Role of c-di-GMP metabolism in the virulence of pathogenic

Transcription

Memoria presentada por
Isabel Mª Aragón Cortés
para optar al grado de Doctora por la Universidad de Málaga
Role of c-di-GMP metabolism in the virulence
of pathogenic Pseudomonas spp.
Director: Dr. Cayo J. Ramos Rodríguez. Catedrático.
Área de Genética
Departamento de Biología Celular, Genética y Fisiología.
Instituto de Hortofruticultura Subtropical y Mediterrénea (IHSM)
Universidad de Málaga-Consejo Superior de Investigaciones Científicas
Málaga, 2014
AUTOR: Isabel M.ª Aragón Cortés
EDITA: Publicaciones y Divulgación Científica. Universidad de Málaga
Esta obra está sujeta a una licencia Creative Commons:
Reconocimiento - No comercial - SinObraDerivada (cc-by-nc-nd):
Http://creativecommons.org/licences/by-nc-nd/3.0/es
Cualquier parte de esta obra se puede reproducir sin autorización
pero con el reconocimiento y atribución de los autores.
No se puede hacer uso comercial de la obra y no se puede alterar, transformar o hacer
obras derivadas.
Esta Tesis Doctoral está depositada en el Repositorio Institucional de la Universidad de
Málaga (RIUMA): riuma.uma.es
COMITÉ EVALUADOR
Presidente
Dr. Antonio de Vicente Moreno
Departamento de Microbiología
Universidad de Málaga
Secretario
Dr. Fernando Govantes Romero
Departamento de Biología Molecular en Ingeniería Bioquímica
Universidad Pablo de Olavide, Sevilla
Vocales
Dra. María Isabel Ramos González
Departamento de Protección Ambiental
Estación Experimental del Zaidín (CSIC), Granada
Dr. Stefania Tegli
Dipartimento di Scienze produzioni Agroalimentari e dell'Ambiente
Universidad de Florencia, Italia
Dr. María Sánchez Contreras
Institute of Plant Biology
Universidad de Zurich, Suiza
Suplentes
Dr. Rafael Rivilla Palma
Departamento de Biología
Universidad Autónoma de Madrid
Dr. Francisco Cazorla López
Departamento de Microbiología
Universidad de Málaga
Área de Genética.
Instituto de Hortofruticultura Subtropical y Mediterrénea (IHSM).
Universidad de Málaga-Consejo Superior de Investigaciones Científicas.
Dr. CAYO J. RAMOS RODRÍGUEZ, Catedrático del Área de Genética del
INFORMA:
que, ISABEL MARÍA ARAGÓN CORTÉS ha realizado en este Departamento y
bajo mi dirección el trabajo titulado “Role of c-di-GMP metabolism in the virulence of
pathogenic Pseudomonas spp.”, que constituye su memoria de Tesis Doctoral para
aspirar al grado de Doctora Internacional en Biología. Y para que así conste, y
tenga los efectos que correspondan, en cumplimiento de la legislación vigente,
extiendo el presente informe.
En Málaga, a 2 de Junio de 2014.
Fdo. Cayo J. Ramos Rodríguez
AGRADECIMIENTOS
Y llegó el momento de recabar un poco en mi memoria y reflexionar sobre esta etapa de mi vida que
ya termina, una etapa que comenzó a finales del año 2007 cuando empecé como alumna interna en el
Departamento de Genética. Desde ese momento hasta llegar al día de hoy, han sido muchas, muchas
las horas que he pasado aquí, lugar que durante todo este tiempo se ha convirtido en mi segunda casa.
Todos estos años me han servido sin duda alguna para madurar como científica y como persona. He
aprendido que la carrera investigadora es dura y sacrificada, y son muchos las veces en las que sentada
delante de tu sitio del laboratorio te inunda el desánimo. Pero a la vez, es una aventura apasionante,
cargada de emociones fuertes, y de momentos muy gratificantes que hacen que te olvides de todo lo
pasado hasta llegar ahí, y que te animan a seguir hacia adelante con más fuerza. Sin embargo, si por
algo hoy estoy aquí, es gracias a mucha gente que ha estado a mi lado desde el principio de esta
aventura, que me han apoyado, que me han ayudado y que me dado todo su cariño. Por ello creo que
todas esas personas se merecen unos sencillos párrafos de agradecimiento y sin duda unas GRACIAS
en mayúsculas.
En primer lugar quiero agradecerle a mi director de Tesis, Cayo Ramos. Gracias por apoyarme y
confiar en mí como científica, especialmente en mis momentos difíciles. Gracias por llevar esta tesis por
el camino correcto y por saber sacar adelante una gran historia. Gracias por el tiempo que has
invertido, por tu esfuerzo, por tu paciencia, y por la sensatez y pragmatismo que has mostrado en las
diferentes etapas por las que ha pasado mi carrera investigadora. Gracias por darme los mejores
consejos siempre que los he necesitado y por estar ahí en todo momento.
A mis compañeros del Cayo´s Lab, con los que tantas horas he compartido y con los que tantos
buenos momentos he pasado. Emperezaré por los que ya se fueron. A Luis, con el que menos tiempo
compartí, gracias por tus sabios consejos en mis inicios. A Isaxi, por ser mi primera maestra en el lab,
gracias por tu paciencia conmigo y por toda la ayuda que me brindaste cuando lo necesité. A Mely, por
llamarme pequeña saltamontes con tanto cariño, y por todos los buenos recuerdos que tengo del tiempo
que trabajamos juntas. A Clara, por los muy buenos ratos de charlas que compartimos en el
laboratorio, y por los que seguimos compartiendo. A los que aún tengo cerca. A Isa P, por volver y
aportarnos a todos tantas cosas buenas en este año, gracias por ser como eres. A Eloy, por los ratos de
“riñas” que hemos pasado, por alegrarme muchas veces el día con una “bonita” sevillana, y por estar
siempre dispuesto a echar una mano. A Nacho, que aunque hace algún tiempo ya no está en el Cayo´s
lab yo lo sigo considerando uno de los nuestros, gracias Nacho por los divertidos momentos que
compartimos (aún recuerdo nuestras clases sobre colores… ) y por estar siempre ahí desde el
principio. A Alba, Kim y Adrian, por toda la ilusión y energía nueva e que traéis al lab. A Chiara, por
tu alegría. Y por último dejo a mi Pi, la propulsora de que todo el lab me llamase “la Aragón” ,
gracias por acompañarme en estos años, por estar siempre dispuesta a escucharme, por levantarme
muchas veces y decirme… venga adelante que tú puedes, por todos los ratos dentro y fuera del lab.
Gracias sin duda por tu amistad. A todos deciros, que siempre os recordaré aunque el tiempo y la
distancia física nos separé.
A los que formais o habeis formado parte del Carmen´s Lab, Inma O., Juanjo, Blanca, Bego, Alberto
… ha sido una suerte teneros a todos tan cerca. A Ainhoichi, mi mañica favorita, por ser un torrente
de alegría y optimismo, se te echa mucho de menos. A Jose y a mi Adeli, por todos los consejos que me
habeís dado tanto en lo científico como en lo personal, gracias por ser buenos amigos. A Diego, porque
en el tiempo hemos compartido me has demostrado que eres una gran persona. A Spy, ευχαριστώ για
τη χαρά σας.
Al único superviviente del lab del fondo, gracias Luis por los buenos ratos de risas que hemos pasado
juntos durante las comidas. Al resto de compañeros del departamento de Genética, a los que siguen por
aquí y a los que se han marchado, Nati, Manolo, Tabata, Edgar, Ana Luna,… aunque os he tenido un
poco más lejos, gracias por vuestra continua disposición a echar una mano. A todos los técnicos que
han pasado por el laboratorio, Mayte, Silvia y Pablo, gracias por hacer más fácil el trabajo diario.
A los profesores del área de Génetica, Eduardo, Carmen, Javi, Araceli, Enrique, Ana, Julia, Mª
Carmen y Guillermo. Por todo lo que he podido aprender de vosotros como profesores y científicos, por
ofrecer siempre vuestra ayuda, y por el entusiasmo que le ponéis a lo que hacéis.
A todos los que forman el gran grupo de Microbiología: Antonio de Vicente, Francis, Alejandro,
Juan Antonio Torel, Diego Romero, Guti, Victor, David, Claudia, Nuria, Laura, Houda, Eva, María,
Davinia, Jesús, Joaquín, Conchita, Carmen, Álvaro, Irene, Codina, (espero no olvidarme de
ninguno)… gracias por los ratos compartidos cada jueves en los seminarios de grupo y en los muchos
congresos, por estar ahí siempre aportando y discutiendo ideas, y por acogernos a “los genéticos”
dentro de vuestro grupo.
A toda la gente de la Estación Experimental del Zaidín con la que compartí más de siete meses de
esta Tesis. A Mari Trini Gallegos, por abrirme siempre las puertas de su laboratorio y hacerme sentir
una más, por estar siempre dispuesta a discutir un proyecto o dar un consejo. A Dani, por mostrarme
lo maravilloso que podía ser el mundo del c-di-GMP, gracias por implicarte desde un principio en este
proyecto. A todos los demás que formáis parte del grupo de interacción planta-bacteria: Juan Sanjuán,
María José Soto, María José Lorite, Quina, Soco, David, Toñi, Harold, Lorena, Lidia, Carol,
Nieves,…gracias por hacerme sentir tan bien entre vosotros, por las tapas/bocatas de los viernes, y por
hacer que recuerde esa etapa de la Tesis con tanto cariño. Pero sin duda no me puedo olvidar de mis
amigas Vivian y Pao, gracias a las dos por estar a mi lado en momentos muy importantes y por saber
que os tengo ahí para lo que necesite.
Many thanks to the people that I have met in my short-term stay in London. Thanks to Alain
Filloux for giving me the opportunity to work within his group; for his enthusiasm, and for always
treating me as a member of his group. I would like also to thank the people from Filloux´s Lab: Abdou,
Sara, Luke, Daniela, Eleni, Kaylin, Cerith…for the good moments in the lab, in the office and out of
the lab, for making my London experience so enjoyable and fruitful. Thanks also to Joana Moscoso, for
being always willing to help and discuss about my experiments or projects.
A Araceli Barceló y Eli Imbroda, gracias por la ayuda prestada con el mantenimiento de las plantas
olivo. A Jose Manuel Pulido, por su gran labor en el cuidado de los invernaderos de “La Mayora”.
A mis amigos de fuera del laboratorio, por hacer que este camino fuese mucho más fácil. A mis
abarteñ@s, Cristina, Eladio, Juani, Mari Paz, Miguel, Loli, Kiko, Fernan,…por todos los momentos
compartidos durante este tiempo (viajes, ferias, fiestas, más fiestas ,...), y por todos los que espero que
sigamos compartiendo. A mis amigas de toda la vida, Maribel, Raquel, Carolina, Tere,…por tener
siempre un ratito para vernos a pesar de nuestras ocupadas vidas. A Raquel quiero agradecerle
especialmente su compañía durante mi estancia en Londres, los días de shopping en Oxford Street, y
toda su ayuda con mis seminarios en inglés. A Mª José dl, por tu amistad, y por los buenos recuerdos
que tengo de nuestros últimos viajes.
A mi familia, la mejor familia del mundo. No puedo nombraros a todos porque necesitaría un par de
folios para hacerlo (qué suerte tengo!!), gracias por preguntarme siempre como va esa Tesis, por
escucharme con paciencia cuando intento explicarles que estoy investigando, por alegrarse con cada
uno de mis éxitos, y sin duda alguna, gracias por quererme tanto. A los padres de Miguel y a mis
cuñados, por su cariño y apoyo. A mi cuñado Rafa, por su generosidad. A Mª Ángeles, por ser mi
hermana y mi amiga, por tu paciencia conmigo (incluso cuándo te rompia tus camisetas nuevas con
reactivo de Salkowski), y por estar a mi lado siempre.
A mis padres, Salvador e Isabel. Por la educación que me han dado desde pequeña, y por sus
continuos esfuerzos y sacrificios para que haya podido llegar hasta donde estoy. Por enseñarme que con
constancia y trabajo todo puede conseguirse. Por su amor incondicional, y por ser mis mayores
ejemplos en la vida. A mi padre le quiero agradecer especialmente que despertase un día en mí el
gusanillo por la ciencia y que fuese mi principal empuje para empezar una carrera científica. A mi
madre, darle las gracias por su ayuda infinita sin esperar nunca nada a cambio. Papá y Mamá, os
quiero con todo mi corazón.
Y por último dejo a Miguel, que sin duda ha sido la persona que más de cerca ha vivido esta Tesis.
Gracias por ser mí mayor apoyo en esta vida. Por estar ahí para mimarme después de un día difícil. Por
confiar en mí y animarme siempre a seguir hacia adelante. Por su compresión. Por llenar mi vida de
ilusión. Por todos los momentos que hemos vivido juntos, y por los muchos que nos quedan por vivir.
Porque como dice nuestra canción… siento que tu compañía es el mejor regalo que me dio la vida, la
fuerza que me empuja a seguir adelante, de todo lo que tengo, es lo más importante. Gracias por otras
muchas cosas. Te quiero.
Este trabajo ha sido financiado por los proyectos AGL2008-05311 y AGL2011-30343CO2-01 del Plan Nacional I+D del Ministerio de Economía y Competitividad
(cofinanciado por FEDER) y por la Beca para la Formación del Profesorado Universitario
(FPU) (2009-2013).
INDEX
INDEX
PREFACIO
ABBREVIATIONS
SUMMARY
RESUMEN
GENERAL INTRODUCTION
Bacterial cyclic di-GMP(c-di-GMP): The discovery
Biochemistry of cyclic di-GMP synthesis, degradation and binding
Types c-di-GMP receptors
Celullar fuctions regulated trougth the c-di-GMP
Role of c-di-GMP in the virulence of Pseudomonas spp
21
25
29
43
57
59
60
63
64
71
79
OBJECTIVES
83
GENERAL MATERIAL AND METHODS
CHAPTER I Bioinformatic prediction of GGDEF and EAL proteins in the
genome of Pseudomonas savastanoi pv. savastanoi NCPPB 3335 and
91
responses to elevated c-di-GMP levels in this phytopathogenic bacteria.
Introduction
Material and Methods
Results
Discussion
93
95
99
108
CHAPTER II The c-di-GMP phosphodiesterase BifA is involved in the
virulence of the Psedomonas syringae complex
Introduction
Results
Discussion
111
113
115
121
131
CHAPTER III The diguanylate cyclase DgcP is involved in plant and human
Pseudomonas spp. infections
Introduction
Results
Discussion
CONCLUDING REMARKS
CONCLUSIONS
CONCLUSIONES
REFERENCES
ANNEX 1
135
137
140
148
161
165
171
175
179
193
19
INDEX
20
PREFACIO
PREFACIO
Esta Tesis Doctoral se dirigió inicialmente a la identificación y caracterización de
factores de virulencia en Pseudomonas savastanoi pv. savastanoi NCPPB 3335. Los
trabajos iniciales de la misma, derivados de resultados obtenidos previamente por
nuestro grupo de investigación, se centraron en el estudio de genes relacionados con la
producción de la fitohormona ácido indol-3-acético (Aragón et al., 2014) y en la
identificación de nuevos efectores del sistema de secreción tipo III (Matas et al., 2014).
Los resultados obtenidos en este sentido, no se han incluido en el cuerpo de esta Tesis
Doctoral, si bien, las publicaciones científicas derivadas de los mismos, junto con mi
contribución en una revisión sobre P. savastanoi pv. savastanoi (Ramos et al., 2012) se
han incluido en el anexo 1 (ANNEX 1: Other publications).
Tras la identificación mediante Signature Tagged Mutagenesis de nuevos factores
relevantes en la interacción P. savastanoi pv. savastanoi-olivo, dentro de los cuales se
encontraron dos proteínas posiblemente relacionadas con el metabolismo del c-di-GMP,
esta Tesis se centró en el estudio del papel de este segundo mensajero en la virulencia
de P. savastanoi pv. savastanoi y otras Pseudomonas patógenas. Los resultados
obtenidos en este sentido se presentan en los tres capítulos incluidos en este
documento. Asimismo, esta Tesis Doctoral incluye un apartado general del material y
métodos usados en los diferentes capítulos, si bien, cada capítulo incluye
adicionalmente su material y métodos especifico. Este trabajo se realizó principalmente
en la Universidad de Málaga, aunque durante su ejecución, llevé a cabo tres estancias
de aproximadamente tres meses cada una en otros centros de investigación, dos en el
grupo de la Dra. María Trinidad Gallegos Fernández (Estación Experimental del Zaidín,
CSIC, Granada) y otra en el grupo del Dr. Alain Filloux (Imperial College, Londres).
Recientemente, y en colaboración con el grupo de la Dra. Gallegos y el Dr. Juan
Sanjuan, este último también del CSIC (Granada), se ha publicado un artículo en la
revista PloS One, titulado Responses to Elevated c-di-GMP Levels in Mutualistic and
Pathogenic Plant-Interacting Bacteria (Pérez-Mendoza et al., 2014). De este artículo,
también incluido en el Anexo I (ANNEX 1: Other publications), se han extraído los
resultados relacionados con la expresión de la diguanilato ciclasa PleD* en P.
savastanoi pv. savastanoi
NCPPB 3335, que junto con el resultado del análisis
bioinformático de proteínas con dominios GGDEF se presentan en el capítulo 1
(Chapter I). Los resultados mostrados en los otros capítulos II y III (Chapters II and III),
se están preparando actualmente para su publicación.
23
PREFACIO
24
ABBREVIATIONS
ABBREVIATIONS
IAA Indole-3-acetic acid
ANOVA Analysis of variance
Ap Ampicillin
ASAP A systematic annotation package
BLAST Basic local alignment search tool
c-di-GMP Cyclic di-GMP or bis-(3'-5')-cyclic dimeric guanosine monophosphate
cDNA Complementary DNA
CF Calcofluor
CFU Colony-forming units
CI Competitive index
CKs Cytokinins
Cm Cloramphenicol
CR Congo red
CV Cystral violet
DGC Diguanylate cyclase
DMSO Dimethyl sulfoxide
dpi Days post-inoculation
EPS Exopolysaccharide
ESI-MS Electrospray ionization- mass spectrometry
dNTPs Desoxinucleotide triphosphate
DNA Deoxyribonucleic acid
Gm Gentamycin
GFP Green fluorescent protein
h hours
HPLC-MS Liquid chromatography–mass spectrometry
Km Kanamycin
Kb Kilobase
KDa Kilodaltons
KB King B medium
LB Luria-Bertani medium
m/z Mass-to-charge ratio
MEGA5 Molecular evolutionary genetics analysis
mM Millimolar
MM Minimal medium
ml Milliliters
mins Minutes
MW Molecular weight
NCBI National center for biotechnology information
NCPPB National collection of plant pathogenic bacteria
Nf Nitrofurantoin
nM Nanomolar
ºC Grades centigrades
OD Optical density
ORF Open reading frame
P. Pseudomonas
PCR Polymerase Chain Reaction
PDE Phosphodiesterase
pv. Pathovar
qRT-PCR Real time PCR
RACE Rapid amplification of cDNA ends
RNA Ribonucleic acid
rpm Revolutions per minute
RT-PCR Reverse transcription polymerase chain reaction
sec Seconds
SOB Super Optimal Broth medium
Sp Streptomycin
STM Signature tagged mutagenesis
T3SS Type III Secretion System
T6SS Type VI Secretion System
27
ABBREVIATIONS
TBE Tris-Borate EDTA
Tc Tetracycline
28
SUMMARY
SUMMARY
Cyclic di-GMP is a second bacterial messenger, which was originally identified in 1987
by Moshe Benziman and colleagues as an allosteric factor required for activation of
cellulose biosynthesis in Gluconacetobacter xylinus (Ross et al., 1987). In later works
related to the discovery of c-di-GMP, the genes encoding enzymes responsible for its
synthesis and breakdown were identified and sequenced. Cyclic di-GMP is synthesized
from two molecules of GTP by the action of diguanylate cyclases (DGC), and hydrolyzed
by specific c-di-GMP phosphodiesterases (PDE). GGDEF protein domains function in cdi-GMP synthesis, whereas the c-di-GMP PDE activity is associated with EAL or HDGYP domains (Galperin et al., 2001; Paul et al., 2004; Christen et al., 2005; Ryan et al.,
2006b). The GGDEF domain can present a four-residue motif constituting the I-site,
RxxD, which has been positioned five amino acids upstream of the GG[D/E]EF motif (Asite) (Chan et al., 2004; Christen et al., 2006). Therefore, according to the amino acids
conservation in the A- and I-sites, DGCs can be classified in four different groups: I+A-, IA+, I-A- and I+A+ (Jenal and Malone, 2006). Only proteins with a conserved A+ GGDEF
motif present DGC activity. Also, early genomic analyses showed that GGDEF and EAL
domains are often found on the same polypeptide chain (Tal et al., 1998). In this case,
both domains could be enzymatically active but they are differentially regulated by
environmental and/or intracellular signals (Tarutina et al., 2006; Ferreira et al., 2008), or
the most common situation is that one of the two domains is non-catalytic or inactive
(Christen et al., 2005). Furthermore, normally the bacterial genomes encode multiple cdi-GMP metabolizing proteins containing one or more of these domains, implying that cdi-GMP signaling are likely complex (Boyd and O'Toole, 2012; Romling et al., 2013).
While these enzymes are readily identifiable due to the characteristic GGDEF, EAL, and
HD-GYP domains, identifying proteins that function as c-di-GMP receptors/effectors
based on sequence information proved to be more difficult. Despite its difficulties, several
types of c-di-GMP receptors have been discovered, and the molecular details of c-diGMP action are beginning to emerge. The first identified and better characterized c-diGMP receptor is the PilZ receptor, which appear associated with the cellulose synthase
(Ross et al., 1985; Ross et al., 1987; Weinhouse et al., 1997), downstream of some EAL
or GGDEF-EAL proteins (Alm et al., 1996), and in several flagellum-related proteins (Ko
and Park, 2000; Ryjenkov et al., 2006; Christen et al., 2007; Pratt et al., 2007). Other
non-PilZ domain c-di-GMP receptors are the I-site receptors described for the
Pseudomonas aeruginosa PelD protein (Lee et al., 2007), and the inactive EAL and HDGYP domains receptors (Minasov et al., 2009; Newell et al., 2009). Additionally, there
are also other unpredictable or non-protein c-di-GMP receptors, which have been
31
SUMMARY
described as transcriptional regulator (e.g. FleQ from P. aeruginosa) (Hickman and
Harwood, 2008) and the riboswitches (Barrick and Breaker, 2007; Sudarsan et al., 2008).
C-di-GMP has been implicated in the regulation of several bacterial behaviors,
including bacterial motility, biofilm formation, and biosynthesis and secretion of adhesins
and exopolysaccharides (Jenal and Malone, 2006; Hengge, 2009; Romling, 2012). This
second messenger has a key role of in the transition between motile and sessile
lifestyles. Low concentrations of c-di-GMP are associated with cells that move by
flagellar motors or retracting pili, while elevated levels of this second messenger promote
transition of bacteria from single motile cells to surface-attached multicellular
communities or biofilms (Jenal and Malone, 2006; Fang and Gomelsky, 2010). The role
of c-di-GMP in bacterial motility was first described for Gram-negative bacteria as G.
xylinus, Salmonella enterica, Escherichia coli, and P. aeruginosa (Simm et al., 2004),
and the molecular mechanisms of this regulation began to emerge several years ago
(Pesavento et al., 2008; Hengge, 2009; Fang and Gomelsky, 2010; Petrova and Sauer,
2012). Currently known mechanisms linking c-di-GMP to motility control involve
regulation of flagellar genes by transcriptional factors as FleQ (Hickman and Harwood,
2008) and VpsT (Krasteva et al., 2010). Additionally, numerous studies have also
connected the c-di-GMP signaling pathways with biofilm formation (Kulasakara et al.,
2006; Ude et al., 2006; Merritt et al., 2007; Matilla et al., 2011; Moscoso et al., 2011;
Boyd and O'Toole, 2012). In contrast to the bacterial motility, high c-di-GMP
concentration promotes the expression of adhesive matrix components and result in
multicellular behavior and biofilm formation. All extracellular matrix components known to
contribute to biofilm formation, including diverse exopolysaccharides, adhesive pili, and
nonfimbrial adhesins, as well as extracellular DNA, can be regulated by c-di-GMP
(Romling, 2012). Emerging data indicate that many of these biofilm matrix components
are regulated by specific c-di-GMP signaling networks, which act at different levels and
can partially overlap (Lee et al., 2007; Merritt et al., 2007; Monds et al., 2007; Mikkelsen
et al., 2011a). In this sense, the expression and/or biosynthesis of exopolysaccharides
such as Pel and Pls from P. aeruginosa (Merritt et al., 2007; Malone et al., 2010) and
other more common, as alginate (Lee et al., 2007; Mikkelsen et al., 2011a) and cellulose
(Ross et al., 1990; Saxena and Brown, 1995; Le Quere and Ghigo, 2009), are directly
controlled by c-di-GMP pathways.
Although the first c-di-GMP dependent processes identified were the biofilm formation
and motility, the c-di-GMP signaling has been also related to the regulation of virulence
phenotypes in bacterial pathogens of humans, animals and plants (Kulasakara et al.,
32
SUMMARY
2006; Ryan et al., 2007; Tamayo et al., 2007; Bobrov et al., 2011; Matas et al., 2012).
Virulence phenotypes affected by c-di-GMP signaling, which are usually related to the
interaction of bacterial cells with host cells, include adherence, invasion, cytotoxicity,
intracellular infection, secretion of virulence factors and stimulation of the immune
response (Tischler and Camilli, 2005; Dow et al., 2006; Kulasakara et al., 2006; Lee et
al., 2010b; Huang et al., 2013). The role of c-di-GMP in pathogenesis has been
extensively studied in animal and human bacterial pathogens, including S. enterica
(Hisert et al., 2005), Vibrio cholerae (Tischler and Camilli, 2005), P. aeruginosa
(Kulasakara et al., 2006) and more recently in a number of other bacterial, including
Legionella pneumophila, Brucella melitensis, pathogenic E. coli, and Burkholderia
pseudomallei (Tamayo et al., 2007; Lee et al., 2010b; Levi et al., 2011; Petersen et al.,
2011; Romling et al., 2013). Despite recent advances in understanding the role of c-diGMP signaling in the pathogenicity and virulence of human and animal pathogens, only
few c-di-GMP metabolizing proteins were experimentally demonstrated as c-di-GMP
signaling components in plant pathogenic bacteria. RpfG and XcCLP of Xanthomonas
campestris, a HD-GYP domain containing protein and a c-di-GMP receptor, respectively,
connect cell-cell signaling to virulence gene expression (Ryan et al., 2007; Chin et al.,
2010). In Dickeya dadantii, c-di-GMP phosphodiesterases EcpB and EcpC were shown
to regulate multiple cellular behaviors and virulence, by controlling the expression of the
type III secretion system (T3SS); (Yi et al., 2010). In Erwinia amylovora, overexpression
of DGC proteins, increased tissue necrosis in an immature-pear infection assay and an
apple shoot infection model (Edmunds et al., 2013), suggesting also that c-di-GMP
negatively regulates virulence. However, a deletion mutant in a DGC protein, CgsA, was
associated with a reduction of the virulence in Xylella fastidiosa (Chatterjee et al., 2010).
Crucial roles of c-di-GMP has been also reported in the regulation of adhesins secretion,
required for binding to the host plants in Pectobacterium atrosepticum SCRI1043 (PérezMendoza et al., 2011a; Pérez-Mendoza et al., 2011b) and in plant-interacting bacteria
belonging to the Pseudomonadaceae family (Fuqua, 2010). Nowadays, there is
abundant evidence that c-di-GMP had an important role in bacteria virulence by affecting
a variety of pathways, in some cases controlling the expression of virulence genes. Thus
regulation of c-di-GMP and control of pathogenicity involve a complex interaction of
DGC, PDE, and the regulatory targets of c-di-GMP (Romling et al., 2013). In this PhD
Thesis we have studied the role of c-di-GMP signaling in the virulence of different
pathogenic Pseudomonas spp.
33
SUMMARY
The genus Pseudomonas is an extremely heterogeneous bacterial group, which
includes Gram-negative motile aerobic rods that are widespread throughout nature and
characterized by elevated metabolic versatility (Franzetti and Scarpellini, 2007).
Pseudomonas bacteria can be found in many different environments such as soil, water,
plant and animal tissue (Palleroni, 1981). Moreover, non-pathogenic species, as
Pseudomonas putida, as well as pathogenic bacteria of humans, animals, or plants can
be found within the Pseudomonas genus. In this PhD Thesis we have mainly focused in
two phytopathogenic bacteria belonging to the Pseudomonas syringae complex
(Mansfield et al., 2012) and in the relevant animal and opportunistic human pathogen P.
aeruginosa (Lyczak et al., 2000). P. aeruginosa, a pathogen that normally inhabits the
soil and aqueous environments (Lyczak et al., 2000), is one of the most common
pathogens causing respiratory infections in hospitalized patients with compromised host
defenses such as in neutropenia, severe burns, or cystic fibrosis (Veesenmeyer et al.,
2009). A large number of virulence determinants are being actively described for P.
aeruginosa. The best described virulence factors in this bacterium are the T3SS and its
effectors, the quorum sensing regulation, the formation of biofilms, and the flagella
(Veesenmeyer et al., 2009). Moreover, a genetic screen of DGCs and PDEs proteins
revealed a role of c-di-GMP in the virulence of P. aeruginosa PA14. In this sense,
mutations in two PDE proteins (PvrR and RocR), or proteins containing GGDEF (SadC)
or GGDEF/EAL domains (PA5017 and PA3311) resulted in virulence attenuation in a
murine thermal injury model (Kulasakara et al., 2006). More recently, Moscoso and
colleagues (2011) described that in P. aeruginosa PAK the T3SS is negatively affected
by c-di-GMP, whiles c-di-GMP signaling had a stimulating effect on the biosynthesis of
the type VI secretion system (T6SS) effectors (Moscoso et al., 2011). These authors,
also showed that control of the expression of the T3SS and T6SS by c-di-GMP is
associated with the RetS/LadS/GacS signaling cascade, which control the transition from
acute to chronic infection in this pathogen. Although several studies have evidenced a
role of c-di-GMP in the virulence of pathogenic bacteria like P. aeruginosa, few data are
currently available in relation to bacteria belonging to P. syringae complex. This bacterial
complex has been recently considered by bacterial pathologists as the most scientifically
and economically relevant plant bacterial pathogen, due to its virulence, ubiquity and its
ability to cause disease in a wide range of the most important commercial crops
(Mansfield et al., 2012). P. syringae encloses a heterogeneous group of bacteria that
infect herbaceous and woody, cultivated and wild plants. It is responsible of foliar
necrosis, blights, stripes, cankers, galls, and tumors, appearing mostly in the aerial part
of the plant (Fatmi et al., 2008). The complex is subgrouped into more than 60 pathovars
34
SUMMARY
according to the host specificity and isolation origin (Young, 2010). In this study, we have
mainly concentrated in two different pathovars of the P. syringae complex, the pathogen
of herbaceous plants Pseudomonas syringae pv. tomato, and the pathogen of woody
hosts Pseudomonas savastanoi pv. savastanoi.
P. syringae pv. tomato is the causal agent of bacterial speck of tomato, which
pathogenecity has been mainly associated with the T3SS (Collmer et al., 2000; LopezSolanilla et al., 2004; Cunnac et al., 2011b). Furthermore, other virulence-related genes
described for P. syringae pv. tomato are toxins (i.e coronatine), transcriptional regulators,
the quorum sensing system, extracellular proteins and polysaccharides, motility-related
genes and multidrug resistance transporters (Mittal and Davis, 1995; Boch et al., 2002;
Brooks et al., 2004; Preiter et al., 2005; Chatterjee et al., 2007; Zeng and He, 2010;
Vargas et al., 2011). On the other hand, P. savastanoi pv. savastanoi is a model
bacterium for the study of the molecular basis of woody plant diseases. Infection of olive
(Olea europaea) by P. savastanoi pv. savastanoi results in overgrowth formation (tumors,
galls or knots) on the stems and branches of the host plant and, occasionally, on leaves
and fruits. The better characterized virulence factors in tumor-inducing isolates of P.
savastanoi are the phytohormones indole-3-acetic acid (IAA) and cytokinins (CKs)
(Surico et al., 1985; Powell and Morris, 1986; Glass and Kosuge, 1988; RodríguezMoreno et al., 2008; Aragón et al., 2014), as well as a functional T3SS (Sisto et al., 2004;
Pérez-Martinez et al., 2010; Tegli et al., 2011). Moreover, virulence of this bacterium has
also been associated with the production of exopolysaccharides, the formation of
biofilms, the adhesion to surfaces, and the quorum sensing regulation (Laue et al., 2006;
Hosni et al., 2011). Recently, Matas and co-workers, used Signature Tagged
Mutagenesis (STM) to reconstruct the metabolic network required for full fitness of P.
savastanoi pv. savastanoi NCPPB 3335 in olive plants. This study revealed novel
mechanisms involved in the virulence of this pathogen, such as the type II and type IV
secretion systems, a battery of genes involved in tolerance and detoxification of reactive
oxygen species (ROS) and a set of genes required for the biosynthesis of the cell wall.
Other features identified in this study include a chemotaxis-related protein, several DNAbinding proteins and seven hypothetical proteins. Interestingly, and related to this PhD
Thesis, two mutants containing the transposon in genes related to the metabolism of cdi-GMP were also selected in this study. Transposon mutant FAM-30 contained the miniTn5 insertion within the PSA3335_4049 gene, which encodes a putative PDE protein
highly identical to BifA of P. aeruginosa PA14 (Kuchma et al., 2007) and Pseudomonas
putida KT2444 (Jiménez-Fernández et al., 2014). On the other hand, mutant FAM-108
35
SUMMARY
showed an insertion in PSA3335_0619, a gene encoding an endonuclease /exonuclease
/phosphatase family protein (EEPP) located upstream of PSA3335_0620, a GGDEF
domain protein-encoding gene (Matas et al., 2012). The characterization of these two
genes related to the metabolism of c-di-GMP (PSA3335_4049 and PSA3335_0620),
including the analysis of their role in the virulence of P. savastanoi pv. savastanoi was
the initial aim of this PhD Thesis. Taking into account the high conservation of these two
genes within the Pseudomonas genus, the overall aim of this Thesis was to analyze their
role in the virulence of P. savastanoi pv. savastanoi and related plant pathogens, as well
as in the opportunistic human pathogen P. aeruginosa. The following specific objectives
have been undertaken: 1) To evaluate the responses to elevated c-di-GMP levels in P.
savastanoi pv. savastanoi NCPPB 3335 by the overexpression of the diguanylate
cyclase PleD* from Caulobacter crescentus; 2) to analyze the role of the bifA gene on
virulence-related phenotypes in two different strains of the P. syringae complex, P.
savastanoi pv. savastanoi NCPPB 3335 and P. syringae pv. tomato DC3000; and 3) to
study the role of the putative diguanylate cyclase encoded by the P. savastanoi pv.
savastanoi PAS3335_0620 gene on virulence-related phenotypes in this bacterial
pythopathogen, as well as in the opportunistic human pathogen P. aeruginosa. The
results obtained in relation to these objectives are described below.
In Chapter I, and in relation to the first objective of this study, we performed an in silico
prediction of GGDEF and GGDEF/EAL-containing proteins encoded in the genome of P.
savastanoi pv. savastanoi NCPPB 3335, and evaluate the responses to the
overexpression of the diguanylate cyclase PleD* from C. crescentus in this bacterium.
Bioinformatics analysis of the P. savastanoi pv. savastanoi NCPPB 3335 (RodríguezPalenzuela et al., 2010) revealed the existence of 34 proteins showing a GGDEF domain
in this bacterium, of which 14 also encode an EAL domain (Table 1). These results
suggested that DGC and PDE activities are closely linked in P. savastanoi pv. savastanoi
NCPPB 3335. A detail analysis of these GGDEF proteins allowed us to classified them in
several A- and I-sites profiles: I+A+ (17 proteins), I-A+ (9 proteins), I+A- (3 proteins) and I-A(5 proteins) (Table 2). Moreover, BLAST searches of these P. savastanoi pv. savastanoi
NCPPB 3335 GGDEF-containing domain proteins against the genomes of several
Pseudomonas spp. strains revealed a high level of conservation of all these proteins
among P. syringae strains. In fact, P. syringae pv. syringae B728A shared all 34 proteins
with NCPPB 3335, while other P. syringae strains shared from 88.23% to 94.1% of them.
A lower level of conservation was observed in the genomes of non-pathogenic
Pseudomonas, such as P. putida KT2440 (47%) and Pseudomonas protegens Pf-5
36
SUMMARY
(53%). This high conservation of GGDEF or GGDEF/EAL proteins among P. syringae
and P. savastanoi strains isolated from different hosts, suggests a possible role of these
proteins in the colonization, infection and/or interaction with their respective plant hosts.
On the other hand, to increase the intracellular levels of c-di-GMP in P. savastanoi pv.
savastanoi, we used the protein PleD*, a constitutively active DGC variant of the wellcharacterized DGC PleD from C. crescentus (Aldridge et al., 2003). The pleD* gene was
cloned under the control of the Plac promoter in a plasmid vector, pJB3 (Blatny et al.,
1997), which can replicate in Pseudomonas strains. The resulting construction pJB3pleD* (Pérez-Mendoza et al., 2014) was introduced in P. savastanoi pv. savastanoi
NCPPB 3335, and the intracellular c-di-GMP contents were quantified by a mass
spectrometry analysis (HPLC-MS). Overexpression of pleD* generated a strong
increases in the levels of c-di-GMP (approximately 200 fold-changed) compared to the
control strain containing the empty vector pJB3. Moreover, the PleD* transformant were
here associated with a modification of several free-living phenotypes such as a complete
turned off of the swimming motility, an increased congo red (CR) and calcofluor (CF)
binding phenotypes and the formation of biofilms. Previous studies have also reported a
modification of these phenotypes in other bacteria synthesizing high levels of c-di-GMP
(Simm et al., 2004; Ryjenkov et al., 2006; Ude et al., 2006). However, and more
remarkably, we report here that high levels of c-di-GMP in P. savastanoi pv. savastanoi
NCPPB 3335 have a clear effect on the interaction of this pathogen with olive plants.
Despite the low stability of plasmid pJB3-pleD* in olive plants, the results obtained
showed that expression of pleD* drastically increased knot size both on in vitro
micropropagated and 1-year-old olive plants. Conversely, transverse sections of knots
induced by the pleD* transformant on 1-year-old olive plants showed a reduced necrosis
of the internal tissues as compared with those developed in plants inoculated with the
control strain, suggesting a delay in the maturation process of the knots induced by the
pleD* transformant. These results suggested the existence of a possible interplay
between pleD*-mediated intracellular levels of c-di-GMP and the expression of both
phytohormones- and type III secretion system (T3SS)-related genes. In order to analyze
the expression dependency of some of these genes (hrpA, hrpL and iaaM) on the
intracellular levels of c-di-GMP, qRT-PCR experiments were carried out using RNA
samples isolated from P. savastanoi pv. savastanoi NCPPB 3335 cells expressing or not
the pleD* gene. A decrease in the transcript levels of the hrpL gene (approximately 1.8
fold) was observed in P. savastanoi overexpressing PleD*. However, no differences
between in the transcript levels of the hrpA and iaaM genes were observed between P.
37
SUMMARY
savastanoi pv. savastanoi NCPPB 3335 derivatives expressing or not the pleD* gene.
Although disease features were clearly affected in the PleD* transformant, we could not
observe clear effects of high c-di-GMP levels on transcription of these genes, suggesting
that c-di-GMP could regulate virulence-related genes in a different manner. In fact,
different c-di-GMP regulatory mechanisms have been demonstrated in bacteria
(Moscoso et al., 2011), including transcriptional regulation (Hickman and Harwood,
2008), but also, translational regulation (Sudarsan et al., 2008), regulation of protein
activity (Fang and Gomelsky, 2010) and cross-envelope signaling (Navarro et al., 2011).
In Chapter II we analyzed the role of BifA in the virulence of the P. syringae complex.
With this purpose, two strains were studied, which induces the formation of different
symptoms in infected plants, the tumor-inducing pathogen of woody hosts P. savastanoi
pv. savastanoi NCPPB 3335 (Ramos et al., 2012) and P. syringae pv. tomato DC3000,
which causes bacterial speck in tomato and Arabidopsis (Buell et al., 2003). The bifA
gene has been previously studied in the opportunistic human pathogen P. aeruginosa
(Kuchma et al., 2007) and, more recently, in the non-pathogenic bacterium P. putida
KT2442 (Jiménez-Fernández et al., 2014). In both pathogenic bacteria the BifA protein
has been located in the inner membrane, and the integrity of their EAL and modified
GGDEF domains have been shown to be crucial for PDE activity and biofilm formation.
However, a link between BifA and the virulence of animal- or plant-pathogenic
Pseudomonads has not yet been established. A comparative phylogenetic analysis of
BifA showed that this protein is widely distributed within the Pseudomonas genus, being
encoded in the genome of almost all sequenced Pseudomonas strains. The phylogeny of
the BifA proteins was largely congruent with the phylogeny of the genus Pseudomonas
(Yamamoto et al., 2000) and with that of the P. syringae complex (Studholme, 2011)
deduced from housekeeping genes, suggesting that the bifA gene is ancestral within this
bacterial group. Moreover, BifA homologs were also found in other gamma
proteobacteria closely related to the Pseudomonas genus, including Azotobacter
vinelandii, Hahella chejuensis and Marinobacter hydrocarbonoclasticus (Gauthier et al.,
1992; Jeong et al., 2005; Setubal et al., 2009). An alignment of the complete amino acids
sequences of BifA from P. savastanoi pv. savastanoi NCPPB 3335 (BifAPsv), P. syringae
pv tomato DC3000 (BifAPto), P. putida KT2440 (BifAPpu) and P. aeruginosa PAO1
(BifAPAO) using ClustalW2 revealed that BifAPsv and BifAPto are 97% identical, and show
87% identity with BifAPpu, and 81-80% identity with BifAPAO. In addition, conservation of
identical EAL and modified GGDEF (GGDQF) domains was observed in all sequenced
Pseudomonas spp. These results suggested that the BifA proteins encoded by the
38
SUMMARY
bacteria here analyzed, P. savastanoi pv. savastanoi NCPPB 3335 and P. syringae pv.
tomato DC3000, should be also functional PDEs. In order to study the role of the BifA
protein on virulence-related phenotypes in P. savastanoi pv. savastanoi and P. syringae
pv. tomato, deletion mutants and strain overexpressing BifA were constructed.
Overexpression of BifA in P. savastanoi, negatively and positively impact, respectively,
biofilm formation and swimming motility. On the other hand, we demonstrate that a
functional BifA is required not only for the control of bacterial motility, but also for full
fitness and virulence of both bacterial pathogens in their corresponding plant hosts. In
fact, the volume of the knots developed by the P. savastanoi pv. savastanoi ΔbifAPsv
mutant resulted to be ~2.0 and 4.2 times smaller than those induced by the wild-type
strain on in vitro and lignified olive plants, respectively. A clear reduction of chlorotic and
necrotic symptoms were associated to deletion of the bifA gene in P. syringae pv. tomato
DC3000. Quantification of the leave areas covered by the necrotic spots revealed a 3.5
times reduction of this symptom in plants infected with the ∆bifAPto mutant in comparison
with the wild-type strain. A complementation of all these phenotypes was observed in
both bifA mutants (ΔbifAPsv and ∆bifAPto) transformed with pJB3-bifAPsv. Furthermore, we
also show that virulence of a P. savastanoi bifA mutant in olive plants can be fully
restored by complementation with the bifA gene from P. aeruginosa, which PDE activity
has been demonstrated, suggesting an identical function of this protein in both bacterial
pathogens. In summary, our results indicate that BifA from P. syringae strains is a
phosphodiesterase protein, which is essential for full virulence in both phytopathogenic
bacteria. This is the first work relating a role of the c-di-GMP phosphodiesterase BifA in
the virulence of a bacterial pathogen.
In Chapter III we have studied the role of a novel DGC protein called here as DgcP
(Diguanylate cyclase conserved in Pseudomonads) on virulence-related phenotypes in
the pythopathogenic bacterium P. savastanoi pv. savastanoi, as well as in the
opportunistic human pathogen P. aeruginosa. BLASTP searches with the sequence of
the DgcP protein revealed that homologs exist only within the Pseudomonas genus, and
include all sequenced P. syringae pathovars, P. putida, Pseudomonas fluorescens,
Pseudomonas entomophila, and the opportunistic human pathogen, P. aeruginosa. DgcP
proteins encoded by P. aeruginosa strains PAO1, PAK and PA14 (671-amino acid
residues) are almost identical (PAO1 vs. PAK and PAO1 or PAK vs. PA14 are 100% and
98% identical, respectively) and show 50% identity to that of P. savastanoi pv.
savastanoi NCPPB 3335, which is 16 amino acids shorter. Moreover, genetic context
analysis around the dgcP gene in a selection of sequenced Pseudomonas spp. revealed
39
SUMMARY
a conserved synteny with two other genes located upstream of dgcP. One gene encodes
an EEPP (PSA3335_0619 and PA14_72430 in P. savastanoi NCPPB 3335 and P.
aeruginosa PA14, respectively) and the other gene encodes a putative disulfide
interchange protein, DsbA. Moreover, in order to determine whether the dgcP gene cotranscribes with the EEPP-encoding gene and the dsbA gene, RT-PCR assays were
performed. The results obtained showed the amplification of the intergenic regions
located between the sequential ORFs, except for that corresponding to the intergenic
region between dgcP and its downstream gene, revealing that these three genes are cotranscribed and suggesting the presence of a terminator downstream dgcP. The initiation
transcription site of the dbsA-dgcP operon was also determined by 5′ RACE in both
NCPPB 3335 and PAK. The transcription start site was localized 37 and 48 bp upstream
from the dsbA gene start codon in NCPPB 3335 and PAK, respectively. The persistence
of the association of these three orthologs genes linked to their co-transcription as a
polycistronic mRNA, suggested a relevant role of this operon in the physiology of the
Pseudomonas genus.
The presence of a GGDEF domain in the DgcP protein suggested that this protein
might function as a diguanylate cyclase. To test this hypothesis, a C-terminally Histagged version of the full-length DgcP protein (DgcP-His6) encoded by P. savastanoi pv.
savastanoi NCPPB 3335 was overexpressed in E. coli BL21. Soluble DgcP-His6 was
purified by nickel affinity chromatography and assayed in vitro for DGC activity in the
presence of 150 µM GTP. As a positive control, we used purified PleD* from C.
crescentus (Aldridge et al., 2003; Paul et al., 2004). Reaction products were analyzed by
HPLC-MS/MS, and we demonstrated c-di-GMP production in samples containing PleD*
or DgcP plus GTP. To further validate in vivo the demonstrated in vitro activity of DgcP,
we first constructed P. savastanoi and P. aeruginosa ΔdgcP mutants with a clean
deletion of the dgcP gene (dgcPPsv or dgcPPAK, respectively) and strains overexpressing
dgcP. We show that in both pathogenic Pseudomonas spp. the dgcP gene is involved in
positive regulation of biofilm formation and EPS production and negative regulation of
swimming motility. Furthermore, we tested the importance of the GGDEF motif in the
functionality of the DgcP protein. In this sense, we generated a mutant changing Glu607
to an Ala (GGEEF to GGAEF) and evaluated the ability of the resulting dgcP mutant
allele (dgcPPsvGGAEF) to complement the free-living phenotypes altered in the ΔdgcPPsv
mutant. The dgcPPsvGGAEF allele fails to restore the biofilm and swimming phenotypes
observed in the ΔdgcPPsv mutant. Therefore, we concluded that the DGC activity of the
DgcP protein is highly dependent on an intact GGDEF domain.
40
SUMMARY
Finally, we analyzed the role of the dgcP genes in the virulence of P. savastanoi
NCPPB 3335 in olive plants, and P. aeruginosa PAK in mice. The results showed a
virulence reduction of the P. savastanoi pv. savastanoi NCPPB 3335 dgcPPsv mutant in
olive plants. The volume of the knots developed by the ΔdgcPPsv mutant or its derivative
strain transformed with pJB3-dgcPPsv-GGAEF was ~2.5 and 1.8 times smaller than those
induced by the wild-type strain on in vitro and lignified olive plants, respectively.
Moreover, our study also revealed that deletion of this gene in P. aeruginosa PAK
resulted in a hypovirulent phenotype in a mouse model of acute infection. The ΔdgcPPAK
mutant presented an alteration of several parameters related to acute infection, e.g. lung
injury and accumulation of bronchoalveolar lavage (BAL) lymphocytes.
In summary, in Chapter III we identify and characterize a novel and Pseudomonadsspecific DGC protein and demonstrate its role in biofilm formation and virulence in both,
the opportunistic human pathogen P. aeruginosa and the plant pathogenic bacterium P.
savastanoi. The persistence of the association of the dgcP and dsbA genes in the
genomes of all sequenced Pseudomonas spp, together with their co-transcription,
suggests that regulation of c-di-GMP levels by DgcP might be linked to DsbA-mediated
posttranslational modification of virulence-related factors, an issue that remains to be
elucidated. Finally, in the light of the broad host range spectrum of DgcP, this DGC
protein emerge as a possible target for the control of P. aeruginosa and P. syringae and
related pathogens infections.
41
SUMMARY
42
RESUMEN
RESUMEN
El diguanilato cíclico (c-di-GMP) es un segundo mensajero bacteriano descubierto en
1987 por Moshe Benziman como un factor alostérico requerido para la activación de la
biosíntesis de celulosa en Gluconacetobacter xylinus (Ross et al., 1987). En trabajos
posteriores relacionados con el descubrimiento del c-di-GMP, se identificaron y
secuenciaron los genes que codifican las enzimas responsables de su síntesis y
degradación. El c-di-GMP se sintetiza a partir de dos moléculas de GTP por la acción de
diguanilato ciclasas (DGC), y se hidroliza por fosfodiesterasas (PDE) específicas. El
dominio GGDEF se ha relacionado con la síntesis de c-di-GMP, mientras que la
actividad PDE se ha asociado con dominios EAL o HD-GYP (Galperin et al., 2001; Paul
et al., 2004; Christen et al., 2005; Ryan et al., 2006b). Además, se ha descrito que el
motivo GGDEF puede presentar asociado un motivo de cuatro residuos denominado
sitio-I o motivo RxxD. Este motivo se ha localizado cinco aminoácidos corriente arriba
del motivo GG[D/E]EF o sitio-A (Chan et al., 2004; Christen et al., 2006). De acuerdo con
la conservación de los aminoácidos y/o presencia de los sitios I e A, las proteínas DGC
se pueden clasificar en cuatro grupos diferentes: I+A-, I-A+, I+A+ e I- A- (Jenal and
Malone, 2006). Sólo las proteínas con un sitio A conservado (A+) presentan actividad
DGC. Además, análisis genómicos han mostrado que los dominios GGDEF y EAL
frecuentemente pueden encontrarse en la misma cadena polipeptídica (Tal et al., 1998).
En este caso serían posibles dos situaciones, ambos dominios podrían ser
enzimáticamente activos pero su actividad estaría diferencialmente regulada por señales
ambientales y/o intracelulares (Tarutina et al., 2006; Ferreira et al., 2008), o la situación
más común, en la que uno de los dos dominios es no catalítico o inactivo (Christen et al.,
2005). Todo esto unido a que normalmente los genomas bacterianos codifican múltiples
proteínas que metabolizan c-di-GMP, sugiere que la señalización mediada por c-di-GMP
es altamente compleja (Boyd and O'Toole, 2012; Romling et al., 2013). Mientras que las
enzimas que metabolizan el c-di-GMP son fácilmente identificables debido a la presencia
de dominios GGDEF, EAL o HD-GYP, la identificación basada en la secuencia de
proteínas que funcionan como receptores o efectores del c-di-GMP presenta una mayor
dificultad. A pesar estas dificultades, se han descubierto varios tipos de receptores de cdi-GMP, y los detalles moleculares de sus mecanismos de acción comienzan a emerger.
El primer receptor de c-di-GMP identificado, y el mejor caracterizado, es el receptor de
PilZ, presente en la celulosa sintasa (Mayer et al., 1991; Weinhouse et al., 1997;
Amikam and Galperin, 2006), corriente abajo de algunas proteínas con dominios EAL o
GGDEF/EAL (Alm et al., 1996), y en proteínas relacionadas con el flagelo (Ko and Park,
2000; Ryjenkov et al., 2006; Christen et al., 2007; Pratt et al., 2007). Más tarde, se han
45
RESUMEN
descrito otros receptores diferentes de los receptores PilZ, como los receptores I
descritos para la proteína PelD de Pseudomonas aeruginosa (Lee et al., 2007), o los
receptores asociados con dominios EAL o HD-GYP inactivos (Minasov et al., 2009;
Newell et al., 2009). Además, también se han descritos receptores de c-di-GMP que
actúan como reguladores transcripcionales (por ejemplo FleQ de P. aeruginosa)
(Hickman and Harwood, 2008) y receptores no proteicos como los riboswitches (Barrick
and Breaker, 2007; Sudarsan et al., 2008).
El c-di-GMP se ha implicado en la regulación de diferentes fenotipos bacterianos,
como la movilidad, la formación de biofilms, y la biosíntesis y secreción de adhesinas y
exopolisacáridos (EPS) (Jenal and Malone, 2006; Hengge, 2009; Romling, 2012). Este
mensajero tiene por tanto un papel clave en la transición entre un estilo de móvil y un
estilo de vida sésil. Las bajas concentraciones de c-di-GMP se asocian con células
móviles, debido a la activación de motores flagelares o la retracción del pili, mientras que
niveles elevados promueven la transición desde células móviles a la formación
comunidades multicelulares o biofilms (Jenal and Malone, 2006; Fang and Gomelsky,
2010). El papel del c-di-GMP en la motilidad bacteriana se describió por primera vez en
bacterias Gram-negativas como G. xylinus, Salmonella enterica, Escherichia coli, y P.
aeruginosa (Simm et al., 2004), y los mecanismos moleculares de relacionados con la
regulación empezaron a emerger hace algunos años (Pesavento et al., 2008; Hengge,
2009; Fang and Gomelsky, 2010; Petrova and Sauer, 2012). Actualmente, es conocido
la vinculación del c-di-GMP con la motilidad se lleva a cabo mediante el control de la
regulación de la expresión de genes flagelares por factores de transcripción como FleQ
(Hickman and Harwood, 2008) y VpsT (Krasteva et al., 2010). Adicionalmente,
numerosos estudios han conectado también las vías de señalización de c-di-GMP con la
formación de biofilms (Kulasakara et al., 2006; Ude et al., 2006; Merritt et al., 2007;
Matilla et al., 2011; Moscoso et al., 2011; Boyd and O'Toole, 2012). En contraste a la
motilidad bacteriana, alta concentraciones de c-di-GMP promueve la expresión de
componentes de la matriz extracelular y la formación de biofilms. La biosíntesis de todos
los componentes de la matriz extracelular, incluyendo EPS, fimbrias adhesivas y
adhesinas no fimbriales, pueden regularse por c-di-GMP (Romling, 2012). Además, es
conocido que muchos de estos componentes de la matriz se regulan por cascadas de
señalización específicas dependientes de c-di-GMP, las cuales pueden actuar a
diferentes niveles y/o superponerse parcialmente (Lee et al., 2007; Merritt et al., 2007;
Monds et al., 2007; Mikkelsen et al., 2011a). En este sentido, la expresión y/o la
biosíntesis de EPS tales como los Pel y Pls de P. aeruginosa (Merritt et al., 2007;
46
RESUMEN
Malone et al., 2010), y otros más comunes como alginato (Lee et al., 2007; Mikkelsen et
al., 2011a) y celulosa (Ross et al., 1990; Saxena and Brown, 1995; Le Quere and Ghigo,
2009), se controla directamente por las vías de señalización del c-di-GMP.
Aunque los primeros procesos celulares dependientes de c-di-GMP identificados
fueron la formación de biofilms y la movilidad, este segundo mensajero se ha
relacionado también con la regulación de la virulencia en bacterias patógenas de
humanos, animales y plantas (Kulasakara et al., 2006; Ryan et al., 2007; Tamayo et al.,
2007; Bobrov et al., 2011; Matas et al., 2012). Los fenotipos relacionados con la
virulencia sobre los que actúa el c-di-GMP incluyen la adhesión e invasión celular, la
citotoxicidad, el proceso de infección intracelular, la secreción de factores de virulencia y
la estimulación de la respuesta inmune (Tischler and Camilli, 2005; Dow et al., 2006;
Kulasakara et al., 2006; Lee et al., 2010b; Huang et al., 2013). El papel del c-di-GMP en
patogénesis se ha estudiado ampliamente en los patógenos bacterianos de humanos y
animales, incluyendo S. enterica (Hisert et al., 2005), Vibrio cholerae (Tischler and
Camilli, 2005) P. aeruginosa (Kulasakara et al., 2006), y más recientemente en otras
bacterias, incluyendo entre otras a Legionella pneumophila, Brucella melitensis, cepas
de E. coli patógenicas, y Burkholderia pseudomallei (Tamayo et al., 2007; Lee et al.,
2010b; Levi et al., 2011; Petersen et al., 2011; Romling et al., 2013). A pesar de los
recientes avances en el conocimiento del papel de c-di-GMP en la patogenicidad y
virulencia de bacterias patógenas de humanos y animales, pocas proteínas relacionadas
con el metabolismo del c-di-GMP se han relacionado hasta la fecha con la virulencia de
bacterias patógenas de plantas. En Xanthomonas campestris se ha descrito la relación
existente entre la virulencia y el c-di-GMP, mediada por la fosfodiesterasa RpfG, que
presenta un dominio HD-GYP, y el receptor de c-di-GMP XcCLP (Ryan et al., 2007;
Chin et al., 2010). En Dickeya dadantii, se describió que las fosfodiesterasas EcpB y
EcpC están implicadas en virulencia mediante el control de la expresión del sistema de
secreción de tipo III (T3SS) (Yi et al., 2010). Más recientemente, en Erwinia amylovora,
se ha relacionado la sobreexpresión de proteínas DGC con el aumento de los síntomas
necróticos en los tejidos infectados (Edmunds et al., 2013), lo que sugiere también una
regulación negativa de la virulencia dependiente de c-di-GMP. Sin embargo, un mutante
de Xylella fastidiosa afectado en la DGC CgsA, mostró una reducción de la virulencia
(Chatterjee et al., 2010). También se ha descrito la regulación por c-di-GMP de la
secreción de adhesinas requeridas para la unión de Pectobacterium atrosepticum
SCRI1043
(Pérez-Mendoza
et
al.,
2011a;
Pérez-Mendoza
et
al.,
2011b)
y
Pseudomonadaceas (Fuqua, 2010) a sus plantas huéspedes. Hoy en día, se dispone de
47
RESUMEN
numerosos estudios que demuestran el relevante papel del c-di-GMP en la virulencia
bacteriana, afectando a gran variedad de vías de señalización, y en algunos casos,
controlando la expresión de genes de virulencia. Por lo tanto, la regulación por c-di-GMP
y el control de la patogenicidad implican una compleja interacción entre proteínas DGC,
PDE, y dianas proteicas reguladas por c-di-GMP (Romling et al., 2013). Esta Tesis
Doctoral se ha centrado en el estudio del papel de c-di-GMP en la virulencia de especies
patógenas pertenecientes al género Pseudomonas.
El género Pseudomonas es un grupo bacteriano extremadamente heterogéneo, que
incluye bacilos Gram-negativos, aerobios, y móviles, que se encuentran distribuidos
ampliamente en la naturaleza y que se caracterizan por su elevada versatilidad
metabólica (Franzetti and Scarpellini, 2007). Las bacterias de este género se pueden
encontrar en ambientes muy diferentes, tales como el suelo, el agua, y los tejidos de
plantas y animales (Palleroni, 1981). Además, dentro del género Pseudomonas se
encuentran especies no patógenas, como Pseudomonas putida, y especies patógenas
de humanos, animales o plantas. En esta Tesis hemos centrado nuestro trabajo
principalmente en dos bacterias fitopatógenas pertenecientes al complejo Pseudomonas
syringae (Mansfield et al., 2012), así como en la bacteria patógena de humanos P.
aeruginosa (Lyczak et al., 2000). P. aeruginosa es un patógeno oportunista que
normalmente habita en el suelo y en medios acuosos (Lyczak et al., 2000), siendo uno
de los patógenos más comúnmente asociado con infecciones respiratorias en pacientes
inmunodeprimidos debido a neutropenia, quemaduras graves, o fibrosis quística
(Veesenmeyer et al., 2009). Entre los determinantes de virulencia más estudiados en P.
aeruginosa se encuentran el T3SS, la regulación mediada por quorum sensing, la
formación de biofilms y la biosíntesis de los flagelos (Veesenmeyer et al., 2009). Por otra
lado, se ha descrito la implicación del c-di-GMP en la virulencia de P. aeruginosa PA14.
En concreto, mutantes por transposición afectados en las proteínas con actividad PDE
PvrR o RocR, en la proteína con dominio GGDEF SadC, o en las proteínas con dominios
GGDEF/EAL PA5017 y PA3311, resultaron hipovirulentos en ratón (Kulasakara et al.,
2006). Más recientemente, Moscoso y colaboradores (2011) describieron que en P.
aeruginosa PAK el c-di-GMP regula negativamente y positivamente, respectivamente, la
expresión del T3SS y del sistema de secreción tipo VI (T6SS). Estos autores, mostraron
que dicho control se asocia a la cascada de señalización RetS/LadS/GacS (Moscoso et
al., 2011). Sin embargo, el papel del c-di-GMP en la virulencia de bacterias
fitopatógenas pertenecientes al complejo P. syringae ha sido poco estudiado hasta la
fecha. Patólogos bacterianos relacionados con la revista "Molecular Plant Pathology",
48
RESUMEN
han considerado recientemente al complejo P. syringae como el grupo de patógenos
bacterianos de plantas más relevantes desde el punto de vista científico y económico,
debido a su virulencia, ubicuidad y a su capacidad de causar enfermedades en una
amplia gama de cultivos de elevado interés agrícola (Mansfield et al., 2012). El complejo
P. syringae incluye un grupo heterogéneo de bacterias que infectan plantas herbáceas y
leñosas, cultivadas y silvestres. Además, los patógenos de este grupo bacteriano
pueden causar una gran variedad de síntomas en las plantas infectadas, como necrosis
foliares, chancros, agallas, y tumores, que se inducen mayoritariamente en las partes
aéreas de las plantas (Fatmi et al., 2008). Las cepas pertenecientes a este complejo se
clasifican actualmente en más de 60 patovares, que difieren en su especificidad de
huésped y origen de su aislamiento (Young, 2010). Esta Tesis se ha centrado
mayoritariamente en el patógeno de olivo Pseudomonas savastanoi pv. savastanoi, así
como en el patógeno de tomate y Arabidopsis, P. syringae pv. tomate.
P. syringae pv. tomate es el agente causal de la mancha bacteriana del tomate. La
patogenicidad de esta bacteria se ha asociado principalmente con el T3SS (Collmer et
al., 2000; Lopez-Solanilla et al., 2004; Cunnac et al., 2011b). Otros factores relacionados
con la virulencia de este patógeno son las toxinas, los reguladores transcripcionales, los
sistemas de quorum sensing, las proteínas y polisacáridos extracelulares, los genes
relacionados con la motilidad, y los transportadores de extrusión (Mittal and Davis, 1995;
Boch et al., 2002; Brooks et al., 2004; Preiter et al., 2005; Chatterjee et al., 2007; Zeng
and He, 2010; Vargas et al., 2011). Por otro lado, la tuberculosis del olivo causada por P.
savastanoi pv. savastanoi se caracteriza por la formación de tumores en los tallos o
ramas de las plantas infectadas. Los factores de virulencia más estudiado en esta
bacteria son la producción de fitohormonas, como el ácido indolacético (IAA) y
citoquininas (CKs) (Surico et al., 1985; Powell and Morris, 1986; Glass and Kosuge,
1988; Rodríguez-Moreno et al., 2008; Aragón et al., 2014), y la presencia de un T3SS
funcional (Sisto et al., 2004; Pérez-Martinez et al., 2010; Tegli et al., 2011). Además, la
virulencia de esta bacteria también se ha asociado con la producción de EPS, la
formación de biofilms, la adhesión a superficies, y la regulación quorum sensing (Laue et
al., 2006; Hosni et al., 2011). En nuestro grupo de investigación, se ha llevado a cabo
recientemente una estrategia de análisis genómico funcional, denominada Signature
Tagged Mutagenesis (STM), que ha permitido reconstruir la red metabólica necesaria
por P. savastanoi pv. savastanoi NCPPB 3335 durante su interacción con olivo. Este
estudio, también reveló la existencia de nuevos mecanismos implicados en la virulencia
de este patógeno, tales como los sistemas de secreción tipo II y de tipo IV, genes
49
RESUMEN
implicados en la tolerancia y la detoxificación de especies reactivas de oxígeno (ROS) y
un conjunto de genes necesarios para la biosíntesis de la pared celular. Otros
mecanismos identificados incluyen una proteína relacionada con la quimiotaxis, varias
proteínas de unión al ADN y siete proteínas hipotéticas. Curiosamente, y relacionado
con esta Tesis Doctoral, en este estudio también se seleccionaron dos mutantes en
genes relacionados con el metabolismo de c-di-GMP. El mutante FAM-30 contiene una
inserción de un mini-Tn5 en el gen PSA3335_4049, codificante de una hipotética PDE
que muestra una identidad elevada con la proteína BifA de P. aeruginosa PA14 (Kuchma
et al., 2007) y P. putida KT2444 (Jiménez-Fernández et al., 2014). Por otra parte, el
mutante FAM-108 contiene la inserción en el gen PSA3335_0619, codificante de una
proteína perteneciente a la familia endonuclease/ exonuclease/ phosphatase family
(EEPP) y localizado corriente arriba del gen PSA3335_0620, codificante de una proteína
con dominio GGDEF (Matas et al., 2012). La caracterización de estos dos genes
posiblemente relacionados con el metabolismo del c-di-GMP (PSA3335_4049 y
PSA3335_0620), incluyendo el análisis de su papel en la virulencia de P. savastanoi pv.
savastanoi NCPPB 3335, fue el objetivo inicial de esta Tesis Doctoral. Además, teniendo
en cuenta la elevada conservación de estos dos genes dentro del género Pseudomonas,
este objetivo se expandió a otra cepa del complejo P. syringae, P. syringae pv. tomato
DC3000, así como al patógeno oportunista de humanos P. aeruginosa. Para llevar a
cabo este objetivo general, se plantearon los siguientes objetivos específicos: 1) Analizar
la respuesta de P. savastanoi pv. savastanoi NCPPB 3335 a niveles elevados de c-diGMP causados por la sobreexpresión de la DGCde Caulobacter crescentus PleD*; 2)
analizar el papel del gen bifA en fenotipos relacionados con la virulencia de dos cepas
diferentes del complejo P. syringae, P. savastanoi pv. savastanoi NCPPB 3335 y P.
syringae pv. tomato DC3000 y; 3) estudiar el papel de la hipotética DGC codificada por
el gen PAS3335_0620 en fenotipos relacionados con la virulencia de P. savastanoi pv.
savastanoi y P. aeruginosa. Los resultados obtenidos para abordar los objetivos
anteriormente descritos se exponen a continuación.
En el Capítulo I, y para llevar a cabo el primer objetivo, se realizó una predicción in
silico de proteínas GGDEF y/o GGDEF/EAL codificadas en el genoma de P. savastanoi
pv savastanoi NCPPB 3335, y se evaluaron las respuestas debidas a la sobreexpresión
de la DGC de C. crescentus PleD* en esta bacteria. El análisis bioinformático del
genoma de P. savastanoi pv savastanoi NCPPB 3335 (Rodríguez-Palenzuela et al.,
2010) reveló la existencia de 34 proteínas con dominios GGDEF en esta bacteria, de
entre las cuales 14, presentan también el dominio EAL en la misma cadena
50
RESUMEN
polipeptídica. Estos resultados sugieren que las actividades de las DGC y PDE están
estrechamente ligadas en esta bacteria fitopatógena. Un análisis detallado de estas
proteínas GGDEF nos permitió clasificarlas atendiendo a los sitios I y A en los siguientes
cuatro grupos: I+A+ (17 proteínas), I-A+ (9 proteínas), I+A- (3 proteínas) e I-A- (5
proteínas). Por otra lado, análisis BLASTp de estas proteínas en relación a las
codificadas por otras especies del género Pseudomonas revelaron un grado elevado de
conservación de todas ellas entre las cepas del complejo P. syringae. De hecho, P.
syringae pv. syringae B728a codifica estas 34 proteínas identificadas en NCPPB 3335,
mientras que otras cepas de P. syringae codifican entre un 88.23% y un 94.1% de las
mismas. La conservación resultó ser inferior en los genomas de Pseudomonas spp. no
patógenas, tales como P. putida KT2440 (47%) y Pseudomonas protegens Pf-5 (53%).
La elevada conservación de las proteínas GGDEF o GGDEF/EAL entre las cepas de P.
syringae y de P. savastanoi aisladas de diferentes hospedadores, sugiere un posible
papel de las mismas en la colonización, la infección y/o la interacción con sus
respectivas plantas huéspedes.
Por otro lado, para aumentar los niveles intracelulares de c-di-GMP en P. savastanoi
pv. savastanoi, se utilizó la proteína PleD*, una variante constitutivamente activa de la
proteína PleD de C. crescentus (Aldridge et al., 2003). El gen pleD* se clonó bajo el
control del promotor Plac en el vector replicativo en Pseudomonas pJB3 (Blatny et al.,
1997). La construcción resultante, pJB3-pleD* (Pérez-Mendoza et al., 2014), se
transformó en P. savastanoi pv.savastanoi NCPPB 3335, y se cuantificaron los niveles
intracelulares de c-di-GMP mediante HPLC/espectrometría de masas (HPLC-MS). La
sobreexpresión de pleD* aumentó notablemente los niveles intracelulares de c-di-GMP
(aproximadamente 200 veces) en comparación con la cepa control transformada con el
vector pJB3 sin inserto. Asimismo, los transformantes PleD* mostraron una clara
alteración de fenotipos de vida libre, como una completa inhibición de la movilidad tipo
swimming, y un aumento de la de la formación de biofilms, así como de la unión a rojo
congo (CR, del inglés, congo red) y calcofluor (CF). En estudios previos, altos niveles de
c-di-GMP se han relacionado también con una alteración de dicho fenotipos en otras
bacterias (Simm et al., 2004; Ryjenkov et al., 2006; Ude et al., 2006). Sin embargo, lo
más remarcable de este trabajo fue el efecto de los altos niveles de c-di-GMP en la
interacción de P. savastanoi pv. savastanoi NCPPB 3335-olivo. A pesar de la baja
estabilidad del plásmido pJB3-pleD* en plantas de olivo, los resultados obtenidos
mostraron que la expresión de pleD* aumentó drásticamente el tamaño de los tumores
inducidos por este patógeno, tanto en olivos micropropagados in vitro como en plantas
51
RESUMEN
de olivo lignificadas. Por el contrario, secciones transversales de los tumores
desarrollados por el transformante PleD* en plantas de olivo lignificadas presentaron una
reducción clara de la necrosis de los tejidos internos, en comparación con los
desarrollados por la cepa silvestre transformada con el vector sin inserto. Todos estos
resultados sugieren la existencia de una posible interacción entre los altos niveles de cdi-GMP, debido a la sobreexpresión de pleD*, y la expresión de otros genes de
virulencia relacionados previamente con estos fenotipos, como serían las fitohormonas y
el T3SS. Con el fin de analizar la dependencia entre los niveles intracelulares de c-diGMP y la expresión de algunos de estos genes (hrpA, hrpL y iaaM), se llevaron a cabo
ensayos de qRT-PCR y se compararon los resultados obtenidos en P. savastanoi
NCPPB 3335 expresando o no el gen pleD*. En el transformante pleD*, se observó tan
solo una pequeña disminución (aproximadamente 1.8 veces) de la transcripción del gen
hrpL en comparación a la cepa silvestre. Sin embargo, no se observaron diferencias
significativas entre los niveles de transcripción de los genes hrpA e iaaM debidas a la
sobreexpresión de este gen. Por tanto, aunque la sobreexpresión de pleD* tuvo un
efecto en los síntomas de la enfermedad, estos cambios no se tradujeron en una
variación de la transcripción de estos genes de virulencia, lo que sugiere que el c-diGMP podría actuar sobre la expresión de estos y otros genes de virulencia a niveles
diferentes del transcripcional. En este sentido, se ha publicado que el c-di-GMP puede
actuar sobre la expresión génica a diferentes niveles, incluyendo la regulación
transcripcional (Hickman and Harwood, 2008), pero también, la regulación de la
traducción (Sudarsan et al., 2008) o post-traduccional (Fang and Gomelsky, 2010).
En el Capítulo II, se analiza el papel del gen bifA en la virulencia del complejo P.
syringae. Con este fin se estudiaron dos cepas que afectan a diferentes plantas
huésped, el patógeno de olivo P. savastanoi pv. savastanoi NCPPB 3335 (Ramos et al.,
2012) , y el patógeno de tomate y Arabidopsis P. syringae pv. tomato DC3000 (Buell et
al., 2003). El gen bifA ya se había estudiado previamente en el patógeno oportunista
humano P. aeruginosa (Kuchma et al., 2007), y más recientemente, en la bacteria no
patógena P. putida KT2442 (Jiménez-Fernández et al., 2014). En ambas bacterias, la
proteína BifA se ha localizado en la membrana interna de la célula, y se ha demostrado
que la integridad de sus dominios EAL y GGDEF, este último degenerado, es crucial
para su actividad PDE y para la formación de biofilms. Sin embargo, hasta la fecha no se
ha establecido una relación entre la proteína BifA y la virulencia de bacterias patógenas
de animales o de plantas pertenecientes al género Pseudomonas.
52
RESUMEN
El análisis de la secuencia de aminoácidos de la proteína BifA demostró que ésta se
encuentra ampliamente distribuida dentro del género Pseudomonas, codificándose en
los genomas de caso todas las cepas de este género secuenciadas hasta la fecha. La
filogenia obtenida para esta proteína, resultó ser congruente con la deducida de genes
esenciales (housekeeping genes) para el género Pseudomonas (Yamamoto et al., 2000)
y para el complejo P. syringae (Studholme, 2011), lo cual sugiere un origen ancestral del
gen bifA dentro de este grupo bacteriano. Además, proteínas homólogas a BifA se
encontraron también en otras gamma proteobacterias emparentadas con el género
Pseudomonas, como Azotobacter vinelandii, Hahella chejuensis y Marinobacter
hydrocarbonoclasticus (Gauthier et al., 1992; Jeong et al., 2005; Setubal et al., 2009). El
alineamiento de la secuencia completa de la proteínas BifA de P. savastanoi pv.
savastanoi NCPPB 3335 (BifAPsv), P. syringae pv tomato DC3000 (BifAPto), P. putida
KT2440 (BifAPpu) y P. aeruginosa PAO1 (BifAPAO) reveló que BifAPsv y BifAPto son 97%
idénticas, y muestran un 87% de identidad con BifAPpu y un 81-80% de identidad con
BifAPAO. Además, el dominio EAL y el GGDEF modificado (GGDQF) se conserva al 100%
en todas las proteínas BifA de cepas secuenciadas del género Pseudomonas. Estos
resultado sugieren que las proteínas BifA de P. savastanoi pv. savastanoi NCPPB 3335
y P. syringae pv. tomate DC3000 deberían ser también PDE funcionales. Con el fin de
estudiar el papel de BifA en fenotipos relacionados con la virulencia en ambas cepas
fitopatógenas, se construyeron mutantes delecionados en el gen bifA, así como cepas
que sobreexpresaban dicho gen. La sobreexpresión de bifA en P. savastanoi tuvo un
impacto positivo sobre la movilidad tipo swimming, y negativo sobre la producción de
EPS y la formación de biofilms. Por otro lado, la deleción del gen bifA en ambas
bacterias patógenas demostró que dicho gen no es importante únicamente para el
