del vino. Algunos de estos son el furfuriltiol, un compuesto identificado en el aroma del Pinot
Manseng blanco, tintos de Burdeos, y en las duelas
tostadas (Tominaga et al. 2000). El furfuriltiol es un
aromatizante extremadamente potente (umbral de
percepción de 0,4 ng/l) y también se ha identificado
en el café tostado, la carne, el pan de trigo y en las
palomitas de maíz. Se cree que la levadura forma el
furfuriltiol mediante la transformación del furfural liberado durante la fermentación a partir de las duelas
de roble tostadas (Tominaga et al. 2000).
Otros tioles volátiles que mejoran el aroma producidos por la levadura a partir de los precursores de
la uva son el 4-mercapto-4-metilpentano- 2-ona
(4MMP), el 3-mercaptohexan-1-ol (3MH) y el acetato
de 3-mercaptohexilo (3MHA). Los tioles volátiles son
extremadamente potentes y tienen umbrales de percepción bajos: 0,8 ng/l (4MMP), 60 ng/l (3MH) y 4 ng/l
(3MHA). En los Sauvignon Blanc, estos compuestos
son de particular importancia para diversos caracteres
dado que ofrecen aromas a “boje” (4MMP), “maracuyá”,
“pomelo”, “grosella espinosa” y guayaba (3MH y 3MHA;
Tominaga et al. 1995, 1998a,b; Dubourdieu et al. 2006).
No obstante, también se han identificado 4MMP, 3MH
y 3MHA en distintas concentraciones en vinos elaborados a partir de uvas Colombard, Riesling, Semillon,
Merlot y Cabernet Sauvignon, por lo que también podrían afectar al aroma y la calidad de tales vinos (Tominaga et al. 1995, 1998a,b; Murat et al. 2001b).
El desafío de la enología moderna es limitar (o eliminar) la producción de H2S y mercaptanos indeseables
y, al mismo tiempo, mejorar la producción de tioles
volátiles beneficiosos. El uso de sulfato de cobre introduce un interesante dilema para el vinicultor, ya
que es utilizado para tratar vinos contaminados con
H2S y mercaptanos, pero al mismo tiempo reduce la
concentración de tioles volátiles deseables ya que el
ión Cu2+ no discrimina entre los dos tipos de compuestos de azufre. Por tanto, la mejor solución yace
en el desarrollo de levaduras que produzcan durante
la fermentación concentraciones absolutas y relativas
de tioles volátiles que mejoren el aroma sin la formación de H2S ni mercaptanos (Pretorius 2000; Pretorius
y Bauer 2002). En el siguiente apartado de este documento se detallan los elementos metabólicos de la
52
levadura del vino que resultan en la producción de
compuestos volátiles de azufre. Además, se discuten
los últimos avances en la modificación del metabolismo del azufre de la levadura del vino para mejorar el
sabor y el aroma del vino.
2.- Mecanismo de formación de azufre
volátil
2.1 Formación de sulfuro de hidrógeno
a través de la ruta de secuencia de
reducción de sulfato.
La levadura del vino puede formar metabólicamente H2S a partir de compuestos inorgánicos de azufre
como los sulfatos y sulfitos, así como de compuestos
orgánicos como la cisteína y el glutatión (Henschke
y Jiranek 1993; Rauhut 1993; Hallinan et al. 1999; Spiropoulos et al. 2000). En general, la uva debe ser deficiente en compuestos orgánicos de azufre, ya que
éstos pueden activar la síntesis de tales compuestos
de azufre a partir de fuentes inorgánicas habitualmente abundantes en el mosto (Henschke y Jiranek
1993; Park et al. 2000; Moreira et al. 2002). En la S. cerevisiae, H2S es el producto de la ruta de la secuencia
de reducción de sulfato (SRS) (Fig. 1; Yamagata 1989;
Rauhut 1993). En la ruta SRS, el H2S procede del ión
HS-, un intermedio metabólico de la reducción del
sulfato o sulfito necesario para la síntesis de compuestos orgánicos de azufre. Si durante la fermentación estas reacciones se producen en presencia de un
Fig. 1 Un diagrama que representa la ruta SRS
y la biosíntesis de aminoácidos en S. cerevisiae.
Adenosil 5′-fosfosulfato (APS); 3′-fosfoadenosil
5′-fosfosulfato (PAPS); O-acetilserina (O-AS);
O-acetlilhomoserina (O-AH)
Seminario Técnico
Parece que, al menos parcialmente, la capacidad de
producción de H2S de una cepa determinada es genética, ya que la producción de H2S de diferentes cepas
varía en las mismas condiciones (Thornton y Bunker
1989; Henschke y Jiranek 1993; Jiranek et al. 1995; Spiropoulos et al. 2000). El primer paso de la ruta metabólica SRS implica el transporte del sulfato desde el
medio hasta la célula de levadura mediante la sulfato
permeasa. El sulfato se reduce a continuación a sulfuro a través de una serie de pasos que implican el uso
de la enzima ATP-sulfurilasa (que emplea dos moléculas de ATP) y de la sulfito reductasa. El siguiente paso
conduce la captación del sulfuro: la O-acetilserina (del
aminoácido serina) se combina con el sulfuro para formar cisteína, y la O-acetilhomoserina (del aminoácido
aspartato) se combina con el sulfuro para formar homocisteína, la cual se puede convertir en metionina
(Thornton y Bunker 1989; Yamagata 1989; Henschke
y Jiranek 1993; Rauhut 1993; Jiranek et al. 1995; Spiropoulos et al. 2000).
Dado que las concentraciones de cisteína y metionina
en los zumos de uva habitualmente no son suficientes
para cubrir las necesidades metabólicas de las células
en crecimiento, se activa la ruta metabólica SRS para
cubrir esta demanda (Henschke y Jiranek 1993). Cuando existe una cantidad adecuada de nitrógeno en el
medio, existirán suficientes precursores de estos aminoácidos (O-acetilserina y O-acetilhomoserina) para
captar el sulfuro. Si la cantidad de nitrógeno es limitada, no habrá suficientes precursores; la ruta SRS se
activará y el sulfuro se acumulará debido a la ausencia
de precursores. El exceso de sulfuro se libera de las células en forma de H2S (Henschke y Jiranek 1993; Rauhut 1993; Jiranek et al. 1995; Spiropoulos et al. 2000).
Algunas veces, se producen cantidades importantes
de H2S cuando en el producto en fermentación hay
sulfito, el cual se difunde hacia las células. Por tanto,
en condiciones de poco nitrógeno, se observa una
producción elevada y continua de H2S en presencia
de sulfito (Jiranek et al. 1995; Hallinan et al. 1999).
Otros factores ambientales que pueden afectar a la producción de H2S son (1) niveles elevados de azufre elemental, (2) presencia de dióxido de azufre, (3) presencia
de compuestos orgánicos con azufre, (4) deficiencia
de pantotenato, (5) alto contenido relativo de treonina con respecto a otros aminoácido y (6) de metionina
con respecto a la concentración de amonio (Henschke
y Jiranek 1991; Rauhut 1993; Spiropoulos et al. 2000).
En un estudio se ha investigado recientemente el
papel de la enzima bifuncional O-acetilserina/Oacetilhomoserina tiolasa como medio para modular
la producción de H2S por la levadura industrial (Spiropoulos y Bisson 2000). El estudio demostró que la
sobreexpresión del gen MET17, que codifica la Oacetilserina/O-acetilhomoserina tiolasa, en una cepa
de S. cerevisiae originó que se formara mucho menos
H2S en un vino en fermentación. Sin embargo esto no
sucedió en otra cepa de S. cerevisiae con sobreexpresión de MET17, lo que indica que la actividad de la
O-acetilserina/O-acetilhomoserina tiolasa no está directamente relacionada con la formación de H2S (Spiropoulos y Bisson 2000).
Se ha demostrado que la sobreexpresión de dos genes, el MET14, que codifica una adenosilfosfosulfato
cinasa, y SSU1, que codifica un portador de sulfito, aumenta la formación de sulfito (Donalies y Stahl 2002).
Por tanto, se ha postulado que la ausencia del gen
MET14 o del gen MRX1, que codifican una metionina
sulfoxido reductasa, podría ser la manera más eficaz
de impedir que la levadura del vino produzca H2S
durante la fermentación (Pretorius 2000, 2003, 2004;
Pretorius y Høj 2005).
Otro método para evitar la formación de H2S fue la
modificación de la actividad de la enzima sulfito reductasa mediante la alteración de una de las subunidades de la enzima (Sutherland et al. 2003). La sulfito
reductasa es un heterotetrámero compuesto de dos
subunidades α y dos subunidades β, las cuales son
codificadas por los genes MET10 y MET5 respectivamente (Sutherland et al. 2003). La enzima, una hemoflavoproteína, enlaza los cofactores flavín adenina
dinucleótido, flavín mononucleótido y sirohemo. Se
introdujeron mutaciones en el gen MET10 de modo
que la subunidad α no se pudiera enlazar a los cofactores pero pudiera formar aun un complejo proteínico
heterotetrámetro con la subunidad β. De este modo,
la sobreexpresión del gen MET10 mutante produciría
una subunidad no funcional que podría reducir la proporción de sulfito reductasa funcional en la célula, y
por tanto reducir la formación de sulfuro. Sin embargo, es necesario investigar más para confirmar si esta
estrategia es capaz de evitar la formación de H2S en el
vino en fermentación.
Textos asociados
aporte adecuado de nitrógeno, el ión HS- es captado
por la O-acetilserina y la O-acetilhomoserina, que son
productos derivados del metabolismo del nitrógeno,
para formar compuestos orgánicos de azufre como
metionina y cisteína (Henschke y Jiranek 1993; Park et
al. 2000; Moreira et al. 2002). Sin embargo cuando las
fuentes de nitrógeno son insuficiente o inadecuadas,
el H2S puede acumularse en la célula y pasar al mosto
en fermentación por difusión (Vos y Gray 1979; Henschke y Jiranek 1991; Giudici y Kunkee 1994; Jiranek et
al. 1995, 1996).
El H2S es muy reactivo y se puede combinar con otros
componentes del vino para formar compuestos volátiles de azufre relacionados (Vermeulen et al. 2005).
Por ejemplo, el etanotiol se puede formar por reacción de H2S con etanol o acetaldehído (Amerine et al.
1980; Rauhut 1993). En el vino, se piensa que la formación de disulfuro de dimetilo, trisulfuro de dimetilo y tetrasulfuro de dimetilo se produce mediante la
oxidación del metanotiol, un compuesto que se con-
53
sidera procedente de la descomposición de la metionina (Rauhut 1993). La concentración de disulfuro de
dimetilo encontrada en algunos vinos está muy por
encima del umbral sensorial de 25 μg/l (vino blanco)
y 60 μg/l (vino tinto; Rauhut 1993). En bajas concentraciones, se considera que el disulfuro de dimetilo es
un compuesto beneficioso que contribuye al aroma
asociado al tiempo de maduración en botella (Rauhut
1993; Ribéreau-Gayon et al. 2000).
2.2. Formación de tioles volátiles
mediante la levadura a través de carbono
tiolasas
Se ha propuesto que la formación de furfuriltiol a partir
de furfural por la S. cerevisiae es catalizada por la enzima
cisteína desulfidrasa, la cual es necesaria para la producción de cisteína (Tominaga et al. 2000). Por tanto el anión
HS- se produce a través de esta enzima, originando la
formación de H2S. La formación de H2S mejora a su vez
la formación de furfuriltiol a partir de furfural. Esto se ha
confirmado al observar que el vino en fermentación con
una fuente añadida de nitrógeno (por tanto se inhibe la
formación de H2S) no produce tanto furfuriltiol. Por consiguiente, la producción de furfuriltiol se vincula a la producción del anión HS-, el cual no se produce cuando el
sulfato de amonio se añade a un caldo en fermentación
en cantidades suficientes (Tominaga et al. 2000).
Los tioles volátiles 4MMP, 3MH y 3MHA son prácticamente inexistentes en el zumo de uva y solamente se
desarrollan durante la fermentación (Fig. 2). No obstante, se ha demostrado que 4MMP y 3MH existen en
la uva en forma de conjugados enlazados a la cisteína
no volátiles y que la levadura del vino es responsable de extraer el tiol del precursor (Darriet et al. 1995).
Ciertos experimentos demuestran que una célula de
un extracto de enzima libre de célula de la Eubacterium limosum (que contiene enzimas carbono–tiolasa) podría liberar 4MMP de su precursor S-4-(4-metilpentan-2-ona)-Lcisteína (Cis-4MMP) lo que indica que
la presencia de un mecanismo similar de liberación a
través de las carbono-tio-lasas de la levadura es más
probable durante la fermentación del vino (Tominaga
et al. 1995). La hipótesis de Tominaga et al. (1995) se
comprobó investigando la capacidad de la levadura
de liberar 4MMP a partir de Cis-4MMP cuando se eliminan los genes que codifican las posibles carbonotio-lasas en una cepa de laboratorio de S. cerevisiae
(Howell et al. 2005). Cuatro genes, identificados como
responsables de las posibles enzimas carbono–tiolasas, influyeron en la liberación del tiol volátil 4MMP,
lo que indica que el mecanismo de liberación implica
probablemente varios genes. Se eliminaron también
los genes identificados en una variación homocigosa
de la levadura comercial VL3, y el resultado mostró que
la eliminación de los cuatro genes asociados a la carbono–tio-lasa conducía a una disminución de la cantidad de 4MMP liberado (Howell et al. 2005). En este
54
último estudio no se observó que la sobreexpresión
de estos genes produjera un aumento de la liberación
de 4MMP. No obstante, recientemente, nuestro grupo sobreexpresó un gen heterolocigoso que codifica
una enzima carbono-tio-lasa en una levadura comercial ampliamente utilizada (VIN13) y demostró como
conclusión que, en vinos en fermentación modelos, la
cepa VIN13 modificada liberaba diez veces más 4MMP
y 3MH de sus precursores sintetizados químicamente
que la cepa control VIN13. Además, el vino Sauvignon
Blanc producido por la levadura modificada tuvo un
muy potente aroma no detectado en el vino control.
Por tanto, es posible modificar levaduras para utilizar
más precursores de tioles derivados de la uva y por
tanto mejorar el aroma del vino (Swiegers et al. sin
publicar).
Se ha demostrado anteriormente que la cantidad
liberada de 4MMP en el vino depende de qué cepa
de levadura se utilice para llevar a cabo la fermentación (Dubourdieu et al. 2006). Por tanto, la genética y
la fisiología de la cepa determinan su capacidad para
liberar tioles volátiles. Algunos estudios del primer trabajo indicaron que las cepas comercialmente disponibles de S. cerevisiae VL3 y EG8 liberan más tioles que
las cepas VL1 y 522d. Además, las cepas de Saccharomyces bayanus liberan más 4MMP que las cepas de
S.cerevisiae VL3 y EG8. Los vinos confeccionados con
cepas híbridas de S.bayanus/S. cerevisiae muestran
un contenido superior de tioles volátiles (Murat et al.
2001b). Estos hallazgos se han confirmado al observar
que diferentes cepas comerciales tienen capacidades
diferentes de liberación de 4MMP a partir del precursor
Cis-4MMP en vinos modelo en fermentación (Howell
et al. 2004). Howell et al. (2004) han identificado cepas
comerciales de levaduras que liberan aún más tioles
que VL3. En un estudio de seguimiento, el Sauvignon
Blanc producido por siete cepas diferentes de levadura del vino (VL3 entre ellas) mostró perfiles únicos
de tioles volátiles, siendo la cepa VIN7 la que produjo mayor concentración de 4MMP y 3MHA, mientras
que VIN13 produjo mayores concentraciones de 3MH
(Swiegers et al. 2006). Se ha demostrado que durante
la fermentación, el 3MHA se forma a partir del 3MH por
la acción de la alcohol acetiltransferasa que forma ésteres y que es codificada por el gen ATF1 (Swiegers et
al. 2005b). La sobreexpresión del gen ATF1 en la cepa
de levadura VIN13 produjo un aumento significativo
de la cantidad de 3MHA producido. Por otra parte, la
sobreexpresión del gen IAH1, el cual codifica un enzima que descompone ésteres, produjo una reducción
en la concentración de 3MHA. También se investigó
la capacidad de diferentes levaduras comerciales para
convertir 3MH en 3MHA durante la fermentación. Se
observaron grandes variaciones en la concentración
de 3MHA y, en la mayoría de los casos, no correspondían con la capacidad de liberación de 4MMP de las
levaduras (Swiegers et al. 2005b). Por tanto, queda
puesto de manifiesto que la selección de la cepa de
levadura es de máxima importancia en la modulación
Seminario Técnico
de las concentraciones de tioles en el vino.
Se ha demostrado que cuando disminuye la concentración del precursor de tioles S-3- (hexan-1-ol)L-cisteina (Cis-3MH), aumenta la cantidad de 3MH
durante la fermentación. No obstante, solamente una
pequeña fracción (1,6%) del precursor enlazado a la
cisteína presente originalmente se libera como 3MH
(Dubourdieu et al. 2006). Además en mostos Cabernet
Sauvignon y Merlot, se ha observado que la cantidad
de 3MH liberada era proporcional a la concentración
de Cis-3MH presente al inicio de la fermentación. Por
tanto, cuanto mayor es la concentración de precursores de tioles conjugados a la cisteína en el mosto,
mayor es la concentración de tioles volátiles en el vino
resultante (Murat et al. 2001a). No obstante, en el estudio anterior, solamente el 3,2% del precursor presente
originalmente en el mosto se liberó en forma de tioles
volátiles durante la fermentación.
3. Conclusión
El objetivo final de todo vinicultor es conseguir un
vino con unas características óptimas de calidad, precio y apariencia al consumidor (Pretorius 2006). Para
lograr este objetivo, es necesario un control exhaustivo del método de producción, de las condiciones de
fermentación, de la elección de la cepa de levadura y
de la producción de componentes que afectan favorablemente a la calidad organoléptica del vino.
Los compuestos volátiles de azufre son aromatizantes
y saborizantes potentes que pueden tener un efecto
Textos asociados
Recientemente se ha determinado el impacto de la
temperatura de fermentación sobre la concentración
de tioles volátiles en un medio modelo y en zumo de
uva. Se demostró que las concentraciones de 4MMP,
3MH y 3MHA fueron mayores cuando se produjo la
fermentación alcohólica a 20 °C con respecto a 13°C,
independientemente de la cepa utilizada (Masneuf
Pomarède et al. 2006). Por el contrario, Swiegers et al.
(2006) ha demostrado que en vinos en fermentación
modelos, se libera más 4MMP y más 3MH se convierte
en 3MHA a bajas temperaturas (18°C) en comparación con altas temperaturas (23 y 28 °C) al final de la
fermentación. No obstante, al principio de la fermentación, hay más tioles volátiles en los caldos en fermentación más calientes (Swiegers et al. 2006).
Fig. 2 El vino es una mezcla muy compleja de compuestos derivados de la uva, de los microorganismo y, en algunos casos, del
roble, que definen en gran medida su apariencia, aroma, sabor y sensaciones en el paladar (Swiegers et al. 2005ª). Los compuestos
derivados de la uva distinguen al vino por su variedad y lo dotan de su estructura básica. La fermentación de los azúcares por
parte de las levaduras no sólo produce etanol y dióxido de carbono, sino que también una gama de metabolitos menores pero
importantes organolépticamente que proporcionan el carácter del vino. Estos metabolitos volátiles que son ésteres, alcoholes
superiores, carbonilos, ácidos grasos volátiles y compuestos de azufre, son derivados del metabolismo de los azúcares y de los
aminoácidos. Los tioles volátiles, particularmente 4MMP, 3MH y 3MHA, contribuyen de manera importante al aroma de los vinos,
particularmente en variedades como la Sauvignon Blanc. Durante la fermentación del vino, la S. cerevisiae favorece la división de
precursores no volátiles con cisteína (Cis-4MMP y Cis-3MH) existente el zumo de uva para liberar 4MMP y 3MH. La ausencia de
tioles volátiles en la uva indica la importancia de la fermentación de la levadura para su formación (Swiegers et al. 2006)
55
considerable sobre la calidad del vino. Las levaduras
de vino son las principales generadoras de compuestos volátiles de azufre, los cuales son producidos a partir de fuentes de azufre y precursores derivados de las
uvas (y en algunos casos por productos añadidos por
el vinicultor, e.g., SO2). A día de hoy se han conseguido
avances significativos para dilucidar las rutas metabólicas responsables de la formación de compuestos volátiles de azufre. Este conocimiento se está utilizando
actualmente para desarrollar cepas de levaduras de
vino que: (1) produzcan nada o mucho menos sulfuro
de hidrógeno y mercaptanos asociados y (2) tengan
una mayor capacidad de producir compuestos volátiles de azufre deseables que aporten aromas afrutados
al vino. En algunos casos, se ha aplicado ingeniería
genética con el objetivo de evaluar la viabilidad del
diseño de tales cepas para lograr los resultados deseados. Si bien los consumidores actuales son aún muy
resistentes a consumir bebidas producidas por microorganismos modificados genéticamente, la reciente
comercialización de una levadura genéticamente
modificada en la industria vitivinícola norteamericana podría indicar la aceptación gradual de esta tecnología (Husnik et al.2006). No obstante, aunque en
el futuro cercano no se utilice para producir vino co-
mercial ninguna de estas levaduras genéticamente
modificadas con metabolismos del azufre alterados,
sirven como modelos y prototipos útiles para aportar
más información que podría aplicarse para desarrollar
cepas no modificadas genéticamente utilizando técnicas más convencionales (por ejemplo, mutagénesis,
hibridación y evolución adaptativa). Por tanto, existe
un gran consenso sobre la posibilidad de confeccionar a medida levaduras de vino sin acudir a ingeniería
genética. Sin embargo, para personalizar levaduras no
modificadas genéticamente con el fin de que los vinicultores ajusten las concentraciones de compuestos
que determinan la calidad del vino, el conocimiento
fundamental requerido continuará generándose ampliamente a partir de información obtenida mediante
cepas prototipo modificadas genéticamente.
Agradecimientos: la investigación en el Australian
Wine Research Institute (Instituto de Investigación
Enológica de Australia) es posible gracias al apoyo de
viticultores y vinicultores australianos a través de su
organismo inversor, la Grape y Wine Research Development Corporation, la cual financia según una metodología “matching funds” junto al Gobierno australiano.
Referencias
Amerine MA, Berg HV, Kunkee RE, Ough CS, Singleton VL, Webb AD (1980) The technology of winemaking, 4th edn. AVI Technical Books, Westport, CT
Bonnarme P, Psoni L, Spinnler HE (2000) Diversity
of L-methionine catabolism pathways in cheese-ripening bacteria. Appl Environ Microbiol 66:5514–5517
Dainty RH, Edwards RA, Hibbard CM, Marnewick
JJ (1989) Volatile compounds associated with microbial growth on normal and high pH beef stored at chill
temperatures. J Appl Bacteriol 66:281–289
Darriet P, Tominaga T, Lavigne V, Boidron J, Dubourdieu D (1995) Identification of a powerful aromatic compound of Vitis vinifera L. var. Sauvignon wines: 4-mercapto-4-methylpentan-2-one. Flavour Fragr J
10:385–392
Donalies UEB, Stahl U (2002) Increasing sulfite formation in Saccharomyces cerevisiae by overexpression of MET14 and SSU1. Yeast 19:475–484
Dubourdieu D, Tominaga T, Masneuf I, Peyrot des
Gachons C, Murat ML (2006) The role of yeasts in
grape flavor development during fermentation: the
example of Sauvignon Blanc. Am J Enol Vitic 57:81–88
56
Giudici P, Kunkee RE (1994) The effect of nitrogen
deficiency and sulfur-containing amino acids on
the reduction of sulfate to hydrogen sulfide by wine
yeasts. Am J Enol Vitic 45:107–112
Hallinan CP, Saul DJ, Jiranek V (1999) Differential
utilization of sulfur compounds for H2S liberation by
nitrogen-starved wine yeast. Austral J Grape Wine Res
5:82–90
Henschke PA, Jiranek V (1991) Hydrogen sulfide
formation during fermentation: effect of nitrogen
composition in model grape must. Proceedings of the
international symposium on nitrogen in grapes and
wine, Seattle, USA. American Society for Enology and
Viticulture, Davis, CA, pp 172–184
Henschke PA, Jiranek V (1993) Yeast−growth during
fermentation. In: Fleet GH (ed) Wine microbiology and
biotechnology. Harwood Academic, Chur, Switzerland,
pp 27–54
Howell KS, Swiegers JH, Elsey GM, Siebert TE, Bartowsky EJ, Fleet GH, Pretorius IS, de Barros Lopes
MA (2004) Variation in 4-mercapto-4-methyl-pentan2-one release by Saccharomyces cerevisiae commercial wine strains. FEMS Microbiol Lett 240:125–129
Seminario Técnico
Husnik JI, Volschenk H, Bauer J, Colavizza D, Luo
Z, van Vuuren HJ (2006) Metabolic engineering of
malolactic wine yeast. Metab Eng 8(4):315–323
Jiranek V, Langridge P, Henschke PA (1995) Validation of bismuthcontaining indicator media for predicting H2S producing potential of Saccharomyces cerevisiae wine yeasts under enological conditions. Am J
Enol Vitic 46:269–273
Jiranek V, Langridge P, Henschke PA (1996) Determination of sulphite reductase activity and its response to assimilable nitrogen status in a commercial
Saccharomyces cerevisiae wine yeast. J Appl Bacteriol
81:329–336
Kappler U, Dahl C (2001) Enzymology and molecular biology of prokaryotic sulfite oxidation. FEMS Microbiol Lett 203:1–9
Masneuf-Pomarède I, Le Jeune C, Durrens P, Lollier M, Aigle M, Dubourdieu D (2006) Influence of
fermentation temperature on volatile thiols concentrations in Sauvignon blanc wines. Int J Food Microbiol 108:385–390
Mendes-Ferreira A, Mendes-Faia A, Leao C (2002)
Survey of hydrogen sulphide production by wine
yeasts. J Food Prot 65:1033–1037
Morales P, Fernandez-Garcia E, Nunez M (2005)
Volatile compounds produced in cheese by Pseudomonas strains of dairy origin belonging to six different
species. J Agric Food Chem 53:6835–6843
Moreira N, Mendes F, Pereira O, Guedes de Pinho P, Hogg T, Vasconcelos I (2002) Volatile sulphur
compounds in wines related to yeast metabolism and
nitrogen composition of grape musts. Anal Chim Acta
458:157–167
Murat ML, Masneuf I, Darriet P, Lavigne V, Tominaga T, Dubourdieu D (2001a) Effect of Saccharomyces cerevisiae yeast strains on the liberation of
volatile thiols in Sauvignon Blanc wine. Am J Enol Vitic
52:136–139
Murat ML, Tominaga T, Dubourdieu D (2001b) Assessing the aromatic potential of Cabernet Sauvignon
and Merlot musts used to produce rose wine by assaying the cysteinylated precursor of 3-mercaptohexan1-ol. J Agric Food Chem 49:5412–5417
Park SK, Boulton RB, Noble AC (2000) Formation of
hydrogen sulfide and glutathione during fermentation of white grape musts. Am J Enol Vitic 51:91–97
Pretorius IS (2000) Tailoring wine yeast for the new
millennium: novel approaches to the ancient art of
winemaking. Yeast 16:675–729
Pretorius IS (2003) The genetic analysis and tailoring
of wine yeasts. In: de Winde JH (ed) Genetics and genomics of industrial yeasts. Springer, Berlin Heidelberg
New York, pp 99–134
Pretorius IS (2004) The genetic improvement of
wine yeasts. In: Arora DK, Bridge PD, Bhatnagar (eds)
