Congress _Proceedings_Publication

Transcription

PROCEEDINGS OF THE
1ST ALL AFRICA CONGRESS ON
BIOTECHNOLOGY
THEME:
HARNESSING THE POTENTIAL OF BIOTECHNOLOGY
FOR FOOD SECURITY AND SOCIOECONOMIC
DEVELOPMENT IN AFRICA
22nd – 26th September 2008
GRAND REGENCY HOTEL, NAIROBI, KENYA
Edited by
Jonathan. M. Nzuma PhD
Approved for Publication by
Felix M’mboyi PhD
Designed by
Adams Namayi
ORGANIZING COMMITTEE
The 1st All Africa Congress on Biotechnology benefitted from the planning skills of
highly profiled and experienced senior scientists from key research institutions and
biotechnology stakeholders from NGOs who volunteered their quality time to develop
the congress implementation framework, including the formulation of a complex
congress programme that ran through five days, including plenary sessions, break
away sessions and field trips to various scientific centres and other destinations within
the vicinity of Nairobi city.
We therefore sincerely appreciate and acknowledge the invaluable technical
contributions from the following organizing committee individuals and their affiliate
institutions.
NAME OF ORGANIZING
COMMITTEE MEMBER
Prof. Norah Olembo
Dr Felix M’mboyi
Dr Edward Mamati
Dr Jonstone Ngugi
Dr Kahiu Ngugi
Dr Nancy Budambula
Dr Roy Mugiira
Dr Santie de Villiers
INSTITUTIONAL AFFILIATION
Dr Sarah Olembo
Dr Roger Pelle
Dr Francis Nang’ayo
ABSF Secretariat, Nairobi, Kenya
Jomo Kenyatta University of Advanced Technology, Kenya
University of Nairobi, Kenya
National Council for Science and Technology, Kenya
ICRISAT, Nairobi, Kenya
International Centre for Maize and Wheat Improvement,
Nairobi, Kenya
African Union, Addis Ababa, Ethiopia
International Livestock research Institute, Nairobi, Kenya
African Agricultural technology Foundation, Nairobi, Kenya
Dr Jacques Moulot
UNESCO Nairobi, Kenya Office in Gigiri
Dr.Simion Githuki
Joseph Wekunda
Otula Owuor
Daniel Otunge
Margaret aleke
Catherine Mbaisi
Joy Owango
Jane Otador
Kinyua Mbijjewe
Ms Leah Ambani
Ms Jeniffer Mwai
Kenya Agricultural Research Institute, Nairobi, Kenya
Biotechnology Trust Africa , Nairobi, Kenya
Chief Editor, Science Africa Magazine
ISAAA Africenter, Nairobi, Kenya
Kenya Burea of Standards, Nairo bi, Kenya
National Environment Management Authority, Kenya
Biosafe Train, Nairobi, Kenya
Ministry of Agriculture, Kenya
Monsanto International Regional Office, Nairobi, Kenya
Africa Harvest Biotech Foundation International, Nairobi,
Kenya
Africa Harvest Biotech Foundation International, Nairobi,
Kenya
Dr Stephen Mugo
Josphine Kilei
Julia Kagunda
Ms Christine M. Nambiro
i
ACKNOWLEDGEMENTS
ABSF wishes to sincerely thank through acknowledgement, the following list of
donors who variably made resource contributions towards the successful hosting of
the 1st All Africa Congress on Biotechnology. Their individual donations and the
inherent collective effort made a significant difference in the biotech congress hosting
standards. We profoundly appreciate their invaluable assistance.
ii
FORWARD
It is an open secret that over 200 million people in Sub-Saharan Africa are facing widespread
acute food crises, much of which is attributed to stagnant or sluggish growth in the individual
countries agricultural sectors. Furthermore, it is worth noting that environmental degradation,
deriving from increased deforestation rates and biodiversity loss, and a decline in investment
in the agricultural sector economy, especially in technology development and transfer,
worsens the already poor picture. The benefits of biotechnology and more specifically,
agricultural biotechnology, are now at the forefront of international interest as having great
potential to influence and benefit agriculture, forestry and fisheries sectors among other
relevant sectors in African economies. Many scientific studies have pointed to the promise of
agricultural biotechnology as an instrument of development and its potential to solve Africa’s
growing food insecurity challenges.
Several countries, especially South Africa, Burkina Faso, Kenya, Uganda and Egypt have
now put in place structures for research and development in agricultural biotechnology.
Transgenic crops including cotton, maize, bananas, sorghum, cassava and cow peas are now
in various confined field trails in several African countries and other key food crops have
been lined up for such trials. Improvements in productivity are beginning to emerge from the
applications of conventional and modern biotechnology in some of these countries. As of
February 2009, three African countries were now part of the League of Nations producing
transgenic crops i.e. South Africa, Egypt and Burkina Faso. It is however important to note
that many African countries still lack policy frameworks and legislation and standards on
development, handling and commercialization of biotechnology derived products.
African Biotechnology Stakeholders Forum (ABSF) appreciates that the issues associated
with agricultural biotechnology still remain fairly complex and highly challenging for both
policy makers and stakeholders on the continent. The approach to biotech issues should be
informed by this fact and by awareness of what happens elsewhere, and not only by the
institutional and capacity limitations facing sub Saharan Africa countries. African countries
must therefore develop appropriate policies and legislations for biotechnology and endeavour
to identify key national priorities for agricultural biotechnology, bearing in mind the needs of
the resource poor farmers who depend on agriculture for sustainable livelihoods.
The 1st All Africa Congress on Biotechnology came at the backdrop of the many challenges
that agricultural biotechnology development faces on the continent. Similarly, the various
alternative proposals that stakeholders have proposed on how agricultural biotechnology
applications can be fast tracked to benefit sub Saharan Africa whose population faces acute
food shortages amid global climate change were thoroughly discussed in the congress.
We at the African Biotechnology Stakeholders Forum (ABSF) trust that the collection of
scientific papers in this proceedings of the 1st All Africa Congress on Biotechnology,
carefully selected from peer reviewed articles that were submitted to the Congress Technical
Committee by scientists from Africa, US, Canada, Europe, Asia, China and the Middle East,
reflect the views and opinions from the global community regarding the potential of
agricultural biotechnology in Africa’s socio-economic development. I hope this proceedings
publication will enlighten and further promote objective and informed debate on agricultural
biotechnology, trade and sustainable development in Africa.
Dr. Felix M’mboyi, Senior Programmes Officer,
ABSF Secretariat, Nairobi, Kenya.
Overall Coordinator, 1st All Africa Congress on Biotechnology_
iii
TABLE OF CONTENTS
Organizing Committee .................................................................................................... i
Acknowledgements ........................................................................................................ii
Forward ........................................................................................................................ iii
Table of Contents .......................................................................................................... iv
Opening Ceremony ........................................................................................................ x
Theme I: Advancement In Biotechnology: Molecular Biology, Bioinformatics,
Genomics, Biotechnology Tools .................................................................................. 1
Engineering Microorganisms For Industrial Bioethanol Production
M. Taylor, M. Tuffin, R. Wadsworth, T. Atkinson , R. Cripps , K. Eley and D.
Cowan ........................................................................................................................ 2
Hormone and temperature mediated micropropagation of Vernonia
amygdalina Del.
Lewu FB, AJ Afolayan ............................................................................................... 8
Controlled Hybridization Between Wild And Cultivated Cotton Species
O. Shilla, F.AR. Ismail and T.P. Hauser.................................................................. 15
The Distribution Of Wild Cotton Species In Southern Highlands Of Tanzania
O. Shilla, F.AR. Ismail and T.P. Hauser.................................................................. 22
Gametoclonal variation for morphology and male sterility in gynogenic
derived polyploids of Tef (Eragrostis tef (Zucc.) Trotter)
A. K. Saria and Likyelesh Gugsa ............................................................................. 28
Morphological And Molecular Characterisation Of Eggplant Varieties And
Their Related Wild Species In Mauritius
Banumaty Saraye and V. M. Ranghoo- Sanmukhiya ............................................... 35
Genetic Engineering At Icrisat And Its Relevance To Africa, With Special
Focus On Pigeonpea And Groundnut
Santie M. de Villiers, Susan Muthoni Maina, Timothy Taity Changa, Quinata
Emongor, Irene Njagi, Jesse Machuka, Moses PH Gathaara ................................. 43
Molecular Characterization Of C. Canephora For Resistance To The Coffee
Wilt Disease: Using Peroxidase Activity As A Marker
1,2
Saleh Nakendo, 1George W. Lubega, 2Africano Kangire, and 2Pascal Musoli .... 48
Bt-Cowpea Transgene Escape To Cowpea Wild-Relatives
Rémy S. PASQUET .................................................................................................. 52
Engineering Two Mutants Of Cdna-Encoding G2 Subunit Of Soybean
Glycinin Capable Of Self-Assembly In Vitro And Rich In Methionine
Reda Helmy Sammour.............................................................................................. 60
iv
Optimisation Of The Biolistic-Mediated Transformation Of White Lupin
(Lupinus Albus) For Improved Fungal Resistance
P. Huzar Futty Beejan and A. Wetten ...................................................................... 68
Delineation of Pona Complex of Yam in Ghana using SSR Markers
E. Otoo, R. Akromah, M. Kolesnikova-Allen and R. Asiedu .................................... 77
Effect of Bt-transgenic maize on ovipositional response in two important
African cereal stem borers, Chilo partellus Swinhoe (Lepidoptera:
Crambidae) and Sesamia calamistis Hampson (Lepidoptera: Noctuidae)
Obonyo, D.N.1, 3, Lovei G.L.2, Songa, J.M.3, Oyieke, F.A.1, Nyamasyo, G.H.N.1 and
Mugo, S.4 .................................................................................................................. 90
Enhanced Propagation of Kenyan Pineapple through in vitro axillary bud
Proliferation
Robert K Ng’enoh Peter K Njenga, Jane W Kahia .................................................. 97
Molecular breeding for the development of drought tolerant and rice yellow
mottle virus resistant varieties for the resource-poor farmers in Africa
Ndjiondjop Marie Noelle, Manneh Baboucarr, Drame Khady Nani, Fousseyni
Cisse, Semagn Kassa, Sow Mounirou, Glenn Greglorio, Cissoko Mamadou,
Djedatin Gustave, Fatondji Blandine, Bocco Roland and Montcho David........... 101
Development of Insect Resistance Management Strategies for Bt Maize in
Kenya
Mulaa M. A., Bergvinson D. and Mugo S. ............................................................ 116
Incidences, Severity and Identification of Viral diseases in Passion fruit
production systems in Kenya
Otipa, M. J., Amata, R. L., Waiganjo, M., Ateka, E., Mamati, E., Miano, D.,
Nyaboga, E., Mwaura, S., Kyamanywa, S.; Erbough, M. and Miller, S................ 123
In vitro selection and characterization of salinity tolerant somaclones of
tropical maize (Zea mays L.)
Matheka Mutie Jonatha1, Esther Magiri, Rasha Adam Omer and Jesse Machuka
................................................................................................................................ 130
Developing Successful Cryopreservation Protocols For Shoot Tips And Nodal
Bud Explants Of Tropical Species Dioscorea Rotundata (Yams)
Marian. D. Quain, Elizabeth Acheampong, Patricia Berjak, and Marceline Egnin
................................................................................................................................ 138
Challenges and opportunities in the Development of Biotechnology in a
Developing Country: A scientist experience
Marian. D. Quain ................................................................................................... 142
Formulation Of Capsaicin As An Analgesic
Manoj Harihara, Anubama Rajan, Vijayashree Nayak and Abhinandan Dev ..... 148
Developing Protocols for Confined field Trials of Virus resistant Cassava in
Africa
v
Mallowa S.O., Ndolo P.J. , Obiero H.M. , Gichuki S. T , T Alicai, Y Baguma, Taylor
N.J., Fauquet C. and Doley W. P. ........................................................................ 152
Extraction of DNA from Macadamia (Macadamia spp): Optimizing on
quantity and quality
Lucy N. Gitonga,, Esther M. Kahangi, Anne W.T. Muigai, Kamau Ngamau, Simon
T. Gichuki, Bramwel W. Wanjala and Brown G.Watiki ........................................ 160
Developing Virus Resistant cassava for Kenya
Njagi Irene., Kuria Paul, Taylor Nigel, Bill Doley, Gichuki Simon ...................... 166
Efficacy of Bt-cotton against African bollworm (H. armigera) and other
arthropod pests
Waturu CN, Wessels W, Kambo CM, Wepukhulu SB, Njinju SM, Njenga GK,
Kariuki JN, Karichu PM, Mureithi JM, ................................................................. 175
Review of Farmers’ Awareness and Perceptions on Bt Cowpea in West Africa:
Case of Nigeria, Niger, Burkina-Faso, Mali and Benin
Aïtchédji C. 1* and O. Coulibaly1, .......................................................................... 181
Genetic and Biochemical Analyses of Cultivated Coffea Canephora (Pierre)
Diversity in In Uganda
ALUKA Pauline Kahiu Ngugi, MUSOLI, Pascal CUBRY, PhilippeDAVRIEUX
Fabrice, RIBEYRE Fabienne GUYOT Bernard, DE BELLIS Fabien, PINARD
Fabrice, KYETERE Denis OGWANG James, DUFOUR, Magali LEROY Thierry.
................................................................................................................................ 187
Genetic Diversity of Groundnut Botanical Varieties Using Simple Sequence
Repeats
Asibuo, J. Y, He, G., Akromah, R ., Safo-Kantanka, O. , Adu-Dapaah, H. K Quain,
M.D. ....................................................................................................................... 190
A Comparative Study of the Bacteriophage Efficiency and Antibiotics
Susceptibility against Sudanese Local Bacteria Species Escherichia Coli and
Staphylococcus Aureus
Ayman, A., E........................................................................................................... 196
Sorghum Proteome Analysis
Bongani K. Ndimba and Rudo Ngara .................................................................... 203
Regeneration Protocol of Aloe Vera L
Cecilia Mbithe Mweu, Justus M. Onguso, Jane Njambi Rugetho, and Aggrey
Bernard Nyende ..................................................................................................... 211
Evaluating A Map-1 Gene From The Chivhu Isolate Of Cowdria
Ruminantium As A Potential Dna Vaccine Candidate
E Chitsungo, A Nyika ............................................................................................. 216
Agro-Morphological and AFLP Markers for Cotton (Gossypium Hirsutum L.)
Genetic Diversity Studies
vi
Everina P. Lukonge, Liezel Herselman & Maryke T. Labuschagne ...................... 221
Gene Flow by Pollen Transfer from Herbicide Resistant (HR) Maize to
Conventional Maize
G. Kyalo, J. Bisikwa, N. Holst, T. P. Hauser and R. Edema ................................. 228
Comparison of BBTV infected with in-vitro derived bananas under field
conditions
Ikram-ul-Haq ......................................................................................................... 235
Competition between cultivated rice (Oryza sativa) and wild rice (Oryza
punctata) in Kenya
J. T. Munene, Jenesio I. Kinyamario, Niels Holst and John K. Mworia .............. 242
Haplotype Sharing for Fine Mapping Quantitative Trait Loci Controlling
Trypanotolerance in Mice
J. M. Kamau, P. W. Amwayi, O. A. Mwai, M.K Limo, P.W. Kinyanjui, M. Agaba ,
S.J. Kemp, J. P. Gibson and F. A. Iraqi ............................................................... 249
Assessment of Pollen-Mediated Gene Flow of Bt-Cotton to Local Commercial
Variety, Hart 89m in Kari-Mwea Station
Kairichi MN, Waswa BW1, Waturu CN, Wiesel W Ngigi RG, Njenga GK, Njinju SM
................................................................................................................................ 257
Effect of Bt-Cotton on Arthropod Diversity in a Confined Field Trial
Kambo CM, Waturu CN, Wessels W, Wepukhulu SB, Njinju SM, Njenga GK,
Kariuki JN, Karichu PM and Mureithi JM. ........................................................... 262
The Effect of Various Densities on Growth, Yield; Yield Components of Three
Soybeans [Glycine Max (L.)Merr.] Cultivars in Kermanshah Province
Keyvan shamsi,,Sohil Kobraee, Hamid Mehrpanah .............................................. 270
The Ecosystem Services Concept Provides a Conceptual Basis for Biosafety
Tests of Genetically Manipulated Plants in the Developing Countries
Gábor L. Lövei, Jenesio I. KINYAMARIO ............................................................. 274
amygdalina Del
Lewu FB, AJ Afolayan ........................................................................................... 280
Status of Biotechnology in Zimbabwe
Ester Mpandi Khosa and Wilson Parawira ........................................................... 287
Theme II: Policy and Biosafety, Communication, Awareness and
Networking................................................................................................................294
Reconstructing Biotechnology And Social Pathways: Interplay Of Cultural,
Science And Biotechnology
W. Quaye, I. Yawson and I. E. Williams ................................................................ 295
Building Capacities For Biosafety In West Africa
Walter S. Alhassan ................................................................................................. 301
vii
Background Ecological Status Of Soil Microbial Community Before Exposure
To Bt Cotton Farming
Swilla J and M. S.T Rubindamayugi ...................................................................... 307
Review Paper On The Status Biotechnology In Nigeria: A Case Study Of
Nabda And Road Map Model
Solomon, B.O, Gidado, R.S.M, and ADETUNJI, O.A. .......................................... 315
Sorghum grain mold: challenges and benefits of risk assessment for food and
feed safety
S.S. Navi, X.B. Yang, R.P. Thakur, and V.P. Rao .................................................. 321
Status Of Biotechnology In Africa
Monty Jones ........................................................................................................... 327
Baseline Survey of Farmers perception of TYLCV disease and their control
measures in the Ashanti region of Ghana
M.K.Osei, R.Akromah ,S.K.Green, S. L. Shih, C.K.Osei ........................................ 334
Biotechnology Applications In Animal Health And Production In Sub-Saharan
Africa: Scientific, Social, Economic And Cultural Limitations, And Prospects
Mbassa G. K., Luziga C., Mgongo F. O. K., Kashoma I. and Kipanyula M. J. .... 340
Communication, public understanding and attitudes toward biotechnology in
developing nations: A synthesis of research findings
Lulu Rodriguez and Eric Abbott ............................................................................ 346
Freedom to Innovate and the Cartagena Protocol on Biosafety
Worku Damena Yifru ............................................................................................. 352
Harnessing Biotechnology for Food Security in Ghana
H. Adu-Dapaah, M.D. Quain, J.Y. Asibuo, E.O. Parkes, R. Thompson, P. AdofoBoateng, J.N. Asafu-Agyei and S. Addy. ................................................................ 358
Towards A “Smart” Biosafety Regulation: The Case of Kenya
Ann Kingiri............................................................................................................. 364
The Status and Challenges of Livestock Biotechnology Research in Ethiopia.
The Case of Ethiopian Institute of Agricultural Research (EIAR)
Chernet, W.W and Jeilu, J ..................................................................................... 372
The Estimated Ex Ante Economic Impact of Bt Cowpea in Niger, Benin and
Northern Nigeria
Gbègbèlègbè D. S.; Lowenberg-DeBoer, J.; Adeoti R.; Lusk, J.; Coulibaly O. .... 378
Africa and Biosafety: International, Regional, and National Issues and
Challenges
Gregory Jaffe ......................................................................................................... 385
Scarecrows and commercial risks: GM-free private standards and their effects
on biosafety decision-making in developing countries
viii
Guillaume P. Gruere Debdatta Sengupta .............................................................. 392
Biosafety at the Crossroads: An Analysis of South Africa’s Marketing and
Trade Policies for Genetically Modified Products
Guillaume P. Gruere Debdatta Sengupta .............................................................. 400
IP in Plant Breeding and Biotechnology: Plant Variety Protection and Patents
in Africa
Niels P. Louwaars, Hamdino M.I. Ahmed & Abebe Demissie .............................. 409
Agricultural Biotechnology for Food Security: Case of Ethiopia
Hiwot Tifsihit ......................................................................................................... 419
Advancing from Biotechnology to Nanotechnology: The current and future
potential risks and benefits in agriculture and food products
Kimatu, Josphert Ngui ........................................................................................... 426
Gender Challenges in plant Biotechnology Research Activities in Ghana
Joyce Haleegoah, Marian Dorcas Quain J. N. Asafu Agyei ................................. 432
Towards functional biosafety regulatory frameworks in Kenya, Uganda,
Ghana and Malawi
Walter S. Alhassan, Catarina Cronquist, John Komen, Alick Manda, David Wafula,
Theresa Sengooba,Boniface Mkoko ....................................................................... 437
Discerning the Possibilibility of an Objective Ethical Framework for
Biotechnology in Africa
Lazarus N. Kubasu, LAMBERT KUBASU ............................................................. 446
Theme III: Potential Impact of Agricultural Biotechnology for Food Security
and Socio-economic Development in Africa, Farmer Participation and Publicprivate Sector Partnership ...................................................................................... 452
Biotechnology And Its Role In Attaining Food Security In Developing
Countries
Tadesse Mehari ...................................................................................................... 453
Biotechnology in Public Research Institutions in Kenya
Makokha S.N., E. Omondi E., Gathaara V., Mwirigi M. and S.T. Gichuki ......... 462
Biotechnology And The Youth: A Kenyan Perspective
W. S. Kahiu ............................................................................................................ 468
the Status Of Biotechnology And Biosafety In Tanzania
Roshan Abdallah, Gratian Bamwenda, Paul Gwakisa, and Nicholaus Nyange. .. 474
Date Palm Biotechnology And Sustainable Development In Nigeria
Chukwuemeka R. Eke, Omorefe Asemota, ............................................................. 478
An Overview Of The Potentials Of Natural Rubber (Hevea Brasiliensis)
Engineering For The Production Of Valuable Proteins
Omo-Ikerodah, E. E*., Omokhafe K.O; Akpobome F.A., M.U. Mokwunye .......... 482
ix
Climate Change, Biofuel, and Strategies for Harnessing Potential of
Agricultural Biotechnology for Food Security and Poverty Reduction in
Africa: The Case of Ghana
Nelson Obirih-Opareh ........................................................................................... 487
Socio Economic Impact Of Biotechnology Among Small Holder Farmers: A
Case Of Tissue Culture Banana Technology In Kenya
M.M. Njuguna, F. M. Wambugu, S. S. Acharya..................................................... 495
Value of herbicide tolerance for irrigated rice farmers in the Sahel
Matty Demont, , Jonne Rodenburg, Mandiaye DiagneSouleyman Diallo, Amadou
Abdoulaye Fall ....................................................................................................... 500
Impact of Information Technology on Biotechnology Development in South
Africa: Various Cases, with specific reference to Agriculture
Lucky Maako .......................................................................................................... 509
Grain Amaranth: A Sustainable Alternative to Genetically Modified/
Transgenic Cereals/Crops for Food and Nutrition Security in Africa?
Linus k. Ndonga ..................................................................................................... 516
GM Research – An Experience of Bejo Sheetal Seeds in India
B. Mazumdar .......................................................................................................... 519
Economic Evaluation Of Experimental Bt- And Non-Bt Cotton Plants In
Mwea Division Kirinyaga District
Muthoka NM., Waturu CN, Wessels W, Njinju SM, and Miriti, L. ........................ 524
Ecological implications of repeated glyphosate application to a weed
population in maize
Manuel Aguilar, Mariano Espinosa, Francisco Borjas......................................... 529
Towards Achieving Self-Sufficiency in Domestic Energy Needs: A Case of
Farmers' Experiences in the Use of Biogas from Plastic Digesters in the
Central Kenya Highlands
E.M. Kiruiro and F. Matiri .................................................................................... 536
A Review of the Development and Adoption of Biotechnology and Genetically
Modified Crops in Africa: antidote to food security and environmental
degradation problems
OBAYELU Abiodun Elijah..................................................................................... 542
Incremental Benefits of Genetically Modified Banana in Uganda
Enoch Kikulwe, Justus Wesseler, José Falck-Zepeda ........................................... 549
H. Adu-Dapaah, M.D. Quain, J.Y. Asibuo, E.O. Parkes, R. Thompson, P. AdofoBoateng, J.N. Asafu-Agyei and S. Addy. ................................................................ 559
Farmers’ Perception about Adoption of Genetically Modified Crops with
Special Emphasis on Banana Production in Kenya
x
Kimenju, J.W., Amugune, N.O., Kinyamario, J.I. and Kasina M.J.,...................... 562
Food Security and Socioeconomic Characteristics of Cocoa farming
households in Nigeria: Support through Agricultural Biotechnology
Lawal, Justina Oluyemisi………………………………………………………………..571
APPENDIX
Congress Summary and declaration
List of Congress Participants
576
576
582
xi
Opening Ceremony
xii
Call to Order
REMARKS BY PROF. NORAH K. OLEMBO DURING THE OFFICIAL
OPENING OF THE 1ST ALL AFRICAN CONGRESS AT THE GRAND
REGENCY HOTEL ON MONDAY SEPTEMBER 22ND 2008 NAIROBIKENYA
I welcome you all to the 1st All Africa Congress on Biotechnology here in Nairobi.
This Congress brings together for the first time in Africa, key stakeholders from four
continents- Africa, Europe, North America, and Asia. I am pleased to note that Africa
is as well presented here by key personalities in biotechnology. Amongst us here this
week farmer organizations, researchers, outreach agencies, regulators, policy makers
and many others are full house.
The primary purpose for this Congress is to share information on progress made in the
understanding and familiarization with the broad range of biotechnologies available
today. The Congress provides a forum for discussion on the potential applications and
risks for Africa’s development. The frequency of hunger and starvation in Africa is an
impediment to development. Of what impact can biotechnology have in addressing
recurrent hunger, starvation, malnutrition and poverty in Africa?
The Conference is not for or against biotechnology; it simply brings together
stakeholders to dialogue and share scientific information now available globally from
research, in order to inform Africa on the value and disadvantages of their application.
The conference is not about convincing anyone or imposing any views on African
countries. It is about sharing information on advantages and disadvantages of a
technology.
ABSF is a forum, which shares and facilitates dialogue amongst stakeholders through
public education and awareness creation on biotechnology and related issue in Africa.
We are a broad open-ended organization of numerous members and other continents.
We expect this conference to provide what is needed in terms of experts, media and
ambience to freely dialogue on this very important topic for Africa today.
Thank you
Professor Norah K. Olembo, Executive Director,
ABSF Secretariat, Nairobi, Kenya.
Chair Person,Planning Committee, 1st All
xiii
Africa
Congress
on
Biotechnology
Statement by Ms. Peace Rhoda P. Tumusiime,
Commissioner, Rural Economy and Agriculture:
Africa Union
I would like to first convey apologies from H.E. the commissioner of REA for not
having been able to attend this meeting due to other commitments so please allow me
to the congress.
1. Allow me to welcome you to this 1st All Africa Congress on Biotechnology to
be held in Africa organized to discuss topical issues of great importance to the
improvement of African agriculture sector. I would like to seize this
opportunity to recognize in our midst, our invited guests and international
partners whose presence amongst us today is a further testimony of their
genuine desire to continue to collaborate with us for the development of
Africa’s agriculture agenda. Further to these I bring you greetings from the
chairman of AU H.E. Jean Ping.
2. May I before proceeding express AU commission’s deepest gratitude to the
government of Kenya organizations, institutions and partners both local and
international for the invaluable financial and technical support towards the
organization of this congress. May I also express the African Union’s
appreciation to the government of the republic of Kenya for hosting this
meeting and the hospitality accorded to the delegates upon arrival here in
Nairobi; Africa’s city in the sun and hub. East Africa has a history of tourism
and I hope you take time and enjoy the beauty this region has to offer. Last bit
not least, I wish to thank the organizers, the African Biotechnology
Stakeholders Forum and the African biotechnology network in Africa who
have spent sleepless nights to bring issues of this congress to the attention of
African Policy makers as well as stakeholders challenged with the mounting
tasks of increasing agricultural productivity and food security in the continent.
3. Honorable Minister, despite the advancements of the highest level of
agricultural technologies in the world over the past twenty to thirty years, the
African continent is still grappling with various challenges including food
insecurity. Africa’s food import bill stands at a whooping $20bn; a situation
that must be reversed. Further down the ladder, statistics reveal that between
1992 and 2002 the number of undernourished people in Africa increased by
20%. The recent high food price outcries are heard everywhere and are still
reverberating and shaking households’ purchasing power to rock bottom.
4. The African union CAADP-NEPAD in collaboration with its development
partners is aimed and committed to explore feasible options that would offer
sustainable solutions to Africa’s agriculture challenges and to make Africa’s
food insecurity situation a history. One such commitment is the decision o
increase investment in agriculture by a minimum of 10% of national budgets.
Though it is over five years (the decision was taken in Maputo in 2003), since
this decision was endorsed by African member states, only a few countries
have surpassed this level. The other commitments that the African Union
heads of states and Government have made include their decisions during their
Extra Ordinary Summit held in Sierte, Libya in February 2004 and at the 5th
xiv
Ordinary Session held in Sirte Libya 2005 to explore the potentials of
Genetically Modified Organisms (GMOs) in agriculture: address the seed
sector; and improve Early Warning Systems For Food Security.
5. Distinguished delegates- it is not only in Africa that the issues of genetic
engineering in agriculture have triggered debates on how to respond to food
insecurity and how to achieve a longer term agricultural growth. The two
extreme positions the pro-genetic engineering and extreme anti-genetic
engineering positions are not unique to Africa. The extreme pro-genetic
engineering groups tend to catalogue potential benefits of the technology and
often dismiss any concerns about potential risks. They tend to portray
biotechnology as the panacea to combat food insecurity in Africa. On the other
extreme the anti-biotechnology activists who see no evident benefits and who
associate the technology with nothing but total danger and risks would like the
development, commercialization and application of the technology stopped.
6. These two extremes have raised concerns and confusion to many african
policy makers and sections of the public mainly because of the scanty and lack
of reliable information and guidance. There is uncertainity in many of the
African governments’ on how to respond to a wide range of social, ethical,
environmental, trade and economic issues associated with the development
and application of modern Genetic Engineering. The absence of an African
consensus and strategic approaches to address these emerging biotechnology
issues has allowed different interest groups to exploit the uncertainty in
policymaking, regardless of what maybe the objective situation for Africa.
Both pro and anti biotech advocacy groups can affect African decision making
adversely, as they portray Genetic Engineering in extremes, making it appear
like it is an “either – or “ situation.
7. African governments have recognized the importance of regional cooperation
to address possibilities and the range of issues associated with biotechnology
and Genetic Modification. It is in this context that the African Heads of States
and Governments during their summit in Sirte, Libya, endorsed a resolution to
promote research in biotechnology and Genetic Engineering. Two years later,
the assembly of heads of states and governments once more reflecting on the
food situation in Africa during the assembly in Maputo, Mozambique, once
more called fro a “Common African position on Genetic Engineering. These
two resolutions indicate the commitment by African leaders that GM
technology may as well be one of the tools along that will resolve some of the
constraints of African agriculture and should be considered along with other
farming practices- fertilizers, seed soil and water conservation, and post
harvest storage. In this regard, the AU commission organized a consultative
meeting of experts in Addis Ababa on October 17, 2006 to address the issues
of GMOs in agriculture and to develop guidelines on the controversies thereof.
I am grateful to inform you that the experts have had in-depth and professional
discussions that enabled them to strike a balance and successfully drew some
guidelines on GMOs that will be presented in this congress
8. Honorable Minister, one of the major concerns in the adoption of Genetic
Engineering for Agriculture and food security in Africa is in the area of
xv
Biosafety. Again to address issues of safety in biotechnology, the African
Heads of State and governments in the 74th Ordinary Session of the AU
Council of Minster held in 2002 in Lusaka Zambia endorsed the African
Model Law on Biosafety.
With support from our partners, the AU department of Human Resources,
Science and Technology, have revised and updated this law for use by the
African Member states most of whom are signatories to the Cartagena
Protocol on Biosafety. The model law and the attendant Biosafety framework
are on the agenda for this congress.
9. Honorable Minister, Distinguished delegates, ladies and gentlemen;
biotechnology and food security are heavily dependant on seed security. This
calls for concerted effort at enhancing the development of the seed sector at
the continental, region and national levels with varieties suited for the various
agro-ecological zones for the continent. When the seed if of the required
quality, the potential benefits including yields, pests, disease and drought
tolerance; as well as enhanced incomes can be high. In addition to a strong
seed industry therefore, it is necessary to improve soil fertility using fertilizers,
provide water and storage facilities to our farmers, provide roads and related
infrastructure, and open markets if our efforts towards food security, should
remain credible and sustainable.
10. Honorable Minister, ladies and gentlemen, you have several challenging
issues to address. Critical among them is the question of capacity building in
all areas of biotechnology:
• We need capacities not only for research but for infrastructure to
handle the enormous work involved in biotechnology work.
• We need not only Biosafety clearing houses, but also capacities for risk
assessment and regional standards to respond to concerns in Biosafety.
• We need research targeting African orphan’s crops on which rural
communities depend for their food security needs and rural livelihoods.
• We need infrastructure for accessing markets
• Embedded in all these is capacity and infrastructure for information
exchange.
11. This congress Honorable Minister has brought together eminent scientists
with wide and varied experience in the science of biotechnology,
representatives of the private sector and development partners in a foru day
debate to find sustainable ways of boosting agricultural productivity in Africa.
In the light of today’s food security crisis and current estimates that the global
demand for food will increase by one half in the next 20 years, greater
investment in agricultural productivity is crucial for poverty reduction and
future economic stability.
12. Agriculture has been shown time and again to have powerful impact on
poverty reduction. Growth in agriculture has driven wider economic growth
throughout history- from 18th Century England, to 19th C Japan, to 20th C
India. Growth in agriculture really delivers: according to the 2008 World
Development Report, GDP growth generated by agriculture is up to four times
more effective in reducing poverty than growth in other sectors. In 2003, the
xvi
United Nations called for agricultural development to be placed at the fore
front of the fight against extreme hunger and poverty. Half a decade later, the
world is still debating how best to bring agricultural development to Africa.
Quoting from the just concluded AGRA meeting report, (Oslo, August 2008)
and I quote-“ the world urgently needs a green revolution in Africa and the
Africa continent has the potential to deliver”, Bage said.” But we are still
failing, collectively, to give Africa the level of a co-coordinated and cohesive
support that it needs to do so”. End of quote.
13. It is therefore my understanding that this congress will underscore the
importance of mobilizing political will across the continent and among our
strategic partners; making the case for globally examining the above and other
emerging issues central to Africa, so as to come up with concrete resolutions
in capacity building as well as to provide policy guidance. The AU
commission will continue to play the harmonization and coordination role in
addressing issues in which it has a comparative advantage.
14. Lastly but not least, let me take this opportunity to invite you to the
forthcoming workshop on Ecological Agriculture towards food security,
mitigating climate change and enhancing rural livelihoods in Africa. The
workshop is scheduled in Addis Ababa Ethiopia from 23-28 November 2008.
The workshop seeks to analyses the implication of high chemical fertilizer
input on the resource poor farmer of Africa, particularly those threatened by
climate change and desertification and to explore niches for adjusting policy
strategies to address food security and rural developments in Africa. Good
attendance by member states coupled with political and resource commitment
will exemplify the continents solidarity in fighting food insecurity from all
angles.
15. Once again the African Union Commission is thankful to the government of
the republic of Kenya, organizations, institutions, and partners, both local and
international for a job well done in making this meeting a success. I wish u
fruitful deliberations.
Thank you.
xvii
Welcome Address by Prof. Shaukat Abdilrazak, Secretary, National
Council for Science and Technology (NCST), Kenya
Ladies and gentlemen
It gives me pleasure to be here this morning to give welcome remarks over this important
international 1st all Africa congress on biotechnology.
Honorable Minister, I understand that for the continent to awaken from sluggish
development in biotechnology a broad based forum comprising of key stakeholders must be
meeting regularly, and this is the first forum of its kind in Africa. These kinds of for a will
fast track the adoption and realization of potential benefits of biotechnology to Africa’s
populations. it is timely that Africa hears from other countries in both the developed and
developing world on how biotechnology application has significantly improved lives and
livelihoods of million of households that is India and south Africa are a good example in Bt.
cotton farming.
The application of safe biotechnology aimed at developing new products which are useful in
many spheres of life has proved to be one of the best options from development, in view of
rising demands caused by human population increase. The potential benefit from the use of
genetically modified organisms in the areas of agriculture, human health, animal production,
trade industry and environmental management are clearly recognized i.e. the development of
insulin in health sector and production of biofuels in those countries which have adopted
biotechnology. Embarrassing biotechnology is to do things differently, big things making
impossible possible or getting more from less, more we need to look at stars with our feet on
the ground. As a result there is a renewed effort at global, regional and national levels to
initiate activities that would enable countries to prepare national biosafety and biosecurity
guidelines and to harmonize regulations so as to be able to use and apply biotechnology
judiciously within the human ecosphere.
Honorable Minister, the ministry of higher education science and technology through
national council for science and technology where I head is spearheading the modern
biotechnology and biosafety activities in Kenya and so far we have accomplished four
components. As you are all aware there is biotechnology policy and biosafety bill which is in
parliament for debate, a manual on monitoring and inspection has been prepared and finally
guidelines to handle genetically modified requests or applications are in place. The
component on public awareness will be launched this week in the name of the national
biotechnology awareness strategy (BioWARE)
Honorable Minister, this congress on biotechnology will be a bold move to consolidate
collective views and responsibility by African governments in adopting broad based
programmes that will implement various biotechnology projects towards millennium
development goals achievements, just as every life is equal. Every mind is innovative.
Innovation is laboratory of life and biotechnology is one of the big sciences that we should
embrace.
Honorable Minister, I wish to welcome everybody in this 1st all Africa congress on
biotechnology and especially those visitors who have come to this wonderful country.
Thank you.
xviii
THEME I
ADVANCEMENT IN BIOTECHNOLOGY:
MOLECULAR
BIOLOGY,
BIOINFORMATICS,
BIOTECHNOLOGY TOOLS
1
GENOMICS,
ENGINEERING
MICROORGANISMS
BIOETHANOL PRODUCTION
FOR
INDUSTRIAL
M. Taylor 1, M. Tuffin1, R. Wadsworth1, T. Atkinson 2, R. Cripps 2, K.
Eley 2 and D. Cowan1
1
Institute of for Microbial Biotechnology and Metagenomics (IMBM), University
of the Western Cape, Cape Town, South Africa.
Fax: +27(0)219593505 ; Email:mtaylor@uwc.ac.za
2
TMO Renewables Ltd, 40 Alan Turing Road, Surrey Research Park, Guildford
GU2 7YF.
Abstract
Biofuels are viewed as a potential solution to the impending challenge of reducing our
dependence on fossil fuels. A bioethanol production process resulting from microbial
fermentations has been shown to be suitable for industrial scale ethanol production.
Traditionally the organisms Saccharomyces cerevisiae and Zymomonas mobilis have
been chosen as production strains. Recently, researchers have decided to seek new, more
adaptable micro-organisms that possess alcohol synthesis pathways with particular focus
on the key intermediately enzyme pyruvate decarboxylase (Pdc). We present an overview
of the current microbial processes and our own progress in screening a range of aerobic
mesophilic and thermophilic isolates using a combination of gene-specific and enzyme
activity assays to identify new and novel enzymes that possess Pdc activity and which
may be suitable in a thermophilic ethanol production process than those currently
characterized.
Keywords:
Thermophile, biofuel, bioethanol, pyruvate decarboxylase, screen.
Introduction
Gasoline is a major drain on existing oil reserves and impacts negatively on both the local
and global environment through the emission of particulates and gases that contribute to
global warming and climate change (Bai et al., 2008;Doran-Peterson et al., 2008). To
address these issues there is significant interest in the incorporation of alcohols,
particularly anhydrous ethanol, into conventional gasoline having the twofold effect of
reducing CO2 emissions and reducing oil consumption that would otherwise be used in
transportation. Biofuels are increasingly viewed as an essential part of the solution to the
impending challenge of reducing our dependency on fossil fuels especially those used in
transport (Hahn-Hagerdal et al., 2006).
Bioethanol production from the fermentation of food grade carbohydrates has
traditionally been mediated by ethanologenic microorganisms such as Saccharomyces
cerevisiae (Zaldivar et al., 2001a) and Zymomonas mobilis (Rogers et al., 2007;Buchholz
and Eveleigh, 1990) expressing endogenous pyruvate decarboxylases (Pdc), key
intermediately enzymes in ethanol synthesis. The traditional dependency on food grade
carbohydrate is of particular concern among African nations (Thomas and Kwong, 2001).
This has stimulated many researchers to look critically at the conventional production
strains and seek new, more adaptable alcohol producing micro-organisms with broader
2
mono- and polymeric carbohydrate catabolic capabilities and the potential therefore to
convert biomass waste products to alcohol.
A number of thermophilic organisms from the genera Clostridium (Demain et al., 2005),
Thermoanaerobacter (Cayol et al., 1995;Peng et al., 2008) and Geobacillus (Thompson
et al., 2008;Fong et al., 2006;McMullan et al., 2004) possess ethanologenic properties as
well as broad catabolic fermentation phenotypes. The additional advantage of high
temperature fermentations is, potentially, the facilitated product separation that can be
achieved through exploitation of the physical properties of ethanol (Hartley and Sharma,
1987). The major limitation in the development of an economically viable process with
these organisms is the low product yield from sugars, metabolism usually favoring the
production of organic acids over alcohols (Hartley and Payton, 1983). Figure 1 shows a
complete summary of the major mixed acid and alcohol fermentative pathways.
Figure 1: Fermentative metabolic fates of pyruvate.
The metabolic fate of pyruvate is dependent upon the gene complement of the microorganism and
environmental conditions. Pdc mediated ethanol production offers a more economical ethanol output by
restricting by-product accumulation associated with the metabolic intermediate acetyl-CoA. Green shows
by-products that have potential for industrial biofuel production, whilst red indicates undesirable byproducts. Reproduced courtesy of R. Wadsworth (IMBM).
Through metabolic engineering, selective gene deletion and gene expression programs,
these limitations can be overcome and product yield increased significantly. One
alternative approach is to seek mesophilic or thermophilic variants of pdc (or similar
enzymes with alternative substrate specificity i.e. pyruvate homologues) and seek their
expression in the chosen host at temperatures optimum for growth and production (the
former strategy requiring a precursive forced evolutionary step to attain in vivo
thermostability).
In this way a thermophilic homo-ethanologenic pathway can be maintained. Apart from
the ability to ferment crude or treated hydrolysate materials it has also been proposed that
several other criteria must be met by an industrially significant 2nd generation
2
ethanologenic strain. These include high ethanol yields (>90% theoretical), ethanol
tolerance >40gL-1 and process adaptability (tolerance to fluctuations in pH and
temperature). Ideally the strain would also not require complex growth supplements
(Zaldivar et al., 2001b).
Methods
An overview of the isolation and characterisation process can be seen in figure 3.
Microbial Isolations.
Novel organisms are isolated from a diverse set of environmental samples using standard
microbial techniques and on a variety of selective media, designed to capture
representative organisms from the known ethanologenic genera. Environmental material
has been sourced from Hydrothermal pools (Figure 2), Western Cape winery waste:
Waste streams, soil and fruit and Desert Soils.
Figure 2: Geothermal pools located in from two different African nations. The pools
are typical of those found in these locations but are significantly divergent with respect to
Organic content, thermal range and salinity/acidity.
Ethanol Production
Alcohol production is screened from liquid culture supernatant run on a suitable column
and analyzed by HPLC with dual UV and RI detection. Individual organic acids, sugar
and alcohol components are quantified against suitable standards and ethanol yields
expressed in terms of both sugar consumption (gg-1 sugar) and biomass production (gg-1
biomass).
Novel gene mining
Cell pellets representative of each isolated are retained and the genomic DNA extracted.
A pdc specific PCR amplification screen is run in order to generate hits from primers
designed on regions of homology (identified from alignments of the pdc gene sequences
from Z. mobilis, Z. palmae and S. ventriculi). Strong PCR amplicons of the expected size
are cloned, sequenced and assessed for their suitability for gene cloning and expression
studies to determine substrate specificity and ultimately any thermostable Pdc activity
2
Wineries
ENVIRONMENTAL SAMPLE
Focus on high glucose/high ethanol sample
sites.
Distilleries
Fruit
factories.
canning
PLATING/ISOLATION
Variety of
selective media
ISOLATES
ETHANOL
SCREEN
PRODUCTION
Gene screen
Interesting strains (based on
EtOH tolerance/Production or
PCR
screen
OR
combinations thereof) taken
for 16S sequencing
HPLC analysis
Figure 3: Isolation and screening methodologies.
A summary of the isolation and characterization screen, for the generation of novel
ethanologenic mesophiles and thermophiles with potentially novel pdcs or similar genes.
Reproduced courtesy of R. Wadsworth (IMBM).
Results and Discussion
Microbial Isolations
So far a variety of novel microorganisms have been isolated from a number of diverse
thermophilic and mesophilic environments from across Africa. Table 1 summarises the
numbers of isolates we have collected so far from a variety of locations. A number of
mesophilic organisms with putative pdc genes have been isolated but as yet, no amplicon,
thermophilic in origin, has been seen. This is consistent with the observation that no Pdc
from a thermophilic organism has ever been reported in the literature and relatively few
from mesophiles, reinforcing the premise that they are rare in bacterial spp and extremely
rare, if existent, from thermophilic species.
2
Location
Ethiopian Hot Springs
Namibian Desert Soil
Wineries
Zambian Hot Springs
Yield a putative Pdc amplicon
Mesophiles
33
325
116
10
Thermophiles
85
3
123
67
0
Table 1: A summary of phenotypically interesting isolates collected as part of the
isolation screen: A variety of mesophiles and thermophiles have been isolated from
several diverse natural environments that would be expected to enrich potentially strains
capable of producing or tolerant to alcohol as well as extremophilic.
In addition to these developments we now employ a metagenomic approach to gene
discovery, isolating the total DNA from an environmental sample and using this as a
template for subsequent PCR reactions. In this way we can isolate genes from the wider
microbial community present in an environmental sample, a high proportional of which
will not be cultured through using standard media and laboratory techniques due to
complex, unmet growth requirements. Parallel to this research and in light of the low
frequency of novel Pdc enzymes, amplicons from mesophilic origins could have both
substrate specificity and thermostability engineered into the protein structure. A number
of interesting genes have already been isolated and identified and significant progress has
been made in the characterization and structural identification of the enzymes they
encode and more specifically the amino acid residues that will require engineering for
substrate/thermo-adaptation.
Having identified the residues that are responsible for substrate/thermo-adaptation we
propose to use site directed mutagenesis to sequentially alter these residues and
potentially generate novel enzymes with pyruvate specificity (and decarboxylase activity)
verified through alcohol dehydrogenase/NAD/NADH linked enzyme assays. Having
altered substrate specificity, a variety of techniques are available such as forced evolution
and error prone PCR, in order to engineer thermostability in a suitable host (a
thermophilic ethanologen) and hence the first in vivo thermostable pyruvate
decarboxylase. Precedents for this strategy exist in the literature where recently several
reports have recently been published demonstrating in vivo Pdc activity (Z. mobilis and
Z. palmae) up to 52°C in thermophilic Geobacillus spp. that have mutations in the lactate
dehydrogenase gene (ldh) and consequently higher ethanol yields across a variety of
substrates(Taylor, 2008;Thompson et al., 2008).
Conclusion
A novel library of mesophilic and thermophilic isolates has been constructed drawing on
a wide variety of unique environmental samples. Ongoing screening of this ever
increasing library is generating a number of interesting ethanol and butanol tolerant
isolates and a number of putative Pdc and iPdc enzymes that can be used as a platform
for the evolution of novel enzymes with pyruvate specificity and thermostability. So far
two iPdcs have been selected, sequenced and cloned and found to have considerable
potential for mutagenesis, by comparison of both their tertiary structure and active site
2
residues. These experiments demonstrate the first steps towards the isolation or evolution
of a thermostable Pdc, which could be a key metabolic route for ethanol production in a
number
of
versatile
thermophilic
hosts
that
are
being
developed in a separate research programme.
References
Bai,F.W., Anderson,W.A., and Moo-Young,M. (2008) Ethanol fermentation
technologies from sugar and starch feedstocks. Biotechnol Adv 26: 89-105.
Buchholz,S.E., and Eveleigh,D.E. (1990) Genetic modification of Zymomonas mobilis.
Biotechnol Adv 8: 547-81.
Cayol,J.L., Ollivier,B., Patel,B.K., Ravot,G., Magot,M., Ageron,E. et al. (1995)
Description of Thermoanaerobacter brockii subsp. lactiethylicus subsp. nov., isolated
from a deep subsurface French oil well, a proposal to reclassify Thermoanaerobacter
finnii as Thermoanaerobacter brockii subsp. finnii comb. nov., and an emended
description of Thermoanaerobacter brockii. Int J Syst Bacteriol 45: 783-9.
Demain,A.L., Newcomb,M., and Wu,J.H. (2005) Cellulase, clostridia, and ethanol.
Microbiol Mol Biol Rev 69: 124-54.
Doran-Peterson,J., Cook,D.M., and Brandon,S.K. (2008) Microbial conversion of
sugars from plant biomass to lactic acid or ethanol. Plant J 54: 582-92.
Fong,J.C.N., Svenson,C.J., Nakasugi,K., Leong,C.T.C., Bowman,J.P., Chen,B. et al.
(2006) Isolation and characterization of two novel ethanol-tolerant facultative-anaerobic
thermophilic bacteria strains from waste compost. Extremophiles 10: 363-372.
Hahn-Hagerdal,B., Galbe,M., Gorwa-Grauslund,M.F., Liden,G., and Zacchi,G.
(2006) Bio-ethanol--the fuel of tomorrow from the residues of today. Trends Biotechnol
24: 549-56.
Hartley,B.S., and Payton,M.A. (1983) Industrial prospects for thermophiles and
thermophilic enzymes. Biochem Soc Symp 48: 133-46.
Hartley,B.S., and Sharma,G. (1987) Novel Ethanol Fermentations from Sugar Cane
and Straw. Philosophical Transactions of the Royal Society of London.Series A,
Mathematical and Physical Sciences. 321(1561), 555-568.
McMullan,G., Christie,J.M., Rahman,T.J., Banat,I.M., Ternan,N.G., and Marchant,R.
(2004) Habitat, applications and genomics of the aerobic, thermophilic genus Geobacillus
27. Biochem Soc Trans 32: 214-7.
Peng,H., Wu,G., and Shao,W. (2008) The aldehyde/alcohol dehydrogenase (AdhE) in
relation to the ethanol formation in Thermoanaerobacter ethanolicus JW200. Anaerobe
14: 125-7.
Rogers,P.L., Jeon,Y.J., Lee,K.J., and Lawford,H.G. (2007) Zymomonas mobilis for
fuel ethanol and higher value products. Adv Biochem Eng Biotechnol 108: 263-88.
Taylor, M.P. Esteban, C and Leak, D. J (2008). Development of a versatile shuttle
vector for gene expression in Geobacillus spp. Plasmid. In Press.
Thomas,V., and Kwong,A. (2001) Ethanol as a lead replacement: phasing cut leaded
2
gasoline in Africa. Energy Policy 29: 1133-1143.
Thompson,A.H., Studholme,D.J., Green,E.M., and Leak,D.J. (2008) Heterologous
expression of pyruvate decarboxylase in Geobacillus thermoglucosidasius. Biotechnol
Lett.. In press.
Zaldivar,J., Nielsen,J., and Olsson,L. (2001a) Fuel ethanol production from
lignocellulose: a challenge for metabolic engineering and process integration. Appl
Microbiol Biotechnol 56: 17-34.
2
amygdalina Del.
Lewu FB11*, AJ Afolayan2
1. Department of Agriculture, University of Zululand, Kwa-Dlangezwa, 3886,
SA.
2. Department of Botany, University of Fort Hare, Alice, 5700, South Africa.
Abstract
Vernonia amygdalina Del. is a medicinal vegetable used for the treatment of diabetics by
the people of Eastern Cape Province, South Africa. Due to the recent discovery of the
medicinal value of the herb by several communities in the province, a high demand for
the species has arisen. However, the Eastern Cape Province is characterized by limited
rain fall and prolonged winter season of over six months per annum, which pose a great
threat to the survival of V. amygdalina which is a tropical species susceptible to frost, an
annual phenomenon of the winter season of the region. In our effort to increase the
population of the species within the province, a micropropagation approach through
tissue culture technology was employed. This study reports the influence of hormones
and temperature on the micropropagation of this valuable species and further elucidates
the importance of transfer techniques in the overall survival of the planets.
Keywords:
Eastern Cape; Hormones; medicinal vegetable; micropropagation;
Temperature; Vernonia amygdalina;
Introduction
Vernonia amygdalina Del. belongs to the plant family Compositae and it is a species
commonly consumed by West Africans as a vegetable and as a good source of medicine
to treat several diseases (Akinpelu, 1999; Masaba, 2000; Abosi, 2003; Iwalokun et al.,
2006). It is a tropical species found growing in several African countries from West to
Central Africa and in the tropical climates of Zimbabwe in Southern Africa. In the
Eastern Cape Province, V. amygdalina is used as a medicinal plant for the treatment of
diabetics (Erasto et al., 2005); a disease that has increased steadily among black and India
populations of South Africa within the last decade (Omar et al., 1993; Erasmus et al.,
2001). Due to the recent discovery of the medicinal value of the vegetable by several
communities in the province, a high demand for the local use of the species has
increased.
However, the Eastern Cape Province is characterized by limited rain fall and prolonged
winter season of over six months per annum. These critical climatic conditions pose a
great threat to the survival of V. amygdalina which is a tropical species susceptible to
frost; an annual phenomenon of the winter season of the Eastern Cape Province of South
Africa. Tissue culture propagation has been found to be an available tool to increasing the
population of this herb. In our effort to increase the population of the species within the
province, a micropropagation approach through tissue culture technology was employed.
This study reports the influence of hormones and temperature on the micropropagation of
1
*Corresponding author: Fax: +27 35902 6056 email: flewu@pan.uzulu.ac.za
3
this valuable species and further elucidates the importance of transfer techniques in the
overall survival of the plantlets.
Materials and methods
Plant materials
The experiments were carried out in the phytomedicine laboratory of the Department of
Botany, University of Fort Hare, South Africa. Explants for this study were collected
from a vigorously growing healthy mother plant of V. amygdalina growing in the
medicinal garden of the Teaching and Research Farm of the University of Fort Hare. Leaf
and stem explants were collected and surface sterilized with 70% ethanol for two minutes
and shaked in 0.1% mercuric chloride for 5 minutes. The sterilized explants were rinsed
in several changes of double distilled sterile water. In order to ensure efficient culturing,
brown portions of the sterilized explants were removed using sterile scalpel before
culturing.