control de la movilidad, sino que también se requiere para la virulencia en sus
respectivos huéspedes vegetales. De hecho, el volumen de los tumores desarrollados
por el mutante ΔbifAPsv de P. savastanoi pv savastanoi resultaron ser aproximadamente
2.0 y 4.2 veces más pequeños que los inducidos por la cepa silvestre en plantas de olivo
microporpagadas in vitro y plantas lignificadas, respectivamente. En relación al mutante
ΔbifAPto, la infección de plantas de tomate indujo una reducción clara de la clorosis y la
necrosis (3.5 veces menor) en relación a las plantas infectadas con la cepa silvestre. La
transformación de ambos mutantes bifA (ΔbifAPsv y ΔbifAPto) con el plásmido pJB3-bifAPsv
resultó en una complementación total de todos los fenotipos alterados en estos
mutantes. Por otra parte, también se mostró que todos los fenotipos relacionados con la
virulencia
alterados
en
los
mutantes
bifA
pueden
restablecerse
mediante
complementación con el gen bifA de P. aeruginosa PAO1, lo que sugiere una función
53
RESUMEN
idéntica de esta proteína en las diferentes bacterias patógenas de género
Pseudomonas. En resumen, nuestros resultados indican que la proteína BifA sintetizada
por cepas del complejo P. syringae es también una PDE, la cual es esencial para la
virulencia de este grupo de bacterias fitopatógenas. Estos resultados suponen la primera
descripción de una PDE, BifA, cuya función se requiere para la virulencia completa de
un patógeno perteneciente al género Pseudomonas.
En el Capítulo III, se ha estudiado el papel de una nueva DGC, aquí llamada DgcP, en
fenotipos relacionados con la virulencia de la bacteria patógena de olivo P. savastanoi
pv. savastanoi, así como en el patógeno oportunista de humanos P. aeruginosa. Análisis
BLASTp de la secuencia de aminoácidos de la proteína DgcP revelaron la existencia de
homólogos sólo en el género Pseudomonas, incluyendo todos los patovares de complejo
P. syringae, P. putida, Pseudomonas fluorescens, Pseudomonas entomophila, y el
patógeno oportunista humano P. aeruginosa. Las proteínas DgcP codificadas por las
cepas de P. aeruginosa PAO1, PAK y PA14 (671 aminoácidos) eran casi idénticas entre
ellas (PAO1 vs. PAK y PAO1 o PAK vs. PA14 son 100% y 98% idénticas,
respectivamente) y mostraban una identidad del 50% con la proteína DgcP de P.
savastanoi pv. savastanoi NCPPB 3335, la cual es 16 aminoácidos más corta. Por otra
parte, el análisis del contexto genético del gen dgcP en los genomas de diferentes
especies del genero Pseudomonas, mostró que se encontraba siempre precedido por
los genes PSA3335_0619, codificante de una EEPP, y el gen dsbA. Para determinar si
estos tres genes podrían formar parte de un operón, se llevaron a cabo ensayos de RTPCR utilizando ADN total de P. savastanoi NCPPB 3335 y P. aeruginosa PAK. La
amplificación de las regiones intergénicas situadas entre cada uno de estos tres genes
confirmaron la co-transcripción de los mismos. El inicio de la transcripción del operón
dsbA-dgcP se determinó mediante 5' RACE tanto para NCPPB 3335 como para PAK,
localizándose a 37 y 48 pb corriente arriba del codón de inicio del la traducción del gen
dsbA en NCPPB 3335 y PAK, respectivamente. La persistencia de la asociación de
estos tres genes, unido a su transcripción en forma de operón, sugiere un papel
relevante de los mismos en la fisiología del género Pseudomonas.
Por otro lado, la presencia de un dominio GGDEF en la proteína DgcP apoyaba la
hipótesis de que esta proteína podía funcionar como una DGC. Para comprobarlo, se
llevo a cabo una fusión C-terminal de la proteína DgcP de P. savastanoi pv. savastanoi
NCPPB 3335 a una cola de histinas (DgcP-His6). La proteína soluble resultante se
purificó mediante cromatografía de afinidad en columna de níquel, y se ensayó su
actividad DGC in vitro en presencia de 150 mM de GTP. Como control positivo, se
54
RESUMEN
purificó también la proteína PleD* de C. crescentus (Aldridge et al., 2003; Paul et al.,
2004). Los productos de reacción se analizaron mediante HPLC-MS/MS, demostrándose
la producción de c-di-GMP en las muestras que contenían PleD* o DgcP. A fin de validar
también in vivo la actividad DGC demostrada in vitro para la proteína DgcP, se llevo a
cabo la construcción de mutantes delecionados en dicho gen tanto en P. savastanoi
como en P. aeruginosa (dgcPPsv o dgcPPAK, respectivamente), así como cepas que
sobreexpresaban dicho gen. Los resultados obtenidos demostraron que el gen dgcP
regula positivamente la formación de biofilms y la producción de EPS, y negativamente
la movilidad tipo swimming. Además, se comprobó la importancia del motivo GGDEF en
la funcionalidad de esta proteína. Para ello, se generó un mutante puntual en este
dominio, cambiando el Glu607 a una Ala (GGEEF a GGAEF), y se evaluó la capacidad
del alelo mutante (dgcPPsvGGAEF) para complementar los fenotipos alterados en el
mutante ΔdgcPPsv. El alelo dgcPPsvGGAEF no fue capaz de restaurar los fenotipos
alterados en el mutante ΔdgcPPsv y relacionados con la formación de biofilms y la
movilidad tipo swimming. Por lo tanto, se concluyó que la actividad de esta proteína era
dependiente de este dominio.
Finalmente, se analizó el papel del gen dgcP en la virulencia de P. savastanoi NCPPB
3335 en plantas de olivo, y la de P. aeruginosa PAK en ratones. Los resultados
mostraron una reducción de la virulencia del mutante dgcP en ambos hospedadores. El
volumen de los tumores desarrollados por el mutante ΔdgcPPsv fue aproximadamente 2.5
y 1.8 veces más pequeño que los inducidos por la cepa silvestre en plantas de olivo
micropropagadas in vitro y en plantas lignificadas, respectivamente. Además, nuestro
estudio también reveló que la deleción de este gen en P. aeruginosa PAK redujo la
virulencia de esta cepa tras la infección de ratones. En este sentido, la acumulación de
linfocitos y las lesiones pulmonares inducidas por el mutante ΔdgcPPAK resultaron ser
inferiores a las provocadas por la cepa silvestre.
En resumen, en el Capítulo III de este trabajo hemos identificado y caracterizado una
proteína DGC específica del género Pseudomonas, y hemos demostrado su papel en la
formación de biofilms y en la virulencia tanto del patógeno oportunista de humanos P.
aeruginosa, como en la bacteria patógena de plantas P. savastanoi. La persistencia de
la asociación de los genes dgcP y dsbA en los genomas de todas las especies del
género Pseudomonas secuenciadas, junto con su co-transcripción, sugiere que la
regulación de los niveles de c-di-GMP mediada por la proteína DgcP podría estar
vinculada con las modificaciones post-traduccionales llevadas a cabo por la proteína
DsbA. Por último, y a la luz del amplio espectro de huéspedes de la proteína DgcP, esta
55
RESUMEN
DGC emerge como una posible diana para el control de infecciones causadas por P.
aeruginosa, P. syringae y otros patógenos relacionados.
.
56
GENERAL
INTRODUCTION
1. Bacterial cyclic di-GMP (c-di-GMP): The discovery
Cyclic di-GMP was originally identified in 1987 by Moshe Benziman and colleagues
as
an
allosteric
factor required for
activation
of
cellulose biosynthesis in
Gluconacetobacter xylinus (Ross et al., 1987). The history of this discovery was
described in a 1991 review by Benziman (Ross et al., 1991) and, more recently, by
Dorit Amikam (Amikam D et al., 2010) and Ute Römling (Romling et al., 2013). Briefly,
studies carried out from 1940s by the Benziman´s group and others authors disclosed
that cellulose synthase presented a low activity without c-di-GMP (Ross et al., 1986;
Weinhouse et al., 1997). After a long search, the cellulose synthase cofactor was
identified, first as a GTP derivative, then as a guanyl nucleotide composed of guanine,
ribose, and phosphate at a 1:1:1 ratio (Ross et al., 1985; Ross et al., 1986), and finally
as bis (3´5´) cyclic dimeric guanylic acid, or c-di-GMP (Ross et al., 1987) (Fig. 1).
Two years on, cellulose synthase from another bacterium, Agrobacterium tumefaciens,
was demonstrated to be c-di-GMP dependent (Amikam and Benziman, 1989), thus
indicating that c-di-GMP had a wider phylogenetic distribution.
Fig. 1. (A) Structure of cyclic di-GMP nucleotide. (B) Three-dimensional structures of cyclic diGMP. Carbon atoms are shown in green, nitrogen in blue, oxygen in red, and phosphorus in
orange.
In a later work related to the discovery of c-di-GMP, Benziman’s group identified and
sequenced the genes encoding enzymes responsible for its synthesis and breakdown,
i.e., the diguanylate cyclase (DGC) and c-di-GMP-specific phosphodiesterase (PDE),
respectively. In this work, sequence analysis of six G. xylinus DGCs and PDEs
revealed that they all had similar multidomain architectures, containing at least three
common domains, PAS-GGDEF-EAL, which turned out to be the most common
domain architecture of c-di-GMP-metabolizing proteins (Tal et al., 1998). However, the
role of each domain in the c-di-GMP synthesis and degradation was not well known.
59
2. Biochemistry of cyclic di-GMP synthesis, degradation and binding.
2.1 Cyclic di-GMP synthesis: the GGDEF domain
Further genetic studies presented by Ausmees and colleagues, and by others,
suggested that the GGDEF domain was sufficient for DGC activity (Ausmees et al.,
2001; Simm et al., 2004; Tischler and Camilli, 2005; Romling et al., 2013).
Bioinformatics analysis of the GGDEF domain sequence and structure published by
Pei and Grishin (2001), confirmed the connection between this domain and the cyclase
activity. Moreover, a loop highly conserved was predicted within the GGDEF domain,
which could be part of the substrate (GTP) binding site encoded in DGC proteins (Pei
and Grishin, 2001). The first biochemical evidence solidifying the connection between
this loop and the GTP binging site came from a study related to the PleD protein from
Caulobacter crescentus (Paul et al., 2004).
The c-di-GMP synthesis proceeds from two molecules of GTP via the diguanosine
tetraphosphate intermediate (pppGpGp) (Ross et al., 1987). DGC proteins function as
homodimers, which active site requires the interaction of its two monomers (Paul et al.,
2007). Each monomer loads one GTP substrate molecule for the c-di-GMP synthesis
reaction. Additionally, the DGC activity can be controlled by other protein domains
linked to a GGDEF domain (Chan et al., 2004; Wassmann et al., 2007). The most
common domains associated in the DGC proteins are the REC domains (response
regulator receiver domains), which have been described in DGC proteins as WspR
(Malone et al., 2007; De et al., 2008; De et al., 2009) and PleD (Paul et al., 2007;
Wassmann et al., 2007), and the PAS domains (cytoplasmic sensor domains),
associated with DGCs and PDEs proteins from G. xylinus (Henry and Crosson, 2011).
Phosphorylation of these domains is a common and powerful mechanism for GGDEF
domain activation (Paul et al., 2007; De et al., 2008).
A last mechanism that affected to activation/inactivation of DGCs involves feedback
inhibition of the GGDEF domain. The GGDEF domain can present a four-residue motif
constituting the I site, RxxD, which has been positioned five amino acids upstream of
the GG[D/E]EF motif (A-site) (Chan et al., 2004; Christen et al., 2006). Binding of c-diGMP to the I-site causes a conformational change in the A-site leading to allosteric
inhibition of DGCs (Christen et al., 2007).
60
2.2 Cyclic di-GMP hydrolysis: the EAL and HD-GYP domains.
Since GGDEF domains function in c-di-GMP synthesis, it was suggested that EAL
domains could be responsible for c-di-GMP hydrolysis. However, it was unclear
whether or not EAL domains are sufficient for the c-di-GMP-specific PDE activity or
whether both GGDEF and EAL domains are necessary (Kuchma et al., 2007; Romling
et al., 2013). EAL domains specifically and rapidly convert c-di-GMP to the linear form
pGpG, are strictly dependent on Mg2+ or Mn2+ ions, and are strongly inhibited by Ca2+
and Zn2+ ions (Jenal and Malone, 2006).The 5´pGpG, is subsequently degraded to
monomeric pG, apparently by different enzymes that had Ca2+ independent activity
(Romling et al., 2013). The observation that isolated monomeric EAL domains can
rapidly degrade c-di-GMP argued that PDEs function as monomers (Christen et al.,
2005).
Later on, a second and unrelated protein domain was associated with c-di-GMP
PDE activity. In the plant pathogen Xanthomonas campestris, the RpfG/RpfC two
component system controls the synthesis of virulence factors and extracellular
polysaccharides in response to extracellular signals. In this sense, Ryan and
colleagues described that the PDE activity was associated with the HD-GYP output
domain of RpfG protein (Ryan et al., 2007). Interestingly, the main product of c-di-GMP
hydrolysis by RpfG was identified as GMP, and not as 5´pGpG, the product of the EAL
domain encoded by PDEs (Fig.2). In addition to Xanthomonas PDEs, the HD-GYP
proteins were identified in representative strains of Pseudomonas and Borrelia (Ryan
et al., 2009; Sultan et al., 2011).
2.3 Proteins with GGDEF and EAL or HD-GYP domains arranged in tandem.
Early genomic analyses showed that GGDEF and EAL domains are often found on
the same polypeptide chain. The first identified DGCs and PDEs of G. xylinus
contained GGDEF-EAL domains arranged in tandem, but they had either DGC or PDE
activity (Tal et al., 1998), implying that one of the two domains in each enzyme was
catalytically inactive. Nowadays, it is well known that a large number of GGDEF
proteins present in the same polypeptide chain both domains (1/3 of all GGDEF
domains and 2/3 of all EAL domains) (Romling et al., 2013). Theoretically, two
possibilities exist that may explain that these proteins contain two domains with
opposite enzymatic activities. One scenario is that while both domains are
enzymatically active, they are differentially regulated by environmental and/or
intracellular signals. Thus, at any given situation, one of the two activities is prevalent
61
(Tarutina et al., 2006; Ferreira et al., 2008). However, the most common situation is
that one of the two domains is non-catalytic or inactive (Christen et al., 2005). “Inactive”
domains have been related to alternative protein functions, such as binding of the
substrate, e.g., GTP binding in the A sites of inactive GGDEF domains, or c-di-GMP
binding in the substrate binding sites of enzymatically inactive EAL domains
(Kazmierczak et al., 2006; Navarro et al., 2009). Another set of functions of GGDEF,
EAL, and HD-GYP domains inactive for c-di-GMP catalysis includes their participation
DIGUANILATE CYCLASE
in protein-protein or protein-RNA interactions (Romling et al., 2013).
Bifuncional
EAL
EAL
GGDEF
HD-GYP
GGDEF
GGDEF
2 GTP
GGDEF
GGDEF
pppG
pppG
PPi
5 pppGpG
PPi
PHOSPHODIESTERASES
c-di-GMP
Bifuncional
EAL
GGDEF
GGDEF
5 pGpG
EAL
EAL
GGDEF
HD-GYP
2pG
HD-GYP
2pG
Fig. 2. Basic biochemistry of c-di-GMP synthesis and degradation. The diagrams show the
protein domains involved in c-di-GMP metabolism. Enzymatically active GGDEF, EAL, and HDGYP domains are shown on a white background. Enzymatically inactive domains involved in
substrate binding are shown in light gray (Adapted from Römling et al., 2013).
62
3. Types of c-di-GMP receptors
Many bacterial species contain several enzymes involved in c-di-GMP metabolism
(Galperin et al., 2001; Jenal and Malone, 2006). While these enzymes are readily
identifiable due to the characteristic GGDEF, EAL, and HD-GYP domains, identifying
proteins that function as c-di-GMP receptors/effectors based on sequence information
proved to be more difficult. We now know that c-di-GMP binds to diverse classes of
proteins, many of which are different in sequence or structure. Despite its difficulties,
this field is progressing. Several types of c-di-GMP receptors have been discovered,
and the molecular details of c-di-GMP action are beginning to emerge. Several classes
of c-di-GMP receptors have been predicted based on primary sequences. The first
identified and better characterized c-di-GMP receptor is the PilZ receptor from G.
xylinus (Ross et al., 1985; Ross et al., 1987; Weinhouse et al., 1997), which appeared
associated with the cellulose synthase complex (Fig. 3A). Later on, a new receptor
domain was found downstream of some EAL or GGDEF-EAL proteins (Alm et al.,
1996) and in several flagellum-related proteins (Ko and Park, 2000; Ryjenkov et al.,
2006; Christen et al., 2007; Pratt et al., 2007; Martínez-Granero et al., 2014). Others
non-PilZ domain c-di-GMP receptors are the I-site receptors described for the
Pseudomonas aeruginosa PelD protein (Lee et al., 2007), and the inactive EAL domain
(Fig. 3B) and HD-GYP domains receptors (Minasov et al., 2009; Newell et al., 2009).
Additionally, there are also others unpredictable or nonprotein c-di-GMP receptors
which have been described:
-Transcriptional regulators. The first characterized was FleQ from P. aeruginosa
(Fig. 3C). Its discovery opened a new page in c-di-GMP signaling, because FleQ does
not fall into any of the known classes of c-di-GMP receptors (Hickman and Harwood,
2008). FleQ is a c-di-GMP binding protein which has been associated with the control
between motile and sessile lifestyles in P. aeruginosa. More recently, VpsR from V.
cholera, a quorum-sensing transcriptional regulator, was also identified as a c-di-GMP
receptor (Srivastava et al., 2011).
63
Environmental signal
Cellulose
C
c-di-GMP
B
(A)
Flagellum
D
A
(B)
(A)
PilZ
c-di-GMP
c-di-GMP
(D)
c-di-GMP
(C)
FleQ
RIBOSWITCH
Fig. 3. General principles of c-di-GMP regulation. Different c-di-GMP receptors are shown
together with DGCs and PDEs proteins: (A), PilZ domain; (B), non-PilZ domain; (C),
transcriptional regulator; (D), riboswitch. A cloud of c-di-GMP generated by a DGC that is
activated by an environmental signal is shown to affect a specific target, cellulose synthase.
Adapted from Wolfe et al., 2010.
-Nonprotein c-di-GMP receptor: Riboswitches. Riboswitches are noncoding
segments of mRNA that adopt specific secondary structures and can affect
transcription, mRNA stability, or translation of its downstream-encoded genes (Fig. 3D)
(Barrick and Breaker, 2007). Surdasan and colleagues (2008) found that c-di-GMP
binds specifically to a particular class of riboswitches known as GEMM. In some
bacteria, the c-di-GMP-specific riboswitch genes are found at the upstream regions of
genes encoding DGCs and PDEs that are controlled by c-di-GMP, including virulence
genes and genes related to the biogenesis of pili and flagella (Sudarsan et al., 2008).
More recently, a second type of c-di-GMP-binding riboswitch was also identified, which
is involved in c-di-GMP-induced RNA splicing (Lee et al., 2010a).
4. Cellular functions regulated through c-di-GMP
C-di-GMP has been implicated in the regulation of several bacterial behaviors,
including biofilm formation, the biosynthesis and secretion of adhesins and
exopolysaccharides, as well as the motility and virulence of bacterial pathogens (Dow
et al., 2006; Jenal and Malone, 2006; Tamayo et al., 2007; Yi et al., 2010) (Fig. 4).
Each of these phenotypes are explained below in more detail.
64
4.1 Motility-to-sessility transition by c-di-GMP
The c-di-GMP has a key role of in the transition between motile and sessile lifestyles
(Fig. 4). Low concentrations of c-di-GMP are associated with cells that move by
flagellar motors or retracting pili, while elevated levels of this second messenger
promote transition of bacteria from single motile cells to surface-attached multicellular
communities (Jenal and Malone, 2006; Fang and Gomelsky, 2010). The role of c-diGMP in bacterial motility was first described for Gram-negative bacteria as G. xylinus,
Salmonella enterica, Escherichia coli, and P. aeruginosa (Simm et al., 2004), and the
molecular mechanisms of this regulation began to emerge several years ago
(Pesavento et al., 2008; Hengge, 2009; Fang and Gomelsky, 2010; Petrova and Sauer,
2012). Currently known mechanisms linking c-di-GMP to motility control involve
regulation of flagellar genes by transcriptional factors as FleQ (Hickman and Harwood,
2008) and VpsT (Krasteva et al., 2010). Moreover, a relation between c-di-GMP and
flagellar motility has also been shown in both, swimming motility (in liquid or semisolid
media) and swarming motility (on wet surfaces) (Girgis et al., 2007; Merritt et al., 2007)
. In that sense, several critical pieces of the c-di-GMP signaling module involved in
swarming motility were identified in P. aeruginosa PA14. Mutations in the DGC protein
SadC (PA4332) and in the protein of unknown function SadB (PA5346) were shown to
promote swarming motility (Caiazza et al., 2007; Merritt et al., 2007), whereas a
mutation in the PDE protein BifA had the opposite effect (Kuchma et al., 2007).
4.2 Biofilm formation
The biofilm definition is a frequent source of debate. Some authors define it as a
simple association of cells to a surface, while others have argued that cells are firmly
fixed to a surface and encased in an extracellular matrix. Independently of these
definitions, the biofilm formation has been likened to a developmental process
consisting of several steps common to many different species (O'Toole et al., 2000).
The steps include attachment to a surface, the formation of cellular aggregates called
microcolonies, and the active departure of cells from a biofilm in a process called
detachment or dispersion (Fig 5). Intense research has been carried out over the
genetics factors that contribute to these different steps during the formation of biofilms.
Interestingly, c-di-GMP signaling is now known to control different aspects of these
developmental steps.
65
Phenotypes activated by c-di-GMP
Phenotypes repressed by c-di-GMP
Sessility
•biofilm formation
•wrinkled colony morphology
•exopolysaccharides
•adhesive matrix components
fimbrie.
Motility
•swimming
•swarming
•twitching
Virulence
•toxin production
•type three secretion
system
•invasion
c-di-GMP
c-di-GMP
Antibiotic production
Virulence
•toxin production
•intracellular replication
•phagocytosis resistance
•type six secretion system
Cell morphology
•cell elongation
•stalk formation
Phage resistance
Cell cycle control
Resistance to detergents
Fig. 4. Phenotypes regulated by cyclic di-GMP signaling. On the left are target outputs
activated by low c-di-GMP levels or repressed by high concentrations of c-di-GMP (requiring the
absence of c-di-GMP binding to the cognate receptor for expression). On the right, target
outputs activated by high c-di-GMP (requiring c-di-GMP binding to the cognate receptor for
expression) are shown. Some processes can be repressed and activated by c-di-GMP,
depending on the bacterial species and conditions. Adapted from Römling et al., 2013.
4.2.1 Biofilm regulation by c-di-GMP
Numerous studies connect the c-di-GMP signaling pathways in biofilm formation
(Kulasakara et al., 2006; Ude et al., 2006; Merritt et al., 2007; Matilla et al., 2011;
Moscoso et al., 2011; Boyd and O'Toole, 2012). In contrast to the bacterial motility,
high c-di-GMP concentration promote the expression of adhesive matrix components
and result in multicellular behavior and biofilm formation (Fig. 4). All extracellular matrix
components
known
to
contribute
to
biofilm
formation,
including
diverse
exopolysaccharides, adhesive pili, and nonfimbrial adhesins, as well as extracellular
DNA, can be regulated by c-di-GMP (Romling, 2012). Emerging data indicate that the
expression and/or biosynthesis of many of these biofilm matrix components are
regulated by specific cyclic di-GMP signaling networks, which act at different levels and
can partially overlap (Lee et al., 2007; Merritt et al., 2007; Monds et al., 2007;
Mikkelsen et al., 2011a). For example, in P. aeruginosa the expression of the Pel and
Psl polysaccharides requires the DGC proteins SadC (Merritt et al., 2007) and YfiN
(Malone et al., 2010), while in some strains alginate biosynthesis is activated by
66
PA1727
(Lee
et
al.,
2007;
Mikkelsen
et
al.,
2011a).
The
regulation
of
exopolysaccharides by c-di-GMP could also be at the post-transcriptional level through
cyclic di-GMP receptors associated with the macromolecular biosynthesis complex
(Lee et al., 2007; Merighi et al., 2007).
Other exopolysaccharide which biosynthesis is control by c-di-GMP is the cellulose.
Cellulose is a common component of environmental bacterial biofilms and a
component of interkingdom biofilms, i.e., bacteria attached to plants, fungi, and human
intestinal cells (Romling et al., 2013). Most bacterial cellulose synthases contain a c-diGMP-binding PilZ domain at their C-terminus, suggesting an allosteric regulation of
cellulose biosynthesis by c-di-GMP (Ross et al., 1990). This post-translational
regulation is possibly the major mechanism of cellulose biosynthesis activation in G.
xylinus, E. coli, and S. enterica (Saxena and Brown, 1995; Le Quere and Ghigo, 2009).
Fig. 5. Diagram showing the different stages of biofilm formation on abiotic surface. The
phases of a biofilm are 1. Initial attachment; 2. Irreversible attachment; 3; Microcolonies
formation; 4 Maturation; 5 Detachment or Dispersion. The stages influenced by c-di-GMP are
indicated by the start. Picture from http://2011.igem.org/Team:Glasgow/Biofilm.
4.2.2 Biofilms and antimicrobial resistance.
Biofilm-growing microorganisms cause chronic infections which share clinical
characteristics, like persistent inflammation and tissue damage. A large number of
chronic bacterial infections involve bacterial biofilms, making these infections very
difficult to be eradicated by conventional antibiotic therapy. Biofilm formation also
causes a multitude of problems in the medical field, particularly in association with
prosthetic devices such as indwelling catheters and endotracheal tubes (Taraszkiewicz
et al., 2013).
67
There are numerous benefits that a bacterial community might obtain from the
formation of biofilms. Biofilms confer resistance to many antimicrobials, protection from
protozoan, and protection against host defenses (Lopez et al., 2010). In P. aeruginosa,
for example, mucoid colonies and small-colony variants, commonly isolated from the
airways of cystic fibrosis patients have been associated with hyper-biofilm-formation,
high c-di-GMP levels and increased antibiotic tolerance (Starkey et al., 2009).
4.3 Role of c-di-GMP in bacterial virulence
Although the first c-di-GMP dependent processes identified were the biofilm
formation and motility, regulation of virulence phenotypes is today a prominent feature
related to c-di-GMP signaling in bacterial pathogens of humans, animals and plants
(Kulasakara et al., 2006; Ryan et al., 2007; Tamayo et al., 2007; Bobrov et al., 2011;
Matas et al., 2012). Virulence phenotypes affected by c-di-GMP signaling, which are
usually related to the interaction of bacterial cells with host cells, include adherence,
invasion, cytotoxicity, intracellular infection, secretion of virulence factors and
stimulation of the immune response (Tischler and Camilli, 2005; Dow et al., 2006;
Kulasakara et al., 2006; Lee et al., 2010b; Huang et al., 2013). The first observations of
a role of c-di-GMP signaling in the virulence of bacterial pathogens were reported for
Vibrio cholerae (Tischler and Camilli, 2005). Later on, other works have been published
in this sense in animal, human, and plant pathogenic bacteria (Table 1). Deletion of
PDEs has been generally associated with a virulence reduction (Ryan et al., 2007; Yi et
al., 2010), while deletion of DGCs usually increases virulence (Hisert et al., 2005;
Tischler and Camilli, 2005). However, several authors have later reported a virulence
reduction of various pathogenic bacteria as a consequence of the overexpression of
DGCs or the loss of function of either PDEs or DGCs (Table I), which have exposed a
more complex relationship between the c-di-GMP metabolizing proteins and bacterial
virulence. Nowadays, there is abundant evidence that c-di-GMP had an important role
in bacteria virulence by affecting a variety of pathways, in some cases controlling the
expression of virulence genes. Thus regulation of c-di-GMP and control of
pathogenicity involve a complex interaction of DGC, PDE, and the regulatory targets of
c-di-GMP (Romling et al., 2013).
68
Table 1. Virulence phenotypes affected by c-di-GMP.
Species
c-di-GMP-metabolizing
enzymes involved
Animal and human pathogenic bacteria
PDE VieA
Vibrio cholera
Phenotype
Reference
Activation of cholera toxin
(Tischler and Camilli,
2005)
Samonella entérica
Typhimurium
PDE CdgR
Host cell invasion and
cytotoxicity
(Hisert et al., 2005)
Pseudomonas aeruginosa
DGCs/PDEs
Virulence in vivo and
cytotoxicity of host cells
(Kulasakara et al.,
2006)
Adherent-invasive
Escherichia coli
PDE YhjH, DGC AdrA
Adherence and invasion to
host cell
(Claret et al., 2007)
Anaplasma
phagocytophilum
DGC PleDAp
intracellular infection
(Lai et al., 2009)
Burkholderia pseudomallei
PDE CdpA
(Lee et al., 2010b)
Ehrlichia chaffeensis
PDE PleDEc
(Kumagai et al.,
2010)
Brucella melitensis
PDEs BpdA and BpdB, DGC
CgsB
Virulence in vivo
(Petersen et al.,
2011)
Salmonella enterica
Typhimurium
4 PDEs/ 6DGCs
(Ahmad et al., 2011)
Legionella pneumophila
Overexpression of DGC
Virulence in vivo, host cell
invasion, and modulation of
immune response
Intracellular infection and
Francisella novicida
Overexpression of DGC
(Zogaj et al., 2012)
Uropathogenic Escherichia
coli CFT073
DGC YdeH, PDE C1610, and
10 additional DGCs/PDEs
Adherence to host cell
(Spurbeck et al.,
2012)
Klebsiella pneumoniae
CG43
PDE YjcC
Virulence in vivo
(Huang et al., 2013)
Virulence in vivo
(Ryan et al., 2006b)
Dickeya dadantii
PDE RpfG and 12 additional
PDEs/DGCs
PDE EcpB and EcpC
(Yi et al., 2010)
Xylella fastidiosa
DGC CgsA
expression of virulence
genes
Virulence in vivo and vector
transmission
Pectobacterium
atrosepticum SCRI1043
DGC ECA3270 and PDE
ECA3271
Adhesion to host cells
(Pérez-Mendoza et
al., 2011b)
Pseudomonas savastanoi
pv. savastanoi
NCPPB3335
DGC PSA3335_0620 and
PDE PSA3335_4049
Virulence in vivo
(Matas et al., 2012)
Erwinia amylovora
Overexpression of DGCs
Virulence in vivo
(Edmunds et al.,
2013)
(Levi et al., 2011)
Plant pathogenic bacteria
Xanthomonas campestris
(Chatterjee et al.,
2010)
69
4.3.1 Virulence of human and animals bacterial pathogens
The first evidences came out in the animal pathogenic bacteria V. cholera. In this
pathogen, low c-di-GMP levels leads to activation of the cholera toxin, and elevated cdi-GMP levels attenuated virulence in an infant mouse model system (Tischler and
Camilli, 2005). The same year, an inhibitory effect of c-di-GMP on the virulence of
Salmonella typhimurium was reported. A screen directed to identify essential genes for
the virulence of this pathogen in a mouse model, identified an EAL domain-encoding
protein, CdgR, with a role in bacterial survival to killing by host phagocyte oxidase
(Hisert et al., 2005). In the human opportunistic pathogen P. aeruginosa PA14, a
systematic genetic analysis of c-di-GMP-related proteins showed attenuated mutants in
DGC and PDE proteins (Kulasakara et al., 2006). Moreover, a number of studies using
genetic screens, overexpression approaches, or transcriptional profiling have
implicated c-di-GMP in the regulation of virulence in a number of other bacteria,
including Legionella pneumophila, Brucella melitensis, pathogenic E. coli, and
Burkholderia pseudomallei (Tamayo et al., 2007; Lee et al., 2010b; Levi et al., 2011;
Petersen et al., 2011; Romling et al., 2013).
4.3.1 c-di-GMP and virulence in plant pathogenic bacteria
The role of the c-di-GMP signaling in plant-interacting bacteria is poorly understood.
Few c-di-GMP metabolism proteins were experimentally demonstrated as c-di-GMP
signaling components in plant pathogenic bacteria. RpfG and XcCLP of X. campestris,
a HD-GYP domain containing protein and a c-di-GMP receptor, respectively, connect
cell-cell signaling to virulence gene expression (Ryan et al., 2007; Chin et al., 2010). In
Dickeya dadantii, c-di-GMP phosphodiesterases EcpB and EcpC were shown to
regulate multiple cellular behaviors and virulence, by controlling the expression of the
type III secretion system T3SS; (Yi et al., 2010). In Erwinia amylovora, overexpression
of DGCs proteins, increased tissue necrosis in an immature-pear infection assay and
an apple shoot infection model, suggesting that c-di-GMP negatively regulates
virulence (Edmunds et al., 2013). However, a deletion mutant in a DGC protein, CgsA,
was associated with a reduction of the virulence in Xylella fastidiosa (Chatterjee et al.,
2010). Crucial roles of c-di-GMP has been also reported in the regulation adhesins
secretion, required for binding to the host plants in Pectobacterium atrosepticum
SCRI1043 (Pérez-Mendoza et al., 2011a; Pérez-Mendoza et al., 2011b) and in plantinteracting bacteria belonging to the Pseudomonadaceae family (Fuqua, 2010).
70
5. Role of c-di-GMP in the virulence of pathogenic Pseudomonads.
Given the importance of Pseudomonas spp. in this work, in this section we describe
the Pseudomonas species and strains used in this study. Additionally, we also
summarize the state of the art in relation to the role of c-di-GMP in the pathogenecity of
these bacterial species.
5.1 The Pseudomonas genus
The genus Pseudomonas is an extremely heterogeneous bacterial group, which
includes Gram-negative motile aerobic rods that are widespread throughout nature and
characterized by elevated metabolic versatility, thanks to the presence of a complex
enzymatic system (Franzetti and Scarpellini, 2007). The genus, identified by Migula in
1894 (Palleroni, 1984), has been reclassified several times on the basis of phenotypic
features (Sneath et al., 1981), DNA–DNA hybridization (Palleroni, 1984), 16S rRNA
gene sequence similarity (Anzai et al., 2000; Palleroni, 2003) and chemotaxonomic
data (Vancanneyti et al., 1996). Pseudomonas bacteria can be found in many different
environments such as soil, water, plant and animal tissue (Palleroni, 1981) Moreover,
within the Pseudomonas genus can be found non-pathogenic species, as
Pseudomonas putida, and pathogenic bacteria of humans, animals, or plants. In this
thesis we have mainly focused in two phytopathogenic bacteria belonging to the
Pseudomonas syringae complex (Mansfield et al., 2012), Pseudomonas savastanoi pv.
savastanoi and Pseudomonas syringae pv. tomato, as well as in the important animal
and opportunistic human pathogen P. aeruginosa (Lyczak et al., 2000) .
5.1.1 Pseudomonas aeruginosa
P. aeruginosa, an opportunistic pathogen that normally inhabits the soil and aqueous
environments (Lyczak et al., 2000), is one of the most common pathogens causing
respiratory infections of hospitalized patients with compromised host defenses such as
in neutropenia, severe burns, or cystic fibrosis (Veesenmeyer et al., 2009). Moreover,
this pathogen can cause bloodstream, urinary tract, surgical site, and soft tissue
infections (Trautmann et al., 2005). A wide range of survival strategies has been
described for such a versatile organism, which can cause both chronic and acute
infections (Roy-Burman et al., 2001). P. aeruginosa infections are associated with a
high resistance to antibiotics and expression of multiple virulence factors, which
contributes to the frequent ineffectiveness of current therapies (Gellatly and Hancock,
71
2013).Chronic infections of this pathogenic bacterium are a major burden and cause of
mortality in people suffering from cystic fibrosis (CF).
A large number of virulence determinants are being actively described for P.
aeruginosa. The best described virulence factors in this bacterium are the T3SS and its
effectors, the quorum sensing regulation, the formation of biofilms, and the flagella
(Veesenmeyer et al., 2009). More recently, others virulence factors have been related
to chronic infections, such as the production of siderophores (pyoverdin and pyochelin),
which allow the bacterium to multiply in the absence of ferrous ions, and the
biosynthesis of exopolysacharides, which form a pseudocapsule of alginate that
protects the bacterium from phagocytosis, dehydration and antibiotics (Ben Haj Khalifa
et al., 2011).
5.1.1.1 c-di-GMP and virulence in P. aeruginosa
A genetic screen of DGCs and PDEs proteins revealed a role of c-di-GMP in the
virulence of P. aeruginosa PA14 (Table 1). Mutations in two PDE proteins (PvrR and
RocR), or proteins containing GGDEF (SadC) or GGDEF/EAL domains (PA5017 and
PA3311) resulted in virulence attenuation in a murine thermal injury model (Kulasakara
et al., 2006). The results obtained supported the idea that DGCs and PDEs could affect
the virulence of this pathogen in the same direction.
More recently, Moscoso and colleagues (2011) described that in P. aeruginosa PAK
the T3SS is negatively affected by c-di-GMP, whiles c-di-GMP signaling had a
stimulating effect on the biosynthesis of the type VI secretion system (T6SS) effectors
(Moscoso et al., 2011). These authors, also showed that control of the expression of
the T3SS and T6SS by c-di-GMP is associated with the RetS/LadS/GacS signaling
cascade, which control the transition from acute to chronic infection in this pathogen
(Fig. 6).
72
Fig. 6. Regulatory networks that switch P. aeruginosa lifestyles. The retS and c-di-GMP
signaling pathways control functions involved in motility vs. biofilm formation, or in acute versus
chronic infection. The RetS/LadS signaling network converges on the post-transcriptional
regulator, RsmA, to inversely regulate the T3SS and the T6SS. The same regulation can be
modulated altering the c-di-GMP levels (overexpressing a DGC or a PDE protein). The dotted
arrows indicate an unknown mechanism of action. From Moscoso et al., (2011).
5.2 The Pseudomonas syringae complex
Bacterial pathologists with an association with the journal “Molecular Plant
Pathology” recently considered P. syringae as the most scientifically and economically
relevant plant bacterial pathogen, due to its virulence, ubiquity and its ability to cause
disease in a wide range of the most important commercial crops (Mansfield et al.,
2012). P. syringae encloses a heterogeneous group of bacteria that infect herbaceous
and woody, cultivated and wild plants. It is responsible of foliar necrosis, blights,
stripes, cankers, galls, and tumors, appearing mostly in the aerial part of the plant
(Fatmi et al., 2008). Phytopathogenic P. syringae strains, which are most of them, elicit
the hypersensitive response (HR) in tobacco plants (Klement, 1963). The complex is
subgrouped into more than 60 pathovars according to the host specificity and isolation
origin (Young, 2010). DNA-DNA hybridization analyses of P. syringae strains carried
out by Gardan and co-workers allowed classification of this species into 9
genomospecies (Gardan et al., 1999). These taxonomic groups are in accordance with
the phylogroups later identified using MLST procedures (Sarkar and Guttman, 2004;
Parkinson et al., 2011).
In this study, we have mainly concentrated in two different pathovars of the P.
syringae complex, P. syringae pv. tomato, and the olive pathogen P. savastanoi pv.
savastanoi.
73
5.2.1 Pseudomonas syringae pv. tomato
P. syringae pv. tomato is the causal agent of bacterial speck of tomato (Fig. 7A).
This pathogen has been of high scientific interest for three main reasons. Firstly, this
bacterial pathogen is amenable to molecular genetic and cell biology techniques,
facilitating the experimental identification and manipulation of putative pathogenicity
and virulence determinants. Second, tomato (Lycopersicon esculentum) is similarly
amenable to transformation and genetic analysis, facilitating the characterization of
plant genes involved in host responses. But third, and perhaps most significantly, P.
syringae pv. tomato is pathogenic on the model plant Arabidopsis thaliana, providing a
model pathosystem for studying both compatible and incompatible host–pathogen
interactions (Preston, 2000). The complete genome of P. syringae pv. tomato DC3000
identified 298 established and putative virulence genes, including several clusters of
genes encoding 31 confirmed and 19 predicted T3SS effector proteins (Buell et al.,
2003). This system has been shown to play a critical role in the infection caused by P.
syringae pv. tomato (Collmer et al., 2000; Lopez-Solanilla et al., 2004; Cunnac et al.,
2011b). Other genes related to the virulence of this pathogen include toxins (i.e
coronatine), transcriptional regulators, quorum sensing system, extracellular proteins
and polysaccharides, motility-related genes and multidrug resistance transporters
(Mittal and Davis, 1995; Boch et al., 2002; Brooks et al., 2004; Preiter et al., 2005;
Chatterjee et al., 2007; Zeng and He, 2010; Vargas et al., 2011). Recently, the light
has been also described as a factor that regulates the virulence in this pathogenic
bacteria (Rio-Alvarez et al., 2013).
5.2.2 Pseudomonas savastanoi pv. savastanoi
P. savastanoi pv. savastanoi is a model bacterium for the study of the molecular
basis of woody plant diseases. Infection of olive (Olea europaea) by P. savastanoi pv.
savastanoi results in overgrowth formation (tumors, galls or knots) on the stems and
branches of the host plant and, occasionally, on leaves and fruits (Fig. 7B). The
disease is thought to reduce both olive yield and productivity (Iacobellis, 2001;
Quesada et al., 2010), and few commercial cultivars are significantly tolerant to olive
knot (Penyalver et al., 2006).
74
A.
B.
Fig. 7. Symptoms characteristic of bacterial speck of tomato caused by P. syringae pv.
tomato (A) and olive knot disease caused by P. savastanoi pv. savastanoi (B).
In our research group, in vitro-propagated olive plants were established as a model
system for the analysis of the interaction of P. savastanoi pv. savastanoi with olive,
allowing successful evaluation of virulence and in vivo monitoring of bacterial
localization inside olive knots (Rodríguez-Moreno et al., 2008; Rodríguez-Moreno et al.,
2009). Additionally, the draft genome sequence and the complete sequence of the
plasmid complement of our reference strain, P. savastanoi pv. savastanoi NCPPB
3335 are currently available (Rodríguez-Palenzuela et al., 2010; Bardaji et al., 2011).
The better characterized virulence factors in tumor-inducing isolates of P. savastanoi
are the phytohormones indole-3-acetic acid (IAA) and cytokinins (CKs) (Surico et al.,
1985; Powell and Morris, 1986; Glass and Kosuge, 1988; Rodríguez-Moreno et al.,
2008; Aragón et al., 2014) and a functional T3SS (Sisto et al., 2004; Pérez-Martinez et
al., 2010; Tegli et al., 2011). Moreover, virulence of this bacterium has also been
associated with the production of exopolysaccharides, the formation of biofilms, the
adhesion to surfaces, and the quorum sensing regulation (Laue et al., 2006; Hosni et
al., 2011). Recently, Matas and co-workers, used Signature Tagged Mutagenesis
(STM) to reconstruct the metabolic network required for full fitness of P. savastanoi pv.
savastanoi NCPPB 3335 in olive plants. Additionally, this study revealed novel
mechanisms involved in the virulence of this pathogen, such as the type II and type IV
secretion systems, a battery of genes involved in tolerance and detoxification of
reactive oxygen species (ROS) and a set of genes required for the biosynthesis of the
cell wall. Other features identified in this study include a chemotaxis-related protein,
several DNA-binding proteins and seven hypothetical proteins (Fig. 8).
75
Fig. 8. Schematic representation of virulence associated mechanisms in P. savastanoi
pv. savastanoi NCPPB 3335 identified by signature tagged mutagenesis. Functional
categories are represented in different colors: blue, secretion systems; green, cell-surface
structures; orange, stress tolerance; gray, transporters; and red, others. OM, outer membrane;
PG, peptidoglycan; IM, inner membrane; T3SS, type III secretion system; T4SS, type IV
secretion system; MCP, methyl-accepting chemotaxis protein; GGDEF, GGDEF/EAL domain
protein-coding gene; IAA, indole-3-acetic acid. From Matas et al. (2012).
Interestingly, and related to this PhD Thesis, two mutants containing the transposon
in genes related to the metabolism of c-di-GMP were also selected in this study (Table
1). Transposon mutant FAM-30 contained the mini-Tn5 insertion within the
PSA3335_4049 gene (Fig. 9A), which encodes a putative PDE protein highly identical
to BifA of P. aeruginosa PA14 (Kuchma et al., 2007) and P. putida KT2442 (JiménezFernández et al., 2014).
76
A.
FAM-30
PSA3335_4049
Protein A
1359pb
Superoxide
dimutase
582pb
2052pb
B.
FAM-108
dsbA
644pb
PSA3335-0619
PSA3335-0620
875pb
2060pb
ampDh2
740pb
Fig. 9. Schematic map of the Pseudomonas savastanoi pv. savastanoi NCPPB 3335
GGDEF-related insertion mutants selected by signature tagged mutagenesis (STM). (A)
Transposon insertion mutant in the PSA3335_4049 gene (FAM-30). (B) Insertion mutant in the
PSA3335_0619 gene (FAM-108). Black triangles represent the transposon location in the
genome of the mutants. dsbA, disulfide oxidoreductase-encoding gene; PSA3335-0620, gene
encoding a GGDEF domain-containing protein; ampDh2, N-acetylmuramoyl-L-alanine amidaseencoding gene.
On the other hand, mutant FAM-108 showed an insertion in PSA3335_0619 (Fig.
9B), a gene encoding an endonuclease/exonuclease/phosphatase family protein
(EEPP) located upstream of PSA3335_0620, a GGDEF domain protein-encoding gene
(Matas et al., 2012). The characterization of these two genes related to the metabolism
of c-di-GMP (PSA3335_4049 and PSA3335_0620), including the analysis of their role
in the virulence of P. savastanoi pv. savastanoi was the initial aim of this PhD Thesis.
77
78
OBJECTIVES
OBJECTIVES
Cyclic di-GMP (c-di-GMP) signaling pathways have been shown to affect virulence in
various human and animal bacterial pathogens, but only a few studies have been
conducted to document the role of c-di-GMP in the pathogenicity and virulence of
bacterial
phytopathogens.
In
a previous
search
for
attenuated
mutants
of
Pseudomonas savastanoi pv. savastanoi NCPPB 3335 during colonization of olive
plants, two transposon insertion mutants were selected, affected in genes possibly
related to the metabolism of c-di-GMP (bifA and PSA3335_0620) (Matas et al., 2012).
These results suggested a connection between c-di-GMP and the virulence of bacterial
phytopathogens of the Pseudomonas syringae complex. Taking into account the high
conservation of these two genes within the Pseudomonas genus, the overall aim of this
Thesis was to analyze their role in the virulence of P. savastanoi pv. savastanoi and
related plant pathogens, as well as in the opportunistic human pathogen Pseudomonas
aeruginosa. The following specific objectives have been undertaken:
1. To evaluate the responses to elevated c-di-GMP levels in P. savastanoi pv.
savastanoi NCPPB 3335 by the overexpression of the diguanylate cyclase
PleD* from Caulobacter crescentus.
2. To analyze the role of the bifA gene on virulence-related phenotypes in two
different strains of the P. syringae complex, P. savastanoi pv. savastanoi
NCPPB 3335 and Pseudomonas syringae pv. tomato DC3000.
3. To study the role of the putative diguanylate cyclase encoded by the P.
savastanoi
pv.
savastanoi
PAS3335_0620
gene
on
virulence-related
phenotypes in this bacterial pythopathogen, as well as in the opportunistic
human pathogen P. aeruginosa.
81
OBJECTIVES
82
GENERAL
MATERIAL AND METHODS
The general material and methods used in the three different chapters of this PhD
Thesis have been described in this section. Specific material and methods are included
within each of the different chapters.
1. Bacterial strains, plasmids and growth conditions
The common plasmids and strains used in this study are described in Table 1. The
specific plasmids constructed appear in each corresponding chapter. Bacteria were
grown at 37ºC (Escherichia coli and Pseudomonas aeruginosa strains) or 28ºC
(Pseudomonas savastanoi pv. savastanoi NCPPB 3335 and Pseudomonas syringae
pv. tomato DC3000) with aeration in Luria-Bertani (LB) medium (Miller, 1972) or Super
Optimal Broth (SOB) medium (2% bactotriptone, 0.5% yeast extract, 10 mM NaCl, 2.5
mM KCl, adjust pH to 7.0 with NaOH, autoclave to sterilize, and add 20 mM of MgCl2
(before use)) (Hanahan, 1983). Solid and liquid media were supplemented, when
required, with the appropriate antibiotics (Table 2).
2. Nucleic acids techniques.
2.1 DNA extraction and purification
Basic DNA and molecular techniques were performed following standard methods
(Sambrook and Russell, 2001). Genomic DNA was extracted using the Jet Flex
Extraction Kit (Genomed; Löhne, Germany). Plasmid DNA for cloning purposes was
extracted using GenEluteTM Plasmid Minsiprep Kit (Sigma-Aldrich, USA).
Routine plasmid clone analysis was carried out by a boiling based plasmid extraction
that followed the method described previously (Holmes and Quigley, 1981), with some
modifications. Cells from a 1.5 ml of an overnight (o/n) grown culture were centrifuged
and resuspended into 110 µl of STETL (8 % sucrose, Triton X-100, 50 mM Tris pH 8,
50 mM EDTA, 0.5 mg/ml lisozyme). After boiling during 30 sec, cells were centrifuged
15 minutes (mins) in a microcentrifuge at maximum speed. The pellet was removed
with a sterile toothpick, which was previously dipped into a 10 mg/ml RNAase solution.
Following addition of 110 µl of isopropanol, cells were centrifuged 15 mins as described
above. The precipitate was air dried and resuspended into 25 µl of distilled water.
DNA gel-purification was carried out using GFXTM PCR DNA and Gel Band
Purification Kit (GE Healthcare, UK).
2.2 DNA hybridization.
DNA hybridization was performed following standard methods (Sambrook and
Russell, 2001), using DIG-Nucleic Acid Detection kit (Roche; Mannheim, Germany),
following the instructions provided by the manufacturer. DNA was transferred onto a
85
nylon membrane by upward capillary transfer, and cross-linked by UV irradiation.
Prehybridization and hybridization stages were carried out at 65 ºC. DNA probe was
labeled by PCR reaction with chemiluminiscent digoxigenin-dNTPs using DIG Labelling
Mix (Roche; Mannheim, Germany). The primers used to generate DNA probes are
presented in specific tables within the different chapters.
2.3 DNA restriction, polymerization, and ligation procedures.
Endonucleases from Takara corp. (Kaohsiung 802, Taiwan) were used according to
the instructions provided by the manufacturer.
Go-Taq®DNA polymerase (Promega Cor.; Madison, EEUU) or Expand High Fidelity
(Roche; Mannheim, Germany) was used as appropriate.
DNA ligation was performed using T4 DNA ligase (Takara biocorp; Kaohsiung 802,
Taiwan). The concentration of the insert was calculated following the formula: [(100 ng
of insert) (bps of insert)]/ bps of vector. Fragments were combined in 1:3 ratio of vector
and insert.
2.4 DNA sequencing
The
sequencing
of
DNA
fragments
were
carried
out
by
Secugen
(http://www.secugen.es/) or Stabvida (http://www.stabvida.com).
2.5 Electrophoresis.
Conventional agarose gel electrophoresis was used to confirm plasmid purifications,
to visualize plasmids digestions, to prepare DNA fragments for Southern hybridization,
to isolate DNA bands from agarose gels, etc. Agarose (Gellyphor® Euroclone; Siziano,
Italy) was dissolved in Tris/Borate EDTA buffer (TBE). Syber ® Safe Gel Stain
(Invitrogen; Carlsbad, California, USA) was added to visualize the DNA. Gels (0.8 % 1.5 % agarose) were casted in a gel tank and electrophoresis was carried out in a
horizontal tank containing TBE buffer. Gels were imaged using Image Lab TM software
(Bio-Rad Laboratories SA; Madrid, Spain).
2.6 Transformation of bacterial strains
Plasmid were transformed into E. coli strains by heat-stock transformation
(Hanahan, 1983). Therefore, high efficiency competent cells were prepared as
described previously (Inoue et al., 1990). Pure culture of the E. coli strain was grown
o/n in 5 ml of SOB medium at 28°C. The cells were diluted 1000 times into 200 ml of
fresh SOB medium and this fresh culture was grown with shaking at 22ºC to an OD600
of 0.5. After 10 mins incubation on ice, cells were centrifuged at 2500 g for 10 mins at
86
4ºC, and resuspended in 80 ml of ice-cold TB buffer (Pipes 10 mM, CaCl2 15 mM, KCl
250 mM, MnCl2 55 mM, pH 6.7, filtrated to sterilize). Cells were incubated 10 more
mins on ice, and centrifuged as before. Finally, the pellet resuspended in 20 ml of cold
TB buffer and 1.5 ml of DMSO. Aliquots of 100 µl were kept at -80ºC. The
transformation was carried out mixing 100 μl of competent cells with plasmid DNA or
ligation reactions. The mixture was incubated on ice for 30 mins, transferred to 42 ºC
and incubated for 45 seg (heat shock). Afterwards, 1ml of SOB medium was added,
and the transformation mixture was incubated with shaking for 2h at 37ºC. The cells
were pelleted, and plated onto LB medium with the appropriated antibiotics.
For Pseudomonas spp. an electroporation protocol was carried out according the
one described by (Choi et al., 2006). Briefly, a culture of the receptor strain, grown o/n
in SOB medium, was centrifuged at 2500 g at room temperature during 3 mins and
resuspended in 300 mM sucrose solution three times. Competent cells were
transformed by electroporation, and incubated in SOB medium for 1 h (for P.
aeruginosa strains), 2 h (for P. syringae pv. tomato DC3000) or 4 h (for P. savastanoi
pv. savastanoi NCPPB 3335).
3. Construction of bacterial strains and plasmids
PCR products were cloned into the cloning vectors pGEM-T easy (Promega, USA)
or pCR2.1 (Invitrogen, California, USA) and sequenced prior to subcloning into the
relevant broad-host-range or suicide vector. To construct deletions mutants in P.
savastanoi pv. savastanoi NCPPB 3335 and P. syringae pv. tomato DC3000, DNA
fragments of a 1.2 and 0.5 Kb, respectively, corresponding to the 5' and 3' flanking
regions of the ORF to be deleted, were amplified by three rounds of PCR using
genomic DNA as a template as previously described (Zumaquero et al., 2010). The
resulting product was A/T cloned into pGEM-T-easy (Table 1) and fully sequenced to
discard mutations on flanking regions. The resulting plasmid was labeled with the nptII,
Km resistance gene, obtained from pGEM-T-KmFRT-BamHI (Table 1). For marker
exchange mutagenesis, theses plasmids were transformed by electroparation into
NCPPB 3335 or DC3000 as described previously (Pérez-Martínez et al., 2007).
Transformants were selected on LB medium containing Km, and replica plates of the
resulting colonies were made on LB-Ap plates to determine whether each
transconjugant underwent plasmid integration (ApR) or allelic exchange (ApS). Southern
blot analyses were carried to confirm that allelic exchange occurred at a single and
correct position within the genome. For each mutant, two different probes were used,
one corresponding to the gene deleted and the second corresponding to the nptII gene.
87
Construction of clean deletion mutants in P. aeruginosa PAK were carried out as
previously described (Mikkelsen et al., 2009; Mikkelsen et al., 2013). Briefly, mutator
fragments were constructed by PCR amplification of 500 bp flanking each gene of
interest. The fragments were amplified and joined by three rounds of PCR, and the
product were cloned into pCR2.1-TA and then sub-cloned into the P. aeruginosa suicide
vector pKNG101. The first crossover event was selected using Sp, and the second with
5% sucrose. Deletion mutants were confirmed using external primers that were
designed up or downstream of the mutator fragments. Chromosomal complementation
of ∆dgcPPAK was carried out using the pME6182 that contain the mini-Tn7 transposon.
DNA fragments of 200 bp corresponding with the promoter localized upstream of dsbA
gene, and other fragment corresponding with the dgcPPAK gene, were amplified and
cloned separately in pGEM-T-easy. The fragments were HindIII/EcoRI and EcoRI/KpnI,
respectively, digested and cloned into an HindIII/KpnI pME6182 vector. The pME6182dgcPPAK was introduced in the ∆dgcPPAK mutant by tetraparental conjugation. Strains
used were; the donor strain (D) DH5α pEM6182-dgcPPAK, the receptor strain (R)
∆dgcPPAK mutant, and two auxiliary strains (A1 and A2): HB101 carrying pRK600 (tra
genes), and S17λpir carrying pUB-BF13 (transposase gene). Cultures were grown o/n
with shaking in LB at 37ºC, adjusted to an OD600 of approximately 4, and mixed in
1:1:1:3 volume ratios of D:A1:A2:R. Cells were incubated onto sterile filters set on LB
plate and incubated at 37ºC for 6h. Then, filters were removed and placed into NaCl
0.9% and vortexed. Bacterial cells were plated on LB supplemented with Nf and Gm.
To confirm that the mini-Tn7-dgcPPAK insertion had occurred in the correct position,
primers Tn7-R-109 and Tn7-glmS-PAO1 were used.
4. Phylogenetic analysis
The phylogenetic analyses of proteins were performed using aminoacidic sequences
obtained from the NCBI (http://www.ncbi.nlm.nih.gov/) and the ASAP genome
(https://asap.ahabs.wisc.edu/asap/logon.php) databases. Multiple alignments of the
different proteins were performed with ClustalW (Larkin et al., 2007), and phylogenetic
trees were obtained using the neighbor-joining method (Saitou and Nei, 1987). The
percentage of replicate trees in which the associated taxa were clustered in the
bootstrap test (10,000 replicate) was shown next to the branches. The phylogenetic
analyses were conducted using MEGA5 (Tamura et al., 2011).
88
Table 1. Bacterial strains and original plasmids used in this study.
Strain/Plasmids
Relevant characteristicsa
Reference or source
Strains
P.savastanoi pv. savastanoi
NCPPB 3335
(Pérez-Martínez et al.,
Wild-type strain
2007)
P. syringae pv. tomato
DC3000
Wild-type strain
(Buell et al., 2003)
Wild-type strain
S. Lory
F -, ϕ80dlacZ M15, (lacZYA-argF) U169, deoR,
(Hanahan, 1983)
P. aeruginosa
PAK
E. coli
DH5α
recA1, endA, hsdR17 (rk - mk -), phoA, supE44,
thi-1, gyrA96, relA1.
GM2929
F -, ara-14, leuB6, thi-1, tonA31, lacY1, tsx-78,
(Palmer and Marinus,
galK2, galT22, glnV44, hisG4, rpsL136, xyl-5,mtl-
1994)
1, dam13::Tn9, dcm-6, mcrB1, hsdR2, mcrA,
recF143. (SpR CmR).
TOP10
F– mcrA, Δ(mrr-hsdRMS-mcrBC), Φ80lacZΔM15,
Invitrogen, USA
lacX74, recA1, araD139, Δ(ara leu) 7697, galU,
endA1, nupG. (SpR).
ONIMAX
F′ proAB+, lacIq, lacZΔM15, Δ(ccdAB)}, mcrA,
Invitrogen,USA
Δ(mrr- hsdRMS-mcrBC)φ80(lacZ)ΔM15,
Δ(lacZYA-argF), U169, endA1, recA1, supE44, thi1, gyrA96, relA1, tonA ,panD (TcR).
Original Plasmids
pGEM-T vector
Cloning vector containing ori f1 and lacZ (ApR)
Promega, USA
(Zumaquero et al.,
R
R
R
pGEM-T- KmFRT-BamHI
Contains Km from pKD4 (Ap Km )
2010)
pCR2.1
TA cloning, lacZα, ColE1, ori f1. (ApR, KmR)
Invitrogen,USA
pLRM1-GFP
pBBR1-MCS5::PA1/04/03-RBSII-GFPmut3*-T0-
(Rodríguez-Moreno et
R
T1(Gm )
pJB3
a
al., 2009)
R
R
Cloning vector, Plac promoter (Ap , Tc )
(Blatny et al., 1997)
Ap, ampicillin; Cm, chloramphenicol; Gm, gentamycin; Km, kanamycin; Sp, spectinomycin and. Tc,
tetracycline
89
Table 2. Concentration (µg/ml) of selective agents used in this thesis.
E.
coli strain
P. syringae strainsa
P. aeruginosa strains
100
300
---
---
---
50
15 (Pto)
---
Gentamicin (Gm)
10
10
100
Spectomycin (Sp)
50
---
2000
Nitrofurantoine (Nf)
---
25
25
Tetracycline (Tc)
10
10
200
X-Gal
40
40
40
Sucrose
---
---
5%
Compound
Ampicillin (Ap)
Cabernicillin (Cb)
Kanamicyn (Km)
a
90
500 (for selection)
300 (for maintenance)
7 (Psv)
Psv, P. savastanoi pv. savastanoi; Pto, P. syringae pv. tomato.
CHAPTER I
Bioinformatic prediction of GGDEF and EAL proteins in the
genome of Pseudomonas savastanoi pv. savastanoi
NCPPB 3335 and responses to elevated c-di-GMP levels in
this phytopathogenic bacteria.
_______________________________________________
Results presented in this chapter are included in the following publication:
Pérez-Mendoza D, Aragón IM, Prada-Ramírez HA, Romero-Jiménez L, Ramos C, Gallegos MT & Sanjuán J (2014) Responses to Elevated c-di-GMP Levels in Mutualistic and Pathogenic
Plant-Interacting Bacteria. PLoS One 9: e91645.
CHAPTER I
INTRODUCTION
The permanent exchange of multiple signals between plant and bacteria during the
establishment of pathogenic or mutualistic interactions need to be integrated to
coordinate, in time and space and upon the local environmental conditions, the
expression of essential determinants allowing colonization and eventually invasion of
the host. Bacterial motility and chemotaxis, exopolysaccharide (EPS) production,
biofilm formation, adhesion and secretion of effector proteins are key traits among
bacteria that interact with plants (Danhorn and Fuqua, 2007; Rodriguez-Navarro et al.,
2007; Yousef-Coronado et al., 2008). Complex regulatory networks involving inter- and
intracellular signalling, orchestrate fine-tuning of all these bacterial traits.
In the last decade cyclic-di-GMP (c-di-GMP) has emerged as an ubiquitous second
messenger in bacteria. Initially identified as an allosteric activator of bacterial cellulose
synthase (Ross et al., 1987), this second messenger has also been shown to regulate
biofilm formation, motility, cell cycle, virulence and other important morphological and
cellular processes in bacteria, playing a key role in the switch between motile and
sedentary lifestyles (Paul et al., 2004; Jenal and Malone, 2006; Romling et al., 2013).
Despite a recent burst of research in this field, knowledge on c-di-GMP signalling
pathways remains largely fragmentary and the molecular mechanisms of regulation
and even c-di-GMP targets are yet unknown for most bacteria (Romling et al., 2013).
Cyclic di-GMP is synthesized from two molecules of GTP by the action of
diguanylate cyclases (DGC), and hydrolyzed by specific phosphodiesterases (PDE).
GGDEF protein domains function in c-di-GMP synthesis, whereas the c-di-GMP PDE
activity is associated with EAL or HD-GYP domains (Galperin et al., 2001; Paul et al.,
2004; Christen et al., 2005; Ryan et al., 2006a). Bacterial genomes usually encode
several and very often up to dozens of proteins that synthesize or hydrolyze c-di-GMP,
which contrasts with the relatively low number of known effector molecules whose
activity and/or stability is modulated upon binding to c-di-GMP. This secondary
messenger binds to diverse classes of structurally and functionally unrelated proteins
(like enzymes or transcription factors) and even to RNAs (riboswitches) (Boyd and
O'Toole, 2012). Thus, c-di-GMP can act at the transcriptional, posttranscriptional and
posttranslational levels. Moreover, it has been proposed that distinct c-di-GMP
signalling modules are separated in time and/or space within the cell (Hengge, 2009).
Approaches like the artificial alteration of the cellular c-di-GMP economy allow focusing
on particular c-di-GMP functional targets. It has been reported that the overproduction
of GGDEF domain proteins very often triggers phenotypes related to sessility, like the
synthesis of adhesins and biofilm matrix components, whereas an excess production of
93
CHAPTER I
proteins with EAL domains usually causes the opposite phenotypes (Kulasakara et al.,
2006; Cotter and Stibitz, 2007; Tamayo et al., 2007; Jimenez et al., 2012).
In plant pathogenic bacteria, few proteins have been experimentally demonstrated
as c-di-GMP signalling components. RpfG and XcCLP of Xanthomonas campestris, an
HD-GYP domain-containing protein and a c-di-GMP receptor, respectively, connect
cell-cell signalling to virulence gene expression (Ryan et al., 2007; Chin et al., 2010). In
Dickeya dadantii, c-di-GMP phosphodiesterases EcpB and EcpC were shown to
regulate multiple cellular behaviors and virulence, by controlling the expression of the
type III secretion system [T3SS; (Yi et al., 2010)]. In the Pseudomonas syringae
complex, which includes economically important bacterial phytopathogens and relevant
models for the study of plant-microbe interactions (Mansfield, 2009), the relation
between c-di-GMP and virulence has not been studied yet. Pseudomonas savastanoi
pv. savastanoi, the causal agent of olive (Olea europaea) knot disease, is an
unorthodox member of the P. syringae complex and a model bacterium in which to
study the molecular basis of pathogenesis and tumour formation in woody hosts (Matas
et al., 2012; Ramos et al., 2012).
In this work, we have identified bioinformatically DGC and PDE proteins in the
genome of P. savatanoi pv. savastanoi NCPPB 3335. Also, we have studied the effects
associated with the overexpression of the well-characterized Caulobacter crescentus
DGC protein PleD* in this bacterial pathogen.
94
CHAPTER I
Strains bacterial and plasmid
P. savastanoi pv. savastanoi NCPPB 3335 strain (Pérez-Martínez et al., 2007) were
transformed by electroporation with the pJB3 plasmid (Blatny et al., 1997), and the
derivate plasmid pJB3-pleD* (Pérez-Mendoza et al., 2014). The bacterial medium and
the growth conditions used for these strains were described in the general Material and
Methods.
Intracellular c-di-GMP measurements
c-di-GMP was extracted using a protocol based on a previous report (Amikam et al.,
1995). Three biological replicates of each strain were grown in 10 ml of LB broth.
Formaldehyde at a final concentration of 0.19 % was added and the cells harvested by
centrifugation (10 mins at 4000 rpm). The pellet was washed in 1 ml of iced deionised
water, centrifuged for 3 mins at 13000 rpm, then resuspended in 0.5 ml of iced
deionised water and heated to 95ºC for 5 mins. A volume of 925 μl of iced absolute
ethanol was added to reach a final concentration of 65%. Nucleotides were extracted
by 30 sec of vortex followed by a centrifugation step (3 mins at 13000 rpm).
Supernatants containing extracted nucleotides were then evaporated to dryness at
50°C in a speed-vacuum system. The pellet was resuspended by vigorous vortexing in
300 μl of AcNH4 10 mM (pH 5.5). Samples were filtered through 0.45 μm GHP
membranes (GHP Acrodisc, PALL). Samples were spiked at a concentration of 250 nM
by mixing 100 μl of a solution of 750 nM of synthetic of c-di-GMP (Axxora) disolved in
AcNH4 10 mM pH 5.5 with 200 μl of each sample. Samples were analyzed by reversed
phase-coupled HPLC-MS/MS. High performance liquid chromatography was performed
on an Agilent 1100 coupled to a 3x125 mm column Waters Spherisorb 5 µm ODS2 (C18). Running conditions were optimised using synthetic c-di-GMP as a reference. ESIMS mass spectra were measured on an Esquire 6000 (Bruker Daltonics) and on a
TSQ7000 (Finnigan) mass spectrometer. Matrix-assisted laser desorption ionization
spectra were measured on a Reflex III spectrometer (Bruker Daltonics). To confirm the
identity of the substance, relevant peaks were fragmented by ESI-MS using the
positive ion mode. Three major ions were visible in the c-di-GMP fragmentation pattern,
and m/z 152 and 540 corresponded to products from single bond fragmentation, and
248 originated from double bond fragmentations. The area of the ion m/z 540 peak was
used to estimate the amount of c-di-GMP in each sample (similar values were obtained
with the other ions; data not shown).
For quantification, a standard curve was established using synthetic c-di-GMP
95
CHAPTER I
(Axxora) dissolved in ammonium acetate (10 mM pH 5.5) at a range of concentrations
(20 nM, 200 nM, 2 μM and 20 μM). After subtracting the basal 250 nM spike, c-di-GMP
concentrations in each strain culture were standardized with the total protein.
Motility assays
For swimming motility assays the P. savastanoi pv. savastanoi NCPPB 3335
transformants, carrying plasmids pJB3 and pJB3-pleD*, were grown on LB plates for
48 h, resuspended in 10 mM MgCl2 and adjusted to an OD660 of 2.0. Aliquots of 2 μl
were inoculated in the centre of 0.3% agar LB plates with Tc and incubated 72 h at
25°C. The diameters of the swimming halos were measured after 24, 48, and 72 h on
LB plates.
Exopolysaccharide detection with congo red o calcofluor staining
For P. savastanoi pv. savastanoi NCPPB 3335 congo red or calcofluor staining, was
carried out on LB medium supplemented with congo red (CR) 50 μg/ml or calcofluor
(CF) 200 μg/ml (in solid media) or 100 μg/ml (in liquid media). Quantification of the
exopolysaccharides CF+ was performed as follows: P. savastanoi pv. savastanoi
transformants were refreshed on LB plates supplemented with Tc. Bacteria were
suspended in 3 ml of 10 mM MgCl2 and diluted into 10 ml flasks containing MM
supplemented with CF (100 μM final concentration) up to initial OD600 = 0.05 and
incubated at 20°C under agitation for 24 h. Afterwards, cultures of the different strains
were centrifuged for 10 mins at 4000 rpm. Supernatant containing broth with unbound
CF of each biological replicate was removed, the pellet was suspended in 2 ml of
distilled water and disposed in wells of 24-well plates. Similar growth of all strains was
confirmed and CF binding measurements for 3 biological replicates of each strain were
performed in a PTI fluorimeter (Photon Technology International), expressing the
results in arbitrary units ± standard error.
Biofilm assays
Biofilm formation by P. savastanoi was analyzed on glass surfaces using a static
microcosm assay (Pliego et al., 2008). Static microcosms were established using 50 ml
polypropylene Falcon tubes containing 15 ml of LB-Tc medium with a sterile object
slide (25 mm x 15 mm x 1.5 mm) placed inside. Overnight LB cultures were used to
inoculate microcosms to densities of approximately 107 cfu/ml (OD600 = 0.1).
Microcosms were incubated for 24 and 48 h, vibration-free, at 28°C with lids loosely in
place. To quantify the biofilms, 500 µl of 0.1% crystal violet (CV) was added to each
object slide and left to stain for 30 min. CV was removed by aspiration and each object
96
CHAPTER I
slide was washed carefully three times with deionized water. CV acceded to slide was
removed by pipetting with one ml of 70% of ethanol, and quantified by measurement of
A595 (Pérez-Mendoza et al., 2011b). Air-Liquid interface biofilm assays were carried out
in glass tubes with 4 ml of diluted cultures (OD600 = 0.05) in MM (Robertsen et al.,
1981) supplemented with 50 mM glucose. These cultures were grown under static
conditions at 20ºC for 72 h. A representative pellicle formed in the interface from each
strain was imaged.
Pseudomonas savastanoi pv. savastanoi virulence assays
Olive plants (Olea europaea L.) derived from seeds germinated in vitro (originally
collected from a cv. Arbequina plant) were micropropagated, rooted and maintained as
previously described (Rodríguez-Moreno et al., 2008; Rodríguez-Moreno et al., 2009).
Micropropagated olive plants were infected in the stem wound with bacterial
suspension (approximately 103 CFU) and incubated for 30 days in a growth chamber
as described by Rodríguez-Moreno et al., (2008). The morphology of the olive plants
infected with bacteria was visualized using a stereoscopic microscope Leica MZ FLIII
(Leica Microsystems, Wetzlar, Germany). Pathogenicity of P. savastanoi pv.
savastanoi isolates in 1-year-old olive explants (lignified plants) was analyzed as
previously described (Penyalver et al., 2006; Pérez-Martínez et al., 2007).
Morphological changes, scored at 90 dpi, were captured with a high-resolution digital
camera Canon D6200 (Canon Corporation, Tokyo, Japan). Knot volume was
calculated by measuring length, width (subtracting the stem diameter measured above
and under the knot from that measured below the knot) and height of the knot with a
Vernier caliper (Moretti et al., 2008; Hosni et al., 2011). Statistical data analysis was
performed by ANOVA test (P ≤ 0.05).
Preparation of mRNA and quantitative RT-PCR assay
P. savastanoi pv. savastanoi NCPPB 3335 carrying plasmids pJB3 and pJB3pleD*
were grown until OD600 of 0.5 in LB medium supplemented with the appropriate
antibiotics at 28°C. Cells were induced in Hrp-inducing medium (Huynh et al., 1989) by
6 h at 28°C. Then, cells were pelleted and processed for RNA isolation using TRI
Reagent LS (Molecular Research Center, Cincinnati, OH, USA) according to the
manufacturer’s instruction, except that the TRI Reagent was preheated at 70°C and the
lysis step was carried out at 65°C. The RNA obtained was treated with TURBO DNAfreeTM14-Kit (Applied Biosystems; California, USA). RNA concentration was
determined spectrophotometrically and its integrity was assessed by agarose gel
97
CHAPTER I
electrophoresis. DNA-free total RNA (1 μg) was retrotranscribed to cDNA with the
iScript™ cDNA18 synthesis kit (BioRad; California, USA) using random hexamers. The
specific primer pairs used to amplify cDNA are shown in Table 1. Primer efficiency,
qRT-PCR´s and confirmation of the specificity of the amplification reactions were
performed as described in Vargas et al., (2011). Relative transcript abundance was
calculated using the ΔΔCt method (Livak and Schmittgen, 2001). Transcriptional data
were normalized to the housekeeping gene gyrA using Bio-Rad i5 software v.2.1. The
expression of a given gene relative to gyrA was calculated as previously described in
(Vargas et al., 2011).
Table 1. Oligonucleotides used for the qRT-PCR assays.
Oligonucleotide
hrpL-F-110
hrpL-R-266
hrpA-F-93
hrpA-R-267
iaaM1-F-293
iaaM1-R-501
gyrA-R
gyrA-F
a
Sequence (5´to 3´)a
CAGATGCTCAGAGCGTTCAT
GATAGGGCTGGCGATACATT
ATCAACAGCGTCAAGAGCAG
ATTTGGTTGGAAAGGGCTTC
GGCCTTTTCCACTACCTGAA
GCAACTAAAGAACCGCCTTC
TTCCAGTCGTTACCCAGCTCG
GACGAGCTGAAGCAGTCCTACC
F and R, forward and reverse primer, respectively. Numbers included after F and R in primers names
correspond to the hybridization position of the 3 end of the primer in the corresponding ORF sequence.
98
CHAPTER I
RESULTS
The Pseudomonas savastanoi pv. savastanoi NCPPB 3335 genome encodes 34
proteins showing GGDEF or GGEDF/EAL domains
DGCs and PDEs contain GGDEF and EAL domains, respectively (Solano et al.,
2009). In addition, DGCs can also carry a RXXD (I-site) motif located 5 amino acids
upstream of the GGDEF motif (A-site), which binds c-di-GMP and provides allosteric
control of its activity (Chan et al., 2004). Therefore, according to the amino acids
conservation in the A- and I-sites, DGCs can be classified in four different groups: I+A-,
I-A+, I-A- and I+A+ (Jenal and Malone, 2006). Only proteins with a conserved A+ GGDEF
motif present DGC activity. Bioinformatics analysis of the P. savastanoi pv. savastanoi
NCPPB 3335 genome (Rodríguez-Palenzuela et al., 2010) revealed the existence of
