cVBD WoRLD FoRUM MeMBeRS AnD SYMPoSIUM PARtIcIPAntS

CVBD
®
GLOBAL VIEW
5th Symposium of the CVBD World Forum in New York City, USA
April 12 – 15, 2010
NEW YORK CITY
PROCEEDINGS
1
cVBD WoRLD FoRUM MAKeS It to tHe U.S.A.
dr. Ernst HEinEn
bayEr HEaltHcarE llc, usa
After four successful CVBD World Forums in Europe, it
was a pleasure to host the 5th CVBD World Forum in New
York City. Researchers from the U.S. have been included
in the forums from the beginning. However, this year was
the ideal time for the meeting to come to the U.S.
The research on vector-borne diseases provides a broader
perspective for pest control on animals and in the environment. The role these products play in vector control
may have a greater benefit to our society beyond the
immediate effect on our pets.
Due to the changing climate and ever-increasing global
mobility, vectors are spreading. Diseases are now seen
in areas where they were unknown before. Many initiatives have been launched to focus on emerging and
neglected zoonotic diseases. Key American stakeholders
including the American Veterinary Medical Association
(AVMA), the American Medical Association (AMA), the
American Public Health Association (APHA), the Centers
for Disease Control and Prevention (CDC), and the
National Institutes of Health (NIH) are heavily involved
in these initiatives.
At Bayer, we are honored to be part of the achievements
in CVBD research and proud of our products and services
that make a difference to pets and their families. We are
committed to continuously supporting these products
while tirelessly looking for new ideas and solutions that
protect, cure, and care for animals.
Canine vector-borne diseases are an important issue in
the world of infectious diseases transmitted by parasites.
The study of these diseases and their transmission is not
only important for the health of our dogs and families – it
is also important in our quest to understand interdependencies and develop diagnostic tools.
2
I hope you enjoy reading the latest developments and
findings in canine vector-borne diseases.
Dr. Ernst Heinen
Head of Research & Development
Bayer HealthCare LLC, Animal Health
IntRoDUctIon to tHe 2010
cVBD WoRLD FoRUM MeetInG
dr. Mario andrEoli and dr. saraH WEston
bayEr aniMal HEaltH GMbH, lEVErKusEn, GErMany
The agenda of the symposium continues to grow with
very interesting and pioneering studies in the field of
the CVBD and this year was carefully nurtured with help
from a scientific board of the World Forum members who
responded to an initial call for papers.
The main themes driving the emergence and reemergence
of CVBD are well established: climate change, changing
lifestyles and land use patterns affecting human contact with animals and vector distribution together with
increasing globalization and mobility of both people and
animals. But it’s the epidemiology, diagnosis and complicated interactions between the vector, dogs, wild life and
humans that means the science in this area is constantly
expanding and paradigms changing.
It is through these multidisciplinary CVBD symposia that
we hope to capture cutting edge advances in CVBD and
help to make this information available to veterinarians
and pet owners worldwide.
The big evolution for the Symposium in 2010 is the move
to a new continent and what better City to host the first
American symposium than New York. A city to which
CVBD is no stranger and of course that never sleeps as
CVBD don’t (though we hope that symposium participants will).
Another important theme for the 5th CVBD symposium
is the public health impact of CVBD. Ranging from the
potential for dogs to be sentinels for vector-borne human
disease to CVBDs where the human impact is still being
discovered.
In 2010 we continue the relationship with the on line
open publishing journal Parasites and Vectors. Concurrent
with the symposium 10 peer reviewed papers will be published as a CVBD 5 thematic series on the Parasites and
Vectors website. This relationship cements the scientific
credibility and independence of the material prepared for
the symposium.
Also in 2010 we need to mention the move of Norbert
Mencke away from the key organizing role. Norberts role
within Bayer has changed from a veterinary technical
services role integrally involved with the use of Bayers
parasiticides in the field to a role heading up our research
facility driving early product development and the provision of in house research capability.
We are grateful that Norbert will remain a member of
the CVBD world forum and before his departure laid the
paving stones on which to build successful symposia in
his absence.
As Bayer we remain dedicated to providing solutions for
the challenges that parasites continue to pose to pets and
to people.
This symposium provides a means not only for capturing science for the veterinary community but also for our
own organization to learn, understand and respond to an
evolving world. As our tagline says the vision is to provide
“Science for a better life”.
It is with great pleasure that Bayer Animal Health welcomes CVBD world forum members and guests to the
5th CVBD Symposium. And with a new decade and half a
decade of symposia evolution is inevitable.
We hope you enjoy the material presented throughout the
5th CVBD symposium as well as the change of scenery,
lively discussion and formulation of future solutions.
Enjoy the 5th Symposium of the CVBD World Forum!
Dr. Mario Andreoli
Bayer Animal Health GmbH
Global Marketing
Head of Companion Animal Parasiticides
Dr. Sarah Weston
Bayer Animal Health GmbH
Global Marketing
Veterinary Services Manager Advantix
3
content
CVBD World Forum makes it to the U.S.A.
Ernst Heinen
2
Introduction to the 2010 CVBD World Forum Meeting
Mario Andreoli and Sarah Weston
3
Symposium abstracts
Emerging tick-borne rickettsial diseases affecting dogs and humans in the United States
JENNIFER H MCQUISTON, WILLIAM L NICHOLSON
West Nile Disease (WND) outbreak in Italy and the role of dogs as potential sentinels
for surveillance programs
TOMMASO PATREGNANI, LEBANA BONFANTI, FABRIZIO MONTARSI, GIOVANNI SAVINI,
SILVIA RAVAGNAN, STEFANO MARANGON, GIOIA CAPELLI
Eco-epidemiological dimensions of Lyme disease and conservation of wild carnivores
in North America
ALONSO AGUIRRE
16
18
Canine leishmaniosis in the United Kingdom: A zoonotic disease waiting for a vector?
SUSAN E SHAW
20
Canine visceral leishmaniosis prevention in Brazil
VITOR M RIBEIRO
26
Bartonella henselae: What do we know from human infections?
VOLKHARD AJ KEMPF
34
Update on canine anaplasmosis: epidemiology and clinical disease
BARBARA KOHN
38
Identification and occurence of Borrelia burdorferi genospecies in Ixodes ricinis ticks
from the main Lyme borreliosis endemic area of Italy
GIOIA CAPELLI, SIlVIA RAVAGNAN, FABRIZIO MONTARSI, ALICE FUSARO,
PIETRO ARIANI, RUDI CASSINI, MARCO MARTINI, ANNA GRANATO
Update on the management of canine leishmaniosis
LAIA SOLANO-GALLEGO, GUADALUPE MIRÓ, LUIS CARDOSO,
ALEXANDER F KOUTINAS, MARIA G PENNISI, LLUIS FERRER, PATRICK BOURDEAU,
GAETANO OLIVA, GAD BANETH
Longitudinal study on the detection of Leishmania exposure in dogs by conjunctival
swab PCR analysis and correlation with entomological parameters
MARINA GRAMICCIA, TRENTINA DI MUCCIO, ELEONORA FIORENTINO, GIOIA BONGIORNO,
SILVIA CAPPIELLO, ROSSELLA PAPARCONE, VALENTINA F MANZILLO, LUIGI GRADONI,
GAETANO OLIVA
4
6
46
50
58
The clinicians view: Interesting CVBD cases
MICHAEL R LAPPIN
62
Prevention of endemic canine vector-borne diseases using imidacloprid 10%
and permethrin 50% in young dogs
68
DOMENICO OTRANTO, DONATO DE CAPRARIIS, RICCARDO P LIA,
VIVIANA D TARALLO, VINCENZO LORUSSO, GABRIELLA TESTINI, FILIPE DANTAS-TORRES, STEFANIA
LATROFA, PEDRO PVP DINIZ, NORBERT MENCKE, RICARDO G MAGGI,
EDWARD B BREITSCHWERDT, GIOIA CAPELLI, DOROTHEE STANNECK
Reprints from Parasites & Vectors
Emergence of zoonotic arboviruses by animal trade and migration
GERHARD DOBLER, MARTIN PFEFFER
70
Biology and ecology of the brown dog tick, Rhipicephalus sanguineus
FILIPE DANTAS-TORRES
88
Environmental risk mapping of canine leishmaniasis in France
LISE CHAMAILLE, ANNELISE TRAN, ANNE MEUNIER, GILLES BOURDOISEAU,
PAUL D READY, JEAN-PIERRE DEDET
Bartonella vinsonii subsp. berkhoffii and Bartonella henselae bacteremia
in a father and daughter with neurological disease
EDWARD B BREITSCHWERDT, RICARDO G MAGGI, PAUL M LANTOS,
CHRISTOPHER W WOODS, BARBARA C HEGARTY, JULIE M BRADLEY
Canine babesiosis in northern Portugal and molecular characterization
of vector-borne co-infections
LUIS CARDOSO, YAEL YISASCHAR-MEKUZAS, FILIPA T RODRIGUES, ALVARO COSTA,
JOÃO MACHADO, DUARTE DIZ-LOPES, GAD BANETH
Experimental infection and co-infection of dogs with Anaplasma platys and Ehrlichia canis:
hematologic, serologic and molecular findings
STEPHEN D GAUNT, MELISSA J BEALL, BRETT A STILLMAN, LEIF LORENTZEN,
PEDRO PVP DINIZ, RAMASWAMY CHANDRASHEKAR, EDWARD B BREITSCHWERDT
A survey of canine filarial diseases of veterinary and public health significance in India
PUTERI AMA RANI, PETER J IRWIN, MUKULESH GATNE, GLEN T COLEMAN,
LINDA M MCINNES, REBECCA J TRAUB
Comparison of selected canine vector-borne diseases between
urban animal shelter and rural hunting dogs in Korea
SUN LIM, PETER J IRWIN, SEUNGRYONG LEE, MYUNGHWAN OH, KYUSUNG AHN,
BOYOUNG MYUNG, SUNGSHIK SHIN
100
110
122
134
146
160
Imported and travelling dogs as carriers of canine vector-borne pathogens in Germany
BRIGITTE MENN, SUSANNE LORENTZ, TORSTEN J NAUCKE
166
CVBD World Forum Members and Symposium Participants
174
5
EMERGING TICK-BORNE RICKETTSIAL
DISEASES AFFECTING DOGS AND HUMANS IN
THE UNITED STATES
JENNIFER H MCQUISTON, WILLIAM L NICHOLSON
RICKETTSIAL ZOONOSES BRANCH, CENTER FOR DISEASE CONTROL AND PREVENTION, ATLANTA, GA, USA
EMAIL: FZH7@CDC.GOV
Abstract
6
Dogs and humans are susceptible to infection by several tick-borne rickettsial pathogens in the United States,
including Rickettsia rickettsii (the agent of Rocky Mountain
spotted fever, RMSF), E. chaffeensis and E. ewingii (the
agents of human ehrlichiosis), and Anaplasma phagocytophilum (the agent of human anaplasmosis). Although
RMSF has been recognized for over a hundred years in
the United States, it has emerged in the last decade in
an unexpected tick vector, Rhipicephalus sanguineus, and
challenged our conventional understanding of the disease
in dogs and humans. Ehrlichiosis and anaplasmosis as
human diseases have come to our attention only in the
last 25 years, but are now recognized as important tickborne illnesses. Because dogs are also susceptible to these
pathogens and can develop disease, understanding and
targeting the epidemiology of these infections in canines
offers insights into preventing and controlling human
disease risks.
Ehrlichia ewingii, and Anaplasma phagocytophilum [3-8].
The pathogens are quintessentially tick-borne, and involve
complicated vector life cycles involving multiple hosts.
While dogs are not thought to pose a direct risk for
zoonotic disease transmission of these pathogens to
humans, dogs do bring people in increased contact with
potentially infected ticks, either by serving as a transport
vehicle for introduction to our homes and peridomestic
environments, or by serving as important blood meal
hosts supporting tick populations. Numerous tick species
feed on dogs, and in turn, will bite humans given the right
circumstances [9]. Dogs also serve a potential predictive
role and could be used as sentinels to predict areas of
emergent human disease risks.
In this report, we review current knowledge on the epidemiology of tickborne rickettsial diseases in dogs and
humans in the United States, and explore how understanding the epidemiology of these infections in canines
offers insights into human disease risks.
Introduction
Rocky Mountain spotted fever (RMSF)
Dogs are considered one of the earliest domesticated species, and have influenced human development for thousands of years as we transitioned from a Paleolithic to
modern society [1]. It is inevitable, however, that with this
rich history of co-existence comes a history of shared pathogens, including those transmitted by ticks and fleas [2].
In the United States, both humans and dogs are susceptible to several tick-borne rickettsial pathogens, including
but not limited to Rickettsia rickettsii, Ehrlichia chaffeensis,
Ecology and Epidemiology: Rocky Mountain spotted
fever (RMSF), caused by the organism R. rickettsii, has
been recognized as an important source of morbidity and
mortality in dogs and humans for over a hundred years.
Infections have been reported from multiple locations in
the continental United States, Mexico, Central America,
and South America. In the United States, the tick vector
responsible for pathogen transmission is most commonly
Dermacentor variabilis, the American dog tick, which has
Figure 1
Human Rocky Mountain spotted fever (RMSF) incidence per million persons per year by county, 2000-2007, United States
(reported to the Centers for Disease Control and Prevention (CDC)).
a distributional range that covers the eastern half of the
country. In western states, RMSF cases are reported within
the geographic range of another common tick vector,
Dermacentor andersoni, the Rocky Mountain wood tick.
Humans and dogs acquire R. rickettsii infection after being
bitten by an infected tick. In nature, the tick maintains
infection through transovarial transmission (i.e. infected
adult females produce infected progeny), with some
replenishment through feeding of ticks on infected wild
mammals [5].
However, some new aspects of RMSF disease ecology
are emerging. Beginning in 2003, a focus of RMSF was
identified in eastern Arizona associated with transmission
from Rhipicephalus sanguineus, the brown dog tick [10].
This outbreak represented the first time this tick species
was recognized as a vector for R. rickettsii transmission in
the United States, although the tick had been previously
reported to transmit the agent in Mexico and some parts of
Latin America. Since the initial outbreak, the problem has
expanded and now appears firmly established as an enzootic focus in eastern Arizona [11-13]. The ecologic cycle for
R. sanguineus-associated R. rickettsii is less well understood
than that of the traditional Dermacentor-associated cycle.
Transovarial transmission occurs, but additional animal
reservoirs have not been identified. Although R. sanguineus
has been found on a number of mammalian hosts, the
strong preference of this tick to feed on dogs for each of
its life cycles suggests that dogs could possibly contribute
to maintaining the infection in this region.
First recognized in 1899 in the Bitterroot Valley of
Montana, RMSF is perhaps misnamed, as contemporary
surveillance reports suggest that the highest human incidence may be found in the southern and central United
States. Human RMSF is a nationally notifiable disease,
and state health departments are required to report cases
of illness to the U.S. Centers for Disease Control and
Prevention (CDC) each year [3]. During 2000-2007,
the incidence of human RMSF tripled, reaching a peak
7
of 7 cases per million persons nationwide (Figure 1)
[14]. However, this national calculation lacks specificity in that state and focal incidence of RMSF is much
higher in some areas. In North Carolina, Oklahoma, and
Missouri, for example, the statewide annual incidence
of reported human RMSF was over 50 cases per million
persons during 2007, and in eastern Arizona, where R.
sanguineus transmits R. rickettsii, the annual incidence is
more than 400 cases per million persons, or over 60 times
the national rate [13, 14, CDC unpublished data]. In
Tennessee, there is an unusually high occurrence of severe
or fatal RMSF outcome, compared to other regions of
the country [15]. Certain populations appear to be more
adversely impacted by RMSF (e.g. American Indian populations across the United States experience an incidence
nearly four times that of other race groups) [16, 17].
RMSF in dogs is not a reportable condition among
veterinary authorities, and many dogs may be treated
empirically without any laboratory confirmation of infection. Therefore, our understanding of the epidemiology
of RMSF in dogs is limited, and areas of risk for canine
infection are presumed to mirror areas of risk for human
infection. The strains of R. rickettsii isolated from dogs in
one study from North Carolina showed a high degree of
homology and in some cases were identical, suggesting
the same strains affecting humans also infect dogs [18].
Seroprevalence surveys in dogs and humans suggest that
prior exposure to R. rickettsii, or to other spotted fever
group rickettsiae (SFGR) that could elicit cross-reactive
antibodies, may be more common than is currently
appreciated. Among humans, background seroprevalence
for antibodies to R. rickettsii in the southeastern United
States can be as high as 10-12 % in children [19]. Other
studies examining background seroprevalence in northern states or among geographically widespread military
personnel suggest a seroprevalence of 4-6 % [20, 21]. In
eastern Arizona, where R. rickettsii is transmitted by R.
sanguineus, a pediatric serosurvey in the affected communities indicated that 10-16 % of children had antibodies
suggesting prior infection [11].
Seroprevalence studies in dogs can be more difficult to
interpret. Because dogs are exposed to a higher number of
ticks over their lifetimes than humans, they may develop
cross-reactive antibodies to nonpathogenic SFGR commonly found in ticks, such as R. rhipicephali. Nonetheless,
these types of studies do offer interesting insights into background rates of exposure to SFGR, and to changes in rates
over time. In one study examining shelter dogs in Rhode
Island, 21.3 % were positive on R. rickettsii assays, while a
study in the highly endemic state of Oklahoma reported
a canine seropositivity rate of 38 % [22, 23]. A study in
North Carolina, which tested canine sera for a variety of
SFGR and differentially compared rates among different
8
SFGR, reported an R. rickettsii-specific seroprevalence rate
of 5 % [24]. In eastern Arizona during 2004, 57-70 % of
dogs show evidence of exposure to R. rickettsii, while only
5 % of dogs from this same region were positive a decade
earlier, providing evidence of recent emergence [11].
Clinical Infection and Treatment: RMSF causes similar
illnesses in humans and dogs, and causes destruction
of the endothelial cells resulting in increased vascular
permeability and organ damage [5]. In humans, RMSF
develops as a febrile illness occurring 2-14 days following
a tick bite, although for many individuals, a tick bite may
not be recalled. Headache, malaise, myalgia, and nausea
frequently accompany the fever, and a rash usually develops 3-5 days following fever onset [3, 5]. The hallmark
rash associated with infection occurs in 90 % of children,
but may be less frequent in adults and some race groups.
When present, the rash usually progresses from macular
or maculopapular to petechial in nature, and may, not in
all cases, extend to the palms of the hand and soles of the
feet [3, 5]. Patients frequently develop thrombocytopenia,
elevations in liver enzymes, and hyponatremia [3, 5].
Severe complications of RMSF in humans include acute
respiratory distress syndrome (ARDS), abdominal distress
that may lead to exploratory surgery or cholecystectomy,
neurologic abnormalities, or bleeding disorders [3, 5].
In canine patients, infections may be asymptomatic to
severe. Clinical illness in dogs includes fever, lethargy,
lameness, abdominal pain, altered mental status, and
dyspnea [25-27]. In canine patients, petechiae and ecchymoses may be observed in the oral mucosa, and edema of
the face and extremities may be noted. Abnormal laboratory findings include hypoalbuminemia and thrombocytopenia. Retinal hemorrhage and genital lesions (orchitis)
have also been reported [25-27].
RMSF is traditionally considered a disease with a high
potential for severe or fatal outcome in both humans
and dogs. This was particularly true in the pre-antibiotic
era, where estimates frequently placed fatal outcome
for humans at over 20 % of cases [5]. Contemporary
estimates of human RMSF case fatality rates in humans
have dropped below 5 %, but the disease is still considered one of the most severe of all tick-borne rickettsial
infections [3, 14]. Explanations for this decrease in case
fatality include improved recognition of milder infections
that may have been missed during traditional surveillance efforts, or improved physician recognition of RMSF
patients and prompt treatment with doxcycline, the antibiotic of choice for rickettsial infections [14]. Early treatment with doxycycline has been shown to significantly
reduce the likelihood of fatal outcome associated with
R. rickettsii infection, and is recommended for humans
and dogs [3, 25].
ehrlichiosis
Ecology and Epidemiology: In the United States, two
Ehrlichia species have been shown to infect both humans
and dogs. These include E. chaffeensis (the causative agent
of human ehrlichiosis, sometimes referred to as human
monocytic ehrlichiosis) and E. ewingii. Both pathogens
have been recognized to cause human illness only in the
last 25+ years, and our understanding of the epidemiology of these infections in dogs and humans continues to
evolve [3, 4, 7, 8].
E. chaffeensis and E. ewingii are transmitted by Amblyomma
americanum, the lonestar tick, which has a distributional
range extending throughout the southern and eastern
United States [3, 28]. These Ehrlichia species also infect
dogs. In addition, a third Ehrlichia species, E. canis, is considered primarily a pathogen of dogs in the United States,
although several human cases have recently been reported
from Venezuela [29, 30]. E. canis is transmitted by
Rhipicephalus sanguineus, and more research into the role
of this organism as a potential pathogen to humans is
needed.
Human infections with E. chaffeensis have been considered a notifiable disease in the United States only since
1998 [3]. Ehrlichia ewingii was made reportable in 2000,
although only a handful of cases have been reported in
humans. The infection can only be diagnosed through
specialized molecular methods; thus, the incidence of
E. ewingii infection is difficult to ascertain. During 20002007, the overall reported incidence of E. chaffeensis was
estimated to be 1.5 cases per million persons, peaking
in 2007 at 3.1 cases per million, although the disease is
likely under-reported through this passive surveillance
system (CDC, unpublished data). Cases were most commonly reported from the southern and eastern United
States, matching the expected range of A. americanum.
Like other tick-borne rickettsial diseases, the incidence of
E. chaffeensis in some highly endemic states or counties
may be much higher than national estimates (Figure 2).
Canine infection with various Ehrlichia species is more difficult to enumerate, as these infections are not reportable
to national authorities. Dogs are susceptible to both E.
chaffeensis and E. ewingii within the same geographic range
as indicated by human surveillance. E. canis is thought to
be more widely distributed in the United States, yet no
human cases have been identified in this country [29].
Although extensive cross-reactivity exists among these
Ehrlichia species and between Ehrlichia and Anaplasma
organisms, serologic studies offer some measure of association to identify the etiologic agent of concern. A crosssectional serosurvey of children in the southern U.S.
suggests that 13 % have evidence of prior exposure or
infection to E. chaffeensis [31]. A national examination
of antibodies to E. canis among dogs from the southern
United States showed that 1.3 % had evidence of past
exposure to an Ehrlichia species, compared to a national
incidence of 0.6 %, suggesting that E. chaffeensis and/or E.
ewingii may be responsible for at least a proportion of the
higher incidence in southern regions [32].
A seroprevalence study of dogs in the highly endemic
state of Oklahoma suggested that 53 % of dogs had been
exposed to E. canis or other genetically related Ehrlichia
species [22]. Among ill dogs suspected of having acute
ehrlichiosis in Missouri, 67 % of ill dogs and 19 % of
healthy dogs had evidence of recent or prior infection
with an Ehrlichia species, and evidence of circulating
Ehrlichia (mainly E. ewingii) was found in > 20 % of
symptomatic and asymptomatic dogs [33].
Clinical Infection and Treatment: Ehrlichia chaffeensis
commonly infects and multiples in macrophages and
monocytes, and microscopic examination of stained
peripheral blood smears may demonstrate the presence of
the organism in distinctive clusters known as “morulae”
within this cell type [3, 7, 8]. Human infection with
E. chaffeensis presents as a moderate to severe illness characterized by fever, headache, myalgia, and malaise that is
often difficult to distinguish from RMSF [3, 7, 8]. A skin
rash is reported in less than a third of cases, although the
proportion of patients with rash may be as high as 66 %
among children [3, 34]. Patients may also present with
thrombocytopenia and elevated liver enzymes. Although
usually not considered as severe as RMSF, almost half of
patients are ill enough to require hospitalization (CDC,
unpublished data). Severe manifestations of the disease
in humans may include pneumonia/ARDS, encephalitis
or other central nervous system complications, or bleeding disorders [3, 7, 8]. E. ewingii multiplies within host
granulocytes (neutrophils and eosinophils), but detection
in stained blood smears is difficult. Ehrlichia ewingii
infection typically elicits a clinically similar but perhaps
milder illness than E. chaffeensis. Both E. chaffeensis and
E. ewingii infections may be more severe in immunecompromised patients [7, 35, 36].
Dogs with E. chaffeensis infections usually present with
fever, lethargy, vomiting, and anorexia [29, 37]. Polyarthritis with resulting lameness may be an initial presenting complaint [29, 37]. In contrast, E. canis infections are
associated with severe clinical disease in dogs, with fever,
myalgia, depression, and reduced white blood cells and
platelet counts that may result in severe bleeding disorders [29]. Dogs with E. canis infection may also present
with epistaxis (bleeding from the nose) or other signs of
overt hemorrhage. In contrast, the few humans reported
to be infected with E. canis were either asymptomatic or
experienced a mild illness [30].
E. chaffeensis infections can be fatal to both humans and
dogs, particularly when appropriate antibiotic treatment
9
Figure 2
Human ehrlichiosis and anaplasmosis incidence per million persons per year (py) by county, 2000-2007, united states
(reported to the centers for disease control and prevention (cdc)).
is delayed or withheld. During 2000-2007, the overall
reported case fatality rate among all human cases was 1.8
% (CDC, unpublished data). Like RMSF, E. chaffeensis and
E. ewingii infections in both humans and dogs are best
treated with doxycycline as the drug of choice [3, 7, 29].
Patients should be treated empirically based on clinical
suspicions, without awaiting the result of confirmatory
diagnostic testing in order to minimize the risk of severe
or fatal outcome.
Anaplasmosis
Ecology and Epidemiology: Anaplasma phagocytophilum,
the causative agent of human anaplasmosis, was recognized in the 1990’s, and was formerly called human
granulocytic ehrlichiosis. The organism was formerly
named Ehrlichia equi and then Ehrlichia phagocytophila.
10
However, taxonomic evaluations combined these into
a single species and were reclassified as members of the
genus Anaplasma in 2001 [38]. Anaplasma phagocytophilum
is primarily transmitted by Ixodes scapularis and Ixodes
pacificus ticks, the same vectors that transmit Borrelia
burgdorferi in the United States, and the distribution of
reported cases closely mirrors that of Lyme disease, being
concentrated in the northeastern United States and upper
Midwestern states [39]. Co-infections with Lyme disease
and anaplasmosis have been recognized in both dogs and
humans [3].
Human infections with A. phagocytophilum have been considered notifiable diseases in the United States since 1998
[3]. During 2000-2007, the overall reported incidence of
A. phagocytophilum infection was estimated to be 2.0 cases
per million persons, peaking in 2007 at 3.1 cases per
million, although the disease is considered to be generally under-recognized and reported (CDC, unpublished
data). Cases were most commonly reported from states
in the Northeast and upper Midwest, coinciding with
the expected range of I. scapularis. Like other tick-borne
rickettsial diseases, the focal and county-specific incidence
of human A. phagocytophilum may be much higher than
national estimates (Figure 2).
As has been previously mentioned, infection with
Anaplasma phagocytophilum may elicit the production of
cross-reactive antibodies on E. chaffeensis-specific serologic assays, so interpreting the relative attributable proportion of reactivity to a specific agent can be difficult.
Nonetheless, these studies do offer some insights into
relative degrees of past exposure in a region. In human
serologic studies, antibodies to A. phagocytophilum have
been reported in up to 3 % of healthy residents from the
Northeast, and among 2 % of U.S. residents with a broad
geographic distribution [20, 21]. A national examination
of antibodies to A. phagocytophilum among dogs from
the Northeast and the Midwest showed 5.5-6.7 % with
evidence of prior exposure; however, in some highly
endemic states, the canine seroprevalence rate was much
higher, and ranged between 10-20 % [32].
Clinical Infection and Treatment: Anaplasma phagocytophilum has a predilection for granulocytes, and morulae
may sometimes be observed in this cell type on peripheral blood smears. Patients commonly present with fever,
headache, malaise, and myalgias; a rash is rarely reported.
Patients may develop thrombocytopenia and elevated
liver functions tests during the course of their illness
[3, 7, 8]. An estimated 37 % of anaplasmosis patients
are hospitalized due to their illness (CDC, unpublished
data). In dogs, a similar clinical presentation is observed,
characterized by fever, lethargy, and anorexia [40, 41].
Less common signs that may occur in dogs include coughing, lameness, vomiting, and signs of hemorrhage [40,
41]. Thrombocytopenia is a common laboratory finding
among infected dogs [39].
Human anaplasmosis is usually considered a less severe
illness than either RMSF or ehrlichiosis, but the infection may nonetheless be even fatal, particularly among
individuals with pre-existing immune compromise [3,
7, 8]. During 2000-2007, the overall reported case fatality rate among all human anaplasmosis cases was 0.6 %
(CDC, unpublished data). Like RMSF and ehrlichiosis,
A.phagocytophilum infections in both humans and dogs
are best treated with doxycycline [3, 7, 8, 40]. Empiric
treatment is necessary, and treatment should not await
the results of confirmatory diagnostic testing or there is an
increased risk for development of more severe disease.
the Role of Dogs in the ecology of
Rickettsial Disease
Tick-borne rickettsial infections have complicated ecologic cycles, involving multiple life stages and bloodmeals,
and the role of dogs in this cycle varies depending on
the organism, the tick vector, and environmental influences. Ixodes scapularis, the vector of A. phagocytophilum, is
known to feed on dogs, although small rodents and other
wildlife are thought to play a predominant reservoir role
for maintenance of the organism [39]. Similarly, whitetailed deer are considered a primary mammalian host for
E. chaffeensis, although A. americanum ticks will feed
on dogs and humans [9, 42]. Ehrlichia ewingii has been
detected in both deer and dogs; however, a conclusive
reservoir for E. ewingii has not been identified [33].
For R. rickettsii, both D. variabilis and D. andersoni nymphal and adult ticks will feed on dogs, although the infection is predominantly maintained through transovarial
transmission, with occasional reintroduction of the
organism into uninfected ticks through feeding on infected small rodent reservoirs. A role for dogs as a reservoir
for the pathogen has not been suspected within the
Dermacentor-R. rickettsii ecologic cycle. Laboratory studies
have shown that among experimentally infected dogs,
circulating rickettsiae can be isolated for a period of only
10 to 14 days [43, 44]. However, these organized laboratory studies have been conducted on healthy populations
of dogs in controlled settings, and it is difficult to predict
if those findings are applicable to a field situation involving dogs of poor and varied health. Transovarial transmission of R. rickettsii has also been seen with R. sanguineus,
but the need for replenishment has not been determined
for this tick species in a contemporary setting. Laboratory
studies examining rickettsemia of dogs were conducted
with R. rickettsii strains isolated from Dermacentor ticks,
and it is possible that strains adapted for survival in
R. sanguineus may have a different ecology or circulate
for longer periods of time in the blood of dogs. If enough
organisms circulate during the rickettsemic period when
ticks are taking a bloodmeal, it is conceivable, that dogs
could replenish the infection. Further studies are needed
to evaluate this possibility.
While their role as a reservoir for rickettsial organisms
may be debated, dogs clearly serve as a convenient blood
meal for these implicated species of ticks, and in the case
of R. sanguineus, are the preferred host in all life stages
[45]. Thus, dogs may serve to increase populations of
ticks to very high levels, and may transport ticks to new
areas. Humans may also be placed at risk for exposure
to tick-borne rickettsial agents when removing engorged
ticks from pets by contaminating abraded skin or mucous
membranes with fluids from the tick [46].
11
Perhaps more significantly, dogs bridge the gap between
human and tick environments. When we accompany our
dogs on walks, we explore tick habitat. As companion
animals, dogs may pick up ticks along fringe environments, and bring them into our homes and our beds. As
a result, many patients diagnosed with tick-borne diseases
report dog ownership [47]. Their role as companions
to humans makes dogs an important part of the public
health response to prevent and control tick-borne diseases
[48-50]. Controlling ticks and other ectoparasites on dogs
not only improves the health of our pets, it may also
reduce the risk of human illness.
Dogs as Sentinels for Surveillance
Because of their close proximity to humans and their
susceptibility to infection, dogs are uniquely poised to
function as a sentinel for human disease risks from tickborne rickettsial pathogens. If properly conducted and
interpreted, seroprevalence studies of these pathogens in
dogs provide insights that may be used to predict areas
of human health risk. For example, when R. sanguineus
RMSF was first recognized in AZ, canine serologic surveys
predicted the disease had actually spread to neighboring
communities before the first human cases were detected
there [11]. More recent canine serologic studies in AZ suggest the risk for R. rickettsii may be even more widespread
than current human surveillance suggests, and highlights
areas where targeted active surveillance and education
might be beneficial [13].
Several published accounts of tick-borne rickettsial infections describe concurrent disease in dogs and owners,
or in some particularly disturbing cases, examples of
fatal human cases that were preceded in time by clinically suggestive dog fatalities, but whose significance
was missed [47, 51]. The knowledge that dogs may help
predict human risk should be capitalized upon to provide
more effective public health practice. Fatal infections in
dogs should be reported to and investigated by public
health authorities, and human risks should be clearly
communicated to owners and other community members. Veterinarians should be educated about owner risks
when these infections are diagnosed in dogs, and should
take an active role in explaining risks to clients. Persons
who find ticks on their dogs should be aware that such
events signal a personal risk of exposure to themselves
and their families, even if human tick bites have not been
recognized.
conclusions
Dogs share our planet, our homes, our pests, and our
pathogens. The changing ecology of these pathogens,
coupled with surveillance data showing an increase in
the recognition and reporting of human infections, sug-
12
gests a need for heightened vigilance. The prevention and
control of tick-borne rickettsial diseases among human
communities requires knowledge and understanding of
the role of dogs in maintenance and transmission of the
tick vectors. While control of ticks on dogs through the
application of chemical tick preventives is an important
part of human public health efforts, community mitigation efforts and the development of new integrated pest
management techniques to address risks on dogs and
in the environment provide sustainable control. A multidisciplinary approach, involving not only pet owners
and veterinarians, but also physicians and public health
officials, is needed to minimize these important disease
risks.
Acknowledgements
the authors thank F. scott dahlgren, John Krebs, and Eric
Mandel for their contributions to the unpublished cdc
surveillance data referenced here.
Disclaimer: The findings and conclusions in this report are
those of the authors and do not necessarily represent the
views of the funding agency.
References
1.
2.
3.
4.
5.
6.
7.
torrey, EF,yolken rH: Beasts of the earth. in
Animals, Humans, and Disease. piscataway: rutgers
university press; 2005:1-96.
pearce-duvet JM: the origin of human pathogens: evaluating the role of agriculture and
domestic animals in the evolution of human
disease. Biol Rev Camb Philos Soc 2006, 81:369-82.
centers for disease control and prevention, 2006.
Diagnosis and management of tick-borne
rickettsial diseases: Rocky Mountain spotted fever, ehrlichioses, and anaplasmosis
– United States: A practical guide for physicians and other health-care and public
health professionals. MMWR Recommendations and
Reports 55(RR-4). [http://www.cdc.gov/mmwr/preview/
mmwrhtml/rr5504a1.htm]. accessed october 23, 2009.
Walker dH, paddock cd, dumler Js: emerging and
re-emerging tick-transmitted rickettsial
and ehrlichial infections. Med Clin N Am 2008,
29:1345-61.
Walker dH: Rocky Mountain spotted fever:
a disease in need of microbiological concern.
Clin Microbiol Rev 1989, 2:227-240.
dantes-torres F: Rocky Mountain spotted fever.
Lancet Infect Dis 2007, 7:724-32.
dumler Js, Madigan JE, pusterla n, bakken Js: ehrlichiosis in humans: epidemiology, clinical presentation, diagnosis, and treatment. Clin Infect
Dis 2007, 45(sppl 1):45-51.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
thomas rJ, dumler Js, carylon Ja: current management of human granulocytic anaplasmosis, human monocytic ehrlichiosis, and
Ehrlichia ewingii ehrlichiosis. Expert Rev Anti Infect
Ther 2009, 7:709-22.
Williamson pc, billingsley pM, teltwo GJ, seals Jp,
turnbough Ma, atkinson sF: Borrelia, Ehrlichia,
and Rickettsia spp. in ticks removed from
persons, texas, USA. Emerg Infect Dis 2010,
16:441-446.
demma lJ, traeger Ms, nicholson Wl, paddock cd,
blau dM, Eremeeva ME, dasch Ga, levin Ml, singleton
J Jr, Zaki sr, cheek JE, swerdlow dl, McQuiston JH:
Rocky Mountain spotted fever from an unexpected tick vector in Arizona. N Engl J Med
2005, 11:353:587-94.
demma lJ, traeger M, blau d, Gordon r, Johnson b,
dickson J, Ethelbah r, piontkowski s, levy c, nicholson
Wl, duncan c, Heath K, cheek J, swerdlow dl,
McQuiston JH: Serologic evidence for exposure
to Rickettsia rickettsii in eastern Arizona and
recent emergence of Rocky Mountain spotted fever in this region. Vector Borne Zoonotic Dis
2006, 6:423-9.
nicholson Wl, Gordon r, demma lJ: Spotted fever
group rickettsial infection in dogs from eastern Arizona: how long has it been there? Ann
N Y Acad Sci 2006, 1078:519-22.
McQuiston JH, Guerra Ma, Watts Mr, lawaczeck E,
lvey c, nicholson Wl, adjemian J, swerdlow dl: evidence of exposure to spotted fever group
rickettsiae among Arizona dogs outside
a previously documented outbreak area.
Zoonoses and Public Health 2009, Epub ahead of print.
openshaw JJ, swerdlow dl, Krebs JW, Holman rc,
Mandel E, Harvey a, Haberling d, Massung rF, McQuiston JH: Rocky Mountain Spotted Fever in the
United States, 2000-2007: Interpreting contemporary Increases in Incidence. accepted to
Am J Trop Med Hyg publication pending 2010.
adjemian JZ, Krebs J, Mandel E, McQuiston J: Spatial
clustering by disease severity among reported Rocky Mountain spotted fever cases in
the United States, 2001-2005. Am J Trop Med Hyg
2009, 80:72-7.
Holman rc, McQuiston JH, Haberling dl, cheek JE:
Increasing incidence of Rocky Mountain
spotted fever among the American Indian
population in the United States. Am J Trop Med
Hyg 2009, 80:601-5.
McQuiston JH, Holman rc, Groom aV, Kaufman sF,
cheek JE, childs JE: Incidence of Rocky Mountain
spotted fever among American Indians in
oklahoma. Public Health Rep 2000, 115:469-75.
Kidd l, Hegarty b, sexton d, breitschwerdt E: Molecular characterization of Rickettisa rickettsii
infecting dogs and people in north carolina.
Ann N Y Acad Sci 2006, 1078:400-409.
19. Marshall Gs, stout GG, Jacobs rF, schultze GE, paxton
H, buckingham sc, deVincenzo Jp, Jackson aM, san
Joaquin VH, standaert sM, Woods cr: Antibodies reactive to Rickettsia rickettsii among children
living in the Southeast and South central
regions of the United States. Arch Pediatr Adolesc
Med 2003, 157:443-448.
20. Hilton E, deVoti J, benach Jl, Halluska Ml, White dJ,
paxton H, dumler Js: Seroprevalence and seroconversion for tick-borne diseases in a highrisk population in the northeast United
States. Am J Med 1999, 106:404-409.
21. Graf pcF, chretien Jp, ung l, Gaydos Jc, richards al:
Prevalence of seropositivity to spotted fever
group rickettsiae and Anaplasma phagocytophilum in a large, demographically diverse
U.S. sample. CID 2008, 46:70-77.
22. rodgers sJ, Morton rJ, baldwin ca: A serological
survey of Ehrlichia canis, Ehrlichia equi, Rickettsia rickettsii, and Borrelia burgdorferi in
dogs in oklahoma. J Vet Diagn Invest 1989, 1:154-9.
23. Hinrichsen Vl, Whitworth uG, breitschwerdt Eb, Hegarty bc, Mather tn: Assessing the association
between the geographic distribution of deer
ticks and seropositivity rates to various ticktransmitted disease organisms in dogs. J Am
Vet Med Assoc 2001, 218:1092-7.
24. breitschwerdt Eb, Moncol dJ, corbett Wt, Maccormack Jn, burgdorfer W, Ford rb, levy MG: Antibodies to spotted fever-group rickettsiae
in dogs in north carolina. Am J Vet Res 1987,
48:1436-40.
25. Warner rd: Rocky Mountain spotted fever.
J Am Vet Med Assoc 2002, 221:1413-1416.
26. comer KM: Rocky Mountain spotted fever.
Vet Clin North Am Small Anim Pract 1991, 21:27-44.
27. Gasser aM, birkenheuer aJ, breitschwerdt Eb: canine
Rocky Mountain spotted fever: a retrospective study of 30 cases. J Am Anim Hosp Assoc 2001,
37:41-48.
28. steirt JG, Gilfoy F: Infection rates of Amblyomma
americanum and Dermacentor variabilis by
Ehrlichia chaffeensis and Ehrlichia ewingii in
southwest Missouri. Vector Borne Zoonotic Dis 2002,
2:53-60.
29. McQuiston JH, Mccall cl, nicholson Wl: ehrlichiosis and related infections. J Am Vet Med Assoc 2003,
223:1750-6.
30. perez M, bodor M, Zhang c, Xiong Q, rikihisa y:
Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. ann N Y
Acad Sci 2006, 1078:110-7.
31. Marshall Gs, Jacobs rF, schultze GE, paxton H, buckingham sc, deVincenzo Jp, Jackson Ma, san Joaquin VH,
standaert sM, Woods cr: tick-borne infections
in children Study Group. Arch Pediatr Adolesc Med
2002, 156:166-170.
13
32. bowman d, little sE, lorentzen l, shileds J, sullivan Mp,
carlin Ep: Prevalence and geographic distribution of Dirofilaria immitis, Borrelia burgdorferi, Ehrlichia canis, and Anaplasma phagocytophilum in dogs in the United States: results
of a national clinic-based serologic survey.
Vet Parasitol 2009, 160:138-148.
33. liddell aM: Predominance of Ehrlichia ewingii
in Missouri dogs. J Clin Micro 2003, 41:4617-4622.
34. schutze GE, buckingham sc, Marshall Gs, Woods cr,
Jackson Ma, patterson lE, Jacobs rF: Human monocytic ehrlichiosis in children. Pediatr Infect Dis J
2007, 26:475-479.
35. paddock cd, Folk sM, shore GM, Machado lJ, Huycke MM, slater ln, liddell aM, buller rs, storch Ga,
Monson tp, rimland d, sumner JW, singleton J, bloch
Kc, tang yW, standaert sM,childs JE: Infections with
Ehrlichia chaffeensis and Ehrlichia ewingii in
person coinfected with human immunodeficiency virus. Clin Infect Dis 2001, 33:1586-94.
36. thomas ld, Hongo i, block Kc, tang yW, dummer s:
Human ehrlichiosis in transplant recipients.
Am J Transplant 2007, 5:1641-7.
37. Goodman ra, Hawkins Ec, olby nJ, Grindem cb, Hegarty b, breitschwerdt Eb: Molecular identification
of Ehrlichia ewingii infection in dogs: 15 cases
(1997-2001). J Am Vet Med Assoc 2003, 222:1102-7.
38. dumler Js, barbet aF, bekker cp, dasch Ga, palmer GH,
ray sc, rikihisa y, rurangirwa Fr: Reorganization
of genera in the families Rickettsiaceae and
Anaplasmataceae in the order Rickettsiales:
unification of some species of Ehrlichia with
Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six
new species combinations and designation of
Ehrlichia equi and ‘HGe agent’ as subjective
synonyms of Ehrlichia phagocytophila. Int J Syst
Evol Microbiol 2001, 51:2145-65.
39. bakken Js, dumler s: Human granulocytic anaplasmosis. Infect Dis Clin North Am 2008, 22:433-448.
40. Granick Jl, armstrong pJ, bender Jb: Anaplasma
phagocytophilum infection in dogs: 34 cases
(2000-2007). J Am Vet Med Assoc 2009, 12:1559-65.
41. carrade dd, Foley JE, borjesson dl, sykes JE: canine
granulocytic anaplasmosis: a review. J Vet Intern
Med 2009, 23:1129-41.
42. yabsley MJ, Wimberly Mc, stallknecht dE, little sE, davidson Wr: Spatial analysis of the distribution
of Ehrlichia chaffeensis, causative agent of
human monocytotropic ehrlichiosis, across
a multi-state region. Am J Trop Med Hyg 2005,
72:840-50.
43. Keenan Kp, buhles Wc, Huxsoll Jr, Williams rG, Hildebrandt Kp, campbell JM, stephenson EH::Pathogenesis
of infection with Rickettsia rickettsii in the
dog: a disease model for Rocky Mountain
spotted fever. J. Infect Dis 1977, 135:911-917.
14
44. piranda EM, Faccini Jl, pinter a, saito tb, pacheco rc,
Hagiwara MK, labruna Mb: experimental infection
of dogs with a Brazilian strain of Rickettsia
rickettsii: clinical and laboratory findings.
Mem. Inst Oswaldo Cruz 2008, 103:696-701.
45. dantas-torres F: the brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control. Vet Parasitol
2008, 152:173-185.
46. Goddard J: Rickettsial organisms in ticks:
Rocky Mountain spotted fever. Infect Med 1997,
14:18-20.
47. paddock cd, brenner o,Vaid c, boyd db, berg JM,
Joseph rJ, Zaki sr, childs JE: Short report: concurrent Rocky Mountain spotted fever in a dog
and its owner. Am J Trop Med Hyg 2002, 66:197-9.
48. davoust b, Marié Jl, Mercier s, boni M,Vandeweghe
a, parzy d, beugnet F: Assay of fipronil efficacy
to prevent canine monocytic ehrlichiosis in
endemic areas. Vet Parasitol 2003, 112:91-100.
49. otranto d, paradies p, testini G, latrofa Ms, Weigl s,
cantacessi c, Mencke n, de caprariis d, parisi a, capelli
G, stanneck d: Application of 10% imidacloprid/50% permethrin to prevent Ehrlichia
canis exposure in dogs under natural conditions. Vet Parasitol 2008, 153:320-8.
50. blagburn bl, spencer Ja, billeter sa, drazenovich nl,
butler JM, land tM, dykstra cc, stafford Kc, pough
Mb, levy sa, bledsoe dl: Use of imidaclopridpermethrin to prevent transmission of
Anaplasma phagocytophilum from naturally
infected Ixodes scapularis ticks to dogs. Vet Ther
2004, 5:212-7.
51. Elchos bn, Goddard J: Implications of presumptive fatal Rocky Mountain spotted fever in
two dogs and their owner. J Am Vet Med Assoc
2003, 223:1450-2, 1433.
15
WEST NILE DISEASE (WND) OUTBREAK IN
ITALY AND THE ROLE OF DOGS AS POTENTIAL
SENTINELS FOR SURVEILLANCE PROGRAMS
TOMMASO PATREGNANI, LEBANA BONFANTI, FABRIZIO MONTARSI, GIOVANNI SAVINI*,
SILVIA RAVAGNAN, STEFANO MARANGON, GIOIA CAPELLI
ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLE VENEZIE, LEGNARO (PD), ITALY
*ISTITUTO ZOOPROFILATTICO SPERIMENTALE DEGLI ABRUZZI E MOLISE, TERAMO, ITALY
EMAIL: GCAPELLI@IZSVENEZIE.IT
16
Background
Results
In Italy an outbreak of West Nile virus (WNV) infection
involving humans, domestic animals and wild birds in
areas surrounding the Po river delta is ongoing since
2008.
WNV is an important emerging arthropod-borne virus
belonging to the family Flaviviridae, genus Flavivirus,
included in the Japanese encephalitis virus group [1]. Its
natural cycle involves birds and mosquitoes, particularly
Culex spp. and Aedes/Ochlerotatus spp. [1, 2]. Many species of wild birds may act as vertebrate amplifying hosts
[3], whereas humans, horses and other mammals are
considered incidental or dead-end hosts [4, 5]. In 2008,
following the first WNV clinical case which occurred in a
horse from Emilia Romagna region, an intensive surveillance program, involving Veneto, Lombardy and Emilia
Romagna regions was put in place for 2008 and 2009
[6, 7]. The surveillance program, as for many other vectorborne zoonotic diseases, aimed to track WNV activity in
humans, horses, other mammals, birds and mosquitoes.
Overall, 388 equine stables were found to have at least
one seropositive horse. Following the positive findings
in animals, passive surveillance detected a total of 25
human cases (12 in Veneto, 11 in Emilia Romagna and 2
in Lombardy) [8].
This paper briefly reports the results of the WNV surveillance program in the Veneto region, with emphasis on
mosquito control and the role of dogs as possible sentinel
animals.
During 2008-2009 in the Veneto region, 171 positive
horse stables enabled the definition of the area of WNV
activity, which comprised the Rovigo, Padua and Venezia
provinces. In this and surrounding areas, a weekly vector
control program was organized and 36527 mosquitoes
were captured by 24 CDC-CO2 traps between May and
October 2009. Twelve mosquito species were identified, the most abundant of which were Culex pipiens and
Ochlerotatus caspius. WNV was not detected in mosquitoes, using a Real time PCR targeting a conserved region
of the Flavivirus genus [9], with a proven sensitivity of 104
RNA copies.
Based on the sampling size and negative results for WNV,
the maximum possible infection rate of mosquitoes has
been calculated to be 0.01%. During mosquito surveillance a second Flavivirus, USUTU virus, was detected in
5 pools of C .pipiens with infection rates ranging from
0.09% to 0.14%.
In addition to equine control and in order to identify the
possible establishment of a WNV urban cycle a serological survey was carried out on stray dogs in animal shelters
in the cities of Rovigo and Padua that had been captured
by the local veterinary services or by dog wardens. The
usually limited home range of stray dogs (0.26 km2) [10]
allowed the identification of the location of possible
exposure with a good level of approximation. A total of
72 dogs (36 from Rovigo and 36 from Padua shelters)
were tested and 47.2% (17/36) and 5.5% (2/36) respec-
tively were positive. Antibody titres to WNV neutralisation test ranged between 1:5 and 1:320. Positive stray
dogs were detected in 14 and 3 municipalities of Rovigo
and Padua provinces, respectively.
Conclusion
WNV infected dogs have been frequently detected in serological surveys. Blackburn [11] reported that dogs may be
incidentally involved in the maintenance of the virus but
do not play a major role in the epidemiology of WNV. As
other authors have previously suggested, these domestic
animals could play a role as sentinels for WNV infection
in humans. In fact whereas infection in birds may only
signal enzootic virus activity in birds, seroconversion in
dogs may reveal increased risk for WNV transmission to
other mammals, including humans [12, 13]. Free-ranging
dogs show most of the characteristics that define good
vertebrate hosts for arbovirus surveillance, which include
susceptibility to the virus, low mortality, local abundance
of populations, local mobility increasing exposure to
the virus, attractive to and tolerant of the vector feeding,
easily captured, ease in handling and obtaining blood
samples, possibility of age determination and relatively
long-lived. Consequently, dogs may be used for monitoring virus activity in urban and sub-urban areas.
To better understand the possible role of pets in WNV
epidemiology a more comprehensive survey is necessary.
References
1.Heinz FX, Collet MS, Purcell RH, Gould EA, Howard CR,
Houghton M, Moorman RJM, Rice CM, Thiel HJ: Family Flaviviridae. In: Virus taxonomy. 7th Report of the
International Committee for the Taxonomy of Viruses. Edited
by Van Regenmortel MH, Fauquet CM, Bishop DHL,
Carstens CB, Estes MK, Lemon SM et al. San Diego, CA:
Academic Press, 2000.
2.Hubalek Z, Halouzka J: West Nile fever-a reemerging mosquito-borne viral disease in
Europe. Emerg Infect Dis 1999, 5:643-650.
3.Kulasekera VL, Kramer L, Nasci RS, Mostashari F, Cherry
B, Trock SC, Glaser C, Miller JR: West Nile virus
infection in mosquitoes, birds, horses, and
humans, Staten Island, New York, 2000.
Emerg Infect Dis 2001, 7:722-725.
4.Komar N, Burns J, Dean C, Panella NA, Dusza S, Cherry
B: Serologic evidence for West Nile virus
infection in birds in Staten Island, New York,
after an outbreak in 2000. Vector Borne Zoonotic
Dis 2001, 1:191-196.
5.Komar N, Panella NA, Boyce E: Exposure of domestic mammals to West Nile virus during
an outbreak of human encephalitis, New
York City, 1999. Emerg Infect Dis 2001, 7:736-738.
6.Calistri P, Giovannini A, Savini G, Monaco F, Bonfanti
L, Ceolin C, Terregino C, Tamba M, Cordioli P, Lelli R:
West Nile Virus Transmission in 2008 in
North-Eastern Italy. Zoonoses Public Health 2009
[Epub ahead of print].
7.Centro Studi Malattie Esotiche (CESME): West Nile
Disease in Italia nel 2009. [http://sorveglianza.izs.
it/emergenze/west_nile/bollettino_2009/2009.pdf] Accessed:02/24/2009.
8.Rizzo C,Vescio F, Declich S, Finarelli AC, Macini P, Mattivi A, Rossini G, Piovesan C, Barzon L, Palu G, Gobbi F,
Macchi L, Pavan A, Magurano F, Ciufolini MG, Nicoletti
L, Salmaso S, Rezza G: West Nile virus transmission with human cases in Italy, August - September 2009. Euro Surveill 2009, 14:9353.
9.Moureau G, Temmam S, Gonzalez JP, Charrel RN, Grard
G, de Lamballerie X: A real-time RT-PCR method for the universal detection and identification of flaviviruses. Vector Borne Zoonotic Dis 2007,
7:467-477.
10.Rubin HD, Beck AM: Ecological behavior of freeranging urban pet dogs. Appl Anim Ethol 1982,
8:161-168.
11.Blackburn NK, Reyers F, Berry WL, Shepherd AJ:
Susceptibility of dogs to West Nile virus:
a survey and pathogenicity trial. J Comp Pathol
1989, 100:59-66.
12.Austgen LE, Bowen RA, Bunning ML, Davis BS, Mitchell
CJ, Chang GJ: Experimental infection of cats
and dogs with West Nile virus. Emerg Infect Dis
2004, 10:82-86.
13.Resnick MP, Grunenwald P, Blackmar D, Hailey C,
Bueno R, Murray KO: Juvenile dogs as potential
sentinels for West Nile virus surveillance.
Zoonoses Public Health 2008, 55:443-447.
17
eco-ePIDeMIoLoGIcAL DIMenSIonS oF
LYMe DISeASe AnD conSeRVAtIon oF WILD
cARnIVoReS In noRtH AMeRIcA
alonso aGuirrE
sEnior VicE prEsidEnt, consErVation MEdicinE proGraM, WildliFE trust, nEW yorK, usa
EMail: aGuirrE@WildliFEtrust.orG
Lyme disease, first recognized in Old Lyme, Connecticut,
is caused by the bacterium Borrelia burgdorferi and is
transmitted by several species of ticks. The symptoms of
Lyme disease are variable, but generally progress through
three stages. At first there are “flu-like” symptoms such
as fatigue, fever, sore throat, nausea and coughing. Little
is known about the signs in wild animals and it is felt
that probably there are not many pathogenic effects. In
humans, many of those infected develop a small red
lesion around the site of the tick or often developing
into “Erythema migrans”. Early signs include malaise and
fatigue, relapsing fever, myalgia, arthralgia, headache,
stiff neck, and lymph node enlargement. Days or months
18
later, a chronic or recurring arthritis may develop which
may lead to neurologic or cardiac problems. Other signs
include chills, profuse sweating, vertigo, and varying
jaundice. Large carnivores are of vital importance to the
stability and integrity of most ecosystems, but recent
declines in free-ranging populations have highlighted the
potentially devastating effect of infectious diseases on
their conservation and the health of domestic animals
and humans. The objective of this presentation was to
review the role of wild carnivores, primarily free-ranging
canids in the eco-epidemiology of Lyme disease in North
America with special emphasis in the implications for
their conservation in natural habitats.
19
CANINE LEISHMANIOSIS IN THE UNITED
KINGDOM: A ZOONOTIC DISEASE WAITING FOR
A VECTOR?
SUSAN E SHAW
DEPARTMENT OF CLINICAL VETERINARY SCIENCE, UNIVERSITY OF BRISTOL, UK
EMAIL: SUSAN.E.SHAW@BRISTOL.AC.UK
Introduction and background
Leishmaniosis is an important sand-fly transmitted protozoan disease of dogs and humans that is endemic in the
Mediterranean areas of Europe, the Middle East and many
tropical and subtropical areas of the world. In Southern
Europe, the cause is Leishmania infantum and the vectors
are Phlebotomus sand flies. In Northern Europe, infection
is mainly restricted to dogs that have travelled to and/
or from endemic areas of the Mediterranean region during periods when there is high sand-fly exposure [1, 2].
Infection causes serious and potentially fatal disease in
susceptible dogs with associated welfare implications.
Infected dogs are the main reservoir for transmission of
Leishmania to sand flies and thus play a major role in the
epidemiology of human leishmaniasis.
Since the introduction of the United Kingdom (UK) Pet
Travel Scheme (PETS) in 2000, there has been a large
increase in the number of dogs travelling into the UK
[3]. However, the prevalence of leishmaniosis in dogs
entering the UK is unknown as infection is not notifiable and there is no pre-travel testing. In addition, there
is very limited information on the geographical location
of dogs with leishmaniosis now resident within the UK,
their travel history and clinical signs. This study aims to
provide information on the canine reservoir of Leishmania
20
infection within the UK and its implication for canine
health and welfare. In addition, it provides base line data
should a competent vector establish and Leishmania infection of wild canids and humans become a concern.
Epidemiological study
Between April, 2005 and December 2007, historical,
clinical and laboratory data were collected from dogs with
confirmed leishmaniosis resident in the UK. Information
on cases was available from two sources. The first was
from detailed submission forms accompanying clinical samples for testing submitted to the Department of
Clinical Veterinary Science, University of Bristol and
subsequent follow-up. The second source was from confirmed cases diagnosed by other laboratories using the
same diagnostic criteria during the same period and for
which treatment and management advice was requested
from our laboratory by telephone, email or FAX.
Dogs were included in the study if they had clinical signs
compatible with leishmaniosis in combination with
positive quantitative real time PCR (qPCR) or serological
results, and/or demonstration of organisms by microscopy in biopsy specimens. Where qPCR was used for diagnosis, DNA was extracted from submitted clinical samples
(blood, synovial fluid, skin, conjunctival swabs or lymph
node aspirates) and Leishmania DNA was detected using
a qPCR technique adapted from methods described by
Lachaud and others [4] and Le Fichoux and others [5]. It
targets a conserved portion of the Leishmania kinetoplast
minicircle DNA and amplifies a 115 base pair product.
Where serological methods were used in the diagnosis
of leishmaniosis in dogs already resident in the UK,
the majority employed a commercially available immunofluorescent antibody test (Test-a-pet, The University of
Liverpool, UK). In 36 dogs imported with disease prior to
import, commercially available ELISA tests (unspecified)
were used for diagnosis in the country of origin.
tive cases recorded from Jersey (Channel Islands) which
are not included on the map. In addition, the location of
15 cases of suspected leishmaniosis identified during the
same period are also included in Figure 1 although these
cases are not included in any other analyses in this study.
The majority of positive cases are resident in the South of
England with concentrations in the greater London area,
the central South coast, Bristol and Birmingham areas.
The frequency of clinico-pathological findings in the 257
affected dogs is shown in Table 2.
A questionnaire was used to collect information from
each case and included documentation of the country
from which the dog was imported (or in which the dog
had travelled), the environment in which it had been kept
(domestic household, re-homing centre) and the time
spent in each location. The major clinico-pathological
findings were recorded for each dog. Where possible,
the geographical location of positive dogs in the UK was
approximated using the post code of their local veterinary practice and the distribution mapped. Locations of
referral veterinary practices and diagnostic laboratories
with positive cases were excluded unless a local veterinary
practice was specified.
Results
Information was available for 257 dogs with confirmed
leishmaniosis. Of these, 131 were cases diagnosed at the
University of Bristol and 126 were cases confirmed elsewhere and for which treatment and management advice
was requested from our laboratory. Travel history was
available from records for 183/ 257 dogs. The countries
from which they were imported or in which they had
travelled prior to UK entry are shown in Table 1. Of the
183 dogs, 15% were rescued from rehoming centres in the
country of origin and 14% entered the UK with confirmed
clinical leishmaniosis previously or currently requiring
therapy. The majority of dogs (96%) had spent at least 6
months in an endemic country. Three affected dogs with
no history of travel were obtained from UK rehoming
centres.
The geographical locations of local UK veterinary practices at which dogs with confirmed leishmaniosis were
registered were available for 141/257 cases and their
distribution is illustrated in Figure 1. There were two posi-
Figure 1
Distribution of UK cases of canine leishmaniosis (2005-2007)
plotted using post codes of their local veterinary practice.
21
Country
Number (%)
Spain
105 (57)
Greece
26 (14)
Portugal
16 (9)
Italy
16 (9)
France
8 (4)
Cyprus
7 (4)
Malta
Gibraltar
Canarias
2 (1)
2 (1)
1 (1)
table 1
countries from which infected dogs had been imported or in
which they had travelled prior to uK entry (n=183)
Clinico-pathological sign
Number (%)
Weight loss, lethargy, inappetance
200 (78)
Skin disease
173 (67)
Lymphadenomegaly/splenomegaly
143 (56)
Lameness/arthropathy
45 (17)
Polyuria/polydipsia /proteinuria
31 (12)
Ocular signs
26 (10)
Epistaxis
21 (8)
Gastrointestinal signs
20 (8)
Hypergammaglobulinemia
72 (30)
Non-regenerative anemia/
mild thrombocytopenia
57 (22)
table 2
Clinico-pathological findings in 257 dogs
with leishmaniosis resident in the uK
(2005-2007).
Discussion
The number of confirmed cases of canine leishmaniosis identified in this study is an underestimation as
additional cases will have been diagnosed by veterinary
surgeons and UK diagnostic laboratories for which we
have no information. In addition, the long incubation
period (years in some cases) that may occur in nonendemic areas where repeated exposure to sand flies is
not present, may delay veterinary diagnosis. However, it
greatly exceeds the number of canine leishmaniosis cases
reported to the UK government’s voluntary reporting
scheme (DACTARI) between 2003 and 2006 [3]. The
canine reservoir is expected to expand due to continued
importation of infected dogs and the low rate of parasitological cure despite therapy [6].
22
The implications of this reservoir to owners and veterinarians in a non-endemic area are multiple. Transmission by
blood banking has been previously reported and recent
screening of donated blood samples albeit in an endemic
area, showed 19.6% were positive by real time PCR [7].
There is a risk of alternative routes of transmission by dog
to dog contact or alternative vectors reported in North
American Fox Hounds, the Netherlands and Southern
Germany and UK [8, 9]. There is potential for venereal spread and the shedding of Leishmania organisms in
semen of infected dogs has been reported [10].
The majority of dogs (105/183) with leishmaniosis in this
study was either imported from Spain or had been resident
there prior to UK entry. This is compatible with the high
prevalence of leishmaniosis in this country and up to 90%
of dogs resident in high risk areas are positive using PCR
[9]. It may also reflect the popularity of Southern Spain as
a destination for holidays and second homes.
This study identifies the issue of importation of dogs with
clinical leishmaniosis previously or currently requiring
therapy. In addition to adding to the reservoir, continued
treatment which is necessary to maintain clinical remission in these dogs is compromised by the lack of any
licensed veterinary products in the UK [11]. The study
also confirms that a significant percentage of dogs with
leishmaniosis are adopted into the UK from re-homing
centres in the country of origin. It could be argued that
imported stray dogs are more likely to develop infection
and disease because of decreased preventative measures
such as the regular application of synthetic pyrethroid fly
repellents [12], and by being outside during the evening
period of peak sand fly activity.
The majority of dogs (96%) had spent at least 6 months
in an endemic country which increases their risk of having been through a period of high Phlebotomus sand fly
exposure. However, there is published information supporting an extension of the season of peak adult sand fly
activity in Southern Europe due to climate change [13],
suggesting that dogs may be at risk of infection if visiting
for much shorter periods of time [14].
In this study, 3/183 cases of leishmaniosis were in dogs
previously obtained from UK re-homing centres with no
history of travel outside the UK. With an increasing number of travelled dogs within the UK population, it is quite
possible that these dogs enter re-homing centres divorced
from their travel history. However, this group of dogs
requires extra consideration as they may be autochthonous cases and a marker for establishment of the disease
in the UK.
The spectrum of clinico-pathological signs in this group
of dogs with leishmaniosis is similar to that reported in
reviews from naturally infected dogs in Italy, Greece and
Spain [15, 16]. The number of dogs presenting with lameness and arthropathy is higher in our study and may be
biased by the interest of UK veterinary surgeons in canine
joint disease. In general, fewer dogs had severe clinicopathological signs and signs of chronic disease (nonregenerative anemia, renal failure) than that resident in
endemic countries, possibly due to shorter periods of
exposure and lower infection loads.
The geographic distribution of positive dogs most probably reflects those areas with high levels of dog ownership
as well as those areas with easier access to ports through
which dogs can leave or enter the UK under PETS. The
concentration of infected reservoirs coincides with an
area where the climate has changed sufficiently to support the transmission of other vector borne diseases [17].
However, the combination of factors required for introduction and spread of competent phlebotomine sand fly
vectors into the UK from continental Europe have not
been studied. In fact, there is little published information
on the northern extent of the competent sand-fly range
in Europe and how or if it is changing with the combined effect of increased dog travel and climate change.
Phlebotomus perniciosus, a competent vector for Leishmania,
has been occasionally reported in Northern France and
Southern Germany [18]. In light of this, the two cases of
leishmaniosis diagnosed in dogs now resident in Jersey
are of interest because of their close proximity to the
French coast and potentially to a competent sand fly vector. Ph. mascittii, a sand fly species whose competency as
a vector for leishmaniosis is currently unknown but suspected, appears to have established in the current climate
of Southern Germany and Belgium and has been identified in at least 12 different sites [18]. Recently, Morosetti
and others [19] described the extension of canine and
human leishmaniosis into previously non-endemic areas
of Northern Italy and identified a combination of four
vector species, two of which (Ph. perniciosus, Ph. neglectus)
had increased in density.
Although there are no reports of confirmed sand fly transmission of leishmaniosis in Northern Europe, authocthonous cases have been reported in non-travelled dogs
on several occasions in the UK, Belgium, Holland and
Germany [20] and there have been cases of Mediterranean
leishmaniosis diagnosed in non-travelled humans in both
England and Germany [21, 22].
conclusion
Our data raise the issue that the reservoir of infected dogs
in the UK is increasing in areas where the climatic conditions may support introduction of competent vectors. The
significance of leishmaniosis as a UK human health issue
is largely dependent on the risk of spread of the phlebotomine sand fly vector. A fly trapping programme targeting
those areas in Southern England where there is a high
density of infected dogs could be justified.
23
References
1.
teske E, van Knapen F, beijer E, slappendel rJ: Risk of
infection with Leishmania spp in a canine
population in the netherlands. Acta Vet Scand
2002, 43:195-201.
2. shaw s, lerga a, Williams s, beugnet F, birtles rJ, day MJ,
Kenney MJ: Review of exotic infectious diseases
in small animals entering the United Kingdom from abroad diagnosed by PcR. Vet Rec
2003, 152:176-177.
3. pet travel scheme [http://www.defra.gov.uk/wildlifepets/pets/travel/pets/index.htm]
4. lachaud l, Marchergui-Hammami s, chabbert E, dereure J, dedet Jp, bastien p: comparison of six PcR
methods using peripheral blood for detection of canine visceral leishmaniasis. J Clin
Microbiol 2002, 40:210-215.
5. le Fichoux y, Quaranta JF, aufeuvre Jp, lelievre a, Marty
P, Suffia I, Rousseau D, Kubar J: occurrence of Leishmania infantum parasitemia in asymptomatic
blood donors living in an area of endemicity
in southern France. J Clin Microbiol 1999, 37:19531957.
6. solano-Gallego l, Koutinas a, Miró G, cardoso l,
pennisi MG, Ferrer l, bourdeau p, oliva G, baneth G:.
Directions for the diagnosis, clinical staging,
treatment and prevention of canine leishmaniosis. Vet Parasitol 2009, 165:1-18.
7. tabar Md, roura X, Francino o, altet l, ruiz de
Gopegui r: Detection of Leishmania infantum
by real-time PcR in a canine blood bank. J
Small Anim Pract 2008, 49:325-328.
8. duprey Z, stuere F, rooney Ja, Kirchhoff lV, Jackson JE,
rowton Ed, schantz pM: canine visceral leishmaniasis, United States and canada, 2000-2003.
Emerg Infect Dis 2006, 12:440-446.
9. trotz-Williams l, trees a: Systematic review of
the distribution of the major vector-borne
parasitic infections in dogs and cats in
europe. Vet Rec 2003, 157: 97-105.
10. diniz s, Melo Ms, boges aM, bueno r, reis bp, tafuri
Wl, nascimento EF, santos rl: Genital lesions
associated with visceral leishmaniasis and
shedding of Leishmania sp. in the semen of
naturally infected dogs. Vet Pathol 2006, 42:650-8.
11. shaw sE, langton da, Hillman tJ: canine leishmaniosis in the United Kingdom: a zoonotic disease waiting for a vector? Vet Parasitol 2009, 163:
281-5.
12. Manzillo FV, oliva G, pagano a, Manna l, Maroli M, Gradoni l: Deltamethrin – impregnated collars for
the control of canine leishmanaisis: evaluation of the protective effect and influence on
the clinical outcome of Leishmania infection on kennelled stray dogs. Vet Parasitol 2006,
142:142-145.
24
13. rossi E, bongiorno G, ciolli E, di Muccio t, scalone a,
Gramiccia M, Gradoni l, Maroli M: Seasonal phenology, host-blood feeding preferences and
natural Leishmania infection of Phlebotomus perniciosis (Diptera, Psychodidae) in a
high endemic focus of canine leishmaniasis in
Rome, Italy. Acta Trop 2008, 105:158-165.
14. shaw sE, Hillman t, Wray J: Unusual case of canine
leishmaniosis in the UK. Vet Rec 2008, 3:83-235.
15. ciaramella p, oliva G, luna rd, Gradoni l, ambrosio r,
cortese l, scalone a, persechino a: A retrospective
study of canine leishmaniasis in 150 dogs
naturally infected by Leishmania infantum.
Vet Rec 1997, 141:539-543.
16. Koutinas aF, polizopoulou Zs, saridomichelakis Mn,
argyriadis d, Fytianou a, plevraki KG: clinical considerations on canine visceral leishmaniasis
in Greece: A retrospective study of 158 cases
(1989-1996). J Am Anim Hosp Assoc 1999, 35:376-383.
17. Medlock J: Vector-related risk mapping of the
introduction and establishment of Aedes albopictus in europe. Vect Bor Zoo Dis 2007, 7:4-14.
18. depaquit J, nauke tJ, scmitt c, Ferté H, léger n: A
molecular analysis of the subgenus Transphlebotomus Artemiev, 1984 (Phlebotomus,
Diptera, Psychodidae) inferred from nD4
mtDnA with new northern records of Phlebotomus mascittii Grassi, 1908. Parasitol Res 2005,
95:113-116.
19. Morosetti G, bongiorno G, beran b, scalone a, Moser J,
Gramiccia M, Gradoni l, Maroli M: Risk assessment
for canine leishmaniasis spreading in the
north of Italy. Geospat Health 2009, 1:115-27.
20. nauke tJ, schmit c: Is leishmaniasis becoming
endemic in Germany? Int J Med Microbiol 2004,
293 (suppl 37):179-181.
21. Harms G, schonian G, Feldmeier H: Leishmaniasis in
Germany. Emerg Infect dis 2003, 9:3-23.
22. darné s, sinclair sa: A sandfly in Surrey? A case
of cutaneous leishmaniasis in the United
Kingdom without history of recent travel
to an endemic area. Clin Exp Dermatol 2006,
31:155-156.
25
CANINE VISCERAL LEISHMANIoSIS PREVENTION
IN BRAZIL
VITOR M RIBEIRO
CLINICA VETERINÁRIA SANTO AGOSTINHO, BELO HORIZONTE, BRAZIL
EMAIL: V
ITOR@PUCMINAS.BR
Introduction
Canine visceral leishmaniosis (CVL) is an important
parasitic disease in Brazil, due to its clinical manifestation, transmissibility and zoonotic potential [1]. Since
the discovery of CVL in Tunisia by Nicolle and Comte
in 1908 [2], dogs have been implicated as important
reservoirs for visceral leishmaniosis (VL). Adler and
Theodore [3] described in detail the coprevalence and
similarity of the disease in human and dog populations in
the Mediterranean and concluded that Leishmania tropica
was the causative organism of cutaneous leishmaniosis
(CL) in both dogs and humans. Since these early findings, several studies have implicated the involvement of
dogs in transmission of VL describing the presence of
canine seropositivity in areas of endemic kala-azar [6,
7]. Although evidence of infection in two hosts does not
imply a causal relationship, a result of this literature is
that control programs for VL often included elimination
or treatment of infected dogs. Control programs can also
include treatment of human cases, sand fly vector control,
or elimination of other suspected animal reservoirs [8]. In
the last twenty years, the number of VL cases diagnosed
in Brazil, as in several countries in Asia, Africa, Americas
and Europe, has increased. The increasing incidence of
VL is associated with environmental changes, migration,
disorganized urbanization and with specific risk factors
such as AIDS and malnutrition [9, 10]. Control programs
in Brazil have focused on the mass elimination of seropositive dogs. However, Brazilian National Health data
over recent decades has shown that widespread culling of
26
seropositive dogs does not reduce the number of human
cases and has prompted a reassessment of this dog control policy in Brazil [11, 12]. The increase in canine and
human disease in Brazil despite control measures, the
social opposition to public health policy focused on
eliminating all seropositive dogs and the absence of effective, long term steps for preventing canine disease and
controlling the vector will be discussed.
Canine visceral leishmaniosis in Brazil
In Brazil, the domestic dog has been incriminated as the
main reservoir for L. infantum. Dogs are highly susceptible
to infection and often show substantial skin parasitism,
which together with their close relationship to humans
makes them a very important reservoir [13]. Cutaneous
parasitism in dogs measured using xenodiagnosis demonstrated that 75% of 16 symptomatic dogs and 29%
of 14 humans with VL were infectious to Lutzomyia
longipalpis. Although humans can act as reservoirs for L.
infantum, dogs are more important in the epidemiology
of the disease [4, 5]. Other reports evaluating the rate of
infectivity of dogs have demonstrated that dogs without
clinical signs have lower infectivity potential to sandflies. Using serial xenodiagnosis to assess the infectivity
of dogs naturally infected with L. infantum, Travi et al.
[14] showed that asymptomatic individuals were unable
to infect L. longipalpis females, while oligosymptomatic
animals were infective at very low rates and symptomatic animals were able to rapidly infect large numbers of
females. These authors also showed the skin of the ear to
be more intensely parasitized than that of the abdomen.
Costa-Val et al. [15] found higher rates of infectivity to
L. longipalpis in symptomatic dogs versus oligosymptomatic and asymptomatic individuals and Michalsky et al.
[16] demonstrated that the rates of infection of L. longipalpis feeding on asymptomatic, oligosymptomatic and
symptomatic dogs were 5.4%, 5.1% and 28.4%, respectively. These results showed that symptomatic dogs were
four times more infectious to L. longipalpis than asymptomatic or oligosymtpomatic animals. Vercosa et al. [18]
reported that six out of nine symptomatic dogs (54%)
infected L. longipalpis, while none out of five asymptomatic dogs was infectious.
and culling. Alves and Bevilaqua [24] analyzed the difficulties in performing valid serological diagnosis and
used statistical analysis to show a VL negative IFAT result
is highly reliable but a positive result not so. A practical
consequence of this would be that a public health control
program in Belo Horizonte, Minas Gerais culled 12,924
false-positive animals and kept alive 2,003 false-negative
ones. Corroborating this research, Ribeiro et al. [25] demonstrated a disparity of 45% between serological IFAT test
results from laboratories working with official exam kits
compared to results from a reference laboratory.
Public health control programs
There is undeniably an ethical question, not only with
respect to the exaggerated pursuit of eliminating dogs, but
also to the continued use of unreliable diagnostic tools.
Based on the idea that the transmission of the agent could
be interrupted by removing dogs, Brazilian public health
authorities have focused control programs on the culling
of seropositive and/or sick dogs. The manual of VL surveillance and control dictates that dogs tested seropositive by ELISA and/or Indirect Fluorescent Antibody Test
(IFAT) with titers equal to or greater than 1:40, whether
symptomatic or not, must be euthanized [19]. This strategy, although systematically applied, has had controversial
results and has become the least accepted control measure
by society [20]. Several reports have demonstrated that
canine culling has not achieved the desired results. Dye
[21] concluded, through mathematical studies using an
importance scale, that culling of seropositive dogs would
be the third measure adopted. Controlled Brazilian studies
on canine culling have not demonstrated positive results.
