COMPARATIVE PROTEIN EXPRESSION OF TWO PAPAYA

Transcription

009_JPP1051RP(Zhu)_571
20-11-2012
11:37
Pagina 571
Journal of Plant Pathology (2012), 94 (3), 571-584
Edizioni ETS Pisa, 2012
571
COMPARATIVE PROTEIN EXPRESSION OF TWO PAPAYA CULTIVARS SHOWING
A DIFFERENTIAL RESPONSE TO THE ROOT-ROT PATHOGEN
PHYTOPHTHORA PALMIVORA
R.Z. Jia1, M. Paidi1, S. Lim1, I.K. Cho2, Q.X. Li2 and Y.J. Zhu1, 2, 3
1Hawaii
Agriculture Research Center, Kunia, HI 96759, USA
of Molecular Biosciences and Bioengineering, University of Hawaii, Honolulu, HI 96822, USA
3Institute of Tropical Bioscience and Biotechnology, China Academy of Tropical Agricultural Sciences,
Haikou, Hainan, 571101, P.R. of China
2Department
SUMMARY
Among the Hawaiian papaya (Carica papaya L.) cultivars, ‘Kamiya’ is more tolerant to Phytophthora palmivora than ‘SunUp’. To understand the molecular basis for
the difference between these two cultivars, their protein
profiles cultivars were investigated by two-dimensional
(2D) electrophoresis. Two hundred and fifty expressed
protein spots were compared between ‘Kamiya’ and
‘SunUp’ on triplicate 2D gels. Twentyfive out of 28 differentially-expressed spots were successfully identified
by liquid chromatography-tandem mass spectrometry
(LC-MS/MS), and three differentially migrating spots
were identified as a single protein. Among the 15 proteins up-regulated 2-fold or higher in ‘Kamiya’, nine
were related to plant disease resistance and defense response, while among the 8 proteins up-regulated 2 fold
or more in ‘SunUp’, one was involved in disease and defense. Six differentially expressed proteins were further
confirmed by semi-quantitative RT-PCR. Identified proteins were involved in at least five categories of plant defense or disease resistance: jasmonic acid (JA)-dependent pathway, ATP binding cassette (ABC) transporters,
plant brassinolide hormone, abscisic acid (ABA)/reactive oxygen species (ROS) plant defense pathway, and
transcription regulation. Our results infer that tolerant
‘Kamiya’ possesses various defense mechanisms against
P. palmivora.
Key words: Phytophthora palmivora, root-rot disease,
resistance protein, defense protein, stress-related protein.
INTRODUCTION
Papaya (Carica papaya L.) is an important fruit crop,
native to the tropics of the Americas. Papaya was introduced to Hawaii in the 1800s and the state has become
Corresponding author: Y.J. Zhu
Fax: +1.808.6211399
E-mail: jzhu@harc-hspa.com
the largest papaya industry in the USA. Papaya has limited resistance to Phytophthora palmivora, a particularly
devastating oomycete, which can reduce fruit production and/or quality and may even cause complete loss of
production (Nishijima, 1994). Symptoms of the disease
on infected papaya include leaf yellowing, wilting of
stems and leaves, and roots rotting (Zhu et al., 2003,
2004). Among Hawaiian papaya cultivars, field observations showed that ‘SunUp’ is susceptible while ‘Kamiya’
is more tolerant towards P. palmivora (Gonsalves, 2006;
Fuchs et al., 2007).
Plants possess two distinct, but complementary, defense mechanisms against pathogen attack (Dangl et al.,
2001). The first mechanism is ‘passive’, consisting of
physical barriers such as the cuticle and cell wall. However, in some cases this is not sufficient. The plant then
relies on a second defense mechanism, also known as an
‘active’ defense response that involves coordination of
diverse genetic and physiological reactions, analogous to
a counterattack. The ‘active’ defense response begins
with host recognition of the invading organism at the
penetration site (Nimchuk et al., 2003). One type of virulence recognition is mediated by resistance (R) genes,
encoding pathogen recognition proteins, which may interact in a precise gene-for-gene manner (Flor, 1971). R
gene-dependent resistance has been used in breeding
programs in several crops with varying degrees of success against a number of pathogens (Dangl et al., 2001;
Di Gaspero et al., 2002; Nimchuk et al., 2003). A further active defense response, systemic acquired resistance (SAR) is an inducible defense mechanism which
may result in a broad, long-lasting immunity in non-infected tissues against both the initial pathogen and also
other pathogens, insects or wounding (Ryals et al.,
1994). Several pathogenesis-related (PR) genes, such as
PR-1, PR-2 and PR-4 are induced during local defenses
and SAR (Ward et al., 1991, 1993). Salicylic acid (SA) is
a signaling molecule involved in both local defense reactions and in the induction of SAR. It has been shown
that applying SA to plants can induce SAR (Ward et al.,
1991, 1993). The three small molecules, jasmonic acid
(JA), SA, and ethylene (ET) which play key roles in the
regulation of the signaling network involved in plant
009_JPP1051RP(Zhu)_571
572
20-11-2012
11:37
Pagina 572
Comparative proteomic analysis of papaya cultivars
stress response and disease resistance have been well reviewed (Dangl et al., 2001; Nimchuk et al., 2003;
Pieterse et al., 2004). However, specific studies on papaya defense and resistance mechanisms have rarely
been reported. It is interesting to compare papaya with
Arabidopsis thaliana, a member of the Brassicales, and a
well-researched plant. The papaya genome is significantly larger than that of Arabidopsis, at 372 mega base
pairs (Mbp) vs. 145 Mbp (Ming et al., 2008). However,
there are fewer nucleotide-binding site (NBS)-containing R genes in papaya than in Arabidopsis, 54 vs. 174,
respectively (Porter et al., 2009).
The papaya cultivars ‘SunUp’ and ‘Kamiya’ differ in
their responses to the pathogen P. palmivora; ‘SunUp’ is
susceptible while ‘Kamiya’ is tolerant. We hypothesize
that differences in susceptibility to P. palmivora may be
mediated by defense proteins. In particular, we expect
that there might be differences in the root proteins of
‘SunUp’ and ‘Kamiya’ and that these might include proteins which are already known to be stress-related or involved in defense. To test this hypothesis, and gain insight into how ‘SunUp’ and ‘Kamiya’ react to P.
palmivora, we used two dimensional (2D) electrophoresis, integrated with liquid chromatography-tandem mass
spectrometry (LC-MS/MS) to identify differentially-expressed proteins. Identification of defense or stress-related proteins in the two papaya cultivars will provide a
molecular basis for determination of the functional roles
of these proteins in the C. papaya-P. palmivora interaction.
MATERIALS AND METHODS
Chemicals. All chemical reagents used in this work
were purchased from either Sigma-Aldrich (USA) or
Bio-Rad Laboratories (USA), except where mentioned
separately. All solvents used for LC-MS/MS analysis
were purchased from Fisher-Scientific (USA) with LC
grade or higher grade purity.
Plant and pathogen cultures. Seeds of ‘Kamiya’ and