Handbook of fungal biotechnology. Marcel Dekker,
New York, USA, pp 183–223
Pretorius IS (2006) Grape and wine biotechnology:
setting new goals for the design of improved grapevines, wine yeast and malolactic bacteria. In: Hui HY,
Barta J, Cano MP, Gusek T, Sidhu JS, Sinha N (eds) Handbook of fruits processing science and technology.
Blackwell, Ames, IA, USA, pp 453–489
Pretorius IS, Bauer FF (2002) Meeting the consumer
challenge through genetically customized wine-yeast
strains. Trends Biotechnol 20:426–432
Pretorius IS, Høj PB (2005) Grape and wine biotechnology: challenges, opportunities and potential benefits. Austral J Grape Wine Res 11:83–108
Purdy KJ, Embley TM, Nedwell DB (2002) The distribution and activity of sulphate reducing bacteria in
estuarine and coastal marine sediments. Antonie Van
Leeuwenhoek 81:181–187
Rauhut D (1993) Yeasts−production of sulfur compounds. In: Fleet GH (ed) Wine microbiology and biotechnology. Harwood Academic, Chur, Switzerland, pp
183–223
Ribéreau-Gayon P, Dubourdieu D, Donéche B,
Lonvaud A (2000) Handbook of Enology, vol 1: the
microbiology of wines and vinification. Wiley, Chichester, UK, p 454
Russell SM, Fletcher DL, Cox NA (1995) Spoilage
bacteria of freshbroiler chicken carcasses. Poult Sci
74:2041–2047 Seefeldt KE, Weimer BC (2000) Diversity
of sulfur compound production in lactic acid bacteria.
J Dairy Sci 83:2740–2746
Textos asociados
Howell KS, Klein M, Swiegers JH, Hayasaka Y, Elsey
GM, Fleet GH, Høj PB, Pretorius IS, de Barros Lopes MA (2005) Genetic determinants of volatile thiol
release by Saccharomyces cerevisiae during wine fermentation. Appl Environ Microbiol 71:5420–5426
Spiropoulos A, Bisson LF (2000) MET17 and hydrogen sulfide formation in Saccharomycescerevisiae.
Appl Environ Microbiol 66:4421–4426
57
Capítulo
Spiropoulos A, Tanaka J, Flerianos I, Bisson LF
(2000) Characterization of hydrogen sulfide formation in commercial and natural wine isolates of Saccharomyces. Am J Enol Vitic 51:233–248
Swiegers JH, Pretorius IS (2005) Yeast modulation
of wine flavour. Adv Appl Microbiol 57:131–175
Tominaga T, Masneuf I, Dubourdieu D (1995) A Scysteine conjugate, precursor of aroma of white sauvignon. J Int Sci Vigne Vin 29:227–232
Swiegers JH, Bartowsky EJ, Henschke PA, Pretorius IS (2005a) Yeast and bacterial modulation of
wine aroma and flavour. Austral J Grape Wine Res
11:139–173
Tominaga T, Peyrot des Gachons C, Dubourdieu
D (1998a) A new type of flavour precursors in Vitis
vinifera L. cv. Sauvignon Blanc: S-cysteine conjugates. J
Agric Food Chem 46:5215–5219
Swiegers JH, Willmott R, Hill-Ling A, Capone DL,
Pardon KH, Elsey GM, Howell KS, de Barros Lopes
MA, Sefton MA, Lilly M,
Tominaga T, Furrer A, Henry R, Dubourdieu D
(1998b) Identification of new volatile thiols in the
aroma of Vitis vinifera L. var. Sauvignon Blanc wines.
Flavour Fragr J 13:159–162
Pretorius IS (2005b) Modulation of volatile thiol and
ester aromas in wine by modified wine yeast. Proceedings of the Weurman flavour research symposium,
Roskilde, Denmark, 21– 24 June 2005, Developments
in Food Science, Elsevier, Amsterdam, The Netherlands
Swiegers JH, Francis IL, Herderich MJ, Pretorius
IS (2006) Meeting consumer expectations through
management in vineyard and winery: the choice of
yeast for fermentation offers great potential to adjust
the aroma of Sauvignon Blanc wine. Austral NZ Wine
Ind J 21:34–42
Sutherland CM, Henschke PA, Langridge P, de Barros Lopes M (2003) Subunit and cofactor binding of
Saccharomyces cerevisiae sulfite reductase−towards
developing wine yeast with lowered ability to produce
hydrogen sulfide. Austral J Grape Wine Res 9:186–193
58
Thornton RJ, Bunker A (1989) Characterisation of
wine yeasts for genetically modifiable properties. J
Inst Brew 95:181–184
Tominaga T, Blanchard L, Darriet P, Dubourdieu
D (2000). A powerful aromatic volatile thiol, 2-furanmethanethiol, exhibiting roast coffee aroma in wines
made from several Vitis vinifera grape varieties. J Agric
Food Chem 48:1799–1802
Vermeulen C, Gijs L, Collin S (2005) Sensorial contribution and formation pathways of thiols in foods: a
review. Food Rev Int 21:69–137
Vos PJA, Gray RS (1979) The origin and control of
hydrogen sulphide during fermentation of grape
must. Am J Enol Vitic 30:187–197
Yamagata S (1989) Roles of O-acetyl-L-homoserine sulfhydrylases in micro-organisms. Biochimie
71:1125–1143
Seminario Técnico
Cordente, T.; Swiegers, H.; (Australian Wine Research
Institute AWRI), Heinrich, A.; (Mauri Yeast Australia)
El artículo íntegramente reproducido a continuación se
publico por primera vez en la revista The Australian and
New Zealand Grapegrover ans Winemaker Magazine en
noviembre de 2007. Publicado con el permiso de la citada revista .
Las cepas de levadura descritas en este artículo como su
correspondiente proceso de desarrollo están pendientes
de patente.
Introducción
La producción excesiva de Sulfuro de Hidrógeno (H2S)
que tiene lugar en el transcurso del proceso de fermentación del mosto constituye un problema bastante común en lo que a vinificación se refiere (Monk
1986; Henschke and Jiranek 1991). El principal motivo
de ello radica en la baja concentración de elementos
nitrogenados en el medio. Con el objeto de paliar
este problema, los enologos pueden, en el transcurso del proceso de fermentación, aumentar el grado
de nitrógeno en el mosto, añadiéndole fosfato diamónico (DAP) o utilizando sulfato de cobre después
de la fermentación con el fin de suprimir el H2S del
vino. Pero a pesar del aporte en DAP, la levadura sigue
produciendo H2S en algunos medios y todo ello sin
hablar del hecho de que la mayoría de los enólogos
preferiría no tener que recurrir al uso del sulfato de
cobre. Los vinos que contienen H2S desprenden un
olor desagradable (a huevo podrido), pero además,
debido a su olor, el H2S, no solo reduce las cualidades
organolépticas del vino sino también oculta las notas
aromáticas favorables de éste.
¿Cabría imaginar que en el futuro podamos llevar a
cabo una fermentación con levaduras de vinificación
que no produzcan H2S detectable sea cual sea el contenido en nitrógeno asimilable del medio y sin ningún
aporte en DAP? Por otro lado, ¿Estas cepas de levadura serían capaces de realzar aromas favorecedores
manteniendo a la vez una excelente capacidad de
fermentación? El Instituto de Investigación Vitivinícola
de Australia (AWRI) ha desarrollado, en colaboración
con la Sociedad Mauri Yeast Australia, nuevas cepas
de levadura que producen cantidades indetectables
de H2S. Estas levaduras son Advantage, Platinum y
Distinction.
¿Cómo han sido desarrolladas estás
levaduras de baja producción de H2S?
Para el desarrollo de estas cepas, el AWRI ha utilizado
métodos biológicos clásicos (no OGM). La cepa Maurivin PDM era la cepa parental ideal, dada la popularidad de la que goza entre los elaboradores a nivel internacional. El objetivo radicaba en adaptar la cepa de
manera que ésta realzara sus propiedades favorables,
es decir su capacidad en no producir cantidades detectables de H2S y a partir de ella se han obtenido las
cepas cuyos ensayos se exponen a continuación.
Estas cepas, pendientes de patente, están clasificadas
como “no OGM” en todos los países vitivinícolas del
mundo.
Probar las cepas en mostos
empobrecidos en nitrógeno asimilable
Las cepas seleccionadas se probaron en mostos que
contenían bajas cantidades de nitrógeno asimilable
(100 mg. N/L). No se añadió ningún aporte en DAP
durante el proceso de fermentación. Las fermentaciones de laboratorio se realizaron a 18º C, por triplicado, con una concentración inicial en azúcar de
240 gr./lt. (aproximadamente 13.5 B). Unas cintas
reactivas (tipo Fluka) extremadamente sensibles al
H2S fueron insertadas en cada frasco con el fin de
poner en evidencia la producción de H2S; las cintas
blancas, indicaban la ausencia de liberación de H2S.
Las cintas de color marrón indicaban, por otra parte,
una presencia de H2S en cantidades indetectables
para el olfato humano. Las cintas negras indicaban
en cambio una presencia de H2S más allá del límite
perceptible por el olfato humano aún que en un nivel de concentración no perjudicial para la calidad
del vino.
Al finalizar la fermentación, las cintas reactivas sumergidas en las muestras que contenían Advantage
y Distinction se quedaron blancas o de color muy
claro Platinum (Figura 1) Este resultado confirmó que
estas cepas no producían cantidades detectables de
H2S, incluso en presencia de cantidades muy bajas de
nitrógeno asimilable. El patrón , Maurivin PDM, quedo claramente coloreado. Conviene destacar que en
los mostos que contenían cantidades suficientes de
nitrógeno asimilable, Maurivin PDM no produjo nada
de H2S.
The Australian and New Zealand Grapegrover
ans Winemaker Magazine, noviembre de 2007
Textos asociados
Una revolución en el
sector enólogico:
Levaduras de
vinificación que no
producen Sulfuro de
hidrógeno (H2S)
59
Una revolución en el sector enólogico: Levaduras de vinificación que no producen Sulfuro de hidrógeno
Estos resultados demuestran que estas tres cepas Advantage, Platinum y Distinction, fermentan mostos
empobrecidos en nitrógeno asimilable sin producir
cantidades de H2S detectables por la nariz humana.
Asimismo, estas tres cepas de levadura presentan
cinéticas de fermentación comparables con las de
la cepa de levadura PDM, conocida por su robustez
(Tabla 1, Figura 2).
cantidad de H2S que sobrepasaba el límite de la percepción sensorial.
Y en condiciones reales de vinificación
En resumen
Las cepas han sido probadas en condiciones reales de
vinificación con el fin de reflejar su aptitud en las condiciones ambientales propias al vino. Se sometió a
prueba un mosto de Chardonnay con una concentración de azúcar de 190 gr./lt. Y, al igual que en la prueba
anterior, no se añadió DAP en todo el transcurso del
proceso de fermentación. Utilizando condiciones de
fermentación similares a las anteriormente descritas,
la fermentación se llevó a cabo a una temperatura de
15º C y, de la misma manera, los grados de fermentación obtenidos fueron similares a los obtenidos con
la cepa testigo de referencia (Maurivin PDM). Las
cintas reactivas de todos los mostos de Chardonnay
fermentados con las tres nuevas cepas se quedaron
blancas. Hecho que confirma que, sin ningún aporte
en DAP estas cepas no producen H2S con la variedad
Chardonnay.
La producción de H2S es perjudicial para la producción de vinos de calidad. Felizmente, hoy en día, existen cepas de levaduras llamadas Advantage, Platinum
Distinction.. Estas cepas se adaptan especialmente
a los mostos que, empobrecidos en nitrógeno, evitan la producción de H2S. Por lo general se trata de
cepas polivalentes que permiten la fermentación de
una amplia gama de variedades a la vez que una producción de vinos de calidad con características sensoriales considerablemente mejoradas. Además, al no
tener que recurrir al DAP (o emplearlo en cantidades
inferiores) se facilita así el procesos de vinificación.
Las catas tampoco revelaron presencia alguna de H2S.
Los catadores indicaron la presencia de notas afrutadas, dada la ausencia de notas azufradas. Estas cepas
de levadura presentan pues con la variedad Chardonnay, unas capacidades de fermentación indudables;
y por este motivo fueron sometidas a prueba otras
variedades con el fin de confirmar dicha aptitud fermentaría.
Resultados obtenidos con la variedad
Sauvignon Blanc
A lo largo de este estudio, se uso un mosto de Sauvignon Blanc para llevar a cabo la fermentación, con
el objetivo de marcar más las diferencias sensoriales
usando una variedad aromática. El mosto presentaba
las características analíticas siguientes: 190 gr./lt. de
azúcar, pH 3.3, acidez total de 5.1 gr./lt. Las fermentaciones se realizaron a una temperatura 18°C. Las
cintas reactivas confirmaron de nuevo que en ausencia de cualquier aporte de DAP las cepas Advantage,
Distinction y Platinum no producían H2S mientras
que en el mismo tiempo, la cepa testigo producía una
60
Las catas llevadas a cabo al finalizar el análisis demostraron que los vinos presentaban características sensoriales positivas. Además, las cepas revelaron unas
cinéticas de fermentación comparables a la obtenida
con la cepa Maurivin PDM .
Agradecimientos
Los autores dan las gracias al Dr. Nick Yap, al Dr. Dan
Johnson y al Profesor Sakkie Pretorius por su valiosa colaboración a lo largo de todo este proyecto así
como por la crítica constructiva que hicieron de este
artículo. El Dr. Toni Cordente se ha beneficiado del
apoyo económico del grupo AB Mauri. El Dr.Hentie
Swiegers es investigador en el Instituto de Investigación Vitivinícola de Autralia, subvencionado por la
asociación de los vinificadores y viticultores Australianos a través de su organismo de inversión: la sociedad
de Desarrollo de la Investigación sobre Uva y Vino así
como por los fondos del gobierno de Australia.
Referencias
Monk, P.R. Formation, utilization and excretion of
hydrogen sulfide by wine yeast. (1986) Wine Industry Journal, Noviembre 10-16.
Henschke PA, Jiranek V (1991) Hydrogen sulfide
formation during fermentation: effect of nitrogen
composition in model grape must. Proceedings of the
international symposium on nitrogen in grapes and
wine, Seattle, USA. American Society for Enology and
Viticulture, Davis, CA, Pág.172–184
Seminario Técnico
Tabla 1. Análisis químicos de los vinos
PDM
Advantage
Platinum
Distinction
Azúcar residual (Fructosa) gr./lt.
1.7
1.2
0.2
0
Glicerol gr./lt.
4.8
5.8
5.2
5.3
Ácido acético gr./lt.
0.28
0.35
0.06
0.20
Etanol %
11.4
11.3
11.3
11.5
Días de fermentación (<2 gr./lt.)
17
19
12
12
Figura 1. Cintas reactivas cuyo color negro indica la presencia de pequeñas cantidades de H2S
Textos asociados
Figura 2. Cinética de fermentación de distintas cepas de levadura
61
62
Seminario Técnico
Ugliano, M.; Henschke, P.A.; Herderich, M.J.; Pretorius,
I.S.
The Australian Wine Research Institute, PO Box 197, Glen
Osmond (Adelaide), South Australia 5064, Australia
“Winemaking begins in the vineyard” is a mantra
that has widespread support amongst winemakers.
It conveys the concept of vineyard or, in French jargon, terroir as an intrinsic property of grape, and
consequently the corresponding wine. There is no
doubt that many great wines are associated with
great vineyards. So, where do yeast fi t in?
The perception that fermentation yeast faithfully
transform grape must into wine has been changing
in the detail over the past decades. This is a result of
science uncovering the many roles that yeast perform, and the wider selection of strains available that
promote these various attributes. For example, whereas most strains produce a relatively similar, generic,
fermentation bouquet only some strains possess a
strong ability to hydrolyse cysteine conjugates responsible for Sauvignon Blanc character, meaning that
only selected strains can enhance varietal expression
(Swiegers et al. 2006).
Winemakers today have many options through fermentation management to enhance the varietal characteristics of their wine, or to express further regional
attributes. Furthermore, yeast strongly respond to
their environment. It is well known that temperature aff ects the rate of fermentation, that grape solids
enhance survival and that high osmotic stress, as
imposed by a Botrytis-aff ected must, leads not only
to increased glycerol production but also to higher
volatile acidity. The latter example highlights the remarkable ability of yeast to adapt to stressful (i.e. high
sugar) environments. However, there is an accompanying metabolic adaptation which can have positive or
negative fl avour implications.
At the time of inoculation, yeast are subjected to a
range of stresses to which the cell must adapt in order
to exploit its new environment. Some of the known
stresses are osmotic pressure, oxidative conditions,
sulphite toxicity and temperature shock (Bauer and
Pretorius 2000). Nutrients, whether present in sub- or
super-optimal concentration, can also induce stress
and metabolic responses. The primary response is
aimed at protecting the cell from committing to reproduction when key nutrients are lacking or dealing
with potential toxicity when the concentration is outside the normal range. The metabolic response often
involves a cascade of biochemical reactions, some of
which can lead to altered metabolism of nutrients
such that the yeast will secrete end-products in diff
erent amounts (Albers et al. 1998). Some of the end
products that have sensory properties can lead to
changes in the fl avour profi le of the wine. H2S formation is an all-too-well known example relating to
nitrogen depletion stress.
Clearly, the vineyard environment and intervention
by the viticulturist shape the development of the vine
and especially the composition of the grape. Because
the viticulturist attempts to balance a long list of priorities in order to produce fruit to specifi cation, most
attention will focus on those factors that cannot be
modifi ed once the fruit has been harvested.
Therefore, yeast nutrients, especially nitrogen, might
not be optimised for fermentation, largely in the belief
that nutrients can be easily corrected in the winery. Given that we estimate that up to 500t of diammonium
phosphate (DAP) could be used each year to produce
Australian wine, is this winemaking input being used
eff ectively? Our current state of knowledge on the
implications of controlling vineyard nitrogen as opposed to fermentation nitrogen on fermentation performance and wine composition has been recently reviewed by Bell and Henschke (2005). In this article, we
will focus on the role that fermentation nitrogen has
in modulating metabolism and some of the changes
that this can have on wine fl avour. We will fi rst summarise current best practice for managing fermentation nitrogen and then describe the main fl avour
changes that are aff ected by nitrogen.
Finally, we will consider the fl avour implications of nitrogen for white and red wine fermentations.
CURRENT BEST PRACTICE FOR
MANAGING FERMENTATION NITROGEN
Textos asociados
Nitrogen
management is
critical for wine
Managing Director,
flavour and style
A common practice amongst winemakers is to make
a standard addition of DAP to the juice or must (100300mg/L) at inoculation without measuring the nitrogen concentration. This article will show that DAP
addition has signifi cant fl avour consequences and
that measuring the initial nitrogen concentration provides the opportunity to adjust DAP addition not only
to achieve an adequate fermentation rate, but also to
more reliably guide the fl avour profi le and style of
wine required. This work is still in a conceptual stage
Wine Industry Journal > Vol 22 No 6 > November / December 2007
63
Nitrogen management is critical for wine Managing Director, flavour and style
1.1 Measuring YAN
gen measurements yields YAN (Figure 1). This procedure is used by NATA-accredited laboratories such as
AWRI’s Analytical Service laboratory (http://www.awri.
com.au/analytical_ service/analyses/yeast_assimilable_
nitrogen/), which can provide a timely service during
vintage.
Grapes contain a variety of nitrogenous compounds
of which the most important are the primary or alpha
amino acids, ammonium ion and small peptides. Proline, a dominant secondary amino acid in many grape varieties, cannot be assimilated under anaerobic
conditions (Ingledew et al. 1987). These nitrogenous
compounds, excluding proline, constitute what is
commonly referred to as yeast assimilable nitrogen
(YAN).
The so-called Formol Titration is a simpler, rapid method for measuring YAN (Shively and Henick-Kling
2001; Gump et al. 2002; Filipe-Ribereiro and MendesFaia 2005), although the use of formaldehyde, a toxic
volatile reagent, requires a well-trained analyst and
suitable laboratory. YAN determination with midinfrared (MIR) spectrometry, which is most rapid, has
recently been developed by the AWRI (Dambergs et
al. 2005).
Because amino acids are chemicallydiverse molecules, the most convenient measure of assimilable
nitrogen relates to assaying the free or alpha-amino
group of the primary amino acids, which is commonly
referred to as free amino nitrogen (FAN). Proline, a secondary amino acid, and protein are excluded in FAN
assay methods. Of the several chemical, enzymatic
and physical methods available (Shively and HenickKling 2001; Bell and Henschke 2005; Filipe-Ribereiro
and Mendes-Faia 2007) the method of choice is the
o-phthaldialdehyde/N-acetyl-L-cysteine (NOPA) method (Dukes and Butzke 1998). An additional enzymatic method is needed to determine ammonia, of
which 82% is nitrogen. Summation of these two nitro-
YAN measurements, ideally, should be performed directly on juice or must samples at the point of inoculation to avoid over-estimation due to processing
losses which inevitably occur between vineyard and
the fermentor. Furthermore, juice samples taken from
grape musts can under-estimate total berry YAN due
to an important proportion of amino acid contained
in the grape skin. Refer to the review by Bell and Henschke (2005) for a detailed discussion of these points.
based on studies with Chardonnay and Shiraz; however, it should stimulate winemakers to experiment
with these and other varieties.
Nevertheless, an early warning for low YAN can be
achieved by sampling in the vineyard one to two weeks prior to harvest, such as during maturity sampling.
1.2 Supplementing must YAN
The YAN content of Australian grape juices varies widely from approximately 50-350mg/L, with a mean
value of around 200mg/L. As a benchmark, it is generally agreed that maximum yeast biomass yield and
fermentation rate results when YAN exceeds 400mg/L,
whereas 150mg/L YAN marks a transition zone, below
which the risk of slow or stuck fermentation notably
increases (Henschke and Jiranek 1993; Blateyron et al.
2003). Since much of the background research work
to establish these benchmarks has been carried out
in synthetic and fi ltered grape juices, this risk value
is technically only valid for highly clarifi ed, anaerobic, juice fermentations. Nonetheless, it represents a
worst-case scenario and is a useful guide for other types of fermentation.
Figure 1. Summation of free amino nitrogen
and ammonia nitrogen levels provides a useful
estimate of the yeast assimilable nitrogen level.
64
In general, in order to achieve an adequate rate of
fermentation to dryness, a cellar bright juice containing <150mg/L YAN should be supplemented with
nitrogen to at least 150-200mg/L when the respective vineyard has a history of low YAN fermentation
problems or a high nitrogen-demanding yeast has
been selected. Nitrogen supplementation should be
increased to the higher end of the range for higher
°Brix juices, whereas juices containing grape solids, or
fermentations that are aerated, are less susceptible to
low YAN diffi culties (Ribéreau-Gayon et al. 2000; Blateyron et al. 2003; Eglinton et al. 2005). Later on in this
Seminario Técnico
One disadvantage of DAP as a supplement is the acidifi cation that can result in some juices, leading to
a lowerthan- expected wine pH. Utilisation of the
ammonium cation by yeast leaves a notable proportion of the phosphate anion, which can lower pH,
depending on initial pH and must titratable acidity
(TA). Furthermore, large additions of DAP can lead to
excessive wine phosphate content. In practice, the
maximum addition of DAP is limited by the concomitant concentration of soluble phosphate remaining in
the wine, which is set at 400mg P/L (Australian and
New Zealand Food Standard 4.5.1). This concentration
of phosphate-P would correspond to a maximum of
1.7g/L
DAP (equivalent to 360mg/L YAN) if we assume that
the juice/must contained no phosphate; in practice a
lesser amount of DAP can only, therefore, be added.
Overuse of DAP can also stimulate overproduction of
acetate esters, especially ethyl acetate, resulting in the
perception of volatile acidity (VA) and suppression of
varietal character. As discussed in the following sections, high YAN (exceeding 450-500mg/L YAN) can
stimulate ethyl acetate production by many yeast
strains.
When working with very low YAN juices, we have observed that other nutrients can similarly be low. Thus,
when YAN is low and other nutrient defi ciencies are
suspected, it can be useful to add a proprietary yeast
food that contains more complex forms of N, as well
as vitamins, lipids and minerals. Indeed, continued
H2S production after DAP addition suggests a general
vitamin defi ciency (Henschke 1996; Wang et al. 2003),
though other causes are also possible.
Most yeast suppliers can advise on the use of yeast
foods, which are generally produced from inactivated
yeast.
The principal role of sugar metabolism in yeast is to
generate energy and carbon skeletons for building all
the components of the cell. These metabolic activities
result in the accumulation of several by-products, including esters, higher alcohols and polyols, carbonyls,
acids and thiols which contribute to the aroma and fl
avour of wine. Nitrogen metabolism, which is involved in the assimilation of nitrogen for the synthesis of
protein and nucleic acids, also contributes to the pool
of aroma and fl avour compounds. Because nitrogen
metabolism is central to cell growth, it regulates other
pathways, including sugar and sulphur metabolism.
Consequently, nitrogen availability can signifi cantly
impact on the production of many fl avouractive metabolites. The nitrogen status of a juice or must, therefore, contributes to wine fl avour as well as aff ecting
yeast growth and the fermentation of sugars.
2.1 Major fermentation products
In addition to ethanol and CO2, other major products
of sugar metabolism are the polyols, such as glycerol
and butanediol and the organic acids, especially acetic and succinic acids and, to a lesser extent, the ketoacids, such as pyruvic acid and -ketoglutaric acid.
The production of many of these primary metabolites
of sugar metabolism is modulated by YAN, although
the magnitude of changes has been observed to
depend on the yeast strain under consideration. Furthermore, the type of nitrogen source used, DAP or
amino acids, aff ects metabolite production (Albers et