Dietze et al. [22], selected two different areas – one with
and one without dog culling to study the control of VL
achieved. The authors concluded that, throughout the
study period of one year, there was no statistically significant difference in the propagation of kala-azar between
the two areas. They also reported a rise of almost 100% in
human disease in Brazil between 1990 and 1994, despite
almost five million dogs being examined and more than
80.000 dogs culled. Ashford et al. [8], reported that in
the short to medium term the effect of culling seropositive dogs is insufficient to completely control VL in dogs
and in the medium to long term (two to four years) does
not have a statistically significant effect on infection in
the canine population between areas with and without
intervention. Thus not demonstrating any benefit of culling seropositive dogs on either canine disease prevalence
or human disease incidence. Courtenay et al. [23] studied
the incidence of infection in fifty sentinel dogs exposed to
Leishmania chagasi on Marajo Island, Brazil, and concluded that eliminating dogs failed due to the high incidence
of infection and infectivity of dogs, the poor sensitivity of
diagnostic tests and the time elapsing between diagnosis
The expansion of VL in Rio de Janeiro was demonstrated
by Silva et al. [26] in spite of the control strategies implemented by FUNASA (Fundação Nacional de Saúde – federal health agency). The authors blamed the failure on
serological tests based on IFAT, irregularity of serological
testing and poor training of the implementation teams.
According to this report, serological testing should be
carried out bimonthly with particular attention given to
the more infectious symptomatic dogs and Western Blot
is the most effective method to identify infected dogs.
Moreira et al. [27] and Moreira et al. [28] concluded
that canine culling did not reduce the incidence of VL
even with optimized protocols using highly sensitive
serological tests (ELISA), shorter diagnostic intervals,
removal of seropositive dogs, and selection of the canine
population exposed to infection. The authors claimed
that the inefficacy of the control program was probably
due to the inability of diagnostic methods to identify all
infected dogs, the immediate replacement of culled dogs
by susceptible puppies or previously infected dogs and
the possible existence of other reservoirs. Pereira et al.
[29] evaluated the efficiency of culling seropositive dogs
for the control of VL in Brazil and concluded that canine
elimination alone, did not contribute to the control of
canine infection by L. chagasi and, consequently also
not human infection. Nunes et al. [30], concluded that
culling dogs should be re-evaluated in light of the fact
canine replacement rate is high and the time needed for
their infection short. They confirmed that canine culling,
as a sole measure, is poorly efficient in controlling VL.
Andrade et al. [31] reported a culled dog replacement
rate of 44.5% in a VL endemic area mainly due to the
need for a companion or guard animal. The major reason
for non-replacement was the fear of VL. They concluded
that canine culling would appear to have more influence
on the structure of the canine population than on its size.
The epidemiological implications of a younger canine
27
population can be pronounced. Therefore, reasonable
ownership programs, focusing on canine quality of life
would be more interesting than the programs adopted at
present. Studies by Nunes et al. [32], in the CVL endemic
area of Brazil, concluded that dog euthanasia and the subsequent replacement rate were high, increasing population
turnover and leading to a younger population that might
be more susceptible to a variety of infectious diseases.
Replacement of seropositive dogs was common, and half
the population became CVL positive within a 2.5-year
period, suggesting the maintenance of VL in that area.
Culling of dogs as a control strategy for VL should be
reassessed. De Souza et al. [33] reported a randomized
community intervention trial comparing the effect of (i)
pyrethroid insecticide spraying; (ii) pyrethroid insecticide
spraying plus culling of seropositive dogs and (iii) no
intervention. The trial lasted two years and reported every
year, insecticide spraying was performed every 6 months.
Although a lower incidence of infection was observed in
the groups with interventions and reduction was compounded after two years, the study failed to show statistically significant differences.
In addition to questioning the technical soundness of
massive elimination of seropositive dogs, society expresses its disagreement through the voices and suffering of
dog owners. This phenomenon is well described by Feijão
et al. [34] reporting the embarrassment of public agents
at the time of euthanizing seropositive dogs. Perceived at
worst to be the declaration of a capital penalty to a family
member this is an emotional event for a family in which
dogs play an important role. This emotional aspect compounds the opposition to these controls by society and
can end in lawsuits between citizens and public agents.
Another occurrence described by Arias et al. [35] is the
removal of dogs by owners to other environments, sometimes to non-endemic areas, contributing to the spread
of the pathogen. In a systematic review, Romero and
Boelaert [36] observed that, in spite of all the limitations,
a relevant number of reports show an absence of strong
evidence for a significant impact on VL transmission for
any of the interventions reviewed. For obvious reasons
canine culling is the least community accepted intervention and is not effective due to the high replacement rate
of eliminated dogs with susceptible puppies. Despite
the above Brazilian public health authorities insist on
prioritizing canine culling as the main component of the
VL control program. The strategy is considered valid and
shows according to Maia-Elkhoury et al. [37], the best
cost-benefit value in reducing human incidence.
To make matters worse, Brazilian public health authorities try to obligate owners of seropositive dogs to cull
them whether infective or not. Lawsuits have been successfully filed by Brazilian citizens to keep dogs alive.
28
This evidence points towards unethical behavior of VL
control service agents. In addition to the persistence of
public health authorities, the impact of existence of other
reservoirs must be considered.
Spontaneous VL has been reported in four vertebrate
species in Brazil: man, dog, cat and the wild dog,
Lycalopex vetulus, known locally as ”raposa”, or fox [4].
This possibility, which includes humans as reservoirs,
was discussed by Dietze et al. [22]. Sherlock et al. [38]
reported, for the first time in the Americas, natural
infection in a non-canid mammalian – Didelphis albiventris – in the state of Bahia. Cabera et al. [39] demonstrated a high prevalence of L. chagasi in opossums
(D. marsupialis) (29%) in Rio de Janeiro and concluded
that the presence of those animals in the areas around
dwellings would increase the risk for canine infection
by 2.6 times. Silva et al. [40], reported a seroprevalence
varying between 8.1% (DAT) and 21.6% (IFAT) in 111
opossums (Didelphis) and two black rats (Rattus rattus)
from the urban region of Belo Horizonte. Using PCR,
they analyzed 74 samples of Didelphis and two samples of
R. rattus: two of the samples of D. marsupialis (2.7%) and
one of R. rattus (50%) contained DNA of L. chagasi/L.
infantum. The authors highlighted the potential role of
these animals as reservoirs of infection in this urban area
of Brazil. Using PCR, Gomes Neto [41] reported seroprevalences of 26.7% and 64.7% in 15 and 17 D. albiventris respectively in the state of Bahia where prevalence in
the canine population was 15.6%. This report also noted
that relative to 2003 canine prevalence had not decreased
despite implementation of control measures. Savani et
al. [42] reported the first occurrence of feline visceral
leishmaniosis (FVL) in Brazil and the Americas, raising
the potential for domestic cats to act as reservoirs of
L. infantum. Silva et al. [43] reported a 25% seroprevalence in cats from a VL endemic area in Rio de Janeiro and
suggested that, as previously reported by other researchers, cats must be considered alternative domestic hosts of
VL and should be included in serological testing programs
in endemic areas. Rabelo et al. [44] reported cats naturally infected with L. infantum in the metropolitan area of
Belo Horizonte for the first time. To date Brazilian public
health authorities have not commented on evidence to
support the existence of other reservoirs and there is not a
differentiated control program.
The justification for widespread canine culling in Brazil
is based on social equality arguments. They sustain that
if a dog from a poor community must be removed for
elimination, a dog that belongs to a wealthier citizen does
not deserve to be treated, because this would constitute
social injustice.
Vector control
Control of the vector, L. longipalpis, seems to be a component in common with all proposals for VL control.
Researchers currently indicate that this might be the most
important control measure that can be adopted. It is
important to highlight the advance in vector control resulting from the use of a 4% deltamethrin impregnated collar.
The use of such collars on dogs in endemic areas will help
to prevent sand flies from approaching the dog and thus
from infection. Other insecticide formulations such as for
example an imidacloprid plus permethrin spot on formulation have been presented as alternatives to the collar. Dye
[21] reported that controlling the vector was statistically
the most efficient measure to control the disease. Vector
control methods used in small towns, based on spraying
in and around the home, are logistically challenging and
expensive in large cities. Nevertheless, their efficacy was
reported by Costa et al. [45] in nine cities with human
VL cases in Brazil. Alpha-cypermethrin vector control was
combined with the use of diagnostic tools, treatment of
human cases and health education. A significant reduction in the number of human cases (54.7%) was observed
over a two-year follow up period. The authors concluded
that chemical vector control, along with improved medical assistance and health education, was responsible for
the marked reduction in the number of human cases of
the disease. The feasibility of vector control using environmental insecticides in large urban centers is challenging
due to the need for continuous reapplication and climatic
variations such as the rainy season. These difficulties have
resulted in research focused on individual animal vector
control measures. Studies on the use of 4% deltamethrin
impregnated collars showed killing and repellent effects
on sand flies, making the collar the most important tool of
vector control on dogs, Killick-Kendrick et al. [46], David
et al. [47], Gavagni et al. [48], Maroli et al. [49], Miró et al.
[50], Ribeiro et al. [51]. Comparative studies have yielded
better results on disease control using the insecticide collars versus culling of seropositive dogs and demonstrate in
addition reduced social trauma, as previously discussed.
It was concluded that deltamethrin impregnated collars
can protect dogs against Brazilian sand flies for up to eight
months that they should be useful in a program to control
human and canine leishmaniosis [48, 52, 47]. CamargoNeves et al. [53] demonstrated the efficiency of insecticide
collars compared to seropositive dog culling in an urban
area and observed a reduction in prevalence of canine
and human cases. The authors stated that this probably
occurred as a result of a decrease in infection pressure on
dogs, which reduced the chances of vector infection due
to the barrier created by constant use of the insecticide
collar. They concluded that, in spite of the collar being an
individual protection measure, its use for public health
will only be feasible if used widely and for a long period.
Reithinger et al. [54] compared the susceptibility of sand
flies to different insecticides used on dogs and observed
that 4% deltamethrin impregnated collars obtained the
best results and should be recommended to dog owners. Permethrin and fenthion, also showed good results.
Mencke et al. [55] and Miró et al. [50] demonstrated,
under controlled conditions, that the repellent effect of
a “spot on” solution of imidacloprid/permethrin against
L. longipalpis exceeded 90% for three weeks after the
application. Such vector control interventions are better
accepted by society and mathematical models suggest
they would be effective. However better knowledge of
vector seasonality and behavior is required to determine
the appropriate timing of these interventions [36].
Vaccination and treatment
Canine and human vaccine development needs to be
prioritized [36]. According to the report published by Dye
[21], an efficient vaccine would be the goal for disease
control. There are two vaccines against CVL registered by
the Ministério da Agricultura, Pecuária e Abastecimento –
federal agricultural department in Brazil. The vaccines have
some protective effect against CVL for dogs but neither of
them was properly evaluated against human VL [56, 57].
Such evaluation is challenging as field trials should include
relevant canine endpoints, related to dog infectiousness for
the sand fly vector, as well as relevant human endpoints,
that include symptomatic and asymptomatic infections
in order to obtain precise estimates of the vaccine’s effect
on transmission rates [36]. Nevertheless, they are being
regularly used in Brazil. Dogs should be vaccinated at the
age of four months if they are healthy and demonstrated
free of L. infantum. The vaccines are administered in three
subcutaneous doses, at 21-day intervals. The first booster
is administrated one year after the first dose followed by
yearly maintenance boosters. Promising results have been
published reporting the use of the one vaccines effect on
blocking transmission and protecting against infection
[58]. The vaccine has also shown results in the treatment of infected dogs confirming its immunotherapeutic
potential. The enriched Leishmune® vaccine, used in
double saponine concentration, reduced clinical signs and
evidence of the parasite, modulating the outcome of the
infection and the dog’s potential infectivity to phlebotomines. Safety studies have shown it to be well tolerated and
safe [59]. The therapeutic effect of immunotherapy has
also been demonstrated in other reports [60, 61]. BorjaCabera et al. [62] used immunotherapy with enrichedLeishmune® combined with alopurinol or amphotericin
b and alopurinol chemotherapy and obtained not only
remission of clinical signs, but also elimination of latent
infection, effectively curing the dogs.
29
There are many options for canine treatment and, each
day, a new perspective arises. The challenge of canine
treatment consists of achieving a permanent condition
of non-infectivity, as well as clinical cure. The reports on
canine treatment in Brazil have demonstrated a marked
decrease or elimination of amastigotes in the skin of
treated dogs [62;63, 64, 65]. These results are promising and encourage veterinary practitioners to treat their
patients according to standards published in the scientific
literature.
It is important to keep in mind that vector control measures are not to be abandoned, with vaccinated and
or treated dogs as stated by the Pan American Health
Organization (PAHO), [66]. These animals must be protected from the risk of new infections and from the risk of
infecting the vector.
the role of the private veterinarian
In Brazil, veterinary practitioners disagree with the arbitrary position of public health authorities in forcing owners to cull their dogs, and not be treated according to the
PAHO [66] guidelines. Our view is that routine measures
developed by veterinary practitioners should be based on
scientific research. According to Ribeiro [67], no human
VL cases occurred in the same residence of dogs submitted
to treatment according to recommended protocols and
standards of care. We hypothesize that the occurrence of
human cases is connected to the increase in the intensity
of transmission that occurs due to the excessive number
of reservoirs but mainly vectors present at the focus. In
the city of Belo Horizonte there is no systematic campaign
encouraging vector control through the use of insecticide
collars or pour-on insecticides for dogs. The guidelines
are focused on canine elimination which we believe
reinforces current misunderstanding. It is important that
veterinary practitioners are informed about the time of
increased vector transmission, during and immediately
after the raining season and should recommend the use of
insecticides on dogs during this period. Spraying around
homes is more difficult and is less efficient. However a
dog that is appropriately protected against the vector by
the methods already recognized and under supervised
treatment would not seem to pose a risk to public health.
Private veterinary practitioners can contribute to public
health management by educating dog owners, regarding
the prevention of new cases and associated reduction
in transmission to vectors. The information network on
disease control should incorporate notification of dogs
infected and dogs being treated.
We conclude that the veterinary practitioner in Brazil currently works to prevent infection and disease in dogs, by
vaccination and vector control measures focused on the
dog and its environment. It now rests with the judiciary in
30
our country to show that the current methods employed
by public health authorities with respect to the handling
of infected or sick dogs do not result in efficient human
disease control.
There is much to be discussed and considered with respect
to CVL treatment and the most appropriate diagnostic
methods that avoid elimination of false-positive and
maintenance of false-negative dogs. As the scientific literature builds that exposes the inefficiency of current control
measures so does the recognition of the importance of
the animal and human bond in many Brazilian families.
We should not forget to base ourselves on the defense of
life.
References
1.
ribeiro VM: treatment and control aspects of
canine leishmaniasis. Clín Vet 2007, 71:66-76, 2007.
2. nicolle c, comte M: Recherches sur kala-azar
enterprises a l´Institut Pasteur de tunis, IV.
origine canine du kala-azar. Arch Inst Pasteur
tunis 1908, 3:59-62.
3. adler s, theodore, o: Investigations on Mediterranean kala azar. VI- canine visceral leishmaniasis. Proc R Soc Lond 1932, 110:402-412.
4. deane lM, deane Mp: observações preliminares sobre a importância comparativa do
homem, do cão e da raposa Lycalopex vetulus
como reservatórios da L. donovani em área
endêmica da calazar no ceará. Hospital 1955,
48:61-70.
5. deane lM, deane Mp: Visceral leishmaniasis in
Brazil: geographical distribution and transmission. Rev I Med Trop 1962, 4:198-212.
6. shaw JJ, lainson Frs: ecology and epidemiology: new World. in The leishmaniases in Biology and
Medicine Volume I. Edited by peters W, Killick-Kendrick r.
london: academic press, 1987:365.
7. bettini, s, Gradoni l: canine leishmaniasis in the
Mediterranean area and its implications
for human leishmaniasis. Insect Sci Applicat 1986,
7:241-245.
8. ashford rW, david Jr, Freire EM, sherlock i, Eeulàlio
Mc, sampaio dp, badarò r: Studies on control of
visceral leishmaniasis: impact of dog control
on canine and human visceral leishmaniasis,
Jacobina, Brazil. Am J Trop Med Hyg 1998, 59:53-57.
9. anstead GM, chandrasekar b, Zhao W,yang J, perez lE,
Melby pc: Malnutricion alters the innate immune response and increases early visceralization following Leishmania donovani infection. Infect Immun 2001, 69:4709-4718.
10. desjeux p: the increase in risk factors for
leishmaniasis worldwide. Trans R Soc of Trop Med
Hyg 2001, 95:239-243.
11. Vieira Jb, coelho GE: Visceral leishmaniasis or
kala-azar: the epidemiological and control
aspects. Rev Soc Bras Med Trop 1998, 31 (suppl. 2):8592.
12. costa cH,Vieira Jb: changes in the control program of visceral leishmaniasis in Brazil. Rev
Soc Bras Med Trop 2001, 34:223-228.
13. ashford rW: Leishmaniasis reservoirs and their
significance in control. Clin Derm 1996, 14:523- 532.
14. travi bl, tabares cJ, cadena H, Ferro c: canine Visceral Leishmaniasis in colombia: relationship
between clinical and parasitologic status and
infectivity for sand flies. Am J Trop Med Hyg 2001,
64:119-124.
15. da costa-Val ap, cavalcanti rr, de Figueiredo Gontjio
n, Michalik Ms, alexander b, Melo Mn: canine visceral leishmaniasis: relationships between
clinical status, humoral immune response,
haematology and Lutzomyia (Lutzomyia)
longipalpis infectivity. Vet J 2007, 174(3):636-643.
16. Michalsky EM, rocha MF, lima ac, Franca-silva Jc,
oliveira Fs, pacheco rs, santos sl, Fortes-dias cl, dias
Es: Infectivity of seropositive dogs, showing
different clinical forms of leishmaniasis, to
Lutzomyia longipalpis phlebotomine sand
flies. Vet Parasitol 2007, 1-2:67-76.
17. alencar JE: Aspectos clínicos do calazar Americano. Rev. Bras Malariol Doenças Trop 1959, 11:19-44.
18. Vercosa bl, lemos cM, silva sM, de carvalho sM,
coata Fa: Transmission potential skin inflammatory response, and parasitism of symptomatic and asymptmatic dogs with visceral
leishmaniasis. BMC Vet Res 2008, 6:4-45.
19. departmento de Vigilância Eepidemiológica, Ministério da saúde, secretaria de Vigilância em saúde, brasil.
Manual de Vigilância e controle da Leishmaniose Visceral. Brasília/DF Ministério da Saúde
2004.
20. oliviera cd, Morais MH, Machado-coelho Gl: Visceral leishmaniasis in large Brazilian cities:
challenges for control. Cad Saúde Pública 2008,
24(12):2953-2958.
21. dye c: the logic of visceral leishmaniasis control. Am J Trop Med Hyg 1996, 55:125-130.
22. dietze r, barros Gb, teixeira l, Harris J, Michelson K,
Falqueto a, corey r: effect of eliminating seropositive canines on the transmission of visceral leishmaniasis in Brazil. Clin Infect Dis 1997,
25:1240-1242.
23. courtenay o, Quinell rJ, Garcez lM, shaw JJ, dye c:
Infectiousness in a cohort of Brazilian Dogs:
Why culling fails to control Visceral Leishmaniasis in Áreas of high transmission. J Infect
Dis 2002, 186:1314-1320.
24. alves W, bevilaqua dp: Quality of diagnosis of
canine visceral leishmaniasis in epidemiological surveys: an epidemic in Belo Horizonte,
Minas Gerais, Brazil, 1993-1997. Cad Saúde
Pública 2004, 20(1):259-265.
25. ribeiro VM, lima Mccd, nogueira Fs, Michalik MsM:
Serological diagnosis of canine visceral leishmaniasis in Brazil: a comparison of results
from private laboratories and from one reference laboratory. in Proceedings of the 4 th World
Congress on Leishmaniasis 2009. Worldleish4, 3rd to 7th
February 2009, lucknow, india.
26. silva aVM, de paula aa, cabera Maa, cabeira Jca:
Leishmaniose em cães domésticos: aspectos
epidemiológicos. Cad. Saúde Pública, Rio de Janeiro
2005, 21:324-328.
27. Moreira Ed, de souza,VMM, sreeenivasan M, nascimento EG, carvalho lp: Assessment of an optimized dog-culling program in the dynamics
of canine Leishmania transmission. Vet Parasitol
2004, 122(4):245-252.
28. Moreire Ed, de souza VMM, carvalho lp: optimized
dog-culling program does not reduce Leishmania infection in children in an endemic
area: results of a community-based trial. in
Proceedings of the Third World Congress on Leishmaniosis,
10-15 april 2005, palermo-terrasini, sicily, italy.
29. pereire Ea, Jennings yl, careneiro la, lima lr, campos
Mb, barbosa rnp, Monteiro aJ, negrao r, Machado r,
chagas EJ, souza aa, ishikawa Eay, lainson r, silveira Ft:
the elimination of seropositive dogs is an
inefficient measure for controlling the canine
Leishmania (L.) chagasi infection. in Proceedings
of the Third World Congress on Leishmaniosis, 10-15 april
2005, palermo-terrasini, sicily, italy.
30. nunes cM, lima VF, paula Hb, andarade aM, buratini
Mn: Dog replacement and susceptibility to
canine visceral leishmaniasis in an endemic
area of Brazil. in Proceedings of the Third World
Congress on Leishmaniosis, 10-15 april 2005, palermoterrasini, sicily, italy.
31. andrade aM, Queriòz lH, nunes Gr, perri sHV, nunes
cM: Dog replacement in an area endemic for
visceral leishmaniasis. Rev Soc Bras Med Trop 2007,
40(5):594-5.
32. nunes cM, lima VF, paula Hb, andarade aM, dias FE,
buratini Mn: Dog culling and replacement in
an area endemic for visceral leishmaniasis in
Brazil. Vet Parasitol 2008, 153(1-2):19-23.
33. de souza VMM, Juliao Fs, neves rcs, bisinoto tV,
lima as, oliveira ss, Moreira Junior Ed: communitary assay for assessment of effectiveness
of strategies for prevention and control of
human visceral leishmaniasis in the municitpality of Feira de Santana, State of Bahia,
Brazil. Epidemiol Serv Saude 2008, 17:97-106.
31
34. Feijão aMM,lima JWo,Vieira F, nationes MK: o significado do cachorro para a família – estudo
qualitativo sobre a estratégia de eliminação
de cães infectados com Leishmania para o
controle do calazar. Rev Soc Bras Med Trop 2001,
34(suppl i):230.
35. arias Jr, Monteiro p, Zicker F: the re-emergence
of visceral leishmaniasis in Brazil. Emerg InfectDis 1996, 2:145-146, 1996.
36. romero Gas, boelaert M: control of Visceral
Leishmaniasis in Latin America – A Systematic Review. PLoS Negl Trop Dis 2010, 4(1), epub
January 2010.
37. Maia-Elkhoury ans, alves Wa, souza-Gomes Ml,
sena JM, luna E: Visceral leishmaniasis in Brazil:
trends and challenges. Cad Saúde Pública 2008,
24(12):2941-2947.
38. sherlock ia, Miranda Jc, sadigursky M, Grimaldi Jr:
natural infection of the opossum Didelphis
albiventris (Marsupialia, Didelphidae) with
Leishmania donovani, in Brazil. Mem Inst Oswaldo
Cruz 1984, 79(4):511.
39. cabera Maa, de paula aa, camacho lab, Marzochi
ca, aguiar GM, Xavier sc: canine Visceral Leishmaniasis in Barra de Guaratiba, Rio de Janeiro, Brazil: assessment of some risk factors.
Rev Inst Med Trop São Paulo 2003, 45(suppl 2):79-83.
40. silva Es,Van der Meid WF, Gontjio cMF, oliveira Fs,
schoone GJ, schallig HdFH, pacheco rs: Dildelphis
marsupialis and Rattus rattus: a potential reservoir host for zoonotic leishmaniosis in the
metropolitan region of Belo Horizonte, Minas Gerais, Brazil. in Proceedings of the Third World
Congress on Leishmaniosis. 10-15 april 2005, palermoterrasini, sicily, italy.
41. Gomes neto cMb: the evaluation of opossum
(Didelphis albiventris) and domiciliated dogs
involvement in the visceral leishmaniasis
transmition cycle in the municipality of
camaçari, locality of Barra do Pojuca, Bahia.
Salvador, Bahia, 2006. Dissertação de Mestrado,
universidade Federal da bahia, Escola de Medicina
Veterinária, 2006.
42. savani EsMM, camargo McGo, carvalho Mr, Zampiere
ra, santos MG, d`auria srn, shaw JJ, Floeter-Winter
lM: The first record in the Americas of an
autochthonous case of Leishmania (Leishmania) infantum chagasi in a domestic cat (Felix
catus) from cotia county, São Paulo State,
Brazil. Vet Parasitol 2004, 120: 229-233.
43. silva aVM, candido cds, pereira dp, brazil rp, carreira
Jca: The first record of american visceral
leishmaniasis in domestic cats from Rio de
Janeiro, Brazil. Acta Tropical 2008, 105:92-94.
32
44. rabelo pF, ribeiro VM, Michalik MsM: Levantamento
sorológico e parasitológico da infecção por
Leishmania (Leishmania) infantum em gatos (Felis catus) em Belo Horizonte, Minas
Gerais, Brasil. Seminário de Iniciação Científica, Belo
Horizonte. pontifícia universidade católica de Minas
Gerais. Ed. puc, 2008.
45. costa Wa, alves Wa, souza M, Maia an, oliviera GM,
Bonfim MR: the experience of Brazil in the
chemical control of the visceral leishmaniasis in municipalities with outbreak in urban
área. in Proceedings of the Third World Congress on Leishmaniosis, 10-15 april 2005, palermo-terrasini, sicily, italy.
46. Killick-Kendrick r, Killick-Kendrick M, Focheux c,
dereure J, puech Mp, cadiergues Mc: Protection of
dogs from bites of phlebotominae sandflies
by deltamethrin collars for control of canine
leishmaniasis. Med Vet Entomol 1997, 11:105-111.
47. david Jr, stamm lM, bezerra Hs, souza rn, Killick-Kendrick r, lima JWo: Deltamethrin-impregnated
dog collars have a potent anti-feeding and
insecticidal effect on Lutzomyia longipalpis
and Lutzomyia migonei. Mem Inst Osw Cruz 2001,
96: 839-847.
48. Gavagni asM, Hodjati MH, Mohite H, davies cr: effect
of insecticide-impregnated dog collars on
incidence of zoonotic visceral leishmaniasis
in Iranian children: a matched-cluster randomized trial. Lancet 2002, 360:3.
49. Maroli M, Mizzoni V, sir agusa c, d`orazi d, Gradoni
l: evidence for an impacto on the incidence
of canine leishmaniasis by the mass use de
deltamethrin-impregnated dog collars in
southern Italy. Med Vet Entomol 2001, 15:358-363.
50. Miró G, Gálvez r, Mateo M, Montoya a, desclazo Ma,
Molina r: Evaluation of the efficacy of a topically administered combination of imidacloprid and permethrin against Phebotomus
perniciosus in dog. Vet Parasitol 2007, 143:375-379.
51. ribeiro VM, rajão ra, araújo M, diniz s, Michalick MsM:
evaluation of the potential transmission of
visceral leishmaniasis in a canine shelter.
Rev Med Vet 2005, 156(1):20-22.
52. reithinger r, coleman pG, alexander b,Vieira Ep, assis
G, davies cr: Are insecticide-impregnated dog
collars a feasible alternative to dog culling
as a strategy for controlling canine visceral
leismaniasis in Brazil? Int J Parasitol 2004, 34:55-62.
53. camargo-neves VlF, rodas lac, pauliquèvis Jr, Use
of deltamethrin impregnated collars at 4% in
the american visceral leishmaniasis control.
Preliminary results of a study conducted in
the state of São Paulo, Brazil. in Procedings of the
Third World Congress on Leishmaniosis, 10-15 april 2005,
palermo-terrasini, sicily, italy.
54. reithinger r, teodoro u, davies cr: topical Insecticide treatments to Protect Dogs from Sand
Fly Vectors of Leishmaniasis. Emerg Infect Dis
2001, 7(5):872-6.
55. Mencke n,Volf p,Volfova V, stanneck d: comparing
the repellent efficacy of a imidacloprid/permethrin spot-on solution against Lutzomyia
longipalpis and Phlebotomus papatasi. in
Proceedings of the Third World Congress on Leishmaniosis,
10-15 april 2005, palermo-terrasini, sicily, italy.
56. parra lE, borja-caberra Gp, santos Fn, souza lQ, palatnik-de-souza cb: Safety trial using Leishmune
vaccine against canine visceral leishmaniasis
in Brazil. Vaccine 2007, 25:2180-2186.
57. Fernandes ap, costa MM, coelho Ea, Michalick Ms,
de Freitas E: Protective immunity against challenge with Leishmania (Leishmania) chagasi in
beagle dogs vaccinated with recombinant A2
protein. Vaccine 2008, 26:5888-5895.
58. nogueira Fs, Moreira Mab, borja-caberra Gp, santos
Fn, Menz i, parra lE, Xue Z, chue HJ, palatnik-de-souza
cb, luvizotto Mcr: Leishmune® vaccine blocks
the transmission f canine visceral leishmaniasis absence of Leishmania parasites in
blood, skin and lymph nodes of vaccinated
exposed dogs. Vaccine 2005, 23:4805-4810.
59. santos Fn, borja-caberra Gp, Miyashiro lM, Grechi, J,
reis ab, Moreira Mab, Mortins Filho oa, Menz i, pessoa
lM, Goncalves pr, palatnik M, palatnik-de-souza cb:
Immunotherapy against experimental canine visceral leishmaniasis with the saponin
enriched-Leishmune vaccine. Vaccine 2007.
25:6176-6190.
60. borja-cabera Gp, Mendes ac, de souza Ep, okadab
lyH, trivellato Fa, Kawasaki JK, costa ac, reis ab,
Genaro, o, batista lMM, palatnik: effective immunotherapy against canine visceral leishmaniasis with the FML-vaccine. Vaccine 2004,
22:2234-2243.
61. ribeiro VM, tafuri Wl, lima Mccd, nogueira, Fs,
Michalick MsM: Immunoterapy with Leishmune
in dogs naturally infected with L. infantum.
in Proceedings of the 4th World Congress on Leishmaniasis
2009. Worldleish4, 3rd to 7th February 2009, lucknow,
india.
62. borja-cabera Gp, santos Fn, santos Fb, trivellato Fa,
Kawasaki JK, costa ac, castro t, Moreira, Ma, palatnik
M, palatinik – de souza, cb: Immunotherapy with
the saponin enriched-Leishmune vaccine
versus immunochemotherapy in dogs with
natural canine visceral leishmaniasis. Vaccine
2010,28(3):597-603.
63. ribeiro VM, tafuri Wl, lima Mccd, nogueira, Fs,
Michalick MsM: evalution of the presence of
L. infantum amastigotes in the skin of dogs
before and during treatment with amphotericin b. in Proceedings of the 4th World Congress on
Leishmaniasis 2009. Worldleish4, 3rd to 7th February
2009, lucknow, india.
64. nogueira Fs: Avaliação clinica-laboratorial
de cães naturalmente infectados por leishmaniose visceral, submetidos à terapia com
anfotericina b. Tese doutorado, universidade Estadual
paulista, Faculdade de Medicina Veterinária e Zootecnia,
botucatu, 2007.
65. silva Ms: Avaliação clínica e laboratorial de
cães naturalmente infectados por Leishmania
(Leishmania) chagasi (cUnHA & cHAGAS,
1937), submetidos a um protocolo terapêutico em clínica veterinária de Belo Horizonte.
Tese de Mestrado, universidade Federal de Minas Gerais,
belo Horizonte, instituto de ciências biológicas, 2007.
66. organización panemaericana de la salud. Consulta de
Expertos OPS/OMS sobre Leishmaniasis Visceral em las
Américas. informe Final. brasília, brasil – 23 al 25 de
noviembre de 2005. organización panamericana de la
salud, organización Mundial de la salud, brasil, rio de
Janeiro, panaFtosa, 2006: 16-17.
67. ribeiro VM: tratamento da LV canina e seu
impacto na incidência de LV humana e na
prevalência da LV em cães. Uma experiência em Belo Horizonte, Minas Gerais, Brasil.
Consulta de Expertos OPS/OMS sobre Leishmaniasis Visceral
em las Américas. Informe Final. Brasília, Brasil – 23 al 25 de
noviembre de 2005. organización panamericana de la
salud, organización Mundial de la salud, brasil, rio de
Janeiro, panaFtosa, 2006: 104-110.
33
BARTONELLA HENSELAE: WHAT DO WE KNOW
FROM HUMAN INFECTIONS?
VOLKHARD AJ KEMPF
INSTITUTE FOR MEDICAL MICROBIOLOGY AND INFECTION CONTROL, UNIVERSITY HOSPITAL FRANKFURT AM MAIN,
JOHANN WOLFGANG GOETHE-UNIVERSITY, FRANKFURT AM MAIN, GERMANY
NATIONAL CONSILIARY LABORATORY FOR BARTONELLA-INFECTIONS (APPOINTED BY THE ROBERT-KOCH-INSTITUTE), GERMANY
EMAIL: V
OLKHARD.KEMPF@KGU.DE
Infectious diseases caused by Bartonella spp. have been
described for more than 1,000 years. Historically, infections with B. bacilliformis (which is endemic in South
America) have been known since the dynasty of the Inca
[17]. B. quintana was detected in 4000-year old human
tissue originating from southeastern France [3] and in the
mortal remains of soldiers of Napoleon’s Grand Army in
Vilnius, Lithuania [10]. In 1990, David Relman identified
B. henselae as the causative agent of bacillary angiomatosis
[BA, 12]. Today, the clinically most important species are
B. henselae, B. quintana and B. bacilliformis. More than 20
different Bartonella species have been found in a variety
of mammals and it has become clear that the number
of Bartonella spp. and their respective reservoir hosts is
constantly growing (synopsis given in Table 1). Bartonella
spp. are present in a broad spectrum of mammals including cats, dogs, ruminants and rodents which might either
suffer from these infections or serve as asymptomatic
reservoir hosts for zoonotic infections.
Most of our current knowledge on Bartonella-infections
is restricted to B. henselae and B. quintana: both genomes
34
have been sequenced [1], diagnostic algorithms have been
improved and significant knowledge about the pathogenicity and infection biology exists. However, after two
decades of Bartonella research, knowledge on transmission and pathogenicity of these bacteria is still limited.
For humans, B. henselae is considered to represent the
most relevant zoonotic Bartonella species and is responsible for cat scratch disease, bacillary angiomatosis and
other disorders. The ability to cause vascular proliferative
disorders and intraerythrocytic bacteremia are unique features of the genus Bartonella. Bartonella adhesin A [6, 13],
a member of the novel group of trimeric autotransporter
adhesins [9] and the VirB/D4 type IV secretion system
[15, 16] are important virulence factors responsible for
host cell infection (Figure 1), inhibition of apoptosis of
endothelial cells and induction of angiogenic gene programming. It is obvious that the analysis of pathogenicity
mechanisms underlying Bartonella infections is needed to
increase our understanding of how these pathogens adapt
to their mammalian hosts resulting in acute or chronic
diseases.
Table 1
Bartonella spp.: reservoirs, vectors, human diseases (modified table from [2])
Reservoir
Vector
Human diseases
B. bacilliformis
human
sandfly
Carrion’s disease: Oroya fever,
verruga peruana
B. quintana
human (dogs?) [7]
body louse (cat
flea, ticks) [14]
trench fever, endocarditis,
bacillary angiomatosis
Bartonella spp.
Human-specific spp.:
Zoonotic spp.:
B. alsatica
rabbit
unknown
endocarditis, lymphadenitis [11]
B. clarridgeiae
cat
cat flea
cat scratch disease
B. elizabethae
rat
unknown
endocarditis, neuroretinitis
B. grahamii
mouse, vole
unknown
neuroretinitis
B. henselae
cat
cat flea (ticks?)
cat scratch disease, bacillary
angiomatosis, endocarditis,
neuroretinitis, bacteraemia
B. koehlerae
cat
unknown
endocarditis
B. rochalimae
foxes, raccoons, coyotes [5]
fleas [5]
bacteremia, fever [4]
B. tamiae
rats (?)
mites (?)
bacteremia, fever [8]
B. vinsonii subsp. arupensis
mouse
tick
bacteremia, fever, endocarditis (?)
B. vinsonii subsp. berkhoffii
dog
tick
endocarditis
B. washoensis
ground squirrel
unknown
myocarditis, endocarditis (?)
B. birtlesii
mouse
unknown
unknown
B. bovis (= B. weissii)
cattle, cat
unknown
unknown
B. capreoli
roe deer
unknown
unknown
B. chomelii
cattle
unknown
unknown
B. doshiae
vole
unknown
unknown
B. peromysci
deer, mouse
unknown
unknown
B. phoceensis
rat
unknown
unknown
B. rattimassiliensis
rat
unknown
unknown
B. schoenbuchensis
roe deer
unknown
unknown
B. talpae
vole
unknown
unknown
B. taylorii
mouse, vole
unknown
unknown
B. tribocorum
rat
unknown
unknown
B. vinsonii subsp. vinsonii
vole
unknown
unknown
Animal-specific spp.:
35
Figure 1
scanning electron microscopy of B. henselae adhering to human umbilical vein endothelial cells
References
1.
2.
3.
36
alsmark cM, Frank ac, Karlberg Eo, legault ba, ardell
dH, canback b, Eriksson as, naslund aK, Handley sa,
Huvet M, la sb, Holmberg M, andersson sG: the
louse-borne human pathogen Bartonella
quintana is a genomic derivative of the
zoonotic agent Bartonella henselae. Proc Natl
Acad Sci USA 2004, 101:9716-9721.
dehio c: Bartonella-host-cell interactions and
vascular tumour formation. Nat Rev Microbiol
2005, 3:621-631.
drancourt Ml, tran-Hung J, courtin H, lumley a,
raoult d: Bartonella quintana in a 4000-yearold human tooth. J Infect Dis 2005, 191:607-611.
4.
5.
6.
Eremeeva ME, Gerns Hl, lydy sl, Goo Js, ryan Et,
Mathew ss, Ferraro MJ, Holden JM, nicholson Wl, dasch
Ga, Koehler JE: Bacteremia, fever, and splenomegaly caused by a newly recognized bartonella species. N Engl J Med 2005, 356:2381-2387.
Henn Jb, chomel bb, boulouis HJ, Kasten rW, Murray
WJ, bar-Gal GK, King r, courreau JF, baneth.G: Bartonella rochalimae in raccoons, coyotes, and
red foxes. Emerg Infect Dis 2009, 15:1984-1987.
Kaiser po, riess t, Wagner dl, linke d, lupas an,
schwarz H, raddatz G, schafer a, Kempf aJ: the head
of Bartonella adhesin A is crucial for host cell
interaction of Bartonella henselae. Cell Microbiol
2008, 10:2223-2234.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Kelly p, rolain JM, Maggi r, sontakke s, Keene b, Hunter
s, lepidi H, breitschwerdt Kb, breitschwerdt Eb: Bartonella quintana endocarditis in dogs. Emerg
Infect Dis 2006, 12:1869-1872.
Kosoy M, Morway c, sheff KW, bai y, colborn J,
chalcraft l, dowell sF, peruski lF, Maloney sa,
baggett H, sutthirattana s, sidhirat a, Maruyama s,
Kabeya H, chomel bb, Kasten r, popov V, robinson
J, Kruglov a, petersen lr: Bartonella tamiae sp.
nov., a newly recognized pathogen isolated
from three human patients from thailand.
J Clin Microbiol 2008, 46:772-775.
linke d, riesst, autenrieth lb, lupas a, Kempf Va:
trimeric autotransporter adhesins: variable
structure, common function. Trends Microbiol
2006, 14:264-270.
raoult d, dutour o, Houhamdi l, Jankauskas r, Fournier pE, ardagna y, drancourt M, signoli M, la Vd, Macia y,
aboudharam G: evidence for louse-transmitted
diseases in soldiers of napoleon’s Grand
Army in Vilnius. J Infect Dis 2006, 193:112-120.
raoult d, roblot F, rolain JM, besnier JM, loulergue J,
bastides F, choutet p: First isolation of Bartonella
alsatica from a valve of a patient with endocarditis. J Clin Microbiol 2006, 44:278-279.
relman da, loutit Js, schmidt tM, Falkow s, tompkins
ls: the agent of bacillary angiomatosis. An
approach to the identification of uncultured
pathogens. N Engl J Med 1090, 323:1573-1580.
riess t, andersson sG, lupas a, schaller M, schäfer a,
Kyme p, Martin J, Wälzlein JH, Ehehalt u, lindroos H,
schirle M, nordheima, autenrieth lb, Kempf Va: Bartonella adhesin A mediates a proangiogenic
host cell response. J Exp Med 2004, 200:1267-1278.
rolain JM, Franc M, davoust b, raoult d: Molecular
detection of Bartonella quintana, B. koehlerae,
B. henselae, B. clarridgeiae, Rickettsia felis,
and Wolbachia pipientis in cat fleas, France.
Emerg Infect Dis 2003, 9:338-342.
schülein r, dehio c: the VirB/VirD4 type IV secretion system of Bartonella is essential for
establishing intraerythrocytic infection. Mol
Microbiol 2002, 46:1053-1067.
schülein r, Guye p, rhomberg ta, schmid Mc, schroder
G,Vergunst ac, carena i, dehio c: A bipartite signal
mediates the transfer of type IV secretion
substrates of Bartonella henselae into human
cells. Proc Natl Acad Sci USA 2005, 102:856-861.
schultz MG: A history of bartonellosis (carrion’s
disease). Am J Trop Med Hyg 1968, 17:503-515.
37
UPDATE ON CANINE ANAPLASMOSIS:
EPIDEMIOLOGY AND CLINICAL DISEASE
BARBARA KOHN
SMALL ANIMAL CLINIC, FACULTY OF VETERINARY MEDICINE, FREIE UNIVERSITÄT BERLIN
EMAIL: KOHN@VETMED.FU-BERLIN.DE
38
Introduction
Epidemiology
Anaplasma (A.) phagocytophilum is the new name of the
species formerly known as Ehrlichia (E.) phagocytophila,
Ehrlichia equi, and Human granulocytic ehrlichiosis agent
[1]. The renaming which was based on sequence results
of the 16S rRNA genes has been controversial because the
former Ehrlichia spp. differed in their virulence and in
their ability to cause disease in different host species [2].
Now the former Ehrlichia spp. are considered to represent
phenotypic variations amongst A. phagocytophilum strains
in different geographical locations [3].
A. phagocytophilum is an obligate intracytoplasmic coccus
that belongs to the family Anaplasmataceae. The outer cell
wall structure of the bacterium resembles that of gramnegative bacteria. It infects cells of mammalian bone marrow derivation, predominantly cells in the myeloid lineage, where it reproduces in membrane-bound vesicles,
forming microcolonies called morulae. Morulae are found
most commonly in neutrophils, rarely in eosinophils [1].
Transmission occurs via ticks of the genus Ixodes: I. ricinus
in Europe, I. scapularis and I. pacificus in the USA, and I.
persulcatus and Dermacentor silvarum in Asia and Russia [4,
5, 6]. Several mammalian species (small wild mammals,
deer) and possibly birds may act as reservoir hosts. Dogs
are accidental hosts. Bacteremia is probably short (< 28
days) and therefore, dogs are not important in transmission to other host species [7].
A further pathway for transmission in dogs is transmission
via infected blood, either experimentally or accidentally
via blood transfusion [8, 9]. A case of perinatal transmission has been described in humans and transplacentary
infection has been documented in cattle [10, 11]. A recent
study described a severe clinical manifestation of A. phagocytophilum infection in a postpartum bitch with a lack of
evidence for perinatal transmission to her puppies [12].
Within Europe the prevalence of A. phagocytophilum in
the European tick I. ricinus established by PCR was 0.8
to 23.6% [13, 14]. In Germany, the prevalence for ticks
harboring A. phagocytophilum is reported to be 1.6 to 4.5%
[15, 16, 17]. In the USA rates of 1.6% to 17% (New Jersey)
have been reported [17, 18]. In South America and Asia
A. phagocytophilum has been identified in ticks [20].
Epidemiologic studies evaluating the seroprevalence (rarely PCR prevalence) of A. phagocytophilum in dogs have
been performed worldwide (Table 1, 2). In Southwest
Germany the seroprevalence in dogs was 50% (n=1124
dogs) [21], whereas in a study from Northwest Germany
it was 43% (n=111 dogs) [22] and in Northeast Germany
45% (n=522 dogs) [23]. In another study from Germany,
the seroprevalence was 22% (n=5881 dogs), however, for
this study a different test system (ELISA) was used [24].
The percentage of healthy dogs and dogs suspicious for
anaplasmosis which were seropositive was not significantly different in two studies from Germany [22, 23]. CBC
results were compared between 88 seropositive and 144
seronegative clinically healthy dogs. Seropositive dogs did
not reveal any more hematological abnormalities than
seronegative dogs. Moreover, in 10 clinically healthy dogs
with positive PCR results the hematological parameters
were within the reference range [23].
This suggests that subclinical or mild disease and silent
elimination might be common. Subclinical infection has
been confirmed in experimental studies in sheep as well
as in horses [25, 26].
In several studies seropositivity of dogs correlated with
increasing age reflecting an increased likelihood of exposure over time [23, 27, 28]. Other risk factors might
include annual seasons and coinfection with other vectorborne pathogens, e.g. Borrelia burgdorferi. B. burgdorferi
and A. phagocytophilum, which are transmitted by the
same Ixodid tick species, may enhance one another’s
pathogenicity [29].
Serological cross-reactivity between A. phagocytophilum
and other related species such as A. platys, E. canis, E.
ewingii and E. chaffeensis has been reported in various
studies [20, 30]. Since none of these Ehrlichia spp. are
endemic in Germany it is very unlikely that the high prevalence in Germany is based on cross-reactivity. However,
cross-reactivity with other non-ehrlichial species (e.g.
Coxiella burnettii) might occur [31].
Five genetic variants of A. phagocytophilum with 1-2
nucleotide differences in the 16S rRNA gene sequences
have been detected [32]. 16S rRNA and DNA sequences
of Swiss and Swedish canine isolates showed a 100%
homology with human isolates [33, 34]. Currently it is
not known if the genetic variation might be responsible
for an altered pathogenicity of different strains of A.
phagocytophilum. In a study on genetic diversity of canine
A. phagocytophilum infections in Germany, 45 dogs with
A. phagocytophilum infection, as detected by real-time PCR,
were included. So far, 7 16S rRNA and 5 msp2 gene types
were found differing in up to 8 nucleotide positions, indicating that different strains of A. phagocytophilum may be
involved in canine anaplasmosis in Germany [35].
Diagnosis
The diagnostic criteria for human granulocytic anaplasmosis are clinical signs and laboratory findings suggestive of
granulocytic anaplasmosis together with either 1) detection of morulae within neutrophils (rarely eosinophils)
on blood smears combined with a single positive reciprocal antibody titer to A. phagocytophilum (or a positive PCR
result); 2) a 4-fold increase or decrease in the antibody
Table 1
Prevalence of infections with A. phagocytophilum in dogs from Europe
(IFAT = indirect immune fluorescent antibody test, ELISA = enzyme-linked immunosorbent assay, PCR = polymerase chain reaction)
Country
Number of
tested dogs (n)
Prevalence (%)
Method
Reference
Germany
1124
50
IFAT
Barutzki et al, 200621
111
43
6
IFAT
PCR
Jensen et al., 200722
5881
22
SNAP 4Dx®
Test (ELISA)
Krupka et al., 200824
245
19
IFAT
Schaarschmidt-Kiener and Müller, 200736
522
43
6
IFAT
PCR
Pfister et al, 200823
344
460
0
0
PCR
PCR
de la Fuente et al., 200637
Solano-Gallego et al., 200638
5634
1232
33
9
IFAT
IFAT
Torina and Caracappa, 200639
Ebani et al., 200840
Poland
192
1
PCR
Skotarczak et al., 200441
Portugal
55
55
0
IFAT
PCR
Santos et al., 200942
Austria
1470
611
246
996
57
18
21
8
IFAT
IFAT
IFAT
IFAT
Kirtz et al., 200728
Egenvall et al., 200027
Jäderlund et al., 200743
Pusterla et al., 199813
Spain
649
466
16
12
IFAT
IFAT
Amusategui et al., 200844
Solano-Gallego et al., 200645
UK
120
1
PCR
Shaw et al., 200546
Italy
Sweden
Switzerland
39
table 2
prevalence of infections with A. phagocytophilum in dogs from usa
(IFAT = indirect immune fluorescent antibody test, ELISA = enzyme-linked immunosorbent assay, PCR = polymerase chain reaction)
Region
Number of
tested dogs (n)
Prevalence (%)
Method
Reference
Connecticut
New York
106 (sick)
9
IFAT
Western Blot
Magnarelli et al., 199747
California
1082 (healthy)
9
IFAT
Foley et al., 200148
California
182
40
8
IFAT
PCR
Henn et al., 200749
Minnesota
731 (642 sick,
89 healthy)
55
10 (of 273)
ELISA
(SNAP 4Dx)
PCR
Beall et al., 200850
New York
32 (sick)
31
38
34
IFAT
Western Blot
ELISA
Magnarelli et al., 200151
North Carolina
Virginia
1845 (sick)
1
IFAT
Suksawat et al., 200052
Oklahoma
257
33
IFAT
Rodgers et al., 198953
Rhode Island
277
14
IFAT
Hinrichsen et al., 200154
USA
479640
5
ELISA
Bowman et al., 200930
titer within 4 weeks; 3) a positive PCR test result using
specific A. phagocytophilum primers, or 4) isolation of
A. phagocytophilum from blood. These criteria can also be
applied to dogs and other species, however, bacterial isolation is not routinely used for diagnosis [7, 55].
Antibody testing can be performed by IFAT or ELISA; an
accurate and reliable serological diagnosis is limited by
the lack of standardization between diagnostic laboratories and tests [56]. In 18 dogs with anaplasmosis, conflicting test results using IFAT and ELISA 4Dx were found in
39% of the dogs [57]. Since the seroprevalence is high in
endemic areas, a diagnosis cannot be based on a single
positive titer (which may only reflect previous exposure). Antibody titers may persist for several months; in
humans seropositivity was detected for as long as 3 years
after infection [7]. But serology remains useful for documenting exposure to a vector-borne organism or disease
surveillance [56]. During acute illness, antibodies may
not yet be apparent and healthy dogs can be seropositive
[57]. A four times or higher increase in antibody titer is
essential to confirm the diagnosis. Paired serum specimens taken at least two to three or more weeks apart are
considered to be most helpful for evaluation (Center for
40
Disease Control, USA). Cross reactions of antibodies do
occur to some extent with other Anaplasma, Ehrlichia and
Neorickettsia species.
Conventional and real-time PCR assays have been developed for the detection of A. phagocytophilum DNA in
peripheral blood, buffy coat, bone marrow, cerebrospinal
fluid and splenic tissue. The targets of the assays have
been either the 16S rRNA gene, or the outer surface protein genes, such as msp2. Assays based on the msp2 gene
are usually specific for A. phagocytophilum, whereas assays
based on the 16S rRNA gene may detect other Anaplasma
species or even other bacteria. In experimentally infected
dogs, PCR tests on whole blood were positive for 6-8
days before and 3 days after morulae appeared on blood
smears [58, 59].
clinical disease
A. phagocytophilum is the causative agent of diseases such
as canine, feline, equine and human granulocytic anaplasmosis, and of tick-borne fever in ruminants [60, 61].
Anaplasmosis is recognised as an ”emerging disease“ in
animals, mainly due to the increasing distribution of its
vector populations.
Most dogs naturally infected with A. phagocytophilum
probably remain healthy as indicated by the high number of seropositive dogs compared to dogs with clinical
disease.
The seasonality and geographic distribution of the disease
in people and domestic animals worldwide follows that of
its Ixodes spp. vectors [20]. In a recently published canine
study from Germany nearly all cases were diagnosed
between April and September [57]. In other studies, seasonality has also been described. However, the months
varied, which may be due to different time periods during
which the vectors are active or climatic differences depending on the various geographical locations [62, 63, 64, 65].
Experimental infections with A. phagocytophilum have
been performed in Sweden [9, 66] and the USA [67].
A natural infection with A. phagocytophilum was first identified in dogs in California in 1982 [68]. In more recent
years numerous case reports from Austria [69], Canada
[70], Switzerland [71], the UK [72], the USA [68, 73, 74]
and a few clinical studies from Germany [57], Italy [62],
Slovenia [75], Sweden [64], and the USA [63, 65, 76, 77]
have been published.
There are differences between these clinical studies;
mainly with regard to the exclusion of other infectious
agents and the extent of hematological and biochemical
examinations.
Various studies have presented different results regarding the tick exposure observed by owners. For example,
tick infestation was not described for any of the dogs
examined by Poitout et al. [77].In a Swedish study, tick
exposure was described for 13 of 14 dogs [64]. In a study
from Germany, 80% of the owners had observed infestation with ticks [57]. Most dogs are usually diagnosed
during the acute stage of disease and the disease appears
to be self-limiting [57]. In a recent paper the duration of
illness prior to diagnosis was more than 7 days for 25%
of the dogs [65].
An age, sex or breed predisposition has not been described
[57, 65].
The majority of dogs with A. phagocytophilum infections
have nonspecific signs of illness. The most common
clinical signs are lethargy, inappetance/anorexia, fever,
reluctance to move, lameness (due to polyarthritis), a
tense abdomen, tachypnea, diarrhea, vomiting, petechiae,
lymphadenopathy, coughing, pale mucous membranes,
melena, epistaxis, and lateral recumbency [57, 62, 65, 77].
It has been reported that dogs may also exhibit CNS signs
[20, 63, 74]. In one retrospective study with 248 dogs with
disorders of the nervous system, there was no apparent
association between neurological signs and infection [43].
In a recent study from Sweden neither A. phagocytophilum
nor B. burgdorferi sensu lato were identified in dogs with
inflammatory diseases of the CNS [78].
Splenomegaly diagnosed by radiography and sonography
was present in all dogs of one study [57]. Seven dogs
infected experimentally were examined pathologically;
the spleens of all these dogs were slightly to moderately
enlarged and congested with a somewhat fleshy consistency. Microscopically, the spleens showed reactive
hyperplasia with enlarged activated lymph nodules and
increased numbers of macrophages and plasma cells in
the red pulp [7].
In 2 studies nearly all dogs with anaplasmosis had thrombocytopenia [57, 65]. Thrombocytopenia was severe (<
50,000/µl) in 52% of the patients [65]. Mild to moderate
thrombocytopenia is common in humans and animals
infected by a wide range of Ehrlichia spp. [64, 79, 80]. It
may be attributed to increased platelet consumption due
to disseminated intravascular coagulation, sequestration
in an enlarged spleen, immunologically mediated platelet
destruction or production of inhibitory factors [81, 82,
83]. In humans infected with A. phagocytophilum, up to
80% of patients had positive antiplatelet antibody test
results [81]. In one study 60% of the dogs tested positive in the platelet-bound antibody test [57]. However,
in mice, experimentally infected with A. phagocytophilum,
equivalent levels of thrombocytopenia were observed in
splenectomized and non-splenectomized animals, as well
as in mice with intact immune systems and those with
severe combined immunodeficiency. Immune-mediated
destruction as well as splenic sequestration seem less
likely based on this study [84]. A. phagocytophilum was
able to infect cells of the megakaryocyte lineage but such
infection did not alter platelet production in cell culture
[85]. Endothelial cells can become infected with A. phagocytophilum, therefore, low platelet counts may be caused
by platelet activation and consumption [86].
Anemia was described in approximately half of the dogs
with granulocytic anaplasmosis [57, 65]. In an experimental study 9 dogs inoculated with A. phagocytophilum
developed mild, normocytic, normochromic anemia
resembling anemia of inflammation [66]. Hemolysis
might be another pathomechanism since dogs with
anemia had also mild hyperbilirubinemia [57]. Antierythrocytic antibodies and agglutination of erythrocytes
have been detected in the sera of dogs infected with a
granulocytic Ehrlichia strain in the USA [76]. In another
study 5 dogs with anemia had negative direct Coombs’
test results [57]. Therefore, the importance of immunemediated erythrocyte destruction in canine anaplasmosis
warrants further study. In the case of dogs with hemorrhage, blood loss can contribute to the anemia.
Abnormal findings of the WBC include (in the order
of occurrence) lymphopenia, neutrophilia, leukocytosis,
leukopenia, monocytosis, lymphocytosis, and neutropenia [57, 62, 64, 65, 77]. Secondary opportunistic
41
infections which have been best documented in ruminants may predispose to leukopenia and impaired neutrophil function [87].
Common abnormal biochemistry findings are increased
liver enzyme activities (mainly ALP), hyperbilirubinemia, hypokalemia as well as hyperproteinemia, hyperglobulinemia and hypoalbuminemia [57, 62, 64, 65,
77]. During an acute phase reaction, hepatic production
of albumin is decreased and that of α- and β-globulins is
increased, which might explain the presence of hypoalbuminemia and hyperglobulinemia [88].
Differences in clinical presentation and laboratory abnormalities between different countries may be caused by
strain differences of A. phagocytophilum.
outcome
Most dogs with CGA are treated with doxycycline for 2-4
weeks and recover; very few dogs die [57, 62, 64, 65, 77].
In dogs in which immune-mediated disease (e.g, reactive
polyarthritis, secondary immune-mediated thrombocytopenia) was suspected, prednisolone was administered
in addition to doxycycline in one study [57].
Whether A. phagocytophilum can persist in tissues and
organs needs further investigation. In an experimental
study, glucocorticoid treatment of dogs up to 6 months
after A. phagocytophilum infection led to positive PCR
results and reappareance of morulae [58]. In a second
study, persistent infections were established in 2 dogs
using a human isolate of cultivated A. phagocytophilum.
Both animals were positive on all PCR assays. As seen
with Ehrlichia canis and A. marginale infections, doxycycline therapy did not eliminate the organism in these
infected dogs [67].
In one study, all dogs that were re-tested 2 to 8 weeks
after treatment had negative PCR test results using EDTAanticoagulated blood and no morulae were detected in
neutrophils [57]. However, dogs were not evaluated after
8 weeks and thus it is possible that infection in these dogs
may have persisted at a level below the one required for
detection or may have persisted in organs such as bone
marrow, liver or spleen [58].
Prevention
No vaccine is available to prevent A. phagocytophilum
infection.
Prevention in endemic areas can be accomplished by
maintaining strict tick control programs for dogs. A thorough check for the presence of ticks should be performed,
and the dogs should be treated with acaricides [80].
One possibility to prevent tick infestation is the application of imidacloprid-permethrin (Advantix®). In an experimental study, a group of eight beagles was treated with
a combination of imidacloprid and permethrin before
42
being exposed to Ixodes scapularis ticks naturally infected
with A. phagocytophilum. None of these dogs seroconverted [89]. An appropriate prophylactic administration
of Advantix® during the tick season protected 96% of the
dogs living in areas with high Ixodes ricinus populations
from A. phagocytophilum infection. 43% of the dogs which
had not been treated, or treated at irregular intervals, or
with drugs ineffective against ticks seroconverted [90].
References
1.
dumler Js, barbet aF, bekker cp, et al.: Reorganization of genera in the families Rickettsiaceae
and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia
with Anaplasma, Cowdria with Ehrlichia and
Ehrlichia with Neorickettsia, descriptions of
six new species combinations and designation of Ehrlichia equi and ‘HGe agent’ as subjective synonyms of Ehrlichia phagocytophila.
Int J Syst Evol Microbiol 2001, 51:2145-2165.
2. pusterla n, pusterla Jb, braun u, et al.: experimental
cross-infections with Ehrlichia phagocytophila
and human granulocytic ehrlichia-like agent
in cows and horses. Vet Rec 1999, 145:311-314.
3. carrade d, Foley JF, borjesson dl et al.: canine
Granulocytic Anaplasmosis: A Review. J Vet
Intern Med 2009, 23:1129-1141.
4. blanco Jr, oteo Ja: Human granulocytic ehrlichiosis in europe. Clin Microbiol Infect 2002, 8:763-772.
5. cao Wc, Zhao QM, Zhang pH, et al.: Granulocytic
ehrlichiae in Ixodes persulcatus ticks from an
area in china where Lyme disease is endemic. J Clin Microbiol 2000, 38:4208-4210.
6. richter pJ, Kimsey rb, Madigan JE, et al:. Ixodes pacificus (Acari: Ixodidae) as a vector of Ehrlichia
equi (Rickettsiales: ehrlichieae). J Med Entomol
1996, 33:1-5.
7. bakken Js, dumler s: Human granulocytic anaplasmosis. Infect Dis Clin North Am 2008, 22:443-448.
8. Galke D, Beelitz P, Pfister K, et al.: Untersuchungen
zur caninen granulozytären Anaplasmose. in
Proceedings of the 16. Jahrestagung der FG „Innere Medizin
und klinische Labordiagnostik“ der DVG, Gießen 2008.
9. Egenvall a, bjöersdorff a, lilliehöök i, et al.: early
manifestations of granulocytic ehrlichiosis
in dogs inoculated experimentally with a
Swedish Ehrlichia species isolate. Vet Rec 1998,
143:412-417.
10. Horowitz HW, Kilchevsky E, Haber s, et al.: Perinatal
transmission of the agent of human granulocytic ehrlichiosis. N Engl J Med 1998, 339:375-378.
11. pusterla n, braun u, Wolfensberger c, et al.: Intrauterine infection with Ehrlichia phagocytophila in a cow. Vet Rec 1997, 141:101-102.
12. plier Ml, breitschwerdt Eb, Hegarty bc, et al.: Lack of
evidence for perinatal transmission of canine
granulocytic anaplasmosis from a bitch to
her offspring. J Am Anim Hosp Assoc 2009, 45:232-238.
13. pusterla n, Huder Jb, lutz H, et al.: Detection of
Ehrlichia phagocytophila DnA in Ixodes ricinus ticks from areas in Switzerland where
tick-borne fever is endemic. J Clin Microbiol 1998,
36:2735-2736.
14. skarphedinsson s, lyholm bF, ljungberg M, et al.:
Detection and identification of Anaplasma
phagocytophilum, Borrelia burgdorferi, and
Rickettsia helvetica in Danish Ixodes ricinus
ticks. Apmis 2007, 115:225-230.
15. leonhard s: Untersuchungen zur Häufigkeit
von Borrelia burgdorferi sensu lato, Anaplasma phagozytophilum und Babesia spp. in
Ixodes ricinus aus Bayern und Baden-Württemberg. Vet Med Dissertation, lMu München: 2005.
16. pichon b, Kahl o, Hammer b, et al.: Pathogens and
host DnA in Ixodes ricinus nymphal ticks
from a German forest. Vector Borne Zoonotic Dis
2006, 6:382-388.
17. silaghi c, Gille, J, Hohle M, et al:. Anaplasma phagocytophilum infection in Ixodes ricinus, Bavaria,
Germany. Emerg Infect Dis 2008, 14:972-974.
18. Fang QQ, Mixson tr, Hughes tr, et al.: Prevalence
of the agent of human granulocytic ehrlichiosis in Ixodes scapularis (Acari: Ixodidae) in
the coastal southeastern United States. J Med
Entomol 2002, 39:251-255.
19. Varde s, beckley J, schwartz i: Prevalence of tickborne pathogens in Ixodes scapularis in a rural
new Jersey county. Emerg Infect Dis 1998, 4:97-99.
20. Greig b, armstrong pJ: canine Granulocytotropic
Anaplasmosis (A. phagocytophilum Infection).
in. Infectious Diseases of the Dog and Cat. Edited by
Greene cE. st. louis: Elsevier saunders; 2006:219-224.
21. barutzki d, de nicola a, Zeziola M, et al:. Seroprevalence of Anaplasma phagocytophilum infection
in dogs in Germany. Berl Munch Tierarztl Wochenschr
2006, 119:342-347.
22. Jensen J, simon d, Escobar HM, et al.: Anaplasma
phagocytophilum in dogs in Germany. Zoonoses
Public Health 2007, 54:94-101.
23. Pfister K, Galke D, Fumi C, et al.: Prevalence of
Anaplasma (A.) phagocytophilum infection in
dogs in Germany. in Proceedings of the 21st International Conference of the World Association for the Advancement of Veterinary Parasitology, Ghent 2007.
24. Krupka i, pantchev n, lorentzen l, et al.: Prävalenz
von Antikörpern gegen Borrelia burgdorferi
sensu lato, Anaplasma phagozytophilum und
Ehrlichia canis bei Hunden in Deutschland. in
Proceedings of the 16. Jahrestagung der FG „Innere Medizin
und klinische Labordiagnostik“ der DVG, Gießen 2008.
25. Madigan JE, richter pJ, Jr., Kimsey rb, et al.: transmission and passage in horses of the agent
of human granulocytic ehrlichiosis. J Infect Dis
1995, 172:1141-1144.
26. stuen s, artursson K, olsson Engvall E: experimental
infection of lambs with an equine granulocytic ehrlichia species resembling the agent
that causes human granulocytic ehrlichiosis
(HGe). Acta Vet Scand 1998, 39:491-497.
27. Egenvall a, bonnett bn, Gunnarsson a, et al.: Seroprevalence of granulocytic Ehrlichia spp. and
Borrelia burgdorferi sensu lato in Swedish
dogs 1991-94. Scand J Infect Dis 2000, 32:19-25.
28. Kirtz b, czettel b, thum d, et al.: Anaplasma phagozytophilum in einer österreichischen Hundepopulation: eine Prävalenz-Studie (20012006). Kleintierpraxis 2007, 52:562-568.
29. nyarko E, Grab dJ, dumler Js: Anaplasma phagocytophilum-infected neutrophils enhance
transmigration of Borrelia burgdorferi across
the human blood brain barrier in vitro.
Int J Parasitol 2006, 36:601-605.
30. bowman d, little sE, lorentzen l, et al.: Prevalence
and geographic distribution of Dirofilaria
immitis, Borrelia burgdorferi, Ehrlichia canis,
and Anaplasma phagocytophilum in dogs in
the United States: Results of a national
clinic-based serologic survey. Vet Parasitol 2009,
160:138-148.
31. santos as, alexandre n, sousa r, et al.: Serological
and molecular survey of Anaplasma species
infection in dogs with suspected tickborne
disease in Portugal. Vet Rec 2009, 164:168-171.
32. poitout FM, shinozaki JK, stockwell pJ, et al.: Genetic
variants of Anaplasma phagocytophilum infecting dogs in western Washington State.
J Clin Microbiol 2005, 43:796-801.
33. pusterla n, Huder J, Wolfensburger c: Granulocytic
ehrlichiosis in two dogs in Switzerland. J Clin
Microbiol 1997, 35:2307-2309.
34. Johansson KE, pettersson b, uhlen M, et al.: Identification of the causative agent of granulocytic
ehrlichiosis in Swedish dogs and horses by
direct solid phase sequencing of PcR products. Res Vet Sci 1995, 58:109-112.
35. silaghi c, Kohn b, Kunow F, et al.: Molecular differentiation of Anaplasma phagocytophilum
involved in canine infections in Germany. in
Proceedings of the 22nd International Conference of the
World Association for the Advancement of Veterinary Parasitology; calgary, 2009; 13:114.
36. schaarschmidt-Kiener d, Müller W: Labordiagnostische und klinische Aspekte der caninen
Anaplasmose und ehrlichiose. Tierärztl Prax
2007, 35:129-136.
43
37. de la Fuente J, torina a, naranjo V, et al.: Molecular
characterization of Anaplasma platys strains
from dogs in Sicily, Italy. BMC Vet Res 2006, 2:24.
38. solano-Gallego l, trotta M, razia l: Molecular survey of Ehrlichia canis and Anaplasma phagocytophilum from blood of dogs in Italy. Ann N Y
Acad Sci 2006, 1078:515-518.
39. torina a, caracappa s: Dog tick borne diseases in
Sicily. Parassitologia 2006, 48:145-147.
40. Ebani V, cerri d, Fratini F, et al.: Seroprevalence of
Anaplasma phagocytophilum in domestic and
wild animals from central Italy. New Microbiol
2008, 31:371-375.
41. skotarczak b, adamska M, rymaszewska a, et al.:
Anaplasma phagocytophila and protozoans
of Babesia genus in dogs from endemic areas
of Lyme disease in north-western Poland.
Wiadomosci Parazytologiczne 2004, 50:555-561.
42. santos as, alexandre n, sousa r, et al.: Serological
and molecular survey of Anaplasma species
infection in dogs with suspected tickborne
disease in Portugal. Vet Rec 2009, 164:168-171.
43. Jäderlund KH, Egenvall a, bergström K, et al.: Seroprevalence of Borrelia burgdorferi sensu lato
and Anaplasma phagocytophilum in dogs with
neurological signs. Vet Rec 2007, 160:825-831.
44. amusategui i, tesouro Ma, Kakoma i, et al.: Serological reactivity to Ehrlichia canis, Anaplasma
phagocytophilum, Neorickettsia risticii, Borrelia burgdorferi and Rickettsia conorii in dogs
from northwestern Spain. Vector Borne Zoonotic
Dis 2008, 8:797-803.
45. solano-Gallego l, llull J, osso M, et al.: A serological study of exposure to arthropod-borne
pathogens in dogs from northeastern Spain.
Vet Res 2006, 37:231-244.
46. shaw sE, binns sH, birtles MJ, et al.: Molecular evidence of tick-transmitted infections in dogs
and cats in the United Kingdom. Vet Rec 2005,
157:645-648.
47. Magnarelli la, ijdo JW, anderson JF, et al.: Antibodies to Ehrlichia equi in dogs from the northeastern United States. J Am Vet Med Assoc 1997,
211:1134-1137.
48. Foley JE, Foley p, Madigan JE: Spatial distribution
of seropositivity to the causative agent of
granulocytic ehrlichiosis in dogs in california. Am J Vet Res 2001, 62:1599-1605.
49. Henn Jb, Gabriel MW, Kasten rW, et al.: Gray foxes
(Urocyon cinereoargenteus) as a potential
reservoir of a Bartonella clarridgeiae-like
bacterium and domestic dogs as part of a
sentinel system for surveillance of zoonotic
arthropod-borne pathogens in northern
california. J Clin Microbiol 2007, 45:2411-2418.
44
50. beall MJ, chandrashekar r, Eberts Md, et al.: Serological and molecular prevalence of Borrelia
burgdorferi, Anaplasma phagocytophilum, and
Ehrlichia species in dogs from Minnesota.
Vector Borne Zoonotic Dis 2008, 8:455-464.
51. Magnarelli la, ijdo W, van andel aE, et al.: Reactivity
of serum samples of dogs and horses tested
by use of class-specific recombinant-based
enzyme-linked immunosorbent assays for
detection of granulocytic ehrlichiosis. Am J Vet
Res 2001, 62:1365-1369.
52. suksawat J, Hegarty bc, breitschwerdt Eb: Seroprevalence of Ehrlichia canis, Ehrlichia equi, and
Ehrlichia risticii in sick dogs from north
carolina and Virginia. J Vet Intern Med 2000,
14:50-55.
53. rodgers sJ, Morton rJ, baldwin ca: A serological
survey of Ehrlichia canis, Ehrlichia equi,
Rickettsia rickettsii, and Borrelia burgdorferi
in dogs in oklahoma. J Vet Diagn Invest 1989,
1:154-159.
54. Hinrichsen Vl, Whitworth uG, breitschwerdt Eb, et al.:
Assessing the association between the geographic distribution of deer ticks and seropositivity rates to various tick-transmitted
disease organisms in dogs. J Am Vet Med Assoc
2001, 218:1092-1097.
55. bjöersdorff a: ehrlichiosis and Anaplasmosis,
Part 2: Anaplasma phagocytophilum comb.
nov. infection. in Arthropod-borne infectious diseases
of the dog and cat. Edited by shaw s, day M. london:
Manson publishing; 2005:120-133.
56. Maggi rG: the Use of Molecular Diagnostic
techniques to detect Anaplasma, Bartonella
and Ehrlichia Species in Arthropods or
Patients. in Proceedings of the International CVBD
Symposium, billesley, alcester, uK 2006:8-13.
57. Kohn b, Galke d, beelitz p, et al.: clinical features of
canine granulocytic anaplasmosis in 18 naturally infected dogs. J Vet Intern Med 2008, 22:12891295.
58. Egenvall a, lilliehöök i, bjöersdorff a, et al.: Detection of granulocytic Ehrlichia species DnA by
PcR in persistently infected dogs. Vet Rec 2000,
146:186-190.
59. pusterla n, pusterla n, chae Js, et al.: one-tube PcR
for the detection of the Ehrlichia phagocytophila genogroup. Vet Rec 2000, 147:22-23.
60. parola p: tick-borne rickettsial diseases:
emerging risks in europe. Comp Immunol Microbiol
Infect Dis 2004, 27:297-304.
61. Pfister K, Roesti A, Boss PH, et al.: Ehrlichia phagozytophila als Erreger des „Weidefiebers“ in
dem Berner oberland. schweiz. Arch Tierheilkd
1987,129:343-347.
62. tarello W: canine granulocytic ehrlichiosis
(cGe) in Italy. Acta Vet Hung 2003, 51:73-90.
63. Greig b, asanovich KM, armstrong pJ, et al.: Geographic, clinical, serologic, and molecular
evidence of granulocytic ehrlichiosis, a likely
zoonotic disease, in Minnesota and Wisconsin dogs. J Clin Microbiol 1996, 34:44-48.
64. Egenvall aE, Hedhammar aa, bjöersdorff ai: clinical
features and serology of 14 dogs affected by
granulocytic ehrlichiosis in Sweden. Vet Rec
1997, 140:222-226.
65. Granick Jl, armstrong pJ, bender Jb: Anaplasma
phagocytophilum infection in dogs: 34 cases
(2000-2007). J Am Vet Med Assoc 2009, 234:1559-1565.
66. lilliehöök i, Egenvall a, tvedten HW: Hematopathology in dogs experimentally infected with
a Swedish granulocytic Ehrlichia species. Vet
Clin Pathol 1998, 27:116-122.
67. alleman ar, chandrashaker r, beall M, et al.: experimental inoculation of dogs with a human
isolate (ny18) of Anaplasma phagocytophilum
and demonstration of persistent infection
following doxycycline therapy. in Procedings of
thr 24th ACVIM Forum, louisville, Kentucky 2006.
68. Madewell b, Gribble d: Infection in two dogs with
an agent resembling Ehrlichia equi. J Am Vet Med
Assoc 1982, 180:512-514.
69. Kirtz G, Meli M, leidinger E, et al.: Anaplasma
phagocytophilum infection in a dog: identifying the causative agent using PcR. J Small Anim
Pract 2005, 46:300-303.
70. lester sJ, breitschwerdt Eb, collis cd, et al.: Anaplasma phagocytophilum infection (granulocytic anaplasmosis) in a dog from Vancouver
Island. Can Vet J 2005, 46:825-827.
71. pusterla n, Huder J, Wolfensberger c, et al.: Granulocytic ehrlichiosis in two dogs in Switzerland.
J Clin Microbiol 1997, 35:2307-2309.
72. Bexfield NH,Villiers EJ, Herrtage ME: Immunemediated haemolytic anaemia and thrombocytopenia associated with Anaplasma
phagocytophilum in a dog. J Small Anim Pract 2005,
46:543-548.
73. arsenault WG, Messick Jb: Acute granulocytic
ehrlichiosis in a rottweiler. J Am Anim Hosp Assoc
2005, 41:323-326.
74. Maretzki cH, Fisher dJ, Greene cE: Granulocytic
ehrlichiosis and meningitis in a dog. J Am Vet
Med Assoc 1994, 205:1554-1556.
75. tozon n, petrovec M, avsic-Zupanc t: clinical and
laboratory features of the first detected
cases of A. phagocytophila infections in dogs
from Slovenia. Ann N Y Acad Sci 2003, 990:424-428.
76. Goldman EE, breitschwerdt Eb, Grindem cb, et al.:
Granulocytic ehrlichiosis in dogs from
north carolina and Virginia. J Vet Intern Med
1998, 12:61-70.
77. poitout FM, shinozaki JK, stockwell pJ, et al.: Genetic
variants of Anaplasma phagocytophilum infecting dogs in Western Washington State.
J Clin Microbiol 2005, 43:796-801.
78. Jäderlund KH, bergström K, Egenvall a, et al.: cerebrospinal fluid PCR and antibody concentrations against Anaplasma phagocytophilum
and Borrelia burgdorferi sensu lato in dogs
with neurological signs. J Vet Intern Med 2009,
23:669-672.
79. Woody bJ, Hoskins Jd: ehrlichial diseases of dogs.
Vet Clin North Am Small Anim Pract 1991, 21:75-98.
80. neer tM, breitschwerdt Eb, Greene rt, et al.: consensus statement on ehrlichial disease of small
animals from the infectious disease study
group of the AcVIM. J Vet Intern Med 2002, 16:309315.
81. Wong sJ, thomas Ja: cytoplasmic, nuclear, and
platelet autoantibodies in human granulocytic ehrlichiosis patients. J Clin Microbiol 1998,
36:1959-1963.