‘SunUp’ were obtained from Hawaii Agriculture Research Center (Kunia, HI, USA). Seeds were surface
sterilized and germinated according to Zhu et al. (2003).
P. palmivora was cultured on medium containing
10% V8 vegetable juice™ (Campbell Soup , USA), 1%
agar, 0.15% CaCO3 for 10-12 days. Zoospores of P.
palmivora were extracted according to Zhu et al. (2004).
The concentration of inoculum was determined using a
hemocytometer. 1x104 zoospores/ml were used to inoculate plants by a root drench method (Zhu et al., 2004).
Three-month-old papaya plants of cvs Kamiya and
SunUp were used. Thirty plants for each cultivar were
inoculated with 10 ml of a P. palmivora zoospore suspension. Prior to inoculation, root samples were collected for protein analysis. Samples collected at 0, 20, 44,
and 144 h after inoculation (HAI) were used for RTPCR. Plants were photographed and fresh weights taken 5 days after inoculation.
Protein extraction and solubilization. Protein extractions and analyses were based on the method of Wang
et al. (2006) with modifications. Prior to extraction, 4 g
of finely ground root samples were washed several
times: twice with 5 ml cold acetone, once with 10% Trichloro acetic acid (TCA) in acetone and once with 80%
acetone. Each wash was followed by centrifugation at
10,000 g for 7 min. The protein pellets were then dried
at room temperature for 45 min. Protein was extracted
by adding 1.5 ml cold phenol (pH 8) and 1.6 ml SDS
buffer (30% sucrose, 2% SDS, 0.1 M Tris-HCl pH 8
Table 1. Primers used in this work for validation of proteins expressed in cvs Kamiya and SunUp.
Primer sequence 5' to 3'
Tm (oC) Product size (bp)
f: TTGGAAGGCACGAGAATG
56
480
r: TAGCAGCAGGAGGGATGA
f: GTCCTCGTGCTTATTATCG
56
222
r: TCGGGTTCATTAGTCCTT
f: TGCTGCTGTAAACTTTGG
58
448
K13 Lipoxygenase
CpLOX
SC458.3(0)
r: GGAGATGCTGTTAGGGAC
f: TATCGAGCTGCTTCACGT
Abscisic-aldehyde
56
443
CpALDO SC103.87(0)
K14
r: AATGTTGGCGGATTCACT
oxidase
f: CTTCTGAGGCATTATTCG
56
204
S5 Hexokinase-1
CpHXK
SC78.21(0)
r: CATCTTGTCCAACCGTAT
f: TATTCTGGGCAACTCG
Serine/threonine56
353
CpATR
SC20.126(0)
S7
r: CTCCCTCTTCATCCTCAT
protein kinase
f: ACTACGAGTTGCCTGATGGA
58
192
Actin protein
CpACTIN AY906938
r: AACCACCACTGAGCACAATG
Oligo dT
TTTTTTTTTTTTTTTT
*: Identified protein sequences were queried against the papaya genome database. Primer Premier (ver. 5.00, Premier
Biosoft International, CA) was used for primer design. All the primers were synthesized by IDT (Integrated DNA
Technologies, Inc. USA).
f: indicates forward primer, and r: reverse primer. Tm: annealing temperature used in RT-PCR reactions.
No. Protein name
Gene name Homolog*
Disease resistance
CpDRL
SC64.10 (2e-49)
K2
protein
WRKY transcription
CpWRKY SC152.35(e-139)
K10
factor
009_JPP1051RP(Zhu)_571
20-11-2012
11:37
Pagina 573
and 5% β-mercaptoethanol). The upper phenol phase
was collected following centrifugation at 10,000 g for 7
min. For every 300 µl of the phenol phase collected, 5
vol of cold 0.1 M ammonium acetate in methanol were
added and proteins were precipitated by storing at
-20°C for 30 min. Proteins were pelleted by centrifugation at 10,000 g for 5 min. The pellets were then washed
twice with 0.1 M ammonium acetate in methanol and
once with 80% cold acetone. The clean protein pellets
were dried at room temperature for 20 min, then solubilized in a rehydration buffer (8 M urea, 2% Triton X100, 10 mM DTT and 0.5% pH 3-5 ampholyte) and
stored at -80°C. Protein concentration was determined
with a Quick StartTM Bradford Dye Reagent (Bio-Rad,
USA) according to manufacturer’s instructions. According to the manufacturer this kit is SDS compatible up to
a level of 0.2%. Ten individual plants for each cultivar
were extracted independently, and the proteins were
pooled for 2D electrophoresis.
2D electrophoresis and image acquisition. Approximately 200 µg of solubilized proteins were applied to
each of the 11-cm, pH 3-11 immobiline dry strips (immobilized pH gradient, IPG) following the manufacturer’s instructions (Bio-Rad, USA). Isoelectric focusing of
the rehydrated strips was conducted in a Bio-Rad protean IEF cell with linear ramping of voltage according
to the PROTEAN IEF Cell instruction manual. The
sample was pre-focused for 1 h, then the IPG strips
were overlaid with a thin film of mineral oil and were allowed to rehydrate for 16 h. Once the maximum voltage
of 8,000 V was reached, the IPG strips were placed in a
rehydration tray that was sealed with plastic wrap and
stored at -80°C until they were used in second dimension electrophoresis. Just before running the second
electrophoresis, the strips were placed into reduction
solution (36% urea, 2% SDS, 25% 1.5 M Tris-HCl v/v,
2% glycerol, and 2.5% DTT) for 10 min, to ensure
complete reduction of any reformed disulphide bonds.
After this, the strips were incubated for 10 min in alkylation solution [36% urea, 2% SDS, 25% 1.5 M TrisHCl v/v, 2% glycerol, and 2.5% iodoacetamide (IAA)]
to alkylate proteins and react with any unreduced DTT.
After equilibration, the IPG strips were immersed in a
tank of 1X SDS-polyacrylamide gel electrophoresis
(PAGE) running buffer (196 mM glycine, 0.1% SDS,
50 mM Tris-HCl, pH 8.3) for 30 sec, and placed on the
pre-cassetted 12.5% SDS-PAGE gel (Bio-Rad, USA).
Electrophoresis was conducted at a constant voltage of
200 V for 55 min.
The gels were stained with Coomassie Blue (Bio-Rad,
USA) (0.25 g/100 ml Coomassie Blue in 10% acetic
acid in 50% aqueous methanol) for 1 h and destained in
solution I (7.5% acetic acid in 50% aqueous methanol)
and subsequently solution II (7.5% acetic acid in 5%
aqueous methanol) until the background was clear.
Jia et al.
573
Cleared gels were scanned on a Bio-Rad GS-800 calibrated densitometer using a 36.3 µm resolution. Gel images were imported and analyzed with PDQuest 8.0
(Bio-Rad, USA) image analysis software. Images were
cropped to ensure identical dimensions for all images.
Sensitivity was adjusted to ensure most of the protein
spots were visible. A filtered image was achieved by removing noise/streaks that could be misinterpreted as
protein spots. A process (local regression) was selected
to normalize all detected peptide spots to the reference
gel. Selected peptide spots were then manually inspected to correct any mismatches produced by the comparative analysis. The isoelectric point (pI) of a protein was
calculated as previously described (Bjellqvist et al.,
1993, 1994). Proteins detected in all three technical
replicates are reported in the results. Differences in spot
location and intensity detected by the PDQuest software were also checked manually. Student T-test analysis in the PDQuest software package was performed for
the spots that were consistently detected in the three