Callus induction
The callus induction medium contained Murashige and Skoog’s (1962) basal salts,
supplemented with 1.0 - 4.0 mg l–1 6-Benzylaminopurine (BA) or α-Naphthaleneacetic
acid (NAA), Na2EDTA (7.4g.l-1), myoinositol (20 g l-1), thiamine-HCl (0.1 g l-1), 2.0 mg
l–1 glycine, 690 mg l–1 proline, sucrose (30 g l-1) and was solidified with 5 g l–1 Difco
bacto-agar. The pH was adjusted to 5.8 and the media were sterilized by autoclaving at
121°C for 20 min. All the explants were incubated for callus induction in the media at 25
±3°C under continuous illumination with a photosynthetic photon flux density of 184.8
(±5) µmol m−2 s−1 provided by cool-white fluorescent lamps. The same experiment was
duplicated under continuous dark condition in five replicates. For each part of the plant
samples used, thirty explants were inoculated per treatment making a total of 60 samples
for both light and dark experiments. Explants kept under dark experiment produced both
calli and prolific shoot organogenesis after 10 days in induction medium. the percentage
of explants producing primary calli were determined, and the calli were then cut into
smaller sizes and transferred to the same medium for another one week under continuous
light condition. Where calli were not produced, the percentage of explants producing
direct shoot organogenesis from stem explants was also determined.
Shoot differentiation and micropropagation of plantlets
The basal composition of the subculture medium was the same as that of the induction
medium. Each callus was cut into smaller pieces (approximately 0.5g fresh weight)
during transfer and subcultured two times. The cultures were transferred onto fresh
subculture medium every week and were maintained at 25 ±3°C under continuous
illumination. After three weeks, the percentages of calli forming shoots were recorded.
Micropropagation of shoots was also conducted on plantlets to determine the rate of
direct shoot proliferation under different hormone concentrations. At about 6 cm height
and with nine visible leaves, plantlets with healthy looking roots were removed from
culture, rinsed in water (to remove media) and transplanted into a mixture of equal parts
(v/v) of sterilized soil and vermiculite. They were watered with half-strength MS salts
solution and acclimatized under 60 – 70% relative humidity in plastic pots. The
1
acclimatizing procedure was maintained under two day and night temperature regimes of
15±3°C -10±3°C and 27±3°C - 23 ±3°C respectively. Plantlets were transferred to the
field after 21 days in glass chambers (Figure 3b)
Data analysis
The callus induction experiment was analyzed in a factorial pattern with hormones and
light condition being the main factors. Two hormones 6-Benzylaminopurine (BA) and αNaphthaleneacetic acid (NAA) at four levels each were tested under continuous darkness
and light conditions. The first data were analyzed using the proc GLM model of SAS
package in a factorial arrangement. Duncan multiple range test (P< 0.01) was used for
multiple mean comparisons of the interactions between the different levels of hormones
used and the two photogenic conditions. In the second experiment, the two hormones
were analyzed at the four levels of concentration and the mean separation was also
conducted using Duncan multiple range test of SAS package (SAS, 1999).
Result
Generally, callus formation and direct shoot organogenesis were more successful under
continuous dark than continuous light condition (Table 1 and Figure 1a). Most of the
samples obtained under continuous light showed necrotic condition and were
subsequently discarded. Explants used for further studies were obtained from samples
previously under continuous dark condition. The highest percentage production of callus
was formed in the medium containing 1 mg l–1 BA with a mean callus yield of 8.0
representing 26.7% of the explants tested. The same medium at the same concentration
under continuous light condition also gave the best response to direct shoot
organogenesis with a mean of 17.80 explants representing 59.33% of the explants
cultured. Increasing concentration of the hormone above 1 mg l–1 showed progressive
decrease in response to callus formation (Table 1).
Table 1. Mean number of stem explants (n=30) which produced callus and direct shoot organogenesis and the number of callus
derived from leaf source under two hormones and light regimes.
Type of hormones and the levels of Light
Number of callus Direct
shoot Callus formed from
concentration
conditionsa
formed from stem organogenesis
from leaf explants ± SDev
explant ± SDev*
stem explant ± SDev
6-Benzylaminopurine (BA)
5.20 ± 0.79e
1.80 ± 1.23c
0
+
3.00 ± 0.67d
a
a
8.0 ± 1.58
17.80 ± 0.84
0.60 ± 0.89d
1
+
2
+
6.20 ± 0.84b
10.40 ± 1.14b
4.00 ± 0.71a
4.60 ± 1.14c
5.80 ± 1.30e
2.0 ± 1.22c
3
+
4
+
3.20 ± 0.84d
8.60 ± 1.14c
3.20 ± .84b
f
d
0.40 ± 0.52
7.00 ± 1.22
0.00 ± 00e
1
2
1.80 ± 0.84e
3.00 ± 0.71f
0.20 ± 0.45d
f
g
0.80 ± 0.84
1.80 ± 0.84
0.20 ± 0.45d
3
f
f
4
0.60 ± 1.55
2.20 ± 0.84
0.40 ± 0.55d
α-Naphthaleneacetic acid (NAA)
0.40 ± 0.55fg
2.30 ± 0.82f
0.60 ± 0.89d
0
+
2.20 ± 1.30de
3.00 ± 0.71f
0.60 ± 0.89d
1
+
e
f
2
+
1.20 ± 1.30
1.80 ± 0.84
0.00 ± 00e
e
f
1.80 ± .084
1.80 ± 0.84
0.60 ± 0.89d
3
+
4
+
1.60 ± 1.14e
2.40 ± 1.14f
0.00 ± 00e
0.20 ± 0.45g
0.40 ± 0.55h
0.00 ± 00e
1
2
0.20 ± 0.45g
0.40 ± 0.55h
0.00 ± 00e
g
h
0.20 ± 0.45
0.40 ± 0.55
0.00 ± 00e
3
g
h
0.20 ± 0.45
0.40 ± 0.55
0.00 ± 00e
4
-
2
a
+ indicates continuous darkness and – indicates continuous light condition. *Standard deviation. Means
with the same letter along the same column are not significantly different (P< 0.01).
This is also true for direct shoot organogenesis up to 3 mg l–1 with a significant increase
of 8.6 (P< 0.01) explants at 4 mg l–1 (Table 1).
Direct shoot organogenesis was generally more successful with BA at 1 mg l–1 than NAA
and the result showed a sharp drop in response (from 1 mg l–1) with progressive increase
in the levels of concentration across both hormones used (Table 1). Leaf explants
generally showed poor response to callus formation and the friable calli formed did not
develop under continuous light condition. In the second experiment, direct
micropropagation of shoot in both hormones under continuous light condition and four
levels of concentration showed similar response as the callus induction study. Plantlets
cultured in 1 mg l–1 BA showed superior (91%) response to shoot organogenesis
compared with NAA and other concentrations used in the study (Table 2 and Figure 1b).
Table 2. Percentage response of micropropagation of V. amygdalina using intact shoots
cultured under two hormone conditions at different levels of concentration
Type of hormones and the levels of concentration
Percentage shoot yield (%)
1
91.11 ± 1.92a
2
3.33 ± 2.00c
3
6.67 ± 2.00b
4
3.33 ± 2.00c
1
3.33 ± 2.00c
2
1.90 ± 2.00c
3
1.92 ± 2.00c
4
3.33 ± 2.00c
Means with the same letter along the same column are not significantly different (P< 0.01).
The micropropagation study did not show any distinct pattern of response to hormone
treatments above 1 mg l–1 BA. Except for 3 mg l–1 BA, all the other concentrations did not
show any significant (P< 0.01) difference in yield across both hormones used in the
experiment (Table 2). Over 90% of the plantlets produced a pair of long healthy roots
which gave the plantlets great opportunity for establishment during acclimatization study
(Figure 2a). Plantlets established under 27±3°C - 23 ±3°C temperature regimes gave 82%
rate of survival (Figure 2b and 3a) while those transferred at lower temperature range of
15±3°C
-10±3°C
gave
a
significant (P< 0.01) low response of 19% rate of success. Plantlets were successfully
established on the farm with 100% survival rate (Figures 3b).
Discussion
Protocols for the induction of callogenesis and direct shoot regeneration have been
developed for V. amygdalina. BA generally showed good response to callus formation in
this species. With the result obtained from this study, it appears that callus formation in
this plant could be impaired from any concentration above 1 mg l–1 as the explants
produced limited number of callus above this concentration in BA medium. This may be
due to high physiological response of plants cells to cytokine growth regulators (Torres,
1989). Cytokinins have been reported to stimulate shoot proliferation in many species
(Theim, 2001; Martinussen et al., 2004). The physiological influence of BA on the callus
1
formation and direct shoot organogenesis of the herb is consistent with early studies on
other species (Hussey, 1977; Glendon et al., 2007).
a
b
Figure 1a. Callus and direct shoot organogenesis after 10 days in continuous dark condition
(1b). Direct micropropagation of shoot under continuous light condition
a
b
Figure 2a. Pair of roots formed in over 90% of in vitro plantlets. (2b). Front view of the
acclimatization chamber showing plantlets ready for transfer to the field
a
b
Figure 3a. Side view of plantlets in acclimatization chamber prior to transfer to the field.
(3b). Established plantlet on the field.
The source of explants used determines the relative success of most in vitro propagation
protocols. Rapid multiplication of this species using intact shoot was best on medium
containing BA 1 mg l–1 compared with leaf explant. This result is in conformity with
early findings that the source of explants determines the relative success of in vitro
culture of several plant species (Ziv and Lilien-Kipnis, 2000; Nhut et al., 2004).
1
Micropropagation techniques have been fund to be one of the cheapest and more
successful available tools for the rapid multiplication of threatened or endangered plant
species (Castillo and Jordan, 1997; Saxena et al., 1997; Murch et al., 2000; Lewu et al.,
2007a).
With the increasing preference for herbal based medicine in the local markets of South
Africa (Cunningham, 1988; van Wyk et al., 1997; van Wyk and Gericke, 2003; Lewu et
al., 2007b), micropropagation technique has become a necessary tool to reverse the
decimation of medicinal plants in the wild through the development of rapid
multiplication protocols for economically important plant species (McCartan and van
Staden, 2002; 2003; Rani et al. 2003; Afolayan and Adebola, 2004; Lewu et al., 2007a).
Our study revealed that the optimal response for callus induction and the rapid in vitro
propagation of V. amygdalina is obtainable using BA 1 mg l–1. This finding will serve a
as baseline information for the propagation of the species in the Eastern Cape Province of
South Africa. Although, population of the species dieback during the winter frost of the
region, the plant starts sprouting after the first few rains during the spring season when
temperature has improved. This innate property appears to affect the establishment of the
plantlets during the acclimatation study. To achieve greater success for the rapid
multiplication of the species, this study demonstrates that the optimum temperature range
for acclimatizing the species prior to the transfer of the plantlet to the field is between
27±3°C - 23 ±3°C.
Acknowledgement
The authors thank the National Research Foundation of South Africa for financial
support.
References:
Abosi AO, Raseroka BH, 2003. In vivo antimalarial activity of Vernonia amygdalina.
British Journal of Biomedical Science. 60 (2):89–91.
Afolayan AJ, Adebola PO, 2004. In vitro propagation: A biotechnological tool capable of
solving the problem of medicinal plants decimation in South Africa. African
Journal of Biotechnology 3 (12): 683-687.
Akinwande AI, 2006. Hepatoprotective and Antioxidant Activities of Vernonia
amygdalina on Acetaminophen-Induced Hepatic Damage in Mice. Journal of
Medicinal Food. 9 (4): 524-530.
Castillo, JA, Jordan, M, 1997. In vitro regeneration of Minthostachys andina (Brett)
Epling- a Bolivia native species with aromatic and medicinal properties. Plant
Cell, Tissue and Organ Culture 49:157-160.
Cunningham, AB, 1988. An investigation of the herbal medicine trade in Natal/KwaZulu.
Investigational Report No. 29, Institute of Natural Resources, University of Natal.
University Press.
Erasmus, RT, Blanco E, Okesina, AB, Arana J, Mesa GZ, Matsha T, 2001.
2
Importance of family history in type 2 black South African diabetic patients.
Postgraduate Medical Journal 77: 323-325
Erasto P, Adebola PO, Grierson DS, Afolayan AJ, 2005. An ethnobotanical study of
plants used for the treatment of diabetes in the Eastern Cape Province, South
Africa. African Journal of Biotechnology 4 (12): 1458-1460
Glendon DA, Erwin J, van Staden J, 2007. In vitro propagation of four Watsonia species.
Plant Cell Tissur and Organ Culture 88:135–145
Hussey G, 1977. In vitro release of axillary shoots from apical dominance in
monocotyledonous plantlets. Annals of Botany 40:1323–1325
Iwalokun, BA, Efedede BU, Alabi-Sofunde JA, Oduala T, Magbagbeola OA,
Akinpelu AI, David A, 1999. Antimicrobial activity of Vernonia amygdalina
leaves. Fitoterapia 70 (4): 432-434.
Lewu FB, Grierson, DS, Afolayan AJ, 2007a. Micropropagation of Pelargonium
sidoides. Proceedings of the second international conference on the role of
genetics and biotechnology in conservation of natural resources, Ismailia, Egypt,
July 9-10, 2007. CATRINA 2 (1): 77 -81.
Lewu, FB, Adebola, PO, Afolayan AJ, 2007b. Commercial harvesting of
Pelargonium sidoides in the Eastern Cape, South Africa: Striking a balance
between resource conservation and rural livelihoods. Journal of Arid
Environments 70: 380–388
Martinussen I, Nilsen G, Svenson L, Junttila O, Rapp K, 2004. In vitro propagation of
cloudberry (Rubus chamaemorus). Plant Cell Tissue and Organ Culture 8:43–
49 Masaba SC, 2000. The antimalarial activity of Vernonia amygdalina Del
(Compositae) Trans R Soc Trop Med Hyg.; 94:694–695.
McCartan SA, Van Staden J, 2003. Micro propagation of the endangered Kniphofia
leucocephala Baijnath. In vitro Cellular and Developmental Biology - Plant 39
(5): 496–499.
Murashige T, Skoog F, 1962. A revised medium for rapid growth and bio-assays with
tobacco tissue cultures. Physiologia Plantarum 15: 473-497.
Murch, SJ, KrishnaRaj S, Saxena PK, 2000. Phytomaceuticals: mass production,
standardization and conservation. Sci. Rev. Alternative Med 4:39-43.
Nhut DT, Teixeira DA, Silva JA, Huyen PX, Paek KY, 2004. The importance of
explant source on regeneration and micropropagation of Gladiolus by liquid shake
culture. Scientia Horticulturae 102:407–414
Omar MAK, Seedat MA, Motala AA, Dyer RB, Becker P, 1993. The prevalence of
diabetes mellitus and impaired glucose tolerance in a group of urban South
African blacks. South African Medical Journal 83: 641-643
Rani G, Virk GS, Nagpal A, 2003. Callus induction and plantlet regeneration in
Withania somnifera (L.) Dunal. In vitro Cellular and Developmental Biology Plant 39 (5): 468-474.
2
Thiem B, 2001. Micropropagation of cloudberry Rubus chamaemorus L. by initiation
of axillary shoots. Acta Societatis Botanicorum Poloniae 70:11–16
Torres KC, 1989. Tissue culture techniques for horticultural crops, edn. AVI-Van
Nostrand
New York, NY, USA
van WYK, B, Oudshoorn V, and Gericke N, 1997. Medicinal plants of South Africa
(first ed.), Briza Publications Pretoria.
van WYK B, Gericke N, 2003. People’s plants. A Guide to Useful Plants of South
Africa (second impression), Briza Publications Pretoria.
Ziv M, Lilien-Kipnis H, 2000. Bud regeneration from inflorescence explants for rapid
propagation of geophytes in vitro. Plant Cell Reports 19: 845–850.
3
CONTROLLED HYBRIDIZATION
CULTIVATED COTTON SPECIES
BETWEEN
WILD
AND
O. Shilla12*, F.AR. Ismail2 and T.P. Hauser3
1
Department of Molecular Biology and Biotechnology, University of Dar es
Salaam, Box 35176,Dar es Salaam, Tanzania
2
Department of Botany, University of Dar es Salaam, Tanzania;
3.
Department of Ecology, Faculty of Life Sciences, University of Copenhagen,
Denmark
Abstract
The potential for hybridization between cultivated and wild cotton was examined by
controlled reciprocal pollinations between two Gossypium barbadense types (W1 and
W2) collected from the Southern Highlands in Tanzania and two Gossypium hirsutum
cultivars (Mkombozi & Ilonga-85, MK & IL-85). Out of the 120 reciprocal crosses of
W1 with MK, 89 resulted into bolls (74.2%), 112 of W1 with IL-85 gave 85 bolls
(75.9%), of 250 W2 with MK gave 52 bolls (20.8%) and 242 of W2 with IL-85 had 68
bolls (28.0%)whereas 276 of W1 with W2 gave 5 bolls. The higher reciprocal crossing
values observed between W1 with both MK and IL-85 suggest that the crossing between
cultivated cotton and wild G. barbadense (W1) is possible unlike the low crossing rate
between the G. barbadense (W2). This suggests that the morphological criteria used to
group both G. barbadense species as one is not conclusive requiring further investigation.
Keywords: hybridization, pollination, wild cotton, compatible species
Introduction
Hybridization is the cross-breeding of genetically dissimilar individuals which may differ
by one or a few genes (pure lines), by several genes or be very different genetically
(hybridization between members of different genera) (Rieseberg, 1997; Glover, 2002).
Hybridization is common within species but can also occur between species and
occasionally between species of different genera (Ellstrand, 2006). In the genus
Gossypium, hybridization is rare as the genus is generally self pollinating (Ram et al,
2007). Currently, there are approximately 45 diploid and 5 allotetraploid species in the
genus divided into eight recognized genomes viz. A, B, E and F originating from the
Africa-Asia region; C, G, and K found in Australia and the D found in the Americas.
In Tanzania, cotton cultivars are chiefly developed from G. hirsutum, tetraploid cotton
from the United States of America. They have been further developed at two cotton
research institutes; Ukiriguru Agricultural Research Institute (ARI-Ukiriguru) for the
Western Cotton Growing Area (WCGA) and Ilonga Agricultural Research Institute (ARIIlonga), for the Eastern Cotton growing Area (ECGA) (Temu and Mrosso, 1999;
Pantaleon et al, 2003; Abdallah and King’iri, 2003; Lukonge et al, 2005). The third
cotton zone (the Southern Highland Quarantine zone) was quarantined against cotton
production due to the red bollworm cotton pest (Temu and Mrosso, 1999) since 1968.
2
corresponding author: samballu2002@yahoo.co.uk Mob: +255 787 229344
4
A dual approach to the establishment of potential hybridization is adopted; one where
presence of hybrids and feral populations in the Southern Highlands is established and
collected seeds crossed with existing cultivars and another where controlled or intentional
crosses between cultivars and known wild parents are carried out. In light of the possible
introduction of a Genetically Modified Gossypium cultivar (Bt cotton), the potential
benefits and risks of the introduction as relates to gene flow are evaluated.
Material and Methods
The controlled hybridisation experiment was set up at ARI-Ilonga, Morogoro region. The
plot had six blocks A, B, C, D, E and F (See Fig.1) and a seventh block, G was left for
testing F1 seed viability. The blocks were planted with two ‘wild species’ referred to as
W-1 and W-2 respectively and the two cultivars Mkombozi and Ilonga-85 (abbreviated in
this
paper
as
MK
and
IL-85
respectively
). The identification of W-1 and W-2 which were collected from the Southern Highlands
zone was not known, hence were sent to the United Kingdom for identification.
According to the Flora of Malvaceae, 2007 from Royal Botanical Gardens, Kew and
identification of W1 and W2 by the Malvaceae taxonomist showed that they belong to
Gossypium barbadense species. That means therefore, actually the crossing were between
Gossypium barbadense (found in naturalized scattered feral populations,) and Gossypium
hirsutum cultivars. The density for each cultivar in respective blocks was as shown in
table 1.
Table 1: Planting density per cultivars
Accession
(MK)
IL-85 (IL-85)
Wild type 1 (W-1)
Wild type 2 (W-2)
Plants per row
16
16
16
13
Total rows/ cultivars
4
4
4
4
Total plants
64
64
64
42
Sowing was done at standard layouts for growing cotton but wild cotton species were
sown before the cultivars so as to synchronize differences in flowering times as it was
deduced in preliminary germination trials at ARI-Ilonga, 2005 that they take longer to
mature from germination. The difference in sowing dates is shown in table 2. The
experiment was set off season so that watering could be controlled for purposes of
monitoring plant development.
1
Table 2: Different sowing dates of different cotton species to synchronize flowering
Trial/plot
Sowing date
Block A
Block B
Block C
Block D
Block E
Block F
Block G
Block G
02.05.2006
23.05.2006
15.07.2006
18.07.2006
04.09.2006
17.11.2006
02.02.2007
18.02.2007
Days
to
Germination
7
5
4
5
5
3
6
7
Days
to
Flowering
97
126
72
98
67
52
130
91
Days to 1st
Boll Open
155
124
120
152
100
126
185
165
Seed source
W-1
MK
IL-85,
W-2
IL-85,
MK,
Viability test F1’s seeds
Refilling F1 failure
All crosses were performed using a technique described by (Brubaker et al, 1999; Liu et
al, 2001; Vanniarajan et al, 2004; Konan et al, 2007). Briefly, a day before the crosses
were done and before the anthers dehisced the flowers that were to be used as pollen
recipients were emasculated. Emasculation was done between 16:00 hrs and 18:00 hrs
before anthesis early the next day, whereby the corolla of a selected flower was opened
and anthers carefully removed with help of forceps so as not to injure the gynoecium (fig.
2a). The gynoecia were then covered with a drinking straw sealed at the top (fig. 2b).
Figure 2: steps of hand pollination; a)-emasculation, b)-gynoecium capping with driking
straw, c)- tieing pollen donor flower d)-pollen drying e)- pollination f)-labelling crossing
for identification
Likewise flowers to be used as pollen donors were tied at the top with a thread a day prior
to the crosses (fig. 2c). On the day of crossing the pollen donor flowers were picked and
the anthers exposed to the sun to dry for about ten to twenty minutes (fig. 2d). dried
anthers were then rubbed against the pollen recipient flowers (fig. 2e) making sure that
the pollen grains stick to the emasculated flowers between 9.00 and 11.00 am, to
maximize seed setting and boll retention (Lukonge, et al 2007). The pollinated gynoecia
were then covered with a drinking straw (Avila and Stewart, 2004; Zhu et al, 2005),
2
which fell off as the fruit developed. The drinking straw in both cases helped to keep the
stigma moist and avoid pollination from any foreign pollen (Lukonge, 2005). All
pollinated flowers were appropriately labeled to indicate crosses (fig. 2f). Between about
50-130 days after crossing the crossed plants were monitored for fruit development and
morphological data recorded. Concomitantly to the collection of crossing data, the
morphological characters were scored during the experimental testing for the viability of
F1 seeds and coded in binary matrix.
The characters included; petal colour, basal petal spot, pollen colour, boll (shape, surface
and colour), leaf (colour, size, hairiness and shape), bracteoles (shape, length, breadth,
teeth length, teeth breadth, teeth number and layout), seed (fuzzy/fuzzless, fuzz colour,
nature, number per boll) and locules per boll. The morphological markers scored above
were then used to construct the cluster tree using the Unweighted Pair Group Method of
Arithmetic
Averages
(UPGMA) and Jacard's coefficient method in the Numerical taxonomy multivariate
analysis (NTSYS) software program.
Results
Table 3 shows that crossing data ranges from highly successful to almost non-successful
in some of the crosses. In summary, out of the 120 reciprocal crosses of W1 with MK, 89
resulted into bolls (74.2%), 112 of W1 with IL-85 gave 85 bolls (75.9%), of 250 W2 with
MK gave 52 bolls (20.8%) and 242 of W2 with IL-85 had 68 bolls (28.0%) whereas 276
of W1 with W2 gave 5 bolls (1.8%). The higher reciprocal crossing values observed
between W1 with both MK and IL-85 suggest that the crossing between cultivated cotton
and wild G. barbadense (W1) is possible unlike the low crossing rate between the G.
barbadense (W2). This suggests that the morphological criteria used to group both the
collect G. barbadense species as one is not conclusive requiring further study to confirm
the variations seen.
Table 3: Observations made during reciprocal crosses
Cross type
Seed
plant
Pollen
donor
Crossed
flowers
Successful
crosses
Interspecific
W-1
MK
73
W-1
IL-85
MK
Intraspecific
Mean
seeds/boll
56
Percentage
successful
crosses
76.7
72
58
80.6
30.3
W-1
47
33
70.2
24.3
MK
W-2
54
3
5.6
9
W-2
IL-85
193
66
34.2
29
W-2
MK
196
49
25
22.7
IL-85
W-1
27
67.5
18.3
IL-85
W-2
49
2
4.1
0
W-1
W-2
216
5
2.3
10
W-2
W-1
60
0
0
0
MK
IL-85
141
16
11.4
18.3
IL-85
MK
156
14
9.0
13.3
40
24
On case by case, it appears that W1 is closely related to both cultivars viz. MK and
Ilonga-85. Reciprocal crosses between MK and W1 were 76.7 and 70.2 % successful and
2
with Ilonga-85 it gave 80.6 and 67.5 % success. Reciprocal crosses between W1 and MK
were more or less similar regardless of whether pollen is donated or received. However,
the crosses between W1 (♂) and Ilonga-85 (♀) are more successful (80.6 %) than the
converse (67.5 %, IL-85 (♂) x W1 (♀)). The cross between W2 with the two cultivars
showed a different phenomenon in both directions. The W2 (♂) - MK (♀) crosses
resulted into 25 % successful crosses and the reciprocal cross gave only 5.6 %.
Reciprocal crosses between W2 and IL-85 were also low in success giving 34.2 %; W2
(♂) – IL85 (♀) and 4.1 %; IL85 (♂) -W2 (♀). Of the 276 reciprocal pollinations done
between W-1 and W-2 five developed into fruits and all were from W-1 (♂) x W-2 (♀)
crosses. The three (MK x IL-85, W1 x W2, IL-85 x W2) successful events when tested
for F1 viability gave a low germination rate of which did not develop into a full plant.
One cross gave no results at all (W2 x W1) and eight crosses had good F1 viability test
which developed to full plants (W1 x IL-85, W1 x MK, IL-85 x W1, MK x W1, W2 x IL85, W2 x MK, MK x IL-85, IL-85 x MK).
Some morphological characteristics were common for all 12 cotton plants and were
therefore neglected. However, clear variation was observed for petal colour, petal spot,
leaf colour, leaf size, leaf hair, pollen colour, boll shape, seed fusion and seed fuzz. These
characteristics were used for characterization and the observed differences among cotton
plants indicated the possibility of using morphological markers to differentiate species for
germplasm collection and preliminary identification of cotton species.
2
Clustering of parents and F1 offspring
Jaccard's Coefficient
IL-85
MK
MKxIL85
IL85xMK
W-1
W-2
W-1xIL85
IL85XW1
MKXW1
W-1xIL85
W-1xMK
W-2xIL85
W-2xMK
0.47
0.55
0.62
0.70
0.77
0.85
0.92
1.00
Coefficient
Figure 3: UPGMA cluster analysis and Jacard's similarity coefficient based on cotton
morphological relationship
The dendrogram (Figure 3) cluster analysis based on (UPGMA) and Jaccard’s similarity
coefficient consisted of two main groups; upper branch and bottom branch. The two
cultivars (IL-85 and MK) and their putative offspring; IL-85(♂) x MK (♀) and MK (♂) x
IL-85(♀)) clustered together. The second cluster grouped the two Gossypium species W1
and W2 and their putative offspring (IL-85(♂) X W1, MK (♂) x WI (♀), W1 (♂) X IL85(♀), W1 (♂) X MK (♀), W2 (♂) X IL-85(♀) and W2 (♂) X MK (♀). There was
further clustering of the offspring of the wild crosses that appeared more related to each
other than to their parents.
Conclusion
The study has shown that, Gossypium species assessed for hybridization potential
between wild and cultivated varieties do cross under controlled conditions. If we consider
this study to infer the likelihood of gene flow then we have two different explanations.
First is, W1 can act in both as a good recipient of exotic transgene as well as a donor in
nature basing on the higher crossing results obtained, whereas W-2 is more likely to act
as a transgene donor rather than a recipient. Therefore, if the aim is to prevent the
likelihood of gene flow from cultivated then more emphasis should to W1 than with W-2.
2
Contrary if gene flow to cultivars is the undesirable phenomenon, both W-1 and W-2 are
to be worried. However, though the study has shown the possibility of formation of
hybrids, it is therefore suggest that a study is required to evaluate the fate of the offspring
formed and also confirmation of the identity of W1 and W2 is also necessary prior to any
exotic cotton species in the Southern Highlands area.
Acknowledgements
The authors are most grateful to ARI-Ilonga and Dr. Manoko of Department of Botany,
University of Dar es Salaam for their technical support on crossing techniques cotton.
This study was financially supported by BioSafeTrain Project.
References
Avila.C.A and Stewart.J.McD (2004): Germplasm enhancement for cotton improvement.
Summaries of Arkansas cotton research 2004. University of Arkansas,
Agricultural Experiment Station Research Series. 533:23-27
Brown, A. H. D, Brubaker, C. L and Kilby, M. J (1997): Assessing the risk of cotton
transgene into wild Australian Gossypium species. In McLean, g. D, Waterhouse,
P. M, Evans, G and Gibbs, M. J (Eds.), Commercialisation of Transgenic Crops:
Risks, Benefit and trade considerations. Bureau of Resource Sciences, Canberra,
pp 83-93
Ellstrand.N.C (2006): When crop transgenes wander in California should we worry?
California Agriculture, Article review. Vol. 60 No. 3: 116-125
Konan.O.N., Hont.A.D., Baudoin.J.P and Mergeai.G (2007): Cytogenetics of a new
trispecies hybrid in cotton: (Gossypium hirsutum L. X G, thurberi Tod.)2 X G.
longicalyx Hutch Lee. Plant breeding 126: 176-181
Liu.B., Brubaker.C.L., Mergeai.G., Cronn.R.C and Wendel.J.F (2001): Polyploid
formation in cotton is not accompanied by rapid genomic changes. Genome
44:321-330
Lukonge, E.P., Labuschagne, M.T and Herselman, L (2007): Combining ability for yield
and fibre characteristics in Tanzanian cotton germplasm. Euphytica 1-7
Lukonge, E. P (2005): Characterisation and diallel analysis of commercially planted
cotton (Gossypiu, hirsutum L.) germplasm in Tanzania. PhD thesis, University of
Free State, Bloemfontein, South Africa, November, 2005
OGTR (2002): The Biology and Ecology of cotton (G. hirsutum) in Australia. Office of
Gene Technology Regulation (OGTR), Canberra. Unpublished
Rieseberg .L. H (1997): Hybrid origins of plant species. Annu. Rev. Ecol. Syst. 28: 359389
Saravanan, N.A, Ram, S.G, Thiruvengadam, V, Ravikesavan, R and Raveendran, T.S
(2007): Production and fertility restoration of an interspecific hybrid between G.
hirsutum L. and G. raimondii U. Cytologia 72(2): 195-203
2
Stelly. D. M, Saha. S, Raska. D. A, Jenkins. J. N, McCarty. J. C and Gutierrez. O. A
(2005): Registration of 17 Upland (Gossypium hirsutum) cotton germplasm lines
disomic for different G. barbadense chromosome or arm substitutions. Crop
science. 45: 2663-2665
Temu, E.E and Mrosso.F.P, (1999): The Cotton Red bollworm (Diparopsis castanea
Hmps) (Lepidoptera) and the quarantine area in southern Tanzania. Ministry of
Agriculture and Cooperatives, the United Republic of Tanzania, June-July 1999
Vanniarajan. C, Kalamani. A and Raveendran.T.S (2004): Principles and Methods of
Plant Breeding, AGB 301-A Practical Manual. Centre for Plant Breeding and
Genetics Tamil Nadu Agricultural University Coimbatore 601 003
Zhang. J. F., Lu. Y., Adragna. H and Hughs. E (2005): Genetic improvement of new
Mexico Acala cotton germaplasm and their genetic diversity. Crop science. Vol.
45. 2363-2373
Zhang. X. Q., Wang. X. D., Jiang. P. D., Hua. S. J., Zhang. H. P and Dutt. Y (2007):
Relationship between molecular marker heterozygosity and hybrid performance in
intra- and interspecific hybrids of cotton. Plant breeding. 126:385-391
2
THE DISTRIBUTION OF WILD COTTON SPECIES IN SOUTHERN
HIGHLANDS OF TANZANIA
O. Shilla13, F.AR. Ismail2 and T.P. Hauser3
1
Department of Molecular Biology and Biotechnology, University of Dar es
Salaam, Box 35176, Dar es Salaam, Tanzania
2
Department of Botany, University of Dar es Salaam, Tanzania;
3.
Denmark
Abstract
In the study a desktop review of herbaria specimen and documents and a field survey was
used to update existing information of wild cotton species in the Southern Highlands of
Tanzania. Records of wild cotton from the Southern Highlands were found in the various
herbaria but the information was un-collated as each review station had a different set of
records. Field surveys revealed through morphological marker analysis of that most of
the cotton plants encountered were most likely to be Gossypium barbadense. This
suggests historic sharing of cotton seed between farmers in East Africa and South
America.
Keywords:
Bt cotton, Red bollworm, gene flow, wild cotton, risk assessment,
morphological markers
Introduction
Cultivated Cotton belongs to the family Malvaceae in the genus Gossypium (Brubaker et
al, 1999). Gossypium comprises approximately 50 species (cultivated and wild) that are
diploid (45 species; genomes A-G and K) and tetraploids (5 species; genomes AD1-AD5)
(Brubaker et al, 1999; Rong et al, 2003; Avila et al, 2004). Both Africa-Asia (Old world)
and the Americas (New World) are thought to be centers of origin for Gossypium species.
G. herbaceum and G. arboreum are African-Asian-Old World diploid cotton (both Agenome) while G. hirsutum and G. barbadense, (both with AD genome) are New World
tetraploid species (Iqbal et al, 2001; Wendel and Cronn, 2003). These four species of
Gossypium provide most of the world’s germplasm for textile fiber and are important
sources of oil and cottonseed meal (Pillay and Myers, 1999).
In Tanzania cotton has been developed from cultivars of G. hirsutum that was introduced
to East Africa from USA (Pantaleon et al, 2003). These cultivars have been further
improved and adapted for Tanzania at two cotton research institutes; the Ukiriguru
Agricultural Research Institute (ARI-Ukiriguru) which has developed nine cultivars;
UK11, UK61, UK68, UK69, UK70, UK71, UK74, UK77 UK82 and UK91. The other is
ARI-Ilonga, which developed four cultivars; IL47/10, IL58, IL74, IL85 and Mkombozi.
ARI-Ukiriguru cultivars are adopted to the environmental conditions of the Western
Cotton Growing Area (WCGA) and the Ilonga cultivars are meant for the Eastern Cotton
growing Area (ECGA) (Temu and Mrosso, 1999; Pantaleon et al, 2003).
3
corresponding author: samballu2002@yahoo.co.uk Mob: +255 787 229 344
3
The third cotton zone is the Southern Highlands which have been quarantined from
cotton production since 1968 due to the infestation of the serious devastating cotton pest,
Diparopsis castanea (Red Bollworm) (Kabissa and Nyambo, 1989; Temu and Mrosso,
1999). Therefore currently this zone is not involved in cotton production apart from the
trials which are conducted to assess and monitored the presence Red bollworm. The
government of Tanzania through its Ministry of Agriculture and Food Security (MAFS)
is contemplating to revive cotton production in this third area using transgenic Bt cotton
(Abdallah & Bamwenda, 2004.
Given the importance of baseline information on wild species distribution prior to
transgenic cotton introduction in the Southern Highlands, this study focused on reviewing
and updating the existing distribution information of wild cotton species in this area.
Baseline information on existing wild relatives of a genetically modified (GM) crop is a
necessary component of an ecological impact assessment prior to introduction of the GM
crop and potential risks associated with gene flow between the Bt cotton and its wild
relatives are among the very beneficial baseline data.
A review of records in 2006 at two herbaria viz. NHT, the UDSM and cotton research
centers viz. ARI-Ukiriguru and ARI-Ilonga was done in 2006. The sites were selected on
the basis of existing literature and consultations done prior to a field visit that served to
identify relevant places to include for assessment of wild cotton distribution. A field
survey was carried out in the districts of Mbeya, Ruvuma and Iringa regions on the
Southern Highlands of Tanzania. The survey adopted the sampling strategies from the
International Board for Plant Genetic Resources (IBPGR), 1985 and Union for the
Protection of new Varieties, (UPOV, 2001) targeting the flowering period.
Morphological data were scored and coded in a binary matrix where presence was scored
as 1 and absence as 0. The morphological markers scored above
were then used to construct the cluster tree using the Unweighted Pair Group Method of
Arithmetic Averages (UPGMA), Dice coefficient (for characters) and Simple Matching
coefficient method (for sites/villages) in the Numerical taxonomy multivariate analysis
(NTSYS) software program. The dendrogram from UPGMA cluster analysis based on
morphological markers and genetic similarity values thereafter are expected to group
together plants which are closely related morphologically which will have high similarity
values and most distantly ones signified by having low genetic similarity values.
Results
The existing information on wild cotton distribution for the whole country indicates
presence of only one true wild cotton species namely G. longicalyx and an out group of
Gossypium viz. Gossypioides kirkii. Gossypioides kirkii. The habitat types recorded for
the various collections ranges from forest edge, to lowland and seasonally wet open
Acacia bush land as detailed at the UDSM-herbarium 2006. Apart from G. longicalyx and
Gossypioides kirkii, the records suggest that Tanzania also hosts other two wild species of
cotton G. barbadense var. brasilience Macf and G. hirsutum var. mariegalante Watt. G.
barbadense var. brasilience, in Tanzania is found in the Songea Highlands. All the plant
1
specimens were collected around homesteads. The location data for each site where
samples were collected was recorded using a GPS and mapped out.
A total of 2 Red bollworm larvae and 28 herbarium vouchers were collected. One set of
collected voucher specimen was deposited at the UDSM herbarium and the other sent to
Kew Royal Botanical Gardens in the United Kingdom for confirmatory identification.
The Red bollworm was found only at two sites; Ipinda ward-Lupaso village and Ushirika
village, both in Kyela district of Mbeya region (See Fig. 2). The observation of red
bollworm larvae indicates that despite the quarantine, the pest still persists in the area.
Figure 1: Red bollworm from Lutusyo and Ushirika village in Kyela, Mbeya
Cluster analysis
The UPGMA cluster analysis of the morphological markers indicates that 27 descriptive
characters scored are divided into major two groups (fig. 3). The characters’
abbreviations used are shown in table 1. Both upper and lower groups have two clusters.
The first cluster in the upper group show that a PC-deep yellow is highly associated with
the PS-presence on petals and a BC-deep green whereas the oval shaped bolls are
normally singly seeded. The second cluster shows PC-cream, BS-round are the most
closely related to each other among the 27 characters and to either SF-fuzzy grey or SFfuzzy brown if seeds have fuzz.
Table 2: Long forms of abbreviations used in characters clustering
1.
2.
3.
4.
5.
PC
PS
BC
BS
SN
Petal colour
Petal spot
Boll colour
Boll shape
Seed nature
6. SF
7. PoC
8.
LC
9.
BSu
10. LH
Seed fuzz
Pollen colour
Leaf colour
Boll surface
Leaf hair
The first cluster of the lower group indicates that PC-light yellow is highly associated
with PS-absent followed by LH-short. In addition, there are BC-light green, BS-conical
and SN-fused seeds in the same cluster. The second cluster has shown strong association
of PoC-deep yellow to BSu-pitted and LC-deep green followed by SF-black naked at a
far distance. The most similar characters are the PC-cream, BS-round with either SFfuzzy grey or SF-fuzzy brown at the similarity value of 1.0. Despite the clustering of
characters, the relatedness among the cotton plants collected with respect to their location
(villages) was observed. The relationship was shown by clustering of villages surveyed
(which stands for the cotton plants) using the same package as above but this time with
Dice similarity coefficient.
2
Cotton from southern highlands
Sm coefficient
PCdeepyellow
PSpresent
BCdeepgreen
BSoval
SNsingly
PCcream
BSround
SFfuzzygrey
SFfuzzybrown
PoCpaleyellow
LClightgreen
PoCcream
Bsusmooth
LHlong
SFnakedbrown
SFfuzzygreen
LHglabrous
PClightyellow
PSabsent
LHshort
BClightgreen
BSconical
SNfused
PoCdeepyellow
BSupitted
LCdeepgreen
SFnakedblack
PClightyellow
0.37
0.52
0.68
0.84
1.00
Coefficient
Figure 2: Dendrogram of 27 morphological descriptors clustered using UPGMA and Simple Matching
coefficient to show their relationships
The resulting dendrogram from Figure 4 comprises of two main groups, an upper group I
(Hanga A to Likuyufusi) and a lower group II, (Kitanda A to Mng’elenge B). The two
main groups (I and II) are each further divided into two sub-clusters. Group I subclusters, area Hanga A, to -Naikesi and Ifumbo-makona to Likuyufusi. The sub-cluster
Hang A - Naikesi further divide into smaller clusters; one containing Hanga A, Hanga B
and Sinai B and the other with Kitanda B, Sinai A and Naikesi. Likewise, second cluster
has two sub-clusters one with Ikulu, Ipinda, Ifumbo, Ushirika and Mbala which also fall
under expected grouping as they are all from Mbeya region and other has Likuyufusi only
which seems to distinctly cluster to the rest members.
Group II is also has two sub-clusters; one with Kitanda A- Namatuhi and the other with
Magamba- Mng’elenge B. The former cluster is also sub divided into sub-clusters which
comprise of Kitanda A, Sinai C, Lilambo and Lutusyo whereas Luhimbililo and
Namatuhi are in the latter sub-cluster. Within the former sub-cluster there are two
groups; Kitanda A and Sinai C in one group and Lilambo and Lutusyo in a second group
but Lutusyo is an outlier being a village from Mbeya while the remaining are all from
Ruvuma region. Likewise in the Mgamba-Mng’elenge B cluster, while Mgamba is from
Mbeya and the others are in Iringa along the road heading to Mbeya. Therefore, plants
2
collected at Magamba may be a result of exchange of seed between farmers in the two
regions of Iringa and Mbeya.
The dendrogram in figure 4 shows that the main groups I and II are separated at a
similarity value of about 0.51. The two clusters in group I have a similarity coefficient of
0.606 and those in group II are separated at 0.607. The most similar groups were; Hanga
A and Hanga B; Kitanda B and Sinai A; Ifumbo-makona, Ikulu and Ipinda; Kitanda A
and Sinai C; Lilambo and Lutusyo; Magamba and Mng’elenge B all at a similarity value
of 0.904. Mng’elenge A is more close to Magamba and Mng’elenge B at similarity value
of 0.856.
Cotton from Southern highlands
Dice coefficient
HangaA
HangaB
SinaiB
KitandaB
SinaiA
Naikesi
IfbMakona
Ikulu
Ipinda
Ushirika
Ifumbo
Mbala
Likuyufusi
KitandaA
SinaiC
Lilambo
Lutusyo
Luhimbililo
Namatuhi
Magamba
Mng'elengeB
Mng'elengeA
Luhimbililo
0.51
0.63
0.76
0.88
1.00
Coefficient
Figure 3: Dendrogram of 22 cotton plants from Southern Highlands using UPGMA and Dice coefficient
method
Conclusion
From the Flora of Malvaceae classification and on-site preliminary evaluation, all wild
cotton species were identified as G. barbadense. There were some deviations in
comparison to the scored data as some of the characters scored belong to G. hirsutum
which was not classified from any of the wild type specimens sent for identification. This
suggests that further studies are needed to have the full discrimination of the deviated
plants and other un-surveyed area. It is also suggested to use of the molecular markers to
confirm the observation above as that was out of the scope of this particular survey on
wild cotton distribution. As the field survey was conducted in selected representative
2
areas based on available information it is worth for an extensive survey be done on
quarantined cotton and non cotton growing areas to have a comprehensive overview of
the distribution of wild cotton in the country.
References
Abdallah, S .R and Bamwenda.G.R, (eds.), (2004): Initiating Agricultural Biotechnology
in Tanzania. Tropical Pesticides Research Institute (TPRI), Arusha, Tanzania,
unpublished
Avila, C. A. & Stewart, J. McD, (2004): Germplasm enhancement for cotton
improvement. Summaries of Arkansas cotton research 2004. University of
Arkansas, Agricultural Experiment Station Research Series 533: 23-27
Brubaker, C.L, Brown, A.H.D, Stewart, J.M, Kilby, M.J., and Grace, J.P, (1999):
Production of fertile hybrid germplasm with diploid Australian Gossypium
species for cotton improvement. Euphytica 108: 199-213
IBPGRI (1985): Cotton descriptors (revised) by International Board for Plant Genetic
Resources (IBPGR) Secretariat, Rome, Italy, November, 1985
Iqbal, M.J, Reddy, O.U.K., El-Zak K.M and Pepper A.E. (2001). A genetic bottleneck in
the evolution under domestication’ of upland cotton Gossypium hirsutum L.
examined using fingerprinting. Theor Appl Genet. 103: 547-554.
Kabissa, J.C.B. and Nyambo, B.T, (1989): The Red bollworm, Diparopsis castanea
Hamps (Lepidoptera: Noctuidae) and cotton production in Tanzania. Journal of
Tropical pest Management 1989, 35 (2): 190-192.
Pantaleon, C.C, Rubindamayugi, M.S.G, Magingo, S.S, Brandernburg, W.A, (2003):
Biological background information on selected crops in Tanzania, Phase Two, A
draft report, Compilation of the Biosafety Information in Tanzania 2002/2003,
under the East African Regional Programme and Research Network for
Biotechnology, Biosafety and Biotechnology Policy Development (BIO-EARN)
Programme, December 2003
Pillay, M and. Myers. G.O (1999). Genetic diversity in cotton assessed by variation in
ribosomal RNA genes and AFLP markers. Crop Sci. 39: 1881-1886.
Rong, J., Abbey, C., Bowers, J. E., Brubaker, C. L., Chang, C., Chee, P. W.,
Delmonte,T.A., Ding, X., Garza, J.J., Marler , B.S., Park,C., Pierce, G.J.,
Rainey,K.M., Rastogi,V.K., Schulze,S.R., Trolinder, N.L., Wendel, J.F., Wilkins,
T.A., Williams-Coplin, T.D., Wing, R.A., Wright, R.J., ZHAO, x., Zhu, L and
Paterson, A.H. (2003): A 3347-Locus Genetic recombination map of SequenceTagged Sites Reveals Features of Genomic Organisation, Transmission and
Evolution of Cotton (Gossypium). Genetics Society of America 166: 389–417
Temu, E.E and Mrosso.F.P, (1999): The Cotton Red bollworm (Diparopsis castanea
Hmps) (Lepidoptera) and the quarantine area in southern Tanzania. Ministry of
Agriculture and Cooperatives, the United Republic of Tanzania, June-July 1999.
2
UPOV (2001): Cotton Guidelines for the conduct of tests for distinctness, uniformity and
stability for cotton (Gossypium L.). International Union for the Protection of New
Varieties of Plants. Document TG/88/6: 1-24
Wendel, J. F and Cronn, C. R (2003): Polyploidy and the Evolutionary History of Cotton.
Advances in Agronomy 78: 139-189
2
Gametoclonal variation for morphology and male sterility in gynogenic
derived polyploids of Tef (Eragrostis tef (Zucc.) Trotter)
A. K. Sarial4 and Likyelesh Gugsa2
1. College of Agriculture, CCS Haryana Agricultural University Campus Kaul, -India
2. Agriculture Research Center, Ethiopian Agricultural Research Institute, Holetta
Abstract
This study was conducted to evaluate regenerated plants for gametoclonal variation for
various morphological and sterility traits. A population of 152 regenerated R0 consisting
of 144 tetraploids, 5 haploids, 2 anueploids and 1 octploid and their R1s were compared
with the control (seed propagated plant) under controlled condition in Hamburg, Germany
and Holetta, Ethiopia. Wide morphological diversity was observed among the regenerants.
Panicle bending and accessory floret development was observed in regenerated plants
Analysis of variance revealed significant differences for all traits studied in R1 among
various polyploids. Octoploids were dwarf, bore heavier panicles and had maximum test
grain weight. Tetraploids were tall, had long panicle bearing highest number of spikelets
and number of florets per spikelet and high yielded. Haploids bore small and light panicles
with minimum number of spikelets per panicle among all polyploids.
Key words: Eragrostis tef, gynogenesis, male sterility, gametoclonal variation.
Introduction
Tef (Eragrostis tef) is an indigenous and widely cultivated staple food crop of Ethiopia.
Ethiopian farmers’ have helped to conserve tef for many years. Its wide agronomic
versatility, adaptability, relative resistance to diseases and insect-pests and, economic and
nutritious value of ‘Enjera’ made of tef rank it first among other cereals such as wheat,
maize and sorghum. However, the improvement in the crop is lagging behind than many
other worlds’ cereals. It is susceptible to lodging and lack improved cultivars as a result
the productivity of tef is very low (national average below 0.9 tons/ha). Recently attempts
have been made to improve tef utilizing non-conventional approaches such as molecular
marker analysis and in vitro culture techniques.
In vitro production of haploids and dihaploids (DHs) is one of the non-conventional
techniques commonly employed in many cereals crops such as rice, maize, wheat and
barley. The haploid cells regenerated in vitro are subjected to chromosome doubling either
spontaneously or through colchicines treatment to produce DHs. In species where DH
lines are produced with high efficiency, such as barley (Hordium vulgare L) and rapeseed
(Brassica napus L), the system is now widely applied in breeding and many areas of
research, including molecular mapping, quantitative trait loci (QTL) analysis, gene
tagging, in vitro mutagenesis and selection or gene transformation (Khush and Virmani
1996). In majority of the cases haploid and DHs are derived either through androgenesis or
wide hybridization. Alternately, gynogenesis despite the limited explants of female organs
compared to microspores is another approach to produce haploids where androgenesis is
either not applicable or successful. San (1976) was the first to report gynogenic haploids
in unfertilized ovary culture of barley.
4
Corresponding author. Email: aksarial@yahoo.com, tel; +91-98963 13776; Fax: +911746 254537 (o)
3
Since then in vitro gynogenesis has been reported in at least 23 species mainly of
horticultural crops (Bhojwani and Soh, 2001). Gugsa et al, (2006) were first to standardize
a gynogenesis technique for the production of haploids and (DHs) in tef. This highly
successful regeneration system exhibited gametoclonal and /or somaclonal variations. In
this paper, we report the gametoclonal variation for some morphological traits and male
sterility mutants in gynogenic derived regenerants of Tef.
The materials for this study consisted of 152 R0 regenerants derived from the gynogenic
cultured tissues of tef, variety DZ-01-196. These regenerants include 144 tetraploids, 5
haploids, 1 octoploid and 2 aneuploids. They were planted in pots in greenhouse of the
Institute of Botanic and Botanical Garden (AMPII), University of Hamburg, Germany.
Pots were kept under 16 h photoperiod at 26±1°C. Plants were fertilized using Plantosam
(Aglucon, Disseldoef, Germany) 12g/pot and N.P.K 15:8:15 applied once, after three
weeks of potting. Seeds were harvested only from the main tillers of R0s. Based on
observations for traits such as polyploidy, yielding ability and fertility, 50 samples were
selected. These samples were used to establish R1s planted in lath house at Holetta
Agricultural. Research Center. Pots were filled with black, red clay soil mixed with sand in
a ratio of: 2: 2: 1. The pots were supplemented with dried cow dung. No additional
fertilizer was applied. Five seeds from each sample were planted in pots with three
replications (each pot considered as one replication). Control plants derived from seeds
harvested from Hamburg were grown with R1s. Seeds harvested from each tiller of the R0
octoploid plant were broadcasted in several pots at the institute of IPK (Gatersleben),
Germany and R1 progeny was grown at Holetta to observe for segregation. Five R0
regenerants with very poor fertility were also grown at Holetta in single pots to investigate
for male sterility mutants
Morphological data collection
Data from R0 was collected only from main tiller of each 152 plants and the control.
Means of different polyploidy variants five haploid(2x), 15 (10% of the total) tetraploids
(4n), one octoploid (8n) and the control (4n) plants were calculated. R1 data was collected
from 3-tagged samples from each pot. Observation were recorded for flag leaf type, plant
height, panicle length, culm thickness, number of florets per spikelet,
number of
spikelets per panicle, panicle form, main panicle weight, 1000 seed weight and grain
yield /main panicle. Statistical analysis was carried out for ANOVA.
Fertility analysis
To evaluate for fertility; panicle development, spikelet formatiom and initiation of flowers
were examined visually. Inflorescence of 1-2 tillers per plants was covered using paper
bags to avoid cross pollination. At seed setting stage, number of seeds set per spikelet was
counted among the R0 regenerants and fertility status of the genotypes was estimated
following Elkonin et al (1994) method.
Microscopic investigation of floret organs
A sample of 10 spikelets per plant was collected from intermediate part of the panicles of
haploids, octoploid and tetraploids plants including the control and investigated under
1
binocular microscope. The normal development of floret organs such as structure and size
of anthers and pollen grains, presence or absence and number of pollen grains in anther
and their viability with ovary growth, stigma receptiveness and estimated length of
filament were examined. Pollen grains viability was tested using 25 mM CaCl2- 0.3 M
maltose solution. Anthers and pollen grains size was measured at 200X and 400 X
magnifications, respectively.
Results
Gametoclonal variations for morphological traits
Majority of the regenerated plants (R0) grown were normal, vigorous, and without any
albino type except some abnormalities like deformed florets and incomplete panicle
emergence. Gametoclonal variation for different morphological traits among the various
gynogenic derived polyploids is depicted in Fig 1 and data presented in Table 1.
Table: 1. Range of variation for different morphological traits in
regenerants and control.