al. 1996). Because low YAN juices are typically supplemented with DAP, only the impact of ammonium ion
concentration on the production of yeast metabolites
will be discussed in this article.
Glycerol
Malic
acid
Succinic
acid
Textos asociados
DAP is widely used as a YAN supplement for this purpose. DAP contains 21% N, therefore, for convenience
we can consider 100mg DAP to contain 20mg YAN. By
way of an example, it will be necessary to add 500mg/L
DAP to a juice to increase its YAN concentration from
100mg/L to 200mg/L. While this fi gure seems a large addition of DAP, the YAN equivalent of 1.5g DAP
would be needed to reach the point at which maximum fermentation rate would be achieved. Australian winemakers can visit the AWRI website to access
the calculator to estimate DAP additions: http://www.
awri.com.au/ practical_solutions/calculators/.
GENERAL METABOLIC RESPONSES OF
YEAST TO YAN
Concentration
article, when we consider the fl avour consequences
of juice YAN content, some winemakers might choose
to supplement low YAN juices up to a fi nal concentration of 250-300mg/L YAN so as to produce a cleaner,
fruitier style.
Acetic
acid
SO2
100
200
YAN
300
400
Figure 2. Effect of yeast assimilable nitrogen
on production or utilisation of major metabolic
products of sugar fermentation and sulphur
assimilation.
65
Theoretically, DAP-grown yeast are forced to synthesise amino acids for cell growth when compared with
amino acid grown yeast. This decreases the proportion of sugar available for ethanol production (Albers
et al. 1996), but in our experiments this has a minor aff
ect on ethanol yield.
Glycerol and acetic acid, which are important to wine
composition and fl avour, respond relatively strongly
to juice YAN concentration (Albers et al. 1998; Torrea et
al. 2005; Vilanova et al. 2007).
Figure 2 summarises general trends observed in synthetic juice and white wine fermentations. Both glycerol and acetic acid production depends strongly
on the yeast strain used. For example, when using
yeast Vitilevure M05 DAP addition increases glycerol
production whereas the reverse is the case for AWRI
796 (Vilanova et al. 2007). Both yeast, however, produce the lowest concentrations of acetic acid at moderate YAN concentrations (range of 200-250mg/L)
while higher concentrations are produced at both
lower and higher concentrations of YAN. Malic acid
consumption does, however, increase with increasing
DAP concentration, irrespective of yeast strain. On the
contrary and depending on the strain, succinic acid
concentration can increase with increasing DAP addition (Coulter et al. 2004). In general, YAN can aff ect TA
and the balance of organic acids which can aff ect fl
avour (Sowalsky and Noble 1998).
Sulphur dioxide production during fermentation can
also be stimulated by initial YAN concentration, but
the response seems to be yeast strain dependent.
Experimental work in synthetic media and wort suggests that low SO2 is produced in low YAN media
but increases when initial YAN availability is higher
(Duan et al. 2004; Osborne and Edwards 2006). SO2
production contrasts with H2S production, which is
generally lowered by increasing YAN. Increased risk
of MLF inhibition has also been associated with high
YAN addition but this inhibition has not been conclusively correlated with SO2 production (Osborne and
Edwards 2006). Nevertheless, until better information
is available, consideration should be given to limiting
high YAN conditions when malolactic fermentation
(MLF) is required.
tation-derived volatiles in the aroma character of wine
(Smyth et al. 2005). Several studies have indicated that
both the total available nitrogen and the balance of
amino acids and ammonia can signifi cantly aff ect
the production of different groups of fermentationderived volatile compounds.
From a practical point of view, the problem of juice nitrogen composition is primarily linked to the frequent
occurrence of juices with suboptimal concentrations
of nitrogen, and higher risk of slow or stuck fermentation. As this problem is frequently corrected in the
winery through the addition of DAP, several studies
have investigated the implications of this common
winery practice on the volatile composition of wine
(Ayrapaa 1971, Rapp and Versini 1991; Carrau 2003; Torrea and Henschke 2004; Hernandez-Orte et al. 2005,
2006; Vilanova et al. 2007). Due to the variety of yeast
strains and fermentation conditions employed, it is
somewhat diffi cult to extrapolate from the literature
defi nitive conclusions concerning the eff ect of DAP
addition on wine aroma. Nevertheless, some general
trends relating to DAP supplementation and wine volatile composition are summarised in Figure 3.
Higher alcohols, which are directly related to amino
acid metabolism in the cell, exhibit a characteristic
behaviour. Therefore, when total nitrogen is increased
by adding ammonium to a medium containing very
low levels of YAN, the production of higher alcohols
is initially increased, but then tends to decrease after
a peak between 200-300mg/L YAN. This activity depends on various factors, including yeast strain and
fermentation conditions.Higher alcohols are characterised by fusel-like odours, and are generally thought
to contribute to the complexity of wine fermentation bouquet. However, when present in very high
concentrations they can have a negative impact on
wine aroma, mainly because they mask fruity characters. Several authors have reported that ammonium
supplementation can improve wine sensory quality
Concentration of yeast aroma compounds
Ethanol is the major product of sugar fermentation.
However, while DAP addition increases yeast growth
and the rate of fermentation, it has little to no practical
eff ect on fi nal ethanol yield.
Higher alcohols
Ethyl acetate
Acetate esters
Fatty acids
ethyl esters
Branched chain
esters
2.2 Volatile aroma compounds
Among the various yeast metabolic pathways that are
infl uenced by the nitrogen composition of the juice,
those leading to volatile compounds are of particular
importance due to the primary role played by fermen-
66
100
200
300
YAN
400
500
Figure 3. Relationship between initial YAN
concentration and fi nal concentration of volatile
compounds after fermentation.
Seminario Técnico
The production of fatty acids ethyl esters, as well as of
acetate esters, including ethyl acetate, is generally increased when DAP is added to the juice prior to alcoholic fermentation (Figure 3). This can have interesting
implications for wine fl avour as fatty acids ethyl esters
and acetates are generally responsible for the fruity character of wine (Guth and Sies 2002). However,
ethyl acetate, one of the dominant yeast-derived volatile metabolites, when present at very high concentrations, can give unwanted sensory characteristics,
often described with terms like nail lacquer/solvent
and volatile acidity. Branched chain esters are, from a
quantitative point of view, the less abundant volatiles
produced during fermentation. Although their contribution to wine fl avour has still to be clarifi ed, tentative evidence is available in the literature for these
compounds to be important contributors to the red
berry fruit character of some red wines (Diaz- Maroto
et al. 2005). Their concentration appears to decrease
with increased DAP additions, however.
The existence of a variety of diff erent responses for
the various groups of yeastderived volatile compounds to DAP supplementation arises from the fact
that each group of volatiles is derived from a diff erent
metabolic pathway, each of which respond differently
to DAP supplementation. However, from a practical
point of view, understanding the potential of DAP
supplementation as a tool to modulate wine sensory
characteristics cannot be based simply on compositional data. The various volatiles or groups of volatiles
illustrated in Figure 3 occur in wine over an extremely
broad range of concentrations. However, this fi gure
does not represent the actual quantitative relationship between diff erent chemical species. For example,
higher alcohols, characterised by herbaceous, fusellike odours, typically occur in concentrations that can
be up to 400 times higher than ethyl fatty acid esters,
120
Odour Activity Value
100
80
Isoamyl alcohol
Ethyl octanoate
Isoamyl acetate
Ethyl 3-methylbutanoate
Ethyl acetate
characterised by fruit-like odours. Nevertheless, relatively small variations in the concentration of ethyl fatty
acid esters, such as those introduced by variations in
YAN content, are more likely to aff ect the aroma of
wine than if proportionally similar variations would
occur for higher alcohols. This is due to the fact that
some of the possible sensory modifi cations associated with changes in the concentration of specifi c
aroma compounds depend, among other factors, on
the ability of that aroma compound to generate an
olfactory stimulus at a given concentration.
This complex relationship is often simplifi ed by
means of the concept of odour threshold, defi ned as
the minimum concentration at which a given compound can be detected by the sense of smell (Guth
1997). This is referred to as the odour activity value
(OAV). Some of the fermentation-derived volatile
compounds, such as esters, that are generally associated with the fruity character of wine, are extremely
powerful odourants (i.e. have a very low odour threshold) and can, therefore, impart specifi c sensory attributes even when present in low concentrations. On
the contrary, compounds like higher alcohols possess
a much higher odour threshold and, therefore, are
likely to generate variations in the aroma profi le of
a wine only when their concentration varies to a very
large extent. In Figure 4, a theoretical relationship between the OAV of selected volatile compounds, belonging to the chemical classes of Figure 3, and DAP supplementation is illustrated. It appears clear then that
the range of variations potentially introduced by DAP
in the concentration of acetates and fatty acid ethyl
esters (isoamyl acetate and ethyl octanoate are used
as reference compounds for these two classes) can
have a dramatic impact on the volatile character of
wine, whereas variations in compounds such as higher alcohols (isoamyl alcohol), although quantitatively
extremely large, are likely to have a limited impact.
Although it has to be stressed that OAVs only give a
projection of the potential of a given compound to
contribute to the overall aroma of a wine, the trends
shown in Figure 4 provide a good indication of which
one of the compositional changes associated with
DAP supplementation is likely to have a greater impact on wine aroma.
IMPLICATIONS OF NITROGEN FOR WINE
FERMENTATIONS
60
Textos asociados
by lowering higher alcohols production (Rapp and
Versini 1991). However, based on the trend shown in
Figure 3, this advice has to be taken cautiously as it
might apply only to fermentations with initial YAN in
the range included in the descending part of higher
alcohols production pattern, i.e. YAN >200mg N/L.
3.1 Implications of nitrogen for white wine
fermentations
40
20
0
100
200
300
YAN
400
500
Figure 4. Theoretical relationship between initial
YAN concentration and Odour Activity Values of
selected yeast-derived aroma compounds.
Interestingly, the results obtained in various winemaking trials conducted at the AWRI with sub-optimal
YAN juices have indicated that, under typical winemaking conditions, DAP supplementation is an extremely
powerful tool for modulating the production of esters
which, based on the previous discussion, are probably
67
the most sensorially-interesting group of compounds
generated during fermentation. Figures 5 and 6 show
the variations in volatile compounds and the sensory
profi le of Chardonnay wines made at diff erent DAP
concentrations. In good agreement with the trends
shown in Figure 3, DAP had a positive eff ect on ester
production, while it lowered the formation of higher
alcohols. However, the wines obtained with moderate
nitrogen supplementation of the juice were preferred
by panellists compared with those obtained without
or with high DAP addition. This preference might be
due to a combination of higher acetates, ethyl fatty
acid ester concentrations and moderate levels of ethyl
acetate, the latter being associated with unwanted,
solvent-like characteristics when present at very high
concentrations. DAP addition to low YAN juices also
suppresses the production of H2S and mercaptans by
many wine yeasts, which although not quantifi ed in
this study, no doubt contributed to the preference of
the moderate YAN wines. The impact of DAP addition
on the production of fruity thiols, such as 4MMP, 3MH
and 3MHA, still needs to be determined.
These results highlight the complexity of predicting
wine aroma from compositional data. They also underline the importance of measuring YAN and adding
the appropriate amount of DAP, if necessary, before or
during fermentation in order to reduce the potentially
negative eff ects that inadequate or excessive DAP supplementation can have on wine aroma. Particularly,
the risk of excessive formation of ethyl acetate has to
be considered as this ester is relatively stable during
wine ageing, compared with other acetate and ethyl
fatty acid esters, which tend to decrease signifi cantly
after several months of bottle storage.
12,000
160mg/L YAN
320mg/L YAN
3.2 Implications of nitrogen for red wine
fermentations
More recently, researchers at the AWRI have investigated the eff ect of DAP supplementation on the volatile
composition of Shiraz wine (Ugliano et al. 2007). It is generally believed that the conditions normally adopted
for the production of red wine (i.e. higher temperatures,
aeration of the fermenting must during cap management operations, extraction of YAN and other nutrients
from skin during maceration) render fermentations less
susceptible to slow or stuck fermentations, even when
YAN concentrations approach the sub-optimal range.
Nevertheless, several surveys have shown that YAN
levels in red grapes can be well below optimal (Gockowiak and Henschke 1992; Butzke 1998; Nicolini et al.
2004; Ugliano and Henschke, unpublished data).
Although during red wine fermentations YAN defi
ciencies are likely to have a more moderate eff ect on
fermentation kinetics, they can still negatively aff ect
the formation of important aroma compounds. From
the results of a trial which was carried out on a low
YAN Shiraz must (YAN 100mg/L) with S. cerevisiae
AWRI 796, it is again clearly evident that DAP supplementation is a powerful tool for modulating the volatile composition of red wine. This confi rms some of
the trends observed during experiments with model
substrates and white grape juices. As can be seen in
Figure 7, DAP supplementation resulted in higher production of ethyl fatty acid esters and acetate esters,
while higher alcohols were scarcely affected.
Preliminary results also indicated that YAN supplementation of must can have an impact on red wine
480mg/L YAN
Wet cardboard
Less preferred aromas
Concentration µg/L
6000
Cheesy
Acetic
Artificial grape
Musk
Floral
More preferred aromas
8000
Fruit ester
3.5
3
2.5
2
1.5
1
0.5
0
Sweaty
10,000
Banana
4
4000
Nail lacquer
Stewed fruit
2000
Stale beer
Tropical
0
Fatty acids ethyl esters
Acetates
Ethyl acetate/10
Higher alcohols/100
Honey
Bruised apple
Figure 5. Volatile compounds of wines obtained
from a low YAN (160mg/L) Chardonnay juice
supplemented with two increasing concentrations
of DAP, to a fi nal YAN of 320mg/L and 480mg/L,
respectively. Fermentations were carried out at
18ºC using S. cerevisiae AWRI 796.
68
Citrus
Figure 6. Sensory characteristics of wines obtained
from a low YAN (160mg/L) Chardonnay juice
(green line) supplemented with two increasing
concentrations of DAP, to a fi nal YAN of 320mg/L
(red line) and 480mg/L (blue line), respectively.
Fermentations were carried out at 18ºC using S.
cerevisiae AWRI 796.
Seminario Técnico
CONCLUSION
This work shows that the concentration of yeast assimilable nitrogen is not only important for ensuring
that adequate yeast growth and fermentation kinetics
are achieved, but also can aff ect the production of
the major metabolites arising from sugar fermentation. Whereas ethanol concentration is little aff ected,
that of glycerol and various carboxylic acids can be
markedly modulated. These changes are likely to aff
ect wine fl avour. Most importantly, however, is the fi
nding that YAN can strongly infl uence production of
some of the volatile metabolites, especially the acetate and ethyl esters, which are known to be positive
to wine aroma when in balance. The impact of higher
alcohols, which can be negative when present in high
concentration, can also be modulated by YAN. These
various yeast metabolites were also found to vary in
10,000
9000
100mg/L YAN
250mg/L YAN
400mg/L YAN
Concentration µg/L
8000
7000
6000
5000
4000
3000
2000
1000
0
Fatty acids ethyl esters
Acetates
Ethyl acetate
Higher alcohols/100
Figure 7. Volatile compounds of wines obtained
from low YAN (100mg/L YAN) Shiraz grapes
supplemented with two increasing concentrations
of DAP, to a fi nal YAN of 250mg/L and 400mg/L
respectively. Fermentations were carried out
at 22ºC using S. cerevisiae AWRI 796, with cap
plunging three times per day.
red wine fermentations, suggesting that, as in white
wines, must YAN can aff ect the development of wine
fl avour. Our preliminary data suggest that wine colour and phenolics composition can also be infl uenced
by YAN.
Overall, these results suggest that, at least for Chardonnay, the fl avour and style of wine is dramatically
modulated by the initial YAN concentration of the grape juice. Low YAN level juices favour the production of
more complex wines with less fruity aromas, whereas
moderate YAN levels produce cleaner and fruitier wines. However, high YAN levels can lead to excessively
estery wines. Similar eff ects can be expected in other
varieties, excepting for those varieties that depend on
thiols, for which no information is presently available.
Clearly, more wine sensory studies need to be undertaken to better understand the eff ects of must YAN
and amino acid profi le on wine fl avour.
A red wine trial is currently in progress to understand
better the impacts of managing nitrogen in the vineyard compared with that in the winery on wine fl
avour and quality. This research can be expected to
provide grapegrowers and winemakers with better
information for optimising wine style and quality according to consumer preferences and other desired
outcomes.
ACKNOWLEDGEMENTS
We thank our many colleagues for supporting this
project, especially Tracey Siebert and Dimitra Capone
for help with analysis of fermentation volatiles; Mariola Kwiatkowski and Meagan Mercurio for analysis
of phenolic compounds; Kate Lattey, Belinda Bramley and Dr Leigh Francis for carrying out the sensory analyses; Industry Development and Support
and Analytical Service team members for help with
chemical analyses; and Dr Paul Chambers, Dr Cristian Varela and Biosciences team members for many
helpful discussions. Professor Francisco Carrau, of
Uruguay, and visiting scientists Drs Diego Torrea and
Mar Vilanova, from Spain, have made important contributions to this project. We are especially grateful to
Mike Farmilo, of Boar’s Rock winery, for supplying a
large number of juice samples and donating must for
the Shiraz fermentation trials, and Russell Johnstone
and Inca Pearce, of Orlando Wines, and Louisa Rose
and Simon Dillon of The Yalumba Wine Company, for
supplying white wine juices. Current work on nitrogen management also involves collaboration with Dr
Sally-Jean Bell and Marcel Essling. Rae Blair is thanked
for her editorial assistance. This project is supported
by Australia’s grapegrowers and winemakers through
their investment agency, the Grape and Wine Research and Development Corporation, with matching
funds from the Australian Government. The AWRI is a
member of the Wine Innovation Cluster.
Textos asociados
colour composition. Analytical parameters related to
colour intensity and hue were indeed found to vary
with DAP supplementation (Ugliano et al. 2007). The
factors responsible for this eff ect are currently being
investigated at the AWRI. The eff ect might be ascribable to various aspects of yeast metabolism that
are known to modulate wine colour and phenolics
composition. Factors include variations in the rate of
ethanol production, absorption of anthocyanins on
yeast cell walls (Morata et al. 2003) or reactions with
yeast-derived metabolites such as pyruvic acid and
acetaldehyde to form pigmented polymers (Romero
and Bakker 1999).
69
REFERENCES
1 Albers, E.; Larsson, C.; Liden, G.; Niklasson, C. &
Gustafsson, L. (1996) Infl uence of the nitrogen
source on Saccharomyces cerevisiae anaerobic
growth and product formation. Appl. Env. Microbiol.
62: 3187-3195.
2 Albers, E.; Lidén, G.; Larsson, C.; Gustafsson, L.
(1998) Anaerobic redox balance and nitrogen metabolism in Saccharomyces cerevisiae. Recent Res.
Develop. Microbiol. 2: 253-279; 1998.
3 Äyräpää, T. (1971) Biosynthetic formation of higher
alcohols by yeast.
Dependence on the nitrogenous nutrient level of
the medium. J. Inst.
Brew. 77: 266-276.
4 Bauer, F.F.; Pretorius, I.S. (2000). Yeast stress response and fermentation effi ciency: how to survive
the making of wine – A review. S. Afr. J. Enol. Vitic.
21: 27-51.
12 Duan, W.; Roddick, F.A.; Higgins, V.J.; Rogers, P.J.
(2004) A parallel analysis of H2S and SO2 formation
by brewing yeast in response to sulphur-containing
amino acids and ammonium ions. J. Am. Soc. Brew.
Chem. 62: 35-41.
13 Dukes, B.C.; Butzke, C.E. (1998) Rapid determination of primary amino acids in grape juice using an
o-phthaldialdehyde/N-acetyl-L-cysteine spectrophotometric assay. Am. J. Enol. Vitic. 49: 125-134.
14 Eglinton, J.; Siebert, T.; Kwaitkowski, M.; Francis, L.; Henschke P. (2005) Compositional and sensory implications of practical strategies for ensuring
complete fermentation with non-conventional
yeast. Blair, R.J.; Williams, P.J.; Pretorius, I.S.(eds.) Proceedings of the twelfth Australian wine industry technical conference; 24-29 July 2004; Melbourne, Vic.
Australian Wine Industry Technical Conference Inc.,
Adelaide SA: 288.
5 Bell, S.-J.; Henschke, P.A. (2005) Implications of nitrogen nutrition for grapes, fermentation and wine.
Aust. J. Grape Wine Res. 11: 242-295.
15 Filipe-Ribeiro, L.; Mendes-Faia, A. (2007) Validation and comparison of analytical methods used
to evaluate the nitrogen status of grape juice. Food
Chem. 100: 1272-1277.
6 Blateyron, L.; Ortiz-Julien, A; Sablayrolles, J.M.
(2003) Stuck fermentations: oxygen and nitrogen
requirements – importance of optimising their addition. Aust. N.Z. Grapegrower Winemaker 478: 73-79.
16 Gockowiak, H.; Henschke, P.A. (1992) Nitrogen
composition of grape juice and implications for fermentation: results of a survey made in N-E Victoria.
Aust Grapegrower Winemaker 340: 131, 133-138.
7 Butzke, C. (1998). Survey of Yeast Assimilable Nitrogen status in musts from California, Oregon, and
Washington. Am. J. Enol. Vitic. 49: 220-224.
17 Gump, B.H.; Zoecklein, B.W.; Fugelsang, K.C.;
Whiton, R.S. (2002) Comparison of analytical methods for prediction of prefermentation nutritional
status of grape juice. Am. J. Enol. Vitic. 53: 325-329.
8 Carrau, F.M. (2003) Characterization of yeast in relation to the ability to utilize nitrogen – Studies of
aroma compounds. PhD thesis, Universidad de la
Republica, Uruguay.
9 Coulter, A.D.; Godden, P.W.; Pretorius, I.S. (2004)
Succinic acid-how is it formed, what is its eff ect on
titratable acidity, and what factors infl uence its concentration in wine? Aust. N.Z. Wine Ind. J. 19: 16-20,
22-25.
10 Dambergs, R.G.; Kambouris, B.; Cynkar, W.; Janik, L.J.; Cozzolino, D.; Henschke, P.A.; Gishen,
M. (2005) A comparison of near infrared and midinfrared spectroscopy for the analysis of yeast-assimilable nitrogen in grape juice. Blair, R.J.; Williams,
P.J.; Pretorius, I.S. (eds.) Proceedings of the twelfth
Australian wine industry technical conference; 2429 July 2004; Melbourne, Vic. Australian Wine Industry Technical Conference Inc., Adelaide SA: 334.
70
11 Diaz-Maroto, M.C.; Schneider, R.; Baumes, R.
(2005) Formation pathways of ethyl esters of branched short-chain fatty acids during wine aging. J.
Agric Food Chem., 53, 3503-3509.
18 Guth, H. (1997) Quantitation and sensory studies
of character impact odorants of diff erent white wines varieties. J. Agric. Food Chem., 45: 3027-3032.
19 Guth, H.; Sies, A. (2002) Flavour of wines: Towards
an understanding by reconstitution experiments
and an analysis of ethanol’s eff ect on odour activity
of key compounds. Blair, R.J.; Williams, P.J.; Høj, P.B.
(eds.). Proceedings of the eleventh Australian Wine
Industry Technical Conference, 7-11 October 2001,
Adelaide SA. Australian Wine Industry Technical
Conference Inc., Adelaide SA 128-139.
20 Henschke, P.A. (1996) Hydrogen sulphide production by yeast during fermentation. Proceedings
Eleventh international oenological symposium, Sopron, Hungary (International Association for Winery
Technology and Management: Breisach, Germany)
pp. 83-102.
Seminario Técnico
22 Hernández-Orte, P.; Ibarz, M.J.; Cacho, J.; Ferreira V. (2005) Eff ect of the addition of ammonium
and amino acids to must of Airen variety on aromatic composition and sensory properties of the obtained wines. Food Chem. 89: 163-174.
23 Hernández-Orte, P.; Bely, M.; Cacho, J.; Ferreira, V. (2006) Impact of ammonium additions on
volatile acidity, ethanol, and aromatic compounds
production by diff erent Saccharomyces cerevisiae
strains during fermentation in controlled synthetic
media. Aust. J. Grape. Wine Res. 12: 150-160.
24 Ingledew, W.M.; Magnus, C.A.; Sosulski, F.W.
(1987) Infl uence of oxygen on proline utilization
during wine fermentation. Am. J. Enol. Vitic. 38: 246248.
25 Morata, A.; Gomez-Cordoves, M.C.; Suberviola,
J.; Bartolomé, B.; Colomo, B.; Suárez, J.A. (2003)
Adsorption of anthocyanins by cell walls during the
fermentation of red wines. J. Agric. Food. Chem. 51,
4084-4088.
26 Nicolini, G.; Larcher, R.; Versini, G. (2004) Status
of yeast assimilable nitrogen in Italian grape musts