replicates for a cultivar. The expression of each protein
spot was determined by the ANOVA procedure for
Duncan’s multiple range test (P = 0.01).
In-gel protein digestion. Protein spots of interest
were excised manually with a one touch spot picker
(The Gel Company, USA) and transferred into 200 µl
water in 1.5 ml microtubes. The excised plugs were
washed with 50 mM ammonium bicarbonate
(NH4HCO3)/50% acetonitrile (ACN) until they were
completely destained. The plugs were dried to a white
color using a speed vacuum (SVC-100H, Savant, USA).
An aliquot of 20 µl of freshly-prepared sequencinggrade modified trypsin (Promega, USA) 20 µg/µl in 50
mM NH4HCO3, was added to the dried gel slices for
imbibition in an ice bath. The unabsorbed solution was
removed before adding 40 µl of 50 mM NH4HCO3,
then the gel slices were incubated overnight at 37°C.
Tryptic digestion was stopped by adding 5 µl of 2% trifluoroacetic acid (TFA). The digested peptides were extracted from each gel slice by incubating for 40 min in a
sonicating water bath (model FS 110, Fisher Scientific,
USA) with 40 µl extraction buffer (water:ACN:TFA,
93:5:2, v/v/v). Supernatants were collected and dried
using vacuum centrifugation. The peptides were re-dissolved in 20 µl of 5% aqueous formic acid, transferred
to fresh tubes and stored at -20°C until they were subjected to LC-MS/MS analysis.
Liquid chromatography ion trap mass spectrometry
(LC-MS/MS) analysis and database search. The tryptic-digested polypeptide mixtures were analyzed using a
Dionex UltiMateTM 3000 nano LC interfaced with an
Esquire HCTultra ion trap mass spectrometer (Bruker
Daltonics, Germany) in nanoelectrospray mode with a
Pico Tip Emitter (New Objective, USA) according to
009_JPP1051RP(Zhu)_571
574
20-11-2012
11:37
Pagina 574
the procedure of Lee et al. (2007). The nano-LC column was a C18 PepMap 100 (Dionex Corp., USA). The
gradient program consisted of solution B in solution A.
Specifically, A = 0.1% formic acid in water and B =
0.1% formic acid in acetonitrile. The timed increase
program was 5% B for 5 min, 60% B for 70 min, 95%
B for 10 min, 5% B for 15 min, and 5% B for 20 min.
Peptide spectra were recorded over a mass range of m/z
300-2500 while MS-MS spectra were recorded over a
mass range of m/z 50-1600. One peptide spectrum was
recorded followed by two MS-MS spectra, and the accumulation time was 1 sec for peptide spectra and 2 sec
for MS-MS spectra. The collision energy was set automatically according to the mass and charge state of the
peptides chosen for fragmentation. Doubly- or triplycharged ions were selected for product ion spectra.
MS/MS spectra were interpreted with MASCOT
(Version: 2.2.04, Matrix Science, UK) using Biotools
software (Bruker Daltonik, Germany). Peptide mass fingerprinting (PMF) searches were carried out with the
Swissprot and MSDB databases through the Mascot
server with available plant databases (Arabidopsis, Oryza
sativa and Viridiplantae) following previous studies (Lee
et al., 2007). Functions for identified peptides were assigned according to the universal protein resource,
Uniprot, and results are listed in Table 2.
RT-PCR. For both papaya cultivars, expression of six
selected genes was tested and the expression profile of
CpLOX was investigated for 0, 22, 44, and 144 h after
inoculation. RNA extraction was performed using an
RNeasy Plant Mini Kit (Qiagen, Germany), according
to manufacturer’s instructions. RNA concentration was
determined using a spectrophotometer (ND-1000, Nanodrop Technologies, USA). An IcyclerTM Thermal Cycler (Bio-Rad, USA) was used for all the reverse transcription and amplification reactions. Total RNA was
treated with DNase (RQ1 RNase-free DNase, Promega,
USA) according to the manufacturer’s instructions. First
strand cDNA synthesis was carried out with ImPromIITM reverse transcriptase (Promega, USA) with an oligo
dT, according to manufacturer’s instructions. Primers
and annealing temperatures used in this study were listed in Table 1. Specific genes were amplified in a total
Fig. 1. Comparison of two papaya cultivars, ‘Kamiya’ and ‘SunUp’, inoculated with the pathogen P. palmivora. A. Photographs of
3 month old plants, 5 days after inoculation with either water or a Phytopthora root drench. ‘Kamiya’ is on the left and ‘SunUp’ is
on the right. B. Fresh weight of whole plants (including roots) and root weight of ‘Kamiya’ and ‘SunUp’, also at 5 days after inoculation. *, ** indicates significant difference at P=0.05 and P=0.01, respectively.
009_JPP1051RP(Zhu)_571
20-11-2012
11:38
Pagina 575
Table 2. Differentially-expressed proteins identified in papaya cultivars ‘Kamiya’ and ‘SunUp’.
Jia et al.
575
009_JPP1051RP(Zhu)_571
576
20-11-2012
11:38
Pagina 576
*: Underlined protein spots were selected for further confirmation by RT-PCR.
a): Bar graph of protein semi-quantity analysis based on 2DE. Y-axis: normalized expression volume of the spot relative optical density
(ROD, intensity X area).
b): Accession number in Swissprot database, version: 51.6 (257964 sequences; 93947433 residues).
c): Organism used for homolog search, At: Arabidopsis thaliana, Os: Oryza sativa, St: Solanum tuberosum.
d): Mascot scores (S) and scores cutoff (SC), the Mascot score are derived from ions scores as a non-probabilistic basis for ranking protein hits. The cutoff scores based on significance threshold P=0.05.
e): MW represents molecular weight (KDa) both experimental MW (Ex) and calculated MW (Ca) were listed in the table.
f): pI means isoelectric point of the proteins with both experimental (Ex) and calculated value (Ca).
g): Sequence coverage (C) in percentage (%).
h): polypeptide sequence (PS), doubly- or triplycharged ions were selected for product ion spectra.
i): Homolog (H) sequences matched by identified protein against Papaya (Carica papaya L.) genome database with blast-P software,
where SC indicated supercontig followed by the gene number. The number in brackets indicates E-value.
j): Potential functional (F) categories of identified proteins were based on the database searches and literature reviews detailed in the results and discussion sections. DD: disease resistance and defense, ST: signal transduction, TR: transcription regulation, MP: metabolic
processes, DR: DNA replication.
volume of 20 µl, containing 1X Green GoTaq Flexi
buffer, 2 mM MgCl2, 0.2 mM dNTP mix, 1 µM forward
primer, 1 µM reverse primer, 1 U GoTaq DNA polymerase (Promega, USA), and <0.5 µg cDNA template.
The PCR procedure was 94°C for 5 min, 30 cycles at
94°C for 30 sec, annealing for 60 sec, 72°C for 60 sec,
final elongation at 72°C 5 min. A 1.5% agarose gel was
used for electrophoresis, visualized with ethidium bromide, and photographed using Electrophoresis Documentation and Analysis System 120 (Kodak, Japan).