Traits
Plant ht (cm)
Panicle length (cm)
No. of leaves
Flag leaf length (cm)
Culm thickness (cm)
No. of nodes
Floret//spikelet
R0
Control
Minimum
maximum
mean
Minimum
maximum
mean
74
40.0
4.0
24.0
1.6
5.0
0.0
227
79.0
13.0
80.0
4.8
8.0
18.0
185
46.6
7.0
45.5
2.3
6,6
8.3
85
46
6
30
2
6
6
209
62
8
56
3
7
10
147
62
7
43
2.5
6.5
8.0
Structually, haploids have narrow leaf while tatraloids and octoploids posses wide leaf, the
latter comparatively larger in width (Fig 1a). Thirteen of the R0 lines exhibited panicle
bending at 45-90° angle downward to culm (Fig 1c). Accessory floret development was
found to be a common phenomenon. Spikelets grown in control typically carry no more
than 10 florets, the number of developed florets of cultured R0 spikelets varied between 1
and 20. Two of the 152 R0 lines possessed 20 florets per spikelet (Fig. 1e,f, g).
The extent of variability for morphological traits within regenerants (R0) generation was
greater than the control (Table 1). For instance, plant height range was 74 to 227cm
among regenerants while 85 to 209 cm for control plants. Panicle length ranged between
40 to 79 cm and 46 to 62 cm, number of leaves 4 to 13 and 6 to 8, flag leaf length 24 to 80
cm and 30 to 56 cm, culm thickness 1.6 to 4.8 and 2.0 to 3.0, number of nodes 5.0 to 8.0
and 6.0 to 10.0 and number of florets per spikelet 0 to 18 and 6.0 to10.0 among
regenerants and control plants in that order. With regards to population mean R0
generation recorded superiority over control for plant height, flag leaf length and number
of florets per spikelet and exhibited inferiority for panicle length and culm thickness.
Analysis of variance revealed significant differences for all traits studied in R1 among
various polyploids and control (Table 2). Mean variation for plant height ranged from 173
2
to 241 cm with control having 199cm. Octoploids were dwarf while tetraploids were found
to be tall.
Panicle length measured 37.6 cm in haploids and 64.2 cm in tetraploids. Number of
spikelets per panicle were maximum 421.8 in tetraploid and minimum 239.0 in haplopids
while
octaploids
were
at par with control. Number of florets per sipkelet were observed more in all polyploids
than
control.
Tetraploids
possessed
maximum
12.5
florets
per
spikelet. Panicles borne on octaploid were slightly and significantly heavier (1.55g) than
tetraploids ( 1.46g) while those borne on haploids were lighter in weight (0.30g).
Table 2.
Phenotypic variation (means) for different morphological traits among
gynogenic derived polyploids (R1)
Polyploids
Plant
height
(cm)
Panicle
length
(cm)
Spikelets
/panicle
Florets
/spike
Panicle
Panicle
weight (g) yield (g)
1000
seed weight (g)
2n
173.1
±1.3c
241.0
±2.2a
37.6
±0.1d
64.2
±0.1a
239.0
± 3.2c
421.8
±2.1a
9.5
± 0.3b
12.5
±0.2a
0.30
±0.2d
1.48
±0.2b
0.20
±0.2d
1.29
±0-7a
0.260 ±0.2d
166.4
±2.0d
199.4
±1.0b
47.6
±0.5c
53.8
±0.3b
298.5 ±1.7b 10.2
±0.1b
297.8 ±1.3b 8.0
±0.5dc
1.55
±0.2a
0.78
±0.2c
0.91
±0.2b
0.47
±0.2c
0.530 ±0.7a
4n*
8n
Control (4n)
0.495 ±0.5b
0.364 ±0.1c
* Data for high yielding 10 % of the population.
Means followed by the same letters are non-significant.
In control they were just half of the tetraploids. Tetraploid’s heavier panicle gave higher
yield (1.29g) while haploid’s lighter panicle produced low yield (0.20g) compared to
control (0.47g). In octoplaoid, test grain weight was maiximum (0.530g) followed by
tetraploids (0.495g) and control (0.364g) while haploids recorded the least (0.260g). There
was no segregation for phenotypic characters (panicle form, lemma color and seed size) in
the progeny of a octaploid grown for three generations (R1, R2 and R3). The plants were
shorter, partial fertile and have large seed size (data not shown).
Gametoclonal variations for male sterility
Tef flowers are hermaphrodite bearing a pistil with three stamens. In pistil, ovary has twothree styles each ending in a plumose (feathery) yellowish white stigma. In variety DZ-01196 used in the study, sometimes twin (Fig 2a) and rarely tripled pistils with two-three
styles were observed. Anthers were two celled, opening lengthwise containing 50-100
pollen grains (Fig 2e). The microscopic examination of the R0 mutants revealed normal as
well as variant form of anther structure (Fig b, c, d). Sterility percentage and variation in
anther and pollen grains size of different polyploids were measured (Table 3). Male
sterility percentage in tetraploids and haploids was almost complete, in octaploid around
40 % compared to control which showed upto 20%. Anther and pollen grains were larger
in size in octaploid and smaller in haploids while in tetraploids and control size was equal.
The octoploid anthers and pollen grains were approximately 2.0 and 0.8 times larger than
the haploids and tetraploids, respectively.
2
Table 3: Sterility percentage and variation in anther and pollen grains size of
different polyploids
Polyploids
No.
of Fertile
florets
florets
examined
Sterile
florets
%
Sterility
Size
Anther
(200 X) µm
Tetraploid (4x)
Line 3
Octoploid (8x)
50
2
38
96
73-80
11-13
42
26
16
40
100
11-18
Haploid (2x)
Control ( 4n)
50
50
2*
40
48
10
98
20
55-80
70-87
9-10
11-13
Pollen
400Xµm
The complete male sterility in haploids (Fig 2j) was mainly due to the production of
deformed and non- functional pollen grains (Fig 2f) .In tetraploids (DH) male sterility
was induced mainly due to failure of pollen formation (Fig 2g) resulting into shriveled
empty anthers. There were only two tetraploid lines which showed complete failure of
seed set (Fig 2k) inspite of having vigorously grown panicles. However, in other
tetraploids male sterile mutants one or two shriveled seeds per spikelet were formed (Fig
2l). Determination of fertility of mutants was calculated according to Elkonin et al.
(1994). Mutants having zero to one seeds per spikelet were considered as compete sterile,
one to two seeds per spikelet as partial sterile and more than 6 seeds per spikelet as fertile.
Five variants of male sterility were observed among the mutants (Table 4). i) Normal
anthers without pollen grains: In this case male sterile DH mutant lines resulted due to
failure of pollen formation in normal but (whitish) and shriveled anthers. (Fig 2b and c).
This phenomenon was observed in 60% of the florets studied . ii) Shriveled anthers
without pollen grains: Sterility in haploids resulted due to formation of non- functional
(deformed) pollen grains. These anthers also failed to dehisce on reaching the stigma.
Around 26% of the studied florets exhibited this cause. iii) Normal anthers with
underdeveloped pollen grains: In some haploid plants anthers were normal bearing round
and big underdeveloped pollen grains which failed to germinate after dehiscence (Fig 2h).
This means the pollens were empty and did not contain starch granules. Only 10% of the
florets showed this trend. iv) Anthers with deformed pollen grains: Pollen grains were
deformed but functional. v) Herkogamy: It’s not exactly male sterility but few DH mutant
plants failed to set seed due to physical barrier between stigma and anthers (2d).
2
Table 4: Male sterility variants observed in gynogenic derived regenerants
Sl. No. Variants
1
2
3.
4.
5
Normal growth (in size and color) of anthers but, devoid
of pollen grains
Shriveled anthers starting the very early stage with no
pollen grains
Normal anthers with very few pollen grains which, were
unable to dehisce
Anther with ample deformed pollen grains
Herkogagous condition, (physical barrier) between
stigma and filament length
Number of
anthers
Fertile
anthers
Sterility (%)
30
20
60
13
37
26
5
40
10
1
49
2
1
49
2
Sample size: 50 anthers
The latter two variants were observed in very few cases upto 2% of the florets studied. In
control plants, pollen grains from fertile anther were viable, large and green (Fig 2i) with
over 90% fertility and seed set per spikelet (Fig 2m). In aneuploids plants, growth was
vigorous but they developed very abnormal panicle branches either without spikelets or
underdeveloped sterile spikelets (Fig 2n). Female sterility was not observed in the tested
lines since all the pistils examined have normal receptive stigmas and ovaries. However,
ovaries were shrinked due of lack of self pollination.
2
a
b
c
d
f
e
i
f
g
j
k
n
h
l
m
Figure 2. Microscopic investigation of male sterility in tef, DH (R0) lines. a) twin pistils with normal
and matured anthers b) variant structure and size of mutant anther c) whitish sterile anthers d) incompatibility (physical
barrier containing fertile anthers with fully receptive stigma e) fertile anther of tef showing normal pollen grains f)
matured anther containing deformed, pollen grains g) shriveled, empty anther containing few pollen grains h) pollinated
stigma with un functional pollen grains (no starch grain, arrows) i) pollen grains from fertile, anther. Viable, largergreen and non-viable, darker (arrow) j) fully sterile matured spikelet of haploid k) fully sterile, matured, mutant spikelet
of tetraploids DH l) partially fertile tetraploids DH m) fertile, matured spikelet of tetraploids DH n). aneuploid plant
without inflorescence
References
Ayele M, Dolezel J, Vav Duren M, Brunner H and Zapata-Arias FJ (1996). Flow
cytometric analysis of nuclear genome of the Ethiopian cereal Tef (Eragrostis tef
(Zucc.) Trotter. Genetica 98: 211-215.
Bhojwani SS and Thomas TD (2001. In vitro gynogenesis. In:S.S Bhojwani and
W.Y.Soh (eds): Current Trends in the embryology of Angiosperms. 489-507.
Kluwer Academic Publisher, Printed in the Netherlands.
Cai D. T., Chen, D.T., Zhu, H. and Jin, Y. (1983). In vitro production of haploid
plantlets from the unfertilized ovaries and anthers of Hubei Photosynthetic Genic
Male Sterile Rice (HPGMR), Acta Biol, Exp.Sin. 21, 401-407
Cheverton M., Pullen M. , Didehvar .F and Jones G.(1992). Database of accessions in
the Eragrostis tef Germplasm Collection at Wye, Interim Report, Tef Improvement
Project. Wye College Univ. London.
Ebba T. (1975). Tef (Eragrostis tef) cultivars. Morphology and classification. Part II
2
Agricultural Experiments Station Bulletin, 66, Addis Abeba University, College of
Agriculture, Dire Dawa, Ethiopia.
Elkonin L.A , Gudova T. N., Ishin A. G. and Tymov V.S (1993). Diplodization in
haploid tissue of sorghum. Plant Breeding 110: 201-206
Elkonin L.A , Gudova T. N., and Ishin A. G (1994). Inheritance of male sterility
mutations in haploid sorghum tissue culture. Euphytica 80.111-118.
Gugsa L. Sarial A.K., Lorz H and Kumlehn J (2006). Gynogenic plant regeneration
from unpollinated flower explants of Eragrostis tef (Zuccagni) Trotter. Plant Cell
Report 25(12): 1287-1293.
Ketema S. (1983). Studies of lodging, floral biology and breeding technique in tef
(Eragrostis tef (zucc.)Trotter). Ph.D. Thesis University of London , Royal
Holloway
College Egham, UK 122 pp.
Khush G.S and Virmani S.S (1996). Haploids in plant breeding. In S.M. Jain, S.K
Sopory and R.E. Veilleux, (eds). In vitro Haploid Production in Higher Plants, 1133. Kluwer Academic. Phillips (1986).
Picard E. and Buyser J. (1977). High production of embryooids in anther culture of
pollen derived homozygous spring wheats. Ann. Amelior, Plant : 24: 483-488.
San Noeum LH (1976) Haploides d’Hordeum vulgare par culture in vitro d'ovaries
nonfécondes. Ann Amélior Plantes 26: 751-754.
Singh B. D. (1986). Polyploidy in plant breeding. In Plant Breeding , Principles and
Methods. Kalyani Publishers, Ludhiana, New Delhi-Noida pp 451- 484.
3
MORPHOLOGICAL AND MOLECULAR CHARACTERISATION
OF EGGPLANT VARIETIES AND THEIR RELATED WILD
SPECIES IN MAURITIUS
Banumaty Saraye1 and V. M. Ranghoo- Sanmukhiya2
1
Agricultural Research and Extension Unit
Newry Complex, S tJean Road, Quatre- Bornes, Mauritius
Tel (230) 4663885 Email: areucrop@intnet.mu
2
University of Mauritius, Faculty of Agriculture, Reduit, Mauritius
Tel (230) 4655746 or (230)4541041, E mail : m.sanmukhiya@uom.ac.mu
Abstract
In this study, fifteen Solanum accessions comprising of thirteen eggplants varieties
(Solanum melongena L.) and two wild types, Solanum violaceum and Solanum torvum
were morphologically analyzed using RAPD technique. The 2x CTAB extraction method
was found to yield sufficient good quality DNA from tender leaves. During optimization
of the RAPD reaction it was found that 30ng of DNA, 4mM of MgCl2, 0.4µM of primer
in a 30µl of reaction mixture were more appropriate to generate distinct bands. Seven
primers OPA 10, OPA 18, OPB 12, OPB 18, OPC 07, OPW01, and ONP07 were
considered to be highly informative because they amplified one or more polymorphic
bands. Using these primers it was possible to differentiate among the cultivated varieties
and between the wild types. These primers are useful for future genetic analysis in
Mauritius and will be useful for eggplant germplasm conservation and breeding program.
Key words: Solanum, morphological, molecular, RAPD, polymorphic, genetic diversity
Introduction
Eggplant (Solanum melongena L., 2n = 24) which belongs to the Solanaceae family is an
herbaceous, prickly perennial that is cultivated as an annual plant. Eggplant has two
centers of origin (Nonneck, 1989). India is probably the prime area for the larger fruited
cultivars while China, the second center, is predominantly associated with the smaller
fruited type. Eggplant fruits are a fairly good source of calcium, phosphorus, iron,
potassium and vitamin B group. It can be used for the treatment of several disease
including diabetes and help to reduce blood and liver cholesterol rates in human (Magnoli
et al., 2003). Based on production statistics, eggplant is the third most production crop in
the solanaceae family after potato and tomato.
In Mauritius eggplant is widely grown and consumed by most of the population in several
types of dishes. Two types of eggplant are currently grown locally, the long cylindrical
type, the variety “Cipaye” and the round type, the variety “Farcie”. Most of the varieties
being grown locally are those developed by the small growers. A few varieties have been
introduced by research organizations and some private seed companies. The main
constraints in eggplant plantation locally they are susceptible to pests and disease. There
exist some wild types of eggplant species that are resistant to such disease and pest
incidence and also to change in environment. This represents a potential gene pool which
can be used for genetic improvement in this particular crop.
In view of including these germplasms in future breeding programme, it is therefore
necessary
to
characterize
them.
4
Since morphological characterization is limited by the influence of the environment, it is
essential to carry out both the morphological and molecular characterization. It has been
reported that the use of different molecular markers such as RAPD ( Karihaloo et al.,
1995, Nunome et al., 2001; Signh et al., 2006), AFLP (Furini and Wunder, 2004; Mace
et al., 1999; Prohens et al., 2005) and microsatellites (Nunome et al., 2001, 2003) have
been very informative in characterize different eggplant germplasms. The use of
molecular markers have been found to be useful in assessing similarities and differences
among accessions and these were used to support morphological conclusions (Furini and
Wunder, 2004).
Since no published data is available on the morphological and molecular characteristics
of the different commercial eggplant varieties and the wild types, there is an urgent need
to assess the genetic diversity by both morphological and molecular techniques. This
study assessed genetic diversity among the different eggplant varieties and the wild
species grown in Mauritius by morphological and molecular techniques. This information
is essential for an effective breeding program which will serve as a general guide in the
selection of the parents for hybridization.
Materials and Methods
Fifteen accessions comprising of 13 cultivars of Solanum melongena L. and 2 wild types
Solanum torvum and Solanum violaceum were used for the study. Among the 13
accessions, 6 accessions were obtained from the Plant Genetic Resources (PGR) of the
Ministry of Agro-Industries and Fisheries (MAIF), Mauritius. The remaining of the
accessions was obtained from growers of different parts of the island mainly the Northern
and Eastern part. These accessions are cultivated varieties which are owned by different
growers. The two wild type species found in the region of Réduit were used in the study.
Table 1: List of eggplant accession used in the experiment
Materials
Accession 1
Accession 2
Accession 3
Accession 4
Accession 5
Accession 6
Accession 7
Accession 8
Accession 9
Accession 10
Accession 11
Accession 12
Accession 13
Accession 14
Accession 15
Taxonomy
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum melongena
Solanum violaceum
Solanum torvum
1
Source
PGR
PGR
PGR
PGR
PGR
PGR
Flacq
Flacq
Roche Noire
Triolet
Petit Raffray
Flacq
Flacq
Réduit
Réduit
Ten plants per accession were grown in the open field in Réduit (altitude). Five plants
were tagged per accession and treated as a replication. Characterisation was done
according to the Descriptors for Eggplant (IBPGR, 1990).
Data were recorded for 21 characters, both qualitative and quantitative. All
measurements/ traits were done on each plant. All data for quantitative traits were
subjected to ANOVA for statistical analysis. Young and tender leaves were collected
from each accession separately. Prior to extraction, leaves were carefully washed with
water to remove any extraneous material. Total genomic DNA was extracted from the
young and tender leaves using the modified CTAB Method (Modified Dellaporta and
Doyle and Doyle method).
PCR and primer survey
The RAPD – PCR technique was used to generate molecular profile of the different
eggplant germplasm. The total reaction volume for DNA amplification was 30 µl. The
reaction mixture contained 1X PCR buffer, 4mM MgCl2, 0.2mM dNTP, 0.4uM primer, 1
unit Taq polymerase, and 30ng of genomic DNA. The reaction (RAPD) was performed in
a thermal cycle (PTC-100) to carry out DNA amplification. The cycling times used were
as follows: 1 cycle of 3 minutes at 94ºC (initial DNA separation) followed by 40 cycles
of 1 minute of 94ºC (denaturation), 1 minute at 35ºC (annealination) and 1 minute at
72ºC (extension) and a final extension at 72ºC for 5 minutes. Thirty one primers were
initially tested for reproducible and scorable bands. The primers that gave reproducible
and scorable amplifications were used in the analysis of all the 15 accessions. PCR
products were resolved by electrophoresis on a 1.5% agarose gel. Each amplification
product was considered as a DNA marker. These were scored across all samples. Bands
were recorded as present (1) or absent (0) across the lanes. Data were entered into a
database program (Microsoft Excel) and compiled into binary matrix for phylogenetic
analysis using Populations1.2.28 CNRS UPR9034 Software.
Results
Table 2: Plant and Inflorescence Characteristics
Accession
1
2
3
4
5
6
7
8
9
10
11
12
13
14
Plant growth habit
Intermediate
Intermediate
Upright
Prostrate
Upright
Upright
Intermediate
Prostrate
Intermediate
Prostrate
Prostrate
Prostrate
Prostrate
Prostrate
Plant Height (cm)
78.0
76.0
74.0
78.0
82.0
70.0
87.0
92.0
77.0
75.0
79.0
80.0
75.0
113.0
Colour of corolla
Bluish Violet
Bluish Violet
Bluish Violet
Light violet
Light violet
Bluish Violet
Pale violet
Pale violet
Light violet
Light violet
Light violet
Pale violet
Pale violet
Bluish violet
15
Upright
210.0
White
1
The qualitative and quantitative morphological traits recorded for the different eggplant
accessions have been grouped under three main categories: the plant and inflorescence
characteristics, leaf characteristics and fruit characteristics. Each group consists of several
traits as shown in the following Tables 2, 3 and 4 respectively.
Table 3: The leaf characteristics of the 15 accessions
Accession
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
Leaf blade
length
21.8
24.0
27.3
21.5
21.3
22.6
21.1
26.6
23.1
22.5
22.0
23.8
24.5
9.2
26.2
Leaf blade
width
16.8
17.7
16.3
13.8
14.8
18.4
13.5
17
15.4
14.7
14.2
16.0
17.3
5.4
16.3
Leaf blade
lobing
Intermediate
Strong
Intermediate
Strong
Intermediate
Strong
Strong
Intermediate
Intermediate
Strong
Intermediate
Intermediate
Intermediate
Weak
Very strong
Leaf blade
Tip angle
Acute
Acute
Acute
Acute
Intermediate
Acute
Acute
Intermediate
Acute
Very Acute
Acute
Acute
Acute
Acute
Acute
Leaf
Prickles
None
None
None
None
None
None
None
None
None
None
None
None
None
Many
Few
Leaf hairs
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Intermediate
Few
A wide range of variation was observed for both qualitative and quantitative traits. A
high degree of variation was recorded for growth habit, flower colour, leaf shape and
size, presence of prickles, fruit shape, size, colour and weight and yield per plant.
Table 4: The Fruit characteristics of the 15 accessions of eggplants
Acce
Fruit
shape
Fruit
colour1
Fruit
weight
(g)
Fruit
length
(cm)
1
2
Long
Long
75.3
100.9
3
Semilong
Long
purple
purple
black
purple
black
lilac
purple
black
white
purple
black
purple
purple
black
purple
purple
4
5
6
7
8
9
10
11
12
13
14
15
Semilong
Long
Long
Round
Semilong
Long
Semilong
Round
Round
Round
Round
17.2
23.7
Fruit
bread
th
(cm)
2.6
2.9
No .of
fruit
per
plant
74
28
156.9
15.8
4.9
29
103.7
17.1
3.5
67
230.1
18.5
5.3
47
82.8
103.3
18.8
19.4
2.9
3.2
43
52
290.1
169.2
15.9
18.6
9.4
4.6
90.2
320.4
16.0
16.8
3.2
6.8
Fruit
curvature
Fruit apex
shape
Fruit
colour 2
Relative
fruit calyx
length
Fruit calyx
prickles
Fruit
position
None
Slightly
curved
None
Protuded
Protuded
uniform
uniform
In termediate
In termediate
Intermediate
Intermediate
Pendent
Pendent
Depressed
uniform
In termediate
None
Pendent
Protuded
uniform
In termediate
Intermediate
Pendent
Depressed
uniform
In termediate
None
Pendent
Slightly
curved
None
Protruded
Protuded
uniform
uniform
In termediate
In termediate
Intermediate
None
Pendent
Pendent
50
50
None
Slightly
curved
None
None
Depressed
Rounded
uniform
uniform
In termediate
In termediate
Few
Few
Pendent
Pendent
59
32
None
None
Protuded
Protuded
uniform
uniform
In termediate
In termediate
Few
None
Pendent
Pendent
Depressed
Depresesed
Rounded
Rounded
uniform
uniform
uniform
uniform
In termediate
In termediate
Short
Short
Intermediate
Few
Intermediate
None
Pendent
Pendent
Erect
Erect
purple
287.2
15.9
8.7
35
None
Purple
234.1
14.3
8.9
37
None
Black
0.3
0.7
0.5
None
Green
1.7
1.0
1.1
None
Fruit colour1 – fruit colour at commercial ripeness
Fruit colour2 – fruit colour distribution at commercial ripeness
1
Means for various characters in different accessions are shown in Table 5. Significant
differences among the accessions were observed for all the characters. Statistically
significant variations among the populations were observed for plant height, leaf length
and breadth, fruit length, breath and weight, number of fruit per plant and yield per plant.
However no assessment for fruit number and yield was done for the two wild types.
Table 5: Means of various quantitative characters of the different eggplant accessions
Accession
Plant
height
(cm)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
SE +/P (< 0.05)
78cde
76de
74.2e
78.2cde
82cd
69.8e
87.0cde
92.0c
77.0de
75.0de
79.0cde
80.0cde
75.0de
113.0b
210.0a
3.7
*
Leaf
blade
length
(cm)
21.8cde
24.0bcd
27.3a
21.5de
21.3de
22.6cde
21.1de
26.6ab
23.1cde
22.5cde
22.0 cde
23.8bcd
24.5bc
9.2f
26.2ab
0.8
*
Leaf
blade
width
(cm)
16.8bcde
17.7bc
16.3bcdef
13.8gh
14.8defgh
18.4b
13.5h
17.0bcd
15.4cdefgh
14.7efgh
14.2fgh
16.0cdefg
17.3bc
5.4i
16.3bcdef
0.6
*
Fruit
length
(cm)
Fruit
breadth
(cm)
Fruit
weight
(g)
17.2 bcd
23.7 a
15.8 de
17.1 bcd
18.5 bcd
18.8 bc
19.4 b
15.9 de
18.6 bcd
16.0 cde
16.8 bcde
15.9 de
14.3 e
0.7 f
1.0f
0.8
*
2.6 ef
2.9 ef
4.9 d
3.5 e
5.3 d
2.9 ef
3.2 ef
9.4 a
4.6 d
3.2 ef
6.8 c
8.7 b
8.9 ab
0.5 h
1.1 g
0.2
*
75.3e
100.9 e
156.9d
103.7e
230.1c
82.8e
103.3e
290.1a
169.2d
90.2e
320.4a
287.2ab
234.1bc
0.3g
1.4 f
14.7
*
No. of
fruits
per
plant
74.0a
28.0d
29.0d
67.0ab
47.0 abcd
43.0 bcd
52.0abcd
50.0abcd
50.0abcd
59.0 abc
32.0cd
35.0cd
37.0cd
8.2
*
Yield
per
plant
/kg
4.2 cde
2.4 e
3.6 de
5.2 bcd
6.2 bc
2.6e
3.6 de
9.2 a
5.3 bcd
6.7 b
5.1 bcd
6.7 b
6.7 b
0.7
*
Means with different superscripts within rows differ at P<0.05
* Significant at P <0.05
A phylogenetic tree was generated from the morphological character noted during the
study, as shown in figure 1. The tree separates the 15 accessions into three majors and
each group consisted of several accessions. Out of the total number of primers screened,
only 14 primers produced random amplification products. However seven random
primers produced distinct and polymorphic bands. Table 6 gives the characteristics of the
RAPD amplification products obtained.
Table 6: Primers found suitable for genetic diversity analysis in eggplant and the
characteristics of the amplification products
Primer
designation
OPA 10
OPA 18
OPB 12
OPB 18
OPC 07
OPW 01
ONP 07
Total
Total no. of
amplicons
9
6
13
10
14
7
8
67
No. of
bands
5
3
7
3
9
3
7
37
polymorphics
% polymorphism
55.0
50.0
53.8
30.0
64.3
42.8
87.5
54.7
2
Fragment
(Kb)
1.5 - 0.25
1.5 – 0.65
1.6 – 0.3
1.5 – 0.25
1.7 – 0.7
1.3 – 0.25
1.4 – 0.4
-
size
Figure 1: Phylogenic tree based on morphological characters of the different accession
Eggplant Accession
Fruit
shape
Long
Fruit curvature
Semi-Long
Fruit colour
Round
Fruit size
Fruit apex shape
No curvature
Fruit colour
Slight curved
Fruit calyx prickles
Purple
ACC 11
Big
Depressed
Rounded
ACC 9
Small
Fruit calyx
flower colour
Leaf blade tip angle
Purple
White
ACC 6
Intermediate
Fruit calyx prickles
Few
Intermediate Purple
ACC 10
ACC 1
No prickles
ACC 7
Fruit length & colour
prickles
Acute
ACC 3
Lilac
black
>20cm
ACC 2
Intermediate
ACC 5
Acute
< 20 cm
ACC4
Keys: features Features used to distinguish between accessions
Accession cultivated varieties Accession wild types
3
Few Intermediate White Violet
Leaf Blade tip ACC 12 ACC15 ACC14
angle
Intermediate
ACC 13
ACC 8
A total of 67 amplification products were scored with the selected primers, which
exhibited overall 54.7 % polymorphism. The average number of amplification
products generated was 9.6 per primer with a maximum of 14 with primer OPC 07
and with a minimum of 6 with primer OPA18.the size of the amplification product
varied with primer used and the range was 0.25 kb to 1.7 kb In general the extent of
polymorphism observed was fairly high. The extent of polymorphism ranged from 30
to 87.5 % where primer OPC 07 and ONP 07 which gave the highest polymorphism.
The RAPD profiles obtained by the different primers are shown in Plates 1 and 2,
which is indicative of the extent of the polymorphism observed among the different
eggplant accessions.
L
1
2 3
4
5
6
7 8
9 10 11 12 13 14 15 16 L
Plate 1: RAPD profile of 15 eggplant accessions using OPC 07 decamer primer
Lane L: 1 Kb ladder
Lane 1: Acc1; Lane 2: Acc2; Lane 3: Acc3; Lane 4: Acc 4; Lane 5: Acc5;
Lane 6 : Acc7; Lane 7 : Acc8 ; Lane 8 : Acc9; Lane 9 : Acc10; Lane 10 :Acc11; Lane
11: Acc12 ; Lane 12: Acc13: Lane 13 :Acc6: Lane 14 :Acc14; Lane 15 :Acc15; Lane
16 : positive control
The RAPD profiles obtained by the three highly polymorphic primers namely OPB12,
POC 07, and ONP 07 were scored.
Data obtained were subjected to
Populations1.2.28 CNRS UPR9034 Software for phylogenetic analysis which gives
rise to the dendogram as shown in figure 2 (as annexed 1).
Conclusions
This study provides a data base for plant breeders to make appropriate choice in
selection of parental accessions to use in a breeding program based upon genetic
diversity. Therefore collection of these species for storage in the gene bank and its
data base in terms of their morphological and molecular characteristics is essential for
any future breeding program in eggplant in Mauritius.
4
L
1
2
3
4
5
6
7
8
9
10
11
12 13 14 15
Plate 2: RAPD profile of 15 eggplant accessions using ONP 07 decamer primer
Lane L: 1 Kb ladder
Lane 1: Acc1; Lane 2: Acc2; Lane 3: Acc3; Lane 4: Acc 4; Lane 5: Acc5;
Lane 6 : Acc7; Lane 7 : Acc8 ; Lane 8 : Acc9; Lane 9 : Acc10; Lane 10 :Acc11; Lane
11: Acc12 ; Lane 12: Acc13: Lane 13 :Acc6: Lane 14 :Acc14; Lane 15 :Acc15
References:
Furini, A. and Wunder, J. (2004). Analysis of eggplant (solanum melongena)
related germplasm morphological and AFLP data contribute to phylogenetic
interpretations and germplasm utilization. Theor Appl Genet 108, 197-208.
International Board for Plant Genetic Resources (1990). Descriptors for
eggplant .
Intl. Board Plant Genet. Resources, Rome.
Mace, E.S., Lester, N.R. and Gebhardt, C.G. (1999). AFLP analysis of genetic
relationships among the cultivated eggplant Solanum melongena L., and wild
relatives (Solanaceae). Theor Appl Genet 99,626-633.
Magioli, C.and Mansur, E. (2005). Eggplant (Solanum melongenaL.): tissue
cultur,genetic transformation and use as an alterantive model plant. Acta bot.
bras 19 (1), 139-148. http://www.scielo.br./abb.
Nonnecke, I.L. (1989). Vegetable production.Van Nostrand Reinhold, NewYork, 251
pp.
Numone, T., Ishiguro, K., Yoshida, T. and Hirai, M. (2001). Mapping of fruit shape
and color development traits in eggplant (Solanum melongena L.) based on
RAPD and AFLP markers. Breeding Sci. 51, 19-26.
Numone,T., Suwabe, A., Ohyama,A. and Fukuka, H. (2003). Characterisation of
trinucleotide microsatellites in eggplant. Breeding Sci. 53, 77-83.
Populations 1.2.28 CNRS UPR9034. http://www.cnrs-gif.fr/pge.
5
GENETIC ENGINEERING AT ICRISAT AND ITS RELEVANCE
TO AFRICA, WITH SPECIAL FOCUS ON PIGEONPEA AND
GROUNDNUT
Santie M. de Villiers15*, Susan Muthoni Maina3, Timothy Taity Changa3,
Quinata Emongor2, Irene Njagi2, Jesse Machuka3, Moses PH Gathaara3
1. ICRISAT-Nairobi, c/o ILRI, PO Box 30709, Nairobi, 00100.
2. Kenya Agriculture Research Institute, Biotechnology Centre, NARL
PO Box 57811, Nairobi
3. Kenyatta University,
P.O Box 43844, Nairobi
5
Corresponding author: s.devilliers@cgiar.org
6
Abstract:
We report here on collaborative research between ICRISAT and two national partners
in Kenya (KARI and Kenyatta University) to establish tissue culture protocols for
pigeonpea and groundnut and a transformation protocol for pigeonpea. The ICRISATIndia protocols have been tested on locally adapted varieties of both crops with the
future aim to introduce traits such as pest resistance that will be of benefit to the
whole eastern and southern Africa region. The first step has been to evaluate varieties
that are adapted to eastern and southern Africa for their ability to regenerate from
single cells in tissue culture, followed by the evaluation of the Agrobacterium
tumefaciens - mediated transformation protocol in each crop. Seven varieties of
pigeonpea, including short, medium and long duration, have been successfully
regenerated in tissue culture and the first attempts at transformation are underway.
Keywords:
In vitro regeneration, genetic
tumefaciens, pigeonpea, groundnut
transformation,
Agrobacterium
Introduction:
Over the past decade, ICRISAT has established plant genetic engineering protocols
for chickpeas (Jayanand et al., 2003), pigeonpeas (Dayal et al. 2003) and groundnuts
(Sharma and Anjaiah, 2000) for varieties that are adapted to Asia. For groundnuts,
there are events aimed at virus resistance against Indian peanut clump virus (IPCV),
peanut bud necrosis virus (PBNV), tobacco streak virus (TSV) and groundnut rosette
disease (GRD). This crop is also being targeted for drought resistance through the
introduction of drought responsive elements (DREB) from Arabidopsis, rice
chitinase-mediated fungal resistance and β-carotene biofortification. Chickpea and
pigeonpea have been engineered to include either Cry 1Ab or Cry1Ac for pod borer
resistance as well as rice chitinase for fungal resistance and β-carotene for
biofortification in pigeonpea (Sharma, pers com).
Over the past three years, ICRISAT’s focus has shifted to Africa, mainly to build on
the work done at the Institute’s headquarters in India. The aim is to bring the
protocols and products from India to Africa, establish the technology, build capacity
in the region and alleviate local constraints that cannot be solved through breeding,
especially for traits where there are no known genes available in close relatives that
can be crossed with improved varieties. ICRISAT, in collaboration with two of its
national partners in Kenya - KARI and KU - recently initiated projects to establish
tissue
culture protocols for pigeonpea and groundnut at the KARI facilities and a
transformation protocol for pigeonpea at KU.
The aim has been to work together to establish protocols for locally adapted varieties
of both crops that can be used to introduce traits such as pest resistance that will be of
benefit to the whole region. The first step has been to evaluate varieties that are
adapted to eastern and southern Africa for their ability to regenerate from single cells
in tissue culture, followed by the evaluation of the Agrobacterium tumefaciens mediated transformation protocol in each crop. The focus in Africa is on disease
resistance,
including viruses, insects and fungi. We shall also attempt to improve
7
drought tolerance and resilience to climate variability and work towards improved
nutritional value of the three crops.
Ongoing and future activities
We currently have a confined greenhouse trial underway at the Agricultural Research
Council
(ARC)
in South Africa to evaluate GM groundnuts for resistance to GRD. In Kenya, we have
evaluated local varieties of pigeonpeas and groundnuts for regeneration in tissue
culture in preparation for genetic engineering. In the future we aim to develop
transgenic pigeonpeas with insect resistance and transgenic groundnuts resistant to
drought and fungi and do greenhouse and field evaluation of GM traits that were
evaluated in India and that are advantageous to Africa as well. These include;
Groundnuts
Groundnut rosette disease (GRD), caused by a complex of two viruses (groundnut
rosette virus (GRV) and groundnut rosette assistor virus (GRAV)) and a satellite RNA
(satRNA), is endemic throughout sub-Saharan Africa (SSA) and Madagascar. It is
transmitted by aphids and epidemics occur every 2-3 years and can cause 100% yield
loss in susceptible varieties, making it the biggest cause of groundnut losses in Africa
(Naidu et al., 1999). Potential solutions to this disease include both conventional
breeding and genetic engineering. ICRISAT has developed products from both
approaches. Inbred resistance (Olorunju et al., 2001) is very good but sometimes still
breaks down under severe disease pressure. On the genetic engineering side,
transgenic groundnuts of varieties JL24 and ICGV44 were obtained containing the
GRAV-coat protein (CP) gene. Thirty five individual events of these are being
evaluated in a confined greenhouse trial in South Africa. It is not clear yet if any of
them are resistant to the disease but the results should be available by early 2009.
The most serious constraints in harvested groundnuts are aflatoxins. These toxins do
not affect productivity itself but is very poisonous (Suryanarayana and Tulpule, 1967)
and there is a zero tolerance to this contamination in international markets. In India,
GM groundnuts containing a rice chitinase gene looks promising in confined
greenhouse trials. Resistant events can also be evaluated in Africa in the future with
the possibility to cross the trait into local varieties. In Kenya, we have tested six
groundnut varieties that are grown in the eastern and southern Africa region for their
regeneration response in tissue culture. The control variety was JL24, which is grown
both in India and Africa and which is regularly used in transformation studies in India
(Sharma and Anjaiah 2000).
The protocol entails sterilizing seeds with either varying concentrations of
commercial bleach or 0.1% (w/v) aqueous solution of HgCl2. Seed coats are removed
from sterile, soaked seeds and the embryo removed from the cotyledons followed by
culture of halved cotyledons on shoot induction medium consisting of Murashige and
Skoog (1962) basal medium (MS) supplemented with B5 vitamins (Gamborg et al.,
1968), 20 uM BAP, 10 uM 2,4-D, 3% (w/v) sucrose and 0.8% (w/v) agar. Explants
that green and form shoots are transferred to shoot elongation medium consisting of
MS medium supplemented with B5 vitamins, 2 uM BAP, 3% (w/v) sucrose and 0.8%
8
(w/v) agar. Strong, individual shoots are separated from the cotyledon explant and
cultured on rooting medium (MS medium supplemented with B5 vitamins, 5 uM
NAA, 3% (w/v) sucrose and 0.8% (w/v) agar) and finally acclimatized in soil in a
greenhouse. For transformation, which will be attempted in the future, the cotyledon
explants are dipped in a suspension of Agrobacterium tumefaciens cells before it is
placed on shoot induction medium.
Our results (Table 1) show that all six varieties can be regenerated in tissue culture
according to the protocol developed by Sharma and Anjaiah (2000). JL24 works best,
followed by Chalimbana, and the ICRISAT varieties ICGV-90704, ICG-2, ICGV12991 and ICGV-99568. Of these, ICGV-90704 and ICGV-12991 are GRD resistant.
It
is
also
interesting
to
note that the two sterilizing agents have different effects on each variety and it is
worth while to consider using HgCl2 for Chalimbana, ICGV-90704, ICGV-12991 and
ICGV-99568 as it seems to be less toxic to the explants, resulting in substantially
larger numbers of rooted plants. For this protocol, the critical steps are the
sterilization and initiation of shoot buds. Once this has been achieved, rooted plants
develop without problems and transgenic plants can be obtained for all of these
varieties.
Variety
JL24
Chalimbana
ICGV-90704
ICG-2
ICGV-12991
ICGV-99568
Treatment
NaOCl
HgCl2
NaOCl
HgCl2
NaOCl
HgCl2
NaOCl
HgCl2
NaOCl
HgCl2
NaOCl
HgCl2
Explants
31
31
28
23
31
35
24
25
33
35
32
35
Surviving
22
29
23
23
27
33
28
22
26
31
27
33
With shoots
6.3
8.0
2.2
7.6
2.2
13
4.6
4.4
1.6
5.0
2.0
5.6
Total no of plants
43
40
22
36
12
39
25
23
10
31
15
24
Table 1: Tissue culture evaluation of groundnut varieties adapted to eastern and southern Africa.
Surface sterilization prior to in vitro culture was achieved using either commercial bleach (NaOCl
active ingredient) or 0.1% HgCl2. Thirty five cotyledon explants were used in each experiment. Results
are the means of at least three repetitions.
Pigeonpeas
Pigeonpeas are grown extensively for domestic use in eastern and southern Africa in
Kenya, Tanzania, Malawi, Uganda and Mozambique are net exporters to India (Nene
et al., 1009). It provides protein-rich food, firewood and income for resource poor
small-holder farmers (Ritchie et al., 2000) and it replenishes soil nutrients and
controls soil erosion (ICRISAT, 1998). Pod borers are the most serious insect pest of
pigeonpeas in Africa and there is no natural resistance available in wild relatives
(Minja et al., 1999). Breeding of the genetically engineered Bt trait from India
(Sharma et al., 2006) into local varieties is difficult and time consuming as the
varieties are very different. Alternatively, the Bt gene can be introduced into African
varieties as has been shown to work for Indian varieties (Sharma et al., 2006).
It would be important to generate a large number of transgenic events to be able to
select suitably good ones with single integrations of the transgene that is expressed at
9
adequate levels, usually more than 0.2% of total soluble protein in the tissue of choice
(Gatehouse, 2008). Like the groundnut protocol reported earlier, the pigeonpea
transformation protocol developed by Dayal and co-workers (2003) also entails
surface sterilization of seed followed by germination in tissue culture on MS basal
medium
supplemented
with
3%
sucrose
and
0.8%
agar.
For
sterilization,
we
use
either
30% commercial bleach (1% NaOCl) as reported by De Villiers et al. (2008), or 0.1%
(w/v) HgCl2 as described by Dayal et al. (2003).
The first cotyledonary leaves are then separated in the petiolar region and this is the
area where shoot buds regenerate from. The leaf explants are cultured on shoot
induction medium (MS supplemented with 5 µM BA, 5 µM kinetin, 3% sugar and
0.8% agar) until clear shoots are visible, after which they are transferred to shoot
elongation medium (MS medium supplemented with 0.58 µM GA3, 3% sucrose and
0.8% agar), followed by dipping of well formed shoots in 11.4 µM IAA and root
formation on MS supplemented with 1% sugar. Rooted plants are hardened off in a
greenhouse. For transformation, the cotyledonary leaves are dipped in an
Agrobacterium tumefaciens suspension before cultivation on shoot induction medium.
This study evaluates seven local pigeonpea varieties and compares them with the
Indian variety ICPL88039. The African varieties included two short duration types,
ICPL87091 and ICPL86012, two medium duration types ICPL00554 and ICPL00557
and three long duration types ICPL00020, ICPL0040 and ICPL0053. It was possible
to regenerate plants from all seven varieties although the control variety was still the
best. Of the African varieties, the short duration varieties responded best, followed by
the medium and long duration types. The biggest constraint in this protocol was the
low germination frequency of seeds, which seem to be seasonal.
Conclusion:
The genetic engineering approach by ICRISAT in Africa is a very recent development
and to date tissue culture evaluation of locally adapted pigeonpea and groundnut
varieties have been completed. An important constraint is the limited facilities
available in eastern Africa for this type of work. Although developing genetically
modified products that can be released to farmers is a slow process, the current efforts
will pave the way to develop pigeonpea and groundnut varieties that are already
resistant to some constraints - achieved through conventional breeding - but with
added, complimentary genetically engineered traits such as pod-borer resistance that
can be grown by resource poor farmers across eastern and southern Africa in the
future. For ICRISAT the future of genetic engineering research in Africa is dependent
on collaborative projects with NARS along with breeders and farmers.
10
References:
Dayal S, Lavanya M, Devi P and Sharma KK (2003). An efficient protocol for shoot
regeneration and genetic transformation of pigeonpea (Cajanus cajan [L.]
Millsp.) using leaf explants. Plant Cell Rep. 21:1072-1079.
De Villiers S, Emongor Q, Njeri R, Gwata E, Hoisington D, Njagi I, Silim S. Sharma
K (2008). Evaluation of the shoot regeneration response in tissue culture of
pigeonpea (Cajanus cajan [L] Millsp.) varieties adapted to eastern and
southern Africa. African Journal of Biotechnology 7:587-590.
Gamborg OL, Miller RA and Ojima K (1968). Nutrient requirements for suspension
cultures of soybean root cells. Experimental Cell Research 50:151-158.
Gatehouse JA (2008). Biotechnological prospects for engineering insect-resistant
plants. Plant Physiol. 146:881-887.
ICRISAT (International Crops Research Institute for the Semi-Arid Tropics) (1998).
Improvement of pigeonpea in eastern and southern Africa
Jayanand B, Sudarsanam G, Sharma KK (2003). An efficient protocol for the
regeneration of whole plants of chickpea ( Cicer arietinum L.) by using
axillary meristem explants derived from in vitro -germinated seedlings. In
Vitro Cel. Dev. Biol. Plant 39:171-179.
Minja EM, Shanower SN, Silim SN, Singh L (1999). Evaluation of pigeonpea pod
borer and pod fly tolerant lines at Kabete and Kiboko in Kenya. African Crop
Sci J 7:71-79.
Naidu RA, Kimmins FM, Deom Cm, Subrahmanyam P, Chiyembekeza AJ, Van der
Merwe PJA (1999). Groundnut rosette: a virus disease affecting groundnut
production in Sub-Saharan Africa. Plant Disease 83:700-709.
Nene YL, Hall SD, Sheila VK (1990) The pigeonpea. CAB, Wallingford, UK, pp.
490. Murashige T and Skoog F (1962). A revised medium for rapid growth
and bioassays with tobacco tissue cultures. Physiologia Plantarum 15:473-479.
Olorunju PE, Ntare BR, Pande S, Reddy SV (2001). Additional sources of resistance
to groundnut rosette disease in groundnut germplasm and breeding lines.
Annals of Applied Biology 159:259-268.
Ritchie JM, Polaszek A, Abeyasekera S, Minja E, Mviha P (2000). Pod pests and
yield losses in smallholder pigeonpea in Blantyre/Shire Highlands. In: Ritchie
JM (ed) Integrated crop management research in Malawi: Developing
technologies with farmers. Proceedings of the Final Project Workshop, Club
Makokola, Mangochi, Malawi, 29 Nov-3 dec 1999. Chatham UK: Natural
Resources Institute.
Sharma KK, Anjaiah V (2000). An efficient method for the production of transgenic
11
plants of peanut (Arachis hypogea L.) through Agrobacterium tumefaciensmediated genetic transformation. Plant Sci. 159:7-19.
Sharma KK, Lavanya M, Anjaiah V (2006). Agrobacterium-mediated production of
transgenic pigeonpea (Cajanus cajan L. Millsp.) expressing the syntheic Bt
Cry1Ab gene. In Vitro Cell. Dev. Biol. Plant 42:165-173.
Suryanarayana R and Tulpule PG (1967). Varietal Differences of Groundnut in the
Production of Aflatoxin. Nature 214:738 - 739
12
MOLECULAR CHARACTERIZATION OF C. CANEPHORA FOR
RESISTANCE TO THE COFFEE WILT DISEASE: USING
PEROXIDASE ACTIVITY AS A MARKER
1,2
Saleh Nakendo, 1George W. Lubega, 2Africano Kangire, and 2Pascal Musoli
1
Faculty of Veterinary Medicine, Makerere University Kampala
Coffee Research Center-NARO, P.O. Box 185, Mukono, Uganda.
nakendosaleh@yahoo.co.uk or snakendo3@vetmed.mak.ac.ug
2
Abstract
The coffee wilt disease (CWD) caused by Fusarium xylarioides Steyaert is the most
devastating production constraint of C.canephora in Uganda. Although breeding
efforts to produce resistant varieties have been underway, this has been hampered by
lack of reliable markers to enhance the process. Use of peroxidase activity could
fasten the screening process for resistance against CWD. We assess the potential of
peroxidase activity as a biochemical marker for resistance to coffee wilt disease.
Peroxidase activity and Survival rate (SR) due to CWD showed a positive correlation.
This implied that peroxidase activity as a means of characterizing for resistance
against coffee wilt disease would be a more precise, quicker, safer and economical
way compared to conventional breeding. Peroxidase activity assays can therefore be
used to characterize C.canephora for resistance against coffee wilt disease and means
for fast screening through marker assisted selection.
Key words: Coffee wilt disease, Peroxidase activity, Mortality rate, Survival rate
Introduction
The coffee wilt disease caused by Fusarium xylarioides Steyaert is the most
devastating production constraint of Robusta coffee in Uganda. The disease is
vascular and specific to Robusta coffee. Result of surveys have shown that if the
disease spreads in East, Cameroon and Cote d’lvoire, Africa’s coffee export revenue
might be reduced by $21.58M yearly Onzima (2001). However, there has been no
viable strategy for addressing the problem other than breeding for resistance. The
conventional method of breeding for resistance is time consuming. Conventional
breeding for resistance against CWD would require about 20 years of experinmental
research. The other basic problem of conventional breeding for resistance is its
frequent lack of durability Lindhout (2002); Lamberti et al. (1982).
This prompted for the need to establish whether peroxidase activity could be used as a
marker for identifying resistant phenotypes to coffee wilt disease in Robusta coffee.
Research done else where, showed that PA is involved in the fight against phytopathogens, F.xylarioides inclusive. This enzyme is a phenol oxidase enzyme and
oxidizes plant compounds to fungi-toxic substances that inhibit the spread of the
infecting pathogen in the plant tissues Lovrekovich et al. (1986). C.canephora
variants were assayed for peroxidase activity and evaluation made of the occurrence
in the difference in the peroxidase activity in relation to their survival and mortality
rates due to coffee wilt disease. The objective of this study was to use peroxidase
13
activity as a marker for molecular characterization of C.canephora for resistance
against coffee wilt disease.
Eight cultivars of C.canephora viz. 1s/2, 1s/3, 1s/6 (Partially susceptible); H/4/1,
E/3/2, 257s/53 (Highly susceptible); J/1/1 and Q/3/4 (Prospective resistant); were
studied. Coffee samples were selected for the study basing on the data of their
individual response to CWD under field conditions (Musoli P.C, unpublished
work)
Table 1:
Variety
1s/3
1s/2
1s/6
E/3/2
257s/53
H/4/1
Q/3/4
J/1/1
Performance of C.canephora variants in CWD infested field
No.
Marked
Plants
Field
6
6
6
6
6
6
6
6
of
in Surviving
Plants
3
2
3
1
2
0
6
6
%
Survival
Rate (SR)
50
33.33
50
16.67
33.33
0
100
100
Dead
Plants
3
4
3
5
4
6
0
0
% Mortality
Rate (MR)
50
66.67
50
83.33
66.67
100
0
0
Peroxidase was extracted from leaf tissues and peroxidase activity was determined
using Jennings. et al. (1969) protocols. Two grammes of leaf tissue were crushed in
1.5ml of 0.05M tris-hydroxymethyl amino methane-HCl Buffer (pH 7.5), using
prechilled mortars and pestles. The crushed materials were centrifuged at 18000g for
10 minutes at 40C, and all the peroxidases were assumed to be in the supernatant.
Peroxidase activity was determined by placing 0.5ml of 1:100 dilutions of the extracts
into a spectrophotometer cuvette into which 0.5ml of 1% guaiacol solution and 1.5ml
tris-HCl buffer (0.05m, pH 7.5), was added.
Diseased tree extraction
Extraction process
Healthy tree
Leaf for peroxidase
The reaction was initiated by adding 0.5ml of 1% H2O2 and optical density (OD)
readings were taken at a wave length of 485ηM. A blank consisting of 0.5ml of
14
diluted extract, 0.5ml of 1% guaiacol and 2.0ml tris-HCl buffer was used to set
spectrophotometer at 100% transmittance. Changes in optical density of the reaction
mixture were read at 15sec interval up to 4 minutes, after mixing all ingredients.
Procedure was repeated 3× for each diluted extract and the mean readings calculated.
A graphical representation was made of optical density versus time.
The change in optical density was calculated from the straight path of the graph and
the total peroxidase activity calculated as follows; Peroxidase Activity = (Change in
OD x 1/T x 1/0.5ml x 100).The incidence data was generally analyzed using
Correlation analysis, ANOVA and Regression analysis under Intercooled STATA 8
statistical package.
Results
The results of survival rate and peroxidase activity of C.canephora (Tables 1& 2); in
relation to the resistance to F.xylarioides showed a positive correlation (r= 0.652).
The variations in survival rate and mortality rate (MR) due to peroxidaes activity was
significant (P=0.0062) at 95% confidence level. Peroxidaes activity coefficient was
also found significant (P=0.006), but the constant was not significant (P=0.282) at
95% confidence level, giving regression equation as SR=95PA. This implied that min1
ml-1 increase in peroxidase activity would result in 95 times increase in survival rate.
Without peroxidase activity (PA=0), the survival rate would be zero.
Table 2:
Peroxidase activity for C.canephora variants
Variety
1s/3
1s/2
1s/6
E/3/2
257s/53
H/4/1
Q/3/4
J/1/1
Peroxidase activity /min-1ml-1 (PA)
0.200
0.204
0.204
0.204
0.544
0.204
0.408
0.880
Discussion and conclusion
The results of PA and SR due to CWD correlated positively (R=0.652). The average
PA of resistant varieties J/1/1 and Q/3/4 was highest with 0.644 min-1 ml-1
(P=0.0062), indicating that PA has a contribution to resistance against CWD. The
result corroborates to what Fehrmann and Diamond (1967) found, in potato tissues,
that resistance to Phytophthora infestans was positively correlated to PA. The
increase in PA of highly susceptible varieties could have been due to tissue wounding
(Table.2). This corroborated with studies on peroxidase induction in response to
wounding, Lagrimini and Rothstein (1987), as such increase in PA in highly
susceptible varieties most especially 257s/53 (Table.2), could have been due to
infection by F. xylarioides. However, Rautela and Payne (1970) suggested that the
failure of peroxidase to arrest the infection in susceptible varieties was probably due
to late increase or insufficient peroxidase. In conclusion, PA can be used as a marker
to characterize C.canephora for resistance to CWD through marker assisted selection.
_____________________________________________________________________
15
Acknowledgements
Author thanks the following individuals and organizations for the financial and
technical support in producing this work:
*Hon. Nakendo Abdul and Hon. Madam. Sarah Nakendo; for the financial support.
*Dr. Africano Kangire, Dr. Pascal Musoli and Dr. James Ogwang of Coffee Research
Center, National
Crops Resources Research Institute, NARO-Uganda; for the technical support and
reviewing the various
drafts of this special project report.
*Prof. G.W. Lubega, Principal supervisor of this work, Makerere University
Kampala. Dr. Jesca L
Nakavuma and Dr. Eddie Wampande, Makerere University Kampala; for the
technical support and
reviewing this work.