34 proteins showing a GGDEF domain in this bacterium, of which 14 also encode an
EAL domain (Table 1). These results suggest that DGC and PDE activities are closely
linked in Psv NCPPB 3335. A detail analysis of these GGDEF proteins allowed us to
classified them in several A- and I-sites profiles: I+A+ (17 proteins), I-A+ (9 proteins), I+A(3 proteins) and I-A- (5 proteins) (Table 2).
BLAST searches of these P. savastanoi pv. savastanoi NCPPB 3335 GGDEF
proteins against the genomes of several Pseudomonas spp. strains revealed a high
level of conservation of all these proteins among P. syringae strains. In fact, P.
syringae pv. syringae B728A shared all 34 proteins with NCPPB 3335, while other P.
syringae strains shared from 88.23% to 94.1% of them (Table 2). A lower level of
conservation was observed in the genomes of non-pathogenic Pseudomonas, such as
Pseudomonas putida KT2440 (47%) and Pseudomonas protegens Pf-5 (53%) (Table
3).
99
CHAPTER I
Table 2. Functional classification of GGDEF proteins in the genome of Pseudomonas
savastanoi pv. savastanoi NCPPB 3335 according to their A- and I-site motifs.
A- and I-site motifs of GGDEF proteinsa, b
+
+
I A
AER-0000114
I-A+
AER-0000738
I+AAER-0002178
I-AAER-0001396
AER-0000200
AER-0001417
AER-0002736
AER-0002781
AER-0000238
AER-0002088
AER-0004589
AER-0003822
AER-0000522
AER-0003429
AER-0003945
AER-0000560
AER-0004496
AER-0004088
AER-0000667
AER-0004508
AER-0001090
AER-0004828
AER-0002086-7
AER-0004957
AER-0002143
AER-0004998
AER-0002353
AER-0002355
AER-0003141
AER-0003662
AER-0004316
AER-0004510
AER-0004766
AER-0004873
a
Light grey background indicates GGDEF proteins also showing an associated EAL
domain.
b
Proteins are named after their corresponding ASAP ID number in the genome of
P. savastanoi pv. savastanoi NCPPB 3335 (http://www.genome.wisc.edu/tools/asap.htm).
Table 3. Conservation of P. savastanoi pv. savastanoi NCPPB 3335 GGDEF proteins in
the genomes of other Pseudomonas strains.
Pseudomonas strains
100
Conservation (%)
P. syringae pv. tomato DC3000
88.23
P. syringae pv. phaseolicola 1448
91.2
P. syringae pv. syringae B728A
100.0
P. syringae pv. tabaci ATCC 11528
91.2
P. syringae pv. aesculi NCPPB 3681
94.1
P. protegens Pf-5
53.0
P. putida KT2440
47.0
CHAPTER I
Increasing the intracellular levels of c-di-GMP in Pseudomonas savastanoi pv.
savastanoi NCPPB 3335
To increase the intracellular levels of c-di-GMP in P. savastanoi pv. savastanoi
NCPPB 3335, we used the PleD* protein, a constitutively active DGC variant of the
well-characterised DGC PleD from C. crescentus (Aldridge et al., 2003). The pleD*
gene was cloned under the control of the Plac promoter in a plasmid vector, pJB3
(Blatny et al., 1997), which can replicate in Pseudomonas strains. The resulting
construction pJB3-pleD* (Pérez-Mendoza et al., 2014) was introduced in the P.
savastanoi NCPPB 3335 by electroporation and the intracellular c-di-GMP contents
were quantified by a mass spectrometry analysis (HPLC-MS). Overexpression of pleD*
generated a strong increases in the levels of c-di-GMP (approximately 200 foldchanged) in P. savastanoi pv. savastanoi NCPPB 3335 as compared to the control
Quantiity c-di-GMP (nM)
strain containing the empty vector pJB3 (Fig. 1).
100000
10000
1000
100
10
1
pJB3 3335 PsvpJB3-pleD*
Psv NCCPP
NCCPP 3335
+ pJB3
+ pJB3::PleD*
Fig. 1. Quantification of total c-di-GMP in cell extracts of P. savastanoi pv. savastanoi
NCPPB 3335 strains by HPLC-MS. Mass chromatography data corresponding to an ion with
m/z 540 was used for quantification of c-di-GMP. Values are the means of 3 biological replicates
± standard error.
Effects of elevating c-di-GMP intracellular levels on free-living bacterial cell
behaviors
Previous studies in different bacteria have shown that an increased of the
intracellular c-di-GMP levels impacts various bacterial phenotypes like colony
morphology, motility, EPS production and biofilm formation (Christen et al., 2006; Jenal
and Malone, 2006; Kulasakara et al., 2006; Pérez-Mendoza et al., 2011a).
High intracellular levels of c-di-GMP artificially generated by overexpressing DGCs,
usually reduce flagella- and pili-based motility (Simm et al., 2004; Ryjenkov et al.,
101
CHAPTER I
2006). Swimming and surface motility under high intracellular levels of c-di-GMP were
evaluated in P. savastanoi pv. savastanoi NCPPB 3335 expressing pleD*, and
compared with the wild-type strain containing the empty vector. The presence of the
pJB3-pleD* plasmid caused a complete turned off of the swimming motility in Psv
NCPPB 3335 at 24, 48 and 72 h of incubation at 25ºC (Fig. 2). In agreement with
Pérez-Martínez et al., (2007), P. savastanoi pv. savastanoi NCPPB 3335 did not show
any surface motility under the conditions tested, therefore it was not possible to
evaluate the influence of pleD* on this feature.
A
Swimming Motility (mm)
B
45
40
35
30
25
20
15
10
5
0
pJB3
pJB3
pJB3::PleD*
pJB3-pleD*
24h
48h
72h
Fig. 2. Swimming motility of PleD* transformants in P. savastanoi pv. savastanoi NCPPB
3335. (A). Motility (LB with 0,3% agar supplemented with tetracycline) of NCPPB 3335 + pJB3
(left) and NCPPB 3335 + pJB3-pleD* (right) after incubation for 48 h. (B). Motility of
transformants with or without pleD* at 24, 48, and 72 h. Results shown are the mean of three
different replicates. Error bars represent the standard deviation from the average.
In many bacteria, c-di-GMP induces congo red (CR) and calcofluor (CF) binding by
extracellular matrix components (Solano et al., 2002; Christen et al., 2006; Recouvreux
et al., 2008; Pérez-Mendoza et al., 2011a). In P. savastanoi pv. savastanoi NCPPB
3335 expressing pleD* significant CR and CF-binding differences were observed (Fig.
3A and 3B) as compared with the wild-type strains containing the empty vector.
Moreover, the colony morphology of this pathogenic bacterium under high intracellular
c-di-GMP levels was severely affected showing a pronounced wrinkly phenotype (Fig.
3A).
102
CHAPTER I
A
B
Abitrary Units
C
pJB3
pJB3-pleD*
pJB3
pJB3-pleD*
2.50E+06
2.00E+06
1.50E+06
1.00E+06
5.00E+05
0.00E+00
Psv
pJB3Tc19
Psv
pJB3
Psv pJBpleD*
Psv
pJB3-pleD*
Fig. 3. Exopolysaccharides production of a P. savastanoi pv. savastanoi NCPPB 3335
PleD* transformant. (A) Colony morphology of NCPPB 3335 cells transformed with pJB3
(empty vector) or pJB3-pleD* grown at 28ºC in LB plates supplemented with congo red (125
µg/ml) during 3 days. (B) Visualisation of calcofluor-derived fluorescence of P. savastanoi
NCPPB 3335 transformants grown in LB plates. (C) Quantification of calcofluor-derived
fluorescence P. savastanoi pv. savastanoi NCPPB 3335 cells grown in MM liquid medium. The
bars represent the mean values from 3 independent cultures ± standard error. Psv, P.
savastanoi pv. savastanoi NCPPB 3335.
To determine the impact of high c-di-GMP levels on EPS production, P. savastanoi
cells were grown in MM liquid medium and their CF-derived fluorescence was
quantified using a fluorometer. Overexpression of pleD* generated a six-fold increase
in the fluorescence of P. savastanoi pv. savastanoi NCPPB 3335 cells grown in the
presence of CF (100μM) (Fig. 3C).
Cyclic
di-GMP-regulated
production
of
extracellular
matrix
components
(polysaccharides and proteins) has been directly linked to the aggregative behavior of
different bacteria (Ude et al., 2006; Klebensberger et al., 2009; Borlee et al., 2010). A
strong aggregative phenotype on glass slide was observed in P. savastanoi pv.
savastanoi NCPPB 3335 with pJB3-pleD* compared to the control strain containing the
empty vector pJB3 (Fig. 4A). Quantification of biofilm formation under this condition
showed an approximately two-fold increases in the strain expressing pleD*.
103
CHAPTER I
Additionally, overexpression of pleD* in Psv promoted the formation of an air-liquid
interface biofilm maintained by bacterial attachment to the walls of the wells at the
meniscus (Fig.4C). The formation of similar air-liquid interface biofilm has been
previously observed in some environmental Pseudomonas isolates (Ude et al., 2006;
Robertson et al., 2013).
A
pJB3
pJB3-pleD*
OD595
B
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
pJB3
pJB3
pJB3-pleD*
pJB3::PleD*
C
pJB3
pJB3-pleD*
Fig. 4. Biofilm formation by P. savastanoi pv. savastanoi NCPPB 3335 cells
overexpressing PleD*. (A) Biofilm formation of P. savastanoi pv. savastanoi NCPPB 3335
transformants on glass slides after 24h growing in LB medium under static conditions. (B)
Quantification of the biofilms shown in (A) using crystal violet. The bars represent the mean
values from 3 independent cultures ± standard deviation. (C) Air-Liquid biofilms produced by
NCPPB 3335 expressing pleD* or containing the empty vector. Cells were grown for 72 h at
20ºC under static conditions in MM medium supplemented with 50 mM glucose and tetracycline.
Phenotypes associated with high c-di-GMP levels in olive plants
To study the effect of pleD* expression in the virulence of P.savastanoi pv.
savastanoi NCPPB 3335, transformants carrying plasmids pJB3 or pJB3-pleD* were
inoculated both on in vitro micropropagated olive plants and on 1-year-old olive plants,
and disease severity was evaluated after 30 days or 90 days, respectively. In addition,
the stability of plasmid pJB3-pleD* was determined in P. savastanoi pv. savastanoiinfected micropropagated olive plants, and determined that from 7 dpi until the end of
104
CHAPTER I
the experiment (30 dpi), only about 25% of the cells isolated from olive knots were
resistant to tetracycline, and thus stably maintained the plasmid (Fig. 5). Despite the
low stability of plasmid pJB3-pleD* in P. savastanoi NCPPB 3335, the results showed
that expression of pleD* drastically increased knot size both on in vitro
micropropagated (Fig. 6A) and 1-year-old olive plants (Fig. 6B). In fact, knot volume
increased significantly (P ≤ 0.05) in the stems of one-year old olive plants inoculated
with the pleD* transformant as compared with those inoculated with the control strain
(wild-type strain carrying pJB3; Fig. 6C). Conversely, transverse sections of knots
induced at 90 days post-inoculation (dpi) by the pleD* transformant on 1-year-old olive
plants showed a reduced necrosis of the internal tissues as compared with those
developed in plants inoculated with the control strain (Fig. 6C), suggesting a delay in
the maturation process of the knots induced by the pleD* transformant.
1.00E+08
1.00E+07
log CFU / mL
CFU / mL
1.00E+06
1.00E+05
1.00E+04
LB+Tc
1.00E+03
LB
1.00E+02
1.00E+01
1.00E+00
0
10
20
time (dpi)
30
40
Fig. 5. Maintenance of plasmid pJB3-pleD* in P. savastanoi pv. savastanoi NCPPB 3335
inoculated on young micropropagated olive plants. Colony forming units (CFU) / mL of P.
savastanoi cells recovered from olive plants and plated on LB medium with tetracycline
(triangles) and without tetracycline (circles) at 0, 7, 15, 20 and 30 dpi. Each point represents the
mean values from 3 independent replicates ± standard deviation.
105
CHAPTER I
A
C
Knot Volume (mm 3)
B
Psv pJB3
Psv pJB3-pleD*
1000
800
600
400
200
0
Psvwt
pJB3
PleD
Psv
pJB3-pleD*
Fig. 6. Virulence of P. savastanoi pv. savastanoi NCPPB 3335 expressing the pleD* gene
in olive plants. (A) Knots induced by Psv pJB3 (left), and Psv pJB3-pleD* (right), on young
micropropagated olive plants at 30 dpi and (B) in one year-old olive plants at 90 dpi. (C) Cross
sections of knots of one year-old olive plants infected with the indicate strains and their mean
volumes. Knot sizes are the means of 6 different knots ± standard error. Psv, P. savastanoi pv.
savastanoi NCPPB 3335.
The symptomatology observed in olive plants infected with P. savastanoi pv.
savastanoi NCPPB 3335 overexpressing the pleD* gene suggested the existence of a
possible interplay between pleD*-mediated intracellular levels of c-di-GMP and the
expression of both phytohormones- and type III secretion system (T3SS)-related
genes. In order to analyze the expression dependency of some of these genes (hrpA,
hrpL and iaaM) on the intracellular levels of c-di-GMP, qRT-PCR experiments were
carried out using RNA samples isolated from NCPPB 3335 cells expressing or not the
pleD* gene. While the T3SS-related genes hrpA and hrpL encodes for the Hrp pilin and
an alternative sigma factor regulatory protein, respectively, the iaaM gene encodes for
the first enzyme involved in the biosynthesis of indole-3-acetic acid from tryptophan
(tryptophan monooxygenase). In agreement with expression analysis previously
reported for other P. savastanoi pv. savastanoi genes (Matas et al., 2014), these
assays were performed 6 h after the transfer of P. savastanoi cells to Hrp-Inducing
medium (Huynh et al., 1989). A decrease in the transcript levels of the hrpL gene
(approximately 1.8 fold) was observed in the overexpressing PleD* strain. However, no
differences between in the transcript levels of the hrpA and iaaM genes was observed
between P.savastanoi pv. savastanoi NCPPB 3335 derivatives expressing or not the
pleD* gene (Fig. 7).
106
CHAPTER I
Normalized Fold Change
1.2
1
0.8
0.6
0.4
0.2
0
hrpL
hrpA
iaaM-1
Fig. 7. Expression of T3SS-related and IAA biosynthetic genes in P. savastanoi pv.
savastanoi NCPPB 3335 under high levels of c-di-GMP. Quantitative reverse-transcription
polymerase chain reaction (qRT-PCR) in NCPPB 3335 pJB3-pleD* vs. NCPPB 3335 pJB3 at 6
h after transfer to Hrp-inducing medium. The fold change was calculated after normalization
using the gyrA gene as an internal control. The results represent the means of three
independent experiments. Error bars represent the standard deviation from the average.
Asterisks indicate significant differences (P = 0.05) between the values obtained for the different
strains.
107
CHAPTER I
DISCUSSION
Many bacterial genomes encode multiple proteins involved in the c-di-GMP turnover,
with a special abundance among bacteria with a variety of lifestyles and coevolutionary
relationships with eukaryote hosts (Romling et al., 2005). This contrasts with the
comparatively few c-di-GMP protein receptors/effectors known so far which, unlike c-diGMP metabolizing proteins, are structurally and functionally more diverse and yet
hardly identifiable through bioinformatics (with the exception of PilZ domains (Ryjenkov
et al., 2006)). Thus, besides genomics and bioinformatics, additional research
approaches need to be implemented to uncover novel c-di-GMP regulation pathways,
particularly in bacteria associated with plants. In agreement with the number of proteins
related to the metabolism of c-di-GMP reported in Pseudomonas aeruginosa
(Kulasakara et al., 2006), our study revealed the existence of 34 common GGDEF or
GGDEF/EAL proteins in the genomes of P. savastanoi pv. savastanoi NCPPB 3335
and P. syringae pv. syringae B728a, many of which were also found in the genomes of
other P. syringae pathovars (Table 2 and Table 3). This high conservation of GGDEF
or GGDEF/EAL proteins among P. syringae and P. savastanoi strains isolated from
different hosts, suggests a possible role of these proteins in the colonization, infection
and/or interaction with their respective plant hosts.
Overexpression of pleD* in P. savastanoi pv. savastanoi NCPPB 3335, resulting in
an increased intracellular level of c-di-GMP (Fig. 1), was here associated with a
modification of several free-living phenotypes (Fig. 2, Fig. 3 and Fig. 4) in this bacterial
phytopathogen. Previous studies, have also reported a modification of these
phenotypes in other bacteria synthesising high levels of c-di-GMP (Simm et al., 2004;
Ryjenkov et al., 2006; Ude et al., 2006). Also, and more remarkably, we report that high
levels of c-di-GMP in P.savastanoi NCPPB 3335 have a clear effect on the interaction
of this pathogen with olive plants (Fig. 6). Despite the low maintenance of plasmid
pJB3-pleD* in P. savastanoi pv. savastanoi NCPPB 3335 (Fig. 5), overexpression of
the pleD* gene in this bacterium resulted in an increased knot size on olive plants (Fig.
6). However, we could associate this phenotype with significant changes in the
expression levels of the iaaM gene (Fig. 7), suggesting that besides IAA production,
additional bacterial traits may also affect knot size. In fact, knot induction by P.
savastanoi-infected plants has been shown to be dependent on several other factors,
including a putative DGC (Matas et al., 2012). Although increased knot size could be
seen as an increased virulence of the strain, a detailed inspection of knots also showed
a reduced necrosis of the internal tissues (Fig. 6C), suggesting a delay in the
108
CHAPTER I
maturation of the knots induced by the P.savastanoi PleD* transformant. Regulation of
virulence by c-di-GMP in bacterial phytopathogens belonging to the P. syringae
complex, which includes P. savastanoi, has not been reported to date. However, c-diGMP has been shown to negatively regulate hrpL and hrpA transcription in the
bacterial phytopathogen D. dadantii, through a mechanism probably mediated by RpoN
(Yi et al., 2010). Also, an artificial increase in c-di-GMP levels in P. aeruginosa, upon
overproduction of the DGC WspR, has been shown to control the levels of T3SS and
T6SS proteins in an inverse manner (Moscoso et al., 2011). Accordingly, we could not
observe clear effects of high c-di-GMP on T3SS gene transcription of P. savastanoi,
although disease features were clearly affected, suggesting that c-di-GMP could
regulate the P. savastanoi T3SS in a different manner. In fact, different c-di-GMP
regulatory mechanisms have been demonstrated in bacteria (Moscoso et al., 2011),
including transcriptional regulation (Hickman and Harwood, 2008), translational
regulation (Sudarsan et al., 2008), regulation of protein activity (Fang and Gomelsky,
2010) and cross-envelope signalling (Navarro et al., 2011) .
In summary, an increment of the intracellular levels of c-di-GMP seems to promote a
plant-associated life-style by reducing the motility, increasing EPS production and
promoting biofilm formation. Several reports have evidenced a negative regulation of
virulence by c-di-GMP in plant pathogens like X. campestris (Ryan et al., 2007; Chin et
al., 2010), D. dadantii (Yi et al., 2010), Pectobacterium atrosepticum (Pérez-Mendoza
et al., 2011b; Pérez-Mendoza et al., 2011a), Agrobacterium tumefaciens (Barnhart et
al., 2013; Xu et al., 2013) or Erwinia amylovora (Edmunds et al., 2013). However, high
c-di-GMP increases virulence of Xylella fastidiosa (Chatterjee et al., 2010). Our results
in P. savastanoi pv. savastanoi NCPPB 3335 could not clearly be related to an
increased or a reduced virulence of this pathogen. On the other hand, a recent study
showed that high c-di-GMP levels did not has an effect on the virulence of P. syringae
pathovars tomato and phaseolicola (Pérez-Mendoza et al., 2014). Thus, high levels of
c-di-GMP provoke contrasting effects depending on the specific plant-bacterial system,
suggesting that there is a need for fine-tuning the c-di-GMP intracellular levels to
ensure the stage transition during the establishment of the association with the host.
109
CHAPTER I
110
CHAPTER II
The c-di-GMP phosphodiesterase BifA is involved in
the virulence of the Pseudomonas syringae complex
CHAPTER II
INTRODUCTION
The modified nucleotide cyclic di-GMP (c-di-GMP) is a ubiquitous second
messenger in bacteria that regulates the transition between planktonic and sessile
lifestyles so that high levels enhance the production of extracellular matrix components,
exopolysaccharides (EPS) and proteins (Zogaj et al., 2001, Solano et al., 2002,
Christen et al., 2006, Recouvreux et al., 2008, Pérez-Mendoza et al., 2011). Cyclic-diGMP is synthesized from two molecules of GTP by diguanylate cyclases (DGC), with
GGDEF
catalytic
domains
(Paul
et
al.,
2004),
and
degraded
by
specific
phosphodiesterases (PDE) with EAL (Christen et al., 2005; Tischler and Camilli, 2005)
or HD-GYP domains (Ryan et al., 2007). The DGC and PDE catalytic domains are
frequently associated to different sensory and regulatory domains, so c-di-GMP
intracellular levels are modulated by various environmental and/or intracellular signals
(Mills et al., 2011). Functions regulated by this second messenger include biofilm
formation and bacterial motility (D'Argenio and Miller, 2004; Dow et al., 2006; Jenal and
Malone, 2006; Tamayo et al., 2007; Hengge, 2009; Yi et al., 2010; Romling et al.,
2013). Additionally, in recent years, c-di-GMP has also been shown to be involved in
the virulence of animal and plant pathogenic bacteria (Hisert et al., 2005; Tischler and
Camilli, 2005; Kulasakara et al., 2006; Ryan et al., 2007; Tamayo et al., 2007; Yi et al.,
2010). Examples of this include the animal bacterial pathogens Salmonella enterica
(Hisert et al., 2005), Vibrio cholerae (Tischler and Camilli, 2005), Pseudomonas
aeruginosa (Kulasakara et al., 2006), Legionella pneumophila, Brucella melitensis,
pathogenic Escherichia coli strains, and Burkholderia pseudomallei (Tamayo et al.,
2007; Lee et al., 2010b; Levi et al., 2011; Petersen et al., 2011; Romling et al., 2013).
However, in phytopathogenic bacteria, only few proteins have been experimentally
demonstrated to function in c-di-GMP signaling. A role in plant infection has been
shown for the HD-GYP domain-containing protein RpfG and the c-di-GMP receptor
XcCLP of Xanthomonas campestris (Dow et al., 2006; Ryan et al., 2006b), the PDE
proteins EcpB and EcpC of Dickeya dadantii (Yi et al., 2010), and the DGC protein
CgsA of Xylella fastidiosa (Chatterjee et al., 2010). More recently, other c-di-GMP
metabolizing enzymes have been related to the regulation of surface attachment to
plants in Agrobacterium tumefaciens (Xu et al., 2013) and Pectobacterium
atrosepticum (Pérez-Mendoza et al., 2011b; Pérez-Mendoza et al., 2011a). In the
Pseudomonas syringae complex, which included some of the most scientifically and
economically relevant plant bacterial pathogens (Mansfield et al., 2012), the responses
to high levels of c-di-GMP have been studied in the tomato, bean and olive plant
pathogens P. syringae pv. tomato, P. syringae pv. phaseolicola and Pseudomonas
CHAPTER II
savastanoi pv. savastanoi, respectively (Pérez-Mendoza et al., 2014). Although
elevated c-di-GMP intracellular levels were associated with several free-living
phenotypes in all three pathogens, virulence was only clearly affected only in P.
savastanoi pv. savastanoi, the causal agent of olive knot disease (Pérez-Mendoza et
al., 2014). In a recent screen for novel virulence factors involved in the P. savastanoi
pv. savastanoi-olive interaction, a homolog of the Pseudomonas aeruginosa (Kuchma
et al., 2007) and Pseudomonas putida KT2442 (Jiménez-Fernández et al., 2014) BifA
was identified (Matas et al., 2012). In both Pseudomonas species, BifA possesses an
active EAL domain and a non-canonical GGDEF domain (GGDQF), both of which are
crucial for the PDE activity required for their function (Kuchma et al., 2007; JiménezFernández et al., 2014). Besides their similar domain conservation and activity, the set
of functions regulated by both proteins seem to be different among those strains. In P.
aeruginosa, BifA reciprocally regulates biofilm formation and swarming motility whereas
in P. putida does not seems to regulate flagella-mediated motility, being a key protein
in the starvation-induced biofilm dispersal (Kuchma et al., 2007; Jiménez-Fernández et
al., 2014). Nevertheless, a link between BifA and the virulence of animal- or plantpathogenic Pseudomonads has not been established yet.
The aim of this work is to analyze the role of BifA in the virulence of the P. syringae
complex, focusing on two strains, the tumor-inducing pathogen of woody hosts P.
savastanoi pv. savastanoi NCPPB 3335 (Ramos et al., 2012) and P. syringae pv.
tomato DC3000, which causes bacterial speck in tomato and Arabidopsis (Buell et al.,
2003). We demonstrate that in both bacterial pathogens, a functional BifA is required
not only for the control of bacterial motility, but also for full fitness and virulence in their
respective plant hosts. Furthermore, overexpression of BifA in P. savastanoi,
negatively and positively impact, respectively, biofilm formation and swimming motility.
We also show that virulence of a P. savastanoi bifA mutant in olive plants can be fully
restored by complementation with the bifA gene from P. aeruginosa, whose PDE
activity has been demonstrated, suggesting that they perform the same function in both
bacterial pathogens.
114
CHAPTER II
Bacterial strains, plasmids, media, and growth conditions
Bacterial strains and plasmids used in this study are listed in Table 1. Pseudomonas
savastanoi pv. savastanoi NCPPB 3335 and Pseudomonas syringae pv. tomato
DC3000 were grown at 28°C in Luria–Bertani (LB) medium (Miller, 1972), or super
optimal broth (SOB) (Hanahan, 1983). For swimming motility assays King’s B medium
(King et al., 1954) diluted 20 times was used. Escherichia coli strains were grown at
37°C in LB and SOB media. Solid and liquid media were supplemented, when required,
with the appropriate antibiotics. Antibiotics were used at the following concentrations.
For E. coli: ampicillin (Ap) 100 µg/ml, kanamycin (Km) 50 µg/ml, tetracycline (Tc) 15
µg/ml and gentamicin (Gm) 10 µg/ml. For NCPPB 3335 and DC3000: Ap 300 µg/ml,
Km 10 µg/ml (NCPPB 3335) or 15 µg/ml (DC3000), Tc 15 µg/ml and Gm 10 µg/ml.
Construction of bacterial strains and plasmids
Oligonucleotides for overexpression and mutator constructs are listed in Table S1.
PCR products were cloned into the pGEM-T easy cloning vector (Promega, USA) and
sequenced prior to subcloning into the relevant broad-host-range or suicide vector.
Construction of Pseudomonas savastanoi pv. savastanoi NCPPB 3335 and
Pseudomonas syringae pv. tomato DC3000 ΔbifA mutants were performed using
vectors pGEM-T-bifAPsv-Km or pGEM-T-bifAPto-Km, respectively (Table 1). First,
DNA fragments of approximately 1.2 kb (NCPPB 3335) or 0.5 kb (DC3000)
corresponding to the 5' and 3' flanking regions of the bifA gene were amplified by three
rounds of PCR using genomic DNA as a template, and primers including a BamHI site
and the T7 primer sequence (Table S1), as previously described (Zumaquero et al.,
2010). The resulting product was A/T cloned into pGEM-T (Table 1) and fully
sequenced to discard mutations on flanking genes. Following sequencing, the resulting
plasmids were labeled with the nptII kanamycin resistance gene, obtained from pGEMT-KmFRT-BamHI (Table 1), yielding pGEM-T-bifAPsv-Km and pGEM-T-bifAPto-Km
(Table 1). For marker exchange mutagenesis, plasmids were transformed by
electroporation into NCPPB 3335 and DC3000 as previously described (PérezMartínez et al., 2007). Transformants were selected on LB medium containing Km, and
replica plates of the resulting colonies were made on LB-Ap plates to determine
whether each transconjugant underwent plasmid integration (ApR) or allelic exchange
(ApS). Southern blot analyses, using both nptII and bifA (NCPPB 3335) as probes,
115
CHAPTER II
were used to confirm that allelic exchange occurred at a single and correct position
within the genome.
Motility assays
For swimming motility, bacteria were grown on LB plates for 48 h, resuspended in 10
mM MgCl2 and adjusted to an OD660=2.0. Aliquots of 2 μl were inoculated in the
centre of 0.3% agar 20-fold diluted KB-Tc plates and incubated 72 h at 25°C. The
diameters of the swimming halos were measured after 48 h for P. syringae pv. tomato
strains and 72 h for P. savastanoi pv. savastanoi strains. For swarming assays, the cell
suspensions were prepared as above but the 2 μl aliquots were deposited on the top of
the plate supplemented with Tc and incubated at 25°C. The surface motility was
observed after 36 h. Three motility plates were used for each strain, and the
experiment was repeated with three independent cultures.
Exopolysaccharide detection and biofilm formation assays
Calcofluor binding assays for P. savastanoi pv. savastanoi were carried out on LB
medium supplemented with 200 μg/ml calcofluor (CF) and incubated at 25ºC for 48h.
Biofilm formation by P. savastanoi pv. savastanoi NCPPB 3335 cells was analyzed
on glass surfaces using a static microcosm assay as previously described (Pliego et
al., 2008). To quantify the biofilms, crystal violet (CV) was used as described by
(Pérez-Mendoza et al., 2011).
Virulence assays in tomato plants
Seeds of Solanum lycopersicum var. Moneymaker were germinated and grown in a
growth chamber with a 16/8 h light/dark photoperiod at 24/18ºC day/night and at 70%
relative humidity. Bacteria were grown on LB agar plates for 48 h at 28ºC and
resuspended at an OD600nm of 0.5, corresponding to 108 colony firming units
(CFU)/mL, in 10 mM MgCl2. Further serial dilutions were carried out to obtain a
suspension of the desired title for different dose inoculations. Four to five week old
plants were inoculated by infiltrating bacterial suspension into the intracellular spaces.
Infiltration was achieved by pressing the bacterial suspension against the leaf with 2
mL syringes without needle. The control plants were inoculated with a solution of 10
mM MgCl2. In all cases, inoculations were carried out in the same half of the leaflet
(three by each leaf), allowing for differentiation by the midrib of the two areas within the
116
CHAPTER II
inoculated leaflet: infiltrated area and non-infiltrated area. The appearance of disease
symptoms was scored at 3, 5, 8 and 10 days post-inoculation (dpi). Symptoms
quantification was done using the image analysis software Visilog 6.3 (Noesis,
Courtaboeuf, France).
Competition assays were performed by mixing cultures of mutants and wild-type
strains with an OD660nm 0.5 in a 1:1 ratio. Tomato plants were inoculated with 5x104
CFU/mL mixed bacterial suspension as described above. Bacteria were recovered
from the infected leaves using a 10 mm diameter cork borer. Five disks (3.9 cm2) per
plant were homogenized by mechanical disruption into 1 mL of 10 mM MgCl2 and
counted by plating serial dilutions on LB plates with and without Km, for selection of the
mutant and wild-type strains, respectively. At four days post-inoculation, bacteria were
recovered from leaf tissues and plated. A competitive index (CI) was calculated as
described previously (Macho et al., 2007).
Virulence assay in olives plants
Olive plants derived from seeds germinated in vitro (originally collected from a cv
Arbequina plant) were micropropagated, rooted and maintained as previously
described (Rodríguez-Moreno et al., 2008, Rodríguez-Moreno et al., 2009).
Micropropagated olive plants were infected in the stem with bacterial suspension (c.
103 CFU) and incubated for 30 days in a growth chamber as described by RodríguezMoreno et al. (2008). Bacteria were recovered from the knots using a mortar containing
1 ml of 10 mM MgCl2, and serial dilutions were plated onto LB medium (to detect wild
type), LB-Km medium (to detect the bifA mutant) or LB-Tc medium (to detect
complemented strain). Population densities were calculated from at least three
independent replicates. The morphology of the olive plants infected with bacteria was
visualized using a stereoscopic microscope (Leica MZ FLIII; Leica Microsystems,
Wetzlar, Germany). The knot volume was quantified using a 3D scanner, and the
MiniMagics 2.0 software. Competitive assays between the wild type and the mutant
were carried out in in vitro plants as described previously (Rodríguez-Moreno et al.,
2008, Matas et al., 2012). To visualize bacterial infection of tumours, P. savastanoi pv.
savastanoi strains were tagged with the green fluorescent protein (GFP) using plasmid
pLRM1-GFP and knots generated were examined by epifluorescence microscopy as
previously described (Rodríguez-Moreno et al., 2009).
Pathogenicity of P. savastanoi pv. savastanoi strains in 1-year-old olive explants
(lignified olive plants) was tested as previously described (Penyalver et al., 2006,
117
CHAPTER II
Pérez-Martínez et al., 2007). Knot volume was calculated by measuring length, width
and height of the knot with a Vernier caliper (Moretti et al., 2008, Hosni et al.,
2011).Statistical data analysis was performed by analysis of variance followed by tStudent test (P ≤ 0.05).
118
CHAPTER II
Table 1. Strains and plasmids used in this study.
Strains/Plasmids
Strains
P.savastanoi pv.
savastanoi
NCPPB 3335
Wild-type strain
∆bifAPsv
Reference or source
(Pérez-Martínez et al., 2007)
R
bifA deletion mutant (Km )
This work
DC3000
Wild-type strain
(Buell et al., 2003)
∆bifAPto
bifA deletion mutant (KmR)
This work
DH5α
F -, ϕ80dlacZ M15, (lacZYA-argF) U169,
deoR, recA1, endA, hsdR17 (rk - mk -),
phoA, supE44, thi-1, gyrA96, relA1.
(Hanahan, 1983)
GM2929
F -, ara-14, leuB6, thi-1, tonA31, lacY1, tsx78, galK2, galT22, glnV44, hisG4, rpsL136,
xyl-5,mtl-1, dam13::Tn9, dcm-6, mcrB1,
hsdR2, mcrA, recF143. (SpR CmR).
(Palmer and Marinus, 1994)
Cloning vector containing ori f1 and lacZ
(ApR)
(Promega, USA)
P. syringae pv. tomato
E. coli
Plasmids
pGEM-T easy
pGEM-T- KmFRT-BamHI
pJB3Tc19
R
R
R
Apr, Tcr; cloning vector, Plac promoter
(Ortíz-Martín et al., 2010)
pLRM1-GFP
pBBR1-MCS5::PA1/04/03-RBSIIGFPmut3*-T0-T1, (GmR)
pGEM-T-bifAPsv
pGEM-T easy derivate containing the bifA
ORF from NCPPB 3335
This work
pGEM-T-bifAPAO
pGEM-T easy derivate containing the bifA
ORF from P.vaeruginosa PAO1
This work
pJB3-bifAPsv
pJB3Tc19 derivative carrying the bifA ORF
from NCPPB 3335
This work
pJB3-bifAPAO
pJB3Tc19 derivative carrying the bifA ORF
from P.aeruginosa PAO1
This work
pGEM-T-K.O bifAPsv
pGEM-T easy derivate, containing 1.2 kb
approx. on each side of the bifA gene from
NCPPB 3335 (ApR)
This work
pGEM-T-K.O bifAPsv- Km
pGEM-T derivate, containing 1.2 kb approx.
on each side of the bifA gene from NCPPB
3335 interrupted by the kanamycin
resistance gen nptII (ApR, KmR)
This work
pGEM-T-K.O bifAPto
pGEM-T easy derivate containing 0.5 kb
DC3000 (ApR)
This work
pGEM-T-K.O bifAPto- Km
pGEM-T derivative containing 0,5 kb
DC3000 interrupted by the kanamycin
resistance gen nptII (ApR, KmR).
This work
a
(Rodríguez-Moreno et al., 2009)
Ap, ampicillin; Cm, chloramphenicol; Gm, gentamycin; Km, kanamycin; and. Tc, tetracycline.
119
CHAPTER II
Table S1.Oligonucleotides used in this study.
Oligonucleotide
Sequence (5’ to 3’) a,b
TA AER-0004089 F-53
GGTGCATGCTGTATCTGG
TA AER-0004088 R-22
CCCTATAGTGAGTCGGATCCCGTTCCTTAGTTCGTGTCG
TD AER-0004088 F-20
GGATCCGACTCACTATAGGGGGCAGTGCTCTTTCGAGC
AER-0004087 R-1059
GCTGACTTTGCTGCCATC
AER-0004088 F-299
GCAGATCGGTCTGGACAG
AER-0004088 R-791
CTGTCCAGACCGATCTGC
ADG-0004437 F-502
CCTACTACATCGACTACCG
TA-ADG-0004439 R-22
CCCTATAGTGAGTCGGATCCCGTTCCTTAGTTCGTGTCG
TD-ADG-0004439 F-5
GGATCCGACTCACTATAGGGGGCGAGTCTCTGAACACC
ADG-0004440 R-312
CCACGCATCACGAGCAGC
TA-BifAPAO F-31
GGTACCTCTTCCTACCGGCTTGTC
TD-BifAPAO R-40
GAGCTCGTTGCTCTGCCTGGGCAG
AER-0004088-F
TCTAGAATCTGGCTTTTCGAGGG
AER-0004088-R
GAGCTCGAAAGAGCACTGCCGTTC
AER-0004088-int
CATCGCTGGTGTATTGCG
a
Restriction sites generated in the oligonucleotide sequence are underlined.
b
F and R, forward and reverse primer, respectively. Numbers included after F and R in primers names
correspond to the hybridization position of the 3’ end of the primer in the corresponding ORF sequence.
120
CHAPTER II
RESULTS
Conservation of BifA in the Pseudomonas genus
A comparative phylogenetic analysis of BifA was carried out using sequences
available at the NCBI database. Results showed that BifA is widely distributed within
the Pseudomonas genus being encoded in the genome of all sequenced
Pseudomonas strains. The phylogeny of the BifA proteins was largely congruent with
the phylogeny of the genus Pseudomonas (Yamamoto et al., 2000) and with that of the
P. syringae complex (Studholme, 2011) deduced from housekeeping genes,
suggesting that the bifA gene is ancestral within this bacterial group. Alignment of the
complete amino acids sequences of BifA from P. savastanoi pv. savastanoi NCPPB
3335 (BifAPsv), P. syringae pv tomato DC3000 (BifAPto), P. putida KT2440 (BifAPpu) and
P. aeruginosa PAO1 (BifAPAO) using ClustalW2 revealed that BifAPsv and BifAPto are
97% identical, and show 87% identity with BifAPpu, and 81-80% identity with BifAPAO.
BifA homologs were also found in other gamma proteobacteria closely related to
Pseudomonas genus, including Azotobacter vinelandii, Hahella chejuensis and
Marinobacter hydrocarbonoclasticus (Gauthier et al., 1992; Jeong et al., 2005; Setubal
et al., 2009), which showed, respectively, 60%, 48% and 45% of identity with BifA Psv
(Fig. 1A). In addition, conservation of identical EAL (EALX57NX33EX2EX26DX20KX35E)
(Rao et al., 2008a) and modified GGDEF (GGDQF) domains was observed in all
sequenced Pseudomonas spp. (Fig. 1B) and in H. chejuensis, while A. vinelandii and
M. hydrocarbonoclasticus encoded a different GGDEF-like domain (GGDRF and
GSDQF, respectively). An RXXD allosteric control motif was not found in any of the
Pseudomonas BifA (Fig. 1B).
121
CHAPTER II
A
tabaci ATCC11528
47 aesculi NCPPB3681
savastanoi NCPPB3335
100 lachrymans M301315
phaseolicola 1448A
82
57
86
96
100
actinidiae M302091
Pseudomonas genus
100
lachrymans M302278
maculicola ES4326
brassicacearum NFM421
99 putida W619
99
98
tomato DC3000
3 fluorecens
99
90
syringae B728A
oryzae 1 6
morsprunorum M302280
64
P. syringae complex
(pathovars)
aceris M302273
49
79 71
53
mori 301020
syringae 642
77
99
100
47
glycinea race4
putida KT2440
90 entomophila L48
fulva 12X
2 mendocina
100
aeruginosa PAO1/PA14
100
2 stutzeri
100
Azotobacter vinelandii CA6
100
Hahella chejuensis
Marinobacter hydrocarbonoclasticus
0.2
B
319
BifAPsv
BifAPto
BifAPpu
BifAPAO
O
CONCESOUS
Modified GGDEFlike domain
338 448
EAL-domain
463
GRLGALARLGGDQFALVQAK…RDHRIVGVEALIRWQH
GRLGALARLGGDQFALVQAS…RDHHVVGVEALIRWQH
GRLGALARLGGDQFALVQAN…RDHRVVGVEALLRWQH
ARLGSLARLGGDQFALVQAD…RDHRVVGVEALLRWQH
XRLGXLARLGGDQFALVQAX…RDHXXVGVEALXRWQH
-***-**************-…***--******-****
Fig. 1. Phylogeny and conservation of BifA in the Pseudomonas genus. (A) Phylogenetic
analysis of BifA from several Pseudomonas strains. The tree was constructed using MEGA5
(Tamura et al., 2011) with the Neighbor-Joining method (Saitou and Nei, 1987) and evolutionary
distances were computed in units of amino acid substitutions per site. The percentages of
replicate trees in which the associated taxa clustered together in the bootstrap test (10,000
replicates) were shown next to the branches. The locus tags corresponding to BifA proteins
used in this analysis are shown in Table 3. (B) Conservation of the EAL domain and modifiedGGDEF (GGDQF) domain of BifA in P. savastanoi pv. savastanoi NCPPB 3335 (BifAPsv), P.
syringae pv. tomato DC3000 (BifAPto), P. putida KT2440 (BifAPpu) and P. aeruginosa PAO1
(BifAPAO). The numbers indicated the positions of the amino acid residues from the first
methionine residue of BifA. Grey background indicates amino acid residues corresponding to
the position of the allosteric control RXXD motif present in other GGDEF-containing proteins.
122
CHAPTER II
Table 3. Locus Tag/Accession numbers corresponding to the BifA proteins used for the
construction of the NJ tree shown in Fig. 1A.
Strains
Locus Tag/ Accession Number (*)
Azotobacter vinelandii
AvCA_37830
Hahella chejuensis
HCH_04607
Marinobacter hydrocarbonoclasticus
MARHY1278
P.savastanoi pv. savastanoi NCPPB3335
PSA3335_4049
P.syringae pv. aceris M302273PT
PSYAR_22924
P. syringae pv. actinidae M302091
PSYAC_16171
P. syringae pv. aesculi NCPPB3681
P. syringae pv. glicinea race4
P. syringae pv. lachrymans M301315
P. syringae pv. maculicola ES4326
PsyrpaN_010100011209
PsgRace4_10867
PLA107_30679
PMA4326_05031
P. syringae pv. mori 301020
PSYMO_06635
P. syringae pv. morsprunorum M302280PT
PSYMP_19609
P. syringae pv. oryzae 1_6
P.syringae pv. phaseolicola 1448A
P. syringae pv. syringae 642
P. syringae pv. syringae B728a
Psyrpo1_010100012116
PSPPH_4065
Psyrps6_010100025549
Psyr_4060
PSYTB_09391
P.syringae pv. tomato DC3000
PSPTO_4365
Pseudomonas aeruginosa PA7
PSPA7_4938
Pseudomonas aeruginosa PAO1
PA4367
PA14_56790
Pseudomonas aeruginosa 39016
PA39016_000830007
PA15_31426
Pseudomonas entomophila L48
PSEEN1120
Pseudomonas fluorescens PfO-1
PflO1_4487
Pseudomonas fluorescens SBW25
PFLU_4858
Pseudomonas fluorescens PICF7
(*)
Pseudomonas fulva12-X
Psefu_1175
Pseudomonas mendocina NK-01
MDS_3651
Pseudomonas mendocina ymp
Pmen_3323
Pseudomonas putida F1
Pput_0953
Pseudomonas putida GB-1
Pseudomonas putida KT2440
Pseudomonas putida W619
Pseudomonas stutzeri A1501
Pseudomonas stutzeri DSM4166
(*) Date not available.
PputGB1_4474
PP_0914
PputW619_0980
PST_3133
PSTAA_3298
123
CHAPTER II
Impacts the motile/sessile lifestyles in both P. savastanoi pv. savastanoi and P.
syringae pv. tomato
Deletion mutants were constructed in both P. savastanoi pv. savastanoi NCPPB
3335 and P. syringae pv. tomato DC3000 by gene replacement. The loss of bifA in
NCPPB 3335 and DC3000 resulted in decreased swimming motility in both bacteria
(~1.3- and ~1.5-fold decrease, respectively) (Fig. 2A and 2B) and a ~1.9 decrease in
swarming motility by DC3000 (Fig. 2C and 2D). Nevertheless, complementation of both
ΔbifA mutants with the bifA gene from P. savastanoi pv. savastanoi NCPPB 3335 or
from P. aeruginosa PAO1 (plasmids pJB3-bifAPPsv and pJB3-bifAPPAO, respectively,
Table 1) resulted in full restoration of both PDE-associated phenotypes (Fig. 2).
Overexpression of BifA in NCPPB 3335 was associated with an increased swimming
motility (~1.8-fold increase) (Fig. 3A), as expected from the phenotype observed for the
ΔbifA mutant of this strain. In contrast, and as previously reported for P. savastanoi pv.
savastanoi NCPPB 3335 (Pérez-Martínez et al., 2007), this strain did not show
swarming motility under the conditions tested. Thus, the impact of the bifA deletion or
the overexpression of this gene in NCPPB 3335 could not be evaluated.
Deletion of the bifA gene positively impacts biofilm formation in P. aeruginosa PA14
(Kuchma et al., 2007) and P. putida KT2442 (Jiménez-Fernández et al., 2014). Under
the conditions tested, the biofilm formation capacity of P. savastanoi pv. savastanoi
NCPPB 3335 and P. syringae pv. tomato DC300 ∆bifA mutants was not altered in
comparison with their respective wild-type strains (data not shown). However, biofilm
formation of NCPPB 3335 cells overexpressing its own BifA decreased approximately
3-fold in comparison with the wild-type strain transformed with the empty vector (Fig.
3B), suggesting that the bifA gene also hinder biofilm formation in this plant pathogen.
Moreover, a decrease in calcofluor (CF) binding was observed for the BifAoverexpressing strain in comparison with wild type NCPPB 3335 (Fig. 3C), suggesting
that EPS production is negatively regulated by the bifA gene in this bacterium.
124
CHAPTER II
A
C
25000
a
5000
Swarming movility (mm2)
Swimming movility (mm2)
6000
a
4000
a
3000
b
2000
1000
20000
B
Swimming movility (mm2)
c
10000
∆bifAPsv
∆bifAPsv
∆bifAPsv ∆bifAPsv
pJB3bifA pJB3bifA*
pJB3-bifA
Psv pJB3-bifAPAO
Psv
6000
5000
0
D
Pto DC3000
pJB3
∆bifAPto
∆bifAPto
pJB3
pJB3
∆bifAPto
∆bifAPto
∆bifAPto
∆bifAPto
pJB3 Psv pJB3-bifA
pJB3
pJB3-bifA
PAO
Pto DC3000 pJB3
ΔbifAPto pJB3
ΔbifAPto
pJB3-bifAPsv
ΔbifAPto
pJB3-bifAPAO
a
5000
4000
b
15000
0
Psv NCPPB ∆bifAPsv
∆bifAPsv
3335 pJB3
pJB3
pJB3
ab
a
b
b
c
3000
2000
1000
0
Pto DC3000
pJB3
∆BifAPto
∆BifAPto
∆BifAPto
∆bifAPto
∆bifAPto
∆bifAPto
pJB3
pJB3bifAPsv
pJB3bifA*
pJB3
pJB3-bifA
pJB3-bifAPAO
Psv
Fig. 2. Swimming and swarming motility of P. savastanoi pv. savastanoi NCPPB 3335 and
P. syringae pv. tomato DC3000 ΔbifA mutants. Size of swimming areas (calculated in mm2)
on 0.3% KB (diluted 20 times) agar plates after 72h at 25 ºC by the indicated P. savastanoi
strains (A) or at 48h at 25 ºC by The indicated P. syringae strains (B). Quantificaton (C) and
images (D) of the swarming motility by the indicated P. syringae strains after 36h at 25ºC. Psv
NCPPB 3335 (pJB3) P. savastanoi pv. savastanoi NCPPB 3335 carrying the empty vector
pJB3; ∆bifAPsv, NCPPB 3335 bifA mutant carrying pJB3; ∆bifAPsv pJB3-bifAPsv, NCPPB 3335
bifA mutant complemented with BifA from P. savastanoi pv. savastanoi NCPPB 3335 (BifAPsv);
∆bifAPsv pJB3-bifAPAO, NCPPB 3335 bifA mutant complemented with BifA from P. aeruginosa
PAO1(BifAPAO); Pto DC3000 (pJB3), P. syringae pv. tomato DC3000 carrying the empty vector
pJB3; ∆bifAPto, DC3000 bifA mutant carrying pJB3; ∆bifAPto pJB3-bifAPsv, DC3000 bifA mutant
complemented with BifA from P. savastanoi pv. savastanoi NCPPB 3335 (BifAPsv); ∆bifAPto
pJB3-bifAPAO, DC3000 bifA mutant complemented with BifA from P. aeruginosa PAO1(BifAPAO).
125
CHAPTER II
Fig. 3. Phenotypes associated with the overexpression of BifA in P. savastanoi pv.
savastanoi NCPPB 3335. (A) Swimming motility by the indicated strains in 0.3% LB agar at
72h. (B) Biofilm formation in LB medium under static growth conditions visualized at 24h by
crystal violet staining. (C) Visualization of exopolysaccharides production using calcofluor agar
plates. Wild type, NCPPB 3335 transformed with empty vector pJB3; BifA overexpression,
NCPPB 3335 transformed with pJB3-bifAPsv (Table 1).
The bifA gene is involved in P. savastanoi and P. syringae pathogenicity
Fitness attenuation in plant tissues has been previously associated to hypovirulence
phenotypes both in P. savastanoi pv. savastanoi NCPPB 3335 (Matas et al., 2012)
and P. syringae pv. tomato DC3000 (Macho et al., 2007; Cunnac et al., 2011a). Mixed
infections NCPPP 3335 vs. ∆bifAPsv and DC3000 vs. ∆bifAPto were prepared to perform
competitive assays on in vitro micropropagated olive plants and tomato plants,
respectively. The results showed that the CI values obtained were significantly lower
than 1.0, indicating that the mutants were outcompeted by their respective wild-type
strains in planta. However, no differences in competence were observed between the
wild-type and their corresponding complemented strains (Fig. 4).
126
CHAPTER II
A
CI index
10
∆bifAPsv
pJB3-bifAPsv
1
∆bifA Psv
*
0.1
B
CI index
10
∆bifAPto
1
∆bifA Pto
pJB3-bifA Psv
*
0.1
Fig. 4. Fitness of P. savastanoi pv. savastanoi NCPPB 3335 and P. syringae pv tomato
DC3000 ΔbifA mutants in plant tissues. CI assays in olive plants at 30 dpi between a ∆bifA
NCPPB 3335 mutant (∆bifAPsv) or ∆bifAPsv complemented with BifAPsv (∆bifAPsv pJB3-bifAPsv) and
wild type NCPPB 3335 (A). CI assays in tomato leaves at 5 dpi between a ∆bifA DC3000
mutant (∆bifAPto) or ∆bifAPto complemented with BifAPsv (∆bifAPsv pJB3-bifAPsv) and wild type
DC3000 (B). Error bars indicate the standard error from the average of three different assays.
Asterisks indicate indices significantly different from one. Statistics analysis were preformed
using Student´s t-test ant P= 0.05.
The P. savastanoi pv. savastanoi NCPPB 3335 ∆bifAPsv mutant was inoculated in
both in vitro micropropagated and lignified olive plants, and the severity of the disease
was evaluated after 30 days or 90 days, respectively. Knots induced by the ΔbifAPsv
mutant in both plant systems were visibly smaller than those developed by the wild-type
or the mutant complemented with its own bifA gene. Moreover, plants infected with the
ΔbifAPsv mutant complemented with the P. aeruginosa bifAPAO gene also developed
knots similar in size to those induced by the wild-type strain (Fig. 5A and 5B).
Quantification of knot volumes confirmed that the ΔbifAPsv mutant induced the formation
of knots ~2.0 smaller than those induced by the wild-type or the complemented strains
on in vitro olive plants (Fig. 5C). Lignified olive plants infected with ΔbifAPsv mutant
induced knots 4.2 times smaller than those infected with the wild-type strain or the
mutant complemented with the P. aeruginosa bifAPAO gene. Complementation of the
mutant with its own bifAPsv gene expressed from a constitutive promoter (plasmid pJB3bifAPsv) yielded knot volumes higher than those induced by the wild-type strain (Fig.
5D), perhaps due to the combined effect of the overexpression of BifAPsv in this strain
and a better adaptation of this BifA variant to the olive pathogen.
127
CHAPTER II
To monitor in real time the infection process of olive plants by the ΔbifAPsv mutant, a
GFP-tagged ΔbifAPsv derivate was constructed by transformation with plasmid pLRM1GFP (Rodríguez-Moreno et al., 2009). Whole knots developed on in vitro
micropropagated olive plants were visualized at 30 dpi. Although CFU levels in knots
induced by the ΔbifAPsv mutant were similar to those induced by the wild-type strain
(approximately 107 CFU/knot), GFP fluorescence emission in knots caused by the
mutant was only detected near the stem wounds, suggesting a restricted spatial
distribution of mutant cells inside olive knots (Fig. 6).
Psv NCPPB 3335
pJB3
∆bifAPsv
pJB3-bifAPsv
∆bifA Psv
pJB3
∆bifAPsv
pJB3-bifAPAO
A
B
C
D
100
bc
b
b
80
a
60
40
20
0
Psv NCPPB
Psv
3335
NCPPB 3335
pJB3
∆bifAPsv
pJB3
∆bifAPsv
∆bifAPsv
pJB3pJB3pJB3bifAPsv
pJB3bifA*
bifAPsv
ΔbifA Psv
bifAPAO
Knot Volume (mm3)
Knot Volume (mm3)
120
800
700
600
500
400
300
200
100
0
c
b
Psv
Silvestre
NCPPB 3335
pJB3
b
a
pJB3
4088
pJB34088
bifAPsv
compl
pJB3BifA
Pae
bifAPAO
ΔbifAPsv
Fig. 5. Virulence assay of a P. savastanoi pv. savastanoi NCPPB 3335 bifA mutant on
olive plants. Knots induced on in vitro olive plants by the indicated strains after 30 dpi (A) and
in lignified olive plants after 90 dpi (B). Knot volume (mm3) on in vitro olive plants (C) and in
lignified plants (D) infected with the indicated strains. Bars are the mean of three biological
replicates from two different assays; error bars represent the standard deviation from the
average. Letters indicate significant differences (α=0.05) using ANOVA statistical test. Psv
NCPPB 3335 (pJB3) P. savastanoi pv. savastanoi NCPPB 3335 carrying the empty vector
pJB3; ∆bifAPsv, NCPPB 3335 bifA mutant carrying pJB3; ∆bifAPsv pJB3-bifAPsv, NCPPB 3335
bifA mutant complemented with BifA from P. savastanoi pv. savastanoi NCPPB 3335 (BifAPsv);
bifAPsv pJB3-bifAPAO, NCPPB 3335 bifA mutant complemented with BifA from P. aeruginosa
PAO1(BifAPAO).
128
CHAPTER II
NCPPB 3335-GFP
∆bifAPsv-GFP
Fig. 6. Real time monitoring of GFP-tagged P. savastanoi pv. savastanoi cells in in vitro
micropropagated olive plants. On the left of each panel, images of knots induced by GFPtagged NCPPB 3335 and a ΔbifA mutant (ΔbifAPsv) at 30 dpi. Complementary epifluorescence
microscopy images are shown on the right of each panel.
Infection of tomato leaves with wild-type P. syringae pv. tomato DC3000 caused
chlorosis and small necrotic lesions detectable near the infiltration zone at 3 to 4 dpi. In
contrast, visualization of these symptoms in leaves infected with the ∆bifAPto mutant
was delayed to 6 dpi (data not shown). At 9 dpi, plants infected with the wild type
displayed chlorosis and necrosis of the leaves spanning the whole infiltrated area and
also showed initiation of chlorosis at the non-infiltrated areas. However, plants infected
with the ∆bifAPto mutant exhibited a clear reduction of both symptoms, which were
restricted to the infiltrated areas (Fig. 7A). Quantification of the leave areas covered by
the necrotic spots revealed a 3.5 times reduction of this symptom in plants infected with
the ∆bifAPto mutant in comparison with the wild type (Fig. 7B).
129
CHAPTER II
A
Pto DC3000 (pJB3)
B
∆bifAPto (pJB3)
% (necrotic area / total area)
45
∆bifAPto pJB3bifAPsv
a
40
35
30
25
b
20
15
c
10
5
0
Pto DC3000
Pto
pJB3
ΔbifAPto
∆bifA
Pto pJB3
ΔbifAPto
pJB3-bifAPsv
∆bifA
Pto pJB3-
bifAPsv
Fig. 7. Hypovirulence of a P. syringae pv. tomato DC3000 bifA mutant in tomato plants. A.
Representative images of symptoms induced at 9 dpi by the indicated strains in tomato plants
var. Money maker. B. Quantification of necrotic areas in the leaflets shown in A. Results shown
are the mean of 9 different leaflets. Error bars represent the standard error. Letters indicate
significant differences (α=0.05) using ANOVA statistical test. Pto DC3000 (pJB3), P. syringae
pv. tomato DC3000 carrying the empty vector pJB3; ∆bifAPto,, DC3000 bifA mutant carrying
pJB3; ∆bifAPto pJB3-bifAPsv, DC3000 bifA mutant complemented with BifA from P. savastanoi
pv. savastanoi NCPPB 3335 (BifAPsv)
Complementation of the ∆bifAPto mutant with the bifAPsv gene (plasmid pJB3-bifAPsv)
resulted in a slight increase of necrosis (1.5 times) and chlorotic symptoms in
comparison to the wild-type strain. In fact, chlorotic lesions of leaves infected with the
complemented strain covered almost the entire non-infiltrated areas. Overall, results
obtained in both pathosystems reveal a relevant role of BifA in the virulence of bacteria
belonging to the P. syringae complex.
130
CHAPTER II
DISCUSSION
Bacteria are able to live either as independent planktonic cells or as sessile
members of organized biofilms. In the case of bacterial pathogens, transition between
those different lifestyles is crucial for bacterial survival during host invasion and is often
tied to virulence (Cotter and Stibitz, 2007). Over the past few years, several c-di-GMP
metabolizing
enzymes
have
been
related
to
both
the
transition
between
acute/planktonic and chronic/biofilm lifestyles and the virulence of bacterial pathogens
(Romling et al., 2013). Although knocking out PDEs and DGCs has been usually
associated with either a reduction (Ryan et al., 2007; Yi et al., 2010) or increase in
virulence (Hisert et al., 2005; Tischler and Camilli, 2005), respectively, nowadays it is
generally accepted that regulation of virulence involves complex interactions of DGCs,
PDEs, and effectors c-di-GMP (Romling et al., 2013). Here we present genetic
evidences for the involvement of the PDE BifA in the virulence of bacterial
phytopathogens belonging to the P. syringae complex.
BifA is highly conserved within the Pseudomonas genus, including their modified
GGDEF-like (GGDQF) and EAL domains (Fig. 1), which have been shown to be
required for the c-di-GMP PDE activity of BifA in P. aeruginosa PA14 (Kuchma et al.,
2007) and P. putida KT2442 (Jiménez-Fernández et al., 2014). These results
suggested that the BifA proteins encoded by the bacteria analyzed in the present work,
P. savastanoi pv. savastanoi NCPPB 3335 and P. syringae pv. tomato DC3000, are
functional PDEs. In fact, complementation of NCPPB 3335 and DC3000 ΔbifA mutants
with BifA from P. aeruginosa PAO1 (100% identical to that of P. aeruginosa PA14)
resulted in full restoration of PDE phenotypes associated to the transition between
motile/sessile lifestyles (Fig. 2). Also complementation of the NCPPB 3335 ΔbifAPsv
mutant with BifAPAO fully restored virulence in olive plants (Fig. 5), suggesting that this
protein might have a relevant role not only in the interaction of P. savastanoi pv.
savastanoi and P. syringae pv. tomato with their respective hosts (Fig. 5 and Fig. 7),
but also in the virulence of other plant, animal, and human pathogens of the
Pseudomonas genus, including P. aeruginosa.
Virulence-related phenotypes affected by c-di-GMP levels include flagellar motility,
EPS production and biofilm formation. Regarding flagellar motility, FleQ and FliC, a
major regulator of the flagellar regulon and the flagellar structural protein, respectively,
have been shown to be required for full in vivo fitness and virulence of bacterial
pathogens (Rogers et al., 2006; Schulz et al., 2012). BifA has been shown to
131
CHAPTER II
differentially affect flagellar motility in P. aeruginosa PA14 and P. putida KT2442. While
deletion of the bifA gene in P. aeruginosa severely affects swarming motility without
significantly affecting swimming (Kuchma et al., 2007), swimming and swarming
assays failed to reveal significant differences between wild-type P. putida and its ΔbifA
mutant (Jiménez-Fernández et al., 2014). A slight but significant reduction of swimming
is reported here for ΔbifA mutants of both P. savastanoi pv. savastanoi NCPPB 3335
and P. syringae pv. tomato DC3000 (Fig. 2). On the other hand, and although the
conditions to visualize swarming motility in P. savastanoi pv. savastanoi strains has not
been established yet (Pérez-Martínez et al., 2007; Pérez-Mendoza et al., 2014), we
show that DC3000 ΔbifAPto is severely affected in swarming motility (Fig. 2). Despite
the differences observed among strains, complementation of ΔbifAPsv and ΔbifAPto
mutants with either BifAPsv or BifAPAO resulted in full restoration of flagellar motilities
(Fig. 2). All these results suggest the existence of diverse c-di-GMP-mediated signaling
pathways regulating flagellar motility in different Pseudomonas species, which could all
interact with different variants of BifA.
Hyperbiofilm phenotypes and increased EPS production have been associated with
deletion of the bifA gene in both P. aeruginosa PA14 (Kuchma et al., 2007) and P.
putida KT2442 (Jiménez-Fernández et al., 2014). Although biofilm formation and EPS
assays showed no significant differences between P. savastanoi pv. savastanoi
NCPPB 3335 and P. syringae pv. tomato DC3000 ∆bifA mutants and their
corresponding wild-type strains, overexpression of BifAPsv in NCPPB 3335 negatively
impacted biofilm formation and calcofluor binding (Fig. 3), revealing a role of BifA in the
regulation of biofilm-related phenotypes also in this pathogen. BifA has been shown to
negatively regulate cellulose biosynthesis and production of polysaccharides produced
by the pel locus in P. putida (Jiménez-Fernández et al., 2014) and P. aeruginosa
(Kuchma et al., 2007), respectively. Although pel homologs are not encoded in the
genomes of P. syringae and related strains, cellulose biosynthetic genes are found in
P. savastanoi pv. savastanoi NCPPB 3335 (Rodríguez-Palenzuela et al., 2010) and P.
syringae pv. tomato DC3000 (Buell et al., 2003), suggesting a possible BifA-mediated
regulation of cellulose biosynthesis in these pathogens. In agreement with this
hypothesis, a role of c-di-GMP levels in cellulose production and biofilm formation has
been recently suggested for P. syringae and related pathogens (Pérez-Mendoza et al.,
2014). Furthermore, P. putida BifA has been shown to regulate starvation-induced
biofilm dispersal and biosynthesis of the adhesin protein LapA (Jiménez-Fernández et
al., 2014). Although LapA homologs are not found in the genomes of P. aeruginosa, P.
132
CHAPTER II
savastanoi or P. syringae strains, we cannot discard that BifA could also have a role in
the regulation of biofilm dispersal in these bacterial pathogens.
Negative regulation of virulence by high c-di-GMP levels in bacterial phytopathogens
has been shown for Erwinia amylovora (Edmunds et al., 2013), Xanthomonas
campestris (Ryan et al., 2006b; Ryan et al., 2007) or Dickeya dadantii (Yi et al., 2010).
In agreement with these authors, here we show that the PDE BifA positively regulate
virulence in bacterial pathogens of the P. syringae complex (Fig. 5 and Fig. 7).
Virulence reduction of the ΔbifAPsv mutant in olive plants was associated with a fitness
reduction (Fig. 4). Although significant differences in the final population density
reached by the mutant in olive knots were not observed in comparison to the wild-type
strain, epifluorescence microscopy of knot tissues showed that ΔbifAPsv cells were
restricted to the stem wound (Fig. 6). These results also suggest that BifA positively
regulate systemic invasion of the host in this pathogen, a phenotype perhaps
associated with its altered control of the motile-to-sessile switch.
This is the first study of the phenotypic consequences of knocking out a c-di-GMPmetabolizing enzyme in two pathogens of the P. syringae complex which induce
different symptoms in their plants hosts. The results presented in this work provide new
insights into the diverse processes involved in and affected by c-di-GMP signaling
during the interaction of bacterial pathogens with plants.
133
CHAPTER II
134
CHAPTER III
The diguanylate cyclase DgcP is involved in plant and human
Pseudomonas spp. infections
CHAPTER III
INTRODUCTION
Bacterial pathogens use an extensive arsenal of virulence-related factors to combat
host defenses and to thrive in hostile environments. Although many bacterial virulence
factors are host-specific, numerous studies have demonstrated the existence of
universal virulence mechanisms against plants, insects and mammals (Finlay and
Falkow, 1997). Virulence factors common to plants and animals pathogens obviously
involved regulatory proteins, of which the response regulator GacA is a remarkable
example (Kitten et al., 1998; Parkins et al., 2001; Cha et al., 2012) together with
quorum sensing systems (Hosni et al., 2011; Jimenez et al., 2012). More specifically,
common features of bacterial pathogens is how they resist to drugs and toxic
compounds using efflux pumps (Rahme et al., 2000), or how they manipulate target
cells by delivering toxins (Carrion et al., 2012; Jimenez et al., 2012) through the use of
a broad range of protein secretion systems (Hueck, 1998). Recently, several genetic
screens have demonstrated that the second bacterial messenger cyclic di-GMP (c-diGMP) is also linked to bacterial virulence in numerous animal and plant pathogens
(Ryan et al., 2007; Tamayo et al., 2007; Bobrov et al., 2011; Romling et al., 2013). In
addition to virulence, c-di-GMP has been shown to regulate bacterial motility, biofilm
formation, production of exopolysaccharides (EPS), cell cycle, differentiation and other
processes (D'Argenio and Miller, 2004; Dow et al., 2006; Jenal and Malone, 2006;
Tamayo et al., 2007; Hengge, 2009; Yi et al., 2010). The enzymes responsible for the
synthesis and breakdown of c-di-GMP are diguanylate cyclases (DGCs) and c-di-GMPspecific phosphodiesterases (PDEs), respectively. GGDEF protein domains are
responsible of c-di-GMP synthesis (Paul et al., 2004), whereas the c-di-GMP PDE
activity is associated with EAL or HD-GYP domains (Christen et al., 2005; Schmidt et
al., 2005; Ryan et al., 2007). In addition, a RXXD motif located upstream of the GGDEF
domain, has been shown to provide allosteric control for the activity of several DGCs
(Chan et al., 2004; Christen et al., 2006). Recent advances in the bioinformatics
analysis of genome sequences have led to the identification of bacterial enzymes
encoding GGDEF, EAL and HY-GYP domains in all major bacterial phyla, which
recognized c-di-GMP as a universal bacterial second messenger (Romling et al.,
2013).
The role of c-di-GMP in pathogenesis has been extensively studied in a number of
animal and human bacterial pathogens, including Salmonella enterica (Hisert et al.,
2005), Vibrio cholerae (Tischler and Camilli, 2005) and Pseudomonas aeruginosa
(Kulasakara et al., 2006). P. aeruginosa is a versatile gram-negative bacterium found in
various environments including soil, water and vegetation (Lyczak et al., 2000).
137
CHAPTER III
Importantly, it is an opportunistic human pathogen, responsible for numerous
nosocomial infections. P. aeruginosa chronic infections are fatal in cystic fibrosis
patients, where the bacteria establishes resilient biofilms within the lungs of the
patients (Singh et al., 2000). These bacterial biofilms are difficult to eradicate by the
immune system or classic antibiotic therapy (Costerton et al., 1999). Regulation of
biofilm formation in P. aeruginosa involves c-di-GMP signaling at several stages during
the maturation process, including from early-stage biofilms (Kuchma et al., 2005) to cell
detachment and dispersal (Morgan et al., 2006). A comprehensive analysis of P.
aeruginosa genes encoding enzymes related to c-di-GMP metabolism revealed that
virulence-related phenotypes, such as cytotoxicity and biofilm formation, are controlled
by multiple DGCs and PDEs (Kulasakara et al., 2006).
The Gac/Rsm pathway is central to the expression of virulence traits and biofilm
formation in Pseudomonas species associated with either plant or human infections. It
was shown that in P. aeruginosa the transition between acute/planktonic and
chronic/biofilm lifestyles involves the sensor kinases LadS (Ventre et al., 2006) and
RetS (Goodman et al., 2009). These two sensors act antagonistically on the Gac
pathway and a retS mutant displays hyperbiofilm phenotype while its toxicity is shut
down by the absence of expression of the type III secretion system (T3SS).
Interestingly, the type VI secretion system (T6SS) is also controlled by this regulatory
network and is co-regulated with the biofilm traits such as it is highly active in the retS
mutant. The T6SS has been shown in many instances to be involved in bacterial
competition. It is thus able to modulate the composition of a mixed biofilm and in the
case of P. aeruginosa might also explain why this organism becomes prevalent in the
CF lungs. It was recently shown that the RetS regulatory network is connected to the cdi-GMP signaling network as such that intracellular levels of this second messenger
are further up in a retS mutant (Moscoso et al., 2011). These observations contributed
to reconcile both Gac/Rsm and c-di-GMP pathways in a larger network impacting
biofilm formation.
Despite recent advances in understanding the role of c-di-GMP signaling in the
pathogenicity and virulence of human and animal pathogens, only few studies have
been conducted in bacterial phytopathogens. Examples of this include the HD-GYP
domain-containing protein RpfG and, the c-di-GMP receptor XcCLP of Xanthomonas
campestris (Dow et al., 2006; Ryan et al., 2006b), the PDE proteins EcpB and EcpC of
Dickeya dadantii (Yi et al., 2010) and several c-di-GMP metabolizing enzymes involved
in the regulation of surface attachment to plant cells in Agrobacterium tumefaciens (Xu
et al., 2013) and Pectobacterium atrosepticum (Pérez-Mendoza et al., 2011b; PérezMendoza et al., 2011a). In addition, regulation of the T3SS and T6SS by RetS and
138
CHAPTER III
LadS has also been shown in the bean pathogen Pseudomonas syringae pv. syringae
B728a (Records and Gross, 2010). Recently, overexpression of the Caulobacter
crescentus DGC protein PleD* has been shown to reduce motility, increase production
of EPS and enhance biofilm formation in the bacterial phytopathogens P. syringae pv.
phaseolicola, P. syringae pv. tomato and Pseudomonas savastanoi pv. savastanoi.
However, development of disease symptoms was only affected by high levels of c-diGMP upon interaction of olive plants with P. savastanoi, resulting in the formation of
larger knots which displayed a reduced necrosis (Pérez-Mendoza et al., 2014). A
signature tagged mutagenesis survey of P. savastanoi pv. savastanoi NCPPB 3335
genes required for full fitness in olive plants, recently identified a transposon insertion
in PSA3335_0619, a gene encoding an endonuclease/exonuclease/phosphatase
family protein (EEPP) located upstream of PSA3335_0620, a GGDEF domain proteinencoding gene (Matas et al., 2012). However, no direct evidences were reported about
the involvement of these genes in the virulence and fitness of P. savastanoi in olive
plants.
The present study is focused on the identification of DgcP, a Pseudomonads-specific
c-di-GMP DGC that participates in the inverse regulation of swimming motility and
biofilm formation in plant and human pathogens. Deletion mutants of the dgcP gene
were constructed in P. aeruginosa PAK and P. savastanoi NCPPB 3335 and evaluated
for their impact on c-di-GMP-related phenotypes and virulence. This work
demonstrates that DgcP activity positively regulates biofilm formation and EPS
production and negatively regulates motility. In addition, we show that the dgcP gene is
required for full virulence of P. aeruginosa and P. savastanoi in a mouse model of
acute infection and olive plants, respectively.
139
CHAPTER III
Bacterial strains, plasmids, media, and growth conditions
The original bacterial strains and plasmids used in this study are listed in Table 1.
The bacterial medium and the growth conditions used for Pseudomonas spp. and E.
coli strains were described in the general Material and Methods.
Construction of bacterial strains and plasmids
Oligonucleotides for overexpression and mutator constructs are listed in Table 2.
PCR products were cloned into the pGEM-T easy (Promega, USA) or pCR2.1
(Invitrogen, California, USA) cloning vector and sequenced, prior to subcloning into the
relevant broad-host-range or suicide vector. Construction of P. savastanoi pv.
savastanoi NCPPB 3335 mutant ΔdgcPPsv was performed using pGEM-T-∆dgcPPsv-Km
(Table 1). First, DNA fragments of approximately 1.2 kb corresponding to the 5' and 3'
flanking regions of this gene were amplified by three rounds of PCR using NCPPB
3335 genomic DNA as a template, and primers including an BamHI site and the T7
primer sequence (Table 2), as previously described (Zumaquero et al., 2010; Matas et
al., 2014). The resulting product was A/T cloned into pGEM-T (Table 1) and fully
sequenced to discard mutations on flanking genes. Following sequencing, the resulting
plasmid was labeled with the nptII (Km resistance gene) obtained from pGEM-TKmFRT-BamHI (Table 1), yielding pGEM-T-ΔdgcPPsv-Km (Table 1). For marker
exchange
mutagenesis,
plasmid
pGEM-T-dgcP-Km
was
transformed
by
electroparation into NCPPB 3335 as described previously (Pérez-Martínez et al.,
2007). Transformants were selected on LB medium containing Km, and replica plates
of the resulting colonies were made on LB-Ap plates to determine whether each
transconjugant underwent plasmid integration (ApR) or allelic exchange (ApS). Southern
blot analyses were used to confirm that allelic exchange occurred at a single and
correct position within the genome. Construction of a clean deletion of the dgcP gene in
P. aeruginosa PAK (ΔdgcPPAK) was performed by marker exchange mutagenesis as
previously described (Mikkelsen et al., 2009; Mikkelsen et al., 2013). Briefly, mutator
fragments were constructed by PCR amplification of 500 bp flanking the gene of
interest. DNA fragments were amplified and joined by three rounds of PCR, and the
product was cloned into pCR2.1-TA and then sub-cloned into the P. aeruginosa suicide
vector pKNG101. The first crossover event was selected using Sp, and the second with
5% sucrose. Deletions were confirmed using external primers designed up- or
downstream of the mutator fragments. Chromosomal complementation of the ΔdgcPPAK
was carried out using the Tn7 transposon vector, pME6182. A DNA fragment
140
CHAPTER III
corresponding to the promoter located upstream of the dsbA gene was ligated to a
fragment encoding the complete dgcPPAK ORF, and cloned in plasmid pME6182
yielding pME6182-dgcPPAK (Table 1). Transformation of pME6182-dgcPPAK in the P.
aeruginosa PAK ΔdgcPPAK, mutant and selection of the transconjugants in LB-Gm
yielded the completed strain ∆dgcPPAKTn::dgcPPAK. Insertion the Tn7 transposon into
the glmS gene was verified using the primers Tn7-glmS-PAO1 and Tn7R-109 (Table
2).
The His-tagged construct of the DgcP protein from P. savastanoi pv. savastanoi
NCPPB 3335 was generated by PCR amplification of wild-type template, and
subcloning into the pET28a expression vector for N-terminal His-tagging (Table 1).
Site-directed mutagenesis was carried out on constructs in pGEM-T using the
QuickChange II Site-Directed Mutagenesis Kit (Stratagene, USA) following the
supplier’s instructions.
Motility assays
For swimming motility assays, P. savastanoi pv. savastanoi cells were grown on LB
plates for 48 h, resuspended in 10 mM MgCl2 and adjusted to an OD660 of 2.0. Two μl
aliquots were inoculated in the center of 0.3% agar LB plates with Tc and incubated 72
h at 25°C. The diameters of the swimming halos were measured after 24, 48, and 72 h.
For P. aeruginosa PAK, 0.5 μl of an overnight bacterial culture was spotted onto LB
plates (0.25% agar) and halo diameters measured after incubation for 24 h at 30°C.
Three motility plates were used for each strain and the experiment was repeated with
three independent cultures.
Biofilm assays
Biofilm formation by P. savastanoi was analyzed on glass surfaces using a static
microcosm assay (Pliego et al., 2008). Static microcosms were established using 50 ml
polypropylene Falcon tubes containing 15 ml of LB-Tc medium with a sterile object
slide (25 mm x 15 mm x 1.5 mm) placed inside. Overnight LB cultures were used to
inoculate microcosms to densities of approximately 107 cfu/ml (OD600 = 0.1).
Microcosms were incubated for 24 and 48 h, vibration-free, at 28°C with lids loosely in
place. To quantify the biofilms, 500 µl of 0.1% crystal violet (CV) was added to each
object slide and left to stain for 30 min. CV was removed by aspiration and each object
slide was washed carefully three times with deionized water. CV acceded to slide was
removed by pipetting with one ml of 70% of ethanol, and quantified by measurement of
A595 (Pérez-Mendoza et al., 2011b).
141
CHAPTER III
For P. aeruginosa PAK, visualization of biofilm formation was carried out in 14 ml
borosilicate tubes. Briefly, LB (3 ml) supplemented with appropriate antibiotics was
inoculated to a final OD600 of 0.1 and incubated at 37°C. Biofilms were stained with
0.1% CV and tubes were washed with water to remove unbound dye. Quantification of
biofilm formation was performed in 24-well polystyrene microtiter plates. M9 medium
(Sambrook and Russell, 2001) (1 ml per well) supplemented with appropriate
antibiotics was inoculated to a final OD600 of 0.01 and incubated at 37°C with shaking
for 6, 8 and 24 h. Biofilms were stained and washed as above, and CV was solubilized
in 96% ethanol before measuring the A600. For each biofilm assay three independent
experimental repetitions were performed.
Exopolysaccharide detection with congo red staining
For P. savastanoi pv. savastanoi the CR-binding assay was carried out on LB
medium supplemented with CR (50 μg/ml) and incubated at 25ºC for 48h. For P.
aeruginosa PAK, the CR staining assay was performed on tryptone (10 g /l) agar (1%)
plates supplemented with 40 mg/ml CR and 20 mg/ml coomassie brilliant blue. Five
microlitres of an overnight bacterial culture was spotted over tryptone plates and
incubated at 30°C for 24h.
Western blots
Cultures were inoculated into LB medium to an OD600 of 0.1 and incubated at 37°C
with shaking for 6 h. Whole-cell lysates were loaded (0.1 OD600 equivalent unit) on
SDS-PAGE and proteins transferred onto nitrocellulose membranes. Primary
antibodies, anti-Hcp1 and anti-PcrV were used at dilutions of 1:500 and 1:1000
respectively. Secondary antibody (horseradish peroxidase-conjugated goat anti-rabbit