82. smith rd, ristic M, Huxsoll dl, et al.: Platelet
kinetics in canine ehrlichiosis: evidence for
increased platelet destruction as the cause
of thrombocytopenia. Infect Immun 1975,
11:1216-1221.
83. Waner t, Harrus s, Weiss dJ, et al.: Demonstration
of serum antiplatelet antibodies in experimental acute canine ehrlichiosis. Vet Immunol
Immunopathol 1995, 48:177-182.
84. borjesson dl, simon si, tablin F, et al.: thrombocytopenia in a mouse model of human granulocytic ehrlichiosis. J Infect Dis 2001, 184:1475-1479.
85. Granick Jl, reneer dV, carlyon Ja, et al.: Anaplasma
phagocytophilum infect cells of the megakaryocytic lineage through sialylated ligands
but fails to alter platelet production. J Med
Microbiol 2008, 57:416-423.
86. Munderloh uG, lynch MJ, Herron MJ, et al.: Infection
of endothelial cells with Anaplasma marginale and A. phagocytophilum. Vet Microbiol 2004,
101:53-64.
87. Foggi a: the effect of tick-borne fever on the
resistance of lambs to staphylococci. J Comp
Pathol 1956, 66:278-285.
88. Eckersall p: Acute phase proteins as markers
of inflammatory lesions. Comp Hematol Int 1995,
93-97.
89. blagburn bl, spencer Ja, billeter sa, et al.: Use of
imidacloprid-permethrin to prevent transmission of Anaplasma phagocytophilum from
naturally infected Ixodes scapularis ticks to
dogs. Vet Ther 2004, 5:212-217.
90. Pfister K, Galke D, Beelitz P, et al.: the effect of a
monthly imidacloprid-permethrin treatment
against Ixodes ricinus on the seroprevalence
of Anaplasma phagocytophilum in dogs. in Proceedings of the 21st International Conference of the World
Association for the Advancement of Veterinary Parasitology,
Ghent 2007.
45
IDENTIFICATION AND OCCURRENCE OF BORRELIA
BURGDORFERI GENOSPECIES IN IXODES RICINUS
TICKS FROM THE MAIN LYME BORRELIOSIS
ENDEMIC AREA OF ITALY
GIOIA CAPELLI1, SILVIA RAVAGNAN1, FABRIZIO MONTARSI1, ALICE FUSARO1, PIETRO ARIANI1,
RUDI CASSINI2, MARCO MARTINI3, ANNA GRANATO1
ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLE VENEZIE, LEGNARO (PD), ITALY
DEPARTMENT OF EXPERIMENTAL VETERINARY SCIENCE, UNIVERSITY OF PADUA, ITALY
3
DEPARTMENT OF PUBLIC HEALTH, COMPARATIVE PATHOLOGY AND VETERINARY HYGIENE, UNIVERSITY OF PADUA, LEGNARO (PD), ITALY
1
2
EMAIL: GCAPELLI@IZSVENEZIE.IT
Background
Spirochetes of the genospecies complex Borrelia burgdorferi sensu lato (s.l.) cause Lyme borreliosis (LB), the most
common vector-borne zoonotic disease in the Northern
Hemisphere [1, 2]. In Europe, infection is transmitted
to vertebrate hosts primarily by the tick species Ixodes
ricinus.
North-eastern Italy is a known endemic area for LB and
accounts for more than 90% of human cases in the
country [3, 4]. Four spirochete genospecies are currently
recognized to cause LB in Europe: B. burgdorferi s.s., B.
afzelii, B. garinii and B. spielmanii [5, 6]. Different clinical manifestations of LB have been associated with these
genospecies [4, 7, 8, 9]. B. garinii is predominantly associated with neurological symptoms, B. afzelii with late
skin manifestations and B. burgdorferi s.s. with arthritis.
Therefore, knowledge of the circulating genospecies can
be useful to assist with diagnosis, prognosis and prevention. The aim of this study was to assess the diversity of
Borrelia genospecies in ticks both in well known foci of LB
as well as sites never before monitored.
Methods
The survey was conducted from 2006 to 2008 in 5 provinces of north-eastern Italy, Vicenza, Verona, Treviso
(Veneto region), Pordenone and Udine (Friuli Venezia
Giulia region). Hilly and pre-alpine areas, presumed
46
suitable habitats for the wood tick I. ricinus, were chosen.
Altitude of the sites ranged from 120 metres above sea
level (masl) to 1308 masl. For each province a permanent
site, monitored monthly and several temporary sites,
monitored once or twice, were sampled using standard
dragging techniques to collect ticks.
806 samples (372 pools of 5 nymphs, 241 pools of 10
larvae and 193 single adults totalling 5388 ticks) were
first screened using real time PCR to investigate the presence of B. burgdorferi s.l. [10]. Positive samples were then
subjected to a more specific PCR [11] and subsequent
amplicon sequencing to determine the genospecies of
B. burgdorferi s.l. For 31 suspected co-infections, four
real-time PCR assays were performed using specifically
designed probes to detect B. burgdorferi s.s., B. afzelii,
B. garinii and B. valaisiana. Phylogenetic analysis of the
sequences from single infections was performed. Rate
of infection was calculated as prevalence for adult ticks
(number of positive ticks/total adults examined x 100),
and as expected rate of infection (ERI) for pooled nymphs.
ERI = 1-(1-x/m)1/k where x = positive pools; m = examined
pools; k = mean number of ticks for each pool [12].
Prevalence or ERI differences in relation to tick stage
(nymphs or adults), origin and year of sampling were
evaluated by means of chi-square test or Fisher’s exact test,
when appropriate.
Results
During the 3 year survey, 66 sites were visited and 5484
ticks were collected from the 5 permanent and 50 temporary sites. Ticks were found at all altitudes and showed an
increasing density going from South to North. The first
screening for LB agents detected 261 positive samples for
Borrelia burgdorferi s.l. and 212 of these were confirmed
by PCR (Fla gene) in ticks collected in 32 sites (58%).
Sequencing revealed the presence of 5 B. burgdorferi genospecies, namely B. afzelii (111 samples, 52.4%), B. garinii
(45 samples, 21.2%), B. valaisiana (43 samples, 20.3%),
B. burgdorferi s.s. (38 samples, 17.9%) and B. lusitaniae
(1 sample, 0.5%). These species have all been previously
detected in Italy in I. ricinus ticks [13, 14, 15, 16, 17, 18,
19, 20]. However, to the Authors knowledge B. lusitaniae
has never been described before in this part of Italy. The
four most prevalent genospecies were found in both
adults and nymphs but B. lusitaniae was detected only in 1
single pool of nymphs. B. afzelii was additionally isolated
from 1 pool of larvae. Overall, the most represented genospecies in nymphs was B. afzelii (except Vicenza province,
where B. garinii was dominant.) and B. valaisiana in
adults. The predominance of B. afzelii in ticks is consistent
with human Italian isolates [7, 16, 21, 22]. The infection
rate for B. burgdorferi s.s., B. garinii and B. valaisiana was
higher in adult ticks than in nymphs but not for B. afzelii
and, interestingly, B. valaisiana was the predominant species in adults. This discrepancy could be a bias of the low
number of adults collected or it may reflect the different patterns of host preference of larvae (more rodentoriented) and nymphs (more bird-oriented). Prevalence
of B. burgdorferi complex was significantly higher in
adults (17.6%) than in nymphs (9.6%) and this difference was constant between years, provinces and for all
the genospecies, except for B. afzelii, which had comparable prevalence in adults and nymphs (5.2% vs 4.75%).
B. afzelii was found in one pool of larvae corresponding
to an ERI of 0.06%.
The four main genospecies were sympatric in the permanent sites of the 3 northern provinces monitored and
were found in sites ranging from 120 to 880 masl.
Phylogenetic analysis showed very limited genetic heterogeneity for strains of B. afzelii and B. valaisiana,
but revealed a higher heterogeneity for B. garinii and
B. burgdorferi s.s. B. garinii was spatially mixed, with different isolates scattered all over the area. On the other
hand, isolates of B. valaisiana were highly homogeneous,
suggesting that these two genospecies, despite being
sympatric, may not share the same bird host population.
An intraspecific geographic structure was not found for
B. afzelii, whereas some B. burgdorferi s.s. isolates were
confined mainly in Udine, the northern area monitored.
These differences underline the influence of the local
host structure [23, 24]. Some temporal prevalence fluctuations were observed, particularly in B. afzelii, with a
significantly higher prevalence in 2006, and B. garinii,
which was absent in adults and decreased in nymphs in
2008. These prevalence fluctuations were not mirrored by
tick density variations, which remained stable throughout
the 3 year study. This fluctuation is likely to be due to the
interaction of several factors directly or indirectly affecting the density of reservoir and dilution hosts. The overall infection rate is very similar of each province (range
9.08%-11.13%), but is significantly higher in adults of
Pordenone (29.79%) than of Udine sites (13.33%). The
epidemiology of genospecies in nymphs is much more
variable. Sympatric genospecies were found in nymphs
in all provinces. In thirteen temporary sites only a single
genospecies was identified. While genospecies diversity was encountered in all provinces, sympatry increased
from southern to northern sites along side tick density.
Conclusions
The results of this study lead to classification of the infection rates of B. burgdorferi s.l. in the monitored area as
low (nymphs, <11%; adults, <20%) compared to Central
and Eastern Europe. However, there are small foci that
are characterized by higher infection rates (up to ∼ 30%),
which when combined with tick density and human land
use can constitute a considerable transmission risk.
The study stresses the importance of vector and vectorborne infection monitoring as a part of a public health
surveillance system in a region. Constant monitoring of a
few permanent sites can give a large amount of information in terms of the diversity of pathogen distribution and
associated ecological interactions. However in this study
the monitoring of temporary sites facilitated the finding
of a new genospecies in this area.
The high heterogeneity of borrelial strains, along with the
varying and high degree of sympatry in the monitored
area, probably has an impact on the variability of Lyme
disease manifestations and clearly poses a challenge to
the interpretation of clinical symptoms and diagnostic
tests and to the development of vaccines.
Acknowledgements
This work was supported by the Italian Ministry of Health
(RC IZS-Ve 07/07).
47
References
1.
derdáková M, lencáková d: Association of genetic
variability within the Borrelia burgdorferi
sensu lato with the ecology, epidemiology of
Lyme borreliosis in europe. Ann Agric Environ Med
2005, 12(2):165-72.
2. steere ac, coburn J, Glickstein l: the emergence
of Lyme disease. J Clin Invest 2004, 113:1093–1101.
3. ciceroni l, ciarrocchi s: Lyme disease in Italy,
1983-1996. New Microbiol 1998, 21(4):407-18.
4. pavan Wo: Local epidemiology and clinical
manifestations of Lyme disease. Int J Med Sci
2009, 6(3):123.
5. baranton G, de Martino sJ: Borrelia burgdorferi
sensu lato diversity and its influence on
pathogenicity in humans. Curr Probl Dermatol
2009, 37:1-17.
6. Gern l, Humair pF: ecology of Borrelia burgdorferi sensu lato in europe. in: Lyme borreliosis:
Biology, Epidemiology and Control. Edited by Gray J, Kahl
o, lane rs, stanek G. Wallingford, oxford, uK, cab
international, 2002.
7. santino i, berlutti F, pantanella F, sessa r, del piano
M: Detection of Borrelia burgdorferi sensu
lato DnA by PcR in serum of patients with
clinical symptoms of Lyme borreliosis. FEMS
Microbiol Lett 2008, 283(1):30-5.
8. Van dam ap, Kuiper H,Vos K, Widjojokusumo a, de
Jongh bM, spanjaard l, ramselaar ac, Kramer Md:
Different genospecies of Borrelia burgdorferi
are associated with distinct clinical manifestations of Lyme borreliosis. Clin Infect Dis 1993,
17:708-717.
9. richter d, postic d, sertour n, livey i, Matuschka Fr,
baranton G: Delineation of Borrelia burgdorferi
sensu lato species by multilocus sequence
analysis and confirmation of the delineation
of Borrelia spielmanii sp. nov. Int J Syst Evol Microbiol 2006, 56:873-881.
10. courtney JW, Kostelnik lM, Zeidner n, Massung rF:
Multiplex real-time PcR for detection of
Anaplasma phagocytophilum and Borrelia
burgdorferi. J Clinical Microb 2004, 42(7):3164-3168.
11. skotarczak b, Wodecka b, cichocka a: coexistence
DnA of Borrelia burgdorferi sensu lato and
Babesia microti in Ixodes ricinus ticks from
north-western Poland. Ann Agric Environ Med 2002,
9(1):25-8.
12. cowling dW, Gardner ia, Johnson Wo: comparison
of methods for estimation of individual-level
prevalence based on pooled samples. Prev Vet
Med 1999, 39:211-25.
48
13. cinco M, padovan d, Murgia r, poldini l, Frusteri l,
van de pol i,Verbeek-de Kruif n, rijpkema s, Maroli M:
Rate of infection of Ixodes ricinus ticks with
Borrelia burgdorferi sensu stricto, Borrelia
garinii, Borrelia afzelii and group VS116 in an
endemic focus of Lyme disease in Italy. Eur J
Clin Microbiol Infect Dis 1998a, 17(2):90-4.
14. cinco M, padovan d, Murgia r, Frusteri l, Maroli M,
van de pol i,Verbeek-de Kruif n, rijpkema s, taggi F:
Prevalence of Borrelia burgdorferi infection
in Ixodes ricinus in central Italy. Eur J Clin Microbiol Infect Dis 1998b, 17(2):134-5.
15. Favia G, cancrini G, carfì a, Grazioli d, lillini E, iori a:
Molecular identification of Borrelia valaisiana
and HGe-like ehrlichia in Ixodes ricinus ticks
sampled in north-eastern Italy: first report
in Veneto region. Parassitologia 2001, 43(3):143-6.
16. santino i, iori a, nicoletti M,Valletta s, cimmino c,
scoarughi Gl, santapaola d, sessa r, del piano M:
Prevalence of Borrelia Burgdorferi sensu
lato genomospecies and of the human
granulocytic ehrlichiosis (HGe) agent in
Ixodes ricinus ticks collected in the area of
Monti Lepini, Italy. Int J Immunopathol Pharmacol
2003, 16(2):105-8.
17. Mannelli a, nebbia p, tramuta c, Grego E, tomassone
l, ainardi r,Venturini l, de Meneghi d, Meneguz pG:
Borrelia burgdorferi sensu lato infection in
larval Ixodes ricinus (Acari:Ixodidae) feeding on blackbirds in northwestern Italy. J Med
Entomol 2005, 42(2):168-75.
18. piccolin G, benedetti G, doglioni c, lorenzato c, Mancuso s, papa n, pitton l, ramon Mc, Zasio c, bertiato
G: A study of the presence of B. burgdorferi,
Anaplasma (previously ehrlichia) phagocytophilum, Rickettsia, and Babesia in Ixodes ricinus collected within the territory of Belluno,
Italy. Vector Borne Zoonotic Dis 2006, 6(1):24-31.
19. Mantelli b, pecchioli E, Hauffe Hc, rosà r, rizzoli a:
Prevalence of Borrelia burgdorferi s.l. and
Anaplasma phagocytophilum in the wood tick
Ixodes ricinus in the Province of trento, Italy.
Eur J Clin Microbiol Infect Dis 2006, 25(11):737-9.
20. pecchioli E, Hauffe Hc, tagliapietra V, bandi c, Genchi c,
rizzoli a: Genospecies of Borrelia burgdorferi
sensu lato in Ixodes ricinus ticks from the
Autonomous Province of trento, Italy. Int J
Med Microbiol 2007, 297(1):53-9.
21. ciceroni l, ciarrocchi s, ciervo a, Mondarini V, Guzzo F,
caruso G, Murgia r, cinco M: Isolation and characterization of Borrelia burgdorferi sensu
lato strains in an area of Italy where Lyme
borreliosis is endemic. J Clin Microbiol 2001,
39(6):2254-60.
22. Floris r, Menardi G, bressan r, trevisan G, ortenzio
s, rorai E, cinco M: evaluation of a genotyping
method based on the ospA gene to detect
Borrelia burgdorferi sensu lato in multiple
samples of lyme borreliosis patients. New
Microbiol 2007, 30(4):399-410.
23. Qiu WG, bosler EM, campbell Jr, ugine Gd, Wang
in, luft bJ, dykhuizen dE: A population genetic
study of Borrelia burgdorferi sensu stricto
from eastern Long Island, new York, suggested frequency-dependent selection,
gene flow and host adaptation. Hereditas 1997,
127:203–216.
24. comstedt p, asokliene l, Eliasson i, olsen b, Wallensten
a, bunikis J, bergström s: complex population
structure of Lyme borreliosis group spirochete Borrelia garinii in subarctic eurasia.
PLoS One 2009, 4(6):e5841.
49
UPDATE ON THE MANAGEMENT OF CANINE
LEISHMANIOSIS
LAIA SOLANO-GALLEGO1, GUADALUPE MIRÓ2, LUIS CARDOSO3, ALEXANDER F KOUTINAS4,
MARIA G PENNISI5, LLUIS FERRER6, PATRICK BOURDEAU7, GAETANO OLIVA8, GAD BANETH9
DEP. PATHOLOGY AND INFECTIOUS DISEASES, ROYAL VETERINARY COLLEGE, UNIVERSITY OF LONDON, UK
DPTO. SANIDAD ANIMAL, FACULTAD DE VETERINARIA, UNIVERSIDAD COMPLUTENSE DE MADRID, SPAIN
3
DEP. DE CIÈNAS VETERINÁRIAS, UNIVERSIDADE DE TRÁS-OS-MONTES E ALTO DOURO, PORTUGAL
4
COMPANION ANIMAL CLINIC, FACULTY OF VETERINARY MEDICINE, ARISTOTLE UNIVERSITY, GREECE
5
DIP. TO SANITÀ PUBLICA VETERINARIA, FACOLTÀ DI MEDICINA VETERINARIA, POLO UNIVERSITARIO ANNUZIATA, MESSINA, ITALY
6
DEP. DE MEDICINA I CIRURGIA ANIMALS, UNIVERSITAT AUTÒNOMA DE BARCELONA, SPAIN
7
ECOLE NATIONALE VETERINAIRE DE NANTES, FRANCE
8
DEP. OF VETERINARY CLINICAL SCIENCES, FACULTY OF VETERINARY MEDICINE, UNIVERSITY OF NAPLES FEDERICO II, ITALY
9
SCHOOL OF VETERINARY MEDICINE, HEBREW UNIVERSITY, ISRAEL
1
2
LeishVet address:
Dpto. Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid,
Spain e-mail: leishvet@vet.ucm.es
CORRESPONDING AUTHORS:
GAD BANETH, SCHOOL OF VETERINARY MEDICINE, HEBREW UNIVERSITY, ISRAEL
LAIA SOLANO-GALLEGO, DEP. PATHOLOGY AND INFECTIOUS DISEASES, ROYAL VETERINARY COLLEGE, UNIVERSITY OF LONDON,UK
Introduction
Canine leishmaniosis (CanL) due to Leishmania infantum
is a major zoonotic disease endemic in more than 70
countries in the world. It is present in regions of Southern
Europe, Africa, Asia, South and Central America [1] and
has recently emerged in the USA [2, 3]. CanL is also
an important concern in non-endemic countries where
imported disease constitutes a veterinary and public
health problem [4, 5]. Dogs are the main reservoir for L.
infantum infection. Phlebotomine sand flies are the proven vectors of L. infantum, the causative agent of CanL in
the Old World and for its New World synonym L. chagasi.
Canine L. infantum infection is changing its boundaries
and spreading north in Europe reaching the foothills of
the Alps in Northern Italy [6].
Transmission of L. infantum from dogs or wildlife animal
reservoirs via sand flies is the main route for human infection. Other less common transmission routes have been
reported in dogs including transmission through blood
products [7, 8] and vertical transplacental transmission
from dam to its offspring [9]. In addition, ticks and fleas
have been proposed as alternative vectors of Leishmania
transmission but evidence of such transmission is lack-
50
ing [10, 11]. Direct transmission without involvement
of a hematophageous vector has been suspected in some
cases of infection in areas where vectors of the disease are
apparently absent [12].
An increased prevalence of Leishmania infection in canine
populations has been associated with increased incidence
of human leishmaniosis [13, 14]. In addition, poor
socioeconomic conditions [13], increased dog density
and ownership of infected dogs are risk factors for infantile human leishmaniosis [15, 16]. Control measures for
CanL include vaccines, topical insecticides, and environmental control of sand flies.
Clinical findings and recommendations for
clinical evaluation
The classical stages of an infectious disease process which
includes an initial infection, an incubation period and a
clinical disease apply only in the minority of dogs that
acquire Leishmania infection [17]. The concept that all dogs
infected with L. infantum will eventually develop severe
clinical leishmaniosis after a variable incubation period
[18, 19] has been disproven. Leishmania infantum infection can elicit a broad spectrum of immune responses and
display a range of clinical manifestations in dogs from a
clinically healthy animal to severe clinical disease [17, 20].
The two opposite extreme poles of this spectrum are characterized by protective immunity that is T cell mediated,
or disease susceptibility associated with the production of
a marked humoral non-protective immune response and a
reduced or depressed cell mediated immunity [1, 21, 22].
Clinical disease can range from a mild papular dermatitis
with specific cellular immunity and low humoral response
[23] to a severe fatal disease with glomerulonephritis
due to immune complex deposition associated with an
extensive humoral response and high parasite loads [24,
27]. Dogs with severe disease or progressing toward overt
disease have high antibody levels, high parasite load in
numerous tissues [28, 29] but decreased or absent leishmanial specific lymphocyte proliferation and delayed
type hypersensitivity (DTH) reaction [30-32]. Conversely,
healthy infected dogs resistant to the development of
clinical disease produce specific lymphocyte proliferation,
strong DTH reaction, variable anti-parasite antibody levels
[30, 33-35] and lower parasite loads when compared with
sick or susceptible dogs [28, 29].
The most common clinical manifestations of CanL include
skin lesions, generalized lymphadenomegaly, progressive weight loss, muscular atrophy, exercise intolerance,
decreased appetite, lethargy, splenomegaly, polyuria and
polydypsia, ocular lesions, epistaxis, onychogryposis,
lameness, vomiting and diarrhea [1]. More rare manifestations of the disease often mimic other disease conditions
and sometimes pose a challenge to the clinician, especially
when presented in non-endemic regions. These more rare
clinical forms include mucosal lesions (oral cavity, tongue
and genital organs), osteolytic and osteoproliferative bone
lesions, joint swelling with erosive or non-erosive polyarthritis [36], chronic hepatitis [37], chronic relapsing colitis
[38], neurological disease due to meningitis and muscle
atrophic myositis or polymyositis [39], autoimmune disorders, pericarditis, systemic vasculitis, thromboembolism
and serum hyperviscosity syndrome [40].
Older terminologies of the disease states have used
the clinical classification of asymptomatic, oligosymptomatic and polysymptomatic dogs [41] based only on
physical examination. This classification has a limited
value because it does not consider clinicopathological
abnormalities and disregards dogs that have widespread
organ dysfunction without apparent visual manifestations [17]. The authors consider a sick dog suffering from
leishmaniosis if it presents with compatible clinical signs
and/or clinicopathological abnormalities and the diagnosis is confirmed by specific tests for the infection [27].
Therefore, even dogs without apparent clinical manifestations typical of leishmaniosis, such as dermal abnormalities, ocular lesions, or epistaxis, are considered sick if they
are hyperglobulinemic, anemic, azotemic or have other
clinicopathological abnormalities due to CanL.
Accurate diagnosis of CanL often requires an integrated
approach (clinicopathological diagnosis and specific laboratory tests) which includes careful documentation of
the clinical history, a thorough physical examination and
several diagnostic tests such as CBC, biochemical profile,
urinalysis, urine protein/creatinine ratio, serum electrophoresis, and a coagulation profile. Imaging of the abdomen by radiographs and ultrasound can assist in raising
the suspicion index for this disease [17, 27].
Specific diagnosis
The most useful diagnostic approaches for investigation
of infection in sick and clinically healthy infected dogs
include detection of serum anti-leishmanial antibodies
by a quantitative serological assay and demonstration
of the parasite DNA in tissues by applying molecular
techniques. In general, good sensitivities and specificities are gained with quantitative serological methods for
the diagnosis of clinical CanL [42]. High antibody titers
are usually associated with disease and a high parasite
density [29, 43] and, for this reason; they are conclusive
of a diagnosis of leishmaniosis. However, the presence of
lower antibody levels is not necessarily indicative of patent disease and needs to be confirmed by other diagnostic methods such as PCR, cytology or histology [27, 42,
44]. Serological cross-reactivity with different pathogens
is possible with some serological tests, especially those
based on whole parasite antigen. Cross reactivity has been
reported with other species of Leishmania [45-47], and
Trypanosoma cruzi [46].
Several PCR assays with various target sequences using
genomic or kinetoplast DNA (kDNA) have been developed for CanL. Assays based on kDNA appear to be the
most sensitive for direct detection in infected tissues [42,
48, 49]. PCR can be performed on DNA extracted from
tissues, blood, biological fluids or from histopathologic
specimens [27]. PCR on bone marrow, lymph node,
spleen or skin is most sensitive and specific for the
diagnosis of CanL [50, 51]. PCR on whole blood, buffy
coat, and urine is less sensitive than the aforementioned
tissues [51, 52]. PCR on aspirates of lymph node and
bone marrow has been shown to be more sensitive than
microscopic detection of amastigotes in stained smears
or parasite culture [53]. Quantitative real-time PCR can
detect extremely low parasitic loads and allows the quantification of Leishmania loads in tissues of infected dogs
which is important for diagnosis as well as for follow-up
during the treatment of CanL [51, 54, 55]. PCR is not
the first confirmatory assay recommended for dogs with
clinical signs suspected of CanL because in endemic areas,
a large portion of the dog population is likely to harbor
51
Leishmania without a clinical disease, or while suffering
from a different medical condition. Since high serological titers are closely associated with clinical disease and
are less frequent among clinically healthy carriers of
Leishmania, quantitative serology would be the first recommended specific assay for the disease [27]. The presence of
Leishmania DNA in the blood or other tissues of clinically
healthy dogs living in endemic areas indicates that these
dogs harbour infection [20] but, they may never develop
clinical disease [56]. The interpretation of PCR results
should be done cautiously in clinically healthy dogs and
with consideration of the diagnostic procedure’s purpose.
For instance, for the purpose of identifying infected dogs
and preventing their importation to non-endemic areas
where infection might spread via local sand fly vectors, or
for the purpose of preventing transmission of infection via
blood products from infected donors, PCR would be an
appropriate technique in combination with quantitative
serological tests. However, the decision to treat clinically
healthy dogs with anti-leishmanial medication based on
positive PCR alone is not recommended [27].
treatment and monitoring
Anti-leishmanial treatment often achieves only clinical improvement in dogs with leishmaniosis and it is
frequently not associated with the elimination of the
parasite [57]. The main drugs used against CanL include
the pentavalent antimony meglumine antimoniate which
selectively inhibits leishmanial glycolysis and fatty acid
oxidation, and allopurinol that acts by inhibiting protein
translation through interfering with RNA synthesis. The
combination of antimony meglumine antimoniate and
allopurinol is the most common treatment protocol used
against CanL in Europe [57]. Miltefosine has recently
been shown to be effective against the disease and it is
recommended as an alternative for meglumine antimoniate in combination with long term allopurinol treatment
[58]. Amphotericin B which acts by binding to ergosterol
in the parasite’s cell membrane and altering its permeability is also used but it is highly nephrotoxic. New drugs
and immunotherapy are also under extensive investigation in dogs [42, 59, 60].
The clinicopathological parameters to be monitored during treatment depend on the individual dog’s abnormalities. It is recommended to perform complete CBC, biochemical profile and urinalysis including urine protein/
creatinine ratio (UPC) in proteinuric dogs. The frequency
of monitoring these parameters would vary for each dog
but, in most cases, monitoring should be carried out
more frequently initially, i.e. after the first month of treatment and then every 3-4 months. If the dog fully recovers
clinically with treatment, then a recheck would be recommended every 6 months [27].
52
Recent studies have demonstrated a slow and progressive
decrease in IgG or IgA antibody levels which is associated
with clinical improvement [61, 62]. Repeating a quantitative serological test in the same laboratory 6 months
after the initial treatment is therefore recommended as a
measure of follow up on the dog’s response to treatment.
Ideally, it would be best to evaluate the antibody kinetics by running sera from the initial and follow-up dates
simultaneously in the same assay. Decrease of IFAT titer
would be considered significant if there is more than a
two fold dilutions difference between the first and the
following sample. Some dogs would present a significant decrease in antibody levels associated with clinical
improvement within six months to one year of treatment
while others might not have a decrease in antibody titers
despite the clinical improvement. However, a marked
increase of antibody levels should be interpreted as a
marker of relapse, especially following the discontinuation of treatment [27].
clinical staging and prognosis
Prognosis for each patient will vary according to its clinicopathological status. A clinical staging system to decide
on the therapy most suitable for each patient and also to
consider a prognosis has been proposed by the LeishVet
group [27, Table 1]. The sick dog is staged at a certain
moment in time but later on, the stage can change as it
deteriorates or improves. The proposed system includes
four clinical stages, based on clinical signs, clinicopathological abnormalities and serological status and is aimed
at replacing the older clinical classification of asymptomatic, oligosymptomatic and polysymptomatic.
The staging proposed by the LeishVet group [27]
includes:
1. Stage I mild disease – Dogs with mild clinical signs
such as peripheral lymphadenopathy or papular dermatitis. There are usually no clinicopathological abnormalities and the antibody level against Leishmania is
negative to low positive. The therapy recommended is simple “scientific neglect” with follow up, or
allopurinol alone, or a course of meglumine antimoniate with allopurinol, or alternatively miltefosine and
allopurinol. The prognosis is good.
2. Stage II moderate disease – Dogs which apart from the
signs listed in stage I may present: diffuse or symmetrical cutaneous lesions such as exfoliative dermatitis,
onychogryposis, ulcerations, anorexia, weight loss, fever
and epistaxis. The clinicopathological abnormalities
include mild non-regenerative anemia, hyperglobulinemia, hypoalbuminemia and serum hyperviscosity
syndrome. Two sub-stages related to kidney function
have been specified for Stage II. In sub-stage IIa – the
table 1
the clinical and clinicopathological characteristics found in the different stages of canine leishmaniosis according to the
leishVet staging system [27]
Disease Stage
Stage I – mild disease
Clinical and clinicopathological abnormalities
Mild clinical signs including peripheral lymphadenopathy or papular
dermatitis.
There are usually no clinicopathological abnormalities.
The clinical signs listed in stage I and diffuse or symmetrical cutaneous
lesions such as exfoliative dermatitis, onychogryposis, ulcerations,
anorexia, weight loss, fever and epistaxis.
Stage II – moderate disease
The clinicopathological abnormalities include mild non-regenerative
anemia, hyperglobulinemia, hypoalbminemia, serum hyperviscosity
syndrome.
Two sub-stages:
Stage IIa – the renal profile is normal with creatinine < 1.4 mg/dl, the dog
is not proteinuric and the urine protein/creatinine ratio (UPC) is < 0.5.
Stage IIb – creatinine is < 1.4 mg/dl and the UPC is 0.5-1.
Stage III – severe disease
In addition to the clinical signs listed for stages I and II, dogs may present
signs caused by severe immune-complex processes with lesions due to
vasculitis, arthritis, uveitis and glomerulonephritis.
The clinicopathological abnormalities are listed in stage II except for
chronic kidney disease (CKD) International Renal Interest Society (IRIS)
stage I with UPC>1 or stage II with creatinine of 1.4-2 mg/dl.
In addition to the clinical conditions listed for stage III, pulmonary
thromboembolism, or nephrotic syndrome, or end state renal disease.
Stage IV – very severe disease
The clinicopathological abnormatlities listed in stage II and in addition
CKD IRIS stage III (creatinine 2-5 mg/dl) or stage IV (creatinine > 5 mg/dl).
The nephrotic syndrome includes a marked proteinuria with UPC>5.
renal profile is normal with creatinine < 1.4 mg/dl, the
dog is not proteinuric and the UPC is < 0.5. In Sub-stage
IIb creatinine is < 1.4 mg/dl and the UPC is 0.5-1. The
anti-leishmanial antibody levels are low to high positive
at this stage. The treatment recommended in stage II is
allopurinol and meglumine antimoniate or allopurinol
and miltefosine, and the prognosis is good to guarded.
3. Stage III severe disease – Dog which apart from the
clinical signs listed for the first two stages may present
signs caused by severe immune-complex processes with
lesions due to vasculitis, arthritis, uveitis and glomerulonephritis. The clinicopathological abnormalities
are listed in stage II except for chronic kidney disease
(CKD) International Renal Interest Society (IRIS) stage
I with UPC >1 or stage II with creatinine of 1.4-2 mg/dl
[63]. The anti-leishmanial antibody levels are medium
to high positive at this stage. The treatment recommended in stage III is allopurinol with meglumine
antimoniate or with miltefosine and adherence to the
IRIS guidelines for CKD [64]. The prognosis at stage III
is guarded to poor.
4. Stage IV very severe disease – Dogs with clinical conditions listed in stage III, pulmonary thromboembolism,
or nephrotic syndrome, or end stage renal disease. The
clinicopathological abnormalities listed in stage II, and
in addition CKD IRIS stage III (creatinine 2-5 mg/dl)
53
or stage IV (creatinine > 5 mg/dl) [63]. The nephrotic
syndrome includes a marked proteinuria with UPC >
5. The anti-leishmanial antibody levels are medium
to high positive at this stage. The treatment recommended in stage IV is allopurinol alone and adherence
to the IRIS guidelines for CKD [64]. The prognosis is
poor.
Prevention
The use of topical insecticides against CanL in collars or
spot-on formulation has been shown to be effective in
reducing disease transmission [65-68]. A permethrin and
imidacloprid spot-on formulation has been shown to be
effective in reducing sand fly bites and disease incidence
in dogs [67]. Deltamethrin-impregnated collars significantly reduced the number of dog sand fly bites under
experimental conditions [69, 70] and decreased infection
transmission in field studies [66]. In a study supported by
the WHO in Iran, collaring of dogs in intervention and
control villages significantly reduced the seroconversion
rate in dogs and in children living in the intervention
villages [71]. A commercial vaccine against CanL has
recently been approved in Brazil [72, 73] and several
vaccine candidates are under experimental [74] or field
evaluation in Europe [75].
7.
8.
9.
10.
11.
12.
13.
References
1.
2.
3.
4.
5.
6.
54
baneth G, Koutinas, aF, solano-Gallego l, bourdeau p,
Ferrer l: canine leishmaniosis - new concepts
and insights on an expanding zoonosis: part
one. Trends parasitol 2008, 24:324-30.
Gaskin aa, schantz p, Jackson J, birkenheuer a, tomlinson l, Gramiccia M, et al.: Visceral leishmaniasis
in a new York foxhound kennel. J Vet Intern Med
2002, 16:34-44.
duprey ZH, steurer FJ, rooney Ja, Kirchhoff lV, Jackson
JE, rowton Ed, et al.: canine visceral leishmaniasis, United States and canada, 2000-2003.
Emerg Infect Dis 2006, 12:440-6.
shaw sE, lerga ai, Williams s, beugnet F, birtles rJ, day
MJ, et al.: Review of exotic infectious diseases
in small animals entering the United Kingdom from abroad diagnosed by PcR. Vet Rec
2003, 152:176-7.
shaw sE, langton da, Hillman tJ: canine leishmaniosis in the United Kingdom: a zoonotic
disease waiting for a vector? Vet Parasitol 2009,
163:281-5.
Maroli M, rossi l, baldelli r, capelli G, Ferroglio E,
Genchi c, et al.: the northward spread of
leishmaniasis in Italy: evidence from retrospective and ongoing studies on the canine
reservoir and phlebotomine vectors. Trop Med
Int Health 2008, 13:256-64.
14.
15.
16.
17.
18.
19.
Giger u, oakley da, owens sd, schantz p: Leishmania donovani transmission by packed RBc
transfusion to anemic dogs in the United
States. Transfusion 2002, 42:381-3.
owens sd, oakley da, Marryott K, Hatchett W, Walton
r, nolan tJ, et al.: transmission of visceral leishmaniasis through blood transfusions from
infected english foxhounds to anemic dogs.
J Am Vet Med Assoc 2001, 219:1076-83.
rosypal ac, troy Gc, Zajac aM, Frank G, lindsay ds:
transplacental transmission of a north
American isolate of Leishmania infantum in
an experimentally infected beagle. J Parasitol
2005, 91:970-2.
coutinho Mt, linardi pM: Can fleas from dogs
infected with canine visceral leishmaniasis
transfer the infection to other mammals?
Vet Parasitol 2007, 147:320-5.
coutinho Mt, bueno ll, sterzik a, Fujiwara rt, botelho
Jr, de Maria M, et al.: Participation of Rhipicephalus sanguineus (Acari: Ixodidae) in the
epidemiology of canine visceral leishmaniasis. Vet Parasitol 2005, 128:149-55.
duprey ZH, steurer FJ, rooney Ja, Kirchhoff lV, Jackson
JE, rowton Ed, et al.: canine visceral leishmaniasis, United States and canada, 2000-2003.
Emerg Infect Dis 2006, 12:440-6.
Werneck Gl, costa cH, Walker aM, david Jr, Wand M,
Maguire JH: Multilevel modeling of the incidence of visceral leishmaniasis in teresina,
Brazil. Epidemiol Infect 2007, 135:195-201.
Margonari c, Freitas cr, ribeiro rc, Moura ac, timbo
M, Gripp aH, et al.: epidemiology of visceral
leishmaniasis through spatial analysis, in Belo
Horizonte municipality, state of Minas
Gerais, Brazil. Mem Inst Oswaldo Cruz 2006, 101:31-8.
Gavgani as, Mohite H, Edrissian GH, Mohebali M, davies
cr: Domestic dog ownership in Iran is a risk
factor for human infection with Leishmania
infantum. Am J Trop Med Hyg 2002, 67:511-5.
acedo sanchez c, Martin sanchez J,Velez bernal id,
sanchis Marin Mc, louassini M, Maldonado Ja, et al.:
Leishmaniasis eco-epidemiology in the Alpujarra region (Granada Province, southern
Spain). Int J Parasitol 1996, 26:303-10.
solano-Gallego l, baneth G: canine leishmaniosis:
a challenging zoonosis. Euro J Comp Animal Pract
2009, 18:232-41.
Ferrer l, rabanal, r, Fondevila, d, ramos, Ja, domingo,
M: Skin lesions in canine leishmaniasis. J Small
Animal Prac 1988, 2:381-8.
slappendel rJ: canine leishmaniasis: A review
based on 95 cases in the netherlands. Vet Q
1988, 10:1-16.
20. solano-Gallego l, Morell p, arboix M, alberola J, Ferrer l:
Prevalence of Leishmania infantum infection
in dogs living in an area of canine leishmaniasis endemicity using PcR on several tissues
and serology. J Clin Microbiol 2001, 39:560-3.
21. alvar J, canavate c, Molina r, Moreno J, nieto J:
canine leishmaniasis. Adv Parasitol 2004, 57:1-88.
22. barbieri cl: Immunology of canine leishmaniasis. Parasite Immunol 2006, 28:329-37.
23. ordeix l, solano-Gallego l, Fondevila d, Ferrer l,
Fondati a: Papular dermatitis due to Leishmania spp. infection in dogs with parasite-specific cellular immune responses. Vet Dermatol
2005, 16:187-91.
24. nieto cG, navarrete i, Habela Ma, serrano F, redondo
E: Pathological changes in kidneys of dogs
with natural Leishmania infection. Vet Parasitol
1992, 45:33-47.
25. poli a, abramo F, Mancianti F, nigro M, pieri s, bionda a:
Renal involvement in canine leishmaniasis.
A light-microscopic, immunohistochemical
and electron-microscopic study. Nephron 1991,
57:444-52.
26. costa Fa, Goto H, saldanha lc, silva sM, sinhorini
il, silva tc, et al.: Histopathologic patterns of
nephropathy in naturally acquired canine
visceral leishmaniasis. Vet Pathol 2003, 40:677-84.
27. solano-Gallego l, Koutinas a, Miró G, cardoso l,
pennisi MG, Ferrer l, bourdeau p, oliva G, baneth G:
Directions for the diagnosis, clinical staging,
treatment and prevention of canine leishmaniosis. Vet Parasitol 2009, 165:1-18.
28. reis ab, Martins-Filho oa, teixeira-carvalho a, carvalho MG, Mayrink W, Franca-silva Jc, et al.: Parasite
density and impaired biochemical/hematological status are associated with severe
clinical aspects of canine visceral leishmaniasis. Res Vet Sci 2006, 81:68-75.
29. reis ab, teixeira-carvalho a,Vale aM, Marques MJ,
Giunchetti rc, Mayrink W, et al.: Isotype patterns
of immunoglobulins: hallmarks for clinical
status and tissue parasite density in Brazilian dogs naturally infected by Leishmania
(Leishmania) chagasi. Vet Immunol Immunopathol
2006, 112:102-16.
30. pinelli E, Killick-Kendrick r, Wagenaar J, bernadina W,
del real G, ruitenberg J: cellular and humoral immune responses in dogs experimentally and
naturally infected with Leishmania infantum.
Infect Immun 1994, 62:229-35.
31. Martinez-Moreno a, Moreno t, Martinez-Moreno FJ,
acosta i, Hernandez s: Humoral and cell-mediated immunity in natural and experimental
canine leishmaniasis. Vet Immunol Immunopathol
1995, 48:209-20.
32. rhalem a, sahibi H, Guessous-idrissi n, lasri s, natami
a, riyad M, et al.: Immune response against
Leishmania antigens in dogs naturally and
experimentally infected with Leishmania
infantum. Vet Parasitol 1999, 81:173-84.
33. cardoso l, neto F, sousa Jc, rodrigues M, cabral M:
Use of a leishmanin skin test in the detection of canine Leishmania-specific cellular
immunity. Vet Parasitol 1998, 79:213-20.
34. cabral M, o’Grady JE, Gomes s, sousa Jc, thompson H,
alexander J: the immunology of canine leishmaniosis: strong evidence for a developing
disease spectrum from asymptomatic dogs.
Vet Parasitol 1998, 76:173-80.
35. solano-Gallego l, llull J, ramos G, riera c, arboix M,
alberola J, et al.: the Ibizian hound presents a
predominantly cellular immune response
against natural Leishmania infection. Vet Parasitol 2000, 90:37-45.
36. blaviera, Keroack s, denerolle p, Goy-thollot i, chabanne l, cadore Jl, bourdoiseau G: Atypical forms
of canine leishmaniosis. Vet J 2001, 162: 108-20.
37. rallis t, day MJ, saridomichelakis Mn, adamamaMoraitou KK, papazoglou l, Fytianou a, Koutinas aF:
chronic hepatitis associated with canine
leishmaniosis (Leishmania infantum): a clinicopathological study of 26 cases. J Comp Pathol
2005, 132:145-52.
38. adamama-Moraitou K.K, rallis ts, Koutinas aF, tontis
d, plevraki K, Kritsepi M: Asymptomatic colitis
in naturally infected dogs with Leishmania
infantum: a prospective study. Am J Trop Med
Hyg2007, 76:53-7.
39. Vamvakidis cd, Koutinas aF, Kanakoudis G, Georgiadis
G, saridomichelakis M: Masticatory and skeletal
muscle myositis in canine leishmaniasis
(Leishmania infantum). Vet Rec 2000, 146:698-703.
40. petanides ta, Koutinas aF, Mylonakis ME, day MJ,
saridomichelakis Mn, leontides ls, Mischke r, diniz p,
breitschwerdt Eb, Kritsepi M, Garipidou Va, Koutinas
cK, lekkas s: Factors associated with the occurrence of epistaxis in natural canine leishmaniasis (Leishmania infantum). J Vet Intern Med
2008, 22:866-72.
41. Mancianti F, Gramiccia M, Gradoni l, pieri s: Studies
on canine leishmaniasis control. 1. evolution of infection of different clinical forms
of canine leishmaniasis following antimonial
treatment. Trans R Soc Trop Med Hyg 1988, 82:566-7.
55
42. Miro G, cardoso, l., pennisi, M. G., oliva, G., baneth, G:
canine Leishmaniosis: new concepts and
Insights on an expanding Zoonosis Part two.
Trends Parasitol 2008, 24:371-7.
43. dos-santos Wl, Jesus EE, paranhos-silva M, pereira
aM, santos Jc, baleeiro co,nascimento EG, Moreira
Ed, oliveira GG, pontes-de-carvalho lc: Associations among immunological, parasitological
and clinical parameters in canine visceral
leishmaniasis: emaciation, spleen parasitism,
specific antibodies and leishmanin skin test
reaction. Vet Immunol Immunopathol 2008, 123:251-9.
44. baneth G, aroch i: canine leishmaniasis: a diagnostic and clinical challenge. Vet J 2008, 175:14-5.
45. porrozzi r, santos da costa MV, teva a, Falqueto a,
Ferreira al, dos santos cd, et al.: comparative
evaluation of enzyme-linked immunosorbent assays based on crude and recombinant
leishmanial antigens for serodiagnosis of
symptomatic and asymptomatic Leishmania
infantum visceral infections in dogs. Clin Vaccine
Immunol 2007, 14:544-8.
46. barbosa-de-deus r, dos Mares-Guia Ml, nunes aZ,
costa KM, Junqueira rG, Mayrink W, et al.: Leishmania
major-like antigen for specific and sensitive
serodiagnosis of human and canine visceral
leishmaniasis. Clin Diagn Lab Immunol 2002, 9:1361-6.
47. Ferreira Ede c, de lana M, carneiro M, reis ab, paes
dV, da silva Es, et al.: comparison of serological
assays for the diagnosis of canine visceral
leishmaniasis in animals presenting different
clinical manifestations. Vet Parasitol 2007,
146:235-41.
48. Gomes yM, paiva cavalcanti M, lira ra, abath FG, alves
lc: Diagnosis of canine visceral leishmaniasis:
biotechnological advances. Vet J 2008, 175:45-52.
49. Maia c, campino l: Methods for diagnosis of
canine leishmaniasis and immune response
to infection. Vet Parasitol 2008, 158:274-87.
50. Maia c, ramada J, cristóvão JM, Gonçalves l, campino l:
Diagnosis of canine leishmaniasis: conventional and molecular techniques using
different tissues. Vet J 2009, 179:142-4.
51. Manna l, reale s,Vitale F, picillo E, pavone lM, Gravino
aE: Real-time PcR assay in Leishmania-infected dogs treated with meglumine antimoniate and allopurinol. Vet J 2008, 177: 279-82.
52. solano-Gallego l, rodriguez-cortes a, trotta M, Zampieron c, razia l, Furlanello t, et al.: Detection of
Leishmania infantum DnA by fret-based realtime PcR in urine from dogs with natural
clinical leishmaniosis. Vet Parasitol 2007, 147:315-9.
53. Moreira Ma, luvizotto Mc, Garcia JF, corbett cE,
laurenti Md: comparison of parasitological,
immunological and molecular methods for
the diagnosis of leishmaniasis in dogs with
different clinical signs. Vet Parasitol 2007, 145:245-52.
56
54. Francino o, altet l, sanchez-robert E, rodriguez a,
solano-Gallego l, alberola J, Ferrer l, sanchez a, roura X:
Advantages of real-time PcR assay for
diagnosis and monitoring of canine leishmaniosis. Vet Parasitol 2006, 137:214-21.
55. pennisi MG, reale s, Giudice sl, Masucci M, caracappa s,
Vitale M,Vitale F: Real-time PcR in dogs treated
for leishmaniasis with allopurinol. Vet Res Commun 2005, 29(suppl 2):301-3.
56. oliva G, scalone a, Foglia Manzillo V, Gramiccia M,
pagano a, di Muccio t, Gradoni l: Incidence and
time course of Leishmania infantum infections examined by parasitological, serologic,
and nested-PcR techniques in a cohort of
naive dogs exposed to three consecutive
transmission seasons. J Clin Microbiol 2006,
44:1318-22.
57. noli c, auxilia st: treatment of canine old
World visceral leishmaniasis: a systematic
review. Vet Dermatol 2005, 16:213-32.
58. Miro G, oliva G, cruz i, canavate c, Mortarino M,
Vischer c, bianciardi p: Multicentric, controlled
clinical study to evluate the effectiveness
and safety of miltefosine and allopurinol for
canine leishmaniosis. Vet Dermatol 2009, 20:397-404.
59. Miret J, nascimento E, sampaio W, Franca Jc, Fujiwara
rt,Vale a, et al.: evaluation of an immunochemotherapeutic protocol constituted of nmethyl meglumine antimoniate (Glucantime)
and the recombinant Leish-110f + MPL-Se
vaccine to treat canine visceral leishmaniasis. Vaccine 2008, 26:1585-94.
60. borja-cabrera Gp, cruz Mendes a, paraguai de souza
E, Hashimoto okada ly, de atFa, Kawasaki JK, et al.:
effective immunotherapy against canine
visceral leishmaniasis with the FML-vaccine.
Vaccine 2004, 22:2234-43.
61. solano-Gallego l, riera c, roura X, iniesta l, Gallego M,
Valladares JE, et al.: Leishmania infantum-specific
IgG, IgG1 and IgG2 antibody responses in
healthy and ill dogs from endemic areas.
evolution in the course of infection and after
treatment. Vet Parasitol 2001, 96:265-76.
62. rodríguez a, solano-Gallego l, ojeda a, Quintana J,
riera c, Gállego M, portús M, alberola J: Dynamics of
Leishmania-specific immunoglobulin isotypes
in dogs with clinical leishmaniasis before and
after treatment. J Vet Intern Med 2006, 20:495-8.
63. iris 2006a. iris staging of chronic renal disease (international renal interest society) [http://www.iris-kidney.
com/guidelines/en/staging_ckd.shtml]
64. iris 2006b. iris treatment recommendation (international renal interest society) [http://www.iris-kidney.
com/guidelines/en/treatment_recommendations.shtml]
65. alexander b, Maroli M: control of phlebotomine
sandflies. Med Vet Entomol 2003, 17:1-18.
66. Maroli M, Mizzon V, siragusa c, d’oorazi a, Gradoni l:
evidence for an impact on the incidence of
canine leishmaniasis by the mass use of
deltamethrin-impregnated dog collars in
southern Italy. Med Vet Entomol 2001, 15:358-63.
67. otranto d, paradies p, lia rp, latrofa Ms, testini G, cantacessi c, et al.: Efficacy of a combination of 10%
imidacloprid/50% permethrin for the prevention of leishmaniasis in kennelled dogs in
an endemic area. Vet Parasitol 2007, 144:270-8.
68. Miro G, Galvez r, Mateo M, Montoya a, descalzo Ma,
Molina r: Evaluation of the efficacy of a topically administered combination of imidacloprid and permethrin against Phlebotomus
perniciosus in dog. Vet Parasitol 2007, 143:375-9.
69. Killick-Kendrick r, Killick-Kendrick M, Focheux c,
dereure J, puech Mp, cadiergues Mc: Protection of
dogs from bites of phlebotomine sandflies
by deltamethrin collars for control of canine
leishmaniasis. Med Vet Entomol 1997, 11:105-11.
70. Halbig p, Hodjati MH, Mazloumi-Gavgani as, Mohite H,
davies cr: Further evidence that deltamethrin-impregnated collars protect domestic
dogs from sandfly bites. Med Vet Entomol 2000,
14:223-6.
71. Gavgani as, Hodjati MH, Mohite H, davies cr: effect
of insecticide-impregnated dog collars on
incidence of zoonotic visceral leishmaniasis
in Iranian children: a matched-cluster randomised trial. Lancet 2002, 360:374-9.
72. borja-cabrera Gp, correia pontes nn, da silva Vo,
paraguai de souza E, santos Wr, Gomes EM, et al.:
Long lasting protection against canine kalaazar using the FML-QuilA saponin vaccine in
an endemic area of Brazil (Sao Goncalo do
Amarante, Rn). Vaccine 2002, 20:3277-84.
73. dantas-torres F: Leishmune vaccine: the newest tool for prevention and control of canine
visceral leishmaniosis and its potential as a
transmission-blocking vaccine. Vet Parasitol 2006,
141:1-8.
74. ramos i, alonso a, Marcen JM, peris a, castillo Ja,
colmenares M, et al.: Heterologous prime-boost
vaccination with a non-replicative vaccinia
recombinant vector expressing LAcK confers protection against canine visceral leishmaniasis with a predominant Th1-specific
immune response. Vaccine 2008, 26:333-44.
75. lemesre Jl, Holzmuller p, Goncalves rb, bourdoiseau G,
Hugnet c, cavaleyra M, et al.: Long-lasting protection against canine visceral leishmaniasis
using the LieSAp-MDP vaccine in endemic
areas of France: double-blind randomised efficacy field trial. Vaccine 2007, 25:4223-34.
57
LONGITUDINAL STUDY ON THE DETECTION OF
LEISHMANIA EXPOSURE IN DOGS BY CONJUNCTIVAL SWAB PCR ANALYSIS AND CORRELATION
WITH ENTOMOLOGICAL PARAMETERS
Marina Gramiccia1, Trentina Di Muccio1, Eleonora Fiorentino1, Gioia Bongiorno1,
Silvia Cappiello2, Rossella Paparcone2,Valentina F Manzillo2, Luigi Gradoni1,
Gaetano Oliva2
Unit of Vector-borne Diseases & International Health, MIPI Department, Instituto Superiore di Sanità, Rome
Department OF VETERINARY Clinical Sciences, University Federico II, Naples, Italy
1
2
EMAIL: GAOLIVA@UNINA.IT
The diagnosis of Leishmania exposure/infection in dogs
may require repeated sampling due to the delayed appearance of specific antibodies and the difficulty of detecting
parasites in tissues. Early PCR diagnosis requires invasive
aspirate sampling of bone marrow or lymph nodes. A
non-invasive conjunctival swab (CS) sampling coupled
with a sensitive and specific PCR analysis, has been proposed for the diagnosis of canine leishmaniasis (CanL)
in dogs with clinical signs suggestive of the disease [1].
This method has since been found to be effective for the
diagnosis of asymptomatic untreated and drug-treated
animals [2].
A longitudinal study was carried out to evaluate the
diagnostic performance of a CS nested (n)-PCR analysis
for Leishmania detection in A) a cohort of asymptomatic,
IFAT- and CS n-PCR-negative dogs exposed to and followed up throughout a full sand fly season, and B) a
cohort of asymptomatic IFAT- and CS n-PCR-negative but
peripheral blood buffy-coat (BC) n-PCR positive dogs
over a year. The study was carried out on kennelled stray
dogs in a CanL endemic area of Southern Italy.
To meet the first objective (A), all dogs (260) were
screened prior to the 2008 transmission season as follows: firstly, clinical examination for any signs supportive
of CanL, asymptomatic dogs (123) were then submitted
to IFAT serology at the low cut-off titre of 1/80, seronegative dogs (80) were then further submitted to CS n-PCR .
58
The 65 dogs subsequently found negative to the CS n-PCR
were enrolled for evaluation. Some dogs were lost during
the study. From July to November 2008, CS were collected
once or twice a month and examined by n-PCR. None of
the dogs evaluated converted to positive CS n-PCR during
the observation period. IFAT was repeated and confirmed
negative in September and November. An entomological investigation was performed in the kennel and surrounding areas to monitor sand fly presence, density and
seasonality. Twice a month from May to November, a
total of around 1,600 sticky traps were set with a cumulative surface area of 63 m2. Four species of sand fly were
identified from the around 2,000 specimens collected.
The collection density showed a bi-modal peak distribution in August (100 insects/m2) and September
(147 insects/m2). Elevated sand fly densities were recorded up until mid October (66/m2). However, the cumulative density of the only proven CanL vector in the area
(Phlebotomus perniciosus) was extremely low (0.5/m2),
and the few female specimens collected were found to be
Leishmania negative on dissection or n-PCR analysis.
To meet the second objective (B), a sub-group of 17 CS
n-PCR-negative dogs as evaluated above which was found
to be BC n-PCR positive in July 2008, was re-examined
by this technique in September and November 2008, and
finally in May 2009 (i.e. before the subsequent transmission season) along with CS n-PCR and IFAT. All dogs
remained substantially seronegative; BC n-PCR results
were intermittently positive during the evaluation period
but at the final time point in May 2009 14/17 dogs (82%)
tested negative. By contrast, 12/17 of these animals (71%)
converted to positive by CS n-PCR in 2009.
Findings from the study can be summarized as follows: i) CS n-PCR is not very effective in detecting early
Leishmania infection in dogs exposed to a low level of
parasite transmission; ii) CS n-PCR-conversion to positive
appears to occur at high rates, albeit slowly, in dogs living in areas with elevated CanL prevalence in the absence
of concomitant serconversion; iii) BC n-PCR may be an
earlier indicator of leishmanial exposure (although an
unknown number of the dogs from the BC n-PCR positive
sub-sample had probably been infected prior to the 2008
season). However positive BC n-PCR results appear to be
transient and prone to negative conversion. In conclusion,
CS n-PCR appears to be a suitable marker for Leishmania
exposure in dogs and represents a non-invasive alternative to current approaches.
We are grateful to Bayer Animal Health for the generous
support to the study.
Table 1
Longitudinal results of peripheral blood buffy-coat (BC) and conjunctival swab (CS) n-PCR, and IFAT in cohort B dogs
Dark grey cells: positive; light grey cells: negative; medium grey cells: faint positive (weak n-PCR amplification, or IFAT titre equal to cut-off)
2008
Dog
2009
July
September
November
May
BC
BC
IFAT
CS
BC
IFAT
CS
BC
17/17
(100%)
5/17
(29%)
0/17
(0%)
0/17
(0%)
6/17
(35%)
1/17
(6%)
12/17
(71%)
3/17
(18%)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
Total
59
No. of specimens/m2
1000
100
10
1
0
May
(12/05)
Jul
Aug
All phlebotomines
Sep
Oct
Nov
(05/11)
Phlebotomus pemiciosus
Figure 1
seasonal trend and density (specimens/m2 sticky paper) of phlebotomine sandflies collected inside and around the study kennel
References
1.
2.
60
strauss-ayali d, Jaffe cl, burshtain o, Gonen l, baneth
G: Polymerase chain reaction using noninvasively obtained samples, for the detection of
Leishmania infantum DnA in dogs. J Infect Dis
2004, 189:1729-33.
di Muccio t, Fiorentino E, Foglia Manzillo V, cappiello s,
oliva G, Gradoni l, Gramiccia M: the potential role
of conjunctival swab analysis for the early
detection of Leishmania-dog contacts: a preliminary study. Parassitologia 2008, 50(suppl 1):154.
61
THE CLINICiANS VIEW: INTERESTING CVBD CASES
MICHAEL R LAPPIN
DEPARTMENT OF CLINICAL SCIENCEs COLLEGE OF VETERINARY MEDICINE AND BIOMEDICAL SCIENCEs;
COLORADO STATE UNIVERSITY, USA
EMAIL: MLAPPIN@COLOSTATE.EDU
Introduction and background
Vector-borne diseases are common in the United States
but the prevalence of individual agents varies by region.
Historically in the Rocky Mountain States, the predominant vector-borne disease diagnosed in dogs was Rocky
Mountain spotted fever (Rickettsia rickettsii vectored by
Dermacentor andersoni). However, other vectors are detected on dogs and cats in the region and include Rhipicephalus
sanguineous, Ctenocephalides felis, and C. canis. Many people
living in Colorado commonly have relocated to the state
from other areas of the country and so there is the potential for importation of dogs with vector-borne agents that
are not common in the area. In addition, while vectorborne diseases were felt to be uncommon in the region,
previous studies were hampered by the lack of availability
of advanced molecular and serological diagnostic assays.
These facts are true for most of the world and it is now
apparent that vector-borne diseases should be on the differential lists of clinicians worldwide. The purpose of this
lecture and proceedings is to present clinical cases that
involved vector-borne disease agents that were diagnosed
at Colorado State University.
Case series 1
In this case series, a group of dogs in Colorado and
Wyoming with cardiac abnormalities were retrospectively
shown to have DNA of Bartonella spp. in cardiac tissues
[1]. To identify the cases, the medical records system at
Colorado State University’s Veterinary Teaching Hospital
was searched for dogs with a clinical diagnosis of endocarditis that had been admitted from January, 1990 to
June, 2008 (Figure 1). Cases included were the 9 dogs for
which the blocks and medical records were available. The
tissue blocks were shipped to the North Carolina State
62
University Tick Borne Disease Diagnostic Laboratory*.
All cardiac tissues were collected from each block using a
microtome that was thoroughly cleaned between samples
to avoid DNA contamination. The tissues were deparaffinized and then total DNA was extracted from the tissues
using previously reported techniques. The total DNA was
assayed for Bartonella spp. DNA using three different PCR
assays. Conventional PCR assays targeting the ITS gene
and Pap31 gene were performed and those samples giving positive results were sequenced. In addition, real time
PCR using both B. henselae and B. vinsonii subsp. berkhoffii
probes, was performed on all samples. DNA extracts positive for Bartonella spp. DNA and the tissue blocks were
then shipped back to Colorado State University. For those
cardiac tissue samples that were positive for Bartonella
spp. DNA by PCR assay, the tissue blocks were re-cut and
one slide was stained with hematoxylin and eosin stain
and another slide stained with silver stain. All slides were
then evaluated microscopically by the same pathologist.
Bartonella spp. DNA was amplified from the tissues of 7 of
the 9 dogs (Table 1). Of the 7 dogs, 6 were from Colorado
and 1 was from Wyoming (B. henselae only) and all were
greater than 5 years of age. There were 3 castrated males
and 4 spayed females. There was no evidence in the
medical record that the dogs had left the region. Two of
the seven dogs were reported to have either fleas or ticks
but none of the vectors were available for identification.
There was no mention of flea and tick preventative use in
the medical history of any dog. Fever (5 of 7 dogs) and
cardiac murmurs (3 of 7 dogs) were not always present.
The clinical manifestations were consistent with those
of bacterial endocarditis and myocarditis as well as those
of systemic bartonellosis. Several of the dogs had dis-
eases with potential to induce immune deficiency. Silver
stain was an inconsistent way to document presence of
Bartonella spp. within cardiac tissues of these dogs. Blood
cultures were positive for one of the two dogs (Cases 2
and 6) tested; Enterococcus faecium and a beta hemolytic
Streptococcus beta spp. were cultured. None of the cases
had been evaluated for Bartonella spp. antibodies or
cultured with special media supporting the growth of
fastidious Bartonella spp. Several dogs had been treated
with antibiotics with poor response to therapy. The
results of this study document that Bartonella spp. associated diseases should be on the differential list for dogs in
this region. The vectors associated with transmission were
unknown.
Case series 2
The following case is abstracted from a case report to be
published in the Journal of Veterinary Internal Medicine
[2]. A one-year-old male intact unilaterally cryptorchid
Foxhound/Walker Coonhound cross with no travel history outside of Colorado was presented to the Colorado
State University Veterinary Teaching Hospital. The dog
was ultimately proven to have leishmaniasis. While
R. sanguineous ticks for Leishmania spp. are found in this
state, the dog was not known to be infested by ticks and
the vector potential of this tick seems low [3]. While
under the referring veterinarian’s care, the dog had a 2.5
month history of diarrhea, weight loss despite a good
appetite, dermatological lesions, and hindlimb stiffness.
Dermatological lesions were initially non-pruritic and
Table 1
Findings from 7 dogs in Colorado and Wyoming with Bartonella spp. DNA amplified from cardiac tissues
Case
Histopathology
Silver Stain
PCR
Clinical and laboratory problems
1
Mitral valve
degeneration
Negative
Bh
Acute collapse; anorexia; lower motor neuron disease;
anemia; proteinuria; chronic renal disease; urinary tract
infection; hypothyroidism.
2
Mitral valve degeneration and myocar­
dial infarction
Positive
Bh
Vomiting; diarrhea; weakness; anorexia; neutropenia;
fever; cardiac murmur.
3
Aortic valve
inflammation
Bh, Bv
Hematemesis; melena; lethargy; anorexia, cardiac
murmur; thrombocytopenia; hypoalbuminemia;
proteinuria; paraparesis progressing to hindlimb
paralysis within 24 hours; ticks (not identified).
4
Aortic valve
inflammation and
myocarditis
Negative
Bh
Lethargy; anorexia; weakness; hindlimb stiffness; central
vestibular disease; suppurative polyarthritis left carpus;
anemia; thrombocytopenia; fever; fleas noted but not
identified.
5
Mitral valve
inflammation and
myocarditis
Positive
(coccoid)
Bh
Vomiting; diarrhea; lethargy; anorexia; fever, cardiac
murmur; ataxia; stiffness; hemorrhagic mucopurulent
nasal discharge; anemia; thrombocytopenia; hypo­
albuminemia; proteinuria; suppurative polyarthritis.
6
Fatty infiltration
of myocardium;
valve not present
Not
performed
Bh, Bv
Lethargy; anorexia; thrombocytopenia; hypoalbuminemia; grade I soft tissue sarcoma of the left forelimb
7
Myocardial necrosis;
valve not present
Negative
Bh, Bv
Weakness; anorexia; vomiting, polyuria/polydipsia;
fever; proteinuria; diabetes mellitus
Negative
Bh = Bartonella henselae; Bv = Bartonella vinsonii
63
began as an alopecic area on the crown of the head.
The lesions progressed to raised and keratinized lesions
involving the face, muzzle, and axillary regions. One
set of samples had been negative for Demodex mites on
deep skin scraping and a dermatophyte culture was negative. Therapeutic trials consisted of administration of an
anthelmintic, a diet change, and trial treatment with
ivermectin. After the skin lesions did not respond after 12
days, a skin biopsy was submitted which revealed severe
chronic folliculitis, potentially of bacterial in origin, but
no organisms were observed. Cephalexin was administered for 30 days with minimal response clinical response
prior to referral.
When examined at Colorado State University, the dog
was bright, alert, and responsive, but was thin (32.5 kg).
Mucopurulent discharge was present OS and thickened
eyelids were present OU. Generalized muscle wasting, peripheral lymphadenopathy, and severe scaling,
crusting, and alopecia on the cranium, face, pinna, ventrum, axillary, and inguinal regions were also detected.
Palpation suggested bilateral tarsal joint effusion and
the left tarsus seemed painful. Laboratory abnormalities included non-regenerative anemia (32.0%; reference
range {RR} = 0.0 - 55.0%), monocytosis (1.4 103/µl,
RR = 0.2 - 1.0 x 103/ µl), hypercalcemia (11.8 mg/dL, RR =
9.2 - 11.7 mg/dL), hyperprotenemia (9.0 gm/dL, RR = 5.3
- 7.2 gm/dL), and hyperglobulinemia 6.3 mg/dL, RR = 2.0
- 3.8 gm/dL). Urinalysis identified proteinuria and urine
specific gravity of 1.015. Aspiration cytology of the lymph
nodes revealed reactive lymphocytes with no organisms
seen. Fungal culture and skin scrapings were negative.
Ultrasound revealed mild hepatomegaly, mild splenomegaly, diffuse abdominal lymphadenomegaly, a possible
retained testicle in the right abdomen, and a thickened
cranial ventral urinary bladder wall. While the dog was
from Colorado and Leishmania spp. amastigotes were not
found on multiple skin scrapings, cytology of lymph node
aspirates, or skin biopsies, the breed and clinical findings
were consistent with leishmaniasis. Thus, serum was
submitted for Leishmania spp. recombinant antigen K39
antibody determination (HESKA Laboratories, Loveland
CO) and was positive. Whole blood and lymph node
aspirates were submitted for Leishmania spp. polymerase
chain reaction (PCR) assay and serum was submitted for
Leishmania spp. indirect fluorescent antibody (IFA) testing
at North Carolina State University. The Leishmania infantum IFA titer was 1:1024 and organism specific DNA was
amplified by PCR from the whole blood sample, confirming the diagnosis of leishmaniasis. The owners declined
treatment because of the dog’s working status, the severity
of the disease, and the expense of treatment with little
chance of a therapeutic cure.
64
The dog was euthanized and a necropsy performed.
The histopathological diagnoses from the skin included chronic multifocal to coalescing lymphohistiocytic,
plasmacytic perifolliculitis which contained intrahistiocytic amastigotes consistent with Leishmania parasites.
Membranoproliferative mesangial glomerulonephritis, moderate to marked lymphoplasmactyic interstitial
nephritis, portal hepatitis, and diffuse bone marrow
hyperplasia were also noted.
The mode of transmission for this dog was not definitively established, however, vertical transmission was
suspected as known vectors are not present in the state
and there was no history of fighting or blood transfusion. The Foxhound dam had clinical manifestations
consistent with leishmaniasis when this dog was in utero.
At whelping, six puppies were stillborn, one puppy died
within a week, and four puppies (including the case
report described here) were seemingly healthy. The dam
had been “leased” from a Foxhound club in Kansas to
be bred with a previously healthy Walker Coonhound
from Colorado. The Foxhound dam had lived primarily in Kansas, but had also traveled to Foxhound clubs
in Michigan and South Carolina, all three of which are
included in the 21 states where the CDC found serological evidence of Leishmania exposure in hunting dogs. Of
the 4 surviving puppies, three (all male) remained in
Colorado, and one (female) returned with the dam to
Kansas. The female puppy was euthanized at one year of
age when a high L. infantum antibody titer was detected.
The clinically ill dog described in this case report lived
with one unaffected littermate, their Walker Coonhound
father, and an unrelated Walker Coonhound female.
After the diagnosis of leishmaniasis was confirmed in
the affected puppy, Leishmania spp. PCR was performed
on blood in EDTA and Leishmania spp. IFA titers were
determined on the other 3 dogs. Based on the negative
serological and PCR assay results, the father, unaffected
puppy, and unrelated bitch did not appear to have been
infected by Leishmania spp.
* North Carolina State University, Tick Borne Disease
Diagnostic Laboratory
http://www.cvm.ncsu.edu/vth/ticklab.html
Figure 1
Valvular endocarditis in a colorado dog
References
1.
2.
3.
4.
5.
6.
Fenimore a,Varanat M, Maggi r, schultheiss p,
breitschwerdt E, lappin Mr: Bartonella spp. endocarditis in dogs in colorado and Wyoming. in
review for submission to J Vet Int Med 2010.
Freeman Ks, Miller M, breitschwerdt Eb, lappin Mr:
Leishmania in a native colorado dog. J Vet Int
Med in press, 2010.
paz GF, ribeiro MF, Michalsky EM, da rocha lima ac,
França-silva Jc, barata ra, Fortes-dias cl, dias Es:
evaluation of the vectorial capacity of Rhipicephalus sanguineus (Acari: Ixodidae) in the
transmission of canine visceral leishmaniasis.
Parasitol Res 2010, 106:523-528.
breitschwerdt Eb, Kordick dl, Malarkey dE, Keene b,
Hadfield TL, Wilson K: endocarditis in a dog due
to infection with a novel Bartonella subspecies. J Clin Microbiol 1995, 33:154-160.
chomel bb, Mac donald Ka, Kasten rW, chang cc,
Wey ac, Foley JE, thomas Wp, Kittelson Md: Aortic
valve endocarditis in a dog due to Bartonella
clarridgeiae. J Clin Microbiol 2001, 39:3548-3554.
chomel bb, Wey ac, and Kasten rW: Isolation of
Bartonella washoensis from a dog with mitral
valve endocarditis. J Clin Microbiol 2003, 41:53275332.
7.
cockwill Kr, taylor sM, philibert HM, breitschwerdt Eb,
Maggi rG: Bartonella vinsonii subsp. berkhoffii
endocarditis in a dog from Saskatchewan.
can Vet J 2007, 48:839-844.
8. coutinho MtZ, bueno ll, sterzik a, Fuiwara rt, botelho Jr, de Maria M, Genaro o, linardi pM: Participation of Rhipicephalus sanguineus (Acari: Ixodidae) in the epidemiology of canine visceral
leishmaniasis. Vet Parasitol 2005, 128:149–155.
9. dantas-torres F, lorusso V, testini G, de paiva-cavalcanti
M, Figueredo la, stanneck d, Mencke n, brandão-Filho
sp, alves lc, otranto d: Detection of Leishmania
infantum in Rhipicephalus sanguineus ticks
from Brazil and Italy. Parasitol Res 2010, Epub
ahead of print.
10. duprey ZH, steurer FJ, rooney Ja, Kirchhoff lV, Jackson
JE, rowton Ed, schantz pM: canine visceral leishmaniasis, United States and canada, 20002003. Emerg Infect Dis 2006, 12:440-446.
11. Gabriel MW, Henn J, Foley JE, brown rn, Kasten rW,
Foley p, chomel bb: Zoonotic Bartonella species in fleas collected on gray foxes (Urocyon
cinereoargenteus). Vector Borne Zoonotic Dis 2009,
9:597-602.
65
12. Henn Jb, Gabriel MW, Kasten rW, brown rn, Koehler
JE, Macdonald Ka, Kittleson Md, thomas Wp, chomel
bb: Infective endocarditis in a dog and the
phylogenetic relationship of the associated
“Bartonella rochalimae” strain with isolates
from dogs, gray foxes, and a human. J Clin
Microbiol 2009, 47:787-790.
13. Kelly p, rolain JM, Maggi r, sontakke s, Keene b, Hunter
s, lepidi H, breitschwerdt Kt, breitschwerdt Eb: Bartonella quintana endocarditis in dogs. Emerg
Infect Dis 2006, 12:1869-1872.
14. ohad dG, Morick d, avidor b, Harrus s: Molecular
detection of Bartonella henselae and Bartonella koehlerae from aortic valves of Boxer
dogs with infective endocarditis. Vet Microbiol
2010, 141:182-185.
15. rosypal ac, troy Gc, Zajac aM, Frank G, lindsay ds:
transplacental transmission of a north
American isolate of Leishmania infantum in a
experimentally infected beagle. J Parasitol 2005,
91:970–972.
16. rosypal ac, lindsay ds: Non-sand fly transmission of a north American isolate of Leishmania infantum in experimentally Infected
BALB/c mice. J Parasitol 2005, 91:1113–1115.
17. sykes JE, Kittleson Md, pesavento pa, byrne ba, Macdonald Ka, chomel bb: evaluation of the relationship between causative organisms and
clinical characteristics of infective endocarditis in dogs: 71 cases (1992-2005). J Am Vet
Med Assoc 2006, 228:1723-1734.
18. Wikswo ME, Hu r, Metzger ME, Eremeeva ME: Detection of Rickettsia rickettsii and Bartonella
henselae in Rhipicephalus sanguineus ticks
from california. J Med Entomol 2007, 44:158-162.
66
67
PReVentIon oF enDeMIc cAnIne VectoRBoRne DISeASeS USInG IMIDAcLoPRID 10 %
AnD PeRMetHRIn 50 % In YoUnG DoGS
doMEnico otranto1, donato dE caprariis1, riccardo p lia1,ViViana d tarallo1,
VincEnZo lorusso1, GabriElla tEstini1, FilipE dantas-torrEs1, stEFania latroFa1,
pEdro pVp diniZ2, norbErt MEncKE3, ricardo G MaGGi4, EdWard b brEitscHWErdt4,
Gioia capElli5, dorotHEE stannEcK3
dipartiMEnto di sanitÀ pubblica E ZootEcnica, uniVErsitÀ dEGli studi di bari,ValEnZano, ba, italy
collEGE oF VEtErinary MEdicinE, WEstErn uniVErsity oF HEaltH sciEncEs, poMona, caliFornia, usa
3
bayEr aniMal HEaltH GMbH, lEVErKusEn, GErMany
4
intracEllular patHoGEns rEsEarcH laboratory, cEntEr For coMparatiVE MEdicinE and translational rEsEarcH,
collEGE oF VEtErinary MEdicinE, nortH carolina statE uniVErsity, ralEiGH, usa
5
istituto ZooproFilattico spEriMantalE dEllE VEnEZiE, lEGnaro, pd, italy
1
2
EMail: d.otranto@VEtErinaria.uniba.it
Canine vector-borne diseases (CVBDs) are highly prevalent and increasing in distribution worldwide. A longitudinal field study was conducted in Southern Italy between
March 2008 and April 2009 to determine the incidence of
many CVBD causing pathogens (Anaplasma platys, Babesia
vogeli, Bartonella spp., Ehrlichia canis, Hepatozoon canis and
Leishmania infantum) in dogs treated with a combination
of imidacloprid 10 % and permethrin 50 % (ImPer). The
111 resident young dogs included in the study were divided into a treatment (Group A) and a control group (Group
B). Both groups consisted of animals which were positive
as well as negative to different diagnostic tests for one or
more of the above mentioned pathogens. Additionally,
10 naïve male beagles were enrolled into each group.
Different tissue samples (i.e., blood, bone marrow and
68
skin samples) were collected from all enrolled animals at
four points in time. Serological, cytological and molecular
tests were performed on the different tissue samples of all
animals to detect the different pathogens. Ectoparasites
like fleas, ticks and sand flies were also monitored. At the
end of the evaluation period there was a 90.68 % reduction in the overall CVBD incidence density rate (IDR)
in the treated group and initially positive dogs showed
significantly lower pathogen prevalence after treatment
at the third follow-up than untreated ones. The results
of this study demonstrated, that a preventative treatment
with ImPer against arthropods protects resident and naive
beagle dogs against tick-borne pathogens and L. infantum
infection in a highly infested environment.