_____________________________________________________________________
References
Fehrmann, H., and Diamond, A. E. 1967. Peroxidase activity and phytopthora resistance in
different organs of the potato plant. Phytopathology 57:69-72.
Jennings, P.H., Brannaman B.L. and Zoheille F.P., Jr. 1969. Peroxidase and
polyphenoloxidase activity associated with Helminthosporium leaf spot of maize.
Phytopathology 59:963-967.
Lagrimini, L.M., and Rothstein. S. 1987. Tissue specificity of tobacco peroxidase
isozymes and their induction by wounding and tobacco mosaic virus infection. Plant
Physiology 84:438-442.
Lamberti, F., Waller, J. M., and Van der Graaff, N. A. 1982. Durable resistance in crops.
NATO Advanced science institutes series A, Life science; Vol.55.
Lindhout, P. 2002. The perspectives of polygenic resistance in breeding for durable
resistance. Euphytica 124:217-226.
Lovrekovich, L., Lovrekovich, H., and Stahman, M.A. 1986. The importance of
peroxidase in the wildfire disease. Phytopathology 58:193-198.
Onzima, R. (2001). Coffee Wilt Disease (CWD), ACRN UPDATES. The African Coffee
Research Network (ACRN). Vol. No.1 (June-Sept, 2001).
Rautela, G.S. and Payne, M .G. 1970. The relation of peroxidase and orthodiphenol
oxidase to resistance of sugarbeet to Cercospora leaf spot. Phytopathology 60:238245
16
BT-COWPEA TRANSGENE ESCAPE TO COWPEA WILDRELATIVES
Rémy S. PASQUET
Abstract
Cowpea seems to be an ideal candidate for proving the potential benefits of genetic
transformation. Cowpea is attacked by a wide array of insect pests and a genetically
modified cowpea with highly effective insect resistance genes would definitely have a
great impact in Africa. However, the cowpea wild progenitor is encountered over
most of Africa and it can hybridize freely with domesticated cowpea varieties.
Therefore, the main concern with GM cowpea would be the move of this efficient
insect resistance gene from domesticated to wild populations. Results from the project
first phase showed that the hybrids between wild and domesticated cowpea (as well as
their progenies) are not unfit. More important, they can easily take advantage of insect
protection to boost their seed production.
Introduction
Cowpea seems to be an ideal candidate for proving the potential benefits of genetic
transformation. Cowpea [Vigna unguiculata (L.) Walp] is one of the most important
legume crops for human consumption. It is cultivated in all tropical lowlands but
Africa, and especially West Africa, is the main area of production. Cowpea is very
important for low-input agriculture, which characterizes most of the African
continent. Cowpea is also cultivated as fodder, in the Sahelian area of West Africa as
well as in the dry areas of Asia (Pasquet and Baudoin 2001).
Cowpea is attacked by a wide array of insect pests (Singh & Jackai 1985) and a
genetically modified cowpea with highly effective insect resistance genes would
definitely have a great impact in Africa. The idea of using genetic engineering to
provide cowpea with insect resistance genes, and especially Bt-toxin against Maruca
vitrata, became evident in the late eighties (Filippone 1990, Latunde-Dada 1990,
Murdock et al. 1990). This idea of eliminating Maruca with GM technology is an
especially interesting one because Maruca is a migrating insect, occuring as
outbreaks, especially in West African savannas. Some years, Maruca does show up,
like in 2007, but it can wipe out most of the potential harvest in some other years
(Taylor 1978, Bottenberg et al. 2007). If farmers cannot spray insecticide at the right
time, they are left with no option.
The GM-cowpea biosafety project
While scientists started to focus on cowpea transformation in the early nineties,
informal meetings on GM cowpea biosafety started in 1996, and the GM-cowpea
project started in ICIPE in 1998. However, after several unsuccessful attempts,
cowpea was transformed for the first time only in 2004 (Popelka et al. 2006), and the
first cowpea with an insect-resistant transgene was produced in 2006 (Higgins et al.
2007). This was fully justified because the existence of a crop-weed complex all over
the continent, and especially in West Africa, was well known (Rawal 1975, Coulibaly
et al. 2002). In fact var. spontanea is present in all lowland areas, outside rain forests
and deserts (fig 1).
17
Fig 1. Distribution of V. unguiculata var. spontanea the wild relative and progenitor
of the domesticated cowpea. Black dots are either accessions or herbarium samples.
Pollen flow and gene escape
The first phase of the project focused on pollen flow between domesticated
(potentially GM) cowpea and its wild relative. Project started to focus on Kenya
because wild relatives in coastal East Africa are more outcrossed (Lush 1979) than in
West Africa and levels of pollen flow were expected to be higher in coastal Kenya.
Pollen flow was immediately confirmed by the study of wild cowpea population
genetics, both in West Africa (Kouam et al., unpublished) and in coastal Kenya
(Rabbi et al. unpublished).
Although both group of populations showed heterozygote deficit and therefore a
predominantly inbred breeding systems, data suggested gene exchange between
population, and outcrossing rates were not negligible: up to 9 % in West Africa and
up to 30 % in coastal Kenya. However, in coastal Kenya the monthly evaluation of
the oucrossing rates (Kouam et al., unpublished) in one of the biggest wild cowpea
population showed that the outcrossing rates are very variable and more or less
correlated with the number of flowers present in the population. Bees are more
numerous when there are more flowers and they induced more outcrossing. In
18
addition, during a brief period in the middle of the dry season, there is an outcrossing
peak up to 80 %, likely due to a sharp decrease in the number of flowers.
Bees are still coming "en masse" while there are only few flowers remaining, which
are becoming over-visited. Study of pollinators showed that if numerous insects are
visiting cowpea flowers, only two groups of bees were are pollinators, i.e. carpenter
bees from genus Xylocopa (fig. 2) and leaf-cutter bees from family Megachilidae (fig
3). All the other insects are pollen thieves or nectar thieves like, for example, the
honey bee. Xylocopa are mainly active during the first half an hour after sunrise while
Megachilids are active as long as flowers stay open. When it is not raining, each
flower is visited at least once (Wosula et al., unpublished data). Similar results were
obtained in Burkina Faso. Although species were different in West Africa, they also
belonged to genus Xylocopa and family Megachilidae (Tignègre, unpublished results).
Fig 2. Xylocopa caffra pollinating a cowpea flower
While the population genetic studies involved almost exclusively wild plants, source
and sink trials were undertaken to assess potential gene flow between wild and
domesticated plants (Pasquet unpublished). One trial was involving a source of
domesticated plants surrounded by concentric rings of wild plants. The closest ring
yielded a small percentage of hybrids, between 5 and 10 % and farther the percentage
decreased sharply.
The last hybrid progeny was detected from a plant situated 17 m from the source.
Fatokun and Ng (2007) did similar trials in West Africa with more inbred sink plants
and found similar results with percentage of hybrid progenies slightly lower than 1 %
in the closest circles and the last hybrid progeny detected 31 m from the source. In
coastal Kenya, using a large source (400 m2) of domesticated plants, 4 lines of sink
wild plants at various distances, and one sink plant isolated in the middle of the
19
"field" of domesticated plants, hybrid progenies were between 1 and 2 % in the lines
at 1 to 2 m, but close to 12 % for the wild
plant in the middle of the "field" and surrounded by domesticated plants.
Fig 3. Megachilidae pollinating a cowpea flower
However, source and sink failed to prove pollen flow beyond few tens of meters. A
different device with two large sources and one large sink yielded 1 hybrid out of
1500 progenies with a distance of 25 m, 1 hybrid out of 3000 progenies with a
distance of 35 m and 0 hybrid out of 4000 progenies with a distance of 50 m.
Therefore, we decided to follow bee movements using radio-tracking of bees and
infer potential pollen flow (Pasquet et al. 2008). We found that bees forage on average
1 km from their nest, but 2 km from their nest when weather conditions are good. This
is far lower than the maximum potential range which is 10 km.
This result obtained with tropical solitary carpenter bees is similar to results obtained
with temperate social honey bee and bumble bees. We found also that carpenter bees
can visit several cowpea populations (wild populations and cowpea fields) during a
single foraging flight, but that they do far many more flower to flower flights within
plant populations than between plant populations. They can definitely move pollen
between domesticated and wild plants, especially if they are close, and a pollen
movement over several km is not impossible. However, a 50 m distance already
strongly reduces pollen flow possibilities.
20
During the first phase of the project, the fitness of the wild-domesticated hybrids and
their progenies was checked. Initial reports (Leleji 1973) showed that bees had a
tendency to follow flower color in cowpea. Therefore, we used devices with a equal
amount of pink and white flowers and followed bee movements. Flights between
same color flowers were more numerous than those between differently colored
flowers. However, numerous pink flower to white flower of white flower to pink
flower were recorded, and flower color cannor be used to prevent pollen flow. The
explanation lies in the UV vision of the bees and their absence of red vision (Kay
1987). Photographed with a UV filter, pink and white cowpea flowers appear identical
(fig. 4).
Fig 4. UV pattern of 524 B (white flower, left) and ICV12 (purple flower, right)
Fig 4. UV pattern of 524 B (white flower, left) and ICV12 (purple flower, right)
Wild cowpea predation
The second phase of the project is now focusing on wild cowpea seed predation. This
work is based on two trials and one survey. Surveyed in two wild cowpea populations
from coastal Kenya, pre-dispersal predation (seeds destroyed before shattering of the
pod and release of the seeds) is mainly due to a beetle (Coleoptera) and a bean fly
(Diptera) (fig. 5 and 6). Since the current GM cowpea is a cowpea with a Bt gene
which affect only Lepidoptera, these predators which are destroying 5-20 % of the
seeds should not be affected. The three Lepidoptera species (including the
domesticated cowpea pest targeted by the Bt gene, Maruca vitrata, fig. 7-9) are
destroying all together less than 5 % of the seeds.
21
If these results are confirmed during the forthcoming years, this would mean that the
potential elimination of the three Lepidoptera predators by the Bt gene would result in
a very limited increase of seed production by wild plants. After two years of survey,
no Maruca outbreak was observed in the wild populations, but no Maruca outbreak
was observed in the cowpea fields either. We suspect that Maruca, which is mainly
living on leguminous trees, goes more easily to cowpea fields with large simultaneous
flowering than to wild cowpea populations with scattered plants and flowers.
However, we have not yet surveyed wild cowpea populations during a Maruca
outbreak in cowpea fields.
Fig 5. Coleoptera Curculionidae
Fig 6. Diptera Agromizidae
Fig. 7. Euchrysops malathana (Lepidoptera: Lycaenidae)
22
Fig. 8. Maruca vitrata (Lepidoptera: Pyralidae)
Fig. 9. Cydia ptychora (Lepidoptera: Tortricidae)
On the other hand, post-dispersal (once the seeds are lying on or within the upper
layer of the soil) on going predation trials are showing that this post dispersal
predation is very important and that it is mainly due to rodents (fig. 10). During these
trials seeds were offered to birds, rodents, and arthropods (or animals smaller than 5
mm). In coastal Kenya conditions, rodents are destroying almost all the seeds
produced by the cowpea plants and are leaving (and dispersing also) just the few
seeds that they forget, which are making the next generation of plants. As rodents
should not be affected by the Bt-toxin, this would show that the major wild cowpea
seed predators will still destroy most of the of seeds produced by the wild plants.
Fig 10. Gerbil eating cowpea seeds.
However, these results should not be applicable directly to West Africa where Btcowpea deployment is planned, due to seasonal and plant habit differences. There is
almost no seasonality in coastal East Africa and all predators are active more or less
all year long, while there is a strong seasonality with a marked dry season up to nine
23
months in West Africa. Therefore, the activity of postdispersal predators during the
dry season (and large areas of bare soil) is not granted. In addition, coastal East
African wild cowpea plants are more or less perennial with a mixed breeding system,
and are easily cleared from the fields (where they are definitely absent) by farmers.
They produce seeds almost all year long, though not profusely.
Conclusion
Cowpea should be the first Bt-crop to be deployed in the middle of a crop-weed
complex. However, studies of predation in wild cowpea populations shows so far that
Bt-gene escape should not lead to increased weediness of the wild plants. In the end
we must emphasized that Bt-cowpea future deployment should be largely eased by the
start of the GM-cowpea biosafety work 8 years before the birth of the first Bt-cowpea
plant, and 14 years before the planned release of Bt-cowpea seeds to farmers. This
definitely seems to be the only example of an ecological assessment of gene escape
"risk" started so early, long before the existence of the first GM-cowpea.
References.
Atachi P, Dannon EA, Arodokoun YD, Tamo M, 2002 - Distribution and sampling of
Maruca vitrata (Fabricius) (Lep., Pyralidae) larvae on Lonchocarpus sericeus
(Poir) HB and K. J. Appl. Entomol.-Z. Angew. Entomol. 126(4): 188-193.
Bottenberg, H., Tamo, M., Arodokoun, D., Jackai, L.E.N., Singh, B.B., Youm, O.,
1997 – Population dynamics and migration of cowpea pests in northern
Nigeria: implications for integrated pest management. In Singh, B.B., Mohan
Raj, D.R., Dashiell, K.E., Jackai, L.E.N., eds, Advances in cowpea research:
271-284. IITA-JIRCAS, Ibadan.
Coulibaly, S., Pasquet, R.S., Papa, R., Gepts, P., 2002 - AFLP analysis of the phenetic
organization and genetic diversity of Vigna unguiculata L. Walp. reveals
extensive gene flow between wild and domesticated types. Theor. Appl.
Genet. 104-2/3: 358-366.
Fatokun CA, Ng Q, 2007 - Outcrossing in cowpea. J. Food Agric. Environ. 5-3/4:
334-338.
Filippone, E., 1990 - Genetic transformation of pea (Pisum sativum L.) and cowpea
(Vigna unguiculata (L.) Walp.) by cocultivation of tissues with Agrobacterium
tumefaciens carrying binary vectors. In: Nq, N.G., Monti, L.M., eds, Cowpea
genetic resources: 175-181. IITA, Ibadan.
Higgins TJ, Popelka C, Ishiyaku M, Pasquet R, Mignouna J, Bokanga M, Huesing J,
Murdock L, 2007 - Insect protected cowpeas-transgenics with Bt or alphaamylase inhibitor genes. In van Houten H, Tom K, Tom-Wielgosz V, eds,
Biotechnology, breeding and seed systems for African crops: 78. Rockefeller
Foundation, Nairobi.
Kay, Q.O.N., 1987 - Ultraviolet patterning and ultraviolet-absorbing pigments in
24
flowers of the Leguminosae. In Stirton, C.H., ed., Advances in legume
systematics, part 3: 317-353. Royal Botanic Gardens, Kew.
Leleji, O.I., 1973 - Apparent preference by bees for different flower colours in
cowpeas (Vigna sinensis (L.) Savi ex Hassk.). Euphytica 22-1: 150-153.
Lush, W.M., 1979 - Floral morphology of wild and cultivated cowpeas. Econ. Bot.
33-4: 442-447.
Murdock, L.L., Huesing, J.E., Nielsen, S.S., Pratt, R.C., Shade, R.E., 1990 –
Biological effects of plant lectins on the cowpea weevil. Phytochemistry 29-1:
85-89.
Pasquet, R.S., 1999 - Genetic relationships among subspecies of Vigna unguiculata
(L.) Walp. based on allozyme variation. Theor. Appl. Genet. 98-6/7: 11041119.
Popelka JC, Gollasch S, Moore A, Molvig L, Higgins TJV, 2006 - Genetic
transformation of cowpea (Vigna unguiculata L.) and stable transmission of
the transgenes to progeny. Plant Cell Reports 25-4: 304-312.
Rawal, K.M., 1975 - Natural hybridization among wild, weedy and cultivated Vigna
unguiculata (L.) Walp. Euphytica 24-3: 699-707.
Richard, A., 1847 - Tentamen florae abyssinicae, volumen primum. Arthus Bertrand.
Paris.
Taylor, T.A., 1978 - Maruca testulalis: an important pest of tropical grain legumes. In
Singh, S.R., Van Emden, H.F., Taylor, T.A., eds., Pests of grain legumes:
ecology and control: 193-200. Academic Press, London.
25
ENGINEERING TWO MUTANTS OF CDNA-ENCODING G2 SUBUNIT OF
SOYBEAN GLYCININ CAPABLE OF SELF-ASSEMBLY IN VITRO AND
RICH IN METHIONINE
Reda Helmy Sammour
Botany Department, Faculty of Science, Tanta University, Tanta, Egypt
E-mail: redasammour@gmail.com
Abstract:
The main goal of this work was to construct a cDNA-encoding subunit G2 of soybean
glycinin, capable of self assembly in vitro and rich in methionine residues. Two
mutants (pSP65/G4SacG2 and pSP65/G4SacG2HG4) were therefore constructed. The
constructed mutants were successfully assembled in vitro into oligomers similar to
those occurred in the seed. The successful self-assembly was due to the introduction
of Sac fragment of Gy4 (the codons of the first 21 amino acid residues), which is
reported to be the key element in self-assembly into trimers. The mutant
pSP65/G4SacG2HG4 included the acidic chain of Gy4 (HG4), which was previously
molecularly modified to have three methionine residues. This mutant will be useful in
the efforts to improve seed quality.
Key words: soybean; Gy2; glycinin; self-assembly; G2 subunit.
Introduction
Glycinin is the predominant storage proteins in soybean seeds. It accounts for more
than 20% of the seed dry weight in some cultivars, has no known catalytic activity,
and is thought to function as a reserve for carbon and nitrogen to be used upon seed
germination (Nielsen et al. 1989). As isolated from seed extracts, the glycinin was an
oliogomer of six similar subunits (Badely et al. 1975). The properties of these
subunits were reviewed extensively (Wolf 1976; Larkins 1981; Nielsen 1984), and
five major subunits were identified on the basis of differences in their primary
structures (Moreira et al. 1979). Each glycinin subunit is composed of two
disulphide-linked polypeptides. One polypeptide has an acidic isoelectric point, and
the other is basic. The two polypeptide chains result from post-translational cleavage
of proglycinin precursors (Turner et al. 1982), after the precursor enters the protein
bodies (Chrispeels et al. 1982).
Nielsen et al (1989) characterized the structure, organization, and expression of genes
that encode the soybean glycinins. It was found that the predominant glycinin
subunits found in soybean seeds were encoded by a family of five genes. These genes
diverged into two subfamilies that are designated as Group-1 and Group-2 glycinin
genes (Nielsen 1984). The genes in Group-1, include Gy1, Gy2, and Gy3, have
nucleotide sequences that are more than 80% homologous to one another (Nielsen et
al. 1989). The nucleotide sequences for members of Group-2, which includes Gy4,
Gy5, are likewise more than 80% identical with one another, but are less than 60%
homologous with those in Group-1 (Cho et al. 1989). Beilinson el al. (2002)
identified two new genes: a glycinin pseudo-gene, Gy6, and a functional gene, Gy7.
Even though the amino acid sequence of the glycinin subunit G7 is related to the other
five soybean glycinin subunits, it does not fit into either the Group-1 (Gl, G2, G3) or
the Group-2 (G4, G5) glycinin subunits.
26
Dickinson et al. (1987) developed an in vitro system that allows the self-assembly of
group-2 proglycinin subunits into that resemble those found naturally in the
endoplasmic reticulum. This system showed that Group-2 subunits were capable of
self assembly into trimers similar to those formed in endoplasmic reticulum.
However, they found that the Group-1 subunits were unable to assemble in the
absence of Group-2 subunits. Group-1 subunits were initially considered to be the
best candidate into which to engineer additional sulfur amino acid residues, because
Group-1 had higher sulfur content than the other glycinin subunits. The aim of this
study was to adopt a better strategy to improve nutritional qualities of soybean seed
proteins through alter Group-1 subunits to be capable of self-assembly in vitro and to
harbor more Met residues.
Material and methods
Plasmids pSP65/248 and pMP18/MG2H served as the first step in the construction of
the plasmids pSP65/G4SacG2 and pSP65/G4SacG2HG4. The isolation of pG27, a
full-length Gy2 cDNA was described in Scallon et al. (1985). The vectors pSP65 and
pMp18 (Melton et al. 1984) was purchased from Promega Biotec (Madison, WI).
Construction of pSP65/G4SacG2
To construct this plasmid, the pSP65/MG2H and pSP65/248 were separately partially
digested at Sac1 and HindIII sites in the polylinker (Fig. 1A). The 0.9 Kb (Kilobase)
polylinker Sac1/HindIII fragment of pSP65/248 substituted Sac1/HindIII fragment,
which included MG2H of pSP65/MG2H to form pSP65/MG2H. However, this
plasmid lacked Sac1 fragment. Therefore, pSP65/248 was digested with Sac1 and the
0.16 Kb Sac1 fragment was isolated, then inserted at Sac1 site in pSP65/MG2H. The
plasmid obtained was denoted pSP65/G4SacG2 (Figure 1A).
Construction of pSP65/G4SacG2HG4
pSP65/G4SacG2HG4 was constructed by separately digestion of pMP18/MG2H and
pSP65/248 with BamH1 and HindIII. BamH1 / HindIII of pMP18/MG2H was
substituted for the corresponding fragment from cDNA clone pSP65/248 to form the
plasmid pSP65/G2HG4 (Figure 1B). The plasmide denoted pSP65/G2HG4 and the
plasmid pMP18/G2Sac were separately digested with Sam1. The Sam1 fragment of
pMP18/G2Sac was trade with Sam1 fragment of pSP65/G2HG4 to construct the
plasmide pSP65/G2SacG2HG4. Both pSP65/G2SacG2HG4 and pSP65/248 were
separately digested with Sac1 and Xho1.
Sac1/Xho1 fragment of
pSP65/G2SacG2HG4 was ligated in the same sites of pSP65/248 to form
pSP65/G2HG4. pSP65/G2HG4 and pSP65/248 were separately digested with Sac1
and then Sac1 fragment of pSP65/248 was inserted in Sac1 site of pSP65/G2HG4 to
form the plasmid pSP65/G4SacG2HG4.
DNA sequence analysis
Nucleotide sequence analysis was carried out by the chemical method of Maxam &
Gilbert
(1977).
Synthetic
oligonucleotides
5'GCGAGACAAGAAACGGGGTTGAGG3’
and
5'GAGAACATTGCTCGCCCTTCGCGC3’ were used as primers for sequencing
across the Gy4 regions.
27
S
S
H
S
S
pMP18/MG2H
pSP65/248
Partial
SacI HindIII
S
S
SacI HindIII
S
H
Ligation
S
S
H
S
S
pSP65/MG2H
SacI
Ligation
S
SacI
S
Phosphorylation
H
pSP65/G4SacG2
Figure 1A
Figure 1. Construction maps of pSP65/G4SacG2 (A), pSP65/G4SacG2HG4 (B).
Figure 2. shows the results of self-assembly of G4 (A), G4SacG2 (B) and
G4SacG2HG4 (C). Radioactive 3H-Leu labeled proglycinins were synthesized in
vitro using pSP65/248, pSP65/G4SacG2, pSP65/G4SacG2HG4. They were incubated
in the translation mixtures for 30 hours at 250C to promote self-assembly and then
analyzed by sedimentation in sucrose gradients. Sedimentation standards are shown
at the top.
In vitro transcription.
Plasmids were linearized with Pvu2 and Pst1 and used as template for run-off
transcription with SP6 RNA polmerase. Transcription reactions were carried out
according to Melton et al. (1984), except that the DNA concentration was raised to
0.2µg /µl. GTP was reduced to 20 µM, and m7GpppG (Pharmacia) was included at
500 µM. After 90 min at 40 0C, the GTP concentration was raised to 500 µM and the
incubation was continued for 30 min at 40 0C.
In vitro translation and assembly
In vitro translation with rabbit reticulocyte lysates and (3H) leucine were performed
according to the manufacturer's (Promega Biotec) specific reactions.
After
28
translation, EDTA was added to 2mM and phenylmethyl-sulfonylfluoride was added
to 250 µM. The mixtures were then incubated for specified times and temperatures
and placed on ice.
Sucrose gradient fractionation
Assembly was assayed by layering 100 µL samples of the in vitro synthesis reaction
onto 11 ml linear 7-25 % sucrose density gradient that contained 35 mM phosphate,
0.4 M NaCl, 0.01 M 2-mercaptoethanol (pH 7.6). The gradients were centrifuged for
24 hr at 35,000 rpm and 4oC in a Beckman SW41 rotor. Fractions of 0.35 ml were
collected from the bottom and assayed for radioactivity after trichloroacetic acid
precipitations.
Trichloroacetic acid precipitation
Trichloroacetic acid precipitation was carried out according to the method reported by
Dickinson et al. (1989). In this method the samples of assembly (100 µL each) of
each mutant were mixed with 25 ml of 25% hydrogen peroxide and incubated at 37
°C for 10 mm. Then 1.5 ml of 25% TCA , 2% casamino acids were added and mixed,
and the mixture was placed on ice for at least 30 min. Samples were collected on glass
fiber filters, washed twice with 10 ml of 10% TCA, and subsequently washed with 5
ml of ethanol. The filters were then dried and counted in 10 ml of ACS scintillation
fluid.
SDS/PAGE
SDS-polyacrylamide gel electrophoresis was performed in 12% gels (Laemmli 1970).
The fractions of the 9S peak of assembly of each mutant were pooled and dialyzed
against sample buffer (0.03 M Tris-HCl, pH 6.8, 2% SDS, 2% 2-mercaptoethanol, 2.5M
urea, 10% glycerol), boiled for 2 min before loading and then electrophoretically
separated. After electrophoresis the gel was stained with Coomassie Blue, treated with
EN3HANCE (New England Nuclear, USA) and visualized by Fluorography.
Cross – Linking
Cross-linking was carried out by a modification of the method described by Siezen et al.
( 1980). Fraction from sucrose gradient that contained 9S complexes were pooled, and
then samples (80 µl) were mixed rapidly with aliquots of a solution of
dithiobis(succinimidylpropionate) (7mg/ml) in acetonitrile to give a final
concentration of 0.016 (wt/vol) cross-liker. After 30 min at room temperature, each
sample was mixed with 20 µl of 6 M urea/0.15M sodium phosphate buffer, pH7/10%
NaDodSo4/0.02% bromophenol blue, and heated to 100oC to prevent further crosslinker. Aliquots (20µl) from each sample were dialyzed against 0.025 M neutral
sodium phosphate buffer (electrode buffer) that contained 10% (vol/vol) glycerol and
0.02% bromophenol blue and were examined by electrophoresis in a 2-10%
acrylamide gradient gel. The gels were then stained with commassie blue, treated
with EN3HANCE (New England Nuclear), and visualized by fluorography. The gel
was
calibrated
with
protein
standards.
29
B
BH
H
Ss sSB
pM18/MG2H2
HX
BamHI/HindIII Partial Digestion
H
Ss sSB
H
SamI
SB
H
pMP18/G2Sac
pSP65/G2HG4
S
H
pSP65/248
BamHI/HindIII Complete Digestion
Ss sSB
HX
SamI
HX
H
S
S
Phosphorylation/Sac1
Ss sSB
HX
H
sSB
HX
SacI/XhoI
pSP65/G2SacG2HG4
Ligation
Ss sSB
HX
H
s
pSP65/G2HG4
Phosphorylation/SamI
SacI
Ss sSB
HX
H
pSP65/SacG2HG4
Figure 1B
30
s
SacI
Results and discussion
The designated mutant pSP65/G4SacG2 was constructed to make G2 self-assembly
(Figure 1A). In this plasmid, Sac1 / Hind3 fragment of pSP65/MG2H substituted
Sac1 / Hind3 fragment of pSP65/248 which includes MG2H of pSP65/MG2H.
However, this plasmid lacked Sac1 fragment. Therefore, pSP65/248 was digested
with Sac1. Sac1 fragment of Gy4 which was critical for self-assembly. Therefore,
pSP65/248 was digested with Sac1, and the G4 Sac1 fragment was isolated and then
inserted at Sac1 site in pSP65/MG2H. The concentration of assembly products of
pSP65/G4SacG2 was above the threshold required for self-assembly compared with
that of the plasmid which harbor Gy4 (pSP65/248). Therefore, the assembly products
of pSP65/G4SacG2 was efficiently assembled in vitro (Figure 2). In addition, their
analysis after self-assembly on SDS-PAGEE showed that the protein assembled was
trimers with subunit molecular mass of 66 KiloDalton (KDa) (Figure 3) similar to
those trimers produced by plasmid pSP65/248.
G4SacG2
B
9S
G4SacG2HG4
9S
C
Radioactivity:
-3
cpm
10x 10
25
22
19
13
10
1
25
22
19
16
0
13
2
0
7
4
2
10
6
4
4
8
6
1
8
7
12S
4S
9S
Radioactivity:
-3
cpm
10x 10
4
Radioactivity:
-3
cpm
10x 10
16
G4
A
Fractions
8
6
4
2
25
22
19
16
13
10
7
4
1
0
Fractions
Figure 2
Since G-2 glycinin subunit has a higher sulfur content than the other glycinin
subunits, it was consider to be the best candidate into which additional sulfur amino
acid residues can be engineered. The main obstacle to do that was that G-2 subunit
was not self-assembly in vitro. However, the ability of pSP65/G4SacG2 which
harbored Gy2 on self-assembly, in combination with the successful introduction three
Met amino acid residues in the acidic chain of Gy4 (Sammour 2005) overcome this
obstacle and renewed the hope to improve the nutritional quality of glycinin through
alter G-1 glycinin genes. I, therefore, constructed pSP65/G4SacG2HG4 that included
both the acidic chain that harbor three Met residues and Sac1 fragment of Gy4 that
responsible
on
self-assembly
(Figure
1B).
Assembly
products
of
pSP65/G4SacG2HG4 were sufficient for self-assembly in vitro. The assembly assay
31
results of pSP65/G4SacG2HG4 showed the distribution of radioactivity in sucrose
gradient after self-assembly (Figure 4).
Analysis of the produced proteins in self-assembly of this mutant and plasmid
pSP65/248 on SDS/PAGE showed that the protein assembled was trimers with
subunit molecular mass of 66 KDa (Figure 3) and molecular weight of 180 (Figure
4). In conclusion, cloned cDNAs encoding glycinin subunit G2 was modified to be
able to self-assemble in vitro and to harbor more Met residues. The ability of selfassembly for the mutants constructed was tested and gave positive results.
Transforming these mutants through PEG, elctroporation, microprojectile
bombardment, or Agrobacterium to soybean is one of the perspectives in our effort to
improve the nutritional quality of soybean seed proteins. However, the expression of
these mutants in a tailor system should have the first priority.
1
2
3
KDa
KDa
1
2
3
330
264
198
66
132
45
066
36
29
Figure 3.
Figure 4.
Figure 3. Fluorogram of SDS/PAGE containing the 3H-labeled products derived from
the plasmids pSP65/248, pSP65/G4SacG2 and pSP65/G4SacG2HG4. Lane 1: : G4
synthesized protein using plasmid pSP65/248; Lane 2: G4SacG2 synthesized protein
using plasmid pSP65/G4SacG2; Lane 3: G4SacG2HG4 synthesized protein using
plasmid pSP65/G4SacG2HG4. Molecular weights of protein markers are given in
KDa.
Figure 4. 9S proglycinins of pSP65/248, pSP65/G4SacG2 and pSP65/G4SacG2HG4
cross-linked with dithiobis (succinimidyl-propionate) at the concentration 0.16%:
Lane 1, pSP65/248; lane 2, pSP65/G4SacG2 ; lane 3, pSP65/G4SacG2HG4.
Protein standard are given in KDa.
References
Beilinson V., Chen Z., Shoemaker C., Fischer L., Goldberg B. & Nielsen C. 2002.
32
Genomic organization of glycinin genes in soybean. Theoretical and Applied
Genetics 104: 1132-1140.
Badley R.A., Atkinson D., Hauser H., Oldani D., Green J.P. & Stubbs, J.M. 1975.
The structure, physical and chemical properties of the soybean protein
glycinin. Biochim. Biophys. Acta 412: 214-228.
Cho T.-J., Davies C.S. & Nielsen N.C. 1989. Inheritance and organization of glycinin
genes in soybean. Plant Cell 1: 329-337.
Chrispeels M. J., Higgins T.J.V. & Spencer D. 1982. Assembly of storage protein
oligomers in the endoplasmic reticulum and processing of the polypeptides in
the protein bodies of developing cotyledons. J. Cell Biol. 93: 306-313.
Dickinson C. D. 1988. Assembly properties of glycinin subunits development of a
novel in vitro assembly assay. Ph. D. Thesis, Purdue University.
Dickinson C.D., Hussein H.A. & Nielsen N.C. 1989. Role of posttranslational
cleavage in glycinin assembly. The Plant Cell. 1: 459-469.
Laemmli U. K. 1970. Cleavage of structural proteins during the assembly of the head
bacterriophage T4. Nature 227:680-685.
Larkins B.A. 1981. Seed storage proteins, pp.449-489. In: Stumpf P.K. & Conn E.E.
(eds), Biochemistry of Plants: A comprehensive Treatse, Vol .6, New York.
Maxam A.M. & Gilbert W. 1980. sequencing end-labeled DNA with base-specific
chemical cleavages. Methods Enzymol. 65: 409-560.
Meinke D. W., Chen J. & Beachy R. N. 1981. Expression of storage protein genes
during soybean seed development. Planta 153: 130-139.
Melton D.A., Kreig P.A., Rebagliati M. R., Maniatis T., Zinn K. & Green M. R.
1984. Efficient in vitro synthesis of biologically active RNA and RNA
hybridization probes from plasmids containing a bacteriophage SP6 promoter.
Nucl. Acids. Res. 12: 7035-7056.
Moreira M. A., Hermodson M.A., Larkins B.A. & Nielsen, N.C. 1979. Partial
characterization of the acidic and basic polypeptides of glycinin. J. Biol.
Chem. 254: 9921- 9926.
Nielsen N.C. 1984. The chemistry of legume storage proteins. Philos. Trans. R. Soc.
Lond. Ser. B 304: 287- 296.
Nielsen N. C., Dickinson C.D., Cho T. J., Thanh V.H., Scallon B.J., Fischer R.L.,
Sims T.L., Drews G.N. & Goldberg, R.B. 1989. Characterization of the
glycinin gene family in soybean. Plant Cell 1: 313-328.
Sammour R. H. 2005. Molecular manipulation and modification of the genes
encoding glycinin subunits Gy2 and Gy4 of soybean seeds. Russian Journal
of Plant Physiology 52:365–373.
33
Siezen R. J., Bindels J. G. & Hoenders H. J. 1980. The quaternary structure of bovine
alpha-crystallin. Chemical cross linking with bi-functional imido-esters. Eur.
J. Biochem. 107: 243-249
Tumer N. E., Thanh V.H. & Nielsen N.C. 1981. Purification and characterization of
m RNA from soybean seeds. J. Biol. Chem. 257: 4016-4018.
Wolf W. J. 1976. chemistry and technology of soybeans. Adv. Cereal Sci. Technol.
11:325-377.
34
OPTIMISATION
OF
THE
BIOLISTIC-MEDIATED
TRANSFORMATION OF WHITE LUPIN (Lupinus Albus) FOR
IMPROVED FUNGAL RESISTANCE
P. Huzar Futty Beejan16 and A. Wetten2
1
2
Agricultural Research and Extension Unit, Quatre Bornes, Mauritius.
School of Plant Sciences, University of Reading, UK
Abstract
This study investigates the conferring expression of the Polygalacturonase Inhibitor
Protein (PGIP) associated with enhanced fungal resistance to Lupinus albus by
optimised biolistic-mediated transformation using particle delivery system PDS1000/He. Cut embryonic axes were used for convenient screening of transient gene
expression. The Green Fluorescent Protein (GFP) was effectively used as a reporter
gene for the development of the transient transformation system. Physical parameters
including microparticle size, effect of macrocarrier well size and volume of
pDNA/microcarrier load as well as pressure of helium gas were found to affect the
transient GFP expression. The adoption of a macrocarrier holder with a larger 11.85
aperture diameter improved the modified launch assembly of the biolistic apparatus.
The optimised parameters provide a basis for further transformation studies for
improved fungal resistance of the crop.
Key words: white lupin, biolistic, anthracnose, Green Fluorescent Protein, transient
expression
Introduction
The seed borne “stem and pod blight” (anthracnose caused by Colletotrichum
gloeosporiodes) is a major fungal disease affecting lupins. L. albus is one of the most
anthracnose-susceptible lupins and, as such, its cultivation is seriously threatened in
countries such as France, Chile, Brazil, Russia and Canada (Sweetingham et al,
1998). Fungicides are rarely used as the control achieved does not provide an
economic return (Sweetingham et al, 1998). Moreover, controlling anthracnose solely
by plant breeding is not practical as the fungus has been demonstrated to be very
diverse with a great potential for further diversification (Dron and Bailey, 1999).
In order to enhance fungal resistance of L. albus, the inhibitory activity of
polygalacturonase-inhibiting proteins (PGIPs) present on plant cell walls which fend
off cell wall degrading enzymes (endopolygalacturonases) produced by
phytopathogenic fungi (Matteo et al, 2003) can be imparted by transformation. The
introduction of an identified PGIP encoding gene into L. albus would provide
resistance against anthracnose. Studies by Pigeaire et al (1997) and Li et al (2000)
established the potential of lupin to undergo transformation. The aim of this study was
to optimise the physical and biological parameters for the biolistic-mediated
transformation system for Lupinus albus that will ultimately allow the expression of
PGIP for enhanced fungal disease resistance.
6
Corresponding author: areu@intnet.mu
35
L. albus (Lucrop) seeds were obtained from the Institut National de la Recherche
Agronomique (INRA) Lusignan, France. Seeds were disinfected, allowed to
germinate in vitro for 22-24 hours in an incubator and then transferred to a laminar
flow cabinet for dissection as per Suso’s method (2001). Two types of embryonic
axes explants were prepared (1) dissected embryonic axes (EA), and, (2) dissected
and cut embryonic axes (CEA). The seed coat and 2 cotyledons were aseptically
removed from each seed so as to expose the embryonic axis. Under a dissecting
microscope, the two outermost true leaves were then carefully excised. The innermost
true leaves were gently teased apart and the apical dome was exposed. The explant
therefore consisted of the entire radicle but with a dissected plumule with third leaves
and apical dome exposed (EA).
All media and glasswares were autoclaved at 121ºC for 15 minutes prior to use. The
MS3 medium, Murashige and Skoog (1962) medium supplemented with 3% sucrose
was used for the experiments. The autoclaved media was poured into sterile
disposable petridishes of 9 cm x 2 cm (approximately 25 ml of MS3). Petridishes used
for biolistic procedures and for viewing of GFP expression were generally filled with
50 - 55 ml media. The dissected EA were aseptically embedded such that the apical
region protruded from the agar surface by around 2 - 5 mm. CEA were similarly
arranged atop the agar medium.
The plasmid DNA, pEGAD, was obtained from the Plant Sciences Laboratories of the
University of Reading and used for optimisation of the transformation of L. albus.
pEGAD is a low copy vector of around 12.5 kB and is a derivative of a GFP gene that
contains the Falkow chromophore and Sheen codon optimisation. To this gene, a
multiple cloning site locus and a “flexi-linker” were added before the entire modified
construct was inserted into pBasta. The transgene imparts gluphosinate (Basta®)
resistance in transgenic plants. The presence of pEGAD in Escherichia coli confers
kanamycin resistance to the bacteria. The isolation of plasmid DNA from the cultured
E. coli was carried out by using the GenEluteTM HP Plasmid Maxiprep Kit (Sigma).
The preparation prior to particle bombardment consisted of 5 steps.
1. Microcarrier Sterilisation
30 mg of gold microparticles (1.0 µl) were weighed into 1.5 ml eppendorf and
sterilised with 70 % ethanol (v/v), washed thrice, suspended and then distributed into
50 µl aliquots and stored at 4ºC as Sanford et al (1993).
2. Coating of The Plasmid DNA onto The Sterilised Microcarrier
6 µl of DNA, 50 µl M CaCl2 and 20 µl of spermidine (tissue culture grade from
Sigma) were added to the aliquots. The eppendorf was vortexed. The microcarriers
were pelleted by pulsing at 6000 rpm for 1 second. After discarding the supernatant,
250 µl of 100 % ethanol (EtOH) was added, pipetted up and down and vortexed. The
eppendorf was pelleted as above and the supernatant was again discarded. The pellet
was resuspended in 70 µl EtOH and vortexed continuously.
3. Macrocarrier Preparation
36
Two types of macrocarriers were prepared by moulding thermo-plastic. They were
deep welled (DW) macrocarriers with a diameter of 8 mm at top of well and 5 mm at
the bottom; or shallow welled (SW) with a diameter of 3 mm at top of well and
tapering to less than 1 mm at the bottom. Macrocarriers were sterilised by immersing
in EtOH for 15 minutes then dried on a sterile filter paper disc placed over calcium
carbonate.
4. Loading of Microcarrier onto The Macrocarrier
10 µl of the coated microcarriers were pipetted into the central well of the
macrocarriers. After evaporation of ethanol from wells, the optimal distribution of
microparticles was verified using a dissecting microscope.
5. Arrangement Of Explants For Bombardment
Six explants had been previously determined to fit in the central particle delivery area
(1 cm diameter). The explants were thus arranged within this bombardment area such
that the EA were embedded into the agar whilst CEA were placed onto its surface.
The biolistic unit PDS-1000/He (Bio-Rad Laboratories, California, USA) with a
modified set up was used to accelerate subcellular sized gold microparticles coated
with DNA into the embryonic axes’ tissue. The modification to the particle delivery
system consisted of an inclusion of a nozzle screwed into the microcarrier launch
assembly. This nozzle helped to direct the burst of microparticles so that they were
incident in the centre (1 cm diameter) of the target petridish. All bombardments were
carried out within the laminar flow cabinet. Components of the biolistic unit were
surface sterilised with 70% ethanol and the launch assembly was autoclaved prior to
use. Before insertion into the retaining cap, rupture discs were dipped in 70%
isopropanol. Stopping plates with 8 mm diameter aperture were used with DW
macrocarriers and those with 2 mm diameter for SW macrocarriers. The petridish
holding the explants to be bombarded was placed onto the target shelf at a target
distance of 9 cm and uncovered before bombardments. After the biolistic unit was
fired, the target petridish was covered then sealed with Nescofilm® before being
transferred to the growth room for 48 hours.
Some 48 hours after each biolistic procedure, bombarded explants were examined
using the Zeiss Axiovert 35 inverted microscope. The latter enabled the observation
of cells expressing transient GFP expression. After detection of transient GFP
expression, explants were replaced in the growth room and allowed to regenerate.
Basta® resistance of explants was used to select stable transformants. Resistance was
evaluated by aseptically dripping 1 µl of 5 mgL-1 of phosphinothricin (PPT) on the
apical meristem region of the L. albus putative transformant. This drop was then
removed with a pipette. The petridishes were sealed and placed in the growth room.
The successfully transformed explants show resistance to Basta®.
The physical and biological parameters were;
I.
Physical Parameters
1. Aperture Diameter of Macrocarrier Holder
During some of the first bombardments, it was observed that the macrocarriers could
not be released by the macrocarrier holder at a helium gas pressure of 1550 psi. This
37
resulted in null bombardments. Two new macrocarrier holders (from the Engineering
Department of the University of Reading) with the same outer diameter as the
standard holder but with differing inner aperture diameters (11.85 mm and 11.90 mm)
were tested. The 11.90 mm holder failed to adequately grip the macrocarrier and
could not be used for bombardment. The standard 11.80 mm and the new 11.85 mm
macrocarrier holders were used during the bombardment of explants at a helium
pressure of 1550 psi. The GFP expressing cells in each of the two treatments were
noted after 48 hours.
2. Microcarrier Size
Three sizes of gold microparticles (0.6, 1.0 and 1.6 µm from Bio-Rad laboratories)
were used. Sterilisation and DNA coating onto the three sizes of microcarrier were
carried out as described above. These microparticles were then used to bombard CEA
explants. The explants were observed for GFP expression after 48 hours.
3. Pressure of Helium Gas Used
The effect of 3 pressures of helium gas (1100, 1550 and 1800 psi) propelling the
macrocarrier towards the target plate were investigated whilst other factors such as
SW macrocarrier well size, pDNA/microcarrier load and gap distance were kept
uniform. The suitability of using the different pressures of helium gas was determined
by recording the transient expression of GFP in CEA explants.
4. Distribution of Microcarrier and Volume of Load
Four volumes of pDNA/microcarrier preparation (10, 20, 30, 40 µl) were loaded onto
DW rigid macrocarriers and, after bombardment, the gold distribution onto the central
region was compared to that from the control load (10 µl onto SW macrocarrier). The
stopping plate used for all bombardments had an aperture diameter of 3 mm. After
bombardment the blank (MS3 medium without explants) target petridishes were
labelled and then viewed using the Axiovert 35. Gold microparticle counts were
recorded at 5 equidistant linearly spaced loci (P1, P2, P3, P4, P5) in the central 1 cm
region of the target petridish (Fig 1).
Fig 1: Left: Schematic diagram indicating the central bombardment area and the 5 points used for
gold microparticle count. Right: Five equidistant count points P1, P2 , P3, P4, P5 in bombardment
region
To enable counts of microparticles at each locus, a grid, as per Fig 2 (Microscope
accessory: Foto 35, 9 x 12, 4 x 5) was mounted into the microscope. The number of
microparticles in two areas E1 and E10 were counted with a handheld tally. E1 and
E10 counts were recorded for each locus P1 to P5 for each bombarded petridish.
38
1
2
3
4
5
6
7
8
9
10
A
B
C
D
E
F
G
H
I
J
Fig 2: Areas E1 and E10 (in grey) on grid Foto 35 as viewed under microscope.
5. Effect of Macrocarrier Well Size and Volume of Load
DW macrocarriers were loaded with 10, 20, 30 µl of pDNA/microcarrier preparation
and used to bombard CEA explants. The control SW macrocarriers were loaded with
10 µl of the microcarriers and were also used for bombardment. With SW
macrocarriers, stopping plate aperture with smaller diameter was used for explants’
bombardment whilst large diameter stopping plate was used for bombardment with
DW macrocarriers. Transient GFP expression was monitored after the usual interval.
II.
Biological Parameters
1. Effect of Osmotic Pre-Treatment
The dissected CEA were transferred onto high osmolarity medium for 4 hours prior to
bombardment so as to induce plasmolysis. The high osmolarity MS media contained
the usual sucrose concentration and sorbitol-mannitol in a 1:1 ratio such that three
concentrations were attained (final concentrations 0.2 M, 0.5 M and 1.0 M). After pretreatment, explants were replaced onto MS3 medium. The control explants were not
subjected to osmotic pre-treatment on sorbitol-mannitol and were only plated on MS3
medium both before and after bombardment. The explants were placed in the growth
room before being used for the biolistic procedure at a pressure of 1550 psi and SW
macrocarrier with 10 µl of pDNA/microcarrier load. This trial was replicated twice.
2. Selection of Putative Transformants
The dissected EA were incubated for 48 hours in the growth room. After this period, a
pipette was used to aseptically drip 1 µl of PPT onto the explants’ apical region
exposed over the medium. Eight varying concentrations of PPT (0, 1, 2, 5, 10, 20, 50,
100 mgL-1) were assessed. The trial was replicated twice
Statistical Analysis
The experiments were run in a completely randomised design. Data was analysed
with GenStat ®. General analysis of variance with Least Significant Differences of
Means at 5% level was used. A treatment was judged significant when probability, p
was ≤ 0.05. T-tests (two-sampled t-tests (unpaired) with 95% confidence limit) were
also carried out.
39
. Two macrocarrier holders with 2 aperture diameters (11.80, 11.85 mm) were used
for bombarding explants. The GFP expression results were compared and they were
statistically non significant with respect to the holder aperture diameter. The 11.85
mm macrocarrier holder was used for subsequent bombardments as it eliminated the
failure of macrocarrier release, as noted with the 11.80 mm macrocarrier holder. This
release failure probably occurred because the macrocarrier base was too tightly fit into
the holder such that even the helium gas burst failed to dislodge the macrocarrier
which resulted in failure of DNA coated microparticles to be ejected.
Table 1: (Run 2) Analysis of variance for the effect of three sizes (0.6, 1.0 and 1.6 µm) of gold
microparticles on GFP expression of L. albus genotype Lucrop
Gold Microparticle size
0.6 micron
1.0 micron
1.6 micron
s. e. d
LSD (5 %)
CI
_
Mean ( x )
1.08
3.67
1.17
0.514
1.079
0.354 – 1.806
2.944 – 4.396
0.444 – 1.896
s. e. d - the significant error of the difference in means, LSD- least significant difference, CIConfidence Interval
The velocity at which microparticles are ejected from the macrocarriers, travel
through the bombardment chamber and finally impact and penetrate the target tissue
is dependent on the size of the microparticles used. Similarly, the size of the
microparticles also influences the amount of DNA that can be coated onto them. A
comparison of 3 microparticles sizes (0.6, 1.0 and 1.6 µm) was thus carried out. The
first bombardment indicated that there was no significant difference between the three
sizes. Replication of the trial and analysis of variance showed that the GFP expression
in bombarded tissue varied significantly with respect to particle size (Table 1). A twosample T-test (at 95% confidence interval for the difference in means, p <0.001)
indicated that the 1 µm microcarrier was significantly more efficient.
Table 2: Analysis of variance using the pooled data from Run 1 and 2 for the effect of
three sizes (0.6, 1.0 and 1.6 µm) of gold microcarriers on GFP expression of L. albus
genotype Lucrop.
Gold Microcarrier size (µm)
Mean
CI
1.094 – 3.326
2.21
0.6
3.384 – 5.616
4.50
1.0
1.134 – 3.366
2.25
1.6
0.789
s. e. d
1.582
LSD (5 %)
s. e. d - the significant error of the difference in means, LSD- least significant
difference, CI-Confidence Interval
Results from the two runs were pooled and the analysis of variance was carried out. A
significant difference was found between treatments (p <0.05) as per Table 2.
Microparticle size of 1 µm was found to be significantly better than the 0.6 and 1.6
40
(units)
Microparticle count
µm. Pooled data analysis confirmed that microparticle size had a significant role in
the efficiency of the bombardment system. Microparticle size is intricately linked to
the amount of cell or tissue damage that can result from bombardment. Cell damage is
more likely to occur with the use of larger microparticle size due to the higher
velocity associated with increased size. There was no significant difference between
the 3 pressure treatments under the standard bombardment conditions.
400
350
300
250
200
150
100
50
0
SW + 10 µL
DW + 10 µl
DW + 20 µl
DW + 30 µl
DW + 40 µl
0
2 Locus
4
6
Fig 3: The effects of macrocarrier well size and pDNA/microcarrier load on the microcarrier
distribution occurring on the surface of the bombarded medium at 5 loci within the bombardment
region of the Modified setup. Based on the average number of microparticle counts per locus (SWShallow well macrocarrier, DW- Deep well macrocarrier and 10-40 µl of load)
The regression analysis of the distribution of microcarriers at the different loci points
indicated that distribution varied significantly (p<0.05). The volume of
pDNA/microcarrier loaded also varied significantly (p<0.001) as did the loci point
and volume loaded taken together (p<0.05). When bombarded using the modified
setup, maximum microparticle distribution occurred at locus P3 (centre) on the target
petridish with the microparticle count decreasing regularly on moving away from the
central 1 cm diameter bombardment region (Figure 3).. Results indicate the loci
within which explants need to be arranged to optimise particle delivery.From GFP
expression results obtained, the macrocarrier well size combined with the stopping
plate used were also seen to vary significantly (p<0.05) as in Table 3.
Table 3: Regression analysis from accumulated analysis of variance for the effect of
macrocarrier well size and pDNA/microcarrier load on the GFP expression of L.
albus(SW- shallow well macrocarrier, DW-deep well macrocarrier)
Well size + Load
Mean
CI
SW + 10 µl
2.75
0.01 – 5.49
DW + 10 µl
15.75
13.01 – 18.49
DW + 20 µl
10.09 – 15.57
12.83
DW + 30 µl
4.07 – 9.49
6.75
4.01
s. e. d
8.29
LSD (5 %)
s. e. d - the significant error of the difference in means, LSD- least significant
difference
41
DW consistently gave superior GFP expression when compared to the standard SW
and 10 µl load. The 10 and 20 µl load volumes with DW macrocarrier performed
significantly better than the control SW with 10 µl load and the DW with 30 µl load.
The former two load volumes with DW gave similar results. High load volumes of 30
µl probably result in tissue damage and decreased GFP expression. The larger well
size in DW macrocarriers enabled more efficient loading by eliminating the overflow
noted in SW with an equal volume. It is therefore recommended to use 10 µl of load
with DW since it gives a higher mean transient GFP expression with relatively less
load volume.
averagenumber of explantsshowingnecrosis(units)
6
5
4
Week 1
Week 2
3
2
1
0
0
20
40
60
80
100
120
PPT concentration (mg/L)
Fig 4: Graph depicting the average number of embryonic axes showing necrosis over
a 2 week period when treated with 1 µl drop of PPT of varying concentrations.
The experiment on selection of putative transformants indicated that maximum
necrosis occurred after addition of drip of 5 mgL-1 PPT. It was observed that the
lowest concentrations of PPT to result in necrosis of explants within 2 weeks were 2
to 5 mgL-1 PPT (Figure 4). A relatively low percentage explant mortality was noted
using PPT drip concentration of 20 mgL-1. All higher PPT concentrations result in 100
% explant necrosis.
The variable results observed after replicating the osmotic pre-treatment and the
microcarrier size trial underlined a problem encountered with biolistic transformation
work notably erratic GFP expression results. This can be explained by shot to shot
variability and other factors such as time taken for and excessive tissue damage
during dissection as well as desiccation of explants before plating, maturity, size and
genetic construct of explants. At velocities required for gene transfer, tissue damage
as a result of air blasts, macroprojectile fragmentation and acoustic shock can affect
GFP expression (Birch and Franks, 1991). The aim of optimising all the above
parameters was to establish an efficient protocol for the incorporation of a PGIP
plasmid conferring resistance to fungal pathogen endo-polygalacturonase into white
lupin.