IgG) was used at 1:5000 dilution. Visualization was achieved using the SuperSignal
West Pico Chemiluminescent Substrate Kit (Thermo) and a LAS3000 Imaging System
(Fuji). For each Western blot three independent experimental repetitions were
performed.
DgcP and PleD* expression, purification and enzymatic assays
E. coli cells carrying the respective expression plasmid were grown at 30ºC in 2-liter
Erlenmeyer flasks containing 1 liter of 2xYT medium (Sambrook and Russell, 2001)
with Km. For DgcP and PleD* production, protein expression was induced at an OD660
of 0.5 to 0.6 by adding isopropyl 1-thio-β-D-galactopyranoside to 1 mM final
concentration and incubated for 3h at 22ºC. After harvesting by centrifugation, the
resulting pellet was resuspended in 30 ml of buffer A (20 mM Tris-HCl [pH 6.4], 20 mM
142
CHAPTER III
NaCl, 5% [vol/vol] glycerol, 0.1 mM EDTA, and protease inhibitor mixture) (Complete;
Diagnostic GmbH, Mannheim, Germany) and broken by treatment with lysozyme and
using a French press at 20μg/ml. Following centrifugation at 13,000 × g for 60 min. The
supernatant was loaded onto Ni-NTA affinity resin (Qiagen), washed with buffer A, and
eluted with an imidazole gradient. Elution fractions were examined for purity by SDSPAGE, and fractions containing the proteins were pooled. Proteins were extensively
dialyzed against 500 mM NaCl, 50 mM Tris-HCl pH 8.0, 5 mM EDTA, pH 8.0, 5 mM βmercaptoethanol, 5 mM dithiothreitol, 10% glycerol, for storage at -70ºC. Protein
concentrations were determined using the Bio-Rad Protein Assay kit. DGC assays
were adapted from procedures described previously (Tran et al., 2011). C. crescentus
PleD* (Paul et al., 2007) was used as a positive control. The standard reaction
mixtures with purified protein (DgcP or PleD*) contained 50 mM Tris-HCl pH 8.0, 100
mM NaCl, 10 mM MgCl2, 5% glycerol in a 300 µl volume and were started by adding of
different concentrations (100-250 µM) of GTP. Purified DgcP without substrate,
desnaturated protein and reactions using ddGTP as substrate were used as negative
controls. The reactions were incubated at 30°C for 2 h. Cyclic-di-GMP production was
analyzed by reverse phase-coupled high performance liquid chromatography-tandem
mass spectrometry (HPLC-MS/MS) as previously described (Pérez-Mendoza et al.,
2014).
Plant infection and isolation of bacteria from olive knots
Olive plants derived from seeds germinated in vitro (originally collected from a cv
Arbequina plant) were micropropagated, rooted and maintained as previously
described (Rodríguez-Moreno et al., 2008; Rodríguez-Moreno et al., 2009).
Micropropagated olive plants were infected in the stem wound with bacterial
suspension (c. 103CFU) and incubated for 30 days in a growth chamber as described
by Rodríguez-Moreno et al. (2008) (Rodríguez-Moreno et al., 2008). Bacteria were
recovered from the knots using a mortar containing 1 ml of 10 mM MgCl2, and serial
dilutions were plated onto LB medium (to detect the wild type), LB-Km medium (to
detect the mutants) or LB-Tc medium (to detect the complemented strains). Population
densities were calculated from at least three independent replicates. The morphology
of the olive plants infected with bacteria was visualized using a stereoscopic
microscope (Leica MZ FLIII; Leica Microsystems, Wetzlar, Germany). Knot volumes
were quantified using a 3D scanner, and the MiniMagics 2.0 software. Competitive
indexes (CI) were carried out in in vitro-grown olive plants as described previously
(Rodríguez-Moreno et al., 2008; Matas et al., 2012).
143
CHAPTER III
Pathogenicity of P. savastanoi pv. savastanoi isolates in 1-year-old olive explants
(lignified plants) was analyzed as previously described (Penyalver et al., 2006; PérezMartínez et al., 2007). Morphological changes, scored at 90 dpi, were captured with a
high-resolution digital camera Canon D6200 (Canon Corporation, Tokyo, Japan). Knot
volume was calculated by measuring length, width (subtracting the stem diameter
measured above and under the knot from that measured below the knot) and height of
the knot with a Vernier caliper (Moretti et al., 2008; Hosni et al., 2011). Statistical data
analysis was performed by ANOVA test (P ≤ 0.05).
Acute lung injury model
Mouse strains. Age- and gender-matched animals in the C57BL/6J background had
free access to a standard laboratory chow diet in a half-day light cycle exposure and
temperature-controlled Specified-Pathogen Free (SPF) environment as determined by
the FELASA recommendations. All animal experiments were performed in an
accredited establishment (N° B59-108) according to the governmental guidelines
N°86/609/CEE.
Animal
experiments
were
approved
by
the
local
Animal
Experimentation Ethical Comittee (N° CEEA 03/2004R). Acute respiratory tract
infection model was induced by intranasal instillation of P. aeruginosa. C57BL6/J mice
were lightly anesthetized with inhaled sevoflurane (Forene Abbott, Queensborough,
Kent, United Kingdom), after which 50 µl of the bacterial solution were administered
intranasally (5.107 CFU of each strain). All mice were euthanized at 24 h. For bacterial
culture, Mouse lungs were homogenized in sterile containers with sterile isotonic
saline. Lung and spleen homogenates were sequentially diluted and cultured on
bromocresol purple agar plates for 24 h assess bacterial load. Finally, to assess
alveolar capillary permeability, transvascular transport of albumin-FITC was used to
study endothelial permeability in lungs of mice. For Bronchoalveolar Lavage (BAL),
Lungs from each experimental group were washed with a total of 1.5 ml of sterile
phosphate-buffered saline (PBS). Recovered lavage fluid was pooled and centrifuged
(200 g for 10 min), the cellular pellet was washed twice with PBS. BAL samples were
filtered and immediately frozen at -80°C after collection for cytokine measurement by
ELISA. Cell monolayers were prepared with a cytocentrifuge and stained with WrightGiemsa stain. Cellular types were obtained by counting 200 cells/sample (Leica
DM100) and expressing each type of cell as a percentage of the total number counted.
Statistical analysis was carried out using Prism 6 software (GraphPad). One-way
144
CHAPTER III
analysis of variance (ANOVA) followed by multiple comparison tests or t-test was used
for all comparisons. Significance was accepted at p< 0.05.
Table 1. Bacterial strains and plasmids used in this work.
Reference or source
NCPPB 3335
Wild-type strain
(Pérez-Martínez et al., 2007)
∆dgcPPsv
Deletion dgcP (PSA3335_0620) mutant
R
(Km )
This work
PAK
Wild-type strain
S.Lory
∆dgcPPAK
dgcPPAK (PAK) mutant (Km )
This work
∆dgcPPAK Tn::dgcPPAK
Chromosomal complemented dgcPPAK
R
R
(PAK) mutant (Km Gm )
This work
DH5α
F -, ϕ80dlacZ M15, (lacZYA-argF) U169,
deoR, recA1, endA, hsdR17 (rk - mk -),
phoA, supE44, thi-1, gyrA96, relA1.
(Hanahan, 1983)
GM2929
F -, ara-14, leuB6, thi-1, tonA31, lacY1,
tsx-78, galK2, galT22, glnV44, hisG4,
rpsL136, xyl-5,mtl-1, dam13::Tn9, dcm-6,
R
R
mcrB1, hsdR2, mcrA, recF143. (Sp Cm ).
(Palmer and Marinus, 1994)
Strains/Plasmids
Strains
P.savastanoi pv. savastanoi
P. aeruginosa
R
E. coli
TOP10
OmniMAX
BL21
F– mcrA, Δ(mrr-hsdRMS-mcrBC),
Φ80lacZΔM15, lacX74, recA1, araD139,
Δ(ara leu) 7697, galU, endA1, nupG.
R
(Sp ).
F′ proAB+, lacIq, lacZΔM15, Δ(ccdAB)},
mcrA, Δ(mrr- hsdRMSmcrBC)φ80(lacZ)ΔM15, Δ(lacZYA-argF),
U169, endA1, recA1, supE44, thi-1,
R
gyrA96, relA1, tonA ,panD (Tc ).
F-, ompT, gal, dcm, lon, hsdSB (rB- mB-),
λ (DE3 [lacI, lacUV5-T7, gene 1, ind1,
sam7, nin5]
(Invitrogen,USA)
(Invitrogen,USA)
(Novagen,USA)
Original Plasmids
pGEM-T easy
pCR2.1
Cloning vector containing ori f1 and lacZ
R
(Ap )
R
TA cloning, lacZα, ColE1, ori f1. (Ap ,
R
Km )
R
R
(Promega, USA)
(Invitrogen,USA)
R
pGEM-T- KmFRT-BamHI
(Ortíz-Martín et al., 2010)
pJB3Tc19
Ap, Tc ; cloning vector, Plac promoter
pET28a(+)
T7 promoter based E. coli expression
R
vector (Km )
pKNG110
oriR6K, oriTRK2, mobRK2, sacBR+ (Sm )
(Kaniga et al., 1991)
pME6182
Mini-Tn7 gene delivery vector based on
pME3280, HindIII-SmaI-KpnI-NcoI-SphI
R
R
MCS, ColE1 replicon. (Gm Ap )
C. Reimmann
r
(Novagen,USA)
R
145
CHAPTER III
Table 1. Continuation
Strains/Plasmids
Reference or source
pGEM-T-∆dgcPPsv
pGEM-T easy derivate containing dgcP
R
from NCPPB 3335 (Ap )
This work
pCR2.1-dgcPPAK
pCR2.1 derivate containing dgcP from
R
PAK (Km )
This work
pJB3-dgcPPsv
pJB3Tc19 derivative carrying dgcP
R
R
gene from NCPPB 3335 (Tc Ap )
This work
pJB3-dgcPPsv GGEAF
gene from NCPPB 3335 with a point
mutation in the canonical GGDEF motif
R
R
(Tc Ap )
This work
pJB3-dgcPPAK
R
R
gene from PAK (Tc Ap )
This work
pGEM-T-∆dgcPPsv
pGEM-T easy derivates, contains 1.2
kb approx. on each side of the dgcP
(PSA3335_0620) gene from NCPPB
R
3335 (Ap )
This work
pGEM-T-∆dgcPPsv- Km
pGEM-T derivates, contains 1.2 kb
approx. on each side of the dgcP gene
from NCPPB 3335 interrupted by the
R
kanamycin resistance gen nptII (Ap ,
R
Km )
This work
pCR2.1-∆dgcPPAK
pCR2.1 derivates, contains 0.5 kb
R
from PAK (Km )
This work
pNG101- ∆dgcPPAK
pKNG101 derivates, contains 0.5 kb
R
from PAK cloned SpeI-ApaI (Sp ).
This work
pET28a-dgcPPsv
pET28a(+) derivative carrying dgcP
R
gene from NCPPB 3335 (Km )
This work
pGEM-T- dgcPPAK
pGEM-T easy derivate containing
promoter upstream PA5489 and dgcP
R
gene from PAK (Ap )
This work
pME6182- / dgcPPAK
pEM6182 derivate containing promoter
upstream PA5489 and dgcP gene from
R
PAK (Gm )
This work
a
Ap, ampicillin; Cm, chloramphenicol; Gm, gentamycin; Km, kanamycin; Sp, spectinomycin and. Tc,
tetracycline
146
CHAPTER III
Table 2. Oligonucleotides used in this study.
Oligonucleotides
Sequence (5’ to 3’)
AER-0002141 RACE-R1
CCAGGTCAAAGCGGTACTTGCCATT
AER-0002141 RACE-R2
GTCGGACGGCAGTTTTTCAATCCAC
US AER-0002141-F
AGAGGTGTCGGTTTCGTTTG
AER-0002141-R-134
GCTCGACGACTTCGATCTTG
AER-0002141 F-461
ACGTTCGACTCTTTCGCAGT
AER-0002142 R-216
ATCAGATCGCCGATTTTCTG
AER-0002142 F- 616
TCTGATGGGCGACATGAATA
AER-0002143 R-231
TCCAGTACGGCTTTTTCGAG
AER-0002143 F-1881
GTCTGACACTGCTCGACGAA
AER-0002144 R-140
GAAGCTGGAGGGATTTTTCC
PA5489 RACE-R1
ATTCCTTGCCGGCGGTATAGTCGTC
PA5489 RACE-R2
GCTTTCCAGGGTCAGGAACATCTGC
US PA5489- F
TACTTCGCCAGCCAGAAGAT
US PA5489- R
GGCAGCCATACCAGAACAGT
PA5489-5488 F
CAGATGGAAAAGGCCAAGAA
PA5489-5488 R
GCTGATACCGACCTGGATGT
PA5488-5487 F
CCGTCGATCTTCTGGAAAAC
PA5488-5487 R
AGCTCCTTCATGCACTGGTC
DS PA5487 F
CCTGTCCGTTCCATTTCAAG
DS PA5487 R
GTGAGGAAGAGCAGCAGCA
AER-0002141 F-543
CATGATCGTCAATGGCAAG
AER-0002143 R-46
CCCTATAGTGAGTCGGATCCTTCCCTTGAGGTACTTCTC
TD-AER-0002143 F-30
GGATCCGACTCACTATAGGGGACCTGAACGAGCACGTC
TD-AER-0002144 R-196
CCTTCGTGCAGGTCGGTC
TA AER-0002141 F-444
TCGTATGAAGTCCTCACC
AER-0002142 R-37
CCCTATAGTGAGTCGGATCCTTCATCGATCCATGATTGC
AER-0002143 F-13
GGATCCGACTCACTATAGGGGGTTGATCACACCCCGTC
AER-0002143 R-1012
CAGGCTGGCATGGGTCAG
GGDEF2143-F
CGGTTTGGCGGTGAGGCATTTGTCATGCTG
GGDEF2143-R
CAGCATGACAAATTCCTCAGCGCCAAACCG
AER-0002143 F-18
AACCAACATATGAGCGACGACGCGGAG
AER-0002143 R-2041
AACCAACTCGAGTCAGCCTTGTTCGACCCTG
TA-PA5487 F-458
ACCCTGCTGGAAGATCATC
PA5487 R-161
CCCTATAGTGAGTCGGATCCCGCAGCTCCTTCATGCAC
PA5487 F-1983
GGATCCGACTCACTATAGGGCGCTGTATCGAGCCAAG
TD-PA5487 R-500
GTGGTGCGCAGGGTGATC
EP PA5487 mutant F
TGGTACCAGCAGCTCAACC
EP PA5487 mutant R
GCAGGTTGTCCAACAGCATA
PA5487 F-1265
TATACCGACGTGCTGGACAA
PA5487 R-1419
GACACCTCCTGTTCGTGCTC
Promoter PA5489 F-HindIII
AAGCTTTGATCGCTGCGTAGCACGG
Promoter PA5489 R-EcoRI
GAATTCGCCCGGTCAGTTCGACCG
UP 5487F-EcoRI
GAATTCATCTGACCACATCCTGCTC
DS PA5487 R-KpnI
GGTACCGGGACAGCCGGTCATTCTAC
Tn7-GlmS-PAO1
CTCAAGTCGAACCTGCAGGAAGTC
Tn7-R-109
CAGCATAACTGGACTGATTTCAG
Restriction sites generated in the oligonucleotide sequence are underlined.
147
CHAPTER III
RESULTS
Conservation of the dgcP gene-containing cluster in the Pseudomonas genus
In a previous search for attenuated mutants of P. savastanoi pv. savastanoi
NCPPB 3335 in olive plants, we identified a transposon insertion in the
PSA3335_0619
gene,
which
encodes
a
protein
from
the
endonuclease/exonuclease/phosphatase (EEPP) family (Matas et al., 2012). This
gene is part of a cluster that also encodes a putative DGC with a GGDEF domain,
PSA3335_0620. BLASTP searches with the sequence of this protein revealed that
homologs exist only within the Pseudomonas genus, and include all sequenced P.
syringae
pathovars,
Pseudomonas
putida,
Pseudomonas
fluorescens
and
Pseudomonas entomophila, among others (Fig. 1A). We thus renamed the protein
DgcP for “Diguanylate cyclase conserved in Pseudomonads”. DgcP proteins
encoded by P. aeruginosa strains PAO1, PAK and PA14 (671-amino acid residues)
are almost identical (PAO1 vs. PAK and PAO1 or PAK vs. PA14 are 100% and 98%
identical, respectively) and show 50% identity to that of P. savastanoi pv. savastanoi
NCPPB 3335, which is 16 amino acids shorter. The identity between P. aeruginosa
and P. savastanoi DgcP proteins is mostly displayed at the 172 amino-terminal and
the 320 carboxy-terminal regions. Also, the carboxy-terminal regions of both proteins
share a GGEEF motif and an allosteric control RXXD motif (RSDD and RQAD in P.
savastanoi pv. savastanoi NCPPB 3335 and P. aeruginosa PAO1, PAK and PA14,
respectively). Moreover, genetic context analysis around the dgcP gene in a
selection of sequenced Pseudomonas spp. revealed a conserved synteny with two
other genes located upstream of dgcP. One gene encodes EEPP (PSA3335_0619
and PA14_72430 in P. savastanoi NCPPB 3335 and P. aeruginosa PA14,
respectively) that we previously described and the other gene encodes a putative
disulfide interchange protein, DsbA. Furthermore, the EEPP coding gene overlaps
the dgcP gene in most sequenced Pseudomonas spp., including NCPPB 3335 and
PA14, suggesting that these two genes could be part of an operon. Furthermore, and
with the exception of the strains belonging to the P. syringae complex and P. fulva,
one or two genes encoding a putative cytochrome C were located upstream of the
dsbA gene in all other Pseudomonas spp. Finally, a gene encoding a putative Nacetylmuramoyl-L-alanine amidase (ampDh2) was found downstream the dgcP gene
in all species, although P. aeruginosa and P. fulva encode a MarC transporter and a
peptidase family M23 gene, respectively (Fig. 1B).
148
CHAPTER III
A
B
64 savastanoi NCPPB3335
66 aesculi NCPPB3681
100 glycinea race4
93
52
89
phaseolicola 1448A
tabaci ATCC 11528
lachrymans M301315
syringae Cit7
GROUP I
actinidae M302091
100 monosporum M302280PT
56 tomato DC3000
69
P. syringae complex
100 syringae B728A
100
100
aceris M302273PT
91
syringae 642
japonica M301072PT
63
100 aptata DSM 50252
oryzae 1 6
89
5 putida
entomophila L48
76
97
4 fluorescens
100
2 stutzeri
fulva 12X
100
mendocina NK01
75
63
100
5 aeruginosa
GROUP III GROUP II
100
P. fluorecens
maculicola ES4326
91
P. putida, P. entomophila
P. stutzeri
P. fulva
P. aeruginosa
0.1
Fig. 1. Phylogeny and genetic organization of dgcP gene cluster in Pseudomonas. (A)
Phylogenetic analysis of DgcP proteins from several Pseudomonas strains. The tree was
constructed using MEGA5 (Tamura et al., 2011) with the Neighbor-Joining method (Saitou
and Nei, 1987) and evolutionary distances were computed in units of amino acid substitutions
per site. The percentages of replicate trees in which the associated taxa clustered together in
the bootstrap test (10,000 replicates) were shown next to the branches. The locus tags
corresponding to the DgcP proteins used in this analysis appear in the Table 3. (B) Schematic
map of the dgcP gene cluster and the genetic context in the Pseudomonas genus. Red
arrows indicate the dgcP gene cluster; downstream, the grey arrow indicates a gene encoding
an antibiotic transporter (marC), the orange arrow a peptidase M23-encoding gene, and the
blue arrows an N-acetylmuramoyl-L-alanine amidase gene (ampDh2). Upstream, yellow
arrows indicate cytochrome C-encoding genes, the white arrow a gene encoding a suface
antigen of 17KDa, and green arrows indicate a gene encoding a GTP-binding protein.
Overall, cluster analysis based on the amino acid sequence of DgcP proteins
yielded three distinct groups, comprised by P. syringae and P. savastanoi strains
(group I), P. fluorescens, P. putida and P. entomophila (group II) and, P. aeruginosa,
P. stutzeri and P. fulva (group III). Clustering of DgcP proteins was largely congruent
with the phylogeny of the genus Pseudomonas (Yamamoto et al., 2000) and of the P.
syringae complex (Studholme, 2011) deduced from housekeeping genes, suggesting
149
CHAPTER III
that the dgcP gene is ancestral within this bacterial group.
Table 3. Locus Tag for DgcP proteins used for the construction of the NJ tree shown in
Fig. 1A.
Strains
P.savastanoi pv. savastanoi NCPPB3335
P. syringae Cit7
P.syringae pv. aceris M302273PT
P. syringae pv. actinidae M302091
P. syringae pv. aesculi NCPPB3681
P. syringae pv. aptata DSM 50252
P. syringae pv. glicinea race4
P. syringae pv. japonica M301072PT
P. syringae pv. lachrymans M301315
P. syringae pv. maculicola ES4326
P. syringae pv. mori 301020
P. syringae pv. morsprunorum M302280PT
P. syringae pv. oryzae 1_6
P.syringae pv. phaseolicola 1448A
P. syringae pv. syringae 642
P. syringae pv. syringae B728a
P.syringae pv. tomato DC3000
Pseudomonas aeruginosa PAO1
Pseudomonas entomophila L48
Pseudomonas fluorecens Pf-5
Pseudomonas fluorecens PfO-1
Pseudomonas fluorescens SBW25
Pseudomonas fluorescens WH6
Pseudomonas fulva 12-X
Pseudomonas mendocina NK-01
Pseudomonas putida F1
Pseudomonas putida KT2440
Pseudomonas putida S16
Pseudomonas putida W619
Pseudomonas stutzeri A1501
Pseudomonas stutzeri DSM4166
150
Locus Tag
PSA3335_0620
PSYCIT7_11999
PSYAR_16805
PSYAC_13693
PsyrpaN_010100023083
PSYAP_11255
PsgRace4_02295
PSYJA_29888
PLA107_17437
PMA4326_01170
PSYMO_20118
PSYMP_07510
Psyrpo1_010100003834
PSPPH_0255
Psyrps6_010100021588
Psyr_0266
PsyrptA_020100000998
PSPTO_0339
PSPA7_6286
PA5487
PA14_72420
PA39016_003370047
PSEEN0083
PFL_0087
PflO1_0050
PFLU_0085
PFWH6_0084
Psefu_0269
MDS_0176
PputGB1_0144
Pput_0146
PputGB1_0144
PP_0129
PPS_0094
PputW619_5099
PST_4057
PSTAA_4207
CHAPTER III
The dgcP gene is transcribed within a polycistronic mRNA in both P.
savastanoi pv. savastanoi and P. aeruginosa
In order to determine whether the dgcP gene co-transcribes with the EEPPencoding gene and the dsbA gene, RT-PCR assays were carried out using RNA
samples isolated from P. savastanoi pv. savastanoi NCPPB 3335 and P. aeruginosa
PAK. Amplification of the intergenic regions located between the sequential ORFs,
except for that corresponding to the intergenic region between dgcP and its
downstream gene, revealed that those three genes are co-transcribed and suggests
the presence of a terminator downstream dgcP in both strains (Fig. 2).
A
1F
0617
B
dsbA
pb
1000
L
C+
2F
1R
3F
2R
3R
AmpDh2
dgcPPsv
0619
1
2
3
(449pb)
(527pb)
(455pb)
C-
RT
C+
C-
RT
C+
C-
3F
3R
RT
500
C
1F
PA5492
D
PA5491 PA5490
pb
L
C+
dsbA
1R
2F
2R
PA5488
dgcPPAK
PA5486
1
2
3
(327pb)
(429pb)
(442pb)
C-
RT
C+
C-
RT
C+
C-
AmpDh2
RT
1000
500
Fig. 2. Transcriptional analysis of dsbA-dgcP operon in P. savastanoi pv. savastanoi
NCPPB 3335 and P. aeruginosa PAK. Localization of primers used for RT-PCR in P.
savastanoi pv. savastanoi NCPPB 3335 (A) and P. aeruginosa PAK (C). Gel electrophoresis
(1.5 % agarose) of RT-PCR amplicons obtained for NCPPB 3335 (B) and P. aeruginosa PAK
(D). C+, RT-PCR amplification reaction from total DNA of NCPPB 3335 or PAK (positive
control);
C-, negative control using RNA as template; RT, amplification using cDNA
synthesized from RNA samples. L, molecular weight DNA marker (DNA ladder, Promega
Co.). The primers pairs used are detailed in the Table 2.
The initiation transcription site of the dbsA-dgcP operon was determined by 5′
RACE in both NCPPB 3335 and PAK. The transcription start site was localized 37
and 48 bp upstream from the dsbA gene start codon in NCPPB 3335 and PAK,
respectively. Putative σ70 promoter sequences were identified upstream both
151
CHAPTER III
transcription start sites (Fig. 3) using BPROM (http://linux1.softberry.com).
A
PPsv
Putative promoter
gggccgtccgtggtcgcccatttttacaacctcagcgttacactaacgaactcaggctttcgcgttcggtcgaaaccaccg tcgcttgaaggc
cccggcaggcaccagcgggtaaaaatgttggagtcgcaatgtgattgcttgagtccgaaagcgcaagccagctttggtggcagcgaacttccg
-70
-60
-50
-40
-30
-20
-10
+1
10
gattcaatctgctcaggagtaaagcatgcgtaatctgatcatcagcgccgctctggttgccgccagtctgttcggtatgtccgcccaggctgc
ctaagttagacgagtcctcatttcgtacgcattagactagtagtcgcggcgagaccaacggcggtcagacaagccatacaggcgggtccgacg
20
30
40
50
60
70
80
90
100
cacgcccatcgaggcgggcaagcaatacgtcgagctggcgagcgctgtgcctgttgccgagccaggcaagatcgaagtcgtcgagcttttctg
ctgcgggtagctccgcccgttcgttatgcagctcgaccgctcgcgacacggacaacggctcggtccgttctagcttcagcagctcgaaaagac
110
120
130
140
150
160
170
180
190
ctatggctgcccgcactgctacgcgttcgagccaacgatcaatccgtggattgaaaaactgccgtccgacgtcaagttcgt
271…472
gataccgacgggcgtgacgatgcgcaagctcggttgctagttagg cacctaactttttgacggcaggctgcagttcaagca
200
210
220
230
240
250
260
270
tctttcgcagtcaagggcaagatcgcccagtacaaggaactggccaagaagtatgaggtgactggcgttccgaccatgatcgtcaatggcaag
agaaagcgtcagttcccgttctagcgggtcatgttccttgaccggttcttcatactccactgaccgcaaggctg gtactagcagttaccgttc
480
490
500
510
520
530
540
550
560
B
Putative promoter
PPAK
cggctgcccttttttgcgtccgccatcgctacaatgctggaacccgtgaccgctccccccggtcgaactgaccgggccgaacccggccggagagcggc
gccgacgggaaaaaacgcaggcggtagcgatgttacgaccttgggcactggcgaggggggccagcttgactggcccggcttgggccggcctctcgccg
-70
-60
-50
-40
-30
-20
-10
+1
10
20
actgacctcgcctaggagtgaacgatgcgtaacctgattctcaccgccatgctggccatggccagcctgttcggcatggccgcccaggccgacgacta
tgactggagcggatcctcacttgctacgcattggactaagagtggcggtacgtccggtaccggtcggacaagccgtaccggcgggtccggctgctgat
30
40
50
60
70
80
90
100
110
120
taccgccggcaaggaatacgtcgagctgagcagcccggtgccggtgtcccagccgggcaagatcgaagtggtggaactgttctggtatggctgcccgc
atggcggccgttccttatgcagctcgactcgtcgggccacggccacagggtcggcccgttctagcttcaccaccttgacaagaccataccgacgggcg
130
140
150
160
170
180
190
200
210
220
attgctacgcgttcgagccgaccatcgtgccgtggagcgagaagctgccggcagatgtccatttcgtgcgcctgcctgccctgttcggcggtatctgg
taacgatgcgcaagctcggctggtagcacggcacctcgctcttcgacggccgtctacaggtaaagcacgcggacggacgggacaagccgccatagacc
230
240
250
260
270
280
290
300
310
320
aacgtccatgggcagatgttcctgaccctggaaagc
ttgcaggtacccgtctacaaggactgggacctttcg
330
340
350
360
Fig. 3. Identification of the transcription start site of the dsbA-dgcP operon in P.
aeruginosa PAK and P. savastanoi pv. savastanoi NCPPB 3335. The +1 positions in
NCPPB 3335 (A) and PAK (B) were determined by 5’RACE and subsequent sequencing. The
coding sequence of the dsbA genes is shadowed. The transcription start sites for NCPPB
3335 (PPsv) and PAK (PPAK) are shown in bold type. The arrowhead indicates the direction of
transcription. The putative promoters, identified using BPROM (http://linux1.softberry.com)
and the sequence of the primers used for 5’RACE are underlined.
DgcP is an active diguanylate cyclase
The presence of a GGDEF domain in the DgcP protein suggested that this protein
might function as a diguanylate cyclase. To test this hypothesis, a C-terminally Histagged version of the full-length DgcP protein (DgcP-His6) encoded by P. savastanoi
pv. savastanoi NCPPB 3335 (686 amino acids with a predicted MW of 76 kDa) was
overexpressed in E. coli BL21. Soluble DgcP-His6 was purified by nickel affinity
chromatography (Fig. 4A) and assayed in vitro for DGC activity in the presence of
150 µM GTP (Fig. 4B). As negative controls, we used either purified DgcP-His6
without substrate or with 2',3'-dideoxyguanosine-5'-triphosphate (ddGTP) instead of
GTP or heat-denatured DgcP-His6 with GTP. As a positive control, we used purified
PleD*, a mutant variant of the polar development regulator PleD, a well-characterized
diguanylate cyclase from Caulobacter crescentus (Aldridge et al., 2003; Paul et al.,
152
CHAPTER III
2004; Pérez-Mendoza et al., 2014). Reaction products were analyzed by HPLCMS/MS, and peaks with retention times identical to those of the c-di-GMP standard
were observed only in samples containing PleD* or DgcP plus GTP (Fig. 4B). The
DgcP protein produced 388 pmol c-di-GMP/mg of protein, approximately 25 times
lower than the production observed for PleD* (Fig. 4C).
A
B
KDa
1
DgcP activity
2
DgcP Protein
(76 KDa)
66
45
PleD* activity
Relative intensity
36
29
20
C
c-di-GMP
pmol of c-di-GMP/mg of
Protein
100000
10000
1000
100
Denatured
protein
10
1
DgcP
PleD*
time (min)
Fig. 4. Purification and demonstration of the activity of DgcP protein. (A) lane 1, protein
molecular weight marker SDS7 (Sigma-Aldrich); lane 2, SDS-PAGE of the purified DgcP
protein, whose predicted molecular weight is 76 KDa. (B) Mass spectroscopy chromatograms
of c-di-GMP produced by 10µM of DgcP (DgcP activity) and 4µM PleD* from C. crescentus
(positive control, PleD* activity). C-di-GMP, chromatogram obtained for synthetic c-di-GMP
(20 nM); denatured protein, chromatogram obtained for heat-denatured DgcP (negative
control). The three peaks observed in the chromatograms correspond to the three specific
ions resulting from the fragmentation of c-di-GMP: m/z 152 (red), 248 (blue) and 540 (green).
(C) c-di-GMP produced by the activity of DgcP and PleD*. Production of c-di-GMP is indicated
as pmol of c-di-GMP/mg of protein using three amounts of protein. For quantification, a
standard curve was established using synthetic c-di-GMP (2-2000nM).
The dgcP gene impacts the motile/sessile lifestyles and the type III and type VI
secretion systems switch
153
CHAPTER III
It has been previously shown that c-di-GMP is a key second messenger in
controlling lifestyle and virulence traits in Gram-negative bacteria. In particular, it has
been reported in several instances that biofilm-related phenotypes, such us
exopolysaccharides (EPS) production and swimming motility, are associated with cdi-GMP levels (Merritt et al., 2007; Monds et al., 2007; Pesavento et al., 2008). To
further validate in vivo the demonstrated in vitro activity of DgcP, we first constructed
P. savastanoi and P. aeruginosa ΔdgcP mutants with a clean deletion in the dgcP
gene (dgcPPsv or dgcPPAK, respectively) (Table 1) and strains overexpressing dgcP.
EPS production was tested using a congo red (CR) binding assay. Whereas no
difference in CR-binding phenotype was observed between the wild-type strains and
the respective mutants (data not shown), overexpression of the dgcP gene from P.
savastanoi pv. savastanoi NCPPB 3335 (pJB3-dgcPPsv, Table 1) or P. aeruginosa
PAK (pJB3-dgcPPAK, Table 1) in P. aeruginosa PAK resulted in an enhanced CR
binding phenotype, accompanied by the formation of wrinkly colonies (Fig. 5A).
These two EPS-related phenotypes were more drastic in PAK overexpressing its own
dgcPPAK gene. However, the CR binding phenotype observed for P. savastanoi
overexpressing the dgcPPsv gene was only slightly higher than that shown by the
wild-type strain (Fig. 5B).
A
PAK pJB3
PAK
pJB3-dgcPPAK
PAK
pJB3-dgcPPsv
B
NCPPB 3335
pJB3
NCPPB 3335
pJB3-dgcPPsv
Fig. 5. Exopolysaccharides production in P. aeruginosa PAK and P. savastanoi pv.
savastanoi NCPPB 3335 overexpressing the dgcP gene. (A) Colony morphology in congo
red agar plates of P. aeruginosa PAK transformants with the dgcP gene from P. aeruginosa
PAK (dgcPPAK) or P. savastanoi NCPPB 3335 (dgcPPsv). (B) Congo red binding assays in P.
savastanoi NCPPB 3335 overexpressing the dgcPPsv gene.
Deletion of the dgcP gene in P. savastanoi and P. aeruginosa resulted in an
increased swimming motility (~1.4- and ~1.5-fold increase, respectively) (Fig. 6A and
154
CHAPTER III
6B) and a ~twofold decrease in biofilm formation (Fig. 6C and 6D). Also,
complementation of the ΔdgcPPsv and ΔdgcPPAK mutants with their corresponding
dgcP genes and complementation of the ΔdgcPPAK mutant with pJB3-dgcPPsv
resulted in full restoration of both DGC-associated phenotypes (Fig. 6). The ability to
form biofilms of the P. savastanoi ΔdgcPPsv mutant complemented with pJB3-dgcPPsv
resulted to be slightly higher than that of the wild-type strain, probably due to the
overexpression of the dgcP gene from a constitutive promoter in this strain (Fig. 6).
A
B
6000
a
Swimming diameter (mm2)
Swimming diameter (mm 2)
2500
a
2000
b
b
1500
1000
500
a
5000
4000
b
2000
1000
0
NCPPB
1 3335
pJB3
+ pJB3
2
+ dgcP
3 Psv
+ dgcP
PAK+pJB3PAK
PAK
ΔPA5487
ΔPA5487
PAK
pJB3-PA5487
pJB3-dgcP
+pJB3
+ dgcPPsv
PAK
pJB3
PAK ΔPA5487
+ dgcP
4 Psv
GGAFE
ΔdgcPPsv
C 0.8
ΔdgcPPAK
ΔdgcPPAK
D
6
0.6
0.5
b
0.3
c
0.2
c
0.1
0
CV staining (OD 595)
a
0.7
CV staining (OD 595)
c
3000
0
0.4
b
b
a
a
a
5
4
b
3
2
1
0
NCPPB 3335
pJB3
+ pJB3
+ dgcPPsv
+ dgcPPsv
GGAFE
ΔdgcPPsv
PAK pJB3
+pJB3
+ dgcPPAK
+ dgcPPsv
ΔdgcPPAK
Fig. 6. Swimming motility and biofilm formation of P. aeruginosa PAK and P.
savastanoi NCPPB 3335 ΔdgcP mutants. Diameter of the swimming halos (mm2) produced
by P. savastanoi NCPPB 3335 (A) and P. aeruginosa PAK (B) at 72 h (0.3% agar LB plates)
and 24 h (0.25% agar LB plates), respectively. Quantification of biofilm formation by ΔdgcP
mutants of NCPPB 3335 (dgcPPsv,) over glass slides (C) and PAK (dcgPPAK) in borosilicate
glass tubes (D) using crystal violet. Bars are the mean of three biological replicates and the
error bars represent the standard deviation from the average. Letters indicate significant
differences (α=0.05) using ANOVA statistical test.
Additionally, overexpression of the dgcPPsv gene in wild type P. savastanoi
NCPPB 3335 and of both dgcP genes in P. aeruginosa PAK was associated with a
clear inhibition of swimming motility and a hyperbiofilm phenotype (Fig. 7 and, Fig.
8A and 8B, respectively, for NCPPB 3335 and PAK). The highest increase in biofilm
155
CHAPTER III
formation was observed for PAK overexpressing its own dgcPPAK gene (Fig. 8B).
Together, these results demonstrate that the dgcP gene has a role in EPS
production, swimming motility and biofilm formation in both Pseudomonas strains.
Moreover, the DGC activity of the P. savastanoi dgcP gene is able to complement
the free-living phenotypes altered in the ΔdgcPPAK mutant, suggesting the existence
of a similar DgcP-mediated signaling pathway in both bacteria.
A
NCPPB 3335
pJB3
NCPPB 3335
pJB3-dgcPPsv
CV staining (OD595)
B
0.8
*
0.6
0.4
0.2
0
NCPPB 3335
pJB3
NCPPB 3335
pJB3-dgcPPsv
Fig. 7. Phenotypes associated with overexpression in P. savastanoi NCPPB 3335 of the
dgcP gene (dgcPPsv). (A) Swimming motility (0.3% agar LB plates supplemented with
tetracycline) of P. savastanoi pv. savastanoi NCPPB 3335 transformants at 72 h. pJB3, empty
vector, pJB3-dgcPPsv, plasmid pJB3 encoding the dgcP gene. (B) Quantification of the crystal
violet (CV)-stained biofilms by the indicated strains in LB medium. The bars represent the
mean values from three independent cultures ± the standard deviation. The asterisks indicate
values significantly different between both strains. Statistical analyses were performed using
Student´s t-test with a threshold of P = 0.05.
Previous studies in P. aeruginosa have suggested a link between c-di-GMP and
certain virulence functions, including a switch from the T3SS to the T6SS and vice
versa (Moscoso et al., 2011). The switch between the T3SS and T6SS was thus
monitored in P. aeruginosa PAK overexpressing either the dgcPPsv or the dgcPPAK
gene. Immunoblot analysis was used for the detection of PcrV, a structural
component of the T3SS needle (Lee et al., 2007), and Hcp1, the main component of
the T6SS nanotube (Ballister et al., 2008). A P. aeruginosa PAK ΔretS mutant, which
displays an elevation in c-di-GMP levels in comparison with the wild-type strain
(Moscoso et al., 2011), was included as positive control. Our data show that Hcp1 is
readily detected in the retS mutant, as well as in the strains overexpressing either of
the DgcP proteins, whereas the parental strain displays only low Hcp1 levels.
156
CHAPTER III
Conversely, PcrV production is clearly higher in the parental strain than in the dgcPoverexpressing strains, which are similar to the retS mutant (Fig. 8C).
The GGEEF domain of DgcP is required for function
GG[D/E]EF motifs have been shown to be responsible for DGC activity (Romling
et al., 2000; Aldridge et al., 2003; Simm et al., 2004). To test the importance of this
motif in the functionality of the DgcP protein, we generated a mutant changing
Glu607 to an Ala (GGEEF to GGAEF). We then evaluated the ability of the resulting
dgcP mutant allele (dgcPPsvGGAEF) to complement the free-living phenotypes
altered in the ΔdgcPPsv mutant. While, the wild type dgcPPsvGGEEF allele
complemented the observed mutant phenotypes, expression of the dgcPPsvGGAEF
allele in the ΔdgcPPsv mutant fails to restore the biofilm and swimming phenotypes
(Fig. 6). Therefore, we concluded that the DGC activity of the DgcP protein is highly
dependent on an intact GGDEF domain.
A
PAK pJB3
PAK
pJB3-dgcPPAK
PAK
pJB3-dgcPPsv
B
CV staning (OD600 )
7
6
5
4
3
2
1
0
PAK
pJB3 PAK pJB3-dgcPPAK
PAK pJB3-dgcPPsv
PAK
pJB3
PAK
pJB3-dgcPPAK
PAK
pJB3-dgcPPsv
C
α-PcrV
α-Hcp1
Fig. 8. Phenotypes of P. aeruginosa PAK associated to increased c-di-GMP levels due
to overexpression of the dgcP gene from P. aeruginosa PAK (dgcPPAK) or P. savastanoi
NCPPB 3335 (dgcPPsv). Swimming motility in LB 0.25% agar (A), quantification of crystal
violet-stained biofilms under static growth conditions (B) and, western blot analysis using
157
CHAPTER III
antibodies directed against PcrV (T3SS effector) and Hcp1 (T6SS structural component) (C).
The P. savastanoi pv. savastanoi NCPPB 3335 ΔdgcPPsv mutant is hypovirulent
in olive plants
Since we described that DgcP is associated with key traits of Pseudomonas
pathogenesis, we analyzed the role of the dgcPPsv gene in the virulence of P.
savastanoi NCPPB 3335 in olive plants. Fitness attenuation and knot size reduction
have been commonly used to describe hypovirulent mutants in P. savastanoi pv.
savastanoi (Rodríguez-Moreno et al., 2008; Matas et al., 2012). Mixed infections
using the wild-type strain NCPPB 3335 and the ΔdgcPPsv mutant or the
complemented strain (ΔdgcPPsv transformed with plasmid pJB3-dgcPPsv) were
prepared to calculate the competitive index (CI) on in vitro olive plants at 30 dpi. The
results showed that the CI value obtained for the wild-type strain and the ΔdgcPPsv
mutant was significantly lower than 1 (0.086±0.039), indicating that this mutant was
outcompeted by the wild-type strain in planta. However, no differences in
competence were observed between the wild-type and the complemented strain.
To analyze the role of the dgcPPsv gene during the formation of knots on olive
plants we used both in vitro microprogated and lignified one-year-old olive plants
infected with approximately 104 colony-forming units (CFU) of bacteria, and the
disease severity was evaluated after 30 days or 90 days, respectively. Despite the
fact that no differences in the final CFU counts were observed between the wild-type
strain and the ΔdgcPPsv mutant (data not shown), knots induced by the ΔdgcPPsv
mutant in both plant systems were visibly smaller that those developed by the wildtype strain or the complemented strain. Moreover, expression of the dgcPPsvGGAEF
allele in the ΔdgcPPsv mutant resulted in the induction of knots similar to those
induced by the ΔdgcPPsv mutant (Fig. 9A-9B). In fact, the volume of the knots
developed by the ΔdgcPPsv mutant or its derivative strain transformed with pJB3dgcPPsv-GGAEF are ~2.5 and 1.8 times smaller than those induced by the wild-type
strain on in vitro and lignified olive plants, respectively (Fig. 9C-9D). Together, these
results demonstrate that the dgcPPsv gene is essential for full fitness and virulence of
P. savastanoi pv. savastanoi in olive plants.
158
CHAPTER III
∆dgcPPsv
wild type
+ pJB3
A
+pJB3
A.1
+dgcPPsv
GGEAF*
+dgcPPsv
A.2
A.3
wild type
+ dgcPPsv
A.4
A.5
A.6
B
C
70
b
40
c
c
20
a
300
200
b
b
100
10
0
400
a
a
500
ab
50
30
D 600
Volume (mm3)
Volume (mm 3)
60
a
0
wild type +dgcP
+pJB3Psv +dgcPPsv +dgcPPsv wild type
+ pJB3
GGEAF* + dgcPPsv
∆dgcPPsv
wild type
+ pJB3
+pJB3
+dgcPPsv +dgcPPsv
GGEAF*
wild type
+ dgcPPsv
∆dgcPPsv
Fig. 9. Virulence assay of P. savastanoi NCPPB 3335 ∆dgcPPsv mutant on olive plants.
(A, B) Knots induced on in vitro (30 dpi) or lignified (90 dpi) olive plants, respectively, by the
indicated strains. Volume (mm3) induced by the indicated strains on in vitro olive plants (C)
and in lignified plants (D). Bars are the mean of three biological replicates from two different
assays; error bars represent the standard deviation from the average. Letters indicate
significant differences (α=0.05) using ANOVA statistical test. (from the left to the right): pJB3,
control empty plasmid; dgcPPsv, NCPPB 3335 dgcP wild-type gene encoding a GGEEF motif;
dgcPPsv-GGDAF, NCPPB 3335 mutant of the dgcP gene encoding a GGDAF motif.
The P. aeruginosa PAK ΔdgcPPAK showed decreased virulence in infected mice in
an acute lung injury model
Using an in vivo model in mice, we compared lung injury, assessed by lung
permeability index, mediated by sub-lethal inocula of either P. aeruginosa PAK,
ΔdgcPPAK and ∆dgcPPAKTn::dgcPPAK strains. Mice infected with ∆dgcPPAK strain showed
decreased lung injury (Fig. 10A), enhanced bacterial clearance (Fig. 10B) and
decreased bacterial dissemination (Fig. 10C) compared to those infected with wilt-type
159
CHAPTER III
strain PAK or the complemented strain, ∆dgcPPAKTn::dgcPPAK, which expresses a
single copy of the dgcPPAK gene from its own promoter. At the same time,
bronchoalveolar lavage (BAL) cellularity was increased in mice infected with the
ΔdgcPPAK mutant (Fig. 10D), showing increased neutrophils recruitment (Fig. 10E).
Taking together, these results indicate that deletion of dgcP leads to a beneficial
neutrophils recruitment, allowing an enhanced bacterial clearance and decreasing lung
injury for the host.
**
4
2
0
109
*
108
107
106
D
Cellularity (total BAL)
**
PAK
ΔdgcPPAK
2×106
ΔdgcPPAK Tn::dgcPPAK
**
*
1×104
1×103
1×102
6×106
0.0740
4×106
1×105
E
8×106
6×106
1×106
Macrophages
Lymphocytes
Neutrophils
4×106
2×106
0
PA
PA
K
∂d
gc
∂d
P
gc
PA
P:
dg K
cP
0
K
6
*
BAL Cell count (/mL)
Lung Injury (%)
***
C
1010
Spleen Cultures (CFU/mL)
B
8
Bacterial Burden (CFU/lung)
A
Fig. 10. The P. aeruginosa PAK ΔdgcPPAK mutant is hypovirulent in mice. Wild-type mice
after 24h infection with either PAK, ∆dgcPPAK and ∆dgcPPAK Tn::dgcPPAK (n=6 per group). (A)
Lung injury index assessed by alveolar capillary barrier permeability. (B) Bacterial burden in
the lungs after 24 h culture. (C) Bacterial dissemination assessed by spleen homogenates
after culture. (D) Bronchoalveolar lavage cellularity. (E) Cell count from bronchoalveolar
lavage. * p<0.05 ** p<0.01*** p<0,001 error bars represent ± s.d. (n=6).
160
CHAPTER III
DISCUSSION
Enzymes involved in the synthesis and degradation of the universal bacterial
second messenger c-di-GMP have been identified in all major bacterial phyla
(Romling et al., 2013). The genomes of bacterial pathogens encode a variable
number of proteins with GGDEF, EAL and HD-GYP domains ranging from less than
10 (e.g. Xylella fastidiosa and Micobacterium tuberculosis) to over 70 in Vibrio
cholera (Galperin et al., 2001). The opportunistic human pathogen P. aeruginosa and
the plant pathogenic bacterium P. savastanoi pv. savastanoi encode approximately
40 and 30 GGDEF/EAL domain-containing proteins, respectively (Galperin et al.,
2001; Rodríguez-Palenzuela et al., 2010), of which the activity has been clearly
demonstrated for the P. aeruginosa DGC proteins WspR (Hickman et al., 2005),
SadC and RoeA (Merritt et al., 2010), and for the PDE proteins BifA and RocR
(Kuchma et al., 2007; Rao et al., 2008b). C-di-GMP has been reported to impact
biofilm-related phenotypes by the control of the flagellar cascade (Pesavento et al.,
2008; Hengge, 2009), the secretion of adhesins (e.g. LapA) (Monds et al., 2007), and
the production of EPS such as Pel (Merritt et al., 2007). Here we present biochemical
and physiological evidences that DgcPPsv, a GGDEF domain-containing protein
encoded in the genome of P. savastanoi pv. savastanoi NCPPB 3335, possesses
DGC activity. Phylogenetic analysis of this novel DGC protein revealed that DgcP
orthologs are widely distributed but only found within the Pseudomonas genus.
Although clustering of DgcP proteins yielded three distinct phylogenetic groups (Fig.
1A), a high conservation of the genetic context of the dgcP gene was here observed
in all sequenced Pseudomonas spp. (Fig. 1B), suggesting an ancestral origin of this
gene within this bacterial group. Furthermore, we also found that the dgcP gene is
cotranscribed together with two other upstream genes, an EEPP-encoding gene and
the dsbA gene, in both P. savastanoi pv. savastanoi NCPPB 3335 and P. aeruginosa
PAK (Fig. 2 and 3). The persistence of the association of these three orthologs genes
linked to their co-transcription as a polycistronic mRNA, suggested a relevant role of
this operon in the physiology of the Pseudomonas genus. In fact, transposon mutants
in the dsbA gene from P. aeruginosa (Ha et al., 2003) and P. syringae (Kloek et al.,
2000) have been reported to be reduced in virulence and showed an altered
twitching and swimming motility, respectively. Also, a PSA3335_0619 (EEPPencoding gene) transposon insertion mutant of P. savastanoi pv. savastanoi NCPPB
3335 showed reduced survival in olive tissues. However, a clean deletion of the
PSA3335_0619 gene in NCPPB 3335 does not affect bacterial motility, biofilm
formation or virulence of this pathogen in olive plants (data not shown), suggesting
161
CHAPTER III
that the phenotypes observed in the transposon mutant were a consequence of a
polar effect downstream the dgcP gene. In this study, and using clean deletions and
overexpression assays of the dgcP gene, we clearly demonstrate an important role of
this gene in the control of EPS production (Fig. 5), bacterial motility (Fig. 6, 7 and 8),
biofilm formation (Fig. 6, 7 and 8), and virulence (Fig. 9 and 10) in both bacterial
pathogens.
Deletion of the dcgP gene in both P. savastanoi pv. savastanoi and P. aeruginosa
resulted in reduced biofilm formation and increased motility (Fig. 6), phenotypes that
have been associated with reduced c-di-GMP levels (Simm et al., 2004; Jenal and
Malone, 2006; Hengge, 2009). Moreover, a site-directed mutant of the GGDEF
domain abolished the ability of the dgcPPsv gene to complement any of these two
phenotypes (Fig. 6), This result is consistent with those previously reported by other
authors, showing that mutation of the first or the second glutamic acid (E) residue of
the core GG[D/E]EF motif abrogated the activity of DGC proteins (Kim and McCarter,
2007; De et al., 2008; Merritt et al., 2010). Reduction of EPS production, a phenotype
also associated with low levels of c-di-GMP (D'Argenio and Miller, 2004; Merritt et al.,
2010; Pérez-Mendoza et al., 2014), was not detected in the dgcP mutants using a
CR binding assay, perhaps due to the low binding ability observed for the wild-type
strains under the conditions tested. However, overexpression of the dgcP gene
resulted in increased CR binding associated with wrinkled colony morphology in both
bacteria (Fig. 5), as expected for increased EPS production under high levels of c-diGMP. CR has been shown to bind EPS in numerous bacteria, including P.
aeruginosa PAK (Friedman and Kolter, 2004; Vasseur et al., 2005) and P. savastanoi
NCPPB 3335 (Pérez-Mendoza et al., 2014). Thus, all these results demonstrate that
the Pseudomonas dgcP gene is involved in mechanisms regulating motility, biofilm
formation and EPS production, phenotypes all associated with the transition between
the motile and the sessile lifestyle.
Cyclic-di-GMP signaling pathways have been shown to affect virulence in
numerous human, animal, and a limited number of plant bacterial pathogens.
Although deletion of PDEs generally reduces virulence, while deletion of DGCs
increases virulence, systematic genetic screens performed in several bacterial
pathogens have exposed a more complex picture in which deletion of specific DGCs
and PDEs affects virulence in an arbitrary fashion (Kulasakara et al., 2006; Tamayo
et al., 2007; Hengge, 2009; Romling, 2012; Romling et al., 2013). The role of c-diGMP signaling in the virulence of bacterial pathogens belonging to the genus
162
CHAPTER III
Pseudomonas has mainly been focused in P. aeruginosa, with little attention being
paid to P. syringae and related plant pathogens. A systematic study of P. aeruginosa
PA14 DGCs and PDEs showed that transposon mutants affecting PDE proteins
(PvrR and RocR), or proteins containing GGDEF (SadC) or GGDEF/EAL (PA5017
and PA3311) domains resulted in virulence attenuation in a murine thermal injury
model (Kulasakara et al., 2006). However, a transposon insertion into PA5487, the
gene ortholog of dgcPPAK, did not abolish the ability of wild-type PA14 to cause lethal
infection of mice (Kulasakara et al., 2006) . Our study revealed that deletion of this
gene in P. aeruginosa PAK resulted in a hypovirulent phenotype in a mouse model of
acute infection. The observed differences in the virulence of the PAK and PA14 dgcP
mutants could be explained by the fact that P. aeruginosa PA14 has an acquired
mutation in the GacS/Rsm sensor LadS, which promotes biofilm formation and
represses the T3SS (Mikkelsen et al., 2011b). Besides the possible genomics and
virulence differences between these two P. aeruginosa strains, our virulence assay
was not based on mice survival after bacterial infection but considered several
parameters related to acute infection, e.g. lung injury and accumulation of
bronchoalveolar lavage lymphocytes (Fig.10). A virulence reduction was also
observed for the P. savastanoi pv. savastanoi NCPPB 3335 dgcPPsv mutant in olive
plants. Although several reports have evidenced a negative regulation of virulence by
c-di-GMP in bacterial phytopathogens like Erwinia amylovora (Edmunds et al., 2013),
Xanthomonas campestris (Ryan et al., 2006a; Ryan et al., 2007) or Dickeya dadantii
(Yi et al., 2010), high c-di-GMP increases virulence of Xylella fastidiosa (Chatterjee et
al., 2010). Also, a recent study showed that overexpression of the DGC PleD* from
C. crescentus in P. savastanoi pv. savastanoi NCPPB 3335, resulted in an increased
knot size on olive plants (Pérez-Mendoza et al., 2014). Along these lines, the
observed reduction of virulence for both dgcPPAK and dgcPPsv mutants could be
related to their reduced ability to form biofilms, a process involved in the infection of
lungs and olive tissues by P. aeruginosa (Singh et al., 2000) and P. savastanoi pv.
savastanoi (Rodríguez-Moreno et al., 2009), respectively. Opposite regulation of
virulence by different DGCs has been explained by temporal and spatial variations in
the levels of c-di-GMP required at different disease stages (Romling et al., 2013).
Also related to bacterial virulence, overexpression of the dgcP gene in P. aeruginosa
PAK repressed the T3SS and induces of the T6SS (Fig. 8C). In agreement with
these results, high levels of c-di-GMP have been previously related to the
T3SS/T6SS switch in P. aeruginosa PAK (Moscoso et al., 2011), as well as with
down-regulation of the T3SS in D. dadantii (Yi et al., 2010), P. syringae pv.
163
CHAPTER III
phaseolicola and P. syringae pv. tomato (Pérez-Mendoza et al., 2014). A direct effect
over the transcription of T3SS genes has not been observed by overexpression of
the DGC PleD* in P. savastanoi pv. savastanoi (Pérez-Mendoza et al., 2014)
although disease features were clearly affected, suggesting that c-di-GMP could
regulate the P. savastanoi T3SS in a different manner or requires fine tuning
expression of various virulence factors. In relation to this, repression of the T3SS and
induction of the T6SS has been recently reported in P. savastanoi by exogenously
added indole-3-acetic acid (Aragón et al., 2014), a well studied pathogenicity factor in
this bacterial pathogen.
In summary, in this work we identify and characterize a novel and Pseudomonadsspecific DGC protein and demonstrate its role in biofilm formation and virulence in
both the opportunistic human pathogen P. aeruginosa and the plant pathogenic
bacterium P. savastanoi. We determined that in both infection models used, biofilm
formation is apparently important, as indicated by the virulence attenuation observed
for the dgcPPAK and dgcPPsv mutants. The persistence of the association of the dgcP
and dsbA genes in the genomes of all sequenced Pseudomonas spp, together with
their co-transcription, suggests that regulation of c-di-GMP levels by DgcP might be
linked to DsbA-mediated posttranslational modification of virulence-related factors,
an issue that remains to be elucidated. Finally, in the light of the broad host range
spectrum of DgcP, this DGC protein emerge as a possible target for the control of P.
aeruginosa and P. syringae and related pathogens infections.
164
CONCLUDING
REMARKS
CONCLUDING REMARKS
In this thesis we have established Pseudomonas savastanoi pv. savastanoi NCPPB
3335 as a model bacterium for the study of the role of c-di-GMP signaling in the
virulence of bacterial phytopathogens belonging to the genus Pseudomonas. First, in
silico analyses carried out using the nucleotide sequence of the draft genome of P.
savastanoi pv. savastanoi NCPPB 3335 (Rodríguez-Palenzuela et al., 2010) revealed
the codification of 34 GGDEF- or GGDEF/EAL-containing proteins, which could be
related
to
c-di-GMP
metabolism
in
this
bacterial
phytopathogen.
Second,
overexpression in this bacterium of the diguanylate cyclase (DGC) PleD* from
Caulobacter crescentus demonstrated that increased c-di-GMP levels are associated
with the control of biofilm- and virulence-related phenotypes (Chapter I). Table 1 shows
the free-living- and virulence-related phenotypes altered in P. savastanoi pv.
savastanoi NCPPB 3335 by modification of its intracellular c-di-GMP levels using the
different strategies exploited in this Thesis. Regulation of biofilm-related phenotypes by
c-di-GMP levels has been described to be mediated by the binding of c-di-GMP to PilZ
protein domains, such as those encoded in the BcsA and BcsB subunits of the
cellulose synthase complex (Mayer et al., 1991; Weinhouse et al., 1997; Amikam and
Galperin, 2006) or in flagellum-related proteins (Ko and Park, 2000; Ryjenkov et al.,
2006; Christen et al., 2007; Pratt et al., 2007; Martínez-Granero et al., 2014). In fact,
PilZ domains (RxxxR and D/NxSxxG motifs) can be found in the in the WssB subunit of
cellulose synthase (PSA3335_1026) and in the FlgZ protein (PSA3335_3327) encoded
by P. savastanoi pv. savastanoi NCPPB 3335 (Fig. 1). Moreover, overexpression of the
pleD* gene in this bacterium also resulted in an increased knot size and a reduction of
necrosis in the internal knot tissue (Table 1). High intracellular levels of c-di-GMP have
previously been shown not to have any detectable impact in the virulence of either
Pseudomonas syringae pv. phaseolicola 1448A or P. syringae pv. tomato DC3000,
since the strains overexpressing PleD* induced the same disease symptoms as the
wild type (Pérez-Mendoza et al., 2014). Thus, the interaction NCPPB 3335-olive plants
has emerged as a more suitable model system to analyze the effect o c-di-GMP
signaling in the virulence of the P. syringae complex. However, clear effects of high cdi-GMP levels in the transcription of virulence-related genes, such as those related with
the biosynthesis of indole-3-acetic acid (IAA) or the type III secretion system (T3SS),
could not be detected in P. savastanoi. It is possible that c-di-GMP regulates the
biosynthesis of these two virulence factors in a different manner, or requires fine tuning
expression of various virulence factors. In fact, different c-di-GMP regulatory
mechanisms have been demonstrated in bacteria, including transcriptional regulation
(Hickman and Harwood, 2008), translational regulation (Sudarsan et al., 2008),
regulation of protein activity (Fang and Gomelsky, 2010) and cross-envelope signaling
167
CONCLUDING REMARKS
(Navarro et al., 2011). Nevertheless, and as described below, mutation of specific P.
savastanoi pv. savastanoi NCPPB 3335 DGC or phosphodiesterase (PDE) proteins
clearly resulted in a virulence reduction (Chapter II and Chapter III), supporting again
the relevance of this model bacterium for further studies related to c-di-GMP signaling.
The Pseudomonas aeruginosa and Pseudomonas putida BifA proteins have been
located in the inner bacterial membrane, and the integrity of their EAL and modified
GGDEF domains have been shown to be crucial for PDE activity and for the regulation
of the intracellular c-di- GMP levels (Kuchma et al., 2007; Jiménez-Fernández et al.,
2014). In Chapter II we show results demonstrating that a functional BifA is required
not only for the control of bacterial motility, but also for full fitness and virulence of P.
savastanoi pv. savastanoi NCPPB 3335 (Table 1) and P. syringae pv. tomato DC3000,
respectively, in olive and tomato plants. Virulence-related phenotypes altered in both
bifA mutants were all fully restored by complementation with the bifA gene from P.
aeruginosa, suggesting that BifA have identical functions in all three bacterial
pathogens. Moreover, overexpression of the bifA gene induced phenotypes associated
with low c-di-GMP levels (Table 1), which are opposite to those induced by high c-diGMP levels in both P. savastanoi pv. savastanoi NCPPB 3335 (Chapter I) and P.
syringae pv. tomato DC3000 (Pérez-Mendoza et al., 2014). Together, all these results
suggest that P. savastanoi and P. syringae BifA are also c-di-GMP PDE proteins
involved in the regulation of the intracellular c-di-GMP concentration, which in turn
regulates virulence-related phenotypes such as EPS production, bacterial motility and
biofilm formation (Table 1). It could be possible that increased levels of c-di-GMP
caused by deletion of the bifA gene could have an effect over the ability of P. syringae
and P. savastanoi to systematically invade the plants tissues, as a consequence of the
inhibition of bacterial motility (Chapter II, Fig. 5, Fig. 6 and Fig. 7). Additionally,
virulence attenuation of the bifA mutants could be also related to c-di-GMP-mediated
regulation of virulence-related genes, such as those involved in the biosynthesis of
phytohormones or the T3SS. However, this hypothesis remains to be elucidated.
168
CONCLUDING REMARKS
Table 1. Free-living and virulence-related phenotypes altered by modification of
intracellular c-di-GMP levels in P. savastanoi pv. savastanoi NCPPB 3335.
Overexpression
Swimming
Biofilm
motility
formation
Reduced
Enhanced
EPS production
Symptoms in
olive plants
Enhanced
of PleD*
Larger knots with
reduced necrosis
BifA deletion
Reduced
Not altered
Not altered
Smaller knots
BifA
Enhanced
Reduced
Reduced
Not determined
DgcP deletion
Enhanced
Reduced
Not altered
Smaller knots
DgcP
Reduced
Enhanced
Slightly enhanced
Not altered
overexpression
overexpression
Finally, in Chapter III we demonstrate that the P. savastanoi pv. savastanoi NCPPB
3335 PSA3335_0620 gene encodes for an active DGC protein (DgcPPsv), which in vitro
activity is dependent on the GGDEF domain. Deletion mutants in this gene caused
decreased biofilm formation and increased motility in P. savastanoi pv. savastanoi
(ΔdgcPPsv) (Table 1) and P. aeruginosa PAK (ΔdgcPPAK). Overexpression of the dgcP
gene in both pathogenic Pseudomonas spp. was here associated with similar
phenotypes to those previously described for the overexpression of the DGC PleD*
(Chapter I) but opposite to the consequences of the overexpression of the PDE BifA
(Chapter II) (Table 1). Interestingly, overexpression of the dgcP gene in P. aeruginosa
PAK inhibited the T3SS and induced the type VI secretion system (T6SS). In
agreement with this observation, high c-di-GMP levels have been previously related to
the T3SS/T6SS switch in P. aeruginosa PAK (Moscoso et al., 2011), as well as with
down-regulation of the T3SS in D. dadantii (Yi et al., 2010), P. syringae pv.
phaseolicola and P. syringae pv. tomato (Pérez-Mendoza et al., 2014). However,
overexpression of this DGC protein in P. savastanoi pv. savastanoi NCPPB 3335 was
not associated with changes in the transcriptional levels of the T3SS or T6SS (data not
shown). Nevertheless, it could be possible that the T3SS/T6SS switch induced by high
c-di-GMP levels occurs at post-transcriptional levels. A functional T3SS is required for
full virulence in P. aeruginosa (Hauser, 2009; Veesenmeyer et al., 2009) and P.
savastanoi (Sisto et al., 2004; Pérez-Martínez et al., 2010; Matas et al., 2012),
however, the role of the T6SS in the virulence of pathogenic Pseudomonas spp. have
not been described. Despite the fact that we could not demonstrate an effect of c-diGMP levels on the expression of virulence-related genes, a clear attenuation of
virulence was observed for the P. savastanoi pv. savastanoi NCPPB 3335 dgcPPsv
mutant in olive plants (Table 1). Opposite to this, high c-di-GMP levels were here
associated with virulence reduction in this pathogen (Chapter II). However, opposite
169
CONCLUDING REMARKS
effects of intracellular c-di-GMP levels on the virulence of bacterial pathogens have
also been reported in other bacteria (Tamayo et al., 2007; Romling, 2012; Romling et
al., 2013). On the other hand, it could be possible that spatiotemporal differences in the
expression of BifA and DgcP during host infection are responsible of the activation of
different c-di-GMP signaling pathways, both resulting in the induction of bacterial
virulence. How and when c-di-GMP signaling pathways affect infections is still poorly
understood, in part because we do not have the means to observe or modulate
bacteria inside their hosts during infection with sufficient spatiotemporal resolution
(Romling et al., 2013). Nevertheless, virulence reduction observed for the dgcPPsv
mutant could be related to its reduced ability to form biofilms, a process involved in
chronic infection of olive tissues by P. savastanoi pv. savastanoi (Rodríguez-Moreno et
al., 2009). Next challenge is to elucidate the precise sites of activity of BifA- and DgcPmediated c-di-GMP signaling in both P. aeruginosa and P. savastanoi, which would
provide more clues about the function of these proteins in the virulence of pathogenic
Pseudomonads.
Cellulose
(EPS)
C
B
D
A
2GTP
Flagellum
c-di-GMP
CH2-COOH
NH
Biofilm
pGpG
Virulence
Fig. 1. Model of PleD*-, BifA- and DgcP-mediated c-di-GMP signaling in P. savastanoi pv.
savastanoi NCPPB 3335. Cyclic-di-GMP-metabolizing proteins are represented in different
colors: orange, DGC proteins; green, PDE proteins. T3SS, type III secretion system; T6SS, type
VI secretion system; IAA, indole-3-acetic acid. Black arrowheads and flat tips show activation
and inhibition processes, respectively. Dotted lines indicated hypothetical connections between
virulence factors and c-di-GMP signaling. Red arrows indicate either activation or inhibition of
virulence depending on the specific c-di-GMP metabolizing protein.
170
CONCLUSIONS
CONCLUSIONS
1. The Pseudomonas savastanoi pv. savastanoi NCPPB 3335 genome encodes 34
GGDEF-containing proteins, which are highly conserved within the Pseudomonas
syringae complex; 14 of these proteins present a tandem GGDEF-EAL domain.
2. High levels of intracellular c-di-GMP obtained by overexpression of the diguanylate
cyclase PleD* in P. savastanoi pv. savastanoi NCPPB 3335 causes reduction of
swimming motility, increased production of extracellular polysaccharides, enhanced
biofilm formation, and the formation of larger knots on olive plants, which however,
display a reduced necrosis..
3. The bifA gene positively impact motility in P. savastanoi pv. savastanoi NCPPB
3335 and P. syringae pv. tomato DC3000 and negatively regulate biofilm formation
and exopolysaccharides production in NCPPB 3335.
4. A functional bifA gene is required for full virulence of both P. savastanoi pv.
savastanoi NCPPB 3335 and P. syringae pv. tomato DC3000 in olive plants and
tomato plants, respectively.
5. The virulence-related phenotypes altered by deletion of the bifA gene in P.
savastanoi pv. savastanoi NCPPB 3335 and P. syringae pv. tomato DC3000 can
be fully restored by expression of the cyclic-di-GMP phosphodiesterase BifA from
Pseudomonas aeruginosa PAO1.
6. The dgcP gene is co-transcribed as an operon with the dsbA gene and an
endonuclease/exonuclease/phosphatase gene in both P. savastanoi pv. savastanoi
NCPPB 3335 and P. aeruginosa PAK, this operon is highly conserved in the
Pseudomonas genus.
7. The P. savastanoi pv. savastanoi NCPPB 3335 DgcP protein is an active
diguanylate cyclase, which activity is highly dependent on its GGDEF domain.
8. The dgcP gene negatively and positively impact motility and biofilm formation,
respectively, in both P. savastanoi pv. savastanoi NCPPB 3335 and P. aeruginosa
PAK.
9. Overexpression of the dgcP gene in P. aeruginosa PAK inhibits the type III
secretion system and induces the type VI secretion system.
10. The dgcP gene is required for full virulence of P. savastanoi pv. savastanoi NCPPB
3335 and P. aeruginosa PAK, respectively, in olive plants and mice.
173
CONCLUSIONS
174
CONCLUSIONES
CONCLUSIONES
1. El genoma de Pseudomonas savastanoi pv. savastanoi NCPPB 3335 codifica 34
proteínas con dominios GGDEF que se encuentran conservadas dentro del
complejo Pseudomonas syringae; 14 de ellas presentan en tándem un dominio
EAL.
2.
El aumento de los niveles intracelulares de c-di-GMP en P. savastanoi pv.
savastanoi NCPPB 3335 debido a la sobreexpresión de la diguanilato ciclasa
PleD*, causa una reducción de la movilidad tipo swimming y un incremento en la
producción de exopolisacáridos y en la formación de biofilms, así como induce el
desarrollo de tumores de mayor tamaño en plantas de olivo, los cuales muestran
una necrosis reducida.
3. La proteína BifA regula positivamente la movilidad en P. savastanoi pv. savastanoi
NCPPB 3335 y P. syringae pv. tomato DC3000, así como afecta negativamente a
la producción de exopolisácaridos y la formación de biofilms en NCPPB 3335.
4. La deleción del gen bifA provoca una disminución de la virulencia de P. savastanoi
pv. savastanoi NCPPB 3335 en olivo y de P. syringae pv. tomato DC3000 en
tomate.
5.
La fosfodiesterasa BifA de Pseudomonas aeruginosa PAO1 complementa todos
los fenotipos relacionados con la virulencia que se encuentran alterados en los
mutantes bifA de P. savastanoi pv. savastanoi NCPPB 3335 y P. syringae pv.
tomato DC3000.
6. El gen dgcP de P. savastanoi pv. savastanoi NCPPB 3335 y P. aeruginosa PAK se
co-transcribe en forma de operón junto con el gen dsbA y otro gen codificante de
una endonucleasa/ exonucleasa/ fosfatasa (EEPP), este operón está conservado
en el género Pseudomonas.
7. La proteína DgcP de P. savastanoi pv. savastanoi NCPPB335 es una diguanilato
ciclasa cuya actividad es dependiente del dominio GGDEF.
8. La proteína DgcP regula positivamente la movilidad y negativamente la formación
de biofilms tanto en P. savastanoi pv. savastanoi NCPPB 3335 como en P.
aeruginosa PAK.
9. La sobreexpresión del gen dgcP en P. aeruginosa PAK inhibe el sistema de
secreción tipo III e induce el sistema de secreción tipo IV.
10. El gen dgcP es esencial para la virulencia completa de P. savastanoi pv.
savastanoi NCPPB 3335 en plantas de olivo y de P. aeruginosa PAK en ratones.
177
CONCLUSIONES
178
REFERENCES
REFERENCES
Ahmad, I., Lamprokostopoulou, A., Le Guyon, S., Streck, E., Barthel, M., Peters, V., Hardt,
W.D., and Romling, U. 2011. Complex c-di-GMP signaling networks mediate transition
between virulence properties and biofilm formation in Salmonella enterica serovar
Typhimurium. PLoS One 6:e28351.
Aldridge, P., Paul, R., Goymer, P., Rainey, P., and Jenal, U. 2003. Role of the GGDEF regulator
PleD in polar development of Caulobacter crescentus. Mol Microbiol 47:1695-1708.
Alm, R.A., Bodero, A.J., Free, P.D., and Mattick, J.S. 1996. Identification of a novel gene, pilZ,
essential for type 4 fimbrial biogenesis in Pseudomonas aeruginosa. J Bacteriol 178:4653.
Amikam, D., and Benziman, M. 1989. Cyclic diguanylic acid and cellulose synthesis in
Agrobacterium tumefaciens. J Bacteriol 171:6649-6655.
Amikam, D., and Galperin, M.Y. 2006. PilZ domain is part of the bacterial c-di-GMP binding
protein. Bioinformatics 22:3-6.
Amikam, D., Steinberger, O., Shkolnik, T., and Ben-Ishai, Z. 1995. The novel cyclic dinucleotide
3'-5' cyclic diguanylic acid binds to p21ras and enhances DNA synthesis but not cell
replication in the Molt 4 cell line. Biochem J 311 ( Pt 3):921-927.
Amikam D, Weinhouse H, and MY., G. 2010. Moshe Benziman and the discovery of c-di-GMP.
The second messenger cyclic di-GMP.p 11-23. In Wolfe AJ, Visick KL (ed). ASM Press,
Washington, DC.
.
Anzai, Y., Kim, H., Park, J.Y., Wakabayashi, H., and Oyaizu, H. 2000. Phylogenetic affiliation of
the pseudomonads based on 16S rRNA sequence. Int J Syst Evol Microbiol 50 Pt
4:1563-1589.
Aragón, I.M., Pérez-Martínez, I., Moreno-Pérez, A., Cerezo, M., and Ramos, C. 2014. New
insights into the role of indole-3-acetic acid in the virulence of Pseudomonas savastanoi
pv. savastanoi. FEMS Microbiology Letters.
Ausmees, N., Mayer, R., Weinhouse, H., Volman, G., Amikam, D., Benziman, M., and Lindberg,
M. 2001. Genetic data indicate that proteins containing the GGDEF domain possess
diguanylate cyclase activity. FEMS Microbiology Letters 204:163-167.
Ballister, E.R., Lai, A.H., Zuckermann, R.N., Cheng, Y., and Mougous, J.D. 2008. In vitro selfassembly of tailorable nanotubes from a simple protein building block. Proc Natl Acad
Sci U S A 105:3733-3738.
Bardaji, L., Pérez-Martínez, I., Rodríguez-Moreno, L., Rodríguez-Palenzuela, P., Sundin, G.W.,
Ramos, C., and Murillo, J. 2011. Sequence and role in virulence of the three plasmid
complement of the model tumor-inducing bacterium Pseudomonas savastanoi pv.
savastanoi NCPPB 3335. PLoS ONE 6:e25705.
Barnhart, D.M., Su, S., Baccaro, B.E., Banta, L.M., and Farrand, S.K. 2013. CelR, an ortholog
of the diguanylate cyclase PleD of Caulobacter, regulates cellulose synthesis in
Agrobacterium tumefaciens. Appl Environ Microbiol 79:7188-7202.
Barrick, J.E., and Breaker, R.R. 2007. The distributions, mechanisms, and structures of
metabolite-binding riboswitches. Genome Biol 8:R239.
Ben Haj Khalifa, A., Moissenet, D., Vu Thien, H., and Khedher, M. 2011. Virulence factors in
Pseudomonas aeruginosa: mechanisms and modes of regulation. Ann Biol Clin (Paris)
69:393-403.
Blatny, J.M., Brautaset, T., Winther-Larsen, H.C., Haugan, K., and Valla, S. 1997. Construction
and use of a versatile set of broad-host-range cloning and expression vectors based on
the RK2 replicon. Appl Environ Microbiol 63:370-379.
Bobrov, A.G., Kirillina, O., Ryjenkov, D.A., Waters, C.M., Price, P.A., Fetherston, J.D., Mack, D.,
Goldman, W.E., Gomelsky, M., and Perry, R.D. 2011. Systematic analysis of cyclic diGMP signalling enzymes and their role in biofilm formation and virulence in Yersinia
pestis. Mol Microbiol 79:533-551.
Boch, J., Joardar, V., Gao, L., Robertson, T.L., Lim, M., and Kunkel, B.N. 2002. Identification of
Pseudomonas syringae pv. tomato genes induced during infection of Arabidopsis
thaliana. Mol Microbiol 44:73-88.
Borlee, B.R., Goldman, A.D., Murakami, K., Samudrala, R., Wozniak, D.J., and Parsek, M.R.
2010. Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce
the biofilm extracellular matrix. Mol Microbiol 75:827-842.
Boyd, C.D., and O'Toole, G.A. 2012. Second messenger regulation of biofilm formation:
breakthroughs in understanding c-di-GMP effector systems. Annu Rev Cell Dev Biol
28:439-462.
181
REFERENCES
Brooks, D.M., Hernández-Guzmán, G., Kloek, A.P., Alarcón-Chaidez, F., Sreedharan, A.,
Rangaswamy, V., Peñaloza-Vázquez, A., Bender, C.L., and Kunkel, B.N. 2004.
Identification and Characterization of a Well-Defined Series of Coronatine Biosynthetic
Mutants of Pseudomonas syringae pv. tomato DC3000. Molecular Plant-Microbe
Interactions 17:162-174.
Buell, C.R., Joardar, V., Lindeberg, M., Selengut, J., Paulsen, I.T., Gwinn, M.L., Dodson, R.J.,
Deboy, R.T., Durkin, A.S., Kolonay, J.F., Madupu, R., Daugherty, S., Brinkac, L.,
Beanan, M.J., Haft, D.H., Nelson, W.C., Davidsen, T., Zafar, N., Zhou, L., Liu, J., Yuan,
Q., Khouri, H., Fedorova, N., Tran, B., Russell, D., Berry, K., Utterback, T., Van Aken,
S.E., Feldblyum, T.V., D'Ascenzo, M., Deng, W.L., Ramos, A.R., Alfano, J.R.,
Cartinhour, S., Chatterjee, A.K., Delaney, T.P., Lazarowitz, S.G., Martin, G.B.,
Schneider, D.J., Tang, X., Bender, C.L., White, O., Fraser, C.M., and Collmer, A. 2003.
The complete genome sequence of the Arabidopsis and tomato pathogen
Pseudomonas syringae pv. tomato DC3000. Proc Natl Acad Sci U S A 100:1018110186.
Caiazza, N.C., Merritt, J.H., Brothers, K.M., and O'Toole, G.A. 2007. Inverse regulation of
biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. J Bacteriol
189:3603-3612.
Carrion, V.J., Arrebola, E., Cazorla, F.M., Murillo, J., and de Vicente, A. 2012. The mbo operon
is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.
PLoS One 7:e36709.
Claret, L., Miquel, S., Vieille, N., Ryjenkov, D.A., Gomelsky, M., and Darfeuille-Michaud, A.
2007. The flagellar sigma factor FliA regulates adhesion and invasion of Crohn diseaseassociated Escherichia coli via a cyclic dimeric GMP-dependent pathway. J Biol Chem
282:33275-33283.
Collmer, A., Badel, J.L., Charkowski, A.O., Deng, W.L., Fouts, D.E., Ramos, A.R., Rehm, A.H.,
Anderson, D.M., Schneewind, O., van Dijk, K., and Alfano, J.R. 2000. Pseudomonas
syringae Hrp type III secretion system and effector proteins. Proc Natl Acad Sci U S A
97:8770-8777.
Costerton, J.W., Stewart, P.S., and Greenberg, E.P. 1999. Bacterial biofilms: a common cause
of persistent infections. Science 284:1318-1322.
Cotter, P.A., and Stibitz, S. 2007. c-di-GMP-mediated regulation of virulence and biofilm
formation. Curr Opin Microbiol 10:17-23.
Cunnac, S., Chakravarthy, S., Kvitko, B.H., Russell, A.B., Martin, G.B., and Collmer, A. 2011a.
Genetic disassembly and combinatorial reassembly identify a minimal functional
repertoire of type III effectors in Pseudomonas syringae. Proc Natl Acad Sci U S A
108:2975-2980.
Cunnac, S., Chakravarthy, S., Kvitko, B.H., Russell, A.B., Martin, G.B., and Collmer, A. 2011b.
Genetic disassembly and combinatorial reassembly identify a minimal functional
repertoire of type III effectors in Pseudomonas syringae. Proceedings of the National
Academy of Sciences 108:2975-2980.
Cha, J.Y., Lee, D.G., Lee, J.S., Oh, J.I., and Baik, H.S. 2012. GacA directly regulates
expression of several virulence genes in Pseudomonas syringae pv. tabaci 11528.
Biochem Biophys Res Commun 417:665-672.
Chan, C., Paul, R., Samoray, D., Amiot, N.C., Giese, B., Jenal, U., and Schirmer, T. 2004.
Structural basis of activity and allosteric control of diguanylate cyclase. Proc Natl Acad
Sci U S A 101:17084-17089.
Chatterjee, A., Cui, Y., Hasegawa, H., and Chatterjee, A.K. 2007. PsrA, the Pseudomonas
sigma regulator, controls regulators of epiphytic fitness, quorum-sensing signals, and
plant interactions in Pseudomonas syringae pv. tomato strain DC3000. Applied and
Environmental Microbiology 73:3684-3694.
Chatterjee, S., Killiny, N., Almeida, R.P., and Lindow, S.E. 2010. Role of cyclic di-GMP in Xylella
fastidiosa biofilm formation, plant virulence, and insect transmission. Mol Plant Microbe
Interact 23:1356-1363.
Chin, K.H., Lee, Y.C., Tu, Z.L., Chen, C.H., Tseng, Y.H., Yang, J.M., Ryan, R.P., McCarthy, Y.,
Dow, J.M., Wang, A.H., and Chou, S.H. 2010. The cAMP receptor-like protein CLP is a
novel c-di-GMP receptor linking cell-cell signaling to virulence gene expression in
Xanthomonas campestris. J Mol Biol 396:646-662.
182
REFERENCES
Choi, K.H., Kumar, A., and Schweizer, H.P. 2006. A 10-min method for preparation of highly
electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer
between chromosomes and plasmid transformation. J Microbiol Methods 64:391-397.
Christen, B., Christen, M., Paul, R., Schmid, F., Folcher, M., Jenoe, P., Meuwly, M., and Jenal,
U. 2006. Allosteric control of cyclic di-GMP signaling. J Biol Chem 281:32015-32024.
Christen, M., Christen, B., Folcher, M., Schauerte, A., and Jenal, U. 2005. Identification and
characterization of a cyclic di-GMP-specific phosphodiesterase and its allosteric control
by GTP. J Biol Chem 280:30829-30837.
Christen, M., Christen, B., Allan, M.G., Folcher, M., Jenö, P., Grzesiek, S., and Jenal, U. 2007.
DgrA is a member of a new family of cyclic diguanosine monophosphate receptors and
controls flagellar motor function in Caulobacter crescentus. Proceedings of the National
Academy of Sciences 104:4112-4117.
D'Argenio, D.A., and Miller, S.I. 2004. Cyclic di-GMP as a bacterial second messenger.
Microbiology 150:2497-2502.
Danhorn, T., and Fuqua, C. 2007. Biofilm formation by plant-associated bacteria. Annu Rev
Microbiol 61:401-422.
De, N., Navarro, M.V., Raghavan, R.V., and Sondermann, H. 2009. Determinants for the
activation and autoinhibition of the diguanylate cyclase response regulator WspR. J Mol
Biol 393:619-633.
De, N., Pirruccello, M., Krasteva, P.V., Bae, N., Raghavan, R.V., and Sondermann, H. 2008.
Phosphorylation-independent regulation of the diguanylate cyclase WspR. PLoS Biol
6:e67.
Dow, J.M., Fouhy, Y., Lucey, J.F., and Ryan, R.P. 2006. The HD-GYP domain, cyclic di-GMP
signaling, and bacterial virulence to plants. Mol Plant Microbe Interact 19:1378-1384.
Edmunds, A.C., Castiblanco, L.F., Sundin, G.W., and Waters, C.M. 2013. Cyclic Di-GMP
modulates the disease progression of Erwinia amylovora. J Bacteriol 195:2155-2165.
Fang, X., and Gomelsky, M. 2010. A post-translational, c-di-GMP-dependent mechanism
regulating flagellar motility. Mol Microbiol 76:1295-1305.
Fatmi, M.C., Iacobellis, N.S., Massffield, J., Murrillo, J., Schaad, N.W., and Ullrich, M. 2008.
Pseudomonas syringae Pathovars and Related Pathogens - Identification,
Epidemiology and Genomics.
Ferreira, R.B., Antunes, L.C., Greenberg, E.P., and McCarter, L.L. 2008. Vibrio
parahaemolyticus ScrC modulates cyclic dimeric GMP regulation of gene expression
relevant to growth on surfaces. J Bacteriol 190:851-860.
Finlay, B.B., and Falkow, S. 1997. Common themes in microbial pathogenicity revisited.
Microbiol Mol Biol Rev 61:136-169.
Franzetti, L., and Scarpellini, M. 2007. Characterisation of Pseudomonas spp. isolated from
foods. Ann. Microbiol. 57:39-47.
Friedman, L., and Kolter, R. 2004. Genes involved in matrix formation in Pseudomonas
aeruginosa PA14 biofilms. Mol Microbiol 51:675-690.