and eff ect of variety, ripening and vintage. Vitis, 43:
89-96.
27 Osborne, J.P.; Edwards, C.G. (2006) Inhibition of
malolactic fermentation by Saccharomyces during
alcoholic fermentation under low- and highnitrogen conditions: a study in synthetic media. Aust. J.
Grape Wine Res. 12: 69-78.
28 Rapp, A.; Versini, G. (1991). Infl uence of nitrogen compounds in grapes on aroma compounds
of wine. Proceedings of the International Symposium
on Nitrogen in Grapes and Wine. Davis USA: American
Society for Enology and Viticulture, 156-164.
29 Ribéreau-Gayon, J.; Dubourdieu, D.; Donéche,
B.; Lonvaud, A. (2000) Handbook of Enology, Volume 1: The microbiology of wines and vinifi cation.
John Wiley & Sons Ltd: Chichester, UK.: 454.
30 Romero C.; Bakker, J. (1999) Interactions between grape anthocyanins and pyruvic acid, with eff
ect of pH and acid concentration on anthocyanin
composition and color in model systems. J. Agric.
Food Chem. 47, 3130-3139.
31 Shively, C.E.; Henick-Kling, T. (2001) Comparison
of two procedures for assay of free amino nitrogen.
Am. J. Enol. Vitic. 52: 400-401.
32 Smyth, H., Cozzolino, D., Herderich, M.J., Sefton, M.A.; Francis, I.L. (2005) Relating volatile
composition to wine aroma: identifi cation of key
aroma compounds in Australian white wines. Blair,
R.J.; Williams, P.J.; Pretorius, I.S. (eds.) Proceedings of
the Twelfth Australian Wine Industry Technical Conference, Melbourne, Vic, 24-29 July 2004. Australian
Wine Industry Technical Conference Inc., Adelaide
SA: 31-33.
33 Sowalsky, R.A.; Noble, A.C. (1998) Comparison
of the eff ects of concentration, pH and anion species on astringency and sourness of organic acids.
Chem. Senses 23: 343-349.
34 Swiegers, J.H.; Francis, I.L.; Herderich, M.J.; Pretorius, I.S. (2006) Meeting consumer expectations
through management in the vineyard and winery:
the choice of yeast for fermentation off ers great potential to adjust the aroma of Sauvignon Blanc wine.
Aust. N.Z. Wine Ind. J. 21: 34-42.
35 Torrea, D.; Henschke P.A. (2004) Ammonium supplementation of grape juice – eff ect on the aroma
profi le of a Chardonnay wine. Tech. Rev. 150, 59-63.
36 Torrea, D.; Siebert, T.; Liebich, B.; Ancin, C.; Francis, L.; Henschke, P.A. (2005) Eff ect of ammonium
supplementation of a Chardonnay must on wine
aroma. Blair, R.J.; Williams, P.J.; Pretorius, I.S. (eds.)
Proceedings of the Twelfth Australian Wine Industry
Technical Conference, Melbourne, Vic,, 24-29 July
2004. Australian Wine Industry Technical Conference Inc., Adelaide, SA: 293.
37 Ugliano, M.; Siebert, T.; Capone, D.; Mercurio,
M.; Henschke, P.A. (2007) Colour, aroma and fl
avour compounds in Shiraz wine as aff ected by DAP
addition before fermentation. Blair, R.J.; Williams, P.J.;
Pretorius, I. S. (eds.) Proceedings of the thirteenth Australian Wine Industry Technical Conference,
Adelaide, SA, 28 July-2 August 2007. Australian Wine
Industry Technical Conference Inc. Adelaide, SA: in
press.
38 Vilanova, M.; Ugliano, M.; Siebert, T.; Pretorius,
I.J.; Henschke, P.A. (2007) Assimilable nitrogen utilization and production of volatile and nonvolatile
compounds in chemically defi ned medium by Saccharomyces cerevisiae wine strains. App. Microbiol.
Biotechnol. 77: 145-157.
Textos asociados
21 Henschke, P.A.; Jiranek, V. (1993) Yeasts – metabolism of nitrogen compounds. In: Wine Microbiology and Biotechnology. Fleet, G.H. (ed.) (Harwood
Academic Publishers: Chur, Switzerland) pp. 77-164.
39 Wang, X.D.; Bohlscheid, J.C.; Edwards, C.G.
(2003) Fermentative activity and production of
volatile compounds by Saccharomyces grown in
synthetic grape juice media defi cient in assimilable
nitrogen and/or pantothenic acid. J. Appl. Microbiol.
94: 349-359.
71
72
Seminario Técnico
Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; and Pretorius, I.S.
In a world first, scientists at the Australian Wine Research Institute have sequenced the wine yeast genome, characterising the ‘recipes of life’ that shape
this winemaker’s ‘friend’.
Unlocking the secret to what makes wine yeast tick
will put winemakers in a stronger position to use
science to their advantage. This work paves the way
for the development of new yeast strains, potentially leading to innovative solutions to tackle stuck
fermentation and to create wines with desired alcohol levels and flavour profiles.
Every four years, the Olympic Games inspire the world
with spectacular performances and feats of endurance, speed and grace. We marvel at the athletic performance of the competitors; most of us can only wonder how these champions reach the standards they
do. What makes world record-breakers so profoundly
different to the rest of us? Are we not the same species, and therefore shouldn’t we all have the same
potential? Couldn’t we also win gold in swimming or
running if we had the same training regimes, diet, lifestyle, etc.? The answer is no. Elite athletes are born
with a potential that has ‘gold’ stamped all over it. They
have muscle-types, physique, physiology and aptitude that, with training, can be honed for international
success. Unfortunately, most of us would require a
great deal more than honing to reach this elite level;
until bionics is able to rebuild what we are born with,
when it comes to athletics, most humans will have to
settle for amateur league or less (Figure 1(a)).
Differences in performance of individuals of the same
species are not peculiar to humans; in fact we see it
everywhere in nature. Take, for example, the humble
yeast that winemakers use to craft complex, delicious
wine from sweet, syrupy grape juice. Most wine yeast
are the same species, Saccharomyces cere visiae, but
not all members of this group are able to produce
wine, and, among those that do, there is considerable
variation in how reliably and efficiently they work, and
in the quality of the wine they produce.
This begs the question: What makes a wine yeast tick?
What, in the inner workings of this elite athlete, enables
it to grow in such an inhospitable environment and de-
liver gold medal wines when other S. cerevisiae strains
don’t even leave the starting blocks? Research at the
Australian Wine Research Institute (AWRI) is beginning
to unravel the mysteries of the variation across the S.
cerevisiae species, and early results on what they tell
us about wine yeast are tantalising.
The variation in performance that we see across strains of S. cerevisiae is inheritable; this means that it is
genetically determined. The starting point for characterising this variation, therefore, should focus on yeast
genetics.
Fortunately, S. cerevisiae was the first organism of its
type to have its genetic make-up (its genome) sequenced, and this was done over ten years ago on a strain, known as S288c, chosen for its ‘laboratory friendly’
characteristics (for more information on what genes
and genomes are, see the breakout box). Scientists
love this yeast because it is very easy to work with, but
it would not win any medals in the winemaking arena;
in fact, it is probably not even up to amateur status.
Nevertheless, if you want to find out what makes wine
yeast so different from other S. cerevisiae strains, you
have to have something to compare it with, and S288c
is a good starting point.
Another strain of S. cerevisiae, YJM789, recently had
its genome sequenced. The genome of this yeast, an
opportunistic pathogen isolated from the lungs of an
AIDS patient, turned out to be quite different to that
S288c. Thus we had two different versions of S. cerevisiae to compare a wine yeast against, and this is what
we found.
It turns out that our wine yeast is a little more different
to the two previously sequenced strains than they are
to each other (Figure 2). About 0.6% of the letters of
the wine yeast sequence are different to what is found
in the laboratory strain. This might seem like a small
difference, but if you consider that genetic differences
between humans and chimpanzees amount to only
about 1-2%, it is really quite large.
Perhaps of greater interest, however, is that there
are extra DNA sequences in the wine yeast; enough
to carry at least 27 genes that are not present in the
two yeasts it was compared against. In fact, some of
the sequences in this extra DNA do not resemble anything found in other species of Saccharomyces; they
appear to be more like genes found in very distant
fungal relatives. We do not yet know how they got
into the wine yeast genome, but we are curious to
find out whether or not they play a part in distinguishing wine yeast from other S. cerevisiae, particularly in
the winemaking stakes.
Textos asociados
Unravelling the
genetic blueprint of
wine yeast
Some of the wine yeast-specific genes encode proteins that are probably associated with the cell wall,
Wine Industry Journal > Vol 23 No 5 > September /October 2008
73
Unravelling the genetic blueprint of wine yeast
a feature of yeast that is undoubtedly important for
resilience in inhospitable environments.
We are curious to find out whether these genes impact on robustness of wine yeast, a feature that is crucial for completing fermentations. Do these genes, for
example, make the yeast more or less vulnerable to
becoming stuck or sluggish in a ferment? We have also
identified genes that probably encode proteins associated with amino acid uptake (a neutral amino acid
transporter) and metabolism (an aspartate transaminase). Because amino acid metabolism is associated
with flavour development, it is tempting to suggest
that these genes will impact on sensory attributes in
wine, but, of course, this will have to be tested.
Then there are lots of genes that we cannot guess the
function(s) of yet, and these might turn out to be the
most exciting of all; time and experimental work will tell.
Interestingly, we also found some sizeable rearrangements in the genome that we are also curious about,
but cannot even guess what their significance will be.
What does the future hold now that we have this rich
source of information on a wine yeast? We will, of
course, ascertain as far as possible, which of the unique features of a wine yeast genome are important in
a winemaking context.
However, we also plan to build on data gathered
from this project by sequencing and comparing the
genomes of several other wine yeast strains that are
known to have different winemaking properties This
will enable us to work out what is common to all wine
yeasts (i.e. what constitutes the core requirements of
a wine yeast) and what differences between them
drive production of wines with differing qualities (e.g.
different propensities to deliver fruity flavours and
aromas).
Once we understand what makes a wine yeast tick,
and the significance of variation among wine yeasts,
we will be much better placed to develop strains of
1(a)
1(b)
Figure 1. No two humans have the same genetic make-up. An elite athlete, for example, is born with
a genome that has ‘gold medal’ stamped all over it (Figure 1(a)). Similarly, not all wine yeasts are the
same; different wine yeasts have different genetic make-up (Figure 1(b)). This is why some wine yeast
strains are more robust that others and different strains impart different sensory properties to wines.
Understanding what, in the genome of a wine yeast, determines its robustness and its ability to produce
desirable (and undesirable) sensory attributes will enable the development of improved strains that will
assist winemakers to craft wines for an increasingly demanding and constantly changing market.
74
Seminario Técnico
ACKNOWLEDGEMENTS
this microorganism that can complete the marathon
of fermentation without becoming stuck or sluggish
en route, while producing gold medal wines; and all
of this should be possible without the need of performance enhancing additives.
Just like our Olympians at the Australian Institute of
Sport, the wine sector has gold-medal aspirations.
Backed by sound science and robust research it should
be gold all of the way for Australian winemakers.
FURTHER READING
Borneman, A.R, Forgan; A., Chambers, P.J. and Pretorius, I.S. (2008) Comparative genome analysis of a
Saccharomyces cerevisiae wine strain.
FEMS Yeast Research 8:1185-1195.
Borneman, A.R.; Chambers, P.J. and Pretorius,
I.S. (2007) Yeast Systems Biology: modelling the
winemaker’s art. Trends in Biotechnology 25:349-355.
Goffeau A.; Barrell B.G.; Bussey H.; Davis R.W.; Dujon B.; Feldmann H.; Galibert F.; Hoheisel J.D.; Jacq
C.; Johnston M,; Louis E.J.; Mewes H.W.; Murakami
Y.; Philippsen P.; Tettelin H. and Oliver S.G. (1996)
Life with 6000 genes. Science 274: 546, 563-567.
Cracking the Code: Genes and Genomes
G
enes are recipes for making proteins. For example, your cells carry a gene/recipe for making the protein insulin, which is a hormone
that regulates blood sugar level. You also have genes/recipes that instruct your cells how to make proteins that control how tall you
can grow, the colour of your eyes, the general shape of your body, etc. It is these recipes of life that dictate whether you will have
athletic potential or not, and, because you inherited them from your parents you end up looking like them.
If genes are recipes then genomes are recipe books. The human genome carries all of the recipes required for making proteins to build a
human body from conception to adulthood, and repair and defend that body during its life. All of our physiology and anatomy is shaped by a
collection of 20,000-25,000 genes that comprise the human genome. And, unless you have an identical twin, your recipe book diff ers a little
from everyone else’s.
The language of the genes is very diff erent the languages we use to communicate with each other. It is based on an alphabet of only four
letters (A, T, G and C) and its lexicon is limited to three letter words, which means there are only 64 words in the genetic dictionary. However
this is more than enough to string together sets of instructions for building all of the proteins (enzymes, hormones, muscles, antibodies,
cartilage etc.) we require for life.
The ‘paper’ on which the words that make up the recipes of life is written is known as DNA, and when we read an entire recipe book of an
organism, decoding what is recorded in its DNA, we say we are sequencing its genome. What we end up with in this process is a long sequence
of millions of A, T, G, and Cs, with no spaces or obvious punctuation marks, that we have to decipher. Thankfully, sophisticated computational
aids can do most of this for us.
Textos asociados
Figure 2. The genome sequences of three strains
of Saccharomyces cerevisiae has revealed how
similar they are to each other. The numbers in
circles on the arrows separating the different
strains represent the number of ‘letters’ in the
genome that differ between the strains. The 60,399
differences between a wine yeast and a laboratory
yeast is equivalent to about 0.6% of the genome.
The AWRI, a member of the Wine Innovation Cluster
in Adelaide, is supported by Australia’s grapegrowers
and winemakers through their investment body, the
Grape and Wine Research and Development Corporation, with matching funds from the Australian Government. Systems biology research at the AWRI is
performed using resources provided as part of the National Collaborative Research Infrastructure Strategy,
an initiative of the Australian Government, in addition
to funds from the South Australian State Government.
We gratefully acknowledge the contribution of the
Australian Genome Research Facility, a member of
Bioplatforms Australia, where the actual sequencing
of the wine yeast genome was carried out. We also
thank Sharon Mascall and Rae Blair for editorial assistance, and JeffEglinton for the preparation of the illustrations. The detailed results of this work are published
in the peer-reviewed journal FEMS Yeast Research.
75
76
Seminario Técnico
Coulter, A.D.; Henschke, P.A.; Simos, C.A. and Pretorius,
I.S.
South Australia was sweltering. For more than two
weeks in March this year, Adelaide sweated in unrelenting heat. Thermometers glared red as daytime
temperatures refused to drop below 35°C. Scientists
called it a record-breaking heatwave: a once in three
millennia event. On the vines, sugar levels also soared
to record-breaking heights. Varieties that normally
mature weeks apart ripened together. Winemakers
scrambled to harvest their fruit and crammed their
fermentors full. Everyone hoped for the best.
Fermenting a must through to dryness with such high
sugar concentrations would have been challenging
even for the toughest yeast due to the high levels of
ethanol produced. Ferments kicked-offwell but later
many started to run out of puffand required robust fermentation rescue procedures. Some were still ticking
over months later. In the past, the number of queries
we receive about stuck fermentations has been fairly
constant. This year they doubled.
The Australian Wine Research Institute (AWRI) regularly handles calls from winemakers looking for help
and advice. But, although the chemistry behind stuck
fermentation is simple, the causes are invariably complex making them frustratingly difficult to predict.
There is evidence that most of the ‘stuck ferment’ queries we received were related to the heatwave that hit
much of South Australia and Victoria in the first half
of March 2008. But stuck fermentation is a complex
24
12
20
Alcohol
Biomass
12
8
4
4
0
°Brix
% Ethanol
16
8
Stuck
Sluggish
Slow
Delayed
onset
Optimal
0
0
100
200
300
400
Time (hr)
Figure 1. Optimal and sub-optimal fermentation
profi les. Four types of sub-optimal fermentation
are commonly observed: delayed on-set;
continuously slow ferments; sluggish ferments;
and incomplete or stuck ferments.
problem and research has identified a multitude of
potential causes, any combination of which can be
involved. Our inability to measure or assess many of
these factors in real time further exacerbates the problem. As a result, it can be difficult to work out why it
happens.
The definition is straightforward. At some point during
fermentation, the process slows or stops too soon,
preventing the remaining sugar in the wine from being converted to alcohol and carbon dioxide (Figure
1). Yeast activity – or a lack of it – is usually the culprit.
The yeast might be feeling quite stressed due to its
environment, or there might be something wrong
with the yeast itself, preventing it from doing its job.
Wine yeast works best when the temperature is not
too hot, or not too cold and there are plenty of nutritious side-dishes to go with the main carbohydraterich course. Like any selfrespecting organism, it enjoys
sanitary conditions and relative freedom from the irritating excesses of unwanted dinner guests (Figure 2)
that can spoil the best parties. Coming up for air turns
out to be surprisingly important for fermenting yeast
– a sniffof oxygen will repay the winemaker many
fold with renewed enthusiasm to get back to the job
at hand. Inebriating ‘agents’ render it incompetent.
Too much ethanol, for example, can stop yeast from
growing by starving it of nutrients and increasing the
toxicity of other compounds.
The advice from the AWRI is that stuck fermentation is
usually avoidable if winemakers keep the basics in balance: moderation of sugar levels, adequate supply of
key nutrients including nitrogen and oxygen, effective
sulfur dioxide, pH control, avoiding over-clarification,
vigilant barrel management and clean conditions
from harvester to fermentor. But this year, the heat
created a new set of problems.
During March’s heatwave, winemakers reported fruit
arriving at the crusher with temperatures in the mid to
high 30s. On one particular day, fruit arrived at one winery where temperatures topped 40°C. Some cooling
systems could not cope. The scramble to harvest and
deliver the rapidly ripening fruit made matters worse.
Inside the wineries, in the fermentors, dehydrated and
shrivelled fruit was hard to process, causing blockages
in heat exchangers. The first week of the heatwave
was bad enough with rapidly rising sugar levels, as
has been seen in previous hot vintages. But, the second week stressed the already drought stressed vines beyond their limit producing heavily dehydrated
fruit, perhaps as the parched vines deprived sunburnt
berries of moisture. Outside, in the trucks queued up
with their precious loads, the microbes took hold.
Textos asociados
When the heat is on,
yeast fermentation
runs out of puff
Micro-organisms had a field day in the mountains of
warm berries. Delays, lack of refrigeration and the un-
77
When the heat is on, yeast fermentation runs out of puff
relenting heat offered an opportunity for growth. The
combination of heat stress, dehydration and mechanical harvesting had left more fruit damaged than usual.
‘Enemy’ microbes had the perfect breeding ground.
Left to grow unchecked, some ‘bugs’ can wreak havoc.
The grape apiculate yeast Hanseniaspora uvarum can
develop quickly, for example, robbing grape must of
important nutrients. One of its targets is thiamine, for
which it has an insatiable appetite. Thiamine is essential for the efficient production of ethanol by Saccharomyces yeast. There is no easy procedure to detect
vitamin deficiencies until the ferment becomes sluggish and responds to supplements. When excessive
growth of wild yeast (Figure 2) is observed between
the harvester and fermentor it is important to add
thiamine and other vitamins to the starter culture.
For musts from vineyards with a history of fermentation problems, the addition of complex inactivated
yeast nutrients can also be beneficial.
Hanseniaspora uvarum can also produce off-flavours
including the vinegary taste of acetic acid. Research
has shown that hot conditions can dramatically increase the production of acetic acid and, this year, winemakers have reported high levels of volatile acidity
(VA) to the AWRI.
Lactic acid bacteria also thrive in warm conditions,
producing acetic acid as well as other unwanted compounds from the grape sugars and acids. Growth of
certain lactic acid bacterial strains is enough to leave
the pluckiest wine yeast running for cover. Spoilage
in addition to stuck fermentation is often the result.
Hanseniaspora
Candida
Kloeckera
When this year’s stuck ferments were tested at the
AWRI, sensory analysis revealed that a number of
them were affected by a mousy off-flavour. They had
high concentrations of acetic acid, low concentrations
of malic acid – many ferments underwent malolactic
fermentation – and they contained various unwelcome micro-organisms. The results after analysing one
red wine with stuck fermentation were typical of those tested (Table 1, see page 27). Lactic acid bacteria
are also known to produce mousy off- flavour in grape
bins when given a long journey under warm conditions without sufficient protective sulfites.
The winemakers’ usual weapons against enemy microbes are sulfites, and clarification treatments for whites. But a review of research into stuck fermentation
published by the AWRI shows that in extreme conditions, adding sulfur dioxide to grape bins might not
be enough. Sulfur dioxide has a tendency to ‘hook up’
with sugar, sapping its effectiveness. The high levels of
sugar caused by this year’s heatwave would have had
such an effect. The higher levels of spoilage noted this
year signals that the levels of sulfites normally used to
control wild yeast and bacteria was often inadequate
under these exceptional conditions.
As a result, winemakers needed to increase their use
of sulfites and clean their harvester bins regularly to
keep the bugs at bay. Without these kinds of control
measures, the development of large populations of
indigenous microorganisms could have depleted nutrients. This would have made it very hard for the wine
yeast to complete the fermentation, which with the
higher sugar levels would have been an even harder
task.
Saccharomycodes
Debaryomyces
Schizosaccharomyces
Pichia
Wild yeast
Spoilage bacteria
Kluyveromyces
Cryptococcus
Metschnikowia
Table 1. Results of analysis of a typical ‘high VA’
2008 red ferment.
Dekkera
Zygosaccharomyces
Saccharomyces
Lactic acid
bacteria
Acetic acid
bacteria
Figure 2. Grapes harbour a variety of yeasts and
bacteria, and depending on the addition of sulfi tes,
grape temperature and time taken for transport to
the winery, the hygienic status of grape processing
machinery, pre-maceration, pressing and clarifi
cation procedures, a variable proportion of grape
yeasts survive in the juice or must. Together with
microorganisms associated with processing
equipment, these yeasts can proliferate in juice or
must, depending on physicochemical and nutrient
conditions.
78
Accumulation of acetic acid beyond a gram per litre
starts to affect yeast growth and becomes more toxic
as the alcohol level builds.
Analysis
Result
Alcohol
12.0% v/v
Acetic acid
1.94g/L
Glucose + fructose
47.0g/L
Malic acid
<0.05g/L
pH
3.81
Microbiological
Yeast:
Saccharomyces sp.,
non-Saccharomyces sp.
Bacteria:
Lactobacillus sp.
Acetobacter sp.
Sensory
Volatile,
mousy off-flavour
Seminario Técnico
High temperatures also increase yeast consumption
of nitrogen. If yeast assimilable nitrogen (YAN; Figure
3) is low – due to growth of wild micro-organisms or
prevailing drought conditions – then stuck fermentation is also more likely.
The AWRI’s analysis of YAN levels in several hundred
juice samples – taken from tanks in two South Australian wine regions after crushing – show a drop in
YAN levels for the 2008 vintage, compared with the
previous year (Figure 4(a)).
There were also greater variations between YAN levels
in samples taken from the 2008 vintage (Figure 4(b)).
This means that some juices would have had relatively
low concentrations and the risk of stuck fermentation
was more likely.
Various studies have tried to find out how much YAN
is needed to reduce the risk of slow or stuck fermentations. As a rough guide, the risk increases when YAN
levels fall below 140mg N/L in clarified white must
of moderate sugar levels, i.e. around 20% (Figure 3).
However, since YAN demand increases at high fermentation temperatures and when sugar concentra200
Initial YAN (mg/L)
Glucose (g/L)
160
120
25
Stuck
80
Slow
40
Optimal
50
400
250
100