Conclusion
The biolistic apparatus PDS-1000/He was successfully used for transformation of L.
albus. GFP was successfully used as reporter gene in L. albus to monitor the sites of
42
transgene expression. An improvement to the modified launch assembly setup of the
apparatus was the adoption of a macrocarrier holder with a larger 11.85 aperture
diameter. Transient expression of GFP was monitored in the bombarded tissue to
assess the influence of physical and biological parameters that influence
transformation efficiency. It was concluded that for maximal GFP expression with the
modified Bio-Rad setup, gold microcarrier size of 1 µm performed better. The
optimal biolistic settings were concluded to be bombardment at a helium pressure of
1550 psi, using a volume of 10µl pDNA/microcarrier preparation to load onto deep
welled rigid thermoplastic macrocarriers used in conjunction with large aperture
stopping plate. Pre-treatment of explants for 4 hours on a high osmotic medium
(sorbitol-mannitol) was initially found to improve transient GFP expression
(maximum expression noted in 1 M osmotic pre-treatment). The replication of the
osmotic pre-treatment trial gave inconsistent results and pooled data revealed that
osmotic pre-treatment does not have significant effects on transient GFP expression.
Though stable transformants were not obtained from the bombarded explants, the
transient GFP expressions observed can be used as a starting condition for the
optimisation of the biolistic transformation of L. albus for improved fungal resistance.
The basis was thus laid for PGIP gene insertion into White Lupin for imparting
resistance to fungal endo-polygalacturonase. The optimised protocol could eventually
be applied to transformation of lupins with other genes and potentially also be adapted
for other legumes.
Acknowledgement
The authors thank the Head of research at the University of Reading and the Director
of AREU for their help and support.
References
Dron, M., Bailey, J.A. (1999). Improved control of bean anthracnose disease in
Latin America and Africa through increased understanding of pathogen
diversity. Summary reports of European Commission supported STD-3
projects (1992-1995), published by CTA
Heiser, W. (2000). Optimization of Biolistic transformation using the heliumdriven PDS-1000/He System. EG Bulletin 1688 BIO-RAD, USA, 1-8.
Li, H., Whylie, S.J, Jones, Jones, M.J.K. (2000). Transgenic yellow lupins
(Lupinus luteus). Plant Cell Reports 19, 634-636
Matteo, A.D, Federici, L., Johnson, K.A, Savino, C., Tsernoglou, D., Mattei, B.,
Galvi, G., De Lorenzo, G., Cervone, F. (2003) The crystal structure of PGIP
(polygalacturonase inhibiting protein), a leucine-rich repeat protein involved in
plant defense. Life Sciences, research highlights, 16-19
Murashige, T. and Skoog, F. (1962). A revised medium for rapid growth and
bioassays with tobacco issue cultures. Physiology Plantae. 15. 473-479
Randolph-Anderson, B., Boynton, J.E., Dawson, J., Dunder, E., Eskes, R.,
Russell, J.A., Roy, M.K. and Sanford, J.C. (1992), Physical trauma and tungsten
toxicity reduce the efficiency of biolistic transformation, Plant Phys, 98
43
Shark, K.B., Smith, F.D., Harpending, P.R., Rasmussen, J.L., Sanford, J.C.
(1991). Biolistic transportation of a prokaryote Bacillus megaterium. Applied
Environmental Microbiology.
Suso, H-P (2001). Development of a system for the genetic transformation of
White Lupin (Lupinus albus). PhD Thesis. University of Reading, UK.
Sweetingham, M.W., Jones, R.A.C., Brown, A.G. P. (1998). Diseases and Pests.
Lupins as Crop Plants- Biology, Production and Utilization. Ed: Gladstones,
J.S, Atkins, C., Hamblin, J. CAB INTERNATIONAL, Oxon, UK
44
Delineation of Pona Complex of Yam in Ghana using SSR Markers
E. Otoo17, R. Akromah2, M. Kolesnikova-Allen3 and R. Asiedu4
1
Crops Research Institute, P.O. Box 3785, Kumasi, Ghana.
Kwame Nkrumah University of Science and Technology, Kumasi, Ghana.
3
Current address: Tun Abdul Razak Research Centre, Brickendonbury, UK.
4
International Institute of Tropical Agriculture, Ibadan, Nigeria.
2
Abstract
Yam (Dioscorea spp), a multi-species, polyploid, and vegetatively propagated tuber
crop, is cultivated widely in the tropics and subtropics. The most popular landrace
cultivar of yams on the market in Ghana is called ‘Pona’. Yam sellers often pass off
any yam of good culinary characteristics as ‘Pona’ and consumers are at a loss as to
the genuine properties of the cultivar. To determine the population structure of this
yam group and the true genetic identity of ‘Pona’, an investigation was conducted on
molecular variability and relationships among 72 accessions of Dioscorea rotundata
collected throughout Ghana. Thirteen (62%) of them were found to be polymorphic
and used for genotyping of the full experimental set. The findings of this study prove
the ability of microsatellite molecular markers to separate closely related groups
within species due to their high specificity.
Key words: Dente, Ghana, Larebako, Muchumudu, Pona, SSRs, Yam
Introduction
The “Pona” yams of Ghana are a class of yam that belongs to the Dioscorea
rotundata-cayenensis complex. The authentic “pona” has unique rheological
properties including aroma and taste. These yams are the choicest on both local and
foreign markets. The problem facing consumers and researchers is that the authentic
“pona” is not easily discernible by morphological characters. If Ghana is to maintain
her position as the leading exporter of the crop, it must ensure purity of its varieties
that will instill confidence in the markets. Systems of classification and identification
based on morphological characters (Dansi et. al., 1998, 1999, 2000), soluble tuber
protein profiles (Ikediobi and Igboanusi, 1983) or isozyme patterns (Dansi et. al.,
2000) have been used to characterize yam germplasm.
Yam genotypes classified in the same cultivar group based on morphology were often
genetically different, emphasizing the need for molecular fingerprinting in yam
germplasm characterization (Mignouna et. al., 1998). On the other hand, DNA
markers, do not have such limitations. They can be used to detect variation and have
proven to be effective tools for distinguishing between closely related genotypes. The
general objective of this study therefore was to use molecular techniques (SSRs) to
determine the true “pona”. The specific objective of the study was to investigate
genetic diversity and relationships among 72 supposed “Pona” yam accessions using
SSR markers.
7
Corresponding author: Email: Otoo_emmanuel@yahoo.com
45
DNA Extraction
Total genomic DNA was extracted from young freshly harvested leaves of 72 yam
accessions (Table 1) from the experimental fields of Crops Research Institute,
Fumesua, Ghana and 4 IITA check materials using Qiagen DNeasy Plant Mini Prep
DNA extraction Protocol (Qiagen, 2006). DNA quantity and quality was determined
using a spectrophotometer (Beckman Coulter DU530) and taking the absorbance
reading at 260 nm and 280 nm (A260 and A280 respectively) levels. Each DNA sample
was diluted ten times (2 µl DNA+ 18 µl Nuclease-free water).
The milli-Q water was used as a reference sample to set the spectrophotometer at 260
nm wavelength (blanking). A 10 µl volume of the diluted DNA sample was loaded to
the cuvette of the spectrophotometer for estimation of the concentration. The quality
of DNA was assessed using the absorbance ratio at 260 and 280 wavelengths
(A260/A280). A DNeasy purified DNA has an A260/A280 ratio of 1.7-1.9. The DNA
concentration of the samples was determined using the double-stranded DNA
standard of 1 A260 = 50 µg/µl of DNA. The working concentration of 2.5µg/µl DNA
was prepared based on the estimated concentration obtained from the
spectrophotometer reading. The working sample concentration was calculated based
on the formula
V1=C2V2/C1
where C1= initial concentration of the sample, C2= required concentration of the
sample, V2 = required volume of the sample, and V1 = volume of the initial
concentration needed to be diluted to the required volume. For samples with very
weak concentration which required V1 of greater or equal to 100 µl, no further dilution
was done. For samples requiring V1 of <100 µl, the volume was taken and topped up
to a final volume of 100µl.
Molecular Markers and Polymerase Chain Reactions
Amplifications were carried out in an automated thermal cycler (Peltier Thermal
Cycler 200). The PCR conditions described by Kawchuk et al., (1996) were used
with some modifications (Mignouna et. al., 2003). Twenty-one (21) SSR primer pairs
were used for this study (Table 2). Amplification reactions were carried out in 20 µl
reaction volumes each containing 5µl of master mix and 1-2 ng of DNA, lx buffer
(ammonium sulphate), deoxynucleoside triphosphates (dNTP), 1.7 mM MgC12, 0.4
mM each of forward and reverse SSR primer, and two units of Taq DNA polymerase
(Promega) (Table 3.).
Reactions were conducted in a Thermal Cycler of Promega programmed for the
following procedures- initial denaturing at 94 °C for 4 min for one cycle, followed by
35 cycles of 94 °C for 30 sec, 53.1 °C for 1 min (annealing temperature depending on
marker) and 72 °C for 1 min. After the 35 cycles, that is the primer extension stage,
the samples were held at 72 °C for 7 min followed by 60 oC for 30 min and then
46
stored at 4 °C. Polymerase chain reaction (PCR) optimization was performed for all
markers and best performing conditions were identified. The optimization PCR
reactions were carried out in 5 µl.
Table 1. List of accessions used for in the study
Serial
Serial no
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
Accession
134P
MP1
142P
142L
125L
163
153
143P
107D
114P
150L
104L
116P
P
107
149P
124P
115M
114P*
107L
164P
128P
113P
145P
156P
108P
160L
133
129P
159L
KP
113L
147P
127P
120P*
150P
166P
111P
no.
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
Accession
139L
125L1
101L
134L
120P
140L
144L
151P
147L
102L
117L
146L
119P
109L
161P
MP
141
158L
115L
165
148L
132
110L
112L
122P
139P
103P
148P
CP
149L
154P
128L
130L
115P
TDr 1902
TDr 1910
TDr 2689
TDr 1929
47
NB: Accessions with serial numbers 73-76 are checks from IITA.
DNA Fragment Analysis
Capillary electrophoresis was performed using a semi-automated system of ABI 3100
Genetic Analyzer in a 36 cm capillary array using POP 4 (Performance Optimized
Polymer)
matrix to separate amplified PCR products. Four negative controls (W1-W4) and four
already genotyped yam genotypes were deliberately added to the 72 accessions to test
the extent to which the GeneMapperTM procedures could classify the accessions
.
Table 2: Set of Yam Microsatellite markers (SSR) used in fingerprinting
SNo
Marker name
1
YM-13
2
YM-26
3
Dpr3D06
4
Da1F08
5
YM-15
6
Dab2E09
7
Da1D08
8
Da1A01
9
Dpr3F04
10
Dab2D06
11
Dab2C05
12
Da1C12
13
Dpr3F10
14
Dpr3B12
15
Dpr3F12
16
Dab2D08
17
YM-5
18
YM-28
19
YM-1
20
YM-19
21
Dab2E07
Primer sequence (5'-3')a
TTCCCTAATTGTTCCTCTTGTTG (F)
GTCCTCGTTTTCCCTCTGTGT (R )
AATTCGTGACATCGGTTTCTCC (F)
ACTCCCTGCCCACTCTGCT (R )
ATAGGAAGGCAATCAGG (F)
ACCCATCGTCTTACCC (R )
AATGCTTCGTAATCCAAC (F)
CTATAAGGAATTGGTGCC (R)
TACGGCCTCACTCCAAACACTA (F)
AAAATGGCCACGTCTAATCCTA (R )
AACATATAAAGAGAGATCA (F)
ATAACCCTTAACTCCA (R )
GATGCTATGAACACAACTAA (F)
TTTGACAGTGAGAATGGA (R )
TATAATCGGCCAGAGG (F)
TGTTGGAAGCATAGAGAA (R)
AGACTCTTGCTCATGT (F)
GCCTTGTTACTTTATTC (R)
TGTAAGATGCCCACATT (F)
TCTCAGGCTTCAGGG (R)
CCCATGCTTGTAGTTGT (F)
TGCTCACCTCTTTACTTG (R)
GCCTTTGTGCGTATCT (F)
AATCGGCTACACTCATCT (R)
TCAAAGGAATGTTGGG (F)
ACGCACATAGGGATTG (R)
CATCAATCTTTCTCTGCTT (F)
CCATCACACAATCCATC (R)
TCCCCATAGAAACAAAGT (F)
TCAAGCAAGAGAAGGTG (R )
ACAAGAGAACCGACATAGT (F)
GATTTGCTTTGAGTCCTT (R)
AATGAAGAAACGGGTGAGGAAGT (F)
CAGCCCAGTAGTTAGCCCATCT (R )
GGAGTGCGGGGAGAGGAG (F)
CGGCGTGAGCTATTGGTGTGT (R )
TTGTCAGCGAAATAAGCAGAGA (F)
CAACAGACGCAGCCCAACT (R )
CCACCCTCTACCTCAAGT (F)
GAGGCTTCTCCCACTAAGT (R )
TTGAACCTTGACTTTGGT (F)
GAGTTCCTGTCCTTGGT (R )
NB: Italicized primers were polymorphic and vice versa.
48
Dye*
PET
VIC
PET
VIC
PET
6-FAM
VIC
PET
VIC
PET
NED
VIC
NED
NED
6-FAM
6-FAM
VIC
6-FAM
NED
PET
a
F, forward primer; R, reverse primer.
49
Table 3. Optimized grid for yam PCR: Volume of reagents for a total volume of 20µl per reaction.
Serial
F
R
10X
BUFFER MgCl2 dNTP
Number Marker
o
10µM
10µM
WATER (NH )
25mM 2mM
TC
4
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
YM-13
YM26
Dpr3D06
Da1F08
YM-15
Dab2E09
Da1D08
Da1A01
Dpr3F04
Dab2D06
Dab2C05
Da1C12
Dpr3F10
Dpr3B12
Dpr3F12
Dab2D08
YM-5
YM-28
YM-1
YM-19
Dab2E07
47.4
55.3
42
47.4
53
42
47.6
47.1
41.9
48
49
50
45.9
47.4
47.7
47.4
56.5
60
54.3
53.1
48.8
12.7
12.7
12
12.7
12.1
12.7
12.7
12.7
11.6
12.1
12.7
12.7
12.7
9.5
12.7
12.7
12.7
9.5
12.1
12.1
9.5
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2
2.2
2.2
1.2
2.2
1.2
2.2
2.2
2.2
1.7
1.2
2.2
2.2
2.2
2.2
2.2
2.2
2.2
2.2
1.2
1.2
2.2
NB: Italicized primers were polymorphic.
50
1
1
2
1
1.5
1
1
1
1
1.5
1
1
1
2
1
1
1
2
1.5
1.5
2
0.5
0.5
0.75
0.5
0.5
0.5
0.5
0.5
0.75
0.5
0.5
0.5
0.5
1
0.5
0.5
0.5
1
0.5
0.5
1
0.5
0.5
0.75
0.5
0.5
0.5
0.5
0.5
0.75
0.5
0.5
0.5
0.5
1
0.5
0.5
0.5
1
0.5
0.5
1
TAQ
5µ/µ
0.1
0.1
0.3
0.1
0.2
0.1
0.1
0.1
0.2
0.2
0.1
0.1
0.1
0.3
0.1
0.1
0.1
0.3
0.2
0.2
0.3
DNA
2.5ng/µl
1
1
1
1
2
1
1
1
2
2
1
1
1
2
1
1
1
2
2
2
2
Size matching, binning, allele size calling and verification
Genotype plots were generated with the GeneMapperTM version 3.7 software (Applied
Biosystems Inc., Foster City, CA 94404, USA) for allele sizing as described by Hall
et. al., (1996). Size matching/calling was based on Local Southern Method (Southern,
1999) algorithm with reference to a defined standard range, GS75-500(-250) Liz base
pairs. To reduce bin sizes and increase interbin distances to enhance efficient
automated binning, Ghosh et. al., (1997) external adjustments was used to verify and
augment the internal GS75-500(-250) Liz size standards. For each marker, alleles for
the data set was sorted according to size and “tolerance level” of 0.4 base pairs
selected as the minimum allowable distance between adjacent bins in base pairs.
When the difference between two sequentially sized alleles is greater than the set
tolerance level a new bin is created. This procedure was conducted for each marker
until all alleles were binned with the smallest and largest sized alleles for any marker
representing the start of the first bin and the end of the last bin, respectively. After
grouping the alleles, the mean and ranges were calculated for all bins. The bin labels,
which represents the mean sizes rounded up to the nearest whole number was
assigned to each group. This data was then submitted manually to the
GeneMapperTM software to adjust the bins.
Data Analysis
The 13 SSR markers (Table 3) and 72 pona complex accessions plus 4 checks from
IITA yam collections were subjected to gene diversity and genetic differentiation
analysis with 4.0% missing data over all loci and accessions. Observed allelic data
were binned into discrete units and SSR fragment sizes were called using
GeneMapperTM v.3.7 software (Figure 1). For the following statistical analysis the
fragment sizes generated by GeneMapperTM software v.3.7 in base pairs were
converted to binary data using the software “ALS Binary” developed by ICRISAT.
The use of binary format was determined by polyploid nature of the crop and different
ploidy levels of studied accessions.
The presence (1) or absence (0) of individual allele was scored for each genotype
across all SSR markers used for the study. Missing data accounted for less than 5%
(i.e. marker × genotype) of the entire data set. Pairwise distance matrices were
computed using the Jaccard similarity coefficient. The resulting matrices were
subjected to unweighted Neighbour-Joining method (Saitou and Nei 1987) to generate
structure tree. The structure of the genetic diversity within population was further
analysed by factor analysis (PCA). Analysis was performed using DARwin 5.0.153
software (developed by CIRAD) and SAS v 9.1. Neighbour joining approach was
employed in classifying the accessions.
DNA Quantification and Quality Testing.
The DNA samples had A260/A280 ratio ranged of 1.02 -1.4 which was quite pure. An
A260/A280 ratio equal to or greater than 1.8 is generally considered to be pure. On the
other hand an A260/A280 value lesser than 1.8 indicates the presence of impurities. The
Qiagen DNEasy yields DNA of A260/A280 ratio of 1.7-1.9. It must however be noted
82
that the PCR of SSR is very robust and can even handle relatively impure DNA
(Scotti et. al., 2003). Hence the DNA samples were pure enough for the analysis.
Allele Frequency Analysis
An electrophenogram of some accessions studied is presented as
number of peaks corresponds to the number of alleles at each locus.
Figure 1 The
Fig. 1. Sample of SSR profiles obtained for three yam accessions with marker
Dab2E09 and analysed using genotyping GeneMapperTM v. 3.7
(Applied Biosystems, USA)
A total of 27 loci were detected from the 13 markers used in this study with an
average of 4.26 alleles per locus ranging from 2 to 14 alleles per locus for Da1C12
and Dpr3D06 respectively (Table 4). The mean allelic richness ranged from 2 alleles
per locus to 12 with a mean of 5.23 per locus, indicating there were many allelic
variants per locus.
The allele frequency analysis calculates two common measures of variation for each
locus, expected heterozygosity and polymorphic information content (PIC). Expected
heterozygosity is calculated using an unbiased formula from allele frequencies
assuming Hardy-Weinberg equilibrium (Nei 1987). This is a useful measure of
informativeness of a locus. Loci with expected heterozygosity of 0.5 or less are in
general not very useful for large-scale parentage analysis. Genetic diversity indicated
by expected heterozygosity (HE) ranged from 0.514 for Dab2E09 to 1.00 for
Dpr3D06, Da1C12, YM15 and YM26 with a mean of 0.6279. Generally the expected
heterozygosity of the loci was greater than 0.5 except in DA1A01 indicating that the
83
good parental analysis can be obtained from the molecular analysis. This is the
probability that, at a single locus, any two alleles, chosen at random from the
population are different to each other.
The mean HE value of 0.6279 means that there was some degree of genetic variation
among the population. Mean proportion of individuals typed was 0.2047; mean
expected heterozygosity was 0.6279 and mean polymorphic information content (PIC)
was 0.4555 (Table 5). The mean polymorphic information content (PIC) values for all
markers used was 0.5339 and ranged from 0.00 to 0.888. Polymorphic information
content (PIC) is a measure of informativeness related to expected heterozygosity and
likewise is calculated from allele frequencies (Botstein et al. 1980; Hearne et al.
1992). It is commonly used in linkage mapping.
Table 4. Range of sizes and allele numbers detected for the 13 SSRs which amplified
the microsatellites used in screening Pona Complex accessions.
Da1F08
Dab2C05
Dab2D06
Dab2E09
Dpr3D06
Min
size
detected
(bp)
166
178
165
117
125
Max
size
detected
(bp)
179
193
186
197
170
Number
of
alleles
detected
5
3
4
3
15
Dpr3F04
81
131
13
Da1A01
YM13
YM15
212
175
170
225
250
293
3
5
10
YM26
Da1D08
Da1C12
Dpr3F10
102
223
140
102
174
337
160
173
8
7
3
12
SSR
Marker
Name
Allele sizes identified
166, 170, 172, 175, 179
178, 192, 200
165, 171, 176, 186
117, 120
125, 127, 131, 133, 137, 143, 145, 148, 150,
160, 166, 170, 175, 179, 197
81, 86, 88, 95, 97, 99, 103, 118, 121, 124, 127,
129, 131
212, 214, 225
175, 212, 220, 227, 250
117, 179, 186,197, 211, 223, 228, 230, 240,
293
102, 107, 127, 133, 135, 141, 162, 174
223, 229, 300, 304, 308, 321, 337
140, 158, 160
102, 107, 111, 127, 129, 133, 136, 142, 149,
155, 168, 173
From this study, deviation from Hardy-Weinberg equilibrium was highly significant
(p<0.0000001) for primers YM13, YM26, Dpr3D06, YM15, Dab2E09, Da1D08,
Dab2D06 and Da1F08. The relatively high number of loci that significantly deviated
from the Hardy-Weinberg equilibrium confirms that the pona complex population had
substructures (Cervus, 2007) and that the population is made up of closely related
varieties such as pona, larbako, kulunku and muchumudu.
From our study null alleles had no effect on the analysis since all the estimates were
negative except for some few which had low population numbers and as such could
not be determined.
Results obtained from allelic frequency analysis showed that all the 13 primers were
polymorphic (Table 5). No rare allele (alleles with allelic frequencies of less than
83
0.005) was obtained; this can be attributed to the closeness of the accessions being
study to each other. The proportion of polymorphic loci (the number of polymorphic
loci divided by the number of loci) was 0.71. All the loci except YM13_212,
Dpr3D06_127, Da1D08_337 and Dpr3F10_107 were heterozygotes.
83
Table 5: Summary statistics of allele frequency analysis of SSRs of Pona Complex in Ghana.
Marker
YM13
YM26
Dpr3D06
YM15
Dab2E09
Da1A01
Da1D08
Dpr3F04
Dab2D06
Da1C12
Dpr3F10
Dab2C05
Da1F08
Count
68
124
148
56
76
76
48
48
116
120
157
36
74
Heterozygotes
66
124
145
56
76
76
48
48
104
120
155
30
74
Homozygotes
1
0
0
0
0
0
1
0
6
0
1
3
0
HObs
0.971
1.0000
1.0000
1.0000
1.0000
0
1.0000
1.0000
1
1
1
0.8333
1.0000
HExp
0.628
0.5693
0.8560
0.8859
0.5953
0
0.7167
1.0000
0.5354
1
0.8174
0.5619
0.5709
PIC
0.545
0.469
0.8309
0.8454
0.5018
0
0.6116
0.375
0.4088
0.375
0.7804
0.4482
0.4670
H-Wa
***
***
***
***
***
ND
**
ND
***
ND
ND
ND
***
ChiSquareb
18.1147
46.8500
18.1112
20.221
29.1068
10.5612
17.1685
26.3008
Dfc
1
1
1
1
1
1
1
1
P-value
<0.0000001
2E-07
<0.0000001
<0.0000001
<0.0000001
3E-05
3E-07
NFd
-0.2494
-0.2944
-0.881
-0.0799
-0.2873
ND
-0.122
ND
-0.3201
ND
ND
-0.2127
-0.2938
Count : Number of occurrences of the allele in the genotype file; HO: Observed heterozygosity; HE: Expected heterozygosity; PIC:
Polymorphic information content. HWa: Significance of deviation from Hardy-Weinberg equilibrium. Key: NS = not significant, * =
significant at the 5% level, ** = significant at the 1% level, *** = significant at the 0.1% level, ND = not done. These significance levels
include a Bonferroni correction.
Chi-Squareb the chi-square value and the number of degrees of freedom to calculate the significance of any deviation from HardyWeinberg equilibrium.
Dfc: The number of degrees of freedom is equal to ½ n(n - 1), where n is the number of allelic classes remaining after rare alleles have
been combined. Yates' correction for continuity (subtracting 0.5 from the absolute value of the difference between observed and expected
frequencies) is applied when there is only one degree of freedom.
NFd: Null allele frequency- Estimates the null allele frequency; the frequency of the allele taking account of any null allele present. They
are meaningless if the if the estimated null allele frequency is negative.
84
Ordination Analysis
Principal Coordinates analysis of the molecular data showed that the first three
coordinates were important (Table 6). PCoA axes 1, 2 and 3 accounted for 40.51% of
observed variation. The genetic distances generated using PCO software was used in
generating the PCoA plots.
Table 6. Principal Coordinates Analysis of Molecular data.
Principal
Coordinates
Axis 1
Axis 2
Axis 3
Percentage of variation explained
individual
Cumulative
18.05%
18.05%
11.80%
29.85%
10.66%
40.51%
The PCoA plots of PCoA1 versus PCoA2 using PCO software showed wide
dispersion of accessions along the four quadrants (Fig. 2). Pona and Laribako
accessions could be found in all four quadrants suggesting that some of pona
accessions clustered with Laribako accessions and vice versa. Quadrants I had 19
accessions of mostly Laribako with 161P as the most distinct member of this group.
Quadrant II had a few (7) accessions with 2 IITA checks (TDr 1929 and TDr 2689)
grouped with 3 and 2 pona and Laribako accessions respectively. TDr 1929 was the
most distinct accession. Mankrong Pona, a hybrid from IITA released as a new
variety in Ghana (circled) was on the horizontal line separating Quadrants I and II.
Quandrant III had the most (26) accessions which was a mixture of pona, Laribako,
muchumudu (115M) among others. All the 15 accessions grouped in Quadrant IV
were pona.
0.5
I
0.4
KP
114P1
117L
160L
TDr1902
139L
0.3
IV
122P
MP1
134P
145P
143P
107D
150P
164P
165
124P
107
PCoA2
153
0.2
148L
0.1
147P 129P
128P
115P
141
TDr1910 132
158L
112L
P
MP
0 156P
163 108P 166P
154P 0.2 145P 0.3
-0.1 104L 0
0.1
110L
CP 139L
115L
-0.1
159L
128L
113P
140L
142P
101L 102L
TDr2689
139P 125L1
109L
-0.2149L
103P
125L
161P
-0.7
-0.6
-0.5
130L
-0.4
-0.3
-0.2
TDr1929
148P
II
111P
120P
127P
-0.3 115M
114P
III
-0.4
PCoA1
Fig. 2. Principal Coordinates Axis1 versus PCoA 2 of SSR allelic data for pona
complex in Ghana.
85
This trend was not different when PCoA 2 was plotted against PCoA3 (Fig. 3) except
that about 4 accessions now occupied the midpoint between Quadrants I and II. Again
TDr 1929 was the most distinct accession.
Further analysis of the molecular data with the Tree analysis concept using the
DARwin 5.0.153 software and tree construction procedure with the neighbour-joining
approach showed large number of intra-specific polymorphisms that enabled us to
reliably discriminate between the samples (Figure 4). Again, some of the Laribako
accessions clustered with Pona and vice versa.
0.6
TDr1929
I
0.5
0.4
I
PCoA3
0.3
125L1
-0.4
II
163
166P 0.2
154P
149P104L
154P
P
114P1
KP
153
124P
0.1
132
113P
116P
MP1
122P
113L
120P1
108P 158L
141
139P
115L
150L
115P
150P
127P
102L
147L
TDr1902
159L
CP 0
TDr1910
164P
103P-0.2
128L -0.1
146L
-0.3
0112L
0.1 128P
0.2
0.4
134P 0.3
101L 140L
110L
117L
115M 120P
107L
165
143P
-0.1
109
133
139L
107
149P
156P
142P TDr2689
130L 148L
129P
107D
148P
-0.2
147P
0.5
III
125L
-0.3
114P
111P
-0.4
PCoA2
Fig. . PCoA2 versus PCoA3 of SSR alleic data
Fig. 3. Plot of PCoA2 against PCoA3 of SSR allelic data for pona complex in Ghana.
.In the Molecular Analysis Fit criterion for tree of edge length sum: 2570.395; Mean
error: -1.2812; Mean absolute error: 7.7747; Maximum absolute error: 50.5987; Mean
square error: 107.3979 and Cophenetic r: 0.9377. A cophenetic value of 0.9 shows
that the phenogram truly represents the genetic structure of the population and no
errors was generated by our methodology.
In total four main groupings and two small ones were identified from the allelic data
from molecular analysis: authenthic pona, Laribako, muchumudu, and dente, and the
minor groups were Hybrid Pona and Hybrid Laribako (Fig. 5). All the IITA checks
clustered in the authenthic pona grouping. The muchumudu grouping had 5 laribako
accessions in addition to muchumudu in that group. The Laribako group had some
pona accessions in it and vice versa.
The dente grouping similarly had some pona and Laribako accessions in it. Hybrid
pona and hybrid Laribako had 8 and 7 accessions respectively. The generally low
polymorphism revealed by each of the primers taken separately is not surprising since
the cultivars analysed were closely related.
86
Fig. 4. Genetic diversity tree of 72 accessions plus 4 IITA checks based on SSR data
using unweighted neighbour-joining analysis
Laribako
104L
134L
LHybrid
102L130L 159L
125L
128L
148L
129P
CP
166P
125L 1
114P1
MP1
151P
108P
Dente
164P
163
115M
110L
145P
153
112L
Muchum
udu
146L
120P1
116P
101L
107
140L
124P
115L
139P
142P
149P
113L
107L
115P
107D
T Dr1902
147L
113P
128P
132
165
149L
109L
MP
142L
147P
133
150L
T Dr2689
143P
160L
117L
127P
120P
156P
103P
T Dr1929
119P 161P
144L
148P
111P
114P
PHybrid
0
50.
87
KP
122P
154P
P
158L
150P
139L
T Dr1910
141
134P
Pona
References
Becker, J. Vos, P. Kuiper, M. Salamini, F. Heun, M. 1995. Combined mapping of
AFLP and RFLP markers in barley. Mol. Gen. Gent. 249: 65-73.
Botstein, D, White, RL, Skolnick, M & Davis, RW (1980) Construction of a genetic
linkage map in man using restriction fragment length polymorphisms.
American Journal of Human Genetics 32, 314-331
Dansi A. H.D. Mignouna, J. Zoundjihekpon, A. Sangare, Asiedu R and Quinn F.M.
1998. Varietal identification key of the cultivated yams (Dioscorea cayenensis/
Dioscorea rotundata complex) of Benin Republic. Plant Genetic Resources
Newsletter. No. 116: 18-25.
Dansi A., Mignouna H.D., Zoundjihekpon J., Sangare A., Asiedu R., Ahoussou N.
2000. Using isozyme polymorphism to assess genetic variation within cultivated
yams (Dioscorea cayenensis / Dioscorea rotundata complex) of the Republic of
Benin. Genetic Resources and Crop Evolution 47: 371-383.
Hearne, CM, Ghosh, S & Todd, J. A 1992. Microsatellites for linkage analysis of
genetic traits. Trends in Ecology and Evolution 8: 288-94.
Kawchuk L M, Lynch D R, Thomas J, Penner B, Sillito D,Kulcsar F. 1996.
Characterization of Solanum tuberosum simple sequence repeats and
application to potato cultivar identification. American Potato Journal 73:325335.
Mignouna H.D, N. T.H Ellis, M. R. Knox, Asiedu R and Quat N.N. 1998. Analysis of
genetic diversity in Guinea yams (Dioscorea spp) Using AFLP Fingerprinting.
Trop. Agric. (Trinidad) Vol. 75. No.2.
Mignouna H.D., Abang M.M., Fagbemi S.A. 2003. A comparative assessment of
molecular marker assays (AFLP, RAPD and SSR) for white yam (Dioscorea
rotundata) germplasm characterization. Ann. Appl. Biol. 142: 269-276
Mignouna H.D., Abang M.M., Wanyera N.W., Chikaleke V.A., Asiedu R.,
Thottapilly G. 2005. PCR-marker based analysis of wild and cultivated yams
(Dioscorea spp.) in Nigeria: genetic relationships and implications for ex situ
conservation. Genetic Resorcs and Crop Evolution 52: 755-763
Mignouna, H.D, Abang, M.M and Fagbemi, S.A. 2003. A comparative assessment of
molecular marker assays (AFLP, RAPD and SSR) for white yam (Dioscorea
rotundata) germp1asm characterization. Ann. Appl. BioI. 142: 269-276.
Nei M and Li W.H. 1979. Mathematical model for studying genetic variation in terms
of restriction endonucleases. Proc. Natl. Acad. Sci. USA 76: 5269-5273.
Nei, M (1987) Molecular Evolutionary Genetics. Columbia University Press:
89
Perrier, X., Flori, A, Bonnot, F. (2003). Data analysis methods. In: Hamon, P.,
Seguin, M., Perrier, X. ,Glaszmann, J. C. Ed., Genetic diversity of cultivated
tropical plants. Enfield, Science Publishers. Montpellier.pp 43 - 76.).
Perrier,
X.,
Jacquemoud-Collet,
http://darwin.cirad.fr/darwin
J.P.
(2006).
DARwin
software.
Qiagen. 2006. DNeasy Plant Handbook. 07/2006. www.qiagen.com.
Saitou N, Nei. M (1987). The Neighbour-Joining method: a new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution. 4
(4):406-425
SAS (1989) SAS/SAT User Guide version 6. 4th edn. SAS Institute Inc., Cary, North
Carolina
Vos P, Hogers R, Bleeker M, Reijans M, VanDe Lee T, Hornes M, Frijters A, Pot J,
Poleman I, Kuiper M, Zabeau M. 1995. AFLP: a new technique for DNA
fingerprinting. Nucleic Acids Res. 23: 4407- 4414.
90
Effect of Bt-transgenic maize on ovipositional response in two
important African cereal stem borers, Chilo partellus Swinhoe
(Lepidoptera: Crambidae) and Sesamia calamistis Hampson
(Lepidoptera: Noctuidae)
Obonyo, D.N.1, 3§§, Lovei G.L.2, Songa, J.M.3, Oyieke, F.A.1, Nyamasyo,
G.H.N.1 and Mugo, S.4
1
School of Biological Sciences, University of Nairobi, P.O. Box 30197-00100,
Nairobi, Kenya.
2
Department of Integrated Pest Management, Faculty of Agricultural Sciences,
University of Aarhus, DK-4200 Slagelse, Denmark.
3
Biotechnology Centre, Kenya Agricultural Research Institute, P.O. Box
14733-00800, Nairobi, Kenya.
4
International Maize and Wheat Improvement Centre, P.O. Box 1041-00621,
Nairobi, Kenya.
Abstract
The introduction of Bt-maize in East Africa to control two lepidopteran pests, Chilo
partellus Swinhoe (Lepidoptera: Crambidae) and Sesamia calamistis Hampson
(Lepidoptera: Noctuidae), is being considered. To manage resistance development to
Bt maize, the use of untreated refuges has been proposed. This study compared C.
partellus and S. calamistis ovipositional responses on Bt (Event 216, containing the
Cry1Ab gene) and isogenic non-Bt (CML 216) maize plants under choice (stem borers
simultaneously exposed to Bt and non-Bt plants) and non-choice (stem borers
exposed to either only Bt or non-Bt plants) conditions. The average number of egg
batches per plant, number of eggs per batch, number of eggs laid per plant and egg
hatchability were not different between Bt and non-Bt plants in either the choice or
non-choice tests. Event 216 did not deter oviposition by these two stem borers, a
factor which has to be considered in designing suitable refuge arrangements.
Key words: Bacillus thuringiensis, environmental biosafety, biological control,
natural enemies, GM maize
Introduction
Stem borers are a major limiting factor to the production of maize, Zea mays L.
(Poaceae), in tropical Africa (Kfir et al., 2002). The spotted stem borer, Chilo
partellus Swinhoe (Lepidoptera: Crambidae) and the pink stem borer Sesamia
calamistis Hampson (Lepidoptera: Noctuidae) are amongst the most important maize
pests (Overholt et al., 1994), and in combination with other stem borer species, can
cause yield losses ranging from 10% to total crop loss (Kfir et al., 2002). Chilo
partellus is the most dominant and important species in the lowlands and midaltitudes in East Africa (Setamou et al., 2005). Chilo partellus is an Asian stem borer
species (Zhou et al., 2001) that was first reported in Africa from Malawi in the early
1930ies (Tams, 1932). Since then, it has spread to nearly all countries in Eastern and
Southern Africa, with the first reports in Kenya in the early 1950ies (Nye, 1960).
§§
Corresponding author. E-mail address: ndolodennis@yahoo.com
91
Chilo partellus has now spread throughout the maize growing areas of Kenya at
elevations below 1500m and sometimes higher (Overholt et al., 1994; Zhou et al.,
2001; Songa et al., 2002).
Chemical insecticides have been widely used for stem borer control (Muhammad and
Underwood, 2004). These synthetic pesticides are too expensive for many farmers
(Bonhof et al., 2001). Besides, widespread use of pesticides causes environmental
pollution. Transgenic crops have the potential to be a viable alternative to chemical
insecticides. The Insect Resistant Maize for Africa (IRMA) project has been
considering the introduction of the transgenic maize, Event 216, which expresses the
gene Cry1Ab, for use against maize stem borers in Kenya. The main objective of this
study was to compare C. partellus and S. calamistis ovipositional responses on Bt
(Event 216, containing the Cry1Ab gene) and isogenic non-Bt (CML 216) maize
plants under non-choice and choice conditions. Chilo partellus and S. calamistis were
chosen for this study because Cry1Ab has only shown sufficient efficacy against these
two stem borer species (Andow et al., 2004).
The Bt maize line Event 216 used for this study expresses the Cry1Ab gene (Andow
et al., 2004) and was produced by co-transformation of a ubi:Cry1Ab construct and a
separate bar selectable marker construct. The marker was eliminated by selection on
the progeny for independent assortment of Cry1Ab and bar. The selectable marker
genes and the Cry1Ab gene were under the control of the 35S cauliflower mosaic
virus (CaMV) promoter. Plants with the CaMV promoter express endotoxins
throughout the entire plant (Koziel et al., 1993). Untransformed plants of the parent
cultivar CML 216 were used as control. Plants were grown in 15 cm diameter pots in
the greenhouse at the Kenya Agricultural Research Institute (KARI) at temperatures
of approximately 250 C and natural light conditions of 12L: 12D photoperiod.
Insects
This study used C. partellus and S. calamistis originating from colonies maintained on
artificial diet according to the procedure of Ochieng et al. (1985). The insects were
obtained from the insectary at the KARI, Katumani, and the Animal Rearing and
Quarantine Unit (ARQU) at the International Centre for Insect Physiology and
Ecology (ICIPE).
Ovipositional responses under non-choice conditions
Experiments with pupae
Ten male and ten blackened female pupae per cage were placed in open Petri dishes
(9cm diameter), in the centre of separate cages. Each cage contained either 8 potted or
8 potted non-Bt maize plants (1 plant/pot). The plants were three weeks old, the age at
which maize is most susceptible to stem borer (Kumar and Asino, 1993). Pupae rather
than adults were used to allow adults to emerge and disperse as they eclosed over a
few days. A 9 cm diameter wad of cotton wool was placed in a Petri dish, moistened
with water to give the best oviposition results (Taneja and Nwanze, 1990). The cages
were 40 cm long; 40 cm wide and 60 cm high with a wire mesh wall over three sides
and galvanized iron on the top, bottom and a top-down sliding door on the front. After
8 days, the plants were removed and the number of egg batches per plant counted.
Subsequently, the sections on which the moths had oviposited for each plant line were
92
cut off and the eggs counted under a microscope (64x magnification). The eggs were
incubated in the laboratory at a temperature of 25±10 C in Petri dishes lined with
moist filter paper for 8 days (by which time it was assumed all fertile eggs had
hatched). Upon hatching, the neonates were counted and expressed as percentage
emergence.
Experiments with moths
Male and female moths that emerged on the same morning were introduced into cages
within the biosafety greenhouse at 250 C±10 C and 12L (light): 12D (dark)
photoperiod. Following a procedure by Khan et al. (2006), 15 male and 12 female
moths per cage were placed in Petri dishes (9 cm diameter), which were then placed at
the centre of separate cages. The rest of the experimental setup was the same as in the
experiment with pupae. Ovipositional responses under choice conditions were set up
as above except that the cages had 4 Bt and 4 non-Bt plants each. In these cages the
plants were arranged such that Bt plants alternated with non-Bt plants, with the leaves
intermingled, to allow, the moths to choose any leaf from any plant for oviposition.
The experiments were replicated four times. Data were subjected to analysis using the
Student’s t-test. Count data were square root transformed while percentage data were
arc sine transformed to correct for heterogeneity of variances prior to analysis.
Results
Ovipositional responses under non-choice conditions
There were no significant differences between Bt and non-Bt maize plants in
the mean number of egg batches per plant (C. partellus; t=0.87, df=6, P=0.417 for
pupae and t=0.23, df=6, P=0.827 for moths: S. calamistis; t=2.05, df=6, P=0.086 for
pupae and t=0.36,df=6,P=0.731 for moths), mean number of eggs per batch (C.
partellus; t=0.09, df=6, P=0.933 for pupae and t=0.21, df=6, P=0.844 for moths: S.
calamistis; t=2.95, df=6, P=0.052 for pupae and t=0.56,df=6,P=0.731 for moths),
mean number of eggs laid per plant per plant (C. partellus; t=0.69, df=6, P=0.513 for
pupae and t=0.70, df=6, P=0.510 for moths: S. calamistis; t=0.33, df=6, P=0.331 for
pupae and t=0.82,df=6,P=0.451 for moths),and percentage of eggs hatched (C.
partellus; t=0.48, df=6, P=0.648 for pupae and t=0.67, df=6, P=0.530 for moths: S.
calamistis; t=1.85, df=6 and P=0.161 for pupae and t=0.46,df=6,P=0.631 for moths)
(Table1).
Table 1: Number of C. partellus and S. calamistis egg batches per plant (Mean ±1
SD), number of eggs per batch (Mean ±1 SD), mean number of eggs laid per plant
(Mean ±1 SD) and mean percentage of eggs hatched (Mean ±1 SD), on Bt (Event
216) and non-Bt (CML 216) maize following introduction of pupae or moths into
oviposition cages under non-choice conditions (number of observations, n in
brackets).
90
Mean
number of egg number of eggs number of eggs
batches per plant
per batch
laid per plant
C. partellus introduced as pupae
Non-Bt maize
3.6±1.3(8)
38.0±12.5(114)
98.3 ±39.1(8)
Bt maize
2.2±1.2(8)
39.9±13.6(70)
77.7 ±28.4(8)
C. partellus introduced as moths
Non-Bt maize
3.4±2.5 (8)
43.0±20.2(109)
115.6±78.8 (8)
Bt maize
3.8±2.8 (8)
46.7±17.8(122)
122.8±83.3 (8)
S. calamistis introduced as pupae
Non-Bt maize
2.7±0.4(8)
54.5±3.9(86)
143.1±27.7(8)
Bt maize
3.3±0.5(8)
49.1±9.3(107)
128.9±14.1(8)
S. calamistis introduced as moths
Non-Bt maize
4.9±1.1(8)
50.2±7.5(157)
231.4±85.3(8)
Bt maize
5.4±0.4(8)
56.6±6.9(169)
293.6±27.6(8)
percentage
of
eggs hatched
82.8±15.0(114)
85.4±9.3(70)
84.4±10.1(109)
89.0±2.5 (122)
97.7±1.0(86)
98.1±1.3(107)
92.8±3.5 (157)
90.8±2.9 (169)
Ovipositional response under choice conditions
There were no significant differences between Bt and non-Bt maize plants in the
mean number of egg batches per plant (C. partellus; t=0.34, df=3,P=0.756 for pupae
and t=1.11, df=3, P=0.349 for moths: S. calamistis; t=0.19, df=3, P=0.192 for pupae
and t=0.33, df=6, P=0.333 for moths), mean number of eggs per batch (C. partellus;
t=0.87, df=3, P=0.451 for pupae and t=0.23, df=3, P=0.832 for moths: S. calamistis;
t=1.14, df=3, P=0.336 for pupae and t=0.20, df=3,P=0.852 for moths) mean number
of eggs laid per plant (C. partellus; t=0.21, df=3, P=0.846 for pupae and t=0.58
df=3,P=0.588 for moths: S. calamistis; t=1.67, df=3, P=0.192 for pupae and t=0.18,
df=6, P=0.863 for moths) and percentage of eggs hatched (C. partellus; t=0.17, df=3,
P=0.877 for pupae and t=0.80, df=3, P=0.796 for moths: S. calamistis; t=0.79, df=3
and
P=0.487
for
pupae
and
t=2.81,df=3,P=0.067
for
moths)
(Table 2).
Table 2: Number of C. partellus and S. calamistis egg batches per plant (Mean ±1
SD), number of eggs per batch (Mean ±1 SD), mean number of eggs laid per plant
(Mean ±1 SD) and mean percentage of eggs hatched (Mean ±1 SD), on Bt (Event
216) and non-Bt (CML 216) maize following introduction of pupae or moths into
oviposition cages under choice conditions (number of observations, n in brackets).
91
number
of
egg
batches per plant
C. partellus introduced as pupae
Non-Bt maize
3.6±2.3(4)
Bt maize
2.2±1.2(4)
C. partellus introduced as moths
Non-Bt maize
4.3±2.9(4)
Bt maize
5.4±3.7(4)
S. calamistis introduced as pupae
Non-Bt maize
3.0±1.0(4)
Bt maize
4.2±0.5(4)
S. calamistis introduced as moths
Non-Bt maize
5.3±1.6(4)
Bt maize
5.6±1.9(4)
Mean
number of eggs
per batch
number of eggs
laid per plant
percentage of eggs
hatched
35.2±15.4(76)
37.4±15.1(60)
98.3±49.1(4)
77.9±38.6(4)
73.0±28.7(76)
73.6±28.3(60)
44.2±3.0(68)
45.1±6.0(86)
201.5±112.7(4)
246.9±162.0(4)
81.7±14.0(68)
78.3±19.4(86)
44.0±13.6(48)
37.1±5.8(67)
125.9±59.5(4)
152.1±21.6(4)
98.4±0.3(48)
98.6±0.7(67)
61.4±10.8(84)
59.4±16.1(90)
298.3±48.8(4)
320.9±44.2(4)
74.5±23.4(84)
83.4±20.0(90)
Discussion
Sesamia calamistis and C. partellus moths did not seem to discriminate between Bt
and non-Bt maize for egg laying under either non-choice or choice conditions
implying that the presence of Bt toxin was either not perceived by the moths or it did
not deter oviposition. The results of this study are consistent with those of other
lepidopteran pests. In field tests, the number of eggs laid by susceptible European
corn borer females did not differ between Bt corn with Cry1Ab, and non-Bt corn (Orr
and Landis, 1997). Pilcher and Rice (2001) observed that O. nubilalis females did not
show any oviposition preference towards non-Bt or Bt maize (using Event 176 and
Bt11). In the laboratory, the number of eggs laid by diamond back moth, Plutella
xylostella L. (Lepidoptera: Plutellidae) females did not differ between Bt and non-Bt
canola (Ramachandran et al., 1998), broccoli (Tang et al., 1999) and cabbage (Kumar,
2004). Kumar (2004) further observed that the transgenic plants had no adverse
effects on the hatchability of P. xylostella eggs.
In four out of five cage experiments and in two field experiments Hellmich et al.
(1999) found that various Bt events did not influence oviposition. In cage experiments
in the greenhouse, Liu et al. (2002) found that the pink bollworm, Pectinophora
gossypiella Saunders (Lepidoptera: Gelechiidae) did not discriminate between Bt and
non-Bt cotton containing Cry1Ac for oviposition. Van den Berg and Van Wyk (2007)
reported that S. calamistis adults did not differentiate between Bt and non-Bt maize
plants in oviposition choice experiments. Dean and De Moraes (2006) observed that
genetic modification did not alter the volatile profile of undamaged maize plants
while Turlings et al. (2005) observed that the ratios of caterpillar-induced odour
emissions of Bt maize plants were identical to that of non-Bt plants. An important
limitation in this study is that the numbers of eggs laid were determined at the end of
the egg-laying period of the moths and hence it was not possible to evaluate the dayto-day dynamics of egg laying.
90
This is because at times the eggs were concealed (especially those of S. calamistis)
and could only be accessed by destroying the plants. It was therefore not possible to
determine if the presence of previously laid eggs had any effect on subsequent
oviposition behaviour. However, in previous studies moth oviposition was not
affected by the presence of previously laid eggs (Chadha and Roome, 1980; Pats and
Ekboom, 1993; Liu et al., 2002). Moreover, the scenario presented in this experiment
is a more holistic situation and closer to what would happen in nature whereby moths
could encounter previously laid eggs. The results of this study may have implications
for resistance management and monitoring. For example, if oviposition is not affected
by Bt toxin and females are exposed equally to Bt maize and refuges it can be
assumed that eggs will be distributed equally between Bt and non-Bt maize hence
there will always be a pool of insects on susceptible crops, which is necessary for
resistance management.
Furthermore, the development of resistance against Bt toxins requires the survival of
at least two exposed larvae to develop into a male and a female (Kumar, 2004). Even
though Bt maize did not affect the hatchability of stem borer eggs, a separate study
showed 100% mortality of neonates on the Bt maize plants (Obonyo et al.,
unpublished). Feeding initiation by neonates is not deterred by Bt toxins in transgenic
crops (Ramachandran et al., 1998; Liu et al., 2002). Kumar (2004) observed that Bt
cabbage did not emit any inhibitory signals to divert diamondback moth larvae from
them. It seems therefore that most of the Bt exposed larvae would initiate feeding on
the Bt plants and be killed hence further restricting the possibility of resistance
development to Bt maize.
The mortality of Bt exposed stem borer larvae, alongside the limited chances of
resistance development, could minimize the likelihood of stem borer natural enemies
getting host-mediated exposure to the Bt toxin. However, the Bt maize could affect
natural enemies indirectly as a result of host depletion due to death (Groot and Dicke,
2002). However, the impact of localized host depletion of maize stem borers on
parasitoid numbers would most likely not be great since several other stem borer
species that also occur in wild host plants also host the same parasitoid species (Van
den Berg and Van Wyk, 2007). Furthermore stem borers surviving on the non-Bt
refuge maize plants could be invaluable in sustaining natural enemy populations.
References
Binning, R.R. and Rice, M. E. (2002) Effects of transgenic Bt corn on growth and
development of the Stalk Borer Papaipema nebris (Lepidoptera:
Noctuidae.).Journal of Economic Entomology 95, 622-627.
Bonhof, M.J., Van Huis, A., Kiros, F.G. and Dibogo, N. (2001) Farmers’ perceptions
of importance, control methods and natural enemies of maize stem borers at
the Kenyan coast. Insect Science and its Application 21, 33-42.
Chadha, G.K. and Roome, R.E. (1980) Oviposition behaviour and the sensilla of the
ovipositor of Chilo partellus (Swinhoe) (Lepidoptera: Pyralidae). Journal of
Zoology 192, 169-178.
90
Dean, J.M. and De Moraes, C.M. (2006) Effects of genetic modification on herbivoreinduced volatiles from maize. Journal of Chemical Ecology 32, 713-724.
Kfir, R., Overholt, W.A., Khan, Z.R. and Polaszek, A. (2002) Biology and
management of economically important lepidopteran cereal stemborers in
Africa. Annual Review of Entomology 47, 701-731.
Khan, Z.R., Midega, C.A.O., Hutter, N.J., Wilkins, R.M. and Wadhams, L.J. (2006)
Assessment of the potential of Napier grass (Pennisetum purpureum) varieties
as trap plants for management of Chilo partellus Entomologia Experimentalis
et Applicata 119, 15-22.
Koziel,M.G.,Beland.G.L.,Bowman,C.,Carozzi,N.B.,Crewshaw,R.,Crossland,L.,Daws
on,J.,Desai,N.,Hill,M.,Kadwell,S.,Launis,K.,Lewis,K.,Maddox,D.,McPherson,
K.,Meghji,M.R.,
Merlin,E., Rhodes,R., Warren,G.W., Wright,M. and Evola, S.V. (1993) Field
performance of elite transgenic maize plants expressing an insecticidal protein
derived from Bacillus thuringiensis. Biotechnology 11, 194-200.
Kumar, H. and Asino, G.O. (1993) Resistance of maize to Chilo partellus
(Lepidoptera: Pyralidae): effect on plant phenology. Journal of Economic
Entomology 86, 969-973.
Muhammad, L. and Underwood, E. (2004) The Maize Agricultural Context in Kenya.
In: Environmental Risk Assessment of Genetically Modified Organisms Vol
1.a Case Study of Bt maize in Kenya (eds, A. Hillbeck and D.A, Andow). pp.
21-56.CAB International, Wallingford, UK.
Nye, I.W.B. (1960) The insect pests of graminaceous crops in East Africa. Colonial
Research Study. Her Majesty’s Stationary Office. pp 48
Ochieng, R.S.S., Onyango, F.O. and Bungu, M.D.O. (1985) Improvement of
techniques of mass rearing of Chilo partellus (Swinhoe). Insect Science and its
Application 6, 425-428.
Orr, D.B. and Landis, D.L. (1997) Oviposition of European Corn Borer Lepidoptera:
Pyralidae) and impact of natural enemy populations in transgenic versus
isogenic corn. Journal of Economic Entomology 90, 905-909.
Pats, P. and Ekboom, B. (1994) Distribution of Chilo partellus egg batches on maize.
Journal of Insect behaviour 7, 29-41.
Pilcher, C.D. and Rice, M.E.(2001) Effect of planting date and Bacillus thuringiensis
corn on the population dynamics of European corn borer (Lepidoptera:
Crambidae). Journal of Economic Entomology 94, 730-742.
Ramachandran,S.,Buntin,G.D.,All,J.N.,Tabashnik,B.E.,Raymer,P.L.,Adang,M.J.,
Pulliam, D.A. and Stewart Jr. C.N.(1998). Survival, development, and
oviposition of resistant diamondback moth (Lepidoptera: Plutellidae) on
90
transgenic canola producing a Bacillus thuringiensis toxin. Journal of
Economic Entomology 91, 1239-1244.