Quantitative analysis of PCR products was carried out
with Quantity One (v 4.6.1, Bio-Rad) to compare gene
expression according to the method of Sundfors et al.
(1996). The relative optical density (ROD, i.e., intensity
×area) of each PCR band, in reference to gene expression, was calculated and compared.
RESULTS
Differential response of ‘Kamiya’ and ‘SunUp’ to P.
palmivora. Visually ‘Kamiya’ plants appeared healthier
009_JPP1051RP(Zhu)_571
20-11-2012
11:38
Pagina 577
than ‘SunUp’ plants after they were challenged with P.
palmivora root drenches. Five days after inoculation,
‘SunUp’ showed typical leaf and stem wilting symptoms
that eventually led to plant death (Fig. 1a). The whole
plant fresh weight of ‘SunUp’ was significantly decreased after treatment with P. palmivora (P=0.05), also
root weight was significantly decreased (P=0.01). Meanwhile, for ‘Kamiya’ the pathogen did not seem to affect
either root or whole plant weight. However, the whole
plant fresh weight of ‘Kamiya’ was slightly heavier than
that of ‘SunUp’ for both the controls and for the inoculated plants. The fresh weight of inoculated roots for
‘Kamiya’ was significantly heavier than that of ‘SunUp’
(Fig. 1b). The inoculated roots of ‘SunUp’ turned
brown and necrotic, indicating the presence of root rot
(not shown). Growth measurements of potted plants
confirmed that ‘Kamiya’ is more tolerant than ‘SunUp’to P. palmivora.
Comparative analysis of proteins detected in the
roots of ‘Kamiya’ and ‘SunUp’. A total of 250 root pro-
Jia et al.
577
tein spots were compared (data not shown) between
‘Kamiya’ and ‘SunUp’ on triplicate gels. A total of 28
spots were significantly different (P=0.01) in their expression between the two cultivars, of which 19 were
from ‘Kamiya’ (Fig. 2a) and 9 from ‘SunUp’ (Fig. 2b).
Among the 19 spots excised from ‘Kamiya’, 12 spots
were detected exclusively in ‘Kamiya’ gels without any
detectable expression in ‘SunUp’ and they were assigned as K1 to K12. The remaining 7 spots were more
than 2-fold greater in ‘Kamiya’ compared to ‘SunUp’
and they were assigned as K13 to K19. Six out of 9
‘SunUp’ spots were detected exclusively in ‘SunUp’ and
they were assigned as S1 to S6 (Fig. 1b and 1d). The
other 3 spots, assigned as S7 to S9, were more than 2fold greater in ‘SunUp’ than in ‘Kamiya’ (Fig. 2b and
2d). All of the 28 proteins spots were further investigated by LC-MS/MS. Of these, 25 protein spots were successfully identified, while 3 protein spots (K11, K12,
and S6) did not match any known proteins in the database (Table 2) (Triplicate gel images and protein spot
data are available upon request).
Fig. 2. 2DE gel images of larger and exclusively detected spots of root proteins from two papaya cultivars, (A) ‘Kamiya’ and (B)
‘SunUp’. All the excised spots are located as a square and identified with a number. Molecular weight standards are shown on the
left margin of the gel image and pH is indicated on the top of the image. A selected region is presented in insets (C) for ‘Kamiya’
and (D) for ‘SunUp’, respectively, to show the selected spots in detail. (E) A bar graph represents the number of identified proteins involved in different biological process in ‘Kamiya’ and ‘SunUp’.
009_JPP1051RP(Zhu)_571
578
20-11-2012
11:38
Pagina 578
Proteins occurring exclusively or in higher quantities in ‘Kamiya’. Potential functions for 17 out of the 19
proteins showing increased expression in ‘Kamiya’ are
proposed in Table 2. Nine proteins were involved in
plant stress response and defense (probable steroid reductase, K1; putative disease resistance protein, K2; myrosinase-binding protein, K3; pleiotropic drug resistance protein, K4; white-brown-complex homolog protein, K6; probable lipoxygenase, K13; abscisic-aldehyde
oxidase, K14; multidrug resistance protein, K16; and
peroxidase protein, K17). Three spots showing different
migration patterns (K7, K8, and K18) were all identified
as a single transcriptional initiation factor. Two proteins,
K5 (serine/threonine protein kinase) and K10 (WRKY
transcription factor) are part of signal transduction
pathways. Two proteins, K15 (4-alpha-gulcanotransferase), and K19 (lon protease) are involved in metabolic processes. One protein, K9 (DNA ligase), is involved
in DNA repair and modification Two proteins (K11 and
K12) were not successfully identified due to a lack of
matched proteins in the existing database (Table 2).
Disease-resistance protein (CpDRL, K2), transcription
factor (CpWRKY, K10), lipoxygense (CpLOX, K13),
and abscisic-aldehyde oxidase (CpALDO, K14) were
selected for further confirmation in RT-PCR experi-
ments. The CpLOX expression in both ‘Kamiya’ and
‘SunUp’ from 0, 20, 44, to 144 HAI was also tested.
Proteins occurring exclusively or in higher quantities in ‘SunUp’. Eight out of nine proteins were detected exclusively or in higher quantities in ‘SunUp’ and
were successfully identified (Table 2). Three proteins
participated in transcriptional regulation (DEAD-box
ATP dependent RNA helicase, S1, elongation factor, S2,
and NAC domain-containing protein, S4). Two proteins
(serine/threonine-protein kinase, S7, and wall associated receptor kinase, S9) were involved in signal transduction. Two proteins, S3 (fructose-bisphosphate aldolase) and S5 (hexokinase) are involved in metabolic
processes. One protein, S8 (phosphatidylinositol-4phosphate kinase), is involved in general stress response. Further confirmation was carried out by RTPCR experiments for hexokinase (CpHXK, S5) and serine/threonine-protein kinase (CpART, S7). Comparison
of the proteins identified in the two cultivars showed
that 9 proteins in ‘Kamiya’ and one protein in ‘SunUp’
were related to plant disease resistance and defense.
One protein, related to DNA repair, was detected in
‘Kamiya’ but not in ‘SunUp’. An identical number of
proteins related to metabolic processes, signal transduc-
Fig. 3. Gene expression of proteins identified in this study. Three biological repeats were performed for both cultivars. Gel images
were also quantitatively analyzed by densitometry, in which relative optical density (ROD) was intensity×area. Background was
calculated by randomly selecting 20 non-band areas as the background control. Values with the same letter were not significantly
different (P=0.01).
009_JPP1051RP(Zhu)_571
20-11-2012
11:38
Pagina 579
Jia et al.
tion, and transcriptional regulation, were detected in
‘Kamiya’ and ‘SunUp’ (Fig. 1e).
Gene expression in ‘Kamiya’ and ‘SunUp’ prior to
inoculation. RT-PCR results (Fig. 3) for proteins K2,
K10, K13, K14, S5, and S7 confirmed the proteomic results. The mRNA amount of two exclusively-expressed
proteins CpDRL (K2) and CpWRKY (K10) in ‘Kamiya’
was significantly higher than those for ‘SunUp’. In particular, in ‘SunUp’, mRNA transcripts for CpDRL were