150
0
0
40
80
120
160
200
Time (hr)
Figure 3. The risk of fermentation problems
is increased when grape must is sub-optimal
in nutrient content, especially for assimilable
nitrogen, and vitamins, the latter of which can be
lost during grape harvest and must processing.
A high ratio of sugar to other nutrients can lead
to low biomass and fermentation rate, and the
early onset of sugar transport inactivation in yeast.
The general rule of thumb is that musts with YAN
levels of <150mg/L are more likely to result in
slow fermentations, and musts with <50mg/L are
more likely to result in stuck ferments (see also
Figure 1).
tions are high, this threshold increases. More research
is needed to determine a threshold for red wine ferments.
Recent research at the AWRI is showing that YAN can
affect wine style, especially so in white wines. Low
YAN ferments tend to give more complex flavour profiles, sometimes a bit ‘dirtier’, whereas moderate YAN
levels give cleaner, fruitier styles in Chardonnay. But
this trend is yeast strain and variety dependent. Some
yeast strains actually make more H2S at moderate YAN
levels compared with low YAN levels; so it is important
to know the characteristics of your favourite yeast. Until we have better information, it appears that moderate diamonnium phosphate (DAP) addition may actually reduce the formation of the characteristic tropical
fruit thiols in Sauvignon Blanc and related varieties.
Using complex inactivated yeast nutrients in this latter case appears to be a better option.
Research has also shown that agrochemicals might
also have played a role in the increased incidence of
stuck fermentations. While residues of copper from
fungicides, are unlikely to cause problems on their
own, they might frustrate fermentation when other
factors come into play. Late application of agrochemicals to fruit that was harvested weeks ahead of schedule, together with the dry conditions, could have
contributed to slightly higher residue levels.
One favourite suspect – often held responsible for
stuck fermentation by winemakers – is not proven
guilty, however, by AWRI research. Every year, the AWRI
handles enquiries about glucose-to-fructose ratios,
as winemakers suspect that fructose is somehow to
blame when fermentation grinds to a halt. Research
has shown, and indeed has been known for nearly a
century, for example, that the Saccharomyces yeast
tends to consume glucose more quickly than fructose
and that the last few grams of sugar feeding the final
stages of fermentation will be fructose. Under ‘normal’ circumstances, when there are no other factors
affecting fermentation, the yeast will use the fructose.
But as far as the AWRI is aware, there is no conclusive
evidence that higher amounts of fructose will cause
stuck fermentation. Until proven otherwise, it appears
that the high fructose:glucose ratio is a symptom rather than cause of stuck fermentation.
Sluggish and stuck ferments from the 2008 vintage are
characterised by higher residual sugar concentrations
than usual. Under these tougher conditions more
robust rescue procedures are needed. By all reports,
the AWRI’s acclimatisation procedure is working well
and has benefited from several improvements, such
as fining musts with yeast hulls and racking offyeast
lees before reinoculation, and rehydrating the initial
yeast preparation with complex yeast nutrients. The
important principal behind this procedure is that the
rescue culture is sequentially acclimatised to the high
Textos asociados
Even when microbes were kept in check, the heatwave still took its toll. Yeast is particularly sensitive
to heat in its growth phase and when temperatures
top well over 30°C, in combination with high ethanol,
it becomes stressed. When the heat is on, research
has shown that the viability and vitality of yeast are
affected; it produces more volatile acidity and stuck
fermentation is more likely.
79
When the heat is on, yeast fermentation runs out of puff
4(a)
2007
2008
4(b)
120
250
100
YAN concentration SD (mg/L)
YAN concentration (mg/L)
200
150
100
50
0
Region A
Region B
80
60
40
20
0
Region A
Region B
Figure 4(a). The average YAN concentration in juices from two regions in South Australia for the 2007
vintage and the 2008 vintage. For region A, n = 855 in 2007 and 1272 in 2008; for region B, n = 414 in 2007
and 788 in 2008. Figure 4(b). Standard deviation in average YAN concentration from wine regions A and B
was greater in 2008 than in 2007.
concentrations of inhibitors in the stuck wine, especially ethanol. It is, however, critically important that
the yeast not be starved of sugar or nitrogen during
the stepwise acclimatisation procedure. The culture
should also be briefly aerated at each step.
Fresh yeast lees from successfully completed ferments
can also be useful for reinvigorating or restarting ferments when a relatively small amount of residual sugar remains. A small addition of DAP and limited aeration, once the yeast is actively fermenting, promotes
good activity. This procedure provides a more convenient rescue option when yeast lees are available.
Looking ahead, the AWRI is also alerting winemakers
to the longer term effects of the 2008 heatwave. If red
wines contain higher than usual amounts of residual
sugar, and other nutrients added as fermentation
stimulants, for example, the Brettanomyces/Dekkera
yeast, can strike later in the maturation cycle or even
after bottling of unfiltered wines. The higher alcohol
concentrations of 2008 wines might slow the growth
of this spoiler meaning that greater vigilance should
be maintained further on down the process chain.
Malolactic fermentation is also adversely affected by
high alcohol levels such that Brettanomyces/Dekkera
yeast can have a greater opportunity while the wine
is unprotected by sulfites. The more alcohol tolerant
lactobacilli, which are capable of forming biogenic
amines, will also thrive if the pH is not maintained below 3.5, which is more favourable to Oenococcus. The
impact of March 2008 might continue if not managed
with greater care due to the perturbed nature of this
year’s wine chemistry.
Stuck fermentations – what you can do
• Increase the concentration of sulfur dioxide
added to grape bins. Th is will keep microbial ‘bugs’ at bay and slow oxidation which
can speed up at higher temperatures.
• Sanitise bins between loads. Cover bins
during transport to keep the sun off fruit.
Clean all equipment to stop bacteria.
• Choose yeast known to have high tolerance
to alcohol and prepare it properly. Rehydration of dried yeast with complex inactivated yeast nutrients can be benefi cial for
stressful ferments.
• Dilute very high sugar musts with low
strength juice (LSJ) before fermentation to
improve wine balance, in accordance with
wine statutory regulations.
80
• Add tartaric acid as soon as must tanks are is not possible, add DAP as a precaution
mixed and acidity levels are known. Check against low YAN, especially in dry years and
again after thorough mixing to ensure le- when sugar concentrations are high, since
vels are correct.
more YAN is needed by yeast to achieve low
• Take steps to reduce pH to improve the effi residual sugars.
cacy of sulfur dioxide. Lower pH increases • Aeration of ferments around the mid point
its antimicrobial and antioxidant proper- of fermentation can be highly benefi cial by
ties. It controls the growth of unwanted restoring lagging rates and has no known
microorganisms including lactobacilli, adverse impact on wine fl avour, rather it
some species of which are known to inhibit can prevent quality losses which sometiyeast development.
mes result from stuck fermentations.
• Monitor pH during fermentation and main- • Increasing juice turbidity consistent with
tain it between 3.4-3.5.
target wine style can considerably improve
• Measure YAN, preferably on the last vine- growth and fermentation activity.
yard maturity sample before harvest, so • Consider adding lysozyme to must of ferthat DAP can be added accordingly. If this ments to control bacterial development.
Seminario Técnico
ACKNOWLEDGEMENTS
The Australian Wine Research Institute, a member of
the Wine Innovation Cluster in Adelaide, is supported
their investment body, the Grape and Wine Research
and Development Corporation, with matching funds
from the Australian Government. We thank Sharon
Mascall and Rae Blair for editorial assistance, and JeffEglinton for the preparation of illustrations.
FURTHER READING
Bell, S.J. and Henschke, P.A. (2005) Implications of
nitrogen management for grapes and wine. Australian Journal of Grape and Wine Research 11:242-295.
Bisson, L.F. and Butzke, C.E. (2000) Diagnosis and
rectification of stuck and sluggish fermentations.
American Journal of Enology and Viticulture 51:168177.
Bisson, L.F. (1999) Stuck and sluggish fermentations.
American Journal of Enology and Viticulture 50:107119.
Eglinton, J.M. and Henschke, P.A. (1999) Restarting
incomplete fermentations: the effect of high concentrations of acetic acid. Australian Journal of Grape and
Wine Research. 5:71-78.
Henschke, P.A. (1997) Stuck fermentation: causes,
prevention and cure. Allen, M.; Leske, P.; Baldwin, G.,
eds. Advances in juice clarification and yeast inoculation: proceedings of a seminar; 15 August 1996; Melbourne, Victoria. Adelaide, South Australia: Australian
Society of Viticulture and Oenology; 1997: 30-38, 41.
Sablayrolles, J.M.; Dubois, C.; Manginot, C.; Roustan, J.L. and Barre, P. (1996) Effectiveness of combined ammoniacal nitrogen and oxygen additions for
completion of sluggish and stuck fermentations. Journal of Fermentation and Bioengineering 82:377-381.
Schmidt, S.A.; Tran, T.; Chambers, P.J.; Herderich,
M.J. and Pretorius, I.S. (2006) Developing indicators
of wine yeast performance: an overview of the impact
of ethanol stress. Australian and New Zealand Wine
Industry Journal 21:24-30.
Ugliano, M.; Henschke, P.A.; Herderich, M.J. and
Pretorius, I.S. (2007) Nitrogen management is critical for wine flavour and style. Australian and New Zealand Wine Industry Journal 22:24-30.
These articles can be obtained by contacting the AWRI’s
John Fornachon Memorial Library.
Email library@awri.com.au, telephone (08) 8303 6600.
Further information is also available on the AWRI’s website www.awri.com.au A summary of factors affecting
sub-optimal fermentation is presented by Dr Paul Henschke in a webcast at www.awri.com.au.
Summary
Textos asociados
This site is accessible to all Australian grape and wine levy
payers.
• The 2008 vintage in southern Australia experienced an increase in • High sugar levels led to high amounts of ethanol, which can be toxic
cases of stuck fermentation.
to yeast, leading to higher residual sugar levels in wine. Higher
• The March heatwave was a key factor. Yeast does not thrive in ex- nutrients can stimulate Brettanomyces/Dekkera yeast during matreme heat or cold, or indeed when subjected to rapid changes in turation.
temperature.
• Low YAN levels after persistent drought also had an impact.
• Heat stress, transport delays and refrigeration problems gave • Simple strategies such as keeping bins and equipment clean, mounwanted microbes a head start, further compromising yeast ac- nitoring pH and using the right yeast and nutrients, can give winetivity.
makers the upper hand.
81
82
Seminario Técnico
Varela, C.; Kutyna, D.; Henschke, P.A.; Chambers, P.J.;
Herderich, M.J.; Pretorius, I.S.
Alcohol is the backbone of wine, yet too much can
put a wine off-balance. Taking control of alcohol levels in wine is, therefore, critical to the winemaker’s
art; can winemakers bottle the sunshine flavours we
expect of Australian wine but leave out some of the
alcohol? One of the keys is wine yeast. Previously
chosen for their efficiency in converting sunshine
into alcohol, we are now generating new strains of
yeast that make reduced levels of alcohol; still lots
of sunshine in the bottle but with less risk of ‘sunburn’.
Getting the alcohol level right in winemaking can be
surprisingly difficult. This is particularly evident when
grapes are grown where the weather is warm and fruit
is given lots of time on the vine for flavour development; in these conditions ‘high alcohol’ can become
a problem.
Over the past 20 years, the Australian Wine Research
Institute has charted an increase in average alcohol levels in Australian wine. In 1984, levels were 12.4% v/v;
in 2004, they had risen to 14.2% v/v, and similar stories
are heard from around the grapegrowing regions of
the world. The 2008 vintage hit another ‘sugar high’
as the heatwave across southern Australia midway
through harvest took its toll.
Hot weather accelerates ripening, which leads to higher levels of sugar. Higher amounts of sugar lead to
higher levels of alcohol. In countries like ours, where
the sun shines for long hours and some grapes are left
on the vine to create rich, full-bodied flavours, high
alcohol is becoming an issue.
Wine with high alcohol levels can mean higher costs.
In countries where taxes are levied according to ethanol content, high alcohol wines can be taxed out of
the market. High alcohol can also compromise flavour,
and today’s society is seeking a healthier approach to
high alcohol consumption.
To tackle the problem, the Australian wine sector is
investigating new ways to lower the concentration of
ethanol in wine. One strategy is to harvest grapes before they reach full maturity, when the concentration
of sugar in the berries is lower. To a degree, this approach is already being used by some winemakers. But,
until we understand viticultural factors that advance
flavour development in relation to sugar ripeness,
this approach can undermine the full-bodied character and ripe fruit flavours for which some Australian
wines are known. Removing sugar from grape must
before fermentation is another way to lower ethanol
but is relatively expensive to carry out. A third strategy
used successfully at a number of wineries around the
world is to remove alcohol from wine after fermentation. Even this has its drawbacks: it adds to production
costs; might impact wine flavour under certain conditions, and not all international markets might accept
Australian wine that has undergone this procedure.
Another strategy is to target wine yeast. The hunt is on
for strains of wine yeast that convert less of the sugar
they consume into ethanol (see, for example, Figure
1). Commercially available Saccharomyces cerevisiae
strains have been categorised by some yeast manufacturers according to the concentrations of ethanol
they produce.
But how different are these yeasts? Do strains really differ in terms of the ethanol they produce? To find out,
scientists at the AWRI checked how much ethanol is
produced by six commercial wine yeasts described by
manufacturers as low- or high-ethanol strains.
We also investigated two of our own novel wine
yeasts – produced at the AWRI – to see how efficient
they were at fermentation and how much ethanol
they produced. The two strains came from early stage
experimental work at the AWRI aimed at generating
yeast that produce reduced amounts of ethanol.
A
Grape sugars:
Ethanol
Glucose
C0 2
Fructose
Glycerol
B
Grape sugars:
Ethanol
Textos asociados
Taking control of
alcohol
Glucose
Fructose
Figure 1. Sugar metabolism of wine yeast. A:
Consumption of sugars leads mainly to the
production of ethanol and carbon dioxide and,
to a lesser extent, glycerol. B: Modifying yeast
metabolism so more glycerol is synthesised
reduces the amount of ethanol produced.
83
Taking control of alcohol
CDGJ
12.0 –
acid as well as alcohol in the synthetic wine (CDGJ)
and Chardonnay using advanced analysis techniques.
Ethanol [% v/v]
11.5 –
11.0 –
10.5 –
10.0 –
AWRI 796 Maurivin B A WRI R2
PDM
UCD522
N96
AWRI 1689 AWRI 1690
Chardonnay
13.5 –
The concentrations of ethanol produced by the six
commercial wine strains are shown in Figure 2. In synthetic wine, ethanol concentrations varied between
11.3% v/v and 11.6% v/v with a maximum difference
of 0.3% v/v. In Chardonnay, ethanol content varied
between 12.4% v/v and 12.9% v/v, with a maximum
difference of 0.5% v/v. The differences look small but
are statistically significant. They are also supported by
a previous research study that tested 113 strains of
wine yeast grown in synthetic grape juice.
13.0 –
Ethanol [% v/v]
12.5 –
12.0 –
11.5 –
11.0 –
10.5 –
AWRI 796 Maurivin B A WRI R2
PDM
UCD522
N96
AWRI 1689 AWRI 1690
Figure 2. Ethanol content of wine produced
from chemically defined grape juice (CDGJ)
and Chardonnay juice, fermented with different
commercial wine yeast strains.
We tested the eight different yeasts using chemically
defined grape juice (CDGJ), containing specified levels of sugar and yeast assimilable nitrogen, and Chardonnay juice. Fermentation took place in controlled
laboratory conditions and, once complete, samples
were collected for analysis. The researchers measured
residual sugar, ethanol, glycerol, malic acid and acetic
Although there are no published data on final ethanol
concentrations in red varieties, our research shows it
is very likely that 0.5% v/v is the maximum difference
possible by choosing a currently available, commercial wine yeast strain. Commercial strains do not give
rise to large differences in ethanol concentrations.
As a result, we are trying to generate novel strains of
wine yeast that metabolise sugar in such a way that
less ethanol is produced while maintaining high wine
quality.
Using a non-genetically modified (non-GM) approach, known as adaptive evolution, we are working
to create the right conditions to ‘persuade’ yeast to
produce less ethanol. Even though the science is not
straightforward, early results have been promising.
So far, two prototype yeast strains have been produced – AWRI 1689 and AWRI 1690. Both generate less
ethanol than their parent strain – N96 (similar to stra-
Table 1. Product concentrations in wine made from Chardonnay juice using N96 and wine yeast variants
obtained by adaptive evolution.
Strain
Ethanol [% v/v]
Glycerol [g/L]
Acetic acid [g/L]
Fermentation
efficiency* [g sugar
per 1% ethanol]
N96
12.9 ± 0.1
5.8 ± 0.1
0.1 ± 0.0
16.1 ± 0.1
AWRI 1689
12.7 ± 0.1
7.0 ± 0.0
0.1 ± 0.0
16.4 ± 0.1
AWRI 1690
12.6 ± 0.1
7.1 ± 0.0
0.0 ± 0.0
16.5 ± 0.1
* Initial and residual sugar concentrations were used to calculate fermentation efficiency.
Table 2. Product concentrations in wine made from Chardonnay juice using a range of different
commercial wine yeast strains.
Strain
Ethanol [% v/v]
Glycerol [g/L]
Acetic acid [g/L]
Fermentation
efficiency* [g sugar
per 1% ethanol]
AWRI 796
12.4 ± 0.1
7.7 ± 0.2
0.1 ± 0.0
16.8 ± 0.2
Maurivin B
12.7 ± 0.1
6.4 ± 0.0
0.5 ± 0.0
16.5 ± 0.1
AWRI R2
12.7 ± 0.1
6.4 ± 0.0
0.1 ± 0.0
16.4 ± 0.1
PDM
12.8 ± 0.1
5.9 ± 0.1
0.2 ± 0.0
16.3 ± 0.1
UCD 522
12.8 ± 0.0
6.3 ± 0.1
0.1 ± 0.0
16.2 ± 0.0
N96
12.9 ± 0.1
5.8 ± 0.1
0.1 ± 0.0
16.1 ± 0.1
* initial and residual sugar concentrations were used to calculate fermentation efficiency.
84
Seminario Técnico
It was also important to investigate other metabolites,
since major distortions in their concentrations might
affect aroma or flavour. Table 2 shows glycerol and
acetic acid concentrations in Chardonnay wines, fermented using commercial wine yeast strains. For all
strains, there was clearly a link between ethanol and
glycerol concentrations. Higher glycerol was associated with lower ethanol. The major component of volatile acidity, acetic acid, was not affected.
The decrease in ethanol concentration might be small
compared with the two ‘lowered ethanol’ prototype
yeast strains produced by the AWRI, but we are confident our ‘non-GM’ strategy is working.
The AWRI’s technology should be capable of generating strains that are even lower in ethanol than
those currently available. For winemakers wanting to
take control of high alcohol, innovation is driving the
evolution of wine yeast in the right direction. Nature
took some 20 million years to evolve highly efficient
fermentation yeast, we hope to reverse some of this
evolution in a relative blink of the eye!
Acknowledgements
The Australian Wine Research Institute, a member of
the Wine Innovation Cluster in Adelaide, is supported
their investment body, the Grape and Wine Research
and Development Corporation, with matching funds
from the Australian Government.
The authors wish to thank Rae Blair and Sharon Mascall for editorial assistance.
Further reading
De Barros Lopes, M.; Eglinton, J.M.; Henschke, P.A.;
Høj, P.B. and Pretorius, I.S. (2003) The connection
between yeast and alcohol production in wine: Managing the double edged sword of bottled sunshine.
Australian and New Zealand Wine Industry Journal
18:27-31.
Godden, P.W. and Gishen, M. (2005) Trends in the
composition of Australian wine 1984-2004. In: Blair,
R.J.; Francis, M.E. and Pretorius, I.S. (ed) Advances in
wine science – commemorating 50 years of The Australian Wine Research Institute, The Australian Wine
Research Institute, pp115-139.
Guth, H. and Seis, A. (2002) Flavour of wines: towards
an understanding by reconstitution experiments and
an analysis of ethanol’s effect on odour activity of key
compounds. Blair, R.J.; Williams, P.J. and Høj, P.B., (eds).
In: Proceedings of the eleventh Australian Wine Industry Technical Conference; 7-10 October 2001. Adelaide, SA Australian, Australian Wine Industry Technical
Conference Inc.; pp128-139.
Jenson, I. (1997) Differences in alcohol production
by various yeast strains: myth or fact? Allen, M.; Leske,
P. and Baldwin, G. (eds.) Advances in juice clarification
and yeast inoculation: Proceedings of a seminar; 15
August 1996; Melbourne, Vic. Adelaide, SA: Australian
Society of Viticulture and Oenology; pp24-25.
Palacios, A.; Raginel, F. and Ortiz-Julien, A. (2007)
Can the selection of Saccharomyces cerevisiae yeast
lead to variations in the final alcohol degree of wines?
Australian and New Zealand Grapegrower and Winemaker 527, 71-75.
Piskur, J.; Rozpedowska, E.; Polakova, S.; Merico, A.
and Compagno, C. (2006) How did Saccharomyces
evolve to become a good brewer? Trends in Genetics
22, 183-186.
Textos asociados
ins known in the industry as EC1118, Pris de Mousse
and PDM) – but were still fast at fermentation. The two
new strains metabolised a small portion of sugar in
such a way that it did not turn into ethanol (Table 1).
Summary
• Hot weather and mature fruit make high alcohol levels in wine more likely.
• The 2008 vintage is set to hit a ‘sugar high’, with high levels of ethanol.
• Winemakers want to keep alcohol under control for cost, taste and health reasons.
• Scientists at the AWRI have pioneered a new, GM-free approach to ‘persuade’ yeast to produce less ethanol during fermentation.
• Studies have shown that the maximum variation in ethanol levels from current, commercial yeast strains is 0.5% v/v.
• Innovation at the AWRI is driving the evolution of new, ‘low ethanol’ yeast in the right direction.
85
86
Seminario Técnico
A la recerca del codi
digital dels llevats
del vi
Borneman, A.R.; Forgan, A.H.; Chambers, P.J. i Pretorius,
I.S.
The Australian Wine Research Institute, Glen Osmond
(Adelaida), Australia.
Per primera vegada, científics del Australian Wine
Research Institute han seqüenciat el genoma d’un
llevat del vi, caracteritzant la «recepta de la vida»
d’aquest microorganisme amic de l’enòleg. Un camí
obert al desenvolupament de noves soques que puguin contribuir amb solucions innovadores al problema de les parades fermentatives i a augmentar
les opcions de l’enòleg.
sistible vi a partir del most del raïm. La majoria dels llevats del vi són de la mateixa espècie, Saccharomyces
cerevisiae, però no tots els membres d’aquest grup
són capaços de produir vi i, entre aquelles soques
que ho són, hi ha una considerable variació de com
d’eficients són i com fidedignament fan la seva feina i
com poden produir vins de qualitat.
Això ens porta a la següent pregunta: Què marca a un
llevat del vi? Què existeix en el funcionament intern
d’aquest atleta d’elit, que li permet créixer en un ambient tan hostil i aconseguir vins amb medalles d’or
mentre altres soques de S. cerevisiae no passen de la
línia de sortida? Estudis portats a terme a l’Australian
Wine Research Institute (AWRI) comencen a desvetllar
misteris de les variacions entre soques de S. cerevisiae, essent els primers resultats obtinguts realment
prometedors.
La variació en el rendiment que observem entre soques de S. cerevisiae és un atribut heretable; això
significa que està genèticament
determinat. Per tant, el punt de
partida per caracteritzar aquesta
variació s’hauria d’enfocar prioritàriament en la genètica dels llevats. Sortosament, S. cerevisiae va
ser el primer organisme del seu
tipus en tenir el seu genoma seqüenciat. Això va assolirse fa uns
deu anys en una soca coneguda
com S288c, escollida per la seva
idoneïtat a les condicions del laboratori (per una informació més
detallada sobre què són els gens
i els genomes, consulteu requadre). Als científics els
encanta aquest llevat ja que és molt fàcil treballar amb
ell, però d’altra banda, no seria una soca capaç de
guanyar cap medalla en el camp de la producció de
vi, de fet, és possible que ni tan sols arribi a nivells dels
que en diríem «amateurs ». No obstant, per discernir
què és el que fa un llevat del vi tan diferent d’altres
soques de S. cerevisiae és necessari disposar d’alguna
cosa amb qui comparar-la, i S288c és un bon punt de
partida.
La resposta és negativa. Els atletes d’elit neixen amb
un potencial que porta el segell de l’«or» ja estampat.
Tenen el tipus de fibres musculars, el físic, la fisiologia
i les aptituds que, amb entrenament adequat, poden
arribar a ser perfeccionats per a l’èxit internacional. Lamentablement, la majoria de nosaltres requeriríem de
molt més que aquest afinament per assolir aquest nivell; fins que la biònica ens permeti substituir allò amb
el que vam néixer, quan parlem d’atletisme, la majoria
de nosaltres ens haurem de conformar amb participar
en una lliga amateur o, fins i tot, menys.
La variació individual
Aquestes diferències en el rendiment dels individus
d’una mateixa espècie no són tan sols exclusives de
l’ésser humà. De fet, podem apreciar- les contínuament a la natura. Prenem, per exemple, l’humil llevat