Setamou, M., Jiang, N. and Schulthess, F. (2005) Effect of the host plant on the
survivorship of parasitized Chilo partellus Swinhoe (Lepidoptera: Crambidae)
larvae and performance of its larval parasitoid Cotesia flavipes Cameron
(Hymenoptera: Braconidae). Biological Control 32, 13-190.
Shelton, A.M., Tang, J.D., Roush, R.T., Metz, T.D and Earle, E.D. (2000) Field tests
on managing resistance to Bt-engineered plants. Nature Biotechnology 18,
339-342.
Songa, J.M., Overholt, W.A., Okello, R.O. and Mueke, J.M. (2002) Control of
lepidopteran stem borers in maize by indigenous parasitoids in semi-arid areas
of eastern Kenya. Biological Agriculture and Horticulture 20, 77-90.
Stodola,T.J.,Andow,D.A.,Hyden,A.R.,Hinton,J.L.,Roark,J.J.,Buschman,L.L., Porter,
P. and Cronholm, G.B.(2006) Frequency of resistance to Bacillus
thuringiensis toxin Cry1Ab in a Southern United States corn belt population of
European Corn Borer (Lepidoptera: Crambidae).Journal of Economic
Entomology 99,502-507.
Tams, W.H.T. (1932) New species of African Heterocera. Entomology 65, 12411249. Taneja, S.L. and Nwanze, K.F. (1990) Mass rearing of Chilo species on
artificial diets and its use in resistance testing. Insect Science and its
Application 11,605-616.
Tang, J.D., Collins, H.L., Roush, R.T Metz, T.D., Earle, E.D. and Shelton, A.M.
(1999) Survival, weight gain, and oviposition of resistant and susceptible Plutella
xylostella (Lepidoptera: Plutellidae) on broccoli expressing Cry1Ac toxin of
Bacillus thuringiensis. Journal of Economic Entomology 92, 47-55.
Tang, J.D., Collins, H.L., Metz, T.D., Earle, E.D., Zhao, J.Z., Roush, R.T and Shelton,
A.M. (2001) Greenhouse tests on resistance management of Bt transgenic
plants using refuge strategies Journal of Economic Entomology 94, 240-247.
Turlings, T.C.J, Leanbourquin, P.M, Held, M and Degen, T. (2005) Evaluating the
induced-odour emission of a Bt maize and its attractiveness to parasitic wasps.
Transgenic Research 14, 807-816.
Wolfenbarger, L.L. and Phifer, P.R (2000). The ecological risks and benefits of
genetically engineered plants. Science 29, 2088-2093.
Zhou, G., Overholt, W.A. and Mochiah, M.B. (2001) Changes in the distribution
of Lepidopteran maize stem borers in Kenya from the 1950’s to 1990’s.Insect
Science and its Application 21,395-402.
91
Enhanced Propagation of Kenyan Pineapple through in vitro axillary
bud Proliferation
Robert K Ng’enoh1 Peter K Njenga2, Jane W Kahia3
1. Institute of Biotechnology Research, Jomo Kenyatta University of
Agriculture and
Technology. P.O. Box, 62000, Nairobi. Email:
robangen@yahoo.com
2. Botany Department, Jomo Kenyatta University of Agriculture and
Technology. P.O. Box, 62000, Nairobi
3. Coffee Research Foundation, P. O. Box 12 Ruiru
Abstract
This study investigated the effect of different concentrations of the cytokinin; kinetin
on microshoot formation from axillary buds from the crown of mature pineapple
fruits. Five different concentrations of kinetin i.e. 5, 10, 20, 30, and 40 µM were
tested and the most effective kinetin concentration was 30µM. The stage of growth of
the explant had an influence on microshoot formation. Very young buds, first and
second topmost next to the terminal bud were scorched by the sterilant and died
before the second week. Mature buds (next to the base of the crown) showed an
outstanding differentiation into microshoots.
Key words:
Ananas comosus, Microshoots, In vitro propagation,
crown, explant, slips.
Introduction
The cultivated pineapple (Ananas comosus)is an herbaceous, perennial, self-sterile
monocotyledon, which at the mature stage, reaches 70-120 cm in height and is has a
spinning top of 130-150 cm in diameter. Pineapple is propagated asexually from
various plant parts. The parts used are crown, Slips, hapas, and suckers, with crowns
and slips being most common in the cooler tropics and suckers being more common
in warmer tropics. Crowns are currently the preferred planting material in most
producing countries. A slip is a rudimentary fruit with an exaggerated crown. Slips
develop from buds in the axils of leaves borne on the pineapple (fruit stalk). Suckers
develop from axillary buds on the stem.
The vegetative methods of propagation are limited in that they are labor intensive,
very slow, and produce very few planting materials. An alternative to the vegetative
methods of pineapple propagation is the tissue culture technique. This is an in vitro
method of propagation. It involves the development of new plants in artificial medium
under aseptic conditions. This paper describes an effective protocol for the micro
propagation of pineapples. The specific objectives of the study were to determine the
optimal sterilization procedure, for pineapple explants and to determine the optimal
culturing conditions for regenerating pineapple micro-shoots using different
concentrations of kinetin.
92
Field grown materials were used, and the experiments were carried out at the coffee
research foundation laboratories. Plant growth substances were weighed and stocks
prepared using appropriate solvents.
Murashige and Skoog (1962) media was used to prepare stock solutions as
recommended by Gamborg and Shyluk (1981). The solutions were stirred until all the
chemicals got dissolved; and then top up to a precise volume of 1000 cm3. The PH of
the media was adjusted to 5.8 using either 1N NaoH or 1N HCl before adding agar
0.6%-1.0% which acts as a gelling agent. The media was then heated on a hot plate
with continuous stirring using magnetic fleas until all the agar got dissolved and
dispensed into the glassware before autoclaving at set temperatures of 121oC and a
pressure of 1.1 kg/cm2 for 20 minutes. After getting the explants from the field, they
were kept under running tap water for thirty minutes. The leaves were then removed
carefully one by one, following their phylotaxy, for the exposure of the axillary buds.
The buds were then excised with a segment of the substending stem tissue, forming
cubed shaped explants of approximately 5 mm3 then soaked for 30 minutes in water
with a few drops (2-3) of a wetter (teepol). The process of sterilization and the
subsequent stage of inoculating into the culture vessels were carried out under sterile
conditions in the lamina flow cabinet. All tools were autoclaved. During their use in
the cabinet, tools were sterilized in steribead sterilizer maintained at 250 oC, then
dipped in 70% ethanol. In the lamina flow cabinet, the buds were flushed using 70%
ethanol for about 30 seconds, then rinsed 3 times using sterilized distilled water.
Sterilization using commercial bleach (Jik) was done under different concentrations as
follow: 20 %( v/v) for 25 minutes, 25 %( v/v) for 20 minutes and 30 %( v/v) for 30
minutes.
After exposure to the sterilant, explants were then rinsed thoroughly in several
changes of sterile distilled water (4-6 times) to remove all traces of the sterilizing
agent. Finally individual explants were inoculated in to test tubes (7.5 cm x 2.5 cm)
containing 15 ml of MS medium (Murashige and Skoog, 1962). The regeneration of
microshoots was carried out in test tubes (7.5 cm x 2.5 cm). The test tubes were
covered with sterile polypropylene sheets using rubber bands to allow entry of light.
The cultures were incubated in growth rooms maintained at 250 C under 16hr
photoperiods for microshoot regeneration. Light conditions were provided by
fluorescent tubes providing a photon flux density of 40-50 µE m2 s1 at culture level.
This light produces a broad-spectrum light, especially in the red wavelengths that
promote shoot and leaf development. The experiments consisted of five treatments
and each treatment was replicated three times. The media consisted of full strength
MS (Murashige and Skoog, 1962) salts and vitamins supplemented with kinetin (5µm,
10µm, 20µm, 30µm, and 40µm) the medium also contained 30g/l sucrose, 100-mg/l
myoinositol and gelled with 3% phytagel agar. The data of microshoot length
differentiation were collected after two weeks, four weeks and six weeks.
Results
As the concentration of the sterilizing agent increases from 20% % to 30%, the
number of contaminated explants reduces with increase in the number of explants that
has been damaged by the sterilant. The percentage figures represent those explants
93
that progressed successfully with neither damage nor contamination. The formula
below can be used in calculating the number of explants that progressed successfully:
{Explants cultured}- {(explants cultured – clean explants) + (damaged explants)}
In conclusion, based on the above formula, the concentration that gave the highest
percentage was 25% for 20 minutes, and that probably became the most preferred
concentration to work with.
Table 2. Effects of different concentrations of sterilant (commercial bleach)
under different time of exposure.
Sterilant
Concentr
ation
(v/v)
Time
(Min)
Explants
Cultured
Clean
Explant
s
Commerc
ial
Bleach
(jik)
20%
20%
20%
25%
25%
25%
30%
30%
30%
25
30
35
20
25
30
20
25
30
64
64
64
64
64
64
64
64
64
5
13
33
58
60
62
62
64
64
Damag
ed
Explant
s
0
0
1
5
14
27
29
31
42
Explants
that
progresse
d
5
13
21
51
42
35
33
33
22
Percentage
(%)
8
20
34
80
66
55
52
52
34
The analysis of the effect of different kinetin concentrations for the induction of
adventitious shoots, (tables 3, 4 and 5) demonstrated that the use of kinetin 30 µm
provided the best response in terms of iv-vitro proliferation. An average microshoot
mean length of 6.1 mm was obtained after 6 weeks; with this results being
significantly superior to all the other concentrations tested. The significant difference
between treatments was determined using ANOVA. The analysis of variance was
carried out to determine the treatment differences in microshoot mean length. The
results in all the tests were considered to be significant when the probability level was
less than or equals to 5% (≤0.05).
Table 3. Effect of kinetin on microshoots formation after two weeks.
Cytokinin
Kinetin
Concentration
(µm)
5
10
20
30
40
No
of
buds
microshoots
15
13
16
19
10
with
Microshoots mean length (mm)
1.8
2.0
2.0
2.3
1.7
Table 4. Effect of kinetin on Microshoots formation after four weeks
Cytokinin
Kinetin
Concentration
(µm)
5
10
20
30
40
No
of
buds
microshoots
12
14
10
16
9
with
Table 5. Effect of kinetin on Microshoots formation after six weeks
90
Microshoots mean length (mm)
2.9
3.1
3.2
4.1
2.7
Cytokinin
Kinetin
Concentration
(µm)
5
10
20
30
40
No of buds with
microshoots
11
9
13
15
8
Microshoots mean length
(mm)
3.7
4.1
4.1
6.1
3.6
The results of the analysis show that there was significant difference between the
treatments (kinetin concentrations) after two, four, & six weeks (table 7a, table 7b &
table 7c). Based on the analysis of variance derived from the experiments, microshoot
lengths were significantly affected by the kinetin concentrations. There was also
formation of new microshoots even after four weeks, while at the same time, some
microshoots died.
The results of this investigation indicated clearly that different kinetin concentrations
had an influence on microshoot formation as observed from the number of buds with
microshoots and the length of the microshoots as indicated by the microshoot mean
length. The most effective kinetin concentration for induction of microshoots
formation was 30 µm with 18 as the mean number of buds with microshoots; it also
had the highest microshoot mean length of 6.1 mm. Also the stage of growth of the
explant had an influence on microshoot formations. Very young buds (first, second or
third top most next to the terminal bud) were scorched by the sterilant and died before
the second week. Mature buds (those that are found next to the base of the crown)
showed an outstanding differentiation in to microshoots.
References
Bartholomew, D.P. and E.P. Malezieux. (1994). Pineapple.In B.Schaffer and
(eds). Handbook of environmental physiology of fruit Crops, Vol 2:
subtropical and tropical crops. Pg 243-291
Boucher, D.H. (1983). Pineapple (pina), pp.101-103. In D.H. Jansen (ed.) Costa.
Cobley, L. S. (1976). An introduction to Botany of Tropical Crops, 2nd ed., Longman.
Collins, J.L. (1960). The Pineapple: botany, cultivation, and utilization. Leonard Hill
Books, Ltd, London.
Duke, J. A. and J. L. DuCellier. (1993). CRC handbook of alternative cash crops.CRC
Press, Boca Raton, FL.
Drew, R.A. Pineapple tissue culture unequalled for rapid multiplication. Queens land
Agricultural Journal, Brisbane, V. 106, n.5, p.447-451, 1980.
John, H. Dodds and Lorin, W. Roberts (1993). Experiments in plant tissue culture
Third Edition.
90
George, E.F. Plant propagation by tissue culture. Part 1.The technology. Edington:
Exegetics, Pg 574.
Indra, K. Vasil and Trevor, A. Thorpe. Plant cell tissue culture. Pg 507-509
Morton, J.F. (1987). Fruits of warm climates.
Murashige, T., Skoog, F. (1962). A revised medium for rapid growth and bioassays
with tobacco tissue culture. Copenhagen, V (15) Pg 743-497, 1962.
Nakasone, H.Y. and R.E.Paull. (1998). Tropical fruits. CAB International,
Wallingford UK.
Samson, J.F. (1987). Fruits of warm climates, Julia F Morton.
90
Molecular breeding for the development of drought tolerant and rice
yellow mottle virus resistant varieties for the resource-poor farmers
in Africa
Ndjiondjop Marie Noelle1****, Manneh Baboucarr2, Drame Khady Nani1,
Fousseyni Cisse3, Semagn Kassa4, Sow Mounirou1, Glenn Greglorio5 6,
Cissoko Mamadou1, Djedatin Gustave1, Fatondji Blandine1, Bocco Roland1
and Montcho David1
1
Africa Rice Center (WARDA), 01 BP 2031, Cotonou, Benin;
Africa Rice Center (WARDA Sahel Station), BP: 96, Saint-Louis, Senegal;
3
Institut d’Economie Rural (IER)- Sikasso, Mali,
4
International Crops Research Institute for the Semi-Arid Tropics (ICRISAT),
5
Africa Rice Center (WARDA), PMB 5320, Ibadan, Nigeria,
6
International Rice Research Institute (IRRI), Manila Philippines.
2
***
Contact author: m.ndjiondjop@cgiar.org,
91
Abstract
This paper addresses the following topics: (1) progresses made in identifying sources
of drought tolerance from Oryza glaberrima and O. sativa, (2) development of highyielding drought-tolerant lines (3) identification of molecular markers linked to QTLs
associated with drought traits (4) introgression of the high resistant allele rymv 1-2
from the donor Gigante into West African elite rice varieties via Marker-Assisted
Selection. O. glaberrima accessions were subjected to drought stress in the field and
pots experiments. In the field, almost all varieties yielded more under control than
drought conditions. In the pot experiment, some varieties survived after drought and
even yield correctly as for RAM 63 (8.79 g/plant). Grain yield under drought was
found to be positively correlated with yield under control, implying that it is possible
to breed drought-tolerant rice genotypes with high yield potential. Thus, several
genotypes gave above average yield under both control and drought stress.
Key words: Drought, gene, Marker Assisted selection (MAS), O. glaberrima, O.
sativa, Rice Yellow Mottle Virus (RYMV), Rice, QTLs.
Introduction
Some drought-tolerant rice genotypes have already been identified in the region.
These include O. glaberrima accessions called Riz Africain du Mali (RAM), collected
at one of the centers of origin of O. glaberrima by the rice breeding programme of the
Institut d’Economie Rural (IER) in Mali, O. glaberrima accessions from WARDA’s
gene bank, O. sativa varieties such as Morobérékan, IRAT109, WAB56-104,
WAB96-3 and WARDA-bred interspecific lines derived from crosses between O.
glaberrima and O. sativa. To enhance the genetic base of this pool of drought-tolerant
materials, tolerance sources identified in other rice-growing regions of the world need
to be introduced and screened and further sources sought among the wide range of O.
glaberrima accessions and O. sativa landraces in WARDA’s gene bank. Many of the
drought-tolerant genotypes so far identified, particularly the O. glaberrima
accessions, have undesirable agronomic characteristics, such as lodging, grain
shattering, long growth cycle and low yield although they are found to be tolerant to
drought, resistant to rice yellow mottle virus, nematodes and African rice gall midge
(AfRGM). Thus their drought tolerance characters could be transferred, through
hybridization, into elite breeding lines and widely-grown varieties of high yielding.
Rice yellow mottle virus (RYMV), severely affects rice cultivation throughout the
African continent. First reported in Kenya in 1966 (Bakker 1974), RYMV has since
been detected in most rice-growing countries of Africa and in Madagascar, but not
elsewhere (Abo et al., 1998). The Africa Rice Center (WARDA), its NARS and
Advanced Research Institutes partners has designed common projects to develop lines
tolerant to drought and rymv for resources poor farmers in Africa. The new
orientations of WARDA research on drought tolerance are (1) to broaden the genetic
base of the pool of drought-tolerant materials, (2) to transfer their drought tolerance
characters, through hybridization, into elite breeding lines and widely-grown varieties
of high yield (3) to identify the QTLs associated with drought tolerance characters.
WARDA has applied Marker Assisted Selection (MAS) to introgress rymv1-2
resistance gene into West African popular but RYMV-susceptible elite varieties.
89
1. Identification of drought tolerance sources in traditional O. glaberrima and O.
sativa accessions, landraces and interspecific breeding lines.
1.1. Identification of sources of drought tolerance in O. sativa landraces and
accessions
Yield (g/plant) under drought stress
30
1:1
line
y = -0.0058x2 + 0.368x + 1.6166
r = 0.41**
25
B6144F-MR
20
15
TOX1857-3-2
IR64
10
N8
FONAIAP
Regression line
N9
N7
Mean
N3
5
N5
N12
N1
N6
0
0
5
N4
N10
10
N2
Mean
15
20
25
30
Yield (g/plant) under full irrigation
Figure 1. Correlation between grain yield of a collection of rice genotypes under
continuous irrigation and drought stress conditions at Cotonou, Benin, in 2005/2006.
N – upland NERICAs are highlighted in purple
A set of 120 rice genotypes including 38 O. sativa ssp. indica, 46 O. sativa ssp.
japonica, 8 O. glaberrima and 15 interspecifics (O. sativa x O. glaberrima), which
were sourced from WARDA, CIAT and IRRI, were screened for drought tolerance at
Togoudo research station (Benin) between 2005–2007. Two trials were conducted
during the main dry season (Dec 2005–March 2006; Dec 2006–March 2007) and one
during the short dry season (July–August 2006). The experimental design was a splitplot with irrigation regime as the main plot factor and genotype as the sub-plot factor.
Within each sub-plot the genotypes were randomized using an alpha lattice design.
Two irrigations levels were used – full irrigation up to maturity and 21 days-drought
stress starting 45 days after sowing (DAS) which coincides with the reproductive
phase of crop development. Recommended agronomic practices such as thinning,
fertilizer application, weeding, spraying against insects, pests and diseases were
carried out in all trials. Over the two seasons of screening, grain yield under drought
was found to be positively correlated with yield under continuous irrigation (Fig. 1;
Fig. 2) implying that it is possible to breed drought-tolerant rice genotypes with high
yield potential.
90
Grain yield (g/plant) under drought stress
24
1:1 line
y = -0.0412x 2 + 1.5111x - 2.2667
R = 0.71
20
IRAT104
LSD=3.42
FONAIAP
2000
16
TOX1857
MOROBEREKAN
ITA212
12
B6144F
Mean
8
4
IR64
0
0
4
8
12
16
20
Grain yield (g/plant) under continuous irrigation
24
yield of a collection of rice genotypes under
Figure 2. Correlation between grain Mean
continuous irrigation and drought stress conditions at Cotonou, Benin, in 2006/2007
Significant phenotypic correlations were detected between grain yield and several
morphophysiological traits. Leaf greenness rating (SPAD reading), leaf width and
leaf length consistently had positive correlations with grain yield under drought
conditions while significant correlations were detected between grain yield and tiller
number, days to 50% flowering and leaf temperature, but the signs differed between
the years. In 2005/2006, grain yield was positively correlated with tiller number and
leaf temperature and negatively correlated with days to 50% flowering (Table 1.)
while grain yield in 2006/2007 was negatively correlated with tiller number and leaf
temperature and positively correlated with days to 50% flowering.
It is noteworthy that all traits with significant correlations to grain yield under drought
stress were only weakly correlated with grain yield (correlations below 50%). Hence
breeding for drought tolerance should employ complex crosses aiming at pyramiding
drought tolerance alleles in adapted backgrounds.
Table 1. Means of traits measured during and after 21 days drought stress on a
diverse population of rice genotypes under irrigated and drought-stressed conditions
at Togoudo Research Station, Benin (n=97) in 2005/2006. Correlation of traits
measured under stress with yield under stress is also included.
90
Traits a
1.
Height 64
2.
Tiller no. 60
3.
Tiller no. 92
4.
Leaf greenness 92
5.
Leaf no. 74
6.
Leaf length 74
7.
Leaf temp. 59
8.
Leaf drying 67
9.
Leaf rolling 80
10. Leaf drying 80
11. Biomass 70 (g)
12. Moisture content 70
(g)
13. Biomass
during
stress
14. 50%
flowering
(days)
15. Fertile panicle no.
16. Fertile panicle wt.
17. Final biomass
18. Grain yield/plant
Fully
irrigate
d
90
19
22
43.30
5
42
31
35.36
Drough
t
stressed
75
12
19
43.10
4
34
33
2.5
2.00
1.70
11.14
Correlatio
n
with
stress
yield
0.05 n.s.
0.163*
0.170*
0.155*
0.180*
0.128*
0.158*
-0.153*
-0.157*
-0.185**
0.325**
107.13
31.09
0.220*
29.43
5.00
0.215*
79
13
14.28
62.26
12.35
91
8
6.10
49.49
5.03
-0.196**
0.366**
0.559**
0.212*
-
S.E.D
.
2.59
0.62
2.64
0.52
0.39
3.39
0.22
0.85
1.26
2.30
4.65
2.31
** significant (P <0.001); * significant (P <0.05); n.s. not significant
a
- Numbers following trait names indicate the DAS on which the trait was measured.
S.E.D – Standard error of the difference between mean trait value under fully
irrigated and that under drought stress.
1.2. Identification of sources of drought tolerance in O. glaberrima accessions
A set of experiments was conducted at Togoudo in WARDA/IITA station with 36
accessions from WARDA’s genbank including 31 O. glaberrima and 5 O. sativa.
Two field trials and one pot experiment were conducted under upland conditions in
2007. In the field trials, a split plot design with two factors, variety and irrigation
level and three repetitions was considered. The main plot was irrigation level (control
and drought stressed) and the subplot factor was the variety. Each basic plot consisted
of four 9 m-rows with 1 m spacing between blocks. Plant spacing was 20 x 20cm
with 3–5 seeds per hill then thinned at one seedling. In the first field trial, drought
stress was applied at 45 days after sowing (DAS) for 36 days and in the second, at 38
DAS and maintained untill all varieties experienced water deficit at flowering. For the
pot experiment, a split plot design with three factors: variety, irrigation level and
growth stage with two repetitions was used. The main plot was irrigation level
(control and drought-stressed) and the subplot factors was the variety (36 varieties)
and the growth stage (vegetative stage and reproductive stage).
The analysis of variance showed that drought stress treatment did not have significant
effect during the first trial. The occurrence of unseasonal rains during the stress
period did not allow a good intensity level of drought stress. Yield loss under drought
stress observed during this trial differed from 2.4 to 50.9% compared to control.
91
However half of the varieties yielded more under drought stress than under control
conditions (Fig. 3), explaining the higher mean yield under drought stress (14.1
g/plant) than under control conditions (11.4 g/plant). This kind of phenomenon can be
observed in cases of accommodation or hardening. When
a plant is submitted to a succession of stress and relief incidents, it becomes more
adapted to the stress and can show better performance than control plants.
Figure 3. Correlation between panicle weight under drought stress and control
conditions.
Average yield (panicle weight) loss due to drought stress was 34.13%, ranging from
9.8% to 72.06%. Mean yield for control plants ranged from 4.19 to 34.13 g/plant and
from 1.54 to 20.78 g/plant for plants that were drought stressed. Almost all varieties
yielded more under control conditions than under drought stress (Fig. 4).
Figure 4. Correlation between panicle weight under control and drought-stress
conditions.
90
The principal component analysis performed with the data from the 2nd field trial
showed four main axes with information concentration of 65%. Yield under drought
stress showed correlation coefficient of 0.52 and 0.45 respectively with the 2nd and 4th
axis. Regarding the parameters for each of these axes (Table 1), plant height at the
end of the drought period and during recovery was positively correlated to yield as
well as shoot biomass. Leaf burning after 35 days of drought stress was negatively
correlated to yield (Table 1). Correlations of yield with the other parameters (tiller
number, leaf number, rolling, days to maturity and days to flowering) were not
significant.
Table 2. Most representative parameters of principal components which showed
significant correlation with yield under drought-stress.
Factor2
Parameters
H3DR
H10DR
H7DR
Hend
Biomshoot
Burn35DS
Factor4
Parameters Corr Coef.
TotFlo
0.7121
Corr Coef.
0.79
0.78
0.77
0.74
0.65
-0.65
Corr. coefficient of Factor 2 Corr. coefficient of
with
Factor 4 with yield =
yield = 0.52312**
0.45602*
Corr. Coef.: Correlation coefficient; Hend, H3JR, H7JR, H10JR: plant height at the
end of drought stress, after 3days, 7 days and 10 days of recovery; Biomshoot: shoot
biomass (dry weight); Burn35DS: leaf tip burning after 35 days of drought stress. **
P <0.01; * P<0.05
During the pot experiment, most of the varieties died at least in one of the two
repetitions during the reproductive stress except CG14, RAM24, TOG6356,
TOG5666, TOG5681, RAM63, IR64, Moroberekan and B6144 (Fig. 5).
90
Figure 5. Drought stress effects after 11 days of irrigation withholding during the
reproductive stage.
The comparison of yield under reproductive and vegetative stress showed that
RAM63 is one of the most stable varieties. Its yield is the least affected by drought at
the reproductive stage. The O. sativa varieties yielded more than all the O.
glaberrima varieties studied during the vegetative stress (Fig. 6).
Figure 6. Grain yield during drought stress at the reproductive and vegetative stages.
High and stable yield under drought conditions is often used to select drought-tolerant
varieties. O. glaberrima varieties are known to have low yield potential in normal conditions.
Hence, our selection criteria of drought tolerant O. glaberrima varieties was based first on
the low leaf drying, rapid recovery, high tillering ability and low leaf rolling and secondly on
yield. Based on the results of the field trials and pot experiment, seven O. glaberrima
varieties can be selected as potentially drought-tolerant: RAM24, TOG6356, CG14,
TOG5681, TOG5882, TOG5666 and RAM63. Among O. sativa varieties, the japonica types
(Moroberekan, IAC165 and Curinga) showed low leaf drying and leaf rolling. However the
indica types (IR64 and B6144F) displayed better recovery ability.
91
1.3. Identification of sources of drought tolerance in WARDA-bred interspecific lines
A population of backcross inbred lines (BILs) developed from a cross of WAB56-104
(O. sativa ssp. japonica) and CG14 (O. glaberrima) were screened together with the
two parents for drought tolerance at Togoudo research station in Benin between 2005
and 2007. The population comprised four hundred and eighty (480) interspecific lines
randomly selected from 120 BC2F4 families. The whole population was screened in
2005 and 300 random lines were selected and screened in 2006/2007. The drought
screening protocol used in this trial involves imposing 21 days drought stress at 45
DAS which coincides with the vegetative/reproductive phase of crop development.
Due to unseasonal rains the drought treatment was started at 48 DAS in the first trial
and at 45 DAS in the second trial. The trials were laid out as split-plot designs with
irrigation regime as the main plot factor and genotype as the sub-plot factor. Within
each sub-plot the genotypes were randomized using an alpha lattice design.
Two irrigation levels were used – full irrigation up to maturity and imposing 21 days
drought stress starting 45 DAS. Recommended agronomic practices such as thinning,
fertilizer application, weeding, spraying against pests and diseases were carried out in
both trials. Soil moisture content was measured as described earlier.
Table 3. Mean scores for leaf rolling, leaf drying and recovery based on the two field
trials and the pot experiment (vegetative and reproductive stress).
N°
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
Varieties
Tog 6334
CG14
Tog 5486
RAM 111
Tog 6121
Tog 5882
IG02
CG 17
RAM 90
Tog 7106
RAM24
Tog 6356
Tog5666
RAM 55
Tog 5672
Saliforeh
Tog 6208
DC kono
RAM48
Tog 6211
Tog6308
Tog 5500
RolSE
8.1
7.43
7.7
7.03
7.9
7.13
8.5
7.6
7.5
8.5
6.22
7.43
7.9
8.5
8.7
8.3
8.2
9.5
9.1
7.03
8.0
8.1
BurnSE
5.4
2.81
5.8
3.92
5.4
3.52
5.6
4.33
4.8
4.23
0.6
2.81
3.82
4.9
4.53
6.4
5.0
3.92
5.2
3.92
5.3
4.7
Rec3DR
4
1.51
2.83
3.13
2.63
3.5
3.4
3
4
4
-1.1
11
22
3.1
3.7
5.6
4
3.1
3.1
3.7
2.32
2.83
92
Burn3DR
5.5
3.82
6.1
5.9
5.8
3.82
5.5
4.83
5.5
5.5
1.0
31
4.33
6.0
5.8
6.5
5.5
5.03
6.0
5.4
5.03
5.9
Rec10DR
4.4
1.41
5.3
3.23
2.32
3.8
3.33
3.03
4.4
4.4
-0.7
1.01
1.51
3.23
4.0
5.6
3.8
3.23
3.23
4.0
33
2.7
Burn10DR
5.6
3.63
5.6
4.03
4.5
2.91
4.6
4.03
4.9
5.2
-0.2
2.01
3.32
4.5
5.4
6.4
4.5
4.3
5.0
5.3
4.6
5.7
23
24
25
26
27
28
29
30
31
32
33
34
35
Pa DC Kono
MG12
Tog 5307
Tog 5674
Tog 5681
RAM68
RAM95
Salikatato
Gbobye
IAC165
Curinga
IR64
Moroberekan
B6144F-MR-636 0-0
8.3
8.3
7.5
8.7
8.2
7.33
7.7
8.7
8.2
5.11
6.22
8.2
5.81
4.02
6.2
4.7
5.9
4.43
4.8
5.2
4.8
5.1
3.92
3.62
4.8
3.62
3.4
5
3.7
3.2
1.31
22
3
3.7
2.42
3.13
3.7
3.03
3.03
5.03
6.3
5.8
6.0
4.83
4.93
5.4
5.8
4.53
4.73
4.93
5.4
4.53
3.3
5.0
4.0
5.0
1.01
1.51
3.03
4.0
2.32
3.23
4.0
2.32
3.03
3.9
6.2
5.4
6.0
3.02
4.13
5.0
5.3
4.0
3.62
4.03
3.93
3.83
7.8
5.3
1.11
5.1
0.81
3.63
SE: end of stress, DR: days of recovery. O. sativa varieties are written in blue.
Numbers in red indicated the top three varieties for each parameter.
Drought stress reduced plant height, tiller number, leaf greenness rating and grain
yield. Plant height, tiller number and leaf greenness were significantly correlated with
grain yield (p<0.01) under drought stress. Within this population yield was generally
reduced under drought relative to the continuously irrigated condition (Fig. 7). For the
parents, WAB56-104 yielded higher than the mean under drought in both trials while
CG14 yielded below the mean in the two trials. Transgressive segregation for grain
yield under drought stress was detected whereby several interspecific lines yielded
significantly higher (p<0.05) than the two parents. This confirms the positive
contribution of O. glaberrima alleles in the sativa background for drought tolerance.
Progeny from three families (77-x; 86-x; 97-x) consistently yielded higher than
WAB56-104 and the mean under drought stress (Table 4.) implying the presence of
drought tolerance in these families.
r drought stress
55
50
45
90
40
35
30
Line 262
Line 287
Figure 7. Correlation between grain yield of an interspecific backcross population
(BC2F5) under continuous irrigation and drought stress conditions at Cotonou, Benin,
in 2006/2007
Table 4. Grain yield (g/plant) of top yielding interspecifics derived from the cross
WAB56-104 x CG14, under 21 days drought stress at Togoudo Research Station,
Benin in 2006 and 2007.
Genotype 2006
Line *
1
2
3
4
5
6
Parent 1
Parent 2
55-1-2
97-1-4
77-5-6
94-2-2
94-3-4
86-1-6A9
WAB56-104
CG14
Grand mean
Standard dev.
Yield
(g/plant)
18.14
7.90
4.22
4.14
2.40
2.30
5.58
0.37
0.26
1.05
Genotype 2007
Line
1
2
3
4
5
6
96-2
787-4-5
86-1-8
97-4-2
114-1-8
77-2-8
Yield
(g/plant)
31.00
29.30
15.32
14.00
13.11
10.75
9.49
8.00
9.41
9.61
* Note: Families with high yielding lines across the two years are highlighted in
bold
2. Development of high-yielding drought-tolerant lines with good grain quality
A series of intraspecific crosses were made between WAB56-104, NERICAs1-7,
IAC165, WAB96-3 and popular upland breeding materials as donors for drought
tolerance traits. A total of 883 F1 seeds were harvested and these were planted for
90
advancement to F2. Three mating schemes were undertaken with these F1s including
top crosses, backcrosses and selfing. In the top crosses Morobérékan was used as a
donor for deep and thick roots whilst IR55419-04 was used as the donor for good
osmotic adjustment. F1 seed from backcrosses and three-way crosses as well as F2
seed from selfed materials were harvested. All F2 from single crosses were fertile. F2
from 18 crosses were planted and subjected to 21 days of drought stress at 45 days
after sowing under upland conditions in a non-replicated trial.
Table 5. Mean F2 yield and no. of selections made from different breeding
populations of rice under stress or non-stress conditions.
Cross combination
Single crosses
1. IAC165/MOROBEREKAN
2. IAC165/OS6
3. IAC165/AZUCENA
4. NERICA1/IDSA10
5. NERICA6/PALAWAN
6. WAB56-104/PALAWAN
7. WAB56-104/MOROBEREKAN
8. WAB96-3/SALUMPIKIT
9. WAB96-3/OS6
10. ITA212/MOROBEREKAN
11. ITA212/IR55419-04
12. IR64/MOROBEREKAN
13. IR64/BALA
14. IR64/CAIAPO
15. IR64/PALAWAN
16. IR64/VANDANA
17. ITA212/PRATAO PRECOCE
18. ITA212/WAB96-1-1
19. ITA212/CT9993-5-10-1-M
20. ITA212/IDSA10
Top-crosses and backcrosses (non-stressed)
21. N1/IDSA10/IR55419-04
22. N4/PALAWAN/MORO
23. N4/IDSA10/IR55419-04
24. N5/LAC23/MORO
25. IAC165/OS6/IR55419-04
26. IAC165/MORO/IR55419-04
27. IR64/CO39/MORO
28. ITA212/MORO/ITA212
29. ITA212/MORO/MORO
Mean
yield
offspring (g/plant)
of
No. selected
(yield >20g/plant)
11.00
12.80
9.48
10.2
9.66
5.31
7.55
5.61
7.00
30.42*
16.71*
21.78*
16.28*
-
149
140
101
14
52
30
39
20
28
103
29
70
36
10
5
14
23
68
10
8
56.61
-
6
8
8
6
14
5
214
88
9
Note: * - mean was computed using yield data of only selected lines
F2 lines from another seven crosses using ITA212 and IR64 as female parents were
subjected to similar drought screening under lowland conditions. F1 lines from topcrosses and backcrosses were selfed to produce F2 lines without drought treatment.
Selections were then made from these segregating populations for heavy yielding
ability, low disease incidence and grain quality. These selections comprising 1307
segregating families (Table 5) were planted under upland conditions and are being
screened for drought tolerance using an augmented rectangular lattice superimposed
90
on a split-plot design with one replication. One block was subjected to drought stress
while the second block is being irrigated continuously.
3. Development of introgression lines tolerant to drought and identification of
molecular markers linked to QTLs associated with drought stress
Regarding the large number of QTLs already identified for drought tolerance, the
objective of this activity was to identify flanking markers tightly linked with major
and consistent QTLs associated with drought-tolerance traits that could be easily used
to develop new drought-tolerant cultivars for West African farmers and thus enhance
breeding programs.
A literature review was carried out to identify drought tolerance QTLs. In rice, QTLs
were reported for drought-tolerance traits such as relative water content, flowering
date, flowering delay, basal root thickness, root dry weight, maximum root length,
root number, root penetration index, drought resistance index, panicle sterility,
spikelet fertility, biomass, harvest index, grain weight, panicle length, osmotic
adjustment and grain yield. Based on this, a list comprising 154 SSR markers
associated to drought tolerance QTLs was prepared. An additional 68 SSR markers
were identified from the Gramene database to create a list of 220 SSR markers
distributed all over the rice genome with an average distance of 5cM between
markers. Some of these markers are reported to be associated with major droughttolerance QTLs in rice. Two hundred and seven SSR markers have been used to
genotype 96 rice lines that were screened for drought tolerance under upland
conditions. Gel scoring is underway to determine polymorphic rates of markers as
well as the allelic diversity of drought-tolerance-implicated QTLs. After completion
of genotyping the association between these markers and drought traits will be
explored in this rice collection to confirm/detect major drought QTLs.
In order to identify drought tolerance QTLs, a population from the cross WAB56-104
(O. sativa ssp. japonica) x CG14 (O. glaberrima) made up of BC2F5 lines (preCSSLs) and developed at WARDA through marker-assisted backcrossing was used.
This population was analyzed for its genomic content at WARDA’s Biotechnology
Laboratory. One hundred microsatellite markers selected from databases such as
Gramene www.gramene.org) and well distributed on the 12 rice chromosomes were
used for the genotyping of the 300 interspecific lines.
The search for a set of lines as candidates for CSSLs was done using program
CSSL Finder v. 0.8a11 (Lorieux et al., unpublished results). The following parameters
were taken into account: size of introgressed segments, minimum number of segments
that cover the genome and treat heterozygotes as donor homozygotes. As a result, 52
lines were selected using 88 of 100 SSRs (Figure 5) markers that showed an even
distribution across the 12 rice chromosomes. These lines covered the complete O.
glaberrima genome with introgressions.
90
Legend:
Recurrent
Chr 1 Chr 2
Donor
Genotype 3
Chr 3
Genotype 4
Chr 4
Chr 5
Heterozygote
Chr 6
Chr 7
Missing data
Chr 8
Chr 9
Chr 10
Chr 11
Chr
264
135
156
265
169
145
39
77
80
61
28
162
198
19
58
13
281
134
284
298
69
14
209
256
194
178
29
18
260
16
213
147
122
184
142
75
1
106
27
204
262
197
82
59
195
289
231
81
26
83
113
109
128
85
Figure 8. Fifty-two introgression lines that covered the entire O. glaberrima genome
Field data from drought screening trials using this population were used in
conjunction with the genotype data for QTL analysis. Two QTLs were identified for
panicle fertility on chromosomes 5 and 6 and one for leaf greenness rating (SPAD
reading) on chromosome 5. Further analysis is ongoing to validate the stability of
these QTLs.
RM415
RM558
RM235
RM512
RM519
chrom. 12
RM286
RM202
RM21
RM206
RM224
RM536
RM209
RM591
chrom. 11
RM474
RM467
RM333
RM258
RM 228
RM219
RM409
RM434
RM257
chrom. 10
chrom. 9
RM25
RM544
RM547
RM72
RM223
RM433
RM264
chrom. 8
RM481
RM234
RM501
RM533
RM455
RM429
chrom. 7
RM589
RM253
RM587
RM003
RM454
RM585
RM527
chrom. 6
RM164
RM161
RM178
RM13
RM169
RM440
RM252
RM255
chrom. 5
RM307
RM335
RM551
RM241
RM471
RM570
chrom. 4
RM232
RM16
RM422
RM545
RM007
RM251
RM208
chrom. 3
RM573
RM530
RM236
RM233
RM263
RM262
RM302
chrom. 2
RM449
RM5
RM220
RM315
RM490
RM243
RM9
A
chrom. 1
A
Grain
2
3
3
3
3.4
7
8
19
22
22
23
23
23
24
25
89
29
54
102
42
30
33
50
82
133
43
49
59
40
131
111
109
105
18
17
16
15
65
106
58
90
44
31
27
26
8,5
8,0
8,0
8,0
.026
.071
.743
.896
.037
.3551.768
.405
.359
1.427
1.966
3.366
.152
.209
.051
.741
.544
.047
.602
.061
1.129
.05
.318
1.47
4.467
3.454
3.217
.063
.737
1.262
.178
1.061
1.177
7.327
7.482
7.21
3.9
6.73
10.
13.971
12.351
90
.736
2.799
.873
1.016
.546
3.745
.217
1.459
1.478
1.321
1.086
1.953
.3
1.311
.174
.376
.189
.006
.171
1.333
1.62
2.971
.12
.025
2.911
.024 2.538
.003
.062
.544 2.991
.216
.143
.368
.826
.61.203
1.058
F-test
Permut
95%ile
99%ile
Max
9,0
90,3
90,3
85,0
85,0
85,0
85,0
84,8
82,3
81,8
81,2
B
RM415
RM558
RM235
RM512
RM519
chrom. 12
RM286
RM202
RM21
RM206
RM224
RM536
RM209
RM591
RM228
chrom. 11
RM474
RM467
RM333
RM258
RM219
RM409
RM434
RM257
chrom. 10
chrom. 9
RM25
RM544
RM547
RM72
RM223
RM433
RM264
chrom. 8
RM481
RM234
RM501
RM533
RM455
RM429
Missing data
chrom. 7
RM589
RM253
RM587
RM003
RM454
RM585
RM527
chrom. 6
RM164
RM161
RM178
RM13
RM169
RM440
RM252
RM255
Heterozygote
chrom. 5
RM307
RM335
RM551
RM241
RM471
RM570
Genotype 4
chrom. 4
RM232
RM16
RM422
RM545
RM007
RM251
RM208
RM573
Genotype 3
chrom. 3
RM530
RM236
RM233
RM263
RM262
Donor
chrom. 2
RM449
RM5
RM220
RM315
RM490
RM243
RM9
chrom. 1
B
RM302
Recurrent
Legend:
AV.TL47
5.56
6.666666
7.7
8
8
8
8.333333
8.5
8.571428
8.6
8.72
8.88
9
9
9
24
40
128
63
83
118
41
61
114
46
104
126
36
39
43
137
136
135
134
133
132
131
130
129
127
125
124
123
122
120
.25
2.446
1.25
1.916
.495
.764
.082
.528
.637
.809
1.689
.6
.101
.004
4.094
2.432
.6861.97
.065
.41
.94
.49 1.826
.071
.083
2.202
.173
.017
1.238
.632
.55
.202
.487
.118
.043 1.974
.118
.283
1.129
.409 2.657
.055
.502
1.533 3.839
.278
.009
.332
.385
.058
.007
3.522
.004 1.77 3.537
.524
.826
1.01
.627
.362
.132
.138
.065
2.456 4.352
.
.221.177
.311
.15
.203
1.539
.749
.399
F-test
Permut
95%ile
99%ile
Max
4.08
7.43
8.177
10.
10.939
C
Figure 9. A-QTLs for panicle fertility were detected on chromosomes 5 and 6; B-QTLs for tiller
number were detected on chromosomes 5; C-QTL for SPAD (leaf greenness) was detected on
chromosome
5.
4. Introgression
of the high resistant gene rymv 1-2 from the donor Gigante into
West African elite rice varieties via Marker-Assisted Selection
4.1 Development of BC1F1 population and Marker Assisted Selection
F1 hybrids obtained by crossing cultivar Gigante (RYMV-resistant donor parent) with
RYMV susceptible elite lines (recurrent parent) were used for developing BC1F1
populations. Finally, a total of 2305 BC1F1 seeds were obtained from all crosses.
The BC1F1 plants were screened for the presence/absence of rymv resistant allele from
Gigante using the microsatellite marker which is mapped 1.8 cM distal to the resistant
gene on chromosome 4. DNA extraction and polymerase chain reaction (PCR) were
carried out using an ultra-simple protocol described for microsatellite analysis of rice
(Ikeda et al., 2001). Amplified products were separated by electrophoresis in 5%
polyacrylamide gels using a SequiGEN 38 X 50 cm gel apparatus (BioRad
Laboratories) and the banding patterns were visualized using silver staining. The
number of individuals that are carrier of rymv resistant allele varied from 3 for
IR64/Gigante//IR64 to 13 for FKR28/Gigante/FKR28. Individuals that were
heterozygous were further checked using two flanking microsatellite markers, which
are located 2.3 cM proximal and 4.2 cM distal to rymv resistant gene, respectively.
This is called background selection on the carrier chromosome, which aims to
accelerate the return to the recipient parent genome outside the target gene so as to
reduce the length of the intact chromosomal segment of donor parent (Gigante)
dragged around the target gene on the carrier chromosome. On the basis of genotypes
at the target marker and the two flanking markers, the individuals could be classified
into three types: (i) Type-1 (ii) Type-2 (iii) Type-3. Based on these classifications, the
numbers of Type-1, Type-2 and Type-3 individuals were 6, 3 and 23, respectively.
The individuals were selected and backcrossed to their corresponding recurrent
parent. Such backcrossing produced a total of 1374 BC2F1 seeds. All these BC2F1
91
seeds will be sown and checked for the presence of rymv resistant gene (foreground
selection), which will be followed by background selection to identify the best
individuals (individuals that contained rymv resistant gene and the highest proportion
of recurrent parent genome on all chromosomes) for developing a BC2F2 population
for RYMV disease evaluation.
5. 2 Marker Assisted Selection to develop BC3F1 progenies
A total of 25 individuals at the level of BC2F1, were selected and backcrossed to their
corresponding recurrent parent. Such backcrossing produced a total of 1,902 BC3F1
seeds. Several BC2F1 panicles were also selfed and 37,370 BC2F2 seeds were
produced. The BC3F1 plants were screened for the presence/absence of rymv1-2
resistant allele from Gigante using the microsatellite marker. A total of 200
individuals contained the rymv1-2 resistance allele were obtained. The individuals
were further checked for the proportion of introgression from the donor parent on
chromosome 4 using two flanking microsatellite markers. BC3F1 individuals bearing
small segment of rymv1-2 resistant allele were successfully obtained. They were also
screened for their background using two microsatellite markers per chromosome.
BC3F2 seeds bearing the rymv1-2 allele were successfully produced and used to
develop BC3F3 fixed lines and also to produce enough seeds for distribution to NARS
breeders. These RYMV-resistant introgressed lines will be sent to NARS involved in
the project for more complete evaluation and incorporation into resistance breeding
programs by African NARS.
Conclusion
Significant variation for drought tolerance exists in rice. Potential sources of drought
tolerance have been identified in the collection of screened materials including O.
sativa and O. glaberrima accessions and interspecific lines. Regarding the small
correlation coefficients of yield with measured parameters, we can conclude that
individual contributions of morphophysiological traits to grain yield are small. Hence,
breeding for high yield under drought stress should employ multiple crossing schemes
in order to pyramid the different drought tolerance alleles in adapted backgrounds.
Yield stability is also an important character which should be taken into account in
breeding programs. O. glaberrima is a good source of drought tolerance alleles with
positive effects on yield under both stress and non-stress conditions. This is assessed
by the transgressive segregation for grain yield under drought stress detected from the
interspecific lines derived from crosses between WAB56-104 × CG14. Few other
crosses have been made to transfer O. glaberrima alleles in high-yielding sativa
backgrounds. Several QTLs associated to leaf greenness (SAPD), tiller number and
plant height under drought stress were identified from an interspecific population
derived from crosses between WAB56-104 × CG14. They are located on
chromosomes 1, 5, 7 and 12. The fine mapping of these QTLs and the assessment of
their effects using Marker Assisted Selection in elite African lines will be done.
Through partnership, joint programs and projects with NARES, promising droughttolerant fixed lines will be given to NARES for testing in their environment and the
RYMV-resistant introgressed lines will be sent to them for more complete evaluation
and incorporation into resistance breeding programs.
90
Acknowledgment
We acknowledge the Rockefeller Foundation, USAID and The Ministry of Foreign
Affair in Japan for their generous and strong support to these projects.
References
Abo, M. E., Sy, A. A., and Alegbejo, M. D. (1998). Rice yellow mottle virus
(RYMV) in Africa: evolution, distribution, economic significance on
sustainable rice production and management strategies. J. Sustain. Agric.
11:85-111.
Abubakar Z., Fadhila A., Agnes P., Oumar T., Placide N’Guessan, Jean-Loup
Notteghem, Frances Kimmins, Gnissa Konaté and Denis Fargette, (2003).
Phylogeography of Rice yellow mottle virus in Africa, Journal of General
Virology, 84, 733–743.
Albar, L., Bangratz-Reyser, M., Hébrard, E., Ndjiondjop, M.-N., Jones, M. and
Ghesquière, A. (2006) Mutations in the eIF(iso)4G translation initiation factor
confer high resistance of rice to Rice yellow mottle virus. Plant J. 47, 417–
426.
Attere, A. F., and Fatokun, C. A. (1983). Reaction of Oryza glaberrima accessions to
rice yellow mottle virus. Plant Dis. 67:420-421.
Awoderu V. A. (1991). Rice yellow mottle virus in West Africa. Tropical Pest
Management 37 (4): 356-362.
Bakker W. (1974). Characterization and ecological aspects of rice yellow mottle virus
in Kenya. Agric. Res. Rep. 829. Wageningen: Cent. Agric. Publ. Doc. 152.
Fomba SN. (1988). Screening for seedling resistance to rice yellow mottle virus in
some rice cultivars in Sierra Leone. Plant Dis. 72:641–42.
Fomba, S. N. (1990). Rice yellow mottle virus on swamp rice in Guinea. Int. Rice
Res. Newsl. 15:21.
IRRI (1996) Standard evaluation system for rice, 4th edition. IRRI, 51 pp.
Ndjiondjop, M. N., Albar, L., Fargette, D., Fauquet, C. M., and Ghesquière, A.
(1999). The genetic basis of high resistance to rice yellow mottle virus
(RYMV) in cultivars of two cultivated rice species. Plant Dis. 83:931-935.
Okioma, S. N. M., Muchoki, R. N., Gathuru, E. M., Yadav, S. K., Singh, S. P., and
Bhan, V. M. (1983). Alternative hosts of rice yellow mottle virus in the Lake
Victoria basin of Kenya. Tropical Pest Management 29:295-296.
Raymundo and Konteh (1980). Distribution, importance, screening methods and
varietal reaction to rice yellow mottle disease. Int. Rice Comm. Newsl. 29:5153.
90
Traoré, O., Pinel, A., Fargette, D., and Konaté, G. (2001). First report and
characterization of Rice yellow mottle virus in Central Africa. Plant Dis.
85:920.
Turner N.C. (2008). Drought Hardening and Pre-Sowing Seed Hardening.
Encyclopedia of Water Science, Second Edition; Stanley W. Trimble; B. A.
Stewart; Terry A. Howell. 218 pp.
91
Development of Insect Resistance Management Strategies for Bt
Maize in Kenya
1
Mulaa M. A., 2Bergvinson D. and 3Mugo S.
National Agricultural Research Centre, P. O. Box 450, Kitale, Kenya,
margaretmulaa@yahoo.com,
2
Bill and Melinda Gates Foundation;
3
CIMMYT Kenya
1
Abstract
A major concern of utilizing Bt maize technology is the likelihood of development of
resistance to the Bt toxins by the target stem borer species. However, the rate of
evolution of this resistance can be slowed or stopped through the use of appropriate
insect resistance management (IRM) strategies. To reduce the possibility of resistance
development to Bt maize, Kenya is developing IRM strategies to delay development
of resistance, thereby extending the efficacy of the Bt maize technology. A proposed
IRM strategy will include a Bt maize variety with multiple forms of control and with
high expression levels. To complement the researchers’ efforts and increase the
chances of the Bt maize and refugia concept being accepted by the farmers,
stakeholder meetings and farmer workshops were organized to raise awareness, and
solicit farmers input into the Bt technology and the refugia concept.
Key Words: Criteria, Gender, Preferences, Ranking, Refugia, Stem borer,
Survivorship
Introduction
The microbial insecticide (Bt) has been used as a conventional insecticide for control
of economically important lepidoptera, coleoptera and diptera for more than 50 years
(Expert Report, 1998), but recent advances in genetic engineering has enabled the
insertion of Bt genes in the plant making it more effective and user and
environmentally friendly compared to the sprays (Roush, 1994b). The insect resistant
transgenic maize with insecticidal crystal Proteins (δ endotoxin) derived from the
common soil bacterium Bacillus thuringiensis (Bt) is becoming increasingly
important for stem borer management mainly because the δ-endotoxins) are extremely
toxic to the stem borers, yet cause no harm to humans, most beneficial insects, and
other non target organisms (Croft, 1990; Flexner et al, 1986).
Kenya is considering introduction of Bt maize as evaluated by researchers in the Biosafety Green House(BGH) and confined field trials in an open plant quarantine to
generate appropriate data required by the regulatory authorities, and efforts are on to
develop effective Bt maize products which will eventually be released to farmers
following biosafety and regulatory requirements. Along side the development of Bt
maize, the regulatory requires that suitable IRM strategies put in place. The IRM
strategies used in developed countries like the US might not be most suitable for the
diverse maize production systems in Kenya.
92
This paper proposes an IRM strategy that considers the unique farming systems in
Kenya that includes intercropping maize with other cereal crops, growing of cereal
fodder crops for livestock feed and for soil erosion control and the growing of maize
in close proximity to uncultivated areas with thick stemmed grass, all of which can be
alternative hosts for stem borers
Developing IRM strategies suitable for Kenya
Refugia Options
To counter the build up of resistance by the borers to Bt maize, The Insect Resistant
Maize for Africa (IRMA) project is developing varieties that carry multiple forms of
resistance—for example multiple Bt genes and combinations of Bt genes as well as
conventional resistance. So a borer population would have to develop multiple
resistances rather than a single resistance to one Bt toxin. The aim is to produce a
durable IRM strategy that incorporates both vertical resistance mechanisms (through
the “pyramiding” or “stacking” of resistance genes), development of refugia and
horizontal resistance through more conventional crop development and agronomic
measures.
The most suitable IRM strategy for Kenya would be use of refugia/high dose strategy
as part of the IPM program already recommended by researchers in Kenya and being
used by farmers which includes: Early planting, use of pest and disease tolerant
varieties, environmentally friendly pesticides and methodologies which preserve
natural enemies such as natural plant products and pull push strategies. Such methods
will also diversify pest mortality factors hence reducing insect resistance to the Bt
trait and borer damage to refugia crops increasing growers’ benefits from the Bt
maize and refugia.