Galperin, M.Y., Nikolskaya, A.N., and Koonin, E.V. 2001. Novel domains of the prokaryotic twocomponent signal transduction systems. FEMS Microbiol Lett 203:11-21.
Gardan, L., Shafik, H., Belouin, S., Broch, R., Grimont, F., and Grimont, P.A.D. 1999. DNA
relatedness among the pathovars of Pseudomonas syringae and description of
Pseudomonas tremae sp. nov. and Pseudomonas cannabina sp. nov. (ex Sutic and
Dowson 1959). Int. J. Syst. Bacteriol. 49:469-478.
Gauthier, M.J., Lafay, B., Christen, R., Fernandez, L., Acquaviva, M., Bonin, P., and Bertrand,
J.-C. 1992. Marinobacter hydrocarbonoclasticus gen. nov., sp. nov., a New, Extremely
Halotolerant, Hydrocarbon-Degrading Marine Bacterium. International Journal of
Systematic Bacteriology 42:568-576.
Gellatly, S.L., and Hancock, R.E. 2013. Pseudomonas aeruginosa: new insights into
pathogenesis and host defenses. Pathog Dis 67:159-173.
Girgis, H.S., Liu, Y., Ryu, W.S., and Tavazoie, S. 2007. A comprehensive genetic
characterization of bacterial motility. PLoS Genet 3:1644-1660.
Glass, N.L., and Kosuge, T. 1988. Role of indoleacetic acid-lysine synthetase in regulation of
indoleacetic acid pool size and virulence of Pseudomonas syringae subsp. savastanoi.
J Bacteriol 170:2367-2373.
Goodman, A.L., Merighi, M., Hyodo, M., Ventre, I., Filloux, A., and Lory, S. 2009. Direct
interaction between sensor kinase proteins mediates acute and chronic disease
phenotypes in a bacterial pathogen. Genes Dev 23:249-259.
183
REFERENCES
Ha, U.H., Wang, Y., and Jin, S. 2003. DsbA of Pseudomonas aeruginosa is essential for
multiple virulence factors. Infect Immun 71:1590-1595.
Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol
166:557-580.
Hauser, A.R. 2009. The type III secretion system of Pseudomonas aeruginosa: infection by
injection. Nat Rev Microbiol 7:654-665.
Hengge, R. 2009. Principles of c-di-GMP signalling in bacteria. Nat Rev Microbiol 7:263-273.
Henry, J.T., and Crosson, S. 2011. Ligand-binding PAS domains in a genomic, cellular, and
structural context. Annu Rev Microbiol 65:261-286.
Hickman, J.W., and Harwood, C.S. 2008. Identification of FleQ from Pseudomonas aeruginosa
as a c-di-GMP-responsive transcription factor. Mol Microbiol 69:376-389.
Hickman, J.W., Tifrea, D.F., and Harwood, C.S. 2005. A chemosensory system that regulates
biofilm formation through modulation of cyclic diguanylate levels. Proc Natl Acad Sci U
S A 102:14422-14427.
Hisert, K.B., MacCoss, M., Shiloh, M.U., Darwin, K.H., Singh, S., Jones, R.A., Ehrt, S., Zhang,
Z., Gaffney, B.L., Gandotra, S., Holden, D.W., Murray, D., and Nathan, C. 2005. A
glutamate-alanine-leucine (EAL) domain protein of Salmonella controls bacterial
survival in mice, antioxidant defence and killing of macrophages: role of cyclic diGMP.
Mol Microbiol 56:1234-1245.
Holmes, D.S., and Quigley, M. 1981. A rapid boiling method for the preparation of bacterial
plasmids. Anal Biochem 114:193-197.
Hosni, T., Moretti, C., Devescovi, G., Suarez-Moreno, Z.R., Fatmi, M.B., Guarnaccia, C.,
Pongor, S., Onofri, A., Buonaurio, R., and Venturi, V. 2011. Sharing of quorum-sensing
signals and role of interspecies communities in a bacterial plant disease. ISME J
5:1857-1870.
Huang, C.J., Wang, Z.C., Huang, H.Y., Huang, H.D., and Peng, H.L. 2013. YjcC, a c-di-GMP
phosphodiesterase protein, regulates the oxidative stress response and virulence of
Klebsiella pneumoniae CG43. PLoS One 8:e66740.
Hueck, C.J. 1998. Type III protein secretion systems in bacterial pathogens of animals and
plants. Microbiol Mol Biol Rev 62:379-433.
Huynh, T.V., Dahlbeck, D., and Staskawicz, B.J. 1989. Bacterial blight of soybean: regulation of
a pathogen gene determining host cultivar specificity. Science 245:1374-1377.
Iacobellis, N.S. 2001. Olive knot. Pages 714-715 in: Encyclopedia of plant pathology, O.C.
Maloy and T.D. Murray, eds. John Wiley & Sons, New York.
Inoue, H., Nojima, H., and Okayama, H. 1990. High efficiency transformation of Escherichia coli
with plasmids. Gene 96:23-28.
Jenal, U., and Malone, J. 2006. Mechanisms of cyclic-di-GMP signaling in bacteria. Annu Rev
Genet 40:385-407.
Jeong, H., Yim, J.H., Lee, C., Choi, S.H., Park, Y.K., Yoon, S.H., Hur, C.G., Kang, H.Y., Kim, D.,
Lee, H.H., Park, K.H., Park, S.H., Park, H.S., Lee, H.K., Oh, T.K., and Kim, J.F. 2005.
Genomic blueprint of Hahella chejuensis, a marine microbe producing an algicidal
agent. Nucleic Acids Res 33:7066-7073.
Jiménez-Fernández, A., López-Sánchez, A., Calero, P., and Govantes, F. 2014. The c-di-GMP
phosphodiesterase BifA regulates biofilm development in Pseudomonas putida. Environ
Microbiol Rep:in press. DOI:10.1111/1758-2229.12153.
Jimenez, P.N., Koch, G., Thompson, J.A., Xavier, K.B., Cool, R.H., and Quax, W.J. 2012. The
multiple signaling systems regulating virulence in Pseudomonas aeruginosa. Microbiol
Mol Biol Rev 76:46-65.
Kaniga, K., Delor, I., and Cornelis, G.R. 1991. A wide-host-range suicide vector for improving
reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia
enterocolitica. Gene 109:137-141.
Kazmierczak, B.I., Lebron, M.B., and Murray, T.S. 2006. Analysis of FimX, a phosphodiesterase
that governs twitching motility in Pseudomonas aeruginosa. Molecular Microbiology
60:1026-1043.
Kim, Y.K., and McCarter, L.L. 2007. ScrG, a GGDEF-EAL protein, participates in regulating
swarming and sticking in Vibrio parahaemolyticus. J Bacteriol 189:4094-4107.
Kitten, T., Kinscherf, T.G., McEvoy, J.L., and Willis, D.K. 1998. A newly identified regulator is
required for virulence and toxin production in Pseudomonas syringae. Molecular
Microbiology 28:917-929.
184
REFERENCES
Klebensberger, J., Birkenmaier, A., Geffers, R., Kjelleberg, S., and Philipp, B. 2009. SiaA and
SiaD are essential for inducing autoaggregation as a specific response to detergent
stress in Pseudomonas aeruginosa. Environ Microbiol 11:3073-3086.
Klement, Z. 1963. Rapid Detection of the Pathogenicity of Phytopathogenic Pseudomonads.
Nature 199:299-300.
Kloek, A.P., Brooks, D.M., and Kunkel, B.N. 2000. A dsbA mutant of Pseudomonas syringae
exhibits reduced virulence and partial impairment of type III secretion. Mol Plant Pathol
1:139-150.
Ko, M., and Park, C. 2000. Two novel flagellar components and H-NS are involved in the motor
function of Escherichia coli. J Mol Biol 303:371-382.
Krasteva, P.V., Fong, J.C., Shikuma, N.J., Beyhan, S., Navarro, M.V., Yildiz, F.H., and
Sondermann, H. 2010. Vibrio cholerae VpsT regulates matrix production and motility by
directly sensing cyclic di-GMP. Science 327:866-868.
Kuchma, S.L., Connolly, J.P., and O'Toole, G.A. 2005. A three-component regulatory system
regulates biofilm maturation and type III secretion in Pseudomonas aeruginosa. J
Bacteriol 187:1441-1454.
Kuchma, S.L., Brothers, K.M., Merritt, J.H., Liberati, N.T., Ausubel, F.M., and O'Toole, G.A.
2007. BifA, a cyclic-Di-GMP phosphodiesterase, inversely regulates biofilm formation
and swarming motility by Pseudomonas aeruginosa PA14. J Bacteriol 189:8165-8178.
Kulasakara, H., Lee, V., Brencic, A., Liberati, N., Urbach, J., Miyata, S., Lee, D.G., Neely, A.N.,
Hyodo, M., Hayakawa, Y., Ausubel, F.M., and Lory, S. 2006. Analysis of Pseudomonas
aeruginosa diguanylate cyclases and phosphodiesterases reveals a role for bis-(3'-5')cyclic-GMP in virulence. Proc Natl Acad Sci U S A 103:2839-2844.
Kumagai, Y., Matsuo, J., Hayakawa, Y., and Rikihisa, Y. 2010. Cyclic di-GMP signaling
regulates invasion by Ehrlichia chaffeensis of human monocytes. J Bacteriol 192:41224133.
Lai, T.H., Kumagai, Y., Hyodo, M., Hayakawa, Y., and Rikihisa, Y. 2009. The Anaplasma
phagocytophilum PleC histidine kinase and PleD diguanylate cyclase two-component
system and role of cyclic Di-GMP in host cell infection. J Bacteriol 191:693-700.
Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H.,
Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., and
Higgins, D.G. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2947-2948.
Laue, H., Schenk, A., Li, H., Lambertsen, L., Neu, T.R., Molin, S., and Ullrich, M.S. 2006.
Contribution of alginate and levan production to biofilm formation by Pseudomonas
syringae. Microbiology 152:2909-2918.
Le Quere, B., and Ghigo, J.M. 2009. BcsQ is an essential component of the Escherichia coli
cellulose biosynthesis apparatus that localizes at the bacterial cell pole. Mol Microbiol
72:724-740.
Lee, E.R., Baker, J.L., Weinberg, Z., Sudarsan, N., and Breaker, R.R. 2010a. An allosteric selfsplicing ribozyme triggered by a bacterial second messenger. Science 329:845-848.
Lee, H.S., Gu, F., Ching, S.M., Lam, Y., and Chua, K.L. 2010b. CdpA is a Burkholderia
pseudomallei cyclic di-GMP phosphodiesterase involved in autoaggregation, flagellum
synthesis, motility, biofilm formation, cell invasion, and cytotoxicity. Infect Immun
78:1832-1840.
Lee, V.T., Matewish, J.M., Kessler, J.L., Hyodo, M., Hayakawa, Y., and Lory, S. 2007. A cyclicdi-GMP receptor required for bacterial exopolysaccharide production. Mol Microbiol
65:1474-1484.
Levi, A., Folcher, M., Jenal, U., and Shuman, H.A. 2011. Cyclic diguanylate signaling proteins
control intracellular growth of Legionella pneumophila. mBio 2:e00316-00310.
Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408.
Lopez-Solanilla, E., Bronstein, P.A., Schneider, A.R., and Collmer, A. 2004. HopPtoN is a
Pseudomonas syringae Hrp (type III secretion system) cysteine protease effector that
suppresses pathogen-induced necrosis associated with both compatible and
incompatible plant interactions. Mol Microbiol 54:353-365.
Lopez, D., Vlamakis, H., and Kolter, R. 2010. Biofilms. Cold Spring Harb Perspect Biol
2:a000398.
Lyczak, J.B., Cannon, C.L., and Pier, G.B. 2000. Establishment of Pseudomonas aeruginosa
infection: lessons from a versatile opportunist. Microbes Infect 2:1051-1060.
185
REFERENCES
Macho, A.P., Zumaquero, A., Ortíz-Martín, I., and Beuzón, C.R. 2007. Competitive index in
mixed infections: a sensitive and accurate assay for the genetic analysis of
Pseudomonas syringae-plant interactions. Mol Plant Pathol 8:437-450.
Malone, J.G., Williams, R., Christen, M., Jenal, U., Spiers, A.J., and Rainey, P.B. 2007. The
structure-function relationship of WspR, a Pseudomonas fluorescens response
regulator with a GGDEF output domain. Microbiology 153:980-994.
Malone, J.G., Jaeger, T., Spangler, C., Ritz, D., Spang, A., Arrieumerlou, C., Kaever, V.,
Landmann, R., and Jenal, U. 2010. YfiBNR mediates cyclic di-GMP dependent small
colony variant formation and persistence in Pseudomonas aeruginosa. PLoS Pathog
6:e1000804.
Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., Verdier,
V., Beer, S.V., Machado, M.A., Toth, I., Salmond, G., and Foster, G.D. 2012. Top 10
plant pathogenic bacteria in molecular plant pathology. Mol Plant Pathol 13:614-629.
Mansfield, J.W. 2009. From bacterial avirulence genes to effector functions via the hrp delivery
system: an overview of 25 years of progress in our understanding of plant innate
immunity. Mol Plant Pathol 10:721-734.
Martínez-Granero, F., Navazo, A., Barahona, E., Redondo-Nieto, M., González de Heredia, E.,
Baena, I., Martín-Martín, I., Rivilla, R., and Martín, M. 2014. Identification of flgZ as a
Flagellar Gene Encoding a PilZ Domain Protein That Regulates Swimming Motility and
Biofilm Formation in Pseudomonas. PLoS One 9:e87608.
Matas, I.M., Lambertsen, L., Rodriguez-Moreno, L., and Ramos, C. 2012. Identification of novel
virulence genes and metabolic pathways required for full fitness of Pseudomonas
savastanoi pv. savastanoi in olive (Olea europaea) knots. New Phytol 196:1182-1196.
Matas, I.M., Castañeda-Ojeda, M.P., Aragón, I.M., Antúnez-Lamas, M., Murillo, J., RodriquezPalenzuela, P., Lopez-Solanilla, E., and Ramos, C. 2014. Translocation and functional
analysis of Pseudomonas savastanoi pv. savastanoi NCPPB 3335 type III secretion
system effectors reveals two novel effector families of the Pseudomonas syringae
complex. Mol Plant Microbe Interact. doi: 10.1094/MPMI-07-13-0206-R
Matilla, M.A., Travieso, M.L., Ramos, J.L., and Ramos-Gonzalez, M.I. 2011. Cyclic diguanylate
turnover mediated by the sole GGDEF/EAL response regulator in Pseudomonas putida:
its role in the rhizosphere and an analysis of its target processes. Environ Microbiol
13:1745-1766.
Mayer, R., Ross, P., Weinhouse, H., Amikam, D., Volman, G., Ohana, P., Calhoon, R.D., Wong,
H.C., Emerick, A.W., and Benziman, M. 1991. Polypeptide composition of bacterial
cyclic diguanylic acid-dependent cellulose synthase and the occurrence of
immunologically crossreacting proteins in higher plants. Proc Natl Acad Sci U S A
88:5472-5476.
Merighi, M., Lee, V.T., Hyodo, M., Hayakawa, Y., and Lory, S. 2007. The second messenger
bis-(3'-5')-cyclic-GMP and its PilZ domain-containing receptor Alg44 are required for
alginate biosynthesis in Pseudomonas aeruginosa. Mol Microbiol 65:876-895.
Merritt, J.H., Brothers, K.M., Kuchma, S.L., and O'Toole, G.A. 2007. SadC reciprocally
influences biofilm formation and swarming motility via modulation of exopolysaccharide
production and flagellar function. J Bacteriol 189:8154-8164.
Merritt, J.H., Ha, D.-G., Cowles, K.N., Lu, W., Morales, D.K., Rabinowitz, J., Gitai, Z., and
O’Toole, G.A. 2010. Specific Control of Pseudomonas aeruginosa Surface-Associated
Behaviors by Two c-di-GMP Diguanylate Cyclases. mBio 1:(4) e00183-10
Mikkelsen, H., Sivaneson, M., and Filloux, A. 2011a. Key two-component regulatory systems
that control biofilm formation in Pseudomonas aeruginosa. Environ Microbiol 13:16661681.
Mikkelsen, H., McMullan, R., and Filloux, A. 2011b. The Pseudomonas aeruginosa reference
strain PA14 displays increased virulence due to a mutation in ladS. PLoS One
6:e29113.
Mikkelsen, H., Ball, G., Giraud, C., and Filloux, A. 2009. Expression of Pseudomonas
aeruginosa CupD fimbrial genes is antagonistically controlled by RcsB and the EALcontaining PvrR response regulators. PLoS One 4:e6018.
Mikkelsen, H., Hui, K., Barraud, N., and Filloux, A. 2013. The pathogenicity island encoded
PvrSR/RcsCB regulatory network controls biofilm formation and dispersal in
Pseudomonas aeruginosa PA14. Mol Microbiol 89:450-463.
186
REFERENCES
Miller, J.H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold
Spring Harbor, NY.
Mills, E., Pultz, I.S., Kulasekara, H.D., and Miller, S.I. 2011. The bacterial second messenger cdi-GMP: mechanisms of signalling. Cellular Microbiology 13:1122-1129.
Minasov, G., Padavattan, S., Shuvalova, L., Brunzelle, J.S., Miller, D.J., Basle, A., Massa, C.,
Collart, F.R., Schirmer, T., and Anderson, W.F. 2009. Crystal structures of YkuI and its
complex with second messenger cyclic Di-GMP suggest catalytic mechanism of
phosphodiester bond cleavage by EAL domains. J Biol Chem 284:13174-13184.
Mittal, S., and Davis, K.R. 1995. Role of the phytotoxin coronatine in the infection of Arabidopsis
thaliana by Pseudomonas syringae pv. tomato. Mol Plant Microbe Interact 8:165-171.
Monds, R.D., Newell, P.D., Gross, R.H., and O'Toole, G.A. 2007. Phosphate-dependent
modulation of c-di-GMP levels regulates Pseudomonas fluorescens Pf0-1 biofilm
formation by controlling secretion of the adhesin LapA. Mol Microbiol 63:656-679.
Moretti, C., Ferrante, P., Hosni, T., Valentini, F., D'Onghia, A., Fatmi, M.B., and Buonaurio, R.
2008. Characterization of Pseudomonas savastanoi pv. savastanoi strains collected
from olive trees in different countries. Pages 321-329 in: Pseudomonas syringae
Pathovars and Related Pathogens – Identification, Epidemiology and Genomics, M.B.
Fatmi, A. Collmer, N. Iacobellis, J. Mansfield, J. Murillo, N. Schaad, and M. Ullrich, eds.
Springer Netherlands.
Morgan, R., Kohn, S., Hwang, S.H., Hassett, D.J., and Sauer, K. 2006. BdlA, a chemotaxis
regulator essential for biofilm dispersion in Pseudomonas aeruginosa. J Bacteriol
188:7335-7343.
Moscoso, J.A., Mikkelsen, H., Heeb, S., Williams, P., and Filloux, A. 2011. The Pseudomonas
aeruginosa sensor RetS switches type III and type VI secretion via c-di-GMP signalling.
Environ Microbiol 13:3128-3138.
Navarro, M.V., Newell, P.D., Krasteva, P.V., Chatterjee, D., Madden, D.R., O'Toole, G.A., and
Sondermann, H. 2011. Structural basis for c-di-GMP-mediated inside-out signaling
controlling periplasmic proteolysis. PLoS Biol 9:e1000588.
Navarro, M.V.A.S., De, N., Bae, N., Wang, Q., and Sondermann, H. 2009. Structural Analysis of
the GGDEF-EAL Domain-Containing c-di-GMP Receptor FimX. Structure 17:11041116.
Newell, P.D., Monds, R.D., and O'Toole, G.A. 2009. LapD is a bis-(3',5')-cyclic dimeric GMPbinding protein that regulates surface attachment by Pseudomonas fluorescens Pf0-1.
Proc Natl Acad Sci U S A 106:3461-3466.
O'Toole, G., Kaplan, H.B., and Kolter, R. 2000. Biofilm formation as microbial development.
Annu Rev Microbiol 54:49-79.
Ortíz-Martín, I., Thwaites, R., Macho, A.P., Mansfield, J.W., and Beuzón, C.R. 2010. Positive
regulation of the Hrp type III secretion system in Pseudomonas syringae pv.
phaseolicola. Mol Plant Microbe Interact 23:665-681.
Palmer, B.R., and Marinus, M.G. 1994. The dam and dcm strains of Escherichia coli--a review.
Gene 143:1-12.
Palleroni, N. 1981. Introduction to the Family Pseudomonadaceae. Pages 655-665 in: The
Prokaryotes, M. Starr, H. Stolp, H. Trüper, A. Balows, and H. Schlegel, eds. Springer
Berlin Heidelberg.
Palleroni, N.J. 1984. Genus I. Pseudomonas Migula 1894. In:Krieg N.R., Holt J.G., Eds,
Bergey’s Manual of Systematic Bacteriology, Vol. 2, Williams & Wilkins, Baltimore MD
Palleroni, N.J. 2003. Prokaryote taxonomy of the 20th century and the impact of studies on the
genus Pseudomonas: a personal view. Microbiology 149:1-7.
Parkins, M.D., Ceri, H., and Storey, D.G. 2001. Pseudomonas aeruginosa GacA, a factor in
multihost virulence, is also essential for biofilm formation. Molecular Microbiology
40:1215-1226.
Parkinson, N., Bryant, R., Bew, J., and Elphinstone, J. 2011. Rapid phylogenetic identification of
members of the Pseudomonas syringae species complex using the rpoD locus. Plant
Pathology 60:338-344.
Paul, R., Abel, S., Wassmann, P., Beck, A., Heerklotz, H., and Jenal, U. 2007. Activation of the
diguanylate cyclase PleD by phosphorylation-mediated dimerization. J Biol Chem
282:29170-29177.
187
REFERENCES
Paul, R., Weiser, S., Amiot, N.C., Chan, C., Schirmer, T., Giese, B., and Jenal, U. 2004. Cell
cycle-dependent dynamic localization of a bacterial response regulator with a novel diguanylate cyclase output domain. Genes Dev 18:715-727.
Pei, J., and Grishin, N.V. 2001. GGDEF domain is homologous to adenylyl cyclase. Proteins:
Structure, Function, and Bioinformatics 42:210-216.
Penyalver, R., García, A., Ferrer, A., Bertolini, E., Quesada, J.M., Salcedo, C.I., Piquer, J.,
Pérez-Panades, J., Carbonell, E.A., Del Rio, C., Caballero, J.M., and López, M.M.
2006. Factors affecting Pseudomonas savastanoi pv. savastanoi plant inoculations and
their use for evaluation of Olive cultivar susceptibility. Phytopathology 96:313-319.
Pérez-Martinez, I., Rodriguez-Moreno, L., Lambertsen, L., Matas, I.M., Murillo, J., Tegli, S.,
Jimenez, A.J., and Ramos, C. 2010. Fate of a Pseudomonas savastanoi pv. savastanoi
type III secretion system mutant in olive plants (Olea europaea L.). Appl Environ
Microbiol 76:3611-3619.
Pérez-Martínez, I., Rodríguez-Moreno, L., Matas, I.M., and Ramos, C. 2007. Strain selection
and improvement of gene transfer for genetic manipulation of Pseudomonas savastanoi
isolated from olive knots. Res Microbiol 158:60-69.
Pérez-Martínez, I., Rodríguez-Moreno, L., Lambertsen, L., Matas, I.M., Murillo, J., Tegli, S.,
Jiménez, A.J., and Ramos, C. 2010. Fate of a Pseudomonas savastanoi pv. savastanoi
type III secretion system mutant in olive plants (Olea europaea L.). Appl Environ
Microbiol 76:3611-3619.
Pérez-Mendoza, D., Coulthurst, S.J., Sanjuan, J., and Salmond, G.P. 2011a. NAcetylglucosamine-dependent biofilm formation in Pectobacterium atrosepticum is
cryptic and activated by elevated c-di-GMP levels. Microbiology 157:3340-3348.
Pérez-Mendoza, D., Coulthurst, S.J., Humphris, S., Campbell, E., Welch, M., Toth, I.K., and
Salmond, G.P. 2011b. A multi-repeat adhesin of the phytopathogen, Pectobacterium
atrosepticum, is secreted by a Type I pathway and is subject to complex regulation
involving a non-canonical diguanylate cyclase. Mol Microbiol 82:719-733.
Pérez-Mendoza, D., Aragón, I.M., Prada-Ramírez, H.A., Romero-Jiménez, L., Ramos, C.,
Gallegos, M.-T., and Sanjuán, J. 2014. Responses to Elevated c-di-GMP Levels in
Mutualistic and Pathogenic Plant-Interacting Bacteria. PLoS One 9:e91645.
Pesavento, C., Becker, G., Sommerfeldt, N., Possling, A., Tschowri, N., Mehlis, A., and Hengge,
R. 2008. Inverse regulatory coordination of motility and curli-mediated adhesion in
Escherichia coli. Genes Dev 22:2434-2446.
Petersen, E., Chaudhuri, P., Gourley, C., Harms, J., and Splitter, G. 2011. Brucella melitensis
cyclic di-GMP phosphodiesterase BpdA controls expression of flagellar genes. J
Bacteriol 193:5683-5691.
Petrova, O.E., and Sauer, K. 2012. Sticky situations: key components that control bacterial
surface attachment. J Bacteriol 194:2413-2425.
Pliego, C., de Weert, S., Lamers, G., de Vicente, A., Bloemberg, G., Cazorla, F.M., and Ramos,
C. 2008. Two similar enhanced root-colonizing Pseudomonas strains differ largely in
their colonization strategies of avocado roots and Rosellinia necatrix hyphae. Environ
Microbiol 10:3295-3304.
Powell, G.K., and Morris, R.O. 1986. Nucleotide sequence and expression of a Pseudomonas
savastanoi cytokinin biosynthetic gene: homology with Agrobacterium tumefaciens tmr
and tzs loci. Nucleic Acids Res 14:2555-2565.
Pratt, J.T., Tamayo, R., Tischler, A.D., and Camilli, A. 2007. PilZ Domain Proteins Bind Cyclic
Diguanylate and Regulate Diverse Processes in Vibrio cholerae. J. Biol. Chem.
282:12860-12870.
Preiter, K., Brooks, D.M., Penaloza-Vazquez, A., Sreedharan, A., Bender, C.L., and Kunkel,
B.N. 2005. Novel virulence gene of Pseudomonas syringae pv. tomato strain DC3000. J
Bacteriol 187:7805-7814.
Preston, G.M. 2000. Pseudomonas syringae pv. tomato: the right pathogen, of the right plant, at
the right time. Mol Plant Pathol 1:263-275.
Quesada, J.M., Penyalver, R., Pérez-Panadés, J., Salcedo, C.I., Carbonell, E.A., and López,
M.M. 2010. Comparison of chemical treatments for reducing epiphytic Pseudomonas
savastanoi pv. savastanoi populations and for improving subsequent control of olive
knot disease. Crop Protection 29:1413-1420.
Rahme, L.G., Ausubel, F.M., Cao, H., Drenkard, E., Goumnerov, B.C., Lau, G.W., MahajanMiklos, S., Plotnikova, J., Tan, M.W., Tsongalis, J., Walendziewicz, C.L., and Tompkins,
188
REFERENCES
R.G. 2000. Plants and animals share functionally common bacterial virulence factors.
Proc Natl Acad Sci U S A 97:8815-8821.
Ramos, C., Matas, I.M., Bardaji, L., Aragón, I.M., and Murillo, J. 2012. Pseudomonas
savastanoi pv. savastanoi: some like it knot. Mol Plant Pathol 13:998-1009.
Rao, F., Yang, Y., Qi, Y., and Liang, Z.X. 2008a. Catalytic mechanism of cyclic di-GMP-specific
phosphodiesterase: a study of the EAL domain-containing RocR from Pseudomonas
aeruginosa. J Bacteriol 190:3622-3631.
Rao, F., Yang, Y., Qi, Y., and Liang, Z.-X. 2008b. Catalytic Mechanism of Cyclic Di-GMPSpecific Phosphodiesterase: a Study of the EAL Domain-Containing RocR from
Pseudomonas aeruginosa. Journal of Bacteriology 190:3622-3631.
Records, A.R., and Gross, D.C. 2010. Sensor kinases RetS and LadS regulate Pseudomonas
syringae type VI secretion and virulence factors. J Bacteriol 192:3584-3596.
Recouvreux, D.O., Carminatti, C.A., Pitlovanciv, A.K., Rambo, C.R., Porto, L.M., and Antonio,
R.V. 2008. Cellulose biosynthesis by the beta-proteobacterium, Chromobacterium
violaceum. Curr Microbiol 57:469-476.
Rio-Alvarez, I., Rodriguez-Herva, J.J., Martinez, P.M., Gonzalez-Melendi, P., Garcia-Casado,
G., Rodriguez-Palenzuela, P., and Lopez-Solanilla, E. 2013. Light regulates motility,
attachment and virulence in the plant pathogen Pseudomonas syringae pv tomato
DC3000. Environ Microbiol.
Robertsen, B.K., Aman, P., Darvill, A.G., McNeil, M., and Albersheim, P. 1981. Host-Symbiont
Interactions : V. The struture of acidic extracellular polysaccharides secreted by
Rhizobium leguminosarum and Rhizobium trifolii Plant Physiol 67:389-400.
Robertson, M., Hapca, S.M., Moshynets, O., and Spiers, A.J. 2013. Air-liquid interface biofilm
formation by psychrotrophic pseudomonads recovered from spoilt meat. Antonie Van
Leeuwenhoek 103:251-259.
Rodríguez-Moreno, L., Barceló-Munoz, A., and Ramos, C. 2008. In vitro analysis of the
interaction of Pseudomonas savastanoi pvs. savastanoi and nerii with micropropagated
olive plants. Phytopathology 98:815-822.
Rodríguez-Moreno, L., Jiménez, A.J., and Ramos, C. 2009. Endopathogenic lifestyle of
Pseudomonas savastanoi pv. savastanoi in olive knots. Microbial Biotechnology 2:476488.
Rodriguez-Navarro, D.N., Dardanelli, M.S., and Ruiz-Sainz, J.E. 2007. Attachment of bacteria to
the roots of higher plants. FEMS Microbiol Lett 272:127-136.
Rodríguez-Palenzuela, P., Matas, I.M., Murillo, J., López-Solanilla, E., Bardaji, L., PérezMartínez, I., Rodríguez-Moskera, M.E., Penyalver, R., López, M.M., Quesada, J.M.,
Biehl, B.S., Perna, N.T., Glasner, J.D., Cabot, E.L., Neeno-Eckwall, E., and Ramos, C.
2010. Annotation and overview of the Pseudomonas savastanoi pv. savastanoi NCPPB
3335 draft genome reveals the virulence gene complement of a tumour-inducing
pathogen of woody hosts. Environ Microbiol 12:1604-1620.
Rogers, T.J., Paton, J.C., Wang, H., Talbot, U.M., and Paton, A.W. 2006. Reduced virulence of
an fliC mutant of Shiga-toxigenic Escherichia coli O113:H21. Infect Immun 74:19621966.
Romling, U. 2012. Cyclic di-GMP, an established secondary messenger still speeding up.
Environ Microbiol 14:1817-1829.
Romling, U., Gomelsky, M., and Galperin, M.Y. 2005. C-di-GMP: the dawning of a novel
bacterial signalling system. Mol Microbiol 57:629-639.
Romling, U., Galperin, M.Y., and Gomelsky, M. 2013. Cyclic di-GMP: the first 25 years of a
universal bacterial second messenger. Microbiol Mol Biol Rev 77:1-52.
Romling, U., Rohde, M., Olsen, A., Normark, S., and Reinkoster, J. 2000. AgfD, the checkpoint
of multicellular and aggregative behaviour in Salmonella typhimurium regulates at least
two independent pathways. Mol Microbiol 36:10-23.
Ross, P., Mayer, R., and Benziman, M. 1991. Cellulose biosynthesis and function in bacteria.
Microbiol Rev 55:35-58.
Ross, P., Aloni, Y., Weinhouse, C., Michaeli, D., Weinberger-Ohana, P., Meyer, R., and
Benziman, M. 1985. An unusual guanyl oligonucleotide regulates cellulose synthesis in
Acetobacter xylinum. FEBS Lett 186:191-196.
Ross, P., Aloni, Y., Weinhouse, H., Michaeli, D., Weinberger-Ohana, P., Mayer, R., and
Benziman, M. 1986. Control of cellulose synthesis Acetobacter xylinum. A unique
guanyl oligonucleotide is the immediate activator of the cellulose synthase.
Carbohydrate Research 149:101-117.
189
REFERENCES
Ross, P., Mayer, R., Weinhouse, H., Amikam, D., Huggirat, Y., Benziman, M., de Vroom, E.,
Fidder, A., de Paus, P., and Sliedregt, L.A. 1990. The cyclic diguanylic acid regulatory
system of cellulose synthesis in Acetobacter xylinum. Chemical synthesis and biological
activity of cyclic nucleotide dimer, trimer, and phosphothioate derivatives. Journal of
Biological Chemistry 265:18933-18943.
Ross, P., Weinhouse, H., Aloni, Y., Michaeli, D., Weinberger-Ohana, P., Mayer, R., Braun, S.,
de Vroom, E., van der Marel, G.A., van Boom, J.H., and Benziman, M. 1987. Regulation
of cellulose synthesis in Acetobacter xylinum by cyclic diguanylic acid. Nature 325:279281.
Roy-Burman, A., Savel, R.H., Racine, S., Swanson, B.L., Revadigar, N.S., Fujimoto, J., Sawa,
T., Frank, D.W., and Wiener-Kronish, J.P. 2001. Type III protein secretion is associated
with death in lower respiratory and systemic Pseudomonas aeruginosa infections. J
Infect Dis 183:1767-1774.
Ryan, R.P., Fouhy, Y., Lucey, J.F., and Dow, J.M. 2006a. Cyclic di-GMP signaling in bacteria:
recent advances and new puzzles. J Bacteriol 188:8327-8334.
Ryan, R.P., Lucey, J., O'Donovan, K., McCarthy, Y., Yang, L., Tolker-Nielsen, T., and Dow, J.M.
2009. HD-GYP domain proteins regulate biofilm formation and virulence in
Pseudomonas aeruginosa. Environ Microbiol 11:1126-1136.
Ryan, R.P., Fouhy, Y., Lucey, J.F., Jiang, B.L., He, Y.Q., Feng, J.X., Tang, J.L., and Dow, J.M.
2007. Cyclic di-GMP signalling in the virulence and environmental adaptation of
Xanthomonas campestris. Mol Microbiol 63:429-442.
Ryan, R.P., Fouhy, Y., Lucey, J.F., Crossman, L.C., Spiro, S., He, Y.W., Zhang, L.H., Heeb, S.,
Camara, M., Williams, P., and Dow, J.M. 2006b. Cell-cell signaling in Xanthomonas
campestris involves an HD-GYP domain protein that functions in cyclic di-GMP
turnover. Proc Natl Acad Sci U S A 103:6712-6717.
Ryjenkov, D.A., Simm, R., Romling, U., and Gomelsky, M. 2006. The PilZ domain is a receptor
for the second messenger c-di-GMP: the PilZ domain protein YcgR controls motility in
enterobacteria. J Biol Chem 281:30310-30314.
Saitou, N., and Nei, M. 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4:406-425.
Sambrook, J., and Russell, D. 2001. Molecular cloning: a laboratory manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor New York, USA.
Sarkar, S.F., and Guttman, D.S. 2004. Evolution of the core genome of Pseudomonas syringae,
a highly clonal, endemic plant pathogen. Appl Environ Microbiol 70:1999-2012.
Saxena, I.M., and Brown, R.M., Jr. 1995. Identification of a second cellulose synthase gene
(acsAII) in Acetobacter xylinum. J Bacteriol 177:5276-5283.
Schmidt, A.J., Ryjenkov, D.A., and Gomelsky, M. 2005. The ubiquitous protein domain EAL is a
cyclic diguanylate-specific phosphodiesterase: enzymatically active and inactive EAL
domains. J Bacteriol 187:4774-4781.
Schulz, T., Rydzewski, K., Schunder, E., Holland, G., Bannert, N., and Heuner, K. 2012. FliA
expression analysis and influence of the regulatory proteins RpoN, FleQ and FliA on
virulence and in vivo fitness in Legionella pneumophila. Arch Microbiol 194:977-989.
Setubal, J.C., dos Santos, P., Goldman, B.S., Ertesvåg, H., Espin, G., Rubio, L.M., Valla, S.,
Almeida, N.F., Balasubramanian, D., Cromes, L., Curatti, L., Du, Z., Godsy, E.,
Goodner, B., Hellner-Burris, K., Hernandez, J.A., Houmiel, K., Imperial, J., Kennedy, C.,
Larson, T.J., Latreille, P., Ligon, L.S., Lu, J., Mærk, M., Miller, N.M., Norton, S.,
O'Carroll, I.P., Paulsen, I., Raulfs, E.C., Roemer, R., Rosser, J., Segura, D., Slater, S.,
Stricklin, S.L., Studholme, D.J., Sun, J., Viana, C.J., Wallin, E., Wang, B., Wheeler, C.,
Zhu, H., Dean, D.R., Dixon, R., and Wood, D. 2009. Genome Sequence of Azotobacter
vinelandii, an Obligate Aerobe Specialized To Support Diverse Anaerobic Metabolic
Processes. Journal of Bacteriology 191:4534-4545.
Simm, R., Morr, M., Kader, A., Nimtz, M., and Romling, U. 2004. GGDEF and EAL domains
inversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol
Microbiol 53:1123-1134.
Singh, P.K., Schaefer, A.L., Parsek, M.R., Moninger, T.O., Welsh, M.J., and Greenberg, E.P.
2000. Quorum-sensing signals indicate that cystic fibrosis lungs are infected with
bacterial biofilms. Nature 407:762-764.
Sisto, A., Cipriani, M.G., and Morea, M. 2004. Knot formation caused by Pseudomonas
syringae subsp. savastanoi on Olive plants is hrp-dependent. Phytopathology 94:484489.
190
REFERENCES
Sneath, P.H., Stevens, M., and Sackin, M.J. 1981. Numerical taxonomy of Pseudomonas based
on published records of substrate utilization. Antonie Van Leeuwenhoek 47:423-448.
Solano, C., Garcia, B., Valle, J., Berasain, C., Ghigo, J.M., Gamazo, C., and Lasa, I. 2002.
Genetic analysis of Salmonella enteritidis biofilm formation: critical role of cellulose. Mol
Solano, C., Garcia, B., Latasa, C., Toledo-Arana, A., Zorraquino, V., Valle, J., Casals, J.,
Pedroso, E., and Lasa, I. 2009. Genetic reductionist approach for dissecting individual
roles of GGDEF proteins within the c-di-GMP signaling network in Salmonella. Proc Natl
Acad Sci U S A 106:7997-8002.
Spurbeck, R.R., Tarrien, R.J., and Mobley, H.L. 2012. Enzymatically active and inactive
phosphodiesterases and diguanylate cyclases are involved in regulation of Motility or
sessility in Escherichia coli CFT073. mBio 3.
Srivastava, D., Harris, R.C., and Waters, C.M. 2011. Integration of cyclic di-GMP and quorum
sensing in the control of vpsT and aphA in Vibrio cholerae. J Bacteriol 193:6331-6341.
Starkey, M., Hickman, J.H., Ma, L., Zhang, N., De Long, S., Hinz, A., Palacios, S., Manoil, C.,
Kirisits, M.J., Starner, T.D., Wozniak, D.J., Harwood, C.S., and Parsek, M.R. 2009.
Pseudomonas aeruginosa rugose small-colony variants have adaptations that likely
promote persistence in the cystic fibrosis lung. J Bacteriol 191:3492-3503.
Studholme, D.J. 2011. Application of high-throughput genome sequencing to intrapathovar
variation in Pseudomonas syringae. Mol Plant Pathol 12:829-838.
Sudarsan, N., Lee, E.R., Weinberg, Z., Moy, R.H., Kim, J.N., Link, K.H., and Breaker, R.R.
2008. Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science
321:411-413.
Sultan, S.Z., Pitzer, J.E., Boquoi, T., Hobbs, G., Miller, M.R., and Motaleb, M.A. 2011. Analysis
of the HD-GYP domain cyclic dimeric GMP phosphodiesterase reveals a role in motility
and the enzootic life cycle of Borrelia burgdorferi. Infect Immun 79:3273-3283.
Surico, G., Evidente, A., Iacobellis, N.S., and Randazzo, G. 1985. A cytokinin from the culture
filtrate of Pseudomonas syringae pv. savastanoi. Phytochemistry 24:1499-1502.
Tal, R., Wong, H.C., Calhoon, R., Gelfand, D., Fear, A.L., Volman, G., Mayer, R., Ross, P.,
Amikam, D., Weinhouse, H., Cohen, A., Sapir, S., Ohana, P., and Benziman, M. 1998.
Three cdg operons control cellular turnover of cyclic di-GMP in Acetobacter xylinum:
genetic organization and occurrence of conserved domains in isoenzymes. J Bacteriol
180:4416-4425.
Tamayo, R., Pratt, J.T., and Camilli, A. 2007. Roles of cyclic diguanylate in the regulation of
bacterial pathogenesis. Annu Rev Microbiol 61:131-148.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5:
molecular evolutionary genetics analysis using maximum likelihood, evolutionary
distance, and maximum parsimony methods. Mol. Biol. Evol. 28:2731-2739.
Taraszkiewicz, A., Fila, G., Grinholc, M., and Nakonieczna, J. 2013. Innovative strategies to
overcome biofilm resistance. Biomed Res Int 2013:150653.
Tarutina, M., Ryjenkov, D.A., and Gomelsky, M. 2006. An unorthodox bacteriophytochrome
from Rhodobacter sphaeroides involved in turnover of the second messenger c-diGMP. J Biol Chem 281:34751-34758.
Tegli, S., Gori, A., Cerboneschi, M., Cipriani, M.G., and Sisto, A. 2011. Type Three Secretion
System in Pseudomonas savastanoi Pathovars: Does Timing Matter? Genes (Basel)
2:957-979.
Tischler, A.D., and Camilli, A. 2005. Cyclic diguanylate regulates Vibrio cholerae virulence gene
expression. Infect Immun 73:5873-5882.
Tran, N.T., Den Hengst, C.D., Gomez-Escribano, J.P., and Buttner, M.J. 2011. Identification and
characterization of CdgB, a diguanylate cyclase involved in developmental processes in
Streptomyces coelicolor. J Bacteriol 193:3100-3108.
Trautmann, M., Lepper, P.M., and Haller, M. 2005. Ecology of Pseudomonas aeruginosa in the
intensive care unit and the evolving role of water outlets as a reservoir of the organism.
Am J Infect Control 33:S41-49.
Ude, S., Arnold, D.L., Moon, C.D., Timms-Wilson, T., and Spiers, A.J. 2006. Biofilm formation
and cellulose expression among diverse environmental Pseudomonas isolates. Environ
Vancanneyti, M., Witt, S., Abraham, W.-R., Kersters, K., and Fredrickson, H.L. 1996. Fatty acid
Content in Whole-cell Hydrolysates and Phospholipid and Phospholipid Fractions of
191
REFERENCES
Pseudomonads: a Taxonomic Evaluation. Systematic and Applied Microbiology 19:528540.
Vargas, P., Felipe, A., Michan, C., and Gallegos, M.T. 2011. Induction of Pseudomonas
syringae pv. tomato DC3000 MexAB-OprM multidrug efflux pump by flavonoids is
mediated by the repressor PmeR. Mol Plant Microbe Interact 24:1207-1219.
Vasseur, P., Vallet-Gely, I., Soscia, C., Genin, S., and Filloux, A. 2005. The pel genes of the
Pseudomonas aeruginosa PAK strain are involved at early and late stages of biofilm
formation. Microbiology 151:985-997.
Veesenmeyer, J.L., Hauser, A.R., Lisboa, T., and Rello, J. 2009. Pseudomonas aeruginosa
virulence and therapy: evolving translational strategies. Crit Care Med 37:1777-1786.
Ventre, I., Goodman, A.L., Vallet-Gely, I., Vasseur, P., Soscia, C., Molin, S., Bleves, S.,
Lazdunski, A., Lory, S., and Filloux, A. 2006. Multiple sensors control reciprocal
expression of Pseudomonas aeruginosa regulatory RNA and virulence genes. Proc Natl
Acad Sci U S A 103:171-176.
Wassmann, P., Chan, C., Paul, R., Beck, A., Heerklotz, H., Jenal, U., and Schirmer, T. 2007.
Structure of BeF3−-Modified Response Regulator PleD: Implications for Diguanylate
Cyclase Activation, Catalysis, and Feedback Inhibition. Structure 15:915-927.
Weinhouse, H., Sapir, S., Amikam, D., Shilo, Y., Volman, G., Ohana, P., and Benziman, M.
1997. c-di-GMP-binding protein, a new factor regulating cellulose synthesis in
Acetobacter xylinum. FEBS Lett 416:207-211.
Xu, J., Kim, J., Koestler, B.J., Choi, J.H., Waters, C.M., and Fuqua, C. 2013. Genetic analysis of
Agrobacterium tumefaciens unipolar polysaccharide production reveals complex
integrated control of the motile-to-sessile switch. Mol Microbiol 89:929-948.
Yamamoto, S., Kasai, H., Arnold, D.L., Jackson, R.W., Vivian, A., and Harayama, S. 2000.
Phylogeny of the genus Pseudomonas: intrageneric structure reconstructed from the
nucleotide sequences of gyrB and rpoD genes. Microbiology 146 ( Pt 10):2385-2394.
Yi, X., Yamazaki, A., Biddle, E., Zeng, Q., and Yang, C.H. 2010. Genetic analysis of two
phosphodiesterases reveals cyclic diguanylate regulation of virulence factors in Dickeya
dadantii. Mol Microbiol 77:787-800.
Young, J.M. 2010. Taxonomy of Pseudomonas syringae. Journal of Plant Pathology 92:S1.5S1.14.
Yousef-Coronado, F., Travieso, M.L., and Espinosa-Urgel, M. 2008. Different, overlapping
mechanisms for colonization of abiotic and plant surfaces by Pseudomonas putida.
FEMS Microbiol Lett 288:118-124.
Zeng, W., and He, S.Y. 2010. A prominent role of the flagellin receptor FLAGELLIN-SENSING2
in mediating stomatal response to Pseudomonas syringae pv tomato DC3000 in
Arabidopsis. Plant Physiol 153:1188-1198.
Zogaj, X., Wyatt, G.C., and Klose, K.E. 2012. Cyclic di-GMP stimulates biofilm formation and
inhibits virulence of Francisella novicida. Infect Immun 80:4239-4247.
Zumaquero, A., Macho, A.P., Rufian, J.S., and Beuzon, C.R. 2010. Analysis of the role of the
type III effector inventory of Pseudomonas syringae pv. phaseolicola 1448a in
interaction with the plant. J Bacteriol 192:4474-4488.
192
ANNEX 1: OTHER
PUBLICATIONS
bs_bs_banner
MOLECULAR PLANT PATHOLOGY (2012) 13(9), 998–1009
DOI: 10.1111/J.1364-3703.2012.00816.X
Pathogen profile
Pseudomonas savastanoi pv. savastanoi: some like it knot
CAYO RAMOS 1 , ISABEL M. MATAS 1 , LEIRE BARDAJI 2 , ISABEL M. ARAGÓN 1 AND
JESÚS MURILLO 2, *
1
Área de Genética, Facultad de Ciencias, Instituto de Hortofruticultura Subtropical y Mediterránea ‘La Mayora’, Universidad de Málaga-Consejo Superior de
Investigaciones Científicas (IHSM-UMA-CSIC), Málaga, Spain
2
Departamento de Producción Agraria, ETS Ingenieros Agrónomos, Universidad Pública de Navarra, Pamplona, Spain
SUMMARY
Pseudomonas savastanoi pv. savastanoi is the causal agent of
olive (Olea europaea) knot disease and an unorthodox member of
the P. syringae complex, causing aerial tumours instead of the
foliar necroses and cankers characteristic of most members of this
complex. Olive knot is present wherever olive is grown; although
losses are difficult to assess, it is assumed that olive knot is one of
the most important diseases of the olive crop. The last century
witnessed a large number of scientific articles describing the
biology, epidemiology and control of this pathogen. However,
most P. savastanoi pv. savastanoi strains are highly recalcitrant to
genetic manipulation, which has effectively prevented the pathogen from benefitting from the scientific progress in molecular
biology that has elevated the foliar pathogens of the P. syringae
complex to supermodels. A number of studies in recent years have
made significant advances in the biology, ecology and genetics of
P. savastanoi pv. savastanoi, paving the way for the molecular
dissection of its interaction with other nonpathogenic bacteria
and their woody hosts. The selection of a genetically pliable model
strain was soon followed by the development of rapid methods for
virulence assessment with micropropagated olive plants and the
analysis of cellular interactions with the plant host. The generation
of a draft genome of strain NCPPB 3335 and the closed sequence
of its three native plasmids has allowed for functional and comparative genomic analyses for the identification of its pathogenicity gene complement. This includes 34 putative type III effector
genes and genomic regions, shared with other pathogens of
woody hosts, which encode metabolic pathways associated with
the degradation of lignin-derived compounds. Now, the time is
right to explore the molecular basis of the P. savastanoi pv.
savastanoi–olive interaction and to obtain insights into why some
pathovars like it necrotic and why some like it knot.
Synonyms: Pseudomonas syringae pv. savastanoi.
Taxonomy: Kingdom Bacteria; Phylum Proteobacteria; Class
Gammaproteobacteria; Family Pseudomonadaceae; Genus Pseudomonas; included in genomospecies 2 together with at least
P. amygdali, P. ficuserectae, P. meliae and 16 other pathovars
*Correspondence: Email: jesus.murillo@unavarra.es
998
from the P. syringae complex (aesculi, ciccaronei, dendropanacis,
eriobotryae, glycinea, hibisci, mellea, mori, myricae, phaseolicola,
photiniae, sesami, tabaci, ulmi and certain strains of lachrymans
and morsprunorum); when a formal proposal is made for the
unification of these bacteria, the species name P. amygdali would
take priority over P. savastanoi.
Microbiological properties: Gram-negative rods, 0.4–
0.8 ¥ 1.0–3.0 mm, aerobic. Motile by one to four polar flagella,
rather slow growing, optimal temperatures for growth of
25–30 °C; oxidase negative, arginine dihydrolase negative; elicits
the hypersensitive response on tobacco; most isolates are fluorescent and levan negative, although some isolates are nonfluorescent and levan positive.
Host range: P. savastanoi pv. savastanoi causes tumours in cultivated and wild olive and ash (Fraxinus excelsior). Although
strains from olive have been reported to infect oleander (Nerium
oleander), this is generally not the case; however, strains of
P. savastanoi pv. nerii can infect olive. Pathovars fraxini and nerii
are differentiated from pathovar savastanoi mostly in their host
range, and were not formally recognized until 1996. Literature
before about 1996 generally names strains of the three pathovars as P. syringae ssp. savastanoi or P. savastanoi ssp. savastanoi, contributing to confusion on the host range and biological
properties.
Disease symptoms: Symptoms of infected trees include hyperplastic growths (tumorous galls or knots) on the stems and
branches of the host plant and, occasionally, on leaves and fruits.
Epidemiology: The pathogen can survive and multiply on aerial
plant surfaces, as well as in knots, from where it can be dispersed by
rain, wind, insects and human activities, entering the plant through
wounds. Populations are very unevenly distributed in the plant, and
suffer drastic fluctuations throughout the year, with maximum
numbers of bacteria occurring during rainy and warm months.
Populations of P. savastanoi pv. savastanoi are normally associated
with nonpathogenic bacteria, both epiphytically and endophytically, and have been demonstrated to form mutualistic consortia
with Erwinia toletana and Pantoea agglomerans, which could
result in increased bacterial populations and disease symptoms.
Disease control: Based on preventive measures, mostly sanitary and cultural practices. Integrated control programmes benefit
© 2012 THE AUTHORS
MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD
Pseudomonas savastanoi pv. savastanoi
from regular applications of copper formulations, which should be
maintained for at least a few years for maximum benefit. Olive
cultivars vary in their susceptibility to olive knot, but there are no
known cultivars with full resistance to the pathogen.
Useful websites: http://www.pseudomonas-syringae.org/;
http://genome.ppws.vt.edu/cgi-bin/MLST/home.pl; ASAP access to
the P. savastanoi pv. savastanoi NCPPB 3335 genome sequence
https://asap.ahabs.wisc.edu/asap/logon.php.
INTRODUCTION
Pseudomonas syringae is an economically important pathogen
and one of the most relevant models for the study of plant–
microbe interactions (e.g. Mansfield, 2009; Mansfield et al., 2012).
The species is currently a taxonomic conundrum and has been
pulled together with P. amygdali, P. avellanae, P. cannabina,
P. caricapapayae, P. ficuserectae, P. meliae, P. savastanoi,
P. tremae and P. viridiflava into a group designated as the P. syringae complex, which could correspond to at least nine different
species (Gardan et al., 1999; Parkinson et al., 2011; Young, 2010).
Pathovars of the P. syringae complex generally exploit the plant
apoplast as a parasitic niche and cause foliar necrosis in diverse
plant hosts, with a minority of strains causing other types of
symptoms, such as vascular diseases on woody plants (Agrios,
2005). Remarkable exceptions include a few pathovars producing
aerial tumours in woody plants, such as P. savastanoi pv. savastanoi. Pseudomonas savastanoi pv. savastanoi is the causal agent
of olive (Olea europaea) knot disease, whose symptoms include
hyperplastic growths (tumorous galls or knots) on the stems and
branches of the host plant and, occasionally, on leaves and fruits
(Fig. 1). Olive knot is present worldwide, wherever olive is grown,
and is considered to be one of the most important diseases of olive
(CMI, 1987; Quesada et al., 2010a; Young, 2004). Diverse research
groups worldwide have made substantial contributions towards
the understanding of the biology, epidemiology and control of this
pathogen; however, most strains of P. savastanoi pv. savastanoi
are highly recalcitrant to genetic manipulation (Pérez-Martínez
et al., 2007), which has significantly slowed down their molecular
analysis.
The growing availability of microbial genomes has promoted a
new research era in the field of plant–microbe interactions,
leading to the identification of potentially comprehensive repertoires of putative virulence genes and the emergence of unified
models of interaction between prototypical pathogens and plant
hosts (Lindeberg et al., 2008; Mansfield, 2009; Schneider and
Collmer, 2010). Extensive recent research efforts have focused on
Pseudomonas diseases of herbaceous plants, with knowledge on
the virulence and pathogenicity determinants specific for the
infection of woody plants, including those of tumour-inducing
999
strains, lagging far behind. The selection of strain P. savastanoi pv.
savastanoi NCPPB 3335 as a research model (Pérez-Martínez
et al., 2007) has opened up the way for the application of highthroughput molecular tools to the analysis of the molecular basis
of bacterial adaptation to woody hosts.
TAXONOMY AND POPULATION BIOLOGY
Despite significant advances in molecular phylogeny and taxonomy, the nomenclature and classification of P. savastanoi pv.
savastanoi are still a source of confusion. This bacterium is part of
the P. syringae complex, encompassing at least 60 pathovars and
several other Pseudomonas species (Bull et al., 2010; Young,
2010). A study limited to a few taxa formally classified pathovars
glycinea, phaseolicola and savastanoi into the new species
P. savastanoi (Gardan et al., 1992), to which pathovars fraxini,
nerii and retacarpa were later added (Bull et al., 2010). DNA–DNA
hybridization distributed P. syringae into at least nine separate
genomospecies (Gardan et al., 1999; Young, 2010). Pseudomonas
savastanoi pv. savastanoi was included in genomospecies 2,
together with 16 other P. savastanoi–P. syringae pathovars (see
‘Summary’) and the species P. amygdali, P. ficuserectae and
P. meliae; when genomospecies 2 is formally named, however, the
species should be designated P. amygdali and not P. savastanoi
(Gardan et al., 1999). Multilocus sequence analyses have shown
that P. savastanoi pv. savastanoi NCPPB 3335 is evolutionarily
closer to P. syringae pathovars aesculi 2250 and NCPPB 3681,
tabaci ATCC 11528 and phaseolicola 1448A (genomospecies 2)
than to P. syringae pv. tomato DC3000 (genomospecies 3) or
P. syringae pv. syringae B728a (genomospecies 1) (Fig. S1, see
Supporting Information) (Parkinson et al., 2011; Sarkar and
Guttman, 2004). These studies support the genomospecies 2
grouping and indicate that it might encompass at least nine
further pathovars (broussonetiae, castaneae, cerasicola, cunninghamiae, daphniphylli, fraxini, nerii, rhaphiolepidis and retacarpa)
plus P. tremae (Parkinson et al., 2011; Sarkar and Guttman, 2004).
Therefore, what name should be used for this bacterium? Although
P. savastanoi is being widely used in the literature, the P. syringae
designation helps to avoid the false idea that this pathogen is a
different species from, for example, P. syringae pv. tabaci.
Natural isolates of P. savastanoi pv. savastanoi are heterogeneous, both phenotypically and genotypically (Table 1), although
they tend to generate clonal populations in colonized areas (e.g.
Quesada et al., 2008; Sisto et al., 2007). There is an important
variation in virulence, with strains showing either low, intermediate or, most commonly, high virulence to diverse olive cultivars
(Penyalver et al., 2006), and also variation in the size and morphology of tumours in artificial inoculations (Pérez-Martínez et al.,
2007). Certain isolates in central Italy are nonfluorescent and
produce levan, in contrast with the majority of other isolates
(Marchi et al., 2005). Amplified fragment length polymorphism
© 2012 THE AUTHORS
MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD MOLECULAR PLANT PATHOLOGY (2012) 13(9), 998–1009
1000
C. RAMOS et al.
Fig. 1 Symptoms produced by Pseudomonas savastanoi pv.
savastanoi NCPPB 3335 in olive plants and pathogen
visualization within knots. In vitro micropropagated olive
plants not inoculated (A) and inoculated (B). (C) Knot
induced on a 2-year-old olive plant 90 days post-inoculation
(dpi). Real-time monitoring of green fluorescent protein
(GFP)-tagged P. savastanoi infection of a young
micropropagated olive plant at 30 dpi (D) and
complementary epifluorescence microscopy image (E). (F)
Cross-section of the knot exposed in (C) showing necrosis
associated with infection of the stem. (G) Cross section of a
30-dpi knot, stained with methylene blue–picrofuchsin;
asterisks indicate newly formed bundles of xylem vessels.
(H) Transverse section of a knot, induced by GFP-tagged
NCPPB 3335, showing GFP emission within the lumen of
xylem vessels, in the internal cavities and at the periphery
of the tumour tissue. (I) Semithin cross-section of a knot
stained with toluidine blue. Stained primary and secondary
walls show dark and light blue in colour, respectively. (J)
Scanning confocal electron microscopy (SCLM) image of a
knot induced by GFP-tagged NCPPB 3335. (K) Scanning
electron micrograph showing a group of rod-shaped
P. savastanoi cells. (L) Transmission electron micrograph of
ultrathin section of a knot showing pathogen cells
colonizing the intercellular spaces of the host tissue.
© 2012 THE AUTHORS
1001
Table 1 Phenotypic and genetic differences among selected pathovars of Pseudomonas savastanoi*.
Plant host†
Genomic location of hormone biosynthesis genes‡
P. savastanoi pv.
Ash
Oleander
Olive
Spanish broom
iaaMH
iaaL
ptz
fraxini
nerii
savastanoi
retacarpa
c
K
K
–
–
K
–
–
c
K
K
–
–
–
–
K
nd
P
Ch
uk
uk
P
Ch
uk
uk
P
Ch
uk
*Modified from Iacobellis et al. (1998), Janse (1982) and Pérez-Martínez et al. (2008).
†Ash, Fraxinus excelsior; oleander, Nerium oleander; olive, Olea europaea; Spanish broom, Retama sphaerocarpa; c, cankers accompanied by wart-like excrescences; K,
knots; –, no visible symptoms.
‡Symbols indicate that the gene is located in the chromosome (Ch) or in plasmids (P) in at least 70% of the strains examined; nd; not detected; uk, unknown. Genes
iaaMH and iaaL are involved in the biosynthesis of indoleacetic acid and indoleacetic acid lysine, respectively, whereas ptz codes for an isopentenyl transferase, involved
in the biosynthesis of cytokinins.
(AFLP) data cluster these levan-positive isolates separately from
most of the common levan-negative isolates. Arbitrarily primed
polymerase chain reaction (PCR) (Krid et al., 2009; Scortichini
et al., 2004), AFLP (Sisto et al., 2007) and typing with IS53
(Quesada et al., 2008) have revealed high levels of polymorphism;
in addition, AFLP clearly differentiates pathovar savastanoi from
pathovars fraxini and nerii. In general, genetic variability associates with geographical origin, with strains from the same area
having a closer genetic relationship than those from different
areas (Krid et al., 2009; Matas et al., 2009; Quesada et al., 2008;
Sisto et al., 2007), suggesting a preference for clonal colonization
of olive orchards; indeed, the spread of bacteria from inoculated to
noninoculated trees in an olive orchard, where they produce
tumours, has been documented in less than 1 year (Quesada et al.,
2010a). Typing with IS53 revealed higher diversity than any of the
other techniques, and could be used to track strains in the environment, because many strains display unique patterns (Quesada
et al., 2008).
EPIDEMIOLOGY AND CONTROL
Pseudomonas savastanoi pv. savastanoi does not survive for long
in soil, and is normally found as an epiphyte and also endophytically, being able to migrate to produce secondary knots in new
wounds (Ercolani, 1978; Penyalver et al., 2006; Quesada et al.,
2007). Epiphytic life allows the build-up of populations for plant
colonization and also fosters the interaction with other microbial
communities in the phyllosphere. The pathogen is usually introduced to new areas through infected plant material. The bacterium
can survive and multiply as a saprophyte on plant surfaces (Ercolani, 1978; Quesada et al., 2007), as well as inside knots, from
where it can be disseminated by rain, wind-blown aerosols, insects
and cultural practices, such as pruning. It enters the plant through
any type of wound, such as leaf scars or those caused by pruning,
harvesting, frost and hail. The presence of knots in even a single
tree normally leads to the rapid infection of the whole orchard
because the pathogen is very rapidly and efficiently disseminated,
with significant colonization of healthy trees in as little as 1 year
(Quesada et al., 2010a). The size of P. savastanoi pv. savastanoi
populations is highly variable, even by several orders of magnitude
between different leaves of the same shoot (Quesada et al., 2007),
with the highest populations occurring in rainy months with moderate temperatures (10–20 °C).
A plethora of nonpathogenic bacterial species is found colonizing olive leaves or closely associated with knots produced by
P. savastanoi pv. savastanoi, and the sizes of their populations are
often positively correlated (Ercolani, 1978; Marchi et al., 2006;
Moretti et al., 2011; Ouzari et al., 2008; Quesada et al., 2007;
Rojas et al., 2004). Several of these species can synthesize large
amounts of indoleacetic acid (IAA), which may favour the proliferation of the pathogen and colonization of the plant (Cimmino
et al., 2006; Marchi et al., 2006; Ouzari et al., 2008). Pantoea
agglomerans is the species most frequently found to be associated
with P. savastanoi pv. savastanoi populations, its growth being
stimulated in the presence of active populations of the pathogen
(Marchi et al., 2006; Quesada et al., 2007). Their interaction is not
completely understood, and can apparently lead to either an
increase in virulence or a decrease in pathogen populations (Hosni
et al., 2011; Marchi et al., 2006). As described below (see ‘Other
virulence factors’), a recent study has demonstrated that both
Erwinia toletana and P. agglomerans can form stable communities
in planta (Hosni et al., 2011).
The literature is elusive with regard to the crop losses caused by
olive knot, which greatly depend on the geographical location and
olive cultivar, although it is generally accepted that it is one of the
most important diseases affecting the olive crop (Young, 2004).Tree
vigour, growth and yield can be moderately or severely reduced, as
can the size and quality of the fruits (Quesada et al., 2010a; Schroth
et al., 1973). Olive knot cannot be eradicated once it is established
in a tree or orchard, and therefore its control is based on preventive measures, mostly sanitary and cultural practices (Quesada
et al., 2010a, b; Young, 2004). Methods should aim to avoid the
© 2012 THE AUTHORS
1002
C. RAMOS et al.
introduction and dissemination of the pathogen, for instance by
using certified pathogen-tested trees and rootstocks to start new
olive groves (EPPO, 2006), by minimizing the wounding of trees and
by reducing epiphytic populations of the pathogen. Detection and
diagnosis of the pathogen can be performed using diverse rapid
and highly sensitive PCR methodologies (see Table S1, see Supporting Information), some of which allow the differentiation of pathovars fraxini, nerii and savastanoi. Pivotal to efficient disease
management is a carefully planned and executed pruning, which
should always start with healthy trees and be avoided in wet
weather. Chemical control with copper compounds has been traditionally used in both nurseries and the field (Teviotdale and Krueger,
2004; Young, 2004). An extensive and systematic study (Quesada
et al., 2010b) reported a significant reduction in pathogen populations from the very first application of copper compounds, either
copper oxychloride or cuprocalcic sulphate plus mancozeb. Nevertheless, treatments should be part of an appropriate integrated
control programme that includes the regular application of two
copper treatments per year. This schedule produced the greatest
difference with respect to the untreated control in the third year,
after five copper treatments, resulting in a significant reduction in
the average number of knots per plant (Quesada et al., 2010b).
Conversely, acibenzolar-S-methyl treatments did not result in a
significant reduction in disease symptoms.
Reduction of host susceptibility, including the use of resistant
cultivars, is the most effective method for the integrated control of
plant diseases; unfortunately, there are no known olive cultivars
that are completely resistant to the pathogen. Early comparative
studies showed a considerable degree of phenotypic variation
among olive cultivars, ranging from high susceptibility to a certain
resistance (reviewed in Young, 2004). A larger assay evaluated the
effect on symptom development of diverse variables—cultivar,
plant age, development of secondary knots, inoculum dose and
strain virulence—and proposed a standardized method to assess
cultivar susceptibility (Penyalver et al., 2006). These authors demonstrated large differences in disease response with small variations in the inoculum dose, which might explain the discrepancies
in cultivar assessment among different studies, and classified 29
cultivars in three categories of high, medium and low susceptibility to the pathogen.
PSEUDOMONAS SAVASTANOI PV.
SAVASTANOI: LIFE INSIDE THE KNOT
Pseudomonas savastanoi pathogenicity and virulence are generally tested on 1–3-year-old olive plants (Glass and Kosuge, 1988;
Hosni et al., 2011; Iacobellis et al., 1994; Penyalver et al., 2006;
Pérez-Martínez et al., 2007; Sisto et al., 2004). Apart from the
space required, this often results in a large variability in the size
and number of knots that develop. In vitro techniques have been
widely used to study the pathogenicity and virulence of animal
bacterial pathogens and can also be conveniently applied in plant
pathology. Several techniques have been described for the micropropagation of a vast number of fruit trees, including several olive
varieties, facilitating the mass production of clonal and diseasefree plants that can easily be maintained under controlled conditions in growth chambers. The use of in vitro micropropagated
olive plants has been established as a fast and inexpensive
method to study the pathogenicity and virulence of P. savastanoi
strains isolated from olive and oleander knots (Rodríguez-Moreno
et al., 2008). As observed previously with older olive plants,
symptom development in micropropagated olive plants is highly
dependent on both the olive variety and the strain. Nevertheless,
histological modifications observed in in vitro olive plants after
infection by P. savastanoi pv. savastanoi strains (Marchi et al.,
2009; Rodríguez-Moreno et al., 2008, 2009) are very similar to
those in older olive plants (Smith, 1920; Surico, 1977; Temsah
et al., 2008), further confirming the suitability of this model
system.
Tagging of P. savastanoi pv. savastanoi NCPPB 3335 with the
green fluorescent protein (GFP), in combination with the use of
in vitro olive plants and epifluorescence microscopy, allows the
real-time monitoring of disease development at the whole-tumour
level, as well as the monitoring of bacterial localization inside
knots at the single-cell level by scanning confocal electron microscopy. In addition, scanning and transmission electron microscopy
can be used for detailed ultrastructural analysis of tumour histology, as well as for the visualization of the P. savastanoi pv. savastanoi lifestyle within knot tissues (Fig. 1) (Rodríguez-Moreno
et al., 2009). A combination of these microscopy techniques was
used for the in vivo analysis of P. savastanoi pv. savastanoi NCPPB
3335 mutants affected in virulence (Bardaji et al., 2011; PérezMartínez et al., 2010).
GENOMIC INSIGHTS INTO P. SAVASTANOI
PV. SAVASTANOI PATHOGENICITY AND
VIRULENCE
In this section, we review how the recent sequencing of the
P. savastanoi pv. savastanoi NCPPB 3335 draft genome, and the
complete sequence of its three-plasmid complement, has allowed
the identification of the virulence gene complement of this
tumour-inducing pathogen of woody hosts (Bardaji et al., 2011;
Rodríguez-Palenzuela et al., 2010).
Phytohormones
In P. savastanoi, IAA is synthesized from tryptophan in two steps
catalysed by the products of the genes iaaM (tryptophan
monooxygenase) and iaaH (indoleacetamide hydrolase) (Comai
and Kosuge, 1982; Palm et al., 1989). In addition, P. savastanoi pv.
nerii (oleander isolates) also converts IAA to IAA-lysine through
© 2012 THE AUTHORS
1003
Fig. 2 Unrooted neighbour-joining (NJ) tree of
iaaL nucleotide sequences from strains of the
Pseudomonas syringae complex. (See Fig. S1
for methodology and Table S3 for accession
numbers.) Only the pathovar name and strain
designation are shown; all strains belong to
P. syringae, except P. cannabina pv. alisalensis
ES4326, which was previously designated as
P. syringae pv. maculicola.
the action of the iaaL gene (Glass and Kosuge, 1988), which is also
present in most P. syringae complex pathovars (Glickmann et al.,
1998). Although P. savastanoi pv. savastanoi strains contain two
iaaL alleles (Matas et al., 2009), IAA-lysine has not been detected
in culture filtrates of P. savastanoi strains isolated from olive
(Evidente et al., 1986; Glass and Kosuge, 1988). Two chromosomally encoded iaaM, iaaH and iaaL alleles were also found in the
genome of P. savastanoi pv. savastanoi NCPPB 3335; however,
the iaaM-2 and iaaH-1 alleles appeared to be pseudogenes
(Rodríguez-Palenzuela et al., 2010). Resequencing of these two
loci has recently confirmed that, in fact, iaaM-2 is a pseudogene,
whereas iaaH-1 encodes a complete coding sequence (CDS).
Gene iaaL is widely distributed within the P. syringae complex
(Glickmann et al., 1998), and its phylogeny (Fig. 2) is largely congruent with the phylogeny deduced from housekeeping genes
(Fig. S1), suggesting that iaaL is ancestral to the complex.
However, clustering of iaaL from P. syringae pv. oryzae 1_6
(genomospecies 4) with genomospecies 2 (Fig. 2) provides evidence of horizontal transfer. This is not surprising because iaaL is
often found in several copies and located in plasmids (Glickmann
et al., 1998; Matas et al., 2009), although the transfer appears to
preferentially occur within the P. syringae complex (not shown).
Conversely, highly conserved iaaMH alleles are present in only a
handful of P. syringae complex strains (Table S2, see Supporting
Information) (Glickmann et al., 1998); nevertheless, diverse patho-
vars contain CDSs (Baltrus et al., 2011) whose deduced products
show very low identity to those of iaaMH (e.g. PSPTO_0518/
PSPTO_4204; 29.3%/29.7% amino acid identity), but high identity
with putative monooxygenase and amidase genes common in the
P. syringae complex (e.g. 99%/89% amino acid identity with
PSA3335_4651/PSA3335_4172 from NCPPB 3335), and whose
role in IAA biosynthesis has not been demonstrated. The limited
data available also suggest the horizontal transfer of iaaMH
within the P. syringae complex, which is also less related to the
corresponding genes of other organisms (Table S2).
Genes for phytohormone biosynthesis have a disparate
genomic localization in different tumour-inducing strains of
P. savastanoi (Table 1), with those for the biosynthesis of cytokinins (CKs) preferentially located in plasmids of the pPT23A family
in P. savastanoi pv. savastanoi (Macdonald et al., 1986; PérezMartínez et al., 2008; Silverstone et al., 1993). The ptz gene,
encoding an isopentenyl transferase and characterized by a low
G + C content (43.4% G + C), was found in a potential genomic
island located in plasmid pPsv48A of P. savastanoi pv. savastanoi
NCPPB 3335 (Bardaji et al., 2011). Knots induced in olive plants by
P. savastanoi strains cured of plasmids containing ptz are smaller
(Bardaji et al., 2011; Iacobellis et al., 1994; Rodríguez-Moreno
et al., 2008) and show a lower presence of spiral vessels (Bardaji
et al., 2011), than those induced by wild-type strains. Another
gene putatively involved in the biosynthesis of CKs, gene ipt,
© 2012 THE AUTHORS
1004
C. RAMOS et al.
encoding a putative isopentenyl-diphosphate delta-isomerase,
was found in plasmid pPsv48C of P. savastanoi pv. savastanoi
NCPPB 3335; however, its role in virulence has not been tested, as
derivatives lacking pPsv48C are not yet available (Bardaji et al.,
2011).
Apparently, P. savastanoi pv. savastanoi does not belong to
the group of 2-oxoglutarate-dependent ethylene producers, a
pathway dependent on gene efe in several P. syringae pathovars
(Weingart et al., 1999). First, no homology to an efe probe was
found by hybridization analysis of 32 different P. savastanoi pv.
savastanoi plasmids (Pérez-Martínez et al., 2008). Second, proteins homologous to ethylene-forming enzymes from P. syringae
pv. phaseolicola, pv. glycinea and pv. pisi have not been found in
the P. savastanoi pv. savastanoi NCPPB 3335 genome (RodríguezPalenzuela et al., 2010).
Type III secretion system (T3SS) and effectors
Cluster analysis of HrpS protein sequences (Inoue and Takikawa,
2006) has shown that P. savastanoi pv. savastanoi NCPPB 3335
belongs to group I, which comprises exclusively proteins from
P. syringae pathovars from genomospecies 2 (Gardan et al.,
1999). In relation to HrpA, P. savastanoi pv. savastanoi NCPPB
3335 contains an hrpA2 gene, which is highly similar to those of
P. syringae pathovars phaseolicola, glycinea and tabaci (PérezMartínez et al., 2010).
In agreement with Sisto et al. (2004), a T3SS mutant of strain
NCPPB 3335 was also unable to multiply in olive tissues and
induce the formation of knots in woody olive plants. Interestingly,
tumours induced by the T3SS mutant on young micropropagated
olive plants did not show the necrosis and internal open cavities
observed in knots induced by the wild-type strain (Pérez-Martínez
et al., 2010).
Bioinformatic analysis of the P. savastanoi pv. savastanoi
NCPPB 3335 genome sequence (Rodríguez-Palenzuela et al.,
2010) has allowed a prediction of hop genes, including 19 putative
T3SS effectors with amino acid identities of 65%–80% to previously described effectors. In addition, a further 11 candidate genes
do not share sequence similarity with known effectors (RodríguezPalenzuela et al., 2010). A later revision of this genome sequence
identified four new candidate effectors: AvrPto1, HopAT1′,
HopAZ1 and HopF4 (Hops Database, http://www.pseudomonassyringae.org/home.html) (Fig. 3). Furthermore, sequencing of the
three-plasmid complement of this strain revealed that two of the
T3SS effector genes are plasmid encoded: hopAF1 (plasmid
pPsv48A) and hopAO1 (plasmid pPsv48B) (Bardaji et al., 2011).
Figure 3 shows an updated and corrected comparison of the T3SS
effector gene complements of P. savastanoi pv. savastanoi NCPPB
3335 and other sequenced plant-pathogenic pseudomonads.
Translocation analysis of the T3SS effector repertoire of P. savastanoi pv. savastanoi NCPPB 3335 is currently in progress.
Fig. 3 Updated and corrected comparison of the type III effector gene complements of Pseudomonas savastanoi pv. savastanoi (Psv) NCPPB 3335 and
other sequenced plant-pathogenic pseudomonads. Pph, P. syringae pv. phaseolicola; Pta, P. syringae pv. tabaci. Gene hopAF1-2, plasmid encoded in
NCPPB 3335, shows 73%–74% amino acid identity with hopAF1 from Psy
B728a, Pph 1448A and Pto DC3000. Psv NCPPB 3335 effectors included in
the Hop database (http://www.pseudomonas-syringae.org/
pst_func_gen2.htm) are indicated in bold type. #Plasmid-encoded gene; asterisks indicate putative pseudogenes; hop genes truncated by a frameshift or a
premature stop codon are indicated by a single quotation mark (Lindeberg
et al., 2005).
Other virulence factors
The pathogenicity of P. savastanoi pv. savastanoi in olive critically
depends on quorum sensing (QS) regulation. The QS system of
P. savastanoi pv. savastanoi strain DAPP-PG 722 consists of a luxI
homologue (pssI) and a luxR homologue (pssR) (Hosni et al.,
2011). However, the lack of signal production in a pssI mutant of
this pathogen has been shown to be complemented in planta by
the presence of wild-type E. toletana, a nonpathogenic bacterium
that is very often found to be associated with the olive knot
pathogen (Hosni et al., 2011). Erwinia toletana produces the same
N-acyl-homoserine lactone molecules as P. savastanoi pv. savastanoi; moreover, populations of E. toletana significantly decline
over time after inoculation in olive tissues, but increase on
co-inoculation with a strain of P. savastanoi pv. savastanoi. This
relationship is mutualistic, because the populations of P. savastanoi pv. savastanoi also increase significantly when the pathogen is
co-inoculated with E. toletana; in addition, the knot size also
increases, reflecting an increase in virulence (Hosni et al., 2011).
The mechanism underlying this relationship is not fully clear, but it
appears to result, at least in part, from the sharing of QS signalling
mediated by N-acyl-homoserine lactones.
© 2012 THE AUTHORS
Other known virulence determinants in plant-pathogenic Pseudomonas include phytotoxins, cell wall-degrading hydrolytic
enzymes, extracellular polysaccharides, iron uptake systems, resistance to plant-derived antimicrobials, adhesion, and the general
processes of motility and chemotaxis. Annotation of the P. savastanoi pv. savastanoi NCPPB 3335 draft genome revealed the existence of 551 genes potentially involved in several processes that
could contribute to virulence, most of which are conserved in
P. syringae pv. phaseolicola 1448A. However, the subset of
P. savastanoi pv. savastanoi NCPPB 3335-specific genes (not
found in 1448A), includes a cellulase, a pectate lyase and a putative filamentous haemagglutinin (Rodríguez-Palenzuela et al.,
2010). Genes for levansucrase, the enzyme responsible for the
biosynthesis of the exopolysaccharide levan, are found in the
genome of all sequenced P. syringae strains, although their
numbers vary from three to one (O’Brien et al., 2011). Only a single
levansucrase-coding gene (PSA3335_2033) was identified in
P. savastanoi pv. savastanoi NCPPB 3335 (Rodríguez-Palenzuela
et al., 2010), probably because P. savastanoi pv. savastanoi strains
are, in general, levan negative, whereas the P. syringae pathovars
of LOPAT subgroup 1a are all levan positive (Lelliott and Stead,
1987). The relevance of all these putative virulence factors in
P. savastanoi has not been reported to date.
METABOLIC VERSATILITY AND ADAPTATION
TO WOODY HOSTS
Pseudomonas syringae pathovars are nutritionally specialized for
growth in the plant environment relative to nonpathogenic pseudomonads (Rico et al., 2011). Biolog GN2 MicroPlate Technology
(Bochner et al., 2001) has revealed that the carbon utilization
profiles of five different P. savastanoi pv. savastanoi strains,
including NCPPB 3335, are almost identical. However, comparative analysis with previously reported data for P. syringae pathovars and nonpathogenic pseudomonads (Mithani et al., 2011; Rico
and Preston, 2008) shows that the metabolic activities of P. savastanoi pv. savastanoi are more similar to those shown by P. syringae pv. tabaci ATCC 11528, P. syringae pv. tomato DC3000 and
P. syringae pv. syringae B728a than to those observed for P. syringae pv. phaseolicola 1448A (Fig. 4), despite the fact that both
strains ATCC 11528 and 1448A cluster together with P. savastanoi
pv. savastanoi NCPPB 3335 by multilocus sequence analysis of
housekeeping genes (Group 3, Fig. S1). Thus, nutritional divergence does not mirror phylogenetic divergence, possibly as a
result of host-specific features or pathogen evolutionary history.
The production of phenolic compounds, which provide a natural
defence against pathogen attack, is greatly increased in olive
knots induced by P. savastanoi pv. savastanoi (Cayuela et al.,
2006), suggesting that bacterial resistance to phenols could be of
paramount importance in pathogenicity. The P. savastanoi pv.