que els enòlegs utilitzen per produir el complex i irre-
El genoma d’una altra soca de S. cerevisiae, YJM789,
s’ha seqüenciat recentment. El genoma d’aquest llevat, un patogen oportunista aïllat dels pulmons d’un
pacient amb SIDA, va resultar força diferent al d’S288c.
Així, ara disposem de dues versions diferents de S. cerevisiae amb les que poder comparar el llevat del vi, i
això va ser el que vam trobar.
Textos asociados
Algunes de les
seqüències de DNA
addicional trobades
en el llevat del vi,
no s’assemblen
a res trobat en
d’altres espècies de
Saccharomyces
Cada quatre anys, els Jocs Olímpics inspiren al món amb actuacions espectaculars i proeses de
resistència, velocitat i elegància.
Ens sorprenem davant les fites
atlètiques dels competidors i la
majoria de nosaltres només podem preguntar-nos com aconsegueixen aquests campions arribar
a aquests estàndards de somni.
Què fa a aquests guanyadors tan
diferents de la resta de persones?
No som la mateixa espècie, i per
tant, no hauríem de tenir tots el mateix potencial? No
podríem, també nosaltres, guanyar una medalla d’or
en natació o atletisme si comptéssim amb el mateix
entrenament, dieta i estil de vida?
L’especificitat genètica del llevat del vi
El nostre llevat del vi presenta més diferències amb
les dues soques prèviament seqüenciades, que les
que presenten aquelles dues entre elles. Prop del 0,6
ACE Revista d’Enologia 4rt Trimestre 2008
87
A la recerca del codi digital dels llevats del vi
% de les lletres genètiques de la seqüència del llevat
del vi són diferents de les de la soca de laboratori. Això
pot semblar una molt petita diferència, però si considerem que la distància genètica entre dues espècies
com els humans i els ximpanzés és únicament d’un
1-2 %, el 0,6 % seria una xifra força considerable per a
dues soques d’una mateixa espècie.
D’altra banda, potser el que sigui més interessant
d’aquests resultats, és que s’han trobat seqüències
addicionals al llevat del vi, que són suficients per afegir com a mínim 27 gens que no estan presents en les
soques de Saccharomyces amb que va ser comparada. De fet, algunes de les seqüències en aquest DNA addicional no
s’assemblen a res trobat en d’altres
espècies de Saccharomyces. De
fet, aquestes seqüències són més
similars a gens trobats en fongs
força llunyans filogenèticament.
Encara no sabem com van arribar
al genoma del llevat del vi, però
tenim una certa curiositat per avaluar si aquestes seqüències estan
involucrades en la diferenciació
entre llevats del vi i altres S. cerevisiae, especialment en allò referent
a les característiques necessàries per produir vi.
llevat del vi, una característica que és de gran importància per completar la fermentació. Ens preguntem,
per exemple, si aquests gens fan al llevat del vi, més o
menys vulnerable a fermentacions lentes o a parades
fermentatives. També hem identificat gens que probablement codifiquen proteïnes associades amb la
captura d’aminoàcids (un transportador d’aminoàcids
neutre) i el seu metabolisme (una aspartat transaminasa). Pel fet que el metabolisme d’aminoàcids està
directament relacionat amb el desenvolupament de
compostos associats a sabor i aroma, és temptador suggerir que aquests gens podrien tenir un impacte en
els atributs sensorials del vi, encara que això s’hauria
d’investigar i confirmar.
En el futur, serem
capaços d’esbrinar
quins d’aquests trets
únics del genoma
d’un llevat del vi són
determinants en
l’àmbit de la producció
vinícola
Alguns dels gens específics en el llevat del vi codifiquen, probablement, proteïnes associades amb
la paret cel·lular, un tret del llevat que és, sense cap
mena de dubte, important per a la seva resistència en
ambients inhòspits. Ens agradaria descobrir si aquests
gens tenen alguna mena d’impacte en la robustesa del
A més a més, existeixen multitud
gens dels quals encara no podem
inferir les seves funcions. Aquests
podrien resultar ser els més interessants de tots; el temps i el treball experimental ens ho diran.
De manera molt interessant,
també hem trobat alguns reordenaments cromosòmics en el
genoma d’aquest llevat i sobre
els quals també estem intrigats,
encara que de moment no podem fer-nos una idea
de quina serà la seva veritable importància i abast.
El que fa a un llevat del vi
Què ens portarà el futur a partir d’ara que ja disposem d’aquesta enorme font d’informació sobre un lle-
Desxifrant el codi: gens i genomes
E
ls gens són receptes per fabricar proteïnes. Per exemple, les cèl·lules del lector posseeixen un gen o recepta per fer la proteïna insulina,
que és una hormona que regula els nivells de sucre en sang. També tenim gens o receptes que instrueixen a les nostres cèl·lules sobre
com fer proteïnes que controlen l’estatura fins la que creixerem, el color dels nostres ulls, la forma general del nostre cos, etc. Són
aquestes mateixes receptes de la vida les que dicten si disposarem de potencial atlètic o no i, degut a que les heretem dels nostres
pares, acabarem semblant-nos a ells. Si els gens són receptes, llavors els genomes són llibres de receptes. El genoma humà disposa de totes les
receptes necessàries per fabricar les proteïnes que es requereixen per construir un cos humà, des del moment de la concepció fins la maduresa,
i per reparar i defensar aquest cos durant tota la vida. Tota aquesta fisiologia i anatomia estan modelades per una col·lecció de 20 000 – 25
000 gens que s’estenen pel genoma humà. Excepte en el cas de tenir un bessó idèntic, el nostre llibre de receptes és diferent
del que tenen la resta dels nostres congèneres.
El llenguatge dels gens és molt diferent dels llen- guatges que fem servir habitualment per comunicar-nos els uns
amb els altres. Està basat en un alfabet de tan sòls quatre lletres (A, T, G i C), i el seu lèxic està limitat a paraules
amb tres lletres, fet que significa que només existeixen 64 paraules en el diccionari genètic. Tot i el que semblaria
a primer cop d’ull, això és més que suficient per elaborar tot el conjunt d’instruccions que permeten construir
totes les proteïnes (enzims, hormones, anticossos, cartílags, etc.) que requerim per a la vida.
El paper en que les paraules que configures les receptes de la vida esta escrites es coneix com DNA, i
quan nosaltres llegim el llibre de receptes complet d’un organisme, desxifrant el que està gravat
al DNA, diem que estem seqüenciant el seu genoma. El que acabem tenint en aquest procés
és una llarga seqüència de milions de lletres A, T, C i G, sense espais o signes de puntuació evidents, i que hem de desxifrar. Afortunadament, disposem de programes informàtics que poden
fer la major part d’aquesta feina per nosaltres.
88
Seminario Técnico
Els membres de l’equip investigador australià. D’esquerra a dreta: Paul Chambers, Angus Forgan,
Sakkie Pretorius i Anthony Borneman.
Un cop puguem entendre que és allò que determina el destí d’un llevat del vi, i el significat profund
d’aquestes variacions entre soques de llevats del vi,
estarem en una millor posició per desenvolupar variants d’aquest microorganisme que puguin completar la marató de la fermentació sense alentir-la o
evitant quedar parades durant el seu curs, produint al
mateix temps vins mereixedors d’una medalla d’or; i
tot això seria possible sense afegir additius que incrementin el rendiment.
De manera similar als nostres esportistes olímpics, el
sector del vi també ha de tenir aspiracions a medalles
d’or. Amb el suport d’una ciència de qualitat i una recerca robusta, haurien de ser tot ors per als productors
de vi.
Agraïments
Els membres de l’equip del AWRI responsables de discernir el mapa genètic del llevat del vi són els doctors
Anthony Borneman, Angus Forgan, Paul Chambers i
Sakkie Pretorius.
L’Australian Wine Research Institute, un dels membres
del Wine Innovation Cluster a Adelaida, disposa del
suport econòmic dels productors de raïm i de vi a través del seu organisme d’inversió, el Grape and Wine
Research and Development Corporation, a més d’una
subvenció equivalent del Govern australià.
La recerca en l’àrea de la biologia de sistemes al AWRI
es realitza amb recursos provinents en part del National Collaborative Research Infrastructure Strategy, una
iniciativa del Govern australià, amb fons addicionals
del Govern de l’Estat de South Australia. Agraïm també la contribució de la Australian Genome Research
Facility, membre de Bioplatforms Australia, on es va
portar a terme la seqüenciació del genoma del llevat
del vi. També volem agrair a Sharon Mascall i Rae Blair
per l’ajut en la redacció, i a Jeff Eglinton per la preparació de les il·lustracions. Els resultats científics detallats
d’aquest treball han estat publicats a la revista FEMS
Yeast Research.
Bibliografia
Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius,
I.S.: «Comparative genome analysis of a Saccharomyces cerevisiae wine strain», FEMS Yeast Research 2008;
8: 1185-1195.
I.S.: «Unravelling the genetic blueprint of wine yeast»,
Australian and New Zealand Wine Industry Journal
2008; 23: 21-23.
I.S.: «Cracking the genetic code of wine yeast», Wine
Business Monthly 2008, octubre: 41-43.
Textos asociados
vat del vi? Per suposat, serem capaços de determinar
quins d’aquests trets únics del genoma d’un llevat del
vi són determinants en l’àmbit de la producció de vi.
Tot i això, també ens plantegem acumular més dades
a partir d’aquest projecte mitjançant la seqüenciació i
comparació dels genomes d’altres llevats del vi, aquelles que posseeixen diferents propietats per la seva
capacitat per produir vi. Això ens permetrà determinar què és comú a tots els llevats del vi (per exemple,
quins són els requeriments fonamentals d’un llevat
del vi) i quines diferències entre elles condueixen a la
producció de vins amb diferents qualitats (per exemple, la predisposició a produir uns determinats aromes
i matisos frutals).
Borneman, A.R.; Chambers, P.J.; Pretorius, I.S.: «Yeast
Systems Biology: modelling the winemaker’s art»,
Trends in Biotechnology 2007; 25: 349-355.
Goffeau, A.; Barrell, B.G.; Bussey, H.; Davis, R.W.; Dujon, B.; Feldmann, H.; Galibert, F.; Hoheisel, J.D.; Jacq,
C.; Johnston, M.; Louis, E.J.; Mewes, H.W.; Murakami, Y.;
Philippsen, P.; Tettelin, H.; Oliver, S.G.: «Life with 6000
genes»,
89
90
Seminario Técnico
Cano-López, M.; Pardo-Mínguez, F.; Schmauch,
G.; Saucier, C.; Teissedre, P.L.; López-Roca, J.M.; and
Gómez-Plaza, E.
Departamento de Tecnología de Alimentos, Nutrición
y Bromatología, Facultad de Veterinaria, Universidad
de Murcia, Spain, Bodegas San Isidro, Jumilla, Murcia,
Spain, and Faculté d’Oenologie, Université Victor
Segalen, Bordeaux 2, France
Several factors may affect the results obtained when
micro-oxygenation is applied to red wines, the most
important being the moment of application, the doses of oxygen, and the wine phenolic characteristics.
In this study, three red wines, made from Vitis vinifera
var. Monastrell (2005 vintage) and with different phenolic characteristics, were micro-oxygenated to determine as to how this technique affected the formation
of new pigments in the wines and their chromatic
characteristics. The results indicated that the different
wines were differently affected by micro-oxygenation.
In general, the micro-oxygenated wines had a higher
percentage of new anthocyanin-derived pigments,
being that this formation is more favored in the wines
with the highest total phenol content. These compounds, in turn, significantly increased the wine color
intensity. The wine with the lowest phenolic content
was less influenced by micro-oxygenation, and the
observed evolution in the degree of polymerization
of tannins suggested that it might have suffered overoxygenation.
KEYWORDS: Wine; color; anthocyanins; anthocyanin-derived compounds; micro-oxygenation.
INTRODUCTION
Phenolic compounds are responsible for many of the
organoleptic characteristics of wines. Among them,
anthocyanins are responsible for the color of red wine,
while their interactions with other compounds largely
determine the color changes observed in maturing
wines. The wine phenolic content depends on the
grape characteristics and on the winemaking process.
Factors such as phenolic maturity of the grapes, length of maceration, frequency of pumping over, etc. determine the final wine phenolic content (1–3).
The importance of oxygen in the evolution of wine
color has been studied for many years, both as regards
its role in polyphenol oxidation (4–7) and as a promoter of the formation on new anthocyanin-derived
compounds (5, 8–11). Indeed, one way of manipulating the phenolic structure of a wine is to use the
micro-oxygenation (MO) technique, which relies on
the formation of microbubbles through the injection
of gaseous oxygen into the wine using a microdiffuser
(12). These bubbles rise through the wine, dissolving
as they travel to the surface.
Empirical results have indicated that MO benefits include the stabilization of wine color, the softening of
tannins, and the lessening of vegetative aromas (13,
14). Reactions involving wine polyphenols are the key
to these processes, which include changes in proanthocyanin chain length and the consequent effect on
wine astringency and the linking of anthocyanins and
tannins to form more stably colored forms. Dissolved
oxygen leads to the formation of acetaldehyde that, in
turn, reacts with flavanols and anthocyanins to induce
the formation of a very reactive carbocation that quickly reacts with another flavanol molecule or with anthocyanin, producing ethyl bridge-linked compounds
(15, 16). They are unstable (17) and undergo reactions
that lead to the formation of new compounds such
as flavanyl pyranoanthocyanins. These end products
are more stable and colored than the original compounds (11). Moreover, incorporation of anthocyanin
into tannin structures also may lead to a decrease in
astringency (18).
Since its commercial adoption, MO has become common practice and is now used worldwide, although
most of the available information is from empirical results. Only a few scientific publications can be found
that are related to the effects of MO (8, 19–23). Several
factors may affect the final results obtained by MO,
the most important being the moment of application,
doses of oxygen, and wine characteristics. Wines have
marked differences in their respective abilities to consume oxygen. As a general rule, this facility is directly
related to their relative concentration of polyphenols
since phenolic compounds are the main consumers
of oxygen (60%) together with ethanol (20%) and SO2
(12%) (22). In our first studies, we tested the use of different doses of oxygen and the effect of the moment
of application on wine chromatic characteristics (23,
24). Here, we report the results of a commercial scale
MO experiment where the influence of applying oxygen to three wines made from Monastrell grapes of
J. Agric. Food Chem. 2008, 56, 5932–5941
Textos asociados
Effect of Microoxygenation on Color
and AnthocyaninRelated Compounds
of Wines with
Different Phenolic
Contents
91
Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic Contents
Table 1. Evolution of Some Physicochemical
Parameters during MO of Monastrell Winesa
t0
pH
titratable acidityb
volatile acidityc
free SO2 (mg/L)
total SO2 (mg/L)
acetaldehyde (mg/L)
pH
titratable acidityb
volatile acidityc
free SO2 (mg/L)
total SO2 (mg/L)
acetaldehyde (mg/L)
pH
titratable acidityb
volatile acidityc
free SO2 (mg/L)
total SO2 (mg/L)
acetaldehyde (mg/L)
t1
t2
t3
W1
W1 W1 W1 W1 W1 W1
(C) (MO) (C) (MO) (C) (MO)
3.72
5.87
0.39
25
39
22.2
3.78
5.76
0.40
26
32
13.5
W2
W2 W2 W2 W2 W2 W2
(C) (MO) (C) (MO) (C) (MO)
3.66
6.31
0.33
25
41
29.1
3.71
5.83
0.33
31
35
23.0
W3
W3 W3 W3 W3 W3 W3
(C) (MO) (C) (MO) (C) (MO)
3.63
6.45
0.40
27
48
32.3
3.66
5.70
0.37
32
44
25.6
3.76
5.35*
0.41
22*
28*
12.8
3.67
5.96
0.34
22*
33
24.7
3.66
5.56
0.38
25*
35
23.2
3.85
5.38
0.43
37
50
15.1
4.00
5.60
0.29
38
61
32.2
4.01
5.66
0.33
26
64
28.7
3.83
5.17*
0.47
37
49
16.6
4.00
5.73*
0.32
33
61
23.4*
4.02
5.27*
0.37
29
64
28.4
3.83
5.06
0.42
22
48
21.3
3.83
5.08
0.37
16
51
41.4
3.77
5.09
0.37
16
61
22.3
3.79*
4.90*
0.34
14*
46
32.6*
3.80
4.90
0.33
11*
35*
45.2
3.78
4.89*
0.39*
11*
38*
35.0*
a
An asterisk indicates significant differences between
control and microoxygenated wines for each time considered. b Expressed as g/L of tartaric acid.
c
Expressed as g/L of acetic acid.
different phenolic contents was investigated.
MATERIALS AND METHODS
Wine Samples. Three different red wines, made from
Vitis Vinifera var. Monastrell (2005 vintage), differing
in their total phenol content, were used for the experiment (W1, W2, and W3). Each wine was distributed into four 17 500 L tanks, and the MO experiment
was carried out in triplicate, with a control (C) and
three MO tanks for each type of wine. The height
of each tank was 4.5 m, enough for the complete
dissolution of oxygen microbubbles into the wine.
MO began just after alcoholic fermentation had finished (November 7, 2005), applying a oxygen dose
of 10 mL/L/month. Malolactic fermentation (MLF)
occurred spontaneously. When MLF started (detected by the decrease in malic acid), the MO system
was stopped (November 30 for W1 and December
20 for W2 and W3). During MLF, the bacteria consume the acetaldehyde produced. They are capable of
metabolizing acetaldehyde, even the acetaldehyde
bound to sulfur dioxide (25); therefore, any excess of
acetaldehyde produced during the MO process will
disappear.
92
When MLF was complete for all wines, SO2 was added
to leave the wines with a free SO2 content close to 30
mg/L, and MO was resumed (January 19, 2006). At this
moment, the oxygen supply was reduced to avoid
accumulation of acetaldehyde (3 mL/L/month). After
2 months, the oxygen supply was reduced again (1.5
mL/L/month) before it was completely stopped. The
wine was analyzed immediately before the MO system
began (t0), at the beginning of MLF (t1), when MO began again after MLF (t2), and 15 days after the MO system
was stopped (t3) since wines take 8-10 days to absorb
the oxygen, depending on temperature and phenolic
composition of the wines (26). The MO system (Agrovin
S.A., Alcazar de San Juan, Spain) was comprised of an
oxygen cylinder (food grade) and a dosing chamber
that allowed the doses of oxygen flowing through nine
different microdiffusers to be programmed.
General Determinations. pH and titratable acidity
were measured using an automatic titrator (Metrohm,
Herisau, Switzerland). Volatile acidity was determined
according to the OIV Official Methods (27). Acetaldehyde and malic acid concentration were determined
using enzymatic test kits from Roche Boehringer,
Mannheim, Germany. The SO2 concentration (free
and total) was measured iodometrically by the Ripper
procedure (28) modified to detect the end point potentiometrically with an automatic titrator (Metrohm,
Herisau, Switzerland).
Identification and Quantification of Anthocyanins. Wines were analyzed by direct injection of the
samples previously filtered through a 45 μm nylon filter (Teknokroma, Barcelona, Spain). The HPLC analyses
were performed on a Waters 2690 liquid chromatograph (Waters, Milford, MA), equipped with aWaters
996 diode array detector and a 250 mm × 4 mm i.d.,
5 μm particle size Lichrocart RP-18 column (Merck,
Darmstadt, Germany), using as solvents 4.5% aqueous
formic acid (solvent A) and acetonitrile (solvent B) at a
flow rate of 0.8 mL/ min. Elution was performed with
a gradient starting with 10% B to reach 14.5% B at 30
min, 15.2% B at 45 min, 18% B at 60 min, 25% B at 100
min, and 25-100% B in 30 min. Chromatograms were
recorded at 520 nm.
Compounds were identified by comparing their UV
spectra recorded with the diode array detector and
those reported in the literature (11, 29). In addition,
an HPLC-MS analysis was conducted to confirm
each peak identity. An LC-MSD-Trap VL-01036 liquid
chromatograph-ion trap mass detector (Agilent Technologies, Waldbronn, Germany) equipped with an
electrospray ionization (ESI) system was used. Elution
was performed with the HPLC analysis conditions
detailed previously. The heated capillary and voltage were maintained at 350 °C and 4 kV, respectively.
Mass scans (MS) were measured from m/z 300-1100.
Mass spectrometry data were acquired in the positive ionization mode. Anthocyanins and anthocyanin-
Seminario Técnico
Color Determinations in Wines. Absorbance measurements were made in a Helios Alpha spectrophotometer (Thermo Electron Corp., Waltham, MA) with 0.1,
0.2, or 1 cm path length glass cells. Samples were previously centrifuged, and the pH was adjusted to 3.6.
CIELab parameters were determined by measuring
the transmittance of the wine every 10 nm from 380
to 770 nm, using a D65 illuminant and a 10° observer.
The L* (measure of lightness), C* (measure of chroma),
and H* (hue angle) parameters were determined. Color intensity (CI), calculated as the sum of absorbance
at 620, 520, and 420 nm, and percentages of red (%R),
yellow (%Y), and blue (%B) color were determined according to Glories (30); the hue was calculated as the
ratio between absorbance at 420 nm and absorbance
at 520 nm (31).
Total phenols (abs280) were calculated according to
Ribe´reau Gayon et al. (32). Wine color (WC), total color
of pigments (WCP), and color due to derivatives resistant to SO2 bleaching (CDRSO2) were determined using
a method adapted from that described by Levengood
and Boulton (33), with all measurements made at 520
nm. These parameters were calculated as follows.
WC. Twenty microliters of 10% acetaldehyde solution
was added to 2 mL of a wine sample in a 10 mm plastic cuvette to release any anthocyanins involved in bisulfite adducts. After 45 min, the sample was placed in
a 1 mm cuvette. The reading was corrected to 10 mm
path length by multiplying by 10.
WCP. A total of 0.5 mL of wine was diluted in 20 mL
of 0.1 N HCl. Absorbance was measured in a 10 mm
cuvette after 30 min to ensure complete conversion
of anthocyanins into the flavylium form. The reading
was corrected for dilution.
CDRSO2. A total of 160 μL of a 5% SO2 solution (10%
potassium metabisulfite solution) was added to 2 mL
of the wine sample. After 1 min, the sample was placed in a 2 mm cuvette. The reading was corrected to
10 mm path length by multiplying by 5.
Determination of Total Tannins. The wine tannin
concentration was evaluated using a protein precipitation assay, with bovine serum albumin (BSA).
Sample preparation and a protein precipitation assay
were conducted according to methods described by
Harbertson et al. (34). For quantification, results were
compared with a (+)-catechin standard and reported
as mg/L (+)-catechin equivalents.
Analysis of Proanthocyanidins. Proanthocyanidin
composition was determinated by HPLC-DAD-MS af-
ter purification and concentration of the wine extract
and acid catalysis in the presence of excess phloroglucinol. The results of phloroglucinolysis provided
information on the proanthocyanidin subunit composition (terminal and extension unit concentrations)
and the mean degree of polymerization (mDP). The
analyses were carried out in triplicate.
The phloroglucinolysis protocol, described by Drinkine et al. (35), included a purification step using C18
solid-phase extraction (SPE). Water (15 mL) was added
to 5 mL of wine, and the sample was passed through
a preconditioned cartridge. The retained compounds
were eluted with 50 mL of methanol with a flow rate
of 2 mL/min. This fraction was dried under reduced
pressure and then dissolved in 2 mL of methanol.
The second step was the phloroglucinolysis reaction.
A solution of 0.2 N HCl in methanol, containing 100
g/L phloroglucinol and 20 g/L ascorbic acid, was prepared. A total of 100 μL of the wine sample was reacted with 100 μL of the phloroglucinol reagent at 50 °C
for 20 min, and then 1 mL of 80 mM aqueous sodium
acetate was added to stop the reaction.
The extension and terminal units resulting from
phloroglucinolysis (catechin, epicatechin, (epi)catechin gallate, and (epi)gallocatechin) were determined by LC-MS. LC-MS analyses were performed
on a Micromass Platform II simple quadruple mass
spectrometer (Micromass- Beckman, Roissy Charlesde-Gaulle, France) equipped with an electrospray
ion source. The mass spectrometer was operated in
negative-ion mode. The source temperature was 120
°C, the capillary voltage was set at 3.5 kV, and the
cone voltage was -30 V. HPLC separations were performed on a Hewlett-Packard 1100 series (Agilent,
Massy, France) instrument including a pump module and a UV detector. Both systems were operated
using Masslynx 3.4 software. The absorbance was recorded at 280 nm, and mass spectra were recorded
from 200 to 1200 amu.
The elution conditions were wateras follows: acetic
acid (99:1; v/v) as solvent A, methyl alcohol as solvent
B, and the following elution gradient: from 5 to 15% B
in 5 min, 15% B for 2 min, from 15 to 20% B in 3 min,
from 20 to 50% B in 10 min, from 50 to 100% B in 2
min, and from 100 to 5% B in 2 min, with a flow of 1
mL/min. The column used was a reversed-phase 4.6
mm × 100 mm i.d., 3.5 μm packing C18 Waters Xterra
protected with a guard column of the same material
(Agilent, Saint Quentin-en-Yvelines, France).
Textos asociados
derived compounds were quantified at 520 nm as
malvidin- 3-glucoside, using malvidin-3-glucoside
chloride as an external standard (Extrasynthe`se, Genay, France).
Statistical Analysis. Significant differences between
wines and for each variable were assessed with analysis of variance (ANOVA). This statistical analysis, together with a cluster analysis and a principal components analysis, was performed using Statgraphics 5.1
(Statistical Graphics Corporation, Rockville, MD).
93
Figure 1. Development of monomeric anthocyanins and ethyl-linked compounds in W1, W2, and W3
wines (±SD). Each point corresponds to t0, t1, t2, and t3.
RESULTS AND DISCUSSION
When comparing the initial composition of the studied
wines (Table S1 in the Supporting Information and initial point in all figures), W1 and W2 showed a very similar phenolic content (abs280 of 52 and 58, respectively),
while the highest phenolic content was found in W3
(abs280 of 76), mainly due to its high tannin content.
