docmolecular biology of the cell - American Society for Cell Biology
download 
Report Transcription
molecular biology of the cell - American Society for Cell Biology
ascb the american society for cell biology MBoC MOLECULAR BIOLOGY OF THE CELL ASCB AWARD ESSAYS, HOW TO START A BIOTECH COMPANY, AND THE 2014 PAPER OF THE YEAR MBoC MOLECULAR BIOLOGY OF THE CELL Published by the American Society for Cell Biology 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Contents EDITORIAL Inspiration from inspirational cell biologists D. G. Drubin 1 ASCB AWARD ESSAYS Working in the real and the imaginary M. Théry Establishing an academic laboratory: mentoring as a business model V. Greco The microenvironment matters V. M. Weaver From junior to senior: advice from the benefit of 20/20 hindsight S. L. Schmid People’s instinctive travels and the paths to science A. August Can small institutes address some problems facing biomedical researchers? M. P. Sheetz Romancing mitosis and the mitotic apparatus W. (B. R.) Brinkley Some personal and historical notes on the utility of “deep-etch” electron microscopy for making cell structure/function correlations J. E. Heuser Onward from the cradle P. Satir 2–4 5–7 8–12 13–16 17–20 21–23 24–26 27–30 31–33 PERSPECTIVE How to start a biotech company A. Tajonar 34–37 MBoC PAPER OF THE YEAR Angiomotins link F-actin architecture to Hippo pathway signaling S. Mana-Capelli, M. Paramasivam, S. Dutta, and D. McCollum 39–48 MBoC MOLECULAR BIOLOGY OF THE CELL Published by the American Society for Cell Biology ASCB Award Essays, How to Start a Biotech Company, and the 2014 Paper of the Year The angiomotin protein AMOT130 (red) localizes to actin stress fibers (green) in U2OS cells. In the 2014 MBoC Paper of the Year (Mol. Biol. Cell 25:1676–1685; reprinted on p. 39), Mana-Capelli et al. show that when AMOT130 is sequestered on F-actin it is unable to inhibit the proliferation/ differentiation regulator YAP. However, if AMOT130 binding to actin is inhibited either by actin disruption or by phosphorylation of the AMOT130 actin-binding domain by the Hippo pathway kinase LATS, AMOT130 is then able to bind and inactivate YAP. The MBoC Paper of the Year is selected by the Editorial Board from among papers published in the journal each year that have a postdoc or student as the first author. (Image: Sebastian Mana-Capelli, Department of Biochemistry and Molecular Pharmacology, University of Massachusetts, Worcester) The Philosophy of Molecular Biology of the Cell Molecular Biology of the Cell (MBoC) is published by the nonprofit American Society for Cell Biology (ASCB) and is free from commercial oversight and influence. We believe that the reporting of science is an integral part of research itself and that scientific journals should be instruments in which scientists are at the controls. Hence, MBoC serves as an instrument of the ASCB membership and as such advocates the interests of both contributors and readers through fair, prompt, and thorough review coupled with responsible editorial adjudication and thoughtful suggestions for revision and clarification. Our most essential review criterion is that the work significantly advances our knowledge and/or provides new concepts or approaches that extend our understanding. At MBoC, active working scientists—true peers of the contributors—render every editorial decision. The Society and MBoC are committed to promoting the concept of open access to the scientific literature. MBoC seeks to facilitate communication among scientists by • publishing original papers that include full documentation of Methods and Results, with Introductions and Discussions that frame questions and interpret findings clearly (even for those outside an immediate circle of experts); • exploiting technical advances to enable rapid dissemination of articles prior to print publication and transmission and archiving of videos, large datasets, and other materials that enhance understanding; and • making all content freely accessible via the Internet only 2 months after publication. Statement of Scope MBoC publishes studies presenting conceptual advances of broad interest and significance within all areas of cell biology, genetics, and developmental biology. Studies whose scope bridges several areas of cell and developmental biology are particularly encouraged. MBoC aims to publish papers describing substantial research progress in full: Papers should include all previously unpublished data and methods essential to support the conclusions drawn. MBoC will not, in general, publish papers that are narrow in scope and therefore better suited to more specialized journals, merely confirmatory, preliminary reports of partially completed or incompletely documented research, findings of as yet uncertain significance, or reports simply documenting well-known processes in organisms or cell types not previously studied. Submissions that report novel methodologies are encouraged, particularly when the technology will be widely useful, when it will significantly accelerate progress within the field, or when it reveals a new result of biological significance. Given the scope of MBoC, relevant methodologies include (but are not limited to) those based on imaging, biochemistry, computational biology, and recombinant DNA technology. Note that MBoC places a premium on research articles that present conceptual advances of wide interest or deep mechanistic understanding of important cellular processes. As such, articles dealing principally with describing behavior or modification of specific transcription factors, or analysis of the promoter elements through which they interact, will not generally be considered unless accompanied by information supporting in vivo relevance or broad significance. MBoC MOLECULAR BIOLOGY OF THE CELL Published by the American Society for Cell Biology Editor-in-Chief David G. Drubin University of California, Berkeley Editors W. James Nelson Stanford University Thomas D. Pollard Yale University Sandra L. Schmid University of Texas Southwestern Medical Center Jean E. Schwarzbauer Princeton University Features Editors William Bement University of Wisconsin Doug Kellogg University of California, Santa Cruz Keith G. Kozminski University of Virginia Associate Editors Richard K. Assoian University of Pennsylvania Francis A. Barr University of Oxford Patricía Bassereau Institut Curie Monica Bettencourt-Dias Instituto Gulbenkian de Ciência Laurent Blanchoin CEA Grenoble Kerry S. Bloom University of North Carolina Charles Boone University of Toronto Patrick J. Brennwald University of North Carolina Julie Brill The Hospital for Sick Children Jeffrey L. Brodsky University of Pittsburgh Marianne Bronner California Institute of Technology Fred Chang Columbia University Jonathan Chernoff Fox Chase Cancer Center Orna Cohen-Fix National Institutes of Health Stephen Doxsey University of Massachusetts Leah Edelstein-Keshet University of British Columbia Richard Fehon University of Chicago Paul Forscher Yale University Thomas D. Fox Cornell University Margaret Gardel University of Chicago Wallace Marshall University of California, San Francisco Thomas F. J. Martin University of Wisconsin A. Gregory Matera University of North Carolina Alex Mogilner University of California, Davis Denise Montell University of California, Santa Barbara Keith E. Mostov University of California, San Francisco Akihiko Nakano RIKEN Donald D. Newmeyer La Jolla Institute for Allergy and Immunology Reid Gilmore University of Massachusetts Asma Nusrat Emory University Mark H. Ginsberg University of California, San Diego Carole Parent National Institutes of Health Benjamin S. Glick University of Chicago Robert D. Goldman Northwestern University Robert G. Parton University of Queensland Samara Reck-Peterson Harvard Medical School Jean E. Gruenberg University of Geneva Howard Riezman University of Geneva J. Silvio Gutkind National Institutes of Health Mark J. Solomon Yale University Jeffrey D. Hardin University of Wisconsin Thomas Sommer Max Delbrück Center for Molecular Medicine Carl-Henrik Heldin Ludwig Institute for Cancer Research Anne Spang University of Basel Martin Hetzer Salk Institute for Biological Studies Gero Steinberg University of Exeter Erika Holzbaur University of Pennsylvania Susan Strome University of California, Santa Cruz Kozo Kaibuchi Nagoya University Judith Klumperman University Medical Centre Utrecht Suresh Subramani University of California, San Diego Thomas Surrey UK London Research Institute Sandra Lemmon University of Miami William P. Tansey Vanderbilt University Daniel J. Lew Duke University Peter Van Haastert University of Groningen Rong Li Stowers Institute Diane Lidke University of New Mexico Adam Linstedt Carnegie Mellon University Kunxin Luo University of California, Berkeley Gia Voeltz University of Colorado, Boulder Thomas M. Magin University of Leipzig Benjamin Margolis University of Michigan Medical School Yu-Li Wang Carnegie Mellon University Valerie Marie Weaver University of California, San Francisco Karsten Weis ETH Zurich Marvin P. Wickens University of Wisconsin Sandra Wolin Yale University Molecular Biology of the Cell (ISSN 1059-1524) is published online twice per month by The American Society for Cell Biology, 8120 Woodmont Avenue, Suite 750, Bethesda, MD 20814-2762. Correspondence: Molecular Biology of the Cell, ASCB, 8120 Woodmont Avenue, Suite 750, Bethesda, MD 20814-2762. Email: mbc@ascb.org. Subscriptions: Institutional subscriptions are available according to a tiered rate structure; please visit www.ascb.org/files/2011_MBC_INS_RATES.pdf for additional information. A personal subscription is included as a benefit of membership in the American Society for Cell Biology. Molecular Biology of the Cell is indexed or abstracted in: Biological Abstracts, BIOSIS Data Base, CAB International, CABS, Chemical Abstracts, Current Contents/Life Sciences, EMBASE, Index Medicus, Medline, and Reference Update. Yukiko Yamashita University of Michigon Alpha Yap University of Queensland John York Vanderbilt University Tamotsu Yoshimori Osaka University Yixian Zheng Carnegie Institution Xueliang Zhu Chinese Academy of Sciences Board of Reviewing Editors Richard Anderson Ken-ichi Arai Mark Ashe Kathryn Ayscough William Balch Georjana Barnes Diana Bautista Arnold Berk Magdalena Bezanilla Sue Biggins Robert Boswell David Burgess James Casanova David Chan Melanie Cobb Charles Cole Ruth Collins Duane Compton Pierre Coulombe Rik Derynck William Dunphy William Earnshaw Gregor Eichele Harold Erickson John Eriksson Marilyn Farquhar Victor Faundez James Feramisco Christine Field Stanley Froehner Joseph Gall Michael Glotzer David Glover Bob Goldstein Bruce Goode Kathleen Gould Barth Grant Wei Guo Rosine Haguenauer-Tsapis Nissm Hay Rebecca Heald Daniel Hebert Martin Hemler Mark Hochstrasser David Hockenbery Thomas Hope Sui Huang Anna Huttenlocher Ken Inoki Andrei Ivanov Catherine Jackson Leanne Jones Kenneth Kemphues Mary Kennedy Daniel Klionsky David Kovar Helmut Kramer Hua Lou Alberto Luini Eugene Marcantonio Michael Marks Satyajit Mayor Tom Misteli David Mitchell Andrea Munsterberg Coleen Murphy Karla Neugebauer Davis Ng Patrick O’Farrell Thoru Pederson Craig Peterson Rob Piper Kornelia Polyak Maureen Powers Michael Rape Karin Romisch Sarita Sastry Dorothy Schafer Danny Schnell Jonathan Scholey Nava Segev Jeff Settleman Shu-ou Shan Alexander Sorkin Harald Stenmark Alex Strongin Woan-Yuh Tarn Peter ten Dijke Mary Tierney Margaret Titus Linton Traub Claire Walczak Paul Wassarman Orion Weiner Matthew Welch Beverly Wendland Zena Werb Mark Winey Howard Worman Michael Yaffe Tadashi Yamamoto Jennifer Zallen Founding Editors Erkki Ruoslahti Bumham lnstitute (Founding Editor, Cell Regulation) David Botstein Princeton University Keith R. Yamamoto University of California, San Francisco Publisher Executive Director Stefano Bertuzzi Publications Director W. Mark Leader Journal Production Manager Eric T. Baker © 2014 by The American Society for Cell Biology. Molecular Biology of the Cell is available online at www.molbiolcell.org and through PubMed Central at www.pubmedcentral.nih.gov. Two months after being published at www.molbiolcell.org, the material in Molecular Biology of the Cell is available for non-commercial use by the general public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). Under this license, the content may be used at no charge for noncommercial purposes by the general public, provided that: the authorship of the materials is attributed to the author(s) (in a way that does not suggest that the authors endorse the users or any user’s use); users include the terms of this license in any use or distribution they engage in; users respect the fair use rights, moral rights, and rights that the Authors and any others have in the content. ASCB®, The American Society for Cell Biology®, and Molecular Biology of the Cell® are registered trademarks of The American Society for Cell Biology. MBoC | EDITORIAL This special issue is only one reflection of MBoC’s continued commitment to its authors and readers. We continue to make changes to better serve the cell biology community. For example, we recently implemented practices to improve recognition for co– first authors of research articles (Drubin, 2014). If you have ideas for David G. Drubin other ways in which MBoC can help scientists communicate their Department of Molecular and Cell Biology, University of California, work, further their careers, and promote our profession, please drop Berkeley, Berkeley, CA 94720-3202 me an email. MBoC’s second special issue, to be published on November 5, recognizes the importance of quantitative approaches in modern cell biology research. The ASCB’s president, This year Molecular Biology of the Cell is publishing Jennifer Lippincott-Schwartz, served as guest two special issues, this award issue and a second editor for this issue, which will contain a fantas“quantitative biology” issue. In the award issue, tic collection of research articles and PerspecMBoC’s tradition of publishing essays by ASCB award tives and signals an exciting expansion in the winners continues. These highly accomplished indiscope of MBoC to include articles that apply viduals inspire us with engaging stories of their lives physical and quantitative approaches to cell and careers and share with us their considerable wisbiology problems. We are particularly interdom. The diversity of the career paths followed by ested in publishing articles on topics such as this year’s award winners and the ways in which they quantitative imaging, biophysical properties and earlier ASCB award winners (www.molbiolcell of cells and cell structures, computational and .org/content/by/section/ASCB+Award+Essays ) mathematical modeling, innovative physical or achieved success show that there is not a single forcomputational approaches to cell biological mula for a fruitful research career. If there is a common problems, and systems studies of cell signaltheme in these essays, it is that the award winners all ing and complex physiological processes. share a passion for scientific discovery and for imAll manuscripts submitted to MBoC are proving the scientific enterprise. Some of the award handled exclusively by working scientists. To essays also remind us that there is still work to be David Drubin better handle manuscripts in quantitative bioldone to make the research community more inclusive Editor-in-Chief ogy, we are excited to announce the addition and supportive of women and minorities. of the following individuals to our editorial Also featured in this issue for the benefit of our readers is an exboard: Patricia Bassereau, Margaret Gardel, Diane Lidke, Wallace cellent Perspective article, “How to Start a Biotech Company” by Marshall, Samara Reck-Peterson, Thomas Surrey, and Valerie Weaver. Adriana Tajonar. The cover illustration was provided by the authors We are also pleased to announce the addition to the editorial board of the 2014 MBoC Paper of the Year (Mana-Capelli et al., 2014). A of Gia Voeltz, who provides expertise in organelle biogenesis and printed collection of the ASCB Award Essays and the Perspective to structure. be distributed at the 2014 ASCB/IFCB meeting will include the Special thanks go to our Features editors Doug Kellogg, Keith Paper of the Year. Kozminski, and Bill Bement, and to MBoC staff members Eric Baker and Mark Leader, whose hard work helped make both of these special MBoC issues possible. DOI:10.1091/mbc.E14-08-1329. Mol Biol Cell 25, 3247. Inspiration from inspirational cell biologists David G. Drubin is Editor-in-Chief of Molecular Biology of the Cell. Address correspondence to: David G. Drubin (drubin@berkeley.edu). © 2014 Drubin. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society for Cell Biology. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year REFERENCES Drubin DG (2014). MBoC improves recognition of co–first authors. Mol Biol Cell 25, 1937. Mana-Capelli S, Paramasivam M, Dutta A, McCollum D (2014). Angiomotins link F-actin architecture to Hippo pathway signaling. Mol Biol Cell 25, 1676–1685. 1 MBoC | ASCB AWARD ESSAY Working in the real and the imaginary Manuel Théry Laboratoire de Physiologie Cellulaire et Végétale, Institut de Recherche en Technologie et Science pour le Vivant, UMR5168, CEA/INRA/CNRS/Université Grenoble-Alpes, Grenoble, France, and Unité de Thérapie Cellulaire et Centre d’Investigation Clinique en Biothérapies, Hôpital Saint Louis, Institut Universitaire d’Hematologie, UMRS1160, INSERM/AP-HP/Université Paris Diderot, Paris, France ABSTRACT The science we practice is shaped by our interactions with people; the enthusiastic teachers, the fascinating mentors, the inspiring colleagues, and the inquisitive students. The science we enjoy takes us into areas we couldn’t have anticipated. From time to time, we come back to reality and try to find ways to share our new explorations with our friends and relatives and to convert our insights into collective progress. What could be a better job? I am honored and pleased to receive the Early Career Life Scientist Award from the American Society of Cell Biology. It is noteworthy that I was not trained in biology but in physics and chemistry. I have always gazed at cell biology as another planet made of beautiful and crazy things to which I would never have access. However, this prize tells me I have just landed. Exploration can start. Let’s put on our spacesuits. waves and then generated tortuous diffraction patterns with homemade lasers. I remember seeing some sort of Möbius strip–like shape on an oscilloscope that was monitoring a chaos-generating electric circuit. By having all these tools available, we felt that we could investigate the core principles of any subject. DO IT YOURSELF I very much belong to the DIY school of science. I get so much more satisfaction PHYSICS AND CHEMISTRY TOOLS from building rather than buying someA physics background doesn’t mean havthing. Labeling a protein with a kit is efing spent hours learning about quantum ficient, but it is not as rewarding as doing theory. It is also about instruments, knowit with the help of your friendly chemist, ing how engines work and having to get a homemade column in a 25-ml pipette, your hands dirty. At the Ecole Supérieure and the UV lamp from the disco dance de Physique et Chimie de la Ville de floor to detect the labeled product. Any Paris, we spent our time in the labs, using small progress is perceived as a real perall the machines, from the mass specsonal advance; you begin to know much trometers and the acousto-optic modubetter what you are manipulating in your lators to the rotating evaporator and the experiments. In the same manner, the milling machine. After synthesizing left bench devices assembled step-by-step and right enantiomers of molecules I can Manuel Théry: The enthusiastic teachers, fascinating morph into large experimental setups. no longer remember, we looked at fluid mentors, inspiring colleagues, and inquisitive students What has impressed me the most are the particles forming circles in standing of whom I am made. instruments that have been combined to enable cell manipulation, including micromanipulators, piezo stacks, and photodiodes driven by Labview. DOI:10.1091/mbc.E14-05-1021. Mol Biol Cell 25, 3248–3250. Manuel Théry is the recipient of the 2014 Early Career Life Scientist Award from I truly believed then, at the Curie Institute, that these setups would the American Society for Cell Biology. open the doors to innovation, not only from a technical standpoint Address correspondence to: Manuel Théry (manuel.thery@cea.fr; www but also from a scientific standpoint, by providing new ways to think .cytomorpholab.com). about cells. For my friends and me at that time, there was nothing © 2014 Théry. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to we couldn’t build to allow us to play with cells. Pulling, pushing, the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Crestretching, squeezing, pressing, blowing, and sucking: we tested ative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). everything, we even played the intercellular bridge like the string of “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of a harp! the Cell®” are registered trademarks of The American Society for Cell Biology. 2 | M. Théry Molecular Biology of the Cell We should not take for granted the basic biological rules laid down in textbooks. So, in parallel to the investigation of complexity with big data, there may be merit in revisiting basic old rules with new tools. How complete is the current set of basic cell cytoskeleton rules that have been identified? How do cells sense space or measure distances? How do cells set their size or define their shape? Do cells have a center? Is it required for polarity orientation? Is the cell architecture a mere scaffold or does it contain information? How is this information perpetuated in a permanently renewing structure? I often tell students that, in starting to tackle questions like these and to identify any laws, we need equations; and for the equations, we need numbers. FREE YOUR MIND FIGURE 1: Pictures taken during the Nuit Blanche, a public all-night art exhibition held 5–6 October 2013. Andreas Christ plated RPE1 cells expressing Lifeact–green fluorescent protein on building-shaped micropatterns. Movies were assembled and music was added by the Groupe LAPS, and the movies were projected back onto the facade of the actual building (www.groupe-laps.org/en). BACK TO BASICS The current tendency in pursuing cell biology experiments is to increase complexity. What happens with this tendency is that you acquire tons of images you will never look at and develop automated image-analysis programs that work in a way you don’t really understand and that reveal information you could not obtain manually. The positive benefits of this tendency have provided some very interesting insights, and I have been lucky enough to be associated with some of them. However, the papers in the cell cytoskeleton field that have impressed me the most were performed with rudimentary tools and most often depended on careful observation. Most milestones in the cytoskeleton field have been established with simple techniques. Although I agree that new techniques will take us into new research areas, I still think there are lots of things to do with simple tools, as long as they are cleverly used. One of my favorite examples is the way Ray Rappaport highlighted the rules of mitotic cleavage furrow positioning by piercing a sand dollar egg with a needle. It is also an example that serves a useful answer to some of our article reviewers, in that the experimental setup can be viewed as highly artificial. Yes, the system is not physiological, but Rappaport’s needle told us a lot about the way the mitotic apparatus actually works in cells. It would take a book to review the seminal experiments in which a simple, well-thought-out tool has been used to reveal the core mechanism of cell cytoskeleton assembly. But is our knowledge so far advanced that there is no more need for this type of research? Do we necessarily have to develop more complex techniques to try to dig deeper into the complexity of biological mechanisms? I am not so sure. On the other hand, modern tools for cell imaging and manipulation have made inner cell life clearer. They revealed detailed but key features about the actual way the cytoskeleton works. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year My view on the way to progress in science and think about experimental design was dramatically changed when I read the Introduction à l’étude de la médecine expérimentale by Claude Bernard (Bernard, 1865, 1957). According to him, all working hypotheses are acceptable as long as they are based on facts established by accurate observation. It may seem obvious, but it opens up a field of possibilities for your imagination. Nothing is too crazy or too foolish to be considered, as long as it is based on rigorous experimental observations. When formulating these hypotheses, it is safe to operate with the spirit that, in the imaginary world, things could be completely different. However, once the experimental results are obtained, you should curb your imaginative and creative impulses and come back to the real world. Forget about your working hypothesis. Conclusions should be drawn from strict observational facts only. These episodes in which the imagination is unleashed give me great pleasure. It is not simply about pushing the boundaries between the real and imaginary, it is about rewiring the real. Even the artists do not have such opportunities. It is our privilege. PLAY HARD The adage “work hard, play hard” applies not only to the necessity of a worthy celebration upon the acceptance of a paper. I try to encourage my students to have some good times seeking new ways to put biology problems in another context to offer a fresh look. Our approaches may be funny, but they may also reveal interesting insights. Dress yourself up as a Golgi, and after receiving a big laugh, you will encounter topological problems and will have consider how these problems are solved in cells. Try to walk as a cell (in a swimming pool of Nutella), and the appreciation of the problem of inertia and force balance in a fluid environment with a low Reynolds number will become clearer. I am convinced that serious games are a great way to think about scientific problems. A few years ago, some colleagues and I organized the world cell race. It was a great experience from which we learned as much as we laughed. It had an impact with the public too, and it was blogged about across the world. People threw up a series of good questions: What controls the speed of a cell? Are cancer cells faster than the others? Do small cells move more rapidly than large ones? Do some cells change direction? Last year we staged a public event to illustrate this question: What is the difference between the architecture of a cell and a building? We achieved this by effectively miniaturizing the front façade of the Saint Louis Hospital, plating cells on it, and videorecording actin dynamics. Videos were then projected back onto the actual building, showing cells attaching stress fibers to windows and gutters. In the crowd, people were discussing the differences between cells and buildings: one was size, of course; but gravity Working in the real and the imaginary | 3 and dynamics of construction were others. A very young child was puzzled by cell divisions and asked, If they divide, do they become twice as small? If it happens again and again, will there be enough space? I was stunned. The video montage lasted 15 min and was in a loop. Some stayed until 5 a.m., gazing at the giant cells climbing over the hospital. By capturing the imagination of both scientists and the general public, both events showed that we could and we 4 | M. Théry should engage the public more in practical experimental science and hence in the exploration of cell biology. REFERENCES Bernard C (1865). Introduction à l’étude de la médecine expérimentale, ed. JB Baillière, Paris: Garnier-Flammarion, 318. Bernard C (1957). An Introduction to the Study of Experimental Medicine, New York: Dover Publications, 272. Molecular Biology of the Cell MBoC | ASCB AWARD ESSAY Establishing an academic laboratory: mentoring as a business model Valentina Greco Departments of Genetics and Dermatology, Yale Stem Cell Center and Yale Cancer Center, Yale University School of Medicine, New Haven, CT 06510 ABSTRACT It is a tremendous honor for my group and me to receive the recognition of the 2014 Women in Cell Biology Junior Award. I would like to take the opportunity of this essay to describe my scientific journey, discuss my philosophy about running a group, and propose what I think is a generalizable model to efficiently establish an academic laboratory. This essay is about my view on the critical components that go into establishing a highly functional academic laboratory during the current tough, competitive times. WHAT HOOKED ME ON SCIENCE Falling in love with science arrived quite late in my life. Growing up, I was fascinated by logical thinking and math. After bumping by chance into biology for my undergraduate degree, I became increasingly excited about it once I started to do my own experiments in the lab of Aldo Di Leonardo at the University of Palermo. What truly triggered my passion was an episode during my PhD interview at the European Molecular Biology Laboratory (EMBL). Using time-lapse videos in real time, Michael Way showed me how the bacterium Listeria infects cells. The ability to monitor processes as they occur in our bodies hooked me. I knew then that a scientific career would provide me with a long fulfilling journey of discovery. MY JOURNEY DURING MY PhD AND POSTDOCTORAL TRAINING I have had the privilege of training in institutions and laboratories where the richness of scientific thinking as well as resources propelled me through a rewarding learning experience. I did Photo credit: Terry Dagradi, Yale University Valentina Greco DOI:10.1091/mbc.E14-06-1079. Mol Biol Cell 25, 3251–3253. Valentina Greco is the recipient of the 2014 ASCB Women in Cell Biology Junior Award. Address correspondence to: Valentina Greco (valentina.greco@yale.edu; www .yale.edu/grecolab). Abbreviations used: EMBL, European Molecular Biology Laboratory; PI, principal investigator. © 2014 Greco. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society for Cell Biology. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year my PhD (1998–2003) with Suzanne Eaton at the EMBL and Max Planck Institute. Suzanne’s free scientific mind and contagious enthusiasm for scientific discovery provided a stimulating framework for defining the questions that excited me. Of great influence also was the open-door policy at my PhD institutions. Hierarchy was only a formality, and scientific discussions happened freely among different labs and across the hierarchical ladder. This fertile context contributed to my passion for addressing mechanisms of tissue growth in development by live imaging using Drosophila. I did my postdoc (2003–2009) with Elaine Fuchs at Rockefeller University, studying tissue regeneration using skin hair follicle in mice as a model system. Elaine and her laboratory, a group of very talented scientists, provided me with strong training that fostered my independence and taught me approaches for efficiency and productivity. MY LAB SCIENCE AND PHILOSOPHY: MENTORING AS A BUSINESS MODEL I started my laboratory in 2009 in the Genetics Department at Yale Medical School, recruited by two terrific scientists, Richard Lifton and Haifan Lin, who believed in my potential and supported me at a time when it wasn’t clear how things would turn out and who continue to support and inspire me to this date. When I established my lab, I wanted to understand how cells orchestrate growth within a tissue and how hierarchical organization plays a role in cell choices at the level of single cells as well as in integration within a group of cells, resulting in a robust and harmonious 5 process of growth. The challenge in addressing these questions was posed by the fact that these processes are highly dynamic, but the field largely used static analysis to study them. During my doctoral thesis, I had experienced firsthand how live imaging had provided us not only a better understanding of the process we were studying but, especially, allowed us to discover new biology that we had not anticipated. Thus, as I began to set up my lab, I addressed the above questions with canonical approaches and invested in a high-risk/ high-reward approach to establish live imaging in the mouse skin. After more than one year of troubleshooting and several discouraging roadblocks, we were finally able to visualize and manipulate hair follicle stem cells and their niches in an intact living mouse. This technology allowed my lab to uncover key principles in stem cell biology. For example, we showed that stem cells can be dispensable for tissue regeneration and that other cells can reprogram to adopt their fates during injury. Conversely, we demonstrated that the niche is required for hair follicle regeneration (Greco and Guo, 2010; Rompolas et al., 2012, 2013; Rompolas and Greco, 2014; Deschene, Myung, et al., 2014; Zito et al., 2014). In retrospect, what I had accomplished was combining my passion for visualizing biological processes in vivo with my knowledge on stem cells gained during my postdoc. This allowed me to create a niche for my lab and distinguish myself from my previous mentors. While defining the key questions and the unique angle for my lab was key to establishing my lab, the next challenge was to identify a way to execute them. In that regard, we depend on our lab members and colleagues to carry out our ideas (i.e., writing papers and obtaining grants). To establish a highly functional lab, I believe that, in addition to defining key exciting questions, the principal investigator (PI) must balance two critical components: business and mentoring. I will now define the words “business” and “mentoring,” describe the challenges junior PIs face in embracing them, and conclude by describing some of the strategies I have adopted in my own lab. Definition of “business” How do we maximize the creation of ideas and data? How do we make these good ideas a reality that catches people’s attention? In this regard, establishing a lab is analogous to setting up a business. In a way, I visualize it as being given a small shop to rent in a big mall. In order for us to be noticed, we need to create a product (our data) that people (our colleagues) can look at and decide whether it is worth their attention/investment or not. We need to make a brand (our unique angle for producing data), find investors (therefore excite future potential reviewers/funding agencies), and gain visibility by going around and creating publicity (giving talks). Definition of “mentoring” I define “mentoring” as the guidance provided by a more experienced researcher to a less experienced one (mentee) that contributes to the mentee’s development as a scientist. This includes teaching trainees how to design experiments and align expectations and how to prepare for talks. All of that should be done within the context of a relationship based on truth and mutual trust. PIs are dependent on their students and postdocs for the realization of their ideas and, therefore, for the success of their labs. It is a mutual dependency. While it is clear that the PI’s investment of time and energy in developing the competencies of the mentees are an investment in the business that supports all members involved, it is less clear how to provide good mentoring that feeds both parties, the mentee and the mentor. 6 | V. Greco Challenges in mentoring There are a number of challenges that prevent people (especially young investigators) from being proper mentors and getting the most out of their labs. First of all, there is no training provided to starting PIs. They have to transition from postdoctoral training, in which they had to master benchwork and a working relationship with primarily one person, the PI, to productively managing a team. Second, there is a dramatic increase in the number of different tasks that we need to cover, which pull us in several different directions. Third, it is not easy to recognize that mentoring is instrumental in maximizing the efforts and the establishment of our lab. How can we improve the situation? 1) Institutions have to recognize these challenges and provide training to educate junior faculty on how to best manage and mentor a group. 2) Junior faculty members themselves have to be proactive about acquiring the necessary knowledge from midcareer PIs, preferably in groups with open discussion on current challenges. 3) PIs must educate their mentees on how to be leaders and mentors themselves. Example of proposed solutions: this model in the context of a group There are different models that can be adopted to best mentor a group while trying to feed into creating the products (papers and grants). One model envisions the leader as the one who seeds ideas and leaves the lab members in charge to develop them in practice. An alternative model, not mutually exclusive with the first one, sees the leader as the one who fosters an environment in which people generate ideas. While I naturally lean toward model 2, it can also be argued that this model has the advantage of 1) giving ownership to the mentee for the scientific project, 2) engendering continuous reevaluation of the excitement and novelty associated with the project, and 3) helping to identify the most practical and fastest way to execute the project. Model 1 is perhaps more efficient in the short term, but in the long term, it runs the risks (among others) of creating less independent scientists who cannot propagate knowledge to the next generation as efficiently or represent the lab at meetings. Thus one of my mentoring approaches is to involve my group in the several tasks I need to perform, as this fills two purposes. It provides a more complete training for the mentees and it produces better outcomes. These tasks include training a lab member to give a talk outside the lab, having a lab member prepare a grant proposal, and so on. Thus everyone is called upon to be an active participant in the process. What this creates is a supportive, unified group experience that elevates the impact and depth of the science we do, thereby feeding into the lab business as well. Specifically, I created the following systems: 1. I set up a number of different forums in addition to the canonical lab meetings and weekly one-on-one meetings. These include brainstorming sessions, when each lab member takes a turn giving a chalk talk to the entire lab over beer and pizza about his or her vision on his or her current project and possible future directions. This is in addition to a broad review of all data with me every six months, when I spend 4–5 h with each individual, discussing all our goals, aligning them, and discussing all the data produced and the expectations we have moving forward. Since these forums have been put in place, these approaches have led to shaping stories earlier than I anticipated Molecular Biology of the Cell and allowing lab members to contribute to one another’s projects more effectively. 2. I seek opportunities for my lab members to give talks outside the lab in order for us to more effectively think about science. Every time we start a project, we get attracted to questions that excite us. The process, however, of going from our questions to finding answers is often lengthy and somewhat abstract (what Uri Alon [2009] in his essay refers to as a cloud), a process comparable to creating an object from clay. As it starts, it doesn’t have a shape, and my mentee and I keep working that material, thinking over time about a product that excites us, is unique, and could be attractive to a broader audience. The way we get there relies strongly on giving talks and especially on the approach used to prepare for talks. To give a practical example, every time a lab member is giving a talk, the preparation follows three steps: 1) he/she will build it two weeks before the event, discussing it back and forth with me. This helps both of us start to think hard about the collected data, the best angle for presenting them, and what conclusions can we draw from them. 2) The lab member will give a practice talk to the lab one week ahead of the event, with everyone actively participating by constructively criticizing, dismantling, and remolding the entire talk. 3) The lab member will give a practice talk to me only few days before the event to finalize it and sharpen all the edges. Strikingly, while at first read this may seem to be a lot of work, this has been the best investment of my time from the beginning, because it has, first, allowed me to put together our manuscripts much faster as a result of this intense thinking; second, it has allowed me to give ownership to the lab member for his or her own project; and third, it has created a sense of unity that allows everyone to feel protected while pushing hard for their own projects as well as for those of their colleagues. These were always moments when we created our “new product.” Thus my mentorship (lab meetings, brainstorming, six-month review, etc.) leads to scientific success (papers) and, therefore, business success (funding). Finally, my mentorship feeds into my business model not only by producing successful science but also by producing a healthy, happy work environment. CONCLUSIONS While generally thought of as independent entities, science–business–mentorship go hand in hand in my opinion. Mentoring brings depth and quality to business, and business brings effectiveness and productivity to mentoring. While everyone naturally enjoys witnessing the accomplishments that our lab members obtain, the process for getting them there is not as intuitive and is sometimes quite intense, which makes us question whether it is the right investment of our energies. Because of this, seeking sources of mentorships through established courses and internal resources at our university 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year is paramount for the effectiveness and establishment of junior PI laboratories. Investing time in meaningful mentorship fosters a productive and harmonious work environment that results in successful science and, therefore, business. ACKNOWLEDGMENTS I am very grateful to more people than I have space to acknowledge. My parents and sister, loving people who showed me how to embrace life with courage and a positive attitude. My dearest friends, including Alessandro Aiuppa, Eugenia Piddini, Elena Trovesi, Janice Zulkeski, and David Berg, who keep me rooted to the ground. My husband and inspiring colleague Antonio Giraldez along with my bubbling kids Gael and Lola, who make me rediscover life through an exciting new pair of glasses. I am grateful to David Berg, Panteleimon Rompolas, Antonio Giraldez, and Cristiana Pineda for brainstorming with me on this essay and to a large community of senior and junior PIs, including Dan DiMaio, Lynn Cooley, Valerie Reinke, Arthur Horwich, Pietro De Camilli, Marc Hammarlund, Katerina Politi, Stephanie Eisenbarth, Joerg Bewersdorf, Scott Weatherbee, and Daniel Colon-Ramos, as well as Deputy Dean Carolyn Slayman, all of whom provide an exceptional mentoring environment at Yale for people to thrive. Last but not least, I am greatly indebted to my trainees. In order of joining my lab: Ichiko Saotome, Elizabeth Deschene Jacox, Sarah Selem, Giovanni Zito, Panteleimon Rompolas, Craig Cromer, Peggy Myung, Kailin Mesa, Thomas Yang Sun, Sangbum Park, Markus Wolfel, Enrico Ferro, Samara Brown, Cristiana Pineda, Tianchi Xin, and Jonathan Boucher. Each of them, past and current, has bet on our relationship to grow in their journeys. Most importantly, they made me, themselves, and the group as a whole a better team of scientists today than we were yesterday. REFERENCES Boldface names denote co–first authors. Alon U (2009). How to choose a good scientific problem. Mol Cell 35, 726–728. Deschene RE, Myung P, Rompolas P, Zito G, Sun TY, Taketo MM, Saotome I, Greco V (2014). β-catenin activation regulates tissue growth via a non-cell autonomous mechanism within the hair stem cell niche. Science 343, 1353–1356. Greco V, Guo S (2010). Compartmentalized organization: a common and required feature of stem cell niches? Development 137, 1586–1594. Rompolas P, Deschene ER, Zito G, Gonzalez D, Saotome I, Haberman A, Greco V (2012). In vivo live imaging of stem cell and progeny behavior in physiological hair follicle regeneration. Nature 487, 496–499. Rompolas P, Greco V (2014). Stem cell dynamics in the hair follicle niche. Semin Cell Dev Biol 25–26, 34–42. Rompolas P, Mesa Kailin R, Greco V (2013). Spatial organization within a niche as a determinant of stem-cell fate. Nature 502, 513–518. Zito G, Saotome I, Liu Z, Ferro EG, Sun TY, Nguyen DX, Bilguvar K, Ko CJ, Greco V (2014). Spontaneous tumour regression in keratoacanthomas is driven by Wnt/retinoic acid signalling cross-talk. Nat Commun 5, 3543. WICB Junior Award | 7 MBoC | ASCB AWARD ESSAY The microenvironment matters Valerie Marie Weaver Center for Bioengineering and Tissue Regeneration, Department of Surgery, and Departments of Anatomy and Bioengineering and Therapeutic Sciences, Eli and Edythe Broad Center of Regeneration Medicine and Stem Cell Research, and UCSF Helen Diller Comprehensive Cancer Center, University of California, San Francisco, San Francisco, CA 94143 ABSTRACT The physical and biochemical properties of the microenvironment regulate cell behavior and modulate tissue development and homeostasis. Likewise, the physical and interpersonal cues a trainee receives profoundly influence his or her scientific development, research perspective, and future success. My cell biology career has been greatly impacted by the flavor of the scientific environments I have trained within and the diverse research mentoring I have received. Interactions with physical and life scientists and trainees and exposure to a diverse assortment of interdisciplinary environments have and continue to shape my research vision, guide my experimental trajectory, and contribute to my scientific success and personal happiness. NURTURING NATURE I am honored to receive the Women in Cell Biology Sustained Excellence in Research Award. I am delighted to be part of a vibrant and supportive cell biology community. I recognize that I am the fortunate recipient of this prestigious award because of the mentoring and encouragement I have enjoyed throughout my career and the group of superb trainees with whom I have had the pleasure to work with. My career trajectory has not always been straightforward. I grew up as part of an extended, working-class family in northern Ontario, Canada, where the only educational expectation placed on a young woman from my background was to acquire practical skills to secure a well-paying job that could supplement the family income if required. However, as fate dictated, I was born with an insatiable curiosity and an inquiring nature that both shocked and perplexed my parents. In hindsight, the mad disassembly of dolls, melting of cosmetics, and dragging home of various skeletons and insects hinted at the beginnings of a scientist. Fortunately, this “research” potential was recognized by a series of teachers and colleagues who encouraged me to attend university and to pursue graduate studies. Valerie Marie Weaver DOI:10.1091/mbc.E14-06-1080. Mol Biol Cell 25, 3254–3258. Valerie Marie Weaver is the recipient of the 2014 ASCB Women in Cell Biology Sustained Excellence in Research Award. Address correspondence to: Valerie M. Weaver (Valerie.Weaver@ucsfmedctr.org). Abbreviations used: 3D, three-dimensional; DOD BCRP, Department of Defense Breast Cancer Research Program; ECM, extracellular matrix; IME, Institute for Medicine and Engineering; MEC, mammary epithelial cells; NIH NCI, National Institutes of Health–National Cancer Institute; NRC, National Research Council; rBM, reconstituted basement membrane. © 2014 Weaver. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society for Cell Biology. 8 | V. M. Weaver DISCOVERING PASSION: SEED AND SOIL Graduate school was a revelation to me. For the first time, not only was I able to indulge my desire to learn and appease my curiosity, but at last I had discovered an environment in which I could express my creativity and challenge my intellect. My doctoral studies in biochemistry, made possible by two graduate scholarships, were completed at the University of Ottawa, where I studied vitamin D metabolism and the pathophysiology of vitamin D deficiency with J. E. Welsh. During my thesis studies, I was immersed in a community involved in a wide range of research, including work on brown fat metabolism, developmental apoptosis, enzymology, lipid biochemistry, and protein crystallography. Strong ties between the Departments of Biochemistry and Cell Biology ensured that I was also exposed to an array of cell biology research. This diverse scientific portfolio instilled in me an Molecular Biology of the Cell FIGURE 1: Phenotype dominates over tumor genotype. β1-inhibitory antibody treatment of tumor cells leads to the formation of reverted acini. (a–a′′) Confocal fluorescence microscopy images of F-actin: both the nonmalignant HMT-3522 S-1 (a) and its malignant cell derivative T4-β1 reverted acini (a′′), showed basally localized nuclei (propidium iodide), and organized filamentous F-actin (fluorescein isothiocyanate), while the tumorigenic HMT-3522 T4-2 mocktreated colonies (T4-2 immunoglobulin G) formed disorganized, hatched bundles of actin and pleiomorphic nuclei (a′). (b–b′′) Confocal immunofluorescence microscopy images of E-cadherin (FITC) and β-catenin (Texas Red): in S-1 (b) and T4-β1 reverted acini (b′′), E-cadherin and β-catenins were colocalized and superimposed at the cell–cell junctions. (©Weaver VM et al., 1997.Originally published in JCB. doi:10.1083/jcb.137.1.231. Reproduced with permission from Weaver et al., 1997.) appreciation for the sheer range of biological questions being asked and the various perspectives and approaches available to test them. Equally important during my training were my interactions with a variety of successful female scientists, which helped me to visualize myself as an independent academic investigator. Toward the end of my graduate studies, I attended the first apoptosis workshop held at the Federation of European Biochemical Societies meeting in Budapest, Hungary, where I met several prominent investigators studying apoptosis and programmed cell death. Apoptosis research was in its infancy, and the ideas discussed at this meeting sufficiently impressed me that I decided to join the laboratory of Roy Walker and Marianna Sikorska at the Canadian National Research Council (NRC) to study links between higher-order chromatin structure and apoptosis regulation. My work at the NRC convinced me that a key regulator of apoptotic decisions in cells was its interaction with the extracellular matrix (ECM). It was during this time that I heard Mina Bissell present at the Canadian Federation of Cell Biology in Windsor, Ontario, on the importance of the ECM in mammary tissue behavior. Fortunately, when I inquired about the possibility of joining Mina’s group, she looked at me intently and immediately agreed. Had I realized that she had just turned down several applicants, I may not have been so confident. LIFE IS WHAT HAPPENS WHILE YOU ARE BUSY MAKING OTHER PLANS Within the first few months of my starting graduate school, my father passed away from a terminal brain tumor. Midway through my 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year graduate studies, after having successfully passed my qualification exam, I embarked on a short “celebratory” skiing holiday with friends in northern Vermont. While traveling to the ski hill one day, I was involved in a horrible car accident that resulted in a broken back and broken legs and hands and ribs, which generally left me pretty bashed up. Needless to say, these two events had a big impact on my life. However, while both traumas certainly, at least temporarily, impeded my thesis research work, they also instilled in me an appreciation for the personal advantages that I enjoyed and gave me a strong resolve to take full advantage of the opportunities provided to me and to live life to the fullest. Therefore, much to the dismay of my senior colleagues, as soon as my settlement funds arrived, I bought a ticket to West Africa with a return from India. Before relocating to Berkeley to train with Mina, I spent six months traveling and meeting people across Africa and Asia. However, despite what could be interpreted as a lackadaisical attitude to science, I have absolutely no regrets about my decision to take a break and explore the world. Not only was that traveling adventure enlightening and one I shall never forget, but the experience broadened my perspective and put my own life experiences into better perspective, and importantly, they renewed my desire to pursue a research career. EXPANDING HORIZONS Joining the Bissell laboratory was a turning point and another major life-changing event. In Mina’s group, I was quite literally surrounded by an enthusiastic group of intelligent postdoctoral fellows and students who were completely engaged in their research and, indeed, in the world in general. The atmosphere in the Bissell laboratory was highly energized and one in which Mina encouraged everyone to think unconventionally and expand their scientific perspective(s). Not only did I learn about the mammary gland and the ECM, but I grew to think more critically and outside the conventional box. Ideas were bandied about freely, and laboratory meetings were lively events during which discussions served to expand my research vision and foster my love of science and amazement at the beauty and elegance of cell biology. My research with Mina followed up on an article she had recently published with Zena Werb and Nancy Boudreau, in which they showed that, in the absence of integrin engagement by the ECM, normal mammary epithelial cells (MECs) underwent apoptosis (Boudreau et al., 1995). I was greatly intrigued by these findings and wanted to use my prior apoptosis experience to expand upon this work as well as on studies by Tony Howlett showing that transformed breast cells resist apoptosis even in the absence of ECM cues (Howlett et al., 1995). In collaboration with Ole Petersen in Copenhagen, I established a human breast tumor progression series and set about clarifying why tumors no longer died in the absence of ECM ligation (Weaver et al., 1995, 1996). What I observed, quite unexpectedly, was that not only did the malignant derivatives in this tumor series not die when I blocked the activity of the major ECM receptor β1 integrin, but the tumor cells A career in context | 9 FIGURE 2: The importance of tissue context: ECM stiffness modulates mammary tissue morphogenesis. MEC growth and morphogenesis are regulated by matrix stiffness. Phase-contrast microscopy and confocal immunofluorescence images of nonmalignant MECs grown for 20 d on top of polyacrylamide gels of increasing stiffness (140–5000 Pa) conjugated with reconstituted basement membrane (rBM) and overlaid with rBM to generate a 3D rBM ECM microenvironment. Findings showed that increasing ECM stiffness enhanced MEC growth, as revealed by an increase in colony size and disrupted tissue organization indicated by aberrant tissue margins and invasive structures (phasecontrast images: top panels). ECM stiffness also progressively disrupted tissue morphology, as indicated by disrupted cell–cell localized β-catenin (green) and loss of basally localized (α6)β4 integrin (red) with nuclei costained with 4′,6-diamidino-2-phenylindole (DAPI; blue) (confocal images: lower panels). (Reproduced with modification and proper permission obtained from Elsevier as published in Paszek et al., 2005.) phenotypically reverted, ceased to grow and invade, and instead assembled a three-dimensional (3D) differentiated tissue structure or “acini” (Figure 1; Weaver et al., 1997). They were also no longer tumorigenic when injected in vivo (Weaver et al., 1997). This was the first of many “humbling” experiences I have experienced throughout my professional career regarding the importance of context and the impact of tissue structure on cell phenotype. I can honestly say that I haven’t looked back since that first experience. In the years following my first observation, I was involved in a series of collaborative studies in which I worked with colleagues in the Bissell group to study the impact of 3D and tissue organization on receptor signaling, nuclear architecture, and apoptosis (Lelievre et al., 1998; Wang et al., 1998; Weaver and Bissell, 1999; Weaver et al., 2002; Rizki et al., 2008). AN INTERDISCIPLINARY ENVIRONMENT Bolstered by my success in Berkeley, and consistent with the interdisciplinary ethos fostered during my sojourn at Lawrence Berkeley National Laboratory, I secured a faculty position in the Pathology Department and gained membership in the new Institute for Medicine and Engineering (IME) at the University of Pennsylvania. After arriving at IME, I set about trying to understand how the 3D organization of a tissue could so dramatically modify cell behavior. I initially chose to focus on apoptosis regulation, because, during my last year with Mina, I had made the rather startling observation that 10 | V. M. Weaver MECs incorporated into a 3D polarized “tissue-like structure” resist apoptosis induction by extrinsic stimuli (Weaver et al., 2002). My journey of discovery was unexpectedly bolstered by the unique environment at the IME, where I was physically surrounded by engineers and biophysicists who routinely discussed concepts such as viscoelasticity, emergent properties, and compression or flow, and who used a grab bag of approaches familiar to physical scientists but quite new to a biochemist/cell biologist. Luckily, my curiosity got the better of me, and it was just a matter of time before I began to apply some of the physical science concepts and methods to my own research. My aha moment came when I realized that ECM topography and compliance were major regulators of tissue behavior and that these ECM features might explain at least some of the different phenotypes in MECs when they grow in the context of a 3D reconstituted basement membrane or in the soft mammary gland in vivo or in the stiffened fibrotic microenvironment of a breast tumor (Figure 2; Paszek and Weaver, 2004; Paszek et al., 2005). I also became enamored with assorted methods for deconstructing, manipulating, and testing how these biophysical cues modify cell and tissue behavior. Over the past several years, I have been converted to the wisdom of working with colleagues across disciplines and applying physical science concepts and approaches to understand cell and tissue biology. I have since relocated my laboratory to the University of California, San Francisco, and expanded my group’s studies to include the development of novel in vivo mechano-regulated Molecular Biology of the Cell FIGURE 3: Scanning angle interference microscopy reveals impact of tissue mechanics on integrin adhesion organization. Joint University of California, San Francisco/Berkeley Bioengineering graduate students Luke Cassereau (left) and Matthew Rubashkin (right) and Valerie Weaver conduct supraresolution imaging studies using scanning angle interference microscopy to explore the interplay between integrin adhesions and tissue mechanics in metastatic breast cancer cells. models and exploration of the role of force in stem cell fate and the impact of force not only on breast cancer but also on brain and pancreatic cancer (Butcher et al., 2009; Levental et al., 2009; Dufort et al., 2012; Paszek et al., 2012, 2014; Mouw et al., 2014; Rubashkin et al., 2014). Regardless, the vision and the passion with which I approach my research remain constant, so while the initial work from my group may have been met with some skepticism, persistence and hard work has paid off, and we are in good company these days. Thus, while years ago my engineering students may have felt isolated when they attended the American Society for Cell Biology conference, nowadays the cell biology community has incorporated interdisciplinary approaches into virtually every aspect of cell biology, and I genuinely look forward to seeing and becoming involved in many of the new and exciting discoveries being made at these interfaces. PAYING IT FORWARD Mentoring is one of the privileges and pleasures of being an academic researcher. The joy that I have experienced when one of my students has passed a qualification exam or obtained his or her PhD or when one of my postdoctoral fellows has secured a permanent job and established his or her independence is wonderful. The fun I have interacting with my trainees sustains and nurtures me in multiple ways, and I am constantly learning and being challenged by them (Figure 3). I view the laboratory community I have created as a microcosm of an ideal world in which scientists of all genders, races, and backgrounds and from different disciplines work together to solve key biological questions (Figure 4). Of course, mentoring scientists from different disciplines and team building are not without their challenges, as one struggles with different sensibilities, scientific languages, and perspectives. However, the rewards are many, and I believe that we are united by common goals, including a love of knowledge and an appreciation for the beauty of cell biology and the precision of engineering and the elegance and logic of physics that continue to challenge and motivate us toward the next discovery and the next new concept. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year FIGURE 4: Fostering interdisciplinary science. It’s not all work and no play. A day out, a bit of sunshine, and liquid refreshments go a long way to nurturing interdisciplinary research. Members of the Center for Bioengineering and Tissue Regeneration on the yearly wine tour. Clockwise from top: Suraj Kachgal (bioengineering postdoc, Boudreau Laboratory), Ori Maller (cell biology postdoc), Jon Lakins (biochemistry lab manager), Matthew Rubashkin (bioengineering graduate student), Janna Mouw (mechanical engineering senior scientist), Matthew Barnes (cell biology postdoc), Christopher Dufort (chemistry postdoc), Jason Tung (bioengineering postdoc), Russell Bainer (genetics postdoc), Laralynne Przybyla (cell biology postdoc), Amanda Wijekoon (cell biology laboratory specialist), Balimkiz Senman (premed student trainee), Laura Damaino (cell biology postdoc), Valerie Weaver (biochemistry principal investigator), and Irene Acerbi (bioengineering postdoc). ACKNOWLEDGMENTS I have been lucky enough to secure funding throughout my career from many private and government agencies. My doctoral studies were initially supported by an Ontario Graduate Scholarship and thereafter by a Canadian Medical Research Council Graduate Scholarship. My postdoctoral training was funded by a series of fellowships, including one from the Canadian National Sciences and Engineering agency, another from the Canadian Medical Research Council, and, finally, one from the California Breast Cancer Research Foundation. My early research success at the University of Pennsylvania was made possible by funding through Institutional Development awards from the School of Medicine Deans office and the American Cancer Society from the University of Pennsylvania Cancer Center as well as a National Institutes of Health–National Cancer Institute (NIH NCI) grant and DOD BCRP IDEA and Career Development Awards. My interdisciplinary studies were initially supported by a DOD BCRP Scholar award and A career in context | 11 more recently by a DOD BCRP Scholar expansion award and the NIH NCI Physical Sciences and Oncology program, and my group’s pancreatic and glioblastoma work is currently supported by grants from the NIH NCI Tumor Microenvironment program, with additional support from the American Association for Cancer Research Pancreatic Action Network and the Susan G. Komen Foundation, and the stem cell work is being supported by the California Institute for Regenerative Medicine. REFERENCES Boudreau N, Sympson CJ, Werb Z, Bissell MJ (1995). Suppression of ICE and apoptosis in mammary epithelial cells by extracellular matrix. Science 267, 891–893. Butcher DT, Alliston T, Weaver VM (2009). A tense situation: forcing tumour progression. Nat Rev Cancer 9, 108–122. DuFort CC, Paszek MJ, Weaver VM (2012). Balancing forces: architectural control of mechanotransduction. Nat Rev Mol Cell Biol 12, 308–319. Howlett AR, Bailey N, Damsky C, Petersen OW, Bissell MJ (1995). Cellular growth and survival are mediated by β1 integrins in normal human breast epithelium but not in breast carcinoma. J Cell Sci 108, 1945–1957. Lelievre SA, Weaver VM, Nickerson JA, Larabell CA, Bhaumik A, Petersen OW, Bissell MJ (1998). Tissue phenotype depends on reciprocal interactions between the extracellular matrix and the structural organization of the nucleus. Proc Natl Acad Sci USA 95, 14711–14716. Levental KR, Yu H, Kass L, Lakins JN, Egeblad M, Erler JT, Fong SF, Csiszar K, Giaccia A, Weninger W, et al. (2009). Matrix crosslinking forces tumor progression by enhancing integrin signaling. Cell 139, 891–906. Mouw JK, Yui Y, Damiano L, Bainer RO, Lakins JN, Acerbi I, Ou G, Wijekoon AC, Levental KR, Gilbert PM, et al. (2014). Tissue mechanics modulate microRNA-dependent PTEN expression to regulate malignant progression. Nat Med 20, 360–367. Paszek MJ, DuFort CC, Rossier O, Bainer R, Mouw JK, Godula K, Hudak JE, Lakins JN, Wijekoon AC, Cassereau L, et al. (2014). The cancer glycocalyx mechanically primes integrin-mediated growth and survival. Nature 511, 319–325. Paszek MJ, DuFort CC, Rubashkin MG, Davidson MW, Thorn KS, Liphardt JT, Weaver VM (2012). Scanning angle interference microscopy reveals cell dynamics at the nanoscale. Nat Methods 9, 825–827. 12 | V. M. Weaver Paszek MJ, Weaver VM (2004). The tension mounts: mechanics meets morphogenesis and malignancy. J Mammary Gland Biol Neoplasia 9, 325–342. Paszek MJ, Zahir N, Johnson KR, Lakins JN, Rozenberg GI, Gefen A, Reinhart-King CA, Margulies SS, Dembo M, Boettiger D, et al. (2005). Tensional homeostasis and the malignant phenotype. Cancer Cell 8, 241–254. Rizki A, Weaver VM, Lee SY, Rozenberg GI, Chin K, Myers CA, Bascom JL, Mott JD, Semeiks JR, Grate LR, et al. (2008). A human breast cell model of preinvasive to invasive transition. Cancer Res 68, 1378–1387. Rubashkin MG, Cassereau L, Bainer R, DuFort CC, Yui Y, Ou G, Paszek MJ, Davidson M, Chen YY, Weaver VM (2014). Force engages vinculin and promotes tumor progression by enhancing PI3-kinase activation of phosphatidylinositol (3,4,5)-triphosphate. Cancer Res 74, 4597–4611. Wang F, Weaver VM, Petersen OW, Larabell CA, Dedhar S, Briand P, Lupu R, Bissell MJ (1998). Reciprocal interactions between β1-integrin and epidermal growth factor receptor in three-dimensional basement membrane breast cultures: a different perspective in epithelial biology. Proc Natl Acad Sci USA 95, 14821–14826. Weaver VM, Bissell MJ (1999). Functional culture models to study mechanisms governing apoptosis in normal and malignant mammary epithelial cells. J Mammary Gland Biol Neoplasia 4, 193–201. Weaver VM, Fischer AH, Peterson OW, Bissell MJ (1996). The importance of the microenvironment in breast cancer progression: recapitulation of mammary tumorigenesis using a unique human mammary epithelial cell model and a three-dimensional culture assay. Biochem Cell Biol 74, 833–851. Weaver VM, Howlett AR, Langton-Webster B, Petersen OW, Bissell MJ (1995). The development of a functionally relevant cell culture model of progressive human breast cancer. Semin Cancer Biol 6, 175–184. Weaver VM, Lelievre S, Lakins JN, Chrenek MA, Jones JC, Giancotti F, Werb Z, Bissell MJ (2002). Beta4 integrin-dependent formation of polarized three-dimensional architecture confers resistance to apoptosis in normal and malignant mammary epithelium. Cancer Cell 2, 205–216. Weaver VM, Petersen OW, Wang F, Larabell CA, Briand P, Damsky C, Bissell MJ (1997). Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. J Cell Biol 137, 231–245. Molecular Biology of the Cell MBoC | ASCB AWARD ESSAY From junior to senior: advice from the benefit of 20/20 hindsight Sandra L. Schmid Department of Cell Biology, UT Southwestern Medical Center, Dallas, TX 75390 ABSTRACT As the first recipient of both the Women in Cell Biology Junior and Senior Awards, I look back to identify key components that have provided the foundation for my successful research career. In retrospect, the three most important building blocks have been: identifying and pursing important problems; attracting and mentoring talented postdoctoral fellows and students; and establishing and nurturing strong collaborations. become a fanatic—an expert! You should be able to identify many unanswered questions, some immediately addressable and others that must await new information and new technologies that you can only begin to imagine. “I wish I could …” That is, you must become obsessed with knowing the details. But, the problem must also be one for which you can balance this obsession for details with a vision of the infinite. “What if …?” “If so, then this could mean …!” Pick a problem that you can address from a new perspective and/or by applying new methodologies or experimental systems that reflect your unique skill set and training background. I was lucky and found my passion early. IDENTIFY AN IMPORTANT PROBLEM When I began my graduate studies in 1980, AND PURSUE LONG-TERM GOALS Sandra L. Schmid I chose to study clathrin-mediated endocyFirst and foremost, you must identify a good tosis (CME), still the subject of my research problem on which to focus your research program. I had first encountered coated vesicle–mediated endocyprogram. You must be passionate about the subject. You should be tosis during a cytology class while studying cell biology at the Uniexcited to read new papers and reviews as soon as they appear, versity of British Columbia. Viewing the spectacular electron microand to discuss their merits and shortcomings and the new experigraphs of Roth and Porter showing uptake of yolk proteins by coated ments they suggest with anyone who will listen. You need to pits and vesicles in mosquito embryos after their mother’s blood meal (Roth and Porter, 1964) and those of Heuser and Reese of the DOI:10.1091/mbc.E14-06-1081. Mol Biol Cell 25, 3259–3262. same structures recycling synaptic vesicles after excitation of a frog Sandra L. Schmid is the recipient of the 2014 ASCB WICB Lifetime Achievement neuromuscular junction (Heuser and Reese, 1973) piqued my curiosAward. Address correspondence to: Sandra L. Schmid (sandra.schmid@utsouthwestern ity and imagination. Barbara Pearse had recently purified coated .edu). vesicles from porcine brain and identified clathrin as their major coat Abbreviations used: CCV, clathrin-coated pits and vesicles; CME, clathrin-mediatconstituent (Pearse, 1975, 1976). A slew of papers had just appeared ed endocytosis; WICB, Women in Cell Biology. showing that ferritin- (Anderson et al., 1977) or 125I-labeled (Gorden © 2014 Schmid. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available et al., 1978) ligands and their receptors were concentrated in clathto the public under an Attribution–Noncommercial–Share Alike 3.0 Unported rin-coated pits and vesicles (CCVs) for efficient internalization. I Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). was swept up in this wave of exciting new discoveries. Moreover, “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of working on my honors thesis project in the lab of Pieter Cullis, who the Cell®” are registered trademarks of The American Society for Cell Biology. In 1990, I was honored to receive the Women in Cell Biology (WICB) Junior Award, which recognized my “significant potential” for scientific contributions. Twenty-four years later (where did the time go?), presumably having met those high expectations, I am once again honored to receive the WICB Senior Award. Being the first recipient of both awards has prompted me to look back, consider, and share what worked, what did not, and what lessons I have learned in the process. Thus, with the benefit of 20/20 hindsight, I offer the following advice to this and future years’ WICB Junior Award recipients. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year 13 FIGURE 1: Schmid (third from right) and current lab members at journal club actively discussing the newest papers, their merits and shortcomings, and the new experiments they suggest. studied nonbilayer phospholipids and their role in membrane dynamics, I wondered which proteins worked together with clathrin to build this elegant cellular machinery and how it could work to deform and pinch off a small piece of the membrane while still maintaining its critical barrier function. There were so many unanswered questions. At about the same time, I attended a seminar and had lunch with a young assistant professor, James Rothman, who had just started his lab at Stanford University. He reported their as-yet-unpublished, early progress toward the first cell-free reconstitution of a vesicular trafficking event (Fries and Rothman, 1980). This was exciting, as the tools were becoming available to measure and understand vesicular transport. Thus I began my graduate studies in Jim’s lab with the goal of reconstituting CME. I quickly learned that inside every big problem are a lot of little problems. In the Biochemistry Department at Stanford University, founded and inspired by Arthur Kornberg, reconstituting complex biological reactions from purified components was almost expected. However, the application of biochemical fractionation and reconstitution to membrane trafficking events was in its infancy. Of course, I was not successful in reconstituting CCV formation during my 4 years at Stanford and instead answered a much simpler problem: given that clathrin could spontaneously assemble into “empty cages” (Woodward and Roth, 1978), we reasoned that energy must be required to disassemble clathrin coats with the help of some yet undiscovered uncoating enzyme. My colleagues (David Schlossman and Bill Braell) and I established sedimentation assays for uncoating and used these to purify and characterize the uncoating ATPase now known to be hsc70 (Braell et al., 1984; Schlossman et al., 1984; Schmid et al., 1984; Rothman and Schmid, 1986). It became clear that to solve the bigger problem of CME, I would need more skills as a cell biologist. And so I moved to Yale to pursue studies among the pioneers of membrane trafficking, George Palade, Marilyn Farquhar, Jim Jamieson, and another young assistant professor just starting his lab, Ira Mellman. Ira and Ari Helenius had recently discovered endosomes and were developing new methods 14 | S. L. Schmid of subcellular fractionation to study them. Here was an opportunity to apply my newfound skills as a biochemist and to be immersed in cell biology. We were able to purify and identify biochemically and functionally distinct early and late endosomes (Schmid et al., 1988). As an assistant professor at the Scripps Research Institute, I returned my focus to the reconstitution of CME. Many talented postdocs contributed to our efforts, allowing us to reconstitute and study CME in perforated cells (Schmid and Smythe, 1991; Carter et al., 1993) and from isolated plasma membrane sheets (Miwako et al., 2003). These studies also led us to focus on the GTPase dynamin, which we eventually showed not only functions as the minimal fission machinery (Pucadyil and Schmid, 2008; Shnyrova et al., 2013), but also regulates early, rate-limiting steps in CME (Sever et al., 1999, 2000; Aguet et al., 2013). Along the way toward our goal of reconstituting CCV formation from its minimum components, we also discovered important two-way links between CME and signaling (Lamaze et al., 1996; Vieira et al., 1996; Conner and Schmid, 2002). Thus it became clear that rather than defining the minimal components, which were later shown to be clathrin, a membrane adaptor, and dynamin (Dannhauser and Ungewickell, 2012), we needed to understand the complexity and regulation of CME. We needed to define the “maximum” components required for this physiologically critical process. This goal could only be accomplished in living cells: a goal now attainable by technological advances, such as green fluorescent protein, RNA interference, total internal reflection fluorescence microscopy, computer-aided image analysis, genome-editing, and others that did not exist in 1980. Almost 35 years after choosing to study CME, the process continues to fascinate me, and our studies continue to reveal new concepts, such as the existence of an “endocytic checkpoint” (Loerke et al., 2009; Aguet et al., 2013), and unexpected twists, such as the ability of specific cargo molecules to “fine-tune” and “customize” the endocytic machinery (Lamaze et al., 1993; Lamaze and Schmid, 1995; Liu et al., 2010; Mettlen et al., 2010). My enthusiasm for reading the newest papers and discussing their merits and shortcomings and the new experiments they suggest has never diminished. Molecular Biology of the Cell BE A GOOD MENTOR As a new assistant professor, your skills at the bench and your direct eyes on the results and incongruities will be critical for your success. Stay active at the bench for as long as possible! However, as your lab grows and begins to incorporate new technologies, your role will change. You will need to be effective in facilitating the work of others, rather than performing experiments yourself. Set high standards for membership in your lab and be explicit about your expectations for effort and attitude. Value every member and realize that each has his or her own strengths, weaknesses, aspirations, and needs. Watch and listen to discover what these are. Some will be well-trained, extremely independent, and ambitious— challenge them to be disciplined, goal-oriented, risk-takers and to mentor others. Some will require closer supervision and more frequent direction until they gain the skills needed for independence. Don’t make them struggle alone. Instead, work with them more closely or pair them up with more senior lab members to efficiently teach them the skills they need for success. Others, with your help, will discover that they’d rather be doing something else. Help them, as quickly as possible, to find their passion and new opportunities to pursue it. If they are in the wrong place and lack motivation, they could create negative feedback that could impact overall lab morale. When I started my lab, I assumed that all postdocs had their own good ideas and ability to execute them and that, like me, they needed/wanted minimum oversight from their mentors. I treated all my postdocs in the same way and each worked independently on his or her own projects. We were a small lab of two postdocs and one technician working on four different projects. It was a disaster! While some succeeded, others floundered and became frustrated and demotivated. Imposing more direction later on was difficult. Today, every new member of my lab begins by working with a more senior member on a well-defined project. The senior member learns mentorship skills and, in exchange for training a new lab member, his or her project advances more quickly. The junior member quickly learns new skills and experiences early success. Independent projects emerge at variable times, as each individual develops the ideas necessary to branch out. My lab works and succeeds as a team. Recognize and reward the individual accomplishments of your postdocs and students, even (or especially) within a team. Then actively help them to transition to the next stages of their own careers. Their success will create positive feedback that motivates current members and attracts talented new members to join your lab. FIND AND NURTURE GOOD COLLABORATORS Effectively tackling big and important questions will require many different technologies and approaches. Pursuing your results will take you down unfamiliar paths. Do not fear them. There is no reason to stop and pull back or to move slowly forward, hobbled by inexperience. Science is increasingly interdisciplinary, but individual scientists can’t possibly be. Seek out the experts whose approach, when applied to your problem, will be mutually beneficial, allowing you both to accomplish an important objective that neither could accomplish alone. Make sure you share credit, engage in honest and open communication, and build a relationship based on trust and mutual respect. I have benefited from outstanding collaborators throughout my career, starting with the already-mentioned David Schlossman and Bill Braell, postdocs with Jim Rothman, who taught me biochemistry and enzymology. With their help, I got a quick start as a graduate student and was able to publish eight primary papers and to complete my Ph.D. training in 4 years. At Yale, I teamed up with Renate 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Fuchs, a skilled and knowledgeable physiologist who could measure ion transport across endosomal membranes. I worked the early shift, preparing endosomal fractions in the mornings, and Renate would take over in the afternoons and evenings to characterize their transport activities. Together, we published three papers in 2 years and, more importantly, developed a lasting friendship. To understand dynamin function, I have collaborated with brilliant physicists (Vadim Frolov and Josh Zimmerberg) and talented structural biologists (Jenny Hinshaw, Ron Milligan, Josh Chappie, and Fred Dyda) with great success. For the past 10 years, I have enjoyed a close collaboration with Gaudenz Danuser, an engineer and mathematician, and his talented lab members who have helped us to develop and analyze live-cell assays for CME. These collaborators have pushed me to accomplish goals I could not have reached alone and to ask questions in new ways and from new perspectives. They too have become valued friends. By far my most successful and rewarding collaboration has been with my husband, Bill Balch, whom I met at Stanford, while he was a postdoc with Rothman. While we have never published together, Bill has been an important advocate, critic, source of support, and sounding board throughout my career. We have collaborated in raising two outstanding young adults, Jeremy, who began medical school at University of Michigan this fall, and Katherine, a composer (www.katherinebalch.com) studying at Yale. Both are happy, accomplished, and successfully following their own passions. Thus my last piece of advice to current and future Junior Award recipients is to enjoy and value your families and loved ones, as these relationships provide the support needed to persevere when times are tough, to believe in yourself, to take risks, and to accomplish your goals. REFERENCES Aguet F, Antonescu CN, Mettlen M, Schmid SL, Danuser G (2013). Advances in analysis of low signal-to-noise images link dynamin and AP2 to the functions of an endocytic checkpoint. Dev Cell 26, 279–291. Anderson RG, Brown MS, Goldstein JL (1977). Role of the coated endocytic vesicle in the uptake of receptor-bound low density lipoprotein in human fibroblasts. Cell 10, 351–364. Braell WA, Schlossman DM, Schmid SL, Rothman JE (1984). Dissociation of clathrin coats coupled to the hydrolysis of ATP: role of an uncoating ATPase. J Cell Biol 99, 734–741. Carter LL, Redelmeier TE, Woollenweber LA, Schmid SL (1993). Multiple GTP-binding proteins participate in clathrin-coated vesicle-mediate endocytosis. J Cell Biol 120, 37–45. Conner SD, Schmid SL (2002). Identification of an adaptor-associated kinase, AAK1, as a regulator of clathrin-mediated endocytosis. J Cell Biol 156, 921–929. Dannhauser PN, Ungewickell EJ (2012). Reconstitution of clathrin-coated bud and vesicle formation with minimal components. Nat Cell Biol 14, 634–639. Fries E, Rothman JE (1980). Transport of vesicular stomatitis virus glycoprotein in a cell-free extract. Proc Natl Acad Sci USA 77, 3870–3874. Gorden P, Carpentier JL, Cohen S, Orci L (1978). Epidermal growth factor: morphological demonstration of binding, internalization, and lysosomal association in human fibroblasts. Proc Natl Acad Sci USA 75, 5025–5029. Heuser JE, Reese TS (1973). Evidence for recycling of synaptic vesicle membrane during transmitter release at the frog neuromuscular junction. J Cell Biol 57, 315–344. Lamaze C, Baba T, Redelmeier TE, Schmid SL (1993). Recruitment of epidermal growth factor and transferrin receptors into coated pits in vitro: differing biochemical requirements. Mol Biol Cell 4, 715–727. Lamaze C, Chuang TH, Terlecky LJ, Bokoch GM, Schmid SL (1996). Regulation of receptor-mediated endocytosis by Rho and Rac. Nature 382, 177–179. Lamaze C, Schmid SL (1995). Recruitment of epidermal growth factor receptors into coated pits requires their activated tyrosine kinase. J Cell Biol 129, 47–54. Liu AP, Aguet F, Danuser G, Schmid SL (2010). Local clustering of transferrin receptors promotes clathrin-coated pit initiation. J Cell Biol 191, 1381–1393. Advice for junior scientists | 15 Loerke D, Mettlen M, Yarar D, Jaqaman K, Jaqaman H, Danuser G, Schmid SL (2009). Cargo and dynamin regulate clathrin-coated pit maturation. PLoS Biol 7, e57. Mettlen M, Loerke D, Yarar D, Danuser G, Schmid SL (2010). Cargo- and adaptor-specific mechanisms regulate clathrin-mediated endocytosis. J Cell Biol 188, 919–933. Miwako I, Schroter T, Schmid SL (2003). Clathrin- and dynamin-dependent coated vesicle formation from isolated plasma membranes. Traffic 4, 376–389. Pearse BMF (1975). Coated vesicles from pig brain: purification and biochemical characterization. J Mol Biol 97, 93–98. Pearse BMF (1976). Clathrin: a unique protein associated with intracellular transfer of membrane by coated vesicles. Proc Natl Acad Sci USA 73, 1255–1259. Pucadyil TJ, Schmid SL (2008). Real-time visualization of dynamin-catalyzed membrane fission and vesicle release. Cell 135, 1263–1275. Roth TF, Porter KR (1964). Yolk protein uptake in the oocyte of the mosquito Aedes aegypti. L. J Cell Biol 20, 313–332. Rothman JE, Schmid SL (1986). Enzymatic recycling of clathrin from coated vesicles. Cell 46, 5–9. Schlossman DM, Schmid SL, Braell WA, Rothman JE (1984). An enzyme that removes clathrin coats: purification of an uncoating ATPase. J Cell Biol 99, 723–733. 16 | S. L. Schmid Schmid SL, Braell WA, Schlossman DM, Rothman JE (1984). A role for clathrin light chains in the recognition of clathrin cages by “uncoating ATPase.” Nature 311, 228–231. Schmid SL, Fuchs R, Male P, Mellman I (1988). Two distinct subpopulations of endosomes involved in membrane recycling and transport to lysosomes. Cell 52, 73–83. Schmid SL, Smythe E (1991). Stage-specific assays for coated pit formation and coated vesicle budding in vitro. J Cell Biol 114, 869–880. Sever S, Damke H, Schmid SL (2000). Dynamin:GTP controls the formation of constricted coated pits, the rate limiting step in clathrin-mediated endocytosis. J Cell Biol 150, 1137–1148. Sever S, Muhlberg AB, Schmid SL (1999). Impairment of dynamin’s GAP domain stimulates receptor-mediated endocytosis. Nature 398, 481–486. Shnyrova AV, Bashkirov PV, Akimov SA, Pucadyil TJ, Zimmerberg J, Schmid SL, Frolov VA (2013). Geometric catalysis of membrane fission driven by flexible dynamin rings. Science 339, 1433– 1436. Vieira AV, Lamaze C, Schmid SL (1996). Control of EGF receptor signaling by clathrin-mediated endocytosis. Science 274, 2086–2089. Woodward MP, Roth TF (1978). Coated vesicles: characterization, selective dissociation, and reassembly. Proc Natl Acad Sci USA 75, 4394–4398. Molecular Biology of the Cell MBoC | ASCB AWARD ESSAY People’s instinctive travels and the paths to science Avery August Department of Microbiology and Immunology, Cornell University, Ithaca, NY 14853 ABSTRACT To be the recipient of the E. E. Just Award for 2014 is one of my greatest honors, as this is a truly rarefied group. In this essay, I try to trace my path to becoming a scientist to illustrate that multiple paths can lead to science. I also highlight that I did not build my career alone. Rather, I had help from many and have tried to pay it forward. Finally, as the country marches toward a minority majority, I echo the comments of previous E. E. Just Award recipients on the state of underrepresented minorities in science. IN THE BEGINNING said a doctor. That’s what kids interested in biology did. But my mother changed the trajectory of my life. She decided that we could get better opportunities in the United States, and she migrated (initially illegally, and then legally), so that she (and her children) could do better. She got her high school GED in the United States, and my story is her story continued. I did not have the same hurdles as the namesake of this award, E. E. Just. My path was different. I was born in Belize, in Central America, to a teenage mother, with the accompanying “destined to fail statistics” that came with my birth circumstances. I grew up practicing science without realizing it, spending summers performing experiments: mixing various chemicals to see what would happen, rediscovering that plants grow toward the sunlight, using tadpoles to study developmental biology. I credit my biology teacher, a Peace Corps volunteer, for encouraging these activities. It was not until much later that I found out one could actually make a living as a scientist. Whenever I was asked what I wanted to be, rather than saying a carpenter (my grandfather’s occupation and what I secretly wanted to be), I CALIFORNIA AND DREAMING I moved to Los Angeles in the mid 1980s, just as the crack epidemic was getting underway. My friends were involved in “the trade.” By the time I was leaving for graduate school, half had been shot, all had been to jail at least once, a few were dead. All were casualties of the war on drugs and the disparity in sentencing laws.1 This is not in Avery August my curriculum vitae, but I was mugged on the campus of Los Angeles Southwest Community College, where I was trying to register for classes, had a gun DOI:10.1091/mbc.E14-06-1120. Mol Biol Cell 25, 3263–3266. stuck in my stomach, and learned not to look a gang member diAvery August is the 2014 recipient of the E. E. Just Award from the American Sorectly in the eye. On arriving in Los Angeles, I was placed in the 11th ciety for Cell Biology. grade at Los Angeles High School, although I dropped out at the Conflict of interest disclosure: The author declares no competing financial interests. end of the semester, deciding to take my chances with the GED. It’s The title of this article is adapted from the title of the 1990 album People’s Instincthe diploma that I have had framed, because it was my ticket to tive Travels and the Paths of Rhythm by A Tribe Called Quest. Address correspondence to: Avery August (averyaugust@cornell.edu). Abbreviations used: LACC, Los Angeles Community College; NIH, National Institutes of Health; NSF, National Science Foundation; TcR, T-cell receptor. © 2014 August. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society for Cell Biology. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year 1 Policies that disproportionately affected the African-American and Hispanic communities, with the proportion of drug arrests of African Americans increasing from 25% in 1980 to 37% in 1995, and these groups being more likely than nonHispanic whites to be jailed for a drug offense. Disparities in sentencing for crack cocaine offences passed by Congress in 1986 and 1988 also contributed to this imbalance. Congress also passed legislation in 1994 prohibiting convicts from receiving Pell Grants, effectively preventing a large proportion of African Americans and Hispanics from being able to get higher education. See Mauer, 1999. 17 being able to register at a community college. At the time, I knew no one who had gone to college in the United States and had no guidance on the process. I eventually registered at Los Angeles Community College (LACC). After two years at LACC, I transferred to the California State University in Los Angeles, initially registering as a biology major but then, like many others, switching to medical technology, because I needed to get a job if medical school didn’t pan out. I was working a full-time job to pay for college, and soon this started to take its toll. I started to reconsider going to medical school, because I was always more interested in the why and how. Fortunately, I took an organic chemistry course with Costello Brown at Cal State; he called me into his office after one exam and asked me my major. He then said: “Do you want to do urine analysis for the rest of your life?” He suggested I try to get some research experience in a lab and go to graduate school. This was the first time I had ever heard of this option. At around the same time, one of my friends in “the trade” said to me, “Why are you hanging out with us, you should be focusing on your studies” (sadly, Joe was later shot). I was eventually able to get into the laboratory of Phoebe Dea, who opened my eyes to the world of science and the idea that one can have a career in science. She even got me financial support from the National Institutes of Health (NIH)-funded Research Infrastructure for Minority Institutions program, so I could reduce my hours working. In her lab, I worked on investigating the catalytic synthesis of fatty acids and other lipids using homogenous catalysts. We eventually published my first paper on this topic (August et al., 1993). Professor Dea encouraged me apply to graduate school. I was skeptical and started looking for jobs as I neared graduation, now burdened with student loans and seeing all my friends enjoying their lives with the accoutrements. I couldn’t afford not to work for the yearlong internship it took to become certified as a medical technologist, and the closest I got to a job was as a part-time technician at the Doheny Eye Institute, harvesting eyes from accident victims (the interview consisting of an actual eye harvest!). So I applied to graduate schools, choosing immunology, because I really enjoyed taking this course, and was accepted to the Graduate School of Medical Sciences at Cornell University in New York City. NEW YORK STATE OF MIND2 I wanted to attend Cornell, because it was in New York City, a place where I didn’t have to drive, thus losing the privilege of lying handcuffed on the sidewalk whenever the Los Angeles Police Department pulled me over for a simple traffic ticket.3 At Cornell, I wasn’t being mugged or shot at or harassed by the police. However, I was initially very scared to start there, because my classmates were from all over the world, including Ivy League institutions; I was afraid that my preparation at Cal State would fall short. However, I soon found out that I could hold my own. After working for a short time in David Posnett’s lab on interactions between the T-cell receptor (TcR) and superantigens (Posnett et al., 1990), I ended up in the laboratory of Bo Dupont. I am eternally grateful to Professor Dupont, as he gave me wide latitude in working on projects in his lab. I investigated the signaling pathways downstream of the TcR and the costimulatory receptor CD28 and showed for the first time that CD28 recruited and activated the lipid kinase PI3K and that the Tec kinase ITK lay downstream of the TcR and CD28 (August and Dupont, 1994a,b, 1995, 1996; August et al., 1994, 1997; Gibson et al., 1996a,b; Teng et al., 1996; King et al., 1997). I continue to work in these areas in some form or another today (August and Ragin, 2012). Following graduate school, I decided to stay in New York City and approached Hidesaburo Hanafusa at the Rockefeller University, who accepted me into his lab. Rockefeller is an awe-inspiring place, although the guards at the gate could never get used to my presence. In the Hanafusa lab, I worked in various areas, one of my discoveries being that the Tec kinase ITK (from my graduate work) lay downstream of Src kinases (August et al., 1997; originally discovered by Hanafusa and others [Takeya and Hanafusa, 1983; Wang et al., 1978]). I am grateful for the support of the National Science Foundation (NSF) for a minority postdoctoral fellowship.4 After about two-and-a-half years, I decided to probe the job market, applying for both industrial and academic positions. Surprisingly, I received several industrial and academic interviews and accepted a position at the Johnson & Johnson Pharmaceutical Research Institute. TRAVELS ALONG THE WAY I was quite happy at J&J, with great colleagues and a healthy respect for industrial work, but I missed the academic environment and really wanted to work with students. So, after a year at the company, I decided to leave and reenter the job market and landed a position at Penn State. I had great colleagues and great students at Penn State, but I very quickly realized how few minority scientists there were. And so I spent a lot of time working with underrepresented undergraduate and graduate students, acting as an unofficial mentor to our few minority students and being a Sloan faculty mentor to the minority students supported by the Sloan Foundation. I also decided to develop, and was able to get NIH funding for, a Bridges to the Doctorate program with Alcorn State (a historically black university) in Mississippi (August et al., 2008). My students helped me build my publications and get funding, allowing me to rise to the title of Distinguished Professor. In 2010, I was recruited to my current position. PUSHING IT ALONG Along the way, I have had great mentors, advisors, and colleagues, and I have always felt that I stand on the shoulders and backs of slaves and civil rights workers, who have fought for people like me to be able to get to this point. I have had great support from my family and help from unknown supporters. I have tried to pass it along, with service on study panels and mentoring groups, always being willing to answer questions and provide support and advice for all students, but particularly for underrepresented students; We have a long way to go. I won’t cite the statistics (they are cited elsewhere, e.g., Hayes, 2010), but I suggest you look around your labs and your campus or research institute to get a sense of the paucity of underrepresented minorities in science. While the NIH and a number of agencies, private and public, including the ASCB, have to be applauded for providing significant resources in training and supporting scientists from underrepresented groups, as well as supporting research into the health disparities of minority citizens,5 we have had very slow progress. I am reminded of an idea from the columnist Ezra Klein (Klein, 2014), commenting on Ta-Nehisi Coates’ 4 The title of a track from the 1994 album Illmatic by Nas. 2 3 For example, in the late 1980s, In Volusia County, Florida, more than 70% of the drivers stopped for traffic stops by local police were either African American or Hispanic, and they were also stopped for longer times, with 80% of their cars being searched. See Harris, 1997. 18 | A. August Where I overlapped with fellow NSF Fellow and 2010 E. E. Just Award recipient Tyrone Hayes. 5 Starting with the Office of Minority programs established in 1990 by then secretary of the U.S. Department of Health and Human Services, Louis Sullivan, and culminating with the establishment of the National Institute on Minority Health and Health Disparities in 2010. Molecular Biology of the Cell FIGURE 1: A changing minority majority. (A) Projection of the minority population in the United States (derived from data in National Science Foundation, 2004). (B) Plot representing the hope that we can exponentially increase representation of underrepresented minorities in science to match the population projections. article “The Case for Reparations” (Coates, 2014). Klein writes that the plight of African Americans in the United States is like a compound interest problem. Applied to the situation in science, it’s the equivalent of getting $10,000 a year for 42 years for minority programs,6 while the majority has gotten the equivalent of a penny a year for 67 years,7 and that penny has been doubling in value every year. The difference? $420,000 for minority programs versus $1,475,739,525,896,764,129.27. That’s a lot of resources to make up. We also know, due to the pioneering work of Ginther, Kington, and colleagues published in 2011, that African-American scientists in particular are significantly less likely to be funded by the NIH, for reasons that remain unclear (Ginther et al., 2011, 2012; Tabak and Collins, 2011). Given the changing face of the nation (Figure 1A), many suggestions have been proposed to address the paucity of minority scientists (Pasick et al., 2003; Carter et al., 2009; Hayes, 2010; Byars-Winston et al., 2011; National Academy of Sciences, National Academy of Engineering, and Institute of Medicine, 2011; Maton et al., 2012; Valla and Williams, 2012). The good thing about any successful approach is that what works for our minority students can also work for our majority students. What I can say we do need is more dedicated mentors from the highest ranks of science, whose careers are dependent on the success of minority students (perhaps tied to their funding). We need to train those mentors on how to mentor minority students and use broader measures to judge minority applicants to graduate schools (e.g., see Posselt, 2014). Those of us from underrepresented groups who have made it here have a duty to be part of this process. We also need to challenge our communities and schools to support bright, smart kids as much as they support talented athletes. We need to find out what worked for those successful minority scientists and replicate it. And we need to keep moving forward to build on past successes with hope (Figure 1B). I am in awe of the company in which I have been placed as a E. E. Just Award recipient,8 and it gives me impetus to follow the words of Rick Ross: “Everyday I’m hustlin’, everyday I’m hustlin’.”9 6 Let’s start with the initiation of the Maximizing Access to Research Careers program at NIH in 1972. 7 Let’s start with the first NIH grants program in 1944, which very likely supported very few minorities, given the state of civil rights in the country at that time. 8 E. E. Just Award recipients: www.ascb.org/component/content/article/122 -about-ascb/committees/membership-committee/awards/144-keith-e-e-just -award. 9 Lyrics from the song “Hustlin’” from the 2006 album Port of Miami by Rock Ross. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year ACKNOWLEDGMENTS I thank all those teachers, professors, colleagues, students, friends, and family who have touched my career. Deep apologies to those not mentioned due to space constraints. REFERENCES August A, Dao CJ, Jensen D, Zhang Q, Dea P (1993). A facile catalytic deuteration of unsaturated fatty acids and phospholipids. Microchem J 47, 224. August A, Dupont B (1994a). Activation of src family kinase lck following CD28 crosslinking in the Jurkat leukemic cell line. Biochem Biophys Res Commun 199, 1466–1473. August A, Dupont B (1994b). CD28 of T lymphocytes associates with phosphatidylinositol 3-kinase. Int Immunol 6, 769–774. August A, Dupont B (1995). Activation of extracellular signal-regulated protein kinase (ERK/MAP kinase) following CD28 cross-linking: activation in cells lacking p56lck. Tissue Antigens 46, 155–162. August A, Dupont B (1996). Association between mitogen-activated protein kinase and the zeta chain of the T cell receptor (TcR) with the SH2,3 domain of p56lck. Differential regulation by TcR cross-linking. J Biol Chem 271, 10054–10059. August A, Gibson S, Kawakami Y, Kawakami T, Mills GB, Dupont B (1994). CD28 is associated with and induces the immediate tyrosine phosphorylation and activation of the Tec family kinase ITK/EMT in the human Jurkat leukemic T-cell line. Proc Natl Acad Sci USA 91, 9347–9351. August A, Ragin MJ (2012). Regulation of T-cell responses and disease by Tec kinase Itk. Int Rev Immunol 31, 155–165. August A, Rajanna B, Sizemore R (2008). Bridging the masters and doctorate degrees. ASBMB Today, November, 28–29. August A, Sadra A, Dupont B, Hanafusa H (1997). Src-induced activation of inducible T cell kinase (ITK) requires phosphatidylinositol 3-kinase activity and the Pleckstrin homology domain of inducible T cell kinase. Proc Natl Acad Sci USA 94, 11227–11232. Byars-Winston A, Gutierrez B, Topp S, Carnes M (2011). Integrating theory and practice to increase scientific workforce diversity: a framework for career development in graduate research training. CBE Life Sci Educ 10, 357–367. Carter FD, Mandell MB, Maton KI (2009). The influence of on-campus, academic year undergraduate research on STEM PhD outcomes: evidence from the Meyerhoff Scholarship Program. Educ Eval Policy Anal 31, 441–462. Coates T-N (2014). The case for reparations. The Atlantic, May 21, 2014. Gibson S, August A, Branch D, Dupont B, Mills GM (1996a). Functional LCK is required for optimal CD28-mediated activation of the TEC family tyrosine kinase EMT/ITK. J Biol Chem 271, 7079–7083. Gibson S, August A, Kawakami Y, Kawakami T, Dupont B, Mills GB (1996b). The EMT/ITK/TSK (EMT) tyrosine kinase is activated during TCR signaling: LCK is required for optimal activation of EMT. J Immunol 156, 2716–2722. Ginther DK, Haak LL, Schaffer WT, Kington R (2012). Are race, ethnicity, and medical school affiliation associated with NIH R01 type 1 award probability for physician investigators? Acad Med 87, 1516–1524. E. E. Just Award essay | 19 Ginther DK, Schaffer WT, Schnell J, Masimore B, Liu F, Haak LL, Kington R (2011). Race, ethnicity, and NIH research awards. Science 333, 1015–1019. Harris DA (1997). “Driving while black” and all other traffic offenses: the Supreme Court and pretextual traffic stops. J Crim Law Crim 87, 562. Hayes TB (2010). Diversifying the biological sciences: past efforts and future challenges. Mol Biol Cell 21, 3767–3769. King PD, Sadra A, Teng JM, Xiao-Rong L, Han A, Selvakumar A, August A, Dupont B (1997). Analysis of CD28 cytoplasmic tail tyrosine residues as regulators and substrates for the protein tyrosine kinases, EMT and LCK. J Immunol 158, 580–590. Klein E (2014). You can be a beneficiary of racism even if you’re not a racist. Vox 1.2, www.vox.com/2014/5/23/5743056/you-can-be-a-beneficiary-of -racism-even-if-you-re-not-a-racist. Maton KI, Pollard SA, McDougall Weise TV, Hrabowski FA (2012). Meyerhoff Scholars Program: a strengths-based, institution-wide approach to increasing diversity in science, technology, engineering, and mathematics. Mt Sinai J Med 79, 610–623. Mauer M (1999). The Crisis of the Young African American Male and the Criminal Justice System, Washington, DC: The Sentencing Project. National Academy of Sciences, National Academy of Engineering, and Institute of Medicine (2011). Expanding Underrepresented Minority Participation: America’s Science and Technology Talent at the Crossroads, Washington, DC: National Academies Press. National Science Foundation (2004). Women, Minorities, and Persons with Disabilities in Science and Engineering: 2004, NSF 04-317, Arlington, VA. 20 | A. August Pasick RJ, Otero-Sabogal R, Nacionales MC, Banks PJ (2003). Increasing ethnic diversity in cancer control research: description and impact of a model training program. J Cancer Educ 18, 73–77. Posnett DN, Schmelkin I, Burton DA, August A, McGrath H, Mayer LF (1990). T cell antigen receptor V gene usage. Increases in V beta 8 + T cells in Crohn’s disease. J Clin Invest 85, 1770–1776. Posselt JR (2014). Towards inclusive excellence in graduate education: constructing merit and diversity in PhD admissions. Am J Educ 120, 481–514. Tabak LA, Collins FS (2011). Sociology. Weaving a richer tapestry in biomedical science. Science 333, 940–941. Takeya T, Hanafusa H (1983). Structure and sequence of the cellular gene homologous to the RSV src gene and the mechanism for generating the transforming virus. Cell 32, 881–890. Teng JM, King PD, Sadra A, Liu X, Han A, Selvakumar A, August A, Dupont B (1996). Phosphorylation of each of the distal three tyrosines of the CD28 cytoplasmic tail is required for CD28-induced T cell IL-2 secretion. Tissue Antigens 48, 255–264. Valla JM, Williams WM (2012). Increasing achievement and higher-education representation of under-represented groups in science, technology, engineering, and mathematics fields: a review of current K-12 intervention programs. J Women Minor Sci Eng 18, 21–53. Wang LH, Halpern CC, Nadel M, Hanafusa H (1978). Recombination between viral and cellular sequences generates transforming sarcoma virus. Proc Natl Acad Sci USA 75, 5812–5816. Molecular Biology of the Cell MBoC | ASCB AWARD ESSAY Can small institutes address some problems facing biomedical researchers? Michael P. Sheetz Mechanobiology Institute of Singapore, National University of Singapore, Singapore, 102275; Department of Biological Sciences, Columbia University, New York, NY 10027 ABSTRACT At a time of historically low National Institutes of Health funding rates and many problems with the conduct of research (unfunded mandates, disgruntled reviewers, and rampant paranoia), there is a concern that biomedical research as a profession is waning in the United States (see ”Rescuing US biomedical research from its systemic flaws” by Alberts and colleagues in the Proceedings of the National Academy of Sciences). However, it is wonderful to discover something new and to tackle tough puzzles. If we could focus more of our effort on discussing scientific problems and doing research, then we could be more productive and perhaps happier. One potential solution is to focus efforts on small thematic institutes in the university structure that can provide a stimulating and supportive environment for innovation and exploration. With an open-lab concept, there are economies of scale that can diminish paperwork and costs, while providing greater access to state-of-the-art equipment. Merging multiple disciplines around a common theme can catalyze innovation, and this enables individuals to develop new concepts without giving up the credit they deserve, because it is usually clear who did the work. Small institutes do not solve larger systemic problems but rather enable collective efforts to address the noisome aspects of the system and foster an innovative community effort to address scientific problems. Being honored to present the Porter Lecture has caused me to reflect on the discussion about the current National Institutes of Health (NIH) funding paradigm and to share a few thoughts. There are a number of concerns about the current system, ranging from the quality of the review of NIH grants to the paranoia that we will get scooped if we share our latest results in a scientific discussion. In addition, there is a major waste of resources on top-down projects to develop huge amounts of data without testing a hypothesis. However, things are not totally terrible. Objectively, the NIH budget is very large, despite the problem of too many scientists vying for a diminishing pot. Worldwide, there are increasing budgets for research, particularly in the East. If we could efficiently deal with some DOI:10.1091/mbc.E14-05-1017. Mol Biol Cell 25, 3267–3269. Michael P. Sheetz is the 2014 Porter Lecturer for the American Society for Cell Biology. Address correspondence to: Michael Sheetz (ms2001@columbia.edu). Abbreviations used: MBI, Mechanobiology Institute; NIH, National Institutes of Health; PI, principal investigator. © 2014 Sheetz. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society for Cell Biology. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Michael P. Sheetz of the increase in regulatory paperwork and break down barriers to sharing technologies across disciplines, then we could spend more time testing new ideas. The Marine Biological Labs provided an open environment for scientific exchange that greatly aided the 21 discovery of kinesin and the development of in vitro motility assays. Likewise, Bell Labs and the Laboratory of Molecular Biology fostered innovation with a strong emphasis on open scientific discussions and with outstanding facilities. Can this type of environment be developed in a university setting? Together with a strong group of international collaborators, I recently had an opportunity to start a small interdisciplinary institute in Singapore that was associated with the National University of Singapore. With some luck, trial and error, and a lot of hard work by staff and colleagues, we developed a system that may work in the U.S. context. The general concept was to provide excellent facilities for all investigators in an open-lab environment that encouraged open discussion of problems by researchers with different backgrounds. We started the Mechanobiology Institute (MBI) in 2009 with a block grant covering about two-thirds of projected indirect and direct costs for 10 years (the remainder to come from outside grants). With the help of excellent support staff and the cooperation of all, an open multidisciplinary lab for 200 investigators (about half grad students and postdoctoral fellows) and 15–20 principal investigators (PIs) was operational by the end of year 3. Many of our PIs were initially skeptical about an open lab, but it provided benefits at multiple levels. First and foremost, the students and postdocs liked the open lab. It made collaborations simple, and they had easy access to all the tools and instrumentation. Further, we hired sufficient staff to manage the equipment and to instruct new students and postdocs in its proper use. Lab areas were managed by staff, which helped to keep order and maintain stocks of disposables. Postdocs were recruited by individual PIs, but other PIs were always involved in reviewing candidates. This aided both the selection process and recruitment. To encourage exchanges between groups, we assigned writing desks on a lottery basis. In a short time, these efforts created a sense of community that enabled meaningful scientific discussions on how to solve biological problems. In the current competitive environment, the institute provides an excellent environment for those who buy in. The major emphasis was to create an environment in which investigators can solve scientific problems—not build lab empires, companies, or clinics. In a recent article in the Proceedings of the National Academy of Sciences, Bruce Alberts and colleagues document the increases in regulatory demands, difficulties in raising funds, and the cutthroat competitive environment that has arisen during the recent funding crisis (Alberts et al., 2014). Although some NIH-level solutions exist, and I support many of the measures proposed by Alberts et al., I feel that the most meaningful changes can be made at the level of small institutes of 12–20 PIs. At that level, there is an economy of scale to alleviate regulatory burdens, while maintaining accountability. My assertion is that small institutes in universities can be the most cost-effective way to undertake interdisciplinary research focused on major research problems. In the remainder of this article, I will describe one approach that succeeded in one environment, and I hope that others will be stimulated to improve on our efforts. GIVING THE RESEARCHER ACCESS TO THE TOOLS FOR PROOF OF CONCEPT In designing a multidisciplinary institute, there was a conscious attempt to provide investigators with tools of other disciplines, so they could efficiently test hypotheses. A related issue is that young investigators could rapidly start doing research without a major effort to purchase and set up equipment. Good central facilities were key to providing biologists with the new generation of micro- and nanofabrication tools and physicists with molecular biology reagents and purified proteins for their studies. All were afforded access to the latest 22 | M. P. Sheetz microscopic technologies. To provide a high level service, we hired Ph.D.