69
Parasites & Vectors, edited by chris
arme, is an open access, peer-reviewed
online journal dealing with the biology of
parasites, parasitic diseases, intermediate
hosts and vectors. articles published in
this journal are available with no subscription charges or barriers to access,
and authors retain the copyright of their
material and may use it, or distribute it,
as they wish.
www.parasitesandvectors.com
eMeRGence oF ZoonotIc ARBoVIRUSeS
BY AnIMAL tRADe AnD MIGRAtIon
Martin pFEFFEr1, GErHard doblEr2*,
1
institutE oF aniMal HyGiEnE & VEtErinary public HEaltH, uniVErsity oF lEipZiG,
an dEn tiErKliniKEn 1, 04103 lEipZiG, GErMany
2
bundEsWEHr institutE oF MicrobioloGy, nEuHErbErGstrassE 11, 80937 MunicH, GErMany
*corrEspondinG autHor
EMail addrEssEs:
Mp: pFEFFEr@VEtMEd.uni-lEipZiG.dE
Gd: GErHarddoblEr@bundEsWEHr.orG
Abstract
arboviruses are transmitted in nature exclusively or to a major extend by arthropods. they belong to the most
important viruses invading new areas in the world and their occurrence is strongly influenced by climatic changes
due to the life cycle of the transmitting vectors.
several arboviruses have emerged in new regions of the world during the last years, like West nile virus (WnV)
in the americas, usutu virus (usuV) in central Europe, or rift Valley fever virus (rVFV) in the arabian peninsula.
in most instances the ways of introduction of arboviruses into new regions are not known. infections acquired
during stays in the tropics and subtropics are diagnosed with increasing frequency in travellers returning from
tropical countries, but interestingly no attention is paid on accompanying pet animals or the hematophagous
ectoparasites that may still be attached to them. Here we outline the known ecology of the mosquito-borne equine
encephalitis viruses (WEEV, EEEV, and VEEV), WnV, usuV, rVFV, and Japanese Encephalitis virus, as well as tickborne Encephalitis virus and its north american counterpart powassan virus, and will discuss the most likely mode
that these viruses could expand their respective geographical range. all these viruses have a different epidemiology
as different vector species, reservoir hosts and virus types have adapted to promiscuous and robust or rather very
fine-balanced transmission cycles. Consequently, these viruses will behave differently with regard to the requirements needed to establish new endemic foci outside their original geographical ranges. Hence, emphasis is given on
animal trade and suitable ecologic conditions, including competent vectors and vertebrate hosts.
Background
During the last decades the appearance of new infectious
diseases and an increasing invasion of diseases into new
areas created a new category of pathogens: emerging and
re-emerging pathogens. Most of the emerging viruses
are zoonotic which means they can infect both animals
and humans [1]. As outlined in detail in the examples
70
provided below, humans are dead-end hosts in most
cases. Hence, in the case of emerging viruses, zoonotic is
mainly defined as transmission of viruses from animals
to humans rather than vice versa [2]. Among emerging
viruses, arboviruses play a major role. Arboviruses are
defined as viruses that survive in nature by transmission
from infected to susceptible hosts (vertebrates) by cer-
tain species of arthropods (mosquitoes, ticks, sandflies,
midges etc.). The viruses multiply within the tissues of the
arthropod to produce high titres of virus in the salivary
glands and are then passed on to vertebrates (humans
and animals) by the bites of the arthropods [3].
To establish and maintain an arbovirus transmission cycle
three factors are essential: the arbovirus, the arthropod,
and the vertebrate. Usually, these three components have
a rather complex relationship including factors such as
the vector competence for the particular virus and the
susceptibility of the vertebrate host for the virus (producing a high-level viremia to allow other vectors to become
infected). As prerequisite for continuous circulation of
the virus between arthropod vector and vertebrate host,
all factors must be available in sufficient numbers, at the
same time and at the same place. Scientifically speaking,
a formula describing the vector capacity has to yield high
positive values to lead to reproduction rates above 1 for
the particular arbovirus [4-7]. Taking all this together,
the chance for such a scenario, i.e. the establishment of a
new endemic transmission cycle, are very low in general
and reports about a new “intruder” are rare. However,
the recent introduction of e.g. West Nile virus into the
Americas, Chikungunya virus into Italy or Usutu virus
into Austria are examples of the vulnerability of our modern societies for arboviruses [3,8, 9]. Sometimes the ways
of introduction of arboviruses are obvious as in the case
of Chikungunya virus in Italy, which was introduced by a
viremic traveller returning from India. In other cases they
remain obscure like the introduction of West Nile virus
into the Americas [10]. Principally, two mechanisms of
importation have to be discussed, the import by viremic
vertebrates (humans, animals) and import by virus-bearing arthropods. While the introduction of new arthropod
species, mainly mosquito species (e.g. Aedes albopictus,
Aedes japonicus), is well-known and, in several countries,
is under close observation, the risk and the importance of
animal trade for the importation of arboviruses has not
been studied extensively [11]. Vertebrate hosts, including
humans, may play a role as vehicles for importation and
the maintenance by amplifying various arboviruses.
Animals may be introduced into new areas intentionally or by their natural migration activities. The latter
naturally varies tremendously depending on the annual
migration patterns of the particular species. In Germany,
for example, 1322 neozoon species have been registered
since 1492, with 262 species that have established permanent and robust population numbers [12]. Regarding
the establishment of a new arbovirus transmission cycle,
these species may be suitable hosts to permit continuous viral transmission. Although not an arbovirus, the
introduction of monkeypox virus into North America in
2003 via a Gambian giant rat from Africa is yet another
example for animal trade contributing to the global spread
of zoonotic diseases [13]. So far, the trade of animals has
been rarely incriminated as means of importation of arboviruses. However, animals are traded for different reasons
across the entire world, for food and food production,
for scientific, educational and conservation reasons or as
companion or, as in the case of the Gambian giant rats,
pet animals, and also for touristic reasons [2, 11, 14]. The
magnitude of global movement of animals is immense.
From 2000 to 2004, more than a billion animals from 163
countries were legally imported into the United States of
America [15]. This equals almost 600000 animals per day,
but disease screening for arboviruses is mandatory only
in limited cases. Likewise, hematophagous ectoparasites
on imported animals which may act as vectors or which
are already infected are likely to go unnoticed. Other data
emphasise the potential of animal movement in the context of exotic pathogens. For the year 2002 it was estimated
that 49 million amphibians and 1.9 million reptiles have
been imported into the USA [16], providing a fair chance
to import pathogens due to a lack of clinical symptoms in
these animals [for review see 17].
Introduction of animals by chance may play a major role
in the introduction of arthropods. Several examples are
prominent like the introduction of Aedes albopictus into
the United States of America by used tyres or by bamboo
plants into the Netherlands [8, 18].
The last International Catalogue of Arboviruses listed
more than 500 arboviruses and related viruses [10; http://
www2.ncid.cdc.gov/arbocat/index.asp]. More than 150 of
these are known to cause human and/or animal diseases.
For many of those viruses, only limited information is
available regarding their vector and host spectrum. Hence,
we have chosen some prominent examples of important
arboviruses causing human and animal diseases, which
belong to the genera alphaviruses (family Togaviridae),
flaviviruses (family Flaviviridae), and phleboviruses (family Bunyaviridae) to discuss the animal aspect in virus
dispersal.
Western Equine Encephalomyelitis virus
Western Equine Encephalomyelitis (WEE) is caused by
the Western equine encephalomyelitis virus (WEEV)
which belongs to the genus Alphavirus in the family
Togaviridae [19]. The virus occurs through most of the
American continent, with virological and/or serological
evidence of occurrence in the western parts of Canada, the
U.S.A., in Mexico and throughout parts of Southern
America (Guyana, Ecuador, Brazil, Uruguay and Argentina)
[20,21]. WEEV is maintained in North America in a natural transmission cycle involving domestic and wild birds
as the most important maintenance and amplifying vertebrate hosts and mosquito vectors, primarily Culex tarsalis
71
[21, Figure 1]. However, WEEV was isolated or detected in
at least 14 mosquito species of the genus Aedes and six
species of the genus Culex [22]. In South America, an
additional mosquito-rodent cycle is postulated, involving
mosquitoes of the genus Aedes and vertebrate hosts
including rice rats (Oryzomys spp.), rabbits and introduced
European hares (Lepus europaeus) [23-26]. Humans and
horses do not develop viremias high enough to infect
blood-sucking mosquitoes [19]. Therefore, they may not
serve as maintenance or amplifying hosts and will not be
able to sustain a transmission cycle in nature.
In humans, WEEV causes severe encephalitis with higher
manifestation rates in children and in elderly persons.
Fatality rates may be up to 5% [21]. WEEV is an important pathogen of horses where it causes a severe form
of encephalomyelitis which may be fatal in up to 10
to 50% [21]. WEEV has constantly been declining in
North America over the last decades and no veterinary
nor human cases have been reported in 2009, with only
one submitted mosquito pool testing positive for WEEV
(http://diseasemaps.usgs.gov/; as of December 8th 2009).
Less land irritation and consequently less breading opportunities for vector mosquito species have been claimed for
the fading of the virus. To some extent the use of vaccines,
which are available for equines but not for humans, might
have attributed to this situation. Nevertheless, WEEV has
been used to develop chimeric vaccines in combination
with other alphaviruses such as Sindbis or eastern equine
encephalitis viruses [27; see below].
WEEV may be introduced to Europe or to other parts outside the Americas by different routes. Infected adult mosquitoes or infected Aedes eggs (Aedes dorsalis) may be possible means of importation [22]. WEEV may also be introduced into Europe by viremic birds or by viremic rodents.
As there are no major bird migration routes between the
American and European continents, a natural introduction via infected birds seems unlikely. However, some
long distance migrating bird species may share breeding
grounds in the arctic with a slight chance of exchanging
arboviruses, providing suitable vector mosquito species
are present. Sick humans or horses do not develop viremias high enough to infect mosquitoes and thus cannot
serve for the establishment of a new transmission cycle.
Although studies on the vector competence of European
mosquito species for the transmission of WEEV are missing, WEEV could be isolated from Culex pipiens and from
Aedes vexans. Both mosquito species form a major part
of the Central European mosquito fauna. For a natural
transmission cycle, WEEV is dependent on passerine birds
and possibly also on small wild mammals. Both groups
of animals are abundant in Europe and although no data
are available on the potential of European species to serve
as natural maintenance or amplifying hosts, there are no
72
obvious reasons to argue against a potential for transmission in European species. Hence, the risk of the introduction of WEEV into Europe seems to be low, although the
required components for a natural transmission cycle of
WEEV seem to be available (Table 1).
eastern equine encephalomyelitis Virus
Eastern equine encephalomyelitis (EEE) is caused by
eastern equine encephalomyelitis virus (EEEV) which
is also a member of the genus Alphavirus in the family Togaviridae. EEEV causes severe disease in humans,
in horses and in some game animals [28]. In humans,
fatality rates of up to 70% may be observed during some
epidemics [29]. In horses, fatality rates of EEV infection
may approach up to near 100% [19]. EEEV infections
cause neurological disease in introduced bird species,
like the sparrow, the ring-necked pheasant, the domestic
pigeon and emus [30]. Emus and pheasants seem to serve
as amplifying vertebrate hosts and epizootics in these animal stocks are observed with high fatality rates and enormous economic losses [31]. Besides birds, EEEV could be
isolated from bats; however no transmission was detected
in bats. Furthermore EEEV was isolated or infection was
serologically proven in amphibians and reptiles. They can
yield high viremias for several months and therefore are
candidates for overwintering of EEEV virus in temperate
climates [29, 32]. An effective vaccine for use in equines
is commercially available, but there is no approved EEEV
vaccine for humans to date.
EEEV occurs in North and South America. While the
natural transmission cycle(s) in South America are not
well understood, transmission in Eastern North America
is mainly dependent on ornithophilic mosquitoes of
the species Culiseta melanura and passerine and wading
birds of different species (Figure 1). The cycle is mainly
maintained in coastal and inland swamps. Human and
equine cases occur if large populations of mosquitoes
of other species are abundant after heavy rains. These
mosquito species may serve as bridging vectors, transmitting the EEEV obtained from viremic birds to horses and
humans due to their more non-catholic feeding behaviour [33, Figure 1]. EEEV was isolated from more than
20 different mosquito species, among them Culex pipiens
and Aedes vexans which also occur in Central Europe
and many other parts of the world (see: http://data.gbif.
org/species/13452448/). The results of studies of transovarial transmission of EEEV in mosquitoes are conflicting.
Probably EEEV is not transmitted via infection of eggs
to the next mosquito generation while for Coquilletidia
perturbans transovarial transmission could be proved [34].
The risk of an importation of EEEV into Europe or other
areas outside of the American continent seems to be low.
Basically, an importation seems possible via infected
table 1
Qualitative estimation of the impact of zoonotic arboviral diseases with a non-zero likelihood of evolving in response to animal
trade, animal migration and climate change.
Chances
for establishing new
endemic
foci (c)
Chances to
Impact on
be eliminapublic
ted again (d) health (e)
Impact on
veterinary
public
health (e)
Occurrence
and distribution influenced by
climate(f)
Arbovirus
Chances for
dispersal
Major mode
of dispersal
WEEV
Moderate
Long distance Moderate
(viremic birds) to high
Low to
moderate
Low
Low
Yes
EEEV
Moderate
Long distance Moderate
(viremic birds) to high
Low to
moderate
Low
Low
Yes
VEEV
Moderate
to high (a)
Short distance
(mosquitoes,
rodents)
Low to
moderate
Low
Low to
Yes
moderate (a)
WNV
Moderate
to high
Long distance Moderate
(viremic birds) to high
Zero to low
Moderate
to high
Low
Yes
JEV
Moderate
Long distance
Moderate
(viremic birds)
Low to
moderate
Moderate
to high
Low to
moderate
Yes
RVFV
Moderate
to high
Short to long
Moderate
distance (liveto high
stock animals)
Low to
moderate
Moderate
Moderate
to high
Yes
USUV
Moderate
to high
Long distance Moderate
(viremic birds) to high
Zero to low
Negligible
Low
Yes
TBEV
Low to
moderate
Short distance
Moderate
(ticks, rodents)
to high
(b)
Zero to low
Low
Negligible
Yes
POWV
Low to
moderate
Short distance
Moderate
(ticks, rodents)
to high
(b)
Zero to low
Low
Negligible
Yes
Moderate
(a)= depending on the VEEV subtype involved.
(b)= When ticks are attached to birds, the respective viruses can as well be carried over longdistances.
(c)= because the mechanisms allowing a successful establishing of new endemic foci are poorly understood, the estimates provided are speculative despite
for the viruses where this happened in recent history, e.g. WnV in america. Expansion of the geographic range of tick borne tbEV and poWV mainly
occurs on a different scale than with mosquito-borne arboviruses.
(d)= the general rule “the earlier the detection of the alien virus, the better the chance to successfully terminate it” applies for both mosquito- and
tick-borne viruses, but due to the life cycle of mosquitoes and the availability of efficient larvicides and adulticides, their abundance can be better
addressed with an integrated pest management and mosquito control program than fighting ticks in a tick habitat.
(e)= TBEV and JEV cause diseases in humans that can be prevented by applying safe and efficient vaccines. There is an inactivated vaccine available for the
three equine encephalitis viruses and WnV.
(f)= The distribution of all arboviruses depends to a major part of the abundance of suitable vector species. Since their life cycle is strongly influenced by
the weather, climate is an important issue in the occurrence and spread of arboviruses.
73
Figure 1
schematic drawing
of the endemic and
epidemic transmission cycles of
eastern (EEEV),
western (WEEV),
and Venezuelan
equine encephalitis
viruses (VEEV).
mosquitoes, infected birds (passerine, waders, farm birds
like emus or pheasants) and also via infected reptiles and
amphibians. As already mentioned for WEEV, no frequent
migration of birds between the Americas and Europe exists.
Therefore an introduction seems only possible as a result
of human activities (e.g. trade, scientific, conservation,
touristic activities). Although no studies on the vector
competence of European mosquito species for EEEV are
available, Aedes vexans and Culex pipens are among the most
abundant mosquito species in Europe. However, at least
in North America, Culiseta melanura seems to be the main
vector for EEEV. The genus Culiseta is a rather species poor
genus (five species worldwide), which has been claimed to
be the reason for higher levels of genetic identity in viruses
transmitted by Culiseta mosquitoes than in viruses that
mainly use Culex or Aedes vector species [35]. In contrast to
WEEV, where no clinical symptoms in birds seem to occur,
EEEV seems to cause neurologic disease and haemorrhagic
disease with death in many species of non-American wild
birds. Therefore, the introduction and establishment of
EEEV in the European bird populations would probably
cause high death rates in birds and would likely be detected
at an early time-point after introduction (Table 1). As for
WEEV, the basic factors for the establishment of a natural
cycle seem to be available in Europe also for EEEV.
74
Venezuelan equine encephalomyelitis Virus
Venezuelan equine encephalomyelitis is caused by a complex of viruses (Venezuelan equine encephalomyelitis virus,
VEEV) which belongs to the genus Alphavirus in the family
Togaviridae. The complex includes seven different virus
species and a number of subtypes and varieties [36]. VEEV
occurs mainly in tropical and subtropical regions of the
Americas and circulate endemically between mosquitoes
of the genus Culex (Melanoconion) and rodents (Oryzomys,
Proechimys, Sigmodon, Peromyscus, Heteromys, Zygodontomys)
[37, Figure 1]. However, some species of birds, mainly
herons, also develop high and prolonged viremias and
thus can infect blood-sucking mosquitoes. Therefore these
birds may serve as maintenance and amplifying hosts on
particular occasions [37]. Other wild or farm animals do
not seem to replicate VEEV in virus titres high enough to
serve as hosts for maintenance of transmission cycles. Also
humans infected with epidemic VEEV strains develop high
titres and may therefore play a role as maintenance and
amplifying hosts [38, 39].
Major VEE epidemics occur sporadically or periodically
when epidemic strains of the subtypes IAB and IC spill over
into competent mosquitoes of the genus Aedes and
Psorophora which have a peridomestic/peri-agricultural
behaviour and may transmit VEEV to equines, donkeys
and mules. Equids develop high virus titres and therefore
may serve as amplifying hosts for VEEV. An equine-mosquito-cycle may induce an extensive virus circulation with
a spill-over to humans and cause epidemic VEE (Figure 1).
Epidemic VEE in humans is a highly incapacitating dengue-like illness which in a small part of infected people,
mainly in children, may cause severe encephalitis with
fatality rates of 1 to 3% [40]. There is no specific treatment
available to cure the disease and no human vaccine to prevent it. A vaccine for equids, however, can be purchased.
The epidemic occurrence of VEEV during the last two
decades shows that it is highly variable in nature and
that single amino acid changes in the viral genome may
cause major changes in vector competence of mosquitoes
or in the pathogenicity in equids [41-43]. Studies also
show that epidemic strains of VEEV adapt to one of the
important epidemic bridge-vectors (Ochlerotatus taeniorhynchus formerly Aedes taeniorhynchus) and replicate to
higher titres in this mosquito species than in mosquitoes
involved in endemic transmission (Melanoconion) [44].
The introduction and establishment of VEEV into Europe
may be possible via infected mosquitoes, rodents, birds
(herons), horses and humans (Table 1). The establishment of enzootic viruses needs susceptible rodents and
transmitting competent mosquitoes. While in Central
and Southern America, mainly rodents of the subfamily
Sigmodontinae are involved as maintenance hosts, data
on the replication of different VEEV subtypes in European
rodents of the subfamilies Murinae and Arvicolinae are
not available. Whether mosquitoes of the genera Culex
and Aedes in Europe are competent for VEEV has not been
studied so far.
However, American strains of Aedes albopictus were found
to be capable of transmitting VEEV [45, 46]. Therefore, at
least a limited peri-domestic or urban (human-mosquitohuman) transmission cycle with epidemic VEEV strains
seems possible (Table 1). However, for larger epizootics and epidemics of VEEV, larger populations of nonimmune equids are a prerequisite for the initiation of the
epidemic transmission cycles.
West nile Virus
„blood
transfusion,
organ
transplantation“
West Nile virus (WNV) is a member of the
Japanese encephalitis group of the genus
Flavivirus in the family Flaviviridae. The
evolutionary origin of WNV seems to be in
Central Africa, from where it spread over
various parts of the world and locally new
genotypes emerged [47]. Actually five genetic lineages are recognized, from which only
lineage 1a is distributed worldwide while
the other lineages and sub-lineages exhibit
a more local geographic distribution [48].
WNV causes a febrile illness or encephalitis
in humans and horses [49]. In humans the
fatality rate of WNV CNS infections ranges
from 5 to 10% with higher rates in elderly
people or those with additional underlying
diseases [50]. The introduction of WNV in
the Americas caused a high fatality rate in
different American species of birds (e.g.
Corvidae), while fatalities by WNV infections in wild birds in the Old World have
not been reported so far [51]. However in
Israel epizootics in geese were repeatedly
reported during the last decades.
Figure 2
schematic drawing of the transmission cycles
and possible modes of dispersal of West nile
virus.
75
Like other members of the Japanese encephalitis serogroup, WNV in nature is maintained in a bird-mosquito
cycle (Figure 2). WNV was isolated or detected in at least
43 species of old world mosquito species, mainly belonging to the genus Culex [52]. The importance of other
mosquito genera and species (Aedes, Anopheles, Aedomyia,
Mansonia, Coquilletidia) and of hard and soft ticks
(Hyalomma, Dermacentor, Rhipicephalus, Amblyomma, Argas,
Ornithodoros) for the endemic and epidemic transmission
cycles remains to be determined [53]. Various birds, mainly passerines serve as primary vertebrate hosts of WNV
[54, 55]. WNV infections were also detected in rodents
and other small mammals, however, these animals do
not seem to produce viremias high enough for maintaining the transmission cycle. Moderate viremias, however,
were detected in horses and in lemurs in Madagascar [55].
These animals may support the virus transmission cycle
under local ecological conditions. In one study a frog
(Rana ridibunda) was found to be viremic and was able
to transmit the virus to blood-sucking Culex pipiens [56].
Therefore, also a frog-mosquito-frog-cycle seems to be
possible under certain ecological conditions.
WNV is an often cited example of a dispersing arbovirus
since it invaded into North America in 1999 [10]. From
the original point of invasion (New York) the WNV
dispersed within a few years over the total continental
U.S.A. and Southern parts of Canada and also migrated
into Central America and parts of South America. The
main way of migration is thought to be via migration
of birds. Several bird species (house sparrow, blue jays,
American robins) may have played an important role in
the distribution of WNV in the Americas. Additionally,
there is evidence that different mosquito species were
important in different parts of Northern America for the
transmission of WNV, and that a more efficiently replicating strain evolved in 2003 entirely replacing the originally
introduced WNV strain in North America [57].
The exact way of introduction of WNV into North America
is still unclear. Several additional factors are discussed
which improved the establishment and transmission of
WNV in this new environment (Table 1). Among them
are the introduction and geographic dispersion of large
and WNV non-immune populations of the house sparrow, which served as a very efficient maintenance host for
WNV, the availability of a very competent vector (Culex
pipiens), climate warming, and perhaps also the decline
of infections with the closely related St. Louis encephalitis virus, an indigenous virus of the Japanese encephalitis serogroup in the Americas [9]. However in Europe,
instead of all discussions on the geographic dispersion
and introduction into new regions, no clear increase
of the range of distribution of WNV can be observed.
Since the early 1970s, when the virus was detected in
Czechoslovakia, no extension of distribution further
northward was detected despite many efforts to detect
WNV in Central and Northern Europe after the introduction in the Americas, although competent vectors as well as maintenance and
amplifying hosts for WNV seem to exist in
Central Europe and repeated introductions
into Central Europe have occurred [58, 59].
In a risk assessment of the introduction
of WNV into the Galapagos Islands, four
modes of introduction are discussed: introduction via infected humans, via infected
migratory birds, via infected mosquitoes,
and via human-transported host vertebrates [60]. The introduction via infected
humans could be excluded, as humans
do not develop viremias high enough for
infecting mosquitoes. The analysis showed
„farms“
that the highest risk of an introduction
of WNV is infected mosquitoes unintentionally transported in airoplanes carrying
„rice fields“
dead-end hosts
rural infections
76
rural & peri-urban infections
Figure 3
schematic drawing of transmission cycles and
rural as well as peri-urban infections of animals
and humans with Japanese encephalitis virus.
tourists. Also the introduction of WNV via infected eggs
or larvae in tyres seemed to be of importance. Instead, the
introduction of WNV via migratory birds or via infected
chickens seemed to be at least one magnitude lower than
due to airoplane-transported mosquitoes. In the case of
optimized conditions the introduction of WNV may most
probably happen due to migratory birds or via carrying
of infected mosquitoes from endemic areas via human
transport activities. Therefore, the migratory bird routes
and the main transport routes from endemic southern
and South-eastern Europe may be most important for
continuous surveillance [48, 61, 62].
Japanese encephalitis Virus
Japanese encephalitis virus (JEV) is a member of the
similarly named serogroup in the genus Flavivirus of
the family Flaviviridae. JEV is transmitted in a natural
transmission cycle involving mosquitoes of the genus
Culex and water birds (mainly egrets and herons) [63].
Actually five lineages of JEV can be distinguished which is
of importance for epidemiological studies [9]. Currently,
JEV is the most important mosquito-transmitted arbovirus, causing encephalitis in the world. An estimated
30,000 to 50,000 human cases occur every year [64]. Up
to 30% of all ill humans die, and about half of the surviving patients show persisting, life-long neurologic sequelae
[65]. JEV infects a number of different animals, among
them dogs, ducks, chicken, cattle, bats, snakes and frogs.
Humans and horses may develop a severe and fatal form
of encephalitis. However, the viremia titres in humans
and horses are not high enough to serve as transmission
hosts (Figure 3). In contrast, pigs develop high viremias
and they therefore serve as amplification hosts for bridge
vectors to initiate epizootics and epidemics [66].
The natural transmission cycle mainly involves mosquitoes of the genus Culex. The primary vector is Culex
tritaeniorhynchus, which is associated with rice paddies
and irrigated crop fields in whole Southeast Asia. Culex
tritaeniorhynchus feeds on water birds and on larger
mammals, also on pigs and therefore transmits JEV to
this important amplifying host, and also to equids and
to humans. Other Culex species, like Culex pipens, Culex
vishnui and Culex bitaeniorhynchus may play a local role for
the transmission of JEV (Figure 3). The natural vertebrate
hosts of JEV are ardeid birds, mainly the black-crowned
night heron (Nycticorax nycticorax) and the Asian cattle
egret (Bubulcus ibis coromandus) [67]. There is evidence
that JEV is also transmitted transovarially in Culex tritaeniorhynchus. Therefore, an enzootic or an epizootic cycle
may be initiated from mosquitoes directly after diapause.
The invasion of JEV in new areas in Southeast Asia during the last decades has been mainly associated with the
increase of human populations and, consequently, in
increasing areas of rice paddies and pig farming [68].
JEV recently expanded also in higher altitudes in the
Kathmandu valley of Nepal and into New Guinea and to
the Torres Straight and to Northern Australia [69, 70].
Japanese encephalitis virus shows a clear tendency of
expansion. One mechanism of spread involves the air
transport of infected mosquitoes. This method of spread
was shown by the introduction of JEV into Pacific islands
like Guam or Saipan [71, 72]. A recent study showed that
the potential risk of an introduction of JEV into the west
coast of the United States is possible. Competent vectors
and pigs as amplifying vertebrate hosts are available in
moderate numbers. However pigs in California do not
live in residential environments as in Asia, but in large
pig farms, which are dispersed throughout the state.
Therefore, the risk of a spread of introduced JEV may
be lower as in the agricultural areas of Asian countries.
However, the feral pig production farms provide sufficient
non-immune populations for an amplification and potential spread of JEV in California. As the viremia in pigs may
be prolonged, also the transport of pigs to new locations/
farms may provide a way of transport for the spread of
JEV for small and moderate distances. Also, a further
introduction into central Asia and even into eastern and
Central Europe seems possible (Table 1). Birds may also
play a critical role of transporting over long distances and
pigs may be responsible for the local distribution of the
virus. JEV is one of the arboviruses with a high potential
of expansion into virgin areas [73].
Rift Valley Fever Virus
Rift Valley fever (RVF) is a disease which was first described
as an entity during an epizootic outbreak in 1930 - 1931
in Kenya [74]. There, the etiologic agent, Rift Valley fever
virus (RVFV) causes severe disease, stillbirth and often
death of cattle, sheep and goats [75]. Only in the 1950s,
first cases of an undifferentiated fever in humans were
associated with infection of RVFV. Apart from the original
outbreak, the pathogenic potential of RVFV for humans
was described in detail during outbreaks in the 1950s [74].
In 1975, during a large outbreak of RVF in South-Africa,
the first fatal human cases were described and the virus
was reclassified as a hemorrhagic fever virus [76]. Until
1977, RVFV outbreaks were limited to Sub-Saharan Africa.
In 1977 an epizootic RVF epidemic occurred in Egypt, for
the first time north of the Saharan desert. During this epidemic more than 200,000 human cases with 600 fatalities
were registered. Besides hemorrhagic manifestations the
virus caused retinitis with blindness, hepatitis and encephalitis [77, 78]. During the late 1980s a new extension of
the geographic range of RVFV into western Africa was
detected. And again in 2000, RVFV caused an epizootic
and epidemic in Saudi-Arabia and Yemen, the first time
77
that RVF was detected outside of Africa [79, 80].
RVFV belongs to the genus Phlebovirus of the family
Bunyaviridae. It is transmitted in an enzootic cycle among
wildlife and mosquitoes [81]. RVF is a promiscuous
virus, using a number of different mosquito species
belonging to different genera (Aedes, Ochlerotatus,
Stegomyia, Anopheles, Culex, Neomelaniconion, Eretmapodites
and others) as vectors [74, Figure 4]. The role of most
of these mosquito species for the maintenance of the
enzootic cycle is unclear. Probably the most important
way of maintaining the enzootic cycle is the transovarial
transmission in mosquitoes, mainly of the genus Aedes.
Aedes macintoshi seems to play a major role in Eastern
Africa [82]. Aedes macintoshi lays infected eggs into the
ground and these eggs need one or more severe flooding to hatch. Therefore an inter-epidemic period (low
mosquito population, low number of cases of RVF) and
an epidemic period (high populations of mosquitoes and
high numbers of sick animals and of human cases) can be
distinguished. The occurrence of epidemic periods is clearly associated with heavy rains which are closely linked to
warming of the Indian Ocean during the El Nino Southern
Oscillations (Figure 4). The impact of
climate change on Rift Valley fever virus
infections is clearly relevant and has been
subject to a recent review [83]. Wild and
domestic animals are infected and serve as
amplification hosts to create more infected mosquitoes. RVFV may be transmitted
to other mosquito species which serve as
bridging vectors to other wild and domestic
animals and to humans which may cause
further amplification of the transmission
cycle [84, Figure 4].
These examples show that RVFV, without
any doubt, is one of the most aggressive migrating arbovirus. The routes of
dispersal detected so far seem to be in
parallel with the great migration routes of
camels. Therefore, there is some good evidence that viremic, but non-symptomatic
infected camels transported the virus to
Egypt and possibly also to the Arabian
Peninsula [85]. As also humans may serve
as amplifying hosts, the introduction of
RVFV by viremic humans seems possible
and probable. In 2008, one case of RVF
was diagnosed retrospectively in Germany
in an ill woman, who had returned from
Africa [86]. However, few data exist on
the vector competence of European mosquito species for RVFV. Initial results on
the dissemination rates in some infected
mosquito species tested, suggest that most
of these may serve as vectors [87]. Likewise,
an introduction into the United States
Figure 4
schematic drawing of the development from an
endemic transmission cycle through an epizootic
transmission cycle to epidemic transmission of
rift Valley fever virus,
78
may be possible, as was seen for West Nile virus in
1999. Several ways of introduction were discussed, and
the risk of importation into the US by infected animals,
by infected people, by mechanical transport of infected
insects, intercontinental wind-borne transport of RVFVbearing insects, and also by intentional introduction
and release of RVFV were assessed [88]. Studies on the
vector competence of Northern American mosquitoes
showed that several common species (Aedes vexans, Culex
erraticus, Culex nigripalpus, Culex quinquefasciatus, Culex
salinarius) can be infected and develop systemic infection.
However, only Aedes vexans and Culex erraticus developed
virus titres which were high enough to transmit the virus
to laboratory animals [89, 90]. Therefore with the presence of competent vectors and large populations of naive,
non-immune wild and domestic ruminants (and possibly
humans), the necessary factors exist in North America to
establish a transmission cycle (Table 1).
Similar studies for Europe are still missing. However,
there is little doubt that vectors and ruminants are present in Europe to allow establishing of at least temporary
enzootic transmission cycles (Table 1).
Usutu virus
Usutu virus (USUV) belongs to the Japanese encephalitis serogroup within the mosquito-borne cluster of the
genus Flavivirus in the family Flaviviridae [91]. It was
originally isolated from mosquitoes of the genus Culex
in South Africa in 1959. Since that time the virus was
isolated several times from mosquitoes, rodents and
birds throughout Sub-Saharan Africa [92]. There has been
some limited information that USUV may be the etiologic agent of a mild human disease with fever and rash
[93]. In 2001, USUV suddenly emerged in the area of the
Austrian capital Vienna and caused widespread deaths
among the population of Eurasian blackbirds (Turdus
merula) and some other bird species. USUV could be
detected the following years and its area of distribution
extended into south-east (Hungary), south (Italy), west
(Switzerland), and north (Czech Republic, Poland) of
the original location of emergence where it also caused
mortality in birds [55, 94, 95]. In 2009, USUV was shown
to exhibit human pathogenicity when it was for the first
time detected to cause neuroinvasive infection in two
patients with immune deficiency (orthotopic liver transplantation, B cell lymphoma) in Italy [96, 97]. USUV,
most probably was introduced into Austria via viremic
birds returning from their winter migration from Africa
to Europe. Another possible way of introduction could
be the transport of virus-infected mosquitoes from Africa
to Austria via airoplane, as the location of emergence in
Austria, Vienna, harbours the largest international airport
in Austria.
USUV is thought to be maintained in nature in a mosquito-bird transmission cycle. In Africa ornithophilic mosquitoes of the genera Culex, Coquillettidia and Mansonia
are thought to be the main vectors. In Austria, Culex spp.
may play a major role, although USUV so far has not
been isolated from mosquitoes but has been detected in
overwintering Culex pipiens pools by real-time RT-PCR
(our own unpublished results). There seems to be a mode
of adaptation of the virus to the new bird species and/
or to the new mosquito species in Europe. After high
mortality rates in blackbirds during the first two years
of emergence of USUV, in the following years increasing
rates of seropositive birds were detected in Austria which
gave evidence for a continuing circulation of USUV with a
somewhat lower pathogenicity, inducing an herd immunity in the bird populations [94].
USUV appears as an impressive example for the introduction and permanent establishment of a so-called “tropical” arbovirus in moderate climates. In a recent study, it
was argued thatUSUV is mainly maintained in a natural
cycle in areas of Austria with a minimum of at least ten
hot days (> 30° C) [98]. In this simulation it is predicted
that USUV will become endemic in larger parts of Central
Europe until the end of the century. According to the
presented model, optimal environmental conditions for
outbreaks of USUV will occur in about 10 years from now
on [98]. Whether USUV will develop in a similar way as
WNV did in the Americas remains to be seen in the future.
And even more striking is the question whether the closely related WNV would behave in a similar way.
tick-borne encephalitis virus
So far, only the invasive potential of mosquito-borne
arboviruses has been discussed. The example of tickborne encephalitis virus (TBEV) shows that also ticktransmitted arboviruses may be able to invade new areas.
TBEV is a flavivirus of the tick-borne group of the genus
Flavivirus in the family Flaviviridae [99]. It is distributed
in the northern hemisphere of Europe and Asia. There, it
is transmitted in nature by hard ticks (Ixodidae, almost
exclusively Ixodes ricinus and Ixodes persulcatus). The natural vertebrate hosts of TBE virus are small rodents of the
genera Myodes and Apodemus, although other Rodentia or
Eulipotyphla (formerly: Insectivora) may contribute to
the natural transmission cycle [99; see Figure 5]. In contrast to mosquitoes, ticks do not depend on a sufficient
viremia of the infected host to take up an arbovirus. While
blood-feeding until repletion of a mosquito is a question
of a few minutes, ticks are attached to their host for up
to a week. So-called saliva-assisted transmission (SAT)
is the indirect promotion of arbovirus transmission via
the actions of tick saliva molecules on the vertebrate host
[100]. The skin site where ticks feed is highly modified
79
Figure 5
schematic drawing
of the transmission
cycle of tick-borne
encephalitis virus.
by the pharmacologically active molecules secreted in
the tick saliva. This phenomenon is crucial in maintaining a threshold level of infected tick individuals in a tick
population through a mechanism known as co-feeding.
Co-feeding is facilitated through feeding of a number of
ticks in close proximity on the host skin and mediated
via the tick saliva. During co-feeding, pathogens such
as TBEV are transferred from one tick to another [101].
Adults and immature ticks (either larvae or nymphs) feed
on the same reservoir host, mostly rodents, thus transmitting and maintaining the arbovirus between the different
life stages of the vector. Co-feeding and thus the TBEV
prevalence in an enzootic focus depends on the simultaneous presence of nymphs and larvae (and adults) on
the vertebrate host. As for Ixodes ricinus in Europe, larvae
become active above 10°C while nymphs start searching
for suitable hosts at 7°C. This means, among many other
factors, that a fast warming in spring will be beneficial for
co-feeding and in turn will result in higher numbers of
TBEV-positive ticks [102, 103].
TBEV is the most important tick-transmitted arbovirus of
human pathogenicity in Europe and Asia [104, 105]. An
estimated 10000 to 15000 human cases occur annually
with a fatality rate of 1% (Western subtype) to up to 20%
80
(Far Eastern subtype) [106, 107]. The geographic origin of
the emergence of TBEV has been known due to comparative sequence studies for several years. These studies show
that TBEV originated somewhere in the Siberian or Far
Eastern area [108]. From there, the virus dispersed to the
south and to the west. During its movement new subtypes
and viruses evolved: the western subtype of TBEV and
louping ill virus on the British islands, in Spain and in
Norway [109]. The movement into the eastern direction
finally ended in the evolution of the Far Eastern subtype
(in China and Japan) and Powassan virus which is prevalent in Russia and in Northern America [109, 110]. More
additional available viral sequences showed that TBEV
was introduced at least three different times to Japan alone
during the last several hundred years [110]. However,
not much is known about the possible ways how TBEV
disperses over long distances. As humans and domestic
animals (cattle, goat, and sheep) and game animals (deer,
boar, fox, and wolf) do not develop high viremias they
are unable to re-infect ticks during blood-sucking (deadend hosts). Therefore, viremic humans and animals seem
not to play a role in transporting TBEV into new areas.
Mainly goats and, to a lesser extent, also cattle and sheep
may transmit the virus via milk to their offspring. In case
of trading raw milk and cheese products, the virus can be
transported and can infect humans [111], but the mode
of dispersal cannot result in establishing a new TBEV
focus (Table 1). Scandinavian researchers showed that the
migration of birds could play a major role for the migration of tick-borne viruses. They found ticks (mainly larvae
and nymphs of Ixodes ricinus) on every 30th bird which
migrated in autumn from Northern Europe towards the
South. About one out of 2200 migrating birds carried a
TBEV-infected tick [112]. These data offer new insights
into the potential migration of TBEV over long distances.
However, no phylogenetic relationship between TBEV
strains from northern Europe and from Central Europe
could be detected. A new phylogenetic study of more than
160 TBE virus strains from the Siberian region shows that
TBEV in Russia moved along the main transport routes in
Russia [113]. At least two introductions from Siberia into
western direction are detectable. These invasions of TBEV
into western parts of Russia and the Baltic countries can
be associated with major human activities, the construction of the first land road into Siberia and the construction of the Trans-Siberian Way [113]. The anthropogenic
factor, i.e. human activity therefore seems to be the most
important factor for the distribution of TBEV into the
western parts of Europe. Potential ways of transport may
be viremic rodents which follow humans on the main
routes or virus-infected ticks which are carried by humans
or human-associated animals (Table 1).
Powassan virus
Powassan virus (POWV) is the sole member of the tickborne encephalitis serological complex of flaviviruses
in North America. It received its name after the town
Powassan in Ontario, Canada, were it was isolated from
the brain of a child deceased after encephalitis in the
late 1950th [114] and a couple of years earlier from ticks
collected in Colorado, USA [115]. The latter was initially
name deer tick virus and listed as a distince virus species
DTV, but recent molecular analyses placed DTV as a genotype of POWV [116-118]. More interesting is the ecology
of POWV, since it seems to exist in three rather discrete
enzootic cycles: Ixodes cookie and woodchucks and mustelids; Ixodes marxi and squirrels; Ixodes scapularis and whitefooted mice [119]. POWV has also been found in considerable numbers in Dermacentor ticks, namely D. andersoni
and D. variablis but the corresponding enzootic cycle has
not ben explored in further detail. Vertical transmission
of POWV was observed in Ixodes scapularis [120]. The current distribution of POWV with parts of Canada and the
USA, as well as Parts of Russia is interesting because it suggests that the Bering Strait had to be crossed at least once
in history to explain the current geographical range of
POWV. Phylogenetic studies of the TBE serogroup viruses
place an Eurasian progenitor as common ancestor for
POWV in North America [121]. One way of how POWV
could have been introduced is by animals moving across
the Bering land bridge during a recent glacial period or
by migrating birds (as discussed above for TBEV). The
tight clustering of Russian and Canadian strains suggests
a rather recent introduction perhaps along with American
mink that were imported to support fur trade [122]. So
this is likely another example of the emergence of an
arbovirus by animal trade.
It is interesting that for other tick-borne arboviruses,
similar results on the importance of human activities for
the spread into new, non-endemic areas are evolving.
Kyasanur Forest virus, a virus related to TBEV is limited
to some regions (Karnataka) in India [123]. However, a
few years ago a closely related tick-borne virus, Alkhurma
virus, was detected in cases of hemorrhagic fever in Saudi
Arabia [123]. Also for this virus, mainly human activities are suspected for the recent dispersion by viremic
animals or virus-infected ticks from India to the Arabian
Peninsula. For another tick-borne arbovirus, CrimeanCongo Hemorrhagic Fever virus, human activities and
changes in agricultural practices seem to be a major factor for emergence and distribution during the last years
[124]. Louping ill virus is a relative of TBEV. This virus
probably evolved on the British Isles from the introduced
TBEV strain(s) [125]. Louping ill virus was transported
with human activities to the Iberian Peninsula where a
new subtype of the virus has evolved since then (Spanish
sheep encephalitis virus). It was also transported to
Norway where it is now dispersing, possibly due to climatic changes, to the north [125].
conclusions
Arboviruses are maintained in nature in complex transmission cycles between arthropods and vertebrates. They
have developed strategies of adaptation and evolution to
spread into new areas and eventually become established.
Several recent examples show, that tropical arboviruses
are capable to spread to countries with moderate climates.
While bird-associated mosquito-borne viruses seem to be
transported mainly by migrating birds, human activities
(travel, trade) play a major role for arboviruses where
humans play a role as natural vertebrate hosts. Also for
tick-borne arboviruses, mainly human activities seem to
contribute to the spread over long distances and the establishment in new ecosystems changed by human activities.
In most cases of newly emerging zoonotic arboviruses,
the ways of introduction remain obscure. Future research
should aim at exploring the circumstances of these events.
A better understanding of how arboviruses travel and why
they become established in other geographic areas will be
of great benefit for human and veterinary public health,
81
because it may help to prevent devastating outbreaks of
arboviral diseases in humans and animals.
7.
competing interests
The authors declare that they have no competing interests.
Author contributions
Both authors contributed equally to this work.
Acknowledgements
8.
9.
10.
The work of the authors is funded by the Federal Ministry
of Education and Research (BMBF) grant 01KI 0712 as
part of the network “Emerging arthropod-borne viral
infections in Germany”. Publication of the CVBD5 thematic series has been sponsored by Bayer Animal Health
GmbH.
11.
Parasites & Vectors 2010, 3:35
(http://www.parasitesandvectors.com/content/3/1/35)
The original article is published as an open access article
distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution,
and reproduction in any medium, provided the original
work is properly cited.
References
1.
2.
3.
4.
5.
6.
82
Jones KE, patel nG, levy Ma, storeygard a, balk d,
Gittleman Jl, daszak p. Global trends in emerging
infectious diseases. Nature 2008, 451: 990-993.
bengis rG, leighton Fa, Fischer Jr, artois M, Mörner t,
tate cM. the role of wildlife in emerging and
re-emerging zoonoses. Rev Sci Tech Off Int Epiz
2004; 23: 497-511.
World Health organization. Arthropod-borne
and rodent-borne viral diseases. Report of a
WHO Scientific group. Wld Hlth Tech Rep Ser 1985,
719: 1-114.
carver s, bestall, a, Jardine a, ostfeld rs. Influence of
hosts on the ecology of arboviral transmission: Potential mechanisms influencing dengue, Murray Valley encephalitis, and Ross
River virus in Australia. Vector-Borne Zoonotic Dis
2009; 9: 51-64.
lambrechts l, scott tW. Mode of transmission
and the evolution of arbovirus virulence in
mosquito vectors. Proc Royal Soc B 2009; 276: 13691378.
pfeffer M, dobler G. Was kommt nach Bluetongue
– europa im Fadenkreuz exotischer Arboviren. Berl. Münch Tierärztl Wochenschr 2009; 122: 458466 [in German].
12.
13.
14.
15.
16.
17.
18.
19.
20.
Kuno G, chang GJJ. Biological transmission of
arboviruses: Reexamination of and new
insights into components, mechanisms, and
unique trias as well as their evolutionary
trends. Clin Micribiol Rev 2005; 18: 608-637.
sutherst rW. 2004. Global change and human
vulnerability to vector-borne diseases. Clin
Microbiol Rev 2004, 17: 136-173.
Weaver sc, reisen WK. Present and future arboviral threats. Antiviral Res 2010; 85: 328-345.
lanciotti rs, roehrig Jt, deubel v, smith J, parker M,
steele K, crise b,Volpe KE, crabtree Mb, scherret JH,
Hall ra, MacKenzie Js, cropp cb, panigrahy b, ostlund
E, schmitt b, Malkinson M, banet c, Weissman J, Komar n,
savage HM, stone W, Mcnamara t, Gubler dJ. origin of
the West nile virus responsible for an outbreak of encephalitis in the northeastern
United States. Science 1999, 286: 2333-2337.
Marano n, arguin pM, pappaioanou M. Impact of
globalization and animal trade on infectious
disease ecology. Emerg Infect Dis 2007, 13: 18071809.
schmidt o. Neue Tier- und Pflanzenarten – Bereicherung oder Bedrohung unserer Wälder?
LWF aktuell 2004 45: 1-3. [in German]
anonymus. Update: multistate outbreak of
monkeypox-Illinois, Indiana, Kansas, Missouri, ohio, and Wisconsin, 2003. Morb Mortal
Wkly Rep. 2003, 52:642-6.
pavlin bi, schloegel lM, daszak p. Risk of importing zoonotic diseases through wildlife trade,
United States. Emerg Infect Dis 2009, 15: 1721-1726.
Jenkins PT, Genovese K, Ruffler H. Broken screens:
the regulation of live animla transportation
in the United States. Washington dc: defenders
of Wildlife 2007. [www.defenders.org/resources/
publications/programs_and_policy/international_
conservation/broken_screens/broken_screens_report.
pdf.]
Ginsburg J. Dinner, pets and plagues by the
bucketful. The Scientist 2004 18: 28 [http://www.thescientist.com/2004/4/12/]
Essbauer s, ahne W.Viruses of lower vertebrates. J Vet
Med B Infect Dis Vet Public Health. 2001; 48: 403-75.
scholte EJ, dijkstra E, blok H, de Vries a, takken W,
Hofhuis a, Koopmans M, de boer a, reusken cb. Accidental importation of the mosquito Aedes
albopictus into the netherlands: a survey of
mosquito distribution and the presence of
dengue virus. Med Vet Entomol 2008, 22: 352-358.
Zacks Ma, paessler s. encephalitic alphairuses. Vet
Microbiol 2010, 140: 281-286.
Karabatson n. 1985. the International catalogue of Arboviruses. san antonio, american
society of tropical Medicine and Hygiene. 3rd Edition.
the subcommittee on information Exchange of the
american committee on arthropod-borne viruses.
21. Weaver sc, Kang W, shirako y, rumenapf t, strauss EG,
strauss JH. Recombinational history and molecular evolution of western equine encephalomyelitis complex alphaviruses. J Virol 1997,
71: 613-623.
22. reisen WK, Monath tp: Western equine encephalomyelits. in: The Arboviruses: Epidemiology and Ecology.
Edited by Monath t. boca raton, crc press 1989, vol V,
89-138.
23. Fulhorst cF, Hardy Jl, Eldrigde bF, presser sb, reeves
Wc. natural vertical transmission of western
equine encephalomyelitis virus in mosquitoes. Science 1994, 263: 676-678.
24. Monath tp, sabattini Ms, pauli r, daffner JF, Mitchell cJ,
bowen Gs, cropp cb. Arbovirus investigations
in Argentina 1977-1980. IV. Serologic surveys
and sentinel equine program. Am J Trop Med Hyg
1985, 34: 966-975.
25. Mitchell cJ, Monath tp, sabattini Ms, daffner JF, cropp
cb, calisher cH, darsie rF, Jacob Wl. Arbovirus
isolations from mosquitoes collected during
and after the 1982-1983 epizootic of western equine encephalitis in Argentina. Am J Trop
Med Hyg 1987, 36: 107-113.
26. calisher cH, Monath tp, Mitchell cJ, sabattini Ms,
cropp cb, Kerschner J, Hunt ar, lazuick Js. Arbovirus investigations in Argentina, 1977-1980.
III Identification and characterization of
viruses isolated, including new subspecies of
western and Venezuelan equine encephalitis viruses and four new bunyaviruses (Las
Maloyas, Resistencia, Barranqueras and Antequera). Am J Trop Med Hyg 1985, 34: 956-965.
27. Kenney Jl, adams ap, Weaver sc. transmission
potential of two chimeric western equine
encephalitis vaccine candidates in Culex
tarsalis. Am J Trop Med Hyg 2010, 82: 354-359.
28. schmitt sM, cooley tM, Fitzgerald sd, bolin sr, lim a,
schaefer sM, Kiupel M, Maes rK, Hogle sa, o’brien dJ.
An outbreak of eastern equine encephalitis
virus in free-ranging white-tailed deer in
Michigan. J Wildl Dis 2007, 43: 635-644.
29. Morris cd. eastern equine encephalomyelitis.
in: The Arboviruses: Epidemiology and Ecology. Edited by
Monath t. boca raton, crc press 1988, vol iii, pp 1-20.
30. cohen sb, lewoczko K, Huddleston db, Moody E,
Mukherjee s, dunn Jr, Jones tF, Wilson r, Moncayo ac.
Host feeding patterns of potential vectors
of eastern equine encephalitis virus at an
epizootic focus in tennessee. Am J Trop Med Hyg
2009, 81: 452-456.
31. tengelsen la, bowen ra, royals Ma, campbell Gl, Komar n, craven rb. Response to and efficiacy of
vaccination against eastern equine encephalomyelitis virus in emus. J Am Vet Med Assoc 2001,
218: 1469-1473.
32. Hayes RO, Daniels JB, Maxfield HK, Wheeler RE. Field
and laboratory studies on eastern encephalitis in warm- and cold-blooded vertebrates.
Am J Trop Med Hyg 1964, 13: 595-601.
33. Vaidyanathan r, Edman Jd, cooper la, scott tW. Vector competence of mosquitoes (Diptera: culicidae) from Massachusetts for a sympatric
isolate of eastern equine encephalomyelitis
virus. J Med Entomol 1997, 34: 346-352.
34. Morris cd, srihongse s. An evaluation of the
hypothesis of transovarial transmission of
eastern equine encephalomyelitis virus by
culiseta melanura. Am J Trop Med Hyg 1978, 27:
1246-1250.
35. lundström Jo, pfeffer M. Phylogeographic structure and evolutionary history of Sindbis
virus. Vector-Borne Zoon Dis 2010, in press.
36. Weaver sc, Ferro c, barrera r, boshell J, navarro Jc.
Venezuelan equine encephalitis. Annu Rev Entomol 2004, 49: 141-174.
37. Walton tE, Grayson Ma. Venezuelan equine
encephalomyelitis. in: The Arboviruses: Epidemiology
and Ecology. Edited by Monath t. boca raton, crc press
1988, vol iV, pp 203-231.
38. aguilar pV, Greene lp, coffey ll, Medina G, Moncayo
ac, anishchenko M, ludwig GV, turell MJ, o’Guinn Ml,
lee J, tesh rb, Watts dM, russell Kl, Hice c,yanoviak
s, Morrison ac, Klein ta, dohm dJ, Guzman H, travassos da rosa ap, Guevara c, Kochel t, olson J, cabezas
c, Weaver sc. endemic Venezuelan equine
encephalitis in northern Peru. Emerg Infect Dis
2000, 10: 880-888.
39. Quiroz E, aguilar pV, cisneros J, tesh rb, Weaver sc.
Venezuelan equine encephalitis in Panama:
fatal endemic disease and genetic diversity
of etiologic viral strains. PLoS Negl Trop Dis 2009,
2: e472.
40. paessler s, Weaver sc. Vaccines for Venezuelan
equine encephalitis. Vaccine 2009, 27S4: d80-85.
41. anishchenko M, bowen ra, paessler s, austgen l,
Greene lp, Weaver sc. Venezuelan encephalitis
emergence mediated by a phylogenetically
predicted viral mutation. Proc Natl Acad Sci U.S.A.
2006, 103: 4994-4999.
42. brault ac, powers aM, Holmes Ec, Woelk cH, Weaver
sc. Positively charged amino acid substitutions in the e2 envelope glycoprotein are
associated with the emergence of Venezuelan equine encephalitis virus. J Virol 2002a 76:
1718-1731.
43. brault ac, powers aM, ortiz d, Estrada-Franco JG,
navarro-lopez r, Weaver sc. Venezuelan equine
encephalitis emergence: enhanced vector infection from a single amino acid substitution
in the envelope glycoprotein. Proc Natl Acad Sci
U.S.A. 2004, 101: 11344-11349.
83
44. brault ac, powers aM, Weaver sc. Vector infection
determinants of Venezuelan equine encephalitis virus reside within the e2 envelope
glycoprotein. J Virol 2002b, 76: 6387-6392.
45. beaman Jr, turell MJ. transmission of Venezuelan
equine encephalomyelitis virus by strains of
Aedes albopictus (Diptera: Culicidae) collected
in north and South America. J Med Entomol
1991, 28: 161-164.
46. Fernandez F, Moncayo ac, carrara as, Forattini op,
Weaver sc. Vector competence or rural and
urban strains of Aedes (Stegomyia) albopictus
(Diptera: Culicidae) from Sao Paulo State,
Brazil for Ic, ID, and IF subtypes of Venezuelan equine encephalitis virus. J Med Entomol
2003, 40: 522-527.
47. peterson lr. Global epidemiology of West nile
virus. in: West nile encephalitis virus infection. (diamond Ms ed.) new york, springer, 2009, 1-24.
48. Vázquez a, sánchez-seo Mp, ruiz s, Molero F, Hernández
l, Moreno J, Magallanes a, Gómez tejedor c, tenorio
a. Putative new lineage of West nile virus,
Spain. Emerg Infect Dis 2010, 16: 549-552.
49. Venter M, Human s, Zaayman d, Gerdes GH, Williams J,
steyl J, leman pa, paweska Jt, setzkorn H, rous G, Murray s, parker r, donnellan c, swanepoel r. Lineage 2
West nile Virus as cause of Fatal neurologic
Disease in Horses, South Africa. Emerg Infect Dis
2009, 15: 877-884.
50. beckham Jd, tyler Kl. clinical manifestation of
neurological disease. in: West nile encephalitis
virus infection. (diamond Ms ed.) new york, springer,
2009, 69- 96.
51. Komar n. West nile virus: epidemiology and
ecology in north America. Adv Virus Res. 2003,
61:185-234.
52. Hubalek Z, Halouska J. West nile fever – a reemerging mosquito-borne viral disease in
europe. Emerg Infect Dis 1999, 5: 643-650.
53. Weaver sc, barrett ad. transmission cycles, host
range, evolution and emergence of arboviral
disease. Nat Rev Microbiol. 2004, 2: 789-801.
54. taylor rM, Work tH, Hurlbut Hs, rizk F. A study of
the ecology of West nile virus in egypt. Am J
Trop Med Hyg 1956, 5: 579-620.
55. Hubalek Z. Mosquito-borne viruses in europe.
Parasitol Res 2008, 103S1: 29-43.
56. Kostyukov Ma, alekseev an, bulychev Vp, Gordeeva
ZE. experimental infection of culex pipiens
mosquitoes with West nile virus by feeding
on infected Rana ridibunda frogs and its subsequent transmission (in russian). Med Parazitol
(Mosk) 1986, 6: 76-78.
57. Moudy rM, Meola Ma, Morin ll, Ebel Gd, Kramer ld.
A newly emergent genotype of West nile
virus is transmitted earlier and more efficiently by culex mosquitoes. Am J Trop Med Hyg
2007, 77: 365-370.
84
58. bakonyi t, ivanics E, Erdélyi K, ursu K, Ferenczi E,
Weissenböck H, nowotny n. Lineage 1 and 2
strains of encephalitic West nile virus,
central europe. Emerg Infect Dis. 2006, 12: 618-23.
59. bakonyi t, Hubálek Z, rudolf i, nowotny n. novel
flavivirus or new lineage of West Nile virus,
central europe. Emerg Infect Dis. 2005, 11: 225-31.
60. Kilpatrick aM, dsazak p, Goodman sJ, rogg H, Kramer
ld, cedeno V, cunningham aa. Predicting pathogen introduction: West nile virus spead to
Galapagos. Conserv Biol 2006, 20: 1224-1231.
61. calistri p, Giovannini a, savini G, Monaco F, bonfanti
l, ceolin c, terregino c, tamba M, cordioli p, lelli r.
West nile Virus transmission in 2008 in
north-eastern Italy. Zoonoses Public Health. 2009,
dec 23. [Epub ahead of print]
62. pradier s, leblond a, durand b. Land cover, landscape structure, and West nile virus circulation in southern France. Vector Borne Zoonotic Dis.
2008, 8: 253-63.
63. Weaver sc, powers aM, brault ac, barrett adt. Molecular epidemiological studies of veterinary
arboviral encephalitides. Vet J 1999, 157: 123-138.
64. Erlanger tE, Weiss s, Keiser J, utzinger J, Wiedenmayer K.
Past, present und future of Japanese encephalitis. Emerg Infect Dis 2009, 15: 1-7.
65. solomon t,Vaughn dW. Pathogenesis and clinical
features of Japanese encephalitis and West
nile virus infections. Curr Top Microbiol Immunol
2002, 267: 171-194.
66. Endy tp, nisalak a. Japanese encephalitis virus:
ecology and epidemiology. Curr Top Microbiol Immunol 2002, 267: 11-48.
67. solomon t, ni H, beasley dW, Ekkelenkamp M, cardosa
MJ, barrett ad. origin and evolution of Japanese
encephalitis virus in southeast Asia. J Virol
2003, 77: 3091-3098.
68. van den Hurk aF, ritchie sa, Mackenzie Js. ecology
and geographical expansion of Japanese
encephalitis. Ann Rev Entomol 2009, 54: 17-35.
69. partridge J, Ghimire p, sedai p, bista Mb, banerjee M.
endemic Japanese encephalitis in the Kathmandu valley, nepal. Am J Trop Med Hyg 2007, 77:
1146-1149
70. Mackenzie Js, Johansen ca, ritchie sa, van den Hurk aF,
Hall ra. Japanese encephalitis as an emerging
virus: the emergence and spread of Japanese
encephalitis virus in Australasia. Curr Top Microbiol Immunol 2002, 267: 49-73.
71. Hammon WM, tigertt Wd, sather GE, berge to, Meiklejohn c. epidemiologic studies on concurrent
virgin epidemics of Japanese B encephalitis and mumps in Guam, 1947-1948, with
subsequent observations including dengue,
through 1957. Am J Trop Med Hyg 1958, 7: 441-467.
72. Mitchell cJ, savage HM, smith Gc, castro lt, roppul M.
Japanese encephalitis on Saipan.: a survey of
suspected mosquito vectors. Am J Trop Med Hyg
1993, 48: 585-590.
73. nett rJ, campbell Gi, reisen WK. Potential for the
Remergence of Japanese encephalitis virus in
california. Vector-Borne Zoonotic Dis 2009, 9: 511-518.
74. Meegan JM, bailey cl. Rift valley fever. in: The
Arboviruses: Epidemiology and Ecology. Edited by Monath t.
boca raton, crc press 1988, vol iV, pp 51-76.
75. bird bH, Ksiazek tG, nichol st, Maclachlan nJ. Rift
Valley fever virus. J Am Vet Assoc 2009, 234: 883-893.
76. Van Velden dJJ, Meyer Jd, olivier J, Gear JHs, Mcintosh
b. Rift Valley fever affecting humans in South
Africa: a clinicopathological study. S Afr Med J
1977, 51: 867-879.
77. boctor WM. the clinical picture of Rift Valley
fever in egypt. J Egypt Publ Health Assoc 1978, 53:
177-180.
78. siam al, Meegan JM Gharbawi KF. Rift Valley fever
ocular manifestation: observations during
the 1977 epidemic in egypt. Br J Ophthalmol 1980,
64: 366-374.
79. balkhy HH, Menish Za. Rift Valley fever: an uninvited zoonosis in the Arabian peninsula. Int J
Antimicrob Agents 2003, 21: 153-157.
80. Madani ta, al-Mazrou yy, al-Jeffri MH, Mishkhas aa, alrabeah aM, turkistani aM, al-sayed Mo, abodahish aa,
Khan as, Ksiazek tG, shobokshi o. Rift Valley fever
epidemic in Saudi Arabia: epidemiological,
clinica and laboratoy characterisitics. Clin Infect
Dis 2003, 37: 1084-1092.
81. Gerdes GH. Rift Valley fever. Rev Sci Tech Off Int Epiz
2004, 23: 613-623.
82. linthicum KJ, davies Fd, Kairo a, bailey cl. Rift Valley
fever virus (family Bunyaviridae, genus Phlebovirus). Isolations from Diptera collected
during an inter-epidemic period in Kenya.
J Hyg (Lond) 1985, 95: 197-209.
83. pfeffer M, dobler G. Impact of climate change
on Rift Valley fever virus infections. Nova Acta
Leopoldina 2010, in press.
84. Martin V, chevalier V, ceccato p, anyamba a, de simone
l,lubroth J, de la rocque s, domenech J. the impact
of climate change on the epidemiology and
control of rift Valley fever. Rev Sci Tech Off Int Epiz
2008, 27: 413-426.
85. Hoogstral H, Meegan JM, Khalil GM, adham FK. the
Rift Valley fever epizootic in egypt 1977-1978.
2. ecological and entomological studies. Trans
R Soc Trop Med Hyg 1979, 73: 624-629.
86. oltmann a, Kämper s, staeck o, schmidt-chanasit J,
Günther s, berg t, Frank c, Krüger d, Hofmann J. Fatal
outcome of hepatitis A virus (HAV) infection
in a traveler with incomplete HAV vaccination and evidence of Rift Valley fever virus
infection. J Clin Microbiol 2008, 46: 3850-3853.
87. Moutailler s, Krida G, schaffner F,Vazeille M, Failloux ab.
Potential vectors of Rift Valley Fever virus in
the Mediterranean region. Vector Borne Zoonotic
Dis 2008, 8: 779-753.
88. Kasari tr, carr da, lynn tV, Weaver Jt. evaluation
of pathways for release of Rift Valley fever virus into domestic ruminant livestock,
ruminant wildlife, and human populations
in the continental United States. J Am Vet Med
Assoc 2008, 232: 514-529.
89. Gargan tp, clark GG, dohm dJ, turell MJ, bailey cl.
Vector potential of selected north American
mosquito species for Rift Valley Fever virus.
Am J Trop Med Hyg 1988, 38: 440-449.
90. turrell MJ, Mores cn, terracina l, Wallette dl, Hribar
lJ, pecor JE, blow Ja. Potential for north American mosquitoes to transmit Rift Valley fever
virus. J Am Mosq Control Assoc 2008, 24: 502-507.
91. calisher cH, Gould Ea. taxonomy of the virus
family Flaviviridae. Adv Virus Res 2003, 59: 1-19.
92. Weissenböck H, Kolodziejek J, url a, lussy H, rebelbauder b, nowotny n. emergence of Usutu virus,
an African mosquito-borne flavivirus of the
Japanese encephalitis virus group, central
europe. Emerg Infect Dis 2002, 8: 652-656.
93. Weissenböck H, Hubalek Z, bakonyi t, nowotny n.
Zoonotic mosquito-borne flaviviruses:
worldwide presence of agents with proven
pathogenicity and potential candidates of
future emergin diseases. Vet Microbiol 2010, 140:
271-280.
94. Meister t, lussy H, bakonyi t, sikutova s, rudolf i,Vogl
W, Winkler H, Frey H, Hubalek Z, nowotny n, Weissenböch H. Serological evidence of continuing
high Usutu virus (Flaviviridae) activity and
establishment of herdimmunity in wild birds
in Austria. Vet Microbiol 2008, 127: 237-248.
95. Manarolla G, bakonyi t, Gallazzi d, crosta l, Weissenböck H, dorrestein GM, nowotny n. Usutu virus in
wild birds in northern Italy. Vet Microbiol 2010,
141: 159-63.
96. pecorari M, longo G, Gennari W, Grottola a, sabbatini
a, tagliazucchi s, savini G, Monaco F, simone M, lelli r,
rumpianesi F. First human case of Usutu virus
neuroinvasive infection, Italy, August-September 2009. Euro Surveill 2009, 17: 15-17.
97. cavrini F, Gaibani p, longo G, rossini G, bonilauri p,
Gerundi GE, di benedetto F, pasetto a, Girardis M, dottori M, landini Mp, sambri V. Usutu virus infectrion
in a patient who enderwent orthotopic liver
transplantation, Italy, August-September
2009. Euro Surveill 2009, 17: 17-19.
98. brugger K, rubel F. Simulation of climate-change
scenarios to explain Usutuvirus dynamics in
Austria. Prev Vet Med 2009, 88: 24-31.
99. Mansfield KL, Johnson N, Phipps LP, Stephenson JR,
Fooks ar, solomon t. tickborne encephalitis
virus – a review of an emerging zoonosis.
J Gen Virol 2009, 90: 1781-1794.
85
100. nuttall pM, labuda M. Saliva-assisted transmission of tick-borne pathogens. in: ticks: biology,
disease and control (bowman as, nuttall pa, eds.)
cambridge university press 2008; 205-219.
101. randolph sE, Gern l, nuttall pa. co-feeding ticks:
Epidemiological significance for tick-borne
pathogen transmission. Parasitol Today 1996, 12:
472- 479.
102. Gray Js. Ixodes ricinus seasonal activity: Implications of global warming indicated by
revisiting tick and weather data. Internatl J Med
Microbiol 2008, 298S1: 19-24.
103. Gray Js. the development and questing activity of Ixodes ricinus L. under field conditions
in Ireland. Bull Entomol Res. 1982, 72: 263-270.
104. süss J, schrader c. tick-borne human pathogenic microorganisms found in europe and those
considered nonpathogenic. Part I: ticks and
viruses. Bundesgesundheitsbl Gesundheitsf Gesundheitsschutz 2004, 47: 392-404 [in German].
105. donoso-Mantke o, schädler r, niedrig M. A survey
on cases of tick-borne encephalitis in european countries. EuroSurveill 2008, 13: pii: 18848.
106. smorodintsev aa. tick-borne spring-summer
encephalitis. Prog Med Virol 1958, 1: 210-247.
107. Kunze u, isW-tbE. tick-borne encephalitis – a
european health challenge. conference of the
8th meeting of the International Scientific
Working Group on tick-borne encephalitis
(ISW tBe). Wien Med Wochenschr 2006, 156: 376-378.
108. Zanotto pM, Gao GF; Gritsun t, Marin Ms, Jiang Wr,
Venugopal K, reid HW, Gould Ea. An arbovirus
cline across the northern hemisphere. Virology
1995, 210: 152-159.
109. Gould Ea, de lamballerie X, Zanotto pM, Holmes Ec.
origins, evolution, and vector/host coadaptations within the genus flavivirus. Adv Virus Res
2003, 59: 277-314.
110. suzuki y. Multiple transmissions of tick-borne
encephalitis virus between Japan und Russia.
Genes Genet Syst 2007, 82: 187-195.
111. Holzmann H, aberle sW, stiasny K, Werner p, Mischak
a, Zainer b, netzer M, Koppi s, bechter E, Heinz FX.
tick-borne encephalitis from eating goat
cheese in a mountain region of Austria. Emerg
Infect Dis. 2009, 15: 1671-1673.
112. Wladenström J, lundkvist a, Falk Ki, Garpmo u, bergström s, lindegren G, sjöstedt a, Mejlon H, Fransson t,
Haemig pd, olsen b. Migrating birds and tickborne encephalitis virus. Emerg Infect Dis 2007, 13:
1215-1218.
113. Kovalev sy, chernykh dn, Kokorev Vs, snitkovskaya tE,
romanenko W. origin and distribution of tickborne encephalitis virus strains of the Siberian subtype in the middle Urals, the northwest of Russia and the Baltic countries. J Gen
Virol 2009, 90: 2884-2892.
86
114. Mclean dM, donahue W. Powassan virus: isolation of virus from fatal case of encephalitis.
Can Med Assoc J 1959, 80: 708-711.
115. thomas la, Kennedy rc, Ecklund cM. Isolation of a
virus closely related to Powassan virus from
Dermacentor andersonii collected along north
cache la Poudre River, colo. Proc Soc Exp Biol Med
1960, 104: 355-359.
116. Kuno G, artsob H, Karabatsos n, tsuchiya Kr, chang GJ.
Genomic sequencing of deer tick virus and
phylogeny of Powassan-related viruses of
north America. Am J Trop Med Hyg 2001, 65: 671-676.
117. beasley dW, suderman Mt, Holbrook Mr, barrett ad.
nucleotide sequencing and serological evidence that the recently recognized deer tick
virus is a genotype of Powassan virus. Virus
Res. 2001, 79: 81-89.
118. Ebel Gd, spielman a, telford sr iii. Phylogeny of
north American Powassan virus. J Gen Virol
2001, 82: 1657-1665.
119. Ebel Gd. Update on Powassan virus: emergence of North American tickborne flavivirus. Annu Rev Entomol 2010, 55: 95-110.
120. costero a, Grayson Ma. experimental transmission of Powassan virus (Flaviviridae) by
Ixodes scapularis ticks (Acari: Ixodidae). Am J
Trop Med Hyg 1996, 55: 536-546.
121. Gould Ea, Moss sr, turner sl. evolution and dispersal of encephalitic flaviviruses. Arch Virol
2004, Suppl. 18: 65-84.
122. leonova Gn, Kondratov iG, ternovoi Va, romanova EV,
protopopova EV, chausov EV, pavlenko EV, ryabchikova
Ei, belikov si, loktev Vb. characterization of
Powassan viruses from far eastern Russia.
Arch Virol 2009, 154: 811-820.
123. Mehla r, Kumar srp,yadav p, barde pV,yergolkar pn, Erickson br, carroll sa, Mishra ac, nichol st, Mourya dt.
Recent ancestry of Kyasanur Forest disease
virus. Emerg Infect Dis 2009, 15: 1431-1437.
124. carroll sa, bird bH, rollin pE, nichol st. Ancient
common ancestry of crimean – congo hemorrhagic fever virus. Mol Phylogenet Evol 2010,
[Epub ahead of print].
125. McGuire K, Holmes Ec, Gao GF, reid HW, Gould Ea.
tracing the origin of louping ill virus by molecular phylogenetic analysis. J Gen Virol 1998, 79:
981-988.
87
Parasites & Vectors, edited by chris
arme, is an open access, peer-reviewed
online journal dealing with the biology of
parasites, parasitic diseases, intermediate
hosts and vectors. articles published in
this journal are available with no subscription charges or barriers to access,
and authors retain the copyright of their
material and may use it, or distribute it,
as they wish.
www.parasitesandvectors.com
BIoLoGY AnD ecoLoGY oF tHe BRoWn DoG
tIcK, RHIPICEPHALUS SANGUINEUS
FilipE dantas-torrEs
dipartiMEnto di sanitÀ pubblica E ZootEcnia, FacoltÀ di MEdicina VEtErinaria, uniVErsitÀ dEGli studi di bari,
70010 ValEnZano, bari, italy
*corrEspondinG autHor
EMail addrEssEs:
F.dantastorrEs@VEtErinaria.uniba.it
FilipE.VEt@Globo.coM
Abstract
the brown dog tick (Rhipicephalus sanguineus) is the most widespread tick in the world and a well-recognized vector of many pathogens affecting dogs and occasionally humans. this tick can be found on dogs living in both urban
and rural areas, being highly adapted to live within human dwellings and being active throughout the year not only in
tropical and subtropical regions, but also in some temperate areas. depending on factors such as climate and host
availability, Rh. sanguineus can complete up to four generations per year. recent studies have demonstrated that ticks
exposed to high temperatures attach and feed on humans and rabbits more rapidly. this observation suggests that
the risk of human parasitism by Rh. sanguineus could increase in areas experiencing warmer and/or longer summers,
consequently increasing the risk of transmission of zoonotic agents (e.g., Rickettsia conorii and Rickettsia rickettsii). in
the present article, some aspects of the biology and ecology of Rh. sanguineus ticks are discussed including the possible impact of current climate changes on populations of this tick around the world.
Review
Ticks (suborder Ixodida) are the most important group
of vectors of pathogens within the phylum Arthropoda,
being comparable only to mosquitoes (family Culicidae)
[1,2]. They are responsible for the maintenance and transmission of many pathogens affecting domestic animals
and humans, including several species of bacteria, helminths, protozoa, and viruses [3].
The brown dog tick Rhipicephalus sanguineus (Figure 1)
is the most widespread tick in the world, even considering that many ticks currently identified as Rh. sanguineus
might actually represent other closely related species (e.g.,
Rhipicephalus turanicus).
88
This tick is a parasite of dogs that can occasionally parasitize other hosts, including humans. Moreover, Rh. sanguineus is a vector of many disease agents, some of them
(e.g., Coxiella burnetii, Ehrlichia canis, Rickettsia conorii, and
Rickettsia rickettsii) being of zoonotic concern [4]. Due to
its veterinary and public health relevance, Rh. sanguineus
is one of the most studied ticks. Indeed, a number of studies on its ecology and biology have been carried out in
many parts of the world. Certainly, knowledge of the
natural history of this tick is seminal for a better understanding of the eco-epidemiology of tick-borne diseases,
such as Mediterranean spotted fever and Rocky Mountain
spotted fever. Herein, some aspects of the biology and
ecology of Rh. sanguineus are discussed, including the
possible impact of current climate changes on populations of this tick around the world.
Figure 1
Immature and adult stages of Rhipicephalus sanguineus
A: larva (mounted in Hoyer’s medium; bar = 400 µm).
B: nymph (mounted in Hoyer’s medium; bar = 0.5 mm).
C: female (bar = 1 mm). D: male (bar = 1 mm).
Biology of Rhipicephalus sanguineus
Ethology
From an ethological standpoint, Rh. sanguineus is an
endophilic (adapted to indoor living), monotropic (all
developmental stages feed on the same host species),
and three-host (each life stage requires a new host to feed
on) tick species. However, although highly endophilic,
Rh. sanguineus is also able to survive in outdoor environments, mainly if refuges (e.g., limestone walls) are available. Moreover, although monotropic, this tick can occasionally feed on other hosts (e.g., humans), which do not
belong to its ‘natural trophic chain’. These facts indicate
that Rh. sanguineus is a catholic tick, being able to adopt
different strategies for survival, as needed.
When seeking a host, the brown dog tick is a hunter
(host-seeking behaviour), although it can also adopt
the ambush strategy (questing behaviour). Indeed, all
these behavioural patterns exhibited by Rh. sanguineus
have been acquired throughout its evolutionary history.
Perhaps, these traits of this tick have evolved from its
relationship with the domestic dog and their shared environment, being part the tick’s strategy for survival and
perpetuation.
Attachment, feeding and mating
Once on the dog, Rh. sanguineus uses its chelicerae to
pierce the host’s skin and then inserts its hypostome and
chelicerae into the host’s epidermis, occasionally reaching
the upper layers of dermis [5]. During attachment, the
tick secretes a cement-like substance, which forms a cone
on the surface of epidermis that extends up to the stratum
corneum [5]. While probing for blood, capillary and small
blood vessels are lacerated and haemorrhage occurs, creating a feeding pool [6], from which the tick sucks blood
and other fluids (telmophagy).