Although tannins and color density were higher in W3,
monomeric anthocyanins and WCP showed higher values in W2, a wine that showed a low degree of anthocyanin polymerization (CRDSO2). Color percentages also
differed between the wines. W1 presented a higher yellow percentage and lower red percentage. W3 was the
darkest wine, with the highest blue percentage. The
tannin characterization showed that the percentages
of the different flavanol units also differed. The profile of W1, with the highest percentage of epicatechin
and epigallocatechin, indicated a high percentage of
skin tannins (18, 36), whereas the lowest percentage
of epigallocatechin and relatively high percentage of
epicatechin gallate in W3 were according to the longer maceration period used during the elaboration
of W3, with seed tannins contributing significantly to
the tannin fraction. The profile found in W2 indicates
94
an intermediate situation, the maceration time being
intermediate between W1 and W3.
As seen in Table 1, there was little effect of MO on pH,
and small differences were observed in titratable acidity after MLF (t2) and at the end of the experiment
(t3). With regard to concerns about potential microbial spoilage, the volatile acidity did not increase during the studied period. When the MO application was
finished, a higher concentration of acetaldehyde was
detected in the W1 and W3 MO wines, as compared
to their control counterparts, and similar quantities
of acetaldehyde were found in W2 (C) and W2 (MO).
Excessive oxidation may result in increased levels of
acetaldehyde, a compound that at sensory threshold
levels adversely affects wine flavor and aroma. Sensory
detection limits for red wines are typically in the range
of 40-100 ppm (37, 38). Our results showed that, even
in wines containing the highest content of acetaldehyde, its sensory detection limit barely was reached.
MO promoted a slightly lower content of free
in the wines, but differences were small. Total
was also lower in W2 and W3 MO wines. Boulet
Moutounet (12) reported no effect of MO on
SO2
SO2
and
SO2
Seminario Técnico
Figure2. Development of carboxypyranoanthocyanins and sum off lavanyl- and vinylpyranoanthocyanins
in W1, W2, and W3 wines (±SD).Each point corresponds to t0, t1, t2, and t3.
Anthocyanins and Derived Compounds. The predominant compounds detected in HPLC analyses were
the monoglucosides of malvidin, petunidin, delphinidin,
peonidin, and cyanidin and their respective acetyl and
coumaryl derivatives. The combined concentration of all
these compounds diminished with time (Figure 1) the
decrease being larger in the MO wines, as also found by
Atanasova et al. (8), a decrease that might be explained
by the various reactions where anthocyanins are involved, including degradation or polymerization reactions.
The most significant decrease was detected between t0
and t2, except in W1, whose concentrations barely changed during this period. This was probably due to the fact
that W1 wines were MO for 17 days before MLF started,
whereas W2 and W3 were MO for 44 days since the starting of MLF was delayed in these wines.
Acetaldehyde-mediated condensation between anthocyanin- 3-glucoside and (epi)catechin leads to
ethyl bridge-linked compounds. Three possible isomers were elucidated as well as another compound in
which the flavanyl moiety is a dimer. Throughout the
experiment, the concentration of ethyl-linked compounds was higher in the MO wines (Figure 1). These
are compounds with a purple color, less sensitive to
bleaching by SO2 and pH than monomeric anthocyanins, and their formation is favored by oxygen (8, 40).
A very large increase was observed in W2 (MO) from
t0 to t1, after which it fell sharply. These compounds
are unstable and have a tendency to increase in size in
the presence of available acetaldehyde. The behavior
is in accordance with their reactivity; they are rapidly
formed, but also, they can be rapidly broken down,
releasing ethyl-flavanol units that, in turn, may react
again with anthocyanins or dimers, giving more condensed products or even polymers (11).
Textos asociados
content, whereas Pérez-Magariño et al. (39) reported
small decreases due to MO, results that are similar to
our findings. The results of Tao et al. (21) showed that
SO2 had a moderating effect on the interaction of oxygen with wine polyphenols since it has the ability to
reduce oxidized polyphenols and to remove peroxide.
The levels of SO2 in MO wine affect the rate of development of wine polyphenol chemistry, including the
formation of polymeric pigments and changes in tannin structure, affecting wine astringency.
Pyroanthocyanins are compounds formed when
a pyran ring is introduced between the C4 and the
95
Figure 3. Development of direct anthocyanin-flavanol adducts and polymeric compounds in W1, W2, and
W3 wines (±SD). Each point corresponds to t0, t1, t2, and t3.
hydroxyl group attached to C5 in the anthocyanin
molecule. Some compounds result from the addition of anthocyanin and pyruvic acid (carboxypyranoanthocyanins). Several of these compounds were
detected in our samples: petunidin 3-glucoside pyruvate, vitisin A (malvidin 3-(glucoside)pyruvate), acetyl
vitisin A (malvidin 3-(acetylglucoside) pyruvate), and
coumaryl vitisin A (malvidin 3-(coumarylglucoside)
pyruvate). Another pyranoanthocyanin resulting from
the cycloaddition of acetaldehyde to malvidin 3-glucoside, and referred to as vitisin B, also was found, and
its quantification was included with the carboxypyranoanthocyanins. Pyranoanthocyanins are considered
to be important compounds concerning the color of
red wine since the cycloaddition process seems to
strongly increase the stability of the products, and, in
this way, vitisin A has been reported as being more
stable than malvidin 3-glucoside or ethyl-linked compounds and more resistant to oxidation (41). The sum
of carboxypyranoanthocyanins and vitisin B increased from t0 to t1 (Figure 2), with MO wines increasing
more (except for W1). At the end of the experiment,
carboxypyranoanthocyanins showed lower concentrations in the control wines than in the MO wines,
the greatest increases being detected in W2. Other
authors found a strong decrease in vitisin A and re-
96
lated compounds during the first year of wine storage, after which the concentration remained relatively
constant (42–44). Such a decrease, observed mainly in
our study between t1 and t2, was ascribed to their incorporation into polymeric compounds (42). The concentration of carboxypyranoanthocyanins in wines is
a result of a balance between the formation reactions
and their incorporation in the polymeric compounds.
The formation of vitisin A and related compounds
requires the presence of free monoglucosides and
pyruvic acid. Oxygen or reactive oxygen species are
also necessary for the reaction to proceed since all
cycloaddition pathways require an oxidation step to
recover the flavylium moiety within the final structures (45–47). Therefore, the MO process seemed to
enhance the formation of vitisin-type compounds by
providing oxygen. This result is contrary to that of Atasanova et al. (8), who stated that the addition of pyruvic acid to anthocyanins is not influenced by oxygen.
W2, with a higher anthocyanin monoglucoside content (as quantified by HPLC), was the wine showing
the highest final concentration of carboxypyranoanthocyanins.
Another group of anthocyanins, constituted by
hydroxyphenyl- pyranoanthocyanins, results from
Seminario Técnico
the reactions of anthocyanins and vinyl derivatives
(48, 49). Malvidin 3-glucoside- 4-vinylphenol, pinotin
A (malvidin 3-glucoside-4-vinylcatechol), and malvidin 3-glucoside-4-vinylguaiacol were detected in our
samples. The presence of vinyl derivatives in wine was
attributed to enzymatic decarboxylation of phenolic
acids by yeast enzymes (48). However, Schwarz and
Winterhalter (50) demonstrated that pinotin A also
could be formed as a result of the direct addition of
caffeic acid to malvidin-3-glucoside, without the need
for prior decarboxylation of cinnamic acid derivatives
by wine yeasts (51). Also, flavanylpyranoanthocyanin
was detected in our samples. We found that the concentration of vinyl and flavanylpyranoanthocyanins
increased with time (Figure 2), the increases being larger in the MO wines, especially from t2 to t3.
We also detected compounds formed by direct reactions between anthocyanins and flavanols (Figure 3).
These may result from the addition of flavanols to anthocyanins (47, 52). Little differences were detected in
the direct adducts between control and MO wines.
A broad peak at the end of the chromatogram was
observed (polymeric peak). It absorbed at around 540,
indicating that it contained flavylium units. Its con-
centration increased with time while its λmax value
decreased, perhaps because anthocyaninethyl- flavanol adducts would first have been formed during
winemaking and then transformed into flavanyl-pyranoanthocyanins during wine aging, compounds that
present lower λmax values. The contribution of these
polymeric pigments to the overall color of aged red
wines may be superior to the contribution of either
genuine monomeric anthocyanins or pyranoanthocyanins (50). The area of this peak, as shown in Figure 3,
is larger, in general, in MO wines, although no significant differences were observed between W3 (C) and
W3 (MO) at the end of the experiment.
Chromatic Characteristics of Wine. Figure 4 reflects
the evolution of color intensity and hue. The wines
behaved in a similar way, independently of their phenolic content. An increase from t0 to t1 was observed in all wines and was higher in MO wines, these
wines also being darker in color (see Table S2 in the
Supporting Information). A decrease during MLF was
then detected, probably due to an increase in pH and
the degradation of pigmented compounds by lactic
bacteria. After MLF, CI increased, although MO wines
maintained a statistically higher CI value. The higher CI
in MO wines was probably due to the contribution of
Textos asociados
Figure 4. Development of color intensity and hue in W1, W2, and W3 wines (±SD). Each point corresponds
to t0, t1, t2, and t3.
97
Figure 5. Development of WC, WCP, and CRDSO2 in W1, W2, and W3 wines (±SD). Each point corresponds
to t0, t1, t2, and t3.
the newly formed pigments, for example, ethyllinked
pigments, since the absorbance of these molecules at
620 nm is higher than that of genuine anthocyanins
(the percentage of blue color in MO wines was higher
than in control wines).
Pyranoanthocyanins also may have participated in
the higher CI as they show both higher absorbance
at 420 nm and contribute to the redness of wines. The
hue evolved in a very similar way in all the wines, with
a tendency to increase, but more so in control wine,
demonstrating that no detectable browning occurred
in the MO wines.
Figure 5 reflects the evolution of WC, WCP, and CRDSO2. A very small decrease in WC was observed in all
wines with no differences due to MO. WCP decreased
with time, and the decreases were concomitant with
the loss of free anthocyanins usually observed during
wine evolution, meaning that the formation of anthocyanin-derived pigments did not compensate for free
anthocyanin degradation.
Figure 6. Development of abs280 and tannins in
different wines (±SD). Each point corresponds to t0,
t1, t2, and t3.
98
A continuous increase in pigments resistant to SO2
bleaching was observed. The formation of pyranoanthocyanins, which are very stable compounds toward
Seminario Técnico
With regard to optical density and tannin content (Figure 6) and mean degree of polymerization (mDP) (Figure 7), no changes in abs280 were detected in any of
the wines, indicating the absence of significant wine
pigment precipitation. As regards tannins, their levels
decreased during MLF in W2 and W3, but since no
decrease in abs280 was detected, this phenomenon
was probably due to tannins breaking down to give
small structures that were not detected by the BSA
method. Similar values for the control and MO wines
were observed at t2. From t2 to t3, the concentration
barely changed, although MO wines showed a slightly
higher tannin content.
Figure 8. Graphical plot representing the
distribution of the wine samples in the plane
defined by principal components 1 and 2 as
regards their chromatic characteristics (MO wines:
solid symbols; control wines: open symbols; W1:
circles; W2: squares; and W3: triangles). The
variance explained by each principal component is
shown in parentheses.
SO2 and pH due to the substitution of C4 (47), was
probably associated with this evolution. Ethyl-linked
compounds also should be resistant to sulfite addition and may have contributed to the observed changes, explaining as to why the values were higher in
MO wines.
Multivariate statistical analysis was used in this study
to check as to whether the wines could be grouped
according to the variables studied. First, a cluster
analysis was conducted using all the studied variables
since this is a powerful visualization tool that enables
groupings to be observed within the data. This is an
unsupervised method for pattern recognition, where
the samples were clustered without prior knowledge
of their belonging to any wine type. The distance matrix was calculated using square Euclidean distances
and an average linkage method algorithm. Distance
measures the similarity or dissimilarity between the
different samples. Two clearly differentiated clusters
were found (data shown in Supporting Information).
In one of them we found W1, both control and MO wines, and W2 (C), showing that W1 (C) and W2 (C) were
quite close. W2 (MO) was classified as closer to the W3
wines. In the case of W2, it seems that MO originated
the maximum differences in the wine characteristics.
MO promoted changes in its phenolic structure, leading to a wine with chromatic characteristics closer to
a wine with a higher phenolic content.
Textos asociados
Figure 7. Development of mean degree of
polymerization of tannins in W1, W2, and W3 wines
(±SD). Each point corresponds to t0, t1, t2, and t3.
Different behavior with regard to mDP was observed
for the different wines. This parameter always increased
in the first period (from t0 to t1) for all wines and then
fell, except for W1. According to Nikfardjam and Dykes
(53), this increase corresponds to the wine structuring
phase described in empirical observations (13), and this
phase appears to occur irrespective of whether oxygen
is being dosed into the wine. The reduction of mDP observed afterward, mainly in W2 (MO) and W3 (MO), may
be due to a possible structural rearrangement of the
tannins to shorter forms, which would correlate with
the small decreases observed in the tannins measured
by the BSA method. This reduction in mDP may be responsible for a reduction in wine astringency (54, 55).
The interaction of these newly formed intermediates
with anthocyanins also may reduce astringency since
they can form terminal units of these shorter forms,
preventing further polymerization (56). The different
behavior of W1 (MO) was similar to that described by
Du Toit et al. (57) when MO was applied to a wine for
too long a period of time. It seems that W1 could have
suffered overoxygenation in the MO wine, and therefore, an increase of mDP was observed.
99
Having obtained this grouping, a principal components analysis was conducted with the same data
and using the same variables to find as to which
variables were mainly responsible for the grouping
found (Figure 8). The first two principal components
explained 83% of the variance. The representation of
these two principal components showed that all MO
wines had lower values in component 1 than their
corresponding control wines mainly due to lower values of L*, H*, and hue and higher values of CI and
anthocyanin-derived compounds, among others. The
wines with the highest phenolic content showed negative values of PC1, while W2 differed from the other
wines especially in the highest values of PC2, due to
the high WC and anthocyanin monoglucoside values.
W2 (MO) and W3 (C) were again very close. MO favored reactions that led to the greater formation of new
pigments, which, in turn, increased CI and CRDSO2 in
all the wines, regardless of their phenolic content. W1
wine was less influenced by MO and the observed
increases in mDP for W1 (MO) suggested overoxygenation. This wine presented an anthocyanin content
that was too low to promote any great level of condensation reactions. W3 was favored by MO, but the
most evident results were found in W2 (MO), with its
high anthocyanin content that favored the formation
of more stable derived pigments and led to a wine
close to W3 (C).
Supporting Information Available: Figure of differentiated clusters and tables of wine characteristics
at the end of alcoholic fermentation and evolution of
CIELab and color. This material is available free of charge via the Internet at http://pubs.acs.org.
LITERATURE CITED
(1) Pérez-Magariño, S.; González-San José, M. L. Evolution of flavanols, anthocyanins, and their derivatives during the aging of red wines, elaborated
from grapes harvested at different stages of ripening. J. Agric. Food Chem. 2004, 52, 1181–1189.
(2) Bautista-Ortıń, A. B.; Fernández-Fernández, J. I.;
López-Roca, J. M.; Gómez-Plaza, E. The effect of
grape ripening stage on red wine color. J. Int. Sci.
Vigne Vin 2006, 40, 14–24.
(3) Bautista-Ortıń, A. B.; Fernández-Fernández, J. I.; López-Roca, J. M.; Gómez-Plaza, E. Wine-making of
highly colored wines: Extended pomace contact
and run-off of juice prior to fermentation. Food
Sci. Technol. Int. 2004, 10, 287–295.
(4) Ribéreau-Gayon, P.; Glories, Y. Phenolics in grapes
and wines. In The Sixth Australian Wine Industry
Technical Conference; Lee, T. H., Ed.; Australian Industrial Publishers: Adelaide, Australia, 1986; pp
247-256.
100
(5) Singleton, V. A survey of wine aging reactions, especially with oxygen. In Proceedings of the 50th
AnniVersary Annual Meeting; Rantz, J. M., Ed.;
American Society for Enology and Viticulture:
Davis, CA, 2000; pp 323-336.
(6) Singleton, V. Oxygen with phenols and related
reactions in must, wines, and model systems:
Observations and practical implications. Am. J.
Enol. Vitic. 1987, 38, 69–77.
(7) Danilewicz, J. Review of reaction mechanism of
oxygen and proposed intermediate reduction
products in wine: Central role of iron and copper.
Am. J. Enol. Vitic. 2003, 54, 73–85.
(8) Atanasova, V.; Fulcrand, H.; Cheynier, V.; Moutounet,
M. Effect of oxygenation on polyphenol changes
occurring in the course of wine-making. Anal.
Chim. Acta 2002, 458, 15–27.
(9) Jordao, A. M.; Ricardo-da-Silva, J. M.; Laureano, O.
Effect of oak constituents and oxygen on the
evolution of malvidin-3- glucoside and (+)-catechin in model wine. Am. J. Enol. Vitic. 2006, 57,
377–381.
(10) Salmon, J. M. Interactions between yeast, oxygen,
and polyphenols during alcoholic fermentations:
Practical implications. Food Sci. Technol. 2006,
39, 959–965.
(11) Alcalde-Eon, C.; Escribano-Bailon, M. T.; SantosBuelga, C.; Rivas-Gonzalo, C. Changes in the detailed pigment conposition of red wine during
maturity and ageing. A comprehensive study.
Anal. Chim. Acta 2005, 563, 238–254.
(12) Boulet, J.; Moutounet, M. Micro-oxigenación de
los vinos. In Enologıá: Fundamentos Cientı´ficos
y Tecnológicos; Flanzy, C., Ed.; MundiPrensa Ediciones: Madrid, 2000; pp 638-642.
(13) Parish, M.; Wollan, D.; Paul, R. Micro-oxygenation.
A review. Aust. Grapegrower Winemaker 2000,
438, 47–50.
(14) Kamio, I.; Kamio, X.; Roig, G.; Otero, B.; Yerle, S.
Microoxygenation dans la Péninsule Ibérique:
Repenser l’elevage des vins du sud. ReV. Oenol.
2008, 126, 22–27.
(15) Dallas, C.; Ricardo da Silva, J. M.; Laureano, O. Products formed in model wine solutions involving
anthocyanins, procyanidin B2, and acetaldehyde.
J. Agric. Food Chem. 1996, 44, 2402–2407.
(16) Es-Safi, N.; Fulcrand, H.; Cheynier, V.; Moutounet, M.
Studies on the acetaldehyde-induced condensation of (-)-epicatechin and malvidin-3-glucoside
Seminario Técnico
(17) Escribano-Bailon, T.; Alvarez-Garcia, M.; RivasGonzalo, J. C.; Heredia, F. J.; Santos-Buelga, C.
Color and stability of pigments derived from the
acetaldehyde-mediated condensation between
malvidin 3-O-glucoside and (+)-catechin. J. Agric.
Food Chem. 2001, 49, 1213–1217.
(18) Cheynier, V.; Dueñas, M.; Salas, E.; Maury, C.;
Souquet, J.; Sarni- Manchado, P.; Fulcrand, H.
Structure and properties of wine pigments and
tannins. Am. J. Enol. Vitic. 2006, 57, 298–305.
(19) Llaudy, M.; Canals, R.; Gonzalez-Manzano, S.; Canals, J. M.; Santos-Buelga, C.; Zamora, F. Influence of micro-oxygenation treatment before oak
aging on phenolic compound composition, astringency, and color of red wine. J. Agric. Food
Chem. 2006, 54, 4246–4252.
(20) Pérez-Magariño, S.; Sánchez-Iglesias, M.; OrtegaHeras, M.; González-Huerta, C.; González-Sanjose,
M. L. Color stabilization of red wines by microoxygenation treatment before malolactic fermentation. Food Chem. 2007, 101, 881–893.
(21) Tao, J.; Dykes, S. I.; Kilmartin, P. A. Effect of SO2
concentration on polyphenol development during red wine micro-oxygenation. J. Agric. Food
Chem. 2007, 55, 6104–6109.
(22) Devatine, A.; Chiciuc, I.; Poupot, C.; Mietton-Peuchot, M. Microoxygenation of wine in presence of dissolved carbon dioxide. Chem. Eng. Sci.
2007, 62, 4579–4588.
(23) Cano-Lopez, M.; Pardo, F.; Lopez-Roca, J. M.; Gómez-Plaza, E. Effect of the micro-oxygenation on
anthocyann and derived pigment content and
chromatic characteristics of red wines. Am. J.
Enol. Vitic. 2006, 57, 325–331.
(24) Cano-López, M.; López-Roca, J. M.; Gómez-Plaza,
E.; Pardo- Minguez, F. Efecto de la microoxigenación en vinos tintos con diferente contenido polifenólico. Tecnol. Vino 2006, Julio-Agosto, 45–50.
(25) Osborne, J.; Mira de Orduña, R.; Pilone, G.; Liu, S.
Acetaldehyde metabolism by wine lactic acid
bacteria. FEMS Microbiol. Lett. 2000, 191, 51–55.
(28) Ough, C. S.; Amerine, M. A. Methods for Analysis of
Musts and Wine; Wiley Interscience Publications:
Νew York, 1974.
(29) Boido, E.; Alcalde-Eon, C.; Carrau, F.; Dellacassa, E.;
Rivas- Gonzalo, C. Aging effect of the pigment
composition and color of Vitis Vinifera L. c.v. Tannat wines. Contribution of the main pigment families to wine color. J. Agric. Food Chem. 2006,
54, 6692–6704.
(30) Glories, Y. La coleur des vins rouges: 1° partie. Les
equilibres des anthocyanes et des tanins. Con.
Vigne Vin 1984, 18, 195– 217.
(31) Sudraud, P. Interpretation des courbes d’absortion
des vins rouges. Ann. Technol. Agric. 1958, 7,
203–208.
(32) Ribéreau Gayon, P.; Glories, Y.; Maujean, A.; Dubourdieu, D. Traité d’Oenologie. 2. Chimie du Vin.
Stabilisation et Traitements; Dunod: Paris, 1998.
(33) Levengood, J.; Boulton, R. The variation in color
due to copigmentation in young Cabernet Sauvignon wines. In Red Wine Color. ReVealing the
Mysteries; Waterhouse, A., Kennedy, J., Eds.; American Chemical Society: Washington, DC, 2004;
pp 35- 52.
(34) Harbertson, J. F.; Kennedy, J. A.; Adams, D. O. Tannin in skins and seeds of Cabernet Sauvignon,
Syrah, and Pinot Noir berries during ripening.
Am. J. Enol. Vitic. 2002, 53, 54–59.
(35) Drinkine, J.; Lopes, P.; Kennedy, J. A.; Teissedre, P.
L.; Saucier, C. Analysis of ethylidene-bridged flavan-3-ols in wine. J. Agric. Food Chem. 2007, 55,
1109–1116.
(36) Fernandez, K.; Kennedy, J. A.; Agosin, E. Characterization of Vitis Vinifera L. Cv. Carmanere grape and
wine proanthocyanidins. J. Agric. Food Chem.
2007, 55, 3675–3680.
(37) Peynaud, E. The Taste of Wine; Wiley: New York,
1996.
(38) Amerine, M.; Roessler, E. Wines, Their Sensory EValuation; W. H. Freeman: New York, 1982.
(26) Vivas, N.; Glories, Y. Racking of red wine matured in
barrels. A tentative classification of racking techniques. Aust. NZ Wine Ind. J. 1995, 10, 241–243.
(39) Perez-Magariño, S.; Sánchez-Iglesias, M.; OrtegaHeras, M.; González-Huerta, C.; González-Sanjosé,
M. L. Color stabilization of red wines by microoxygenation treatment before malolactic fermentation. Food Chem. 2007, 101, 881–893.
(27) O.I.V. Recueil des Méthodes Internationales
d’Analyse des Vins et des Mouts; Office International de la Vigne et du Vin: Paris, 1990.
(40) Rivas-Gonzalo, J.; Bravo-Haro, S.; Santos-Buelga,
C. Detection of compounds formed through the
reaction of malvidin-3- monoglucoside and ca-
Textos asociados
in model solution systems. J. Agric. Food Chem.
1999, 47, 2096–2102.
101
techin in the presence of acetaldehyde. J. Agric.
Food Chem. 1995, 43, 1444–1449.
(41) Morata, A.; Gomez-Cordoves, C.; Colomo, B.; Suarez, J. A. Pyruvic acid and acetaldehyde by different strains of Saccharomyces cereVisiae: Relationship with vitisin A and B formation in red
wines. J. Agric. Food Chem. 2003, 51, 7402–7409.
(42) Schwartz, M.; Quast, P.; von Baer, D.; Winterhalter,
P. Vitisin A content in Chilean wines from Vitis Vinifera cv. Cabernet Sauvignon: A contribution to
the color of aged red wines. J. Agric. Food Chem.
2003, 51, 6261–6267.
(43) Revilla, I.; González-San José, M. L. Evolution during the storage of red wines treated with pectolytic enzymes: New anthocyanin pigment formation. J. Wine Res. 2001, 12, 183–197.
(44) Asestorfer, R.; Markides, A.; Iland, P.; Jones, G. Formation of vitisin A during red wine fermentation
and maturation. Aust. J. Grape Wine Res. 2003, 9,
40–46.
(45) Lee, D.; Swinny, E.; Asenstorfer, R.; Jones, G. Factors
affecting the formation of red wine pigments.
In Red Wine Color. ReVealing the Mysteries. ACS
Symposium Series 886; Waterhouse, A., Kennedy,
J. A., Eds.; American Chemical Society: Washington, DC, 2004; pp 125-142.
(46) Pozo-Bayon, M. A.; Monagas, M.; Polo, M. C.; Gomez-Cordoves, C. Occurrence of pyroanthocyanins in sparkling wines manufactured with red
grape varieties. J. Agric. Food Chem. 2004, 52,
1300–1306.
(47) Fulcrand, H.; Atanasova, V.; Salas, E.; Cheynier, V.
The fate of anthocyanins in wine. Are they determining factors? In Red Wine Color. ReVealing
the Mysteries. ACS Symposium Series 886; Waterhouse, A., Kennedy, J. A., Eds.; American Chemical
Society: Washington, DC, 2004; pp 68-88.
(48) Monagas, M.; Nuñez, V.; Bartolomé, B.; GomezCordobes, C. Anthocyanin-derived pigments in