savastanoi NCPPB 3335 genome (Rodríguez-Palenzuela et al.,
1005
Fig. 4 Unrooted unweighted pair group method with arithmetic mean
(UPGMA) tree based on nutrient utilization data of Pseudomonas savastanoi
pv. savastanoi (Psv) and other pseudomonads. Metabolic activities of Psv
strains, tested using Biolog GN2 plates, were compared with carbon
utilization data reported for P. syringae strains and nonplant pathogenic
species of Pseudomonas (Rico and Preston, 2008). The tree was constructed
using MEGA5 (Tamura et al., 2011) and is drawn to scale, with branch
lengths in the same units as those of the evolutionary distances used to infer
the dendrogram. Distances were computed using the maximum composite
likelihood method and are in units of the number of substrate utilizations per
site. P. syringae pathovars: syringae, Psy; tomato, Pto; tabaci, Pta;
phaseolicola, Pph. Pseudomonas putida, Ppu; P. entomophila, Pme;
P. fluorescens, Pfl; P. aeruginosa, Pae.
2010) encodes a region of about 15 kb, named VR8 (60.1%
G + C), which is absent in all sequenced P. syringae strains infecting herbaceous plants, but shared with P. syringae pathovars
infecting woody hosts, such as aesculi (Green et al., 2010), morsprunorum and actinidiae (Fig. 5), which are pathogenic to chestnut, cherry and kiwi, respectively. Among other genes encoded in
this region, the antABC and catBCA operons are involved in the
degradation of anthranilate and catechol, respectively, and could
offer a selective advantage for growth in woody hosts. Indeed, the
antABC cluster is homologous to the anthranilate degradation
genes found on plasmid pCAR1 of Pseudomonas resinovorans
(Nojiri et al., 2002; Urata et al., 2004), a bacterium commonly
found in the lubricating oils of wood mills. Other metabolic pathways involving the cat and/or ant genes included in the KEGG
Pathway Database (http://www.genome.jp/kegg/pathway.html)
are those related to the degradation of benzoate, fluorobenzoate,
toluene, chlorocyclohexane and chlorobenzene. In P. savastanoi
© 2012 THE AUTHORS
1006
C. RAMOS et al.
Fig. 5 Schematic map of variable region 8 (VR8) in the genomes of
Pseudomonas savastanoi pv. savastanoi NCPPB 3335 and other sequenced
P. syringae pathovars. (A) Pseudomonas savastanoi pv. savastanoi NCPPB
3335, P. syringae pathovars aesculi strains 2250 and NCPPB 3681,
morsprunorum MAFF302280 and actinidiae MAFF302091. (B) Pseudomonas
syringae pathovars tabaci ATCC 11528, mori 301020, phaseolicola 1448A,
glycinea race 4, lachrymans MAFF302278 and japonica MAFF301072. (C)
Pseudomonas syringae pathovars syringae B728a, tomato DC3000 and
oryzae 1_6. Black and grey arrows indicate genes flanking VR8 in
P. savastanoi pv. savastanoi NCPPB 3335 which are present (PSA3335_3197
and PSA3335_3214) or not (PSA3335_3198), respectively, in the genome of
all the strains analysed. Pink and orange arrows indicate genes involved in
the catabolism of catechol (catBCA) and anthranilate (antABC and antR),
respectively. PSA3335_3197, outer membrane protein; PSA3335_3198,
ribosomal-protein-S5p-alanine acetyltransferase (rimJ); PSA3335_3206,
aerotaxis receptor; PSA3335_3207, nitrilotriacetate monooxygenase
component B, flavin reductase; PSA3335_3208, protein involved in
meta-pathway of phenol degradation; PSA3335_3209, putative oxygenase
subunit; PSA3335_3210, short-chain alcohol dehydrogenase/reductase;
PSA3335_3211, dienelactone hydrolase; PSA3335_3212, hypothetical
protein; PSA3335_3214, voltage-dependent potassium channel protein.
pv. savastanoi NCPPB 3335 and all other strains encoding VR8, the
genetic content and chromosomal location of this region are identical (Fig. 5). However, genetic elements suggesting its possible
acquisition by horizontal transfer were not found bordering VR8 in
P. savastanoi pv. savastanoi NCPPB 3335 (Rodríguez-Palenzuela
et al., 2010).
PLASMID GENETICS AND BIOLOGY
Plasmids are the main agents in the horizontal exchange of DNA
amongst bacteria, and the P. syringae complex contains a significant horizontal gene pool distributed in diverse native plasmids
(Jackson et al., 2011). Strains of P. savastanoi pv. savastanoi
usually contain one to six plasmids (around 10 to >100 kb)
(Murillo and Keen, 1994; Pérez-Martínez et al., 2008). Most of
these belong to the pPT23A-like family of plasmids (PFP), characterized for sharing a highly conserved replication module (Gibbon
et al., 1999), although strains might contain from zero to four
non-PFP plasmids. As usual in the P. syringae complex, plasmid
profiles are highly variable and often strain specific, offering a
simple method of strain tracking (Pérez-Martínez et al., 2007,
2008). Nevertheless, plasmid profiles of P. syringae complex
strains are dynamic and often change in response to repeated
subculture or interaction with the host (e.g. Lovell et al., 2011).
PFP plasmids carry a panoply of genes involved in pathogenicity, virulence and adaptation to the environment, such as genes for
T3SS effectors, type IV secretion systems, phytotoxins, phytohormones and resistance to antibiotics and heavy metals, as well as
an array of insertion sequences (Sundin, 2007). Similar types of
genes have been found in 32 native plasmids from 10 P. savastanoi pv. savastanoi strains using a macroarray containing 135 different genes, albeit with a limited presence of rulAB genes for UV
radiation tolerance. This could be significant because rulAB genes
often appear to control the expression of integrases, and are
predicted to facilitate the dispersal of associated T3SS effector
genes (Jackson et al., 2011). Native plasmids from P. savastanoi
pv. savastanoi contain diverse virulence genes carried indistinctly
by PFP and non-PFP plasmids (Pérez-Martínez et al., 2008),
although PFP plasmids have been traditionally recognized as the
main, or the only, repository of valuable genes in the P. syringae
complex. At least eight T3SS effector genes (Jackson et al., 2002;
Pérez-Martínez et al., 2008) are frequently found on P. savastanoi
pv. savastanoi plasmids. Other relevant virulence genes are those
involved in the biosynthesis of phytohormones, which were the
first plasmid-borne pathogenicity genes found in Pseudomonas
spp. (Comai and Kosuge, 1980). Unlike pathovar nerii, most strains
of pathovar savastanoi carry chromosomal copies of genes for the
biosynthesis of IAA and CKs (Table 1).
The complete sequences of the three-PFP plasmid complement
of strain NCPPB 3335 (pPsv48A, 78 kb; pPsv48B, 45 kb; pPsv48C,
42 kb) (Bardaji et al., 2011) contain 152 predicted CDSs; the
majority (38 CDSs) have been annotated as hypothetical proteins,
followed by 37 CDSs involved in DNA metabolism, including
plasmid replication and maintenance. Each of the plasmids
contain at least one putative toxin–antitoxin system, involved in
plasmid maintenance, which is probably why we could not obtain
derivatives cured of the three plasmids (Bardaji et al., 2011). The
three plasmids contain seven putative virulence genes, five of
which are putative type III effectors preceded by an Hrp-box:
pPsv48A contains a chimeric copy of gene hopAF1, included in the
transposon effector ISPsy30, plus three copies of a large CDS
found in many plant-associated proteobacteria, whereas pPsv48B
contains gene hopAO1 (avrPphD2). In addition, two genes putatively involved in CK biosynthesis, ptz (PSPSV_A0024) and ipt
(PSPSV_C0024), are also found in plasmids A and C, respectively.
Plasmids are very plastic and dynamic molecules, facilitating
the exchange of sequences among them and with the chromosome (Jackson et al., 2011; Ma et al., 2007; Sundin, 2007). This is
illustrated by plasmids pPsv48B and pPsv48C, which probably
arose from a duplication event because their replication gene,
repA, is 98.6% identical. However, they only share around 10 kb
with at least 80% identity, implying they participate in an active
exchange of DNA. Indeed, pPsv48B contains a complete type IVA
© 2012 THE AUTHORS
secretion system and a well-conserved origin of conjugational
transfer, suggesting that it might be conjugative; in addition,
pPsv48C also contains an origin of transfer and could be mobilizable by pPsv48B. Although, in principle, plasmids can be transferred to very distant organisms, they tend to propagate within a
specific host clade (Jackson et al., 2011). A phylogenetic analysis
of the repA gene from diverse PFP plasmids, and of other genes
carried by them, indicate that they are actively exchanging
DNA and moving amongst P. syringae complex pathovars (Ma
et al., 2007).
The role of native plasmids in the life cycle of P. savastanoi pv.
savastanoi has not been assessed in detail because of the difficulties of genetic manipulation and plasmid curing. Nevertheless,
in diverse strains of P. savastanoi pv. savastanoi and pv. nerii,
certain native plasmids are essential for the expression of wildtype symptoms, to reach high population densities in planta and
for competitive fitness, all of which are related to the presence in
these plasmids of genes for IAA and/or CK biosynthesis (Bardaji
et al., 2011; Iacobellis et al., 1994; Rodríguez-Moreno et al., 2008;
Silverstone et al., 1993). As these effects are very drastic, they
could conceivably have obscured more subtle roles in the pathogenic process of other plasmid-borne genes; however, the current
availability of genetically tractable strains and plasmid sequences
will facilitate a more detailed analysis of their potential role.
FUTURE PROSPECTS
Diseases of woody plants caused by pathovars of the P. syringae
complex are of major concern in fruit-producing areas and nurseries worldwide, and result in considerable economic losses (Kennelly et al., 2007). Undoubtedly, advances in the understanding of
diseases caused by P. syringae pathovars on herbaceous plants,
including the model plant Arabidopsis, are relevant to our understanding of fruit tree diseases, and vice versa. However, there is a
pressing need for appropriate research model systems facilitating
the identification and analysis of specific determinants involved in
bacterial interactions with trees and shrubs. A series of studies in
recent years have made significant advances in the biology,
ecology, genetics and genomics of P. savastanoi pv. savastanoi,
which has emerged as a powerful and uniquely valuable model for
the study of the molecular basis of disease production and tumour
formation in woody hosts. Analysis of the P. savastanoi–olive
interaction, and comparison with the model systems of herbaceous plants, can provide insights into the interactions of other
bacterial pathogens with woody hosts and address relevant unresolved questions, such as: What is the role of the T3SS system and
its effectors during infection of woody tissues? Are there differences in the metabolic network required by bacterial pathogens
for survival in woody hosts and herbaceous hosts? What virulence
determinants are singularly required for infection of woody
tissues? What factors are involved in tumour induction by
1007
P. savastanoi and what evolutionary advantage derives from producing them instead of necroses? To what degree do bacterial
consortia influence disease incidence and severity, and can they be
targeted for disease control? What traits govern host specificity in
P. savastanoi pathovars? Comparative genomics among P. syringae and P. savastanoi pathovars is generating workable hypotheses to critically investigate these questions. However, a great deal
of research remains to establish genome-wide approaches that
will allow the functional characterization of bacterial interactions
with woody hosts and to develop effective control strategies for
Pseudomonas diseases. Genetic dissection of the P. savastanoi pv.
savastanoi–olive pathosystem is technically very challenging and
requires the analysis of the always unfriendly woody plants but, as
Osgood wisely summarized in the delightful Billy Wilder film,
‘Well, nobody’s perfect’.
ACKNOWLEDGEMENTS
This work was supported by the Spanish Plan Nacional I+D+i grants
AGL2008-05311-C02-01, AGL2008-05311-C02-02, AGL2011-30343C02-01 and AGL2011-30343-C02-02 (Ministerio de Economía y Competitividad), co-financed by Fondo Europeo de Desarrollo Regional (FEDER),
and by grant P08-CVI-03475 from the Junta de Andalucía, Spain (http://
www.juntadeandalucia.es). IMM and IMA were supported by the Ramón
Areces Foundation (Spain) and by an FPU fellowship from the Ministerio
de Economía y Competitividad (Spain), respectively. We thank L.
Rodríguez-Moreno for confocal and electron microscopy images and T.
Osinga for help with the English language.
REFERENCES
Agrios, G.N. (2005) Plant Pathology. San Diego, CA: Elsevier Academic Press.
Baltrus, D.A., Nishimura, M.T., Romanchuk, A., Chang, J.H., Mukhtar, M.S.,
Cherkis, K., Roach, J., Grant, S.R., Jones, C.D. and Dangl, J.L. (2011) Dynamic
evolution of pathogenicity revealed by sequencing and comparative genomics of 19
Pseudomonas syringae isolates. PLoS Pathog. 7, e1002132.
Bardaji, L., Pérez-Martínez, I., Rodríguez-Moreno, L., Rodríguez-Palenzuela, P.,
Sundin, G.W., Ramos, C. and Murillo, J. (2011) Sequence and role in virulence of
the three plasmid complement of the model tumor-inducing bacterium Pseudomonas
savastanoi pv. savastanoi NCPPB 3335. PLoS ONE, 6, e25705.
Bochner, B.R., Gadzinski, P. and Panomitros, E. (2001) Phenotype microarrays for
high-throughput phenotypic testing and assay of gene function. Genome Res. 11,
1246–1255.
Bull, C.T., De Boer, S.H., Denny, T.P., Firrao, G., Fischer-Le Saux, M., Saddler, G.S.,
Scortichini, M., Stead, D.E. and Takikawa, Y. (2010) Comprehensive list of names
of plant pathogenic bacteria, 1980–2007. J. Plant Pathol. 92, 551–592.
Cayuela, J.A., Rada, M., Rios, J.J., Albi, T. and Guinda, A. (2006) Changes in phenolic
composition induced by Pseudomonas savastanoi pv. savastanoi infection in olive
tree: presence of large amounts of verbascoside in nodules of tuberculosis disease. J.
Agric. Food Chem. 54, 5363–5368.
Cimmino, A., Andolfi, A., Marchi, G., Surico, G. and Evidente, A. (2006) Phytohormone production by strains of Pantoea agglomerans from knots on olive plants
caused by Pseudomonas savastanoi pv. savastanoi. Phytopathol. Mediterr. 45, 247–
252.
CMI (1987) Pseudomonas syringae pv. savastanoi (E.F. Smith) Young, Dye & Wilkie. CMI
Distribution Maps of Plant Diseases, Map 135, 4th edn. Wallingford, Oxon.: CAB
International.
Comai, L. and Kosuge, T. (1980) Involvement of plasmid deoxyribonucleic acid in
indoleacetic acid synthesis in Pseudomonas savastanoi. J. Bacteriol. 143, 950–957.
Comai, L. and Kosuge, T. (1982) Cloning and characterization of iaaM, a virulence
determinant of Pseudomonas savastanoi. J. Bacteriol. 149, 40–46.
© 2012 THE AUTHORS
1008
C. RAMOS et al.
EPPO (2006) Pathogen-tested olive trees and rootstocks. EPPO Bull. 36, 77–83.
Ercolani, G.L. (1978) Pseudomonas savastanoi and other bacteria colonizing surface of
olive leaves in the field. J. Gen. Microbiol. 109, 245–257.
Evidente, A., Surico, G., Iacobellis, N.S. and Randazzo, G. (1986) a-N-acetyl-indole3-acetyl-e-L-lysine: a metabolite of indole-3-acetic-acid from Pseudomonas syringae
pv. savastanoi. Phytochemistry, 25, 125–128.
Gardan, L., Bollet, C., Abu Ghorrah, M., Grimont, F. and Grimont, P.A.D. (1992)
DNA relatedness among the pathovar strains of Pseudomonas syringae subsp. savastanoi Janse (1982) and proposal of Pseudomonas savastanoi sp. nov. Int. J. Syst.
Bacteriol. 42, 606–612.
Gardan, L., Shafik, H., Belouin, S., Broch, R., Grimont, F. and Grimont, P.A.D.
(1999) DNA relatedness among the pathovars of Pseudomonas syringae and description of Pseudomonas tremae sp. nov. and Pseudomonas cannabina sp. nov. (ex Sutic
and Dowson 1959). Int. J. Syst. Bacteriol. 49, 469–478.
Gibbon, M.J., Sesma, A., Canal, A., Wood, J.R., Hidalgo, E., Brown, J., Vivian, A.
and Murillo, J. (1999) Replication regions from plant-pathogenic Pseudomonas
syringae plasmids are similar to ColE2-related replicons. Microbiology, 145, 325–
334.
Glass, N.L. and Kosuge, T. (1988) Role of indoleacetic acid lysine synthetase in
regulation of indoleacetic-acid pool size and virulence of Pseudomonas syringae
subsp. savastanoi. J. Bacteriol. 170, 2367–2373.
Glickmann, E., Gardan, L., Jacquet, S., Hussain, S., Elasri, M., Petit, A. and
Dessaux, Y. (1998) Auxin production is a common feature of most pathovars of
Pseudomonas syringae. Mol. Plant–Microbe Interact. 11, 156–162.
Green, S., Studholme, D.J., Laue, B.E., Dorati, F., Lovell, H., Arnold, D., Cottrell,
J.E., Bridgett, S., Blaxter, M., Huitema, E., Thwaites, R., Sharp, P.M., Jackson,
R.W. and Kamoun, S. (2010) Comparative genome analysis provides insights into
the evolution and adaptation of Pseudomonas syringae pv. aesculi on Aesculus
hippocastanum. PLoS ONE, 5, e10224.
Hosni, T., Moretti, C., Devescovi, G., Suárez-Moreno, Z.R., Fatmi, M.B., Guarnaccia, C., Pongor, S., Onofri, A., Buonaurio, R. and Venturi, V. (2011) Sharing of
quorum-sensing signals and role of interspecies communities in a bacterial plant
disease. ISME J. 5, 1857–1870.
Iacobellis, N.S., Sisto, A., Surico, G., Evidente, A. and DiMaio, E. (1994) Pathogenicity of Pseudomonas syringae subsp. savastanoi mutants defective in phytohormone production. J. Phytopathol. 140, 238–248.
Iacobellis, N.S., Caponero, A. and Evidente, A. (1998) Characterization of Pseudomonas syringae ssp. savastanoi strains isolated from ash. Plant Pathol. 47, 73–83.
Inoue, Y. and Takikawa, Y. (2006) The hrpZ and hrpA genes are variable, and useful for
grouping Pseudomonas syringae bacteria. J. Gen. Plant Pathol. 72, 26–33.
Jackson, R.W., Mansfield, J.W., Ammouneh, H., Dutton, L.C., Wharton, B., OrtizBarredo, A., Arnold, D.L., Tsiamis, G., Sesma, A., Butcher, D., Boch, J., Kim, Y.J.,
Martin, G.B., Tegli, S., Murillo, J. and Vivian, A. (2002) Location and activity of
members of a family of virPphA homologues in pathovars of Pseudomonas syringae
and P. savastanoi. Mol. Plant Pathol. 3, 205–216.
Jackson, R.W., Vinatzer, B., Arnold, D.L., Dorus, S. and Murillo, J. (2011) The
influence of the accessory genome on bacterial pathogen evolution. Mob. Genet.
Elem. 1, 55–65.
Janse, J.D. (1982) Pseudomonas syringae subsp. savastanoi (ex Smith) subsp. nov.,
nom. rev., the bacterium causing excrescences on Oleaceae and Nerium oleander L.
Int. J. Syst. Bacteriol. 32, 166–169.
Kennelly, M.M., Cazorla, F.M., de Vicente, A., Ramos, C. and Sundin, G.W. (2007)
Pseudomonas syringae diseases of fruit trees. Progress toward understanding and
control. Plant Dis. 91, 4–17.
Krid, S., Rhouma, A., Quesada, J.M., Penyalver, R. and Gargouri, A. (2009) Delineation of Pseudomonas savastanoi pv. savastanoi strains isolated in Tunisia by
random-amplified polymorphic DNA analysis. J. Appl. Microbiol. 106, 886–894.
Lelliott, R.A. and Stead, D.E. (1987) Methods for the Diagnosis of Bacterial Diseases
of Plants. Oxford: Blackwell Scientific Publications.
Lindeberg, M., Stavrinides, J., Chang, J.H., Alfano, J.R., Collmer, A., Dangl, J.L.,
Greenberg, J.T., Mansfield, J.W. and Guttman, D.S. (2005) Proposed guidelines for
a unified nomenclature and phylogenetic analysis of type III Hop effector proteins in
the plant pathogen. Pseudomonas syringae. Mol Plant Microbe Interact. 18, 275–
282.
Lindeberg, M., Myers, C.R., Collmer, A. and Schneider, D.J. (2008) Roadmap to new
virulence determinants in Pseudomonas syringae: insights from comparative genomics and genome organization. Mol. Plant–Microbe Interact. 21, 685–700.
Lovell, H.C., Jackson, R.W., Mansfield, J.W., Godfrey, S.A.C., Hancock, J.T.,
Desikan, R. and Arnold, D.L. (2011) In planta conditions induce genomic changes
in Pseudomonas syringae pv. phaseolicola. Mol. Plant Pathol. 12, 167–176.
Ma, Z., Smith, J.J., Zhao, Y., Jackson, R.W., Arnold, D.L., Murillo, J. and Sundin,
G.W. (2007) Phylogenetic analysis of the pPT23A plasmid family of Pseudomonas
syringae. Appl. Environ. Microbiol. 73, 1287–1295.
Macdonald, E.M.S., Powell, G.K., Regier, D.A., Glass, N.L., Roberto, F., Kosuge, T.
and Morris, R.O. (1986) Secretion of zeatin, ribosylzeatin, and ribosyl-1′′methylzeatin by Pseudomonas savastanoi: plasmid-coded cytokinin biosynthesis.
Plant Physiol. 82, 742–747.
Mansfield, J.W. (2009) From bacterial avirulence genes to effector functions via the hrp
delivery system: an overview of 25 years of progress in our understanding of plant
innate immunity. Mol. Plant Pathol. 10, 721–734.
Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow,
M.A.X., Verdier, V., Beer, S.V., Machado, M.A., Toth, I.A.N., Salmond, G. and
Foster, G. (2012) Top 10 plant pathogenic bacteria in molecular plant pathology.
Mol. Plant Pathol. 13, 614–629.
Marchi, G., Viti, C., Giovannetti, L. and Surico, G. (2005) Spread of levan-positive
populations of Pseudomonas savastanoi pv. savastanoi, the causal agent of olive
knot, in central Italy. Eur. J. Plant Pathol. 112, 101–112.
Marchi, G., Sisto, A., Cimmino, A., Andolfi, A., Cipriani, M.G., Evidente, A. and
Surico, G. (2006) Interaction between Pseudomonas savastanoi pv. savastanoi and
Pantoea agglomerans in olive knots. Plant Pathol. 55, 614–624.
Marchi, G., Mori, B., Pollacci, P., Mencuccini, M. and Surico, G. (2009) Systemic
spread of Pseudomonas savastanoi pv. savastanoi in olive explants. Plant Pathol. 58,
152–158.
Matas, I.M., Pérez-Martínez, I., Quesada, J.M., Rodriguez-Hervá, J.J., Penyalver,
R. and Ramos, C. (2009) Pseudomonas savastanoi pv. savastanoi contains two iaaL
paralogs, one of which exhibits a variable number of a trinucleotide (TAC) tandem
repeat. Appl. Environ. Microbiol. 75, 1030–1035.
Mithani, A., Hein, J. and Preston, G.M. (2011) Comparative analysis of metabolic
networks provides insight into the evolution of plant pathogenic and nonpathogenic
lifestyles in Pseudomonas. Mol. Biol. Evol. 28, 483–499.
Moretti, C., Hosni, T., Vandemeulebroecke, K., Brady, C., De Vos, P., Buonaurio, R.
and Cleenwerck, I. (2011) Erwinia oleae sp. nov., isolated from olive knots caused by
Pseudomonas savastanoi pv. savastanoi. Int. J. Syst. Evol. Microbiol. 61, 2745–2752.
Murillo, J. and Keen, N.T. (1994) Two native plasmids of Pseudomonas syringae
pathovar tomato strain PT23 share a large amount of repeated DNA, including
replication sequences. Mol. Microbiol. 12, 941–950.
Nojiri, H., Maeda, K., Sekiguchi, H., Urata, M., Shintani, M., Yoshida, T., Habe, H.
and Omori, T. (2002) Organization and transcriptional characterization of catechol
degradation genes involved in carbazole degradation by Pseudomonas resinovorans
strain CA10. Biosci. Biotechnol. Biochem. 66, 897–901.
O’Brien, H.E., Thakur, S. and Guttman, D.S. (2011) Evolution of plant pathogenesis
in Pseudomonas syringae: a genomics perspective. Annu. Rev. Phytopathol. 49,
269–289.
Ouzari, H., Khsairi, A., Raddadi, N., Jaoua, L., Hassen, A., Zarrouk, M., Daffonchio,
D. and Boudabous, A. (2008) Diversity of auxin-producing bacteria associated to
Pseudomonas savastanoi-induced olive knots. J. Basic Microbiol. 48, 370–377.
Palm, C.J., Gaffney, T. and Kosuge, T. (1989) Cotranscription of genes encoding
indoleacetic-acid production in Pseudomonas syringae subsp. savastanoi. J. Bacteriol. 171, 1002–1009.
Parkinson, N., Bryant, R., Bew, J. and Elphinstone, J. (2011) Rapid phylogenetic
identification of members of the Pseudomonas syringae species complex using the
rpoD locus. Plant Pathol. 60, 338–344.
Penyalver, R., García, A., Ferrer, A., Bertolini, E., Quesada, J.M., Salcedo, C.I.,
Piquer, J., Pérez-Panadés, J., Carbonell, E.A., del Río, C., Caballero, J.M. and
López, M.M. (2006) Factors affecting Pseudomonas savastanoi pv. savastanoi plant
inoculations and their use for evaluation of olive cultivar susceptibility. Phytopathology, 96, 313–319.
Pérez-Martínez, I., Rodríguez-Moreno, L., Matas, I.M. and Ramos, C. (2007) Strain
selection and improvement of gene transfer for genetic manipulation of Pseudomonas savastanoi isolated from olive knots. Res. Microbiol. 158, 60–69.
Pérez-Martínez, I., Zhao, Y., Murillo, J., Sundin, G.W. and Ramos, C. (2008) Global
genomic analysis of Pseudomonas savastanoi pv. savastanoi plasmids. J. Bacteriol.
190, 625–635.
Pérez-Martínez, I., Rodríguez-Moreno, L., Lambertsen, L., Matas, I.M., Murillo, J.,
Tegli, S., Jiménez, A.J. and Ramos, C. (2010) Fate of a Pseudomonas savastanoi pv.
savastanoi type III secretion system mutant in olive plants (Olea europaea L.). Appl.
Environ. Microbiol. 76, 3611–3619.
Quesada, J.M., García, A., Bertolini, E., López, M.M. and Penyalver, R. (2007)
Recovery of Pseudomonas savastanoi pv. savastanoi from symptomless shoots of
naturally infected olive trees. Int. Microbiol. 10, 77–84.
© 2012 THE AUTHORS
Quesada, J.M., Pérez-Martínez, I., Ramos, C., López, M.M. and Penyalver, R.
(2008) IS53: an insertion element for molecular typing of Pseudomonas savastanoi
pv. savastanoi. Res. Microbiol. 159, 207–215.
Quesada, J.M., Penyalver, R., Pérez-Panadés, J., Salcedo, C.I., Carbonell, E.A. and
López, M.M. (2010a) Dissemination of Pseudomonas savastanoi pv. savastanoi
populations and subsequent appearance of olive knot disease. Plant Pathol. 59,
262–269.
Quesada, J.M., Penyalver, R., Pérez-Panadés, J., Salcedo, C.I., Carbonell, E.A. and
López, M.M. (2010b) Comparison of chemical treatments for reducing epiphytic
Pseudomonas savastanoi pv. savastanoi populations and for improving subsequent
control of olive knot disease. Crop Prot. 29, 1413–1420.
Rico, A. and Preston, G.M. (2008) Pseudomonas syringae pv. tomato DC3000 uses
constitutive and apoplast-induced nutrient assimilation pathways to catabolize nutrients that are abundant in the tomato apoplast. Mol. Plant–Microbe Interact. 21,
269–282.
Rico, A., McCraw, S.L. and Preston, G.M. (2011) The metabolic interface between
Pseudomonas syringae and plant cells. Curr. Opin. Microbiol. 14, 31–38.
Rodríguez-Moreno, L., Barceló-Muñoz, A. and Ramos, C. (2008) In vitro analysis of
the interaction of Pseudomonas savastanoi pvs. savastanoi and nerii with micropropagated olive plants. Phytopathology, 98, 815–822.
Rodríguez-Moreno, L., Jiménez, A.J. and Ramos, C. (2009) Endopathogenic lifestyle
of Pseudomonas savastanoi pv. savastanoi in olive knots. Microb. Biotechnol. 2,
476–488.
Rodríguez-Palenzuela, P., Matas, I., Murillo, J., López-Solanilla, E., Bardaji, L.,
Pérez-Martínez, I., Rodríguez-Moskera, M.E., Penyalver, R., López, M.M.,
Quesada, J.M., Biehl, B.S., Perna, N.T., Glasner, J.D., Cabot, E.L., Neeno-Eckwall,
E. and Ramos, C. (2010) Annotation and overview of the Pseudomonas savastanoi
pv. savastanoi NCPPB 3335 draft genome reveals the virulence gene complement of
a tumour-inducing pathogen of woody hosts. Environ. Microbiol. 12, 1604–1620.
Rojas, A.M., García de los Rios, J.E., Saux, M.F.-L., Jimenez, P., Reche, P., Bonneau,
S., Sutra, L., Mathieu-Daudé, F. and McClelland, M. (2004) Erwinia toletana sp.
nov., associated with Pseudomonas savastanoi-induced tree knots. Int. J. Syst. Evol.
Microbiol. 54, 2217–2222.
Sarkar, S.F. and Guttman, D.S. (2004) Evolution of the core genome of Pseudomonas
syringae, a highly clonal, endemic plant pathogen. Appl. Environ. Microbiol. 70,
1999–2012.
Schneider, D.J. and Collmer, A. (2010) Studying plant–pathogen interactions in the
genomics era: beyond molecular Koch’s postulates to systems biology. Annu. Rev.
Phytopathol. 48, 457–479.
Schroth, M.N., Osgood, J.W. and Miller, T.D. (1973) Quantitative assessment of the
effect of the olive knot disease on olive yield and quality. Phytopathology, 63,
1064–1065.
Scortichini, M., Rossi, M.P. and Salerno, M. (2004) Relationship of genetic structure
of Pseudomonas savastanoi pv. savastanoi populations from Italian olive trees and
patterns of host genetic diversity. Plant Pathol. 53, 491–497.
Silverstone, S.E., Gilchrist, D.G., Bostock, R.M. and Kosuge, T. (1993) The 73-kb
pIAA plasmid increases competitive fitness of Pseudomonas syringae subspecies
savastanoi in oleander. Can. J. Microbiol. 39, 659–664.
Sisto, A., Cipriani, M.G. and Morea, M. (2004) Knot formation caused by Pseudomonas syringae subsp. savastanoi on olive plants is hrp-dependent. Phytopathology, 94, 484–489.
Sisto, A., Cipriani, M.G., Tegli, S., Cerboneschi, M., Stea, G. and Santilli, E. (2007)
Genetic characterization by fluorescent AFLP of Pseudomonas savastanoi pv. savastanoi strains isolated from different host species. Plant Pathol. 56, 366–372.
Smith, E.F. (1920) Bacterial Diseases of Plants. Philadelphia, PA: W.B. Saunders
Company.
Studholme, D.J. (2011) Application of high-throughput genome sequencing to intrapathovar variation in Pseudomonas syringae. Mol. Plant Pathol. 12, 829–838.
Sundin, G.W. (2007) Genomic insights into the contribution of phytopathogenic bacterial plasmids to the evolutionary history of their hosts. Annu. Rev. Phytopathol. 45,
129–151.
Surico, G. (1977) Osservazioni istologiche sui tubercoli della ‘rogna’ dell’Olivo. Phytopathol. Mediterr. 16, 109–125.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. (2011)
MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.
1009
Temsah, M., Hanna, L. and Saad, A.T. (2008) Anatomical pathogenesis of
Pseudomonas savastanoi on olive and genesis of knots. J. Plant Pathol. 90, 225–
232.
Teviotdale, B.L. and Krueger, W.H. (2004) Effects of timing of copper sprays, defoliation, rainfall, and inoculum concentration on incidence of olive knot disease. Plant
Dis. 88, 131–135.
Urata, M., Miyakoshi, M., Kai, S., Maeda, K., Habe, H., Omori, T., Yamane, H. and
Nojiri, H. (2004) Transcriptional regulation of the ant operon, encoding
two-component anthranilate 1,2-dioxygenase, on the carbazole-degradative
plasmid pCAR1 of Pseudomonas resinovorans strain CA10. J. Bacteriol. 186, 6815–
6823.
Weingart, H., Völksch, B. and Ullrich, M.S. (1999) Comparison of ethylene production
by Pseudomonas syringae and Ralstonia solanacearum. Phytopathology, 89, 360–
365.
Young, J.M. (2004) Olive knot and its pathogens. Australas. Plant Pathol. 33, 33–39.
Young, J.M. (2010) Taxonomy of Pseudomonas syringae. J. Plant Pathol. 92, S5–S14.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the online
version of this article:
Fig. S1 Evolutionary relationships of Pseudomonas savastanoi
pv. savastanoi and selected P. syringae pathovars. The tree was
constructed by multilocus sequence analysis using a concatenated
dataset (exactly 12 000 nucleotides) of acnB, fruK, gapA, gltA,
gyrB, pgi, recA and rpoD genes. Phylogenetic groups 1, 2, 3 and 4
(Sarkar and Guttman, 2004; Studholme, 2011) correspond to
genomospecies (Gsp) 3, 1, 2 and 4 (Gardan et al., 1999), respectively. Sequence alignment using Muscle; determination of the
optimal nucleotide substitution model and phylogenetic tree construction were performed using MEGA5 (Tamura et al., 2011); all
positions containing gaps and missing data were eliminated using
the option of complete deletion. Bootstrap values (1000 repetitions) are shown on the branches. Similar or identical topologies
were obtained by maximum likelihood. The scale bar represents
nucleotide substitutions per site.
Table S1 Primers used for the detection of Pseudomonas savastanoi pv. savastanoi.
Table S2 Comparison of the deduced products of iaaM-1
(PSA3335_1475) and iaaH-1 (PSA3335_1476), from Pseudomonas savastanoi pv. savastanoi NCPPB 3335, with their homologues in selected organismsa.
Table S3 Accession numbers and coordinates of the nucleotide
sequences used for the construction of the neighbour-joining tree
shown in Fig. 2.
Please note: Wiley-Blackwell are not responsible for the content or
functionality of any supporting materials supplied by the authors.
Any queries (other than missing material) should be directed to
the corresponding author for the article.
© 2012 THE AUTHORS
MPMI Vol. 27, No. 5, 2014, pp. 424–436. http://dx.doi.org/10.1094/MPMI-07-13-0206-R
e -Xtra*
Translocation and Functional Analysis
of Pseudomonas savastanoi pv. savastanoi NCPPB 3335
Type III Secretion System Effectors Reveals Two Novel
Effector Families of the Pseudomonas syringae Complex
Isabel M. Matas,1 M. Pilar Castañeda-Ojeda,1 Isabel M. Aragón,1 María Antúnez-Lamas,2,3
Jesús Murillo,4 Pablo Rodríguez-Palenzuela,2,3 Emilia López-Solanilla,2,3 and Cayo Ramos1
1
Instituto de Hortofruticultura Subtropical y Mediterránea “La Mayora”, Universidad de Málaga-Consejo Superior de
Investigaciones Científicas (IHSM-UMA-CSIC), Área de Genética, Facultad de Ciencias, Campus Teatinos s/n, E-29010
Málaga, Spain; 2Centro de Biotecnología y Genómica de Plantas (CBGP), Universidad Politécnica de Madrid-Instituto
Nacional de Investigación y Tecnología Agraria y Alimentaria, Parque Científico y Tecnológico de la UPM, Campus de
Montegancedo, 28223 Pozuelo de Alarcón, Madrid; 3Departamento de Biotecnología. Escuela Técnica Superior de
Ingenieros Agrónomos, UPM. Avda, Complutense S/N, 28040, Madrid; 4Departamento de Producción Agraria, ETS
Ingenieros Agrónomos, Universidad Pública de Navarra, 31006 Pamplona, Spain
Submitted 26 July 2013. Accepted 28 November 2013.
Pseudomonas savastanoi pv. savastanoi NCPPB 3335 causes
olive knot disease and is a model pathogen for exploring
bacterial infection of woody hosts. The type III secretion
system (T3SS) effector repertoire of this strain includes 31
effector candidates plus two novel candidates identified in
this study which have not been reported to translocate into
plant cells. In this work, we demonstrate the delivery of
seven NCPPB 3335 effectors into Nicotiana tabacum leaves,
including three proteins from two novel families of the P.
syringae complex effector super-repertoire (HopBK and
HopBL), one of which comprises two proteins (HopBL1
and HopBL2) that harbor a SUMO protease domain.
When delivered by P. fluorescens heterologously expressing
a P. syringae T3SS, all seven effectors were found to suppress the production of defense-associated reactive oxygen
species. Moreover, six of these effectors, including the truncated versions of HopAA1 and HopAZ1 encoded by NCPPB
3335, suppressed callose deposition. The expression of
HopAZ1 and HopBL1 by functionally effectorless P. syringae pv. tomato DC3000D28E inhibited the hypersensitive
response in tobacco and, additionally, expression of HopBL2
by this strain significantly increased its competitiveness in
N. benthamiana. DNA sequences encoding HopBL1 and
HopBL2 were uniquely detected in a collection of 31 P.
savastanoi pv. savastanoi strains and other P. syringae
strains isolated from woody hosts, suggesting a relevant
role of these two effectors in bacterial interactions with
olive and other woody plants.
Current address for I. M. Matas: Instituto de Agrobiotecnología, CSICUPNA-Gobierno de Navarra, Universidad Pública de Navarra, Campus
Arrosadía, 31192 Mutilva, Spain.
Corresponding author: C. Ramos; Telephone: +34-95213 1955; Fax: +3495213 2001; E-mail: crr@uma.es
* The e-Xtra logo stands for “electronic extra” and indicates that six
supplementary tables and one supplementary figure are published online.
© 2014 The American Phytopathological Society
424 / Molecular Plant-Microbe Interactions
Type III secretion system (T3SS) effectors (T3E) delivered
by bacterial pathogens are key elements for establishing infection. In bacterial plant pathogens, these proteins primarily interfere with the plant immune system at two main defense
layers: pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI)
(Chisholm et al. 2006; Jones and Dangl 2006). Because there
is an overlap between these two layers of immunity, T3E
may target PTI, ETI, or both (Boller and Felix 2009; Katagiri
and Tsuda 2010). Examples include the Pseudomonas syringae effector AvrPtoB, which has been demonstrated to suppress both PTI and ETI (de Torres et al. 2006; Lin et al.
2006). The production of reactive oxygen species (ROS) is
one of the earliest cellular responses associated with plant
immunity (Doke 1983). ROS can directly strengthen the host
cell wall (Bradley et al. 1992; Huckelhoven 2007) and are
important signals that mediate defense gene activation (Levine
et al. 1994; Torres and Dangl 2005). Moreover, this oxidative
burst is associated with the hypersensitive response (HR), a
localized response at the site of pathogen attack characterized by the induction of programmed cell death (Mur et al.
2008) that limits pathogen spread.
The growing availability of bacterial genomes and the evolution of bioinformatics tools have revolutionized the discovery of novel plant pathogen effectors. Genome-wide searches
for motifs shared by known T3E have recently revealed a repertoire of these proteins in plant bacterial pathogens, including
P. syringae and related pathogens (Collmer et al. 2009;
Lindeberg 2012; Lindeberg et al. 2008). The P. syringae complex, which encompasses up to 10 Pseudomonas spp. and 60
P. syringae pathovars (Young 2010), has become a model for a
systems-level exploration of effector repertoires and their functions in biotrophic pathogenesis. T3E proteins of P. syringae and
related plant pathogens are generically known as Hrp outer
proteins (hops) (Lindeberg et al. 2005). Over 60 effector families, whose expression is transcriptionally activated by the alternative σ factor HrpL (Xiao and Hutcheson 1994), are currently
defined in the P. syringae pangenome. Currently, three P. syringae strains—P. syringae pv. tomato DC3000 (Alfano and
Collmer 1996), P. syringae pv. phaseolicola 1448A (Jackson et
al. 1999) and P. syringae pv. syringae B728a (Hirano and Upper
2000)—prevail as model systems for identifying and functionally analyzing protein effectors. Each strain provides a different perspective on the complex interactions of this pathogen
with herbaceous plants. Comparisons of T3E gene repertoires
within a phylogenetic context has elucidated the molecular
basis of host specialization and host range evolution in fully or
partially sequenced P. syringae pathovars (Baltrus et al. 2011,
2012; Lindeberg 2012; Lindeberg et al. 2012). However, a
molecular mechanism governing P. syringae pathovar adaptation to woody hosts remains undefined.
P. savastanoi pv. savastanoi NCPPB 3335 causes olive knot
disease and is a model bacterium to study the molecular basis
of disease production and tumor formation in woody hosts
(Ramos et al. 2012). As previously established for several P.
syringae strains (Cunnac et al. 2009; Mansfield 2009), P.
savastanoi pv. savastanoi NCPPB 3335 T3SS is required for
infection establishment and knot formation on olive plants
(Matas et al. 2012; Pérez-Martínez et al. 2010). Additionally,
bioinformatics analysis of the draft genome sequence of
NCPPB 3335 identified 30 putative T3E in this pathogen, 19
of which were more than 65% similar to previously described
effectors based on their amino acid identity (RodríguezPalenzuela et al. 2010). Furthermore, sequencing of the threeplasmid complement of this strain revealed that two of these
T3E genes, hopAF1 and hopAO1, are encoded in plasmids
(Bardaji et al. 2011). A later revision of this genome sequence
discarded three of the previously identified nonhomologous
T3SS and identified four new candidate effectors in NCPPB
3335: AvrPto1, HopAT1, HopAZ1, and AvrRpm2 (Ramos et
al. 2012) (Hop Database). Among these 31 T3E candidates, only
two are homologs of P. syringae T3E with a previously demonstrated enzymatic function (i.e., HopAO1, a protein tyrosine
phosphatase [Underwood et al. 2007], and HopAB1, an E3
ubiquitin ligase [Janjusevic et al. 2006]). Moreover, translocation of effector proteins into plant cells through the T3SS has
not been reported to date for P. savastanoi pv. savastanoi or
any other P. syringae pathovar of woody hosts.
In this work, we searched for additional P. savastanoi pv.
savastanoi NCPPB 3335 T3E candidates on the basis of proteindomain similarity to known plant-pathogen effectors. A group
of selected candidates was further analyzed in relation to their
translocation into plant cells and their inhibition of plant
defense responses. In this study, we demonstrated the translocation of seven Hop-Cya fusions through the P. savastanoi pv.
savastanoi T3SS, including three novel T3E of the P. syringae
complex, which belong to two new effector families; that is,
HopBK (HopBK1) and HopBL (HopBL1 and HopBL2).
RESULTS
Bioinformatics prediction of novel T3E
in the P. savastanoi pv. savastanoi NCPPB 3335 genome.
We started with the set of candidate effector genes identified
previously in the P. savastanoi pv. savastanoi NCPPB 3335
genome (Rodríguez-Palenzuela et al. 2010) and later updated
(Ramos et al. 2012). In addition, we searched specifically for
NCPPB 3335 proteins with pfam domains (The Pfam Database)
already found in known T3E (details below and in Supplementary Table S1). Two novel candidate T3E (AER-0000509 and
Table 1. Putative type III effectors identified in the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 genomea
ID-ASAP
AER-0005350
AER-0005727
AER-0005728
AER-0002657
AER-0000274
AER-0004725
AER-0000741
AER-0000968
AER-0003643
AER-0001776
AER-0000610
AER-0005024
AER-0005726
AER-0000625
AER-0001017
AER-0000696
AER-0000509
AER-0003844
AER-0004681
AER-0000629
AER-0000168
AER-0005351
AER-0004680
AER-0004685
AER-0003015
AER-0003833
AER-0000344
AER-0000393
AER-0001113
AER-0001936
AER-0002597
AER-0002714
AER-0003934
Locus tag
Pfamb
Name
Reference
Homologc
Reference
PSA3335_1360
PSA3335_5082
PSA3335_5091
PSA3335_5065
na
PSA3335_2333
PSA3335_4315
PSA3335_1469
PSA3335_1477
PSA3335_2927
PSA3335_0875
PSA3335_4684
PSA3335_5084
PSA3335_5031
PSA3335_1783
PSA3335_2068
PSA3335_0157
PSA3335_4544
PSA3335_4805
PSA3335_0852
PSA3335_4509
PSA3335_1358
PSA3335_4804
PSA3335_4809
PSA3335_2327
PSA3335_5066
PSA3335_5061
PSA3335_1416
PSA3335_0894
PSA3335_3242
PSA3335_0106
PSA3335_2804
PSA3335_1247
PF11725
PF11592
None
None
None
PF09046
PF15457
None
None
PF00150
PF14566
None
None
PF10791
None
PF13974
PF02902
PF02902
None
None
PF00226
None
PF01156
None
PF13485
None
None
None
PF07090
None
PF15184
PF01565
None
avrE1
avrPto1
avrRpm2
HopA1
HopAA1
HopAB1
HopAE1
HopAF1
HopAF1-2#
HopAH2
HopAO1#
HopAS1
HopAT1′
HopAU1
HopAZ1
HopBK1
HopBL1
HopBL2
HopD1
HopG1
HopI1
HopM1′
HopQ1
HopR1
HopV1
HopW1′
HP0344
HP0393
HP1113
HP1936
HP2597
HP2714
HP3934
Ramos et al. 2012
Ramos et al. 2012
Ramos et al. 2012
Rodríguez-Palenzuela et al. 2010
Ramos et al. 2012
Ramos et al. 2012
Ramos et al. 2012
Ramos et al. 2012
This study
This study
+
+
nd
+
–
+
+
+
+
+
+
+
+^
+
nd
nd
nd
nd
+
+
+
+
+
+
+
+
nd
nd
nd
nd
nd
nd
nd
Badel et al. 2006, Vinatzer et al. 2006
Vinatzer et al. 2006
…
Chang et al. 2005
Chang et al. 2005
Chang et al. 2005, Vinatzer et al. 2006
Vinatzer et al. 2006
Chang et al. 2005
Chang et al. 2005
Zumaquero et al. 2010
Chang et al. 2005
Vencato et al. 2006
Chang et al. 2005
Vencato et al. 2006
…
…
…
…
Chang et al. 2005
Chang et al. 2005
Chang et al. 2005; Vinatzer et al. 2006
Badel et al. 2003; Vinatzer et al. 2006
Chang et al. 2005
Chang et al. 2005; Schechter et al. 2006
Schechter et al. 2004
Chang et al. 2005; Zumaquero et al. 2010
…
…
…
…
…
…
…
Bold indicates effectors for which translocation was analyzed in this study; # = plasmid-encoded genes, ′ = putative pseudogenes, nd = not determined, na =
not available, and ^ = translocation tested for HopAT1 of P. syringae pv. tomato DC3000 but not for HopAT1′.
b
Accession number for the corresponding protein families at the pfam database.
c
Homolog translocated in P. syringae.
a
Vol. 27, No. 5, 2014 / 425
AER-0003844) were found, both containing the domain
PF02902. This domain, which belongs to the Ulp1 protease
family with SUMO protease activity, has been associated with
several known effector proteins in pathogenic bacteria of the
genus Xanthomonas, such as XopD (Kay and Bonas 2009).
The final set of 33 candidate P. savastanoi pv. savastanoi
NCPPB 3335 effectors is listed in Table 1, which includes
these two novel putative T3E. Based on the translocation, functional, and phylogenetic analysis of these proteins shown below,
and taking into account the guidelines for a unified nomenclature of T3E in the plant pathogen P. syringae proposed by
Lindenberg and associates (2005), hereafter these T3E are
called HopBL1 (AER-0000509) and HopBL2 (AER-0003844)
(Table 1; Supplementary Table S2).
Translocation assay of T3E candidates revealed
novel effectors in P. savastanoi.
Of the 33 candidate P. savastanoi pv. savastanoi NCPPB
3335 T3E, 12 were selected for further analysis (Table 1). These
candidates included the three proteins with a P. syringae homolog for which plant-cell translocation has not been demonstrated
to date (AvrRpm2, HopAA1, and HopAZ1). Additionally, we
selected seven of the 10 hypothetical T3E identified in the genome of P. savastanoi pv. savastanoi NCPPB 3335 that are not
present in P. syringae pv. phaseolicola 1448A, its closest relative that infects herbaceous plants for which there is a closed
genome. The selection also included AER-0003934, which
harbors a homolog in the genome of 1448A, and HopA1
(AER-0002657). With the exception of the hopA1 gene,
Table 2. Occurrence of consensus Hrp-box sequences upstream of type III secretion system effector genes from Pseudomonas savastanoi pv. savastanoi
NCPPB 3335
Gene name
Consensusb
avrPto1
avrRpm2
hopAA1
hopAZ1
hopBK1
hopBL1
hopBL2
HP0344
HP0393
HP1113
HP2714
HP3934
hopA1
a
b
Hrp-box positiona
…
–69 to –39
–474 to –444
–193 to –163
–124 to –94
–218 to –197
–244 to –214
–412 to –383
–184 to –155
–56 to –26
–84 to –55
–82 to –53
–483 to –451
…
Hrp-box sequence
BGGAACYHNNNNNNNNNNNNNNNCCACNHAG
TGGAACCGACCTGCCCCCGATGACCACTCAG
TGGAACCAAATATGTAGTTATGGTCACTCAC
TGGAACCGTCAACGGATCCGGGACCACACAG
TGGAACCTCTCCTCAATGAGTTGCCACTCAC
AGGTGCGCCGGGGTTATGACGAGGCCACGGTG
TGGAACCTAATCGCTGGAGAGGCCTACTAAT
AGGAATTTAAGCTCGATAGTTGCCACAGTC
GGCAAGGCGCCTGCACCTAGAGCCACAACG
AGGAACCCGGCCCACGCAAGTGGACACCCGG
TGAAACCCTTTTGATCGACAACCCACGCCG
AGGACCCGGTAGTTTTCGCAATCCGCGACC
TGGAACCTGTTCAATGTGCTGTCGGCACCCGC
na
Coordinates are with respect to the annotated start codon of the coding sequence.
Consensus Hrp box sequence (Fouts et al. 2002). Conserved sequences are highlighted in bold; na = not available in the draft genome sequence of P.
savastanoi pv. savastanoi NCPPB 3335.
Fig. 1. Translocation assay of candidate Pseudomonas savastanoi pv. savastanoi NCPPB 3335 type III secretion system (T3SS) effectors (T3E) in Nicotiana
tabacum var. Newdel plants by the NCPPB 3335 T3SS. Calmodulin- and Cya-dependent production of cAMP was used to measure the translocation of T3ECya fusions into plant cells. N. tabacum plants were inoculated with P. savastanoi pv. savastanoi NCPPB 3335 or NCPPB 3335-T3 (T3SS mutant) expressing the indicated Hop-Cya fusions from pCPP3234 derivatives. T3E are denoted by their corresponding names. Values represent the mean and standard error
for samples obtained in triplicate; similar results were obtained in multiple experiments. Asterisks indicate significant differences (P = 0.05) between the
cAMP levels obtained for the NCPPB 3335 and NCPPB 3335-T3 strains.
whose upstream region is not available in the draft genome
sequence of P. savastanoi pv. savastanoi NCPPB 3335
(Rodríguez-Palenzuela et al. 2010), an identifiable Hrp box
(Fouts et al. 2002) was found in the 500 nucleotides upstream
of the start codon of the other 11 T3E candidates (Table 2).
To determine whether the selected candidate effectors were
T3SS substrates that could translocate into plant cells, we constructed pCPP3234 derivatives (Supplementary Table S3) expressing fusions of Bordetella pertussis adenylate cyclase
(Cya) to the C terminus of full-length T3E. This system, which
is based in cyclic AMP (cAMP) production exclusively in the
presence of eukaryotic calmodulin, has been widely used for
analyzing the translocation of P. syringae T3E (Casper-Lindley
et al. 2002; Schechter et al. 2004; Sory and Cornelis 1994).
Nicotiana tabacum leaves were infiltrated with either P.
savastanoi pv. savastanoi NCPPB 3335 or the strain NCPPB
3335-T3, a T3SS mutant derived from wild-type NCPPB 3335
(Pérez-Martínez et al. 2010), expressing each of the 12 constructed Cya fusions. Significant differences in cAMP production between the wild-type strain and the T3SS mutant strain
were observed in seven of the 12 candidate T3E tested—
AvrRpm2, HopA1, HopAA1, HopAZ1, HopBK1 (the first described member of a novel effector family of the P. syringae
complex), HopBL1, and HopBL2 (Fig. 1)—indicative of their
translocation through the P. savastanoi pv. savastanoi T3SS.
Notably, HopA1 was translocated by P. savastanoi pv. savastanoi in tobacco (Fig. 1), as expected because its homolog in P.
syringae pv. tomato DC3000 has been shown to be translocated into Arabidopsis leaves (Chang et al. 2005).
HrpL-dependent expression of novel P. savastanoi T3E.
To unveil the HrpL-dependent expression of the three hypothetical proteins identified here as novel T3E of the P. syringae
complex (HopBK1, HopBL1, and HopBL2), a ∆hrpL P. savastanoi pv. savastanoi NCPPB 3335 mutant was constructed. As
previously described for the P. savastanoi pv. savastanoi
NCPPB 3335-T3 (Pérez-Martínez et al. 2010), the NCPPB
3335 ∆hrpL mutant was unable to elicit an HR in N. tabacum
plants (Fig. 2A) or form knots in lignified olive plants (Fig. 2B).
The expression of the hopBK1, hopBL1, and hopBL2 genes
was analyzed using quantitative reverse-transcription polymerase chain reaction (qRT-PCR) with both the wild type and the
NCPPB 3335 ∆hrpL mutant. In addition, the expression of the
avRPto1 gene and the iaaM gene (encoding tryptophan
monooxygenase, involved in the biosynthesis of indoleacetic
acid) was also tested as positive and negative controls, respectively. Under noninducing conditions (cells grown in King’s B
[KB] medium), the expression of the hopBK1, hopBL1, and
hopBL2 genes was comparable in the ∆hrpL mutant and the
wild-type strain (data not shown). However, 6 h after the transfer of bacterial cells to Hrp-inducing medium, the expression
of all three genes and the expression of the avrPto1 gene decreased (0.002- to 0.4-fold) in the ∆hrpL mutant compared
with the wild type, demonstrating an expression dependency
on HrpL. As expected for the negative control, no reduction in
the expression of the iaaM gene was observed under the same
conditions (Fig. 2C).
Distribution of HopBK1, HopBL1, and HopBL2 T3E
among P. savastanoi pv. savastanoi and related strains.
To study the conservation of the three new P. savastanoi pv.
savastanoi NCPPB 3335 effectors among strains from the P.
syringae complex, their protein sequences were used as queries to perform BLASTp searches against the nonredundant
protein sequence database. The results revealed that HopBL1
and HopBL2 are similar to XopD of Xanthomonas spp. and infrequent within the P. syringae complex. Conversely, HopBK1
is present in P. syringae pathovars tomato, actinidae, aceris,
oryzae, syringae, and lachrymans (Fig. 3A and B).
The hopBK1, hopBL1, and hopBL2 P. savastanoi pv. savastanoi NCPPB 3335 T3E genes were used as probes in dot-blot
hybridizations to ascertain their distribution among a collection
of 31 P. savastanoi pv. savastanoi strains isolated in different
countries and among a selection of P. syringae strains isolated
from either woody or herbaceous hosts. The strains used in this
assay are presented in Supplementary Table S4. These three
effector genes were present in most of the P. savastanoi pv.
savastanoi strains, two strains of P. savastanoi pv. nerii (2 and
519), and in strains P. syringae pv. eriobotryae CFBP 2343, pv.
morsprunorum CFBP 2116, and pv. myricae CFBP 2897 (Fig.
3C). The hopBK1 gene was not detected in six P. savastanoi pv.
savastanoi strains (CFBP 71, CFBP 1670, CFBP 1746, IMC-1,
IVIA 1624-1b, and NCPPB 1479), P. syringae pv. dendropanacis CFBP 3226, and pv. mori CFBP 1642. Furthermore,
hopBL1 and hopBL2 were absent in P. syringae pv. glycinea
Fig. 2. HrpL-dependent expression of the Pseudomonas savastanoi pv.
savastanoi NCPPB 3335 novel type III secretion system effectors (T3E).
A, Hypersensitive response of Nicotiana tabacum var. Newdel leaves 24 h
after infection with P. savastanoi pv. savastanoi NCPPB 3335 or NCPPB
3335 ∆hrpL. B, Symptoms induced in lignified olive plants 90 days after
inoculation with NCPPB 3335 or NCPPB 3335 ∆hrpL. C, Quantitative
reverse-transcription polymerase chain reaction with the indicated P. savastanoi pv. savastanoi NCPPB 3335 T3E genes in NCPPB 3335 ∆hrpL
versus NCPPB 3335 at 6 h after transfer to Hrp-inducing medium. The
fold change was calculated after normalization using the gyrA gene as an
internal control. Results represent the means from three independent experiments. Error bars represent the standard deviation.
Vol. 27, No. 5, 2014 / 427
PG4180, pv. lachrymans CFBP 1644, pv. sesami CFBP 1671,
and pv. tomato PT23 (Fig. 3C). The widespread distribution of
these three effectors among strains of P. savastanoi pv. savastanoi suggests that they might be important for the interaction
with olive. However, their patchy distribution among pathovars
infecting woody hosts indicate that they are not universally
essential for the infection of woody plants and that their effect
might be dependent on the particular pathosystem.
Fig. 3. Distribution and phylogeny of HopBK1, HopBL1 and HopBL2 among pathovars of the Pseudomonas syringae complex. Unrooted neighbor-joining
tree of A, HopBK1 and B, HopBL1 and HopBL2 proteins from strains of the P. syringae complex. HopBK1 is widely distributed in P. syringae pv. actinidiae, with at least two alleles showing 94% amino acid identity, although only a single strain is shown for clarity. Similar or identical topologies were
obtained by maximum likelihood. Bootstrap percentage values (10,000 repetitions) are shown on the branches and evolutionary distances are given in units
of amino acid substitutions per site. C, Distribution of the novel P. savastanoi pv. savastanoi NCPPB 3335 type III secretion system effector genes hopBK1,
hopBL1, and hopBL2 among a collection of strains from the P. syringae complex isolated from woody and herbaceous plant hosts. A colony blot analysis
was performed using the indicated gene probes. Strains are indicated by their pathovar abbreviation. Black and white squares represent the presence or absence,
respectively, of strong hybridization signals with the indicated effectors for each strain analyzed. Superscript 1 indicates 25 strains of P. savastanoi pv.
savastanoi: B15.00, C1.01, C2.01, C3.01, CFBP 1020, CFBP 2074, DAPP-PG722, IMC-2, ITM 317, IVIA 1628-3, IVIA 1629-1a, IVIA 1637-a, IVIA 1637B3, IVIA 1649-1, IVIA 1651-C15, IVIA 1657-A2, IVIA 1657-B8, IVIA 2733-1a, IVIA 2743-3, NCPPB 64, NCPPB 1342, NCPPB 1344, NCPPB 1506,
NCPPB 3335, and PVFi-1; and superscript 2 indicates six strains of P. savastanoi pv. savastanoi: CFBP 71, CFBP 1670, CFBP 1746, IMC-1, IVIA 1624-1b,
and NCPPB 1479.
P. savastanoi pv. savastanoi NCPPB 3335 encodes
truncated versions of HopAA1 and HopAZ1.
The occurrence of premature stop codons and transposon
disruptions is common in T3E across the P. syringae phylogeny. Although these variants are generally considered to be
functionless pseudogenes, the functional significance of these
truncated alleles remains unresolved (Baltrus et al. 2011). The
P. syringae hopAA1 and hopAZ1 families contain alleles of
vastly different lengths. The truncated version of hopAA1 encoded by P. savastanoi pv. savastanoi NCPPB 3335 (189
amino acids) harbors a single nucleotide insertion within codon
188 relative to the full-length hopAA1-1 allele of P. syringae
pv. tomato DC3000 (486 amino acids). Truncations of the
hopAA1 gene have also been identified in P. syringae pvs.
phaseolicola and actinidiae (Fig. 4). On the other hand, P.
savastanoi pv. savastanoi NCPPB 3335 also contains a truncated version of hopAZ1, encoding a polypeptide of 122 amino
acids lacking the C-terminal domain of the HopAZ1 versions
encoded by other P. syringae pathovars (Fig. 4). The truncated
versions of the hopAA1 and hopAZ1 genes encoded by P.
savastanoi pv. savastanoi NCPPB 3335 were included in the
plant bioassays described below, in order to determine their
functionality during plant infection.
Heterologous expression of P. savastanoi T3E
in the nonpathogen P. fluorescens 55
expressing a cloned P. syringae Hrp system.
T3E activities interfere with the innate immunity response
of the plant at different levels. ROS production and callose
deposition upon pathogen recognition are early plant defense
responses. To test the ability of the seven P. savastanoi pv.
savastanoi T3E identified here—AvrRpm2, HopA1, HopAA1,
HopAZ1, HopBK1, HopBL1, and HopBL2—to attenuate
these responses, we expressed their corresponding genes
(pCPP5040 derivatives) in P. fluorescens 55 (pLN18), which
heterologously expresses a P. syringae T3SS, thus enabling the
delivery of effector proteins into plant cells at levels characteristic of a natural infection (Jamir et al. 2004; Lopez-Solanilla
et al. 2004; Oh et al. 2010; Rodríguez-Herva et al. 2012). For
this purpose, N. tabacum leaves were used. PAMPs displayed
by P. fluorescens 55 generate a PTI response in inoculated
plants, which is increased by the pLN18-encoded T3SS, as
indicated by a higher ROS level than that induced by P. fluorescens 55 without a T3SS (Oh et al. 2010). The ROS levels,
determined by 3,3′-diaminobenzidine (DAB) staining, were
significantly reduced by the expression of each of the seven
T3E compared with the control strain P. fluorescens 55
(pLN18) harboring an empty vector (Tukey test; P ≤ 0.01)
(Fig. 5A and B). Moreover, with the exception of HopA1, all
the other T3E significantly reduced the levels of callose deposition compared with the control strain (Tukey test; P ≤ 0.01)
(Fig. 5C and D). These results suggest that these T3E interfere
with the early responses associated with plant immunity.
Heterologous expression of P. savastanoi T3E
in the functionally effectorless polymutant
P. syringae pv. tomato DC3000D28E.
To further analyze the individual roles of the P. savastanoi
pv. savastanoi T3E when confronting the plant immune system, we constructed derivatives of the P. syringae pv. tomato
DC3000D28E strain expressing each of the seven effectors
from the pCPP5040 plasmid. DC3000D28E is a polymutant of
the model pathogen P. syringae pv. tomato DC3000 that harbors deletions in all 28 well-expressed effector genes. Thus,
DC3000D28E is considered to be functionally effectorless but
otherwise wild type in planta. Although the wild-type strain
DC3000 induces an ETI-like rapid plant cell death in N. ben-
thamiana and N. tabacum, DC3000D28E has a reduced ability
to induce this response and seems to elicit plant defenses that
are T3SS-dependent and additional to basal PTI (Cunnac et
al. 2011). This elicitation is explained by the fact that
DC3000D28E has the wild-type complement of T3SS helper
proteins (except HrpW1), and several of these proteins can
elicit plant defenses and induce an HR response (Cunnac et al.
2011; Kvitko et al. 2007). Therefore, this strain is an excellent
tool to investigate the role of heterologous effectors in amenable systems, such as N. benthamiana and N. tabacum.
DC3000D28E derivatives expressing the selected T3E were
compared with DC3000D28E regarding their ability to elicit
cell death in N. tabacum at two different inoculum levels,
which were chosen to exceed the threshold typically needed to
elicit cell death associated with ETI. Neither the polymutant
strain DC3000D28E nor the derivatives expressing P. savastanoi pv. savastanoi T3E incited the HR response typical of
the wild-type strain DC3000 at a bacterial dose of 2 × 107
CFU/ml. However, with 10× more bacteria (2 × 108 CFU/ml),
the polymutant strain stimulated an ETI-like response after 48
h of inoculation, which was partially or completely inhibited
by the expression of the P. savastanoi pv. savastanoi proteins
HopAZ1 and HopBL1, respectively (Fig. 6A and B). These results suggest that these two effectors participate in the inhibition of the plant defense response associated with the onset of
programmed cell death.
The DC3000D28E strain has been shown to grow better in
planta when coinoculated with a strain that is able to suppress
plant immunity, such as DC3000∆hopQ1-1 (Cunnac et al.
2011). Therefore, this strain is considered an excellent tool for
testing the ability of individual T3E to restore bacterial growth
or to induce specific plant responses. To investigate the effect
of the seven P. savastanoi pv. savastanoi T3E on the ability of
DC3000D28E to colonize N. benthamiana, competition assays
between the polymutant strain (DC3000D28E) and each derivative expressing the selected T3E were conducted. N. bentham-
Fig. 4. Schematic map of HopAA1 and HopAZ1 alleles with variable protein
length from the Pseudomonas syringae complex. Strains are indicated by
their pathovar abbreviation. Superscript numbers indicate different strains
or ortholog genes; aa = amino acids residues encoded by the corresponding
genes.
Vol. 27, No. 5, 2014 / 429
iana leaves were infiltrated with a mixed inoculum (1:1) of
DC3000D28E and each of the derivatives and, after 6 days,
bacteria were recovered and viable cells were determined. The
results presented in Figure 6C are expressed as the competition
indices (CI) of the derivatives expressing each of the P. savastanoi pv. savastanoi T3E relative to the DC3000D28E strain.
Interestingly, the expression of P. savastanoi pv. savastanoi
HopBL2 in DC3000D28E significantly increased the competitiveness of the strain, which was reflected in a CI value
(HopBL2/DC3000D28E) of 21.1. Expression of HopAA1 also
increased the competitiveness of the strain, although at a lower
level (CI = 2.6) than HopBL2. These results suggest that these
effectors inhibit plant defense responses.
DISCUSSION
The recent availability of complete and draft genome sequences for several P. syringae and P. savastanoi pathovars and
the relevant advances in the development of bioinformatics
tools led to a comprehensive catalog of candidate effector repertoire for 19 different strains (Baltrus et al. 2011). Given that
only nine new effector families were identified after the latest
comparative genome-sequence analysis, the P. syringae complex effector super-repertoire may be nearly complete with 57
effector families (Baltrus et al. 2011; Lindeberg et al. 2012).
However, novel candidate effectors identified using these strategies should be functionally characterized in the context of a
unified model for a two-layered immune system in plants
(Block and Alfano 2011; Lindeberg et al. 2012). To that end, in
this study, we demonstrated that the Hrp T3SS mediated the
delivery into plant cells of seven P. savastanoi pv. savastanoi
NCPPB 3335 effectors, including HopA1; three T3E for which
translocation into plant cells has not been demonstrated for any
other P. syringae strain (AvrRpm2, HopAA1, and HopAZ1);
and three novel T3E (HopBK1, HopBL1, and HopBL2) from
two new effector families of the P. syringae complex (HopBK
and HopBL) (Fig. 1). Moreover, we demonstrated that the expression of these three genes encoding novel T3E was transcriptionally dependent on HrpL.
Translocation assays based on Cya reporters were designed
for use in herbaceous plants and require injection of bacterial
suspensions expressing T3E-Cya fusions into fully expanded
Fig. 5. 3,3′-Diaminobenzidine (DAB) staining and callose deposition in Nicotiana tabacum var. Xanthi leaves. Plants were challenged with Pseudomonas fluorescens 55 (pLN18) harboring the pCPP5040 empty vector or the vectors expressing the indicated P. savastanoi pv. savastanoi NCPPB 3335 type III
secretion system effectors. A, The DAB signal was quantified 4 h after infection and B, represented in a histogram. C, The callose deposition was assessed
using aniline blue staining, quantified 12 h after infection, and D, represented in a histogram. Asterisks in A and C indicate inoculation zones. For histograms, data are means ± standard error of the mean for at least five replicas; bars topped with the same letter represent values that are not significantly different using one-way analysis of variance followed by post-hoc comparisons using the Tukey test.
upper leaves. However, adapting this assay to study the interaction of bacterial effectors with a woody plant such as olive
has been limited by two main restrictions, both due to secondary wall thickenings of the host. First, inoculating the olive
plant stem with bacteria requires artificially wounding the
plant material, a process that induces complex plant defense
mechanisms (Conrath 2011); and, second, visualizing the damaged stem tissue after bacterial inoculation is complex. For
these reasons, translocation assays of T3E through the P. savastanoi pv. savastanoi T3SS were performed in N. tabacum, a
nonhost plant of this pathogen (Pérez-Martínez et al. 2010).
Cya has been used as a reporter to study T3SS-mediated translocation of effector proteins by animal- and plant-pathogenic
bacteria (Schechter et al. 2004). This system has been optimized in host and nonhost plants with the well-studied effector
protein AvrPto from P. syringae pv. tomato. The translocation
of several DC3000 candidate T3E has been assessed using
this Cya reporter, which induces cAMP accumulation in tomato or N. benthamiana after effectors are delivered by the P.
fluorescens 55, which expresses a P. syringae Hrp system
(Schechter et al. 2004). Our results demonstrated that several
P. savastanoi pv. savastanoi NCPPB 3335 effector proteins
were translocated. However, we cannot exclude that the negative results obtained for some of the other candidate proteins
tested were due to the induction of an HR response in N.
tabacum, which impedes cAMP accumulation.
The P. syringae pangenome includes only four effector families that are considered core members of the effector superrepertoire: AvrE, HopI, HopM1, and HopAA (Baltrus et al.
2011; Lindeberg et al. 2012). Candidate effectors from all four
families were identified in the genome of P. savastanoi pv.
savastanoi NCPPB 3335 (Table 1). Our in silico survey also
demonstrated that the three novel T3E identified here
(HopBK1, HopBL1, and HopBL2) are present in only a few P.
syringae strains (Fig. 3A and B). In contrast, dot-blot hybridization analysis revealed that these three T3E were present in
most P. savastanoi pv. savastanoi strains (Fig. 3C). Interestingly, hopBL1 and hopBL2 were detected in all P. savastanoi
pv. savastanoi strains analyzed and in other P. syringae strains
isolated from woody hosts, suggesting a relevant role for these
effectors in the interaction of P. syringae and P. savastanoi
with certain woody plants. However, this association did not
occur with hopBK1, because it was not present in all P. savastanoi strains analyzed and was also detected in diverse P. syringae pathovars associated with herbaceous plants.
The vast majority of the P. syringae pv. tomato DC3000
T3E have been demonstrated to suppress ETI and many can
also suppress PTI, suggesting that numerous T3E exert multiple activities or, alternatively, that common T3E targets are
utilized in pathways needed for ETI, PTI, or both (Guo et al.
2009). Our results indicate that the seven P. savastanoi pv.
savastanoi NCPPB 3335 T3E shown to translocate in this
study, including the truncated versions of HopAA1 and
HopAZ1, interfered with early responses associated with
plant defense. In addition, we demonstrated that HopAZ1
and HopBL1 also inhibited the ETI-like response incited by
DC3000D28E in tobacco.
Although all the tested effectors significantly reduced ROS
production, expression of HopA1 in P. fluorescens 55 did not
significantly reduce callose deposition under the conditions
Fig. 6. Delivery of Pseudomonas savastanoi pv. savastanoi type III secretion
system effectors (T3E) by functionally effectorless P. syringae pv. tomato
DC3000D28E in Nicotiana leaves. A, Cell death response in Nicotiana tabacum var. Newdel leaves 48 h after inoculation with P. syringae pv. tomato
strains DC3000 (wild type) or DC3000D28E cells suspended in MgCl2 and
adjusted to the indicated densities (in CFU/ml). B, Cell death response in N.
tabacum var. Newdel leaves 48 h after inoculation with P. syringae pv. tomato DC3000D28E cells suspended in MgCl2 carrying pCPP5040 (empty
vector) derivatives expressing the indicated P. savastanoi pv. savastanoi
NCPPB 3335 T3E adjusted to 2 × 108 CFU/ml. Cell death response: + =
positive, – = null, and ± = partial. Each experiment was repeated at least
three times with similar results. C, Competition assays in N. benthamiana
leaves between P. syringae pv. tomato DC3000D28E and each of its transformants carrying pCPP5040 derivatives expressing the indicated P. savastanoi pv. savastanoi T3E. Competition indices (CI) were normalized with
respect to the CI obtained for DC3000D28E versus DC3000D28E expressing the empty vector (pCPP5040). Values are the mean ± standard error of
the mean of three replicates demonstrating typical results from three independent experiments; bars topped with the same letter represent values that
are not significantly different using one-way analysis of variance followed by
post-hoc comparisons using the Tukey test.
Vol. 27, No. 5, 2014 / 431
tested. The secretion of HopA1 via the T3SS in P. syringae
pv. syringae 61 requires the ShcA chaperone (van Dijk et al.
2002). Although a ShcA protein homolog has been annotated
in the draft genome of P. savastanoi pv. savastanoi (AER0002589), the expression analysis of this effector in this
study did not include the NCPPB 3335 ShcA. Thus, we cannot
exclude that this protein chaperone may also be necessary for
full secretion and in planta activity of HopA1 in P. savastanoi. Conversely, HopA1 from P. syringae pv. syringae 61
has been demonstrated to elicit an HR in tobacco when expressed in P. fluorescens (Alfano and Collmer 1996). In agreement with these authors, HopA1 expression in DC3000D28E
did not suppress the HR response incited by DC3000D28E in
tobacco.
DC3000D28E has been demonstrated to be suitable for testing the ability of T3E to restore bacterial growth and induce
plant responses (Cunnac et al. 2011). Although the expression
of P. savastanoi pv. savastanoi HopBL2 in DC3000D28E did
not inhibit the ETI-like response induced at high cell doses by
DC3000D28E in N. tabacum, HopBL2 expression in this strain
significantly increased its competitiveness in N. benthamiana
(Fig. 6C). Significant DC3000D28E growth restoration in N.
benthamiana due to the expression of single DC3000 effectors
was demonstrated for only AvrPto and AvrPtoB; however, neither other effectors such as HopM1 nor a set of several conserved effectors displayed this effect. Conversely, single
DC3000 effectors promoted growth when combined with other
effectors in DC3000D28E (Cunnac et al. 2011). Thus, our results suggest that the P. savastanoi pv. savastanoi HopBL2,
which harbors a C-terminal XopD-like SUMO protease domain (Kim et al. 2011), and HopBL1 might be involved in the
inhibition of the initial perception of pathogens. More specifically, XopD has been recently demonstrated to suppress the
ethylene production required for anti-Xanthomonas euvesicatoria immunity (Kim et al. 2013). Although the current
knowledge of specific T3E functions is limited, our results
suggest that the seven P. savastanoi T3E analyzed here inhibited PTI, whereas HopAZ1 and HopBL1 also inhibited the
ETI-like response. Moreover, and although truncated T3E are
generally considered as functionless pseudogenes, our results
also demonstrate that the N-terminal region of the truncated
versions of HopAA1 and HopAZ1 encoded by P. savastanoi
pv. savastanoi NCPPB 3335 (Fig. 4; Supplementary Table S5)
are able to interfere with responses associated with plant defense
(Figs. 5 and 6). Although no function has been yet established
for the HopAZ and HopAA T3E families, P. syringae pv.
avellanae HopAZ1 is a promising candidate for modulating
hazelnut host specificity (O’Brien et al. 2012). On the other
hand, deletion of hopAA1-1 in P. syringae pv. tomato significantly reduced the formation of necrotic speck lesions in
tomato leaves (Munkvold et al. 2009). Moreover, HopAA1 has
been demonstrated to attenuate the innate immunity in Arabidopsis (Li et al. 2005).
In summary, bioinformatics prediction of proteins belonging
to the Ulp1 protease family revealed two novel T3E (HopBL1
and HopBL2) encoded in the genome of P. savastanoi pv.
savastanoi NCPPB 3335, yielding a final set of 33 T3E candidates in this strain. We demonstrated here that seven of these
proteins, including HopBK1, HopBL1, and HopBL2, were
translocated into the plant cell via the NCPPB 3335 T3SS and
interfered with early responses associated with plant defense.
In addition, we demonstrated that HopAZ1 and HopBL1 also
inhibited the ETI-like response. Collectively, our results revealed the existence of two novel effector families of the P. syringae complex, of which HopBL1 and HopBL2 appear to be
specific for P. syringae and P. savastanoi strains isolated from
woody hosts. Future studies should focus on elucidating the
precise mechanisms and targets of these and other effectors
that are included in the P. syringae pangenome and that specifically participate in the infection of woody plants.
MATERIALS AND METHODS
Bioinformatics analysis.
Bioinformatics-based predictions of novel candidate T3E in
the genome of P. savastanoi pv. savastanoi NCPPB 3335
(ASAP Database) were performed by searching for specific
protein families corresponding to known T3E that have been
previously demonstrated in either P. syringae, Xanthomonas
spp., or Ralstonia spp. Positive hits were further analyzed for
the presence of N-terminal sequence features and potential
HrpL boxes in the promoter sequences (500 nucleotides upstream of the start codon), as previously described (RodríguezPalenzuela et al. 2010). Novel candidate T3E meeting both criteria were selected for further investigation.
Sequence alignment using Muscle, determination of the
optimal amino acid substitution model, and phylogenetic tree
construction were performed using MEGA5 (Tamura et al.
2011). Neighbor-joining and maximum-likelihood phylogenetic
trees of the individual protein sequences were generated using
MEGA5 with the optimal model (John-Taylor-Thornton model)
and the option of complete deletion to eliminate positions
containing gaps. Confidence levels for the branching points
were determined using 10,000 bootstrap replicates.
Bacterial strains, plasmids, and growth conditions.