The feeding period of Rh. sanguineus can vary from
two days (e.g., larvae) to several weeks (e.g., females),
depending on tick developmental stage (e.g., feeding
period of nymphs is longer than that of larvae) and host
(e.g., engorgement of females may take longer on rabbits than on dogs) [7,8]. Male ticks can take multiple
blood meals. Indeed, it has been shown that male ticks
previously attached to one dog can move onto another
co-housed dog and feed on it [9]. Furthermore, male
ticks can remain for long periods of time on the host.
Interestingly, it has been observed that the presence of
males can increase the feeding performance of Rh. sanguineus immature ticks, particularly nymphs [10]. This
fact suggests that males may have other biological roles
in addition to reproduction.
Rhipicephalus sanguineus ticks can attach everywhere on
the dog, but the head (particularly on ears), inter-digital
spaces, back, inguinal region, and axilla (Figure 2) are
among their preferred attachment sites [11-16]. Although
Rhipicephalus ticks have short hypostome (Figure 3) and
attach more superficially in comparison with others ticks
(e.g., most species of Amblyomma and Ixodes), they can
attach firmly to the host’s skin (Figure 4).
89
Figure 4
attachment of Rhipicephalus sanguineus
A: A male firmly attached to the dog’s skin. Note that while the tick is
being gently pulled with the help of a tweezers, the skin is stretched out.
b: a female exhibiting a piece of a dog’s skin that remained attached to
her mouthparts after her forced removal.
Figure 2
attachment sites of Rhipicephalus sanguineus
a: three adults on the ear of a dog.
b: two females attached to the axilla of a dog.
c: an engorged nymph on the interdigital region of a dog.
As a metastriate tick (lineage Metastriata), Rh. sanguineus
attains sexual maturity and mates solely on the host.
Although the female can start to feed even in the absence
of a male, she will not become fully engorged unless
mated. Indeed, the ingestion of blood is a major stimulus
for spermatogenesis in males and for oogenesis in females.
During mating, the male climbs onto the dorsum of the
female and crawls to her ventral surface, standing in
juxtaposition (venter to venter) with her. Then, the male
stimulates the female genital aperture (gonopore), by
inserting the tips of his chelicerae into it. Soon afterwards,
the male transfers the spermatophore (a double-walled,
sperm-filled sac) to the female genital aperture (Figure 5)
with the help of his mouthparts [17]. The spermatophore
then everts itself into the female’s genital tract. Around 24
h after copulation, a capsule full of mature spermatozoa
(spermiophores) can be found in the receptaculum seminis
of dissected females [17].
Figure 3
tick mouthparts
a: ixodes ricinus nymph (bar = 200 µm).
b: Rhipicephalus sanguineus nymph (bar = 250 µm). note the rostrum of
Rh. sanguineus (wider than long) in comparison with the one of I. ricinus
(twice longer than wide).
Figure 5
Mating of Rhipicephalus sanguineus
a: a couple of Rh. sanguineus mating on a dog (the male is arrowed).
b: a spermatophore attached to the female genital aperture (bar = 600 µm).
90
Drop-off rhythm
Most ticks have a definite circadian rhythm of detachment
from the host (drop-off), which is usually coordinated
with host’s activity [18]. Rhipicephalus sanguineus larvae
exhibit a diurnal drop-off pattern [19-21], detaching
mostly during the daytime. Conversely, engorged nymphs
and females detach predominantly during the night period [19-21]. The reasons for this particular drop-off behaviour of larvae, nymphs, and females of Rh. sanguineus are
not fully understood, but might be related to the activities
of the host as well as it might represent strategies adopted
by the tick during different phases of its life cycle. In any
case, this data should be taken into account while planning control measures focused on the environment, as
the places where dogs stay at night are more likely to
harbour the largest number of non-parasitic stages of
Rh. sanguineus [21].
Female oviposition and larval hatching
When feeding is complete, the engorged female detaches
from the host, drops to the ground and after a pre-oviposition period (from three days to some weeks) deposits thousands of eggs (Figure 6). Typically, females of
Rh. sanguineus oviposit uninterruptedly an average of
1500–4000 eggs [7,22]; however, some disturbed females
(e.g., removed daily from the vials for separation and
counting of the eggs) can interrupt the oviposition and
then restart it the day after, although loses in terms of
egg production efficiency are usually minor (unpublished
observations). The oviposition period can last for several weeks and the number of eggs laid by each female
is directly correlated with her weight and the length of
the oviposition period [7]. Eggs are deposited in hidden
places, such as cracks and crevices in the walls, between
rocks, and sometimes, almost inside the ground. The
females need to find a hidden place to protect themselves
and their fore coming progeny, as they constitute an easy
prey for predators, such as spiders [23], birds [24], and
wasps [25]. The larval hatching is preceded by an incubation period that ranges from 6 days to some weeks [4].
Similarly to what occurs in other tick species, a longitudinal fissure (hatching line) encircling the egg chorion can
be observed at the end of the incubation period, characterizing the beginning of the hatching process, which
culminates in the hatching of a flat, fragile six-legged
larva. The newly hatched larva usually needs sometime to
harden its chitin-made exoskeleton before seeking a host.
For instance, in an experimental study, larvae younger
than 7 days were unable to attach and feed on rats [22].
Figure 6
oviposition of Rhipicephalus sanguineus
a: several females laying eggs under laboratory conditions (temperature
26°c, relative humidity, 80%).
b: a close-up of the previous image, showing in detail the newly laid eggs.
Moulting process
When feeding is complete, engorged larvae and nymphs
detach from the host and drop to the ground to find a
hidden place. The moulting process is preceded by a period of seclusion (pre-moult period) that might vary widely
(from days to several weeks), depending on factors such
as life stage (i.e., it takes longer in nymphs than in larvae)
and weather conditions (e.g., stressful temperature and
humidity can extend the moulting period). At low temperatures (e.g., at 10°C), the engorged larvae and nymphs
may undergo diapause and the higher is the temperature,
the shorter is the moulting period [26].
As in insects, the ecydisis in ticks is regulated by moulting hormones (ecdysteroids) [27]. In Rh. sanguineus, the
ecydisis starts with the rupture of the old cuticula and
then the old integument is moved forward by means of
abdominal peristaltic waves (see additional file 1). In
a few hours, the newly moulted tick emerges, leaving
behind its exuvia (Figure 7).
Figure 7
Moulting of Rhipicephalus sanguineus
a: a nymph (arrow) emerging from its larval exuvia.
b: an engorged nymph (few hours prior the ecydisis), exhibiting the short,
anterior dorsal scutum (ds) and the alloscutum (as) of a typical female.
a nymphal exuvia (arrow) left behind by other female can be seen as well.
91
During moulting, even prior to rupture of and emergence
from its old integument, the tick starts to defecate. The faeces are initially seen as white spherules (see additional file
2) consisting of guanine, xanthine and other similar compounds [28]. These compounds result from the metabolism of the blood meal and are formed in the Malpighian
tubules as the nitrogenous wastes, being accumulated
in the rectal sac and eliminated via the anal pore [28].
Guanine is the most abundant component of tick excreta
and is a natural semiochemical that has been identified as
an assembly pheromone, inducing aggregation in many
Ixodes and argasid species [28]. So far, neither guanine
nor other assembly pheromones have been identified for
Rh. sanguineus ticks. What is known is that aggregation accelerates the moulting process of nymphs [29].
Interestingly, the presence of newly moulted nymphs
appears to act as a mechanical stimulus for the ecdysis
of other nymphs (see additional file 3) (unpublished
observations).
ecology of Rhipicephalus sanguineus
On host-ecology
The domestic dog is the main host of Rh. sanguineus
in both urban and rural areas [30-32]. Occasionally,
Rh. sanguineus can infest a wide range of domestic and
wild hosts, including cats, rodents, birds, and humans
[33-39]. The parasitism by Rh. sanguineus on hosts other
than dogs is quite unusual in certain areas, being mainly
associated to the presence of heavily infested dogs and in
highly infested environments. In the same way, ticks collected from domestic and wild animals that might eventually resemble Rh. sanguineus might actually represent
other species, such as Rh. turanicus which is often found
on cattle, horses, goats, cats, and a wide range of wildlife
species [36].
The likelihood of a host other than the dog being attacked
by Rh. sanguineus might vary according to tick population.
For instance, the human parasitism by Rh. sanguineus
is relatively common in Europe, particularly during the
summer [40]. In contrast, the human parasitism is much
less common (or maybe much less reported) in South
American countries [41], such as Brazil [38,42].
The prevalence and mean intensity of infestation by Rh.
sanguineus on dogs can vary widely, both geographically and seasonally. These and other “on-host” ecological parameters can also vary according to diverse factors,
at both population (e.g., dog population density and
proportion of dogs treated with ectoparasiticides or tick
repellents within a population) and individual levels (e.g.,
age, breed, and lifestyle). For instance, the prevalence of
Rh. sanguineus infestation on dogs can be as high as 80%
in some areas, as in north-eastern Thailand [43]. The
prevalence is higher among free-ranging dogs (which are
92
usually untreated against ectoparasites) as compared with
domiciled dogs [31]. Mean intensities of infestation of
3.8, 5.4, 7.8 and 39.4 have been reported in north-western
Georgia (United States) [44], north-eastern Brazil [32],
south-eastern Brazil [45], and Italy [46], respectively. In
south-eastern Brazil, the prevalence and mean intensity
were much higher among dogs living in houses with grassy
yards as compared with dogs kept in apartments [45]. In
a recent study carried out in the same region, dogs were
significantly more infested during the dry season [15].
Furthermore, the tick burden is often higher among urban
dogs in comparison with rural ones [30,32,47]. However,
in some rural areas, Rh. sanguineus might be even absent
and dogs can be infested by many other tick species
(e.g., Amblyomma oblongoguttatum, Amblyomma ovale, and
Amblyomma cajennense in eastern Amazon, Brazil) [48].
It is not rare to see some dogs infested by a single tick
and others confined in the same kennel (even in the same
cage) carrying hundreds of ticks. This suggests that the tick
burden might also be influenced by individual dog factors,
such as age and breed. Indeed, the tick burden is heavier on
young dogs in comparison to older ones [16,32]. Young
dogs heavily infested by ticks might develop anaemia,
particularly if they are also infected by tick-borne pathogens, such as Ehrlichia spp. [49]. Although the prevalence
of infestation is often higher among males than females
[15], it is uncertain whether this is a gender-related susceptibility or a matter of exposition. Furthermore, some
breeds (e.g., English cocker spaniels) are apparently more
susceptible than others [50]. A more recent study has suggested that Rh. sanguineus ticks can display distinct behavioural patterns upon exposure to odours from different
dog breeds [51]. As a hunter tick, Rh. sanguineus seeks its
host actively oriented by host-produced substances (kairomones), including CO2. Whether other host-produced
substances can induce questing activity or even an escapeoriented behaviour in Rh. sanguineus remains uncertain.
The resistance of dogs to ticks is usually measured by
comparing some biological parameters of ticks fed on ticknaïve dogs with those fed on dogs previously infested by
ticks [50,52]. These biological parameters (e.g., tick yield,
weight of engorged females and egg production efficiency)
can provide direct or indirect evidence on the resistance of
dogs to ticks. However, even though some females fed on
dogs previously exposed to ticks might weigh significantly
less and produce fewer eggs than those fed on tick-naïve
dogs, these females will still be able to produce viable
offspring.
A recent study showed that Rh. sanguineus ticks fed on
resistant hosts (i.e., guinea pigs) presented several histological alterations (e.g., swelling of the epithelial cells of
Malpighian tubules, an increase in guanine content secreted by Malpighian tubules, vacuolization of epithelial wall
of tracheae, and vacuolization of oocytes) as compared to
ticks fed on dogs [53]. However, further research employing ultrastructural and immunohistochemical techniques
would be helpful to reveal the nature of these alterations.
Off-host ecology
Strange as it seems (e.g., when you see a single dog infested
by hundreds of ticks), most of the ticks are not on the dog
but in the environment. As a typical three-host tick, Rh.
sanguineus spends most of its lifetime in the environment,
where it is under direct influence of several biotic (e.g.,
predators) and abiotic (e.g., weather condition) factors.
In tropical and subtropical areas, Rh. sanguineus ticks are
prevalent throughout the year [42,54,55] whereas in temperate regions they are most active from the late spring
to early autumn [56,57]. Rhipicephalus sanguineus ticks
can overwinter in the environment and even infest dogs
during winter in some regions of temperate climate (e.g.,
south-eastern Oklahoma and north-western Arkansas,
United States) [11]. However, successful oviposition, egg
hatch as well as larval and nymphal moulting are unlikely
at low temperature conditions [26,58]. In this regard,
it has been shown that Rh. sanguineus can develop well
under different conditions in terms of temperature (e.g.,
20–35°C) and relative humidity (e.g., 35–95%) [26].
The number of generations that Rh. sanguineus ticks can
complete each year can vary from region to region. Under
favourable conditions (e.g., temperature, relative humidity, and host availability), they can complete up to three
or four generations per year, as recorded in centre-western
Brazil [14,15].
Rhipicephalus sanguineus is an endophilous tick, being
usually found indoors crawling on carpets, walls, and
furniture [38,59]. However, it can also be abundant in
peridomestic areas, as reported in eastern Arizona [60,61].
They can be found walking on outside walls of houses,
on the ground (between rocks), and inside cracks and
crevices (Figure 8). Indeed, high levels of environmental
infestation might increase the risk of human exposure to
Rh. sanguineus [38,59,62,63] and thus the risk of acquiring
certain tick-borne pathogens, such as R. rickettsii [59].
In an epidemiological study carried out in Marseille
(France) it was observed that dense centres of housing
were much less favourable for Rh. sanguineus ticks than
scattered ones [64]. Furthermore, it was observed that
houses with gardens were more a suitable biotope for Rh.
sanguineus than the environment of large buildings [64].
Similar results have been obtained in Japan, where dogs
that had contact with a garden (two weeks prior to examination) had a higher chance of being infested by Rh. sanguineus [65]. Furthermore, in the same Japanese study, this
tick was most frequently associated with dogs from urban
and suburban areas [65].
Overall, studies on the ecology of Rh. sanguineus show that
this tick is well-adapted to live within human dwellings,
being also capable to colonize peridomiciliary environments (e.g., gardens and kennels) if the weather is suitable
and if hosts are available.
Figure 8
Hiding-places of Rhipicephalus sanguineus
a: a fully engorged female walking on a limestone wall.
b and c: Engorged females (arrows) hidden in cracks of the same wall.
d: several engorged females on the ground between rocks.
the brown dog tick, global warming, human
parasitism, and tick-borne diseases
The brown dog tick is an ectoparasite of public health
significance, being involved in the transmission of major
human pathogens, as it is the case of R. rickettsii [66].
There has been a lot of discussion about climate changes
and their impact on ticks and on the eco-epidemiology
of tick-borne diseases [67]. Tick biology and ecology
are under the direct influence of climate factors, such as
temperature and humidity. Indeed, while global warming might affect the survival of some tick species that are
adapted to live in humid environments (e.g., Atlantic
rainforest), it will probably have only a minor (if any)
negative impact on ticks like Rh. sanguineus that are less
dependent upon a moisture-rich habitat for survival [68]
and more resistant to desiccating conditions [26]. On the
contrary, the global warming might prompt the establishment of tick populations in previously free areas. For
93
94
instance, it has been speculated that an increase of about
2–3°C in the mean temperature from April to September
could result in the establishment of populations of Rh.
sanguineus in regions of northern temperate Europe
[67]. However, the actual impact of global warming on
Rh. sanguineus ticks is uncertain.
Interestingly, recent studies have demonstrated that
Rh. sanguineus ticks exposed to high temperatures attach
more rapidly to rabbits and humans [40,69]. Therefore,
it has been suggested that the risk of human parasitism
could increase in areas that are experiencing warmer
and/or longer summers, which could ultimately increase
the risk of transmission of some pathogens, such as
R. conorii [40]. It is important to stress that exposure to
light and high temperature provoke excitation and induce
increased questing behaviour not only in Rh. sanguineus,
but in any tick species, particularly in those parasitic on
homeothermic vertebrates.
Cases of human parasitism by Rh. sanguineus ticks have
sporadically been described in the literature [38,59,62,7076] and the risk factors associated to this parasitism
include dog ownership, presence of infested dogs indoors
and high level of environmental infestation. In Brazil,
people dealing daily with dogs (e.g., veterinarians, pet
shop workers, and dog owners) appear to be at risk of
exposure to Rh. sanguineus [38,42]. In south-east Nigeria,
in an outbreak of human parasitism by Rh. sanguineus,
the grounds of the family dwelling, the sheep pens,
and dog kennels were heavily infested by Rh. sanguineus
[63]. Indeed, the higher is the level of environmental
infestation, the higher is the risk of human exposure to
Rh. sanguineus ticks.
research [82,83]. The main problem is that the type-specimen of Rh. sanguineus has been lost [82] and, therefore, a
bona fide taxonomic definition of this species is currently
lacking. This taxonomic question needs to be resolved in
the near future to avoid misidentifications and misleading
on the role of Rhipicephalus spp. ticks in the epidemiology
of tick-borne diseases.
As previously mentioned in this article, some dog breeds
appear to be more resistant than others [50] to infestations by Rh. sanguineus. Further studies on the possible
role of individual dog factors (e.g., genetics and nutritional status) on the susceptibility of dogs to ticks are needed.
Specifically, it would be interesting to investigate whether
previous tick infestations could reduce the number of
successive tick bites and thus the risk of infection by tickborne pathogens, for example, E. canis and Babesia vogeli.
Although dogs are the main hosts of Rh. sanguineus, the
finding of this tick on wild canids [37] indicates that freeranging wild canids might be involved in its maintenance
and dispersion through different regions. This could have
implications in the control of ticks and in the epidemiology of tick-borne diseases, particularly in areas where
dogs live in close contact with their wild counterparts. In
conclusion, all topics stressed above are worthy of research
in the future. Data from these studies would provide new
insights into the biology and ecology of Rh. sanguineus
and ultimately prompt the development of optimized
strategies for the control of this tick and the pathogens it
transmits.
concluding remarks and research needs
Acknowledgements
Dogs can be affected by a number of vector-borne diseases [77,78], most of which are transmitted by ticks. Among
the tick species implicated in the transmission of pathogens to them [79-81], Rh. sanguineus is undoubtedly the
most important species from the veterinary standpoint.
Moreover, in the era of globalization and climate changes,
the brown dog tick has becoming increasingly relevant
from a public health perspective. This tick has also been
implicated in the transmission of pathogens of zoonotic
concern (e.g., R. rickettsii) and recent studies have shown
that Rh. sanguineus ticks exposed to high temperatures are
more prone to bite humans [40]. This scenario highlights
that the climate warming could affect Rh. sanguineus
populations of around the world and, consequently, the
epidemiology of certain tick-borne infections [40].
Another important issue to be considered is the taxonomy of the genus Rhipicephalus and, in particular, of the
Rh. sanguineus group that has long been a subject of
I would like to express my thanks to Luciana A. Figueredo
and Professor Domenico Otranto for their invaluable
suggestions on a draft of this manuscript. Thanks also to
Dr. Riccardo Lia and Viviana Domenica Tarallo for their
assistance in taking some of the pictures of ticks on dogs
presented in this article. Publication of the thematic series
has been sponsored by Bayer Animal Health GmbH.
competing interests
The author declares there are no competing interests.
Parasites & Vectors 2010, 3:26
(http://www.parasitesandvectors.com/content/3/1/26)
The original article is published as an open access article
distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/
by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work
is properly cited.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Hoogstraal H: Argasid and nuttalliellid ticks as
parasites and vectors. Adv Parasitol 1985,
24:135-238.
Marcondes cb: Doenças transmitidas e causadas por artrópodes. são paulo: Editora atheneu;
2009.
Jongejan F, uilenberg G: the global importance of
ticks. Parasitology 2004, 129(suppl 1):s3–s14.
dantas-torres F: the brown dog tick, Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control. Vet parasitol
2008, 152:173-185.
szabó Mp, bechara GH: Sequential histopathology
at the Rhipicephalus sanguineus tick feeding
site on dogs and guinea pigs. Exp appl acarol
1999, 23:915-928.
Mans bJ, neitz aW: Adaptation of ticks to a
blood-feeding environment: evolution from
a functional perspective. Insect Biochem Mol Biol
2004, 34:1-17.
Koch HG: oviposition of the brown dog tick
(Acari: Ixodidae) in the laboratory. Ann Entomol
Soc Am 1982, 75:583-586.
troughton dr, levin Ml: Life cycles of seven
ixodid tick species (Acari: Ixodidae) under
standardized laboratory conditions. J Med
Entomol 2007, 44:732-740.
little sE, Hostetler J, Kocan KM: Movement of
Rhipicephalus sanguineus adults between cohoused dogs during active feeding. Vet Parasitol
2007, 150:139-145.
rechav y, nuttall pa: the effect of male ticks on
the feeding performance of immature stages
of Rhipicephalus sanguineus and Amblyomma
americanum (Acari: Ixodidae). Exp Appl Acarol
2000, 24:569-578.
Koch HG: Seasonal incidence and attachment
sites of ticks (Acari: Ixodidae) on domestic
dogs in southeastern oklahoma and northwestern Arkansas, USA. J Med Entomol 1982,
19:293-298.
Mumcuoglu Ky, Frish K, sarov b, Manor E, Gross E, Gat
Z, Galun r: ecological studies on the brown
dog tick Rhipicephalus sanguineus (Acari:
Ixodidae) in southern Israel and its relationship to spotted fever group rickettsiae. J Med
Entomol 1993, 30:114-121.
papazahariadou MG, saridomichelakis Mn, Koutinas aF,
papadopoulos EG, leontides l: tick infestation of
dogs in thessaloniki, northern Greece. Med
Vet Entomol 2003, 17:110-113.
louly ccb, Fonseca in, oliveira VF, linhares GFc,
Menezes lb, borges lMF: Seasonal dynamics of
Rhipicephalus sanguineus (Acari: Ixodidae)
in dogs from a police unit in Goiania, Goias,
Brazil. Cienc Rural 2007, 37:464-469.
15. silveira Ja, passos lM, ribeiro MF: Population dynamics of Rhipicephalus sanguineus (Latrielle,
1806) in Belo Horizonte, Minas Gerais state,
Brazil. Vet Parasitol 2009, 161:270-275.
16. tinoco-Gracia l, Quiroz-romero H, Quintero-Martínez Mt, rentería-Evangelista tb, González-Medina y,
barreras-serrano a, Hori-oshima s, Moro MH,Vinasco J:
Prevalence of Rhipicephalus sanguineus ticks
on dogs in a region on the Mexico-USA border. Vet Rec 2009, 164:59-61.
17. Feldman-Muhsam b, borut s: copulation in ixodid
ticks. J Parasitol 1971, 57:630-634.
18. oliver JH Jr: Biology and systematics of ticks
(Acari: Ixodida). Annu Rev Ecol Syst 1989, 20:397-430.
19. Hadani a, rechav y: tick-host relationships.
1. the existence of a circadian rhythm of
“drop-off” of engorged ticks from their
hosts. Acta Trop 1969, 26:173-179.
20. Jacobs pa, Fourie lJ, Horak iG: A laboratory comparison of the life cycles of the dog ticks
Haemaphysalis leachi and Rhipicephalus
sanguineus. Onderstepoort J Vet Res 2004, 71:15-28.
21. paz GF, labruna Mb, leite rc: Ritmo de queda de
Rhipicephalus sanguineus (Acari: Ixodidae) de
cães artificialmente infestados. Rev Bras Parasitol
Vet 2008, 17:139-144.
22. srivastava sc,Varma MGr: the culture of the tick
Rhipicephalus sanguineus (Latreille) (Ixodidae) in the laboratory. J Med Entomol 1964,
1:154-157.
23. sautet J: Invasion domiciliare de Rhipicephalus
sanguineus et de Teutana triangulosa. Role
ixodiphage dês araignees. Ann Parasitol Hum Comp
1936, 14:126-129.
24. Guglielmone aa, Mosa sG: Predation of ticks of
the Rhipicephalus sanguineus (Latreille, 1806)
group and Boophilus microplus (canestrini,
1888) (Acari: Ixodidae) by Nothura Temminck,
1815 (Aves: tinamidae) in Salta, Argentina.
Folia Parasitol (Praha) 1991, 38:114.
25. coronado a: Ixodiphagus hookeri Howard, 1907
(Hymenoptera: encyrtidae) in the brown dog
tick Rhipicephalus sanguineus Latreille, 1806
(Acari: Ixodidae) in Venezuela. Entomotropica
2006, 21:61-64.
26. Koch HG, tuck Md: Molting and survival of the
brown dog tick (Acari: Ixodidae) under different temperatures and humidities. Ann
Entomol Soc Am 1986, 79:11-14.
27. rees HH: Hormonal control of tick development and reproduction. Parasitology 2004,
129(suppl 1):s127-143.
28. sonenshine dE: tick pheromones and their use
in tick control. Annu Rev Entomol 2006, 51:557-580.
95
29. cançado pH, piranda EM, Faccini Jl: Influência do
comportamento gregário nos processos de
muda de Rhipicephalus sanguineus (Latreille,
1806) (Acari: Ixodidae), em condições laboratoriais. Rev Bras Parasitol Vet 2007, 16:205-210.
30. szabó Mp, cunha tM, pinter a,Vicentini F: ticks
(Acari: Ixodidae) associated with domestic
dogs in Franca region, São Paulo, Brazil. Exp
Appl Acarol 2001, 25:909-916.
31. dantas-torres F, Figueredo la, Faustino MaG: ectoparasitos de cães provenientes de alguns
municípios da Região Metropolitana do Recife, Pernambuco, Brasil. Rev Bras Parasitol Vet 2004,
13:151-154.
32. dantas-torres F, Melo MF, Figueredo la, brandão-Filho
sp: ectoparasite infestation on rural dogs in
the municipality of São Vicente Férrer, Pernambuco, northeastern Brazil. Rev Bras Parasitol
Vet 2009, 18:75-77.
33. saxena VK, Maheshwari uK. Seasonal incidence of
Rhipicephalus sanguineus (Lat) (Acarina) on a
wild host Hemiechinus auritus collaris (Gray)
(Insectivora). J Commun Dis 1985, 17:227-229.
34. iori a, lanfranchi p, Manilla G: contribution to the
knowledge of Ixodidae ticks of wild mammals of Somalia. Parassitologia 1996, 38:571-573.
35. Estrada-peña a, Jongejan F: ticks feeding on humans: a review of records on human-biting
Ixodoidea with special reference to pathogen
transmission. Exp Appl Acarol 1999, 23:685-715.
36. Walker Jb, Keirans JE, Horak iG: Genus Rhipicephalus (Acari, Ixodidae). A guide to the brown
ticks of the world. cambridge: cambridge university press; 2000.
37. labruna Mb, Jorge rs, sana da, Jácomo at, Kashivakura
cK, Furtado MM, Ferro c, perez sa, silveira l, santos ts
Jr, Marques sr, Morato rG, nava a, adania cH, teixeira
rH, Gomes aa, conforti Va, azevedo Fc, prada cs,
silva Jc, batista aF, Marvulo MF, Morato rl, alho cJ,
pinter a, Ferreira pM, Ferreira F, barros-battesti dM:
ticks (Acari: Ixodida) on wild carnivores in
Brazil. Exp Appl Acarol 2005, 36:149-163.
38. dantas-torres F, Figueredo la, brandão-Filho sp:
Rhipicephalus sanguineus (Acari: Ixodidae),
the brown dog tick, parasitizing humans in
Brazil. Rev Soc Bras Med Trop 2006, 39:64-67.
39. dantas-torres F, Ferreira dr, de Melo lM, lima pa,
siqueira db, rameh-de-albuquerque lc, de Melo aV,
ramos Ja: ticks on captive and free-living wild
animals in northeastern Brazil. Exp Appl Acarol
2010, 50:181-189.
40. parola p, socolovschi c, Jeanjean l, bitam i, Fournier
pE, sotto a, labauge p, raoult d: Warmer weather
linked to tick attack and emergence of severe rickettsioses. PLoS Negl Trop Dis 2008, 2:e338.
96
41. Guglielmone aa, beati l, barros-battesti dM, labruna
Mb, nava s,Venzal JM, Mangold aJ, szabó Mp, Martins Jr,
González-acuña d, Estrada-peña a: ticks (Ixodidae)
on humans in South America. Exp Appl Acarol
2006, 40:83-100.
42. louly ccb, Fonseca in, oliveira VF, borges lMF: ocorrência de Rhipicephalus sanguineus em trabalhadores de clínicas veterinárias e canis,
no município de Goiânia, Go. Cienc Anim Bras
2006, 7:103-106.
43. nithikathkul c, polseela r, iamsa-ard J, Wongsawad
c, Jittapalapong s: A study of ectoparasites of
Canis lupus familiaris in Mueang district,
Khon Kaen, thailand. Southeast Asian J Trop Med
Public Health 2005, 36(suppl 4):149-151.
44. Goldberg M, recha y, durden la: ticks parasitizing
dogs in northwestern Georgia. J Med Entomol
2002, 39:112-114.
45. soares ao, souza ad, Feliciano Ea, rodrigues aF,
d’agosto M, daemon E: Avaliação ectoparasitológica e hemoparasitológica em cães criados em apartamentos e casas com quintal na
cidade de Juiz de Fora, MG. Rev Bras Parasitol Vet
2006, 15:13-16.
46. otranto d, lia rp, cantacessi c, Galli G, paradies p,
Mallia E, capelli G: Efficacy of a combination of
imidacloprid 10%/permethrin 50% versus
fipronil 10%/(S)-methoprene 12%, against
ticks in naturally infected dogs. Vet Parasitol
2005, 130:293-304.
47. neves l, afonso s, Horak iG: Ixodid ticks on dogs
in southern Mozambique. Onderstepoort J Vet Res
2004, 71:279-83.
48. labruna Mb, Homem Vs, Heinemann Mb, Ferreira neto
Js: ticks (Acari: Ixodidae) associated with rural dogs in Uruará, eastern Amazon, Brazil.
J Med Entomol 2000, 37:774-776.
49. Kordick sK, breitschwerdt Eb, Hegarty bc, southwick
Kl, colitz cM, Hancock si, bradley JM, rumbough r,
Mcpherson Jt, Maccormack Jn: coinfection with
multiple tick-borne pathogens in a Walker
Hound kennel in north carolina. J Clin Microbiol
1999, 37:2631-2638.
50. louly ccb, soares s, silveira d, neto o, silva a, borges
l: Differences in the susceptibility of two
breeds of dogs, english cocker spaniel and
beagle, to Rhipicephalus sanguineus (Acari:
Ixodidae). Inter J Acarol 2009, 35:25-32.
51. louly cc, soares sF, da nóbrega silveira d, Guimarães
Ms, borges lM: Differences in the behavior
of Rhipicephalus sanguineus tested against
resistant and susceptible dogs. Exp Appl Acarol,
[Epub ahead of print].
52. inokuma H, tamura K, onishi t: Dogs develop resistance to Rhipicephalus sanguineus. Vet Parasitol
1997, 69:295-297.
53. Veronez Va, de castro Mb, bechara GH, szabó Mp:
Histopathology of Rhipicephalus sanguineus
(Acari: Ixodidae) ticks fed on resistant hosts.
Exp Appl Acarol 2010, 50:151-161.
54. Goddard J: ticks of medical importance occurring in the Western Hemisphere. texas: usaF
school of aerospace Medicine; 1987.
55. Jacobs paH, Fourie lJ, Kok dJ, Horak iG: Diversity,
seasonality and sites of attachment of adult
ixodid ticks on dogs in the central region of
the Free State Province, South Africa. Onderstepoort J Vet Res 2001, 68:281-290.
56. Gilot b: Biologie et ecologie de Rhipicephalus
sanguineus (Latreille, 1806) (Acariens, Ixodoidea) dans le Sud-est de la France. Bull Soc
Sci Vet Med Comp 1984, 86:25-33.
57. papadopoulos b, Morel pc, aeschlimann a: ticks of
domestic animals in the Macedonia region of
Greece. Vet Parasitol 1996, 63:25-40.
58. inokuma H, tamura K, onishi t: Seasonal occurrence of Rhipicephalus sanguineus in okayama Prefecture, Japan and effect of temperature on development of the tick. J Vet Med Sci
1996, 58:225-228.
59. demma lJ, traeger Ms, nicholson Wl, paddock cd,
blau dM, Eremeeva ME, dasch Ga, levin Ml, singleton
J Jr, Zaki sr, cheek JE, swerdlow dl, McQuiston JH:
Rocky Mountain spotted fever from an unexpected tick vector in Arizona. N Engl J Med
2005, 353:587-594.
60. demma lJ, Eremeeva M, nicholson Wl, traeger M, blau
d, paddock c, levin M, dasch G, cheek J, swerdlow d,
McQuiston J: An outbreak of Rocky Mountain
Spotted Fever associated with a novel tick
vector, Rhipicephalus sanguineus, in Arizona,
2004: preliminary report. Ann N Y Acad Sci 2006,
1078:342-343.
61. nicholson Wl, paddock cd, demma l, traeger M,
Johnson b, dickson J, McQuiston J, swerdlow d: Rocky
Mountain spotted fever in Arizona: documentation of heavy environmental infestations of Rhipicephalus sanguineus at an
endemic site. Ann N Y Acad Sci 2006, 1078:338-341.
62. uspensky i, ioffe-uspensky i: the dog factor in
brown dog tick Rhipicephalus sanguineus
(Acari: Ixodidae) infestations in and near
human dwellings. Int J Med Microbiol 2002,
291(suppl 33):156–163.
63. okoli i c, okoli cG, opara M: environmental and
multi-host infestation of the brown dog tick,
Rhipicephalus sanguineus in owerri, southeast nigeria – a case report. Vet Arhiv 2006,
76:93-100.
64. Gilot b, laforge Ml, cabassu Jp, romani M: Éléments
pour la cartographie écologique des populations de Rhipicephalus du groupe sanguineus
(Acariens, Ixodoidea) dans l’agglomération
Marseillaise, en relation avec les diverses
formes d’urbanisation. Acarologia 1992, 33:17-33.
65. shimada y, beppu t, inokuma H, okuda M, onishi t:
Ixodid tick species recovered from domestic
dogs in Japan. Med Vet Entomol 2003, 17:38-45.
66. dantas-torres F: Rocky Mountain spotted fever.
Lancet Infect Dis 2007, 7:724-732.
67. Gray Js, dautel H, Estrada-peña a, Kahl o, lindgren E:
effects of climate change on ticks and tickborne diseases in europe. Interdiscip Perspect Infect
Dis 2009, 2009:593232.
68. yoder Ja, benoit Jb, rellinger EJ, tank Jl: Developmental profiles in tick water balance with a
focus on the new Rocky Mountain spotted
fever vector, Rhipicephalus sanguineus. Med Vet
Entomol 2006, 20:365-372.
69. socolovschi c, raoult d, parola p: Influence of temperature on the attachment of Rhipicephalus
sanguineus ticks on rabbits. Clin Microbiol Infect
2009, 15:326-327.
70. Goddard J: Focus of human parasitism by the
brown dog tick, Rhipicephalus sanguineus
(Acari: Ixodidae). J Med Entomol 1989, 26:628-629.
71. carpenter tl, McMeans Mc, McHugh cp: Additional
instances of human parasitism by the brown
dog tick (Acari: Ixodidae). J Med Entomol 1990,
27:1065-1066.
72. Gilot b, laforge Ml, pichot J, raoult d: Relationships between the Rhipicephalus sanguineus
complex ecology and Mediterranean spotted
fever epidemiology in France. Eur J Epidemiol
1990, 6:357-362.
73. Felz MW, durden la, oliver Jr JH: ticks parasitizing humans in Georgia and South carolina.
J Parasitol 1996, 82:505-508.
74. Harrison ba, Engber br, apperson cs: ticks (Acari:
Ixodida) uncommonly found biting humans
in north carolina. J Vector Ecol 1997, 22:6-12.
75. Manfredi Mt, dini V, piacenza s, Genchi c: tick species parasitizing people in an area endemic
for tick-borne diseases in north-western
Italy. Parassitologia 1999, 41:555-560.
76. Fernández-soto p, pérez-sánchez r, alamo-sanz r,
Encinas-Grandes a: Spotted fever group rickettsiae in ticks feeding on humans in northwestern Spain: is Rickettsia conorii vanishing?
Ann N Y Acad Sci 2006, 1078:331-333.
77. dantas-torres F: canine vector-borne diseases
in Brazil. Parasit Vectors 2008, 1:25.
97
78. otranto d, dantas-torres F, breitschwerdt Eb: Managing canine vector-borne diseases of zoonotic
concern: part one. Trends Parasitol 2009, 25:157-163.
79. regendanz p, Muniz J: o Rhipicephalus sanguineus
como transmissor da piroplasmose canina no
Brasil. Mem Inst Oswaldo Cruz 1936, 31:81-84.
80. Ewing sa, Mathew Js, panciera rJ: transmission of
Hepatozoon americanum (Apicomplexa: Adeleorina) by ixodids (Acari: Ixodidae). J Med
Entomol 2002, 39:631-634.
81. Forlano M, Scofield A, Elisei C, Fernandes KR, Ewing
sa, Massard cl: Diagnosis of Hepatozoon spp.
in Amblyomma ovale and its experimental
transmission in domestic dogs in Brazil. Vet
Parasitol 2005, 134:1-7.
82. pegram rG, Keirans JE, clifford cM, Walker Jb: Clarification of the Rhipicephalus sanguineus group
(Acari, Ixodoidea, Ixodidae). II. R. sanguineus
(Latreille, 1806) and related species. Syst Parasitol 1987, 10:27-44.
83. burlini l, teixeira Kr, szabó Mp, Famadas KM: Molecular dissimilarities of Rhipicephalus sanguineus
(Acari: Ixodidae) in Brazil and its relation
with samples throughout the world: is there
a geographical pattern? Exp Appl Acarol, [Epub
ahead of print].
98
99
Parasites & Vectors, edited by chris
arme, is an open access, peer-reviewed
online journal dealing with the biology of
parasites, parasitic diseases, intermediate
hosts and vectors. articles published in
this journal are available with no subscription charges or barriers to access,
and authors retain the copyright of their
material and may use it, or distribute it,
as they wish.
www.parasitesandvectors.com
enVIRonMentAL RISK MAPPInG oF cAnIne
LeISHMAnIASIS In FRAnce
lisE cHaMaillÉ1,2, annElisE tran2,3, annE MEuniEr4, GillEs bourdoisEau4, paul rEady5
and JEan-piErrE dEdEt1*
1
uniVErsitÉ MontpElliEr, laboratoirE dE parasitoloGiE, cEntrE national dE rÉFÉrEncE dEs lEisHMania,
cHu dE MontpElliEr and uMr 2724 GEMi (ird-cnrs-uM1), MontpElliEr, FrancE, 2cirad, ur aGirs, MontpElliEr, FrancE,
3
cirad, uMr tEtis, MontpElliEr, FrancE, 4unitÉ dE parasitoloGiE, EcolE nationalE VÉtÉrinairE dE lyon, Marcy l’EtoilE, FrancE,
5
dEpartMEnt oF EntoMoloGy, natural History MusEuM, london, unitEd KinGdoM
*corrEspondinG autHor
JEan-piErrE dEdEt laboratoirE dE parasitoloGiE 39, aVEnuE cHarlEs FlaHault, 34295 MontpElliEr, cEdEX 5 (FrancE)
tEl. : 00 334 67 33 23 50, FaX : 00 334 67 33 23 58, E-Mail : parasito@uniV-Montp1.Fr
EMail addrEssEs:
LC: CHAMAILLE@TELEDETECTION.FR • AT: ANNELISE.TRAN@CIRAD.FR • AM: NANOUE@HOTMAIL.COM •
GB: G.BOURDOISEAU@VET-LYON.FR • PR: P.READY@NHM.AC.UK • JPD: PARASITO@UNIV-MONTP1.FR
Abstract
Background
canine leishmaniasis (canl) is a zoonotic disease caused by Leishmania infantum, a trypanosomatid protozoan transmitted by phlebotomine sandflies. Leishmaniasis is endemic in southern France, but the influences of environmental
and climatic factors on its maintenance and emergence remain poorly understood. From a retrospective database,
including all the studies reporting prevalence or incidence of canl in France between 1965 and 2007, we performed
a spatial analysis in order to i) map the reported cases in France, and ii) produce an environment-based map of the
areas at risk for canl. We performed a principal component analysis (pca) followed by a Hierarchical ascendant
Classification (HAC) to assess if the locations of CanL could be grouped according to environmental variables related to climate, forest cover, and human and dog densities. For each group, the potential distribution of canl in France
was mapped using a species niche modelling approach (Maxent model).
Results
Results revealed the existence of two spatial groups of CanL cases. The first group is located in the Cévennes region
(southern Massif central), at altitudes of 200-1000 m above sea level, characterized by relatively low winter temperatures (1.9° c average), 1042 mm average annual rainfall and much forest cover. the second group is located on the
Mediterranean coastal plain, characterized by higher temperatures, lower rainfall and less forest cover. these two
groups may correspond to the environments favoured by the two sandfly vectors in France, Phlebotomus ariasi and
Phlebotomus perniciosus respectively. our niche modelling of these two eco-epidemiological patterns was based on
environmental variables and led to the first risk map for CanL in France.
conclusion
results show how an ecological approach can help to improve our understanding of the spatial distribution of canl
in France.
100
Background
Methods
Canine leishmaniasis (CanL) is a disease caused by
Leishmania infantum, a Trypanosomatid protozoan transmitted by phlebotomine sandflies. This parasite also
causes the human disease (zoonotic visceral leishmaniasis) throughout its worldwide range, including the
Mediterranean Basin. The domestic dog is the main reservoir host, and this explains the socio-economic interest
of the zoonosis [1]. CanL threatens a large number of
dogs in endemic areas, and it is difficult to control as no
efficient vaccine exists and the chemotherapeutic agents
have a limited efficacy and a high cost [2]. Although
CanL is endemic in southern France, it is not a notifiable
disease nationally, which results in an absence of clear
knowledge of its incidence and emergence. Up to now,
the prevalence of CanL in France has been evaluated
either directly through canine serological surveys [3, 4],
or indirectly through surveys by questionnaires to practising veterinarians [5]. Based on temporal surveys, CanL
prevalence seems to have increased over the last decade
[5, 6]. For example, between 1988 and 2004, there was a
doubling in the numbers of « départements » (the French
administrative unit equivalent to a county) in which vets
diagnosed more than 50 cases per year [5]. Nevertheless,
it is difficult to distinguish between new cases resulting
from local transmission by sandflies and those arising
from dogs taken on holiday in the Mediterranean region
[1]. Epidemiological surveillance and risk mapping of
the disease require additional information and, since
2004, the EDEN EU FP6 project (Emerging Diseases in a
changing European eNvironment: www.eden-fp6project.
net) has been identifying and evaluating environmental
conditions that can influence the spatial and temporal
distribution of CanL and other vector-borne diseases. A
retrospective CanL database was prepared by teams in
many endemic European countries (France, Greece, Italy,
Portugal and Spain), in order to carry out risk mapping
using Geographic Information Systems (GIS). EDEN’s
risk map for CanL in Europe is based on a statistical
approach using logistic regression, but here we present an
ecological approach to modelling used only for France.
Two sandfly species are vectors of CanL in France,
Phlebotomus perniciosus and P. ariasi [4, 7]. However, each
species has specific environmental associations [7]: P.
perniciosus is present throughout Mediterranean France
at altitudes less than 600 m above sea level (a.s.l.), while
P. ariasi preferentially occurs in mixed oak forests (holm
and downy oaks) 200-1400 m a.s.l. and it is less abundant on the Mediterranean littoral plain. This knowledge
helped inform our choice of environmental variables for
modelling.
Retrospective canine leishmaniasis database. The retrospective canine leishmaniasis database was specifically created within the EDEN project (Davies CR, Cox
J and Ready PD, unpublished). The criteria for inclusion
included any case report or study reporting prevalence or
incidence of canine leishmaniasis in France between 1965
and 2007. The cases included were confirmed by parasitological, serological or molecular techniques. Imported
cases were excluded from the database.
All data were entered into a single spreadsheet file. The
data entered included the source of information, the type
of survey or case reporting, the method of diagnosis used,
information about the dog(s) concerned, and the location
of the case(s) or survey(s), with geographical coordinates
of the locality obtained using “Google Earth”.
Mapping used GIS software (ESRI ArcGISTM) to observe
distribution patterns and to facilitate statistical analyses.
Environmental variables. The geographical distribution of
CanL is related to environmental conditions that can influence the distribution and density of both the sandfly vector
and the mammalian reservoir host [8]. The distribution
of sandflies in France is strongly influenced by favoured
Mediterranean vegetation zones [7] and climatic factors,
e.g. seasonal temperatures [9]. Based on this knowledge,
the following environmental variables were chosen as
explanatory variables for CanL distribution: summer and
winter precipitations, summer and winter temperatures,
land use (in particular the type of forest) and altitude
levels. Human and canine densities were also selected,
although it should be noted that the latter was calculated
using a different estimate of the former (Table 1).
All variables were transformed, in order to be integrated
into a GIS with the same projection (Lambert conformal
conic projection) and the same geographical area (or
mask) corresponding to the southern part of France, the
grey area in Figure 1.
Statistical analysis. In order to take into account the error
of localization of the cases and to compare equivalent
spatial units, we used a regular grid with 5 x 5 km cells for
the analysis. This surface is equal to the average surface of
the municipalities. A cell was considered to be endemic
for CanL if it contained at least one locality with at least
one CanL case. A Principal Component Analysis (PCA)
was carried out to generate an integrative description of
the different characteristics of the cells, namely the following variables (Table 1):
–average altitude
–average annual temperature, average winter minimum
temperature and average summer maximum temperature
–average annual, winter and summer rainfall
101
Figure 1
location in France of canl cases for the 1965-2007 period.
– percentages of surface covered by broadleaf forest,
coniferous forest and mixed forest
– percentage of surface covered by forest (total forest)
– average human density
– average dog density
The PCA results in synthetic variables – Principal Components (PC) – which are a linear combination of the initial
variables. By construction, there is no correlation between
the resulting PCs, although two or more individual variables might be co-varying within a PC. A Hierarchical
Ascendant Classification (HAC) was performed on the
PCs, allowing the cells with similar environmental characteristics to be grouped together. This classification method
successively grouped together the cells, in order to obtain
the most homogeneous and the most distinctive classes
(groups) according to similarity and aggregation criteria
(10). The criterion of similarity was the Spearman coefficient and the criterion of aggregation was the average link.
102
Ecological niche modelling. We used an ecological niche
modelling approach to map the areas more suitable for
the presence of the CanL in France. Various models of
presence-only data are available to define the borders of
potential ecological niches [11, 12, 13, 14, 15]. We chose
a general-purpose machine learning method, the Maxent
model, which has been recently demonstrated to offer
better performance compared to other presence-only
models [14, 16]. Maxent is a method based on the maximal entropy principle. The model estimates the probability distribution (the probability of a case being present
in each cell) that respects a set of constraints based on
the values of the environmental variables observed for
the occurrence data. Among all probability distributions
that satisfy the set of constraints, the one with the maximum entropy is chosen. Unlike other species’ modelling
approaches, Maxent does not rely on any assumption
of independence of the environmental variables, which
is frequently not met for environmental data sets, and
can incorporate interactions between different variables
[16, 17].
For each group identified by the HAC, a univariate correlation analysis was performed to select the environmental
variables to be used as input of the Maxent model. The
initial data set with all locations of reported CanL cases
(presence-only data) was transformed into a relative
density map (quantitative data), using a quadratic Kernel
function [18]. The radius for the Kernel density estimates
(0.1435°) was chosen following the method of Berman
and Diggle [19]. The correlations between the case density and the different environmental variables were tested
using the Pearson r correlation coefficient. Significant
variables in this preliminary univariate screening analysis
at a 0.1 p-value were then used in the Maxent procedure.
Results
Retrospective canine leishmaniasis database. The retrospective CanL database was produced between 2006 and
2008. It contains 718 entries, corresponding to 45 publications or sources and 425 locations.
The map of the locations corresponding to the presence of
CanL since 1965 highlighted a spatial heterogeneity in the
disease distribution (Figure 1). There were three clusters
in southern France: i. on the foothills of the Cévennes
table 1
Environmental information used to characterize the canl locations in southern France
Information
Variable (unit)
Data source (spatial resolution, date)
Altitude
Altitude (m)
Institut Géographique National (IGN)
BDALTI database (250 m)
Temperature
Winter minimum temperature (°C):
average of the normal minimum
temperatures of January, February and
March
Summer maximum temperature (°C):
average of the normal maximal
temperatures of July, August and
September
Annual mean temperature (°C):
annual average of the normal temperature
Precipitation
Summer rainfall (mm): sum of rainfall of
July, August and September
Winter rainfall (mm): sum of rainfall of
January, February and March
Annual total rainfall (mm)
Forest
Presence of three types of forest
(Broadleaf forest, coniferous forest,
mixed forest)
CORINE Land Cover (100 m, 2006)
Human density
Density per locality (number of residents
divided by the surface of the locality)
IGN and Institut national de la statistique
et des études économiques (INSEE)
(locality, 2006)
Canine density
Density per locality (estimated number of
dogs divided by the surface of the locality)
Météo France (Interpolation from values
of normal of temperatures and
precipitation of Météo France stations
between 1971 and 2000.
The method of interpolation is the
method of the exponential ordinary
kriging for the continent; the method is
the inverse distance weighted for Corsica.
They show the most suitable results
compared with a set of map from Météo
France)
EDEN project
(http://edendatasite.com)
(0.008333°, 2005)
103
table 2
results of the univariate correlation analysis between canl density and the environmental variables for two main
ecological profiles
Class 1
Class 2
Variable
Cor
p
Variable
Cor
p
Human density
0.57
0.000
Human density
0.34
0.000
Summer rainfall
0.41
0.000
Mean annual temperature
0.29
0.001
Canine density
0.32
0.000
Winter temperature
0.28
0.002
Mean annual temperature
-0.21
0.019
Broadleaf forest
-0.19
0.029
Winter temperature
-0.21
0.021
Canine density
0.16
0.071
Coniferous forest
0.19
0.044
Total forest
-0.14
0.114
Elevation
-0.17
0.062
Annual rainfall
0.11
0.202
Winter rainfall
-0.15
0.114
Winter rainfall
-0.09
0.310
Mixed forest
0.14
0.122
Mixed forest
0.07
0.441
Broadleaf forest
-0.13
0.155
Summer temperature
0.06
0.507
Annual rainfall
0.10
0.290
Coniferous forest
0.046
0.624
Summer temperature
-0.06
0.523
Altitude
0.046
0.632
Total forest
-0.04
0.664
Summer rainfall
0.01
0.912
mountains and other southern ranges of the Massif
Central facing the Mediterranean; ii. on the southwest
foothills of the Maritime Alps; and iii. on the hilly Côte
d’Azur near the Italian border. Fewer cases were observed
on the littoral plain of the Mediterranean, and cases were
sparse in the south-west region, within the Massif Central,
in Indre-et-Loire department and in Corsica.
Statistical analysis. The PCA was performed for 296
cells of 5x5 km, corresponding to the CanL case locations, coloured violet in our map of France (Figure 1). It
resulted in 10 synthetic variables (PCs), with the first four
factors summarizing about 80% of the observed variance.
The first PC (PC1), which summarized more than 44%
of the information, is a combination of temperature and
precipitation variables. It can therefore be interpreted as a
climatic factor. The second PC (PC2), summarizing 15%
of the information, contains forest variables (coniferous,
mixed forests and total forest), winter precipitation and
altitude. The third PC (PC3, 10 %) is mainly linked to
broadleaf forest (Figure 2). The fourth PC (PC4, 8 %) is
linked to human and canine densities.
The HAC of the individual coordinates of the PCA led to
the successive grouping of the cells according to their environmental characteristics (Figure 3). It brought to light at
least two important ecological profiles: cells located inland
(Class 1) and those close to the coast (Class 2). Class 1
104
was positively associated with PC1. The cells of Class 1
corresponded to locations 200-1000 m a.s.l., which had
the coldest winter temperatures (minimum winter temperatures between -0.6°C and 3.1°C, with an average of
1.9°C) and the highest precipitation (annual precipitation
between 972 mm and 1254 mm, with an average of 1042
mm), and an important percentage of broadleaf forest.
Class 2 included cells close to the mainland coast and
in Corsica, with warmer summers (maximum summer
temperatures between 23.4°C and 28°C, with an average
of 26.1°C) and winters (minimum winter temperatures
between 0.8°C and 6°C, with an average of 3.4°C) and
less precipitation (annual precipitation between 362 mm
and 1178 mm, with an average of 860 mm).
These two main classes may be divided into subclasses
(Figure 3). Distinctions can be made between the cells of
Class 1: sub-class 1a, positively associated with PC3 and
PC4, contains more broadleaf forest as well as higher dog
and human densities; sub-class 1b, positively associated
with PC2, presents larger areas of coniferous and mixed
forests; and sub-class 1c is negatively associated with PC2
and PC3 and thus contains less forest.
Class 2 can also be divided into three sub-classes: subclass 2a, with a higher proportion of coniferous and
mixed forests (correlated with PC2); sub-class 2b, with a
lower proportion of forested areas (negatively correlated
with PC2 and PC3); and sub-class 2c with a drier and
warmer climatic profile combined with important areas
of broadleaf forest.
Ecological niche modelling. The Maxent model was run
for the two main ecological profiles: Classes 1 and 2.
According to the univariate analysis, seven significant
environmental variables were selected as input for the
Maxent model for Class 1: human and dog densities, average summer rainfall, average annual temperature, average
winter minimum temperature, percentage of surface cov-
ered by coniferous forest, and altitude. For Class 2, five
significant variables were selected: human density, average annual temperature, average winter minimum temperature, percentage of surface covered by broadleaf forest, and dog density (Table 2).
The final risk map (Figure 4) was produced by superimposing the results of the Maxent model for Class 1 and 2. It
showed an unequal distribution of the area suitable for the
disease in the southern part of France: the most suitable
areas extended along the southern slopes of the Cévennes
Figure 2
results of the principal component analysis: composition of the principal components (pc1, pc2 and pc3) and projection
of the initial variables on the first principal component analysis plans. HUM: human density; CAN: canine density; ALT: altitude;
broFor: broadleaf forest; conFor: coniferous forest; MiXFor: mixed forest; totFor: total forest; suMtEMp: summer
temperature; WintEMp: winter temperature; anntEMp: average annual temperature; suMrain: summer rainfall; Winrain:
winter rainfall; annrain: annual rainfall
Figure 3
Results of a Hierarchical Ascendant Classification of CanL cases according to environmental characteristics, 1965-2007, France.
a) dendrogram and b) map of the different classified groups.
105
Figure 4
Risk map of CanL in southern France. The areas suitable for the transmission of CanL by the sandfly species P. ariasi and
P. perniciosus are coloured in green and violet, respectively. the risk is expressed as a probability of occurrence with values
ranging from 0 to 1.
from the Montagne Noire in the southwest to Monts du
Vivarais in the northeast, and along the Mediterranean
coast, particularly in the central and the eastern part of this
littoral region. The main risk area for CanL in France included the Ardèche, Gard, Hérault, Bouches-du-Rhône, Var and
Alpes-Maritimes départements. Several potentially suitable
areas occurred on the western part of the Mediterranean
coast and in the extreme southwest (Pays Basque).
Less suitable areas were the Alps, the Massif Central and
the northern Rhône valley.
106
Discussion
For the first time, a retrospective study of CanL in France
has been carried out, based on cases reported between
1965 and 2007. The map of cases highlights a strong
heterogeneity in the spatial distribution of the disease.
Visually, the distribution of CanL in southern France
is clustered, with higher case densities on the southern
slopes of the Cévennes Mountains and two regions
of the Maritime Alps (Figure 1). In addition to these
Mediterranean records, this case map also shows a north-
ern focus, corresponding to 13 cases detected by Houin et
al. [20] in six different localities near Tours.
The case map is based on presence only, which does not
takes into account the prevalence data obtained by some
surveys. Some biases could not be avoided. Firstly, a single case report has the same value as a locality with high
disease prevalence. Secondly, the clustering of presence
spots might reflect the spatial distribution of the disease,
and/or the sampling effort and strategy of the leishmaniasis teams from Montpellier, Lyon, Marseilles and Nice.
Certainly, some areas were insufficiently reported, such
as in the Pyrénées-Orientales département, where all the
specific case localities were not noted in a publication giving an overall prevalence of 6.9 % [21].
The statistical environmental analysis (PCA followed by a
HAC) revealed the existence of two groups of leishmaniasis cases. The first group is located on the Cévennes slopes,
characterized by relatively low average temperatures, high
average rainfall and much forest cover. The second group
is located on the Mediterranean coast, characterized by
higher average temperatures, lower average rainfall and
less forest cover (Figure 2). These two groups may correspond to the environments favoured by the two species
of sandfly vectors in France, as previously shown in southern France [7] and Morocco [22, 23]. Rispail et al. [23]
identified, in Morocco, different associations between
the distributions of the two vectors and Mediterranean
bioclimatic zones, namely humid and sub-humid for
P. ariasi, compared with sub-humid and semi-arid for
P. perniciosus. Our environmental model also identified
two distinctive profiles, with the two main classes matching the bioclimates associated with the two vector species:
Class1 matches the bioclimates of P. ariasi, whereas Class
2 matches those of P. perniciosus.
According to the univariate correlation analysis, human
and canine densities are, as we expected, significant variables for explaining the distribution of CanL in France.
Their densities co-vary (Spearman r = 0.84), but both were
retained to provide all relevant information about CanL
distribution. This was possible because the Maxent procedure does not require independent variables. Average
annual temperature and winter temperature also helped
to define both environmental profiles, but in different
ways: the number of CanL cases was negatively correlated with the temperature averages in the first profile
(P. ariasi), whereas it was positively correlated in the
second profile (P. perniciosus). Moreover, additional significant variables were selected for P. ariasi: the average
summer rainfall, the proportion of coniferous forest
and the elevation. On the other hand, the distribution of
P. perniciosus was negatively correlated with the proportion of broadleaf forest. These differences are also consistent with the ecological niches of these two sandflies [7].
Our ecological niche modelling approach has produced
the first risk map of CanL for France, highlighting the
potential distribution of the disease. The new areas at risk
are mostly located in western France, along the Atlantic
coast, from the Pyrénées-Atlantique in the South to the
Loire-Atlantique in the North. These areas correspond
mainly to areas likely to be favoured by P. perniciosus, with
only a few places having the ecological profile of P. ariasi
(Haute-Vienne and Pyrénées-Atlantiques) (Figure 4). Some
new areas at risk have ecological niches likely to be favourable for both species, but they are rare (Figure 4).
This risk map is consistent with the known distribution
of P. perniciosus. Moreover, it should be noted that, in
recent years, CanL cases have been reported in several
locations outside the Mediterranean region, and always
inside the Atlantic area where the risk map predicts
emergence. These cases were reported around Limoges
(Haute-Vienne) [24], near Cholet and Angers (Maineet-Loire) (Bourdeau, 2009, personnal communication),
and around Niort (Deux-Sèvres) [Kasbari, 2009, personal
communication]. In these places, a few imported CanL
cases seem to be at the origin of local dog transmission,
and horizontal dog transmission cannot be ruled out
because cases were always grouped inside kennels.
However, vectors were present as well.
Our risk map does not match well the range extensions of
CanL mapped by Bourdeau [5]. The latter is based on vet
questionnaires, and it shows a more limited range extension of clinical autochthonous cases of CanL to the north
and west of the enzootic Mediterranean region. Our ecological niche model predicts the environmental suitability
for CanL, separating this into two classes that probably
reflect the niches of the two vectors, but the realized niche
may be smaller than the fundamental niche predicted by
the model [16].
The areas identified at risk for the disease may be used for
entomological or veterinary surveillance. However, our
results have to be treated with caution. Indeed, the risk
model is based on a retrospective database concerning all
reported cases of CanL. The assignment of the case locations (often the centre of the municipality) is likely to
introduce some errors. For example, some cases recorded
from the littoral plain of the Languedoc could be related
to hunters’ dogs, which could have contracted the disease
in the Cévennes Mountains, where they are taken for
hunting [3]. Subclass 2b could correspond to the leishmaniasis cases in this population of dogs (Figure 3).
conclusions
This paper shows how an ecological approach can help
to improve our understanding of the spatial distribution
of CanL in France. Our environmental risk map is the
first to be produced and proved to be a useful tool for for-
107
mulating hypotheses about CanL emergence. Further studies are needed to better understand the ecology of CanL
in France. In particular, surveys to investigate the ecology
of both sandfly vectors, P. ariasi and P. perniciosus, would
help to interpret our risk maps. For example, studies of
presence-absence of these sandflies in a smaller area could
identify specific environmental variables (including land
cover) that might be important predictors at local scales.
References
1.
2.
3.
competing interests
No competing financial interest exist
Authors’ contribution
LC and AT performed the statistical analyses of the data
and the ecological niche modelling; AM and GB helped
complete the retrospective database; PR was the coordinator of the leishmaniasis component of the EDEN project;
J-PD directed the French team and helped develop the
retrospective database. The manuscript was written by AT,
LC, J-PD and PR.
Acknowledgments
This research was funded by EU grant GOCE-2003-010284
EDEN (http://www.eden-fp6project.net/). The contents
of this publication are the responsibility of the authors
and do not necessarily reflect the views of the European
Commission. It is catalogued by the EDEN Steering
Committee as EDEN0194. The authors thank Yves Balard,
Patrick Lami and Hugues Corbière for expert technical
assistance. Luc Bertolus is acknowledged for processing
data in the retrospective database. Many thanks also to
Robert Killick-Kendrick, Arezki Izri and Patrick Bourdeau
for fruitful discussions, and to Guy Hendricks, Avia-GIS
for providing the dog density map.
Publication of this thematic series has been sponsored by
Bayer Animal Health GmbH.
Parasites & Vectors 2010, 3:31
(http://www.parasitesandvectors.com/content/3/1/31)
The original article is published as an open access article
distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/
by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work
is properly cited.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
108
ready pd: Leishmaniasis emergence and
climate change. in: Climate change: impact on the
epidemiology and control of animal diseases. Edited by de
la roque s. Rev sci tech Off int Epiz 2008, 27: 399-412.
dedet Jp, pratlong F. Leishmaniasis. in: Manson’s
Tropical Diseases, 22nd edition. Edited by cook Gc,
Zumla ai. london: saunders; 2009: 1341-1365.
lanotte G, rioux Ja, croset H,Volhardt y: (1974).
ecologie des leishmanioses dans le sud de la
France. 7. Dépistage de l’enzootie canine par
les méthodes immunosérologiques. Ann Parasit
Hum Comp 1974, 49:41-62.
Marty p, Jambou r, Jambou d, bayada M, Jourdain n,
Haas p, le Fichoux y: Premières enquêtes prospectives sur la leishmaniose canine dans
le département des Alpes-Maritimes. Bull Soc
Franç Parasitol 1986, 4:21-24.
bourdeau p: canine vector-borne diseases in
France : information obtained from veterinary clinics in national servey. Proc. 4th Symposium of the CVBD World Forum 2008: 78-84.
dereure J,Vanwambeke so, Male p, Martinez s, pratlong
F, balard y, dedet Jp: the potential effects of
global warming on changes in canine leishmaniasis in a focus outside the classical area
of the disease in Southern France. Vect Born
Zoon Dis 2009, 9:687-694.
rioux Ja, Golvan yJ, croset H, tour s, Houin r, abonnenc E, petitdidier M,Vollhardt y, dedet Jp, albaret Jl,
lanotte G, Quilici M: epidémiologie des leishmanioses dans le sud de la France. paris:
insErM, paris ; 1969.
dedet Jp: Répartition géographique des leishmanioses. Méd Mal Infect 2001, 31 Suppl 2:178-183.
ready pd, croset H: Diapause and laboratory breeding of Phlebotomus perniciosus
newstead and Phlebotomus ariasi tonnoir (Diptera: Psychodidae) from southern
France. Bull Entom Res 1980, 70: 511-523.
sanders l: L’analyse statistique des données en
géographie. Montpellier: reclus; 1990.
busby Jr: A biogeographical analysis of
Nothofagus cunninghamii (Hook.) oerst. in
southeastern Australia. Aust J Ecol 1986, 11:1-7.
nix Ha: A biogeographic analysis of Australian elapid snakes. in: atlas of Elapid snakes of australia. camberra: australian Government publications
service; 1986: 4-15.
carpenter G, Gillison an,Winter J: DoMAIn: a
flexible modeling procedure for mapping
potential distributions of plants, animals.
Biodivers Conserv 1993, 2:667-680.
14. Elith J, Graham cH, anderson rp, dudik M, Ferrier s,
Guisan a, Hijmans rJ, Huettmann F, leathwick Jr, lehmann a, li J, lohmann lG, loiselle ba, Manion G, Moritz
c, nakamura M, nakazawa y, overton J Mcc, peterson
at, phillips sJ, richardson Ks, scachetti-pereira r, schapire rE, soberon J, Williams s, Wisz Ms, Zimmermann
nE: novel methods improve prediction of
species’ distributions from occurrence data.
Ecography 2006, 29:129-151.
15. tsoar a, allouche o, steinitz o, rotem d, Kadmon r,
A comparative evaluation of presence only
methods for modelling species distribution.
Diversity Distrib 2007. 13:397-405.
16. phillips sJ, anderson rp, schapier rE: Maximum
entropy modeling of species geographic distributions. Ecological Modelling 2006, 190:231-259.
17. aspinall r: An inductive modelling procedure
based on Bayes’ theorem for analysis of pattern in spatial data. Intern J Geo Inform System 1992,
6:105-121.
18. silverman bW: Density estimation for Statistics
and Data Analysis. london: chapman & Hall; 1986.
19. berman M: estimating weighted integrals of
the second order intensity of a spatial point
process. J Roy Statistic Soc 1989, B51:81-92.
20. Houin r, Jolivet G, combescot c, deniau M, puel F, barbier d, romano p, Kerboeuf d: etude préliminaire
d’un foyer de leishmaniose canine dans la
région de tours. in: Colloque Ecologie des Leishmanioses, 18-24 août 1974, Montpellier: cnrs Editions; 1977:
109-115.
21. rioux Ja, lanotte G, pratlong F, dereure J, Jarry d,
Moreno G, Killick-Kendrik r, perieres J, Guilvard E,
belmonte a, portus M: La leishmaniose cutanée
autochtone dans le Sud-est de la France. Résultats d’une enquête éco-épidémiologique
dans les Pyrénées-orientales. Méd Mal Infect
1985, 11:650-656.
22. rioux Ja, rispail p, lanotte G, lepart J: Relations
phlébotomes-bioclimats en écologie des
leishmanioses. corollaires épidémiologiques.
L’exemple du Maroc. Bull Soc Bot Fr 1984, 131:549557.
23. rispail p, dereure J, Jarry d: Risk zones of human
leishmaniases in the western Mediterranean
Basin. Correlation between vector sand flies,
bioclimatology and phytosociology. Mem Inst
Oswaldo Cruz 2002, 97:477-483.
24. izri a, Marty p, bouteille b, izri l, deniau M, dardé Ml:
epidémiologie de la leishmaniose canine à
Limoges. Résultats d’une enquête éco-épidémiologique [abstract]. Congr Soc Franç Parasitol
2003.
109
Parasites & Vectors, edited by chris
arme, is an open access, peer-reviewed
online journal dealing with the biology of
parasites, parasitic diseases, intermediate
hosts and vectors. articles published in
this journal are available with no subscription charges or barriers to access,
and authors retain the copyright of their
material and may use it, or distribute it,
as they wish.
www.parasitesandvectors.com
BARTONELLA VINSONII SUBSP. BERKHOFFII AnD
BARTONELLA HENSELAE BActeReMIA In A FAtHeR
AnD DAUGHteR WItH neURoLoGIcAL DISeASe
EdWard b brEitscHWErdt1*, ricardo G MaGGi1, paul M lantos2, cHristopHEr W Woods2,
barbara c HEGarty1, JuliE M bradlEy1
1
intracEllular patHoGEns rEsEarcH laboratory, cEntEr For coMparatiVE MEdicinE and translational rEsEarcH,
collEGE oF VEtErinary MEdicinE, nortH carolina statE uniVErsity, 4700 HillsborouGH st., ralEiGH, nc, usa
2
duKE uniVErsity MEdical cEntEr, 2301 ErWin rd, durHaM, nc, usa
*corrEspondinG autHor
EMail addrEssEs:
EBB*: ED_BREITSCHWERDT@NCSU.EDU • RGM: RGMAGGI@NCSU.EDU • PML: PAUL.LANTOS@GMAIL.COM •
CWW: WOODS004@MC.DUKE.EDU • BCH: BARBARA_HEGARTY@NCSU.EDU • JMB: JULIE@BRADLEY@NCSU.EDU
Abstract
Background
Bartonella vinsonii subsp. berkhoffii is an important, emerging, intravascular bacterial pathogen that has been recently
isolated from immunocompetent patients with endocarditis, arthritis, neurological disease and vasoproliferative neoplasia. Vector transmission is suspected among dogs and wild canines, which are the primary reservoir hosts. this investigation was initiated to determine if pets and family members were infected with one or more Bartonella species.
Methods
pcr and enrichment blood culture in Bartonella alpha proteobacteria growth medium (bapGM) was used to determine infection status. antibody titers to B. vinsonii subsp. berkhoffii genotypes i-iii and B. henselae were determined
using a previously described indirect fluorescent antibody test. Two patients were tested sequentially for over a year
to assess the response to antibiotic treatment.
Results
intravascular infection with B. vinsonii subsp. berkhoffii genotype ii and Bartonella henselae (Houston 1 strain) were
confirmed in a veterinarian and his daughter by enrichment blood culture, followed by PCR and DNA sequencing.
symptoms included progressive weight loss, muscle weakness, lack of coordination (the father) and headaches, muscle
pain and insomnia (the daughter). B. vinsonii subsp. berkhoffii genotype ii was also sequenced from a cerebrospinal
fluid BAPGM enrichment culture and from a periodontal swab sample. After repeated courses of antibiotics, posttreatment blood cultures were negative, there was a decremental decrease in antibody titers to non-detectable levels
and symptoms resolved in both patients.
conclusions
B. vinsonii subsp. berkhoffii and B. henselae are zoonotic pathogens that can be isolated from the blood of immunocompetent family members with arthralgias, fatigue and neurological symptoms. therapeutic elimination of Bartonella
spp. infections can be challenging, and follow-up testing is recommended. an increasing number of arthropod vectors,
including biting flies, fleas, keds, lice, sandflies and ticks have been confirmed or are suspected as the primary mode of
transmission of Bartonella species among animal populations and may also pose a risk to human beings.
110
Background
Patients, pets and methods
When a genus of bacteria is discovered or, in the case of
Bartonella, rediscovered; numerous clinical, microbiological and pathological concepts related to disease causation
and microbial pathogenesis are sequentially redefined.
Subsequently, the medical relevance of the genus undergoes continued maturation; as knowledge of the organism, the host immune response, diagnostic test sensitivity and specificity, treatment efficacy and epidemiology
expand. Since the early 1990s, this paradigm of discovery
and ongoing biological and medical redefinition has
clearly been applicable to the genus Bartonella. Prior to
1990, only two pathogenic Bartonella species, B. bacilliformis and B. quintana, were known to exist. Since 1990,
greater than 22 Bartonella species have been described, of
which at least half have been implicated or confirmed as
human pathogens [1,2].
Bartonella vinsonii subsp. berkhoffii was initially isolated
from a dog with endocarditis in 1993 [3]. Subsequently,
four genotypes of B. vinsonii subsp. berkhoffii were
described, based upon analysis of blood samples from
coyotes, dogs and foxes [4]. To date, genotype II has
been the most frequently isolated genotype sequenced
from dog and human blood samples [5-8]. Previously,
B. vinsonii subsp. berkhoffii genotype II was documented
in a healthy dog on 8 of 10 culture attempts spanning
a 16-month period, thereby supporting the potential
for persistent intravascular infection in pet dogs [9].
Although tick transmission of B. vinsonii subsp. berkhoffii
has been suggested, the mode(s) of transmission among
canines has not been determined [10]. In contrast to the
canine reservoir for B. vinsonii subsp. berkhoffii, domestic
and wild felids represent the primary reservoir in nature
for Bartonella henselae, an organism transmitted among
cats by fleas (Ctenocephalides felis); a factor that contributes to a worldwide distribution for this Bartonella sp.
[1,2]. Similar to dogs, outwardly healthy cats can remain
bacteremic with B. henselae for months to years [11,12].
However, despite what seems to be exceptional evolutionary adaptation of B. vinsonii subsp. berkhoffii in canines
and B. henselae in felines, both of these two bacterial species can be pathogenic in both cats and dogs.
In this study, intravascular infection with B. vinsonii
subsp. berkhoffii genotype II and B. henselae were found
in a veterinarian and his daughter. The father presented
with progressive weight loss, muscle weakness and lack
of coordination; his daughter had developed headaches,
muscle pain and insomnia. Both individuals were being
evaluated by a neurologist at the time of initial testing
for evidence of Bartonella infection. Multiple courses of
antibiotics were administered before the patients’ clinical
status improved and before microbiological, molecular
and serological evidence of infection diminished or was
negative.
In October, 2007, the primary author was contacted by the
father of a family residing in North Carolina, who requested Bartonella testing as a component of an IRB approved
study (North Carolina State University Institutional
Review Board, IRB#s 4925-03 and 164-08-05). For all
family members and pets (Institutional Animal Care
and Use Protocol 07-014-0) tested in this study, a previously described approach that combines PCR detection
of Bartonella spp. DNA and enrichment culture of blood
and serum samples in Bartonella alpha Proteobacteria
growth medium (BAPGM) was used [8]. The three part
BAPGM diagnostic platform incorporates PCR amplification of Bartonella spp. following direct DNA extraction
from patient blood and serum samples, PCR amplification following enrichment culture in BAPGM for 7 to 14
days, and PCR from isolates obtained following BAPGM
subculture inoculation onto trypticase soy agar with 10%
rabbit blood. Agar plates are incubated for 4 weeks and
checked weekly for evidence of bacterial growth. To assess
for potential laboratory contamination, an un-inoculated
BAPGM culture flask was processed simultaneously and
in an identical manner with each batch of patient blood
and serum samples tested. Specifically, while establishing
cultures using a batch of samples in the biosafety hood,
the top was removed from the BAPGM un-inoculated
control flask until all patient samples had been processed.
Methods used for testing sample cultures, including DNA
extraction, PCR amplification targeting the Bartonella
16S-23S intergenic spacer region (ITS), and sequencing
procedures were performed using previously described
methods [5-8]. Following the standard operating procedures in the Intracellular Pathogens Research Laboratory,
sample preparation including BAPGM cultures and agar
plate sub-inoculation, DNA extraction, PCR preparation
and PCR amplification and analysis were performed in
separate laboratory rooms to avoid culture as well as
DNA contamination. In addition, negative and positive Bartonella DNA test control samples, consisting of
bacteria-free blood DNA and DNA spiked with B. henselae genomic DNA at 0.5 genome copies per microliter,
respectively, were used for each batch of DNA tested. For
all results reported in this study, PCR products consistent
in size with a Bartonella spp. (400-600 bp amplicon size)
were sequenced to confirm the species and ITS strain.
Sequences were aligned and compared with GenBank
sequences using AlignX software (Vector NTI Suite 6.0,
InforMax, Inc.).
Serology was performed using modifications of a previously described indirect fluorescent antibody test [13].
Bartonella vinsonii subsp. berkhoffii and B. henselae antibodies were determined following traditional immunofluorescence antibody assay (IFA) practices with fluorescein
conjugated goat anti-human IgG. Bartonella vinsonii subsp.
111
berkhoffii genotypes I, II and III and B. henselae (Houston
I strain) were passed from agar grown cultures of each
organism into DH82 (a continuous canine histiocytic cell
line) cultures to obtain antigens that would seemingly be
expressed by an intracellular bacteria localized to erythrocytes or endothelial cells within the vasculature. Heavily
infected cell cultures were spotted onto 30-well Teflon
coated slides (Cel-Line/Thermo Scientific), air dried, acetone fixed and stored frozen. Serum samples were diluted
in phosphate buffered saline (PBS) solution containing
normal goat serum, Tween-20 and powdered nonfat dry
milk to block non-specific antigen binding sites. Patient
sera were screened at dilutions of 1:16 to 1:64. All sera that
remained reactive at a titer of 1:64 were further tested with
twofold dilutions out to a final dilution of 1:8192.
Results
Father
The father was a 50-year-old veterinarian whose symptoms
began in 2006 with arthralgias and fatigue, which became
progressively severe over ensuing 18 months. He described
pain and stiffness of the joints, muscles, and neck that were
most severe in the morning but improved throughout the
day. He did not have fevers, but he suffered from profound
fatigue. He had also experienced an 80-pound weight
loss, though this was partially intentional. Beginning in
September 2007, and of greatest concern to the patient, was
progressive difficulty maintaining his balance while standing or ambulating. His history was notable for extensive
occupational and domestic animal exposure. International
travel was minimal. He was initially evaluated by a neurologist, and because of his exposure to zoonotic pathogens
he was referred for infectious disease evaluation. He had
not received any empiric courses of antibiotics.