barely detected (not visible on the agarose gel). The expression of CpWRKY in ‘Kamiya’ was significantly higher (P=0.01) than that in ‘SunUp’. CpLOX (K13), mRNA
transcripts in ‘Kamiya’ were significantly higher
(P=0.01) than those in ‘SunUp’, which supports the proteomic results. The gene CpALDO (K14) showed no significant difference at the mRNA level under our RT-PCR
conditions. For the proteins selected from ‘SunUp’,
CpART (S7) and CpHXK (S5), the RT-PCR results
agreed with their protein profiles as mRNA levels of
both proteins were significantly higher in ‘SunUp’ than
‘Kamiya’. In particular, a PCR product for CpHXK was
only detected in the ‘SunUp’ samples, which supports
the results of the protein expression study
579
CpLOX gene expression in ‘Kamiya’ and ‘SunUp’
following inoculation. Samples from both cultivars at
four time points after inoculation (at 0, 20, 44, and 144
h) were used to examine P. palmivora-regulated CpLOX
gene transcript level (Fig. 4). The CpLOX level in
‘Kamiya’ after P. palmivora inoculation increased at all
time points up to 144 h (Fig. 4a). Meanwhile in ‘SunUp’
there was a delay in detection of the transcript till after
44 h. For each time point studied, the transcripts of
CpLOX were higher in ‘Kamiya’ than in ‘SunUp’ (Fig.
4b).
DISCUSSION
Proteomics, or global analysis of gene expression at a
protein level, enabled us to evaluate potential differences between Kamiya and SunUp papaya cultivars. In
this study, 2DE and high-sensitivity protein identification by electrospray ionization and MS/MS were used.
Previous fieldwork had shown that ‘Kamiya’ is more
tolerant to P. palmivora than ‘SunUp’. By comparing
250 protein spots in the two cultivars it was found that
expression of 28 proteins was significantly different.
Among them, 25 proteins were successfully identified
Fig. 4. Comparison of CpLOX expression in papaya cultivars ‘SunUp’ and ‘Kamiya’. (a) Agarose gel image showing products of
RT-PCR using CpLOX primers listed in Table 1. Both ‘Kamiya’ and ‘SunUp’ were inoculated with P. palmivora and sampled at 0,
20, 44, and 144 hours after inoculation (HAI). (b) Relative expression of CpLOX was semi-quantified using Quantity One (v 4.6.1,
Bio-Rad) (see Materials and Methods). The CpLOX band density was converted to ROD value by subtracting the value for
CpActin expression. *: significant level P=0.05, **: significant level P=0.01.
009_JPP1051RP(Zhu)_571
580
20-11-2012
11:38
Pagina 580
but three spots remained unidentified. Lack of identification was partly due to poor genome annotation, the
scores were not significant enough for an unambiguous
identification (Wang et al., 2003; Karabacak et al., 2009)
and other technological concerns (Marcotte, 2007). We
also detected a single protein, a transcriptional initiation
factor, which produced three differently migrating spots
(K7, K8, and K18). A possible explanation for this result might be alternative splicing of mRNA or posttranslational modification (Gygi et al., 2000; Kosaihira
et al., 2009).
Steroid reductase DET2 (spot K1) controls a reduction step in the biosynthesis of the plant steroid, brassinolide, and was shown to be exclusively-expressed in
‘Kamiya’. The physiological role of plant steroids is
largely unknown. In Arabidopsis, steroid reductase AtDET2 was shown to have an important role in light-regulated development of higher plants (Li et al., 1996).
Steroids as signals controlling plant growth and development were reviewed by Clouse et al. (2003). Brassinosteroids can induce plant tolerance to a variety of abiotic stresses, such as high and low temperature, drought
and salinity (Krishna, 2003; Kwak et al., 2006), aluminium stress (Ali et al., 2008), and cadmium stress (Hayat
et al., 2007). Exclusive expression of a steroid reductase
protein in ‘Kamiya’, but not in ‘SunUp’ implies a connection between ‘Kamiya’ tolerance to P. palmivora and
brassinolide metabolism in plant defense.
A disease resistance protein (K2) was another protein
detected only in ‘Kamiya’, but not in ‘SunUp’. This protein belongs to the disease-resistance nucleotide binding
leucine-rich repeat (NB-LRR) family. Papaya genome
analysis revealed 54 of the nucleotide binding site
(NBS) family of genes (Porter et al., 2009). A major
plant resistance strategy, called plant innate immunity,
relies on specialized immune receptors that can detect
and defend against a wide variety of microbes (Tameling
et al., 2007). The first group comprises trans-membrane
pathogen or pattern-recognition receptors (PRRs),
which recognize and respond to slowly evolving
pathogen- or microbe-associated molecular patterns
(PAMPs/MAMPs). The second group of immune receptors is formed by polymorphic disease resistance (R)
proteins that detect microbe-derived effector proteins.
Most R proteins are members of the NB-LRR class
(Tameling et al., 2007; Ting et al., 2008). The fact that
this NBS-containing resistance protein was found to be
expressed only in ‘Kamiya’ may indicate this R gene
may play an important role in the reaction of ‘Kamiya’
to P. palmivora.
Three out of the 28 differentially-expressed proteins
between ‘Kamiya’ and ‘SunUp’ were identified as proteins in the ABC transporter superfamily. The proteins
were pleiotropic drug resistance protein (CpPDR, spot
K4), white-brown complex homolog protein (CpWBC,
Spot K6), and multidrug resistance protein (CpMRP,
spot K16). ABC transporters, which constitute a large
gene family in all living organisms (Crouzet et al., 2006),
have been implicated in the active transport of a wide
variety of substrates across cellular membranes (Higgins, 1992).
It is intriguing that three ABC transporters were detected either exclusively or at higher quantities in
‘Kamiya’. MRP and PDR proteins were known to be involved in the transport of antifungal and antibiotic
drugs. The WBC subfamily is thought to mediate the
export of wax components across the plasma membrane, which serves as the primary line of defense
against pathogens by providing a physical barrier to
pathogen ingress (Bird et al., 2007; Panikashvili et al.,
2007). Differences in ABC transporters detected between the two cultivars may indicate that ABC transporters are responsible for transporting an antifungal
agent that is more effective in controlling P. palmivora.
Future experiments with knockout mutants may provide direct evidence for the role of specific ABCs in papaya defense against Phytophthora.
Abscisic-aldehyde oxidase (spot K14) and peroxidase
(spot K17) detected in this study were up-regulated in
‘Kamiya’. Abscisic-aldehyde oxidase is known to catalyze the reaction of abscisic aldehyde, H2O, and O2 to
produce abscisate and H2O2. The optimal substrate of
the peroxidase is H2O2, but it is also active with organic