-level managers for the facilities with sufficient staff to train users and/or provide materials needed with information on the best practices in certain applications. Facilities offered tutorials and regular educational sessions for all investigators. To encourage the facilities to be responsive to the users, we asked that multiple PIs participate in facility management committees. This bottom-up approach has kept the priorities in touch with the user needs. After all, the money spent on the facilities was coming out of our common research funds. COPING WITH THE MUNDANE BUT NECESSARY ISSUES The burden of paperwork for regulations for the responsible conduct of science, effort reporting, conflict of interest, safety training, animal care, and so on all detract from the time that can be spent on research. Most of these tasks can be fulfilled more responsibly by staff (with some PI input) than by individual PIs in separate labs. A team of lab managers was hired to handle such diverse tasks as safety training of new students, assembling best-practices protocols for routine operations (tissue culture, gel electrophoresis, etc.), and stocking disposables for the lab benches. Similarly, the microscope facility staff trained new students/researchers and kept the facility functioning. Microfabrication and cloning were performed by staff after consultation with the faculty and students. This system enabled the PIs, with the assistance of the staff, to satisfy the requirements of safety, basic training, and maintenance with minimal daily input. PIs met regularly with the facility staff to answer questions and assure that things were functioning properly. INNOVATION IS OFTEN INTERDISCIPLINARY There is a lot written about innovation and even more discussion about it. Almost by definition, however, it is a process of unexpected random connections that enable new approaches or insights to solve problems. Those connections need to make sense to someone who can actually test new ideas, often with new tools. To facilitate innovation, it helps to have people with different backgrounds discuss a problem, because they will often benefit from one another’s perspective. Such discussions are most fruitful when there are chance encounters over lunch, tea, or beer, as has been proven at Bell Labs, the Laboratory of Molecular Biology, and the European Molecular Biology Laboratory. Open labs lower the energy barriers to meeting people outside your lab, and then the discussions are easier. Small institutes provide good chances to bring together people with vastly different backgrounds and to encourage them to be adventurous. Having resources available also lowers the energy barriers to trying something new. Further, it is useful in institutes to bring in outside experts, because that stimulates everyone. With all of these features in place, innovation relies upon motivated researchers; the PIs need to encourage the pursuit of the unusual as opposed to the expected result. This occurs more often if there are seed funds designated for innovative experiments. Finally, in an interdisciplinary environment, it is usually easy to know who did which part of the work, and credit can be given to the proper person during evaluation for promotion. FUNDING OF SMALL INSTITUTES A major drawback to the formation of small institutes is that they are expensive. However, our analyses show that there are real savings due to the economy of scale. For example, when we added up the cost of the central facilities (microscopy, cloning, microfabrication, computers, and wet lab management plus disposables) and divided it by the number of investigators, we calculated that the central services cost on average about $15,000 per person per year. With Molecular Biology of the Cell proper record keeping, these costs can be charged to grants. The overhead costs of facilities (heat, lighting, etc.) and faculty salaries and administrative costs for ordering, employment, and so on are commonly borne by the university. In many cases, those costs are significant and can account for 30–50% of the overall budget. To fund such an institute in the long term, there needs to be outside funding; a figure of 20–30% of the total budget is a common figure in Europe and Asia (more in the United States). A very important part of the budget is an internal seed grant to the PIs that provides funding for innovation and start-up. If PIs can support one to two researchers for innovative projects, then they can develop the successful ideas to the point that they can compete for outside funding. Because these funds are internal, they can be carried over from one year to the next to avoid hurried or wasteful spending at the end of a grant year. For ∼20 PIs with an average lab size of approximately eight people, the cost for central facilities and the seed grants is about $6 million per year after the initial capitalization. This is significant, but it is low compared with the internal budgets of most European and Asian institutes, where the total budget divided by the number of PIs provides an annual cost of $1.4–2.2 million per PI. If the point of a research institute is to foster innovative research, then flexible research funds are critical for the researchers to be able to take risks. MAINTAINING VITALITY IN SMALL INSTITUTES The Singapore government mandated a major feature of the MBI. Namely, members of the institute are members of departments at the university. This means that there can be fluidity between the departments and the institute. As the directions and the needs of the institute change, the PIs in the institute can change, without loss of tenure. This means that high standards can be maintained without major disruption to either the institute or the faculty member’s career. In regard to evaluating research performance, the stories of Sanger and the long time he spent to develop sequencing technologies serve to remind us that progress is not always measured in regular publications. Similarly, impact factor points don’t really correlate with impact when we look back on the initial publications of 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year many important, novel findings. Thus, it is very difficult to strike a proper balance between accountability and the freedom to try something really new. With a site visit, an outside panel of experts can see the people in context and can better evaluate the performance. Still, no one has a crystal ball that sees into the future, and in the end, some difficult decisions need to be made for the vitality of the institute. In this regard, it is much easier for an administrative panel to move a PI from an institute to a department than from an institute to the street. Dynamics is a critical part of long-term vigor and can help to avoid the feelings of entitlement that sap the energy from many longer-lived institutes. Further, universities need to have teachers, and it is reasonable for young faculty members to have the chance to do research before they take on a large teaching load. SUMMARY No system is perfect, but there are some glaring flaws in the U.S. system that perhaps will mean that other systems will do better in innovation and solving problems in the future. Moving to multidisciplinary institutes in universities can provide a much more efficient approach to research and to innovation. Multidisciplinary institutes also encourage a sharing of ideas and a questioning that is very healthy for the system. New technologies can easily be combined with old problems. Many of the problems in research are best approached with multiple techniques that are seldom done well in one lab. I put this idea forward with the hope that this or an even better idea can help the system to thrive. This is the best occupation in the world despite the current challenges. ACKNOWLEDGMENTS I gratefully acknowledge the helpful comments of Linda Kenney, G.V. Shivashankar, Gareth Jones, and Ronen Zaidel-Bar. This paper was made possible by the generous support of the Singapore Government. REFERENCE Alberts B, Kirschner MW, Tilghman S, Varmus H (2014). Rescuing US biomedical research from its systemic flaws. Proc Natl Acad Sci USA 111, E2634. A small-institute solution | 23 MBoC | ASCB AWARD ESSAY Romancing mitosis and the mitotic apparatus William (B. R.) Brinkley Baylor College of Medicine, Molecular and Cellular Biology, Houston, TX 77030 ABSTRACT One of the earliest lessons students learn in biology is the process of mitosis and how cells divide to produce daughter cells. Although first described more than a century ago by early investigators such as E. B. Wilson, many aspects of mitosis and cell division remain the subject of considerable research today. My personal investigations and research contributions to the study of mitosis were made possible by recent developments in the field when I began my career, including access to novel mammalian cell culture models and electron and fluorescence microscopy. Building upon those innovations, my laboratory and other contemporary investigators first charted the ultrastructure and molecular organization of mitosis and chromosome movement and the assembly and function of the cytoskeleton. This field of research remains a significant challenge for future investigators in cell biology and medicine. MITOSIS, EARLY ENCOUNTERS dividing cells. Later in my master’s-degree research, I was able to acquire a more advanced research microscope equipped with bright-field and phase optics with 50× and 100× oil-immersion lenses sufficient to study mitotic chromosomes in the neurons of larval mosquito brains. Although the optics were improved, we had no cameras, and my illustrations and measurements were still recorded using a camera lucida. Even so, I was able to make accurate measurements and drawings of metaphase chromosomes from various species for my study of mosquito taxonomy and speciation. I confirmed, as previously documented, that homologous chromosomes of mosquitoes and other dipterian insects remained paired during mitosis. My fascination and curiosity about mitosis and chromosomes grew from those early encounters, and I wanted to pursue this William (B. R.) Brinkley topic further for my doctoral degree. I decided to pursue my PhD degree at Iowa State University in the early 1960s because the college was one of the first to establish a new graduate curriculum entitled “Cell BiolDOI:10.1091/mbc.E14-06-1123. Mol Biol Cell 25, 3270–3272. ogy” that included training in electron microscopy. During this period, William (B. R.) Brinkley is corecipient of the 2014 E. B. Wilson Medal from the research in the cell sciences was advancing at an accelerated pace American Society for Cell Biology. and beginning to move into more molecular and analytical realms. Of Address correspondence to: William R. Brinkley (brinkley@bcm.edu) particular interest was the emergence of new analytical instruments, © 2014 Brinkley. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available including electron optics, and reports of novel research on mitosis in to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported a variety of systems, including marine organisms, insects, plants, and Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). animals. I was especially fascinated by the innovative use of time® ® “ASCB ,” “The American Society for Cell Biology ,” and “Molecular Biology of lapse movies to capture mitosis in live cells. Also, electron microscopy the Cell®” are registered trademarks of The American Society for Cell Biology. I first encountered a microscope in the early 1950s as a freshman biology major. The instrument was an old brass student microscope that we were instructed to use to identify and examine the stages of mitosis in cells of the onion root tip. I was fascinated. It was then that I became more curious about chromosomes, how they attach to the spindle, and how they move through each of the mitotic stages. At that time, the study of mitosis was largely descriptive and limited to light microscopy. Photomicroscopy was still in its infancy, and most published illustrations were hand-drawn images made using a “camera lucida,” an apparatus with a pair of small mirrors attached to the microscope oculars that projected an image onto the desktop at the base of the microscope. Thus the image could be traced in pencil or ink, enabling the observer to accurately measure and record chromosomes and associated structures in 24 | W. (B. R.) Brinkley Molecular Biology of the Cell models uniquely suited for this purpose, with low numbers of chromosomes that were unusually large. I selected Chinese hamster cells, because they could be synchronized and harvested at precise stages of the cell cycle, especially mitosis. In addition, I wanted to investigate rat kangaroo cells with karyotypes containing only 11 chromosomes. I also had access to an even more fascinating cell line derived from the Indian barking deer (Muntiacus muntjac) with a diploid chromosome number of 2N = 6 in the male line and 2N = 7 in the female. The resources of Hsu’s lab opened seemingly endless opportunities for me as the only team member trained in electron microscopy. I enjoyed early success in characterizing the structure and organization of specialized regions of mammalian chromosomes such as primary constrictions, centromere and kinetochore structures, and secondary constrictions, including nucleolar organizing regions and telomeres. Our most significant early accomplishment was to proFIGURE 1: Diagram of the kinetochore with associated microtubules and the five compartments vide the first detailed EM images of the kiwithin the centromere. Symbols depict centromere-kinetochore proteins that have been netochore on mammalian chromosomes identified in various labs. Figure 1a is a crest-stained kinetochore (green) in an Indian M. muntjac (Brinkley and Stubblefield, 1966). Following chromosome. Figure 1b is an electron micrograph of the kinetochores of an Indian muntjac our first publication describing the trilayered chromosome. Figure 1c is an image of mammalian chromosomes double stained with crest platelike structure and fibrous corona, simiantibody (green) and antibody to satellite DNA (red). Modified from Brinkley and Slattery (2006). lar observations have been widely reported on mitotic chromosomes of many eukaryotic organisms. Thus the design of the kinetochore (Figure 1) is widely was becoming a more widely used research tool for studies of cell conserved in eukaryotic cells. There is still much to be learned, howdivision. Remarkable experiments were just underway involving the ever, about this specialized chromosomal component and its funcuse of micromanipulation techniques with fine needles to probe into tion in partitioning chromosomes and maintaining genomic and cells and actually hook onto chromosomes to measure the minute genetic stability. Many studies are currently underway worldwide. spindle forces that act upon them in insect cells (Nicklas and Staehly, 1967). Clearly, discoveries in cell research were accelerating. An exciting new era of experimental cellular and molecular biology had LIGHTING UP THE CYTOSKELETON dawned, and with it began a new professional organization known as My laboratory’s second major accomplishment was to develop the the American Society for Cell Biology. It was clear to me that it was an first antibody against tubulin and use it as a fluorescent probe to auspicious time to enter the field of cell science. “illuminate” the microtubule cytoskeleton in mammalian cells. After completing graduate school and receiving my PhD degree With this discovery, along with similar reports from other labs, beat Iowa State University in the mid-1960s, I was anxious to pursue gan a dynamic era of research on the cytoskeleton. I gladly share postdoctoral research on the molecular basis of mitosis and chromothe credit for developing this tubulin antibody with my former some movements in mammalian cells. Specifically, I wanted to gain colleague at the University of Alabama, G. M. Fuller. Working in expertise in the biomedical sciences, with emphasis on mitosis and collaboration with me, Fuller and his students produced the first chromosomes in both normal and neoplastic cells. For this, I needed monospecific antibodies against bovine brain tubulin (Brinkley access to cancer cells and tissue culture model systems. I was fortuet al., 1975; Fuller et al., 1975). This significant achievement nate in this regard to be accepted as a postdoctoral student in the provided a vital new tool for the detection and analysis of microtulaboratory of T. C. Hsu, a distinguished expert in chromosome biolbules in mammalian cells. When we began this collaboration, I ogy at the University of Texas M. D. Anderson Hospital and Tumor questioned whether a useful antibody to 6s tubulin could be proInstitute in Houston (currently known as the University of Texas M. D. duced by the techniques available at that time. My lab had tried Anderson Cancer Center). There, I soon met and began collaboratbefore and failed. Undaunted, Fuller and his students proceeded ing with his team, a highly motivated group of colleagues with wideto inject rabbits with 6s tubulin purified from bovine brain tissue. ranging expertise. From them, I learned the fundamental methods of When he tested the affinity-purified antisera by staining a monomammalian cell culture. I learned how to synchronize the growth of layer of mouse 3T3 cells, we were delighted that the new antibody cultured cells by arresting and collecting cell populations at specific stained mitotic spindles. However, to our surprise and initial contime points in the cell cycle, including mitosis (M phase), G1, S, and cern, we also observed numerous brightly fluorescent fibers coursG2 phases. In addition to his dynamic team, Hsu’s lab housed an ing through the cytoplasm of every interphase cell. Initially, we unparalleled collection of unique mammalian cell lines stored in his feared that our new probe might be cross-reacting with another −80°C freezer, known as “Professor Hsu’s frozen zoo.” For the first cytoskeletal component, perhaps intermediate filaments. Yet time, I could carry out experiments on the mitotic apparatus in animal further tests confirmed that our tubulin antibody was highly specific 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Mitosis and the mitotic apparatus | 25 for tubulin and microtubules. Our new probe had illuminated an elaborate array of cytoplasmic microtubules heretofore undetected. We named this interphase network the “cytoplasmic microtubule complex” or CMTC. Following a series of champagne toasts to celebrate our success and discovery, I placed a call to the discoverer of microtubules, Keith Porter. He immediately invited us to Boulder, Colorado, to share our findings. Just when we published our initial report in Science in 1975 (Fuller et al., 1975), several other laboratories in the United States and Europe began to report similar results. The era of the cytoskeleton had begun and continues unabated today. ACKNOWLEDGMENTS I acknowledge with gratitude the invaluable contributions of many students, postdoctoral fellows, technicians, and colleagues 26 | W. (B. R.) Brinkley throughout my career without whom my being honored with the E. B. Wilson Award would not have been possible. REFERENCES Brinkley BR, Fuller GM, Highfield DP (1975). Cytoplasmic microtubules in normal and transformed cells in culture: analysis by tubulin antibody immunofluorescence. Proc Natl Acad Sci USA 72, 4981–4985. Brinkley W, Slattery S (2006). Centromere. In: Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine, ed. D Ganten and K Ruckpaul, Berlin: Springer, 247–250. Brinkley BR, Stubblefield E (1966). The fine structure of the kinetochore of a mammalian cell in vitro. Chromosoma 19, 28–43. Fuller GM, Brinkley BR, Baughter JM (1975). Immunofluorescence of mitotic spindles by using monospecific antibody against bovine brain tubulin. Science 187, 948–950. Nicklas RB, Staehly CA (1967). Chromosome micromanipulation. I. The mechanics of chromosome attachment to the spindle. Chromosoma 21, 1–16. Molecular Biology of the Cell MBoC | ASCB AWARD ESSAY Some personal and historical notes on the utility of “deep-etch” electron microscopy for making cell structure/function correlations John E. Heuser WPI Institute, Kyoto University, Kyoto 606-8501, Japan; Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO 63110 ABSTRACT This brief essay talks up the advantages of metal replicas for electron microscopy and explains why they are still the best way to image frozen cells in the electron microscope. Then it explains our approach to freezing, namely the Van Harreveld trick of “slamming” living cells onto a supercold block of metal sprayed with liquid helium at −269ºC, and further talks up this slamming over the alternative of high-pressure freezing, which is much trickier but enjoys greater favor at the moment. This leads me to bemoan the fact that there are not more young investigators today who want to get their hands on electron microscopes and use our approach to get the most “true to life” views of cells out of them with a minimum of hassle. Finally, it ends with a few perspectives on my own career and concludes that, personally, I’m permanently stuck with the view of the “founding fathers” that cell ultrastructure will ultimately display and explain all of cell function, or as Palade said in his Nobel lecture,electron micrographs are “irresistible and half transparent … their meaning buried under only a few years of work,” and “reasonable working hypotheses are already suggested by the ultrastructural organization itself.” After hyping “deep-etch” electron microscopy (EM) for my whole career (Heuser, 2011), I’ll take this invitation to write an ASCB award essay to talk it up some more! Some will say that this is “flogging a dead horse,” but I really think not. The advantages of metal replicas for EM are just too huge. Replicas are not only impervious to beam damage in the electron microscope, forever the big problem, because the electron beam heats up the sample so terribly during viewing, but their electron-scattering power is also excellent, so they are simple to image and give super high-contrast. And the key thing to remember is that replicas are utterly faithful to whatever they are replicating—they’re just surface renderings, copying exactly the contours of the sample and displaying these contours in the electron microscope image. So the whole approach boils down to worrying about how to prepare your biological samples for replication. (Well, I can’t claim it’s quite that simple. It takes the right equipment and some practice to make a proper replica, but, once mastered, it’s utterly routine and simple to learn. When Mark KirschJohn E. Heuser ner first watched me do it—while helping me to put it on the map by providing gorgeous cytoskeletons DOI:10.1091/mbc.E14-05-1016. Mol Biol Cell 25, 3273–3276. [ Heuser and Kirschner, 1980 ]—he got bored right away and asked John E. Heuser is corecipient of the 2014 E. B. Wilson Medal from the American me, “Can’t you teach a monkey to do that?”) Society for Cell Biology. Address correspondence to: John E. Heuser (jheuser@icems.kyoto-u.ac.jp or Anyway, replicas have a glorious history, because in the early jheuser@wustl.edu). days of EM, way before thin-sectioning techniques had been deAbbreviations used: EM, electron microscopy; SEM, scanning electron veloped, they were the only way to go—the only way to get any microscopy. sort of biological sample into the electron microscope. Thus the © 2014 Heuser. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to EM pioneers in the 1940s used metal replicas to discover viruses the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creand phages and to make the first halting characterizations of ative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). macromolecular assemblies like collagen and neurofilaments. ® ® “ASCB ,” “The American Society for Cell Biology ,” and “Molecular Biology of What they lacked back then was a way to see inside cells, which the Cell®” are registered trademarks of The American Society for Cell Biology. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year 27 The best way to freeze everything turned out to be a spruced-up version of an approach Anthonie Van Harreveld had used in the 1960s at CalTech to freeze brains in preparation for classical thin-section EM. Van Harreveld wanted to maintain the proper distribution of electrolytes in the brain and had reason to believe that the classical fixation techniques being used on brain were distorting this distribution. He reasoned that the “freeze-substitution” technique that Ned Feder and Richard Sidman had put on the map in the late 1950s would give him more realistic views. With this technique, a frozen sample is fixed and prepared for embedding in plastic by dissolving the ice out of it at subzero temperatures, using acetone or the like. Van reasoned, quite correctly, that this should prevent artifacts from occurring during fixation, because nothing ever melted; but how he came up with the idea to freeze the brain by “slamming” it onto an ultracold block of copper remains a mystery FIGURE 1: A platinum replica of the inside surface of a HeLa cell prepared by “unroofing” it in to this day. (It’s fun to mention here that Van culture before quick-freezing and freeze-drying it in the usual way (Heuser, 2000). This fun Harreveld didn’t start developing this tech“anaglyph” three-dimensional view was used for the publicity and table cards for our nique until he was already 60 years old!) department’s centennial celebration three years ago. It focuses on the various “honeycomb” Anyway, it sure worked for Van, and it clathrin lattices found on all cell membranes and illustrates the various stages in their evolution, also worked for Tom Reese and me when we from totally flat to fully curved and ready to pinch off during endocytosis. Such threecopied his “slammer,” even though we had dimensional deep-etch images were the first to illustrate that F-actin filaments (highlighted in to spend years ironing out the bugs and purple) often become involved in the later stages of such clathrin coated–pit formation and stay making a freezing machine that was mebehind as circular “scars” after coated vesicles have left the surface (above the “Wash” in chanically sound and gave reproducible reWashington University). As explained in this essay, the swell opportunity to view such expanses sults (Heuser et al., 1979). The result was our of the plasma membrane at such a high resolution was a lucky outcome of our being able to freeze samples fast enough to avoid ice-crystal formation and then, miraculously, to platinumso-called liquid helium–cooled “cryopress” replicate such frozen membranes without melting them. (renamed to avoid the distressing idea of a delicate piece of tissue being “slammed” Keith Porter achieved for the first time in 1945 by simply growing against anything—albeit, it’s the abruptness of contact and the sucells flat enough to see through in the electron microscope—reperfast extraction of heat from the sample by the copper block that ally, really flat—and then fixing and staining them properly for EM gives such good freezing in the first place). Fast-forward to today, (his other huge contribution). People not familiar with EM should and we find that freeze substitution is still the backbone of modern be reminded that Porter’s 1945 images opened the door to cell efforts to image cells in the electron microscope, and indeed prebiology, and his development of thin-sectioning techniques for serves the structure of cells far better than the techniques of fixation cells in the following 10 years really put cell biology on the map. and plastic embedding developed by the pioneers of thin-section But back to replicas. The whole field of scanning electron microsEM. When combined with thicker sections, higher EM voltages, and copy (SEM) was totally dependent on them because everything had modern tomographic reconstruction techniques, it yields really outto be coated with metal in order to be seen in the scanning electron standing images. microscope. Likewise, the exciting field of freeze-fracture EM took So why aren’t there more than 10 labs in the world using our (or off after Hans Moor teamed up with a Swiss company that made Van Harreveld’s) cryopress to get the quality of freezing our lab has replicating machines (Balzers of Lichtenstein) and mounted a microdepended on for decades? The answer lies in part with another adtome inside one, so that frozen cells could be fractured open (not vance that Hans Moor spearheaded in Switzerland, again with the quite thin-sectioned, the microtome wasn’t that good). This made it same enlightened Balzers company producing vacuum evaporators, possible for people to make metal replicas of frozen cells without namely, high-pressure freezing. At the time, phase diagrams of wamelting them even a little bit—some sort of miracle! ter indicated that water could be frozen into an amorphous glass Deep-etch EM is a variant of what Moor introduced (Heuser and without the induction of any damaging ice-crystal formation by putSalpeter, 1979) and deserves special attention only because its purting it under extreme pressure (>2000 atm). Today, theories about pose has been to avoid all of the fixation and staining and dehydrathow water turns into vitreous (noncrystalline) ice are much more ing procedures that had accompanied previous approaches to EM complex, but Moor went ahead and developed ways to put a bioand essentially to get living cells replicated after they were frozen logical sample under huge pressures and only then freeze it by (Figure 1). We found that freeze fracture works just as well or better spraying liquid nitrogen at it rather than slamming it against a liquid on unfixed cells and molecules, and therefore made a huge effort to nitrogen–cooled copper block. (The rapidity of freezing, he readevise a really good way to freeze living cells, tissues, and cell exsoned, should no longer be important if the pressure trick works—as tracts without introducing such artifacts as ice-crystal damage. apparently it does.) Today, most EM labs have a high-pressure 28 | J. E. Heuser Molecular Biology of the Cell freezer, and most of the EM papers that are published on freezesubstituted cells have availed themselves of these devices. So why not use our “slammer” (or cryopress) for freezing before freeze substitution, since it’s cheaper, faster, more reliable, and handles larger samples? Frankly, we don’t get it! Not only that, but highpressure frozen samples cannot be freeze-fractured at all—at least no one has yet devised a way to do so—because the samples end up encased in various sorts of metal pressure chambers, whereas our quick-frozen or “cryopressed” samples are spread out and open to the world (mandatory for freeze fracture, but also good for freeze substitution). And for that matter, why aren’t more labs making good old replicas of quick-frozen, deep-etched molecules (Heuser, 1983; Goodenough and Heuser, 1984; Hanson et al., 1997)? That is, of course, the ultimate mystery to us. Probably it’s just because people don’t realize that there are still good replicating machines available for purchase, and people don’t realize that these machines aren’t so expensive and are easy to operate. Well, as I said at the outset, I’ve been hyping our technique for decades and can’t stop now. I believe that an opportunity is being missed and that simplifying techniques so that “even a monkey could do it” will attract not monkeys to the field, but serious young investigators who want to get their hands on electron microscopes and want to get the most “true to life” views of cells out of them with a minimum of hassle. I’ll close with some brief perspectives on my own career. I’m a photographer at heart and love sharing images, all sorts of images, with people who appreciate them and can learn from them—I love that more than anything. What fun it was, to be able to interact on a daily basis with the Mark Kirschners, Tom Pollards, Ron Vales, Bernie Gilulas, and Ira Mellmans of cell biology (and sorry to all those whom I didn’t mention—you know who you are!). Plus, a handful of people really fired me up: Tom Reese, my boss as a postdoc at the National Institutes of Health, with whom I became so intertwined for so many years that he and I will never know who did what or who deserves what credit in the original development of quick-freeze, deep-etch EM (Heuser and Reese, 1973; Heuser et al., 1979); and then Nobutaka Hirokawa, who came to my lab as a postdoc, and immediately orchestrated a host of collaborations with leading cell biologists around the world that put “deep etching” on the map (before leaving for the University of Tokyo to become chairman of the Department of Cell Biology, and then dean of the Medical School, and now head of the whole Human Frontier Science Program); and finally, my ex Ursula Goodenough, who absorbed my images and simply took off, making huge advances in several fields, thanks to her deep grasp of all aspects of cell biology. Finally, I’d like to simply add this: biological EM was terribly interesting for me in the early days, back when it first allowed people to zoom in on the structures that light microscopists had been studying for so long and show what they actually were— what they actually looked like—what their “fine structure” was. I used to wait with eager anticipation for each new issue of the Journal of Cell Biology to arrive in the mail and then would devote a whole evening (maybe with a glass of wine) to carefully examining every new electron micrograph published that month. But EM became even more captivating for me as people began more and more to systematically manipulate cells by physical and pharmacological (and eventually genetic) methods and then to look in the microscope to see how this altered the fine structures of their cells. This opened the door to true structure/function correlations—at least when the effects of these experimental manipulations of cell physiology and biochemistry were properly determined, along with the microscopy. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year This era of EM was the most fun for me, personally, but as it happened, this heyday was cut short by an overwhelming urge in some quarters to improve the methods of EM, in an attempt to make the imaging of cells more “lifelike.” This trend particularly captivated the equipment manufacturers and led to an “arms race” of microscope development that ended up making electron microscopes so very costly that only a few centers could support them anymore. The result was actually a curtailment of general, everyday EM as it had been practiced by individual investigators in command of their own microscopes and published every month in the Journal of Cell Biology. And as a consequence, over the past 15 years or so, EM has gradually been relegated to a service status, carried out largely by EM cores in most major institutions. Gone is the primacy and independence of those who once considered themselves true “electron microscopists,” and gone also is the use of EM for all sorts of fun structure/function correlations. And helping to eclipse the “routine” EM that I enjoyed so much have been all the tremendous advances in light microscopy, coupled with all the advances in digital camera recording of live-cell dynamics (not to mention the burgeoning field of superresolution light microscopy, crowned this year with the Nobel awards). These huge advances have captivated nearly everyone still interested in functional correlations of cell structure and have left traditional EM sort of out in the cold, an outcome I find most unfortunate. I feel strongly that seeing cell structures at the EM level still is the only way to fully grasp their molecular architecture, and that seeing changes in their molecular architecture at this level is the only way to truly understand their function. I’m permanently stuck with the founding fathers’ view that cell ultrastructure will ultimately display and explain all of cell function! George Palade was my greatest hero, and his fun explanation in his Nobel lecture of why he chose to study the pancreatic acinar cell is my favorite quote: “Perhaps the most important factor in this choice was the appeal of the amazing organization of the pancreatic acinar cell, whose cytoplasm is packed with stacked ER cisternae studded with ribosomes. Its pictures had for me the effect of the song of a mermaid: irresistible and half transparent. Its meaning seemed to be buried under only a few years of work, and reasonable working hypotheses were already suggested by the structural organization itself.” Irresistible and half transparent, indeed! Thanks, George. And thanks to all of you who cared to look at my images and all the institutions and funding agencies that made it possible for me to generate them! P.S. AN APOLOGIA Every picture I take, I already have an audience for it right as I take it. I already have someone “looking over my shoulder.” I’m already showing it to them, telling them about it. (Of course, they’re not actually there, they may be continents away, but I’m imagining them being there and already planning how I will get that picture to them and what I’ll tell them about it as soon as it’s in the computer.) I’m not kidding: every single picture I take is like that. It’s for showing to someone who immediately comes to mind as soon as that field pops into view in the electron microscope. “Oh, Pietro will love that huge neuromuscular junction; Fulvio will be amazed by that quality of membrane preservation in freeze-substituted yeast; Ursula will be psyched by that run of axonemal dynein; Tom will be impressed with such a clear view of actin branchpoints.” Only rarely am I lucky enough to have someone actually sitting next to me and to be able to talk to him or her right then, person to person—maybe a new postdoc or a close collaborator who E. B. Wilson medal | 29 really needs to look over my shoulder to see how his or her prep came out. Anyway, I want each of my real or imaginary viewers to like that picture, to think it’s a good picture—attractive, clear, understandable, useful, illuminating, that is, illuminating something about the subject (be it a personal portrait or a picture of a cell interior or a molecule). I want my audience’s appreciation! My whole drive of focusing all my work on improving techniques of preparation for EM has come from wanting to take better pictures and get more of that appreciation. Besides that, there’s just that darn old curiosity: what does it actually look like, what does it look like exactly? How good a picture of it can I take? How good-looking can I make it (or him or her, with my personal portraits)? (Nic Spitzer once irritably dubbed the latter my “thin sections of life” as I was clicking away while canoeing with him down a rapids on the Allagash River, but not paddling.) Always on my mind is what’s the most expressive or most characteristic or “attractive” attire or decoration I can outfit it (them) with? Osmium or platinum or gold … or furs and silks? Capturing that best picture will help me to get to know my subject better, to really see it for what it is. Even artifacts can be extremely beautiful and informative, if one knows how one got them and what they say about what the structure was, before it got “altered.” All these aspects of photography I can appreciate by myself, all alone, but never as much as when there is just one other person with me, with the same inclination and proclivity. Sharing, mutual appreciation, communion—that has been the whole name of the game for me in my research career. My advisor Don Fawcett, one of the great masters of EM of all times, told me when I graduated from 30 | J. E. Heuser medical school, “Don’t become an electron microscopist, you’ll become everybody’s slave.” Actually, I think I can say that it turned out just the opposite: everyone else turned out to be my audience, my source of appreciation and self-worth, my foils, my mentors, and, most important of all, my best source for interesting things to look at in the electron microscope! REFERENCES Goodenough U, Heuser JE (1984). Structural comparison of purified dynein proteins with in situ dynein arms. J Mol Biol 180, 1083–1118. Hanson PI, Roth R, Morisaki H, Jahn R, Heuser JE (1997). Structure and conformational changes in NSF and its membrane receptor complexes visualized by quick-freeze/deep-etch electron microscopy. Cell 90, 523–535. Heuser JE (1983). Procedure for freeze-drying molecules adsorbed to mica flakes. J Mol Biol 169, 155–195. Heuser JE (2000). The production of “cell cortices” for light and electron microscopy. Traffic 1, 545–552. Heuser JE (2011). The origins and evolution of freeze-etch electron microscopy. J Electron Microsc 60 (Suppl 1), S3–S29. Heuser JE, Kirschner MW (1980). Filament organization revealed in platinum replicas of freeze-dried cytoskeletons. J Cell Biol 86, 212–234. Heuser JE, Reese TS (1973). Evidence for recycling of synaptic vesicle membrane during transmitter release at the frog neuromuscular junction. J Cell Biol 57, 315–344. Heuser JE, Reese TS, Dennis MJ, Jan Y, Evans L (1979). Synaptic vesicle exocytosis captured by quick freezing and correlated with quantal transmitter release. J Cell Biol 81, 275–300. Heuser JE, Salpeter SR (1979). Organization of acetylcholine receptors in quick-frozen, deep-etched, and rotary-replicated Torpedo postsynaptic membrane. J Cell Biol 82, 150–173. Molecular Biology of the Cell MBoC | ASCB AWARD ESSAY Onward from the cradle Peter Satir Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, Bronx, NY 10461 ABSTRACT This essay records a voyage of discovery from the “cradle of cell biology” to the present, focused on the biology of the oldest known cell organelle, the cilium. In the “romper room” of cilia and microtubule (MT) biology, the sliding MT hypothesis of ciliary motility was born. From the “summer of love,” students and colleagues joined the journey to test switchpoint mechanisms of motility. In the new century, interest in nonmotile (primary) cilia, never lost from the cradle, was rekindled, leading to discoveries relating ciliogenesis to autophagy and hypotheses of how molecules cross ciliary necklace barriers for cell signaling. students were encouraged to spend a year abroad. In 1958–1959, I How lucky to be there at the beginning! The Rockefeller Institute for chose to work in the laboratory of Eric Zeuthen, one of the first cell Medical Research began its graduate program in 1955, and I was biologists, in Denmark—a choice that was accepted into the program in 1956, when Keith to influence my life profoundly, since that Porter and George Palade, just promoted to is where and when I met Birgit Hegner, members (i.e., professors), were first accepting my partner in life. When I returned to students into what Palade later referred to as New York, I began my thesis work in earthe “cradle” of cell biology (Moberg, 2012). nest. I wanted to learn how cilia, the oldEvery day was an adventure into the new fine est known cell organelle, moved. Porter structure of the cell revealed by the transmishad done pioneering work on the TEM of sion electron microscope (TEM), when every9+2 motile and modified nonmotile 9+0 one in the laboratory gathered at teatime to cilia. I’ve told the story of my thesis dissee the newest images hot off the drier and to covery—fixation of the metachronal wave try to decipher what they meant in terms of of mussel gill cilia—and some of the conorganelle structure and function. In 1960, the sequences of that discovery elsewhere American Society for Cell Biology was born. As (Satir, 2010; Moberg, 2012). a student completing my Ph.D. with Porter, I By the autumn of 1961, impatient to was encouraged by him to join the society, start my own laboratory, I had left the subscribe to the Journal of Biophysical Biocradle to become an instructor in biology chemical Cytology, soon to be the Journal of and zoology at the University of Chicago. Cell Biology—the journal of the ASCB before I chose that position, in part, because Molecular Biology of the Cell—and to consider Peter Satir Frank Child, one of the first people to sepresenting an abstract at the first meeting. I riously work on the molecular biology of cilia, was also a young factook his advice. ulty member in the department. In the following years, the UniverThe Rockefeller Institute graduate program had a special feature: sity of Chicago did indeed become, if not the cradle, certainly the to illustrate the international nature of the scientific endeavor, “romper room” of cilia and microtubule (MT) biology. In addition to Frank, Birgit, and me, the following years saw Sid Tamm, Gary Borisy, DOI:10.1091/mbc.E14-05-1014. Mol Biol Cell 25, 3277–3279. Joel Rosenbaum, David Phillips, and eventually Fred Warner studyPeter Satir is corecipient of the 2014 E. B. Wilson Medal from the American Society for Cell Biology. ing cilia, while across the street in biophysics, our colleague Ed Address correspondence to: Peter Satir (satir@aecom.yu.edu). Taylor and his group began working on the structure of MTs. Abbreviations used: CLEM, correlated light and electron microscopy; GAS, By 1967, when I had finally figured out that the fixed metachrogrowth arrest–specific; MT, microtubule; TEM, transmission electron microscope. nal wave showed cilia whose tip patterns varied with beat stage, and © 2014 Satir. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to I was beginning to study serial sections to show that the patterns the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Crewere consistent with a sliding MT hypothesis of ciliary motion, I was ative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). recruited to the Department of Physiology–Anatomy at the Univer® ® “ASCB ,” “The American Society for Cell Biology ,” and “Molecular Biology of sity of California–Berkeley. Birgit and I with our two young children the Cell®” are registered trademarks of The American Society for Cell Biology. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year 31 negative stain. These findings led to two new ideas: 1) that we could study the mechanochemistry of dynein by looking at changes in dynein arm structure in different activity states (Satir et al., 1981) and 2) that all arms couldn’t be active at once during a ciliary beat. As seen in the fixed metachronal wave, arms were switched off across about half of the axoneme, where doublet N+1 was found basal to doublet N at the ciliary tip, which later led to the switch-point hypothesis (Satir 1985). Differential sliding activity of the doublet MTs was demonstrated in different beat stages, corresponding to “hands up” and “hands down” cilia (Satir and Matsuoka, 1989), wherein switching depends in some part on a central pair projection of hydin (Lechtrack and Witman, 2007). In 1977, I was invited to take the chair of the Department of Anatomy at the Albert Einstein College of Medicine. Birgit became a tenured professor. We led the FIGURE 1: (a) An MEF primary cilium (arrows, inset) labeled in IFM for localization of acetylated department, eventually called the Departα-tubulin (red), 4′,6-diamidino-2-phenylindole (blue), and clathrin (green). (b) SEM and ment of Anatomy and Structural Biology, (c and d) CLEM of the same specimen. At the base of the cilium, a ciliary pocket is surrounded for 24 years. My laboratory remained small by clathrin-coated vesicles. (From J. Kolstrup, Thesis, University of Copenhagen [2012], with and mostly focused on cilia. A partial list of permission.) students and colleagues who worked or published with me at Einstein while I was chair includes Alastair Stuart, Ellen R. Dirksen, Michael welcomed the move. It was the “summer of love” and the times Holwill, Tim Bradley, Marika Walter, Jeff Salisbury, John Condeelis, they were a-changin! Again lucky, we were the first couple to break Tim Otter, Michael Melkonian, Michael Sanderson, Phyllis Novikoff, the nepotism rule at UC–Berkeley and were allowed to work indeAllan Wolkoff, Toshikazu Hamasaki, Yuuko Wada, and Søren T. pendently in the same department. Christensen. I began to attract graduate and postdoctoral students. My first As cell biology transformed into molecular cell biology during this postdoctoral student was Fred Warner, who rejoined the lab after period, the complexity of ciliary structure and biochemistry was growcompleting his Ph.D. in Chicago. The first graduate student to coming, new genetic and cloning techniques for studying cilia and MT plete a degree with me was Norton B. (Bernie) Gilula. While with molecular motors (dyneins and kinesins) were evolving. My fellow me, dodging gas canisters from helicopters and National Guardsawardee, John Heuser, made a discovery crucial to dynein structure men with fixed bayonets (signs of the protest against the Vietnam and function (Goodenough and Heuser, 1982). War that shook the campus), these people became extraordinary In Chlamydomonas, a panel of swimming mutants showed that electron microscopists whose images, some of which we published the inner dynein arms of the cilium are mainly responsible for bend together (Gilula and Satir, 1971, 1972; Warner and Satir, 1973, 1974), amplitude and form, while the outer dynein arms control beat freremain classic. quency (Brokaw and Kamiya, 1987). We (Satir et al., 1993) were able At Berkeley, freeze fracture, a new technique to study cell memto demonstrate in ciliates that cAMP phosphorylation of a small probranes, was being used by Dan Branton in the botany department. tein related to the outer arm led to faster swimming and therefore A description of the structure of mussel gill membrane junctions faster ciliary beat because of an increase in sliding velocity, demonwith the new technique would provide a thesis for Bernie Gilula. So strated in vitro. It is likely that faster sliding of the inner dynein arms I asked Dan to teach Bernie the technique. With freeze fracture, in vitro (Wirschell et al., 2011) is the equivalent of greater bend amBernie discovered that the mussel gill cells had true gap junctions plitude, but the biophysics here is more complicated, and the dem(Gilula and Satir, 1971) and at the base of the ciliary membrane, onstration remains incomplete. Bernie and I (Gilula and Satir, 1972) described the ciliary necklace in Stepping down from the chair in 2001 was a new beginning that both motile and primary cilia, a structure that has come back into more or less coincided with the rediscovery of the importance of the fashion 30-odd years later. primary cilium (Pazour et al., 2000) and the growing recognition of Meanwhile, the sliding MT hypothesis was receiving definitive the role of intraflagellar transport in normal ciliary growth and funcproof (Summers and Gibbons, 1971). The next graduate student tion (Rosenbaum and Witman, 2002). After a brief excursion into caught in the ciliary web was Win Sale; I asked him to do the near nanotechnology (e.g., Seetharum et al., 2006; Bachand et al., 2009), impossible, to take the Summers and Gibbons results to TEM resoin close collaboration with Søren T. Christensen’s new laboratory in lution, which might demonstrate how the dynein arms worked, The Copenhagen, I began to study signaling in primary cilia. images from Sale and Satir (1977) show that axonemal dynein funcFrom the work of Tucker et al. (1979), we knew that primary cilia tions as a minus-end motor, in that active arms on one doublet (N) grew when cultured fibroblasts were starved and went into growth push the adjacent doublet (N+1) tipward during active sliding. For arrest (G0), so initially we examined the literature for growth the first time, we could visualize the arms along the doublets in 32 | P. Satir Molecular Biology of the Cell arrest–specific (GAS) genes. We discovered that PDGFRα was known to be encoded by a GAS gene (Lih et al., 1996), and shortly thereafter we were able to show that PDGFRα localized to and signaled exclusively from the primary cilium (Schneider et al., 2005). We were later able to show that this signal could be translated into chemotaxis (Schneider et al., 2009, 2010) and cytoskeletal and membrane reorganization (Clement et al., 2012). This collaboration led to an exchange of students and visits, culminating in a return sabbatical in 2012–2013 for me and Birgit at the Department of Biology, University of Copenhagen, supported by the Lundbeck Foundation. It was a time to rekindle old memories and friendships and to make new ones. Søren and I and our laboratories made several other discoveries related to primary cilia. We showed that primary cilia with Hedgehog signaling were present on human embryonic stem cells (Kiprilov et al., 2008). We also introduced a new technique, correlated light and electron microscopy (CLEM), for the study of primary cilia (Figure 1; Christensen et al., 2013). Recently we have been formulating new hypotheses concerning how molecules cross the ciliary necklace barriers. In a further development, Birgit and I noticed that starvation upregulated autophagy with about the same time course as ciliogenesis. Together with Ana Maria Cuervo and her laboratory, we showed a reciprocal relationship between the two processes—where cilia growth up-regulates autophagy, which eventually shuts down growth (Pampliega et al., 2013). When you have a good and stable childhood, you are buffered from the vicissitudes of later life. So it has been in cell biology for me: the lessons from the cradle have not been lost. But Porter and Palade knew that cell biology had a longer history, in which one of the heroes was E. B. Wilson. Together with Dan Mazia, Porter and Palade were recipients of the first E. B. Wilson award of the ASCB. I am very proud to follow in their footsteps. REFERENCES Bachand GD, Hess H, Ratna B, Satir P, Vogel V (2009). “Smart dust” biosensors powered by biomolecular motors. Lab on a Chip 9, 1661–1666. Brokaw CJ, Kamiya R (1987). Bending patterns of Chlamydomonas flagella IV. Mutants with defects in inner and outer dynein arms indicate differences in dynein arm function. Cell Mot Cytoskel 8, 68–75. Christensen ST, Veland IR, Schwab A, Cammer M, Satir P (2013). Analysis of primary cilia in directional migration in fibroblasts. Methods Enzymol 525, 45–58. Clement DL, Maily S, Stock C, Lethan M, Satir P, Schwab A, Pedersen SF, Christensen ST (2012). PDGFRα signaling in the primary cilium regulates NHE1-dependent fibroblast migration via coordinated differential activity of MEK1/2-ERK1/2- p90 RSK and AKT signaling pathways. J Cell Sci 126, 953–965. Gilula NB, Satir P (1971). Septate and gap junctions in molluscan gill epithelium. J Cell Biol 51, 869–872. Gilula NB, Satir P (1972). The ciliary necklace: a ciliary membrane specialization. J Cell Biol 53, 494–509. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Goodenough UW, Heuser JE (1982). Substructure of the outer dynein arm. J Cell Biol 95, 798–815. Kiprilov E, Awan A, Velho M, Christensen ST, Satir P, Bouhassira EE, Hirsch RE (2008). Human embryonic stem cells in culture possess primary cilia with hedgehog signal machinery. J Cell Biol 180, 897–904. Lechtreck KF, Witman GB (2007). Chlamydomonas reinhardtii hydin is a central pair protein required for flagellar motility. J Cell Biol 176, 473–482. Lih CJ, Cohen SN, Wang C, Lin-Chao S (1996). The platelet-derived growth factor alpha-receptor is encoded by a growth-arrest-specific (gas) gene. Proc Natl Acad Sci USA 93, 4617–4622. Moberg CL (2012). Entering an Unseen World, New York: Rockefeller University Press. Pampliega O, Orhon I, Sridhar S, Diaz A, Beau I, Cordogno P, Satir BH, Satir P, Cuervo AM (2013). Functional interaction between autophagy and ciliogenesis. Nature 502, 194–200. Pazour GJ, Dickert BL, Vucica Y, Seeley ES, Rosenbaum JL, Witman GB, Cole DG (2000). Chlamydomonas IFT88 and its mouse homologue, polycystic kidney disease gene Tg737, are required for assembly of cilia and flagella. J Cell Biol 151, 709–718. Rosenbaum JL, Witman GB (2002). Intraflagellar transport. Nat Rev Mol Cell Biol 11, 813–25. Sale WS, Satir P (1977). Direction of active sliding of microtubules in Tetrahymena cilia. Proc Natl Acad Sci USA 74, 2045–2049. Satir P (1985). Switching mechanisms in control of ciliary motility. Modern Cell Biol 4, 1–46. Satir P (2010). Eyelashes up close. The Scientist, July 10, 30–35. Satir P, Barkalow K, Hamasaki T (1993). The control of ciliary beat frequency. Trends Cell Biol 3, 409–412. Satir P, Matsuoka T (1989). Splitting the ciliary axoneme: implications for a “switch point” model of dynein arm activity in ciliary motion. Cell Motil Cytoskel 14, 345–358. Satir P, Wais-Steider J, Lebduska S, Nasr A, Avolio J (1981). The mechanochemical cycle of the dynein arm. Cell Motil 1, 303–327. Schneider L, Cammer M, Lehman J, Nielsen SK, Guerra CF, Veland IR, Stock C, Hoffmann EK, Yoder BK, Schwab A, et al. (2010). Directional cell migration and chemotaxis in wound healing response to PDGF-AA are coordinated by the primary cilium in fibroblasts. Cell Physiol Biochem 25, 279–292. Schneider L, Clement CA, Teilmann SC, Pazour GJ, Hoffman EK, Satir P, Christensen ST (2005). PDGFRαα signaling is regulated through the primary cilium in fibroblasts. Curr Biol 15, 1861–1866. Schneider L, Stock C, Dieterich P, Jensen BE, Pedersen LB, Satir P, Schwab A, Christensen ST, Pedersen SF (2009). The Na+/H+ exchanger, NHE1, plays a central role in fibroblast migration stimulated by PDGFRα signaling in the primary cilium. J Cell Biol 185, 163–176. Seetharam RN, Wada Y, Ramachandran S, Hess H, Satir P (2006). Long-term storage of bionanodevices by freezing and lyophilization. Lab on a Chip 6, 1239–1242. Summers KE, Gibbons IR (1971). Adenosine triphosphate-induced sliding of tubules in trypsin-treated flagella of sea-urchin sperm. Proc Natl Acad Sci USA 68, 3092–3096. Tucker RW, Pardee AB, Fujiwara K (1979). Centriole ciliation is related to quiescence and DNA synthesis in 3T3 cells. Cell 17, 527–535. Warner FD, Satir P (1973). The substructure of ciliary microtubules. J Cell Sci 12, 313–326. Warner FD, Satir P (1974). The structural basis of ciliary bend formation. J Cell Biol 63, 35–63. Wirschell M, Yamamoto R, Alford L, Gokhale A, Gaillard A, Sale WS (2011). Regulation of ciliary motility: conserved protein kinases and phosphatases are targeted and anchored in the ciliary axoneme. Arch Biochem Biophys 510, 93–100. Onward from the cradle | 33 MBoC | PERSPECTIVE How to start a biotech company Adriana Tajonar California Institute for Quantitative Biosciences (QB3), San Francisco, CA 94158-2330 ABSTRACT The spirit of life science entrepreneurship is alive and well, with outstanding innovation hubs arising throughout the country and the world. Of note, many of these hubs flourish in close proximity to research universities. If universities are the engine for discovery, then startups are the vehicle for innovation. The creativity and drive of young researchers has the potential to explore novel or underserved applications and revolutionize industries. INTRODUCTION With the current exuberant energy surrounding biotech entrepreneurship, it is hard to believe that the industry is close to 50 years old. Much has changed since Herb Boyer, a professor at the University of California, San Francisco (UCSF), and Bob Swanson, a young entrepreneur and aspiring venture capitalist, started Genentech in 1976, giving rise to the entire biotechnology industry. Back then, spinning out a company was limited to faculty members or experienced biotechnology professionals. Today, the democratization of life science entrepreneurship is allowing graduate students and postdocs to apply their scientific expertise toward the commercialization of newly developed technologies. Much like the path of a PhD project, the life of a science startup is not straightforward, but there are some common milestones from birth to growth and success (Figure 1). THE BIRTH OF A STARTUP In 2009, Dan Widmaier was a fifth-year graduate student at UCSF in the area of synthetic biology. His research was centered on engineering Salmonella to produce and secrete spider silk. Spider silk protein has incredible tensile strength, being stronger than steel and tougher than the body armor and tire material Kevlar. Despite these properties, the silk extraction process has remained incredibly labor-intensive for hundreds of years, limiting its use mostly to luxury textiles. Dan saw an opportunity to use synthetic DOI:10.1091/mbc.E14-06-1162. Mol Biol Cell 25, 3280–3283. Address correspondence to: Adriana Tajonar (adriana.tajonar@qb3.org). Abbreviations used: CEO, chief executive officer; IP, intellectual property; LLC, limited liability corporation; NDA, nondisclosure agreement; QB3, California Institute for Quantitative Biosciences; SBIR, Small Business Innovation Research; STTR, Science and Technology Transfer Research; UCSF, University of California, San Francisco; VC, venture capital, venture capitalists. © 2014 Tajonar. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society for Cell Biology. 34 | A. Tajonar Monitoring Editor Doug Kellogg University of California, Santa Cruz Received: Aug 1, 2014 Revised: Sep 4, 2014 Accepted: Sep 9, 2014 biology to streamline the production and extraction of spider silk. He convinced his lab-mate and collaborator Ethan Mirsky and microfluidics expert David Breslauer, then a graduate student at the University of California, Berkeley, to join him in creating a new company, and Refactored Materials was born in 2009. The team successfully applied for small business grants from the National Science Foundation and Department of Defense with their proposal for producing spider silk from engineered microbes for ballistic armor and medical device applications. The company started their operations out of a single bench in an incubator space at UCSF called the QB3 Garage. Since then, Refactored Materials has successfully raised two venture rounds and is going after the textile market, a much larger market than originally anticipated that has seen little innovation since Lycra in the 1950s. In a few years, expect your athletic clothes to be more breathable, your socks to be softer, and your silk garments to be more durable, all thanks to three grad students with a vision to change the world, one spider dissection at a time. TURNING RESEARCH INTO AN AGENT OF CHANGE There is no question that having a meaningful impact on society is a powerful driver for scientists. It is not surprising that so many of the discoveries that have improved our society by increasing efficiency, adding capabilities, and bettering health have come from basic research done in universities. Universities, however, are not equipped to fully translate technologies out of the academic lab into the market, and a separate vehicle is needed to truly fulfill the promise of societal impact. Certain efficiencies in the industry environment are rare in academia. This has been the case since Genentech’s inception and remains true today, a reminder for young scientists and future entrepreneurs that industry is the conduit for translational applications. Startups are the vehicle needed for this translation for three key reasons. First, startups can address key technical risks and arrive at go/no-go decision points with relatively low amounts of capital and close to no overhead. Of importance, thinly capitalized startups are Molecular Biology of the Cell FIGURE 1: Life of a science startup. incentivized to listen to their investors and advisors and act swiftly, a feat that is easily said but more rarely achieved in the academy. If the startup wishes to survive, the achievement of milestones is not optional. Thus every experiment is tailored at answering go/no-go questions. Data must be not only publication worthy, but, more important, worth millions of investors’ dollars and years of work. Second, founders must constantly assess risk, and a thorough study is essential to select the best market for a technology with several potential applications. The selective pressures for an early stage startup are extremely high when all the contributors to a viable business model are considered. These pressures enable a competitive marketplace for the best ideas. In such a marketplace, the startup structure allows for the ability to “pivot”—to remain nimble as the business model evolves. Startup founders can ensure that the technology has a viable market and create a validated plan to get there. Third, startups allow the correct alignment of incentives for their founders in terms of real-world impact and financial return. Students and postdocs are at a point in their careers at which they can dedicate the time to build this opportunity, something that faculty founders usually cannot do. Science startups often involve the original inventors behind the innovation—postdocs or graduate students who can easily address key proof-of-concept questions and develop the original technology. In most cases, it was at the hands of these young scientists that the invention materialized, so the sense of ownership is strong, and they remain very passionate and motivated to see their work address a real-world need (and reap the benefits of their effort). ADVICE POINTS At QB3, the California Institute of Quantitative Biosciences, we have helped more than 200 teams of scientists start companies through the Startup in a Box Program. Of these teams, 65 have successfully raised funds within the first 18 months of coming to QB3 for help. Two-thirds of the teams come directly from academia, with postdocs or graduate students at the helm. Following are some lessons for the life science entrepreneur-to-be. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Identify the unmet need that your technology addresses The best way to articulate your solution and the value of your approach is to clearly state the problem you are solving. It is important to solve a problem you are passionate about, but there must be a large enough market for this technology; in other words, make sure that there are enough people who care about this problem enough to pay for your solution. Going after a small or niche market is acceptable, too, but your sources of capital will be fewer, and you will need to clearly articulate how your company can even recover its costs. When looking for your market, “don’t be a hammer in search of a nail”; that is, be objective when identifying a need instead of trying to make your special interest into a market that might never exist. Build a high-quality, well-rounded team No startup was ever created by a single person. When starting a company, find one or more cofounder(s) with complementary skill sets. For example, if you are a cancer biologist and your idea is to develop new cancer therapeutics, find someone with pharmacology or drug development experience. If you have a clinical background and want to develop a medical device, find an engineer. In the case of Refactored Materials, Dan had the chemistry knowhow, Ethan brought in the electrical engineering and operational expertise, and David was able to spin fibers thanks to his microfluidics background. Having a cofounder has multiple benefits, from expanding the company’s skillset, to having a sounding board and accountability partner, to showing investors that you can work with others. Having a well-rounded team with the best people you can recruit is a key asset for a startup. Faculty cofounders commonly remain involved as advisors or board members. If your team is made up of academics, it can be extremely helpful to find an experienced entrepreneur or executive with startup experience. A youthful team is great, but an experienced person will help anchor the team and give you credibility in front of investors. The same goes for qualified mentors and advisors: everyone in your team should be passionate about the company’s vision and mission. How to start a biotech company | 35 Understand incentives, and use them to drive your company to success Once you have put your all-star team together, make sure the people involved are incentivized to do their best work for the company. At the very early stage, you will not have the funding needed to steal your colleagues away from a salary in industry, consulting, or any salary for that matter. Therefore you give equity or shares in your company tied to a vesting schedule, allowing your cofounders and early employees to participate in the ownership of your company. Initially these company shares will be worth very little, but the idea is to incentivize high-quality work that will drive up the value of the shares with a large potential up-side to the shareholders. Equity is also a vehicle to recruit an experienced entrepreneur, senior advisor, or consultant with unique expertise to help your company. Get quality legal advice A good lawyer will become a key advisor in the early stages of your company, so it is crucial to seek out quality legal advice in the field of your startup (a lawyer with experience in real estate can help little when it comes to a company inventing cardiovascular implants). Yes, it is pricey, but you really get what you pay for, so it is worth spending slightly more to set up the foundation of your company correctly. Many large law firms have special incentives for startups, often with fees deferred until a funding event happens. In terms of company formation, make sure you choose the company structure that fits your business model best. For example, if you will need to incentivize early advisors with equity and if you will need to seek private capital to bring your product to market, a C-corporation makes more sense. If you will be operating as a service and do not depend on raising investor dollars, you might consider a Limited Liability Corporation (LLC). A “quick and dirty” online site to register your company may seem appealing now, but try to avoid it—fixing all the problems later will cost more money, and it will create unnecessary paperwork and transactions. Your intellectual property (IP) is also one of your most valuable assets, so make sure you secure it early and well. If you are filing your own patent, craft the claims so that your technology is protected as broadly as possible; if you are licensing IP (for example, from a university), do this early and seek your lawyer’s counsel to make sure the license terms are acceptable. Money, money, money—search under every rock There are many sources of early-stage funding: Small Business Innovation Research (SBIR)/Science and Technology Translation Research (STTR) and other federal grants, angels, venture capital (VC), foundations, crowd funding, friends, and family. Explore them all, but be prepared to roll up your sleeves and write some grants. SBIRs and STTRs are grants by any federal government agency that has an annual budget larger than $100 million. Familiar sources such as the National Institutes of Health, National Science Foundation, Department of Defense, and Department of Energy participate and provide these types of grants. The process is involved and competitive, but many successful companies, including Refactored Materials, started on the backs of these grants. Most VCs and angels have moved farther down the pipeline to where the technology has been de-risked, so government grants are certainly worth your time and effort. As an example, one-third of Startup in a Box graduates started operations on the back of SBIRs. Finally, leave no rock unturned. It is always helpful to start building relationships with your potential future investors to understand what is needed for a “yes” later on and ask for advice before asking 36 | A. Tajonar for money (the old adage, “if you want money, ask for advice,” is certainly true in the early-stage investment world). Respect your investors Research your investors before meeting with them. Find out what their investment interests are and in which space they usually participate. This will help you spin your story appropriately in terms of specific application (if you have several possible ones), amount to ask for (some large investors cannot give you seed money), and your use of the funds. Sooner or later, you will run into the rumor that you should not talk science with investors. Know that this is just a myth; sophisticated life science investors will want to understand the technology into which they are putting their cash. In the words of engineer and statistician William Edwards Deming, “In God we trust, all others must bring data.” Your investors will know more about the market than you will. This means that you do not need to dwell on the point that cancer is an important problem. Listen to your investors’ advice even before they become your investors. Their insight can help you identify opportunities and refine your strategic thinking. Be unfocused at the beginning, but learn to identify opportunities This advice applies to technologies with more than one application, such as platform technologies; in such situations, it might be difficult to pick which application or market to pursue first. It is useful to think of having a strategy that includes an earlier or easier path to revenue. Large markets may be alluring as a first battlefield, but they are often plagued with regulatory and market risks. Find out whether there is a better route to establish your proof of concept, even if it is in a smaller market. Having a direct path to market will allow you to move quicker on fewer funds; this will make it easier to tackle the larger and more challenging market later on. Refactored Materials realized that ballistic armor and medical devices would be challenging markets to crack, and they received much interest from the textile industry. The door is open to come back to the other applications in the future, but the silk textile market is primed for disruption. Identify your white-hot risk, and use your time wisely There are many risks in the way of taking a scientific technology to market: technical/scientific risk, regulatory risk, market risk. Higher risk in any of these areas correlates directly with the difficulty of getting money (since the uncertainty of return on investment for investors is higher). Convincing investors to accept these risks strongly affects early stage companies, as they have the largest number of unknowns. Your goal as an entrepreneur is to focus on answering the questions that will help you address and decrease those risks. Understand what the major risks are that stand between you and getting to market, and focus your time on them. Test and build your business model—no, you do not need a business person—yes, you can use a scientific approach, too As a startup, one of your most important tasks will be to discover your business model, that is, how your company fits into the market. What is your value proposition? Who are your customers and partners? Do you understand how your product fits into the entire process or patient care procedure? If you are developing a diagnostic for a disease that has no current therapy, why will people be inclined to use (and pay for) your product? You might have answers to all Molecular Biology of the Cell these questions, but at the moment they are really just hypotheses. The best way to validate these and develop your business model is to talk to relevant partners directly in a process developed by Steve Blank and called “customer discovery” (Blank and Dorf, 2012). The founders are the best people to do this validation, since they have a deep understanding of the technology and can make changes to the model (or pivot) if necessary. So, in Blank’s words, “Get out of the building!” Be lean Money is the lifeline of a startup, and you will never have enough. You must use it wisely when you have it, and take it whenever you can. Make a budget and prioritize to ensure that your resources are going toward your key activities, and follow this plan with superb execution: in other words, be a lean startup. For example, you do not need to hire a full-time business person from the beginning; instead find someone who is willing to work with your company as an advisor or interim CEO in exchange for equity and reduced (or no) pay. If they believe in your company, they will be incentivized to help the company grow. When being lean, you often need to find a middle ground that allows you to focus on your core skills. Trying to save some money by attempting to cram “Accounting 101” might not be a wise use of your time. Conversely, you do not need to hire a full-time accountant; outsource the company’s accounting work, and pay by the hour or service. Tell a story without giving away your secrets An idea alone is not enough to make a company; you need execution and feedback from others. You will need to learn how to talk about your idea without revealing the “secret sauce” with investors and potential partners: in fancy terms, this is called having a nonconfidential discussion. While you are in the process of filing a patent to protect your IP, it is useful to learn how to describe the problem you are solving and your approach without revealing confidential details. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Being able to describe your idea in nonconfidential terms will also allow you to avoid having to ask for a nondisclosure agreement (NDA) when you have an introductory discussion with a potential partner. Oh, and whatever you do, don’t ask VCs for an NDA for an initial pitch: they will not sign them, and it makes you seem naive. Inform yourself Staying informed is the key to success: talk to entrepreneurs in the field, and find resources at your institution (career office, technology transfer office, entrepreneurship groups) that can help you learn about entrepreneurship and connect with alumni who have started their company or joined a startup. Reach out to faculty who have founded companies, and try to get connected with the entrepreneurs that drove their company. Do not give up, and get ready for the best roller coaster ride! Despite the plethora of (at times daunting) things to think about, I have not yet met a single entrepreneur who regrets starting a company. There will be ups and downs, much as in academic science, but as with any goal worth pursuing, it will all be worth it. In the case of Refactored Materials, it will be revolutionizing a centuries-old industry by enabling spider silk production for multiple applications at a large scale and in an environmentally conscious way. ACKNOWLEDGMENTS I acknowledge Douglas Crawford, Regis Kelly, Richard Yu, and Filip Ilievski for constructive discussions and thoughtful feedback on this Perspective. REFERENCE Blank S, Dorf B (2012). The Startup Owner’s Manual: The Step by Step Guide for Building a Great Company, Pescadero, CA: K&S Ranch Press. How to start a biotech company | 37 MBoC | ARTICLE 2014 MBoC PAPER OF THE YEAR Angiomotins link F-actin architecture to Hippo pathway signaling Sebastian Mana-Capelli, Murugan Paramasivam, Shubham Dutta, and Dannel McCollum Department of Biochemistry and Molecular Pharmacology and Program in Cell Dynamics, University of Massachusetts Medical School, Worcester, MA 01605 ABSTRACT The Hippo pathway regulates the transcriptional coactivator YAP to control cell proliferation, organ size, and stem cell maintenance. Multiple factors, such as substrate stiffness, cell density, and G protein–coupled receptor signaling, regulate YAP through their effects on the F-actin cytoskeleton, although the mechanism is not known. Here we show that angiomotin proteins (AMOT130, AMOTL1, and AMOTL2) connect F-actin architecture to YAP regulation. First, we show that angiomotins are required to relocalize YAP to the cytoplasm in response to various manipulations that perturb the actin cytoskeleton. Second, angiomotins associate with F-actin through a conserved F-actin–binding domain, and mutants defective for F-actin binding show enhanced ability to retain YAP in the cytoplasm. Third, F-actin and YAP compete for binding to AMOT130, explaining how F-actin inhibits AMOT130-mediated cytoplasmic retention of YAP. Furthermore, we find that LATS can synergize with F-actin perturbations by phosphorylating free AMOT130 to keep it from associating with F-actin. Together these results uncover a mechanism for how F-actin levels modulate YAP localization, allowing cells to make developmental and proliferative decisions based on diverse inputs that regulate actin architecture. INTRODUCTION The Hippo pathway regulates contact inhibition of cell growth, cell proliferation, apoptosis, stem cell maintenance and differentiation, and the development of cancer in mammals and flies (Yu and Guan, 2013). The core Hippo pathway in mammals consists of the MST1/2 kinases, which activate the LATS1/2 kinases, which in turn phosphorylate and inhibit the homologous transcriptional coactivators YAP and TAZ (hereafter referred to as YAP), causing them to relocalize from the nucleus to the cytoplasm. Nuclear YAP promotes growth, proliferation, and stem cell maintenance. YAP localizes to the This article was published online ahead of print in MBoC in Press (http://www .molbiolcell.org/cgi/doi/10.1091/mbc.E13-11-0701) on March 19, 2014. Mol Biol Cell 25, 1676–1685. Address correspondence to: Dannel McCollum (dannel.mccollum@umassmed .edu). Abbreviations used: AB, actin binding; BSA, bovine serum albumen; DAPI, 4′,6-diamidino-2-phenylindole; GFP, green fluorescent protein; GST, glutathione S-transferase; IgG, immunoglobulin G; PBS, phosphate-buffered saline; MBP, maltose-binding protein. © 2014 Mana-Capelli et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0). “ASCB®,” “The American Society for Cell Biology®,” and “Molecular Biology of the Cell®” are registered trademarks of The American Society of Cell Biology. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Monitoring Editor Benjamin Margolis University of Michigan Medical School Received: Dec 2, 2013 Revised: Feb 28, 2014 Accepted: Mar 11, 2014 nucleus in cells at low density, and at high density YAP exits the nucleus and cells stop proliferation. How YAP is regulated in response to cell density is not known, although recent evidence suggests that the organization of the actin cytoskeleton contributes through an unknown mechanism (Dupont et al., 2011; Fernandez et al., 2011; Sansores-Garcia et al., 2011; Wada et al., 2011; Zhao et al., 2012). In addition, G protein–coupled receptors have been shown to modulate Hippo signaling through F-actin (Miller et al., 2012; Mo et al., 2012; Yu et al., 2012). F-actin can influence YAP activity through both Hippo pathway (LATS)–dependent (Wada et al., 2011; Zhao et al., 2012; Kim et al., 2013) and Hippo pathway–independent mechanisms (Dupont et al., 2011; Aragona et al., 2013). Intriguingly, angiomotin family members AMOT, AMOTL1, and AMOTL2 can also inhibit YAP both in a Hippo pathway–independent manner by binding and sequestering YAP in the cytoplasm and by activating the YAP inhibitory kinase LATS (Hippo dependent; Chan et al., 2011; Paramasivam et al., 2011; Wang et al., 2011; Zhao et al., 2011; Hirate et al., 2013; Leung and Zernicka-Goetz, 2013). Given their ability to associate with actin structures (Ernkvist et al., 2008; Gagne et al., 2009), we hypothesized that angiomotins might mediate the effects of F-actin on YAP. Here we report evidence in support of this hypothesis. 39 FIGURE 1: AMOT130 associates with F-actin through a domain in its N-terminus. (A) U2OS cells were transfected with plasmids for expression of Myc-tagged full-length AMOT130, amino acids 100–200 of AMOT130 (AMOT130 (100-200)), AMOT130 with a deletion in the actin-binding region (AMOT130-ΔAB), or a fragment containing the actin-binding region fused to GFP (AMOT130-(157-191)) and imaged at low densities. Cells were stained for AMOT130 using anti-Myc or GFP antibodies and for F-actin using phalloidin. DNA was stained with DAPI. Bar, 20 μm. (B) U2OS cells were transfected with a plasmid for expression of full-length Myc-tagged AMOT130 and then stained for AMOT130 (using anti-Myc antibodies) and endogenous myosin IIA, which is a marker for stress fibers. Bar, 20 μm. (C) Representation of angiomotin protein features, including the actin-binding region flanked by YAP-binding motifs. (D) An alignment of the amino-terminal region of human AMOT130, AMOTL1, and AMOTL2 is shown. The region containing the actin-binding region (underlined) and LATS phosphorylation site are indicated (box). Numbers correspond to amino acid numbers for AMOT130. RESULTS The N-terminal Hippo pathway regulatory domain of angiomotins contains an actin-binding motif Overexpression of the long isoform of AMOT (AMOT130) causes formation of large F-actin bundles that also contain AMOT130 (Ernkvist et al., 2008; Dai et al., 2013; Figure 1A). When expressed at lower levels, AMOT130 localizes as puncta on stress fibers but does not cause obvious actin bundling (Figure 1B). To determine the significance of AMOT130 localization to the actin cytoskeleton, we sought to identify mutants defective in actin localization and bundling. Deletion analysis revealed that the actin localization domain was contained within an ∼100–amino acid conserved stretch near the amino terminus of all three angiomotin proteins (Figure 1, A, C, and D, and Supplemental Figure S1A). By deleting individual blocks of conserved sequence within this region, we found that actin localization required a short motif (e.g., AMOT130 residues 169–178; Figure 1, C and D). Deletion of this region in full-length AMOT130 (AMOT130-ΔAB; AB = actin binding; Figure 1A) or in the actin-localizing fragment of AMOTL2 (Supplemental Figure S1A) disrupts both actin localization and bundling activity. (Note that the AMOT130ΔAB mutant and other forms of AMOT130 that cannot bind F-actin 40 | S. Mana-Capelli et al. localize to vesicular structures [see Discussion], as observed for AMOT80 [Heller et al., 2010], a shorter form of AMOT lacking the actin-binding region.) In addition, a small fragment (AMOT130 residues 157–191) centered around the residues deleted in AMOT130ΔAB localized to F-actin structures when fused to green fluorescent protein (GFP; Figure 1A). Actin binding of AMOT130 is regulated by LATS2 kinase Of interest, the conserved sequence block in the actin-binding region of angiomotins contains a perfect consensus LATS phosphorylation site (HXRXXS; serine 175 in AMOT130; Figure 1, C and D), suggesting that LATS might regulate the actin-binding properties of angiomotins. Consistent with this idea, expression of LATS2 (but not kinase-dead LATS2) could disrupt both AMOT130 localization to actin fibers and its actin-bundling activity (Figure 2, A–C). Mutation of the putative LATS phosphorylation site in the actin-binding region of AMOT130 or AMOTL2 blocked in vitro phosphorylation of each protein by LATS2 (Supplemental Figure S2A) and blocked the ability of LATS2 to inhibit the actin-bundling and localization activity of AMOT130 (Figure 2, A–C). In contrast, AMOT130-S175E could not localize to or bundle actin (Figure 2, A–C). Thus LATS2 Molecular Biology of the Cell FIGURE 2: LATS2 inhibits association of AMOT130 with F-actin. (A) U2OS cells were transfected with the indicated AMOT130 and LATS2 plasmids and imaged at low densities. Cells were stained for AMOT130 (Myc), F-actin using phalloidin, and LATS2 or LATS2-KD (FLAG). DNA was stained with DAPI. Bar, 20 μm. (B, C) Quantification of the phenotypes of the cells in A. Graphs represent the average from three experiments (n ≥ 100 each), and error bars indicate SD of the averages. In all cases, brackets on top of bars represent statistical significance (Fisher test, p < 0.00001). (D) Immunostaining of endogenous AMOT130, phospho-AMOT130, and actin. HEK 293T cells were stained with phalloidin to visualize actin and with the indicated antibodies. (E) HEK 293T cells growing at increasing densities were costained with anti-AMOT130 and anti–phospho-AMOT130 (p-AMOT130). DNA was stained with DAPI. Bar, 20 μm. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Actin regulates angiomotins and YAP | 41 (no AMOT130) YAP remained primarily in the nucleus. Wild-type AMOT130 and AMOT130-S175A were able to cause limited translocation of YAP to the cytoplasm (only in cells with high AMOT130 expression levels; Figure 4C). Of interest, the AMOT130-S175A mutant was less effective than wild-type AMOT130 at bringing YAP to the cytoplasm. In contrast, the mutants that could not bind F-actin (AMOT130-ΔAB or AMOT130-S175E) were much more effective at shifting YAP to the cytoplasm (Figure 4, A–C), and in these cases YAP colocalized with AMOT130 on vesicles (Figure FIGURE 3: LATS phosphorylation of AMOT130 prevents its association with F-actin, and 4A), similar to when AMOT130 was coexAMOT130 binding to F-actin inhibits LATS phosphorylation. (A, B) In vitro binding assays between recombinant MBP-AMOT130 or MBP-AMOT130-S175E and purified nonmuscle F-actin pressed with LATS2 (Supplemental Figure (A) or recombinant GST-YAP2 (B). MBP-AMOT130 protein bound to beads was used to pull S3A). Similarly, soon after disruption of down (PD) F-actin or GST-YAP2. Levels of bound proteins and input are shown. (C) Kinase assays F-actin in HEK 293T cells using latrunculin B, of recombinant MBP-AMOT130 (preincubated with or without purified nonmuscle F-actin) and endogenous YAP was observed to colocalLATS2 kinase immunoprecipitated from HEK293 cells. Phosphorylated AMOT130 was detected ize with S175-phosphorylated endogenous using a phospho-S175–specific antibody. The levels of bound proteins and input are shown. AMOT130 on structures (possibly vesicles) near the plasma membrane (Figure 4D). phosphorylation of AMOT130 inhibits its localization to F-actin. When we assayed transcription from a synthetic YAP-dependent Localization of endogenous AMOT130 in 293T cells supported this promoter (Dupont et al., 2011), although all forms of AMOT130 are conclusion. In cells at low density, AMOT130 was observed to coexpressed similarly (Supplemental Figure S3B) and show inhibition localize with actin fibers (Figure 2D). In contrast, phospho-AMOT130 of YAP (probably due to overexpression), we again found that the (analyzed with phospho-serine 175–specific antibodies; Hirate AMOT130 mutants that could not bind F-actin were more effective et al., 2013) did not colocalize with F-actin fibers and was instead at inhibiting YAP (Figure 4E and Supplemental Figure S3C). Together observed at regions of cell–cell contact (Figure 2D). As cells bethese results show that F-actin binding antagonizes the ability of came more dense and established more cell–cell contacts, inAMOT130 to inhibit YAP nuclear localization and function. creased phospho-AMOT130 staining was observed at cell–cell junctions (Figure 2E). Endogenous phospho-AMOT130 was only F-actin and YAP compete for binding to AMOT130 occasionally seen at vesicles, like the phospho-mimetic AMOT130Binding to F-actin could inhibit the ability of AMOT130 to direct YAP S175E mutant (see Discussion). to the cytoplasm by blocking either AMOT130 activation of LATS or Because the LATS phosphorylation site is in the middle of the binding of AMOT130 to YAP. To address this question, we made AMOT130 actin-binding region, we hypothesized that just as phosAMOT130 mutants that were specifically defective at either activatphorylation inhibits AMOT130 actin binding, binding of AMOT130 ing LATS2 or binding YAP. To disrupt interaction between AMOT130 to F-actin might interfere with phosphorylation by LATS. To test this and YAP, we mutated the three L/PPXY motifs in AMOT130 that are model in vitro, we first determined whether AMOT130 could bind known to mediate interaction between AMOT130 and the WW dodirectly to F-actin in vitro. Consistent with in vivo data, recombinant mains of YAP (Chan et al., 2011; Wang et al., 2011; Zhao et al., 2011; AMOT130 (Figures 3A and Supplemental Figure S2B), but not Adler et al., 2013a). Because AMOT130 mutants defective at actiAMOT130-S175E (Figure 3A), could bind to F-actin, whereas both vating LATS had not been identified, we mutated blocks of conAMOT130 and AMOT130-S175E bound recombinant YAP (Figure served residues in the amino terminus of AMOT130, which was 3B). Using in vitro kinase assays, we observed that LATS2 could known to be required for LATS2 activation (Paramasivam et al., phosphorylate AMOT130 in the absence but not in the presence of 2011), and tested their ability to promote LATS2 phosphorylation of F-actin (Figure 3C). This result is consistent with recent observations YAP. Because mutation of residues 13–27 abolished the ability of showing that LATS phosphorylation of AMOT130 in vivo is enhanced AMOT130 to activate LATS2 (Figure 4F), this domain was termed by disruption of F-actin (Dai et al., 2013). Thus LATS may act, after the LATS activation domain (LAD). Of interest, both AMOT130-ΔAB perturbations that reduce F-actin levels, to phosphorylate free and wild-type AMOT130 promoted LATS2 phosphorylation of YAP AMOT130 to keep it from rebinding to F-actin. to a similar degree, suggesting that F-actin binding might not regulate AMOT130 activation of LATS2. Next we used these mutants to test how F-actin regulates the ability of AMOT130 to promote cytoActin binding–deficient mutants of AMOT130 show plasmic localization of YAP. Expression of different versions of enhanced YAP inhibition AMOT130-ΔAB with deletions in either the YAP-binding motifs or Previous studies showing that YAP is inhibited by F-actin disruption the LAD demonstrated that the enhanced ability of AMOT130-ΔAB could be explained if an inhibitor of YAP was kept sequestered by to translocate YAP to the cytoplasm depends mostly on the L/PPXY binding to F-actin. If AMOT130 functions in this manner, then mumotifs, with the LAD making only a minor contribution (Figure 4B). tants that cannot bind F-actin should have enhanced ability to This suggests that F-actin binding primarily interferes with AMOT130 inhibit YAP in vivo. Therefore we tested whether localization to binding to YAP. F-actin affected the ability of AMOT130 to inhibit YAP nuclear localBecause the F-actin–binding domain of AMOT130 is closely ization and transcriptional activity. Wild-type and mutant forms of flanked by YAP-binding motifs (Figure 1C), we hypothesized that AMOT130 were transfected into U2OS cells, and the localization of F-actin and YAP might compete for binding to AMOT130, which endogenous YAP was examined (Figure 4, A–C). In control cells 42 | S. Mana-Capelli et al. Molecular Biology of the Cell could allow F-actin levels to modulate the ability of AMOT130 to bind to YAP. Consistent with