On physical examination, the patient had a blood pressure of 141/88 mm Hg, a pulse of 98 beats/min, and a
temperature of 37ºC. He was in no acute distress and
had a normal sensorium. Notable abnormal findings
included a positive Romberg sign and difficulty with
heel-toe walking. Cranial nerves, muscle strength, sensation, and deep tendon reflexes were normal and symmetrical, and his funduscopic examination was normal.
There was no lymphadenopathy, no organomegaly, and
no rash. Lumbar puncture revealed normal cerebrospinal
fluid indices and opening pressure. Magnetic resonance
imaging of the brain was notable for an increase in signal
intensity throughout the pons and upper medulla lateralizing to the left of the midline (Figure 1).
Bartonella vinsonii subsp. berkhoffii was amplified and
sequenced directly from the initial EDTA-anti-coagulated
Figure 1
cranial t2-weighted Mri showing mildly increased signal throughout the pons (circled), as well as in the upper medulla to the
left of midline. Also noted was mild diffuse atrophy and a few nonspecific foci of increased T2 signal seen in the frontal lobes.
112
table 1
serological, culture and molecular test results for a 50-year-old veterinarian (the father) with chronic weight loss and progressive neurological dysfunction
PCR/DNA Sequencing Results
Bartonella IFA Reciprocal Titers
Date/Sample
(Father)
B.
henselae
Bvb
Genotype II
Bvb
Genotype III
Direct
Extraction
BAPGM
Enrichment
Culture
Subculture
Isolate
10-18-07 Blood
512
32
256
Bvb TII
Neg
NIO
11-02-07 Blood
8192
64
128
Neg
Bvb TII
NIO
11-05-07 CSF
NT
NT
NT
Neg
Bvb TII
NIO
12-11-07 Oral Swab
NT
NT
NT
Bvb TII
N/A
N/A
1-18-08 Blood
1024
32
128
Neg
Bh H1
NIO
5-27-08 Blood
<16
16
16
Neg
Neg
NIO
11-04-08 Blood
<16
<16
<16
Neg
Neg
NIO
Neg = DNA was not amplified using Bartonella 16s-23s intergenic spacer (its) primers.
nio = no isolate obtained by subculture following bapGM (Bartonella alpha proteobacteria growth medium) enrichment culture.
n/a = not applicable
nt = not tested
Bvbii = Bartonella vinsonii subsp. berkhoffii Genotype ii by dna sequencing
Bh H1 = Bartonella henselae its Houston i like strain by dna sequencing
blood sample obtained from the father; however, enrichment blood culture was PCR negative following a 7-day
incubation period and a subculture (agar plate maintained for 4 weeks) failed to result in bacterial growth
(Table 1). By IFA testing, the father was seroreactive
to B. vinsonii subsp. berkhoffii genotypes II and III and
B. henselae antigens. Based upon these findings, blood
and cerebrospinal fluid were obtained for culture in
BAPGM approximately 3 weeks later, at which time
B. vinsonii subsp. berkhoffii was amplified and sequenced
from both 14 day blood and cerebrospinal fluid enrichment cultures (7-day enrichment cultures were again
PCR negative). Seroreactivity to B. vinsonii subsp. berkhoffii antigens remained essentially unchanged (within
one dilution of previous results); however, there was a
marked increase in the B. henselae antibody titer. The
father reported a history of periodontal disease, which
coincided with the onset of his illness. Sterile cotton
swabs were used to obtain saliva and periodontal surface
samples, after which ITS-PCR generated amplification
products from both samples. Efforts to sequence the
amplicon from saliva was not successful; however, B. vinsonii subsp. berkhoffii was amplified and sequenced from
the periodontal swab. As B. vinsonii subsp. berkhoffii DNA
was identified in three different sample sources (blood,
CSF and periodontal surface) and at three different time
points in the laboratory, he was treated for bartonellosis
with doxycycline plus rifampin. During the first week of
therapy he reported a worsening of symptoms, followed
by gradual improvement. Following 3 weeks of antibiotics his B. henselae antibody had titer decreased fourfold,
his B. vinsonii subsp. berkhoffii titers remained unchanged,
and B. henselae (ITS Houston I strain) was amplified
and sequenced from two 14-day BAPGM enrichment
cultures (both EDTA and ACD-anti-coagulated blood
samples were independently processed). Based upon this
result, he received an additional 6 weeks of doxycycline
plus rifampin. During the subsequent 11 months, PCR
evidence of Bartonella infection was not detected in two
additional blood cultures, the patient became non-sero-
113
reactive B. henselae and B. vinsonii subsp. berkhoffii. Posttreatment, the patient gradually regained body weight
and no longer experienced arthralgias or neurological
symptoms.
Based upon prior detection of B. vinsonii subsp. berkhoffii
in the father’s blood sample, a decision was made to test
the daughter. The daughter was seroreactive to antigens of
B. vinsonii subsp. berkhoffii genotypes II and III and to
B. henselae (Table 2). In addition, B. vinsonii subsp. berkhoffii was amplified and sequenced from two BAPGM
blood cultures obtained approximately three weeks apart.
She was treated with a 6-week course of azithromycin,
after which there was a fourfold decrease in the B. henselae
antibody titer, though her B. vinsonii subsp. berkhoffii antibody titers remained unchanged. Despite initial symptomatic improvement, her symptoms recrudesced towards
the end of this antibiotic course. B. vinsonii subsp. berkhoffii was again amplified and sequenced from a 14-day
BAPGM enrichment culture and from the agar plate subculture (both the 7-day enrichment culture and subculture were PCR negative). She began a 9-week course of
doxycycline, and at week 6, Bartonella spp. DNA was no
Daughter
The 7 ½ year old daughter of the above patient first
sought medical care for a similar constellation of symptoms in October, 2007. Her illness began suddenly one
morning with severe neck pain. Over the next month the
pain gradually improved but never fully remitted, and
she additionally developed headaches, low-grade fevers,
and general malaise. Her symptoms evolved to include
intermittent weakness of her legs and paresthesias, which
were so debilitating that she was no longer able to attend
school. She was seen by a pediatric neurologist, and her
vital signs and physical exam were noted to be normal.
She did not have any objective neurologic deficits.
table 2
serological, culture and molecular test results for a 7 ½ -year-old girl (the daughter) with progressive neurological dysfunction
PCR/DNA Sequencing Results
Bartonella IFA Reciprocal Titers
Date/Sample
(Daughter)
B.
henselae
Bvb
Genotype II
Bvb
Genotype III
Direct
Extraction
BAPGM
Enrichment
Culture
Subculture
Isolate
11-07-07 Blood
256
<16
128
Neg
Bvb TII
NIO
11-28-07 Blood
256
<16
64
Neg
Bvb TII
NIO
1-11-08 Blood
64
32
32
Neg
Bvb TII
Bvb TII
3-20-08 Blood
64
32
32
Neg
Neg
NIO
5-08-08 Blood
64
16
16
Neg
Neg
Ochrobactrum
sp.
6-24-08 Blood
64
32
16
Neg
Neg
NIO
7-31-08 Blood
16
32
64
Neg
Neg
NIO
10-13-08 Blood
<16
16
<16
Neg
Bh H1
NIO
12-01-2008 Blood
<16
<16
<16
Neg
Neg
NIO
Neg = DNA was not amplified using Bartonella 16s-23s intergenic spacer (its) primers.
nio = no isolate obtained by subculture following bapGM (Bartonella alpha proteobacteria growth medium) enrichment culture.
Bvbii = Bartonella vinsonii subsp. berkhoffii Genotype ii by dna sequencing
Bh H1 = Bartonella henselae its Houston i like strain by dna sequencing
114
Figure 2
Axial T2-weighted MRI of the daughter showing multiple, very small calcifications throughout the cerebrum in both white and
gray matter, sparing the cerebellum. these lesions were felt to be most consistent with a prior, inactive granulomatous process.
longer detectable from the extracted blood sample, from
the BAPGM enrichment blood culture, or from the agar
plate. Due to continued intermittent neck and back pain
the BAPGM diagnostic platform was repeated approximately 6 weeks later and a bacterial subculture isolate was
obtained. Because no product was amplified using the ITS
primers, different primers were used. An Ochrobactrum sp.
was amplified and sequenced from a subculture isolate,
using primers targeting the RpoB gene. She remained
symptomatic while off therapy for the next two months,
and though her symptoms were milder than before, they
persisted and she was retreated with a 6-week course of
doxycycline. During the subsequent two months antibody titers remained unchanged and two BAPGM blood
cultures failed to result in PCR detection of Bartonella spp.
infection. However, despite becoming seronegative to all
test antigens, B. henselae (Houston 1 strain) was amplified
and sequenced from a BAPGM enrichment culture
obtained 3 months later. She had a relapse of neck pain
several months later, but she did not receive antibiotics
that time. One year after testing was initiated, the girl was
no longer symptomatic and remained seronegative and
blood culture negative. She suffered a minor, unrelated
head injury during this time. A CT scan and subsequent
MRI of the brain incidentally revealed multiple curvilinear calcifications in the left posterior parietal lobe along
the periphery, throughout the cerebrum in both the gray
and white matter, and sparing the cerebellum (Figure 2).
These were thought to represent calcifications, possibly
consistent with a prior granulomatous process. She was
evaluated for infections known to induce granulomas,
(toxoplasmosis, tuberculosis, histoplasmosis) but this
workup was negative. The relationship of this radiographic finding to her Bartonella spp. infection is unclear. She
remained off therapy, and has had no subsequent recurrence in symptoms during a 12-month follow-up period.
115
Other Family Members: Within the family, the mother
and two sons were reportedly healthy. As described for
the father and daughter, B. henselae and B. vinsonii subsp.
berkhoffii serology and BAPGM blood cultures were performed for the mother (March, 2008) and for the two
sons (January, 2008). In these three individuals, antibody
titers ranged from 1:32 to 1:128 to antigens of B. henselae and B. vinsonii subsp. berkhoffii genotypes II and III.
Bartonella spp. was not isolated nor PCR amplified from
blood or serum samples obtained from these three other
family members.
Family Pets: The family had four domestic shorthair cats
and two recently acquired one-year-old English Springer
Spaniel littermates. Two other dogs, previously owned by
the family, had been killed in an automobile accident,
five months prior to the onset of illness in the father and
daughter. All four cats had antibodies to B. henselae and B.
vinsonii subsp. berkhoffii antigens by IFA testing, whereas
antibodies were not detectable in serum samples from the
two newly acquired dogs (Table 3). Bartonella henselae (ITS
Houston 1strain) was isolated from three of four cats. By
DNA sequencing, the B. henselae ITS strains obtained from
the father and daughter were identical to each of the B.
henselae ITS sequences obtained from the three cats following direct extraction from blood, following BAPGM enrichment culture, and from agar plate derived isolates. The two
English Springer Spaniel littermates were PCR negative for
Bartonella spp. DNA following blood extraction, BAPGM
enrichment cultures and no bacteria were isolated.
Discussion
In this study, we report the simultaneous detection of
B. vinsonii subsp. berkhoffii infection in two family members who were experiencing neurological dysfunction.
Bartonella vinsonii subsp. berkhoffii is an important emerging intravascular pathogen that has been isolated from
patients with endocarditis, arthritis, neurological disease
and vasoproliferative neoplasia [5,6,14,15]. In the current
case report, both the father and daughter were infected
with B. vinsonii subsp. berkhoffii genotype II strains and
both were either co-infected or sequentially infected with
B. henselae. Considering the sequential serological test
results obtained for the father, it seems likely that he was
co-infected, when the first blood culture was obtained.
Initial B. henselae antibody titers for the father were 8
to 12 fold higher than the titers obtained using B. vinsonii subsp. berkhoffii genotype II antigens, whereas only
a 6 fold difference was found in the initial two serum
samples from the daughter. As there is a less convincing
serological association supporting co-infection in the
daughter and as three of four cats in the household were B.
henselae bacteremic during the period in which the father
116
and daughter were being treated for their B. vinsonii subsp.
berkhoffii infections, it is possible that sequential infection
with two different Bartonella spp. was documented in the
daughter during the course of this study. As the isolation
and molecular detection of these bacteria from patient
samples remains microbiologically challenging, we were
unable to clearly establish whether either patient was coinfected or sequentially infected at various time points.
Previously, we described the preferential amplification of
one Bartonella sp. when two or more species are present in
the extracted sample [16]. The mechanism(s) responsible
for preferential amplification of one bacteria when DNA of
two species is present in a patient sample is unclear, but
mechanisms could include the relative concentrations of
DNA of the respective organisms in the sample at the time
of DNA extraction for PCR amplification, or selective
amplification of one DNA sequence over the other one,
when comparable template concentrations are present.
Targeting multiple Bartonella genes can enhance the possibility of detecting co-infection in patient samples [17-19].
Potentially, PCR primers targeting different gene fragments
preferentially amplify different Bartonella spp. in co-infected individuals. It is also possible that BAPGM enrichment
culture preferentially selects for the growth of one Bartonella
spp. in a co-infected individual. Therefore both individuals may have been co-infected with B. vinsonii subsp. berkhoffii and B. henselae at the outset of this study.
As the sequences of the B. henselae strains obtained from
the father and daughter’s blood cultures were identical
(B. henselae ITS strain Houston1) to the blood culture
strains obtained from the three cats, the family cats were
the presumed source of this infection.
Although the mother and two sons were healthy and
blood culture negative when tested on a single occasion,
all three had serological evidence supporting prior exposure to B. henselae. The two newly acquired young dogs
were not seroreactive to Bartonella antigens and both were
blood culture negative; therefore it seems unlikely that
these dogs played a role in transmission of B. henselae or
B. vinsonii subsp. berkhoffii in the family. Although cats are
the primary reservoir host, B. henselae has been isolated by
blood culture from dogs and sequenced from dog saliva
[8,9]. It is possible that an arthropods or the two older
dogs that had died prior to initiation of this study were the
source of B. vinsonii subsp. berkhoffii infection, as historically this organism has been isolated from domestic and
wild canines and humans [1,2]. Infection with B. vinsonii
subsp. berkhoffii was recently described in a cat with recurrent osteomyelitis that was bacteremic over a 15-month
time period [20]. Therefore, cats may be able to maintain
a persistent B. vinsonii subsp. berkhoffii bacteremia and
potentially serve as a source of bacterial transmission to
humans [14]. Efforts to amplify B. vinsonii subsp. berkhoffii
table 3
serological, culture and molecular test results for the household pets
PCR/DNA Sequencing Results
Bartonella IFA Reciprocal Titers
Pet Designation
B.
henselae
Bvb
Genotype II
Bvb
Genotype III
Direct
Extraction
BAPGM
Enrichment
Culture
Subculture
Isolate
JE Cat
512
128
64
Bh H1
Bh H1
Bh H1
CO Cat
<16
128
<16
Bh H1
Bh H1
Bh H1
SN Cat
256
128
64
Neg
Neg
NIO
JA Cat
2048
2048
2048
Bh H1
Bh H1
Bh H1
TO Dog
<16
<16
<16
Neg
Neg
NIO
EM Dog
<16
<16
<16
Neg
Neg
NIO
Neg = DNA was not amplified using Bartonella 16s-23s intergenic spacer (its) primers.
nio = no isolate obtained by subculture following bapGM (Bartonella alpha proteobacteria growth medium) enrichment culture.
Bh H1 = Bartonella henselae its Houston i like strain by dna sequencing
from the cats in this study using subspecies-specific primers were not successful. Over 100 years ago, B. quintana
was transmitted to human volunteers, when saliva from
a febrile patient was applied to escharified skin [21]. As
saliva obtained from soldiers with trench fever apparently contains viable, infectious Bartonella quintana, oral
transmission of B. vinsonii subsp. berkhoffii from the father
or a pet cat to the daughter through close family contact
cannot be ruled out. Bartonella spp. DNA has now been
reported in the saliva of cats, dogs and humans [22,23].
Clearly, additional data is needed to define the risk factors
for Bartonella spp. transmission to humans and to their
pets, but it seems prudent to recommend hygienic measures after contacting pet and perhaps human saliva.
The father in this report is the second patient in which
enrichment culture enhanced the molecular detection of a
Bartonella spp. in cerebrospinal fluid. In a previous study,
B. henselae was repeatedly detected by blood or cerebrospinal fluid culture in a 23 year-old girl who developed progressively severe seizures following a history of cat scratch
disease [6]. In both patients, cerebrospinal fluid analyses
were reported to be within normal limits; however, inadvertent contamination of the sample with blood cells
cannot be ruled out. As Bartonella spp. appear to target vascular endothelial cells, it is possible that B. vinsonii subsp.
berkhoffii and B. henselae contributed to the nonspecific
area of vascular injury reported on the father’s MRI.
The use of an optimized insect-based cell culture growth
medium can facilitate the isolation or enhanced molecular
detection of Bartonella spp. following culture-enrichment
of patient samples prior to performing PCR [5,6,8,14,18].
The enhanced diagnostic utility of the enrichment
approach is best illustrated in Table 2, where B. vinsonii
subsp. berkhoffii and B. henselae DNA were never directly
amplified from extracted blood samples obtained from
the daughter and were only detectable by PCR following enrichment culture. In our experience, at least a 7 to
14-day incubation period is required before the enriched
sample is obtained from liquid BAPGM for DNA extraction. At no time during this study was Bartonella spp.
DNA amplified from a DNA extraction control, a BAPGM
un-inoculated enrichment culture control or a subculture
agar plate control. Although not detailed in the table,
it is not unusual for 7-day enrichment cultures and
subcultures to be PCR negative for Bartonella spp. DNA,
whereas the respective organism can be amplified
and sequenced after a 14-day incubation period from
the enriched liquid culture, the agar plate isolate, or
both. Due to the high level of B. henselae bacteremia
generally found in cats, the same strain could be detected
117
in each cat following direct extraction of the blood sample, enrichment culture and the agar plate isolates (Table
3). Unfortunately, despite the enhanced utility of enrichment culture for the molecular microbiological diagnosis
of Bartonella infection, obtaining viable agar plate isolates
after subculture from liquid BAPGM at 7 or 14 days postincubation remains technically difficult. In this study, only
one B. vinsonii subsp. berkhoffii isolate was obtained from
the daughter’s post-antibiotic blood culture after a 14-day
enrichment period, whereas the 7-day BAPGM enrichment
culture and subculture were both PCR negative. An isolate
was never obtained from the father; however as described
above, using the same BAPGM enrichment platform, B.
henselae isolates were obtained from three of the four cats
in the household. As overtly healthy cats can maintain a
high-level of bacteria in systemic circulation for months
to years, isolation of B. henselae form cat blood samples
is comparatively easy to achieve, as compared to isolation
using the same approaches from dog or human blood
samples [11,12]. Failure to obtain stable Bartonella isolates
is a major patient management limitation, as it prevents
routine testing for antibiotic sensitivity and resistance of
specific isolates at time points prior to and following antibiotic administration. This was of particular concern for
these two patients, as B. henselae DNA was still sequenced
from an enrichment culture of the father’s blood following a 3-week course of doxycycline and rifampin and
B. vinsonii subsp. berkhoffii was detected in the girl’s blood
following a 6-week course of azithromycin. Based upon
negative post-antibiotic blood cultures and a decremental
decrease in antibody titers to non-detectable levels, antibiotic treatment appeared to correlate with microbiological
elimination of B. vinsonii subsp. berkhoffii and B. henselae
infections, cessation of antibody production, and with the
eventual clinical resolution of illness in both patients.
The father reported a recent history of severe periodontal
disease. Two previous molecular microbiological studies
identified Bartonella spp. DNA in subgingival samples
from patients with periodontitis. [24,25]. In addition,
other investigators have detected B. henselae DNA and
B. quintana DNA in the parotid salivary glands of an
immunocompetent woman and man, respectively and
B. quintana in the dental pulp of a homeless man
[26,27,28]. After which B. vinsonii subsp. berkhoffii genotype II was successfully sequenced from the periodontal
swab, but attempts to sequence the amplicon obtained
from the salivary swab were not successful (Table 1).
As identical techniques were used, this result might be
explained by a higher concentration of B. vinsonii subsp.
berkhoffii DNA at the periodontal surface, as compared
to dilution of bacterial DNA targets floating in saliva in
the oral cavity. In our laboratory, a B. henselae SA2 strain
(2.5 copies/reaction) is used as the source of positive con-
118
trol DNA for the ITS PCR reaction; therefore, contamination with positive control DNA could not explain any PCR
results obtained in these two patients. As over 500 species
of bacteria have been estimated to inhabit the oral cavity,
BAPGM enrichment culture was not attempted because
rapidly growing organisms would negate efforts to increase
Bartonella numbers via the enrichment process [29,30]. It
is also possible that detection of B. vinsonii subsp. berkhoffii
in close approximation of the periodontal surface reflects
passive leakage of bacteria through inflamed and compromised vascular tissues or alternatively the establishment
of an active foci of infection that contributed to the recent
history of periodontitis. Detection of DNA in the oral
cavity does not confirm the presence of viable bacteria;
however, caution should be exercised by dentists and physicians when examining the oral cavity of an individual
with chronic Bartonella spp. bacteremia.
conclusions
B. vinsonii subsp. berkhoffii and B. henselae are zoonotic
pathogens that can be isolated from the blood of immunocompetent family members with arthralgias, fatigue
and neurological symptoms. Therapeutic elimination of
Bartonella spp. infections can be challenging, and followup testing is recommended. An increasing number of
arthropod vectors, including biting flies, fleas, keds, lice,
sandflies and ticks have been confirmed or are suspected
as the primary mode of transmission of Bartonella species
among animal populations and may also pose a risk to
human beings.
competing interests
In conjunction with Dr. Sushama Sontakke and North
Carolina State University, Dr. Breitschwerdt holds U.S.
Patent No. 7,115,385; Media and Methods for cultivation
of microorganisms, which was issued October 3, 2006.
He is the chief scientific officer for Galaxy Diagnostics, a
newly formed company that provides diagnostic testing
for the detection of Bartonella species infection in animals and in human patient samples. Dr. Ricardo Maggi
performed all molecular microbiological testing reported
in this study and is the Scientific Technical Advisor and
Laboratory Director for Galaxy Dx.
Authors’ contributions
EBB was involved in all aspects of this study, including
generation of the initial draft of the manuscript; RGM
performed all blood cultures, PCR, sequencing and
molecular data analyses, PML and CWW were responsible
for patient evaluation, medical record review and patient
follow-up, BCH and JMB were responsible for serological testing. All authors contributed to the content and
approved the final manuscript.
Acknowledgements
Supported in part by the state of North Carolina and
grants from the American College of Veterinary Internal
Medicine Foundation, the Kindy French Foundation and
the Southeastern Center for Emerging Biological Threats.
Publication of this thematic series has been sponsored by
Bayer Animal Health GmbH.
Parasites & Vectors 2010, 3:29
(http://www.parasitesandvectors.com/content/3/1/29)
The original article is published as an open access article
distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/
by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work
is properly cited.
9.
10.
11.
12.
13.
References
1.
2.
3.
4.
5.
6.
7.
8.
chomel bb, boulouis HJ, Maruyama s, breitschwerdt Eb:
Bartonella spp. in pets and effect on human
health. Emerg Infect Dis 2006, 12(3):389-394.
Jacomo V, Kelly pJ, raoult d: natural history of
Bartonella infections (an exception to Koch’s
postulate). Clin Diagn Lab Immunol 2002, 9(1):8-18.
breitschwerdt Eb, Kordick dl, Malarkey dE, Keene b,
Hadfield TL, Wilson K: endocarditis in a dog due
to infection with a novel Bartonella subspecies. J clin Microbiol 1995, 33(1):154-160.
Maggi rG, chomel b, Hegarty bc, Henn J, breitschwerdt
Eb: A Bartonella vinsonii berkhoffii typing
scheme based upon 16S-23S ItS and Pap31
sequences from dog, coyote, gray fox, and
human isolates. Mol Cell Probes 2006, 20:128-134.
breitschwerdt Eb, Maggi rG, duncan aW, nicholson
Wl, Hegarty bc, Woods cW: Bartonella species
in blood of immunocompetent persons with
animal and arthropod contact. Emerg Infect Dis
2007, 13:938-941.
breitschwerdt Eb, Maggi rG, nicholson Wl, cherry na,
Woods cW: Bartonella spp. bacteremia in patients with neurological and neuro-cognitive
dysfunction. J Clin Microbiol 2008, 46(9):2856-2861.
breitschwerdt Eb, Maggi rG,Varanat M, linder KE,
Weinberg G: Isolation of Bartonella vinsonii
subsp berkhoffii genotype II from a boy with
epitheloid hemangioendothelioma and a dog
with hemangiopericytoma. J Clin Microbiol 2009,
47:1957-1960.
duncan aW, Maggi rG, breitschwerdt Eb: A combined approach for the enhanced detection and isolation of Bartonella species in
dog blood samples: Pre-enrichment culture
followed by PcR and subculture onto agar
plates. J Microbiol Meth 2007, 69:273-281.
14.
15.
16.
17.
18.
19.
20.
21.
Kordick dl, breitschwerdt Eb: Persistent infection
of pets within a household with three Bartonella species. Emerg Infect Dis 1998, 4:325-328.
billeter sa, levy MG, chomel bb, breitschwerdt Eb:
Vector transmission of Bartonella species
with emphasis on the potential for tick
transmission. Med Vet Entomol 2008, 22:1-15.
Kordick dl, brown tt, shin Ko, breitschwerdt Eb:
clinical and pathological evaluation of
chronic Bartonella henselae or Bartonella
clarridgeiae infection in cats. J Clin Microbiol 1999,
37:1536–1547.
Kordick DL, Wilson KH, Sexton DJ, Hadfield TL,
berkhoff Ha, breitschwerdt Eb: Prolonged Bartonella bacteremia in cats associated with
cat-scratch disease patients. J Clin Microbiol 1995,
33:3245-3251.
dalton MJ, robinson lE, copper J, regnery rl, olson
JG, childs JE: Use of Bartonella antigens for
serologic diagnosis of cat-scratch disease at
a national referral center. Arch Intern Med 1995,
155:1670-1676.
breitschwerdt Eb, Maggi rG, cadenas Mb, diniz ppVp:
A ground hog, a novel Bartonella sequence
and my father’s death. Emerg infect dis 2009,
15:2080-2086.
roux V, Eykyn sJ, Wyllie s, raoult d: Bartonella vinsonii subsp. berkhoffii as an agent of afebrile
blood culture-negative endocarditis in a human. J Clin Microbiol 2000, 38:1698-1700.
Maggi rG, duncan aW, breitschwerdt Eb: novel
chemically modified liquid medium that will
support the growth of seven Bartonella species. J Clin Microbiol 2005, 43:2651-2655.
diniz pp, Maggi rG, schwartz ds, cadenas Mb, bradley
JM, Hegarty b, breitschwerdt Eb: canine bartonellosis: serological and molecular prevalence
in Brazil and evidence of co-infection with
Bartonella henselae and Bartonella vinsonii
subsp. berkhoffii. Vet Res 2007, 38:697-710.
diniz ppVp, Wood M, Maggi rG, sontakke s, stepnik
M, breitschwerdt Eb: co-isolation of Bartonella
henselae and Bartonella vinsonii subsp. berkhoffii from blood, joint and subcutaneous
seroma fluids from two naturally infected
dogs. Vet Microbiol 2009, 138:368-372.
Maggi rG, Kosoy M, Mintzer M, breitschwerdt Eb:
Isolation of candidatus Bartonella melophagi
from human blood. Emerg Infect Dis 2009; 15:66-68.
Varanat M, travis a, lee W, Maggi rG, bissett sa, linder
KE, breitschwerdt Eb: Isolation of Bartonella vinsonii subsp berkhoffii genotype II from a cat
with recurrent osteomyelitis. J Vet Intern Med
2009, 23:1273-1277
strong rp: trench Fever. report of commission,
Medical research committee, american red cross,
oxford: oxford university press, 1918.
119
22. duncan aW, Maggi rG, breitschwerdt Eb: Bartonella
DnA in dog saliva. Emerg Infect Dis 2007, 13:19481950.
23. Kim ys, seo KW, lee JH, choi EW, lee HW, Hwang cy,
shin ns,youn HJ,youn Hy: Prevalence of Bartonella henselae and Bartonella clarridgeiae in
cats and dogs in Korea. J Vet Sci 2009, 10(1):85-87.
24. colombo ap, teles rp, torres Mc, souto r, rosalém WJ,
Mendes Mc, uzeda M: Subgingival microbiota
of Brazilian subjects with untreated chronic
periodontitis. J Periodontol 2002, 73(4):360-369.
25. colombo ap, Haffajee ad, dewhirst FE, paster bJ, smith
cM, cugini Ma, socransky ss: clinical and microbiological features of refractory periodontitis
subjects. J Clin Periodontol 1998, 25(2):169-180.
26. Kempf VaJ, petzold H: cat scratch disease due to
Bartonella henselae micking parotid malignancy. Eur J Clin Microbiol Infect Dis 2001, 20:732-733.
27. Vitale G, incandela s, incandela c, Micalizzi a, Mansueto p:
Isolation and characterization of Bartonella quintana from the parotid gland of an
immunocompetent man. J Clin Microbiol 2009,
47(3):862-864.
28. aboudharam G, Fournier pE, drancourt M, raoult d,
Foucault c, brouqui p: Molecular detection of
Bartonella quintana DnA in the dental pulp
of a homeless patient. Eur J Clin Microbiol Infect Dis
2004, 23(12):920-922.
29. cortelli Jr, aquino dr, cortelli sc, Fernandes cb,
de carvalho-Filho J, Franco Gc, costa Fo, Kawai t:
etiological analysis of initial colonization of
periodontal pathogens in oral cavity. J Clin
Microbiol 2008, 46:1322-1329.
30. nakano K, nemoto H, nomura r, inaba H,yoshioka H,
taniguchi K, amano a, ooshima t: Detection of oral
bacteria in cardiovascular specimens. Oral
Microbiol Immunol 2009, 24:64-68.
120
121
Parasites & Vectors, edited by chris
arme, is an open access, peer-reviewed
online journal dealing with the biology of
parasites, parasitic diseases, intermediate
hosts and vectors. articles published in
this journal are available with no subscription charges or barriers to access,
and authors retain the copyright of their
material and may use it, or distribute it,
as they wish.
www.parasitesandvectors.com
cAnIne BABeSIoSIS In noRtHeRn PoRtUGAL
AnD MoLecULAR cHARActeRIZAtIon oF
VectoR-BoRne co-InFectIonS
luÍs cardoso1,2*§,yaEl yisascHar-MEKuZas3*, Filipa t rodriGuEs4, ÁlVaro costa5,
JoÃo MacHado1, duartE diZ-lopEs4, Gad banEtH3
DEPARTMENT OF VETERINARY SCIENCES, UNIVERSITY OF TRÁS-OS-MONTES E ALTO DOURO,VILA REAL, PORTUGAL • 2parasitE disEasE
GROUP, INSTITUTO DE BIOLOGIA MOLECULAR E CELULAR, UNIVERSIDADE DO PORTO, PORTUGAL • 3scHool oF VEtErinary MEdicinE,
HEBREW UNIVERSITY OF JERUSALEM, REHOVOT, ISRAEL • 4CLÍNICA VETERINÁRIA DR. DUARTE DIZ-LOPES, BRAGANÇA, PORTUGAL •
5
clÍnica VEtErinÁria os bicHos, cHaVEs, portuGal
1
*tHEsE autHors contributEd EQually to tHis WorK
§corrEspondinG autHor
EMail addrEssEs:
LC: LCARDOSO@UTAD.PT • YYM: MEKUZAS@AGRI.HUJI.AC.IL • FTR:VETSANTIAGO@GMAIL.COM • AC: ALVAROSANTOSCOSTA@SAPO.PT •
JM: JPCMACHADO@GMAIL.COM • DDL:VETSANTIAGO@GMAIL.COM • GB: BANETH@AGRI.HUJI.AC.IL
Abstract
Background
Protozoa and bacteria transmitted by arthropods, including ticks and phlebotomine sand flies, may cause a wide
range of canine vector-borne diseases. dogs can be simultaneously or sequentially infected with multiple pathogens.
canine babesiosis caused by Babesia canis canis and Babesia canis vogeli is known to occur in portugal. this study
assessed, by means of blood smear examination, pcr and dna nucleotide sequencing, the presence of Babesia spp.
and co-infecting agents Leishmania, Anaplasma/Ehrlichia and Hepatozoon in 45 dogs from northern portugal clinically
suspected of babesiosis.
Results
Forty-four dogs (98%) had infection with B. canis canis and one with B. canis vogeli. co-infections were detected in
nine animals (20%). Eight dogs were found infected with two vector-borne agents: six with B. canis canis and Leishmania infantum; one with B. canis canis and Ehrlichia canis; and one with B. canis canis and Hepatozoon canis. another dog
was infected with three vector-borne pathogens: B. canis vogeli, E. canis and L. infantum. overall, L. infantum was found
in seven (16%), E. canis in two (4%), and H. canis in one (2%) out of the 45 dogs with babesiosis. almost 90% of the
45 cases of canine babesiosis were diagnosed in the colder months of october (18%), november (27%), december
(20%), February (13%) and March (9%). co-infections were detected in February, March, april, May, october and
november.twenty-two (50%) out of 44 dogs infected with b. canis were found infested by ticks including Dermacentor
spp., Ixodes spp. and Rhipicephalus sanguineus. Mortality (9%) included two co-infected dogs that died spontaneously
and two with single infections that were euthanized.
conclusions
Babesia canis canis is the main etiological agent of canine babesiosis in northern portugal. a higher sensitivity of
Babesia spp. detection was obtained with pcr assays, compared to the observation of blood smears. twenty percent
of the dogs were co-infected with L. infantum, E. canis or H. canis. Furthermore, this is the first molecular identification
of H. canis in dogs from northern portugal.
122
Background
A large variety of protozoa and bacteria transmitted by
arthropods, including ixodid ticks and phlebotomine
sand flies, may cause diseases in dogs and other vertebrate
hosts [1,2]. Canine piroplasmosis is caused by several
tick-borne Babesia and Theileria protozoal haemoparasites (termed piroplasms) and represents a pathological
condition with significant veterinary medical importance
in many parts of the world [3]. Mainly depending on
the piroplasm species or subspecies, the effects of infection in dogs may range from a subclinical condition to
severe and even fatal illness. Clinical abnormalities associated with piroplasmosis frequently comprise lethargy,
anorexia, pale mucous membranes, icterus, hyperthermia,
haemolytic anaemia, haemoglobinuria and thrombocytopenia [4,5]. Other factors, such as the canine host age
and immunity [6], together with concomitant infections
or diseases, also play a role in the potentially variable
pathogenicity of the disease [7].
Morphological appearance in the erythrocytes and especially molecular analysis have allowed the differentiation of several large (3–5 µm) and small (0.5–2.5 µm)
piroplasms of dogs [3]. In Europe, the causative agents
of canine babesiosis include large Babesia canis canis, a
subspecies transmitted by the tick Dermacentor reticulatus
which causes a mild to severe disease, and B. canis vogeli,
transmitted by Rhipicephalus sanguineus [8-11]. Babesia
canis vogeli, the less virulent subspecies of B. canis, is
also present in tropical and subtropical areas of Africa
[12], Asia [13], Australia [14], North and South America
[15,16]. The most virulent of the three subspecies,
B. canis rossi, has been reported only in central and
southern Africa [4,17]. Furthermore, another large yet
unnamed Babesia sp., genetically related to Babesia bigemina of cattle, has been reported in dogs with clinical
signs of babesiosis in North Carolina [18,19].
Small Theileria annae, a Babesia microti-like piroplasm
[20] endemic in northwestern Spain [21], and Babesia
gibsoni have also been detected as agents of babesial disease in European dogs [22-24]. Outside Europe,
T. annae has been detected in one dog from Mississipi
[25]. Babesia gibsoni has a wider distribution, with infections reported primarily from Asia [13] but also from
America [15,26] and Australia [27]. One other genetically
distinct small piroplasm species is recognised to cause
canine babesiosis: Babesia conradae in southern California
[28]. Furthermore, DNA of large Babesia caballi [24] and
small Theileria equi [24,29] and Theileria annulata [30],
in Europe, and an unnamed Theileria sp., in South Africa
[31], have been detected in dogs, but their role in canine
piroplasmosis needs to be confirmed.
The geographical distribution of canine piroplasms is
largely determined by the ecological ranges of their vector
arthropods [32]. Epidemiological surveillance of disease
occurrence and prevalence is required to map local risk
and forecast vector-borne infection scenarios. Canine
babesiosis caused by large piroplasms is known to occur
in northeastern Portugal [33], and both B. canis canis
and B. canis vogeli have recently been identified in some
naturally infected dogs from this area [34]. In areas where
canine vector-borne diseases (CVBD) are endemic, dogs
can be simultaneously or sequentially infected with more
than one vector-borne agent, depending on the presence
and abundance of arthropod vectors [1]. Leishmania infantum [35] and the rickettsiae Anaplasma platys and Ehrlichia
canis are also proven agents of CVBD in northern Portugal
[36]. The sand fly season runs from May to October in the
Douro subregion of northern Portugal: Phlebotomus perniciosus and Phlebotomus ariasi, vectors of Leishmania, are
most abundant in July and September, respectively [37].
Ticks of the species D. reticulatus and R. sanguineus have
been found to infest dogs in northeastern Portugal [3840]. In addition to transmitting B. canis vogeli and E. canis,
and presumably A. platys, R. sanguineus is also the main
vector for protozoan Hepatozoon canis in Europe [41,42].
This study assessed the presence of Babesia spp. and the
co-infecting pathogens Leishmania, Anaplasma/Ehrlichia
and Hepatozoon in dogs from northern Portugal clinically
suspected of babesiosis by means of blood smear examination, PCR and DNA nucleotide sequencing.
Methods
Animals and samples
Forty-five dogs from Alto Trás-os-Montes and Douro
(northern Portugal) suspected of babesiosis, between
October 2007 and March 2009, were included in this
study. The two subregions of Alto Trás-os-Montes (north)
and Douro (south) cover a total area of 12,282 sq. km
and are bordered by Spain to the north and east. The
terrain is hilly, and agriculture is the main source of
occupation and income. No history of travel to southern
Portugal or to Spain was obtained for any of the 45 dogs.
After recording the dog’s signalment, each animal was
physically examined and blood samples were collected
from the ear tip to prepare glass slide smears and to assess
microhaematocrit (HCT). The thin smears were air-dried,
fixed with methanol, Giemsa-stained and then examined
under light microscopy (magnification 1000x; 100 fields)
for detection of babesial piroplasms and other possible
infective agents. Additional samples of peripheral or
venous blood were spotted onto individual filter papers
(7.5 cm x 2.5 cm; GB 002 Schleicher and Schuell, Dassel,
Germany) allowed to air-dry and stored at –20 ºC until
further use. Dogs were also examined for the presence of
infesting ticks. The anti-babesial treatment administered
was recorded and the disease outcome followed.
123
DNA extraction
Filter paper portions, corresponding to approximately
20 µl of spotted blood, were cut out by use of individual
sterile scalpel blades and put into sterile tubes for DNA
extraction [43]. DNA was extracted by adding 300 µl of
lysis buffer [50 mM NaCl, 50 mM Tris, 10 mM EDTA (pH
8.0)], proteinase K to a final concentration of 250 µg/ml
and Triton X-100 (20%) to a final concentration of 1%.
Following a 2 h incubation at 56 ºC and an inactivation
of proteinase K at 90 ºC for 10 min, 300 µl of phenol
(75%), chloroform (24%) and isoamylalcohol (1%)
mixture were added, vortexed and centrifuged (12,000 x
g) for 4 min. The supernatant was collected and 300 µl of
a mixture of phenol (50%), chloroform (48%) and isoamylalcohol (2%) were added, vortexed and centrifuged
(12,000 x g) for 4 min. The supernatant was collected and
300 µl of a mixture of chloroform (96%) and isoamylalcohol (4%) were added, vortexed and centrifuged (12,000
x g) for 4 min. The supernatant was collected, and 1:10
volume of Na-acetate (3 M) and one volume of ice cold
100% isopropanol (–20 ºC) were added and incubated
over night at –20 ºC. Following centrifugation (14,000
x g) at 4 ºC for 30 min, the supernatant was discarded
and the pellet was washed with 150 µl of ethanol (75%,
–20 ºC) and centrifuged (13,000 x g 4 ºC) for 15 min.
The supernatant was discarded and the pellet was airdried. The DNA was then hydrated with 30 µl of doubledistilled H2O for 1 h at 50 ºC.
PCR assays for Babesia, Anaplasma/Ehrlichia,
Hepatozoon and Leishmania
Primers PIRO-A and PIRO-B (Table 1) were used to
amplify an approximate 408 bp fragment of the 18S
ribosomal RNA (rRNA) gene of Babesia spp. by PCR [44].
Amplification was done under the following conditions:
94 ºC for 1 min followed by 39 cycles of 94 ºC for 45 sec,
62 ºC for 45 sec and 72 ºC for 45 sec.
Primers EHR16SD and EHR16SR (Table 1) were used to
amplify an approximate 345 bp fragment of the Ehrlichia
and Anaplasma genera 16S rRNA gene [45]. PCR amplification was performed under the following conditions:
95 ºC for 5 min; 40 cycles of 94 ºC for 30 sec, 55 ºC for
30 sec and 72 ºC for 90 sec; then final extension at 72 ºC
for 5 min [46].
PCR for the detection of Hepatozoon was performed using
primers (125 nM each) HEP-F and HEP-R [47,48] (Table
1). The following conditions were used to amplify a partial 666 bp fragment of the 18S rRNA gene sequence of
Hepatozoon spp.: 95 ºC for 5 min; 35 cycles of 95 ºC for
20 sec, 57 ºC for 30 sec and 72 ºC for 90 sec; and 72 ºC
for 5 min. PCR was performed using Syntezza PCR-Ready
High Specificity (Syntezza Bioscience, Israel).
A 265 bp fragment within the internal transcribed spacer
1 (ITS1) region of the L. infantum rRNA operon was
124
amplified by real-time PCR using the primers ITS-219F
and ITS-219R (Table 1) and then evaluated by high
resolution melt (HRM) analysis [49]. The PCR reaction
was performed in a total volume of 20 µl containing
5 µl DNA, 40 nM of each primer, 10 µl Thermo-start PCR
Master Mix (Thermo-start ABgene, Rochester, NY, USA),
0.6 µl 100-fold diluted SYTO9 (Invitrogen, Carlsbad, CA,
USA), and sterile, DNase/RNase-free water (Sigma, St.
Louis, MO, USA) using a Rotor-Gene 6000 real-time PCR
machine (Corbett Life Science). Initial denaturation for
15 min at 95 ºC was followed by 40 cycles of denaturation at 5 sec at 95 ºC per cycle, annealing and extension
for 30 sec at 57 ºC, and final extension for 1 sec at 76 ºC.
This was followed by a conventional melting step from 60
ºC to 95 ºC at 1 ºC/sec, after which the temperature was
slowly decreased from 90 to 50 ºC (1 ºC/sec) to allow
re-annealing. In the final step, HRM analysis was carried
out increasing the temperature from 75 ºC to 90 ºC at
0.4 ºC/sec increments [49].
Positive B. canis, E. canis, H. canis and L. infantum DNA
control samples from the blood of naturally infected
dogs negative by PCR for other pathogens, and negative
DNA controls from colony-bred dogs negative by PCR for
vector-borne pathogens were run with each corresponding PCR reaction.
Sequencing
DNA sequencing was performed at the Center for Genomics
Technologies, Hebrew University of Jerusalem. Obtained
DNA sequences were evaluated with ChromasPro software
version 1.33 and compared for similarity to sequences in
GenBank, using the BLAST program hosted by NCBI,
National Institutes of Health, USA (http://www.ncbi.nlm.
nih.gov).
Statistical analysis
The Chi-squared or Fisher’s exact tests were used to
compare proportions. Differences between independent
groups were analyzed with the Mann-Whitney U test [50].
Analyses were performed with SPSS 10.0 software for
Windows, with a probability (p) value < 0.05 as statistically significant.
Results
The 45 dogs suspected of having babesiosis consisted of
24 males and 21 females. Age was not determined for
seven dogs; in the remaining 38 animals it ranged from
2 months to 14 years (median value of 3.0 years [interquartile range: 1.1–4.8]). There were 28 dogs from nine
defined breeds and 16 mongrels; breed was not determined for one dog. The most represented breeds were
Podengo (n = 17) and the Brittany (n = 3).
The clinical signs found on physical examination in
39 dogs were: lethargy (n = 24; 62%), red urine (n = 19;
14
12
Cases (n)
10
8
6
4
2
0
Jan
Feb
Mar
Apr
May
Jun
Jul
Aug
Sep
Oct
Nov
Dec
Figure 1
Monthly distribution of canine babesiosis and of co-infection cases in 45 dogs from northeastern portugal
orange bars represent 36 cases of babesiosis with no co-infecting agents (Anaplasma/Ehrlichia, Hepatozoon or Leishmania). all 36 dogs infected solely
with Babesia had B. canis canis infection. blue bars represent nine cases of babesiosis with one or two concurrent infecting agents along with B. canis canis
(n = 8) or B. canis vogeli (n = 1), respectively.
49%), hyperthermia (n = 18; 46%), anorexia (n = 17;
44%), pale mucous membranes (n = 17; 44%), hypothermia (n = 9; 23%), yellow mucous membranes (n =
5; 13%), vomiting (n = 4; 10%), abdominal pain (n = 3;
8%), ataxia (n = 2; 5%), uterine discharge (n = 2; 5%),
cough (n = 1; 3%), gingival petechiae (n = 1; 3%) and
ocular discharge (n = 1, 3%). Blood tests showed that 26
(79%) out of 33 dogs were anaemic, with a HCT value
below the reference interval (37–55%). Data on physical
examination were not determined in six and HCT was
not evaluated in 12 out of the 45 dogs. Peripheral blood
smear evaluation showed intraerythrocytic piroplasms
morphologically compatible with B. canis (3–5 µm long
and mainly occurring in pairs or single ring shapes) in
41 (91%) of the 45 clinically suspected dogs. Presence of
other infective agents could not be confirmed by microscopy of blood smears. Those 41 dogs and the remaining
four suspected animals were all found positive for Babesia
spp. by PCR. Further sequence analysis revealed that
44 dogs (98%) were infected with B. canis canis (98–
100% relatedness to the GenBank closest sequence) and
one with B. canis vogeli (100% relatedness).
Results concerning the observation of large babesial parasites in smears, and PCR amplification with sequencing
of Babesia and co-infecting Anaplasma/Ehrlichia, Hepato-
zoon or Leishmania agents are shown in Table 2. Thirtysix dogs were found infected only with B. canis canis,
whereas co-infections were detected in nine dogs (20%).
Eight dogs were found infected with two vector-borne
agents: six dogs with B. canis canis and L. infantum; one
dog with B. canis canis and E. canis; and one dog with B.
canis canis and H. canis. Another dog was found infected
with three vector-borne organisms: B. canis vogeli, E. canis
and L. infantum. Overall, L. infantum was found in seven
dogs (16%), E. canis in two dogs (4%), and H. canis was
found in one (2%) out of the 45 dogs diagnosed with
babesiosis.
Monthly distribution of the 45 observed cases of canine
babesiosis was as follows: January (n = 2), February (n
= 6), March (n = 4), April (n = 1), May (n = 1), July (n
= 1), September (n = 1), October (n = 8), November (n
= 12) and December (n = 9). No cases were observed
during June or August. Co-infection cases were detected
in February, March, April, May, October and November
(Figure 1 and Table 3).
Ticks were detected on 22 dogs and tick identification
was performed in 10 of these animals. Dermacentor
spp. found on four dogs infected with B. canis canis,
and Ixodes spp. on four other dogs also infected with
B. canis canis. Rhipicephalus sanguineus was present on the
125
table 1
Primer sets for the PCR amplification and sequencing of vector-borne infective agents
used in the study
Agent
Primers
Reference(s)
Babesia spp.
PIRO-A: 5’-AAT ACC CAA TCC TGA CAC AGG G-3’
PIRO-B: 5’-TTA AAT ACG AAT GCC CCC AAC-3’
[44]
Anaplasma spp./
Ehrlichia spp.
EHR16SD: 5’-GGT ACC YAC AGA AGA AGT CC-3’
EHR16SR: 5’-TAG CAC TCA TCG TTT ACA GC-3’
[45,46]
Hepatozoon spp.
HEP-F: 5’-ATA CAT GAG CAA AAT CTC AAC-3’
HEP-R: 5’-CTT ATT ATT CCA TGC
TGC AG-3’
[47,48]
Leishmania spp.
ITS-219F: 5’- AGC TGG ATC ATT TTC CGA TG-3’
ITS-219R: 5’-ATC GCG ACA CGT TAT GTG AG-3’
[49]
table 2
comparison of results from blood smear examination, pcr and sequence analysis in
45 dogs suspected of babesiosis
percentage values refer to species or subspecies relatedness to the Genbank closest sequences.
Blood smear
Large piroplasms
Piroplasms not
found
PCR and sequencing
Co-infection
B. canis canis (98-100%)
Negative
32
B. canis canis (99-100%)
L. infantum (99-100%)
6
B. canis canis (99%)
E. canis (100%)
1
H. canis (99%)
1
B. canis vogeli (99%)
E. canis (100%) and
L. infantum (99%)
1
B. canis canis (100%)
Negative
4
dog found co-infected with B. canis vogeli, E. canis and
L. infantum. Another dog was co-infested with
Dermacentor spp. and R. sanguineus and infected with
B. canis canis. Ticks were not detected on 22 dogs
and information from one animal was not determined.
Twenty-two (50%) out of 44 dogs infected with B. canis
were found infested by ticks; and seven (78%) out of nine
dogs with co-infections had ticks.
Table 3 provides information on gender, breed, age, clinical
signs, HCT, detected vector-borne agents, presence of ticks
and month of sampling for the nine dogs found co-infect-
126
Dogs (n)
Babesia spp.
ed. Differences between HCT values in a group of eight coinfected (B. canis canis and L. infantum, E. canis or H. canis and
B. canis vogeli, L. infantum and E. canis) and another group
of 25 dogs not found co-infected (infected solely with B.
canis canis) were not statistically significant (Mann-Whitney
U test [MWU]; p = 0.449); the differences in HCT between
a group of five dogs co-infected with B. canis canis and
L. infantum and those 25 dogs not found co-infected were
also not significant (MWU; p = 0.504). The same was true
for age differences between eight co-infected and 30 dogs
not found co-infected (MWU; p = 0.971); and for differenc-
table 3
signalment, clinical signs and vector-borne agents in nine co-infected dogs
F: female; Hct: haematocrit (normal range: 37-55%); M: male; nd: not determined;
pMM: pale mucous membranes; ru: red urine;yMM: yellow mucous membranes.
*r. sanguineus.
Clinical signs
HCT (%)
Ticks
Month
Clinical
outcome
(imidocarb
treatment)
Agents
Gender
Breed
Age
(months)
B. canis
canis and
L. infantum
F
Dalmatian
72
ND
ND
NO
October
Recovered
M
Mongrel
02
Hyperthermia,
PMM, RU
20
Yes
November
Died
M
Mongrel
02
ND
10
Yes
November
Recovered
F
Mongrel
36
ND
40
Yes
February
Recovered
M
Mongrel
36
Hyperthermia,
RU
40
Yes
February
Recovered
M
Mongrel
ND
PMM, RU
15
Yes
March
Recovered
B. canis
canis and
H. canis
F
Podengo
47
Hyperthermia,
PMM, RU
25
Yes
May
Recovered
B. canis
canis and
E. canis
M
German
pointer
78
Anorexia,
hyperthermia,
lethargy, RU
40
No
March
Recovered
Podengo
36
Anorexia,
hypothermia,
lethargy, YMM
03
Yes*
April
Died
B. canis vogeli,
M
E. canis and
L. infantum
es between age in five dogs co-infected with B. canis canis
and L. infantum and in those 30 dogs solely infected with
B. canis canis (MWU; p = 0.409). No significant difference,
although close to significance, was observed when comparing the proportions of co-infected mongrel dogs (6/16;
37.5%) and that of co-infected defined breed animals
(3/28; 10.7%) (Fisher’s exact test; p = 0.053). Statistically
significant differences were not found upon comparison of
proportions of co-infected male (6/24; 25%) and co-infected female dogs (3/21; 14.3%); or co-infected dogs among
those infested with ticks (7/22; 31.6%) and co-infected
dogs among those with no ticks (2/22; 9.1%).
Of the 45 dogs diagnosed with babesiosis, four (9%)
died. Despite treatment with imidocarb dipropionate,
two dogs died (22%) out of the nine found co-infected
(Table 3). One of these animals was found infected with
B. canis vogeli, E. canis and L. infantum; and the other
one with B. canis canis and L. infantum. Two other dogs
with babesiosis were subject to euthanasia as requested
by their owners. Molecular analysis later revealed infection with B. canis canis in these two animals. Forty-one
dogs – including seven co-infected with B. canis canis and
L. infantum, E. canis or H. canis and 34 with single infection (only B. canis canis) – clinically recovered after treatment with imidocarb dipropionate.
Discussion
In this study, babesiosis in northern Portugal was found
to be caused predominantly by infection with B. canis
canis, with L. infantum as the most prevalent co-infecting
127
agent. Although ticks were found only on approximately
half the dogs with babesiosis, a considerable proportion
of the co-infected dogs were infested by ticks (78%). In
addition, canine babesiosis was diagnosed mainly from
October to March, when climate conditions favour the
activity of Dermacentor spp. ticks [38]. In agreement with
previous studies [34,36], molecular confirmation of the
presence of vector-borne pathogens in northern Portugal
has been reestablished for B. canis vogeli and E. canis. In
addition, to our best knowledge, this is the first report of
molecular identification of H. canis in dogs from northern
Portugal. Based on the observation of H. canis gamonts in
neutrophils, it had been previously assumed that H. canis
is the species involved in canine infection, but genetic characterization was not available at the species level [40].
Babesia canis canis was detected in 98% of the 45 cases of
canine babesiosis. This could be due to a higher prevalence of infected dogs or tick vectors in the study area,
in comparison to B. canis vogeli, or to its more virulent
nature. Due to the severity of clinical presentation, as
compared with the relatively milder signs induced by
B. canis vogeli [7], dogs infected with B. canis canis would
potentially be brought in more often for veterinary consultation [34]. No comparisons were done between the
dogs found infected with each one of the two subspecies
of B. canis, because there was only one animal found
infected with B. canis vogeli. An investigation of 164 Italian
dogs suspected of tick-borne disease found B. canis canis
in 34 and B. canis vogeli in 11 different cases [51]. This
same study showed that clinical cases with B. canis vogeli
infection did not present a homogenous clinicopathological pattern as observed in the clinical cases of infection
with B. canis canis. Furthermore, in these dogs from Italy,
B. canis vogeli infections were found in three puppies (1-2
months) associated with severe haemolytic anaemia (fatal
disease in one case) but with no reported concomitant
disease; in one other young dog with chronic renal failure;
and in four older dogs with leishmaniosis (n =1), immunosuppression (n = 2) or post splenectomy (n =1) [51].
In the present study, co-infection with L. infantum was
more prevalent (16%) than with E. canis (4%) or H. canis
(2%) among the 45 dogs with babesiosis. Due to relatively
lower parasite loads of Leishmania in the blood, compared
with other tissues, use of blood to assess infection with
Leishmania may have limited the sensitivity of detection;
however, the use of highly sensitive quantitative real time
PCR for Leishmania spp. in this study probably improved
the prospects of detection, when compared with conventional PCR assays [49,52]. In the present study, large babesial piroplasms were detected in blood smears of nearly
90% of the clinically suspected dogs further confirmed as
infected with B. canis canis or B. canis vogeli. Parasites were
not detected in the smears of four dogs found infected
128
with B. canis canis and diagnosed by PCR and sequencing.
Microscopy may lack sensitivity in dogs clinically suspected of babesiosis, possibly due to low parasitaemia [2,7].
The arthropods described as vectors of the detected
pathogens – D. reticulatus for B. canis canis; Phlebotomus
spp. for L. infantum; and R. sanguineus for B. canis vogeli,
E. canis, and H. canis – are present in northern Portugal
[37,39]. In this study, Dermacentor spp. were found on
dogs infected with B. canis canis and R. sanguineus on one
dog co-infected with B. canis vogeli and E. canis (and also
L. infantum). History of travel outside this area, where
canine leishmaniosis and babesiosis are endemic, was not
obtained for any of the dogs. This situation supports the
assumption that infections with Babesia, Leishmania and
the other vector-borne agents were acquired locally.
The only dog found infected with B. canis vogeli in our
study also had co-infection with E. canis and L. infantum.
It is possible that chronic subclinical or acute infection
with B. canis vogeli had been made clinically apparent by
these co-infections. We had previously detected one clinical case in a dog from northern Portugal infected with
B. canis vogeli concurrently with A. platys [36]. Babesia canis
vogeli and E. canis share the same vector species, i.e. R. sanguineus ticks. The co-infected dog may have been exposed
to arthropods infected with single pathogen species at different points in time or to vector(s) concurrently infected
with multiple agents [1]. Co-infections with Leishmania
and tick-borne organisms may affect the severity of CVBD
and the variety of associated clinical signs [53]. In a
study with beagle dogs naturally exposed to E. canis and
L. infantum, the frequency of clinical signs (lymphadenomegaly, splenomegaly, epistaxis, onychogryposis, dermatits and weight loss) was significantly different between
animals with dual infection and those with single infection [54]. However, the clinical signs of co-infections with
two or more vector-borne organisms are often difficult
to be specifically assigned to each one of the infecting
agents [55]. In the present study, although a complete
clinicopathological evaluation was not performed, especially blood cell counts, no significant differences among
HCT values were found between the co-infected dogs and
those with one single infection detected. Nevertheless,
dogs with co-infections had a lower survival rate when
compared to those with single infection. In fact, two dogs
(22%) died out of the nine found co-infected: one with
B. canis vogeli, E. canis and L. infantum, and the other one
with B. canis canis and L. infantum infection. From the 36
dogs found infected only with B. canis canis, two (6%)
were euthanized and the remaining 34 animals (94%)
clinically recovered with the anti-babesial treatment.
Another study in rural and hunting dogs (n = 473), from
northeastern Portugal, showed a 15% seroprevalence of
antibodies to E. canis, and a 2% prevalence of Hepatozoon
spp. in blood smears [40]. Six dogs were simultaneously found to be seropositive for E. canis and positive
for Hepatozoon spp., but PCR did not detect Ehrlichia or
Anaplasma in any of those animals. Nevertheless, E. canis
DNA was sequenced from four other dogs, thus revealing
a 0.9% prevalence of infection. No babesial piroplasms
were found in blood smears from all the dogs included in
the same study. The differences between these prevalence
rates for E. canis, as detected by molecular methods, and
piroplasms and those observed in the present study may
be explained by a different sample population and the
methods used. In fact, only 10% of the dogs studied by
Figueiredo [40] were clinically suspected of bacterial or
protozoal diseases, and infection with Babesia spp. was not
assessed molecularly by this author, whereas all the dogs
in the present study were positive to Babesia spp. and thus
exposed to at least one species of tick-borne pathogen.
In this study, two littermates aged two months old were
both found co-infected with B. canis canis and L. infantum.
This finding could suggest the possibility of transplacental transmission of L. infantum [56] and/or B. canis canis
[57]. However, both puppies were found infested with
ticks (species not identified), which should be regarded
as the most likely source of transmitting Babesia to them.
Regarding infection with Leishmania, these animals were
born in early October and transmission by phlebotomine
sand flies should still be considered [37]. Data on physical examination were not available for one of the dogs.
The other dog presented hyperthermia, pale mucous
membranes and red urine, which could be attributed to B.
canis canis infection. Both animals suffered from anaemia,
and one of the dogs died. It is not clear whether infection
with L. infantum contributed to the clinical abnormalities
in these two puppies and whether they were suffering
from pathological effects of infection with Leishmania.
Other tests, including serological analysis for antibodies
to Leishmania, complete blood count, serum biochemistry
panel and urinalysis, could have been helpful in clarifying the clinical status of these two and of the other seven
co-infected dogs as well [58]. In general, the incubation
period of canine babesiosis is short (4-21 days) [3], while
the incubation of canine leishmaniosis is much longer (2
months to several years) [59].
The trend of canine babesiosis seasonality found in
the present study is further strengthened by results
from an additional study (Diz-Lopes D, Rodrigues
FT: Babesiose canina – estudo clínico no Nordeste
Transmontano [unpublished abstract]. V Congresso
Veterinário Montenegro: 17-18 January 2009; Porto). A
higher occurrence of disease was found during October
and November (21 cases during each month) in 98 dogs
from northeastern Portugal diagnosed with babesiosis by
clinical examination and by observation of intraerythro-
cytic large piroplasms, from January 2005 to December
2008. Considerable numbers of canine babesiosis cases
were also found from December to May, with monthly
values ranging between 6% and 11%. Sixty-two per
cent of all the cases were detected in hunting dogs, and
52% of all the affected animals were Podengo dogs
(Diz-Lopes D, Rodrigues FT: Babesiose canina – estudo clínico no Nordeste Transmontano [unpublished
abstract]. V Congresso Veterinário Montenegro: 17-18
January 2009; Porto). In the present study, it was found
that approximately 90% of the 45 cases of babesiosis in
dogs from northern Portugal were diagnosed in October
(18%), November (27%), December (20%), February
(13%) and March (9%), i.e. autumn and winter months.
In central Europe, the occurrence of canine babesiosis
due to B. canis has been found to change in an annual
seasonal pattern, although exact time of beginning and
ending of Dermacentor spp. activity is strongly correlated
with specific local climate conditions [60]. In fact, epidemiological and clinical surveillance studies are needed
for mapping the risk of babesiosis and other CVBD in different geographical regions.
A study in urban and rural dogs (n = 651) from
Hungary revealed a 6% seropositivity to B. canis [61].
Seroprevalence to B. canis was significantly different for
German shepherd and Komondor dogs, suggesting a
genetic predisposition to chronic subclinical infection
(carrier state) with long-term maintenance of seropositivity. A higher prevalence of specific antibodies in three out
of four Komondors, a local breed, was explained by an
increased risk of them having unnoticed ticks attached
to their heavy hair coat [61]. In the present study,
B. canis canis was found in males and females, younger
and older dogs, from nine defined breeds and particularly
from mongrels. There was no clear distinction of age and
sex between single-infected and co-infected dogs. When
comparing the proportions of co-infected mongrel dogs
(~38%) and that of co-infected defined breed animals
(~11%), there was a quantitative but not significant
difference. Mongrels, Podengo and Brittany dogs represented the larger part of those found affected by babesiosis. Rather than a genetic or breed predisposition, this
situation probably reflects the fact that these dog breeds
and crosses are popular and over-represented in northern
Portugal. Furthermore, a considerable percentage of these
dogs live outdoors and are used for hunting activities in
the field, where they face a higher risk of contacting with
infected arthropod vectors.
Theleria annae may cause severe illness in dogs, including
renal failure, and is endemic in northwestern Spain [21],
which borders part of the area where the present study was
carried out. To our knowledge, there are no written reports
of autochthonous canine T. annae infection in Portugal.
129
Nevertheless, due to the increasing mobility of dogs and
the existence of competent or presumptive vectors, piroplasms may spread into non-endemic areas [1,2].
References
conclusions
2.
In conclusion, this study confirmed the presence of
B. canis canis and B. canis vogeli as agents of babesiosis
in dogs from northern Portugal, with a large majority
of the clinical cases found with the former piroplasm.
A higher sensitivity of Babesia spp. detection was obtained
by use of PCR assays, compared to microscopy of blood
smears. Co-infections with some other vector-borne agents
were also detected and molecularly characterized, namely
L. infantum, E. canis and H. canis. Detection and identification of species and subspecies of pathogens, either in
single or in co-infection, are necessary for the treatment,
clinical management and prevention of CVBD.
competing interests
The authors declare that they have no competing interests.
1.
3.
4.
5.
6.
7.
8.
Authors’ contributions
Conceived and design the study: LC, YYM and GB.
Collected and characterized clinical samples: FTR, AC,
JM and DDL. Performed PCR and genetic analysis: YYM.
Analyzed data, drafted and revised the manuscript: LC
and GB. All authors gave final approval of the version to
be submitted.
Acknowledgements
The authors thank Dr. Joana Tuna and Dr. Lisete Vieira,
from Clínica Veterinária Os Bichos, Dr. Dalit Talmi-Frank,
from the Hebrew University, and the Board and the Staff
of the Veterinary Teaching Hospital, University of Trás-osMontes e Alto Douro, for their assistance. Publication of
the thematic series has been sponsored by Bayer Animal
Health GmbH.
9.
10.
11.
12.
Parasites & Vectors 2010, 3:27
(http://www.parasitesandvectors.com/content/3/1/27)
The original article is published as an open access article
distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/
by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work
is properly cited.
130
13.
14.
otranto d, dantas-torres F, breitschwerdt Eb: Managing canine vectorborne diseases of zoonotic
concern: part one. Trends Parasitol 2009, 25:157-163
otranto d, dantas-torres F, breitschwerdt Eb: Managing canine vectorborne diseases of zoonotic
concern: part two. Trends Parasitol 2009, 25:228-235
boozer al, Macintire dK: canine babesiosis. Vet
Clin Small Anim 2003, 33:885-904.
lobetti rG: canine babesiosis. Compend Cont Educ
Pract Vet 1998, 20:418-431.
bourdoiseau G: canine babesiosis in France.
Vet Parasitol 2006, 138:118-125.
brandão lp, Hagiwara MK, Myiashiro si: Humoral
immunity and reinfection resistance in
dogs experimentally inoculated with Babesia canis and either treated or untreated
with imidocarb dipropionate. Vet Parasitol 2003,
114:253-265.
irwin p: canine babesiosis: from molecular
taxonomy to control. Parasites Vect 2009,
2(suppl 1):s4.
uilenberg G, Franssen FFJ, perie M, spanjer aMM:
three groups of Babesia canis distinguished
and a proposal for nomenclature. Vet Q 1989,
11:33-40.
Zahler M, schein E, rinder H, Gothe r: characteristic genotypes discriminate between Babesia
canis isolates of differing vector specificity
and pathogenicity to dogs. Parasitol Res 1998,
84:544-548.
cacciò sM, antunovic b, Moretti a, Mangili V, Marinculic
a, baric rr, slemenda sb, pieniazek nJ: Molecular
characterisation of Babesia canis canis and
Babesia canis vogeli from naturally infected
european dogs. Vet Parasitol 2002, 106:285-292.
solano-Gallego l: Update on canine babesiosis:
the european perspective. in Proceedings of the
4th Symposium of the CVBD World Forum: 25-28 March
2009; seville. Edited by bayer animal Health. leverkusen:
30-33.
Matjila tp, penzhorn bl, bekker cpJ, nijhof aM, Jongejan F: Confirmation of occurrence of Babesia
canis vogeli in domestic dogs in South Africa.
Vet Parasitol 2004, 122:119-125.
inokuma H,yoshizaki y, Matsumoto K, okuda M, onishi
t, nakagome K, Kosugi r, Hirakawa M: Molecular
survey of Babesia infection in dogs in okinawa, Japan. Vet Parasitol 2004, 121:341-346.
Jefferies r, ryan uM, Muhlnickel cJ, irwin pJ: two
species of canine Babesia in Australia:
detection and characterization by PcR.
J Parasitol 2003, 89:409-412.
15. birkenheuer aJ, correa Mt, levy MG, breitschwerdt Eb:
Geographic distribution of babesiosis among
dogs in the United States and association
with dog bites: 150 cases (2000-2003). J Am Vet
Med Assoc 2005, 227:942-947.
16. Passos LMF, Geiger SM, Ribeiro MFB, Pfister K,
Zahler-rinder M: First molecular detection of
Babesia vogeli in dogs from Brazil. Vet Parasitol
2005, 127:81-85.
17. sasaki M, omobowale o, tozuka M, ohta K, Matsuu a,
nottidge Ho, Hirata H, ikadai H, oyamada t: Molecular survey of Babesia canis in dogs in nigeria.
J Vet Med Sci 2007, 69:1191-1193.
18. birkenheuer aJ, neel J, ruslander d, levy MG,
breitschwerdt Eb: Detection and molecular
characterization of a novel large Babesia
species in a dog. Vet Parasitol 2004, 124:151-160.
19. sikorski lE, birkenheuer aJ, Holowaychuk MK, Mccleary-Wheeler al, davis JM, littman Mp: Babesiosis
caused by a large Babesia species in 7 immunocompromised dogs. J Vet Intern Med. [Epub ahead
of print].
20. Zahler M, rinder H, schein E, Gothe r: Detection
of a new pathogenic Babesia microti-like
species in dogs. Vet Parasitol 2000, 89:241-248.
21. camacho-García at: Piroplasma infection in dogs
in northern Spain. Vet Parasitol 2006, 138:97-102.
22. criado-Fornelio a, Gónzalez-del-río Ma, buling-saraña
a, barba-carretero Jc: Molecular characterization of a Babesia gibsoni isolate from a Spanish dog. Vet Parasitol 2003, 117:123-129.
23. Hartelt K, rieker t, oehme rM, brockmann so, Müller
W, dorn n: First evidence of Babesia gibsoni
(Asian genotype) in dogs in Western europe.
Vector Borne Zoonotic Dis 2007, 7:163-166.
24. Beck R,Vojta L, Mrljak V, Marinculić A, Beck A, Živičnjak
t, cacciò sM: Diversity of Babesia and Theileria
species in symptomatic and asymptomatic
dogs in croatia. Int J Parasitol 2009, 39:843-848.
25. yeagley tJ, reichard MV, Hempstead JE, allen KE, parsons
lM, White Ma, little sE, Meinkoth JH. Detection of
Babesia gibsoni and the canine small Babesia
‘Spanish isolate’ in blood samples obtained
from dogs confiscated from dogfighting
operations. J Am Vet Med Assoc 2009, 235:535-539.
26. trapp sM, Messick Jb,Vidotto o, Jojima Fs, de Morais
Hs: Babesia gibsoni genotype Asia in dogs
from Brazil. Vet Parasitol 2006, 141:177-180.
27. Muhlnickel cJ, Jefferies r, Morgan-ryan uM, irwin pJ:
Babesia gibsoni infection in three dogs in
Victoria. Aust Vet J 2002, 80:606-610.
28. Kjemtrup aM, Wainwright K, Miller M, penzhorn bl,
carreno ra: Babesia conradae, sp. nov., a
small canine Babesia identified in California.
Vet Parasitol 2006, 138:103-111.
29. criado-Fornelio a, Martinez-Marcos a, buling-saraña a,
barba-carretero Jc: Molecular studies on Babesia, Theileria and Hepatozoon in southern
europe. Part I. epizootiological aspects.
Vet Parasitol 2003, 113:189-201.
30. criado a, Martinez J, buling a, barba Jc, Merino s, Jefferies r, irwin pJ: new data on epizootiology and
genetics of piroplasms based on sequences
of small ribosomal subunit and cytochrome
b genes. Vet Parasitol 2006, 142:238-247.
31. Matjila pt, leisewitz al, oosthuizen Mc, Jongejan F,
penzhorn bl: Detection of a Theileria species in
dogs in South Africa. Vet Parasitol 2008, 157:34-40.
32. Gray Js, dautel H, Estrada-peña a, Kahl o, lindgren E:
effects of climate change on ticks and tickborne diseases in europe. Interdiscip Perspect Infect
Dis, 2009:593232. [Epub ahead of print].
33. diz-lopes d, rodrigues Ft, alves s, santos-silva M:
Babesiose em cão de Gado transmontano.
Vet Tec 2005, 11(set/out):36.
34. cardoso l, costa a, tuna J,Vieira l, Eyal o,yisascharMekuzas y, baneth G: Babesia canis canis and
Babesia canis vogeli infections in dogs from
northern Portugal. Vet Parasitol 2008, 156:199-204.
35. abranches p, sampaio-silva Ml, santos-Gomes GM,
avelino ic, conceição-silva FM, seixas-lopes a, silvapereira Mcd, Janz JG: Kalaazar in Portugal. VII.
epidemiological survey in Alijó (endemic
region of Alto-Douro). Res Rev Parasitol 1992,
52:121-124.
36. cardoso l, tuna J,Vieira l,yisaschar-Mekuzas y, baneth
G: Molecular detection of Anaplasma platys
and Ehrlichia canis in dogs from the north of
Portugal. Vet J 2008, 183: 232-233.
37. alves-pires c, ribeiro H: the phlebotomine
sandflies of Portugal. V. Observations on the
ecology of the vectors of leishmaniasis in the
Alto Douro region. Parassitologia 1991, 33(suppl
1):63-68.
38. caeiro VMp: As carraças em Portugal: seus
hospedeiros domésticos e silvestres. ciclos
vitais, preferências de vegetação e clima.
Med Vet 1992, 28:7-25.
39. santos-silva M, sousa r, santos as, lopes d, Queijo
E, doreta b,Vitorino l, bacellar F: ticks and tickborne rickettsiae surveillance in Montesinho
natural Park, Portugal. Ann NY Acad Sci 2006,
1078:137-142.
40. Figueiredo tcd: estudo da prevalência de
doenças associadas a vectores em canídeos
domésticos do distrito de Bragança. MSc
dissertation. lisbon university, Faculty of Medicine; 2008.
41. shaw sE, day MJ, birtles rJ, breitschwerdt Eb: tickborne infectious diseases of dogs. Trends
Parasitol 2001, 17:74-80.
131
42. baneth G, samish M, shkap V: Life cycle of Hepatozoon canis (Apicomplexa: Adelorina: Hepatozoidae) in the tick Rhipicephalus sanguineus
and domestic dog (Canis familiaris). J Parasitol
2007, 93:283-299.
43. strauss-ayali d, Jaffe cl, burshtain o, Gonen l, baneth
G: Polymerase chain reaction using noninvasively obtained samples, for the detection of
Leishmania infantum DnA in dogs. J Infect Dis
2004, 189:1729-1733.
44. olmeda as, armstrong pM, rosenthal bM,Valladares b,
del castillo a, de armas F, Miguelez M, Gonzalez a,
rodriguez, Ja, spielman a, telford sr: A subtropical
case of human babesiosis. Acta Trop 1997,
67:229-234.
45. Brown GK, Canfield PJ, Dunstan RH, Roberts TK, Martin
ar, brown cs, irving r: Detection of Anaplasma
platys and Babesia canis vogeli and their
impact on platelet numbers in free-roaming
dogs associated with remote Aboriginal
communities in Australia. Aust Vet J 2006, 84:
321-325.
46. Gal a, loeb E,yisaschar-Mekuzas y, baneth G: Detection of Ehrlichia canis by PcR in different tissues obtained from dogs surveyed for naturally occurring canine monocytic ehrlichiosis.
Vet J 2008, 175:212-217.
47. inokuma H, okuda M, ohno K, shimoda K, onishi t:
Analysis of the 18S rRnA gene sequence of a
Hepatozoon detected in two Japanese dogs.
Vet Parasitol 2002, 106:265-271.
48. rubini as, paduan Ks, cavalcante GG, ribolla pE,
o’dwyer lH: Molecular identification and
characterization of canine Hepatozoon
species from Brazil. Parasitol Res 2005, 97:91-93.
49. talmi-Frank d, nasereddin a, schnur lF, schönian G,
Özensoy s, Jaffe cl, baneth G: Detection and
identification of Old World Leishmania by
high resolution melt analysis. PLoS Negl Trop Dis
2010, 4:e581.
50. petrie a, Watson p: Statistics for Veterinary and Animal
Science. oxford: blackwell; 1999.
51. solano-Gallego l, trotta M, carli E, carcy b, caldin M,
Furlanello t: Babesia canis canis and Babesia
canis vogeli clinicopathological findings and
DnA detection by means of PcR-RFLP in
blood from Italian dogs suspected of tickborne disease. Vet Parasitol 2008, 157:211-221.
52. Francino o, altet l, sánchez-robert E, rodriguez a,
solano-Gallego l, alberola J, Ferrer l, sánchez a, roura
X: Advantages of real-time PcR assay for
diagnosis and monitoring of canine leishmaniosis. Vet Parasitol 2006, 137:214-221.
132
53. tabar Md, Francino o, altet l, sánchez a, Ferrer l,
roura X: PcR survey of vectorborne pathogens in dogs living in and around Barcelona,
an area endemic for leishmaniosis. Vet Rec
2009, 164:112-116.
54. Mekuzas y, Gradoni l, oliva G, Foglia Manzillo V, baneth
G: Ehrlichia canis and Leishmania infantum
co-infection: a 3-year longitudinal study in
naturally exposed dogs. Clin Microbiol Infect, 2009
Mar 26. [Epub ahead of print].
55. Kordick sK, breitschwerdt Eb, Hegarty bc, southwick
Kl, colitz cM, Hancock si, bradley JM, rumbough r,
Mcpherson Jt, Maccormack Jn: coinfection with
multiple tick-borne pathogen in a Walker
Hound kennel in north carolina. J Clin Microbiol
1999, 37:2631-2638.