hydroperoxides such as lipid peroxides, which accumulate in plants during pathogen attack or other
biotic/abiotic stresses. Plant peroxidases are involved in
the oxidation of the plant hormone indole-3-acetic acid
and defense-related compounds, such as SA, which
then generates ROS (Kawano, 2003). Studies have
shown that plant peroxidases participate in lignification,
suberization, auxin catabolism, wound healing and defense against pathogen infection, which are induced via
different signal transduction pathways from those of
other known defense-related genes (Hiraga et al., 2001).
ABA is known to be involved in plant tolerance to
abiotic stresses, such as response to salt, drought and
osmotic and cold stresses. Evidence suggests that ABA
plays an ambivalent role in the defense response to
pathogens. Those defense mechanisms involve the interaction of the plant via a variety of signaling networks,
including the suppression of SA- and ethylene/JA-dependent basal defenses, synergistic cross-talk with JA
signaling, and other physiological and molecular responses, such as the suppression of reactive oxygen
species (ROS) generation, induction of stomatal closure,
and stimulation of callose deposition (Ton et al., 2009).
Analysis of A. thaliana defense response to the damping-off oomycete pathogen, Pythium irregulare, show
that resistance to P. irregulare requires a multi-component defense strategy: penetration recognition, subsequent signaling of inducible defenses, which is predominantly mediated by JA. ABA is an important regulator
009_JPP1051RP(Zhu)_571
20-11-2012
11:38
Pagina 581
of defense gene expression including affecting JA
biosynthesis in the activation of defenses against this
oomycete (Adie et al., 2007).
Lipoxygenase (spot K13) was detected at higher levels in ‘Kamiya’ than ‘SunUp’. This was confirmed in RTPCR experiments which showed an increase in CpLOX
mRNA level in ‘Kamiya’. To confirm expression of
CpLOX during infection, root samples from the two
cultivars were monitored 0, 20, 44, and 144 h after inoculation. Expression of CpLOX appeared higher in
‘Kamiya’ than in ‘SunUp’. In ‘SunUp’, expression of
CpLOX appeared to be delayed. Plant lipoxygenases
are involved in a number of diverse aspects of plant
physiology including growth and development, pest resistance, senescence, and response to wounding.
Lipoxygenases catalyze hydroperoxidation of lipids containing a cis, cis-1, 4-pentadiene structure. JA, derived
from linolenic acid via lipoxygenation, is recognized as a
gaseous growth regulator in rice (Ohta et al., 1992). JA
is also a signaling molecule in JA-dependent pathways
that are involved in the activation of a suite of PR genes
to promote plant defense against pathogens (Asai et al.,
2002). Molecular characterization of lipoxygenase from
maize embryos showed that it accumulates during treatment with ABA, gibberellic acid and JA (Jensen et al.,
1997). A novel lipoxygenase gene expressed in rice is
part of the early response of the host to pathogen attack
(Peng et al., 1994). The higher level of probable lipoxygenase 8, a chloroplast precursor in ‘Kamiya’, may indicate a JA-dependent pathway leading to the activation
of different PR genes which then contribute to its tolerance to P. palmivora.
Two transcription factors were identified in comparing the papaya cultivars ‘Kamiya’ and ‘SunUp’. These
proteins were WRKY transcription factor (TF) (spot
K10) and transcription initiation factor TFIID (spot K7,
K8 and K18). WRKY TFs belong to a large family of
regulatory networks involved in various plant processes
but most notably they allow the plant to cope with diverse biotic and abiotic stresses. The WRKY TF was
up-regulated in ‘Kamiya’ at both the protein and mRNA levels. TFIID mediates promoter responses to various activators and repressors. In the present study, we
identified three independent protein spots as TFIID
subunits. Two were identified as TFIID subunit 1 (K8)
and 1A (K7) and were exclusively expressed in
‘Kamiya’, while a third was identified as TFIID subunit
1B (K18) and was up-regulated in ‘Kamiya’. There are
limited reports about direct involvement of TFIID in either plant defense or stress response.
WRKY TFs are indeed global regulators of host responses at various levels, acting partly by directly modulating immediate downstream target genes, and partly
by activating or repressing other TF genes (Pandey et
al., 2009). In Arabidopsis, expression of the key defense
regulator, non-expresser of pathogenesesis-related
Jia et al.
581
(NPR) gene, is induced by pathogen infection or treatment with defense-inducing compounds such as SA and
is controlled by unknown WRKY TFs (Yu et al., 2001).
In papaya, over-expression of the NPR1 gene has resulted in improved resistance to P. palmivora (Zhu et al.,
2007). Together these results suggest that WRKY TFs
are involved in papaya defense against this oomycete
pathogen.
Additional proteins identified in this study were either up- or down-regulated in ‘Kamiya’ in comparison
with ‘SunUp’. Current knowledge of these proteins is
too limited to suggest either a direct or an indirect link
to plant defense reactions. To our knowledge, this is the
first report of a proteomic study comparing protein profiles between these two papaya cultivars.
Myrosinase-binding protein (spot K3) occurred at a
higher amount in ‘Kamiya’ than in ‘SunUp’. Myrosinase
(or thioglucoside glucohydrolase) is a family of enzymes
involved in plant defense against herbivores. In Brassica
napus, myrosinase-binding proteins were up-regulated
after treating young plants with methyl jasmonate (MeJA), JA or ABA, and to some extent in response to the
ethylene precursor 1-aminocyclopropane-1-carboxylic
acid (Taipalensuu et al., 1997), indicating its role in the
cross-talk for plant defense signal transduction.
Lon protease (K19) was also up-regulated in
‘Kamiya’. It catalyzes the initial steps of protein degradation, hydrolyzes ATP, degrades protein and peptide
substrates in an ATP-dependent manner, and is localized in chloroplasts and mitochondria. The diverse roles
of plant proteases in defense responses that are triggered by pathogens or pests are becoming evident.
Some proteases, such as papain in papaya latex, were reported to execute the attack on the invading organisms
(van der Hoorn et al., 2004).
Serine/threonine-protein kinase (SAPK) (S7) known
as stress-activated protein kinase, was found exclusively
expressed in the cultivar ‘Kamiya’. SAPKs involved in
signal transduction, as well as mitogen-activated protein
kinases (MAPKs) are activated when plants respond to
infectious agents such as bacterial flagellin. Another serine/threonine-protein kinase (ATR) was found to be expressed at a higher level in ‘SunUp’ and the third downregulated protein in ‘Kamiya’ was the wall-associated receptor kinase that may function as a signaling receptor