Graciano, Tempranillo, and Cabernet Sauvignon
wines produced in Spain. Am. J. Enol. Vitic. 2003,
54, 163–169.
(49) Schwartz, M.; Winterhalter, P. A novel synthetic
route to substituted pyranoanthocyanins with
unique color properties. Tetrahedron Lett. 2003,
44, 7583–7587.
(50) Schwartz, M.; Winterhalter, P. Novel aged anthocyanins from Pinotage wines: Isolation, characterization, and pathway of formation. In Red Wine
Color. ReVealing the Mysteries. ACS Symposium
Series 886; Waterhouse, A., Kennedy, J. A., Eds.;
American Chemical Society: Washington, DC,
2004; pp 179- 197.
(51) Schwarz, M.; Hofmann, G.; Winterhalter, P. Investigations on anthocyanins in wines from Vitis
Vinifera cv. Pinotage: Factors influencing the formation of Pinotin A and its correlation with wine
age. J. Agric. Food Chem. 2004, 52, 498–504.
(52) Salas, E.; Atanasova, V.; Poncet-Legrand, C.; Meudec, E.; Mazauric, J. P.; Cheynier, V. Demostration of the occurence of flavonol-anthocyanin
adducts in wine and in model disolutions. Anal.
Chim. Acta 2004, 513, 325–332.
(53) Nikfardjam, M.; Dykes, S. I. Micro-oxygenation research at Lincoln University. Part 3: Polyphenolic
analysis of Cabernet Sauvignon wines under the
application of micro-oxygenation. Aust. NZ Grapegrower Winemaker 2003, 467, 41–44.
(54) Vidal, S.; Cartalade, D.; Souquet, J. M.; Fulcrand, H.;
Cheynier, V. Changes in proanthocyanidin chain
length in winelike model solutions. J. Agric. Food
Chem. 2002, 50, 2261–2266.
(55) Cheynier, V.; Remy, S.; Fulcrand, H. Mechanisms of
anthocyanin and tannin changes during winemaking and aging. In The ASEV 50th AnniVersary
Annual Meeting; Rautz, J., Ed.; ASEV: Davis, CA,
2000; pp 337-344.
(56) Du Toit, W.; Marais, J.; Pretorius, I. S.; du Toit, M.
Oxygen in must and wine: A review. S. Afr. J. Enol.
Vitic. 2006, 57, 76–94.
(57) Du Toit, W.; Lisjak, K.; Marais, J.; du Toit, M. The effect
of micro-oxygenation on the phenolic composition, quality, and aerobic wine-spoilage microorganisms of different South African red wines. S.
Afr. J. Enol. Vitic. 2006, 27, 57–67.
Received for review February 28, 2008. Revised manuscript received May 9, 2008. Accepted May 9, 2008. This
work was made possible by financial assistance from the
Fundación Séneca (PB/31/FS/02).
102
Seminario Técnico
Cano Lopez, M,; Fuentes Peralta, S.; Pardo Minguez,
F.(1); López-Roca, J.M.; Gómez-Plaza, E
Departamento de Tecnología de Alimentos, Nutrición
y Bromatología. Facultad de Veterinaria, Universidad
de Murcia. Campus de Espinardo, 30071 Murcia
(1)
Bodegas B.S.I. Ctra. Murcia, Jumilla, Murcia
Autor de contacto: e-mail: encarnag@um.es, tel. 968
367323
RESUMEN
La microoxigenación está basada en el aporte controlado de pequeñas cantidades de oxigeno de forma
continua y lenta; siendo la velocidad del aporte de
oxigeno inferior a la velocidad de su consumo, evitando la acumulación de oxigeno. El objetivo de esta
técnica es favorecer la condensación entre taninos y
antocianos y la formación de nuevos pigmentos; proporcionando así un incremento y estabilización del
color del vino. Se ha estudiado el efecto de la técnica
aplicando distintas dosis de oxigeno (dosis baja, media y alta), a vinos de Monastrell. Los resultados obtenidos muestran que la aplicación de oxigeno no afecta a la sanidad del vino. Los vinos microoxigenados
presentan mayor intensidad colorante que el testigo.
La tonalidad es similar en todos ellos, manifestando la
mínima oxidación de polifenoles producida. Se destaca el incremento de la fracción de color debido a
pigmentos poliméricos, el índice de ionización y de
PVPP en los vinos microoxigenados, presentando sus
valores máximos en el vino microoxigenado con dosis
media. Estos parámetros muestran que se ha favorecido la formación de nuevos pigmentos en los vinos.
Por otro lado, el contenido de acetaldehído libre en
los vinos microoxigenados es menor que en el testigo,
manifestando que el acetaldehído generado forma
parte de nuevos pigmentos, no interfiriendo en las
características organolépticas de los vinos microoxigenados. Al final del tratamiento se realizó un análisis
organoléptico de los vinos, que junto a los resultados
obtenidos se concluye que la dosis media resultó ser
la mas adecuada al finalizar la microoxigenación.
INTRODUCCIÓN
Los compuestos fenólicos en un vino tinto determinan sus características sensoriales, principalmente el
color y la astringencia. La composición fenólica depende de la composición de la uva, factores edafoclimáticos, procesos de vinificación y diferentes prácticas enológicas.
El oxigeno juega un papel importante en diversos
procesos bioquímicos en los mostos y en los vinos,
tanto durante la fermentación alcohólica como en las
reacciones de oxidación y/o polimerización de compuestos polifenólicos que se producen durante el
envejecimiento del vino. Por ello, tradicionalmente se
han efectuado aportes de oxigeno, bien mediante remontados al inicio de la fermentación alcohólica; bien
mediante trasiegos tras la fermentación alcohólica y
fermentación maloláctica cuyo objetivo es eliminar
y/o evitar la formación de compuestos sulfhídricos y
retirar las lías gruesas (1).
Durante el envejecimiento del vino en barrica de roble se produce la cesión de compuestos fenólicos y
aromas propios de la madera al vino, además de una
microoxigenación natural, al difundirse pequeñas cantidades de oxígeno a través del esquive de la barrica,
Textos asociados
Efectos de la
microoxigenación en
vino tinto
Figura 1.- Estructura del polímero por condensación directa, A) tanino-antociano y B) compuesto bicíclico
formado por la reacción entre el flavano y Mv-3Glu. (Remy et al. 2000).
Enólogos
Efecto de la microoxigenación en vinos tintos. Enologos 34,46-50, 2005
103
Capítulo
entre las uniones de las duelas y los poros de la madera. Este oxigeno se ha demostrado que influye notablemente en la composición fenólica del vino, ya que
interviene en reacciones de oxidación y/o polimerización, generando nuevos pigmentos que incrementan
y estabilizan el color del vino (7,8,9,10,11,12,13,14, 15).
La generación de estos pigmentos sigue los siguientes mecanismos:
a) Reacciones de condensación directa entre antocianos (A) y taninos (T):
Los nuevos compuestos se forman mediante procesos de adición nucleofílica dando lugar a estructuras
A+-T y T-A+. Han sido encontradas en vinos envejecidos (10, 16), ya que es una reacción lenta (17). Ambas
estructuras son mas complejas que los antocianos
monómeros, de color similar a los antocianos pero
resistentes a la decoloración por SO2, especialmente
la estuctura A+-T. La formación de estos compuestos
genera una disminución de la astringencia de los vinos durante el envejecimiento (Figura 1).
b) Reacción de condensación mediante puentes
de etilo.
En estas reacciones está involurado el acetaldehído,
producto que aparece en el vino producido en pequeñas cantidades por las levaduras durante el metabolismo de azúcares (18) y por la oxidación de etanol. El
resultado son productos enlazados por puente de etilo,
incluyendo taninos (T-etil-T), aductos de taninos-antocianos (T-etil-A) y oligómeros de antocianos (A-etil-A).
La reacción de polimerización finaliza cuando en el
otro extremo del polímero se encuentra unido un antociano (20, 21). Su formación es más rápida que la de los
pigmentos poliméricos por condensación directa (17).
La presencia de estos pigmentos produce incremento
y estabilización del color del vino; su color es malva,
son resistentes a las variaciones de pH, a la decoloración del sulfuroso y a las oxidaciones (19, 24), aunque
se ha demostrado que su estabilidad en el tiempo
es pequeña y evolucionan hacia otros tipos de compuestos poliméricos (Figura 2).
Figura 2.- Compuestos formados en presencia de acetaldehído y de otros metabolitos de las levaduras.
(Cheynier 2005).
104
Seminario Técnico
MATERIALES Y MÉTODOS
a) Condiciones de microoxigenación de los vinos
Para la experiencia de microoxigenación se ha utilizado un vino tinto de la variedad Monastrell, elaborado
por Bodegas BSI de Jumilla (Murcia), que presentaba
las siguientes características cromáticas iniciales: intensidad colorante (IC): 14.7,
tono: 0.51, índice de
polifenóles totales (IPT): 67.40 y antocianos totales:
443.63 mg/L
Tras la fermentación alcohólica el vino se dispuso en
depósitos de 17.500L., uno de ello se utiliza como testigo, en los otros se aplicó tres dosis diferentes de oxígeno y en tres periodos distintos de la elaboración.
La adición de oxigeno se ha realizado durante tres periodos:
Figura 3.- Estructura química Vitisina 1) A y 2) B.
(Cheynier 2005).
c) Nuevos pigmentos de bajo peso molecular.
Estos pigmentos se forman mediante la cicloadicón
de metabolitos producidos por las levaduras, como el
acetaldehído, ácido pirúvico o vinilfenoles, con el antociano, generando pigmentos como la Vitisina A y B
y los antocianovinilfenoles. Han sido identificados en
vinos envejecidos (8,9,12,13,15,22) en botella y en barrica y en vinos microoxigenados (7). Son pigmentos
ligeramente anaranjados, más resistentes a las variaciones de pH, al sulfuroso (9) y a las oxidaciones que
los antocianos; estabilizando así el color del vino (12,
23) (Figura 3).
Debido a la importancia de la presencia de pequeñas cantidades de oxígeno y de acetaldehído en la
formación de estos pigmentos, nació en la década
de los 90 la técnica de la microoxigenación, basada
en el aporte controlado de pequeñas cantidades de
oxigeno al vino mediante un microdifusor poroso, de
forma continua y lenta, siendo la velocidad de aporte
de oxigeno inferior a la velocidad de consumo, evitando la acumulación en vino y generando la máxima
cantidad posible de este aldehído.
Determinadas experiencias han observado que tanto
la crianza en barrica como la microoxigenación producen resultados similares en cuanto al incremento
de color y disminución de astringencia, pudiendo
con esta técnica reproducir, e incluso acelerar, parte
de las transformaciones que sufren los compuestos
fenólicos durante la crianza en barrica (3, 4). En este
estudio se pretende conocer el efecto de esta técnica,
aplicando distintas dosis de oxigeno, sobre el color de
un vino tinto de la variedad Monastrell.
- Durante dos semanas, entre el final de la fermentación alcohólica y el inicio de maloláctica, con dosis aplicadas de 5, 10 y 15 mL/L/mes. La cantidad de
oxigeno aplicada en este periodo, es la mas alta, para
favorecer la generación de acetaldehído.
- Después de la fermentación maloláctica, durante un
periodo de 45 días, las dosis aplicadas fueron 3, 5 y 7
mL/L/mes.
- Tras un análisis organoléptico de los vinos, se continuó microxigenando 15 días más, suavizando los vinos microxigenados, aunque en este periodo las dosis
en los tres casos se reduce a la mitad, puesto que el
contenido de antocianos había descendido en todos
los vinos.
La Figura 4 muestra un esquema del sistema de microoxigenación. Cada salida de oxigeno esta conectada a
un microdifusor poroso que se encuentra suspendido
en el interior del depósito sin llegar a tocar el fondo,
de tal manera que las microburbujas se disuelvan en
el vino antes de que lleguen a la superficie.
b) Determinaciones fisico-químicas y espectrofotométricas
El pH, la acidez total (g/L de ácido tartárico) y la acidez
volátil se determinaron según los métodos oficiales.
Textos asociados
Las medidas de absorbancia se realizan en un espectrofotómetro Helios Alpha (Thermospectronic). Las
muestras son centrifugadas y se ajustó el pH a 3.6. La
intensidad de color (IC) se calculó como la suma de
absorbancias a 620 nm, 520 nm y 420 nm; otras variables calculadas son los porcentajes de rojo, amarillo
y azul del color del vino (30). El tono como el coeficiente entre la absorbancia a 420 nm y 520 nm (25).
El análisis del índice de polifenoles totales (IPT), antocianos totales y taninos totales (g/L), y los índices
105
Capítulo
SISTEMA DE ALIMENTACIÓN BOMBONA DE OXÍGENO MANÓMETRO
MICRODIFUSOR Figura 4.- Esquema de la disposición del sistema de microoxigenación en el depósito.
de PVPP, ionización y HCl se efectuó siguiendo los
métodos descritos por Ribereau-Gayon et al. (29). La
fracción de color debida a los pigmentos poliméricos
se calculó de acuerdo con los métodos descritos por
Boulton (27).
RESULTADOS Y DISCUSIÓN
El Gráfico 1 muestra la evolución de pH, acidez total y
acidez volátil durante la microoxigenación. Dichos parámetros son similares en los vinos microoxigenados y
el testigo, manifestando que el aporte de oxigeno no
altera la sanidad del vino.
Se observa un incremento en la IC (Gráfico 2a) en el
primer periodo de microoxigenación (Octubre-Diciembre/03) en los vinos microoxigenados. Tras la fermentación maloláctica (Enero/04) se observó en todos ellos un descenso, probablemente consecuencia
de la variación del pH y la precipitación de materia coloidal que arrastra materia colorante. Aunque el aporte de oxigeno durante el segundo periodo fue menor,
se observó de nuevo un aumento de IC en los vinos
microoxigenados, diferenciándose todos los vinos en
color. Este incremento de color en presencia de pequeñas cantidades de oxigeno durante los primeros
meses de la elaboración también ha sido encontrado
por otros autores (3,5,6, ). Por otra parte, la evolución
del tono, representado por el Gráfico 2b; es similar en
los distintos vinos, indicando que los compuestos fenólicos sufren una mínima oxidación durante el tratamiento.
Mientras que la IC varió para los diferences vinos, el %
rojo tras la microoxigenación (Gráfico 3) se mantuvo
constante en todos los vinos; sugiriendo que ambos
parámetros no están relacionados directamente, tal
y como se ha indicado en otros trabajos (31,32), sino
que la IC depende también de la absorbancia de los
compuestos que aportan tonos amarillos y azules. El
106
Gráfico 1.- Evolución durante la microoxigenación
de a) pH, b) acidez total y c) acidez volátil de los
vinos durante la microoxigenación.
Seminario Técnico
go, de forma similar a los resultados encontrados por
Cabanillas et al.(3). Finalizada la microoxigenación, el
vino testigo sufre una disminución de este índice y
su valor se incrementa en los vinos microoxigenado,
poniéndose de manifiesto de esta forma la presencia
de pigmentos coloreados formados mediante puente
de acetaldehído y por cicloadición del aldehído a los
antocianos. Siendo el índice de ionización máximo en
el vino con dosis media de oxigeno.
Por otro lado, el índice de PVPP, que representa el porcentaje de antocianos combinados con taninos, nos
da una idea del incremento y estabilidad del color,
ya que estos compuestos presentan un color malva
y son menos sensibles a las oxidaciones, a las variaciones pH y al sulfuroso que los antocianos libres. Su
comportamiento es similar al índice de ionización, su
valor es mayor en los vinos microxigenados, pero en
el testigo disminuye tras el periodo de la microoxigenación, de forma opuesta a lo que ocurre en los vinos
microoxigenados, siendo máximo su valor en el vino
con dosis media.
Gráfico 2.- Evolución de a) intensidad colorante
(I.C.) y b) tono durante la microoxigenación.
El contenido de antocianos totales (Gráfico 4) desciende por igual en todos los vinos durante la experiencia.
El incremento de color y la disminución de antocianos
totales en los vinos microoxigenados son datos aparentemente contradictorios, pero tiene su explicación
cuando se analiza la evolución de la fracción de color
debido a pigmentos poliméricos, como muestra el
Gráfico 5. El color debido a los pigmentos poliméricos incrementa durante la aplicación de oxigeno, al
igual que los resultados recogidos por Atanasova et
al. (7). Su evolución es similar a la variación del color
(Gráfico 2a), dicha relación también fue observada por
Castellari et al. (6), presentando al finalizar la microoxigenación su valor máximo en el vino con dosis media.
El incremento de color en los vinos microoxigenados
puede explicarse también mediante el análisis del
índice de ionización y PVPP, como muestra el Gráfico 6. El índice de ionización indica el porcentaje de
antocianos que presentan color en el vino. Los vinos
microoxigenados presentan mayor valor que el testi-
Textos asociados
Gráfico 3 muestra la variación de la componente amarilla y azul en los vinos tras la microoxigenación. Se
observa un incremento de la componente azul en los
vinos microoxigenados, siendo máxima para el vino
donde se aplicó la dosis media de oxígeno; mientras
que la componente amarilla se mantiene constante
en todos ellos excepto en el testigo. Estos resultados
señalan la presencia de pigmentos poliméricos unidos mediante acetaldehído en los vinos microoxigenados, ya que como propone Gómez-Cordovés et al.
(23) existe una correlación directa con la componente
azul y la polimerización de polifenóles.
Gráfico 3.- Variación al inicio y al final de la
microoxigenación de los distintos vinos, % rojo, %
amarillo y % azul.
107
Capítulo
Gráfico 4.- Evolución de antocianos totales (mg/L)
de los vinos durante la microoxigenación.
Gráfico 5.- Evolución de la fracción de color debido
a pigmentos poliméricos.
108
Gráfico 6.- Índice de ionización y de PVPP
en el vino inicial y en todos los vino tras la
microoxigenación.
Gráfico 7.- Evolución de A) IPT y B) taninos totales
(g/L) de los vinos durante la microoxigenación.
Gráfico 8.- Índice de HCl finalizada la
microoxigenación
Los Gráficos 7a y 7b muestran la evolución de IPT y
taninos totales. Ambos parámetros son similares en
todos los vinos; lo que indica que no se produce ninguna precipitación de taninos durante la aplicación
de esta técnica.
et al.(2001), presentando el máximo en el vino microoxigenado con la dosis media. Confirmando que la
presencia de oxigeno favorece la polimerización de
taninos, traduciéndose en una disminución de astringencia.
El análisis del contenido en taninos (procianidinas),
representado por el Gráfico 7b, muestra que los niveles se mantiene durante la microoxigenación y es
semejante en todos los vinos. No obstante, el índice
de HCl, indicador del porcentaje de la polimerización
de taninos presentes en vino; es superior en los vinos
microoxigenados que en el testigo tras el periodo de
microoxigenación (Gráfico 8), al igual que a Cabanillas
Tras la microoxigenación se realizó el análisis organoléptico de los vinos, concluyendo que:
- El vino testigo era ligeramente áspero en boca con
taninos agresivos.
- Los vinos microoxigenados con dosis baja y media
en boca eran redondos y con gusto agradable a mitad
Seminario Técnico
- El vino microoxigenado con dosis más altas en boca
era similar a los otros dos vinos microoxigenados,
aunque se apreciaban aromas a fruta madura y algo
más evolucionado.
Concluyendo que organolépticamente las dosis más
adecuadas son las dosis baja y media.
Teniendo en cuenta los resultados expuestos y el análisis organoléptico de los diferentes vinos se concluye
que la dosis adecuada durante la microoxigenación
es la dosis media. Cabe esperar que estas diferencias
sean mayores con el tiempo, haciendo interesante el
seguimiento durante el envejecimiento en barrica y
botella.
BIBLIOGRAFÍA
(1) Delteil D.(2000). Los diferentes roles del oxigeno.
Viticultura/ Enología Profesional, 74, 35-45.
(2) Pérez- Magariño y Gozález San-José Mª L. (2003).
Efectos de la aplicación de la microoxigenación
durante la fermentación de los vinos tintos. Tecnología del vino, 47, 107-112.
(3) Cabanillas P, Canals J.M., Rozés N., Arola L. Y Zamora F.(2001) “ Influencia de la microoxigenación
en el color y las características organolépticas de
los vinos tintos” Tecnología del vino, Sept/Octubre 2001,51-55.
(4) Llaudy C., Canals R., Cabanillas P., Rozés N., Canals
J.M. y Zamora F. (2004) Logroño “ Influencia de la
microoxigenación en presencia y ausencia de lías
sobre la composición en polifenoles y el color del
vino; comparación con la crianza en barricas” IV
Foro Mundial del vino 13-14 mayo 2004.
(5) González D.C., Herrera P., Fernández J.A., Sánchez
M.,Pérez S., Ortega M., González M.L.(2003) Memoria de Actividades de Investigación 2002/2003.
Instituto Tecnológico Agrario de Castilla y León.
Estación Enologíca 03.
(6) Castellari M., Matricardi l., Arfelli G., Galassi S.,
Amati A. (2000) “ Level of single bioactives phenolics in red wine as a function of the oxygen
supplied during storage”, Food Chemistry 69,6167.
(7) Atanasova V., Fulcrand H., Cheynier V., Moutonet
M. (2002) “Effect of the oxigenation on polyphenol changes occurring in the course of wine-making” Analitica Chimica Acta 458, 15-27.
(8) Wang H., Edward J.R., Shrikhande J. (2003). Anthocyanin transformation in Cabernet Sauvignon
Wine during Aging. J. Agric. Food Chem.,51,79897994.
(9) Bakker J. and Timberlake C.F. (1997). Isolation,
Identification and Characterization of New Color-Stable Anthocyanins Occuring in Some Red
Wine. J. Agric. Food Chem.,45,35-47.
(10) Vivar- Quintana A.M., Santos-Buelga C., RivasGonzalo J.C. (2002). Analytica Chimica Acta,458,
147-155.
(11) Mateus N. and Freitas V. (2001). Evolution and Stability of Anthocyanin-Derived Pigments during
Port Wine Aging. J. Agric. Food Chem.,49,52175322.
(12) Mateus N, Silva A.M.S., Vercauteren J., Freitas
V.(2001). Occurrence of Anthocyanin- Derived Pigments in Red Wines. J. Agric. Food
Chem.,49,4936-4840.
(13) Mateus N., Pascual-Teresa S., Rivas-Gonzalo J.C.,
Santos Buelga C. (2002). Stuctural diversity of anthocyanin-derived pigments in port wines. Food
Chemistry,76, 335-342.
(14) Cameira-dos-Santos P.J., Brillouet J.M., Cheynier V,
Moutounet M. (1996) Detection and Partial Characterisation of New Anthocyanin- Derived Pigments in Wine. J. Agric. Food Chem.,70,204-208.
(15) Revilla I., Pérez-Magariño S., González-SanJosé
M.L., Beltran S. (1999) Identification of anthocyanin derivatives in grape skin extracts and red
wine by liquid chromatography with diode array
and mass spectrometric detection. J. Chromatogr. A, 847, 83-90.
(16) Remy S., Fulcrand H., Labarbe B., Cheynier V.
(2000). First confirmation in red Wine of products
resulting from direct anthocyanin-tannin reactions. J. Sci. Food Agric. 80, 745-751.
(17) Dallas C., Ricardo-da-Silva J., Laureano O. (1996).
Products Formed in Model Wine Solutions involving Anthocyanins, Procyanindin B2 , and Acetaldhyde. J. Agric. Food Chem.,44, 2402-2407.
Textos asociados
de boca. En nariz aparecía aroma afrutado y sin notas
a reducción.
(18) Morata A., Gómez-Cordovés M.C., Colomo B.,
Suárez J.A.(2003). Pyryvic Acid
(19) Sims C.A. and Morris J.R. (1986) “Effects of acetaldehyde and tannins on the color and chemical
age of red Muscadine (Vitis Rotundifolia) Wine”
Research Note JEV 37(2), 163-165.
109
Capítulo
(20) Es-Safin.E, Fulcrand H., Cheynier V., Mountounet
M.(1999). Studies on the Acetaldhyde-Induced
concensacion of (-)- epicatequina and Malvini-3
– Glucoside in a Model Solution system. J. Agric.
Food Chem.,47,2096-2102.
(21) Es-Safin.E, Cheynier V., Mountounet M.(2002).
Role of Aldehydic Derivates in the Condensation of Phenolic Compounds with emphasis on
the sensorial Propieties of fruit-derived foods. J.
Agric. Food Chem.,50,5571-5585.
(28) Ribéreau-Gayon J, Peynaud E., Sudraud P., Ribéreau-Gayon P. (1982) Traité dÓenologie. Sciences
et Thechniques et du Vin.Tome I. Analise et contrôle des Vins.Ed.Dunod. Paris. Francia.
(29) Ribéreau-Gayon P., Gories Y., Maujean A., Dubourdieu D.(1998). Traité dÓenologie.2. Chimie du
Vin. Stabilisation et traitaments. Editorial Dunod.
(22) Fancia- Aricha E.M., Guerra M.T., Rivas- Gonzalo
J.C., Santos-Buelga C. (1997) ”New anthocyanin
Pigments formed after condensation with flavanols” J.Agric. Food Chem.,45,2262-2266.
(30) Glories Y. (1978). Recherches sur la materie colorant des vins rouges. Thesis de la Universite de
Bourdeaux, Université de Bourdeaux.
(23) Sarni-Manchado P., Fulcrand H., Souquet JM.,
Cheynier V., Moutounet M.(1996). Stability and
Color of unreported wine anthocyanin-derived
Pigments. J.Food Science,61,938-941.
(31) Revilla I., González-SanJosé M.L. and Gómez Cordovés (1999). Modificaciones cromáticas del vino
timto de crianza según el tipo de varrica en que
envejece. Food Sci. Tech. Int., 5(2): 177-181.
(24) Escribano-Bailon T., Álvarez-García M., RivasGonzalo J., Heredia F.J., Santos-Buelga C.(2001).
Color and Stabity of Pigments-Derived from
Acethaldehido medianted condensation between Mv-3-O-Glu and (+)-catequin. J.Agric. Food
Chem.,49,1213-1217.
(32) Pérez-Prieto L.J., De la Hera-Orts M.L., López Roca
J.M., Fermandez-fernández J.I. y Gómez Plaza E.
(2003). Oak-matured wines: Influence of the caracteristics of the barrel on wine colour and sensory characteristics. J. Sci. Food Agric., 83: 14451450.
(25) Sudraud P.(1958). Interpretationdes courbes dábsortion des vins rouges. An Technol
Agric.,7,203-208.
(33) Gómez- Cordovés C and González-SanJosé M.L
(1995). Interpretation of color Varibles during the
aging of red wines: Relathionship with Families
of phenolic compounds. J.Agric. Food Chem.,
43(3): 557-561.
(26) OIV (1990).Récueil des Méthodes Internationales
dÁnalyse des vins et moûts. Office International
de la Vigne et du Vin, Paris, Francia.
110
(27) Boulton R.B. (2001). The copigmentationof anthocyanins and its role in the color in red wine: a
critical review. Am. J. Enol. Vitic. 52, 67-87.
(34) Cheynier V. (2005). Polyphenols in foods are more
complex than often thought. Am. J. Clin. Nutr., 81
(suppl): 223S-229S.
Avd. de los Vinos s/n. Pol. Alces
13600 Alcázar de San Juan (Ciudad Real)
Tel.: +34 926 55 02 00
Fax.: +34 926 54 62 54
central@agrovin.com
www.agrovin.com
Modesto Lafuente 41-2º D
28003 Madrid
fundacion@culturadelvino.org
www.culturadelvino.org

Compuestos azufrados volátiles en vinos

Transcription

Similar documents

Diapositiva 1 - Fundacion para la Cultura del Vino

Moscatel Cruz Conde Moscatel Cruz Conde

DQANB_del_Barri sUsoPreparadosLevadura

1 estudio de la fermentación anaeróbica semicontinua de bagazo y

The Denominations of Origin

Rutas del Vino y Brandy del Marco de Jerez

OBTENCIÓN, ESTABILIZACIÓN Y SELECCIÓN DE

REVISTA DE EDUCACIÓN BIOQUÍMICA

Icon - Universidad EAN

Los aruxes en

Tesis Doctoral María García Sanz

Consulta la lista completa - Instituto de Biotecnología

alternativas de tratamiento del mucilago residual producto del

Catálogo de variedades y clones