this idea, overexpression of YAP in U2OS cells blocked localization of coexpressed AMOT130 to F-actin, and both proteins localized to vesicles (Supplemental Figure S3D). We next tested biochemically whether F-actin and YAP compete for binding to AMOT130. AMOT130 (on beads) was allowed to bind F-actin and then incubated in the presence or absence of increasing amounts of YAP (Figure 4G). We observed that high YAP concentrations displaced F-actin from AMOT130, showing that YAP and actin compete for binding to AMOT130. Together these data point toward competition between F-actin and YAP for binding to AMOT130, which could explain how actin modulates AMOT130 regulation of YAP. Angiomotins mediate the effects of actin perturbation on YAP localization Various treatments that perturb F-actin (Supplemental Figure S4A) cause YAP to exit the nucleus (Dupont et al., 2011; Fernandez et al., 2011; Sansores-Garcia et al., 2011; Wada et al., 2011; Zhao et al., 2012). Examples include 1) F-actin depolymerization by latrunculin B or cytochalasin D; 2) serum withdrawal, which acts through G protein–coupled receptors to affect the actin cytoskeleton (Miller et al., 2012; Mo et al., 2012; Yu et al., 2012); 3) type 2 myosin inhibition, which affects F-actin stress fibers (Dupont et al., 2011); and 4) increased cell density (Dupont et al., 2011). We found that angiomotins (and LATS) are required for regulation of YAP localization in each case. We used small interfering RNA (siRNA)/short hairpin RNA (shRNA) to knock down AMOT, AMOTL1, and AMOTL2 in HEK293A and MCF10A cells (Supplemental Figure S4B). Although knockdown of individual angiomotins had limited effects, knockdown of all three caused nuclear retention of YAP and maintenance of YAP activity after F-actin depolymerization, type 2 myosin inhibition, serum withdrawal, and increased cell density in HEK293A and MCF10A cells (Figure 5, A–D, and Supplemental Figure S4, C–F). (Note that the effect of triple knockdown in HEK293A cells after latrunculin B treatment or serum starvation could be rescued by overexpression of AMOT130 or AMOTL2; Figure 5, A and B.) In HEK293A cells, triple angiomotin knockdown blocked cytoplasmic accumulation of YAP to a similar degree as LATS1/2 knockdown after latrunculin B treatment but had a significantly stronger effect than LATS1/2 knockdown after starvation (Figure 5, A and B). Combined knockdown of both LATS1/2 and all three angiomotins caused an additive effect after latrunculin B treatment compared with knockdown of LATS1/2 or the three angiomotins alone (Figure 5A). However, after serum starvation, combined LATS1/2 and triple angiomotin knockdown did not significantly enhance YAP nuclear retention compared with triple angiomotin knockdown alone (Figure 5B). The different relative effects of LATS and angiomotin knockdown after latrunculin or serum starvation treatment could be explained if LATS and angiomotin respond somewhat differently to each stimuli. Collectively these results show that LATS and angiomotins are major mediators of various inputs that act through the F-actin cytoskeleton to affect YAP localization. DISCUSSION The F-actin cytoskeleton is a major regulator of the Hippo pathway target YAP, mediating signals triggered by substrate stiffness, cell density, and cell detachment, as well as signaling from G protein– coupled receptors (Dupont et al., 2011; Sansores-Garcia et al., 2011; Wada et al., 2011; Miller et al., 2012; Mo et al., 2012; Yu et al., 2012; Zhao et al., 2012). We show here that angiomotin proteins connect F-actin organization to YAP regulation. The AMOT130 protein binds 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year purified F-actin in vitro, and we observe it on stress fibers in cells. This fits with studies suggesting that F-actin structures that respond to mechanical forces such as stress fibers are involved in YAP regulation (Dupont et al., 2011; Wada et al., 2011). Although we show that AMOT130 can bind F-actin in vitro, it will be important in future studies to determine whether AMOT130 can distinguish between types of F-actin structures in vivo. A direct competition for binding to AMOT130 between F-actin and YAP appears to underlie the ability of F-actin to keep AMOT130 from binding and sequestering YAP in the cytoplasm. Angiomotins are major mediators of the effects of F-actin on YAP, since they are required for the cytoplasmic retention of YAP that occurs when F-actin is disrupted. Together these results suggest a model (Figure 5E) in which AMOT130 is sequestered on F-actin structures and stimuli that cause loss of these structures, such as increased cell density, result in release of AMOT130, allowing it to bind and inhibit YAP. This simple model may actually be more complex. For example, in overexpression studies, we observe that the phosphomimetic form of AMOT130, which does not bind F-actin and has enhanced ability to keep YAP out of the nucleus, colocalizes with YAP in vesicular structures in the cytoplasm. This raises the possibility that membrane/vesicular localization could play an additional role in YAP regulation. It is worth noting that we only observe localization of endogenous phospho-AMOT130 and YAP to possible vesicular structures soon after F-actin disruption. In other situations phosphoAMOT130 colocalizes with YAP at cell junctions. One explanation for these results is that overexpression of AMOT130-S175E may cause accumulation of vesicular intermediates that would normally be sent on to the plasma membrane. Consistent with this notion, overexpression of AMOT80, a short form of AMOT lacking the F-actin–binding domain, causes accumulation of large endosomallike compartments (Heller et al., 2010). In future studies it will be important to determine whether localization of AMOT130-YAP complexes to vesicles and the plasma membrane plays a role in YAP regulation. There has been some question about the importance of LATS for F-actin–dependent regulation of YAP (Dupont et al., 2011; Yu et al., 2012; Zhao et al., 2012; Aragona et al., 2013). Our work, together with other studies, suggests that LATS functions together with angiomotins to regulate YAP in response to F-actin perturbation. We show that LATS contributes to cytoplasmic retention of YAP after Factin disruption and serum withdrawal, and several reports have shown that LATS becomes activated and inhibits YAP by direct phosphorylation when F-actin is disrupted (Wada et al., 2011; Zhao et al., 2012; Aragona et al., 2013). Our work indicates that activated LATS can also act through angiomotins to inhibit YAP. LATS phosphorylation of AMOT130 is enhanced by F-actin disruption in vivo (Dai et al., 2013), and we show that the ability of LATS2 to phosphorylate AMOT130 in vitro is increased in the absence of F-actin. From this study, as well as from several recent reports, it is clear that LATS phosphorylation of AMOT130 inhibits its ability to bind F-actin (Adler et al., 2013b; Chan et al., 2013; Dai et al., 2013; Hirate et al., 2013). We show that LATS phosphorylation blocks AMOT130 binding to F-actin, allowing it to bind YAP and sequester it in the cytoplasm. LATS phosphorylation of AMOT130 appears to have additional functions. A recent study indicates that AMOT130 phosphorylation could also enhance AMOT130 binding to the WW domain–containing E3 ubiquitin ligase AIP4, which can both stabilize AMOT130 and promote YAP degradation (Adler et al., 2013a,b). It remains to be determined whether AIP4, like YAP, directly competes with F-actin for binding to AMOT130. Recent studies also suggest that AMOT130 phosphorylation by LATS could enhance Actin regulates angiomotins and YAP | 43 FIGURE 4: Actin and YAP compete for binding to AMOT130, and AMOT130 mutants that cannot bind F-actin are more efficient at inhibiting YAP. (A, B) U2OS cells were transfected with either control plasmid or one of the indicated AMOT130 plasmids. The next day, cells were stained for endogenous YAP and scored for the percent of cells with more YAP in the nucleus than the cytoplasm (N > C), more in the cytoplasm than the nucleus (C > N), or equal signal in the cytoplasm and nucleus (C = N). (A) Example images. (B) Average from three experiments (n ≥ 100 each), and the error bars indicate SD of the averages. Brackets on top of bars represent statistical significance (Fisher test, *p < 0.00001, **p < 0.02). Bar, 20 μm. (C) The AMOT130, AMOT130-S175A, AMOT130-S175E, and AMOT130-ΔABD expression levels 44 | S. Mana-Capelli et al. Molecular Biology of the Cell the AMOT130–LATS interaction (Hirate et al., 2013) and have effects on the actin cytoskeleton (Dai et al., 2013). Thus LATS can promote cytoplasmic localization of YAP in response to F-actin depolymerization by phosphorylating AMOT130 in addition to its well-characterized function in phosphorylating YAP (Figure 5E). The competition between F-actin and YAP for binding to AMOT130 could also provide a LATS-independent mechanism for F-actin–dependent regulation of YAP. The LATS-dependent and -independent mechanisms could allow for combinatorial regulation of YAP activity based on both inputs that affect the actin cytoskeleton, such as cell density, and inputs that affect LATS activity, such as cell– cell contacts (Kim et al., 2011), as was recently suggested (Aragona et al., 2013). Together this work shows that F-actin, angiomotins, and LATS form a regulatory module that controls YAP in response to diverse inputs such as changes in cell density, substrate stiffness, and G protein–coupled receptor signaling (Halder et al., 2012). MATERIALS AND METHODS Cell culture Human HEK 293, HEK293A, HeLa, and U2OS cell lines were grown in DMEM (GIBCO, Grand Island, NY) supplemented with 10% (vol/vol) fetal bovine serum (GIBCO) and 1% (vol/vol) penicillin/ streptomycin (Invitrogen, Grand Island, NY). Human mammary epithelial MCF10A cells were cultured in MEGM BulletKit (Lonza, Hopkinton, MA) with all additives except for the gentamicin– amphotericin B mix. Media was also complemented with 100 ng/ml cholera toxin (Sigma-Aldrich, St. Louis, MO) and 1% penicillin and streptomycin (Invitrogen). All cell lines were cultured in a humidified incubator at 37°C with 5% CO2. For kinase assays in the presence of F-actin, LATS2-FLAG was transfected in HEK293 cells together with its activators, MST1 and MOB1. After 24 h, LATS2 was purified in phosphate buffer using anti-FLAG M2 antibody (Sigma-Aldrich) and magnetic protein G beads (Invitrogen) following the manufacturers’ directions. Maltose-binding protein (MBP)–AMOT130 was expressed and purified as described and eluted with 20 mM maltose in supplemented actin buffer (5 mM Tris-Cl, pH 8.0, 0.2 mM CaCl2, 50 mM KCl, 2 mM MgCl2, and 1 mM ATP; Cytoskeleton, Denver, CO) for 30 min at 4ºC. Eluted AMOT130 (10 μl, ∼0.5 μg) was then preincubated with or without 10 μl of F-actin (see prior description, 5 μM final concentration) for 15 min at room temperature. Control reactions were taken to 20 μl with supplemented actin buffer. For kinase reactions the AMOT130/F-actin mix was added to LATS2bound beads prerinsed with supplemented actin buffer. After incubation at 30°C for 30 min, kinase reactions were stopped by boiling in SDS sample buffer. Samples were then subjected to SDS–PAGE, and phospho-AMOT130 was detected by Western blotting using a phosphospecific antibody. Luciferase assays were performed in U2OS and HeLa cells 24 h after transfection. All transfections were performed in 12-well plates using Lipofectamine 2000 and a combination of 300 ng of GTIICLuc (34615; Addgene, Cambridge, MA), 20 ng of pRL-SV40P (referred to as renilla, 27163; Addgene), and the described AMOT130 plasmid (300 ng for U2OS and 25 ng for HeLa cells). Cells lysates were generated and reactions performed following directions described in the Dual Luciferase Reporter Assay System (Promega, Madison, WI). Cell starvation and drug treatments In vitro kinase assays and luciferase assays For detection of LATS2-mediated phosphorylation of angiomotins with P-32, HEK 293 cells were transfected in 12-well plates with LATS2, various angiomotin constructs, and LATS activators (MST1, SAV, and MOB1), using Lipofectamine 2000 (Invitrogen). Forty hours after transfection, cells were lysed in immunoprecipitation buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1.0% Nonidet P-40, 2% glycerol) supplemented with 1× protease inhibitor cocktail (Sigma-Aldrich), 100 nM sodium vanadate (Sigma-Aldrich), and 50 mM sodium fluoride (Sigma-Aldrich), and lysates were cleared by centrifugation at 13,000 rpm for 10 min at 4°C. Protein lysate (300 μg) was processed for immunoprecipitation as described previously (Paramasivam et al., 2011). Both LATS2 and angiomotin proteins were immunoprecipitated together on the same beads. Kinase assays and Western blotting were carried out as previously described (Paramasivam et al., 2011). HEK293A cells were starved for 2 h in DMEM without serum. MCF10A cells were starved overnight in DMEM/F12 supplemented with 100 ng/ml cholera toxin (Sigma-Aldrich) and 1% penicillin and streptomycin (Invitrogen). Latrunculin B and cytochalasin D were used at 1 μM for 1 h, except for the phospho-AMOT130/YAP staining (Figure 4D), for which cells were incubated for only 15 min. Note that cytochalasin D was used to disrupt F-actin in MCF10A cells because latrunculin B was too toxic in these cells. Blebbistatin was used at 25 μM for 1 h. Immunocytochemistry U2OS, HeLa, and MCF01A cells cultured on coverslips were fixed in phosphate-buffered saline (PBS)/4% paraformaldehyde for 10 min and permeabilized/blocked with 0.1% Triton X-100 and 5% normal goat serum (Invitrogen) for 30 min. Cells were subsequently incubated with appropriate primary antibodies for 1–2 h at room in single cells were quantified and correlated with endogenous YAP localization. The graphs plot the average AMOT130 levels for individual cells (ordered based on AMOT levels) and are scored for those with more YAP in the nucleus than cytoplasm (N > C, solid symbols) or not (N = C + C > N, open symbols). (D) Endogenous YAP and phospho-AMOT130 (p-AMOT130) staining in HEK193T cells with or without treatment with latrunculin B for 15 min. DNA is stained with DAPI. Bar, 20 μm. (E) U2OS cells were transfected with the same AMOT130 plasmids as in A, as well as with an 8xGTIIC-luciferase YAP-dependent promoter plasmid and a plasmid with the SV40 promoter driving Renilla luciferase. The next day, cell extracts were made, and luciferase activity was measured for each sample. The levels of firefly luciferase (YAP activity) were normalized to the level of Renilla luciferase in each sample. Error bars indicate the SD between triplicates. Brackets on top of bars represent statistical significance (Student’s test, *p < 0.005, **p < 0.01). In all cases, the experiments were done in triplicate, and the error bars indicate the SD of the averages. (F) LATS2, YAP, and the indicated AMOT130 plasmids were transfected into HEK293 cells, and the levels of AMOT130, LATS2, YAP, and phospho-YAP were analyzed by Western blotting. The experiment was done in triplicate, and error bars indicate the SD of the averages. (G) Competition between actin and YAP for binding to AMOT130. Recombinant MBP-AMOT130 protein on beads was prebound to F-actin then incubated in the presence or absence of increasing amounts of recombinant GST-YAP2. The levels of bound proteins and input are shown. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Actin regulates angiomotins and YAP | 45 FIGURE 5: Angiomotins and LATS are required to efficiently inhibit YAP after F-actin disturbance. (A) HEK293A cells were transfected with control siRNA (luciferase) or siRNA against AMOT130, AMOTL1, AMOTL2, a combination of all three angiomotins (triple KD), or a combination of LATS1 and LATS2 (LATS1+2), as indicated. To test for off-target effects, plasmids for expressing either AMOT130 (R AMOT130) or AMOTL2 (R AMOTL2) were transfected the next day to test for rescue of the triple-knockdown phenotype. Forty-eight hours later, all cells were treated with either latrunculin B (see example images) or blebbistatin (Blebb) and then fixed and stained for localization of endogenous YAP. Cells were scored for the percentage of cells with more YAP in the nucleus than the cytoplasm (N > C), more in the cytoplasm than the nucleus (C > N), or equal signal in the cytoplasm and nucleus (C = N). Brackets on top of bars represent statistical significance (Fisher test, p < 0.0005). (B) HEK293A cells were manipulated as in A, except that instead of drug treatment, cells were shifted to media without serum for 2 h and then fixed and stained for endogenous 46 | S. Mana-Capelli et al. Molecular Biology of the Cell temperature. They were washed three times in PBS with 0.1% Triton X-100 and incubated with Alexa Fluor–conjugated secondary antibodies (Molecular Probes, Grand Island, NY) for 1 h at room temperature. 4′,6-Diamidino-2-phenylindole (DAPI) staining and Alexa-conjugated phalloidin (488 or 568; Invitrogen) were also added to the secondary antibody solution when appropriate. After three washes, coverslips were mounted on slides using Vectashield (Vecta Laboratories, Burlingame, CA) and viewed using fluorescent microscopy (Nikon Eclipse E600). Images were acquired using a cooled charge-coupled device camera (ORCA-ER; Hamamatsu, Bridgewater, NJ). Image processing and analysis were carried out with IPLab Spectrum software (Signal Analytics, Vienna, VA) and ImageJ software (Schneider et al., 2012). Plasmids Sources for plasmids used in this study were described previously (Paramasivam et al., 2011). All AMOT130, AMOTL1, and AMOTL2 constructs were expressed from pCDNA4-Myc-His. Large deletion mutants in AMOT130, AMOTL1, and AMOTL2 were constructed using PCR followed by subcloning. Point and small deletion mutations in AMOT130 and AMOTL2 were made using the QuickChange II Site mutagenesis kit (Stratagene, Santa Clara, CA). All localization studies were performed in a 12-well format. The various angiomotin plasmids were transfected at 600 ng/well, and LATS2 constructs (pcDNA3.1-LATS2-FLAG and pcDNA3.1-LATS2-KDFLAG) were transfected at 400 ng/well. Antibodies In vitro protein-binding assays AMOT130 and AMOT130-S175E were cloned in pDEST-MBP (provided by Marian Walhout’s lab) using Gateway (Invitrogen) standard procedures. MBP-AMOT130 and MBP-AMOT130-S175E were expressed with 1 mM isopropyl-β-D-thiogalactoside (IPTG) for 4 h at 25°C and shaking. MBP fusion proteins were purified with maltose beads (NEB, Ipswich, MA) in phosphate buffer (50 mM NaH2PO4, 150 mM NaCl, 10 mM β-mercaptoethanol, 0.1% Triton, and 1 mM phenylmethylsulfonyl fluoride) following the manufacturer’s directions. Expression of glutathione S-transferase (GST)–YAP2 (pGEX5X-2 vector; GE Healthcare, Piscataway, NJ) was induced by addition of 1 mM IPTG for 2 h at 25°C, and then GST-YAP2 was purified with glutathione beads (GE Healthcare) in phosphate buffer and eluted with 20 mM glutathione for 30 min. Nonmuscle actin was purchased as part of the Actin Binding Protein Kit (Cytoskeleton) and was polymerized for 1 h at 25°C following the manufacturer’s directions. For the in vitro pull-down experiments, bead-bound AMOT130 and AMOT130-S175E were incubated for 30 min at room temperature with eluted GST-YAP2 and/or ∼5 μM F-actin in phosphate buffer containing 2 mM ATP and 2 mM MgCl2 to keep F-actin stable (Actin Binding Protein Kit manual). Competition assays were assembled as follows. First, a constant amount of actin was incubated with MBP-AMOT130 beads for 15 min at room temperature. Then a constant volume of either GST elution buffer or increasing amounts of eluted GST-YAP2 were added as indicated in Figure 3F. Samples were then incubated for an additional 30 min. In all cases, beads were washed once with phosphate buffer and boiled in SDS– PAGE sample buffer. For the cosedimentation experiment, MBPAMOT130 was eluted from maltose beads with 10 mM maltose for 30 min and incubated with actin as for 30 min at room temperature. Samples were then centrifuged at 150,000 × g in a Beckman TLX bench-top ultracentrifuge for 1.5 h. Pellets were suspended in the same volume as the supernatants and boiled in SDS–PAGE loading buffer. Protein samples were the subjected to SDS–PAGE and Western blotting with the specified antibodies. Mouse anti-tubulin and mouse anti-FLAG (M2) were purchased from Sigma-Aldrich. The rabbit-anti YAP (sc15407), mouse anti-YAP (sc10199), rabbit anti-Myc (sc789), mouse anti-Myc 9E10 (sc46), mouse anti-GFP (9996), mouse anti-AMOT130 B-4 (sc-166924), and goat anti-AMOTL2 (82501) were from Santa Cruz Biotechnology (Dallas, TX). Myosin IIa was purchased from Cell Signaling Technology (3403; Beverly, MA). The rabbit anti-AMOT antibody was generated by the Fernandes lab (CHUQ-CHUL Research Center, Université Laval, Quebec City, Canada). Rabbit anti-AMOTL1 was provided by Anthony Schmitt (Pennsylvania State University, State College, PA). AMOT130-S175 phospho-specific antibody was from Hiroshi Sasaki (Kumamoto University, Kumamoto, Japan). siRNA/shRNA transfection Knockdowns in HEK293A cells were performed using 30 nM control siRNA or SMARTpool siRNA (Dharmacon, Lafayette, CO) and 3 μl of RNAiMAX Lipofectamine (Invitrogen). Cells were cultured for 48 h after transfection. The only exceptions were experiments with cells at high densities, for which siRNAs were transfected twice at 40 nM (second transfection after 24 h), and cells were fixed after 72 h of the first transfection. For rescuing experiments, plasmids for protein expression were transfected after 24 h of knockdown with Lipofectamine 2000. Silencing reagents were as follows. Control siRNA (firefly luciferase 5′CGUACGCGGAAUACUUCGA3′, referred to as GL2), AMOT SMARTpool siRNA (targeting both AMOT80 and AMOT130; M-015417), AMOTL1 SMARTpool siRNA (M-017595), AMOTL2 SMARTpool siRNA (M-013232), LATS1 SMARTpool siRNA (M- 004632), and LATS2 SMARTpool siRNA (M-003865). MCF10Acell knockdowns were done using lentiviral infection of shRNA, and cells were collected after 3 d. For the studies with AMOTL2 knockdown alone, MCF10A with integrated constructs for stably knocking down AMOTL2 and control (luciferase) were used (Paramasivam et al., 2011). To generate a triple knockdown, stable AMOTL2 knockdown cells were infected with a combination of AMOT130 and AMOTL1 lentiviral supernatants. At the same time, stable YAP. Cells were scored as in A. Example images are shown. Brackets on top of bars represent statistical significance (Fisher test, *p < 0.0005, **p < 0.005). (C) Lentiviral infection was used to introduce either control shRNA (directed against luciferase) or shRNA against all three angiomotins (AMOT130, AMOTL1, and AMOTL2; triple knockdown) into MCF10A cells. Sixty hours after infection, cells were left untreated, treated with cytochalasin D (CytoD), or starved of serum for an additional 12 h. Cells were then fixed and stained for endogenous YAP. YAP localization was scored as in A. Example images are shown. (D) HEK293A cells were transfected twice with control or a combination of AMOT130, AMOTL1, and AMOTL2 siRNA (see Materials and Methods). Cells were fixed after 72 h and stained for endogenous YAP. YAP localization was scored as predominantly excluded from the nucleus (excluded) or diffuse throughout the cell (diffuse). Example images are shown. In all cases, the bar graphs represent averages from three experiments (n ≥ 100 each), and the error bars indicate the SD of the averages. Nuclei were visualized with DAPI. Bar, 20 μm. C, cytoplasm; Kd, knockdown; N, nucleus. (E) Model of F-actin–regulated angiomotin (AMOT) inhibition of YAP. 2014 ASCB Award Essays, Selected Perspective, and MBoC Paper of the Year Actin regulates angiomotins and YAP | 47 control cells were infected with control viral supernatant as a control. Viral supernatants were generated by the shRNA Core Facility, University of Massachusetts Medical School (Worcester, MA), to target GCCATGAGAAACAAATTGG (AMOTL1) or TGGTGGAATATCTCATCTA (AMOT130). Real-time quantitative PCR After appropriate treatments to cells on 6-well (MCF10A) or 12-well plates (HEK293A), media was aspirated off and cells were lysed with TRIzol (Life Technologies, Grand Island, NY) and processed for total RNA isolation according to the manufacturer’s protocol. cDNA was prepared by oligo-dT (Promega) using SuperScript II Reverse Transcriptase (Invitrogen). Real-time quantitative PCR was performed using KAPA SYBR Fast-Master Mix Universal kit (Kapa Biosystems, Wilmington, MA). Target mRNA levels were measured relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. The following primers were used. GAPDH-F, CTCCTGCACCACCAACTGCT, and GAPDH-R, GGGCCATCCACAGTCTTCTG; CTGFF, AGGAGTGGGTGTGTGACGA, and CTGF-R, CCAGGCAGTTGGCTCTAATC; AMOT-F2, ACTACCACCACCTCCAGTCA, and AMOT-R2, ACAAGGTGACGACTCTCTGC; AMOTL1-F1, GCAGACAGGAAAACTGAGGA, and AMOTL1-R1, AAATGTGGTGGGAACAGAGA; and AMOTL2-F1, GCTACTGGGGTAGCAACTGA, and AMOTL2-R1, GAAGGCAGTGAGGAACTGAA. AMOT, AMOTL1, and AMOTL2 primers were ordered from Real Time Primers (Elkins Park, PA). ACKNOWLEDGMENTS We thank Clark Wells and Bin Zhao for communication of unpublished results; Anthony Schmitt, Maria Fernandes, and Hiroshi Sasaki for antibodies; Elizabeth Luna for technical advice; and Peter Pryciak for comments on the manuscript. This work was supported by National Institutes of Health Grant GM058406-14 to D.M. REFERENCES Adler JJ, Heller BL, Bringman LR, Ranahan WP, Cocklin RR, Goebl MG, Oh M, Lim HS, Ingham RJ, Wells CD (2013a). Amot130 adapts atrophin-1 interacting protein 4 to inhibit Yes-associated protein signaling and cell growth. J Biol Chem 288, 15181–15193. Adler JJ, Johnson DE, Heller BL, Bringman LR, Ranahan WP, Conwell MD, Sun Y, Hudmon A, Wells CD (2013b). Serum deprivation inhibits the transcriptional co-activator YAP and cell growth via phosphorylation of the 130-kDa isoform of angiomotin by the LATS1/2 protein kinases. Proc Natl Acad Sci USA 110, 17368–17373. Aragona M, Panciera T, Manfrin A, Giulitti S, Michielin F, Elvassore N, Dupont S, Piccolo S (2013). A mechanical checkpoint controls multicellular growth through YAP/TAZ regulation by actin-processing factors. Cell 154, 1047–1059. Chan SW, Lim CJ, Chong YF, Pobbati AV, Huang C, Hong W (2011). Hippo pathway-independent restriction of TAZ and YAP by angiomotin. J Biol Chem 286, 7018–7026. Chan SW, Lim CJ, Guo F, Tan I, Leung T, Hong W (2013). Actin-binding and cell proliferation activities of angiomotin family members are regulated by Hippo pathway-mediated phosphorylation. J Biol Chem 288, 37296–37307. 48 | S. Mana-Capelli et al. Dai X et al. (2013). Phosphorylation of angiomotin by Lats1/2 kinases inhibits F-actin binding, cell migration and angiogenesis. J Biol Chem 288, 34041–34051. Dupont S et al. (2011). Role of YAP/TAZ in mechanotransduction. Nature 474, 179–183. Ernkvist M, Birot O, Sinha I, Veitonmaki N, Nystrom S, Aase K, Holmgren L (2008). Differential roles of p80- and p130-angiomotin in the switch between migration and stabilization of endothelial cells. Biochim Biophys Acta 1783, 429–437. Fernandez BG, Gaspar P, Bras-Pereira C, Jezowska B, Rebelo SR, Janody F (2011). Actin-capping protein and the Hippo pathway regulate F-actin and tissue growth in Drosophila. Development 138, 2337–2346. Gagne V, Moreau J, Plourde M, Lapointe M, Lord M, Gagnon E, Fernandes MJ (2009). Human angiomotin-like 1 associates with an angiomotin protein complex through its coiled-coil domain and induces the remodeling of the actin cytoskeleton. Cell Motil Cytoskeleton 66, 754–768. Halder G, Dupont S, Piccolo S (2012). Transduction of mechanical and cytoskeletal cues by YAP and TAZ. Nat Rev Mol Cell Biol 13, 591–600. Heller B, Adu-Gyamfi E, Smith-Kinnaman W, Babbey C, Vora M, Xue Y, Bittman R, Stahelin RV, Wells CD (2010). Amot recognizes a juxtanuclear endocytic recycling compartment via a novel lipid binding domain. J Biol Chem 285, 12308–12320. Hirate Y et al. (2013). Polarity-dependent distribution of angiomotin localizes hippo signaling in preimplantation embryos. Curr Biol 23, 1181–1194. Kim NG, Koh E, Chen X, Gumbiner BM (2011). E-cadherin mediates contact inhibition of proliferation through Hippo signaling-pathway components. Proc Natl Acad Sci USA 108, 11930–11935. Kim M, Lee S, Kuninaka S, Saya H, Lee H, Lim DS (2013). cAMP/PKA signalling reinforces the LATS-YAP pathway to fully suppress YAP in response to actin cytoskeletal changes. EMBO J 32, 1543–1555. Leung CY, Zernicka-Goetz M (2013). Angiomotin prevents pluripotent lineage differentiation in mouse embryos via Hippo pathway-dependent and -independent mechanisms. Nat Commun 4, 2251. Miller E, Yang J, DeRan M, Wu C, Su AI, Bonamy GM, Liu J, Peters EC, Wu X (2012). Identification of serum-derived sphingosine-1-phosphate as a small molecule regulator of YAP. Chem Biol 19, 955–962. Mo JS, Yu FX, Gong R, Brown JH, Guan KL (2012). Regulation of the HippoYAP pathway by protease-activated receptors (PARs). Genes Dev 26, 2138–2143. Paramasivam M, Sarkeshik A, Yates JR3rd, Fernandes MJ, McCollum D (2011). Angiomotin family proteins are novel activators of the LATS2 kinase tumor suppressor. Mol Biol Cell 22, 3725–3733. Sansores-Garcia L, Bossuyt W, Wada K, Yonemura S, Tao C, Sasaki H, Halder G (2011). Modulating F-actin organization induces organ growth by affecting the Hippo pathway. EMBO J 30, 2325–2335. Schneider CA, Rasband WS, Eliceiri KW (2012). NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671–675. Wada K, Itoga K, Okano T, Yonemura S, Sasaki H (2011). Hippo pathway regulation by cell morphology and stress fibers. Development 138, 3907–3914. Wang W, Huang J, Chen J (2011). Angiomotin-like proteins associate with and negatively regulate YAP1. J Biol Chem 286, 4364–4370. Yu FX et al. (2012). Regulation of the Hippo-YAP pathway by G-proteincoupled receptor signaling. Cell 150, 780–791. Yu FX, Guan KL (2013). The Hippo pathway: regulators and regulations. Genes Dev 27, 355–371. Zhao B, Li L, Lu Q, Wang LH, Liu CY, Lei Q, Guan KL (2011). Angiomotin is a novel Hippo pathway component that inhibits YAP oncoprotein. Genes Dev 25, 51–63. Zhao B, Li L, Wang L, Wang CY, Yu J, Guan KL (2012). Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes Dev 26, 54–68. Molecular Biology of the Cell