of extracellular matrix component. The role of
serine/threonine-protein kinases in papaya is largely unknown. Further analysis of the papaya genome may provide some information about their possible roles in
plant defense and stress.
In the present study, we carried out proteomic analysis of root samples from two C. papaya cvs, tolerant
‘Kamiya’ and susceptible ‘SunUp’, with the aim of identifying a potential protein basis for their different responses to Phytophthora. We identified a number of defense proteins expressed exclusively or in higher
009_JPP1051RP(Zhu)_571
582
20-11-2012
11:38
Pagina 582
amounts in tolerant ‘Kamiya’. The defense or stress-related proteins include disease resistance proteins and
enzymes involved in JA-dependent pathway, ABC transporters, plant brassinolide hormone biosynthesis,
ABA/ROS plant defense pathway. These findings indicate that JA-dependent proteins related to the pathway
or signal transduction may play a crucial role in
‘Kamiya’ defense against P. palmivora. The identified
proteins may help build a protein database to understand the resistance mechanisms of ‘Kamiya’ to P.
palmivora and to support future studies on the functions of these defense proteins using over-expression or
knockout mutants. We are currently analyzing changes
in protein profiles of these two papaya cultivars following inoculation with P. palmivora and conducting
genome-wide analysis on several groups of proteins.
These studies will generate further information about
papaya tolerance and defense mechanisms.
ACKNOWLEDGEMENTS
We thank Drs. Heather McCafferty and Susan
Schenck, Hawaii Agriculture Research Center (HARC),
for their assistance on papaya pathology work and Drs.
Heather McCafferty and Paul Moore (HARC) for their
critical review of the manuscript. This work was supported partially by a cooperative agreement (No. CA 585320-3-460) between the U.S. Department of Agriculture-Agricultural Research Service and HARC. MP and
RZJ contributed equally to this proteomics study and
participated in the project design, data collection and
analysis, and manuscript writing. SL was involved in the
RT-PCR validation work. IC and QL instructed and consulted in the LC/MSMS experiment and manuscript review. YJZ designed and supervised the project. All authors declare that they have no competing interests.
REFERENCES
Adie B.A.T., Perez-Perez J., Perez-Perez M.M., Godoy M.,
Sanchez-Serrano J.-J., Schmelz E.A., Solano R., 2007. ABA
is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defenses in
Arabidopsis. Plant Cell 19: 1665-1681.
Ali B., Hasan S.A., Hayat S., Hayat Q., Yadav S., Fariduddin
Q., Ahmad A., 2008. A role for brassinosteroids in the
amelioration of aluminium stress through antioxidant system in mung bean (Vigna radiata L.). Environmental and
Experimental Botany 62: 153-159.
Asai T., Tena G., Plotnikova J., Willmann M.R., Chiu W.-L.,
Gomez-Gomez L., Boller T., Ausubel F.M., Sheen J., 2002.
MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415: 977-983.
Bird D., Beisson F., Brigham A., Shin J., Greer S., Jetter R.,
Kunst L., Wu X., Yephremov A., Samuels L., 2007. Char-
acterization of Arabidopsis ABCG11/WBC11, an ATP
binding cassette (ABC) transporter that is required for cuticular lipid secretion. The Plant Journal 52: 485-498.
Bjellqvist B., Hughes G.J., Pasquali C., Paquet N., Ravier F.,
Sanchez J.-C., Frutiger S., Hochstrasser D., 1993. The focusing positions of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences.
Electrophoresis 14: 1023-1031.
Bjellqvist B., Basse B., Olsen E., Celis J.E., 1994. Reference
points for comparisons of two-dimensional maps of proteins from different human cell types defined in a pH scale
where isoelectric points correlate with polypeptide compositions. Electrophoresis 15: 529-539.
Clouse S.D., Sasse J.M., 2003. BRASSINOSTEROIDS: essential regulators of plant growth and development. Annual
Review of Plant Physiology and Plant Molecular Biology 49:
427-451.
Crouzet J., Trombik T., Fraysse A.S., Boutry M., 2006. Organization and function of the plant pleiotropic drug resistance ABC transporter family. FEBS Letters 580: 1123-1130.
Dangl J.L., Jones J.D.G., 2001. Plant pathogens and integrated defense responses to infection. Nature 411: 826-833.
Di Gaspero G., Cipriani G., 2002. Resistance gene analogs are
candidate markers for disease-resistance genes in grape
(Vitis spp.). Theoretical and Applied Genetics 106: 163-172.
Flor H.H., 1971. Current status of the gene-for-gene concept.
Annual Review of Phytopathology 9: 275-296.
Fuchs M., Gonsalves D., 2007. Safety of virus-resistant transgenic plants two decades after their introduction: Lessons
from realistic field risk assessment studies. Annual Review
of Phytopathology 45: 173-202.
Gonsalves D., 2006. Transgenic papaya: Development, release, impact and challenges advances in virus research. In:
Maramorosch K., Shatkin A.J., Thresh J.M. (eds). Plant
Virus Epidemiology, pp. 317-354. Academic Press, USA.
Gygi S.P., Corthals G.L., Zhang Y., Rochon Y., Aebersold R.,
2000. Evaluation of two-dimensional gel electrophoresisbased proteome analysis technology. Proceedings of the National Academy of Sciences 97: 9390-9395.
Hayat S., Ali B., Aiman Hasan S., Ahmad A., 2007. Brassinosteroid enhanced the level of antioxidants under cadmium
stress in Brassica juncea. Environmental and Experimental
Botany 60: 33-41.
Higgins C.F., 1992. ABC transporters: from microorganisms
to man. Annual Review of Cell Biology 8: 67-113.
Hiraga S., Sasaki K., Ito H., Ohashi Y., Matsui H., 2001. A
large family of class III plant peroxidases. Plant and Cell
Physiology 42: 462-468.
Jensen A.B., Poca E., Rigaud M., Freyssinet G., Pages M.,
1997. Molecular characterization of L2 lipoxygenase from
maize embryos. Plant Molecular Biology 33: 605-614.
Karabacak N.M., Li L., Tiwari A., Hayward L.J., Hong P.,
Easterling M.L., Agar J.N., 2009. Sensitive and specific
identification of wild type and variant proteins from 8 to
669 kDa using top-down mass spectrometry. Molecular and
Cellular Proteomics 8: 846-856.
Kawano T., 2003. Roles of the reactive oxygen species-generating peroxidase reactions in plant defense and growth in-
009_JPP1051RP(Zhu)_571
20-11-2012
11:38
Pagina 583
duction. Plant Cell Reports 21: 829-837.
Kosaihira S., Tsunehiro Y., Tsuta K., Tochigi N., Gemma A.,
Hirohahsi S., Kondo T., 2009. Proteome expression database of lung adenocarcinoma: a segment of the genome
medicine database of Japan proteomics. Journal of Proteomics and Bioinformatics 2: 463-465.
Krishna P., 2003. Brassinosteroid-mediated stress responses.
Journal of Plant Growth Regulation 22: 289-297.