56. rosypal ac, troy Gc, Zajac aM, Frank G, lindsay ds:
transplacental transmission of a north
American isolate of Leishmania infantum in
an experimentally infected beagle. J Parasitol
2005, 91:970-972.
57. Fukumoto s, suzuki H, igarashi i, Xuan X: Fatal experimental transplacental Babesia gibsoni
infections in dogs. Int J Parasitol 2005, 35:1031-1035.
58. Miró G, cardoso l, pennisi MG, oliva G, baneth G:
canine leishmaniosis – new concepts and
insights on an expanding zoonosis: part two.
Trends Parasitol 2008, 24:371-377.
59. slappendel r: canine leishmaniasis. A review
based on 95 cases in the netherlands. Vet Q
1988, 10:1-16.
60. leschnik M, Kirtz G, tichy a, leidinger E: Seasonal
occurrence of canine babesiosis is influenced
by local climate conditions. Int J Med Microbiol
2008, 298(s1):243-248
61. Hornok s, Edelhofer r, Farkas r: Seroprevalence
of canine babesiosis in Hungary suggesting
breed predisposition. Parasitol Res 2006, 99:
638-642.
133
Parasites & Vectors, edited by chris
arme, is an open access, peer-reviewed
online journal dealing with the biology of
parasites, parasitic diseases, intermediate
hosts and vectors. articles published in
this journal are available with no subscription charges or barriers to access,
and authors retain the copyright of their
material and may use it, or distribute it,
as they wish.
www.parasitesandvectors.com
eXPeRIMentAL InFectIon AnD co-InFectIon
oF DoGS WItH ANAPLASMA PLATYS AnD EHRLICHIA
CANIS: HeMAtoLoGIc, SeRoLoGIc AnD MoLecULAR FInDInGS
stEpHan d Gaunt1, MElissa J bEall2*, brEtt a stillMan2, lEiF lorEntZEn2, pEdro pVp diniZ3,
raMasWaMy cHandrasHEKar2, EdWard b brEitscHWErdt4
louisiana statE uniVErsity, scHool oF VEtErinary MEdicinE, baton rouGE, la, usa
idEXX laboratoriEs, inc. WEstbrooK, ME, usa
3
WEstErn uniVErsity, collEGE oF VEtErinary MEdicinE, poMona, ca, usa
4
nortH carolina statE uniVErsity, collEGE oF VEtErinary MEdicinE, ralEiGH, nc, usa
1
2
*corrEspondinG autHor
EMail addrEssEs:
MELISSA-BEALL@IDEXX.COM • ED_BREITSCHWERDT@NCSU.EDU
Abstract
Background
Rhipicephalus sanguineus is a ubiquitous tick responsible for transmitting Ehrlichia canis and most likely Anaplasma
platys to dogs, as either single or co-infections. the objective of this study was to assess the effects of either simultaneous or sequential experimental infections with E. canis and A. platys on hematological and serological parameters,
duration of infection, and efficacy of doxycycline therapy in dogs infected with one or both organisms. Six dogs per
group were either uninfected, A. platys infected, E. canis infected, A. platys and E. canis co-infected, A. platys infected and
E. canis challenged or E. canis infected and A. platys challenged at day 112 post-infection (pi). doxycycline treatment
was initiated at 211 days pi, followed by dexamethasone immunosuppression beginning 410 days pi.
Results
initially, transient decreases in hematocrit occurred in all groups infected with E. canis, but the mean hematocrit
was significantly lower in the A. platys and E. canis co-infected group. all dogs except the controls developed marked
thrombocytopenia after initial infection followed by gradually increased platelet counts by 112 days pi in groups with
the single infections, while platelet counts remained significantly lower in the A. platys and E. canis co-infected group.
both sequential and simultaneous infections of A. platys and E. canis produced an enhanced humoral immune response
to A. platys when compared to infection with A. platys alone. likewise, co-infection with E. canis and A. platys resulted in
a more persistent A. platys infection compared to dogs infected with A. platys only, but nearly all A. platys infected dogs
became A. platys pcr negative prior to doxycycline treatment. E. canis infected dogs, whether single or co-infected,
remained thrombocytopenic and E. canis pcr positive in blood for 420 days. When treated with doxycycline, all
E. canis infected dogs became E. canis pcr negative and the thrombocytopenia resolved. despite immunosuppression,
neither A. platys nor E. canis DNA was PCR amplified from doxycycline-treated dogs.
conclusion
the results of this study demonstrate that simultaneous or sequential infection with A. platys and E. canis can alter
various pathophysiological parameters in experimentally infected dogs, and because natural exposure to multiple
tick-borne pathogens occurs frequently in dogs, awareness of co-infection is important in clinical practice.
134
Background
Ehrlichia canis is a Gram-negative, obligate intracellular bacterium which infects monocytes and is the primary causative agent of canine monocytic ehrlichiosis
[1]. Rhipicephalus sanguineus transmits E. canis to dogs
both transtadially and intrastadially [2]. Canine infections caused by E. canis are more commonly reported
in the southern regions of the United States, however
R. sanguineus is distributed throughout the country [3].
Experimentally, infection with E. canis results in acute,
subclinical and chronic disease stages with dogs having
a variety of clinical signs and laboratory abnormalities
including fever, lethargy, lameness, oculonasal discharge,
thrombocytopenia, non-regenerative anemia, leukopenia,
hyperglobulinemia and proteinuria during various stages
of infection. Often, chronic infection with E. canis will go
unrecognized because infected dogs appear healthy until
late in the infection when pancytopenia, uveitis, weight
loss and hemorrhagic disorders arise, and a diagnosis of
ehrlichiosis is made [1].
Canine cyclic thrombocytopenia is caused by Anaplasma
platys, a Gram-negative, obligate intracellular bacterium
that infects platelets [1]. The dog is the primary reservoir
host for A. platys and to date, this organism has not been
shown to infect humans. A. platys is likely transmitted by
the R. sanguineus tick, however experimental infection
studies have not conclusively demonstrated transmission [4]. A. platys infections are often found in the same
geographic regions as E. canis and evidence of exposure
to or infection with both organisms is often detected
in the same dog [5-8]. Both organisms are found on all
continents throughout the world, but are more prevalent
in tropical and subtropical climates [2, 9]. Case reports
and case series, incorporating PCR-based modalities
have confirmed co-infections with E. canis and A. platys
[8, 10]. Experimentally, A. platys infections cause a cyclic
thrombocytopenia that may be severe enough to result in
bleeding, including petechiae and ecchymoses, but most
dogs are thought to control the infection immunologically [1].
Given that E. canis and A. platys likely share the same tick
vector, R. sanguineus, dogs may become infected with both
organisms, either simultaneously or sequentially. Most
dogs infested with R. sanguineus have numerous attached
ticks. The clinical impact of an E. canis and A. platys coinfection on the pathophysiology of disease in dogs has
not been thoroughly investigated. A previous study has
shown that naturally infected clinically ill dogs, suspected
of having either Lyme disease, granulocytic anaplasmosis,
or both diseases, were nearly twice as likely to have antibodies to both Borrelia burgdorferi and A. phagocytophilum
as compared to healthy dogs from the same region, suggesting that exposure to more than one pathogen may
increase the likelihood of disease expression [11]. The
objective of this study was to assess the effects of either
simultaneous or sequential infections with E. canis and
A. platys on hematological and serological parameters,
the duration of infection, and the comparative efficacy of
doxycycline therapy in the dogs infected with one or both
organisms.
Methods
Inoculum
An A. platys isolate originating from blood of a dog with
uveitis, thrombocytopenia and morulae in platelets was
used to infect dogs in this study [12]. Several prior experimental infections of dogs with this isolate have been
reported [13, 14]. For the inoculum, blood from a splenectomized dog inoculated with this A. platys isolate 10
days before was collected into 3.8% citrate. Platelet-rich
plasma was prepared, 10% DMSO added, and 2 mL aliquots were stored in liquid nitrogen until administration.
The number of platelets containing A. platys inclusions or
morulae in this platelet-rich plasma was approximately
35%: After storage of less than 6 months, the vials were
thawed to ambient temperature and the entire 2 mL aliquot was administered within 1 hour into the cephalic
vein of each dog.
The E. canis isolate originated from the blood of a different dog in Louisiana with fever and thrombocytopenia.
Experimental canine infections, using this culture grown
isolate in canine histiocytic cells, were described in two
previous studies [15, 16]. The E. canis infected cells were
harvested after approximately 5 days of in vitro growth
when > 80% of cells contained ehrlichial inclusions as
judged by a Wright-stained cytocentrifuged smear. Ten
percent DMSO was added to a suspension of the cultured
E. canis-infected DH82 cells, after which 2 mL aliquots
were stored in liquid nitrogen for less than 12 months. At
the time of inoculation, the vials were thawed to ambient
temperature and the 2 mL aliquot administered through
the cephalic vein of each dog within 1 hour of thawing.
Dogs
Six month old, female hound-type dogs were inoculated
intravenously with A. platys and/or E. canis organisms. Six
groups of six dogs each were evaluated: non-infected controls, A. platys infected (A), E. canis infected (E), A. platys
and E. canis co-infected (A+E), A. platys infected followed
by administration of E. canis 112 days later (AE), and
E. canis infected followed by administration of A. platys
112 days later (EA). Doxycycline treatment (10mg/kg
PO daily for 28 days) was administered to half the dogs
in each group beginning at 211 days post-infection (PI).
To assess treatment efficacy, all dogs were subsequently
immunosuppressed by administering dexamethasone
0.3mg/kg IM daily for 5 days beginning at day 410 of the
study. The timing of the challenge infection, administra-
135
tion of doxycycline, and dexamethasone immunosuppression was chosen based upon stabilization of platelet
counts for infected dogs and the findings of a previous
experimental infection using this isolate of E. canis [17].
The study duration was 485 days for all groups.
Whole blood and serum were collected at twice weekly,
weekly or every other week intervals for 15 months after
infection. Aspirates of the popliteal or prescapular lymph
nodes were obtained pre- and post-immunosuppression
(day 400 and 414, respectively), while bone marrow
samples were obtained as aspirates collected from the
iliac crest using a 16 gauge Osgood marrow needle and
aseptic technique post-immunosuppression (day 414).
Physical exams that included rectal temperatures, were
performed twice weekly for six weeks following each
inoculation and weekly thereafter. The dogs were housed
indoors in climate-controlled kennels at a facility accredited by the American Association for Laboratory Animal
Science. The study was approved by the Institutional
Animal Care and Use Committee (protocol #06-52) at
Louisiana State University.
Hematology
Blood was collected into 2 mL vacutainer tubes containing potassium EDTA and then quickly inverted to avoid
platelet clumping. Blood samples were analyzed within 3
hours of collection using a Bayer Advia 120 to measure
hematocrit, mean cell volume (MCV), mean platelet volume (MPV), and platelet and total leukocyte concentrations. Prior to analysis, each blood sample was inspected
for clots; any sample with visible clots was discarded and
another blood sample collected. Wright-stained blood
smears were also prepared from these blood samples
and reviewed for platelet aggregation. Quality control
procedures for the hematology instrument included daily
intralab control reagents, monthly participation in the
Bayer CHECKpoint Interlab QC Program, and quarterly
participation in external assurance program offered by the
Veterinary Laboratory Association.
Serology
All serum samples through day 420 were tested for antibodies to E. canis and A. platys using the Canine SNAP®
4Dx® Test kit (IDEXX Laboratories, Inc., Westbrook, ME)
according to the product insert. This multivalent ELISA
(enzyme-linked immunosorbent assay) uses synthetic
peptide reagents to independently detect serum antibodies to Anaplasma spp. (e.g. A. platys, A. phagocytophilum) and to E. canis. Following addition of test serum
and development of the color reaction, the intensity of
the color was semiquantitated by densitometry (RCP
Densitometer, Tobias Associates, Ivyland, PA). The difference in optical density (OD) between the test spot
136
color reaction and the white background on the test strip
(blank) was recorded as a relative OD between 0.0 and
1.0. Although the test is not licensed for semiquantitative interpretation, a previous study has demonstrated a
positive correlation between the optical density of the
E. canis test spot and the inverse IFA titer for E. canis in
dogs experimentally infected with E. canis [18].
Polymerase Chain Reaction (PCR) Testing
Molecular evidence of infection was assessed by two
independent laboratories. The first laboratory (IDEXX
Laboratories, Westbrook, ME) performed real-time PCR
on whole blood collected throughout the study (Days
0-154, 183, 218, 246, 275, 303, 400, 414, 420), lymph
node aspirates collected pre- and post-immunosuppression, and bone marrow collected post-immunosuppression. Whole blood samples (200µl) were processed for
DNA (100µl elution volume) using an automated system
(MagNA Pure, Roche) while DNA from bone marrow
and lymph node aspirates was extracted manually using a
commercially available kit (HighPure Kit, Roche) according to the product insert.
A real-time PCR, hybridization probe assay was
developed to detect an A. platys p44 polynucleotide
[GenBank:GP282016] from genomic DNA [19]. Realtime PCR was performed using a LightCycler 480 genotyping master mix (Roche) in a 20ul volume reaction
with 5ul of template DNA. Primers (Table 1) were used
at a concentration of 0.3µM for the forward primer and
0.6µM for the reverse primer. Both probes were used at
a concentration of 0.3µM. PCR was performed under the
following conditions: a single hot-start cycle at 95°C for
10 minutes followed by 50 cycles of denaturation at 95°C
for 30 seconds, annealing at 58°C for 20 seconds, and
extension at 72°C for 10 seconds. A melting curve was
performed by heating the PCR product to 95°C for 1 minute, cooling to 45°C for one minute, and then gradually
heating to 80°C. Positive samples were identified from
the software as having both positive crossing points and
a melting curve temperature of 66.5°C +/-1°C. Analytical
sensitivity was determined to be at least 10 gene copies
per reaction in negative canine genomic DNA based on
serial dilutions of the control plasmid. The A. platys p44
PCR detected strains of A. platys from across the US, the
Caribbean and Brazil. The A. playts p44 PCR did not detect
A. phagocytophilum p44 DNA from a control plasmid containing the A. phagocytophilum p44 template or A. phagocytophilum PCR-positive field samples.
An Ehrlichia spp. real-time PCR targeting the groEL gene
of three Ehrlichia species [GenBank: U96731 (E. canis),
AF195273 (E. ewingii), L10917 (E. chaffeensis)] was developed based on published primers [20], however using a
hydrolysis probe format. Real-time PCR was performed
table 1
primers and probes used for the a. platys (apl) and Ehrlichia spp. (Ehr) pcr assays [19, 20].
Name
Sequence (5’ to 3’)
Apl forward primer
CCGGCGTTTAGTAAGATAAATG
Apl reverse primer
GCAAATTTAACGATCTCCGCC
Apl probe 1 FITC
ACAGTATCGGGGTAGCGAGAGTAGAA
Apl probe 2 LC670
GGAGATCGGCTATGAACAGTTCAAGAC
Ehr1 forward primer
CAGAGTGCTTCTCAGTGTAACGA
Ehr2 reverse primer
TCGCAGTTAAAATAGAACATGTAGTTG
Ehr3 forward primer
CAGAGTGCTTCTCAATGTAACGA
Ehr4 reverse primer
TTGCGGTTAAGATAGAACATGTAGTTG
Roche UPL probe #9
Catalog # 04685075001
using Lightcycler 480 probes master mix (Roche) in a
20ul volume reaction with 200nM of each of the four
primers (Table 1) and UPL probe 9 (Roche) and 4 ul of
template DNA. PCR was performed under the following
conditions: a single hot-start cycle at 95°C for 5 minutes
followed by 50 cycles of denaturation at 95°C for 10 seconds, annealing at 60°C for 20 seconds, and extension at
72°C for 5 seconds with a single acquisition.
Conventional PCR assays, designed to detect A. platys,
and E. canis infection, were performed at the second
laboratory (Intracellular Pathogens Research Laboratory
at North Carolina State University) on the pre- and postimmunosuppression samples. These samples included
whole blood, bone marrow and lymph node aspirates.
Total DNA was automatically extracted using a Qiagen
robot from 200 µl of blood with a commercially available
kit (MagAttract DNA Blood kit, Qiagen, Valencia, CA).
The final eluted volume was 200 µl per sample. The DNA
concentration was quantified by spectrophotometry, and
absence of PCR inhibitors demonstrated by the amplification of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) [21]. Samples were initially screened using
16S rRNA oligonucleotide primers designed to amplify
all Anaplasma and Ehrlichia species [17]. The E. canis
PCR assay was performed as previously described [22].
The A. platys 16S rRNA and groEL genes were targeted
as described previously [11]. The limit of detection, as
determined by positive control plasmid dilution for each
target, was: 16S rRNA = 10 gene copies per reaction and
groEL gene = 5 gene copies per reaction.
In order to prevent PCR amplicon contamination, sample extraction, reaction setup, PCR amplification and
amplicon detection were performed in separated areas.
Negative water controls were included with each run as
was a dilution of the positive control plasmid.
Statistical analysis
The hematology data were evaluated with one-way
ANOVA and Tukey’s multiple comparison test to compare each group at each time point to detect significant
differences (p≤0.05). A software program (GraphPad
Prism v.5, GraphPad Software, La Jolla, CA) was used to
perform these analyses. A t-test was performed for serology and PCR results using statistical software (JMP8, SAS,
Cary, NC). Agreement between the results of the two PCR
assays was calculated by dividing the number of sample
results in agreement by the total number of samples
tested.
Results
Hematology and clinical signs
Compared to the non-infected controls, dogs infected
with E. canis (Group E) developed decreased hematocrits,
while the hematocrits of dogs infected with A. platys
137
Figure 1
Effect of A. platys and/or E. canis infections on hematocrits of dogs prior to doxycycline treatment. (a.) uninfected controls are
compared to single infections of A. platys (Group a), E. canis (Group E) or simultaneous infections of both A. platys and E. canis
(Group a+E). (b.) Groups receiving sequential infections of A. platys followed by E. canis (Group aE) and E. canis followed by
A. platys (Group Ea), with the challenge infection at 112 days pi (dotted line). controls shown in panel
a. (Hematocrit shown as mean ± sEM per group.)
Figure 2
Effect of A. platys and/or E. canis infections on platelet counts of dogs prior to doxycycline treatment. (a.) uninfected controls
are compared to single infections of A. platys (Group a), E. canis (Group E) or simultaneous infections of both A. platys and
E. canis (Group a+E). (b.) uninfected controls are compared to groups receiving sequential infections of A. platys followed by
E. canis (Group aE) and E. canis followed by A. platys (Group Ea), with the challenge infection at 112 days pi (dotted line).
(platelet counts shown as mean ± sEM per group).
(Group A) did not differ from controls (Fig. 1a). Dogs
that were co-infected with A. platys and E. canis (Group
A+E) also developed decreased hematocrits relative to
the control dogs (Fig. 1a). At several time points (days 7,
84, and 112), their hematocrits were significantly lower
than dogs infected with E. canis alone (One-way ANOVA,
p≤0.05). Likewise, dogs initially infected with A. platys
and challenged with E. canis at day 112 (Group AE) had
a marked decrease in hematocrit following the challenge
138
infection, whereas there was no anemia when E. canis
infected dogs were challenged with A. platys at day 112
(Group EA; Fig. 1b).
All dogs in groups A, E and A+E developed severe thrombocytopenia within 7 days compared to non-infected,
control dogs (Fig. 2a). While the platelet counts in the
Group A dogs (A. platys only) gradually increased after 75
days PI, the platelet counts in the co-infected dogs (Group
A+E) remained significantly lower than Group A platelet
counts at several time points (days 77, 98-130, 144-158,
171-203; One-way ANOVA, p≤0.05). In comparison to
E. canis infected dogs (Group E), the Group A+E platelet
counts were also significantly lower at several time points
(days 7, 11, 63, 77, 84, 120, 192; One-way ANOVA,
p≤0.05). In dogs that were infected sequentially with
these agents (Group AE and Group EA), the platelet
concentrations decreased following the inoculation of the
second organism (Fig. 2b). However, there was no significant difference between these two groups in the severity
of the thrombocytopenia, regardless of which organism
was initially and subsequently administered.
Compared to the non-infected controls, the total leukocyte counts were significantly decreased in dogs from
groups E and E+A between days 14-49 PI (One-way
ANOVA, p≤0.05), however leukocyte counts did not
differ between these two groups (data not shown). The
leukocyte counts of dogs infected with A. platys (Group A)
did not differ from controls at any time point PI.
Clinically, none of the dogs developed an acute illness
following inoculation with A. platys and/or E. canis organisms. Compared to controls, rectal temperatures were
increased in E. canis infected dogs (Group E and A+E)
between 21-35 days PI, but dogs infected with both
A. platys and E. canis (Group A+E) were not significantly
different from dogs infected with only E. canis (Group E).
Real-time PCR Testing
Within three to five days PI, A. platys DNA was amplified by PCR in all dogs inoculated with this organism. In
contrast, E. canis DNA was detected between seven and
fourteen days PI (mean 10 days) from the E. canis infected
dogs. All E. canis infected dogs consistently tested positive by PCR between day 14 and initiation of doxycycline
therapy on day 211. In contrast, the majority of A. platys
infected dogs became PCR negative prior to doxycycline
treatment including those in Group EA. Co-infection
with E. canis (Group A+E), however, appeared to prolong
the duration of active A. platys infection. The median duration of infection for the dogs in Group A was 104 days
whereas the co-infected dogs in Group A+E had a median
duration of A. platys infection of 119 days, excluding one
dog from Group A+E that was A. platys PCR-positive for
the duration of the study.
Serology
On average, antibodies to Anaplasma spp. were first
detected in the dogs inoculated with A. platys (Groups A
and AE) by day 16 PI (S.D. 4.4 days; range 10-24 days).
On average, groups E and EA dogs had a detectable
antibody response to the E. canis antigens 24 days PI (S.D.
4 days, range 17-35 days). However, co-infected dogs
(Group A+E) had a delayed humoral immune response to
A. platys antigens, with A. platys antibodies first detectable
on average 27 days PI (S.D. 10.3 days, range 14-35 days),
while the E. canis antibody response was similar to dogs
infected with E. canis only (avg. 24 days PI; S.D. 7.6 days).
In the two groups that received challenge infections
(Group AE and Group EA), the time between receiving the second inoculum and a measurable antibody
Figure 3
snap 4dx od values for Anaplasma spp. vary with E. canis co-infection and doxycycline treatment. (a.) comparison of only
A. platys infected (Group a) to A. platys infected challenged with E. canis on day 112 pi (Group aE). three dogs from each
group were either treated with doxycycline starting at day 211 (+doxy) or not treated. (b.) comparison of Anaplasma spp.
od values for co-infected dogs (Group a+E). three dogs from this group were treated with doxycycline at day 211 pi (+doxy)
and three dogs were left untreated. (Mean od per group).
139
table 2
compiled real-time and conventional E. canis pcr results pre- and post-immunosuppression.
Pre-immunosuppression
(Day 400)
Post-immunosuppression
(Day 414 and 420)
Group (n=3)
Blood
Lymph Node
Blood
Lymph Node
Bone Marrow
Group E
3/3
3/3
3/3
2/2
2/3
Group E+doxy
0/3
0/3
0/3
0/2
0/3
Group A  E
3/3
3/3
3/3*
2/2
1/3
Group A  E+doxy
0/3
0/3
0/3
0/3
0/3
Group E  A
3/3
3/3
3/3
3/3
3/3*
Group E  A+doxy
0/3
0/3
0/3
0/3
0/3
Group A+E
3/3
3/3
3/3*
3/3
2/3*
Group A+E+doxy
0/3
0/3
0/3
0/3
0/2
untreated control dogs are compared to the doxycycline treated dogs (+doxy). doxycycline was administered between days 211 and 238.
dexamethasone was administered between days 410 and 414. (number of dogs testing pcr positive/number tested in each group.
*indicates those groups where pcr results for individual samples disagreed between the methods.)
Figure 4
snap 4dx od values for E. canis remain elevated through
day 420 of the study. comparison of mean od values for
dogs infected only with E. canis (Group E), infected with
A. platys and challenged with E. canis or infected with E. canis
and challenged with A. platys (Groups aE and Ea) at day
112, and dogs co-infected with A. platys and E. canis (Group
a+E). three of six dogs in each group were treated with
doxycycline beginning at day 211 (+doxy) while the other
three dogs per group served as untreated controls (not
shown). (Mean od per group.)
140
response to antigens of the challenge infection averaged
28 days (range 14-35 days) regardless of whether the second inoculum consisted of A. platys or E. canis.
Serologic results from SNAP 4Dx were semiquantitated
by optical densitometry for all dogs through 420 days of
the study, allowing the graphical representation of the
humoral immune response over time. Group A dogs,
regardless of doxycycline treatment, had a steady decline
in OD values after reaching an initial peak OD around
75 days PI with 5/6 dogs testing Anaplasma seronegative
by day 420 (Fig. 3a). A. platys infected dogs that were
subsequently challenged with E. canis (Group AE) had
a marked increase in their OD values for A. platys within
two weeks of receiving the E. canis inoculum (Fig. 3a).
Like the Group A dogs, the OD values for the Group AE
dogs, regardless of doxycycline treatment, showed a steady
decline in the Anaplasma OD through day 420 of the study
with 5/6 dogs Anaplasma seronegative at that time point
(Fig. 3a). The serologic response to Anaplasma antigens
was influenced by co-infection (Group A+E) such that the
A. platys OD values were significantly greater in the coinfected group as compared to dogs in Group A between
80 and 160 days PI (t-test, p<0.0001). Compared to the
untreated co-infected dogs, A. platys OD values declined
Figure 5
differences in platelet counts in dogs infected with A. platys and/or E. canis and receiving doxycycline treatment (a.) relative
to their untreated controls (b). three dogs from each group were either treated with doxycycline starting at day 211 (+doxy)
or not treated. all doxycycline treated and untreated dogs were administered dexamethasone between days 410 and 414 pi.
(platelet counts shown as mean ± sEM per group.)
in the co-infected dogs receiving doxycycline therapy,
with 2/3 dogs seronegative at day 420 (Fig. 3b).
All dogs receiving the E. canis inoculum had a steady
increase in E. canis OD values on SNAP 4Dx, reaching
peak levels approximately 100 days PI. E. canis OD values
remained elevated throughout the course of the study
independent of doxycycline therapy (Fig. 4). Dogs in the
control group remained A. platys and E. canis seronegative
on SNAP 4Dx for the duration of the study.
Doxycycline Treatment and Immunosuppression
Doxycycline was administered to 3/6 dogs in each group,
including uninfected controls, for a total of 28 days
beginning at day 211 of the study. In order to better assess
the efficacy of doxycycline following the course of treatment, all dogs were given an immunosuppressive dose
of dexamethasone for 5 days beginning at day 410 of the
study. Physical examinations and complete blood counts
were monitored through day 485. Prior to doxycycline,
the uninfected controls and Group A had platelet counts
within the laboratory reference interval, while all other
groups (E, AE, EA, and E+A) were thrombocytopenic
(mean 125, 600/µl). Over the next three months, average platelet counts increased in those thrombocytopenic
dogs treated with doxycycline (Fig. 5a). Dogs in groups
E, AE, EA, and E+A that did not receive doxycycline
remained thrombocytopenic at day 410 (mean 130, 500/
µl; Fig. 5b). Immunosuppression with dexamethasone
resulted in an increase in platelet counts for all dogs, but
the effect was most pronounced for those dogs that were
thrombocytopenic prior to immunosuppression and had
not been treated with doxycycline (Fig. 5b). By day 485
of the study, the platelet counts of the dogs that did not
receive doxycycline in groups E, AE, EA, and E+A were
significantly lower than the platelet counts of the dogs in
these respective groups that had been treated with doxycycline (t-test, p<0.0001).
In addition to resolving the thrombocytopenia, doxycycline treatment appeared to successfully clear the dogs of
any PCR evidence of the E. canis infection in blood, bone
marrow and lymph node. At day 183 of the study, prior
to doxycycline treatment, all dogs from groups E, AE,
EA and E+A were PCR positive for E. canis DNA. Dogs
treated at 99 (Group AE) and 211 (Groups E, EA,
and A+E) days post-E. canis infection were E. canis PCR
negative within 7 days of initiating doxycycline therapy
and remained PCR negative for the duration of the study,
including the post-immunosuppression period (Table 2).
Despite immunosuppression, neither A. platys nor E. canis
DNA was PCR amplified from blood, lymph node or
bone marrow of any doxycycline-treated dog with complete agreement between the two laboratories performing
the PCR testing.
In contrast, those dogs in Groups E, AE, EA and E+A
that were not treated with doxycycline remained E. canis
PCR positive both pre- and post-immunosuppression in
blood and lymph node, however fewer E. canis PCR positive results were obtained with bone marrow (Table 2).
The results of both the conventional and real-time PCR
assays were in complete agreement for the pre-immuno-
141
suppression samples, but demonstrated only 82% agreement on the post-immunosuppression samples. Only one
untreated, A. platys infected dog from Group A+E tested
PCR positive for A. platys DNA in blood pre-immunosuppression, and was PCR positive in blood, lymph node and
bone marrow post-immunosuppression.
Discussion
Results of this study demonstrate that concurrent or
sequential infection with A. platys and E. canis can impact
the hematological changes induced by these pathogens
and can also alter the anticipated host immune response
that would be induced following exposure to only one
organism. Simultaneous infection with E. canis and
A. platys in dogs resulted in a more pronounced anemia
and thrombocytopenia, when compared to the sole infection with either pathogen. Both sequential and simultaneous infections with A. platys and E. canis produced an
enhanced immune response to A. platys when compared
to infection with A. platys alone. Also, co-infection with
E. canis and A. platys appeared to result in a more persistent A. platys infection than was observed in those dogs
that were infected only with A. platys. While the dogs in
this study were infected experimentally, there is substantial evidence to support natural exposure to and infection
with multiple tick-borne pathogens in dogs [5-8, 10,
11, 23-27]. Under natural conditions, tick transmission
potentially influences the course of infection and clinical
manifestations, and is therefore a limitation of experimental infection studies. It is likely that co-infection or
sequential infections contribute to some of the “atypical”
manifestations that have been historically and clinically
attributed to single pathogen infections.
In this study, the hematologic effects of infection with
only A. platys or only E. canis were similar to those
previously reported [28-31]. The cyclic nature of the
thrombocytopenia reported in A. platys infected dogs
was not clearly demonstrated in this study due to the
comparatively low frequency (e.g. twice weekly) in which
platelet concentration was measured, and due to the
effect of averaging platelet concentrations from multiple
dogs per study group at a point in time. When compared
directly, the initial decrease in platelet concentrations
(~day 10 PI) occurred more rapidly in dogs infected with
only A. platys, as compared to dogs infected with only
E. canis. This suggests that each of these organisms may
induce pathophysiologically different mechanisms that
contributed to the thrombocytopenia documented in
these dogs. However, the more rapid onset of thrombocytopenia in A. platys infected dogs may reflect a difference
in either the strain, dosage or the specific isolate of the
organisms used in this study. Nevertheless, compared to
E. canis, which induces thrombocytopenia in association
142
with the development of anti-platelet antibodies, A. platys
directly infects platelets and may have a more immediate
effect on the platelet circulating half-life [32-34].
An unexpected alteration in the pattern of seroconversion occurred in dogs that were initially infected with A.
platys and later challenged with E. canis. Following E. canis
challenge infection, there was a dramatic increase in antiAnaplasma antibodies; even for one dog in which A. platys
serum antibodies were no longer detectable at the time
of E. canis infection. In addition, there was no molecular
evidence (PCR positivity) that A. platys organisms were
present in the circulation of these dogs at the time this
increase in Anaplasma serum antibodies occurred. The
sensitivity and specificity of the ELISA for antibodies to
Anaplasma and Ehrlichia species has also been shown to
be high, reducing the likelihood of cross-reacting or false
positive results [35]. This finding suggests that infection
with E canis, and potentially other pathogenic organisms, can induce an immunogenic effect that results in an
increased anamnestic response to previously recognized
antigens, in addition to a specific humoral immune
response to E. canis. This result is potentially consistent
with previous findings which demonstrated that acute
E. canis infections do not result in immunosuppression
in the dog [36].
This study is the first to report the long-term serologic
and PCR results for dogs experimentally infected with
A. platys. Previous A. platys experimental studies reported
on the acute phase of infection; with dogs being monitored for a maximum of 75 days PI independent of treatment [29, 30]. Immunological clearance of A. platys was
supported in this study by the progression from PCR
positive to PCR negative blood analyses by day 160 PI
in all infected only with A. platys. All dogs appeared to
have cleared their infection prior to antibiotic treatment.
These findings support prior clinical impressions that
most A. platys strains in the United States are considered
to cause minimal clinical disease, despite concurrent
documentation of thrombocytopenia [37]. However,
isolates from other parts of the world are reported to
induce a more severe disease in dogs [5, 30]. This study
was limited to the strains of A. platys and E. canis available for establishing the experimental infection and the
results of single, sequential and simultaneous infections
may differ depending upon the strain encountered in
nature. Likewise, all inoculums were prepared stored and
administered in an identical manner, however, undetermined variability in the infectious dose administered to
each dog could have influenced the results. As dogs coinfected with A. platys and E. canis in this study developed
a more persistent infection in conjunction with more
severe thrombocytopenia and anemia, clinicians investigating natural infection due to A. platys should consider
the potential influence of other known or unknown tickborne pathogens.
In this study, similar to several previous studies utilizing
experimental infections, doxycycline was found to be an
efficacious therapy for E. canis infection when administered for four weeks [17, 38]. Those dogs treated at 99
(Group AE) and 211 (Groups E, EA, and A+E) days
post-E. canis infection were E. canis PCR negative within
7 days of beginning doxycycline therapy. For those dogs
that did not receive doxycycline, E. canis DNA could be
found in infected dogs through the last time point tested
by PCR (day 420 of the study) with blood and lymph
node samples being more reliable sources for testing than
bone marrow, similar to a previous studies of naturally
infected dogs [7, 27].
Dexamethasone-induced immunosuppression resulted
in a marked increase in the platelet counts for all dogs,
which was more pronounced in chronically thrombocytopenic dogs infected with E. canis. Multiple mechanisms
have been proposed for the thrombocytopenia associated
with E. canis infections including increased platelet consumption, splenic sequestration and immune-mediated
mechanisms associated with increased platelet destruction [1, 33, 39]. If immunosuppression was able to inhibit the immune-mediated destruction and the removal of
platelets by tissue macrophages, the rapid rise and fall in
platelet counts before and after corticosteroid administration may reflect an ongoing hyperplastic bone marrow
response, which could potentially lead to hypoplastic
bone marrow (exhaustion) in the chronic phase of canine
ehrlichiosis [40, 41]. The use of immunosuppressive corticosteroids for treatment of in immune-mediated thrombocytopenia must be considered carefully when a dog
is knowingly or unknowingly infected with a pathogen.
Severe immunosuppression in dogs with chronic, undiagnosed infections could contribute to highly variable
clinical outcomes, including death.
conclusions
This study was designed to evaluate the influence of
simultaneous or sequential infections with A. platys and
E. canis in dogs as compared to dogs inoculated with either
pathogen alone. The study identified differences in the
hematological and serological parameters and in the duration of infection during simultaneous co-infection or after
inducing a sequential infection. Under natural conditions,
it is not always clinically possible to know the variety of
organisms dogs are exposed to or infected with, particularly in those regions of the world where a spectrum of
vectors and multiple pathogens are endemic. Awareness
and prevention of tick-borne and other vector-borne infections, using acaricides and other preventive modalities are
clearly important. Diagnostically, co-infection should be
considered in those dogs with atypically severe or unusual
clinical presentations.
competing Interests
MJB, BAS, LL and RC are employees of IDEXX Laboratories,
Inc. EBB is a consultant for IDEXX Laboratories, Inc.
PPVD was funded as a research postdoctoral fellow in
the Intracellular Pathogens Research Laboratory at North
Carolina State University, which EBB directs. SG has
received funding from IDEXX Laboratories, Inc. within the
last 5 years.
Authors’ contributions
The authors from IDEXX have been working with Drs.
Breitschwerdt, Diniz and Gaunt for a number of years on
vector-borne diseases and collaborated to design, analyze
and interpret the data generated in this study. MJB and
SDG drafted and revised the manuscript. All authors critically reviewed and approved the final manuscript.
Acknowledgements
The authors would like to acknowledge Kristen DeBisceglie,
Brendon Thatcher, Phyllis Tyrrell, and Jancy Hanscom for
assistance with serologic and molecular testing at IDEXX,
and Del Philips, LeeAnn Eddleman, Loree Haines, Claire
Webster, and Elizabeth Chatelain for their veterinary technical assistance at LSU.
This study was funded by IDEXX Laboratories, Inc.
Publication of this thematic series has been sponsored by
Bayer Animal Health GmbH.
Parasites & Vectors 2010, 3:33
(http://www.parasitesandvectors.com/content/3/1/33)
The original article is published as an open access article
distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/
by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work
is properly cited.
References
1.
2.
Greene cE: Infectious Diseases of the Dog and
cat. 3rd edn. new york: Elsevier Health sciences; 2006.
stich rW, schaefer JJ, bremer WG, needham Gr, Jittapalapong s: Host surveys, ixodid tick biology
and transmission scenarios as related to the
tick-borne pathogen, Ehrlichia canis. Vet Parasitol 2008, 158:256-273.
143
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
144
bowman d, little sE, lorentzen l, shields J, sullivan Mp,
carlin Ep: Prevalence and geographic distribution of Dirofilaria immitis, Borrelia burgdorferi, Ehrlichia canis, and Anaplasma phagocytophilum in dogs in the United States: results
of a national clinic-based serologic survey. Vet
Parasitol 2009, 160:138-148.
simpson rM, Gaunt sd, Hair Ja, Kocan KM, Henk
WG, casey HW: evaluation of Rhipicephalus
sanguineus as a potential biologic vector of
Ehrlichia platys. Am J Vet Res 1991, 52:1537-1541.
Harrus s, aroch i, lavy E, bark H: clinical manifestations of infectious canine cyclic thrombocytopenia. Vet Rec 1997, 141:247-250.
cardoso l, tuna J,Vieira l,yisaschar-Mekuzas y, baneth
G: Molecular detection of Anaplasma platys
and Ehrlichia canis in dogs from the north of
Portugal. Vet J 2008.
Gal a, loeb E,yisaschar-Mekuzas y, baneth G: Detection of Ehrlichia canis by PcR in different
tissues obtained during necropsy from dogs
surveyed for naturally occurring canine
monocytic ehrlichiosis. Vet J 2008, 175:212-217.
diniz ppVp, beall MJ, omark K, chandrashekar r,
daniluk da, cyr KE, Koterski JF, robbins rG, lalo pG,
Hegarty bc, breitschwerdt Eb: High prevalence of
tick-borne pathogens in dogs from an Indian
reservation in northeastern Arizona. Vector
Borne Zoonotic Dis, [Epub ahead of print].
yabsley MJ, McKibben J, Macpherson cn, cattan pF,
cherry na, Hegarty bc, breitschwerdt Eb, o’connor t,
chandrashekar r, paterson t, perea Ml, ball G, Friesen
s, Goedde J, Henderson b, sylvester W: Prevalence
of Ehrlichia canis, Anaplasma platys, Babesia
canis vogeli, Hepatozoon canis, Bartonella
vinsonii berkhoffii, and Rickettsia spp. in dogs
from Grenada. Vet Parasitol 2008, 151:279-285.
Kordick sK, breitschwerdt Eb, Hegarty bc, southwick
Kl, colitz cM, Hancock si, bradley JM, rumbough r,
Mcpherson Jt, Maccormack Jn: coinfection with
multiple tick-borne pathogens in a Walker
Hound kennel in north carolina. J Clin Microbiol
1999, 37:2631-2638.
beall MJ, chandrashekar r, Eberts Md, cyr KE, diniz pp,
Mainville c, Hegarty bc, crawford JM, breitschwerdt
Eb: Serological and molecular prevalence of
Borrelia burgdorferi, Anaplasma phagocytophilum, and Ehrlichia species in dogs from
Minnesota. Vector Borne Zoonotic Dis 2008, 8:455-464.
Glaze Mb, Gaunt sd: Uveitis associated with
Ehrlichia platys infection in a dog. J Am Vet Med
Assoc 1986, 189:916-917.
baker dc, simpson M, Gaunt sd, corstvet rE: Acute
Ehrlichia platys infection in the dog. Vet Pathol
1987, 24:449-453.
14. Eddlestone sM, Gaunt sd, neer tM, boudreaux cM,
Gill a, Haschke E, corstvet rE: PcR detection of
Anaplasma platys in blood and tissue of dogs
during acute phase of experimental infection. Exp Parasitol 2007, 115:205-210.
15. Eddlestone sM, neer tM, Gaunt sd, corstvet r, Gill a,
Hosgood G, Hegarty b, breitschwerdt Eb: Failure of
imidocarb dipropionate to clear experimentally induced Ehrlichia canis infection in dogs.
J Vet Intern Med 2006, 20:840-844.
16. Gaunt sd, corstvet rE, berry cM, brennan b: Isolation of Ehrlichia canis from dogs following
subcutaneous inoculation. J Clin Microbiol 1996,
34:1429-1432.
17. Eddlestone s, diniz, ppVp, neer, tM, Gaunt sd, corstvet r, cho d, Hosgood G, Hegarty b, breitschwerdt
Eb: Doxycycline clearance of experimentally
induced chronic Ehrlichia canis infection in
dogs. J Vet Intern Med 2007, 21: 1237-42.
18. stillman b, debisceglie K, bradley J, saucier J, breitschwerdt Eb, Gaunt sd, o’connor t, chandrashekar
r: experimental E. canis infection in dogs:
Antibody response pre- and post-treatment
[abstract]. JVIM 2008, 22:781-782.
19. idEXX laboratories, inc.(2009). Detection of Anaplasma platys. us patent 7,507,789.
20. bell ca, patel r: A real-time combined polymerase chain reaction assay for the rapid
detection and differentiation of Anaplasma
phagocytophilum, Ehrlichia chaffeensis, and
Ehrlichia ewingii. Diagn Microbiol Infect Dis 2005,
53:301-306.
21. birkenheuer aJ, levy MG, breitschwerdt Eb: Development and evaluation of a seminested PcR
for detection and differentiation of Babesia
gibsoni (Asian genotype) and B. canis DnA
in canine blood samples. J Clin Microbiol 2003,
41:4172-4177.
22. dawson JE, biggie Kl, Warner cK, cookson K, Jenkins
s, levine JF, olson JG: Polymerase chain reaction
evidence of Ehrlichia chaffeensis, an etiologic
agent of human ehrlichiosis, in dogs from
southeast Virginia. Am J Vet Res 1996, 57:1175-1179.
23. breitschwerdt Eb, Hegarty bc, Hancock si: Sequential evaluation of dogs naturally infected
with Ehrlichia canis, Ehrlichia chaffeensis,
Ehrlichia equi, Ehrlichia ewingii, or Bartonella
vinsonii. J Clin Microbiol 1998, 36:2645-2651.
24. de paiva diniz pp, schwartz ds, de Morais Hs,
breitschwerdt Eb: Surveillance for zoonotic
vector-borne infections using sick dogs from
southeastern Brazil. Vector Borne Zoonotic Dis 2007,
7:689-697.
25. Gal a, Harrus s, arcoh i, lavy E, aizenberg i, Mekuzasyisaschar y, baneth G: coinfection with multiple
tick-borne and intestinal parasites in a
6-week-old dog. Can Vet J 2007, 48:619-622.
26. Mylonakis ME, Koutinas aF, baneth G, polizopoulou Z,
Fytianou a: Mixed Ehrlichia canis, Hepatozoon
canis, and presumptive Anaplasma phagocytophilum infection in a dog. Vet Clin Pathol 2004,
33:249-251.
27. Mylonakis ME, Koutinas aF, breitschwerdt Eb, Hegarty
bc, billinis cd, leontides ls, Kontos Vs: chronic
canine ehrlichiosis (Ehrlichia canis): a retrospective study of 19 natural cases. J Am Anim
Hosp Assoc 2004, 40:174-184.
28. de castro Mb, Machado rZ, de aquino lp, alessi ac,
costa Mt: experimental acute canine monocytic ehrlichiosis: clinicopathological and
immunopathological findings. Vet Parasitol 2004,
119:73-86.
29. Harvey JW, simpson cF, Gaskin JM: cyclic thrombocytopenia induced by a Rickettsia-like agent
in dogs. J Infect Dis 1978, 137:182-188.
30. Kontos Vi, papadopoulos o, French tW: natural and
experimental canine infections with a Greek
strain of Ehrlichia platys. Vet Clin Pathol 1991,
20:101-105.
31. reardon MJ, pierce Kr: Acute experimental
canine ehrlichiosis. I. Sequential reaction of
the hemic and lymphoreticular systems.
Vet Pathol 1981, 18:48-61.
32. French tW, Harvey JW: canine infectious cyclic
thrombocytopenia (Ehrlichia platys infection
in dogs). new york: pergamon press; 1993.
33. Harrus s, Waner t, Weiss dJ, Keysary a, bark H:
Kinetics of serum antiplatelet antibodies in
experimental acute canine ehrlichiosis.
Vet Immunol Immunopathol 1996, 51:13-20.
34. Waner t, Harrus s, Weiss dJ, bark H, Keysary a: Demonstration of serum antiplatelet antibodies
in experimental acute canine ehrlichiosis.
Vet Immunol Immunopathol 1995, 48:177-182.
35. chandrashekar r Mc, beall MJ, o’connor t, Eberts
M, alleman ar, Gaunt sd, breitschwerdt Eb: Performance of the in-clinic SnAP® 4Dx® test
for detection of antibodies to Anaplasma
phagocytophilum, Ehrlichia canis, Borrelia
burgdorferi and Dirofilaria immitis antigen
in dogs. AJVR in press.
36. Hess pr, English rV, Hegarty bc, brown Gd,
breitschwerdt Eb: experimental Ehrlichia canis
infection in the dog does not cause immunosuppression. Vet Immunol Immunopathol 2006,
109:117-125.
37. Bradfield JF,Vore SJ, Pryor WH, Jr.: Ehrlichia platys
infection in dogs. Lab Anim Sci 1996, 46:565-568.
38. schaefer JJ, Kahn J, needham Gr, rikihisa y, Ewing sa,
stich rW: Antibiotic clearance of Ehrlichia
canis from dogs infected by intravenous inoculation of carrier blood. Ann N Y Acad Sci 2008,
1149:263-269.
39. Waner t, leykin i, shinitsky M, sharabani E, buch H,
Keysary a, bark H, Harrus s: Detection of plateletbound antibodies in beagle dogs after artificial infection with Ehrlichia canis. Vet Immunol
Immunopathol 2000, 77:145-150.
40. Harrus s, Waner t, bark H, Jongejan F, cornelissen aW:
Recent advances in determining the pathogenesis of canine monocytic ehrlichiosis.
J Clin Microbiol 1999, 37:2745-2749.
41. reardon MJ, pierce Kr: Acute experimental
canine ehrlichiosis. II. Sequential reaction
of the hemic and lymphoreticular system
of selectively immunosuppressed dogs.
Vet Pathol 1981, 18:384-395.
145
Parasites & Vectors, edited by chris
arme, is an open access, peer-reviewed
online journal dealing with the biology of
parasites, parasitic diseases, intermediate
hosts and vectors. articles published in
this journal are available with no subscription charges or barriers to access,
and authors retain the copyright of their
material and may use it, or distribute it,
as they wish.
www.parasitesandvectors.com
A SURVeY oF cAnIne FILARIAL DISeASeS oF
VeteRInARY AnD PUBLIc HeALtH SIGnIFIcAnce
In InDIA
putEri aMa rani*1, pEtEr J irWin2, MuKulEsH GatnE3, GlEn t colEMan1, linda M McinnEs2
and rEbEcca J traub1
scHool oF VEtErinary sciEncE, tHE uniVErsity oF QuEEnsland, QuEEnsland 4072, australia
scHool oF VEtErinary and bioMEdical sciEncE, MurdocH uniVErsity, WEstErn australia 6150, australia
3
boMbay VEtErinary collEGE, MaHarastra aniMal and FisHEriEs sciEncEs uniVErsity, parEl, MuMbai 400012, india
1
2
*corrEspondinG autHor
EMail addrEssEs:
paMar: putEri.MEGatabdrani@uQconnEct.Edu.au
pJi: p.irWin@MurdocH.Edu.au
MG: MrsGatnE@yaHoo.co.in
Gtc: G.colEMan@uQ.Edu.au
lMM: l.McinnEs@MurdocH.Edu.au
rJt: r.traub@uQ.Edu.au
Abstract
Background
Dirofilaria spp., Acanthocheilonema spp. and Brugia spp. have all been reported in indian dogs. in previous studies, diagnosis was made by morphological identification only. This is the first geographically stratified cross-sectional study
in India to determine the prevalence and geographical distribution of canine filarial species of veterinary and public
health importance, using a combination of conventional and molecular diagnostic techniques.
Results
A total of 139 from 525 dogs (26.5%; 95% CI 22.7, 30.3) were positive for microfilariae. The most common species
of canine filaria identified in this study was A. reconditum (9.3%) followed by D. repens (6.7%) and D. immitis (1.5%).
three out of 525 dogs were found to have mixed infections on pcr. the morphological and molecular evidence on
the sequence of the 18s gene and phylogenetic analysis of the its-2 region provided strong evidence that the canine
microfilariae discovered in the Himalayan city of Ladakh belong to a novel species of Acanthocheilonema. two dogs
in Ladakh were also found to have mixed infections of the novel species described above and a unique microfilaria
which morphologically resembled Microfilaria auquieri Foley, 1921.
conclusions
At least six species of filarial nematode are now known to infect dogs in India, two of which were reported for
the first time in this study. The study also confirms and extends the geographical distribution of canine heartworm
(D. immitis) which overlaps with D. repens, emphasising the importance for veterinary clinicians and diagnostic laboratories to utilise immunodiagnostic tests that will not cross-react between those two filarial species. From a public
health viewpoint, the distribution and prevalences of these nematodes warrant an appropriate prophylaxis to be
administered to dogs.
146
Background
Filariasis in dogs is caused by several species of filariids. Dirofilaria immitis, the most pathogenic canine
filarid is responsible for heartworm disease in dogs. Both
D. repens and Acanthocheilonema spp. develop into adult
worms in the subcutaneous tissue resulting in skin nodules. Adults of Brugia spp. are usually recovered from the
mandibular, retropharyngeal and axillary lymphatics.
Most infections with D. repens, Acanthocheilonema spp.
and Brugia spp. are of minimal veterinary clinical significance, however all canine filariae have the potential
to infect humans and remain important from a public
health perspective [1, 2].
Diagnostic methods for filarial infections include isolation of adult worms followed by morphological identification, morphological observation of circulating microfilariae by stained blood smears, direct wet smears, modi-
fied Knott’s technique and the Wylie’s filtration technique
[2, 3]. Histochemical or immuno-histochemical staining
of circulating microfilariae has also been performed [4-6].
Detection of circulating antigen with commercial test kits
is currently available and widely used for D. immitis [7,
8]. Molecular diagnostic approaches are also increasingly
utilised for research and surveillance purposes [9, 10].
In India, Dirofilaria spp., Acanthocheilonema spp. and
Brugia spp., have all been reported in dogs [6, 11-13].
Previous reports on filarial infections in India are summarised in Table 1. Based on these limited number of
studies, it is currently accepted that D. immitis is geographically restricted to India’s north-east and D. repens
to India’s south, with an overlapping area centrally. There
are no reports of D. immitis occurring elsewhere in India,
despite anecdotal evidence to suggest its occurrence in
Delhi (Sharma, personal communication, July 2008,
Delhi). This accepted view is questionable as competent mosquito
vectors for D. immitis, belonging
to the genera Culex, Aedes and
Anopheles, that also happen to act
as vectors for D. repens, are present all over India [14]. Moreover,
a case of human pulmonary dirofilariasis due to D. immitis was
reported in Mumbai in 1989 [15],
which casts further doubt on its
currently accepted geographical
distribution. Recently, 16 out of 75
microfilaraemic dogs were shown
to harbour B. malayi by researchers at the Kerala Agricultural
University’s College of Veterinary
and Animal Sciences using morphological and immunodiagnostic criteria [13]. However, since
B. ceylonensis is endemic in Sri
Lanka this finding needs to be
confirmed using PCR as the microfilariae cannot be differentiated
morphologically from B. malayi
and it is likely the ELISA test crossreacts among Brugia spp. [16].
In previous reported studies,
microfilarial identification relied
Figure 1
Political map of India.
Areas outlined in red rectangles
indicate sampling locations.
147
table 1
Previous reported prevalences of canine filarial species in different location in India*
Northeast India
Southern India
Mizoram
n = 240
Orissa
n=7
Kolkata
n = 3200
Kerala
n = 160
Karnataka
n = 400
Dirofilaria
immitis
34%
57%
3%
0%
0%
Dirofilaria
repens
0%
14%
0%
7%
21%
*data obtained from [52][29][24][30][6]
on morphological assessment only. Despite the availability of published measurements of various microfilariae,
the inadequacy of morphological diagnosis was demonstrated by Rishniw and colleagues (2006) [9] when
microfilariae initially identified as A. reconditum were
later determined to be D. immitis by molecular methods.
Morphological identification of microfilariae not only
requires experienced personnel but it may be difficult to
detect multiple infections with more than one species of
filarial worms [2].
A geographically stratified cross-sectional study was
undertaken to determine the prevalence and geographical distribution of canine filarial species of veterinary and
public health importance in India using a combination of
conventional and molecular diagnostic techniques.
Methods
Study site
India features a wide range of climatic zones, ranging from
montane (cold, wet alpine regions) and semi-arid regions
to the wet tropics. The ecology of vectors of medical and
veterinary importance (and therefore the diseases they
transmit) is highly dependent on climate [17]. The study
was stratified to include four climatic zones of India. The
locations of the places sampled represent a unique climatic condition of their own, based on information produced
by The World Meteorological Organization [18]. Ladakh in
India’s far north (3000m altitude), experiences a temperature that rarely exceeds 27°C in summer, while in winter
temperatures drop to minus 20°C. Mumbai’s climate can
be described as tropical with a high level of humidity. The
mean average temperature for Mumbai ranges from 16°C
during winter to 30°C in summer. The climate of Delhi
is a monsoon-influenced humid subtropical climate with
average temperatures range from 7°C during its dry winter
to 39°C in summer. Sikkim’s climate can be described as
subtropical highland with mild temperatures range from
25°C in summer to 4°C in winter [19].
148
To facilitate the fieldwork, collaborations were established
with Vets Beyond Borders, Jeevaashram, Krishnaashram,
Bombay Veterinary College and In Defence of Animals
India. These organisations allowed us access to stray and
refuge dogs through their Animal Birth Control (ABC)
and rabies vaccination programs. In these programs stray
dogs are impounded, vaccinated, surgically neutered and
released back to their original location [20]. The purpose
of this program is to stabilise the street dog population
and to help control the spread of rabies. Capillary and
whole blood samples were collected from 525 dogs from
four different cities (Figure 1), namely Gangtok and
Jorethang in Sikkim (n=101), Ladakh (n=100) in Jammu
and Kashmir, Delhi (n=162) and Mumbai (n=162).
Blood samples were subjected to normal-thin and buffycoat smears, air-dried and fixed in 100% ethanol and later
stained with Giemsa for microscopic screening. Whole
blood samples were also applied onto QIAcard FTA® Four
Spots (Qiagen) for molecular-based screening later.
Microscopic examination of blood films
Stained blood films were examined under ×200 and ×400
objective lens for microfilariae. The microfilariae were
measured using Olympus BH-2 microscope (Japan) calibrated eye micrometer and photographed using Olympus
DP12 digital microscope camera (Japan).
DNA extraction of adult D. immitis and blood from
QIAcard FTA®
DNA from an adult worm of D. immitis (courtesy of
Murdoch University) was extracted using the tissue
sample protocol of the MasterPure DNA purification kit
(Epicentre) according to the manufacturer’s instructions
and utilised as a positive control for this study.
Approximately 500 µl of blood from each animal was
applied on QIAcard FTA® Four Spots (Qiagen) which
were cut into two cm strips (vertically) and allowed to
air dry. A modified DNA purification protocol for tis-
sue samples using the MasterPure DNA purification kit
(Epicentre) was used to extract DNA from FTA cards.
A 2 cm2 piece of dried FTA card impregnated with a blood
sample was cut into small pieces using a sterile scalpel
blade on a clean microscope slide and placed in a 1.5 ml
microcentrifuge tube. One µl of Proteinase K, 150 µl tissue lysis buffer and 150 µl phosphate buffer saline were
added to the FTA card sample and incubated overnight at
65ºC. The lysed sample was then cooled on ice for 5 minutes, 175 µl of MPC protein precipitation reagent added
and the sample centrifuged at 6, 800 g for 10 minutes.
Following centrifugation the supernatant was transferred
into a clean 1.5 ml tube and 500 µl of isopropanol added.
The sample was then inverted 30-40 times to promote
DNA precipitation, centrifuged at 6,800 g for 10 minute
and the supernatant removed carefully so as to not dislodge the DNA pellet. DNA pellet was washed twice with
70% ethanol. The sample was air dried for 5 minute to
remove any remaining ethanol before the DNA pellet was
resuspended in 20 µl of TE buffer.
PCR assays and DNA sequencing
A single-step multiplex PCR targeted at amplifying the
internal transcribed spacer-2 region of ribosomal DNA
developed by Rishniw and colleagues (2006) [9] was utilised for molecular screening of canine filarial species in
blood. Pan-filarial primers, forward: DIDR-F1 5’-AGT
GCG AAT TGC AGA CGC ATT GAG-3’ and reverse:
DIDR-R1 5’-AGC GGG TAA TCA CGA CTG AGT TGA-3’
were utilized to amplify and differentiate D. immitis, D.
repens, B. malayi, B. pahangi, A. reconditum and A. dracunculoides. The PCR assay was carried out in a final volume of
25 µl containing 1 x PCR buffer, 1.5 mM MgCl2, 200 µM
dNTPs, 0.5 µM of each primer, 1 U of Taq polymerase and
1 µl of DNA template. The PCR procedure was executed
according to Rishniw et al. (2006). The PCR products were
run on a 2% agarose gel in 1xTAE buffer at 100V and
visualised using Geldoc (Biorad). The anticipated product
sizes of each species of microfilaria are listed in Table 2.
PCR products from 30% of all positive samples were
purified using Qiagen spin columns (Qiagen). When a
multiple-band product was obtained, target bands were
excised and purified with Qiaquick Gel Extraction kit
(Qiagen) prior to DNA sequencing. DNA sequencing
was performed using an ABI 3130xl Genetic Analyzer
(Applied Biosystems) with Big Dye 3.0 chemistry, after
which sequences were edited and assembled using Finch
TV (Geospiza Inc.).
Primer design for 18S gene and amplification
A nested PCR was designed to amplify a partial region
of the 18S rDNA of canine filarial species. Sequences
of the near complete 18S rDNA of B. malayi [GenBank:
AF036588], Wuchereria bancrofti [GenBank: AF227234]
D. immitis [GenBank: AF036638] and Dipetalonema sp.
[GenBank: DQ531723.1] were aligned using Clustal W
(http://align.genome.jp/) and an external and an internal set of primers (Table 3) were designed to amplify an
approximately 800 bp and 700bp product, respectively.
The PCR assay was carried out in a volume of 25 µl containing 1 x PCR buffer (Qiagen), 1.5 mM MgCl2, 200 µM
of each dNTP, 0.5 µM of each of the forward and reverse
primers, 1 U of Taq DNA polymerase (Qiagen) and 1 µl
of extracted DNA. Five microlitres of Q-solution (Qiagen)
was also added to optimise the PCR. The PCR conditions
of both primary and secondary PCR are as follows: an initial activation step at 94ºC for 2 min was followed by 35
cycles of amplification (94ºC for 30s, 56ºC for 30s and
72ºC for 30s) followed by a final extension step of 72ºC
for 7 min. The template for the secondary PCR amplification consisted of 1 µl of amplicon from the primary
amplification.
table 2
Primer sequences used to amplify PCR products from filarial and canine blood samples [9]
Product size and species of filarial nematodes amplified are also reported.
Primer pair
Primer sequence
Gene target
Product origin
Product size
(base pairs)
DIDR-F1
AGT GCG AAT TGC AGA CGC ATT GAG
5.8S-ITS2-28S
D. immitis
542
DIDR-R1
AGC GGG TAA TCA CGA CTG AGT TGA
D. repens
484
B. malayi
615
B. pahangi
664
A. reconditum
578
A. dracunculoides
584
149
table 3
External and internal primer sets for the amplification of a partial region of the 18S gene of
most filarial species.
Primer name
Sequence (5’- 3’)
PAFilariaF1 (external)
GGTGAAACCGCGAACGGCTC
PAFilariaR1 (external)
CCGTCCCTCTTAACCATTATC
PAFilariaF2 (internal)
CTATAATGTACTTGATGTTGATTATC
PAFilariaR2 (internal)
CCATGCACGAGTATTCAGGCA
table 4
The prevalences of canine filarial species in different cities in India by PCR and microscopy
(in parentheses)
Delhi
n = 162
Mumbai
n = 162
Sikkim
n = 101
Ladakh
n = 100
Overall
prevalence
n = 527
Dirofilaria
immitis
4.3%
(0%)
0%
(0%)
1%
(0%)
0%
(0%)
1.5%
(0%)
Dirofilaria
repens
4.9%
(0%)
16.7%
(8%)
0%
(0%)
0%
(0%)
6.6%
(2.2%)
Acanthocheilonema
reconditum
22.2%
(0.6%)
4.3%
(1.2%)
5.9%
(0%)
0%
(0%)
9.3%
(0.6%)
Novel spp.
0%
(0%)
0%
(0%)
0%
(0%)
48%
(13%)
9.1%
(2.5%)
Microfilaria
auquieri
0%
(0%)
0%
(0%)
0%
(0%)
0%
(2%)
0%
(0.4%)
Figure 2
Unidentified microfilaria observed in Giemsa
blood smears of dogs from ladakh.
150
Figure 3
Microfilaria observed in Giemsa blood smears
of dogs from ladakh, india which conform to
the morphological descriptions of Microfilaria
auquieri Foley, 1921.
table 5
Measurements of microfilaria recorded by various author*
Filarial
species
Dirofilaria
immitis
Microfilaria
Special features of microfilaria
Unsheathed, tapered head,
relatively straight tail
Length (µm) Width (µm)
218 – 329
5.4 – 6.2
Dirofilaria
repens
283 – 360
7.1 – 8.3
Acanthocheilonema
reconditum
250 – 270
4 – 4.5
195 – 230
Not
available
567
Not
available
Acanthocheilonema
Unsheathed, round curved body,
cephalic hook, blunt
Dracunculoides
anterior end
Cercopithifilaria grassi
Microfilaria
auquieri
Unsheathed
58 – 102
Not
available
Microfilaria
ochmanni
Sheathed
320
Not
available
Brugia
malayi
Sheathed, cephalic space:
6.3 – 6.7 µm
254 – 234
5.99 – 7.99
Brugia
pahangi
Sheathed, cephalic space:
6.4 µm
200 – 189
4–5
Brugia
ceylonensis
Sheathed, blunt tail, cephalic space:
6.3 – 6.7µm
220 – 275
Not
available
*data obtained from [2, 6, 21, 53, 54]
Results
Out of the 525 dogs examined for circulating microfilaria,
27 (5.1%; 95% CI 3.3, 7.0) were positive using microscopic screening and 139 (26.5%; 95% CI 22.7, 30.3)
confirmed for at least one filarial species by PCR. The
most common species of canine filarial parasite identified
in this study was A. reconditum followed by D. repens and
D. immitis. The prevalence and geographical distribution
of canine filarial species using both morphology and multiplex PCR are summarised in Table 4.
Morphology identification
All microfilariae found in this study except for those identified from dogs in Ladakh could be identified based on
previously described and published morphological criteria. In Ladakh, 13 dogs were found to harbour unsheathed
microfilariae (Figure 2) with an average length of 165 µm
(range 130 µm to 180 µm), that did not match the length
of previously described canine microfilariae (Table 5).
Two dogs in Ladakh were also found to have mixed infections of the unidentified microfilaria described above and
another microfilaria of an unusual appearance (Figure 3)
which was identified morphologically and presumed as
Microfilaria (Mf.) auquieri, a species previously described
by Foley [21] and Rioche [22] in Algeria, North Africa.
Further analyses with regard to the genetic identity of the
unidentified canine microfilariae in Ladakh were conducted using the 18S and ITS-2 genes.
Single-step multiplex PCR
Out of 525 samples, 139 produced amplicons corresponding to D. immitis, D. repens or A. reconditum. Three
151
Figure 4
Phylogenetic placement of the unidentified species of microfilaria from Ladakhi dogs based on partial SSU rDNA gene
sequences. bootstrap values at nodes indicate percentage calculated in 1000 replicates. Thelazia lacrymalis was used as an
outgroup.
out of 527 dogs were found to have mixed infections
based on the amplicon sizes; one from the city of Mumbai
with D. repens and A. reconditum, and two from the city of
Delhi with D. immitis and A. reconditum, and D. immitis
with D. repens. Two samples from Ladakh which found to
have mixed infections by microscopic screening with presumably Mf. auquieri, only produced a single amplicon
corresponds to A. reconditum. All PCR products amplified
and sequenced at the ITS-2 region, except those from
Ladakh as well as A. reconditum isolates from Delhi and
Mumbai had their multiplex PCR results confirmed with
published sequences for D. immitis from Mizoram, India
[GenBank: EU087699], D. repens from Kerala, India
[GenBank: FJ717410] and A. reconditum from Taiwan
[GenBank: AF217801] with 99-100% homology on the
basic local alignment search tool, BLASTn (http://blast.
ncbi.nlm.nih.gov/Blast.cgi).
Acanthocheilonema reconditum isolates from Delhi and
Mumbai displayed 95% and 90% homology to the published ITS-2 sequence for A. reconditum from Taiwan
[GenBank: AF217801]. Sequences for the ITS-2 region of
Acanthocheilonema isolates from each city; Delhi, Mumbai
and Ladakh were submitted to GenBank under accession
numbers GU593976, GU593978 and GU593978, respectively.
152
Genetic characterisation of unidentified canine microfilaria species
Clear and readable sequences spanning a 441 bp region of
the SSU rDNA gene were obtained from a single Ladakhi
isolate of the unidentified species of canine microfilaria.
These were aligned and compared with previously published sequences of closely related filariid species B. malayi
[GenBank: AF036588], Loa loa [GenBank DQ094173],
W. bancrofti [GenBank: AY843436], A. vitae [GenBank:
DQ094171], Onchocerca cervicalis [GenBank: DQ094174],
Setaria digitata [GenBank: DQ094175] and D. immitis
[GenBank: AF182647] using Clustal W (BioEdit v 7.0.5.3).
Thelazia lacrymalis [GenBank: DQ503458] was used as an
outgroup [23]. Although bootstrap support was low for
the differentiation of all genera of filariid, the unidentified
microfilariae isolated from dogs in Ladakh were distinctly
placed within the same clade as A. vitae (Figure 4).
ITS-2 sequences of Acanthocheilonema were found to have
identical sequence homology within the same geographical area. Sequences of six of the unidentified microfilaria
isolates from Ladakh, two isolates of A. reconditum from
Mumbai and Delhi and a single isolate from Sikkim,
together with GenBank reference sequences of canine
filarial species A. reconditum [GenBank: AF217801],
A. dracunculoides [GenBank: DQ018785] were compared
and aligned with a using Clustal W (BioEdit v 7.0.5.3).
The topology of the unrooted phenogram recognises
five major groups within the genus Acanthocheilonema,
which encompassed A. reconditum from Taiwan/ Sikkim,
A. reconditum from Delhi, A. reconditum from Mumbai,
Acanthocheilonema isolates from Ladakh and A. dracunculoides as separate groups. Isolates from Mumbai formed a
sister group to A. reconditum isolates from Taiwan, Sikkim
and Delhi. There was very strong bootstrap placement
for all six Acanthocheilonema isolates from Ladakh into a
distinct group from all isolates of A. reconditum as well as
A. dracunculoides (Figure 5).
Genetic distances of the ITS-2 region between A. reconditum and Acanthocheilonema isolates from Ladakh (11%)
and Mumbai (9%) were similar to that between A. reconditum and A. dranunculoides (19%) (Table 6), whereas
those between A. reconditum and isolates from Delhi were
significantly less (3%).
Discussion
This is the first comprehensive study that has utilised a
combination of conventional and molecular techniques
to determine the distribution and occurrence of canine
filarial species in India. Despite anecdotal accounts of
heartworm being present in Delhi, this study is the first to
confirm its presence in that city, together with D. repens.
This study is in agreement with previous reports [6, 11,
24] demonstrating a low prevalence of microfilaraemia
overall, and that the most common filarial species found
in India are A. reconditum and D. repens. Despite the relatively limited geographical locations used in this study,
our results also support the aforementioned hypothesis
that canine heartworm is primarily confined to tropical
and sub-tropical areas of northern India, but seems to be
absent towards the south.
This hypothesis is debatable since competent mosquito
vectors for D. immitis are present throughout central and
southern India. For example, Aedes albopictus [25-27], a
competent vector for D. immitis is present in Maharastra,
Karnataka and Pondicherry [28], and heartworm is yet
to be reported in dogs from these areas where climate
would support larval development within the mosquito
vector. It is noteworthy however that the prevalence
of all filarial species determined in the current study
may still an underestimate of its true value due to false
negative test results. The high prevalence of D. immitis by
necropsy that was reported in eastern and central India
cannot be disregarded [29, 30]. Authors of these studies
also mentioned that more than 30% of dogs positive for
D. immitis had occult infections, which is in agreement
with studies from Australia in the 1980s [31]. Several types
of occult filarial infection in dogs have been documented:
pre-patent infection, naturally occurring unisexual infection and immune-mediated clearance of microfilariae, a
similar situation that exists also in human filariasis [3,
32-34]. PCR has been shown to detect occult infections
of Loa loa in humans [35, 36], however a recent study by
Duscher (2009) has shown that a minimum parasitaemia
level of 6 ± 0.43 microfilariae per 100 µl of blood on the
FTA cards is need for detection of D. repens microfilariae
by PCR detection [37]. The authors explain that it is hard
to distribute large extracellular metazoan stages such as
table 6
Distance matrix showing the nucleotide difference among ITS-2 gene sequences for microfilaria isolated from dogs from Delhi,
Mumbai, sikkim and leh with reference sequences from Genbank for A. reconditum [Genbank: aF217801] and A. dracunculoides
[Genbank: dQ018785]. isolates from the study designated ‘a.r’ in parentheses are those that morphologically resembled
A. reconditum.
A. dracunculoides_DQ018785
A. reconditum_AF217801
0.19
Canine, Delhi isolate (A.r)
0.20
0.03
Canine, Ladakh isolate
0.22
0.11
0.13
Canine, Sikkim isolate (A.r)
0.19
0.00
0.03
0.11
Canine, Mumbai isolate (A.r)
0.26
0.09
0.09
0.17
0.09
153
Figure 5
An unrooted phenogram of the ITS-2 region of the unidentified species of microfilariae from Ladakh using neighbour-joining
analysis with the tamura-nei model. bootstrap values at nodes indicate percentage calculated in 1000 replicates.
microfilariae on a filter paper, and this can therefore lead
to false negative results for low parasitaemia infections.
Furthermore, macrocyclic lactones such as ivermectin
are known to possess microfilaricidal effects. Almost half
the refuge dogs from Mumbai and Delhi sampled in this
study had a history of receiving treatment with ivermectin for the control of gastrointestinal and ectoparasites.
A recent study by Bazzocchi and colleagues [38] confirmed that with prolonged treatment of ivermectin, a significant decreased in circulating microfilariemia in dogs
(less than 100 microfilariae / ml) occurred.
The most common filarial species found in dogs from this
study are A. reconditum and D. repens. Most infections with
A. reconditum and D. repens do not contribute to any
clinical illness in dogs, but this is not the case in humans
[1, 2]. Dirofilaria repens causing subcutaneous nodules and
sub-conjunctival infections in humans is now considered
as a re-emerging zoonoses and it often leads to misdiagnosis of malignant tumours in endemic areas [1, 24].
154
Although D. repens is endemic to a wide geographical area
spanning Europe and Asia, human cases, often involving
nodules in organs such as lungs, male genitals and female
breast are most commonly reported from Italy and Sri
Lanka [39]. With regard to Acanthocheilonema, only one
human case has been reported in Australia, which involved
the eye; the recovered worm morphological features were
consistent with an unfertilised adult female A. reconditum
[40]. Dirofilaria immitis infection in humans is rarely
reported, but associated with pulmonary lesions or radiological coin lesions of the lung. The significance of D.
immitis infection in human is the confusion and invariable radiological misdiagnosis of a primary or metastatic
lung tumour, which usually leads to thoracotomy for
open lung biopsy or wedge resection of the lung to obtain
the correct diagnosis [41, 42]. Sporadic reports of the
immature heartworm in unusual locations such as the
eye, mesentery, cerebral artery, spermatic cord and liver
also exist [43-47]. To date, twelve cases of human
subcutaneous dirofilariasis due to D. repens has been
reported in southern India [24] and a single case of
human pulmonary dirofilariasis due to D. immitis in
Mumbai [15].
All microfilariae found in this study except for those identified from dogs in Ladakh could be identified based on previously described and published morphological criteria.
Morphologic dimensions of the microfilariae genetically
characterised as A. reconditum from Delhi, Mumbai and
Sikkim matched previously documented measurements for
A. reconditum. This was supported by molecular evidence
to show that the isolates clustered within the A. reconditum group on phylogenetic analysis. Genetic distances of
the ITS-2 region between A. reconditum and isolates from
Delhi were within the range expected for intra-species
variation of different geographical populations. However
genetic distances of the ITS-2 region between A. reconditum
and isolates from Mumbai were within the range expected
for separate species of the same genera. Different species
of filarial nematodes are reported to vary in their degree
of intra-species variation based on the ITS-2 gene [48],
making this comparative analysis difficult to confirm.
Future molecular epidemiological studies comparing the
intra-species variation of Acanthocheilonema spp. in different geographical locations at multiple loci is necessary
to confirm this hypothesis. This finding is in contrast to
the situation discovered with the microfilariae found to
infect nearly half the dogs in Ladakh. Morphologically,
the length of these latter microfilariae did not match any
of the documented or known species of canine filariae.
Molecular evidence based on the phylogenetic analysis
of the 18S and ITS-2 regions provided strong evidence
to show that the canine microfilariae found in Ladakh
belong to a novel species of Acanthocheilonema. Genetic
distances between this novel species and A. reconditum
were within the range expected for separate species of the
same genera. We propose that in the interim, this new
species of microfilaria be designated Acanthocheilonema
ladakhii until further and more detailed morphological,
molecular and clinic-pathological studies are undertaken
to describe and name this novel species of canine filarial
parasite and ascertain its veterinary significance.
This study also presents the first report of what we presume to be Mf. auquieri in India and this serendipitous
re-encounter with this filarial species after 50 years is
of great parasitological interest. Although previously
reported in stray dogs of Algeria, there is still much to be
discovered about this enigmatic parasite. The adult form
of Mf. auquieri is not yet known as attempts to search for
the adult parasite failed despite a systematic post-mortem
by the early French researchers [22]. It is interesting to
note also that almost all dogs in Ladakh, and a small
proportion in Delhi, were found infested with a species
of blood-sucking fly (authors’ personal observation),
identified as Hippobosca longipennis syn. capensis Fabricius,
1805 [49], which is known to be an intermediate host
and vector of A. dracunculoides [50]. Our findings in
Ladakh have prompted us to speculate whether this same
Hippobosca fly is also the vector/intermediate host for
Mf. auquieri or whether it is just mere co-incidence that
this fly also happens to be common in Algeria where
Mf. auquieri was first reported [49].
As a side note the authors would like to add that the
application of blood samples to filter paper-based technology, such as the FTA cards used in this study, allow
for the rapid and safe dispatch of samples to diagnostic
facilities capable of PCR-based diagnosis, with the added
advantage of providing an archival potential. However,
using this technique in humid regions can result in fungal
contamination of the blood-impregnated filter paper as
we have experienced during this study. A careful drying
process of the papers is therefore recommended to prevent this problem from occurring.
conclusion
At least six species of filarial parasite are now known to
infect dogs in India, two of which were reported for the
first time in this study, namely Mf. auquieri and a novel
species of Acanthocheilonema, both of which were discovered in the Himalayan city of Ladakh. The study also confirms and extends the known geographical distribution of
canine heartworm in India. The distribution of heartworm
in India extends from the Pakistani border in the west
[51], Delhi and Sikkim in the north to the Burmese border in the east and Orissa to the south. The public health
importance of D. repens also suggests that appropriate
prophylaxis be administered to dogs throughout central
and west India from as far south as Kerala to as far north
as Delhi. From a diagnostic viewpoint, it is important to
utilise an immunodiagnostic test that will not cross-react
[8] between D. immitis and D. repens in areas where these
two filarial species co-exist, for example, Delhi.
competing interests
The authors declare that they have no competing interests.