Pseudomonas and Escherichia coli strains were grown at
28 and 37°C, respectively, using Luria-Bertani (LB) medium
(Miller 1972), KB medium (King et al. 1954), or super optimal broth medium (Hanahan 1983). Solid and liquid media
were supplemented, when required, with the following antibiotics for the Pseudomonas or E. coli strains: ampicillin
(Ap) at 300/100, gentamicin (Gm) at 10/10, spectinomycin
(Sp) at 7/50, and kanamycin (Km) at 10/50 µg/ml. Expression plasmids were generated using Gateway cloning technology (Invitrogen Corp., Carlsbad, CA, U.S.A). Using this
system, an open reading frame without a stop codon cloned
in an entry vector can be transferred by recombination into a
destination vector, creating an in-frame fusion. Entry vectors
were constructed by cloning PCR products, amplified with
specific primer pairs (Supplementary Table S6), into the plasmid pENTR/SD/D-TOPO (Invitrogen Corp.). DNA sequencing using the universal primers T7 and M13-20 confirmed
the absence of mutations in the cloned DNA fragments. Expression clones were constructed by combining the pENTR
plasmids with the desired expression vector and the LR
clonase. The recombination reactions were performed as suggested by the manufacturer (Invitrogen Corp.). Two Gatewaycompatible expression vectors were used: i) pCPP3234, a derivative of the broad host-range vector pVLT35 that employs
a tac promoter to express insert genes and generates hybrid
proteins with a C-terminal Cya fusion for T3SS translocation
studies (Schechter et al. 2004); and ii) pCPP5040, a derivative of the broad-host-range vector pML123 (Labes et al.
1990), which expresses inserted genes from the nptII promoter
and generates protein products with a C-terminal HA tag for
expression in Pseudomonas spp.
A P. savastanoi pv. savastanoi NCPPB 3335 hprL mutant
was constructed using the pIAC4-Km plasmid. First, DNA
fragments of approximately 1.2 kb, corresponding to the 5′
and 3′ flanking regions of the NCPPB 3335 hrpL gene, were
amplified using three rounds of PCR with NCPPB 3335 genomic DNA as a template and primers that included an EcoRI
site and the T7 primer sequence, as previously described
(Zumaquero et al. 2010). The resulting product was A/T
cloned into pGEM-T and fully sequenced to discard mutations
on flanking genes. Following sequencing, the resulting plasmid (pIAC4) was tagged with the nptII Km-resistance gene
obtained from pGEM-T-KmFRT-EcoRI, yielding pIAC4-Km.
For marker-exchange mutagenesis, the pIAC4-Km plasmid
was electroporated into NCPPB 3335, as described previously
(Pérez-Martínez et al. 2007). Transformants were selected on
LB medium containing Km, and the resulting colonies were
replica plated onto LB-Ap plates to assess whether each transconjugant integrated the plasmid into the chromosome (ApR)
or engaged in allelic exchange (ApS). Southern blot analyses,
using both nptII and hrpL as probes, were used to confirm that
allelic exchange occurred at a single position and at the correct
site within the genome.
Translocation assay
of P. savastanoi pv. savastanoi NCPPB 3335 T3E candidates.
Translocation assays were performed as previously described
by Schechter and collaborators (2004). This method is based
on the construction of fusion proteins between identified T3E
and the calmodulin-dependent Cya reporter domain. Electrocompetent P. savastanoi pv. savastanoi NCPPB 3335 and
NCPPB 3335-T3 cells were transformed with Cya fusions, as
previously described (Choi et al. 2006). SpR transformants
were tested by PCR using a forward primer designed specifically for each T3E gene and a reverse primer annealing to the
cya gene (primer Cya-R135). Cya assays were performed in N.
tabacum var. Newdel plants, as previously described
(Schechter et al. 2004). P. savastanoi pv. savastanoi NCPPB
3335 and NCPPB 3335-T3 transformants carrying plasmids
expressing T3E-Cya fusions were scraped off of the LB plates,
washed twice, and resuspended to an optical density at 600 nm
(OD600) of 0.5 (approximately 108 CFU/ml) in 5 mM morpholinoethanesulfonic acid (pH 5.5) and 100 µM isopropyl-thiogalactopyranoside (IPTG). Cell suspensions were injected into
the fully expanded upper plant leaves using a 1-ml syringe.
Leaf disks were collected at 6 h postinoculation with a 10-mm
inner-diameter cork borer, frozen in liquid nitrogen, ground to
a powder, and suspended in 250 µl of 0.1 M HCl. The samples
were incubated at –20°C overnight, and cAMP levels were determined using a 1:100 dilution of the samples and the Correlate-EIA cAMP immunoassay kit according to the manufacturer’s directions (Assay Designs, Inc., Ann Arbor, MI,
U.S.A.). The protein content of each sample was determined
using the Pierce BCA protein-assay kit (Thermo Scientific,
Rockford, IL, U.S.A.).
The Cya activity of the Cya fusion proteins expressed in E.
coli XL1Blue from pCPP3234 derivatives were assayed as previously reported (Schechter et al. 2004). Bacterial cells were
grown in 5 ml of LB medium containing 100 µM IPTG to an
OD600 of 0.6 to 0.8. The culture was centrifuged, and the pellet
was washed and resuspended in sonication buffer (20 mM
Tris-HCl [pH 8.0] and 10 mM MgCl2). The bacteria were sonicated with a microtip for 2 min, and the cellular debris was
pelleted by centrifugation. Cya activity was determined in the
presence or absence of bovine calmodulin (Calbiochem, Darmstadt, Germany) by using 5 µl of each lysate (Sory and Cornelis
1994). cAMP was quantified in bacteria as described above for
the leaf samples. Every Cya hybrid protein exhibited calmodulin-dependent Cya activity in E. coli XL1Blue lysates, indicating that all of them could induce cAMP accumulation in
planta. The in vitro activity of all the Cya fusions without significant differences in cAMP production in planta between the
wild-type P. savastanoi pv. savastanoi NCPPB 3335 and its
T3SS mutant (strain NCPPB 3335-T3) is illustrated in Supplementary Figure S1.
Plant bioassays.
The N. benthamiana and N. tabacum (var. Newdel and var.
Xanthi) plants used in this study were 5 to 7 and 4 to 6 weeks
old, respectively. The plants were grown with a photoperiod of
16 h of light and 8 h of darkness with day and night temperatures of 26 and 22°C, respectively. Bacterial suspensions in 10
mM MgCl2 were inoculated into plant leaves using a blunt
syringe. Assays with derivatives of P. fluorescens 55 (pLN18)
were performed by injecting a bacterial suspension (5 × 107
CFU/ml) into N. tabacum var. Xanthi leaves using a blunt
syringe. The injected areas were lightly marked on the back of
the leaves. The bacterial inoculum levels differed among experiments. The bacterial levels in planta were determined by
cutting three leaf disks with a boring tool (inner diameter of 10
mm) and placing the plant material in 1 ml of 10 mM MgCl2.
The disks were completely homogenized and the resulting suspensions, containing the bacteria, were diluted and plated on
LB-Sp plates (DC3000D28E) or LB-Sp-Gm plates (transformants containing pCPP5040 derivatives). N. tabacum var.
Newdel plants were used for the HR assays. The leaves were
infiltrated with bacterial suspensions (107 and 108 CFU/ml) of
P. syringae pv. tomato DC3000D28E or its derivatives harboring plasmids expressing each of the different P. savastanoi pv.
savastanoi T3E. The generated symptoms, scored 48 h after
inoculation, were captured with a high-resolution digital camera (Nikon DXM 1200; Nikon Corporation, Tokyo).
For competition assays, the N. benthamiana leaves were
inoculated with mixed suspensions containing equal CFU
(approximately 104 CFU/ml) of P. syringae pv. tomato
DC3000D28E and each of its transformants carrying
pCPP5040 derivatives expressing P. savastanoi pv. savastanoi
T3E. Input and ouput pools assayed 1 and 6 h after inoculation, respectively, were plated onto LB-Sp and LB-Sp-Gm to
select for DC3000D28E and the transformants with pCPP5040
derivatives, respectively. A CI was calculated by dividing the
output ratio (CFU transformant:CFU DC3000D28E) by the
input ratio (CFU transformant:CFU DC3000D28E). CI of the
transformant strains expressing P. savastanoi pv. savastanoi
T3E versus DC3000D28E were normalized with respect to the
CI obtained for DC3000D28E (pCPP5040). The CI presented
in Figure 6 represent the mean of three replicates demonstrating typical results from three independent experiments.
The results were statistically analyzed using one-way analysis of variance (ANOVA) followed by post-hoc comparisons
using the Tukey test. Statistical analysis of the results obtained
for CI revealed significant differences (F [7/41] = 17,273, P ≤
0.0001).
Olive plants derived from seed germinated in vitro (originally collected from an ‘Arbequina’ plant) were micropropagated, rooted, and maintained as previously described
(Rodríguez-Moreno et al. 2008, 2009). To analyze the pathogenicity of the P. savastanoi pv. savastanoi NCPPB 3335
∆hrpL mutant in 1-year-old olive explants (woody plants), micropropagated olive plants were transferred into soil and maintained in a glasshouse at 27°C with a relative humidity of 58%
under natural daylight. The plant stems were wounded and
infected with approximately 106 CFU of P. savastanoi pv.
savastanoi as previously described (Penyalver et al. 2006;
Pérez-Martínez et al. 2007). Morphological changes, scored at
90 days postinoculation, were captured with a high-resolution
digital camera (Nikon DXM 1200).
Detection of ROS production and callose deposition.
ROS production was observed after DAB staining (ThordalChristensen et al. 1997) 4 h after inoculation with P. fluorescens
55 (pLN18) derivatives. Bacterial suspensions (108 CFU/ml)
were inoculated into N. tabacum var. Xanthi leaves using a blunt
Vol. 27, No. 5, 2014 / 433
syringe. Small pieces of tobacco leaves cut from around the
injection area were placed into a syringe and stained by vacuum infiltration of a freshly prepared 1 mg/ml solution of
DAB (Sigma-Aldrich D-8001; Sigma-Aldrich, Inc., St. Louis)
in 8 mM HCl, pH 3.8. Chlorophyll was removed by submerging the leaves into a solution of ethanol/lactic acid/glycerol
(3:1:1 [vol/vol/vol]) at 60°C and stored overnight at room temperature on water-soaked filter paper. At least 10 biological
replicates from each specimen were mounted on slides in a
50% glycerol (vol/vol) solution and observed with a Nikon
Eclipse E800 microscope (Nikon Corporation) under bright
field. DAB staining produces an intensely brown precipitate at
the sites of ROS production, which were next to the infection
zone.
Callose deposition samples were developed 12 h after inoculation and stained as described previously (Guo et al. 2009).
Chlorophyll was removed in 95% (vol/vol) ethanol from small
pieces of tobacco leaves, which were cut from around the
injection area, and staining was performed in a 0.02% (wt/vol)
solution of aniline blue (number 415049; Sigma-Aldrich, Inc.)
in 150 mM potassium phosphate, pH 9, for 1 h in the dark. At
least 10 biological replicates from each specimen were
mounted in 50% (vol/vol) glycerol on glass slides. Observations were conducted under UV-light excitation using the filter
UV-2ª (EX 330-380, DM 400; BA 420) on a Nikon Eclipse E
800 microscope (Nikon Corporation).
ROS production and callose deposition were quantified as
previously described (Rodríguez-Herva et al. 2012), with
slight modifications. Up to four snapshots of each specimen
from equivalent areas surrounding the wound (inoculation
zone) were captured with a Nikon DXM1200 camera using the
Nikon ACT-1 2.70 software. The same settings and a final
magnification of ×40 were applied to all the samples. After
calibrating all the images using the scale bar included in each
picture, DAB staining and aniline blue fluorescence were quantified using the program Visilog 6.3 (Noesis, Les Ulis, France).
For this purpose, the characteristic brown color of the DAB
precipitate and the specific blue fluorescence of callose deposition (Fig. 5) were separated by color deconvolution using the
i_classification command. Then, the stained areas were quantified and the results were expressed in square millimeters. Five
to six images per assay were analyzed, and statistical analyses
were performed using one-way ANOVA followed by post-hoc
comparisons using the Tukey test. Statistical analysis of the
results obtained for ROS production and callose deposition
revealed significant differences (F [8/44] = 59.12, P ≤ 0.0001
and F [8/44] = 24.33, P ≤ 0.0001, respectively).
Colony blots.
To fix total DNA from the colonies, overnight cultures of
Pseudomonas strains grown on LB microtiter plates were transferred onto nylon membranes placed on LB agar plates using a
48-pin replicator (Sigma-Aldrich, Inc.). Total DNA from the
bacterial colonies was denatured on the membranes by alkaline
lysis by placing a Whatman 3 MM paper soaked in denaturing
solution (0.4 M NaOH) for 15 min on top of the colonies. The
membranes were neutralized twice for 15 min in 1 M NaCl
and 0.5 M Tris, pH 7.2, then washed twice for 10 min in 2×
SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate).
Finally, the DNA was cross-linked by UV fixation (Vilber
Lourmat, Eberhardzell, Germany). DNA probes were amplified and labeled by PCR using primers and digoxigenin (DIG)dNTPs from the Dig labeling mix kit (Roche Applied Science,
Mannheim, Germany), and the appropriate pENTRY plasmid
as the DNA template. Hybridization was performed at 65°C
using the DIG Nucleic Acid Detection Kit (Roche Applied Science), following the manufacturer’s instructions.
qRT-PCR assays.
Pure cultures of the wild-type P. savastanoi pv. savastanoi
NCPPB 3335 and its ∆hrpL mutant were grown overnight in
KB medium at 28°C. The cells were diluted in fresh KB
medium and incubated with shaking at 28°C to an OD600 of
0.5. The sample was split into two. One half was pelleted and
frozen (for noninducing condition) and the other half was pelleted, washed twice with 10 mM MgCl2, and resuspended in
the same volume of Hrp-inducing medium (Huynh et al. 1989)
supplemented with 5 mM mannitol and 0.0006% ferric citrate
(Roine et al. 1997; Sambrook and Russell 2001). After 6 h of
incubation, the cells were pelleted and processed for RNA isolation using TriPure Isolation Reagent (Roche Applied Science)
according to the manufacturer’s instructions, except that the
TriPure was preheated at 65°C, the lysis step was performed at
65°C, and BCP (Molecular Research Center, Cincinnati, OH,
U.S.A.) was used instead of chloroform. Total RNA was treated
with the RNAeasy kit (Qiagen GmbH, Hilden, Germany), as
detailed by the manufacturer. The RNA concentration was determined spectrophotometrically and its integrity was assessed
by agarose gel electrophoresis. DNA-free total RNA was retrotranscribed to cDNA using the cDNA Reverse Transcription
kit (Applied Biosystems, Foster City, CA, U.S.A.) and random
hexamers. The primer efficiency tests, qRT-PCRs, and confirmation of the specificity of the amplification reactions were
performed as described previously (Vargas et al. 2011). The
relative transcript abundance was calculated using the ∆∆ cyclethreshold (Ct) method (Livak and Schmittgen 2001). Transcriptional data were normalized to the housekeeping gene
gyrA using the Roche LightCycler 480 Software and are presented as the fold change in expression compared with the
expression of each gene in the wild-type strain. The relative
expression ratio was calculated as the difference in qPCR
threshold cycles (∆Ct = Ctgene of interest – CtgyrA). One
PCR cycle represents a twofold difference in template abundance; therefore, fold-change values were calculated as 2–∆∆Ct,
as previously described (Pfaffl 2001; Rotenberg et al. 2006).
qRT-PCRs were performed in triplicate.
ACKNOWLEDGMENTS
This study was supported by Spanish Plan Nacional I+D+i grants
AGL2011-30343-C02-01, AGL2011-30343-C02-02, and AGL2012-32516
from the Ministerio de Economía y Competitividad (MINECO), cofinanced by FEDER, and by the grant P08-CVI-03475 from the Junta de
Andalucía, Spain. I. M. Matas, I. M. Aragón, and M. P. Castañeda-Ojeda
were supported by the Ramón Areces Foundation (Spain) and by FPU and
FPI fellowships from the MINECO, respectively. We thank M. Vega
Sánchez for excellent assistance with image analysis for quantifying ROS
production and callose deposition, L. Santín (University of Malaga, Spain)
for statistical analysis of data, and A. Barceló and I. Imbroda (IFAPA,
Churriana, Spain) for micropropagating the olive plants.
LITERATURE CITED
Alfano, J. R., and Collmer, A. 1996. Bacterial pathogens in plants: Life up
against the wall. Plant Cell 8:1683-1698.
Badel, J. L., Nomura, K., Bandyopadhyay, S., Shimizu, R., Collmer, A.,
and He, S. Y. 2003. Pseudomonas syringae pv. tomato DC3000
HopPtoM (CEL ORF3) is important for lesion formation but not growth
in tomato and is secreted and translocated by the Hrp type III secretion
system in a chaperone-dependent manner. Mol. Microbiol. 49:12391251.
Badel, J. L., Shimizu, R., Oh, H. S., and Collmer, A. 2006. A Pseudomonas syringae pv. tomato avrE1/hopM1 mutant is severely reduced in
growth and lesion formation in tomato. Mol. Plant-Microbe Interact.
19:99-111.
Baltrus, D. A., Nishimura, M. T., Romanchuk, A., Chang, J. H., Mukhtar,
M. S., Cherkis, K., Roach, J., Grant, S. R., Jones, C. D., and Dangl, J.
L. 2011. Dynamic evolution of pathogenicity revealed by sequencing
and comparative genomics of 19 Pseudomonas syringae isolates. PLoS
Pathog. 7:e1002132. Published online.
Baltrus, D. A., Nishimura, M. T., Dougherty, K. M., Biswas, S., Mukhtar,
M. S., Vicente, J., Holub, E. B., and Dangl, J. L. 2012. The molecular
basis of host specialization in bean pathovars of Pseudomonas syringae.
Mol. Plant-Microbe Interact. 25:877-888.
Bardaji, L., Pérez-Martínez, I., Rodríguez-Moreno, L., RodríguezPalenzuela, P., Sundin, G. W., Ramos, C., and Murillo, J. 2011.
Sequence and role in virulence of the three plasmid complement of the
model tumor-inducing bacterium Pseudomonas savastanoi pv.
savastanoi NCPPB 3335. PLoS One 6:e25705. Published online.
Block, A., and Alfano, J. R. 2011. Plant targets for Pseudomonas syringae
type III effectors: Virulence targets or guarded decoys? Curr. Opin.
Microbiol. 14:39-46.
Boller, T., and Felix, G. 2009. A renaissance of elicitors: Perception of
microbe-associated molecular patterns and danger signals by patternrecognition receptors. Annu. Rev. Plant Biol. 60:379-406.
Bradley, D. J., Kjellbom, P., and Lamb, C. J. 1992. Elicitor- and woundinduced oxidative cross-linking of a proline-rich plant cell wall protein:
A novel, rapid defense response. Cell 70:21-30.
Casper-Lindley, C., Dahlbeck, D., Clark, E. T., and Staskawicz, B. J. 2002.
Direct biochemical evidence for type III secretion-dependent translocation of the AvrBs2 effector protein into plant cells. Proc. Natl. Acad.
Sci. U.S.A. 99:8336-8341.
Chang, J. H., Urbach, J. M., Law, T. F., Arnold, L. W., Hu, A., Gombar, S.,
Grant, S. R., Ausubel, F. M., and Dangl, J. L. 2005. A high-throughput,
near-saturating screen for type III effector genes from Pseudomonas
syringae. Proc. Natl. Acad. Sci. U.S.A. 102:2549-2554.
Chisholm, S. T., Coaker, G., Day, B., and Staskawicz, B. J. 2006. Hostmicrobe interactions: Shaping the evolution of the plant immune
response. Cell 124:803-814.
Choi, K. H., Kumar, A., and Schweizer, H. P. 2006. A 10-min method for
preparation of highly electrocompetent Pseudomonas aeruginosa cells:
Application for DNA fragment transfer between chromosomes and
plasmid transformation. J. Microbiol. Methods 64:391-397.
Collmer, A., Schneider, D. J., and Lindeberg, M. 2009. Lifestyles of the
effector rich: Genome-enabled characterization of bacterial plant pathogens. Plant Physiol. 150:1623-1630.
Conrath, U. 2011. Molecular aspects of defence priming. Trends Plant Sci.
16:524-531.
Cunnac, S., Lindeberg, M., and Collmer, A. 2009. Pseudomonas syringae
type III secretion system effectors: Repertoires in search of functions.
Curr. Opin. Microbiol. 12:53-60.
Cunnac, S., Chakravarthy, S., Kvitko, B. H., Russell, A. B., Martin, G. B.,
and Collmer, A. 2011. Genetic disassembly and combinatorial reassembly identify a minimal functional repertoire of type III effectors in
Pseudomonas syringae. Proc. Natl. Acad. Sci. U.S.A. 108:2975-2980.
de Torres, M., Mansfield, J. W., Grabov, N., Brown, I. R., Ammouneh, H.,
Tsiamis, G., Forsyth, A., Robatzek, S., Grant, M., and Boch, J. 2006.
Pseudomonas syringae effector AvrPtoB suppresses basal defence in
Arabidopsis. Plant J. 47:368-382.
Doke, N. 1983. Involvement of superoxide anion generation in the hypersensitive response of potato tuber tissues to infection with an incompatible race of Phytophthora infestans and to the hyphal wall components. Physiol. Plant Pathol. 23:345-357.
Fouts, D. E., Abramovitch, R. B., Alfano, J. R., Baldo, A. M., Buell, C. R.,
Cartinhour, S., Chatterjee, A. K., D’Ascenzo, M., Gwinn, M. L.,
Lazarowitz, S. G., Lin, N. C., Martin, G. B., Rehm, A. H., Schneider, D.
J., van Dijk, K., Tang, X., and Collmer, A. 2002. Genomewide identification of Pseudomonas syringae pv. tomato DC3000 promoters controlled by the HrpL alternative sigma factor. Proc. Natl. Acad. Sci.
U.S.A. 99:2275-2280.
Guo, M., Tian, F., Wamboldt, Y., and Alfano, J. R. 2009. The majority of
the type III effector inventory of Pseudomonas syringae pv. tomato
DC3000 can suppress plant immunity. Mol. Plant-Microbe Interact.
22:1069-1080.
Hanahan, D. 1983. Studies on transformation of Escherichia coli with
plasmids. J. Mol. Biol. 166:557-580.
Hirano, S. S., and Upper, C. D. 2000. Bacteria in the leaf ecosystem with
emphasis on Pseudomonas syringae-a pathogen, ice nucleus, and epiphyte. Microbiol. Mol. Biol. Rev. 64:624-653.
Huckelhoven, R. 2007. Cell wall-associated mechanisms of disease
resistance and susceptibility. Annu. Rev. Phytopathol. 45:101-127.
Huynh, T. V., Dahlbeck, D., and Staskawicz, B. J. 1989. Bacterial blight of
soybean: Regulation of a pathogen gene determining host cultivar
specificity. Science 245:1374-1377.
Jackson, R. W., Athanassopoulos, E., Tsiamis, G., Mansfield, J. W.,
Sesma, A., Arnold, D. L., Gibbon, M. J., Murillo, J., Taylor, J. D., and
Vivian, A. 1999. Identification of a pathogenicity island, which contains
genes for virulence and avirulence, on a large native plasmid in the
bean pathogen Pseudomonas syringae pathovar phaseolicola. Proc.
Natl. Acad. Sci. U.S.A. 96:10875-10880.
Jamir, Y., Guo, M., Oh, H. S., Petnicki-Ocwieja, T., Chen, S., Tang, X.,
Dickman, M. B., Collmer, A., and Alfano, J. R. 2004. Identification of
Pseudomonas syringae type III effectors that can suppress programmed
cell death in plants and yeast. Plant J. 37:554-565.
Janjusevic, R., Abramovitch, R. B., Martin, G. B., and Stebbins, C. E.
2006. A bacterial inhibitor of host programmed cell death defenses is an
E3 ubiquitin ligase. Science 311:222-226.
Jones, J. D., and Dangl, J. L. 2006. The plant immune system. Nature
444:323-329.
Katagiri, F., and Tsuda, K. 2010. Understanding the plant immune system.
Mol. Plant-Microbe Interact. 23:1531-1536.
Kay, S., and Bonas, U. 2009. How Xanthomonas type III effectors manipulate the host plant. Curr. Opin. Microbiol. 12:37-43.
Kim, J. G., Taylor, K. W., and Mudgett, M. B. 2011. Comparative analysis
of the XopD type III secretion (T3S) effector family in plant pathogenic
bacteria. Mol. Plant Pathol. 12:715-730.
Kim, J. G., Stork, W., and Mudgett, M. B. 2013. Xanthomonas type III
effector XopD desumoylates tomato transcription factor SlERF4 to suppress ethylene responses and promote pathogen growth. Cell Host
Microbe 13:143-154.
King, E. O., Ward, M. K., and Raney, D. E. 1954. Two simple media for
the demonstration of pyocyanin and fluorescin. J. Lab. Clin. Med.
44:301-307.
Kvitko, B. H., Ramos, A. R., Morello, J. E., Oh, H. S., and Collmer, A.
2007. Identification of harpins in Pseudomonas syringae pv. tomato
DC3000, which are functionally similar to HrpK1 in promoting translocation of type III secretion system effectors. J. Bacteriol. 189:80598072.
Labes, M., Puhler, A., and Simon, R. 1990. A new family of RSF1010derived expression and lac-fusion broad-host-range vectors for gramnegative bacteria. Gene 89:37-46.
Levine, A., Tenhaken, R., Dixon, R., and Lamb, C. 1994. H2O2 from the
oxidative burst orchestrates the plant hypersensitive disease resistance
response. Cell 79:583-593.
Li, C., Potuschak, T., Colon-Carmona, A., Gutierrez, R. A., and Doerner,
P. 2005. Arabidopsis TCP20 links regulation of growth and cell division
control pathways. Proc. Natl. Acad. Sci. U.S.A. 102:12978-12983.
Lin, N. C., Abramovitch, R. B., Kim, Y. J., and Martin, G. B. 2006. Diverse
AvrPtoB homologs from several Pseudomonas syringae pathovars elicit
Pto-dependent resistance and have similar virulence activities. Appl.
Environ. Microbiol. 72:702-712.
Lindeberg, M. 2012. Genome-enabled perspectives on the composition,
evolution, and expression of virulence determinants in bacterial plant
pathogens. Annu. Rev. Phytopathol. 50:111-132.
Lindeberg, M., Stavrinides, J., Chang, J. H., Alfano, J. R., Collmer, A.,
Dangl, J. L., Greenberg, J. T., Mansfield, J. W., and Guttman, D. S.
2005. Proposed guidelines for a unified nomenclature and phylogenetic
analysis of type III Hop effector proteins in the plant pathogen Pseudomonas syringae. Mol. Plant-Microbe Interact. 18:275-282.
Lindeberg, M., Myers, C. R., Collmer, A., and Schneider, D. J. 2008.
Roadmap to new virulence determinants in Pseudomonas syringae: Insights from comparative genomics and genome organization. Mol.
Plant-Microbe Interact. 21:685-700.
Lindeberg, M., Cunnac, S., and Collmer, A. 2012. Pseudomonas syringae
type III effector repertoires: Last words in endless arguments. Trends
Livak, K. J., and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–∆∆CT method.
Methods 25:402-408.
Lopez-Solanilla, E., Bronstein, P. A., Schneider, A. R., and Collmer, A.
2004. HopPtoN is a Pseudomonas syringae Hrp (type III secretion system) cysteine protease effector that suppresses pathogen-induced necrosis associated with both compatible and incompatible plant interactions.
Mol. Microbiol. 54:353-365.
Mansfield, J. W. 2009. From bacterial avirulence genes to effector functions via the hrp delivery system: An overview of 25 years of progress
in our understanding of plant innate immunity. Mol. Plant Pathol.
10:721-734.
Matas, I. M., Lambertsen, L., Rodríguez-Moreno, L., and Ramos, C. 2012.
Identification of novel virulence genes and metabolic pathways required for full fitness of Pseudomonas savastanoi pv. savastanoi in
olive (Olea europaea) knots. New Phytol. 196:1182-1196.
Miller, J. H. 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, U.S.A.
Munkvold, K. R., Russell, A. B., Kvitko, B. H., and Collmer, A. 2009.
Pseudomonas syringae pv. tomato DC3000 type III effector HopAA1-1
functions redundantly with chlorosis-promoting factor PSPTO4723 to
produce bacterial speck lesions in host tomato. Mol. Plant-Microbe
Interact. 22:1341-1355.
Vol. 27, No. 5, 2014 / 435
Mur, L. A., Kenton, P., Lloyd, A. J., Ougham, H., and Prats, E. 2008. The
hypersensitive response; the centenary is upon us but how much do we
know? J. Exp. Bot. 59:501-520.
O’Brien, H. E., Thakur, S., Gong, Y., Fung, P., Zhang, J., Yuan, L., Wang,
P. W., Yong, C., Scortichini, M., and Guttman, D. S. 2012. Extensive
remodeling of the Pseudomonas syringae pv. avellanae type III secretome associated with two independent host shifts onto hazelnut. BMC
Microbiol. 12:141.
Oh, H. S., Park, D. H., and Collmer, A. 2010. Components of the Pseudomonas syringae type III secretion system can suppress and may elicit
plant innate immunity. Mol. Plant-Microbe Interact. 23:727-739.
Penyalver, R., García, A., Ferrer, A., Bertolini, E., Quesada, J. M.,
Salcedo, C. I., Piquer, J., Pérez-Panades, J., Carbonell, E. A., Del Rio,
C., Caballero, J. M., and López, M. M. 2006. Factors affecting Pseudomonas savastanoi pv. savastanoi plant inoculations and their use
for evaluation of Olive cultivar susceptibility. Phytopathology 96:313319.
Pérez-Martínez, I., Rodríguez-Moreno, L., Matas, I. M., and Ramos, C.
2007. Strain selection and improvement of gene transfer for genetic
manipulation of Pseudomonas savastanoi isolated from olive knots.
Res. Microbiol. 158:60-69.
Pérez-Martínez, I., Rodríguez-Moreno, L., Lambertsen, L., Matas, I.M.,
Murillo, J., Tegli, S., Jiménez, A.J., and Ramos, C. 2010. Fate of a
Pseudomonas savastanoi pv. savastanoi type III secretion system
mutant in olive plants (Olea europaea L.). Appl. Environ. Microbiol.
76:3611-3619.
Pfaffl, M. W. 2001. A new mathematical model for relative quantification
in real-time RT-PCR. Nucleic Acids Res. 29:e45.
Ramos, C., Matas, I. M., Bardaji, L., Aragón, I. M., and Murillo, J. 2012.
Pseudomonas savastanoi pv. savastanoi: Some like it knot. Mol. Plant
Pathol. 13:998-1009.
Rodríguez-Herva, J. J., González-Melendi, P., Cuartas-Lanza, R., AntúnezLamas, M., Rio-Alvarez, I., Li, Z., López-Torrejon, G., Díaz, I., Del
Pozo, J. C., Chakravarthy, S., Collmer, A., Rodríguez-Palenzuela, P.,
and López-Solanilla, E. 2012. A bacterial cysteine protease effector
protein interferes with photosynthesis to suppress plant innate immune
responses. Cell Microbiol. 14:669-681.
Rodríguez-Moreno, L., Barceló-Muñoz, A., and Ramos, C. 2008. In vitro
analysis of the interaction of Pseudomonas savastanoi pvs. savastanoi
and nerii with micropropagated olive plants. Phytopathology 98:815822.
Rodríguez-Moreno, L., Jiménez, A. J., and Ramos, C. 2009. Endopathogenic lifestyle of Pseudomonas savastanoi pv. savastanoi in olive
knots. Microb. Biotechnol. 2:476-488.
Rodríguez-Palenzuela, P., Matas, I. M., Murillo, J., López-Solanilla, E.,
Bardaji, L., Pérez-Martínez, I., Rodríguez-Moskera, M. E., Penyalver,
R., López, M. M., Quesada, J. M., Biehl, B. S., Perna, N. T., Glasner, J.
D., Cabot, E. L., Neeno-Eckwall, E., and Ramos, C. 2010. Annotation
and overview of the Pseudomonas savastanoi pv. savastanoi
NCPPB3335 draft genome reveals the virulence gene complement of a
tumour-inducing pathogen of woody hosts. Environ. Microbiol.
12:1604-1620.
Roine, E., Saarinen, J., Kalkkinen, N., and Romantschuk, M. 1997. Purified HrpA of Pseudomonas syringae pv. tomato DC3000 reassembles
into pili. FEBS (Fed. Eur. Biochem. Soc.) Lett. 417:168-172.
Rotenberg, D., Thompson, T. S., German, T. L., and Willis, D. K. 2006.
Methods for effective real-time RT-PCR analysis of virus-induced gene
silencing. J. Virol. Methods 138:49-59.
Sambrook, J., and Russell, D. 2001. Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY, U.S.A.
Schechter, L. M., Roberts, K. A., Jamir, Y., Alfano, J. R., and Collmer, A.
2004. Pseudomonas syringae type III secretion system targeting signals
and novel effectors studied with a Cya translocation reporter. J. Bacteriol. 186:543-555.
Schechter, L. M., Vencato, M., Jordan, K. L., Schneider, S. E., Schneider,
D. J., and Collmer, A. 2006. Multiple approaches to a complete inventory of Pseudomonas syringae pv. tomato DC3000 type III secretion
system effector proteins. Mol. Plant-Microbe Interact. 19:1180-1192.
Sory, M. P., and Cornelis, G. R. 1994. Translocation of a hybrid YopEadenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar,
S. 2011. MEGA5: Molecular evolutionary genetics analysis using
maximum likelihood, evolutionary distance, and maximum parsimony
methods. Mol. Biol. Evol. 28:2731-2739.
Thordal-Christensen, H., Zhang, Z., Wei, Y., and Collinge, D. B. 1997.
Subcellular localization of H2O2 in plants, H2O2 accumulation in papillae and hypersensitive response during barley-powdery mildew interaction. Plant J. 11:1187-1194.
Torres, M. A., and Dangl, J. L. 2005. Functions of the respiratory burst
oxidase in biotic interactions, abiotic stress and development. Curr.
Opin. Plant Biol. 8:397-403.
Underwood, W., Zhang, S., and He, S.Y. 2007. The Pseudomonas syringae
type III effector tyrosine phosphatase HopAO1 suppresses innate immunity in Arabidopsis thaliana. Plant J. 52:658-672.
van Dijk, K., Tam, V. C., Records, A. R., Petnicki-Ocwieja, T., and Alfano,
J. R. 2002. The ShcA protein is a molecular chaperone that assists in
the secretion of the HopPsyA effector from the type III (Hrp) protein
secretion system of Pseudomonas syringae. Mol. Microbiol. 44:14691481.
Vargas, P., Felipe, A., Michan, C., and Gallegos, M. T. 2011. Induction of
Pseudomonas syringae pv. tomato DC3000 MexAB-OprM multidrug
efflux pump by flavonoids is mediated by the repressor PmeR. Mol.
Plant-Microbe Interact. 24:1207-1219.
Vencato, M., Tian, F., Alfano, J. R., Buell, C. R., Cartinhour, S., DeClerck,
G. A., Guttman, D. S., Stavrinides, J., Joardar, V., Lindeberg, M.,
Bronstein, P. A., Mansfield, J. W., Myers, C. R., Collmer, A., and
Schneider, D. J. 2006. Bioinformatics-enabled identification of the
HrpL regulon and type III secretion system effector proteins of Pseudomonas syringae pv. phaseolicola 1448A. Mol. Plant-Microbe Interact.
19:1193-1206.
Vinatzer, B. A., Teitzel, G. M., Lee, M. W., Jelenska, J., Hotton, S., Fairfax,
K., Jenrette, J., and Greenberg, J. T. 2006. The type III effector repertoire of Pseudomonas syringae pv. syringae B728a and its role in survival and disease on host and non-host plants. Mol. Microbiol. 62:2644.
Xiao, Y., and Hutcheson, S. W. 1994. A single promoter sequence recognized by a newly identified alternate sigma factor directs expression of
pathogenicity and host range determinants in Pseudomonas syringae. J.
Bacteriol. 176:3089-3091.
Young, J. M. 2010. Taxonomy of Pseudomonas syringae. J. Plant Pathol.
92:S1.5-S1.14.
Zumaquero, A., Macho, A. P., Rufian, J. S., and Beuzón, C. R. 2010. Analysis of the role of the type III effector inventory of Pseudomonas syringae pv. phaseolicola 1448a in interaction with the plant. J. Bacteriol.
192:4474-4488.
AUTHOR-RECOMMENDED INTERNET RESOURCES
ASAP database: www.genome.wisc.edu/tools/asap.htm
Junta de Andalucía website: www.juntadeandalucia.es
Pfam database: pfam.sanger.ac.uk
Pseudomonas syringae genome resources home page:
www.pseudomonas-syringae.org
RESEARCH LETTER
New insights into the role of indole-3-acetic acid in the
virulence of Pseudomonas savastanoi pv. savastanoi
n1, Isabel Pe
rez-Martınez1, Alba Moreno-Pe
rez1, Miguel Cerezo2 & Cayo Ramos1
Isabel M. Arago
1
Area de Gen
etica, Facultad de Ciencias, Instituto de Hortofruticultura Subtropical y Mediterrnea “La Mayora”, Universidad de M
alaga-CSIC
(IHSM-UMA-CSIC), Malaga, Spain; and 2Plant Physiology Section, Departamento CAMN, Metabolic Integration & Cell Signalling Group,
n de La Plana, Spain
Universitat Jaume I, Castello
Correspondence: Isabel Perez-Martınez,
Area
de Gen
etica, Facultad de Ciencias,
Universidad de M
alaga, Campus de Teatinos,
Boulevard Louis Pasteur s/n, E-29010-Malaga,
Spain.
Tel.: +34 952131676;
fax: +34 952132001;
e-mail: iperezm@uma.es
Received 27 February 2014; accepted 28
February 2014.
DOI: 10.1111/1574-6968.12413
MICROBIOLOGY LETTERS
Editor: Bernard Glick
Keywords
indole-3-acetic acid; auxin; olive knot disease;
T3SS; T6SS.
Abstract
Indole-3-acetic acid (IAA) is a widespread phytohormone among plant-associated bacteria, including the tumour-inducing pathogen of woody hosts, Pseudomonas savastanoi pv. savastanoi. A phylogenetic analysis of the iaaM/iaaH
operon, which is involved in the biosynthesis of IAA, showed that one of the
two operons encoded by Pseudomonas savastanoi pv. savastanoi NCPPB 3335,
iaaM-1/iaaH-1, is horizontally transferred among bacteria belonging to the Pseudomonas syringae complex. We also show that biosynthesis of the phytohormone,
virulence and full fitness of this olive pathogen depend only on the functionality
of the iaaM-1/iaaH-1 operon. In contrast, the iaaM-2/iaaH-2 operon, which
carries a 22-nt insertion in the iaaM-2 gene, does not contribute to the production
of IAA by this bacterium. A residual amount of IAA was detected in the culture
supernatants of a double mutant affected in both iaaM/iaaH operons, suggesting
that a different pathway might also contribute to the total pool of the
phytohormone produced by this pathogen. Additionally, we show that exogenously
added IAA negatively and positively regulates the expression of genes related to the
type III and type VI secretion systems, respectively. Together, these results suggest
a role of IAA as a signalling molecule in this pathogen.
Introduction
Production of the phytohormone indol-3-acetic acid
(IAA) is common among plant-associated bacteria, and
this phytohormone can interfere with plant development
by disturbing the auxin balance in plants. Moreover, IAA
has been described as a signalling molecule that can
influence microbial gene expression, including that of
bacterial phytopathogens (Spaepen & Vanderleyden, 2010;
Patten et al., 2012). The best characterized IAA
biosynthetic pathway in phytopathogenic bacteria is the
indole-3-acetamide pathway. In this pathway, the genetic
determinants involved in the conversion of tryptophan
(Trp) to IAA are Trp monooxygenase (encoded by the
iaaM gene), which converts Trp to indoleacetamide
(IAM), and IAM hydrolase (encoded by the iaaH gene),
which catalyses the conversion of IAM to IAA.
Furthermore, the oleander pathogen Pseudomonas savastanoi pv. nerii (Psn) is also able to convert IAA to a less
biologically active compound, the amino acid conjugate
FEMS Microbiol Lett && (2014) 1–10
IAA–lysine (IAA–Lys), through expression of the iaaL
gene (Glass & Kosuge, 1986).
The iaaM/iaaH genes, which are best characterized in
phytopathogenic bacteria such as Agrobacterium spp. and
Pseudomonas savastanoi, have been proposed to have
originated from common ancestor genes in these two
species based on their amino acid sequences (Gielen
et al., 1984; Yamada et al., 1985, 1986; Inze et al., 1987).
In Psn, these two genes are encoded on plasmids. They
are co-transcribed in the same transcriptional unit, and
they are essential for gall formation in oleander and olive
(Comai & Kosuge, 1980; Yamada et al., 1985; Palm et al.,
1989; Gaffney et al., 1990). In contrast, P. savastanoi pv.
savastanoi (Psv, olive isolates) usually carries two copies
of both IAA genes on its chromosome (Perez-Martınez
et al., 2008). Psv NCPPB 3335 causes olive knot disease
and is a model bacterium in which to study the
molecular basis of pathogenesis and tumour formation in
woody hosts (Matas et al., 2012). This strain contains
two chromosomally encoded copies of the iaaM/iaaH
ª 2014 Federation of European Microbiological Societies.
Published by John Wiley & Sons Ltd. All rights reserved
n et al.
I.M. Arago
2
genes (Rodrıguez-Palenzuela et al., 2010), which are
organized into two operons called iaaM-1/iaaH-1 and
iaaM-2/iaaH-2. Additionally, the iaaM-2 gene has been
suggested to be a pseudogene that contains a premature
termination codon yielding a product of 142 amino acids
(Ramos et al., 2012). However, the specific role of each
of these two IAA operons in the pathogenicity and
virulence of Psv strains has not been reported to date.
In addition to the contribution of IAA in bacterial
phytopathogens in circumventing plant defence responses,
IAA can also directly affect bacterial physiology and
survival during plant infection (Spaepen & Vanderleyden,
2010). Examples of the signalling role of IAA in plantassociated bacteria include the upregulation of the type
III secretion system (T3SS) and the type VI secretion
system (T6SS) in the bacterial phytopathogen Dickeya
dadantii (Yang et al., 2007) and the rhizosphere bacterium Azospirillum brasilense (Van Puyvelde et al., 2011),
respectively. However, the role of IAA as a signalling
molecule in the Pseudomonas syringae complex, which
also includes P. savastanoi, has only been reported for the
synthesis of the virulence determinant syringomycin
(Mazzola & White, 1994).
In the present study, we investigated the functionality of
the two iaaM/iaaH operons present in the genome of Psv
NCPPB 3335 and their individual roles in virulence using
single and double DiaaMH mutants constructed by gene
replacement. Moreover, we report the effect of exogenously
added IAA on the transcription of virulence-related genes,
including the T3SS (hrpA and hrpL) and the T6SS (vgrG).
Materials and methods
Bacterial strains and culture conditions
Strains and plasmids used in this study are listed in Table 1.
The strains of Psv NCPPB 3335 and Escherichia coli were
grown at 28 and 37 °C, respectively, in Luria–Bertani (LB)
medium (Miller, 1972) or super optimal broth (SOB;
Hanahan, 1983). When required, antibiotics were added at
Table 1. Strains and plasmids used in this study
Strain/plasmid
Relevant characteristics
Reference or source
Strain
P. savastanoi pv. savastanoi
NCPPB 3335
ΔiaaMH-1
ΔiaaMH-2
ΔiaaMH-1.2
ΔiaaMH-1-Kms
ΔiaaMH-1.2-Kms
E. coli
DH5a
Wild-type strain
iaaM/iaaH-1 mutant (KmR)
iaaM/iaaH-2 mutant (KmR)
Double iaaM/iaaH mutant (KmR)
iaaM/iaaH-1 mutant
iaaM/iaaH-1 mutant
P
erez-Martınez et al. (2007)
This work
This work
This work
This work
This work
F -, /80dlacZ M15, (lacZYA-argF) U169, deoR, recA1, endA,
hsdR17 (rk - mk -), phoA, supE44, thi-1, gyrA96, relA1.
F -, ara-14, leuB6, thi-1, tonA31, lacY1, tsx-78, galK2, galT22,
glnV44, hisG4, rpsL136, xyl-5,mtl-1, dam13::Tn9, dcm-6,
mcrB1, hsdR2, mcrA, recF143. (SpR CmR).
Hanahan (1983)
GM2929
Plasmid
pGEM-T easy
pGEM-T-KmFRT- XhoI
pGEM-T-KmFRT- HindIII
pFLP2
pMP220
pGEM-T-DiaaMH1-Km
pGEM-T-DiaaMH2-Km
pMP220-PhrpL
pMP220-PhrpA
Cloning vector containing ori f1 and lacZ (ApR)
Contains KmR from pKD4 and XhoI sites (ApR KmR)
Contains KmR from pKD4 and HindIII sites (ApR KmR)
Contains a flipase gene (ApR)
Broad-host-range, low-copy-number promoter probe vector,
IncP replicon, lacZ (TcR)
pGEM-T derivative containing c. 1.2 kb on each side of
the iaaM/iaaH-1 operon from NCPPB 3335 interrupted
by the kanamycin resistance gene nptII (ApR, KmR).
pGEM-T derivative containing c. 1.2 kb on each side of
the iaaM/iaaH-2 operon from NCPPB 3335 interrupted
by the kanamycin resistance gene nptII (ApR, KmR).
Contains a fragment of 270 bp corresponding with
the hrpL promoter from NCPPB 3335 directionally
cloned in pMP220 using EcoRI
Contains a fragment of 245 bp corresponding with
the hrpA promoter from NCPPB 3335 directionally
cloned in pMP220 using EcoRI
Palmer & Marinus (1994)
Promega, Madison, WI
Zumaquero et al. (2010)
This work
Hoang et al. (1998)
Spaink et al. (1987)
This work
This work
This work
This work
3
Role of IAA in the virulence of P. savastanoi pv. savastanoi
the following concentrations. For E. coli: ampicillin
100 lg mL1, kanamycin 50 lg mL1 and tetracycline
10 lg mL1. For P. savastanoi: ampicillin 300 lg mL1,
kanamycin 10 lg mL1, and tetracycline 10 lg mL1.
When relevant, 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-Gal) was added to a final concentration of
0.02%.
Construction of Psv mutants
To construct the single mutants DiaaMH-1 and DiaaMH-2,
a fragment of c. 2 kb was removed from the iaaM/iaaH
operon. To construct the plasmids pGEM-T-DiaaMH1 and
pGEM-T-DiaaMH2, the upstream and downstream fragments of the region to be deleted were cloned into the
pGEM-T Easy Vector (Table 1) as described by Matas et al.
(2014). Later, the nptII kanamycin resistance gene obtained
from pGEM-T-KmFRT-XhoI and pGEM-T-KmFRT-HindIII
(Table 1) was introduced into these plasmids, yielding pGEM-T-DiaaMH1-Km and pGEM-T-DiaaMH2-Km,
respectively (Table 1). Finally, for marker exchange mutagenesis (Supporting Information, Fig. S1), each plasmid was
transformed by electroporation into NCPPB 3335 as
described previously (Perez-Martınez et al., 2007). Screening
and verification of the mutants was carried out as previously
described (Matas et al., 2014).
The double mutant DiaaMH-1.2 was generated using the
DiaaMH-1 single mutant, in which the kanamycin gene
was removed using the pFLP2 plasmid (Zumaquero et al.,
2010). Then, a DiaaMH1-KmS clone was transformed with
the pGEM-T-DiaaMH2-Km plasmid for marker exchange
mutagenesis to obtain the double mutant.
Transcription initiation mapping by 50 cRACE
The transcription start point of the iaaM-1/iaaH-1
operon was determined using a system for rapid amplification of cDNA ends (50 cRACE; Filiatrault et al., 2011).
Total RNA from wild-type Psv NCPPB 3335 was obtained
as previously described (Matas et al., 2014). One microgram of this RNA was used as a template to synthesize
the first-strand cDNA, using the synthesis kit SMARTTM
RACE cDNA Amplification (Clontech, Mountain View,
CA) and iaaM-1-specific primers designed to anneal
within the coding region of this allele and not iaaM-2.
All reactions were performed according to the manufacturer’s instructions. The amplification products were
cloned into the pGEM-T Easy Vector and sequenced.
added tryptophan was collected and acidified to pH 2.5–
3.0 with 1 M HCl. Then, the supernatant was mixed with
the same volume of ethyl acetate and incubated under
shaking conditions for 30 min at room temperature.
Finally, the extracted ethyl acetate fraction was evaporated
at room temperature, and the pellet was resuspended in
1 mL MeOH/H2O (10 : 90; v/v), filtered (0.2 lm) and
injected into the HPLC machine. The analyses were
carried out using a SunFire HPLC system with C18 analytical column, 5 lm particle size, 2.1 9 100 mm
(Waters). The chromatographic system was interfaced to
a triple quadrupole mass spectrometer (TQD, Waters,
Manchester, UK). MASSLYNX NT version 3.4 (Micromass)
was used to process the quantitative data from the
calibration standards and bacterial samples. IAA
quantities were normalized using the dry weight (DW) of
a 2-mL bacterial pellet, which was obtained by complete
drying for 1 h at 80 °C.
Plant infection and isolation of bacteria from
olive knots
Olive plants were micropropagated, rooted and maintained as previously described (Rodrıguez-Moreno et al.,
2008). Micropropagated plants were infected in the stem
wound with a bacterial suspension (c. 103 CFU) and
incubated for 30 days in a growth chamber as described
by Rodrıguez-Moreno et al. (2008). The morphology of
the olive plants infected with bacteria was visualized using
a stereoscopic microscope (Leica MZ FLIII; Leica
Microsystems, Wetzlar, Germany). Knot volume was
quantified using a three-dimensional scanner, and MINIMAGICS 2.0 software. The competitive index (CI) between the
wild-type and the iaaMH mutants was determined as
described previously (Rodrıguez-Moreno et al., 2008;
Matas et al., 2012). To analyse the pathogenicity of
P. savastanoi isolates in 1-year-old olive explants (lignified
plants), the plants were maintained and inoculated
according to previously described methods (Penyalver
et al., 2006; Perez-Martınez et al., 2007; Matas et al.,
2012). Morphological changes, scored at 90 days postinfection (d.p.i.), were captured with a high-resolution
digital camera (Canon D600; Canon Inc., Tokyo, Japan).
Knot volume was calculated as previously reported
(Moretti et al., 2008; Hosni et al., 2011). Statistical data
analysis was performed by ANOVA followed by Student’s ttest (P ≤ 0.05).
b-Galactosidase assays
Quantification of IAA production
For the IAA extraction for HPLC, 2 mL of the supernatant from liquid cultures grown in LB medium without
The transcriptional fusions of the T3SS-related genes,
hrpA (structural gene encoding Hrp pilin) and hrpL (a
regulatory gene encoding an alternative sigma factor)
4
promoters, to lacZ were constructed by PCR amplification using NCPPB 3335 genomic DNA and the forward
and reverse primers shown in Supporting Information,
Table S1. The resulting DNA fragments were EcoRIdigested and cloned into pMP220 to generate the plasmids pMP220-PhrpA and pMP220-PhrpL (Table 1). PCR
using the forward primer specific for each promoter and
pMP220-R was carried out to confirm that the promoters
were directionally cloned in pMP220. Preinocula of bacterial strains harbouring the relevant plasmids were grown
overnight in LB. The next day, the cells were diluted to
an OD600 of 0.05 and grown to an OD600 of 0.5. At this
point, total cells were pelleted, washed twice with 10 mM
MgCl2 and resuspended in 5 mL of Hrp-inducing medium (Huynh et al., 1989) in the presence or absence of
1 mM IAA. No changes in the pH of this medium (pH
5.7) were observed after addition of IAA. b-Galactosidase
activity was measured after 2, 6 and 24 h of incubation
in this medium, as previously described (Miller, 1972).
Quantitative RT-PCR assays
Quantitative real-time PCR (qRT-PCR) assays in Psv
NCPPB 3335 were performed in the same conditions as
those used for the b-galactosidase assays. RNA extraction
was carried out after 6 h of incubation in the Hrp-inducing
medium. The cells were pelleted and processed for RNA
isolation using TriPure Isolation Reagent (Roche Applied
Science, Mannheim, Germany) as described previously
(Matas et al., 2014). cDNA synthesis and qRT-PCR assays
were as described by Matas et al. (2014). Transcriptional
data were normalized to the housekeeping gene gyrA. qRTPCR reactions were performed in triplicate.
Results and discussion
Horizontal transfer of the iaaM/iaaH operon in
the P. syringae complex
IAA is synthesized in P. savastanoi through the indole-3acetamide pathway, which involves the genetic determinants iaaM and iaaH (Fig. 1a). Two different alleles of
each of these genes were found in the chromosome of
Psv NCPPB 3335, organized in two operons (iaaM-1/
iaaH-1 and iaaM-2/iaaH-2; Rodrıguez-Palenzuela et al.,
2010; Fig. 1c), which are located at a distance of about
670 kb (data not shown). A nucleotide sequence alignment of the complete iaaM/iaaH operons (from the start
codon of the iaaM gene to the stop codon of the iaaH
gene) encoded by NCPPB 3335 revealed 92% identity
between them (the percentage identity between iaaM-1
and iaaM-2 and between iaaH-1 and iaaH-2 was 92%
and 93%, respectively). In addition, a comparative
n et al.
I.M. Arago
phylogenetic study of the same nucleotide fragment was
performed using all available bacterial genomes. Those
sequences showing an identity lower than 40% with
NCPPB 3335 were not included in this analysis. The
iaaM/iaaH operon was found in five different groups of
plant-pathogenic bacteria, i.e. the Pseudomonas syringae
complex, Pantoea spp., Burkholderia spp., Dickeya spp.
and Agrobacterium spp. In fact, all these bacteria have
recently been included in Group I of iaaM-like sequences
(Patten et al., 2012). According to these authors, Group I
can be clearly distinguished from Group II, which
includes many other bacterial species encoding a divergent Trp-monooxygenase. In general, the phylogeny of
the iaaM/iaaH sequences is largely congruent with the
phylogeny deduced from housekeeping genes (Ramos
et al., 2012), suggesting that this operon is ancestral
within these bacterial groups. However, the clustering of
iaaM-2/iaaH-2 from Psv NCPPB 3335 (genomospecies 2)
with P. syringae pv. aceris M302273PT and P. syringae pv.
syringae B728a (genomospecies 1; Fig. 1b) is consistent
with the possibility of horizontal gene transfer. This result
is not surprising given that the iaaM/iaaH operon is
often found in several copies and located in plasmids
(Caponero et al., 1995; Perez-Martınez et al., 2008). In
contrast, the clustering of the NCPPB 3335 iaaM-1/iaaH1 operon with Psn and P. syringae pv. glycinea (genomospecies 2) is consistent with the phylogeny of the iaaL-1
gene reported by Ramos et al. (2012). This gene is located
upstream of the iaaM-1/iaaH-1 operon in NCPPB 3335
(Matas et al., 2009). Co-evolution and recent stabilization
of the plasmid-encoded Psn fragment containing all three
genes (iaaM, iaaH and iaaL) in the genome of Psv have
been proposed (Matas et al., 2009). In agreement with
this hypothesis, the transcription start site of the iaaM-1/
iaaH-1 operon in Psv NCPPB 3335, determined by
50 cRACE, was located within the ORF of an IS4 transposase gene 401 bp upstream of the iaaM-1 start codon
(Fig. 1c). This site is almost coincident (1 bp further
upstream) with the transcription initiation site predicted
for this operon in Psn (Gaffney et al., 1990). Moreover,
the 10 and 35 promoter regions previously described
in Psn (Gaffney et al., 1990) were found upstream of the
+1 site identified for the iaaM-1/iaaH-1 operon in Psv
NCPPB 3335. Taking into account that the iaaM-2 gene
has been shown to be a pseudogene (Ramos et al., 2012),
the transcription start site of the iaaM-2/iaaH-2 operon
was not identified in this study.
Production of IAA in Psv NCPPB 3335 mainly
depends on the iaaM-1/iaaH-1 operon
To determine the individual roles of the iaaM/iaaH
operons in the biosynthesis of IAA by Psv NCPPB 3335,
5
(a)
(b)
(c)
Fig. 1. Biosynthetic pathway, gene organization and distribution of the iaaM/iaaH operon in bacteria. (a) IAA is synthesized from L-tryptophan by
the enzymes 2-monooxygenase (IaaM) and indoleacetamide hydrolase (IaaH). (b) Phylogenetic tree of iaaM/iaaH homologues present in the
bacterial strains already sequenced. Asterisks indicate sequences that have been confirmed experimentally to function in IAA synthesis. The locus
tags or accession numbers of the nucleotide sequences used are shown in Table S2. Sequence alignment was using Muscle, and determination
of the optimal nucleotide substitution model and phylogenetic tree construction were conducted using MEGA5 (Tamura et al., 2011). Bootstrap
values (1000 repetitions) are shown on the branches. Similar or identical topologies were obtained using maximum-likelihood. The scale bar
represents nucleotide substitutions per site. (c) Schematic map of the two iaaM/iaaH operons in Psv NCPPB 3335. The promoter of the iaaM-1/
iaaH-1 operon located inside the transposase IS4 is indicated with a black arrow. Upstream of iaaM-2/iaaH-2, a putative pyruvate
aminotransferase (PSA3335_1016) is located. The double line shows the position of the 22-nt insertion in the iaaM-2 gene.
single (DiaaMH-1 and DiaaMH-2) and double (DiaaMH1.2) knockout mutants were constructed by gene replacement (Fig. 1c). Psv NCPPB 3335 and all three mutants
were grown on LB medium to the stationary phase, and
IAA was extracted from the culture supernatants and
quantified by HPLC. The level of IAA in the culture supernatants of the DiaaMH-1 and DiaaMH-1.2 mutants
was c. 40 times lower than the level in the wild-typestrain (5565 lg g1 DW). However, a residual amount of
IAA was found in the culture supernatants of these two
strains. Moreover, no significant differences were found
between the DiaaMH-2 mutant and the wild-type strain
(Fig. 2), suggesting that the iaaM-2/iaaH-2 operon does
not contribute to the pool of IAA produced by Psv
NCPPB 3335. In fact, transcription analysis of the iaaM-2
gene performed by qRT-PCR indicated that this gene is
not expressed in Psv cells grown in LB medium (data not
shown). Furthermore, the residual amounts of IAA (120
and 167 lg g1 DW) detected in cultures of DiaaMH-1
and DiaaMH-1.2, respectively, might indicate the existence of an additional IAA biosynthetic pathway in Psv
NCPPB 3335. Redundancy in IAA biosynthetic pathways
has been previously predicted in other microorganisms
after the inactivation of a single pathway (Patten et al.,
2012).
Contribution of the iaaM-1/iaaH-1 operon to
the virulence and fitness of Psv NCPPB 3335 in
olive plants
To determine the role of the Psv NCPPB 3335 operons in
the virulence and fitness of this pathogen in olive plants,
we analysed the ability of the single mutants (DiaaMH-1
and DiaaMH-2) and the double mutant (DiaaMH-1.2) to
cause olive knot symptoms and maintain fitness in the
olive plant. Fitness attenuation and knot size reduction
6
Fig. 2. IAA quantification in the iaaMH mutants by HPLC.
Quantification of total IAA produced by iaaMH mutants and the wildtype strain after growing for 24 h in LB medium at 28 °C. Data are
represented as lg IAA per g DW of bacterial cells. Each bar is the
mean of three biological replicates, and the error bars represent
standard deviation.
have been commonly used to describe hypovirulent
mutants in Psv (Rodrıguez-Moreno et al., 2008; Matas
et al., 2012). Mixed infections using the wild-type strain
and each of the mutants were prepared to calculate the
CI on in vitro olive plants at 30 d.p.i. The results showed
that the CI values obtained for the wild-type strain and
each of the ΔiaaMH-1 and ΔiaaMH-1.2 mutants were significantly lower than 1, indicating that these mutants
were outcompeted by the wild-type strain in planta. Conversely, this value was not significantly different from one
in the competition assay between the ΔiaaMH-2 mutant
and the wild-type strain, revealing that the iaaM-2/iaaH-2
operon is not required for the full fitness of Psv NCPPB
3335 (Fig. 3).
Fig. 3. Competition assays of iaaMH mutants in olive plants.
Competitive index values for mixed inoculations of Psv NCPPB 3335
and its derivative strains in micropropagated olive plants. Error bars
indicate the standard error from the average of three different assays.
Asterisks indicate values significantly different from 1. Statistical
analyses were performed using Student0 s t-test with a threshold of
P = 0.05.
n et al.
I.M. Arago
All the strains were inoculated independently on in
vitro-grown and 1-year-old olive plants, and disease severity was evaluated after 30 or 90 d.p.i., respectively. In both
plant systems, the symptoms developed upon infection
with the DiaaMH-1 and DiaaMH-1.2 mutants were visually
less severe than those induced by the wild-type strain and
the DiaaMH-2 mutant (Fig. 4a and b). Additionally, the
knot volumes in olive plants infected with the DiaaMH-1
and DiaaMH-1.2 mutants were approximately eight times
smaller (in vitro-grown olive plants, Fig. 4a, bottom) and
16 times smaller (lignified olive plants, Fig. 4b, bottom),
respectively, of the knot volume of plants infected with the
wild-type strain. Together, these results show that the
iaaM-2/iaaH-2 operon encoded by Psv NCPPB 3335 does
not contribute to IAA biosynthesis or the induction of
symptoms in olive plants. Moreover, these results suggest
that the redundancy of IAA biosynthetic genes in some Psv
strains (Perez-Martınez et al., 2008) does not affect the
total amount of IAA produced or the full virulence and
fitness of the pathogen in olive plants. Nevertheless, a comparative virulence analysis with other Psv strains and a
functional analysis of their iaaM/iaaH operons is necessary
to verify this hypothesis.
Exogenous IAA affects the expression of
virulence-related genes in Psv
IAA has been described as a signalling molecule that
affects the expression of virulence factors, such as the
T3SS and T6SS, and IAA biosynthesis in several plantassociated bacteria (Spaepen & Vanderleyden, 2010; Van
Puyvelde et al., 2011; Patten et al., 2012). Previous studies
on Psv NCPPB 3335 demonstrated that the T3SS-related
genes, hrpA and hrpL, are required for infection establishment and knot formation on olive plants (Perez-Martinez
et al., 2010; Matas et al., 2014). To investigate a possible
link between IAA and the T3SS in Psv, we monitored
expression of the hrpA and hrpL genes using transcriptional fusions of their corresponding promoter regions to
the lacZ gene. Psv NCPPB 3335 cells grown to the
exponential phase expressing each of these fusions were
transferred to Hrp-inducing medium lacking IAA or
containing 1 mM IAA. The expression of T3SS-related
genes in P. syringae and related pathogens is usually
analysed in this medium, which is widely believed to
mimic the apoplastic environment (Rico & Preston,
2008). However, the production of IAA by Psv NCPPB
3335 under these conditions was negligible (data not
shown). Thus, a comparison of the expression of the
T3SS promoters in the wild-type strain vs. the Diaa
mutants could not be performed. To circumvent this limitation, we analysed the expression of the promoters in
the wild-type strain transferred to Hrp-inducing medium
7
(a)
(b)
Fig. 4. Virulence assay of iaaMH mutants on
young micropropagated and lignified olive
plants. Knots were induced in vitro (a) and on
lignified (b) olive plants by the indicated strains
30 and 90 d.p.i., respectively. Below the
pictures, the average volume of at least three
knots is represented with their corresponding
standard deviations. The total volume is
indicated in mm3.
lacking IAA or supplemented with IAA. In agreement
with expression analysis previously reported for other Psv
genes (Matas et al., 2014), the highest differences were
observed 6 h after transfer to Hrp-inducing medium. In
the presence of IAA, the expression levels of hrpA and
hrpL were c. 77 and seven times lower, respectively, than
those in the absence of this compound, indicating that
IAA had a negative effect on the expression of the T3SS
genes (Fig. 5a). Similar differences in the b-galactosidase
activities of these promoters were observed after 24 h
(data not shown). Additionally, qRT-PCR experiments
were carried out under the same culture conditions used
for the b-galactosidase assays. In these assays, we also
(a)
analysed the expression of hrpA and hrpL, as well as vgrG,
a gene related to the T6SS, and iaaL, a gene involved in
the biosynthesis of IAA-Lys in Psn (Glass & Kosuge,
1988), which contains an hrp box promoter sequence recognized by the alternative sigma factor HrpL (Fouts et al.,
2002). In the presence of IAA, and in agreement with the
b-galactosidase assays (Fig. 5a), the total amount of hrpA
and hrpL transcripts was reduced 40- and 25-fold, respectively, compared with their levels in the absence of IAA
(Fig. 5b). Interestingly, the level of expression of the iaaL
gene was similar in the presence and absence of IAA
(Fig. 5b). Taking into account the possible dependency of
the expression of this gene on HrpL (Fouts et al., 2002),
(b)
Fig. 5. Differential expression of virulence-related genes in Psv NCPPB 3335 upon exogenous IAA treatment. (a) b-Galactosidase activity of PhrpA
and PhrpL in Psv NCPPB 3335 6 h after transfer to Hrp-inducing medium without IAA [IAA (–)] and with 1 mM IAA [IAA (+)]. Psv NCPPB 3335
transformed with the empty vector was included as a negative control. The results were obtained from triplicate analysis. Error bars represent the
standard deviation. (b) The expression of the indicated Psv NCPPB 3335 genes measured by qRT-PCR in the wild-type strain after transfer to Hrpinducing medium with IAA vs. without IAA. The fold change was calculated after normalization using the gyrA gene as an internal control. The
results represent the means from three independent experiments. Error bars represent standard deviations. Asterisks indicate significant
differences (P = 0.05) between the values obtained for the different conditions.
8
the low level of transcripts of the hrpL gene observed in
the presence of IAA does not seem to affect the levels of
iaaL transcripts. Nevertheless, the expression and function
of the iaaL gene remain to be investigated in Psv.
Conversely, the transcript levels of vgrG doubled in the
presence of IAA, indicating a positive effect of IAA on
the expression of the T6SS in Psv. A similar effect on the
transcript levels of T6SS genes has been reported in Azospirillum brasilense by the addition of exogenous IAA
(Van Puyvelde et al., 2011).
Concluding remarks
The phytohormone IAA plays an essential role in the virulence of bacterial phytopathogens, including the olive
pathogen Psv. Here we show that the biosynthesis of IAA
in this pathogen mainly depends on one of its two chromosomally encoded iaaM/iaaH operons (iaaM-1/iaaH-1),
a gene cluster horizontally transferred among bacteria
belonging to the P. syringae complex. We also demonstrate that the full fitness and virulence of Psv in olive
plants depends on the functionality of this operon. Moreover, we show that IAA acts as a signalling molecule in
Psv, affecting the expression of other virulence-related
genes such as the T3SS and the T6SS.
Acknowledgements
This research was supported by the Spanish Plan Nacional I+D+I grants AGL2011-30343-CO2-01 and AGL-201239923-CO2-02, as well as grants ref. P08-CVI-03475 and
P10-AGR-05797 from the Junta de Andalucía. I.M.A. was
supported by an FPU fellowship (Ministerio de Ciencia e
Innovaci
on/Ministerio de Economía y Competitividad,
Spain). We thank Manuela Vega (SCAI, UMA) for assistance with the image analysis of knot volumes. We are
grateful to A. Barcel
o (IFAPA, Churriana, Spain) and
J. M. Sanchez Pulido (CSIC-La Mayora, Malaga, Spain)
for the plant material. M. Castillo-Lizardo is acknowledged for help with plasmid constructions. Pablo Garcıa
is gratefully acknowledged for technical help. We thank
the SCIC (Universitat Jaume I) for its technical support.
References
Caponero A, Contesini AM & Iacobellis NS (1995) Population
diversity of Pseudomonas syringae subsp. savastanoi on olive
and oleander. Plant Pathol 44: 848–855.
Comai L & Kosuge T (1980) Involvement of plasmid
deoxyribonucleic acid in indoleacetic acid synthesis in
Pseudomonas savastanoi. J Bacteriol 143: 950–957.
Filiatrault MJ, Stodghill PV, Myers CR et al. (2011)
Genome-wide identification of transcriptional start sites in
n et al.
I.M. Arago
the plant pathogen Pseudomonas syringae pv. tomato str.
DC3000. PLoS One 6: e29335.
Fouts DE, Abramovitch RB, Alfano JR et al. (2002)
Genomewide identification of Pseudomonas syringae pv.
tomato DC3000 promoters controlled by the HrpL
alternative sigma factor. P Natl Acad Sci USA 99: 2275–
2280.
Gaffney TD, da Costa e Silva O, Yamada T & Kosuge T (1990)
Indoleacetic acid operon of Pseudomonas syringae subsp.
savastanoi: transcription analysis and promoter
identification. J Bacteriol 172: 5593–5601.
Gielen J, De Beuckeleer M, Seurinck J, Deboeck F, De Greve
H, Lemmers M, Van Montagu M & Schell J (1984) The
complete nucleotide sequence of the TL-DNA of the
Agrobacterium tumefaciens plasmid pTiAch5. EMBO J 3:
835–846.
Glass NL & Kosuge T (1986) Cloning of the gene for
indoleacetic acid-lysine synthetase from Pseudomonas
syringae subsp. savastanoi. J Bacteriol 166: 598–603.
Glass NL & Kosuge T (1988) Role of indoleacetic acid-lysine
synthetase in regulation of indoleacetic acid pool size and
virulence of Pseudomonas syringae subsp. savastanoi. J
Bacteriol 170: 2367–2373.
Hanahan D (1983) Studies on transformation of Escherichia
coli with plasmids. J Mol Biol 166: 557–580.
Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ & Schweizer
HP (1998) A broad-host-range Flp-FRT recombination
system for site-specific excision of chromosomally-located
DNA sequences: application for isolation of unmarked
Pseudomonas aeruginosa mutants. Gene 212: 77–86.
Hosni T, Moretti C, Devescovi G, Suarez-Moreno ZR, Fatmi
MB, Guarnaccia C, Pongor S, Onofri A, Buonaurio R &
Venturi V (2011) Sharing of quorum-sensing signals and
role of interspecies communities in a bacterial plant disease.
ISME J 5: 1857–1870.
Huynh TV, Dahlbeck D & Staskawicz BJ (1989) Bacterial
blight of soybean: regulation of a pathogen gene
determining host cultivar specificity. Science 245: 1374–1377.
Inze D, Follin A, Velten J, Velten L, Prinsen E, Rudelsheim P,
Van Onckelen H, Schell J & Van Montagu M (1987) The
Pseudomonas savastanoi tryptophan-2-mono-oxygenase is
biologically active in Nicotiana tabacum. Planta 172: 555–
562.
Matas IM, Perez-Martınez I, Quesada JM, Rodrıguez-Herva JJ,
Penyalver R & Ramos C (2009) Pseudomonas savastanoi pv.
savastanoi contains two iaaL paralogs, one of which exhibits
a variable number of a trinucleotide (TAC) tandem repeat.
Appl Environ Microbiol 75: 1030–1035.
Matas IM, Lambertsen L, Rodrıguez-Moreno L & Ramos C
(2012) Identification of novel virulence genes and metabolic
pathways required for full fitness of Pseudomonas savastanoi
pv. savastanoi in olive (Olea europaea) knots. New Phytol
196: 1182–1196.
Matas IM, Casta~
neda-Ojeda MP, Arag
on IM, Ant
unez-Lamas
M, Murillo J, Rodriquez-Palenzuela P, Lopez-Solanilla E &
Ramos C (2014) Translocation and functional analysis of
9
Pseudomonas savastanoi pv. savastanoi NCPPB 3335 type III
secretion system effectors reveals two novel effector families
of the Pseudomonas syringae complex. Mol Plant Microbe
Interact doi: 101094/MPMI-07-13-0206-R.
Mazzola M & White FF (1994) A mutation in the
indole-3-acetic acid biosynthesis pathway of Pseudomonas
syringae pv. syringae affects growth in Phaseolus vulgaris and
syringomycin production. J Bacteriol 176: 1374–1382.
Miller JH (1972) Experiments in Molecular Genetics. Cold
Spring Harbor Laboratory, Cold Spring Harbor, NY.
Moretti C, Ferrante P, Hosni T, Valentini F, D’Onghia A,
Fatmi MB & Buonaurio R (2008) Characterization of
Pseudomonas savastanoi pv. savastanoi strains collected from
olive trees in different countries. Pseudomonas syringae
Pathovars and Related Pathogens – Identification,
Epidemiology and Genomics (Fatmi MB, Collmer A,
Iacobellis N, Mansfield J, Murillo J, Schaad N & Ullrich M,
eds), pp. 321–329. Springer, Dordrecht.
Palm CJ, Gaffney T & Kosuge T (1989) Cotranscription of
genes encoding indoleacetic acid production in Pseudomonas
syringae subsp. savastanoi. J Bacteriol 171: 1002–1009.
Palmer BR & Marinus MG (1994) The dam and dcm strains
of Escherichia coli – a review. Gene 143: 1–12.
Patten CL, Blakney AJ & Coulson TJ (2012) Activity,
distribution and function of indole-3-acetic acid
biosynthetic pathways in bacteria. Crit Rev Microbiol 39:
395–415.
Penyalver R, Garcıa A, Ferrer A et al. (2006) Factors affecting
Pseudomonas savastanoi pv. savastanoi plant inoculations
and their use for evaluation of Olive cultivar susceptibility.
Phytopathology 96: 313–319.
Perez-Martinez I, Rodriguez-Moreno L, Lambertsen L, Matas
IM, Murillo J, Tegli S, Jimenez AJ & Ramos C (2010) Fate
of a Pseudomonas savastanoi pv. savastanoi type III secretion
system mutant in olive plants (Olea europaea L.). Appl
Environ Microbiol 76: 3611–3619.
Perez-Martınez I, Rodrıguez-Moreno L, Matas IM & Ramos C
(2007) Strain selection and improvement of gene transfer
for genetic manipulation of Pseudomonas savastanoi isolated
from olive knots. Res Microbiol 158: 60–69.
Perez-Martınez I, Zhao Y, Murillo J, Sundin GW & Ramos C
(2008) Global genomic analysis of Pseudomonas savastanoi
pv. savastanoi plasmids. J Bacteriol 190: 625–635.
Ramos C, Matas IM, Bardaji L, Arag
on IM & Murillo J (2012)
Pseudomonas savastanoi pv. savastanoi: some like it knot.
Mol Plant Pathol 13: 998–1009.
Rico A & Preston GM (2008) Pseudomonas syringae pv.
tomato DC3000 uses constitutive and apoplast-induced
nutrient assimilation pathways to catabolize nutrients that
are abundant in the tomato apoplast. Mol Plant Microbe
Interact 21: 269–282.
Rodrıguez-Moreno L, Barcel
o-Munoz A & Ramos C (2008) In
vitro analysis of the interaction of Pseudomonas savastanoi
pvs. savastanoi and nerii with micropropagated olive plants.
Phytopathology 98: 815–822.
Rodrıguez-Palenzuela P, Matas IM, Murillo J et al. (2010)
Annotation and overview of the Pseudomonas savastanoi pv.
savastanoi NCPPB 3335 draft genome reveals the virulence
gene complement of a tumour-inducing pathogen of woody
hosts. Environ Microbiol 12: 1604–1620.
Spaepen S & Vanderleyden J (2010) Auxin and plant-microbe
interactions. Cold Spring Harb Perspect Biol 3: 1–13.
Spaink HP, Okker RJH, Wijffelman CA, Pees E & Lugtenberg
BJJ (1987) Promoters in the nodulation region of the
Rhizobium leguminosarum Sym plasmid pRL1JI. Plant Mol
Biol 9: 27–39.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M &
Kumar S (2011) MEGA5: molecular evolutionary genetics
analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Mol Biol Evol 28: 2731–
2739.
Van Puyvelde S, Cloots L, Engelen K, Das F, Marchal K,
Vanderleyden J & Spaepen S (2011) Transcriptome analysis
of the rhizosphere bacterium Azospirillum brasilense reveals
an extensive auxin response. Microb Ecol 61: 723–728.
Yamada T, Palm CJ, Brooks B & Kosuge T (1985) Nucleotide
sequences of the Pseudomonas savastanoi indoleacetic acid
genes show homology with Agrobacterium tumefaciens
T-DNA. P Natl Acad Sci USA 82: 6522–6526.
Yamada T, Lee PD & Kosuge T (1986) Insertion sequence
elements of Pseudomonas savastanoi: nucleotide sequence
and homology with Agrobacterium tumefaciens transfer
DNA. P Natl Acad Sci USA 83: 8263–8267.
Yang S, Zhang Q, Guo J, Charkowski AO, Glick BR, Ibekwe
AM, Cooksey DA & Yang CH (2007) Global effect of
indole-3-acetic acid biosynthesis on multiple virulence
factors of Erwinia chrysanthemi 3937. Appl Environ Microbiol
73: 1079–1088.
Zumaquero A, Macho AP, Rufian JS & Beuzon CR (2010)
Analysis of the role of the type III effector inventory of
Pseudomonas syringae pv. phaseolicola 1448a in interaction
with the plant. J Bacteriol 192: 4474–4488.
Supporting Information
Additional Supporting Information may be found in the
online version of this article:
Fig. S1. Strategy for the construction of the mutant DiaaMH-1 in Psv NCPPB 3335 by gene replacement.
Table S1. Oligonucleotides used in this study.
Table S2. Locus Tag/Accession numbers for the iaaM and
iaaH genes used for the construction of the NJ tree
shown in Fig. 1c.
Responses to Elevated c-di-GMP Levels in Mutualistic
and Pathogenic Plant-Interacting Bacteria
Daniel Pérez-Mendoza1, Isabel M. Aragón2, Harold A. Prada-Ramı́rez1, Lorena Romero-Jiménez1,
Cayo Ramos2, Marı́a-Trinidad Gallegos1, Juan Sanjuán1*
1 Dpto. Microbiologı́a del Suelo y Sistemas Simbióticos, Estación Experimental del Zaidı́n, CSIC, Granada, Spain, 2 Área de Genética, Universidad de Málaga, Instituto de
Hortofruticultura Subtropical y Mediterránea ‘‘La Mayora’’, Universidad de Málaga-CSIC (IHSM-UMA-CSIC), Málaga, Spain
Abstract
Despite a recent burst of research, knowledge on c-di-GMP signaling pathways remains largely fragmentary and molecular
mechanisms of regulation and even c-di-GMP targets are yet unknown for most bacteria. Besides genomics or
bioinformatics, accompanying alternative approaches are necessary to reveal c-di-GMP regulation in bacteria with complex
lifestyles. We have approached this study by artificially altering the c-di-GMP economy of diverse pathogenic and
mutualistic plant-interacting bacteria and examining the effects on the interaction with their respective host plants.
Phytopathogenic Pseudomonas and symbiotic Rhizobium strains with enhanced levels of intracellular c-di-GMP displayed
common free-living responses: reduction of motility, increased production of extracellular polysaccharides and enhanced
biofilm formation. Regarding the interaction with the host plants, P. savastanoi pv. savastanoi cells containing high c-di-GMP