Kwak J.M., Nguyen V., Schroeder J.I., 2006. The role of reactive oxygen species in hormonal responses. Plant Physiology 141: 323-329.
Lee S.-E., Seo J.-S., Keum Y.-S., Lee K.-J., Li Q.X., 2007. Fluoranthene metabolism and associated proteins in Mycobacterium sp. JS14. Proteomics 7: 2059-2069.
Li J., Nagpal P., Vitart V., McMorris T.C., Chory J., 1996. A
role for brassinosteroids in light-dependent development
of Arabidopsis. Science 272: 398-401.
Marcotte E.M., 2007. How do shotgun proteomics algorithms
identify proteins? Nature Biotechnology 25: 755-757.
Ming R., Hou S., Feng Y., Yu Q., Dionne-Laporte A., Saw
J.H., Senin P., Wang W., Ly B.V., Lewis K.L.T., Salzberg
S.L., Feng L., Jones M.R., Skelton R.L., Murray J.E., Chen
C., Qian W., Shen J., Du P., Eustice M., Tong E., Tang H.,
Lyons E., Paull R.E., Michael T.P., Wall K., Rice D.W., Albert H., Wang M.-L., Zhu Y.J., Schatz M., Nagarajan N.,
Acob R.A., Guan P., Blas A., Wai C.M., Ackerman C.M.,
Ren Y., Liu C., Wang J., Wang J., Na J.-K., Shakirov E.V.,
Haas B., Thimmapuram J., Nelson D., Wang X., Bowers
J.E., Gschwend A.R., Delcher A.L., Singh R., Suzuki J.Y.,
Tripathi S., Neupane K., Wei H., Irikura B., Paidi M.,
Jiang N., Zhang W., Presting G., Windsor A., NavajasPerez R., Torres M.J., Feltus F.A., Porter B., Li Y., Burroughs A.M., Luo M.-C., Liu L., Christopher D.A., Mount
S.M., Moore P.H., Sugimura T., Jiang J., Schuler M.A.,
Friedman V., Mitchell-Olds T., Shippen D.E., dePamphilis
C.W., Palmer J.D., Freeling M., Paterson A.H., Gonsalves
D., Wang L., Alam M., 2008. The draft genome of the
transgenic tropical fruit tree papaya (Carica papaya Linnaeus). Nature 452: 991-996.
Nimchuk Z., Eulgem T., III B.F.H., Dangl J.L., 2003. Recognition and response in the plant immune system. Annual
Review of Genetics 37: 579-609.
Nishijima W., 1994. Papaya. In: Ploetz R.C., Zentmyer G.A.,
Nishijima W.T., Rohrbach K.G., Ohr H.D. (eds). Compendium of Tropical Fruit Diseases pp. 1-10. APS Press, St
Paul, MN, USA.
Ohta H., Shirano Y., Tanaka K., Morita Y., Shibata D., 1992.
cDNA cloning of rice lipoxygenase L-2 and characterization using an active enzyme expressed from the cDNA in
Escherichia coli. European Journal of Biochemistry 206: 331336.
Pandey S.P., Somssich I.E., 2009. The role of WRKY transcription factors in plant immunity. Plant Physiology 150:
1648-1655.
Panikashvili D., Savaldi-Goldstein S., Mandel T., Yifhar T.,
Franke R.B., Hofer R., Schreiber L., Chory J., Aharoni A.,
2007. The Arabidopsis DESPERADO/AtWBC11 transporter is required for cutin and wax secretion. Plant Physiology 145: 1345-1360.
Jia et al.
583
Peng Y.L., Shirano Y., Ohta H., Hibino T., Tanaka K., Shibata
D., 1994. A novel lipoxygenase from rice. Primary structure and specific expression upon incompatible infection
with rice blast fungus. Journal of Biological Chemistry 269:
3755-3761.
Pieterse C.M., Van Loon L., 2004. NPR1: the spider in the
web of induced resistance signaling pathways. Current
Opinion in Plant Biology 7: 456-464.
Porter B., Paidi M., Ming R., Alam M., Nishijima W., Zhu Y.,
2009. Genome-wide analysis of Carica papaya reveals a
small NBS resistance gene family. Molecular Genetics and
Genomics 281: 609-626.
Potter S., Uknes S., Lawton K., Winter A., Chandler D., DiMaio J., Novitzky R., Ward E., Ryals J., 1993. Regulation
of a hevein-like gene in Arabidopsis. Molecular Plant Microbe Interactions 6: 680-685.
Ryals J., Uknes S., Ward E., 1994. Systemic acquired resistance. Plant Physiology 104: 1109-1112.
Sundfors C., Collan Y., 1996. Basics of quantitative polymerase
chain reaction: 2. Electrophoresis and quantitation of polymerase chain reaction products. Electrophoresis 17: 44-48.
Taipalensuu J., Eriksson S., Rask L., 1997. The myrosinasebinding protein from Brassica napus seeds possesses lectin
activity and has a highly similar vegetatively expressed
wound-inducible counterpart. European Journal of Biochemistry 250: 680-688.
Tameling W.I.L., Joosten M.H.A.J., 2007. The diverse roles of
NB-LRR proteins in plants. Physiological and Molecular
Plant Pathology 71: 126-134.
Ting J.P., Lovering R.C., Alnemri E.S., Bertin J., Boss J.M.,
Davis B.K., Flavell R.A., Girardin S.E., Godzik A., Harton
J.A., Hoffman H.M., Hugot J.P., Inohara N., Mackenzie
A., Maltais L.J., Nunez G., Ogura Y., Otten L.A., Philpott
D., Reed J.C., Reith W., Schreiber S., Steimle V., Ward
P.A., 2008. The NLR gene family: a standard nomenclature. Immunity 28: 285-287.
Ton J., Flors V., Mauch-Mani B., 2009. The multifaceted role
of ABA in disease resistance. Trends in Plant Sciences 14:
310-317.
van der Hoorn R.A., Jones J.D., 2004. The plant proteolytic
machinery and its role in defense. Current Opinion in Plant
Biology 7: 400-407.
Wang W., Sun J., Nimtz M., Deckwer W.-D., Zeng A.-P.,
2003. Protein identification from two-dimensional gel electrophoresis analysis of Klebsiella pneumoniae by combined use of mass spectrometry data and raw genome sequences. Proteome Science 1: 6.
Wang W., Vignani R., Scali M., Cresti M., 2006. A universal
and rapid protocol for protein extraction from recalcitrant
plant tissues for proteomic analysis. Electrophoresis 27:
2782-2786.
Ward E.R., Uknes S.J., Williams S.C., Dincher S.S., Wiederhold D.L., Alexander D.C., Ahl-Goy P., Metraux J.P.,
Ryals J.A., 1991. Coordinate gene activity in response to
agents that induce systemic acquired resistance. Plant Cell
3: 1085-1094.
Ward E.R., Ryals J.A., Miflin B.J., 1993. Chemical regulation
of transgene expression in plants. Plant Molecular Biology
22: 361-366.
009_JPP1051RP(Zhu)_571
584
20-11-2012
11:38
Pagina 584
Yu D., Chen C., Chen Z., 2001. Evidence for an important
role of WRKY DNA binding proteins in the regulation of
NPR1 gene expression. Plant Cell 13: 1527-1540.
Zhu Y.J., Qiu X., Moore P.H., Borth W., Hu J., Ferreira S.,
Albert H.H., 2003. Systemic acquired resistance induced
by BTH in papaya. Physiological and Molecular Plant
Pathology 63: 237-248.
Zhu Y.J., Agbayani R., Jackson M.C., Tang C.S., Moore P.H.,
Received December 16, 2011
Accepted May 24, 2012
2004. Expression of the grapevine stilbene synthase gene
VST1 in papaya provides increased resistance against diseases caused by Phytophthora palmivora. Planta 220: 241250.
Zhu Y.J., Agbayani R., Nishijima W., Moore P., 2007. Characterization of disease resistance of Carica papaya to Phytophthora. Proceedings of the 1st International Symposium on
Papaya. Genting Highlands, Malaysia: 265-269.

COMPARATIVE PROTEIN EXPRESSION OF TWO PAPAYA

Transcription

Similar documents

September 2015 Airshio Newsletter

Voices of Compton: Compton Literary / Arts Journal

Egils.Milbergs Testimony 12-6-2010

Lecture8

1 2 - RCSB PDB

Proteome Science

Proteins - Département de Biologie

COMPREHENSIVE SECURITY AND DEFENSE POLICY FOR

PDF

PoinsettiaTrees_Final