Authors’ contributions
P.A. Megat Abd Rani was involved in all phases of the
study, including sampling and data collection, laboratory
work, data analysis, intellectual interpretation, and writing
the manuscript. R.J. Traub designed the study project,
supervised the study, and was involved in sampling, field
data collection, intellectual interpretation and critical revision of the manuscript for publication. L.M. McInnes
modified the DNA extraction method for FTA cards,
155
construction and intellectual interpretation of the phylogenetic trees. P.J. Irwin, M. Gatne and G.T. Coleman supervised the study and were involved in intellectual interpretation and critical revision of the manuscript for publication.
All authors read and approved the final manuscript.
6.
7.
Acknowledgements
Financial support for this study was provided by Bayer
Animal Health. We gratefully thank our collaborators;
Vets Beyond Borders, Jeevaashram, Krishnaashram and
In Defense of Animal for their help with the fieldwork.
Special thanks to David Spratt and Odile Bain for their
very insightful information about Mf. auquieri, Jenny
Seddon for her help with construction and interpretation of the phylogenetic results, Brian Bynon and Mark
Roper for their help with slides staining process and Myat
Kyaw-tanner for her help with molecular methods. PhD
scholarship support for Puteri Azaziah Megat Abd Rani is
provided by The Ministry of Higher Education, Malaysia.
Publication of this thematic series has been sponsored by
Bayer Animal Health GmbH
8.
9.
10.
11.
12.
Parasites & Vectors 2010, 3:30
(http://www.parasitesandvectors.com/content/3/1/30)
The original article is published as an open access article
distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/
by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work
is properly cited.
References
1.
2.
3.
4.
5.
156
Macpherson cn, Meslin FX, Wandeler ai: Dogs,
Zoonoses and Public Health. anthony rowe
limited, Eastbourne; 2000.
irwin pJ, Jefferies r: Arthropod-transmitted
diseases of companion animals in Southeast
Asia. Trends Parasitol 2004, 20:27-34.
Grieve rb, lok Jb, Glickman lt: epidemiology of
canine heartworm infection. Epidemiol Rev 1983,
5:220-246.
Kuecks rW, slocombe Jod: Rapid histochemical differentiation of Dirofilaria immitis and
Dipetalonema reconditum. in Proceedings of the
Heartworm Symposium; 23-24 February 1980; Dallas,Texas.
Edited by otto GF. 1980: 48-50.
peribanez Ma, lucientes J, arce s, Morales M, castillo
Ja, Gracia MJ: Histochemical differentiation
of Dirofilaria immitis, Dirofilaria repens and
Acanthocheilonema dracunculoides microfilariae by staining with a commercial kit,
Leucognost-SP (R). Vet Parasitol 2001, 102:173-175.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
ananda KJ, d’souza pE, Jagannath Ms: Methods for
identification of microfilaria of Dirofilaria
repens and Dipetalonema reconditum.
J Vet Parasitol 2006, 20:45-47.
atkins cE: comparison of results of three
commercial heartworm antigen test kits in
dogs with low heartworm burdens. J Am Vet
Med Assoc 2003, 222:1221-1223.
ranjbar-bahadori s, Eslami a, bokaic s: evaluation of
different methods for diagnosis of Dirofilaria
immitis. Pakistan J Bio Sci 2007, 10:1938-1940.
rishniw M, barr sc, simpson KW, Frongillo MF, Franz
M, dominguez alpizar Jl: Discrimination between
six species of canine microfilariae by a single
polymerase chain reaction. Vet Parasitol 2006,
135:303-314.
casiraghi M, bazzocchi c, Mortarino M, ottina E,
Genchi c: A simple molecular method for
discriminating common filarial nematodes
of dogs (Canis familiaris). Vet Parasitol 2006,
141:368-372.
Gogoi ar: Filarids of animals in India. J Vet
Parasitol 2002, 16:131-138.
dam t, das p: The importance of dirofilariasis
in India. Internet J Parasitic dis 2006, 1.
Human filariasis parasite found in dogs:
[http://www.hindu.com/2008/12/06/stories/
2008120654580400.htm]
sabu l, subramanian H: Prevalence and vector
potentiality of mosquitoes from thissur,
Kerala. J Vet Parasitol 2007, 21:165-167.
badhe bp, sane sy: Human pulmonary dirofilariasis in India: a case report. J Trop Med Hyg 1989,
92:425-426.
supali t, rahmah n, djuardi y, sartono E, rückert p,
Fischer p: Detection of filaria-specific IgG4
antibodies using Brugia Rapid test in individuals from an area highly endemic for Brugia
timori. Acta Trop 2004, 90:255-261.
patz Ja, campbell-lendrum d, Holloway t, Foley Ja:
Impact of regional climate change on human
health. Nature 2005, 438:310-317.
current weather forecast and climatological
information – India
[http://www.worldweather.org/066/m066.htm]
current weather information – Gangtok
[http://imdsikkim.gov.in/]
Menezes r: Rabies in India. Can Med Assoc J 2008,
178:564.
Foley H: Microfilaires du chien dans le Sudoranais. Ann Inst Pasteur (Paris) 1921, 35:212 - 217.
rioche M: Presence de Dipetalonema dracunculoides (cobbold, 1870) chez le chien dans la
region d’Alger. Arch Inst Pasteur Algér 1960,
38:386-398.
23. casiraghi M, anderson tJc, bandi c, bazzocchi c,
Genchi c: A phylogenetic analysis of filarial
nematodes: comparison with the phylogeny
of Wolbachia endosymbionts. Parasitology 2001,
122:93-103.
24. sabu l, devada K, subramanian H: Dirofilariosis in
dogs & humans in Kerala. Indian J Med Res 2005,
121:691-693.
25. lai c-H, tung K-c, ooi H-K, Wang J-s: Susceptibility
of mosquitoes in central taiwan to natural
infections of Dirofilaria immitis. Med Vet Entomol
2001, 15:64-67.
26. cancrini G, Frangipane di regalbono a, ricci i, tessarin
c, Gabrielli s, pietrobelli M: Aedes albopictus is a
natural vector of Dirofilaria immitis in Italy.
Vet Parasitol 2003, 118:195-202.
27. tiawsirisup s, Kaewthamasorn M: the potential for
Aedes albopictus (Skuse) (Diptera:culicidae)
to be a competent vector for canine heartworm, Dirofilaria immitis (Leidy). Southeast Asian
J Trop Med Public Health 2007, 38:208-214.
28. Kumar np, rajavel ar, natarajan r, Jambulingam p:
DnA barcodes can distinguish species of
Indian mosquitoes (Diptera: culicidae). J Med
Entomol 2009, 44:1-7.
29. patnaik MM: On filarial nematodes in domestic
animals in orissa. Indian Vet J 1989, 66:573-574.
30. borthakur sK, sarmah K, rajkhowa tK, das Mr, rahman s: Dirofilaria immitis infection in dog. J Vet
Parasitol 2006, 20:167-169.
31. atwell rb: Basic pathophysiology and epidemiology in Australia. in Heartworm symposium:
Refresher course for veterinarians; 5-7 July 1988; Leura,
NSW. 1988: 36-43
32. Weil GJ, powers KG, parbuoni El, line br, Furrow rd,
ottesen Ea: Dirofilaria immitis .6. Antimicrofilarial immunity in experimental filariasis.
Am J Trop Med Hyg 1982, 31:477-485.
33. Elsadr WM, aikawa M, Greene bM: In vitro immunemechanisms associated with clearance of
microfilariae of Dirofilaria immitis. J Immunol
1983, 130:428-434.
34. simón F, Morchón r, Gonzáles-Miguel J, Marcos-atxutegi
c, siles-lucas M: What is new about animal and
human dirofilariosis? Trends Parasitol 2009,
25:404-409.
35. touré Fs, bain o, nerrienet E, Millet p, Wahl G, toure
y, doumbo o, nicolas l, Georges aJ, Mcreynolds la,
Egwang tG: Detection ofLoa loa-Specific DNA
in Blood from occult-Infected Individuals.
Exp Parasitol 1997, 86:163-170.
36. touré Fs, Mavoungou E, Kassambara l, Williams t, Wahl
G, Millet p, Egwang tG: Human occult loiasis: field
evaluation of a nested polymerase chain
reaction assay for the detection of occult
infection. Trop Med Int Health 1998, 3:505-511.
37. duscher G, peschke r, Wille-piazzai W, Joachim a:
Parasites on paper – the use of FtA elute®
for the detection of Dirofilaria repens
microfilariae in canine blood. Vet Parasitol 2009,
161:349-351.
38. bazzocchi c, Mortarino M, Grandi G, Kramer lH,
Genchi c, bandi c, Genchi M, sacchi l, Mccall JW:
combined ivermectin and doxycycline treatment has microfilaricidal and adulticidal
activity against Dirofilaria immitis in experimentally infected dogs. Int J Parasitol 2008,
38:1401-1410.
39. pampiglione s, rivasi F: Human dirofilariasis
due to Dirofilaria (Nochtiella) repens: an update of world literature from 1995 to 2000.
Parassitologia 2000, 42:231-254.
40. Huynh t, thean J, Maini r: Dipetalonema reconditum in the human eye. Br J Ophthalmol 2001,
85:1391.
41. theis JH: Public health aspects of dirofilariasis
in the United States. Vet Parasitol 2005,
133:157-180.
42. Foroulis cn, Khaldi l, desimonas n, Kalafati G: Pulmonary dirofilariasis mimicking lung tumor
with chest wall and mediastinal invasion.
Thorac Cardiovasc Surg 2005, 53:173-175.
43. dobson c, Welch Js: Dirofilariasis as a cause of
eosinophilic meningitis in man diagnosed by
immunofluorescence and arthus hypersensitivity. Trans R Soc Trop Med Hyg 1974, 68:223-228.
44. Moorhouse dE: Dirofilaria immitis: A cause of
human intra-ocular infection. Infection 1978,
6:192-193.
45. tada i, sakaguchi y, Eto K: Dirofilaria in the Abdominal cavity of a Man in Japan. Am J Trop Med
Hyg 1979, 28:988.
46. theis JH: case report: Unusual location of
Dirofilaria immitis in a 28-year-old man
necessitates orchiectomy. Am J Trop Med Hyg
2001, 64:317-322.
47. Kim MK, Kim cH,yeom bW, park sH, choi sy, choi Js:
The first human case of hepatic dirofilariasis.
J Korean Med Sci 2002, 17:686-690.
48. areekit s, singhaphan p, Khucareontaworn s, Kanjanavas
p, sriyaphai t, pakpitchareon a, Khawsak p, chansiri K:
Intraspecies variation of Brugia spp. in cat
reservoirs using complete ItS sequences.
Parasitol Res 2009, 104:1465-1469.
49. bequaert J: notes on Hippoboscidae 2. the
subfamily Hippoboscinae. Psyche (Stuttg) 1930,
XXXVII:303-326.
50. nelson Gs: Dipetalonema drancunculoides
(cobbold, 1870), from the dog in Kenya: with
a note on its development in the louse-fly,
Hippobosca longipennis. J Helminthol 1963,
37:235-240.
157
51. Wolfe Ms, aslamkhan M, sharif M, E. p: Acanthocheilonema dracunculoides (cobbold, 1870) in
dogs in Lahore, West Pakistan. J Helminthol
1971, 45:171-176.
52. chakravarty a, chaudhuri Mn: Studies on canine
filariasis in West Bengal. Indian J Anim Health
1983, 22:151-155.
53. lapage G: Veterinary Helminthology and entomology. 4th edn. london: bailliere, tindall and cox;
1956.
54. schacher JF: Developmental stages of Brugia
pahangi in the final host. J Parasitol 1962,
48:693-706.
158
159
Parasites & Vectors, edited by chris
arme, is an open access, peer-reviewed
online journal dealing with the biology of
parasites, parasitic diseases, intermediate
hosts and vectors. articles published in
this journal are available with no subscription charges or barriers to access,
and authors retain the copyright of their
material and may use it, or distribute it,
as they wish.
www.parasitesandvectors.com
coMPARISon oF SeLecteD cAnIne VectoRBoRne DISeASeS BetWeen URBAn AnIMAL
SHeLteR AnD RURAL HUntInG DoGS In KoReA
sun liM1, pEtEr J irWin2, sEunGryonG lEE3, MyunGHWan oH3, KyusunG aHn3,
boyounG MyunG4, sunGsHiK sHin*3
biotHErapy HuMan rEsourcEs cEntEr (bK21), cHonnaM national uniVErsity, GWanGJu 500-757, KorEa
australasian cEntrE For coMpanion aniMal rEsEarcH, scHool oF VEtErinary and bioMEdical sciEncEs,
MurdocH uniVErsity, MurdocH 6150, Wa, australia
3
collEGE oF VEtErinary MEdicinE, cHonnaM national uniVErsity, GWanGJu 500-757, KorEa
4
GWanGJu aniMal sHEltEr, GWanGJu 500-757, KorEa
1
2
*corrEspondinG autHor
EMail addrEssEs:
SL: BLUESUN@IPET.RE.KR • PJI: P.IRWIN@MURDOCH.EDU.AU • SRL: SAGA5464@NATE.COM • MHO: SUPERVET@HANMAIL.NET •
BYM: BOYOUNG.MYUNG@GMAIL.COM • KSA: KYUSUNG.AHN@GMAIL.COM • SSS*: SUNGSHIK@JNU.AC.KR
Abstract
a serological survey for Dirofilaria immitis, Anaplasma phagocytophilum, Ehrlichia canis, and Borrelia burgdorferi infections
in rural hunting and urban shelter dogs mainly from southwestern regions of the republic of Korea (south Korea)
was conducted. From a total of 229 wild boar or pheasant hunting dogs, the number of serologically positive dogs
for any of the four pathogens was 93 (40.6%). the highest prevalence observed was D. immitis (22.3%), followed by
A. phagocytophilum (18.8%), E. canis (6.1%) and the lowest prevalence was B. burgdorferi (2.2%). in contrast, stray dogs
found within the city limits of Gwangju showed seropositivity only to D. immitis (14.6%), and none of the 692 dogs
responded positive for A. phagocytophilum, E. canis or B. burgdorferi antibodies. this study indicates that the risk of
exposure to vector-borne diseases in rural hunting dogs can be quite high in Korea, while the urban environment
may not be suitable for tick infestation on dogs, as evidenced by the low infection status of tick-borne pathogens in
stray dogs.
Findings
The situation with respect to parasitic diseases of companion animals in the Republic of Korea (South Korea)
still remains relatively uninvestigated. Especially, limited
information is available on the status of vector-borne disease transmission among dogs and cats. As global warming is affecting climate conditions of Korea, subtropical
parasitic diseases such as malaria that has not been established in South Korea are now emerging [1].
Canine vector-borne pathogens which include Dirofilaria
spp., Anaplasma spp., Ehrlichia spp., Borrelia spp. and
160
others can elicit serious illness in domestic dogs. These
agents can also cause clinical illness such as human
dirofilariasis as a result of accidental infection [2]. Lyme
disease, anaplasmosis, and infections with Ehrlichia canis
have been reported in humans, too [3-5]. Canine vectorborne diseases have been found throughout major continents of the world [6, 7]. In Japan, the prevalence of
E. canis was 4.7% [8] while that of B. burgdorferi was
8.8% in dogs [9]. In Korea, little information is available regarding the occurrence of these diseases in dogs,
although the prevalence in ticks and small mammals has
Table 1
Seroprevalence of selected arthropod-borne pathogens in hunting dogs from Korea as detected by a commercial screening test
Category
Dogs
examined
(%)
Di Ag
Ap Ab
Ec Ab
Bb Ab
Total*
Number(%) of positive dogs by SNAP 4Dx test
Gender
Female
Male
84(36.7)
145(63.3)
23(27.4)
28(19.3)
13(15.5)
30(20.7)
3(3.6)
11(7.6)
2(2.4)
3(2.1)
33(39.3)
60(41.4)
Age(year)
<2
>=2
50(21.8)
179(78.2)
4(8.0)
47(26.3)
5(10.0)
38(21.2)
3(6.0)
11(6.1)
0(0.0)
5(2.8)
12(24.0)
81(45.3)
Geographical origin
Beolgyo
Gwangyang
Suncheon
Asan
32(14.0)
65(28.4)
26(11.4)
106(46.3)
7(21.9)
18(27.7)
2(7.7)
24(22.6)
6(18.8)
7(10.8)
7(26.9)
23(21.7)
4(12.5)
3(4.6)
4(15.4)
3(2.8)
2(6.3)
0(0.0)
1(3.8)
2(1.9)
14(43.8)
27(41.5)
12(46.2)
40(37.7)
229(100.0) 51(22.3)
43(18.8)
14(6.1)
5(2.2)
93(40.6)
Total
*Number of positive dogs by any of the four test results by SNAP 4Dx test
Di Ag, Dirofilaria immitis antigen; Ap Ab, Anaplasma phagocytophilum antibody; Ec Ab, Ehrlichia canis antibody; Bb Ab, Borrelia burgdorferi antibody
been well documented [10, 11]. With regard to the dog,
most studies on vector-borne diseases have focused on
canine heartworm disease, which has a prevalence ranging from 9.9% to 50.3% [12-16]. Since outdoor dogs
such as hunting, military or stray dogs are vulnerable to
vector-borne pathogens, we investigated the prevalence of
D. immitis, A. phagocytophilum, E. canis, and B. burgdorferi
among hunting and stray dogs from Korea.
From December of 2007 to August of 2009, blood samples were collected from 229 hunting dogs in Beolgyo,
Gwangyang, Suncheon, and Asan areas of South Korea.
These areas are located from 34° 50’ N to 35° 05’ N
latitude and from 127° 15’ E to 127° 34’ E longitude
(southwestern region of South Korea) except for Asan
which is located 36° 45’ N latitude and 126° 89’ E
longitude (mid-western region of South Korea). Dogs
included in this study were raised for the purpose of
hunting either pheasants or wild boars with an average
of 3.2 years of age and an average body weight of 23.3
Kg. The majority of dogs were cross breeds of German
Shorthaired Pointer, and were composed of 145 (63.3%)
male and 84 (36.7%) female dogs. Blood samples were
also collected from a total of 692 stray dogs admitted to
the Gwangju Animal Shelter from January to December
of 2009. The city of Gwangju, with a population of 1.4
million people in December 2009, is also located in the
southwestern region of Korea where Beolgyo, Gwangyang
and Suncheon is situated within the distance of 100 Km
from the city. The majority of stray dogs admitted to the
only shelter of the city were either small- or middle-sized
breeds with an average body weight of 4.0 Kg. Among
them, Maltese (27.0%), mixed breeds (21.4%), Shih Tzu
(16.0%), Yorkshire terrier (11.0%), and Poodle (7.5%)
were the most commonly found breeds. Blood samples
collected from dogs were tested using a commercial ELISA
assay kit (SNAP® 4Dx®; IDEXX Laboratories, Inc. U.S.A.)
which detects D. immitis antigen, and antibodies specific
to A. phagocytophilum (synthetic peptide from the major
surface protein (p44/MSP2)), E. canis (P30 and P30-1
outer membrane proteins), and B. burgdorferi (C6 peptide). A test of independence for significance of the relationship between categorical variables (gender, age, and
geographic regions) was made via Pearson’s chi-Square
test and Fisher’s exact test for expected counts under five
using SPSS 17.0 (SPSS Inc., Chicago, IL, USA).
The serological prevalence of D. immitis, A. phagocytophilum, E. canis, and B. burgdorferi in hunting dogs from
Korea is shown in Table 1. The number of dogs serologically positive with any of the four pathogens surveyed in
this study was 93 (40.6%).
The number of dogs with single, dual or triple seropositivity was 75 (32.8%), 16 (7.0%), and 2 (0.9%), respectively. The highest prevalence was observed in D. immitis
(22.3%), followed by A. phagocytophilum (18.8%), and
the lowest by B. burgdorferi (2.2%). Although a significant
variation in geographical origin was observed in E. canis
161
table 2
seroprevalence of selected arthropod-borne pathogens in stray dogs admitted to a shelter in Gwangju, Korea as detected
by a commercial screening test
Category
Dogs
examined
(%)
Di Ag
Ap Ab
Ec Ab
Bb Ab
Total*
Number(%) of positive dogs by SNAP 4Dx test
Gender
Female
Male
280(40.5)
412(59.5)
50(17.9)
51(12.4)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
50(17.9)
51(12.4)
Age(year)
<2
>=2
211(30.5)
481(69.5)
19(9.0)
82(17.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
19(9.0)
82(17.0)
Geographical origin
(district)
East
West
South
North
Gwangsan
58(8.4)
105(15.2)
87(12.6)
355(51.3)
87(12.6)
12(20.7)
15(14.3)
13(14.9)
53(14.9)
8(9.2)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
0(0.0)
12(20.7)
15(14.3)
13(14.9)
53(14.9)
8(9.2)
0(0.0)
0(0.0)
0(0.0)
101(14.6)
Total
692(100.0) 101(14.6)
*number of positive dogs by any of the four test results by snap 4dx test
di ag, Dirofilaria immitis antigen; ap ab, Anaplasma phagocytophilum antibody; Ec ab, Ehrlichia canis antibody; bb ab, Borrelia burgdorferi antibody
Ab (χ2 = 7.968, p=0.032: Fisher’s exact test), the overall
exposure of dogs to these pathogens was irrelevant to
geographical locality (χ2 = 0.848, p=0.838). The number
of serologically positive dogs was similar between male
(41.4%) and female (39.3%, χ2 = 0.097, p=0.756), but
dogs of above two years in age (45.3%) were significantly
more exposed to these pathogens than younger dogs
(24.0%, χ2 = 7.318, p=0.007) which was mostly influenced by the exposure of the dogs to D. immitis (χ2 =
7.525, p=0.006).
The seroprevalence of selected arthropod-borne pathogens in stray dogs admitted to the Gwangju Animal
Shelter during the year 2009 is shown in Table 2. Unlike
the hunting dogs raised and living outside of the city,
stray dogs found within the city limit of Gwangju showed
seropositivity only to D. immitis (14.6%) and none of
the 692 dogs responded positive for A. phagocytophilum,
E. canis or B. burgdorferi antibodies. The number of serologically positive dogs was significantly more in female
(17.9%) than in male (12.4%, χ2 = 4.014, p=0.045),
and dogs of more than two years old were significantly
more exposed to these pathogens than younger dogs
(χ2 = 7.611, p=0.006).
This study strongly indicates that dogs from Korea
are potentially vulnerable to exposure to major canine
vector-borne diseases, as evidenced by the relatively high
prevalence rates of both mosquito- and tick-borne patho-
162
gens in hunting dogs. Previous reports also indicate that
vector-borne pathogens such as E. chaffeensis, A. phagocytophilum, and A. bovis were identified by TaqMan real-time
PCR [17] from ticks collected from various areas of Korea.
Also, five species of ticks in two genera (Haemaphysalis
spp. and Ixodes spp.) collected from small wild-caught
mammals or by dragging/flagging in Korea contained
species-specific fragments of A. phagocytophilum, A. platys,
E. chaffeensis, E. ewingii, E. canis, and Rickettsia rickettsii, as
evidenced by the PCR assay [10].
While infection status of the mosquito-transmitted
D. immitis infection was relatively high in both hunting
and stray dogs, the tick-borne pathogens were present only
in hunting dogs. Two factors may be involved to explain
the result. First, although 38.9% of the 501 million m2
land of the city of Gwangju is covered with woods and
fields, it is presumed that wild animals that can transmit
ticks to dogs are rarely able to enter or persist in the urban
environment. Secondly, the floor of people’s homes has a
special place in the culture of Koreans; it is generally polished and un-carpeted, on which they sit and often sleep.
People always remove their shoes when entering a Korean
home because a dirty floor is seldom tolerated in a Korean
home. As the result, ticks and fleas are rarely found infesting urban indoor dogs of Korea. For the same reason, small
dogs like Maltese, Yorkshire, and Shi Tzu are commonly
preferred by pet owners in Korea because they are well
adapted to being apartment dwellers. Stray dogs admitted
to the Gwangju Animal Shelter very much represent dog
breeds favoured by urban-dwelling Koreans; Maltese, Shih
Tzu, Yorkshire terrier, Poodle, and Schnauzer, etc [18].
While mosquitoes are ever-present in the city environment and even indoor-only dogs can get bitten by them,
this study indicates that ticks, in contrast, may have limited access to the city environment of Korea. Similar results
were observed in 2008 from a previous study on the
infection status of stray dogs at the same animal shelter as
investigated in this study in which 130 of 1,143 stray dogs
(11.4%) showed positive reaction to D. immitis on SNAP®
3Dx® test, while only one dog each showed seropositive
to E. canis and B. burgdorferi, respectively [18].
Since the first report of D. immitis in dogs from Korea
was published in 1962 [19], there have been several studies on the epidemiology of canine dirofilariasis in Korea.
The prevalence of D. immitis for instance, was 31.2% using
an antigen test (Heartworm SNAP® test, IDEXX, Inc.) in
outdoor dogs and 2.8% in indoor dogs from Busan, Korea
[12], and that in German shepherd using and antigen test
(DiroCHEK®, Synbiotics Co., USA) was 28.3% [13]. In
our studies, the prevalence of D. immitis in both hunting
and stray dogs was similar to those of previous studies on
outdoor dogs. In contrast to relatively low prevalence rate
in dogs from the USA (1.4%) [20], the prevalence of D.
immitis in dogs from Korea was high in general, possibly
because of better public apprehension and prophylactic
programs carried in the USA than in Korea.
Little information is available about the infection status of
dogs with A. phagocytophilum which is also responsible for
human granulocytic anaplasmosis [21]. Although the
prevalence of A. phagocytophilum in ticks collected from
small mammals at U.S. military installations and training
sites was 25.9% as identified by DNA analysis in Korea
[10], only one clinical case due to A. platys has so far been
reported in dogs [22], and our study is the first report
about seroprevalence of A. phagocytophilum in dogs from
Korea. In the USA, the mean prevalence of A. phagocytophilum seroreactivity in dogs was reported to be 4.8% by
SNAP®4Dx® test [20]. In contrast to previous studies, hunting dogs in our study show a high prevalence of A. phagocytophilum seroreactivity (18.8%), presumably due to frequent exposure of dogs to vector ticks during hunting in
wooded mountains of Korea. Information on the species
of ticks collected from hunting dogs in our study will be
available in a separate article. It is possible that some dogs
with seroreactivity to A. phagocytophilum were actually seropositive for A. platys because both A. phagocytophilum and
A. platys exist among ticks in Korea [10] and because the
SNAP®4Dx® cannot distinguish infection between A. phagocytophilum and A. platys in dogs. Further molecular-based
studies will be necessary to distinguish between these two
pathogens in seropositive dogs.
The prevalence of E. canis in ticks of Korea was 1.1%,
as identified by DNA analysis [10], and the seroprevalence of E. canis in dogs (German shepherd) using the
IDEXX® 3Dx® test was reported to be 13% in female
and 11.6% in male [23]. Both E. canis and E. chaffeensis
are present in Korea, as detected from ticks [10]. Since
SNAP® 3Dx® and 4Dx® tests are known not to be able to
distinguish between E. canis and E. chaffeensis infections
in dogs [24], it will be necessary to distinguish them by
further investigation.
B. burgdorferi is a zoonotic pathogen because it causes
Lyme disease in humans and infects some domestic mammals including dogs. In Korea, the seroprevalence of B.
burgdorferi was reported to be 2.6% in female and 5.8% in
male German shepherd dogs [23] and more than 4 clinical
human cases have been reported [25]. B. burgdorferi was
also isolated from ticks in 1992 [26]. The seroprevalence
rate of B. burgdorferi in dogs was 1.3% in U.S [20] and
0.6% in Spain [27]. In our studies, the prevalence of B.
burgdorferi in hunting dogs (2.2%) was similar to that of a
previous study in German shepherd dogs in Korea [23].
In conclusion, this study indicates that hunting dogs
are frequently exposed to D. immitis, A. phagocytophilum,
E. canis, and B. burgdorferi in Korea while urban stray dogs
are exposed mainly to D. immitis. Since canine vectorborne diseases can cause severe clinical illness such as
pulmonary disease, lameness, fever and anorexia and
can also potentially cause severe diseases in humans,
dogs must be examined for the presence of vector-borne
diseases.
competing interests
The authors declare that they have no competing interests.
Authors’ contributions
SL, PJI, SRL and SSS conceived the paper and wrote the
manuscript. MHO, KSA, and BYM assisted in laboratory
studies.
Acknowledgements
This study is supported in part by a grant from the
Australia-Korea Foundation of the Department of Foreign
Affairs and Trade, PO Box 5050, Kingston Act 2604,
Australia and the graduate fellowship provided by the
Korean Ministry of Education, Science and Technology
through the Brain Korea 21 project. Publication of this
thematic series has been sponsored by Bayer Animal
Health GmbH.
163
Parasites & Vectors 2010, 3:32
(http://www.parasitesandvectors.com/content/3/1/32)
The original article is published as an open access article
distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/
by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work
is properly cited.
References
1.
Kim Hc, pacha la, lee WJ, lee JK, Gaydos Jc, sames
WJ, lee Hc, bradley K, Jeung GG, tobler sK, Klein ta:
Malaria in the Republic of Korea, 1993-2007.
Variables related to re-emergence and persistence of Plasmodium vivax among Korean
populations and U.S. forces in Korea. Mil Med
2009, 174:762-769.
2. Miyoshi t, tsubouchi H, iwasaki a, shiraishi t, nabeshima
K, shirakusa t: Human pulmonary dirofilariasis:
a case report and review of the recent Japanese literature. Respirology 2006, 11:343-347.
3. shapiro Ed, Gerber Ma: Lyme disease. Clin Infect Dis
2000, 31:533-542.
4. perez M, bodor M, Zhang c, Xiong Q, rikihisa y:
Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann N Y
Acad Sci 2006, 1078:110-117.
5. Kocianova E, Kost’anova Z, stefanidesova K, spitalska E,
boldis V, Huckova d, stanek G: Serologic evidence
of Anaplasma phagocytophilum infections in
patients with a history of tick bite in central
Slovakia. Wien Klin Wochenschr 2008, 120:427-431.
6. otranto d, dantas-torres F, breitschwerdt Eb: Managing canine vector-borne diseases of zoonotic
concern: part one. Trends Parasitol 2009, 25:157-163.
7. irwin pJ: canine babesiosis: from molecular
taxonomy to control. Parasit Vectors 2009,
2 Suppl 1:s4.
8. inokuma H, ohno K,yamamoto s: Serosurvey of
Ehrlichia canis and Hepatozoon canis infection in dogs in Yamaguchi Prefecture, Japan.
J Vet Med Sci 1999, 61:1153-1155.
9. isogai E, isogai H, sato n,yuzawa M, Kawakami M:
Antibodies to Borrelia burgdorferi in dogs in
Hokkaido. Microbiol Immunol 1990, 34:1005-1012.
10. Kim cM,yi yH,yu dH, lee MJ, cho Mr, desai ar,
shringi s, Klein ta, Kim Hc, song JW, baek lJ, chong
st, o’guinn Ml, lee Js, lee iy, park JH, Foley J, chae Js:
tick-borne rickettsial pathogens in ticks and
small mammals in Korea. Appl Environ Microbiol
2006, 72:5766-5776.
164
11. Kim cM, Kim Jy,yi yH, lee MJ, cho Mr, shah dH, Klein
ta, Kim Hc, song JW, chong st, o’Guinn Ml, lee Js,
lee iy, park JH, chae Js: Detection of Bartonella
species from ticks, mites and small mammals
in Korea. J Vet Sci 2005, 6:327-334.
12. byeon KH, Kim bJ, Kim sM,yu Hs, Jeong HJ, ock Ms:
A serological survey of Dirofilaria immitis
infection in pet dogs of Busan, Korea, and
effects of chemoprophylaxis. Korean J Parasitol
2007, 45:27-32.
13. lee Jc, lee cy, shin ss, lee cG: A survey of
canine heartworm infections among German
shepherds in South Korea. Korean J Parasitol 1996,
34:225-231.
14. byun JW, park yi, lee os, shim Hs, cho KM,yoon ss:
Prevalence of canine dirofilariasis of the stray
dogs in Korea. Korean J Vet Pub Health 2007, 31:15-19.
15. song KH, lee sE, Hayasaki M, shiramizu K, Kim dH, cho
KW: Seroprevalence of canine dirofilariosis in
South Korea. Vet Parasitol 2003, 114:231-236.
16. Wee sH, lee JG, Kim Jt: Prevalence of Dirofilaria
immitis infection in dogs of chuncheon area.
Korean J Vet Pub Health 2001, 25:229-232.
17. Kim cM, Kim Ms, park Ms, park JH, chae Js: Identification of Ehrlichia chaffeensis, Anaplasma
phagocytophilum, and A. bovis in Haemaphysalis longicornis and Ixodes persulcatus ticks
from Korea. Vector Borne Zoonotic Dis 2003, 3:17-26.
18. Myung by,yi yK, paik iy, chung GM, lim s, suh GH,
Kang ss, shin ss: the disease status of stray
dogs admitted to an animal shelter in
Gwangju, Korea. Korean J Vet Res 2009, 49:297-307.
19. bak ub, lee Hs: Studies on the infection rate
of Dirofilaria immitis in chinju area by use of
blood test and intracutaneous test. Jinju Agr
Univ Report 1962, 1:54-58.
20. bowman d, little sE, lorentzen l, shields J, sullivan Mp,
carlin Ep: Prevalence and geographic distribution of Dirofilaria immitis, Borrelia burgdorferi, Ehrlichia canis, and Anaplasma phagocytophilum in dogs in the United States: results
of a national clinic-based serologic survey.
Vet Parasitol 2009, 160:138-148.
21. rodgers sJ, Morton rJ, baldwin ca: A serological
survey of Ehrlichia canis, Ehrlichia equi,
Rickettsia rickettsii, and Borrelia burgdorferi in
dogs in oklahoma. J Vet Diagn Invest 1989, 1:154-159.
22. lee sJ, lee MJ, chae Js, na KJ: Diagnosis of anaplasmosis by PcR and long term medication
in a dog. Korean J Vet Clin 2005, 22:170-173.
23. lee sE, song KH, lee sH: Survey of Ehrlichia canis
and Borrelia burgdorferi antibodies in dogs
(German shepherd) reared in Korea. Korean J
Vet Res 2007:281-284.
24. o’connor tp, Hanscom Jl, Hegarty bc, Groat rG,
breitschwerdt Eb: comparison of an indirect
immunofluorescence assay, western blot
analysis, and a commercially available eLISA
for detection of Ehrlichia canis antibodies in
canine sera. Am J Vet Res 2006, 67:206-210.
25. lee d, Kim sH, Hong sK, seo JK, sung Hs, Hwang sW:
A case of Lyme disease with various general
symptoms (case Report). Korean J Dermatol 2008,
46:1112-1116.
26. park KH, lee sH, chang WH, Won WJ, chang WJ: Isolation of Borrelia burgdorferi, the causative
agent of Lyme disease, from Ixodes ticks in
Korea. J Korean Soc Microbiol 1992, 27:307-312.
27. solano-Gallego l, llull J, osso M, Hegarty b, breitschwerdt E: A serological study of exposure to
arthropod-borne pathogens in dogs from
northeastern Spain. Vet Res 2006, 37:231-244.
165
Parasites & Vectors, edited by chris
arme, is an open access, peer-reviewed
online journal dealing with the biology of
parasites, parasitic diseases, intermediate
hosts and vectors. articles published in
this journal are available with no subscription charges or barriers to access,
and authors retain the copyright of their
material and may use it, or distribute it,
as they wish.
www.parasitesandvectors.com
IMPoRteD AnD tRAVeLLInG DoGS AS cARRIeRS
oF cAnIne VectoR-BoRne PAtHoGenS In
GeRMAnY
briGittE MEnn1*, susannE lorEntZ2*, torstEn naucKE2,3,4§
institutE For ZooMorpHoloGy, cytoloGy and parasitoloGy, HEinricH HEinE uniVErsity, duEssEldorF, GErMany
parasitus EX E.V., niEdErKassEl, GErMany
3
dEpartMEnt oF ZooloGy, diVision oF parasitoloGy, uniVErsity oF HoHEnHEiM, stuttGart, GErMany
4
laboKlin GMbH & co. KG, bad KissinGEn, GErMany
1
2
*tHEsE autHors contributEd EQually to tHis WorK
corrEspondinG autHor
§
EMail: tJnaucKE@aol.coM
Abstract
Background
With the import of pets and pets taken abroad, arthropod-borne diseases have increased in frequency in German
veterinary practices.This is reflected by 4,681 dogs that have been either travelled to or relocated from endemic areas
to Germany. The case history of these dogs and the laboratory findings have been compared with samples collected
from 331 dogs living in an endemic area in portugal.the various pathogens and the seroprevalences were examined to
determine the occurrence of, and thus infection risk, for vector-borne pathogens in popular travel destinations.
Results
4,681 dogs were examined serological for Leishmania infantum, Babesia canis and Ehrlichia canis. buffy coats were
detected for Hepatozoon canis and blood samples were examined for microfilariae via the Knott’s test. The samples
were sent in from animal welfare organizations or private persons via veterinary clinics. upon individual requests, dogs
were additionally examined serological for Anaplasma phagocytophilum, Borrelia burgdorferi and Rickettsia conorii. overall
B. canis was the most prevalent pathogen detected by antibody titers (23.4 %), followed by L. infantum (12.2 %) and
E. canis (10.1 %). Microfilariae were detected in 7.7 % and H. canis in 2.7 % of the examined dogs. in 332/1862 dogs
A. phagocytophilum, in 64/212 B. burgdorferi and in 20/58 R. conorii was detected. of the 4,681 dogs, in total 4,226 were
imported to Germany from endemic areas. Eighty seven dogs joined their owners for a vacation abroad. in comparison
to the laboratory data from Germany, we examined 331 dogs from portugal. the prevalence of antibodies/pathogens
we detected was: 62.8 % to R. conorii, 58 % to B. canis, 30.5 % to A. phagocytophilum, 24.8 % to E. canis, 21.1 % to H. canis
(via pcr), 9.1 % to L. infantum and 5.3 % to microfilariae.
conclusions
the examination of 4,681 dogs living in Germany showed pathogens like L. infantum that are non-endemic in Germany.
Furthermore, the German data are similar in terms of multiple pathogen infection to the data recorded for dogs from
Portugal. Based on these findings the importation of dogs from endemic predominantly Mediterranean regions to Germany as well as travelling with dogs to these regions carries a significant risk of acquiring an infection. Thus we would
conclude that pet owners seek advice of the veterinarians prior to importing a dog from an endemic area or travel to
such areas. in general, it might be advisable to have a European recording system for translocation of dogs.
166
Background
The zoogeographical range of pathogens of arthropodborne diseases is restricted by the distribution areas of
their vectors and hosts [1]. Dogs are competent reservoir
hosts of several zoonotic pathogens and can serve as a
readily available source of nutrition for many blood-feeding arthropods [2]. Increasing pet tourism and importation of animals from endemic areas present German veterinary practitioners increasingly with exotic diseases, like
leishmaniosis, babesiosis, ehrlichiosis and dirofilariosis
[3-7]. The frequency of dog-tourism and -import was first
reported in the study of Glaser and Gothe, who analyzed
5,340 questionnaires in the years 1985 to 1995 [4]. The
results revealed a steady increase of dogs taken abroad,
rising from 31.1% in 1990 to 40.8% in 1994. Also in
the United Kingdom an increasingly mobility of pets is
conspicuous. Since February 2000 every pet entering the
United Kingdom is registered in conjunction with the
Pet Travel Scheme (PETS) and the released data show a
steadily increase from 14,695 pets in the year 2000 up to
82,674 pets in the year 2006 [8,1]. Besides the registration
of departure and entry, pets have to run through a serology and ecto- and endoparasiticidal treatment 24-48 h
before re-entry to the United Kingdom [1]. This is important, because pets travelling abroad are exposed to various
arthropodborne diseases, especially in the popular destinations of the Mediterranean area and Portugal [4,7,9]. In
addition to the pets joining their owners for a vacation, a
large number of dogs, is imported to Germany by tourists
or animal protection societies [3,4,10,11]. While born
and raised in the endemic area - their country of origin
– imported dogs have an increased risk of contracting a
canine vector-borne disease (CVBD) [5].
National and international investigations are necessary to
be able to estimate topical risks, both in endemic and in
currently non-endemic regions. This information would
suggest how to avoid an import of pathogens, e.g. with
the help of preventive measures. The increased mobility of pets is an important matter in the extension of
the zoogeographical ranges for many arthropod-borne
pathogens [1]. A previously non-endemic region may
become endemic tomorrow. This risk is supported by the
first autochthonous cases in Germany published for infections with H. canis [12], L. infantum [13], E. canis [14] and
D. repens [15,16]. These are pathogens of traditional so
called travel-related diseases.
To obtain an overview of the situation of travelling, and
particularly imported dogs, the results of the diagnosed
4,681 dog samples between July 2004 and December
2009 are analyzed epidemiologically- including information of origin countries and length of vacation. To compare the data from non-endemic diseases in Germany a
randomly selected endemic area in Portugal was selected.
Blood- samples of 331 dogs from Portugal were examined
during the years 2007 and 2008 for examination of CVBD
pathogens and their seroprevalences.
Results
In the present study we included the findings from
4,681 dog blood samples collected between July 2004
and December 2009 and additional 331 samples from
Portuguese dogs on the occurrence of single and multiple infections of the following CVBD’s: L. infantum,
E. canis, B. canis, microfilariae and H. canis. L. infantum,
E. canis and B. canis were detected serological using the
Immunofluorescence Antibody Test (IFAT). All samples
were examined for microfilariae using the Knott’s test and
buffy coats were detected for gamonts of H. canis. The
331 Portuguese samples were additionally examined for
H. canis via PCR. A. phagocytophilum and R. conorii were
detected serological in the Portuguese and in 1862 and 58
samples of the laboratory diagnosed data. Additional 212
samples of the laboratory diagnosed data were examined
serological for B. burgdorferi.
Results of the 4,681 samples diagnosed from July,
2004 to December, 2009
4,226 of the 4,681 were imported dogs from various
endemic regions (90.3%). Eighty-seven dogs were of
German origin and accompanied their owners for vacation to endemic areas (1.8%). For 368 dogs, or 7.9% of
the sample, the documentation sheet was incomplete,
thus these dogs could not be allocated to either other
group.
From the total of 4,226 imported dogs, 2,906 (68.8%)
were born either in Portugal (n = 928) or in countries bordering the Mediterranean, especially Spain (n = 1,162),
Italy (n = 367), Greece (n = 267) and Turkey (n = 106),
but also in France (n = 37), Malta (n = 18), Croatia (n =
17) and Slovenia (n = 4).
A total of 1,320 (31.2%) of the 4,226 imported dogs were
born in European countries beyond the Mediterranean
region, mostly in Hungary (n = 1,013) and Romania (n =
279). Twenty-eight other dogs were born in Bulgaria (n =
14), Poland (n = 8), Switzerland (n = 2), Denmark (n =
1), Austria (n = 1), Holland (n = 1) and Czech Republic
(n = 1).
78.2% of 87 dogs which had accompanied their owners
abroad, travelled to Mediterranean countries: Spain (n
= 22), Italy (n = 21), France (n = 10), Turkey (n = 8),
Croatia (n = 3), Greece (n = 3) and Portugal (n = 1).
Less than a quarter of the dogs (21.8%) traveled to
Hungary (n = 7), Austria (n = 3), Denmark (n = 3),
Switzerland (n = 2), Belgium (n = 1), Czech Republic (n
= 1), Great Britain (n = 1) and Holland (n = 1).
The prevalence of antibodies was: 24.3% to B. canis (n
167
4500
3507
3682
4000
4309
4308
4548
5000
3500
3000
2500
questionable
33
64
115
B. burgdorferi
2
20
R. conorii 36
microflilariae
47
332
372
133
H. canis
negatve
A. phagocytophilum
positive
B. canis
E. canis
L. infantum
0
36
61
492
430
500
569
1000
1138
1500
1481
2000
Figure 1
number of pathogens detected by iFat, bc and Knott’s test in 4,681 German dogs send in from animal welfare organizations
and private persons between July 2004 and december 2009. numbers of positive, negative and questionable test results of a
total of 4,681 dogs sent in from animal welfare organizations and private persons. blood samples were examined by means of
Knott’s test for microfilariae. The samples were tested on H. canis with the help of the examination of the buffy coats (bc).
the seroprevalences of B. canis, E. canis and L. infantum were determined by means of Immunofluorescence Antibody Test
(iFat). in 1,862 cases the seroprevalence of A. phagocytophilum, in 212 cases of B. burgdorferi and in 58 cases of R. conorii were
examined.
168
= 1,138), 12.2% to L. infantum (n = 569) and 10.1% to
E. canis (n = 492). Microfilariae and H. canis were detected in 372 (7.7%) and 133 dogs (2.2%), respectively.
Antibodies to A. phagocytophilum were detected in 17.8%
(n = 334) out of 1862 tested dogs, B. burgdorferi in 30.2%
(n = 64) of 212 dogs and R. conorii in 34.5% (n = 20) of
58 dogs. The results are illustrated in Figure 1.
With the help of the Knott’s test we found microfilariae in
21 samples (5.3%). The results are summarized in Figure 2.
With help of the acid phosphatase staining and morphological surveys, 8 microfilariae of the species Acanthocheilonema (Dipetalonema) dracunculoides, 7 of Dirofilaria
immitis and 6 of Acanthocheilonema (Dipetalonema) – were
detected in the dog samples.
Results of the 331 examined dog samples from
Portugal
From the total of 331 autochthonous Portuguese dogs
tested, 208 showed antibodies to R. conorii (68.2%). The
prevalence of the other antibodies detected was: 58% to
B. canis (n = 192), 30.5% to A. phagocytophilum (n = 101),
24.8% to E. canis (n = 82) and 9.1% to L. infantum (n =
30). Using PCR to detect DNA for H. canis, 70 dogs had a
positive result (21.1%). Screening the buffy coats, we
detected gamonts of H. canis in 62 of the samples (18.7%).
Single and multiple infections in German and
Portuguese dogs
In both the German and Portuguese dogs double and
even multiple CVBD infections were detected. In 56.3%
of the German dogs investigated (n = 2,637) no antibodies or pathogens were found. In 28.7% of the dogs, antibodies or one pathogen could be detected (n = 1,341).
Altogether in 10.7% an infection with two pathogens
(n = 502) was found. In 4.3% of the dogs an infection
with more than two pathogens (n = 201) was determined.
70
18
questionable
R. conorii
negatve
A. phagocytophilum
B. canis
positive
H. canis
E. canis
L. infantum
0
microflilariae
10
21
32
30
50
82
100
101
150
123
139
200
208
192
250
212
239
269
300
261
310
350
Figure 2
number of pathogens detected by iFat, pcr and Knott’s test in 331 autochthonous dogs from kennels/shelters in portugal.
number of positive, negative and questionable test results of a total of 331 dogs from portugal. blood samples were examined
by means of Knott’s test for microfilariae and on H. canis with the help of the polymerase chain reaction (pcr). the seroprevalences of A. phagocytophilum, B. canis, E. canis, L. infantum and R. conorii were determined by means of Immunofluorescence
antibody test (iFat).
in %
60
n = 4,681
n = 331
56,3
50
40
28,7
30
24,5
26,9
20
16,9
13
12,1
10,7
10
4,5
0
0
1
German dogs
2
3
0,7
0,1
4
5
0
1
2
3
4
5
2,1
6
Portuguese dogs
number of detected pathogens and accordingly seropositve results
positive
negatve
Figure 3
single and multiple infections detected by iFat, pcr, bc and Knott’s test in 4,681 German and 331 portuguese dogs.
percentage of single, double and multiple infections left from altogether 4,681 German dogs and right from 331 portuguese dogs.
169
In contrast to the data from the German dogs, 26.9% of
the Portuguese dogs had an infection with two pathogens
(n = 89) and in 35.6% of the dogs (n = 118) multiple
infections could be detected. Only in 43 dogs (13%) no
antibodies or pathogens could be detected. These data are
shown in Figure 3.
Discussion
The study reported here was conducted to evaluate the
health status of dogs living in Germany that had either
traveled to or were imported from CVBD endemic regions
and a comparison was made with an autochthonous
Portuguese group of dogs. The results of the 4,681 German
dogs clearly indicates that the importation of dogs to
Germany is still an explosive topic. Altogether 4,226 dogs
were imported to Germany, 2,906 from the Mediterranean
area including Portugal. These areas have a considerable
prevalence of canine arthropodborne diseases [5,9,17-24].
Serological testing detects basically chronic and inconspicuous infections and is limited by reduced ability to
identify acute infections. In the present study we choose
the immunofluorescence antibody test to detect antibodies to L. infantum, B. canis, E. canis, A. phagocytophilum,
R. conorii and B. burgdorferi. Many dogs appear to be able
to support chronic infection with vector-borne pathogens
for months or even years without displaying obvious
deleterious effects [25]. In most cases, dogs without clinical signs and without acute infections, are imported to
Germany mostly by animal welfare organizations. With
the IFAT, we were aiming to detect clinically inconspicuous infections, in dogs that can be infected with one or
even more pathogens. These asymptomatic carriers play a
very important role in the epidemiology of zoonotic infection as they are still infectious to the vectors.
B. canis was with 1,158 dogs (24.3%) the most diagnosed for German dogs followed by L. infantum (12.2%),
E. canis (10.1%) and infections with microfilariae (7.7%)
and H. canis (2.2%). In contrast R. conorii is the most
detected antigen in the Portuguese dogs (68.2%) followed by B. canis (58%), A. phagocytophilum (30.5%),
E. canis (24.8%), H. canis (21.1%), L. infantum (9.1%) and
microfilariae (5.3%). Differences between the German
and Portuguese dogs can caused by the wide spectrum
of countries of origin and destinations dogs travelled to.
The spectrum of pathogens and vectors differs in different
countries. For example Hepatozoon is detected just in 0,7%
of 153 examined dogs from Greece [9] but in 48% of 301
examined foxes in Portugal [23]. These data are similar
to the number of H. canis detected in the 331 Portuguese
dogs. Rickettsia and Anaplasma data are only available for
58 and 1862 German dogs. They could be more similar to
the Portuguese results if more samples were detected.
DNA of H. canis was examined in 70/331 dogs from
170
Portugal but only in 62 of the examined 331 buffy coat
smears gamonts of H. canis could be detected. Infections
with a low rate of gametocyte-containing leucocytes
are difficult to detect, that could be a reason why in 28
samples H. canis DNA is found via PCR but no gamont
in the buffy coats. But there are 20 cases with definitive
diagnosis of H. canis gamonts in the blood smears and
no findings of DNA via PCR. So it is advisable to employ
various diagnostic techniques to achieve a definitive
etiological diagnosis of CVBDs, whenever available and
economically feasible [26].
Altogether, in 10.2% of the German dogs and in 26.9%
of the Portuguese dogs, an infection with two pathogens
could be detected. In 4.3% of the dogs from Germany and
in 35.6% of the dogs from Portugal multiple infections were
found. This indicates that multiple infections are frequent
within imported pets – and probably also within pets taken
abroad. Clinical signs of dogs infected with more than one
pathogen are often non-specific and very variable, such as
wasting, weight loss, fever and poor appetite or anorexia,
making a definite diagnosis difficult [27].
All in all, dog-tourism and -import confront practicing
veterinarians increasingly with rare or still unknown
arthropod-borne diseases. In addition, the expanding
import and the travelling of dogs can lead to a spread of
pathogens and vectors in Germany. These dogs may act
as a source of infection for local and still pathogen-free
vector populations. Also there is a risk that imported dogs
infested with infected vectors might contribute to the further spread of travel related diseases in Germany [3].
conclusions
Frequent investigations – particularly in popular holiday
destinations - are important to estimate the local risk. For
the corresponding countries, specific methods in prophylaxis, diagnostics and therapy must be elaborated. The
consultation of pet-owners with a veterinarian prior to
importation of a dog or a journey with their pets to endemic regions is important to either limit importation or establish preventative measures prior to traveling. Prophylactic
measures must be in place against vectors, to reduce the
likelihood of transmission of vector-borne pathogens, like
ectoparasiticides with repellent properties. It would be
advisable to create a European recording system for translocation of dogs that register every departure and entry of
pets. Standardized serology and ecto- and endoparasiticidal treatments before a re-entry to a non-endemic area
should be regularized, like in the United Kingdom [1].
Methods
During the period of July 2004 to December 2009 blood
samples of 4,681 dogs were sent in mostly for random
examinations by welfare organizations and private per-
sons via veterinary practitioners. The samples were not
accompanied by a case history of the dogs, nor is any
information available on the health status. The dog
samples examined serological for the following pathogens: L. infantum, B. canis and E. canis. All samples were
examined for microfilariae using the Knott’s test and
buffy coats were detected for gamonts of H. canis. 1,862
of the sample were examined serological additional
for A. phagocytophilum, 212 samples for B. burgdorferi and
58 samples for R. conorii.
In the autumn of 2007 and 2008, altogether blood
samples of 331 dogs from kennels and shelters from
the western part of Algarve/Portugal were collected.
Blood samples were collected from brachial veins, 1 ml
kept for the Knott’s test and centrifuged at 1000 × g for
5 min. Buffy coat smears were exposed, sera separated
and stored at -20°C. The dog samples examined serological for the following pathogens: L. infantum, B. canis,
E. canis, A. phagocytophilum and R. conorii. The samples were
examined for microfilariae using the Knott’s test and for
H. canis via PCR and screening the buffy coats.
All examinations were conducted in the same laboratory
with the same methods, except the H. canis PCR.
d0640-S, MegaScreen FLUOANAPLASMA ph.®, 11211-N,
MegaScreen FLOURICKETTSIA con.® 10447-I, MegaScreen
FLUOBORRELIA dog®, d1560-L, – Mega Cor Diagnostik
GmbH, Hörbranz, Austria). The slides were exposed to
sera diluted (1:50) in phosphate buffer solution (PBS,
pH 7.2) in a moist chamber and, after washing, to
fluorescence labeled anti-dog IgG conjugate (anti-dog
IgG, MegaCor, Diagnostik GmbH, Hörbranz, Austria);
both incubations were at 37°C for 30 min. Slides were
observed under a fluorescence microscope at ×40 magnifications and samples were scored positive when they
produced cytoplasmatic inclusion bodies fluorescence.
The positive cut-off adopted was at a dilution of 1:50 and
all positive sera were titred.
Direct pathogen evidence – Knott’s test, Buffy Coat, PCR
All EDTA samples were screened for the presence of microfilariae using a modified Knott’s test [28]. For the modified Knott’s test, 1 ml EDTA blood is mixed with 5 ml of
2% formaldehyde solution in a 15 ml centrifuge tube
and centrifuged at 400 × g for 5 min. The supernatant is
discarded. The sediment is transferred to glass slides, covered with coverslips and examined by light microscopy at
×10 and ×40 magnifications. Positive Knott’s tests were
evaluated with the help of the acid phosphatase staining
(1.16304.0002. LEUCOGNOST® SP, Merck, Darmstadt,
Germany) following the manufacturer’s instructions.
For creation of the buffy coats, the blood was centrifuged (1000 × g for 5 min), buffy coat was removed and
exposed on glass slides. Buffy coats were stained with
May Grünwald’s Giemsa (Merck, Darmstadt, Germany)
and examined by light microscopy at ×40 magnification. Samples of the 331 Portuguese dogs were examined
additionally via a Polymerase Chain Reaction (PCR) on
H. canis at the laboratory Laboklin GmbH & Co. KG
(Bad Kissingen, Germany) according to their established
method.
Authors’ contributions
Acknowledgements
This research was financially supported by the Bayer Vital
GmbH and Bayer Healthcare AG as well as Parasitus
Ex e.V. Many thanks to Norbert Mencke for his helpful
comments on the manuscript and to Dr. Gaby Clemens
and Johannes von Magnis for help and support in the
fieldwork. Publication of this thematic series has been
sponsored by Bayer Animal Health GmbH.
All the authors have contributed substantially to this
study. BM, SL and TJN designed the field studies and carried out the laboratory studies. BM and SL participated in
the field studies. BM drafted the manuscript. All authors
read and approved the final manuscript.
competing interests
The authors declare that they have no competing interests.
Parasites & Vectors 2010, 3:34
(http://www.parasitesandvectors.com/content/3/1/34)
The original article is published as an open access article
distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/
by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work
is properly cited.
Indirect pathogen evidence – IFAT
Immunofluorescence Antibody Test (IFAT) was performed
by using commercial kits for L. infantum, B. canis, E. canis,
A. phagocytophilum, R. conorii and B. burgdorferi (MegaScreen
FLUOLEISH®, d4170-L, MegaScreen FLUOBABESIA
canis®, 19017-Q, MegaScreen FLUOEHRLICHIA canis®,
171
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
172
shaw sE, day MJ, birtles rJ, breitschwerdt Eb: tickborne infectious diseases of dogs. Trends Parasitol 2001, 17:74-80.
otranto d, dantas-torres F, breitschwerdt Eb: Managing canine vectorborne diseases of zoonotic
concern: part one. Trends Parasitol 2009, 25:157-163.
Glaser b, Gothe r: Imported arthropod-borne
parasites and parasitic arthropods in dogs:
Spectrum of species and epidemiological
analysis of the cases diagnosed in 1995 and
1996. Tierärztl Prax 1998, 26:40-46.
Glaser b, Gothe r: tourism and import of dogs:
An inquiry in Germany on the extent as
well as on the spectrum and preference of
countries concerning stay abroad and origin,
respectively. Tierärztl Prax 1998, 26:197-202.
Weise M: Relevant species of the canine
parasite fauna in european Mediterranean
countries and Portugal for dogs in Germany
concerning epidemiology and travel veterinary medicine – a literature review. PhD thesis
university Munich, Faculty of Veterinary Medicine 2004.
Beelitz P, Pfister K: Diagnosis and treatment of
exotic diseases in travelling dogs. Tierärztl Prax
2004, 32:158-165.
Hirsch M, pantchev n: occurrence of the travel
diseases leishmaniosis, ehrlichiosis, babesiosis and dirofilariosis in dogs living in Germany. Kleintierprax 2008, 53:154-165.
Defra department for environment Food
and Rural Affairs. [http://www. defra.gov.uk/
wildlife-pets/pets/travel/pets/procedures/stats.htm].
Jensen J, Müller E, daugschies a: arthropod-borne
diseases in Greece and their relevance for
pet tourism. Prakt Tierarzt 2003, 84:430-438.
daugschies a: Import of parasites by tourism
and animal trading. Dtsch Tierärztl Wschr 2001,
108:348-352.
deplazes p, staebler s, Gottstein b: travel medicine
of parasitic diseases in the dog. Schweiz Arch
Tierheilk 2006, 9:447-461.
Gärtner s, Just Ft, pankraz a: Hepatozoon canis
infections in two dogs from Germany. Kleintierprax 2008, 53:81-87.
naucke tJ, Menn b, Massberg d, lozentz s: Sandflies
and leishmaniasis in Germany. Parasitol Res 2008,
103(Suppl 1):65-68.
Jensen J, simon d, schaarschmidt-Kiener d, Müller W,
nolte i: Retrospective assessment of autochthone infection with Ehrlichia canis in dogs in
Germany. Tierärztl Prax 2007, 35:123-128.
Hermosilla c, pantchev n, dyachenko V, Gutmann M,
bauer c: First autochthonous case of canine
ocular Dirofilaria repens infection in Germany. Vet Rec 2006, 158:134-135.
16. pantchev n, norden n, lorentzen l, rossi M, rossi u,
brand b, dyachenko V: current Surveys on the
Prevalence and Distribution of Dirofilaria
spp. in Dogs in Germany. Parasitol Res 2009,
105:63-74.
17. solano-Gallego l, lull J, osso M, Hegarty b, breitschwerdt E: A serological study of exposure to
arthropod-borne pathogens in dogs from
northeastern Spain. Vet Res 2006, 37:231-244.
18. tabar Md, Francino o, altet l, sánchez a, Ferrer l,
roura X: PcR survey of vectorborne pathogens in dogs living in and around Barcelona,
an area endemic for leishmaniosis. Vet Rec
2009, 164:112-116.
19. torina a, caracappa s: Dog tick-borne diseases in
Sicily. Parassitologia 2006, 48:145-147.
20. otranto d, dantes-torres F: canine and feline
vector-borne diseases in Italy: current situation and perspectives. Parasit Vectors 2010, 3:2.
21. cardoso l, costa a, tuna J,Vieira l, Eyal o,yisascharMekuzas y, baneth G: Babesia canis canis and
Babesia canis vogeli infections in dogs from
northern Portugal. Vet Parasitol 2008, 156:199-204.
22. alexandre n, santos as, núncio Ms, sousa r, boinas F,
bacellar F: Detection of Ehrlichia canis by polymerase chain reaction in dogs from Portugal.
Vet J 2009, 181:343-344.
23. conceição-silva FM, abranches p, silva-pereira Mcd,
Janz G: Hepatozoonosis in foxes from Portugal. J Wildl Dis 1988, 24:344-347.
24. cortes s, afonso Mo, alves-pires c, campino l: Stray
Dogs and Leishmaniasis in Urban Areas,
Portugal. Emerg Infect Dis 2007, 13:1431-1432.
25. breitschwerdt Eb: canine and feline anaplasmosis: emerging infectious diseases. Proceedings of
the 2nd Canine Vector-Borne Disease (CVBD) Symposium:
25-28 April 2007; Sicily, Italy 2007, 6-14.
26. otranto d, dantas-torres F, breitschwerdt Eb: Managing canine vectorborne diseases of zoonotic
concern: part two. Trends Parasitol 2009, 25:228-235.
27. Kordick sK, breitschwerdt Eb, Hegarty bc, southwick
Kl, colitz cM, Hancock si, bradley JM, rumbough r,
Mcpherson Jt, Maccormack Jn: coinfection with
multiple tick-borne pathogens in a Walker
Hound kennel in north carolina. J Clin Microbiol
1999, 37:2631-2638.
28. Euzeby J: Diagnostic expérimental des Helminthoses animales livre 1. Boulevard de Grenelle.
Paris 1981, 277-312.
173
cVBD WoRLD FoRUM MeMBeRS AnD
SYMPoSIUM PARtIcIPAntS
alonso aGuirrE
dVM, Ms, phd
Conservation Medicine
Wildlife Trust
460 W. 34th St, 17th Floor
New York, NY 10001
USA
aguirre@wildlifetrust.org
Mario andrEoli
dr. pharmaceutical chemistry
Bayer Animal Health GmbH
Head of Global Marketing
Companion Animals - Parasiticides
51368 Leverkusen
Germany
mario.andreoli@bayerhealthcare.com
bob artHEr
phd, Ms
Bayer HealthCare LLC
Animal Health
Parasitology / Entomology
PO Box 390
Shawnee Mission, KS 66201
USA
bob.arther.b@bayer.com
Gad banEtH
associate professor of
veterinary medicine,
dVM, ph.d. dipl. EcVcp
School of Veterinary Medicine
Hebrew University
P.O. Box 12
Rehovot 76100
Israel
baneth@agri.huji.ac.il
tobias boldt
Mba
Bayer Animal Health GmbH
Global Brand Manager Advantage, (K9)Advantix
Companion Animal Products
51368 Leverkusen
Germany
tobias.boldt@bayerhealthcare.com
patricK bourdEau
professor,
dVM, phd,
dipl. EVpc,
dipl. EcVd
174
Unité de Dermatologie,
Parasitologie CE, Mycologie
Ecole Nationale Vétérinaire, Agroalimentaire et de
l´Alimentation, Nantes-Atlantique (ONIRIS)
Atlanpole – La chantrerie
B-P 40706 – 44307 Nantes
Cedex 3
France
Patrick.bourdeau@oniris-nantes.fr
GillEs bourdoisEau
professor,
dVM, agrégé EnV,
dipl. EVpc,
directeur adjoint EnVl
Unité de Parasitologie, Mycologie,
Maladies Parasitaires
Ecole Nationale Vétérinaire de Lyon
1 av. Bourgelat
69280 Marcy l‘Etoile
France
g.bourdoiseau@vet-lyon.fr
dWiGHt d. boWMan
professor,
Ms, phd
Department Microbiology & Immunology
College of Veterinary Medicine
Cornell University
C4-119 VMC
Tower Road
Ithaca, NY, 14853-6401
USA
ddb3@cornell.edu
EdWard b. brEitscHWErdt
professor,
dVM, phd
Department of Clinical Sciences
College of Veterinary Medicine
North Carolina State University
4700 Hillsborough Street
Raleigh, NC, 27606
USA
ed_breitschwerdt@ncsu.edu
Gioia capElli
dVM, phd,
dipl. EVpc
Laboratorio di Parassitologia e Ecopatologia
Istituto Zooprofilattico Sperimentale delle
Venezie
35020 Legnaro – Padova
Italy
gcapelli@izsvenezie.it
luÍs cardoso
dVM, Msc, phd,
dipl. EVpc
Department of Veterinary Sciences
University of Trás-os-Montes e Alto Douro
PO Box 1013
5001-801 Vila Real
Portugal
lcardoso@utad.pt
FilipE dantas-torrEs
dVM, Msc, phd
Department of Veterinary Public Health
Faculty of Veterinary Medicine
University of Bari
Str. prov. per Casamassima Km3
70010 Valenzano, Bari
Italy
f.dantastorres@veterinaria.uniba.it
MicHaEl day
professor of Veterinary
pathology,
bsc, bVMs (Hons), phd,
dsc, dipl. EcVp, FasM,
Frcpath, FrcVs
Division of Veterinary Pathology, Infection
and Immunity
School of Clinical Veterinary Science
University of Bristol
Langford BS40 5DU
UK
M.J.Day@bristol.ac.uk
175
JEan-piErrE dEdEt
professor,
Md, bsc
Laboratoire de Parasitologie-Mycologie du CHU
de Montpellier
UMR 2724 (CNRS-Université Montpellier1/-IRD)
Centre National de Référence des Leishmania
Laboratoire de Parasitologie
39, Avenue Charles Flahautt
34295 Montpellier Cedex 5
France
parasito@univ-montp1.fr
GErHard doblEr
dr. med.
Department of Virology and Rickettsiology
Bundeswehr Institute of Microbiology
Neuherbergstrasse 11
80937 Munich
Germany
gerharddobler@bundeswehr.org
MarGarEt M. FairHurst
Head of Global Marketing
Bayer Animal Health GmbH
Global Marketing
51368 Leverkusen
Germany
margaretmary.fairhurst@bayerhealthcare.com
lluÍs FErrEr
professor,
dVM, phd,
dipl. EcVd
Department of Animal Medicine
Universitat Autònoma de Barcelona
Edifici A.
08193 Bellaterra
Cerdanyola del Vallés (Barcelona)
Spain
lluis.ferrer@uab.cat
ronan FitZGErald
b Vet Med., MrcVs
Bayer plc
Animal Health Division
Customer and Technical Services Manager
Bayer House
Strawberry Hill
Newbury
RG14 1JA
UK
ronan.fitzgerald@bayerhealthcare.com
diEGo Gatti
dVM, dr. med. vet.
Bayer HealthCare Italy
Animal Health Division
Product Manager,
Companion Animal Products
Viale Certosa, 130
20156 Milan
Italy
diego.gatti@bayerhealthcare.com
JoE HostEtlEr
dVM
Bayer HealthCare LLC
Animal Health
Veterinary Services Manager
PO Box 390
Shawnee Mission, KS 66201
USA
joe.hostetler.b@bayer.com
176
pEtEr J. irWin
associate professor,
small animal Medicine
b. vet. med., phd,
FacVsc, MrcVs
School of Veterinary and
Biomedical Sciences
Division of Health Sciences
Murdoch University
Murdoch, Western Australia, 6150
Australia
P.Irwin@murdoch.edu.au
VolKHard a. J. KEMpF
professor,
Md
director
Institut für Medizinische Mikrobiologie
und Krankenhaushygiene
Klinikum der Goethe-Universität
Paul-Ehrlich-Straße 40
60596 Frankfurt am Main
Germany
volkhard.kempf@kgu.de
brucE KilMEr
dVM
Bayer Inc.
Bayer HealthCare
Animal Health
77 Belfield Road
Toronto, Ontario
M9W 1G6
Canada
bruce.kilmer.b@bayer.com
barbara KoHn
professor,
dVM, dr. med. vet.
pd, dipl. EcViM-ca
Clinic of Small Animals
Faculty of Veterinary Medicine
Free University of Berlin
Oertzenweg 19b
14163 Berlin
Germany
kohn@vetmed.fu-berlin.de
MicHaEl r. lappin
professor,
dVM, phd
Department of Clinical Sciences
College of Veterinary Medicine and
Biomedical Sciences
Colorado State University
300 West Drake Road
Fort Collins, CO, 80523
USA
mlappin@colostate.edu
robbin l. lindsay
research scientist,
phd
National Microbiology Laboratory
Public Health Agency of Canada
1015 Arlington Street R3E
3R2 Winnipeg
Canada
Robbin_Lindsay@phac-aspc.gc.ca
susan E. littlE
professor,
Krull-Ewing Endowed chair
in Vet. parasitol.,
dVM, phd,
dipl. EVpc
Department of Pathobiology
Center for Veterinary Health Sciences
Oklahoma State University
250 McElroy Hall
Stillwater, OK, 74078-2800
USA
susan.little@okstate.edu
177
JoycE loGin
dVM
Bayer HealthCare LLC
Animal Health
Senior Technical Services Manager
PO Box 390
Shawnee Mission, KS 66201
USA
joyce.login.b@bayer.com
lEiF lorEntZEn
dVM
One IDEXX Drive
IDEXX
04092 Westbrook, Maine
USA
Leif-Lorentzen@IDEXX.com
ricardo G. MaGGi
research assistant professor,
Ms, phd
Intracellular Pathogens Research Laboratory
College of Veterinary Medicine
North Carolina State University
Research Bld. 432
4700 Hillsborough Street
Raleigh, NC, 27606
USA
rgmaggi@ncsu.edu
tHoMas MatHEr
professor
bs, Ms, phd
University of Rhode Island
Center for Vector-Borne Disease
231 Woodward Hall
9 East Alumni Avenue, Suite 7
Kingston, RI 02881
USA
tmather@uri.edu
JEnniFEr McQuiston
dVM, Ms
Rickettsial Zoonoses Branch
CDC
1600 Clifton Rd
Atlanta, GA 30333
USA
fzh7@cdc.gov
norbErt MEncKE
dVM, dr. med. vet.
dipl. EVpc
Bayer Animal Health GmbH
51368 Leverkusen
Germany
norbert.mencke@bayerhealthcare.com
GuadalupE MirÓ
associate professor,
dVM, phd, dipl. EVpc
Dpto. Sanidad Animal
Facultad de Veterinaria
Universidad Complutense de Madrid
Avda. Puerta de Hierro s/n
28040 Madrid
Spain
gmiro@vet.ucm.es
178
torstEn J. naucKE
dr. rer. nat.
Department of Zoology – Division of Parasitology
University of Hohenheim
70599 Stuttgart, Germany
Institute of Medical Microbiology
Immunology and Parasitology (IMMIP)
University Hospital Bonn
Sigmund-Freud-Str. 25
53105 Bonn, Germany
tjnaucke@aol.com
GaEtano oliVa
professor,
dVM, phd
Dip. to di Scienze Cliniche Veterinarie
Universita di Napoli
Federico II, Via F. Delpino I
80137 Napoli
Italy
gaeoliva@unina.it
doMEnico otranto
professor,
dVM, phd, dipl. EVpc
Department of Veterinary Public Health
Faculty of Veterinary Medicine
University of Bari
Str. prov. per Casamassima Km3
70010 Valenzano, Bari
Italy
d.otranto@veterinaria.uniba.it
stEFan pacHnicKE
phd, dVM
Bayer Vital GmbH
BV-TG-M-CPO
Leverkusen, K 56
Germany
stefan.pachnicke@bayerhealthcare.com
Martin pFEFFEr
professor,
dVM, dr. med. vet.,
dipl. EcVpH
Institut für Tierhygiene und Öffentliches
Veterinärwesen
Veterinärmedizinische Fakultät
Universität Leipzig
An den Tierkliniken 1
04103 Leipzig
Germany
pfeffer@vmf.uni-leipzig.de
bob rEEs
dVM, bVsc-, MacVsc
Bayer Australia
Animal Health Division
Technical Services Veterinarian
Brisbane
Australia
bob.rees@bayerhealthcare.com
Vitor ribEiro
MV, phd
Departamento de Medicina Veterinária
Pontifícia Universidade Católica de Minas Gerais
Rua do Rosário 1081, Bairro Angola
Betim, Minas Gerais
CEP 32630-000
Brazil
vitor@pucminas.br
179
XaViEr roura
dVM, phd,
dipl. EcViM-ca
Servei de Medicina Interna
Hospital Clínic Veterinari
Facultat de Veterinària
Universitat Autònoma de Barcelona
Bellaterra, 08193
Spain
xavier.roura@uab.cat
anGEl sainZ
associate professor,
dVM, phd
Dpto. de Medicina y Cirugía Animal
Facultad de Veterinaria
Universidad Complutense de Madrid
Ciudad Universitaria s/n
28040 Madrid
Spain
angelehr@vet.ucm.es
susan E. sHaW
bVsc (Hons), Msc,
dipl. acViM, FacVsc,
dipl. EcViM,
cert arts (arch),
MrcVs
sunGsHiK sHin
professor,
dVM, phd
School of Clinical Veterinary Science
University of Bristol
Langford House
Langford BS40 5DU
Bristol
UK
susan.e.shaw@bristol.ac.uk
College of Veterinary Medicine
Chonnam National University
300 Yongbong-dong, Gwangju
500–757
South Korea
sungshik@jnu.ac.kr
susannE siEbErt
dr. med. vet.
Global Brandmanager
Product Portfolio Support Global Marketing
Companion Animals
Building 6210
D-51368 Leverkusen
susanne.siebert@bayerhealthcare.com
laia solano-GallEGo
dVM, phd,
dipl. EcVcp
Department of Pathology and Infectious Diseases
The Royal Veterinary College
Hawkshead Lane
North Mymms
Hatfield, Hertfordshire AL9 7TA
UK
lsolano@rvc.ac.uk
dorotHEE stannEcK
dVM, dr. med. vet.,
dipl. EVpc
Bayer Animal Health GmbH
Clinical Research & Development
51368 Leverkusen
Germany
dorothee.stanneck@bayerhealthcare.com
180
JulianE straubE
dVM, dr.med.vet.
Institut für Tierhygiene und Öffentliches
Veterinärwesen
Veterinärmedizinische Fakultät
Universität Leipzig
An den Tierkliniken 1
04103 Leipzig
Germany
straube@vmf.uni-leipzig.de
rEinHard K. straubinGEr
professor,
dVM, dr. med. vet.,
phd
Lehrstuhl für Bakteriologie und Mykologie
Veterinärwissenschaftliches Department
Tierärztliche Fakultät
Ludwig-Maximilians-Universität München
Veterinärstr. 13
80539 München
Germany
r.straubinger@lmu.de
MontsErrat tarancÓn
dVM, dr. med. vet.
Bayer HealthCare Spain
Animal Health Division
Product Manager
Companion Animal Products
Avda. Baix Llobregat, 3–5
08970 Sant Joan Despí, Barcelona
Spain
montserrat.tarancon@bayerhealthcare.com
rEbEcca J. traub
bsc, bVMs (Hons), phd
School of Veterinary Science
University of Queensland
St Lucia, QLD, 4072
Australia
r.traub@uq.edu.au
alEXandEr trEEs
professor, bVM&s,
phd, MrcVs, ,
dean of the Faculty of Vet. science
Veterinary Parasitology
Liverpool School of Tropical Medicine/
Faculty of Veterinary Medicine
University of Liverpool
Pembroke Place
Liverpool L3 5QA
UK
trees@liverpool.ac.uk
uWE truyEn
professor,
dVM, dr. med. vet.,
dipl. EcVpH
Institut für Tierhygiene und Öffentliches
Veterinärwesen
Veterinärmedizinische Fakultät
Universität Leipzig
An den Tierkliniken 1
04103 Leipzig
Germany
truyen@vmf.uni-leipzig.de
luiGi VEnco
dVM, dipl. EVpc
Clinica veterinaria ”Città di Pavia”
Viale Cremona 179
27100 Pavia
Italy
luigivenco@libero.it
181
Cristiano von Simson
Dr. med. vet.,
Bayer Healthcare LLC Animal Health
Director – Veterinary Technical Services
PO Box 390
Shawnee Mission, KS 66201
USA
cristiano.vonsimson.b@bayer.com
Edward M. Wakem
DVM
Bayer Healthcare LLC Animal Health
Senior Technical Services Veterinarian
PO Box 390
Shawnee Mission, KS 66201
USA
edward.wakem.b@bayer.com
Sarah Weston
BVSc
Bayer Animal Health GmbH
VTS Manager Advantage, (K9)Advantix
Companion Animal Products
51368 Leverkusen
Germany
sarah.weston@bayerhealthcare.com
Mark L. Wilson
Professor,
ScD
Departments of Epidemiology and Ecology
and Evolutionary Biology
The University of Michigan
109 Observatory Rd.
Ann Arbor, Michigan 48109
USA
wilsonml@umich.edu
182
183
www.cvbd.org
4