Ongoing Research in Kenya on Development of IRM Strategy for Bt Maize
The Objectives of the IRMA Project are to identify suitable alternate hosts which can
serve as a refugia for Bt maize in different agro-ecological zones within Kenya and
estimate and document % area covered by already established potential alternative
hosts of major stem borer species which may be recommended as natural Refugia. To
quantify existing refugia and identify where interventions need to be taken, research
in three areas is ongoing: characterizing host suitability using field trials and insect
bioassays, farm surveys to characterize percent area covered by different alternate
hosts, and map percent refugia at a district level to identify regions where structured
refugia and frequent monitoring for resistance will be necessary.
Evaluation of recommended forages and maize for stem borer oviposition,
survivorship, fitness and development time
To select suitable crop species to be used as refugia, recommended forages, sorghum
and maize varieties were evaluated for stem borer preference and survivorship in the
field in four locations representing different agro-ecological zones in Kenya, over four
seasons between 2001 and 2005. Data recorded included: % plants damaged by
borers, number of exit holes, tunnel length and yield (grain and fodder).
89
Results from field trials indicate higher borer damage rating and exit holes in all
sorghum and maize varieties. Grass species with many exit holes included some
improved Napier varieties e.g. Kakamega 1 and Columbus grass (Table1).
Bioassay for larval development rates and fecundity
Laboratory bioassay for larval development rates and fecundity were conducted using
four stem borer species: Chilo partellus, Busseola fusca, Sesamia calamistis and
Eldana saccharina and 30 genotypes at KARI, Kitale under ambient laboratory
conditions. Days taken from neonate stage to pupation were recorded for each pupa.
Data was also collected on egg production and fertility. The results of the bioassays
are presented in table 2.
Table 1: Summary means for different damage and plant performance parameters for
three maize growing environments (Kakamega, Kitale Mtwapa 2001-2005
Damage
Rating
Exit Holes
Crop
Damaged
Plants
Bana
Clone 13
Columbus Grass
Panicum
Kakamega 1
Kakamega 3
Maize
Pearl millet
Sorghum
Sudan Grass
Total
LSD(0.05)
2.09
2.02
2.07
1.83
2.32
2.14
2.2
2.13
2.68
2.04
2.17
0.64
0.85
0.93
1.02
0.20
1.26
1.10
3.72
1.00
6.74
0.59
1.91
3.01
50
39
56
16
75
33
52
32
42
68
39
43
Tunnel
Length
(cm)
1.37
2.51
7.14
0.65
1.44
2.38
13.61
5.28
23.14
4.43
6.49
10.80
Field Yield
(T/ha)
10.90
8.41
2.56
1.65
9.00
9.65
1.90
1.23
1.11
1.93
4.41
3.16
Estimated
moth
production
11308
14712
406864
1832
22711
18187
136977
52000
346204
246090
93595
39200
The differences between borer species were significant. In the case of Busseola fusca,
the species for which resistance development is a major concern, the highest
survivorship was observed on sorghums and maize and lowest in Napier grass. Maize
also demonstrated the shortest life cycle. Egg production per female was highest in
maize and lowest for Napier grass.
Table2. Life cycle and reproductive potential for Busseola fusca and Sesamia
calamistis reared on different classes of alternate hosts under Laboratory
conditions, Kitale, 2002-2005.
Cop type
Napier Grass
Local Sorghum
Maize
Busseola fusca
Life
Cycle
Percent
(days)
Survival
64.5
2.8
60.3
37.8
53.2
18.5
Sesamia calamistis
Egg
Production
5.0
184.8
246.6
89
Life CyclePercent
(days)
Survival
60.9
3.3
56.5
13.3
51.7
27.5
Egg
Production
93.0
67.0
629.3
Larval weight gain was generally greatest for the two preferred hosts, sorghum and
maize (Table 3) for Busseola fusca and Sesamia calamistis. Among the grasses, giant
setaria showed the greatest gains in larval weight.
Table3. Average weight of four species of stem borer reared on four groups of
hosts under controlled conditions, Kitale, 2002-2005
Crop
Wild Grasses
Maize
Napier
Sorghum
Overall Mean
LSD(0.05)
Chilo
partellus
0.018
0.023
0.017
0.024
0.020
0.009
Busseola fusca
0.038
0.025
0.026
0.025
0.026
0.009
Sesamia
calamistis
0.035
0.020
0.014
0.021
0.020
0.003
Eldana
sacharina
0.015
0.015
0.012
0.015
0.013
0.002
Characterizing maize cropping systems in different agro ecologies in Kenya to
estimate the potential of natural refugia
Vegetation surveys were conducted in major maize growing districts in Kenya to
quantify the percent area covered by different natural refugia in order to estimate the
availability of refugia in existing maize cropping systems. During this survey 850
farmers were interviewed with all interviews being geo-referenced and GIS maps on
existing refugia generated for both cropping seasons. Kwale district at the coastal
region of Kenya had maize equivalent refugia of 18%, a level comparable to the 20%
recommended for commercial maize in the USA. Some districts had less than 20%
refugia. Such regions will require structured or augmented refugia to attain 20%
refugia. This is due largely to an almost exclusive planting of maize and very little
area planted to alternate hosts, including sorghum. Most parts of Kenya have enough
natural refugia more than 20%. Areas with less than 20% will require a structured
refugia and frequent monitoring for resistance
Stakeholder meetings and Sensitisation workshops
Because most people in Kenya are not well informed a bout the Bt technology, over
100 different stakeholders were invited annually to attend the annual meetings
organised by the IRMA project, between 2001 to 2007 as a strategy to have a wider
dissemination of information on the projects aims and progress so that everybody is
able to make an informed decision based on scientific facts. The aim of the annual
stakeholders meetings is to inform the representatives of the public, including the
media, about progress in the IRMA project because they would be the right people to
deliver the right information to the wider public and to have their input into the
project. Stakeholders who attended the IRMA stakeholders meetings from 2001 to
2007 included representatives from various institutions and organizations such as:
Donors, Research institutions, Government, International Research Institutes, Media,
Journalists, Seed companies, Regulatory bodies, Universities and Farmers.
Farmer and Extension workshops on Refugia
To be accepted by farmers, IRM strategies must be compatible with the existing
cropping systems, normal farming practices and the refugia crops must be
89
economically viable and socially acceptable to those making the management
decisions at the farm level. To complement the researchers’ efforts and increase the
chances of the Bt. Maize and refugia concept being accepted by the farmers, the
KARI and CIMMYT scientists in the IRMA project organized workshops in three
different maize growing areas, the lowland coastal, medium and the highland areas of
North rift and western Kenya to familiarise the participants with refugia concept and
practise and get the farmers and extension input into the project before Bt is released.
A part from sensitising farmers and extension workers on the importance of refugia,
group exercises were also conducted to rank refugia species in the experimental plots
by the 3 categories of participants (farmers, extensionists and researchers) based on
their criteria. There were differences in the criteria and the ranking of the varieties for
use as refugia among the researchers, extensionists and farmers in the different maize
growing areas. When all the criteria listed by the 3 groups were combined the most
common criteria used by all was resistance to stem borers, having alternative uses
(food, pasture, refugia, hay) and the ability to attract and support stem borers. The
farmers also mentioned availability of seed as important criteria, which should not be
ignored.
Non-Refugia Options
Proposed Post Release Insect monitoring strategies in Kenya
The most practical strategy for management of resistance will be use of 20% refugia
next to 80% Bt maize with high dose, that will kill all susceptible and heterozygote,
and few resistant insects of the target pest. Suitable crop species have been identified
as suitable refugia such as sorghum, maize and improved Napier varieties. However
the economics (benefit/cost ratios) have to be determined from the yield data already
obtain from the refugia field trials conducted in Kitale, Kakamega, Embu and
Mtwapa. Farmer preferences in different regions and farming systems have to be
included in the evaluations. The suitability of these crops as refugia has to be verified
in other regions because a number of factors have been found to influence moth
behaviour and movement such as the weather, crop diversity, cropping patterns and
landscape.
Other key issues to be addressed will be how to maintain the Bt gene in the seeds
especially where farmers grow open pollinated varieties and those farmers who
recycle. Some farmers neighbouring Bt maize growers might not want the Bt trait in
their maize (gene flow effects). Recycling and gene flow will create a situation where
by some genes will segregate producing some plants without Bt on which borers can
survive. These will require educating farmers on effects of seed recycling, gene flow
and seed selection criteria on Bt gene technology. Farmers using the Bt maze
technology will be advised not to recycle seed but to purchase new certified Bt seeds
every season, they will also be advised to scout their farms very often and de-tassel
damaged plants because they will not contain Bt gene and they are likely to support
resistant larvae hence increasing chances of resistance developing faster to the Bt
trait.
De-tasselling such plants before pollen shed will reduce chances of contamination
from plants, which don’t have the Bt trait. These will depend on the farmers’ ability to
time de-tasselling and the costs of de-tasselling which need to be determined.
90
However the costs may be less because few plants will be damaged. It also requires
frequent monitoring for damage. To reduce effects of gene flow resulting to
contamination of Bt maize by pollen from non Bt maize which may be planted by
neighbours, the farmers should be advised to harvest seed from plants not damaged
from the middle rows of the Bt maize plot. Gene flow studies on maize in Kenya have
indicated that most of the pollen (70%) falls within 10 metres from the source (Mugo
et al., 2001), so farmers who don’t want any Bt in their maize can keep an Isolation
distance of a bout 20 metres from the Bt maize.
Growers’ acceptance and participation in the implementation of the IRM strategy will
depend on the success of the initial attempts to sensitise those involved in the Bt
technology and the type of IRM strategy put in place. Success of the IRM plan will
also depend on the individual responsibility of all those involved in the Bt technology
starting from the owners of the Bt trait (seed companies or research institutes) to those
growing the seed. Education of all those involved with the Bt crop will therefore be
priority in the IRM plan in Kenya. Those involved include farmers, extension agents,
traders, seed stockists, regulators and policy makers. Several workshops will be
conducted to educate all those involved in the Bt technology on importance of refugia,
suitable refugia plans, how to establish and locate refugia in relation to Bt. maize plots
and its management to get maximum benefits from its use.
Contingency plans
It is important that Kenya Plant Health Inspectorate Service (KEPHIS), which is
mandated to verify seed quality, check for Homozygosity of the seeds given to
farmers using the standard methods and commercial kits (dipsticks) to verify the
presence of Bt gene in the plants to be used as seed. Farmers and extension staff will
be encouraged to scout and report any changes observed in the efficacy of the Bt
technology and report any damages observed on the Bt crop to the extension agents,
research station or to seed companies supplying the seed. Careful field scouting of Bt
Maize plots will also be done by experienced entomologists to detect occurrence of
crop damage which may be due to resistance or failure of control and conduct detailed
investigations on cause of pest survival including rearing surviving insects in the
laboratory and conducting bio-assays using an appropriate single discriminatory dose
(LC99) which kills all the susceptible insects leaving the resistant ones in order to
confirm presence of resistant individuals. More intensive surveys will be conducted in
areas where damage is observed and a discriminatory dose used to test and detect for
resistant individuals. Diagnostic or discriminating assays have been used successfully
in the US (Roush, 1994 a&b; Roush and Miller, 1986).
Conclusion
To avoid confusing farmers with different IRM strategies, and because the same
strategy is likely to be used in other African counties, it will be necessary to have a
regional multidisciplinary working group meeting of experts in Africa, with assistance
of consultants to modify the planed IRM strategy based on scientific facts,
experiences and lessons learned by those who are already using the technology. There
is also need to have a coordinated effort among all those who are likely to be involved
in the Bt technology such as multidisciplinary teams of researchers, seed company
representatives, universities, regulatory bodies, policy makers, seed stockists and
91
farmers to create a national IRM stewardship technical committee which will develop
a uniform IRM plan for the region in association with the regulatory bodies in the
region. There will be need to incorporate the growers concerns in the different regions
while developing a proper refuge to be used on-farm.
These will increase the possibly of growers complying with the recommended IRM
plan when Bt maize is eventually released. Surveys on grower’s awareness and
adoption should be conducted before and after release of Bt maize. Followed by
similar annual surveys to asses growers adherence to the recommended IRM
strategies and find out reasons for non- compliance so that relevant modifications are
made to the IRM plans and results used to design further education programs and
topics in order to strengthen growers stewardship of the technology. It might be
necessary to start discussing the type of agreements that may be necessary between
the growers and seed companies, which may facilitate compliance in the proper use of
the Bt technology. Proper guidelines in the use of the technology must accompany the
agreements between the companies owning the seeds with the Bt trait and the
growers.
92
References
Corinne Alexander (2007). Insect Resistance Management Plans: The Farmers’
Perspective. AgBioForum, 10(1): 33-43
Croft B. A. (1990). Anthropod Biological control agents and pesticides. New York:
John Wiley and Sons 723 pp.
De Groote H. C., C. Bett, L. Mose, M.Odendo, J.O. Okuro and E. Wekesa (2001).
Direct measurement of maize crop losses from stem borers in Kenya.
Preliminary results from the 2000-2001 season. Paper presented during the 7th
Eastern and South African Regional maize Conference, Nairobi, Kenya 11th15th Feb 2002
Flexner J. L., Lighthart B., Croft B. A., (1986). The effects of microbial pesticides on
non-target, beneficial arthropods. Agrc. Ecosysts. Environ 116: 203-54
Mulaa M. A. (1997). Utilization of wild Gramineous plants for management of cereal
stem borers in Africa. Insect Sci. Applic. (17) (1): 143-150
Mugo S.N, D.Poland, M. Mulaa and D.Hoisington (eds).2003, Third Stakeholders
meeting. Insect Resistant Maize for Africa (IRMA) project: Document 11.
Nairobi, Kenya
Mulaa M.A. (1995). Evaluation of factors leading to rational pesticide use for the
control of the maize stalkborer, Busseaola fusca (Lepidoptera: Noctuinidae) in
Trans-Nzoia district, PhD thesis University of Wales
Roush, R. T. (1994a). Can we slow adaptation by pests to insect resistant transgenic
crops ? In Biotechnology for Integrated Pest Management, G. Persley and R.
Macintyre, eds. CAB International: London
Roush, R. T. (1994b). Managing pests and their resistance to Bacillus thuringiensis:
Can transgenic crops be better than sprays ? Biocontrol Science and
Technology 4: 501-516
Roush R.T.and G. L. Miller (1986). Considerations for design of Insect Resistance
monitoring programs. J. Econ. Entomol. 179: 293-298
Tabashnik B. E. (1994). Evolution of resistance to Bacillus thuringiensis. Annual
Rev. Entomol. 39: 47-79.
90
Incidences, Severity and Identification of Viral diseases in Passion
fruit production systems in Kenya
1
Otipa, M. J., 1Amata, R. L., 1Waiganjo, M., 4Ateka, E., 4Mamati, E., 1Miano,
D., 1Nyaboga, E., 1Mwaura, S., 2Kyamanywa, S.; 3Erbough, M. and 3Miller, S.
1
Kenya Agricultural Research Institute, P.O. Box 14733, 00800 Nairobi,
Kenya;
2
Makerere University, P.O Box 7062, Kampala, Uganda;
3
Ohio State University, P.O Box 44691-4096, Ohio, USA;
4
Jomo Kenyatta University of Agriculture and Technology, P.O Box 62000,
00200, Nairobi, Kenya
Abstract
The objective of this study was to determine the distribution, incidence and severity of
viral diseases of passion fruit in Kenya. Surveys were carried out in Bungoma, Trans
Nzoia, Kisii, Molo, Nakuru, Thika, Muranga, Embu and Meru districts. Most areas
had severity of 3-4 except Murang’a and Meru with 1. When 46 samples were tested
using ACP-ELISA, 15 (32%) were found to be positive to potyvirus antisera. Reverse
transcription (RT-PCR) for 12 samples with Cucumber mosaic virus specific primer
pairs CMV1/2 and CMV3/5 gave the expected products of 500 bp on 1% agarose gel
for 0 and 3 test samples respectively after further amplification. Information on
occurrence and molecular variability of Passion fruit viruses is essential in selecting
sources of resistance for incorporation in management options of the diseases.
Key words: Passion fruit viruses, incidences, severity, cucumber mosaic virus
Introduction
Passion fruit is an important fruit crop in Kenya which not only generates income to
local smallholder farmers but also earns the country foreign exchange (MOA, 2003;
Njuguna et al., 2005). The crop has been grown commercially in Kenya since the
1930’s with more acreage put under the crop in 1960’s (Morton 1987). Currently in
Kenya, it is grown mainly by smallholder farmers who have formed community based
organizations (CBOs) and have been contracted by export companies such as East
African Growers and Kenya Horticultural Exporters (Personal communication with
farmers) for export. It is rich in Vitamins A, C, and D, hence increasing its demand
since it is a requirement for the healthy growth of children, the sick, and community
as a whole (Morton1987; Njuguna et al., 2005).
Production Constraints
One of the major constraints hindering sustainable crop production in East Africa is
pests and diseases (Sutherland and Kibata, 1993; Njuguna et al., 2005). Diseases
affecting passion fruit in Kenya include, shoot die back, which has often been
mistaken for wilt when observed at later stages, brown spot (Alternaria passiflorae)
affecting leaves, fruit and stem, anthracnose (Colletotrichum passiflorae),
crown/collar rot (Fusarium solani), wilt (Fusarium oxysporum f.sp. passiflorae) and
90
passion fruit woodiness virus disease (PWD) complex (New Zealand passion fruit
growers 2007; Njuguna et al., 2005). Root knot nematodes (Meloidogyne spp.) and
insect pests including aphids, thrips, stink bugs, leaf miners and white flies are also a
major problem in passion fruit production (Njuguna et al., 2005).
Due to conducive climatic conditions, multiple pest infestations and disease infection
are found to affect this crop in the tropics and subtropics thus complicating their
management and leading to the crop lifespan reduction from 5 to as low as less than 2
years (Lippmann 1978; Morton 1987; Njuguna et al., 2005). Viral diseases have been
reported as one of the major constraints in passion fruit production in Kenya, although
losses attributed to these diseases alone have not been quantified (Lippmann 1978;
Njuguna et al., 2005).
There has been a general decline of Passion fruit production in Kenya over the past
five years. This has been observed in the total acreage under passion fruit production
in terms of tonnes as well as the total value (MOA 2001). This scenario is attributed
to mostly diseases and woodiness viruses are among the very devastating for the
growth of the crop. So far, there is no comprehensive documentation of the status of
viruses causing the woodiness complex in Kenya. This is an important step towards
the development of sustainable management strategies for this disease especially
breeding for tolerance. Therefore the objective of this study was to determine the
distribution, incidence and severity of viral diseases of passion fruit in Kenya and
identify them and develop IPM strategies that would enhance productivity, improve
product quality, productivity and sustain its production.
Material and Methods for Virus Work
Surveys were conducted in major passion fruit growing areas in Kenya to determine
the distribution and incidence of passion fruit infecting viruses in different agroecological zones. Passion fruit leaves and fruits were taken from farmer’s fields and
from a germplasm collection for virus diagnosis. The fields were randomly selected at
a distance of between 5 to 20 Km. Two types of leaf samples were collected from
each field: 10 to 15 plants exhibiting viral symptoms and 10 asymptomatic. A total of
98 samples were collected from all sampling sites and immediately placed in tubes
containing anhydrous calcium hypochlorite or silica gel, stored in a cold box
containing dry ice and transported to the laboratory for DNA extraction.
The incidences were measured by counting the number of visibly diseased plants in
relation to the total number of plants assessed. Severity among 50 plants in each field
was recorded using a scale1 to 5 where; 1= no symptoms, 2= mild symptoms on
leaves, little distortion of leaf shape, apparent but negligible stunting, 3= moderate
symptoms on leaf, moderate distortion of leaf shape, moderate stunting of plants,
symptoms on pods, 4= severe symptoms on leaf, stems, severe leaf distortion, with
reduced size, plant partially stunted, 5= very severe symptoms on leaf, severe leaf
distortion, reduced size, plant severely stunted.
Characterization of the virus isolates
The diseased plant samples were screened using the potyvirus monoclonal antibody to
detect presence of viruses. The negative samples were subsequently tested for
presence of other non-potyvirus virus species reported to infect passion fruit
worldwide including Cucumber Mosaic Virus. All the samples were tested using
indirect antigen plate ELISA (ACP-ELISA) according to the recommendations of the
89
DSMZ commercial antiserum kit. Antibodies and alkaline phosphates conjugate were
diluted with buffer and the plant sap extracted in extraction buffer. The antigenantibody conjugate reaction was incubated for 60min at 37oC, using 1 mg/ml p-nitro
phenyl phosphate as substrate.
Reactivity between viral antigens and respective antibodies was measured as optical
density at wavelength of 405nm in an ELISA micro well reader with lyophilized virus
samples from DSMZ as positive controls in each plate. The constituent buffer and/or
sap extract from a healthy passion fruit plant was used as negative controls. Positive
threshold values were twice the average value of the negative control. Virus
occurrence was established for ELISA positive samples within the total number of
samples for each sampled district and reference isolates from the passion fruit virus
collected at the DSMZ, maintained on clean passion fruit plant to be used for
comparative analyse. All virus isolates were purified through indicator plants of
Nicotiana benthaamiana and Chenopodium quinoa.
Samples that were positive to Elisa were molecularly characterized by extracting total
genomic RNA from a concentrated viral preparation obtained from infected passion
fruit plants using the RNEasy Mini Kit (Qiagen, Germany). This RNA was used as a
template for reverse transcription polymerase chain reaction (RT-PCR) in either onestep or two-step procedures to generate first strand complementary DNA using Super
Scrip TM11 . A 20µl reaction volume consisting of 0.5 µl Reverse primer, 0.5 µl toward
primer, 10 µl Total RNA, 1 µl 10mM dNTPs and 8 µl sterile distilled water was
heated to 650C for 5mins, then placed on ice for at least 1 min, collected by short spin
and 4 µl 5x first-strand buffer, 2 µl 0.1M DTT and 1 µl ml RNase OUT TM added.
These contents were then mixed gently and placed on a water bath at 420C for 2 mins.
I µl of Super Scrip TM II was added and mixed by pipetting gently up and down and
then placed on a water bath at 420C for 50 mins. The reaction was terminated by
heating at 70 0C for 15 mins, I µl of RNase H added and incubated/heated at 37 for
200C mins. The cDNA was used as a template for amplification in PCR.
The SuperScript TM One-step RT Kit (Invitrogen, USA) was used for reactions with
CMV primers (virus sense 5’-CTC GAA TTC GGA TCC GCT TCT CCG CGA G-3’
and virus antisense 5’ GGC GAA TTC GAG CTC GCC GTA AGC TGG ATG GAC3’). The two-step procedure was used for potyvirus pimers (virus sense 5’-TGA GGA
TCC TGG TGY ATH GAZ AAY GG-3’ and virus antisense 5’-GCG GGA TCC
(T)15T(AGC)X-3’) In this procedure, the RT mix was incubated at 43C for 40min.
Eighty micro-litres of the PCR mix incorporated and ran through denaturation at 95C
for 3 min, 35 cycles of 95C for 1 imn, annealing at 45 C for 1 min 30s (1 min for
potyvirus primers), 72C for 1min (1min 30s for potyvirus primers) and final extension
at 72C for10min. The amplified DNA fragments were separated on 1% agarose gel,
visualized by a UV transilluminator and the gel image captured with a camera.
Results
Incidences and severity
In all the 9 surveyed districts there was presence of typical viral like symptoms on
passion fruit plants. These included vein clearing, leaf curl and roll, fruit hardening
and deformation, foliar mosaics, spot and /or diffuse chlorosis and crinkling. These
symptoms occurred singularly or in mixed presentations on plants. Thika district
90
recorded the highest average incidence of 62.2 while Meru had the lowest
respectively 11.0% (Table 1). Severity ranged from 1 to 4 in all surveyed areas (Table
1). Thika and Trans Nzoia districts had the highest severity of 4 while Murang’a and
Meru had the lowest of 1 respectively (Table 1).
Table 1. Incidence and severity of virus like symptoms in 8 districts surveyed
District surveyed
Murang’a
Thika
Bungoma
Trans Nzoia
Kisii
Nakuru
Molo
Embu
Meru
Average incidences (%)
20.40
62.20
41.50
48.40
31.40
45.45
47.80
48.00
11.00
Average severity (1-5)
1
4
3
4
3
3
3
3
1
When 46 samples were tested for the presence of potyvirus using potyvirus antisera
15 sample representing (32%) from all the districts were found to be positive to the
antisera (Table 2) indicating that there were potyvirus viruses. Thika district had the
highest number of those that tested positive followed by Trans Nzoia and Uashin
Gishu districts respectively (Table 2) while Bungoma district had the lowest
percentage of infected plants.
Table 2. Number of samples analyzed from different districts using antigen coated
plate-ELISA
District surveyed
Murang’a
Thika
Bungoma
Trans Nzoia
Uashin Gishu
Embu
Total
Percentage of
infected
No. of samples tested
12
6
6
7
8
7
46
samples
No. of samples positive to
potyvirus antisera
2
4
1
3
3
2
15
32%
Indexing for Cucumber Mosaic Virus
The house keeping genes concept was used to index for CMV from 15 positive
samples by first using Actin and Rubisco primers to ascertain the presence of good
quality RNA. PCR amplification of the cDNA showed the expected products 1%
agarose gel for all the samples tested indicating that RNA was present for all samples
91
tested (Figure 1). These samples were then indexed for presence of CMV using RTPCR protocols using two primer pairs specific to CMV (namely CMV1/CMV2 and
CMV3/CMV5). Following PCR amplification of the cDNA, the expected products for
CMV3/CMV5 were observed on 1% agarose gel for 3 out of 12 samples tested (Table
3). These were from Embu and Meru districts (Table 3).
Figure1. PCR amplification of the cDNA, as observed on 1% agarose gel for 7 of the
samples indicating that RNA was present for the test samples
M
M
1
2
1
2
3
4
5
6
7 ActinMprimer
3
4
5
6
7 RubiscoMprimer
Table3: Passion fruit samples that tested positive to CMV3/CMV5
Primers used
Sample No.
Sample ID.
District
CMVI/CMV2
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
C .1.1
J 1.4
M 1.2
A1
A 1.3
G 1.2
B 1.3
A1.3
G 1.5
F 1.4
F 1.4
M8
Embu
Meru
Meru
KARI-Embu
KARI-Embu
Meru
Embu
Embu
Meru
Meru
Meru
Meru
90
CMV3/CMV5
+
+
+
-
Figure 2. PCR amplification of the cDNA, as observed on 1% agarose gel showing
the expected products for CMV3/CMV5 for 3 out of 12 samples tested
12
11
10
9
8
7
6
5
4
3
2
1
M
Discussion
High virus disease incidences observed in all visited districts may be attributed to
conducive climatic conditions for disease development in this areas, limited
knowledge by farmers on disease management options and lack of resources for
disease control by most farmers in all the areas visited (Personal communication with
farmers). Lower disease incidences in Bungoma may be attributed to most orchards
being young relative to those in other regions and may be the virus had not set in
fully. It was also observed that viral diseases were more prevalent in areas where thrip
infestation was high. This could be the vector that is transmitting virus diseases.
Climatic conditions such as high temperatures and humidity play a role in this disease
development and spread (Agrios, 1997, Ssekyewa et al., 1999.) as it favours insects
mulitiplication.
Effective control is achieved when the spread of the disease is curtailed at an early
stage before the disease spreads to the entire plant. It was evident that most farmers
were not aware of this very important fact and most did nothing until the crop was
heavily infected leading to high incidences of the disease. Therefore disease scouting
must be re-emphasized in passion fruit production systems as a very important step in
production so that farmers can start implementing management strategies early
enough to minimize losses.
Conclusion
Accurate disease diagnosis is a prerequisite to proper management of diseases thus
enhancing sustainable passion fruit production and empowering rural communities
through wealth creation and employment. Further studies to determine the molecular
variability of the viruses associated with woodiness disease complex should be
undertaken as a step towards development of tolerant varieties as one of the
management options. This will contribute to incremental and sustainable growth of
the passion fruit industry that is at the verge of collapsing by availing disease-free
seedlings to local and neighbouring farmers to spur renewed interest in passion fruit
production by farmers thus increased rural employment at farm and nursery levels.
90
Acknowledgements
The authors thank USAID-IPM-CRSP project for financial support and Kenya
Agricultural Research Institute, Makerere University and Ohio State Universities for
technical support.
References
Chagas, C. M., E. W. Kitajima, M. T. Lin, M. I. Gama, T. Yamashiro (1981):
Grave moléstia do maracujá amarelo (Passiflora edulis f. flavicarpa Deg.) no Est.
Bahia, causada por um isolado de virus do `woodiness' do maracujá. Fitopatol.
Bras. 6: 259–268.
Crestani, O. A., E. W. Kitajima, M. T. Lin, V. L. A. Marinho (1986): passion
fruit yellow mosaic virus, a new tymovirus found in Brasil. Phytopathology 76:
951–955.
CIP International Potato Centre). 1999. Training Manual: Techniques in plant
virology-serology.
Clark, M. F., and Adams, A.N. 1977. Characteristics of the microplate method
of enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen
Virol. 34:475-483.
Colariccio, A., C.M. Chagas, M. Mizuki, J. Vega, and E. Cereda. 1987. Natural
infection of golden passion fruit with cucumber mosaic virus in Brazil.
Fitopatologia Brasileira 12: 254-257.
KARI. 2001. Annual Report, Kenya Agricultural Research Institute, Nairobi,
Kenya.
Lippmann, D. 1978. Cultivation of Passiflora edulis S. General information on
passion fruit growing in Kenya. German Agency For Technical
Cooperation,(GTZ).
McCarthy, A. 1995. Passion fruit culture. Farmnote 51.
MoA. 2005. Production and export statistics for fresh horticultural produce for
the year 2005. Ministry of Agriculture, Horticulture Division, Nairobi, Kenya.
MoA, 2003. Production and export statistics for fresh horticultural Produce for
the year 2003. Ministry of Agriculture, Horticulture Division Nairobi, Kenya.
Morton, J. 1987. Passion fruit. In fruits of warm climates. Miami Florida. pp
320-328.
New Zealand Passion fruit growers association Inc. 2007. Passion fruit. Katikati
90
New Zealand.
Njuguna, J. K., Ndungu, B. W., Mbaka, J. N. and Chege, B. K. 2005. Report on
passion fruit diagnostic survey.
Sutherland, J. A. and Kibata, G. N. 1993. Technical Report II KARI/ODA Crop
Protection Project, National Agricultural Research Laboratories.
Sutherland, J. A., Kibata, G. N. and Farell, G. 1996. Field Sampling Methods for
Crop Pests and diseases in Kenya; National Agricultural Research Laboratories.
Ssekyewa, C., Swinburne, T. R. Van Damme, P. L. J and Aburbakar, Z. M. 1999.
Passion fruit collar rot disease occurrence in major growing districts of Uganda.
Fruits 54:405-411.
Wasilwa, L. A., Wasike, V. W., Nyongesa, D., Gitonga, L., Nambiro, E. L., Muli,
H. A. Passion fruit diseases of economic importance in Kenya: research needs.
Kenya Agricultural Research Institute – 9th Biennial Scientific Conference,
Nairobi, Kenya. November 2004.
90
In vitro selection and characterization of salinity tolerant somaclones
of tropical maize (Zea mays L.)
Matheka Mutie Jonathan1, Esther Magiri1, Rasha Adam Omer
Machuka2
2,3
and Jesse
1
Department of Biochemistry, Jomo Kenyatta University of Agriculture and
Technology, P.O. Box 62000, Nairobi, Kenya. 2Department of Biochemistry
and Biotechnology, Kenyatta University, P.O. Box 43844, Nairobi, Kenya. 3
Agricultural Research Corporation, P.O. Box 126, Medani, Sudan.
Abstract
Tolerance to salinity was obtained in an open pollinated variety (KAT) widely grown
in the East African region and a dryland hybrid (PH01) by applying in vitro selection
and regeneration procedures. Immature zygotic embryos of KAT and PH01 plants
were cultured on N6 medium supplemented with 2mg/l 2,4-dichlorophenoxyacetic
acid to initiate embryogenic calli. Calli were then maintained for one month after
which time they were subjected to increasing concentrations of NaCl (between 0 and
2.9%) to determine the appropriate concentrations of selection pressure. The survival
and regeneration capacity of KAT and PH01 calli were significantly lower (p<0.05)
than those of their controls after exposure on both levels of NaCl. The genotype did
not influence the survival capacity of selected calli. However, KAT and PH01 were
found to differ significantly (p<0.05) in regeneration capacity.
Key words: Somaclonal variation, maize, salinity tolerance, RAPD.
Introduction
Maize, an important food crop in the world and in Africa in particular, has continued
to produce below its potential for several reasons, key among them being yieldreducing biotic and abiotic factors. Priority biotic challenges to maize production in
the tropical regions of Africa include insect pests e.g. stem borers, grain borers and
weevils (Ajanga and Hillocks, 2000), diseases e.g. common rust, Turcicum leaf blight,
maize streak virus (Schechert et al., 1999), and parasitic weeds e.g. striga (Kanampiu
et al., 2002). Drought and salinity are some of the major abiotic challenges to maize
production. In Kenya drought and salinity problems characterise over 80% of the
Kenyan land surface, thus classified as arid and semi arid lands (ASAL).In this study,
we used a stepwise procedure to isolate salt tolerant calli of Kenyan maize using NaCl
the selective agent. RAPD-PCR was subsequently used to screen plants regenerated
from the tolerant calli to confirm the genetic variations in the clones.
Plant materials and general methodology
Callus induction and maintenance from of two Kenyan maize genotypes, Katumani
composite B (KAT) and Pwani hybrid 01 (PH01) was done as reported by Oduor et
al. (2006). Friable embryogenic calli were isolated and transferred to fresh callus
initiation media (CIM) at 2-3 week intervals depending on growth rate. To determine
91
the survival capacity, calli were cultured on 25-30 ml of CIM enriched with the
selective agent. Four clones (designated ST JM1-01, ST JM2-01, ST JM3-01, and ST
JM4-01) from 4 different calli of PH01 that survived 0.75% NaCl-induced salinity
and one unselected (control) plant were chosen for random amplified polymorphic
DNA
(RAPD)
analysis.
Determination of optimum selection concentration of NaCl
Preliminary experiments were performed to determine the optimum concentrations of
NaCl used as initial selection levels and for exertion of artificial salinity. This was
done by determining the reduction in the fresh weight of one-month-old calli induced
from immature embryos of KAT. The calli were grown on CIM containing various
levels of NaCl (0, 0.6, 1.2, 1.8, 2.4, 2.9%). Five callus pieces weighing 200±50 mg
were used for every treatment level and replicated twice. The optimum NaCl level
selected was that which decreased the fresh weight of the selected calli by about 50%
relative to untreated calli (controls) after the fourth week.
In vitro selection for salinity tolerance
Following callus induction, the calli were grown on stress free CIM for 3 months to
generate somaclonal variation. They were then subjected to a step-up selection
scheme modified from Lupotto et al. (1988) (Fig. 1) to isolate the putative salinity
tolerant clones. Two levels of NaCl (0.6 and 0.75%) were used to impose salinity. A
total of 236 KAT and 192 PH01 embryogenic calli were screened for tolerance to
salinity. Selected calli (diameter ranging between 6-10 mm) of each genotype were
grown on 30 ml CIM containing 0.6% NaCl (level 1) for 3 passages (Fig. 1, stage 13), each lasting 21 days (Fig. 1, step 2). At every passage stage, embryogenic
outgrowths from surviving calli were excised and transferred to the same media
conditions. After the third subculture (stage 3), a pool of the tolerant somaclones was
transferred on maturation media (Oduor et al., 2006) for three weeks and
subsequently to shoot induction media (Oduor et al., 2006) (Fig. 1, step 6). Calli that
performed particularly well and were perfectly embryogenic were transferred on CIM
supplemented with 0.75% NaCl (level 2) (Fig. 1, step 4) to assess their ability to
tolerate higher salinity levels. These calli were subcultured three times at a three-week
interval on the level 2 (Fig. 1, stages 4-6). The entire selection period lasted a total of
18 weeks.
Regeneration of plants
For the regeneration of putative tolerant plants on salt stress-free media, procedures
described by Oduor et al. (2006) were followed. Putative salinity tolerant callus lines
obtained at stage 3 and stage 6 (Fig. 1) were evaluated for their ability to regenerate
shoots. Briefly, tolerant somaclones were transferred to callus maturation media for
maturation. Shoots were then induced from the mature calli on shoot induction
medium (SIM). The shoots obtained simultaneously formed roots but those that did
not were transferred to rooting medium (Oduor et al., 2006). Shoots were maintained
in rooting media until the roots were properly developed before being acclimatized.
Data collection
89
To determine the optimum concentration of NaCl to use for selection for salinity
tolerance, the fresh weight of the calli was determined and recorded at a seven-days
interval for four weeks. To determine the survival capacity, the number of calli
surviving 0.6 and 0.75% NaCl were counted and survival computed as the number of
calli surviving selection compared with the total number of calli cultured. To
determine regeneration capacity of selected calli shoots regenerated were counted
after attaining a length of 2 cm. The regeneration capacity of the calli was computed
as calli that regenerated at least a shoot compared to the total calli attempted for
regeneration. Regeneration frequency was computed on 15 randomly selected onegram pieces of calli as the percent number of shoots per regenerating callus.
Step1
Calli cultured on CIM for 3 months
Step2
Calli transferred to CIM+level 1 of
selective agent
Stage 1
Stage 2
Stage 3
Step3
Step4
Tolerant calli were obtained
Plantlets
Regenerate
Step6
Calli transferred to CIM+level 2 of
selective agent
Stage 4
Stage 5
Stage 6
Step5
Tolerant calli were obtained
Figure 1 Step up scheme for in vitro selection for salinity tolerance in clones of Zea mays L. CIM,
callus induction media = N6 (Chu et al., 1975) + 3% sucrose + 2 mg/L 2,4-Dichlorophenoxyacetic
acid: Each stage is 21 days at the end of which embryogenic outgrowths from surviving callus lines
were subcultured on fresh CIM supplemented with 0, 0.6, or 0.75% NaCl.
Data analysis
Differences in survival percentage and regeneration capacity between genotypes were
analysed by analysis of variance (ANOVA) using Genstat for Windows (Discovery
Edition). All percentage data were square root-transformed before analysis. Means
were separated at 5% significance using Least Significant Difference (LSD).
RAPD analysis
90
DNA extraction was carried out according to Saghai-Maroof et al. (1984). Genomic
DNA was isolated from 200 mg of leaf from five somaclones designated ST JM1-01,
ST JM2-01, ST JM3-01, and ST JM4-01 and one control plant. Agarose (0.8%) gel
electrophoresis was used to determine the quality of the DNA extracts. For optimum
RAPD-PCR reaction conditions, the protocol of Chin and Smith (1993) was first
modified as reported previously (Matheka et al., 2008). Six primers (Table 1) that
previously produced amplification on target DNA (Matheka et al., 2008) were chosen
and used in screening the DNA samples isolated from the salt tolerant somaclones.
All primers were from Operon Technologies Inc., USA. PCR reactions were
performed on duplicate samples of DNA from each somaclone and control as
described previously (Matheka et al., 2008).
Table 1. The number of fragments and polymorphic bands generated by the 6 primers
on the five DNA samples from the salinity tolerant and control plants. Dash
(-) denotes the absence of detectable amplification.
Primer
Sequence
OPA-07
OPC-02
OPD-08
OPD-20
OPU-19
OPU-20
Total
5’-ACCACCCGCT-3’
5’-GTGAGGCGTC-3’
5’-GTGTGCCCCA-3’
5’-ACCCGGTCAC-3’
5’-GTCAGTGCGG-3’
5’-ACAGCCCCCA-3’
Total number of
Fragments
5
4
9
4
7
29
Number
of
polymorphic bands
1
4
3
0
5
13
Results
Effect of different concentration of NaCl on callus fresh weight
To determine the sub-lethal level of NaCl for salinity exertion, calli were grown on
CIM supplemented with different concentrations of NaCl. Calli growing on 0.6%
NaCl had fresh weights of 52.76% of calli on stress-free medium. Calli exposed on
higher levels were observed to be arrested in growth, indicating the lethality of such
levels.
Effect of salinity on survival of callus
In comparison to unselected calli, the growth of KAT and PH01 calli on 0.6% NaCl
was greatly impeded after selecting for 3-5 weeks. Callus death, signified by the onset
of necrosis, was observed to start six weeks after selection, with total death occurring
at the end of the eighth week (Fig. 3A). Calli on 0.75% NaCl died, although at a lower
rate. Surviving calli were embryogenic and white in colour (Fig. 3A). The treatment
had a drastic effect on the survival capacity of the KAT calli, reducing it to between
8.96 and 25%, after 9 weeks of selection on 0.6%NaCl-containing medium. The
subsequent transfer of surviving calli to CIM containing 0.75% NaCl (Fig. 1, step 4)
followed by 3 passages on this medium (Fig. 1, step 5) gave survival percentages of
between 0.0 & 83%. On the other hand, PH01 callus growing on 0.6% NaClcontaining medium had their survival percentages reduced to between 10 and 37.5%.
90
Table 2. Effect of NaCl on survival and regeneration capacity of embryogenic KAT
and PH01 callus cultures.
Parameter
(%)
Survival
capacity
Regenerati
on capacity
NaCl
selectio
n level
(%)
0.6
0.75
0.6
0.75
KAT
Unselected
Selected
92.50±5.00a 17.72±3.27 b
83.33±4.17a 52.42±15.27a
94.50±7.87a 49.39±13.0b.
75.23±3.89a 40.00±13.8b
PH01
Unselected
Selected
87.50±5.59a 35.63±12.51b
83.33±4.17a 62.78±8.41a
85.11±6.54a 68.83±15.03a
85.81±5.04a 94.44±5.56a
Survival capacity did not differ significantly (p=0.203) between genotypes after
selection for 63 days on 0.6% NaCl-containing medium (Table 2). However stressselected calli of the two genotypes had survival capacities significantly lower
(p≤0.05) than that of control or non-stress selected calli. There were no significant
differences in survival capacity between stress-selected genotypes (p=0.584) or
between the stress- and non stress-selected calli (p≥0.05), after selecting on 0.75%
NaCl-containing culture medium (Table 2).
Shoot regeneration capacity of salt tolerant callus
After selection on 0.6% NaCl, a pool of surviving calli were transferred to CMM for 3
weeks then to SIM in pieces of about one gram to evaluate their shoot regeneration
capacity. All calli surviving the 0.75% NaCl selection level were also treated in a
similar fashion. Calli started to form green spots rapidly after 3 days in culture in
light. Emergence of shoots was delayed for 3-5 days, especially in the 0.75% NaClselected calli, compared to unselected calli. The 0.75% NaCl-tolerant calli germinated
shoots after 12-16 days. Unselected calli regenerated shoots after 7-14 days. Sixtythree days after culturing on 0.6% NaCl-containing CIM, surviving KAT calli
recorded regeneration capacities ranging from 0.0 to 75%. The pool of 0.6% NaClsurviving KAT calli transferred to CIM containing 0.75% NaCl had regeneration
capacities ranging from 20.0 to 66.67% after culturing for 63 days. In PH01, a sodium
chloride level of 0.6% lead to regeneration capacities ranging from 12.5 to 100%,
whilst 0.75% produced regeneration capacities of between 42.82 and 100%. The
average regeneration capacity of stress-selected PH01 calli was higher than that of
stress-selected KAT after selection in the two levels. Only on 0.75% NaCl was such a
difference significant (p=0.022) (Table 2). The average regeneration capacity of
nonstress-selected (control) calli was higher than that of stress-selected calli, but
significantly so only for KAT calli after selection on level 1(p=0.015) and level 2
(p=0.040) (Table 2).
Regeneration of putative salt tolerant plants
Unselected callus started to develop green color 2-5 days after transfer to light.
However a delay in greening in NaCl-selected callus relative to unselected was
observed, with some greening from 1-2 weeks after transfer to SIM. Shoots
germination response was also relatively delayed in selected calli, sometimes taking
up to four weeks for a distinct shoot to emerge. Regeneration frequency of the two
90
genotypes in selective and nonselective conditions is shown in Table 3. The data
indicate that unselected calli regenerated shoots at higher frequency than selected
calli. Additionally, the frequencies of shoot regeneration by stress selected PH01 calli
were higher than those of stress selected KAT calli.
Table 3. Shoot regeneration frequency of salt selected and unselected KAT and
PH1calli
NaCl selection level (%)
KAT
PH01
0.6
Unselected
57.81
Selected
17.58
Unselected
43.75
Selected
52.00
0.75
108.59
21.72
33.98
52.96
The majority of salt selected PH01 and KAT calli developed shoots and roots
simultaneously on SIM (Fig. 3B), but roots were less abundant on this media
compared to RIM. Some of the surviving shoots produced a well pronounced rooting
system with densely arranged hairy roots on SIM after 2-4 weeks, but majority failed
to root on this medium but rooted well after transfer on RIM. Plants with a welldeveloped root system were hardened (Fig. 3C and D) according to Oduor et al.
(2006) before transfer to the screen house. Most of the plantlets survived hardening
and were transferred into the soil in the screen house and maintained to maturity (Fig.
E). The most commonly observed abnormalities in salt-selected regenerants were
tussel ear formation and dwarfism (Fig. 3E), and albinism (Fig. 3D). Despite the
observed abnormalities, plants grew to maturity and set seeds (Fig. 3F).
90
A
D
B
C
E
F
Figure 3. In vitro selection, regeneration and screen house growth of putative salt
tolerant plants. (A) In vitro selection showing surviving (cream coloured) and dead
(dark brown coloured) calli of KAT after growing on 0.6% NaCl-containing medium
for 9 weeks. (B) Regeneration of shoots from putative salt tolerant calli of PH01. (C)
PH01 plantlets growing on peat moss 5 days after commencement of hardening. (D)
An albino plant regenerated from a salt tolerant KAT calli. (E) Mature salt selected
plant showing dwarfism and tussel ear abnormalities (F) R0 seeds from putative
salinity tolerant plants.
Figure 4: Polymorphic RAPD amplification of control and salt selected somaclones
of PH01 maize with the decamer primer OPD-08. Lane M: 1 kb ladder; Lane 1:
control unstressed plant; Lane 1-4: salinity tolerant variants ST JM1-01, ST JM2-01,
ST JM3-01, and ST JM4-01; Lane 5: control amplification without DNA;
MC 1 2 3 4 5
1000
750
750
500
RAPD analysis
250 bp
90
Out of the 6 primers assayed, five produced amplification of the target DNA template
(Table 3). RAPD analysis resolved 29 scorable bands out of the six primers screened.
Primers produced between 0 and 9 amplification products, which ranged 0.30 to 1.5
Kb. Out of the 29 bands, 16 were monomorphic across all the tolerant and control
samples (Table 1). Although the primers produced some polymorphic bands, none
could be used to discriminate the tolerant and control plants except the primer OPD08 (Fig. 4).
Amplification products with primer OPD-08 (Fig. 4) showed the absence of a 750 bp
band in the control plants. However, this band was present in the tolerant clones ST
JM1-01, ST JM2-01, ST JM3-01 and ST JM4-01. Additionally, a band intensity
polymorphism was observed in the control plants whereby two bands had a relatively
higher intensity compared to similar bands in the selected plants (Fig. 4).
In conclusion, in vitro selection was successfully used to isolate salinity tolerant cells
of tropical maize. The RAPD profile revealed genetic polymorphism between the
selected salt tolerant lines from the control plant, implying that tolerance to salinity of
the cell lines may have genetic basis. Sequencing of the 750 bp marker band in the
variants ST JM1-01, ST JM2-01, ST JM3-01, and ST JM4-01 can help in firmly
establishing the genetic mechanism responsible for tolerance to salinity in these
variants.
Acknowledgement
The work reported here was accomplished through the financial support and facilities
at the Rockefeller Foundation-funded Plant Transformation Facility at Kenyatta
University. The authors are also grateful to Mr. Duncan Ogweda for the field and
screenhouse care of maize plants.
References
Aguiar-Perecin M.L.R., A. Fluminhan, J.A. Santos-Serejo, J.R. Gardingo, M.R.
Bertao, M.J.U. Decico and M. Mondin, 2000. Heterochromatin of maize
chromosomes: structure and genetic effects. Gen. Mol. Bio., 23(4): 1015-1019.
Ajanga S. and Hillocks R. J. (2000). Maize cob rot in Kenya and its association with
stalk borer damage. Crop Protection, 19:297-300.
Almansouri M., J.M. Kinet and S. Lutts, 2001. Effect of salt and osmotic stresses on
germination in durum wheat (Triticum durum Desf.). Plant and Soil, 231(2):
243-254.
Chin E. and S. Smith, 1993. Cycling parameters for RAPD in maize. Maize Genet.
Coop. News Lett., 67: 61.
90
Chu C.C., C.C. Wang, C.S. Sun, C. Hus, K.C. Yin, C.Y. Chu and F.Y. Bi, 1975.
Establishment of an efficient medium for anther culture of rice through
comparative experiments on the nitrogen sources. Sci. Sin., 18: 659-668.
Dolgykh Y.I., S.N. Larina and Z.B. Shamina, 1992. Use of tissue culture to test plant
resistance to abiotic stresses. Maize Genet. Coop. News Lett., 66: 82.
aeppler S.M., H.F. Kaeppler and Y. Rhee, 2000. Epigenetic Aspects of Somaclonal
Variation in Plants. Plant Mol. Bio., 43: 179-188.
Kanampiu F., J. Ransom, J. Gressel, D. Jewell, D. Friesen, D. Grimanelli, and D.
Hoisington, 2002. Appropriateness of biotechnology to African agriculture:
Striga and Maize as paradigms. Plant Cell Tiss. Org. Cult., 69:105-110.
Liu S., Z. Guo and X. Peng, 2003. Effects of ABA and S-3307 on drought
resistance and antioxidative enzyme activity of turfgrass. J. Hort.
Sci.Biotech., 78(5): 663-666.
Matheka J.M., E. Magiri, O.A. Rasha and J. Machuka, 2008. In vitro selection and
characterisation of drought tolerant somaclones of tropical maize (Zea mays L.).
Biotechnology-1325-BTC-ANSI (article in press).
Mohamed M.A.H., P.J.C. Harris and J. Henderson, 2000. In vitro selection and
characterisation of a drought tolerant clone of Tagetes minuta. Plant Sci.
(Shannon), 159(2): 213-222.
Muhammad L. and E. Underwood, 2004. The maize agricultural context in Kenya. In
Environmental risk assessments of genetically modified organisms: A case study
of Bt maize in Kenya. Edited by A. Hilbeck and D.A. Andow. CAB
International, Wallington, UK, pp 21-56.
Nzaro M.G. 2007. Effect of long term culture and stability of regenerants of three
Kenyan hybrids and an open pollinated variety. MSC thesis, Kenyatta
University, Kenya.
Oduor R. O., Ndung'u S., Njagi E. N. and J. Machuka, 2006. In vitro regeneration of
dryland Kenyan maize genotypes through somatic embryogenesis. Inter. J. Bot.,
2(2): 146-151.
Rasha A.O., A.M. Abedelbagi, J.M. Matheka and J. Machuka, 2008. Regeneration of
Sudanesse inbred lines and open pollinated varieties. Afri. J. Biotech., 7(11):
1759-1764.
Saghai-Maroof M.A., K.M. Soliman, R.A. Jorgensen, and R.W. Allard, 1984.
Ribosomal DNA spacer-length polymorphisms in barley: mendelian inheritance,
chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. USA.,
81: 8014–8018.
Schechert A.W., H.G. Welz and H.H. Geiger, 1999. QTL for resistance to Stesphaeria
turcica in tropical African maize. Crop Sci., 39: 514-523.
90
DEVELOPING
SUCCESSFUL
CRYOPRESERVATION
PROTOCOLS FOR SHOOT TIPS AND NODAL BUD EXPLANTS
OF TROPICAL SPECIES Dioscorea rotundata (YAMS)
Marian. D. Quain
Marceline Egnin4
1, 2, 3*
, Elizabeth Acheampong2 , Patricia Berjak1, and
1
School of Life and Environmental Sciences, University of KwaZulu-Natal,
Howard College
2
Tissue Culture Laboratory, Department of Botany, University of Ghana,
Legon, Accra Ghana
3
Biotechnology Unit, CSIR-Crops Research Institute, Box 3765, Kumasi,
Ghana.
4 Plant Biotechnology and Genomics Research Lab, Tuskegee University,
Tuskegee, Alabama, USA
Abstract
Dioscorea rotundata is a major staple food in West Africa. Yams are traditionally
cultivated vegetatively using the whole tuber or relatively large tuber piece, or
minisett, to generate true-to-type progeny. There is thus the need to carry out studies
on the use of shoot tips and axillary buds as sources of planting material and its
conservation, using cryopreservation as a complementary preservation technique for
long-term storage of germplasm, since conservation on slow grow medium serves
only short to medium-term purposes. Explants (shoot tips and axillary buds) from in
vitro maintained cultures were subjected to vitrification-based cryopreservation
protocols. Based on explants surviving vitrification treatment, there was 72 and 36%
survival following cooling both to -70ºC, and -196ºC respectively when tested with
tetrazolium salts. This protocol can therefore be effectively adapted and used in
national programs for conservation of different yam varieties.
Keywords: Dioscorea, cryopreservation, germplasm, molecular, ultrastructure
Introduction
Dioscorea rotundata (white yam) is a perennial monocotyledonous climber with
underground tubers, belonging to family Dioscoreaceae (yam) which is considered to
be among the oldest recorded food crops. In West Africa, the collection and
domestication of yam began as early as 50 000 B.C., the Paleolithic era (Davies
1967), before the introduction of cereals and grains. It is estimated that yam-based
agriculture started approximately, 3000 years B.C. in West Africa. Dioscorea
rotundata, D. cayenensis and D. domentorum are the earliest domesticated yams in
West and Central Africa.
Seed production and viability is a major constraint in yams. There may be no embryo
or endosperm, poor pollination, and fertilization. Also, seeds may also be shrunken or
undersized (Doku 1985). The use of yam seeds for propagation does not give rise to
true-to-type progeny. This thus warrants studies on the use of shoot tips and axillary
buds as source of planting material and conserve the germplasm. Traditional
conservation is by means of bulky tuber in yam barns, and in the field as plantations.