levels formed larger knots on olive plants which, however, displayed reduced necrosis. In contrast, development of disease
symptoms in P. syringae-tomato or P. syringae-bean interactions did not seem significantly affected by high c-di-GMP. On
the other hand, increasing c-di-GMP levels in symbiotic R. etli and R. leguminosarum strains favoured the early stages of the
interaction since enhanced adhesion to plant roots, but decreased symbiotic efficiency as plant growth and nitrogen
contents were reduced. Our results remark the importance of c-di-GMP economy for plant-interacting bacteria and show
the usefulness of our approach to reveal particular stages during plant-bacteria associations which are sensitive to changes
in c-di-GMP levels.
Citation: Pérez-Mendoza D, Aragón IM, Prada-Ramı́rez HA, Romero-Jiménez L, Ramos C, et al. (2014) Responses to Elevated c-di-GMP Levels in Mutualistic and
Pathogenic Plant-Interacting Bacteria. PLoS ONE 9(3): e91645. doi:10.1371/journal.pone.0091645
Editor: Jesús Murillo, Universidad Pública de Navarra, Spain
Received December 5, 2013; Accepted February 13, 2014; Published March 13, 2014
Copyright: ß 2014 Pérez-Mendoza et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grant P10-CVI-5800 from the Andalusian Government (Junta de Andalucı́a) and by the Spanish Plan Nacional I+D+i grants
BIO2011-23032 and AGL2011-30343-C02-01 (Ministerio de Economı́a y Competitividad), all co-financed by Fondo Europeo de Desarrollo Regional (FEDER). IMA
was supported by FPU and HPR by an FPI fellowship (Ministerio de Ciencia e Innovación/Ministerio de Economı́a y Competitividad, Spain). LRJ was supported by
JAE-Pre fellowship and DPM by a JAE-doc postdoctoral contract from Consejo Superior de Investigaciones Cientı́ficas (CSIC, 2009–2011) and by a postdoctoral
contract from Junta de Andalucia (2011–2013). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the
manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: juan.sanjuan@eez.csic.es
motile and sedentary lifestyles ( [5] and references therein). Despite
a recent burst of research in this field, knowledge on c-di-GMP
signaling pathways remains largely fragmentary and molecular
mechanisms of regulation and even c-di-GMP targets are yet
unknown for most bacteria [5].
The c-di-GMP is synthesized from two molecules of GTP by the
action of diguanylate cyclases (DGC), and hydrolyzed by specific
phosphodiesterases (PDE). GGDEF protein domains function in cdi-GMP synthesis, whereas the c-di-GMP PDE activity is
associated with EAL or HD-GYP domains [6–9]. Bacterial
genomes usually encode several and very often up to dozens
proteins that synthesize or hydrolize c-di-GMP, which contrasts
with the relatively low number of known effector molecules whose
activity and/or stability is modulated upon binding to c-di-GMP.
This secondary messenger binds to diverse classes of structurally
and functionally unrelated proteins (like enzymes or transcription
factors) and even to RNAs (riboswitches, reviewed in [10]). Thus,
c-di-GMP can act at the transcriptional, posttranscriptional and
posttranslational levels. Moreover, it has been proposed that
distinct c-di-GMP signaling modules are separated in time and/or
Introduction
The permanent exchange of multiple signals between plant and
bacteria during the establishment of pathogenic or mutualistic
interactions need to be integrated to coordinate, in time and space
and upon the local environmental conditions, the expression of
essential determinants allowing colonization and eventually
invasion of the host. Bacterial motility and chemotaxis, exopolysaccharide (EPS) production, biofilm formation and secretion of
adhesion and effector proteins are key and very often shared traits
among bacteria that interact with plants, both mutualistic and
pathogenic [1–3]. Complex regulatory networks involving interand intracellular signaling, orchestrate fine-tuning of all these
bacterial traits.
In the last decade cyclic-di-GMP (c-di-GMP) has emerged as an
ubiquitous second messenger in bacteria. Initially identified as an
allosteric activator of bacterial cellulose synthase [4], this second
messenger can regulate biofilm formation, motility, the cell cycle,
virulence and other important morphological and cellular
processes in bacteria, playing a key role in the switch between
PLOS ONE | www.plosone.org
1
March 2014 | Volume 9 | Issue 3 | e91645
Cyclic Diguanylate in Plant-Bacteria Interactions
space within the cell [11]. The likely functional redundance
among c-di-GMP metabolizing proteins, together with the
presumed complexity of c-di-GMP signaling very often hinder
genetic and genomic approaches to reveal c-di-GMP networks and
components affecting a particular function, especially in bacteria
with varying lifestyles like those interacting with plants. Thus,
alternative approaches like the artificial alteration of the cellular cdi-GMP economy allows focusing on particular c-di-GMP
functional targets. It has been reported that the overproduction
of GGDEF domain proteins very often triggers phenotypes related
to sessility, like the synthesis of adhesins and biofilm matrix
components, whereas an excess production of proteins with EAL
domains usually causes the opposite phenotypes [12–18]. We have
exploited the overexpression of a well characterized diguanylate
cyclase to artificially raise the intracellular levels of this second
messenger in diverse plant-interacting bacteria such as phytopathogenic Pseudomonas and symbiotic Rhizobium bacteria. The impact
of elevated c-di-GMP levels on the virulence of pathogens and on
root nodule formation by mutualistic rhizobia was examined. This
type of approach will facilitate dissecting novel c-di-GMP
functional targets during the establishment of plant-bacteria
associations.
Recombinant DNA Techniques
Molecular biology techniques were performed according to
standard protocols and manufacturer’s instructions. Plasmid
pJBpleD* was constructed by subcloning the XbaI/EcoRI
fragment containing pleD* gene from pRP89 plasmid [7] into
the broad host range vector pJB3Tc19 [22] previously digested
with the same restriction enzymes. Transformation of Pseudomonas
strains with the different plasmid constructions was carried out by
electroporation. Electro-competent cells were prepared according
to [23]. Briefly, cells were mixed with DNA (0.3–0.5 mg of DNA
per ml of cell suspension), transferred to 0.1 cm cuvettes and
submitted to a high-voltage pulse (1.800 V) for 5 ms by using a
MicroPulser electroporation apparatus (Bio-Rad). Transformants
were selected in LB agar plates supplemented with tetracycline.
Plasmid pJBpleD* and pJB3Tc19 were introduced in rhizobia
strains by bacterial conjugation using the E. coli b2163 donor
strain [24] in matings as previously described [25].
Construction of Cellulose Synthase Mutants
To generate a R. etli CFN42 derivative carrying a deletion of
cellulose synthase celAB genes (RHE_CH01542 and
RHE_CH01543), two fragments flanking the two ORFs were
amplified separately, using two pairs of primers celAB-1/celAB-2
(836 bp) and celAB-3/celAB-4 (969 bp, Table S1). These two
fragments were purified and used as template DNA for an
overlapping PCR with primers celAB-1 and CelAB-4. The final
fragment was cloned into pCR-XL-TOPO (Invitrogen) and
sequenced. A correct HindIII/XbaI DNA insert was isolated and
subcloned into the suicide plasmid pK18mobSacB [26] generating
the pK18DcelAB. The pK18DcelAB plasmid was introduced into
R. etli CFN42 by a biparental conjugation from E. coli S17.1 strain,
and the celAB deletion of 3277 bp (1618863–1622139) was
generated by homologous recombination, following procedures
described in [26]. The Ret DcelAB mutant contained an untagged
(without resistance or reporter genes) deletion of both ORFs that
was corroborated by PCR.
For construction of PtoDwssBC mutant, two fragments including the upstream region of wssB and the downstream region of
wssC genes from strain DC3000 were amplified separately using
two pairs of primers: 1026-F/1027-R (1192 bp) and 1028-F/1029R (1311 bp), respectively (Table S1). These two fragments were
purified and used as a DNA template for an overlapping PCR in
combination with primers 1026-F and 1029-R. The final fragment
was cloned into pCR-XL-TOPO (Invitrogen) and sequenced. A
EcoRI DNA fragment was purified and subcloned into the EcoRI
site of the suicide plasmid pK18mobsacB [26] generating the
pK18DwssBC. The pK18DwssBC plasmid was introduced into
Pto by electroporation, and the wssBC deletion of 2642 bp was
generated by homologous recombination according to [26]. The
PtoDwssBC mutant was corroborated by PCR.
Materials and Methods
Bacteria and Culture Conditions
Bacterial strains and plasmids used in this work are listed in
Table 1.
Overnight cultures of Pseudomonas strains (Pto, Pph, and Psv)
were routinely grown in Luria–Bertani broth (LB; containing
10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl) at 25uC.
Starting cultures of rhizobial strains (Ret and Rle) were grown
overnight at 28uC on TY broth (tryptone-yeast extract-CaCl2
[19]). MM medium [20] was used for both rhizobial and
Pseudomonas strains in different assays, supplemented with 50 mM
glucose for the latest. In some cases, MMF medium was used for
Pseudomonas [21]. When required, antibiotics and other compounds
were added at the following final concentrations: Tetracycline
(Tc), 10 mg ml21 (5 mg ml21 for Ret); Congo Red (CR), 50 mg
ml21, Calcofluor (CF) 200 mg ml21 (in solid media) or 100 mg
ml21 (in liquid media). All free-living assays with strains carrying
pJB3Tc19 or pJBpleD* plasmids were done in media supplemented with Tc to prevent plasmid losses. To determine possible effects
of plasmid pJBpleD* on growth rates, growth curves were
performed and compared with strains carrying the empy vector
pJB3Tc19. Overnight cultures were diluted to an OD600 of 0.05 in
100 ml Erlenmeyer flasks (3 replicates per strain) containing 25 ml
of LB (Pseudomonas) or TY (Rhizobium) supplemented with Tc.
Cultures were incubated in rotary shaker (180 r.p.m.) at 28uC and
OD600 measured every 2–3 hours.
Stability of pJB3Tc19 or pJBpleD* plasmids in the absence of
antibiotics was also determined. Overnight cultures grown under
Tc selection were diluted 1/100 in nonselective LB (Pseudomonas) or
TY (Rhizobium) media, and incubated for 12–24 h at 28uC with
shaking. The cultures were again diluted in nonselective medium
and the procedure repeated until the total number of generations
reached at least 100. After this, serial dilutions were spread on non
selective and selective agar plates, and CFUs (colony formig units)
counted after incubation at 28uC. Stability was determined as the
ratio (%) of CFUs appeared in selective medium of the total CFUs
in nonselective plates.
Preparation of mRNA and Quantitative RT-PCR Assay
Pto DC3000, Pph 1448A and Psv NCPPB 3335 carrying
plasmids pJB3Tc19 and pJBpleD* were grown until OD600 of 0.5
in LB medium supplemented with the appropriate antibiotics at
20uC. Cells were induced in MMF by 3 hours at 20uC. Then, cells
were pelleted and processed for RNA isolation using TRI Reagent
LS (Molecular Research Center, Cincinnati, OH, USA) according
to the manufacturer’s instructions, except that the TRI Reagent
was preheated at 70uC and the lysis step was carried out at 65uC.
The RNA obtained was treated with TURBO DNA-freeTM-Kit
(Applied Biosystems; California, USA). RNA concentration was
determined spectrophotometrically and its integrity was assessed
by agarose gel electrophoresis.
2
Table 1. Bacterial strains and plasmids used in this study.
Strains
Reference or
source
Relevant characteristic
Rhizobia strains
R. etli CFN42
Wild-type
[77]
R. leguminosarum bv. viciae UPM791
Wild-type, Smr derivative of 128C53
[78]
RetDcelAB
CFN42 DcelAB
This work
P. syringae pv. tomato DC3000
Rifr
[79]
PtoDwssBC
DC3000 DwssBC
This work
Pseudomonas strains
P. syringae pv. phaseolicola 1448A
Race 6
[80]
P. savastanoi
NCPPB 3335
[37]
DH5a
supE44, DlacU169, W80, lacZDM1, recA1, endA1, gyrA96, thi1, relA1, 5hsdR171
[81]
S17.1
Tmpr, Smr, Spr; thi, pro, recA, hsdR, hsdM, Rp4Tc::Mu, Km::Tn7
[82]
b2163
(F2) RP4-2-Tc::Mu _dapA::(erm-pir) [KmR EmR]
[24]
OmniMAX
F9 [proAB+ lacIq lacZDM15 Tn10(TetR) D(ccdAB)] mcrA D(mrr-hsdRMS-mcrBC) Q80(lacZ)DM15
D(lacZYA-argF) U169 endA1 recA1 supE44 thi-1 gyrA96 relA1 tonA panD
Invitrogen
pRP89
Apr, pET11 derivate carrying pleD*, a mutant variant of pleD from C. crescentus
[7]
pJB3Tc19
Apr, Tcr; cloning vector, Plac promoter
[22]
pJBpleD*
Apr, Tcr; pJB3Tc19 derivate bearing a 1423 bp XbaI/EcoRI fragment containing pleD*
This work
pK18mobsacB
Kmr; mobilizable suicide plasmid
[26]
pK18DcelAB
Kmr; pK18mobsacB carrying the deleted version of the celAB genes
This work
pK18DwssBC
Kmr; pK18mobsacB carrying the deleted version of the wssBC genes
This work
pCR-XL-TOPO
Kmr; cloning vector for PCR products
Invitrogen
TOPODcelAB
Kmr; pCR-XL-TOPO carrying the deleted version of the celAB genes
This work
Escherichia coli strains
Plasmids
r
TOPODwssBC
r
r
r
Km ; pCR-XL-TOPO carrying the deleted version of the wssBC genes
r
r
r
r
This work
r
Ap , Km , Nal , Rif , Sm , Sp , Tc , Tmp , stand for resistance to ampicillin, kanamycin, nalidixic acid, rifampicin, streptomycin, spectinomycin, tetracycline and trimethropin,
respectively. NCPPB, National Collection of Plant Pathogenic Bacteria.
doi:10.1371/journal.pone.0091645.t001
DNA-free total RNA (1 mg) was retrotranscribed to cDNA with
the iScript cDNA synthesis kit (BioRad; California, USA) using
random hexamers. The specific primer pairs used to amplify
cDNA are shown in Table S1. Primer efficiency, qRT-PCR’s and
confirmation of the specificity of the amplification reactions were
performed as described in [27]. Relative transcript abundance was
calculated using the DDCt method [28]. Transcriptional data were
normalized to the housekeeping gene gyrA using Bio-Rad i5
software v.2.1. The expression of a given gene relative to gyrA was
calculated as previously described in [27].
observe surface motility. Migration zones were calculated as the
average length of the two sides of a rectangle able to exactly frame
each colony. For swimming motility assays with Pseudomonas
strains, bacteria were grown on LB plates for 48 hours,
resuspended in 10 mM MgCl2 and adjusted to an OD660 of 2.
Two ml aliquots were inoculated in the centre of 0.3% agar LB
plates with Tc and incubated 48 hours at 25uC. The diameters of
the swimming halos were measured after 24 and 48 hours on LB
plates. Three motility plates were used for each strain and the
experiment was repeated with three independent cultures. For
swarming assays, the cell suspensions were prepared as above but
the 2 ml aliquots were deposited on the top of PG-agar plates
(0.5% proteose peptone No. 3 (Difco 212693) and 0.2% glucose
with 0.5% Difco Bacto-Agar) with Tc and incubated at 25uC. The
surface motility was observed after 24 hours. Three motility plates
were used for each strain, and the experiment was repeated with
three independent cultures.
Motility Assays
For swimming motility assays performed with rhizobia, bacteria
were grown on MM plates for 48 hours, resuspended in MM and
adjusted to an OD600 of 1. Two ml aliquots were spotted onto
semisolid Bromfield (BM) medium (0.04% tryptone, 0.01% yeast
extract, 0.3% Agar and 0.01% CaCl2?2H2O) and halo diameters
measured after incubation for 3 days at 28uC. Surface motility
with rhizobia was analyzed using a protocol previously described
[29], in which 2 ml of cultures grown in TY (OD600 = 1), washed in
MM and resuspended in 0.1 volume of the latter medium, were
dropped into swarm plates and allowed to dry for 10 min. Swarm
plates were prepared with 20 ml of MM containing 0.6% purified
agar (Agar Noble, Difco), and air dried at room temperature for
15 min. Incubation periods of 3 days at 28uC were enough to
Calcofluor Binding Assays
Quantification of the exopolysaccharides CF+ of the different
strains were performed as follows: Pseudomonas strains were
refreshed on LB plates with respective antibiotics. Bacteria were
suspended in 3 ml of 10 mM MgCl2 and diluted into 10 ml flasks
containing MM supplemented with CF (100 mM final concentra-
3
tion) up to initial OD600 = 0.05 and incubated at 20uC under
agitation for 24 h.
Starting cultures of rhizobial strains were prepared as detailed
above. After washing with MM, cultures were diluted 1/100 into
10 ml flasks containing MM supplemented with CF (100 mM final
concentration) at 28uC under agitation for 48 h.
Afterwards, cultures of the different strains were centrifuged for
10 minutes at 4000 rpm. Supernatant containing broth with
unbound CF of each biological replicate was removed; the pellet
was suspended in 2 ml of distilled water and disposed in wells of
24-well plates. Similar growth of all strains was confirmed and CF
binding measurements for 3 biological replicates of each strain
were performed in a PTI fluorimeter (Photon Technology
International), expressing the results in arbitrary units 6 standard
error.
spectra were measured on an Esquire 6000 (Bruker Daltonics) and
on a TSQ7000 (Finnigan) mass spectrometer. Matrix-assisted laser
desorption ionization spectra were measured on a Reflex III
spectrometer (Bruker Daltonics). To confirm the identity of the
substance, relevant peaks were fragmented by ESI-MS using the
positive ion mode. Three major ions were visible in the c-di-GMP
fragmentation pattern, and m/z 152 and 540 corresponded to
products from single bond fragmentation, and 248 originated from
double bond fragmentations. The area of the ion m/z 540 peak
was used to estimate the amount of c-di-GMP in each sample
(similar values were obtained with the other ions; data not shown).
For quantification, a standard curve was established using
synthetic c-di-GMP (Axxora) dissolved in ammonium acetate
(10 mM pH 5.5) at a range of concentrations (20 nM, 200 nM,
2 mM and 20 mM). After subtracting the basal 250 nM spike, c-diGMP concentrations in each strain culture were standardised with
the total protein content, determined by Bradford assay [31].
Biofilm Assays
Starting cultures of rhizobial strains were prepared as above.
After washing with MM, cultures were diluted up to OD600 = 0.1
in sterile MM. 200 ml samples of diluted strains were aliquoted
into the wells of sterile 96-well polystyrene plates (Sarstedt) and
were left in a humid environment at 28uC for 3 days. After
incubation, the liquid from the wells was removed by aspiration
and wells were washed with 240 ml of deionised water. 240 ml of
crystal violet (0.1% in water) was added to each well and left to
stain for 1 hour. The crystal violet was removed by aspiration and
each well was washed carefully with 36240 ml of deionised water.
240 ml of 70% ethanol was added to each well and the plate was
gently agitated for at least 1 hour. The purple colour of
appropriate dilutions was quantified by measurement of A550 in
a Sunrise microplate reader (Tecan).
Starting cultures of Pseudomonas strains were carried out from
plates as described above and 4 ml of diluted cultures in MM [20]
supplemented with 50 mM glucose (OD600 = 0.05) and Tc were
disposed in glass tubes and let grow under static conditions at 20uC
for 72 h. A representative pellicle formed in the Air-Liquid
interface from each strain was imaged. The same procedure was
followed when the assays were performed in non-treated 24-well
polystyrene plates (Iwaki).
Alginate Quantification
For quantification of bacterial alginate production, three-day
plate cultures of P. syringae on MM medium supplemented with
50 mM glucose at 20uC were resuspended in 0.9% NaCl for
alginate extraction and quantification as in [32]. Alginate levels of
each strain were standardised by total protein of the initial sample
determined by Bradford assay [31] expressed in mg uronic acids/
mg of total cell protein 6 standard deviation.
Plant Root Binding Assays
Bean and vetch seeds (Phaseolus vulgaris cv. contender and Vicia
sativa cv. Jose, respectively) were surface-sterilized by washing the
seeds abundantly with tap water followed by treatment (265
minutes) with ethanol 100%. Ethanol was removed by washing
three times with deionised water and a second treatment was
applied by adding sodium hypochlorite 5% for 5 minutes. Seeds
were washed with abundant sterile deionised water to remove any
remains of sodium hypochlorite. Bean seeds were germinated in
purified agar:water 1% for 72 h at 28uC in the dark. Vetch seeds
were soaked in sterilised water for 10 h and then placed on plates
with water wet filter paper at 28uC for 48 h in the dark.
Nine seedlings were transferred into a flask containing 108 cells
of each strain in 50 ml of nutrient solution and gently agitated at
28uC for 4 h. After this time, roots were separated from the shoots
and 3 groups of 3 roots each were separately taken and washed
vigorously four times with 10 ml of sterile deionised water in
Falcon tubes, to removed unbound or weakly bound bacteria.
After these washings, 10 ml of MM with 2 mM EDTA were
added and root bound bacteria were released by 2 cycles of 1 min
of vortex and 1 min of sonication. Serial dilutions were prepared
and spread onto Congo red MM tetracycline plates and incubated
at 28uC for 3–4 days. CFUs were counted to determine bound
rhizobial cells harbouring pJBpleD* (red colonies) or the empty
vector pJB3Tc19 (white colonies). The ratio (%) of bounded cells
per g of root to total inoculum cells were calculated for each strain.
Intracellular c-di-GMP Measurements
c-di-GMP was extracted using a protocol based on a previous
report [30]. Three biological replicates of each strain were grown
in 10 ml of TY for rhizobia or LB broth for Pseudomonas strains.
Formaldehyde at a final concentration of 0.19% was added and
the cells harvested by centrifugation (10 min at 4000 rpm). The
pellet was washed in 1 ml of iced deionised water, centrifuged for
3 min at 13000 rpm, then resuspended in 0.5 ml of iced deionised
water and heated to 95uC for 5 min. A volume of 925 ml of iced
absolute ethanol was added to reach a final concentration of 65%.
Nucleotides were extracted by 30 sec of vortex followed by a
centrifugation step (3 min at 13000 rpm). Supernatants containing
extracted nucleotides were then evaporated to dryness at 50uC in a
speed-vacuum system. The pellet was resuspended by vigorous
vortexing in 300 ml of AcNH4 10 mM (pH 5.5). Samples were
filtered through 0.45 mm GHP membranes (GHP Acrodisc,
PALL). Samples were spiked at a concentration of 250 nM by
mixing 100 ml of a solution of 750 nM of synthetic of c-di-GMP
(Axxora) disolved in AcNH4 10 mM pH 5.5 with 200 ml of each
sample. Samples were analysed by reversed phase-coupled HPLCMS/MS. High performance liquid chromatography was performed on an Agilent 1100 coupled to a 36125 mm column
Waters Spherisorb 5 mm ODS2 (C-18). Running conditions were
optimized using synthetic c-di-GMP as a reference. ESI-MS mass
Rhizobia Symbiotic Assays
Bean (Phaseolus vulgaris cv. Contender) and vetch (Vicia sativa cv.
Jose) seeds were surface-sterilized and germinated as above. To
test the infectivity of rhizobial strains, 12 bean or 25 vetch
seedlings were sown in Leonard-type assemblies containing a mix
(3:1) vermiculite:perlite on the top part and nitrogen-free nutrient
solution [33] in the bottom. Each seedling was inoculated with 106
CFU of the compatible bacterial symbiont (Ret for beans and Rle
for vetch). Bean plants were cultivated in a growth chamber with
4
with a Vernier caliper [38,39]. Statistical data analysis was
performed by analysis of variance followed by t-Student test (P#
0.05). For counting bacterial populations, bacteria were recovered
from the knots at different times post-inoculation using a mortar
containing 1 ml of 10 mM MgCl2, and serial dilutions were plated
onto LB medium (to detect the total amount of Psv cells) and LBTc medium (to detect bacterial cells maintaining the PleD*
plasmid). Population densities were calculated from at least three
independent replicates.
16/8-h light/dark photoperiod at 24/16uC day/night and 75%
relative humidity. Vetch plants were grown in a greenhouse.
The shoot fresh weight and the number of nodules were
determined after 29 days for bean and 41 days for vetch plants,
respectively. Shoot dry weights were determined after desiccating
the samples in an oven (65uC) for 3 days. Dry shoots were ground
and total nitrogen contents were determined following the Dumas
method at the Ionomics Service of the institute CEBAS-CSIC
(Murcia,
Spain;
http://www.cebas.csic.es/general_english/
ionomics.html). To evaluate the presence or absence of nodule
bacteria carrying pJBpleD* or pJB3Tc19 plasmids, fifty of the
nodules formed by each strain were surface-sterilised with HgCl2
0.25% for 5 min followed by washing with abundant sterile
deionised water. Nodules were individually crushed and the
content spread on TY and TY+Tc plates. Statistical data analysis
was performed by analysis of variance followed by Anova test (P#
0.05) with IBM SPSS Statistic 20 software.
Results
Increasing the Intracellular Levels of c-di-GMP
To increase the intracellular levels of c-di-GMP in our model
bacteria, we used the PleD* protein, a constitutively active DGC
variant of the well-characterised DGC PleD from Caulobacter
crescentus [40]. The pleD* gene was cloned under the control of the
lac promoter in a plasmid vector, pJB3Tc19, that can replicate in
both rhizobia and Pseudomonas strains. The resulting construction
pJBpleD* was introduced in the model strains Rhizobium etli
CFN42 (Ret) and Rhizobium leguminosarum bv. viciae UPM791 (Rle),
and Pseudomonas savastanoi pv. savastanoi NCPPB 3335 (Psv) and
Pseudomonas syringae [pv. phaseolicola 1448A (Pph) and pv. tomato
DC3000 (Pto)] and intracellular c-di-GMP contents were quantified. The over-expression of pleD* generated strong c-di-GMP
increases in all the strains compared to control strains containing
the empty vector pJB3Tc19, being higher in rhizobial strains than
in the Pseudomonas (Fig. S1).
Pseudomonas Virulence Assays
Seeds of Solanum lycopersicum cv. Moneymaker and Phaseolus
vulgaris cv. Canadian Wonder were germinated and grown in a
growth chamber with 16/8-h light/dark photoperiod at 24/18uC
day/night and 70% relative humidity for 5 weeks or 2 weeks,
respectively.
P. syringae pv. tomato DC3000 and pv. phaseolicola 1448A
grown on LB plates for 48 h at 28uC, were suspended in 10 mM
MgCl2 and the inocula adjusted to 108 cfu/ml or 105 cfu/ml.
Infiltration was achieved by pressing the bacterial suspension into
the abaxial side of the leaf using a syringe without needle. For
symptom observation and bacterial population counting in plant,
individual inocula (106 cfu/ml) of the strains were sprayed into
different plants and sampling were performed 3 hours after
inoculation (time 0) and several days after inoculation (dpi, days
post-inoculation) to determine output CFU. Bacteria were
recovered from the infected leaves using a 10-mm-diameter
cork-borer. Five disks (3.9 cm2) per plant were homogenized by
mechanical disruption into 1 ml of 10 mM MgCl2 and counted by
plating serial dilutions onto LB plates with the corresponding
antibiotics.
Olive plants (Olea europaea L.) derived from seeds germinated
in vitro (originally collected from a cv. Arbequina plant) were
micropropagated, rooted and maintained as previously described
[34,35].
Micropropagated olive plants were infected in the stem wound
with bacterial suspension (approximately 103 CFU) and incubated
for 30 days in a growth chamber as described by [34]. The
morphology of the olive plants infected with bacteria was
visualized using a stereoscopic microscope Leica MZ FLIII (Leica
Microsystems, Wetzlar, Germany). To analyse the pathogenicity
of P. savastanoi pv. savastanoi isolates in 1-year-old olive explants
(woody plants), micropropagated olive plants were transferred to
soil and maintained in a greenhouse at 27uC with a relative
humidity of 58% under natural daylight. The plants were
wounded in the stem with a sterile scalpel and infected with
approximately 106 CFU of P. savastanoi pv. savastanoi as previously
described [36,37]. The wounds in inoculated plants, which were
0.5 cm deep and spanned from the stem surface to the cambial
area, were protected with Parafilm M (American National Can,
Chicago, IL, USA) for one week post-inoculation. Morphological
changes, scored at 90 dpi, were captured with a high-resolution
digital camera Nikon DXM 1200 (Nikon Corporation, Tokyo,
Japan). Knot volume was calculated by measuring length, width
(subtracting the stem diameter measured above and under the
knot from that measured below the knot) and height of the knot
Stability of Plasmid pJBpleD* and Effects on Growth
Rates
We determined whether pleD* expression and high c-di-GMP
intracellular levels could affect bacterial growth rates in laboratory
media. However, formation of flocs induced by pleD* (see below)
hindered measuring culture ODs and even countingCFU. Pto and
Ret mutants impaired in cellulose production, which did not show
such aggregative behaviour in rich medium (see below), were used
for this purpose. However, no significant changes in growth rates
were observed for the Pto or Ret Cel2 strains carrying the pleD*
plasmid (Figure S2). Likewise, we did not observe any growth
delay of Cel+ strains carrying pJBpleD* on agar plates compared
to strains carrying the empty vector.
Although all free-living assays with pJBpleD* strains were done
in selective media supplemented with Tc, we were also interested
to know plasmid stability under nonselective conditions. Plasmid
stability in the absence of Tc, was variable and highly dependant
on the bacterial strain. In all Pseudomonas strains both pJB3Tc19
and pJBpleD* plasmids were similarly stable (Table S2). In R.
leguminosarum stability of both the vector and the pJBpleD* plasmid
was also similar and relatively high. In contrast, only 8.3% of R. etli
CFUs were able to maintain the pJB3Tc19 vector whereas only
0.6% maintained pJBpleD* after approximately 100 generations
(Table S2).
Effects of Increased c-di-GMP Levels on Free-living
Phenotypes
Over-expression of PleD* generated wrinkled colonies that
stained in media with Congo Red (CR+) in all strains, except in
Pph that showed no significant binding to CR (Fig. 1). PleD* also
increased 5- to 80-fold the Calcofluor (CF)-derived fluorescence of
all the strains except Pph, which showed no significant differences
and very low CF binding (Fig. S3).
Enhanced CR and CF binding suggested the production of
cellulose in response to elevated c-di-GMP levels. To verify this
5
Figure 1. Effects of high c-di-GMP on bacterial external features. Colony morphology (A) and Congo red (B) or Calcofluor staining (C) of
Rhizobium etli CFN42 (Ret), Rhizobium leguminosarum bv. viciae UPM791 (Rle), Pseudomonas savastanoi pv. savastanoi NCPPB 3335 (Psv),
Pseudomonas syringae pv. tomato DC3000 (Pto) and Pseudomonas syringae pv. phaseolicola 1448 (Pph) expressing pleD* (pJBpleD*) and their
respective control strains (pJB3Tc19, empty vector). Colonies were imaged after growth under the following conditions: for Ret and Rle, 3 days at
28uC in MM or YGT plates, respectively, supplemented with tetracycline (10 mg/ml or 5 mg/ml for Rle and Ret, respectively), CR (125 mg/ml; A and B)
or CF (200 mg/mL; C). For Psv, Pto and Pph, 3 days at 20uC in MM (supplemented with 15% of glycerol for Pph) agar plates, supplemented with
tetracycline (10 mg/ml) and with CR (125 mg/ml; A and B) or CF (200 mg/mL; C). Scale bars in (A) correspond to 1 mm.
doi:10.1371/journal.pone.0091645.g001
The presence of the pJBpleD* plasmid caused inhibition of both
surface and swimming motilities in all the strains tested (see Fig.
S5). In agreement with [37], Psv did not show any surface motility
under different conditions, therefore it was not possible to evaluate
the influence of PleD* on this feature.
possibility, Pto and Ret cellulose synthase mutants were generated.
As expected, cultures of the Pto Cel2 mutant (PtoDwssBC)
expressing pleD* had lost the ability to stain with CR or fluoresce
in the presence of CF (Fig. S3). The Ret Cel2 mutant (RetDcelAB)
expressing PleD* showed reduced CR and CF staining in
comparison with the wild-type, but still bound significantly these
dyes, i.e. CF-derived fluorescence was about 50% of the wild-type
(Fig. S3). This and other phenotypes (reduced flocculation and
biofilm formation, see below) suggested that the Cel2 mutation
was likely affecting cellulose production but the high c-di-GMP
levels were yet inducing the production by R. etli of another
compound(s) able to bind CR and CF.
A strong aggregative phenotype was observed when pleD* was
over-expressed in rhizobial and Pseudomonas strains, with bacteria
forming flocs after overnight culture, particularly in minimal
media. Correlating with this, over-expression of pleD* in rhizobial
strains (Ret and Rle) enhanced production of a strong and visually
obvious biofilm that was easily quantified after crystal violet (CV)
staining of microtitre plates (Fig. 2A). At least in the case of R. etli,
this c-di-GMP induced biofilm required a cellulose synthase, since
the Cel2 mutant had lost most of the PleD* enhanced biofilm
capacity (Fig. 2A).
In contrast to rhizobia, over-expression of pleD* in the three
Pseudomonas strains promoted the formation of an air-liquid (A-L)
interface biofilm or pellicle maintained by bacterial attachment to
the walls of the tubes (and microtitre wells) at the meniscus
(Fig. 2B), instead of the formation of an archetypal biofilm
attached to the container surface. These pellicles formed under
static growth conditions and easily sank when gentle shaking was
applied (Fig. 2B), what prevented quantification after CV staining.
The Pto Cel2 mutant was still able to form pellicles similar to
those of the wild type (Fig. 2B), strongly supporting that cellulose is
not necessary for this type of biofilms. An analysis of the
polysaccharides produced by Pto and Pph indicated that alginate
was also present in the matrix of those pellicles. Alginate
production was strongly induced by high c-di-GMP in both Pto
and Pph, although total amounts of alginate were much higher in
Pph (Fig. S4).
Influence of High Intracellular Levels of c-di-GMP on
Rhizobia Interaction with Legumes
We tested the impact of high bacterial c-di-GMP levels in two
rhizobia-legume associations forming different nodule types: R.
leguminosarum-Vicia sativa and R. etli-Phaseolus vulgaris, that give rise to
indeterminate and determinate nodules, respectively. Bacterial
attachmet to roots as well as several symbiotic and plant growth
related parameters were determined. Significant effects of pleD*
expression were observed on both interactions, starting with
enhanced attachment of bacterial cells to roots (Table 2), probably
due to cellulose overproduction, since the Ret Cel2 mutant
expressing PleD* did not exhibit that behaviour (data not shown).
PleD* strains also showed a trend to form fewer nodules than the
controls, although the differences were statistically significant only
in the case of R. etli; however, average nodule size and weight
seemed unaffected (Table 2). In all cases, nodule visual aspect and
color were indicative of nitrogen fixation. Concerning plant
parameters, aerial biomass was significantly reduced in the case of
P. vulgaris plants inoculated with the PleD* strain (Fig. 3). In both
symbioses, shoot dry weights were smaller in plants inoculated
with the PleD* variants and the nitrogen content of the shoots
followed a similar decreasing trend (Table 2). Concerning the
stability of the pleD* construction, a strong pressure to get rid of the
pJBPleD* plasmid seems to be exerted during symbiosis establishment. In the case of P. vulgaris, no tetracycline resistant bacteria
were recovered from nodules formed by the Ret (pJBpleD*) strain
(0 of 50 nodules analysed), contrasting with the 98% (49 of 50
nodules) of Ret (pJB3Tc19) nodule bacteria which maintained the
tetracycline resistance vector. When plasmid stability was measured in V. sativa nodules, we could isolate Tcr bacteria from 86%
of nodules formed by the Rle strain carrying the empty vector, and
from 70% of the PleD* nodules. However, it is important to
6
Figure 2. Effects of high c-di-GMP on biofilm production. Biofilm formation by Rhizobium etli CFN42 (Ret), Rhizobium leguminosarum bv. viciae
UPM791 (Rle), Pseudomonas savastanoi pv. savastanoi NCPPB 3335 (Psv), Pseudomonas syringae pv. tomato DC3000 (Pto) and Pseudomonas syringae
pv. phaseolicola 1448 (Pph) expressing pleD* (pJBpleD*) and their respective control strains (pJB3Tc19, empty vector). (A) Biofilm formation by Ret
and Rle quantified after static growth, 72 h in MM in a 96-well plate at 28uC, by crystal violet (CV) staining and represented as the means of eight
different wells for each strain 6 standard error. Similar growth of all strains was confirmed by measuring OD600 before CV staining. (B) Air-Liquid
biofilms produced by Pph, Psv, Pto expressing pleD* and their respective control strains after static growth in MM supplemented with 50 mM glucose
and Tc, for 72 h at 20uC. Similar biofilms formed in microtitre plates.
also tested the stability of plasmids pJB3Tc19 and pJBpleD* in
Pto-inoculated plants, and determined that after 10 days most
(67%) bacteria isolated from different plants maintained the
plasmid-encoded tetracycline resistance.
Despite no changes in the virulence of Pph and Pto expressing
high levels of intracellular c-di-GMP seemed apparent, we
compared the expression of T3SS genes in strains with pJB3Tc19
or pJBpleD*. Expression analysis was performed by quantitative
reverse-transcription polymerase chain reaction (RT-qPCR) of Pto
and Pph cells growing in the T3SS inducing medium MMF. In
both Pto and Pph pJBpleD* cells transcripts levels of hrpL (the
alternative sigma factor controlling the expression of T3SS genes)
and hrpA (encoding the protein subunits composing the T3SS pili)
decreased approximately 2 fold (see Fig. S6D). Thus, there was a
low but consistent reduction of T3SS gene expression by high c-diGMP, although this seemed to have no effects on the severity of
disease symptoms in their respective hosts.
We also examined whether expression of the pleD* gene in Psv
had an effect in the development of olive knot symptoms. Psv
transformants carrying plasmids pJB3Tc19 or pJBpleD* were
inoculated both on in vitro micropropagated olive plants and on 1year-old olive plants, and disease severity was evaluated after 30
days or 90 days, respectively. In addition, the stability of plasmid
remark that only one to few CFU per nodule could be recovered
from most those PleD* nodules, in clear contrast with the
pJB3Tc19 nodules, from which hundreds to thousands Tcr CFU
were usually recovered. Thus, the majority of the PleD* nodules
contained none or few bacteria that still maintained the pJBpleD*
plasmid. Compared to plasmid loss in nonselective media under
free-living conditions (Table S2), it would seem that plasmid
unstability was higher in symbiotic conditions, especially for
pJBPleD*.
Impact of High Intracellular Levels of c-di-GMP on the
Interaction of Phytopathogenic Pseudomonas with Host
Plants
To study the effect of pleD* expression in Pto and Pph virulence,
transformants carrying pJB3Tc19 or pJBpleD* plasmids were
inoculated on 4-week old tomato plants or 2-week old bean plants,
respectively, and disease symptoms were evaluated after 3, 6 and
10 days. The results showed that high intracellular levels of c-diGMP did not have any detectable impact on the virulence of either
Pto or Pph, since the strains over-expressing PleD* induced the
same disease symptoms as the wild type (Fig. S6, A and B).
Furthermore, in planta growth of Pto DC3000 carrying either of
these plasmids followed a similar trend over time (Fig. S6C). We
7
Figure 3. Effects of high c-di-GMP levels on the Rhizobium etli CFN42 (Ret) symbiotic interaction with its host. (A) Appearance of
representative bean plants 29 days after inoculation with the indicated strains. (B) Mean shoot fresh weight per plant. NI, non inoculated. Bars
indicate standard errors.
Table 2. Parameters related to the interaction of PleD* rhizobial strains with their hosts.
Plant
Rhizobia
Attachmenta
Nu of nodulesb
Nodule weightc
SDWd
Phaseolus vulgaris
Ret pJB3Tc19
0.0460.01%{
301619{
3.3360.24
0.9560.04{
35.3563.22{
Ret pJBpleD*
6.5560.73%
{
203612
{
4.3060.42
0.6660.06
{
19.6463.29{
2.2360.18%
{
238633
0.7360.06
0.4160.09
9.9362.24{{
6.7960.34%
{
190615
0.6560.12
0.3060.02
5.6660.40{{
Vicia sativa
Rle pJB3Tc19
Rle pJBpleD*
Nitrogene
a
Percentage of bacterial cells attached per gram of roots.
Number of nodules per plant.
c
Average nodule fresh weight, in mg.
d
Average shoot dry weight per plant, in g.
e
Nitrogen content per plant, in mg.
{
Indicates an statistically significant difference (P#0.05) between pJB3Tc19 and pJBpleD*.
{{
Indicates an statistically significant difference (P#0.1) between pJB3Tc19 and pJBpleD*.
doi:10.1371/journal.pone.0091645.t002
b
8
pJBpleD* was checked in Psv-infected micropropagated olive
plants, and determined that from 7 dpi until the end of the
experiment (30 dpi), only about 25% of the bacterial cells isolated
from olive knots were resistant to tetracycline, and thus stably
maintained the plasmid (Fig. S7). Despite the low stability of
plasmid pJBpleD* in Psv, the results showed that expression of
pleD* drastically increased knot size both on in vitro micropropagated (Fig. 4A) and 1-year-old olive plants (Fig. 4B). In fact, knot
volume was increased significantly (P#0.05) in the stems of oneyear old olive plants inoculated with the pleD* transformant as
compared with those inoculated with the control strain (Psv
carrying pJB3Tc19; Fig. 4C). Conversely, transverse sections of
knots induced at 90 days post-inoculation (dpi) by the pleD*
transformant on 1-year-old olive plants showed a reduced necrosis
of the internal tissues as compared with those developed in plants
inoculated with the control strain (Fig. 4C), suggesting a delay in
the maturation process of the knots induced by the pleD*
transformant. Taken together, these results suggested the existence
of a possible interplay between pleD*-mediated intracellular levels
of c-di-GMP and the expression of both phytohormones- and type
III secretion system (T3SS)-related genes in Psv. However, we
could not detect significant changes in the transcript levels of hrpL
or hrpA in Psv overexpressing the DGC PleD* after transfer to
MMF medium, neither could we observe significant variations in
transcription of gene iaaM (encoding triptophane monooxygenase,
which converts tryptophan to indoleacetamide in the IAA
biosynthetic pathway; data not shown).
encode multiple proteins involved in the c-di-GMP turnover, with
a special abundance among bacteria with a variety of lifestyles and
coevolutionary relationships with eukaryote hosts [41]. This
contrasts with the comparatively few c-di-GMP protein receptors/effectors known so far which, unlike c-di-GMP metabolizing
proteins, are structurally and functionally more diverse and yet
hardly identifiable through bioinformatics (with the exception of
PilZ domains; [42,43]). Thus, additional research approaches,
besides genomics and bioinformatics, need to be implemented to
uncover novel c-di-GMP regulation pathways, particularly in
bacteria with complex lifestyles like those associating with plants.
One of such approaches involves the artificial alteration of
intracellular c-di-GMP levels through the expression of DGCs or
PDEs in order to assess its effect on particular phenotypes. In our
study, we have used the well characterized DGC PleD* to increase
the levels of this second messenger in different symbiotic and
phytopathogenic bacteria of great agronomic relevance. Evaluation of the free-living and plant-related behaviors clearly shows a
significant impact of high c-di-GMP on both types of plantinteracting bacteria.
As it has been reported for other bacteria [42,44], raising c-diGMP levels causes a prominent reduction of bacterial motility,
significantly changes colony morphology and increases biofilm
formation in all our model strains, likely through the upregulation
of extracellular polysaccharide production. Nevertheless, we
spotted significant and interesting differences, as well as some
novelties among the strains analyzed. Most strains seem to be able
to produce c-di-GMP dependent cellulose, except Pph which lacks
cellulose biosynthesis genes [45]. Cellulose is needed for c-di-GMP
dependent biofilm formation by R. etli CFN42, since the Cel2
mutant did not produce it. Interestingly, we could reveal that
besides cellulose, R. etli CFN42 produces other CR- and CFbinding c-di-GMP activated compound(s) of yet unknown nature
that deserves to be characterized in a future work. Since three
putative cellulose synthase genes have been annotated in its
genome (http://genome.microbedb.jp/rhizobase), this strain may
Discussion
Cyclic-di-GMP has emerged during the last decade as an
ubiquitous second messenger in bacteria. However, our understanding of c-di-GMP signaling is still fragmentary probably due to
the diversity of cellular functions and the great variety of
mechanisms of action displayed by this dinucleotide (reviewed in
[5]). To this complexity adds the fact that many bacterial genomes
Figure 4. Virulence of P. savastanoi pv. savastanoi NCPPB 3335 expressing the pleD* gene in olive plants. Knots induced by Psv
pJB3Tc19 (left), and Psv pJBPleD* (right), on young micropropagated olive plants at 30 days dpi (A) and in one year-old olive plants at 90 dpi (B).
Cross sections of knots of one year-old olive plants infected with the indicate strains and their mean volumes (C). Knot sizes are the means of 6
different knots 6 standard error.
9
carry additional unknown cellulose synthesis systems; however,
only the one mutated in this work resembles typical bacterial
cellulose synthases [46,47].
In contrast to the formation of strong and visually obvious
archetypal surface biofilms by rhizobia, we observed the formation
of c-di-GMP dependent A-L pellicles by P. syringae strains,
suggesting a strong cell to cell attachment but loose adhesion of
bacteria to the container surface (borosilicate tubes or polystyrene
microtitre wells). Similar A-L interface biofilms were produced by
some environmental Pseudomonas isolates and cellulose was
proposed as the principal component of the biofilm matrix
[48,49]. However, the P. syringae pellicles may or may not contain
cellulose, since both the wild-type Pph (which is cellulose negative)
and the Pto Cel2 mutant were still able to form such pellicles. We
found that alginate production was induced by high c-di-GMP
levels in both Pto and Pph, consistent with reports for other
bacteria like P. aeruginosa [50]. Interestingly, c-di-GMP-dependent
alginate production by Pph was much higher than in the celluloseproducing strain Pto, suggesting that the lack of one EPS may be
compensated by increasing the production of others. It remains to
be investigated if P. syringae can produce, besides alginate or
cellulose, additional polysaccharides under high levels of c-diGMP (i.e., levan or psl, as described in P. aeruginosa; [51]) and
which of those polimers is essential for pellicle formation.
One of the critical early steps in rhizobia-legume interactions is
the bacterial attachment to the host plant root [2,52]. The pleD*
over-expression strongly increased the ability of Ret and Rle to
attach to bean and vetch roots, respectively, most likely due to the
c-di-GMP-dependent cellulose overproduction, although the
participation of other type of compounds cannot be excluded. A
two-steps model has been proposed for attachment of rhizobia to
plant cells: the first phase involves attachment of bacteria to root
hairs through the Ca++-binding protein rhicadhesin and/or
bacterial surface polysaccharides, and the second step involves
cap formation through bacterial aggregation or agglutination and
requires the active synthesis of bacterial cellulose fibrils [2,53,54].
The fact that enhanced cellulose production of the PleD* strains
correlates with incresased attachment to roots, indicates that c-diGMP participates in the second step by activating cellulose
synthesis. How cellulose gene expression is regulated in rhizobia
remains unknown, albeit some authors have suggested induction
by plant compounds [55,56]. Also, cellulose-mediated aggregation
has been suggested to indirectly contribute to infection by
enhancing bacterial growth on the host plant root; however,
cellulose-deficient mutants resulted to be as infective as Cel+
strains [53–55].
Our results also reveal important effects of c-di-GMP at other
stages of the symbiotic interaction. High c-di-GMP levels strongly
impaired the symbiotic efficiency of both R. etli and R.
leguminosarum bv. viciae, as evidenced by the reduced shoot weights
and N contents of the plants inoculated with PleD* strains. Nodule
number was also significantly reduced in the case of R. etli-P.
vulgaris but not in the R. leguminosarum-vetch interaction. We need
to point out that, although nodules formed by the PleD* strains
had normal size and appearance, contained few o none bacteria or
bacteroids carrying the PleD* plasmid, therefore they mainly
contained wild-type like bacteria and bacteroids by the end of the
experiment. The high intracellular c-di-GMP levels appear to have
imposed a strong pressure against progression of the symbiosis,
which might not have proceeded until a significant loss of the pleD*
plasmid occurred within the inoculant population. Plasmid loss
could have happened during bacterial multiplication in the
rhizosphere and rhizoplane or afterwards during nodule induction
and invasion. Hence, high c-di-GMP levels likely determine a
delay of symbiosis establishment, although it is difficult to discern if
one or more stages (e.g., nodule induction, nodule infection,
bacteroid differentiation or function) are directly affected. Therefore, it will be of great interest to assess the impact of the c-di-GMP
economy at various (early and late) stages of symbiosis establishment using more stable, i.e. chromosomal, PleD* constructions in
which high c-di-GMP levels will be maintained throughout
symbiosis development.
High c-di-GMP levels in phytopathogenic Pseudomonas had
varying effects on the development of disease symptoms. On one
hand, Pto and Pph overexpressing PleD* did not show any
changes in virulence, despite important phenotypes like motility or
EPS production were clearly altered. Among the overproduced
EPSs was alginate, which has been associated with phenotypes
important for virulence [57,58]. Thus, it is possible that c-di-GMP
positively impacts on certain traits (i.e., alginate production)
compensating for the negative effects on other traits (T3SS gene
transcription), leading to an apparent lack of visual differences in
disease symptoms. Conversely, high levels of c-di-GMP in Psv
resulted in an increased knot size on olive plants. However, we did
not observe significant changes in iaaM gene transcription,
suggesting that besides IAA production, additional bacterial traits
may also affect knot size. In fact, knot induction by Psv-infected
plants has been shown to be dependent on several other factors,
including a putative DGC [59]. Although increased knot size
could be seen as an increased virulence of the strain, a detailed
inspection of knots showed a reduced necrosis of the internal
tissues (Fig. 4C), suggesting a delay in the maturation of the knots
induced by the Psv pleD* transformant. Regulation of virulence by
c-di-GMP in bacterial phytopathogens belonging to the P. syringae
complex, which includes P. savastanoi, has not been reported to
date. However, c-di-GMP has been shown to negatively regulate
hrpL and hrpA transcription in the bacterial phytopathogen D.
dadantii, through a mechanism probably mediated by RpoN [60].
Also, an artificial increase in c-di-GMP levels in P. aeruginosa, upon
overproduction of the DGC WspR, has been shown to control the
levels of T3SS and T6SS proteins in an inverse manner [61]. In
contrast to the P. syringae strains, we could not observe significant
effects of high c-di-GMP on T3SS gene transcription of P.
savastanoi, although disease features were clearly affected, suggesting that c-di-GMP could regulate the Psv T3SS in a different
manner. In fact, different c-di-GMP regulatory mechanisms have
been demonstrated in bacteria [61], including transcriptional
regulation [62], translational regulation [63], regulation of protein
activity [64] and cross-envelope signalling [65].
In summary, an increment of the intracellular levels of c-diGMP seems to promote a plant-associated life-style versus a
saprophytic one by reducing the motility, increasing EPS
production and promoting biofilm formation. However, several
reports have evidenced a negative regulation of virulence by c-diGMP in plant pathogens like Xanthomonas campestris [16,66], Dickeya
dadantii [60], Pectobacterium atrosepticum [67,68], Agrobacterium tumefaciens [69,70] or Erwinia amylovora [71]. The case of Xylella fastidiosa,
where high c-di-GMP increases virulence, seems to be unique
[72]. In several plant beneficial bacteria, c-di-GMP positively
regulates important features for rhizosphere colonization, like in
Pseudomonas putida [73], P. fluorescens [74,75] or Rhizobium [76].
Our results show that, for a given plant-bacterial system, high
levels of c-di-GMP provoke contrasting effects depending on the
stage of the interaction, e.g. promoting rhizobial attachment to the
legume root but impairing symbiosis establishment, or increasing
the volume of knots induced in olives by Psv whereas reducing
necrosis of plant tissues. This suggests that there is a need of fine
10
tuning the c-di-GMP intracellular levels to ensure the stage
transition during the establishment of the association with the host.
agar) 3 days after inoculation at 28uC for Rle and in PG-agar
plates (0,5%) 24 hours after inoculation at 25uC for Pph. Similar
results were obtained for the rest of strains, except Psv which did
not show surface motility in any condition tested.
(TIF)
Supporting Information
Intracellular c-di-GMP contents. c-di-GMP in
cell extracts of Rhizobium etli CFN42 (Ret), Rhizobium leguminosarum
bv. viciae UPM791 (Rle), Pseudomonas savastanoi pv. savastanoi
NCPPB 3335 (Psv), Pseudomonas syringae pv. tomato DC3000 (Pto)
and Pseudomonas syringae pv. phaseolicola 1448 (Pph) expressing
pleD* (pJBpleD*) and their respective control strains (pJB3Tc19,
empty vector). Values are the means of 3 biological replicates 6
standard error. See Material and Methods for details.
(TIF)
Figure S1
Figure S6 Virulence of Pseudomonas syringae. Disease
symptoms in leaves of common bean at 6 dpi (A) or tomato at 9
dpi (B) induced by Pseudomonas syringae pv. phaseolicola 1448 (Pph)
or Pseudomonas syringae pv. tomato DC3000 (Pto), respectively,
expressing pleD* (pJBpleD*) and their respective control strains
(pJB3Tc19, empty vector). (C) Bacterial growth on tomato leaves.
Time course of in planta growth of Pto DC3000 pJB3Tc19 (black),
and Pto DC3000 pJBpleD* (white). Development of CFU on the
primary leaves of tomato plants at 0, 3, 6 and 10 days after spray
inoculation with approximately 106 CFU/ml. Data represent the
average of six experiments. (D) Relative transcript leves of T3SS
genes hrpL and hrpA in Pto and Pph expressing pleD* (filled bars)
and they respective control strains with pJB3Tc19 (empty bars);
results shown are the means and standard deviations of three
experiments with three replicates.
(TIF)
Figure S2 Bacterial growth curves. Growth curves of Pto
and Ret Cellulose synthase mutants carrying plasmid pJB3Tc19 or
pJBPleD*.
(TIF)
Figure S3 Calcofluor-derived fluorescence. Quantification
of calcofluor-derived fluorescence of cultures of Rhizobium etli
CFN42 (Ret) and its Cel2 mutant derivative, Rhizobium leguminosarum bv. viciae UPM791 (Rle), Pseudomonas savastanoi pv.
savastanoi NCPPB 3335 (Psv), Pseudomonas syringae pv. tomato
DC3000 (Pto) and its Cel2 mutant derivative, and Pseudomonas
syringae pv. phaseolicola 1448 (Pph) expressing pleD* (pJBpleD*)
and their respective control strains (pJB3Tc19, empty vector).
Mean values from 3 independent cultures 6 standard error.
(TIF)
Figure S7 Plasmid stability in P. savastanoi. Maintenance
of plasmid pJBpleD* on young micropropagated olive plants.
Counts of CFU/mL in LB medium with tetracycline (triangles)
and without tetracycline (circles) at 0, 7, 15, 20 and 30 dpi. Each
point is the mean of three replicates. Error bars represent the
standard error.
(TIF)
Figure S4 Quantification of alginate production. Alginate
Table S1 Primers used in this work.
production in Pseudomonas syringae pv. tomato DC3000 (Pto) and
Pseudomonas syringae pv. phaseolicola 1448 (Pph) expressing pleD*
(pJBpleD*) and their respective control strains (pJB3Tc19, empty
vector). Values are the means of 5 independent replicates 6
standard deviation.
(TIF)
(DOCX)
Table S2 Plasmid stability in nonselective medium.
(DOCX)
Acknowledgments
Figure S5 Motility and high c-di-GMP. Effects of high cdi-GMP levels on bacterial motility. Pseudomonas syringae pv.
phaseolicola 1448 (Pph) and Rhizobium leguminosarum bv. viciae
UPM791 (Rle) are shown as representative strains. (A) Swimming
tests in Bromfield medium (0.3% agar) supplemented with
tetracycline after 3 days at 28uC for Rle strains and in 0,3% LB
agar plates supplemented with tetracycline after 2 days at 25uC for
Pph strains. (B) Surface motility on semisolid MM plates (0.6%
Antonia Felipe, David Rodrı́guez-Carbonell and Socorro Muñoz are
acknowledged for excellent technical assistance.
Author Contributions
Conceived and designed the experiments: JS MTG CR DPM. Performed
the experiments: DPM IMA HAP-R LR-J. Analyzed the data: JS MTG
CR DPM IMA HAP-R LR-J. Contributed reagents/materials/analysis
tools: JS MTG CR. Wrote the paper: JS MTG CR DPM.
References
1. Danhorn T, Fuqua C (2007) Biofilm formation by plant-associated bacteria.
Annu Rev Microbiol 61: 401–422.
2. Rodrı́guez-Navarro DN, Dardanelli MS, Ruiz-Sainz JE (2007) Attachment of
bacteria to the roots of higher plants. FEMS Microbiol Lett 272: 127–136.
3. Yousef-Coronado F, Travieso ML, Espinosa-Urgel M (2008) Different,
overlapping mechanisms for colonization of abiotic and plant surfaces by
Pseudomonas putida. FEMS Microbiol Lett 288: 118–124.
4. Ross P, Weinhouse H, Aloni Y, Michaeli D, Weinbergerohana P, et al. (1987)
Regulation of Cellulose Synthesis in Acetobacter xylinum by Cyclic Diguanylic Acid.
Nature 325: 279–281.
5. Römling U, Galperin MY, Gomelsky M (2013) Cyclic di-GMP: the first 25 years
of a universal bacterial second messenger. Microbiol Mol Biol Rev 77: 1–52.
6. Galperin MY, Nikolskaya AN, Koonin EV (2001) Novel domains of the
prokaryotic two-component signal transduction systems. FEMS Microbiol Lett
203: 11–21.
7. Paul R, Weiser S, Amiot NC, Chan C, Schirmer T, et al. (2004) Cell cycledependent dynamic localization of a bacterial response regulator with a novel diguanylate cyclase output domain. Genes Dev 18: 715–727.
8. Schmidt AJ, Ryjenkov DA, Gomelsky M (2005) The ubiquitous protein domain
EAL is a cyclic diguanylate-specific phosphodiesterase: enzymatically active and
inactive EAL domains. J Bacteriol 187: 4774–4781.
9. Ryan RP, Fouhy Y, Lucey JF, Dow JM (2006) Cyclic di-GMP signaling in
bacteria: recent advances and new puzzles. J Bacteriol 188: 8327–8334.
10. Boyd CD, O’Toole GA (2012) Second messenger regulation of biofilm
formation: breakthroughs in understanding c-di-GMP effector systems. Annu
Rev Cell Dev Biol 28: 439–462.
11. Hengge R (2009) Principles of c-di-GMP signalling in bacteria. Nat Rev
Microbiol 7: 263–273.
12. Jenal U, Malone J (2006) Mechanisms of cyclic-di-GMP signaling in bacteria.
Annu Rev Genet 40: 385–407.
13. Römling U, Amikam D (2006) Cyclic di-GMP as a second messenger. Curr
Opin Microbiol 9: 218–228.
14. Kulasakara H, Lee V, Brencic A, Liberati N, Urbach J, et al. (2006) Analysis of
Pseudomonas aeruginosa diguanylate cyclases and phosphodiesterases reveals a role
for bis-(39-59)-cyclic-GMP in virulence. Proc Natl Acad Sci U S A 103: 2839–
2844.
15. Cotter PA, Stibitz S (2007) c-di-GMP-mediated regulation of virulence and
biofilm formation. Curr Opin Microbiol 10: 17–23.
16. Ryan RP, Fouhy Y, Lucey JF, Jiang BL, He YQ, et al. (2007) Cyclic di-GMP
signalling in the virulence and environmental adaptation of Xanthomonas
campestris. Mol Microbiol 63: 429–442.
17. Tamayo R, Pratt JT, Camilli A (2007) Roles of cyclic diguanylate in the
regulation of bacterial pathogenesis. Annu Rev Microbiol 61: 131–148.
11
18. Jimenez PN, Koch G, Thompson JA, Xavier KB, Cool RH, et al. (2012) The
multiple signaling systems regulating virulence in Pseudomonas aeruginosa.
Microbiol Mol Biol Rev 76: 46–65.
19. Beringer JE (1974) R Factor Transfer in Rhizobium-Leguminosarum. J Gen
Microbiol 84: 188–198.
20. Robertsen BK, Aman P, Darvill AG, Mcneil M, Albersheim P (1981) The
Structure of Acidic Extracellular Polysaccharides Secreted by RhizobiumLeguminosarum and Rhizobium-Trifolii. Plant Physiol 67: 389–400.
21. Huynh TV, Dahlbeck D, Staskawicz BJ (1989) Bacterial blight of soybean:
regulation of a pathogen gene determining host cultivar specificity. Science 245:
1374–1377.
22. Blatny JM, Brautaset T, Winther-Larsen HC, Haugan K, Valla S (1997)
Construction and use of a versatile set of broad-host-range cloning and
expression vectors based on the RK2 replicon. Appl Environ Microbiol 63: 370–
9.
23. Choi KH, Kumar A, Schweizer HP (2006) A 10-min method for preparation of
highly electrocompetent Pseudomonas aeruginosa cells: application for DNA
fragment transfer between chromosomes and plasmid transformation.
J Microbiol Methods 64: 391–397.
24. Demarre G, Guerout AM, Matsumoto-Mashimo C, Rowe-Magnus DA,
Marliere P, et al. (2005) A new family of mobilizable suicide plasmids based
on broad host range R388 plasmid (IncW) and RP4 plasmid (IncPalpha)
conjugative machineries and their cognate Escherichia coli host strains. Res
Microbiol 156: 245–255.
25. Pérez-Mendoza D, Sepúlveda E, Pando V, Muñoz S, Nogales J, et al. (2005)
Identification of the rctA gene, which is required for repression of conjugative
transfer of rhizobial symbiotic megaplasmids. J Bacteriol 187: 7341–7350.
26. Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, et al. (1994) Small
mobilizable multi-purpose cloning vectors derived from the Escherichia coli
plasmids pK18 and pK19: selection of defined deletions in the chromosome of
Corynebacterium glutamicum. Gene 145: 69–73.
27. Vargas P, Felipe A, Michan C, Gallegos MT (2011) Induction of Pseudomonas
syringae pv. tomato DC3000 MexAB-OprM multidrug efflux pump by flavonoids
is mediated by the repressor PmeR. Mol Plant Microbe Interact 24: 1207–1219.
28. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:
402–408.
29. Soto MJ, Fernández-Pascual M, Sanjuan J, Olivares J (2002) A fadD mutant of
Sinorhizobium meliloti shows multicellular swarming migration and is impaired in
nodulation efficiency on alfalfa roots. Mol Microbiol 43: 371–82.
30. Amikam D, Steinberger O, Shkolnik T, Ben-Ishai Z (1995) The novel cyclic
dinucleotide 39-59 cyclic diguanylic acid binds to p21ras and enhances DNA
synthesis but not cell replication in the Molt 4 cell line. Biochem J 311: 921–927.
31. Bradford MM (1976) A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem 72: 248–254.
32. May TB, Chakrabarty AM (1994) Isolation and assay of Pseudomonas aeruginosa
alginate. Methods Enzymol 235: 295–304.
33. Rigaud J, Puppo A (1975) Indole-3 Acetic Acid Catabolism by Soybean
Bacteroids. J Gen Microbiol 88: 223–228.
34. Rodrı́guez-Moreno L, Barcelo-Munoz A, Ramos C (2008) In vitro analysis of the
interaction of Pseudomonas savastanoi pvs. savastanoi and nerii with micropropagated olive plants. Phytopathology 98: 815–822.
35. Rodrı́guez-Moreno L, Jimenez AJ, Ramos C (2009) Endopathogenic lifestyle of
Pseudomonas savastanoi pv. savastanoi in olive knots. Microb Biotechnol 2: 476–
488.
36. Penyalver R, Garcia A, Ferrer A, Bertolini E, Quesada JM, et al. (2006) Factors
affecting Pseudomonas savastanoi pv. savastanoi plant inoculations and their use for
evaluation of olive cultivar susceptibility. Phytopathology 96: 313–319.
37. Pérez-Martı́nez I, Rodrı́guez-Moreno L, Matas IM, Ramos C (2007) Strain
selection and improvement of gene transfer for genetic manipulation of
Pseudomonas savastanoi isolated from olive knots. Res Microbiol 158: 60–69.
38. Moretti C, Ferrante P, Hosni T, Valentini F, D’Ongiha A, et al. (2008)
Characterization of Pseudomonas savastanoi pv. savastanoi strains collected from
olive trees in different countries. In: Fatmi MB, Collmer A, Lacobellis N,
Mansfield J, Murillo J et al., editors. Pseudomonas syringae pathovars and related
pathogens – Identification, epidemiology and genomics. Netherlands: Springer.
321–329.
39. Hosni T, Moretti C, Devescovi G, Suarez-Moreno ZR, Fatmi MB, et al. (2011)
Sharing of quorum-sensing signals and role of interspecies communities in a
bacterial plant disease. ISME J 5: 1857–1870.
40. Aldridge P, Paul R, Goymer P, Rainey P, Jenal U (2003) Role of the GGDEF
regulator PleD in polar development of Caulobacter crescentus. Mol Microbiol 47:
1695–1708.
41. Römling U, Gomelsky M, Galperin MY (2005) C-di-GMP: the dawning of a
novel bacterial signalling system. Mol Microbiol 57: 629–639.
42. Ryjenkov DA, Simm R, Römling U, Gomelsky M (2006) The PilZ domain is a
receptor for the second messenger c-di-GMP: the PilZ domain protein YcgR
controls motility in enterobacteria. J Biol Chem 281: 30310–30314.
43. Amikam D, Galperin MY (2006) PilZ domain is part of the bacterial c-di-GMP
binding protein. Bioinformatics 22: 3–6.
44. Simm R, Morr M, Kader A, Nimtz M, Römling U (2004) GGDEF and EAL
domains inversely regulate cyclic di-GMP levels and transition from sessility to
motility. Mol Microbiol 53: 1123–1134.
45. Joardar V, Lindeberg M, Jackson RW, Selengut J, Dodson R, et al. (2005)
Whole-genome sequence analysis of Pseudomonas syringae pv. phaseolicola 1448A
reveals divergence among pathovars in genes involved in virulence and
transposition. J Bacteriol 187: 6488–6498.
46. Zogaj X, Bokranz W, Nimtz M, Römling U (2003) Production of cellulose and
curli fimbriae by members of the family Enterobacteriaceae isolated from the
human gastrointestinal tract. Infect Immun 71: 4151–4158.
47. Whitney JC, Howell PL (2013) Synthase-dependent exopolysaccharide secretion
in Gram-negative bacteria. Trends Microbiol 21: 63–72.
48. Ude S, Arnold DL, Moon CD, Timms-Wilson T, Spiers AJ (2006) Biofilm
formation and cellulose expression among diverse environmental Pseudomonas
isolates. Environ Microbiol 8: 1997–2011.
49. Robertson M, Hapca SM, Moshynets O, Spiers AJ (2013) Air-liquid interface
biofilm formation by psychrotrophic pseudomonads recovered from spoilt meat.
Antonie Van Leeuwenhoek 103: 251–259.
50. Merighi M, Lee VT, Hyodo M, Hayakawa Y, Lory S (2007) The second
messenger bis-(39-59)-cyclic-GMP and its PilZ domain-containing receptor Alg44
are required for alginate biosynthesis in Pseudomonas aeruginosa. Mol Microbiol 65:
876–895.
51. Starkey M, Hickman JH, Ma L, Zhang N, De LS, et al. (2009) Pseudomonas
aeruginosa rugose small-colony variants have adaptations that likely promote
persistence in the cystic fibrosis lung. J Bacteriol 191: 3492–3503.
52. Albareda M, Dardanelli MS, Sousa C, Megias M, Temprano F, et al. (2006)
Factors affecting the attachment of rhizospheric bacteria to bean and soybean
roots. FEMS Microbiol Lett 259: 67–73.
53. Smit G, Kijne JW, Lugtenberg BJ (1987) Involvement of both cellulose fibrils
and a Ca2+-dependent adhesin in the attachment of Rhizobium leguminosarum
to pea root hair tips. J Bacteriol 169: 4294–4301.
54. Williams A, Wilkinson A, Krehenbrink M, Russo DM, Zorreguieta A, et al.
(2008) Glucomannan-mediated attachment of Rhizobium leguminosarum to pea root
hairs is required for competitive nodule infection. J Bacteriol 190: 4706–4715.
55. Ausmees N, Jonsson H, Hoglund S, Ljunggren H, Lindberg M (1999) Structural
and putative regulatory genes involved in cellulose synthesis in Rhizobium
leguminosarum bv. trifolii. Microbiology 145: 1253–1262.
56. Laus MC, van Brussel AA, Kijne JW (2005) Role of cellulose fibrils and
exopolysaccharides of Rhizobium leguminosarum in attachment to and infection of
Vicia sativa root hairs. Mol Plant Microbe Interact 18: 533–538.
57. Fett WF, Dunn MF (1989) Exopolysaccharides produced by phytopathogenic
Pseudomonas syringae pathovars in infected leaves of susceptible hosts. Plant Physiol
89: 5–9.
58. Yu J, Peñaloza-Vázquez A, Chakrabarty AM, Bender CL (1999) Involvement of
the exopolysaccharide alginate in the virulence and epiphytic fitness of
Pseudomonas syringae pv. syringae. Mol Microbiol 33: 712–720.
59. Matas IM, Lambertsen L, Rodriguez-Moreno L, Ramos C (2012) Identification
of novel virulence genes and metabolic pathways required for full fitness of
Pseudomonas savastanoi pv. savastanoi in olive (Olea europaea) knots. New Phytol 196:
1182–1196.
60. Yi X, Yamazaki A, Biddle E, Zeng Q, Yang CH (2010) Genetic analysis of two
phosphodiesterases reveals cyclic diguanylate regulation of virulence factors in
Dickeya dadantii. Mol Microbiol 77: 787–800.
61. Moscoso JA, Mikkelsen H, Heeb S, Williams P, Filloux A (2011) The Pseudomonas
aeruginosa sensor RetS switches Type III and Type VI secretion via c-di-GMP
signalling. Environ Microbiol 13: 3128–3138.
62. Hickman JW, Harwood CS (2008) Identification of FleQ from Pseudomonas
aeruginosa as a c-di-GMP-responsive transcription factor. Mol Microbiol 69: 376–
389.
63. Sudarsan N, Lee ER, Weinberg Z, Moy RH, Kim JN, et al. (2008) Riboswitches
in eubacteria sense the second messenger cyclic di-GMP. Science 321: 411–413.
64. Fang X, Gomelsky M (2010) A post-translational, c-di-GMP-dependent
mechanism regulating flagellar motility. Mol Microbiol 76: 1295–1305.
65. Navarro MV, Newell PD, Krasteva PV, Chatterjee D, Madden DR, et al. (2011)
Structural basis for c-di-GMP-mediated inside-out signaling controlling
periplasmic proteolysis. PLoS Biol 9: e1000588.
66. Chin KH, Lee YC, Tu ZL, Chen CH, Tseng YH, et al. (2010) The cAMP
receptor-like protein CLP is a novel c-di-GMP receptor linking cell-cell signaling
to virulence gene expression in Xanthomonas campestris. J Mol Biol 396: 646–662.
67. Pérez-Mendoza D, Coulthurst SJ, Humphris S, Campbell E, Welch M, et al.
(2011) A multi-repeat adhesin of the phytopathogen, Pectobacterium atrosepticum, is
secreted by a Type I pathway and is subject to complex regulation involving a
non-canonical diguanylate cyclase. Mol Microbiol 82: 719–733.
68. Pérez-Mendoza D, Coulthurst SJ, Sanjuán J, Salmond GPC (2011) NAcetylglucosamine-dependent biofilm formation in Pectobacterium atrosepticum is
cryptic and activated by elevated c-di-GMP levels. Microbiology 157: 3340–
3348.
69. Xu J, Kim J, Koestler BJ, Choi JH, Waters CM, et al. (2013) Genetic analysis of
Agrobacterium tumefaciens unipolar polysaccharide production reveals complex
integrated control of the motile-to-sessile switch. Mol Microbiol 89: 929–948.
70. Barnhart DM, Su S, Baccaro BE, Banta LM, Farrand SK (2013) CelR, an
ortholog of the diguanylate cyclase PleD of Caulobacter, regulates cellulose
synthesis in Agrobacterium tumefaciens. Appl Environ Microbiol 79: 7188–7202.
71. Edmunds AC, Castiblanco LF, Sundin GW, Waters CM (2013) Cyclic Di-GMP
modulates the disease progression of Erwinia amylovora. J Bacteriol 195: 2155–
2165.
12
77. Quinto C, De La Vega H, Flores M, Leemans J, Cevallos MA, et al. (1985)
Nitrogenase reductase - A functional multigene family in Rhizobium phaseoli. Proc
Natl Acad Sci U S A 82: 1170–1174.
78. Leyva A, Palacios JM, Mozo T, Ruiz-Argueso T (1987) Cloning and
characterization of hydrogen uptake genes from Rhizobium leguminosarum.
J Bacteriol 169: 4929–4934.
79. Cuppels DA (1986) Generation and characterization of Tn5 insertion mutations
in Pseudomonas syringae pv. tomato. Appl Environ Microbiol 51: 323–327.
80. Taylor JD, Teverson DM, Allen DJ, Pastor-Corrales MA (1996) Identification
and origin of races of Pseudomonas syringae pv. phaseolicola from Africa and other
bean growing areas. Plant Pathol 45: 469–478.
81. Hanahan D (1983) Studies on transformation of Escherichia coli with plasmids.
J Mol Biol 166: 557–580.
82. Simon R, Priefer U, Pühler A (1983) A broad host range mobilization system for
in vivo genetic-engineering-transposon mutagenesis in gram-negative bacteria.
Biotechnology 1: 784–791.
72. Chatterjee S, Killiny N, Almeida RP, Lindow SE (2010) Role of cyclic di-GMP
in Xylella fastidiosa biofilm formation, plant virulence, and insect transmission.
Mol Plant Microbe Interact 23: 1356–1363.
73. Matilla MA, Travieso ML, Ramos JL, Ramos-Gonzalez MI (2011) Cyclic
diguanylate turnover mediated by the sole GGDEF/EAL response regulator in
Pseudomonas putida: its role in the rhizosphere and an analysis of its target
processes. Environ Microbiol 13: 1745–1766.
74. Newell PD, Monds RD, O’Toole GA (2009) LapD is a bis-(39,59)-cyclic dimeric
GMP-binding protein that regulates surface attachment by Pseudomonas fluorescens
Pf0–1. Proc Natl Acad Sci U S A 106: 3461–3466.
75. Newell PD, Boyd CD, Sondermann H, O’Toole GA (2011) A c-di-GMP effector
system controls cell adhesion by inside-out signaling and surface protein
cleavage. PLoS Biol 9: e1000587.
76. Ausmees N, Mayer R, Weinhouse H, Volman G, Amikam D, et al. (2001)
Genetic data indicate that proteins containing the GGDEF domain possess
diguanylate cyclase activity. FEMS Microbiol Lett 204: 163–167.
13
NOTES
NOTES
NOTES
NOTES
NOTES
NOTES

Role of c-di-GMP metabolism in the virulence of pathogenic

Transcription

Similar documents

corrected exercises

- Olive Communications

Olive country life

Tributes An Invitation

P. aeruginosa - American Society for Microbiology

poster ECFGversie2 gecorrigeerd.pub

Genetic Analysis of Fluorescent Pigment Production

el camí de s`alzina fumadora

Aerobic Reactors for Biotreatment of Polluted Waters and Synthetic

corporate presentation.