91
In vitro slow growth tissue culture methods have been used in conserving the
germplasm, however, it serves only short to medium-term storage purposes.
Plate 1. Yam cultures generated from cryopreserved explants
The RAPDs profiles did not reveal polymorphism or variation in the DNA obtained
from the cryopreserved and non-cryopreserved yam accession PS 98 013 as indicated
in Plate 2.
The RAPDs profiles showed an average of 13 scorable bands per primer and the
bands were in the range of 900 to 200 bp.
M
C
1
2
1000bp
Plate 2. Amplification profiles with RAPDs
primers Lanes; M-100bp ladder; C-control,
1-PS 98 013 (D. rotundata), 2-PS 98 013 cryopreserved (D. rotundata), there were
no polymorphic bands observed.
100bp
92
The use of electron microscopy revealed that, following cryopreservation, explants
surviving has well constitute ultrastructure (Plate 3).
M
N
N
S
V
P
Gb
Plate 3. Ultrastucture of yam following MPVS2 treatment with cooling reveals wellconstituted cells with occurrence of mitochondria (M), Golgi bodies (Gb), nuclei (N),
vacuoles (V) and starch grain (S) deposits in plastids (P).
Conclusion
Cryopreservation of Dioscorea species is possible using Vitrification – based
protocols. The described protocol is simple and can be easily utilized in laboratories
with limited resources. The cryopreservation techniques used do not compromised the
genetic integrity of germplasm and the ultrastructure is not distorted.
References
Egnin, M., A. Mora and C. S. Prakash, (1998). Factors Enhancing Agrobacterium
tumefaciens-Mediated Gene Transfer in Peanut (Arachis Hypogaea L.). In Vitro
Cellular and Developmental Biology-Plants 34, 310-318.
Murashige T & E. Skoog (1962) A revised medium for rapid growth and bioassays
with tobacco tissue cultures. Physiologia Plantarum 15, 473 – 497.
Spurr, A. R. (1969). A low-viscosity epoxy resin embedding medium for
electromicroscopy. Journal of Ultrastructure Research 26, pp. 31-43
93
Challenges and opportunities in the Development of
Biotechnology in a Developing Country: A scientist experience.
Marian. D. Quain
Biotechnology Unit, CSIR-Crops Research Institute, Box 3765, Kumasi,
Ghana.
md.quain@cropsresearch.org, marianquain@hotmail.com
Abstract
This presentation outlines the challenges faced in the development of these techniques
in a developing country using limited resources. The ability to convince others to
accept the technique has been very challenging, as well as the limited acceptance of
the technology. The challenges faced as we started with very little to develop a
working system which ensures maximum application of the various techniques,
getting local artisans to design some laboratory supplies are also outlined in this
presentation. Effective collaboration with advanced laboratories has greatly enhanced
the development of the various Biotechnology tools in Ghana.
Keywords: Biotechnology, tools, techniques, challenges, tissue, culture
Introduction
This presentation outlines the challenges faced in the development of biotechnology
tools in a developing country using limited resources. The ability to convince others
to accept the technique has been very challenging, as well as the limited acceptance of
the technology. The challenges faced as we started with very resources little to
develop a working system which ensures maximum application of the various
techniques, getting local artisans to design some laboratory supplies are also outlined
in this presentation. Effective collaboration with advanced laboratories has greatly
enhanced the development of the various Biotechnology tools in Ghana.
Challenges and Opportunities as a BSc. and Masters Biotechnology Student
“Tissue culture is possible because a single unit of cell is the starting point for
complex events occurring in life cycles. The plant cell is known to be totipotent and
that, it contains all the information necessary to regenerate the whole organism.
Harberlandt (Thomas and Davey, 1975) realized that since plant cells are totipotent,
on isolation, and altering their environment and nutrient, a cell should be able to
recapitulate the developmental sequence occurring in intact plants and develop”.
These are some of on the statements I heard during my plant physiology lectures
which opened my curious mind to exploring the tools available in tissue culture, such
as callus culture, anther and pollen culture, cell culture, embryo culture, organ culture,
meristem culture and embryo culture.
Attempts by my university project supervisor to start running the tissue culture
laboratory in the previous years had come to no fruition. In the 1990/91 academic
year, however, when I had to choose an area for my dissertation, I approached Dr.
Elizabeth Acheampong and she was very excited to know that I was prepare to take
94
up the challenge to do tissue culture. The Department of Botany released one of the
laboratory spaces for the laboratory to start operation. Below are the items that we in
the laboratory the first day I entered the lab.
Table 1. minimum equipment and supplies for starting tissue culture work
Item
1
2
3
4
5
6
7
8
9
10
11
12
13
14
Description
Refrigerator
Hotplate and stirrer
Magnetic stir bar
Magnetic stir bar retriever
Measuring cylinder (25, 50, 100, 250, 1000 ml)
Beaker (250, 500, 1000 ml)
Laminar flow cabinet
Laboratory stools and benches
Dissection kit
Burner for alcohol
Course Balance
Chemicals for the preparation of Murashige and Skoog’s medium
10 l aspirator
Shelve with fitted fluorescent lamps for incubation
Quantity
1
1
10
1
1 each
1 each
1
Enough
2 sets
1
1
Enough
1
4
The above information (table 1) indicates how much limited resources one can start
work with. The equipment listed below were shared with other users on different
projects. This may not be the ideal situation. However, it can get you started and you
can used your outputs to source for funding to purchase equipment that will be used
only by the facility especially those that my expose your work to contaminations.
Table 2. Equipment and instruments that were shared with other users
Item
1
Equipment
PH meter
2
Autoclave
3
Dissection microscope
4
Analytical balance
5
Camera
6
Water distilling plant
Location/comments
One at a central point for the whole Department-cited
approximately 30 m from tissue culture laboratory. The
same instrument was used by the microbiology and
ecology students.
One at a central point for the whole Department-cited
approximately 20 m from tissue culture laboratory. The
microbiology students used the same equipment
Borrowed one from the anatomy laboratory whenever we
had to do meristem cultures.
Chemistry department which was approximately 200 m
away from tissue culture laboratory. Used it to weigh
micro nutrients and growth regulators.
Department had one which could be borrowed. When
others take it to the field, cultures had to be taken to
archeology department or another institute to use their
photography equipment especially for microscopic
imagery.
At a central point in the department, about 35m from the
tissue culture laboratory.
95
A typical day on my project work was assemble the following Murashige and Skoog’s
(MS) microsalts, vitamins (Murashige and Skoog, 1962), glassware, alcohol (for
cleaning or dissolving growth regulator), tissue, weighing paper, distilled water and
go to the chemistry department to use analytical balance to weigh microsalts and
growth regulators for the preparation of the stock solutions.
Macrosalts stock solutions were, however, prepared in my laboratory for storage.
Glassware in the laboratory was limited so my supervisor brought up the slogan “beg,
steal or borrow” glassware for our work in the laboratory. Since we did not have
tween 20, we used liquid soap during surface sterilise. Sucrose for media was regular
sugar form the supermarkets. Overcoming in vitro fungal and bacterial
contaminations was very crucial. These experiences were very challenging since my
colleagues had made great advances in their project work while I was still battling
with getting clean cultures. Stringent asceptic rules were thus applied and these
included sterilizing water, instruments, glassware, practically everything before use in
the laboratory to ensure cultures were clean. With these in place, and the use of
meristem cultures, we had for the first time, in vitro growth of cocoyam and yam from
meristem, shoot tip and nodal cutting cultures growing into whole plantlets. Seeing
my first shoot sprout was however very rewarding and fulfilling as having the
opportunity to be the first student to have ever used tissue culture technique in a local
university. Making a grade A in my project work (Ashun, 1991) my supervisor
proudly refer to me as the “first-home-grown-tissue culture scientist”.
Following my first degree, I had the opportunity of introducing the tissue culture
techniques to students during their under graduate studies, in practical such as
embryogenesis from leave explants, and embryo culture as a teaching assistant in my
department. I worked on the following crops Dioscorea species, Xanthosoma species,
cowpea, tobacco, orchids, plantain, banana, cocoa and some other ornamental crops as
a teaching assistant. I further pursued my masters degree (Ashun, 1996). This earned
me recognision by colleagues of my supervisor who wanted a tissue culture specialist
to work with on their project. I had the opportunity to visit IITA on attachment, and
also, participate in a regional training workshop in Nigeria. It is worth noting that
since I completed my masters, my supervisor has been able to win funding from the
UNU/INRA to put up a new tissue culture facility and provide all that is needed for
under one roof in a proper set up.
Experiences, Challenges and Opportunities On the Job as Research Scientist
On joining my present, I realized that all the basic equipment and supplies for tissue
culture were available, but they were not in use the technique. It was a great
opportunity for me seeing all that I needed for tissue culture, under one roof instead of
the situation at my university where I had to move from room to block during media
preparation. It was challenging, organizing all the equipment with the help of the
supporting staff. I, however, had to share laminar flow cabinet with the microbiology
group, and unfortunately the growth cabinets I was using were also located in the
same room as the laminar flow cabinet. It was therefore very challenging dealing with
contaminations. I therefore lobbied with the authorities, who managed to relocate the
microbiology group and furnished them with a laminar flow cabinet.
Tissue culture is a technique that needs reliable supply of consumables and this
implies ensuring having consistent source of funds. I realized my institute allocate
89
funds on commodity basis I therefore approached the various scientist leading
research activities of the different crops. I presented to them how tissue culture can
complement their conventional practices and the advantages. This earned funding on
citrus, mango, musa, yam, cocoyam, and cassava project activities. I had the
opportunity to introduce and train scientist and technical staff numbering about five
within my first year of joining the institute with practical experience in tissue culture.
Typically, on training my technical staff to daily inspect culture for contamination, I
had to assist them to draw a clear line between contamination and callus development
since some callus cultures were once discarded as contamination. Students from the
university in the city where my institute is located also had the opportunity of having
a first time exposure to the technique since their university did not have a tissue
culture laboratory at that time. With a functional tissue culture laboratory, other
scientist in the institution could apply for and participate in biotechnology training
courses and workshops. I had the opportunity to introduce the technique to a Gambian
student who worked on mango for his MSc degree.
Starting the tissue culture laboratory in the institute, it was very challenging to release
my first set of plantlets through the screenhouse to the breeders on the field as clean
planting material. I had to improvise an ordinary net house with the help of local
artisans as a screenhouse for hardening tissue culture generated planting materials.
Through this however, West African Seed Development Unit, a GTZ and IITA
sponsored project expanded the tissue culture facility to facilitate the generation of
clean planting material of vegetatively propagated crops. The project also provided a
screenhouse for the tissue culture facility. Following this, we were able to offer
training in the handling of tissue culture raised clean planting material for agriculture
extension officers. It was the first time they had seen the technology and having seen
the product in the field, couple with higher tuber yield than their regular planting
materials. They were very convinced and advocated for implementation of projects
that will promote the use of the tool.
Pursuing PhD Studies: the Challenges and opportunities
Participating in international biotechnology training courses, introduced me to the
numerous tools in biotechnology, realizing the need to pursue a PhD to acquire more
tools for application. I found it very challenging finding funding to be trained in the
application of these other techniques in our research. Through funding obtained from
the Third World Organisation for Women in Sciences (TWOWS), I carried out certain
aspects of my PhD research at the University of Kwa-Zulu Natal under the
supervision of Professor Patricia Berjak. I had registered with my local university for
the studies but needed to work with an expect in cryopreservation. Working in her
laboratory for more than one and a half years was to me a luxury since all reagents,
consumables chemicals and equipment we at my disposal. Any supplies needed were
available, once the order had been made within a matter of day.
This exposure encouraged me that though in Ghana we are not at that stage yet, we
are at least at the starting point. We definitely cannot have it all right at the beginning
and there is actually hope for us. To apply molecular biology techniques to my PhD
studies, I joint the biotechnology laboratory in Tuskegee University, Alabama, USA
under the supervision of Dr. Marceline Egnin. Their facility though in an advanced
country is not complex and knowing where I was coming from, Dr. Egnin trained me
90
from the basics so that back home with the minimum facility I can perform as a full
fledged biotechnologist. After a 10 month training, I gained expertise in molecular
characterization, somatic embryogenesis, and plant transformation, working on
Peanut, Dioscorea specie, Solenostemon rotundifolius, and Sweetpotato having had
hands-on experience during my training.
Transfer acquire techniques to your home country
Returning to Ghana in December 2005,
I was at my home institute in January 2006. Again, I was ushered into a room with all
the basic equipment for molecular biology laboratory. The challenge this time was to
start a molecular biology laboratory to facilitate the breeding programs. Thus in
addition to the tissue culture laboratory, a complete biotechnology outfit would be
developed. Together and with the assistance of other colleagues who had exposure to
molecular biology, we can presently boast of a functional molecular biology
laboratory. The challenges never stop and this is a clear indication that the full
potential of the application of biotechnology in Ghana is yet to be unraveled and it all
begins with a decision to walk where others have not walked before in order to make
discoveries.
During my studies at the Tuskegee University, I was hinted by my institute back
home that, I will have to start the molecular biology outfit, once I got back.
Discussing this with my supervisors at Tuskegee, I was sent home at the end of my
stay, with the basic consumables for the molecular biology laboratory. Back home,
most of our buffers are prepare in the laboratory. Our first attempt to isolate DNA and
use Random Amplification Polymorphic DNAs (RAPDs) Polymerase Chain Reaction
(PCR) marker was very successful. We have since optimized DNA isolation protocols
for most of the institutes mandate crops. We have had students working on their
molecular based project work in the lab, and we have also collaborated on other
institutions on training their staff and being involved in project work. These efforts
convince my research organization CSIR to invest research funds in the technology.
The laboratory has since been equipped with more instruments, consumables, and
supplies, including computers and vehicles.
More Challenges
Being on the job, one big challenge has been the local availability of laboratory
supplied. Any opportunity for me to travel presents an opportunity to shop for the
laboratory. Biotechnology literature is also woefully inadequate in our libraries since
most of the traditional journals are not based on biotechnology. Equipment are also
not available locally and actually everything is imported. My university supervisor
and I have however had some carpenters, and welders locally producing test tube
racks for cultures. Glassblowers have also been contracted to produce thick wall test
tubes that will pass for any catalogue. And test-tube closures have been improvised by
wrapping nonabsorbable cotton wool with aluminium foil.
Electricians wiring incubation rooms have been directed by us to remove heating
components of fluorescent tubes and place them outside the laboratory. Automatic
electricity cut-out when temperature of the laboratory rises above the maximum safe
91
for the cultures have also been designed for the laboratories. A private commercial
farmer was also introduced to tissue culture by my university supervisors’ (Dr.
Elizabeth Acheampong) team and I in 2002. The farmer has since set up a private
tissue culture laboratory in Ghana, which happens to be the first in the country.
Setting up the laboratory came with several challenges (Quain, 2002), expertise from
ARC South Africa however helped in streamlining the running of the facility’s
operation.
Way Forward and Conclusion
Presently, there is the West African Agriculture Productivity Program (WAAPP),
based on root and tuber crops and my institution has been selected as the national
center for specialization in biotechnology. This is putting up over a million US Dollar
facility to house laboratories of the institute, with the biotechnology facility as the
main focus. This facility will offer training for scientist and students in the sub-region.
I am hopeful that at such a forum others will be encouraged that there is hope for
biotechnology in Africa. As the challenges we face in the development of
biotechnology are brought to the fore, assistance will be made available. Policy will
be structured to remove the bottlenecks; we face such as acquiring consumables.
Suppliers will stock our reagents and consumables for ease of obtaining regular
supplies and funds for will be forthcoming. The potentials of biotechnology are yet to
be unraveled and the opportunities are numerous. One may not have it all right from
the start, however, you have to get started no matter how little you have because if
you don’t get going no one will help you and nobody will follow you. Believe in what
you
can
offer
and
give
it
your
best.
References
Ashun, M.D. (1991). Effect of various Hormonal (Growth regulators) combinations
on in vitro sprouting of various species of Dioscorea under light and dark conditions
B.Sc. dissertation, Department of University of Ghana - Legon.
Ashun, M.D. (1996). In vitro studies on micropropagation of various yam species
(Dioscorea species) M.Phil. Thesis submitted to University of Ghana – Legon.
Murashige T & E. Skoog (1962) A revised medium for rapid growth and bioassays
with tobacco tissue cultures. Physiologia Plantarum 15, 473 – 497.
Quain, M.D., E. Acheampong and B. Asante (2005). The use of tissue culture
techniques to improve private sector commercial farming: The challenges being
faced. – In West Africa Seed and Planting Material Newsletter of the West Africa
Seed Network (WASNET). Issue No. 14.
Thomas, E. and M.R. Davey (1975). From Single Cells to Plants. Wykeham. London.
92
FORMULATION OF CAPSAICIN AS AN ANALGESIC
Manoj Hariharan1.. Anubama Rajan2., Vijayashree Nayak3 and Abhinandan
Dev4
1
Department of Biotechnology, Rajalakshmi Engg college,Chennai,India
E-mail: manojhariharan@gmail.com
2
Department of Biotechnology,Rajalakshmi Engg college,Chennai,India
3
4
Abstract:
Researches on finding a better analgesic have been going on in various institutions at
great scales. Natural organic compounds like capsaicin were known for its pain
relieving effects since ages. Since the real causes of the diseases are unknown
symptomatic pain relievers are being given for treatment. Natural substances like
pepper, chili were known for its anti inflammation and pain relieving effects since
ages. This paper aims at extracting the organic compound which is responsible for
anti inflammation and analgesic property. The lipo organic compound capsaicin is to
be extracted and can be given to patients in the form of tablets or capsules using
enteric coated drugs also comparing its potential with other conventional analgesics.
The level of toxic substance is considerably less when compared with synthetic
analgesics like aspirin. Capsaicin has got many proven medicinal properties like
reducing the allergic reactions, congestion, ulcers, flatulence, antibacterial, anticancerous etc. Due to all these properties Capsaicin can work as a better analgesic and
is also cost effective.
Keywords: Capsaicin, analgesic, lipo-organic compound, congestion ,inflammation
INTRODUCTION:
Capsaicin (8-methyl-N-vanillyl-6-nonenamide)
Chilies and pepper are one of the world’s most important spices. When these
substances are taken inside the body the protein capsaicin present in it, does several
things. It blocks the nerve growth factor(NGF) which helps in the production of
substance P(SP),which transmits all pain signals through out the body. Where
substance P is an 11-aminoacid polypeptide with the sequence: Arg Pro Lys Pro Gln
Gln Phe Phe Gly Leu Met. Substance P is a neuropeptide: a short-chain polypeptide
that functions as a neurotransmitor and as a neuromodulator. It belongs to the
tachykinin neuropeptide family. It causes a massive release of SP from hypothalamus,
which at first though increases the pain later diminishes. By producing such a
depletion of SP from hypothalamus, pain signals no longer are able to get to brain. It
also boosts up the production of endorphins, the natural pain killer produced by the
body after exercise. It acts on the nociceptors and switches it off temporarily by
90
continuous influx of ions. Anti inflammatory property: Reduces inflammation by
influencing arachidonic acid metabolism, collagenase, elastase, hyaluronidase, which
acts as the precursors for pro-inflammatory mediators such as eicosanoids.
Mechanism of Action Of Capsaicin In Trpv1
•
VANILLOID RECEPTORS
1. Vanilloid receptors or capsaicin receptors belongs to TRPV(Transient
Receptor Potential Vanilloid 1 receptor)
2. These contain non voltage gated ions which are involved in sensory
signaling.
3. These pathways are activated at temperature>43 degree Celsius and
strong acidic conditions, that is pH less than 6.
•
ACTIVATION OF CATION CONDUCTANCE
1. Capsaicin , the lipo organic compound present in chilli are the
receptor molecules of TRPV pathway.
2. The non selective pathway of cation channels gets opened as soon
they bind.
3. It excites neurons involved in pain transmissin by activation of cation
specific channels.
4. This causes the influx of sodium, calcium and potassium ions and
thus causing very high depolarization level.
5. Next, it activates all the calcium ion dependent outward current and
inhibition of voltage gated ionic gates.
6. This causes desentisation of all the pain transmitting neurons.
7. Thus it temporarily switches off or kill the nociceptors by continuous
influx of ions.
8. Its activity is restricted only to the nerves involved in pain
transmission.
Materials and Methods:
We are now going to discuss about the methodology involved in the formulation of
capsaicin as an analgesic. The first step in this process is extraction of capsaicin .
Extraction. 10g of finely chopped chilli or powdered fresh pepper is to be taken for
extraction. Acetonitrile can be used as solvent for extraction. Vacuum filtration flasks
91
with Buchner funnels are used to remove insoluble plant parts. The volume of the
extract must be 25 ml (Volume must be measured exactly, if necessary rinse with 5 ml
more ACN). 1 ml of the extract is transferred to a 10 ml volumetric flask and dilute
till10 ml mark with deionized water. This diluted sample must next be cleaned up for
analysis.
Extraction Equipment:
Mortar and Pestle , Tissue Grinder (Blender), Soxhlet Extractor (Requires at least 1-2
hrs of extraction. Followed by time for solvent reduction.), Sonicator Bath and
Separation Flasks (Liquid-Liquid extraction).
Cleanup: A C-18 solid-phase extraction cartridge is conditioned each with 2 column
volumes of ethanol, acetonitrile, deionized water. Centrifuge out all of the water and
add 10 ml of diluted extract to the column. Flow through the cartridge should be
adjusted less than 5 ml per minute. Care must be taken not to let the cartridge go dry
during conditioning. Elute the capsaicinoids from the solid-phase extraction
cartridge with 4 ml of methanol followed by 1 ml of ethanol containing 1% acetic
acid.
Analysis: Analysis of the extract will be carried out by reverse-phase HPLC with UV
detection at 281 nm (optimizes for capsaicin) or with a diode-array detector, C-18
stationary phase or either acetonitrile or ethanol: water Mobile phase. It will
quantitate by calibrating the HPLC with standard solutions of capsaicin.
High-Yieldmethod:
Mix the dried peppers with the oil of choice. Set the chiller to keep the oil below
about 160F and let it grind for a few hours in colloidal mill. Vacuum filter the
oil/pepper mixture through a 25u prefilter then through a 5u coarse filter and then
finally through a 0.5 u absolute filter maintaining about 150F to keep the oil thin .
It can also be extracted by hydro distillation and acetone extraction of dried pepper.
Results and Discussion:
Three modes of capsaicin metabolism which are oxidation by hepatic mixed-function
oxidase systems, oxidation through radical formation, and non-oxidative metabolism.
Capsaicin-hydrolyzing activity was found highest in the liver, followed by the kidney,
lung, and small intestine. Hydrolysis of the amide linkage produces vanillyamine,
which is later reduced to vanillyl alcohol(activation of prodrug to biologically active
form by phase1 metabolism).The liver cytochrome P450 E21 (CYPE21) activity is
responsible for converting capsaicin into a phenoxy radical that either dimerizes or
covalently binds to CYPE21, inactivating the enzyme(phase2).
Thus, capsaicin absorbed in the intestine and liver reaches reaches the central nervous
system almost exclusively in the form of degradation products .Capsaicin and its
analogs are rapidly absorbed by non active process and readily transported by portal
vein to CNS from the gastrointestinal tract. The unabsorbed drugs are excreted via
kidney in the form of urine(assited by rennin angiotensin mechanism).The half life of
90
capsaicin can be calculated using this formula: t ½=0.693V/Cl where V- volume of
distribution and Cl- system clearance.
After extracting the capsaicin, it needs to be formulated in the form of tablets . It is
given in the form of enteric coated drugs such that it remains intact in stomach but
quickly release the drug in intestine. It is enteric coated to protect acid liable drugs
from the gastric fluid and to prevent gastric distress or nausea due to irritation from
capsaicin. Substances like cellulose acetate phthalate, polyvinyl acetate phthalate and
hydroxyl propyl methyl cellulose pthalates are used. All these have a common feature
of containing dicarboxylic acid and pthalic acid in ester form.
These polymers being acid esters are insoluble in gastric media(pH~4 ) , intend to
hydrate and begin dissolving in duodenum (pH~4 to 6) and then in intestine(pH ~7
to8).The crystallization of the capsaicin can be achieved by conditioning in 3
successive steps: super saturation , formation of nuclei and growth of crystals.
Super saturation can be done by evaporation of solvent. Nucleus consists of some 100
molecules having spatial arrangement of crystal. If polymorphs exist, it can be
removed by careful temperature control and seeding . Natural and synthetic
emulsifying substances likePEG400 monosterate,methyl cellulose,benzalkonium
chloride can be added to increase the viscosity of aqueous phase, solubility ,
dissolution and to reduce pungency. Lecithin is added as a liposomes to enhance drug
delivery . It offers many advantages like biologically inert and degradable. It can
encapsulate both water soluble and insoluble drugs, less susceptible to degradation.
Organ targeted delivery can be achieved without disturbing other cells and tissues.
The stealth liposomes (coated with PEG) are used to evade detection by body’s
immune system(since they are removed easily by kupfer cells of liver and
reticuloendothelial system).Micro crystalline cellulose and dextromethrophan can be
added to increase the hardness , disintegration time of the tablets. Calcium carbonates
are added as excipients.
Conclusion:
Thus being a natural substance it is bio-degradable, non toxic, non carcinogenic it
finds its use as an analgesic more potent than the conventional medicines. Also it
posses many other medical applications which are advantageous and are also
available at much cheaper rates. The hepatoprotective property of capsaicin helps in
reducing hepatitis and increases blood circulation.It improves the migration of white
blood cells to attack foreign materials..Thus acts as a better analgesic when taken
orally.Capsaicin finds plethora of application in the medical field.
References
Remington ‘The science and practice of pharmacology, volume 1 & 2.
Lippincott’s Williams and Wilkins Review of Pharmacology.
Clinical Pharmacology by P.N Bennel and M.J Brown.
Goodman and Gilman’s the pharmacological basis of therapeutics .
91
Developing Protocols for Confined field Trials of Virus resistant
Cassava in Africa
Mallowa S.O.1†††, Ndolo P.J. 1, Obiero H.M. 1, Gichuki S. T 2, T Alicai3, Y
Baguma3, Taylor N.J., 4 Fauquet C. 4and Doley W. P. 4
1
Kenya Agricultural Research Institute Kakamega, Kenya.
Kenya Agricultural Research Institute – Biotechnology Center, Nairobi,
Kenya.
3
National Crop Resources Research Institute, NARO, Kampala, Uganda.
4
Donald Danforth Plant Science Center, St Louis Missouri, USA.
2
Abstract
Viral diseases are currently the most important biotic constraint to cassava production
in Africa. The ones with the greatest economic impact are the cassava brown streak
disease (CBSD) and the cassava mosaic disease (CMD). Efforts are being made to
look for ways to manage the disease; in Africa the most common mode is the
production of resistant varieties by conventional breeding and their multiplication and
dissemination to farmers. Recent research has sought to develop transgenic versions
of farmer-preferred cassava cultivars, retaining their desirable agronomic and
processing qualities and with resistance to virus diseases.. This paper presents the
importance, definition and use of Confined Field Trial (CFT) and a detailed look at
the protocols and forms developed during the just concluded Mock Cassava CFT in
western Kenya.
Introduction
Virus diseases affect the yield and quality of the tuberous roots of cassava (Manihot
esculenta Crantz). Cassava brown streak disease (CBSD) is caused by cassava brown
streak virus (CBSV) (genus Ipomovirus). A new outbreak of the disease has been
reported in Uganda and parts of western Krnya (Alicai et al., 2007). Cassava mosaic
disease (CMD) is the most widespread and economically important disease of cassava
in Africa (Thresh et al., 1994). The disease is caused by cassava mosaic geminiviruses
(CMGs) and spread by planting infected cuttings. The CMGs are transmitted by the
whitefly Bemisia tabaci (Gennadius) (Storey and Nichols, 1938). A novel
recombinant CMG (East African cassava mosaic virus-Uganda) is responsible for the
current pandemic, which was first reported in Uganda in the late 1980s and has since
spread to affect nine countries in East and Central Africa (Legg et al., 2006).
Management efforts for CMD have focused mainly on multiplication and
dissemination of CMD-resistant varieties with considerable success (Otim-Nape et al.,
2000).
However, the spread of the pandemic exceeds the pace of implementation of these
measures (Legg and Fauquet, 2004). There is a need to investigate alternative means
of management using local varieties already available in ‘post-epidemic’ areas to
enhance development of integrated management approaches for CMD and more
†††
mallowa@yahoo.com
90
recently CBSD. This includes the virus resistant cassava for Africa (VIRCA) project
is based on research partnerships between Donald Danforth Plant Science Center
(DDPSC) and African institutions (currently: Kenya, Uganda and Malawi).
Research is on-going to develop transgenic versions of farmer-preferred cassava
cultivars, retaining their desirable agronomic and processing qualities and with
resistance to CMD and possibly CBSD. Scientists from these partner institutions will
participate in all steps of product development, including identification of target
cultivars, generating transgenic events, conducting confined field trials (CFTs) and
seeking regulatory approval for commercialization. VIRCA will also support
institutional and human capacity building as required for biotechnology product
development in the partner countries.
Confined Field Trials
Confined Field Trials (CFTs) are field experiments carried out on a small scale to
evaluate the performance of GM plants. They are done under stringent terms and
conditions that confine the experimental material. They are very similar to field
experiments done in conventional breeding involving quarantine crops but they are
confined. The risk in CFTs is mitigated by limiting exposure with science-based
confinement measures to prevent gene flow, material release and prevent persistence
after the trial by isolation, confinement and monitoring respectively. CFTs are needed
because after the experiments in the lab are completed they allow for the testing of the
value of the trait in local varieties of GM plants under real field conditions and in the
local environment.
Studies on non-targets are conducted at initiation of CFTs where applicable. Decision
making on whether to move forward or try again is possible and selection of the best
performing lines based on scientific evidence can be done. After selection it is
possible to scale-up production of material, prior to regulatory approval. CFTs
generate the safety data needed for subsequent risk assessment and approval in terms
of environmental safety assessment and plant material availed from CFTs for feeding
studies. It is important to confine these research experiments because a full risk
assessment has not been done and no regulatory approval has been made of the GM
plants in question (Hasley 2006, Kingiri 2006b).
Confined Field Trials in Kenya
Prior to the passing of a biotechnology policy and biosafety bill in Kenya, There are
guidelines based on Science and Technology Act Cap 250 of 1980 that established the
National Council for Science and Technology (NCST). Through the NCST the
National Biosafety Committee (NBC) and Institutional Biosafety Committees (IBC)
are established. The NBC coordinated the regulations and guidelines being used to
regulate biosafety facilities commensurate with the level of risk. These have been
used since 1998 to date as we await a presidential approval of the biotechnology
policy and biosafety bill.
To date Kenya has approved three confined field trials (Bt cotton, Bt maize and
transgenic sweet potato and soon a fourth of transgenic cassava (Mallowa, 2006). The
trial applications are discussed by the IBC then presented to the NBC. The NBC
discusses the application and in the case of an approval requests the regulatory agency
91
(Kenya Plant Health Inspectorate Service- KEPHIS) to issue a permit. They help to
assure compliance that only approved accessions are imported. KEPHIS monitor and
inspect the trial at all stages and ensure that the applicants comply with the conditions
stipulated on the permit and that premises are continuously suitable maintained for
confinement of GM material as per existing laws (Kingiri 2006a).
Steps towards development of a VIRCA product include: identification of target
cultivars, generating transgenic events, conducting confined field trials (CFTs) of
lines that have been developed and seeking regulatory approval for
commercialization. As a preliminary to this a mock confined field trial of cassava was
set up at KARI Alupe with the following goals: To develop stringent biosafety
compliant protocols for all activities and an effective data collection framework, to
provide hands on biosafety training for staff involved in the research team and build
confidence of regulatory authorities in the capacity of the team to carry out the
research and to identify weaknesses in existing biosafety compliance and develop
effective solutions.
There was training of all staff working on the project on biosafety regulations,
handling of transgenic plants; features of biosafety level two screen house and CFT
facilities, principles of confined field trials and standard operating procedures. The
training was conducted by scientists from DDPSC and KARI on 22nd-23rd August
2006 to 19 people in attendance. In vitro plantlets were hand carried from DDPSC to
KARI- Kakamega by Dr. Bill Doley and Dr. Nigel Taylor of DDPSC. The 450 plants
arrived in Kakamega on 21st August 2006. Plants were given time to acclimatize in
the screenhouse in polythene tents and the caps were opened gradually each day. The
gel was washed off from the roots starting 27th August 2006 and put in water with
Miracle Gro fertilizer this was changed daily. The plants were potted in plastic pots
starting 1st September 2006. They were hardened and looked after in the screenhouse
for ten weeks: when they were about 12-17 cm tall they were prepared for
transportation and planting at the CFT site in Alupe.
Transportation
Material confinement was maintained during the journey to Alupe on 31st October
2006. The 377 plants were packaged in their individual plastic pots with. These were
then loaded onto trays and the trays put into crates that had wooden framing and
white nylon screen to allow for aeration. The tops of the cases were covered with a
polythene sheet the crates loaded onto the truck; the base of the truck was lined with
foam.
Cassava Confined Field Trial Site.
The site was 40 x 57 = 2280 square metres. A pollen buffer of 4 rows of maize was
planted all around the plot at a spacing of 50cm. There were also 5 rows of non-tissue
culture cassava variety MM96/3868 that was planted in September 2006 that acted
successfully as a whitefly attractant. There was a row of infected cassava from
Fumba Chai and Serere varieties around each plot that acted as spreader rows. The
trial was in randomized complete block design with 5 varieties replicated 3 times
90
making a total of 15 plots. The five varieties were: cv 60444, Bukalasa 11(Uganda),
Serere (Kenya), Ebwanatareka (Kenya) and Tareka (Uganda). Each of the 15 plots
was planted with 20 plants at a spacing of 1 m x 1 m these were transplanted on 31st
October 2006.
Compliance Binder
A compliance binder and diary were kept starting 21st August 2006, when the plants
were received until the trial was terminated on 26th October 2007. Observations made
during the post harvest restriction and monitoring were also recorded.
The diary was used to keep a daily record of all activities and protocols at the site.
The compliance binder contained all compliance forms and data sheets filled by the
technician at the site and periodically checked for accuracy and countersigned by the
Trial site manager. These included: Material transfer form (MTF), Meteorological
data sheet, Record of plants in the screeenhouse, Record of plants in the field,
Screenhouse plant height data sheet, Planting of Confined Field Trial form,
Instructions for completing forms, Weekly (bi-weekly) plot , observations data sheet,
CMD weekly(later bi-weekly) rating of Individual plants, Weekly flower bud
removal form, Periodic flower bud removal form, Monthly isolation monitoring form,
Incidence and corrective action form, Phenotypic data collection sheet, Harvest and
destruction form, Volunteer monitoring form and Harvesting data sheet.
Insect Study
The study was carried out at the Mock CFT site with the objective of collecting
baseline data over the one year period on the arthropod species present in a cassava
experimental site in order to monitor changes in their populations, identify major
arthropod species of economic importance as pests or natural enemies in the cassava
and natural ecosystems and establish strategies for their monitoring and management.
Weeding
Weeding was done systematically starting from the main test plots and spreader rows
before moving on to the whitefly attractant and the rows of maize buffer. After each
weeding, the weeds residue were collected and thrown into the pit. The residue was
not used as dead mulch because the weed seeds, rhizomes, stolons or tubers contained
in this could increase weed problems on the farm. It was noted that varieties like
60444 and MM96/3868 that branched early low and often, eventually developed a lot
of branches and leaves quickly that shaded the ground. This prevented weeds in these
areas from growing as vigorously as in the plots with the other varieties. A herbarium
was made containing a specimen of each weed specimen found on the trial.
Identification of the specimens was done by Mr. Simon Mathenge an expert botanist
formerly of the University of Nairobi herbarium.
Results
On 31st October 2006 plant movement was documented from KARI-Kakamega to the
mock CFT site at KARI-Alupe. At the screen house level, data was collected three
times a day starting 1st September 2006. Data was recorded on rainfall, relative
humidity and temperature. The KARI-Alupe sub-center where the CFT is located has
91
a small meteorological station and data was sourced from them monthly on the same
parameters from November 2006 – October 2007. During the post harvest monitoring
November 2007- April 2008 the data was also sourced.
This was used to monitor the general health of the plantlets during the ten week
hardening period and to document the healthy, poor and dead plants on a regular
basis. This was used to document and monitor the general health of the plants in the
field during the first six weeks in the field after transplanting. It helped to follow
through on the individual plant history and account for plants that died and were
replaced. After the six week period all remaining plants were destroyed and no
further replacements were made. Plant height was the parameter chosen to monitor
the growth of the plants in the screenhouse. Weekly measurements were taken on
each plant and the tallest and shortest plants were noted.
Planting of the CFT was done in several stages. The spreader rows and the whitefly
attractant cassava were planted earlier using stakes on 15th September 2006, as well
as and the KSTP maize buffer. On the 31st October 2006, 300 plants were planted in
the 15 main test plots and the form was filled. The maize buffer aged and was
replanted twice on 15th January 2007 with Hybrid 513 and on 23rd August 2007 with
Hybrid 25. This was also included in the compliance binder to remind users’ the
correct way of recording information and the correction codes to use in case of
changes. Data was recorded on 5 preselected plants in each plot weekly starting
immediately the week of planting, for the first 20 weeks and biweekly from then on
until the 50th week. Parameters measured included. Cassava green mite, cassava
mealy bug, adult whitefly, cassava bacterial blight, cassava anthracnose disease,
cassava brown streak disease and the plant height from the ground level to the highest
shoot tip.
Symptom severity for CMD was done for all plants in all plots using the 0-5 scale
described below. Data was recorded weekly for the first 20 weeks starting
immediately after planting and biweekly thereafter. This exercise was very important
as it eliminated gene flow from the CFT site. A summary of the flower bud removals
done each week was done starting at one month after planting (MAP). Initially the
number of inspections and the number of flower bud removed was noted however
from the tenth month accurate flower bud enumeration was very tedious as they were
very many and numbers were estimated. A total of 140 inspections were done during
the course of the mock CFT.
Periodically a thorough and systematic search for flower buds was made through the
site. Since cassava has a 3 way apical branching that precedes flowering (which was
very clear with cv. 60444) identification of pre flowering branches and plants was
easier. Each time an inspection was done the number of buds from each plot and
border rows were estimated before being disposed off in the onsite incineration pit.
Prior to the planting of the mock CFT an isolation distance of 200 m in all directions
was marked out from the site. This was taken to be the ‘isolation area’ and all
individual farmers and institutions were identified and requested not to plant cassava
during the course of the trial.
Every month monitoring was done of this isolation area and the agricultural activities
were recorded, field ownership was also updated in some instances. Only once during
the monitoring carried out on 30th November was cassava (or any other sexually
92
compatible plant) found within the isolation area. The farmer concerned was talked to
and the cassava uprooted and disposed off appropriately. A sketch map of the
isolation area relative to the mock CFT site was made together with a list of farmers
and institutions. This was the second mode of ensuring genetic confinement.
Any incidences that could have led to a breach of confinement during the course of
the trial were noted in this form and the trial manager Mr. Ndolo, as well as the head
of cassava program KARI-Kakamega Mr. Obiero were notified. In January 2007 it
was noted that the maize buffer was aging and the stakes would not tide through to
the end of the trial. The corrective action advised and taken was to plant another set
of plants. In August 2007 the security guards observed a monkey trying to steal an ear
of maize from the site. It was scared away by stoning anytime it came within the
vicinity of the site and with time it gave up.
The main aim of this process was to phenotypically distinguish between the Kenyan
and Ugandan varieties that shared the same name. Leaves alone could not spell this
out clearly therefore other traits were selected so that the differences come out
clearly. This was done on the same five plants in each plot that had been pre-selected
randomly. Data was collected from only these selected plants, simple analysis was
used to get the averages for numeric and non-numeric traits. Data was collected at 3,
6 and 9 months after planting (MAP) in the field on leaf colour, number of lobes, lobe
length and width, petiole length, plant height, stem growth habit, and pubescence on
the leaves. At 6 and 9 MAP on stem exterior colour, petiole colour, orientation of
petiole and branching habit. Data on colour of stem epidermis and the distance
between scars was only collected at 9 MAP.
This form was used to document the harvest of test plants and border rows on 16th
October 2007 in the presence of KARI, KEPHIS and DDPSC officers. Destruction of
the material by burning using wood fuel and diesel was documented on 26th October
2007. The delay in destruction was necessitated the large amount of plant material
(including tuberous roots) that resulted from the trial, this required a couple of days to
dry before burning. KEPHIS was present at the destruction to ensure that
confinement of the material had been maintained until destruction was completed.
This was used fortnightly to document the post-harvest inspection within the site for
volunteers and an enumeration of what is found and destroyed.
This was used to record the parameters that were being measured at harvest. These
included the number of plants harvested the plant height, the weight of all the above
ground parts and finally the presence and severity of CBSD symptoms in the roots
and leaves. The baseline data collected from the insect study could be useful in future
in proving to regulators that possible risks are being identified and measures being
put in place for risk assessment to be conducted in future including changes in the
biodiversity. The weed herbarium has been kept for future reference when the real
transgenic trial is planted. A total of 40 species from 13 different families were
identified, the families with the largest number of species were Leguminosae and
Graminae. Euphorbiaceae which houses cassava also had representation with
Euphorbia hirta. Only species richness which is the total number of different species
in the study area was measured.
93
The results on various pests and diseases (which have not been presented here)
concurred with previous results from literature that varietal susceptibility and disease
severity. The results obtained at the MOCK CFT site except for CBSD were typical
of cassava field trials in Alupe showing that tissue culture derived plantlets and stake
derived plants behave the same way in terms of pests and diseases under similar
agroecological conditions. CBSD had previously not been reported in western Kenya,
but in 2007 there were reports of its presence in Siaya, Busia and Teso districts of
western Kenya and its presence at the MOCK CFT site concurred with the recent
CBSD recordings in the region. Biosafety compliant standard operating
procedures(SOPs) were developed for each activity this includes: Soil sterilization,
Receiving and unpacking plant materials, Acclimatization, Potting plantlets, Planting
cassava spreader rows and maize buffer, Transport and labelling, Storage of extra
plants, Planting main trial, Field maintenance, Data collection and recording, Harvest,
Destruction and Post harvest restriction and volunteer monitoring.
Discussion and Conclusion
The collaborative research team has successfully developed biosafety protocols for
the handling of transgenic cassava in western Kenya (Africa) from the laboratory to
the field. There is a clearly chartered method documented for every single process
and procedure used to carry out an activity. This includes the screenhouse hardening
process, the CFT, harvesting destruction and disposition, the post harvest site,
management of forms in compliance document binder and submission of the field
testing report. KEPHIS was involved in all major steps of the Mock CFT and assisted
in development of key protocols that ensure confinement e.g. Material transfer and
harvest and destruction. Weaknesses in the existing biosafety compliance structures
were identified and corrected e.g. the initially proposed harvest method and timing did
not work out and was adjusted appropriately.
An effective data collection framework was developed including the post harvest
restriction and monitoring and staffs are now familiar with how to go about it. CFT
applications will be submitted in Kenya for transgenic field trials in 2008. CBSD
though not a major factor in the initial plant development protocol will in future be
considered as the disease could be a major threat in the region and development of
plants with resistance to only CMD could be overtaken by events. Cassava CFTs in
Africa have an advantage that is not experienced in other places. They are carried out
in very limited numbers (1 or 2) trials per year and hence can be closely watched and
controlled by all stakeholders, they are therefore well-tested and low risk. The trials
are placed on government facilities which are in remote areas and access is highly
restricted by two layers of security a perimeter fence and a guard.
The reproductive isolation and other genetic confinement measures are ensured
according to the standard operating procedures. There is usually support for
procedures, training and documentation. Around the world confinement measures and
adequate inspection by regulators have ensured the safe conduct of confined field
trials of field experiments. To date there is not a single documented example of actual
'harm' to the environment or to people or to animals, in the course of conducting
CFTs. The confinement measures therefore increase and ensure the safety of GM field
trials. Their proper management provides a demonstration that the chain of custody
and control of the plants has been maintained at all times (Hasley, 2006). The
94
successful long-term use of GM crops will depend on public confidence in their
safety, that any risk in testing is being carefully managed and that benefits outweigh
any potential risks. The VIRCA-Kenya mock CFT has laid down a background of
very useful information for cassava CFTs that other projects IN can use.
Acknowledgement
The VIRCA project in Kenya is financed by USAID. The contribution and support of
the Kenya Agricultural Research Institute – Biotech Center, Kakamega and Alupe is
acknowledged.
References
Hasley, M. 2006. Confined field trials and why they are needed Material developed
for PBS by Dr Donald Mackenzie adapted by Kent, L., Hasley, M. and Hokanson, K.
In : Proceedings of the Compliance training for Managers and Inspectors of
Confined Field Trials 24th-27th January 2006, Nairobi, Kenya.
Kingiri, A. N. 2006a. Regulatory requirements and procedures for Kenya. In:
Proceedings of the Compliance training for Managers and Inspectors of Confined
Field Trials 24th-27th January 2006, Nairobi, Kenya.
Kingiri, A. N. 2006b. Genetic and material confinement for genetically modified
crops. In: Proceedings of the Compliance training for Managers and Inspectors of
Confined Field Trials 24th-27th January 2006, Nairobi, Kenya.
Legg, J. P. and C. M. Fauquet. 2004. Cassava mosaic geminiviruses in Africa. Plant
Molecular Biology. 56(4):585-599.
Legg, J. P., Owor, B., Sseruwagi, P. and Ndunguru, J. (2006). Cassava mosaic virus
disease in East and Central Africa: Epidemiology and management of a regional
pandemic. Advances in Virus Research 67, 355-418.
Mallowa, S.O. 2006. Precaution measures for introducing genetically modified (GM)
seeds in Africa –The case for confined field trials (CFT). Proceedings of the
CENSAD Seed Conference 25th -27th April 2006, Tripoli, Libya.
Otim-Nape, G. W., A. Bua, J. M. Thresh, Y. Baguma, S. Ogwal, G. N. Ssemakula, G.
Acola,G., Byabakama, J. B. Volvin, R. J. Cooter and A. Martin. 2000. The Current Pandemic
of Cassava Mosaic Virus Disease in East Africa and its Control. Natural Resources
Institute. Chatham, UK.
Storey, H.H. and Nichols, R.F.W. (1938). Studies on the mosaic of cassava. Annals of
Applied Biology 25, 790-806.
Thresh, J. M., G. W. Otim-Nape and D. L. Jennings. 1994. Exploiting resistance to African
cassava
mosaic
virus.
Annals
of
Applied
Biology
39:51-60.
95
Extraction of DNA from Macadamia (Macadamia spp): Optimizing
on quantity and quality
Lucy N. Gitonga1,4,‡‡‡, Esther M. Kahangi4, Anne W.T. Muigai3, Kamau
Ngamau4, Simon T. Gichuki2, Bramwel W. Wanjala2 and Brown G.Watiki1
1
Kenya Agricultural Research Institute, National Horticultural Resaerch
Center
2
Kenya Agricultural Research Institute, Biotechnology Center
3
Department of Botany, Jomo Kenyatta University of Agriculture and
Technology, 4Department of Horticulture, Jomo Kenyatta University of
Agriculture and Technology
Abstract
Good quality DNA of adequate amounts is the basis of successful DNA analysis for
downstream applications such as genetic characterization of germplasm, studies on
diversity of genetic resources, cloning and even in forensic cases. Existing
Macadamia germplasm in Kenya was introduced from different countries and
morphological diversity is evident. Molecular analysis of DNA is expected to reveal
the real genetic diversity of the existing germplasm. As a basis for molecular diversity
studies, DNA was extracted from different species and cultivars of Macadamia.
Different extraction methods including CTAB, SDS, Sarkosyl, Dellaporta, DNA
Extraction KIT and FTA cards were compared using either small-scale or large-scale
extraction procedures. Effect of age of leaves from which DNA was extracted was
also compared. DNA was quantified using spectrophotometry and quality assessed by
running the samples on a 0.7% agarose gel. Results indicated that age of the leaves
was not critical for small-scale CTAB extraction but was a critical factor in large scale
extraction procedure. Other critical factors included amount of starting material,
freshness on reagents and buffers. Among other extraction methods, small scale
CTAB-based method was most promising and was adopted for DNA extraction from
Macadamia.
Key words: Macadamia; genetic characterization; diversity; morphological;
molecular; DNA extraction; spectrophotometry; agarose
Introduction
For successful molecular studies, good quality DNA in sufficient quantities is a
required for downstream applications. A variety of problems may be encountered
during the isolation and purification of high molecular weight DNA from plant
species. These include; (1) partial or complete DNA degradation by endogenous
nucleases, (2) co-isolation of highly viscous polysaccharides which render the
handling of samples difficult and may also inhibit enzymatic reactions, and (3) coisolation of soluble organic acids, polyphenols and other secondary compounds
which cause damage to DNA and/or inhibit enzymatic reactions. As a consequence,
the quality of DNA obtained by standard procedures may be poor and yields may
range from less than I µg to more than 200µg of DNA per gram of fresh leaf tissue
‡‡‡ *
Corresponding Author: lucygitonga2000@yahoo.com
90
(Weising et al., 2005). Several DNA isolation methods have been published most of
which aim at isolating total cellular DNA which is a suitable substrate for almost all
PCR-based
marker
applications.
However, there are also other protocols that are specifically designed for the
isolation of nuclear DNA (Langridge et al., 1999). Plant DNA isolation methods
differ in many respects including the disruption of tissues and cells, the composition
of extraction and lysis buffers and in the way that DNA is purified from other cell
ingredients such as proteins, RNA, membranes, polysaccharides and polyphenols.
Because of the biochemical composition of plant tissues and the diversity of species
it is difficult to supply a single isolation protocol that is optimally suited for each
plant species (Weising et al., 2005). This study was set up to evaluate different
methods of DNA isolation and factors that affect quality and quantity of DNA to
come up with an optimized protocol for DNA isolation from Macadamia.
Plant material
Three Macadamia species; Macadamia integrifolia, M. tetraphylla and (M.
integrifolia x M. tetraphylla) hybrids were used. Leaves were either obtained from
new sprouting shoots from field- grown Macadamia orchards (Plate 1) or from 2-3
weeks-old sprouts from cuttings of Macadamia accessions sprouted in pots filled
with sand and covered with polyvinyl sheet under greenhouse conditions (Plate 2) at
KARI-Thika, 70 km north of KARI-NARL laboratory where DNA extraction was
performed.
Plate 1
Plate 2
Tissue preparation for DNA extraction
Leaf tissues were ground in liquid nitrogen using a mortar and pestle and the fine
powder, weighed and put in either 15 ml centrifuge tubes for large-scale extraction
or 2.0 ml eppendorf tubes for small-scale extraction depending on the experiment
and immediately returned to freezer at -20ºC.
DNA Extraction
Comparison of Macadamia spp, source and age of leaves
Three varieties representing 3 species of Macadamia; MRG-20 (Macadamia
integrifolia), KMB-3 (Macadamia integrifolia x M. tetraphylla) hybrid Ondabu et
89
al., 1996; Tominaga and Nyaga, 1997) and Tetraphylla (M. tetraphylla) were used.
Leaf samples were obtained from ether mature field-grown trees or sprouted cuttings
as described above. DNA was extracted using the standard CTAB method for maize
(Hoisington et al., 1994). DNA quality was assessed by loading 1µl of loading
buffer mixed with 10µl of DNA sample solution on 0.7% agarose gel stained with
ethidium bromide and running at 50 mA (100 V) for 90 minutes.
Comparison of extraction protocols and age of leaves
Six varieties representing the 3 species of Macadamia; KRG-15, MRG-20 , HAES
508 (Macadamia integrifolia), KMB-3, KMB-9 (Macadamia integrifolia x M.
tetraphylla) hybrids and Tetraphylla (M. tetraphylla)were used. Shoots were
obtained from 2-3 weeks old sprouts from cuttings. Young (apical shoot and
adjacent bud) and old (any other from 2nd and 3rd node but fully expanded) leaves
were compared. DNA was extracted using either CTAB (mixed alkyltrimethylammonium bromide) (CH3(CH2)15N+(CH3)3Br-) (Weising et al., 2005) or SDS
(Sodium dodecyl sulphate) (CH3(CH2)11OSO3-Na+) (Edwards et al, 1991) using
either small-scale or large-scale extraction methods. For large scale extraction, 1.2 2.5 g of sample powder was used while 0.2 g was used for small scale extraction.
This experiment was repeated twice but using 3 g of sample powder for large scale
extraction. DNA was quantified using spectrophotometric methods while quality of
the extracted DNA was assessed by running the samples on a 0.7% agarose gel.
Comparison of six DNA extraction methods
Six methods based on CTAB, SDS, Sarkosyl (CH3(CH2)11N(CH3)CH2COO-Na+)
(Langridge et al., 1999), Dellaporta (Dellaporta and Hicks, 1983), FTATM (Flinders
Technology Associates) (http://www.whatman.com), and DNA extraction Kit
((http://www.sigma-aldrich.com) all with some modifications were evaluated. The
weight of sample powder was 0.2 g recommended for small scale extraction method.
Young leaves (apical shoot including the leaves from adjacent node) of KRG-15,
EMB-1 (M. integrifolia), KRG-T3, EMB-T4 (M. tetraphylla), and KMB-3 and
MRU-23 (M. integrifolia x M. tetraphylla) hybrid were used. Extraction using
FTATM (Whatman Inc. Clifton NJ) and DNA extraction Kit (GenEluteTM Plant
Genomic DNA miniprep Kit (G2N-70)) (3050 Spruce St. Louis MO 63103
(314)771-5750) was carried out according to manufacturers instructions. Methods
were evaluated on general efficiency based on time taken and throughput.
Effect of Macadamia species, source and age of leaves
Results are shown in Fig 1. Banding patterns showed differences in intensity in the
three species. It was noted that samples collected from mature field grown trees had
some degree of withering despite being transported under the similar conditions as
intact cuttings. This could have caused some DNA degradation resulting to some
smearing observed on the gel picture. Weising et al. (2005) states that quality and
yield of plant DNA preparations are to a considerable extent influenced by the
condition of starting material and whenever possible fresh, young tissue harvested
immediately before DNA isolation should be used. Effect of age was not consistent
with age as both young and old leaves generated DNA bands while some samples of
90
old and young leaves did not, necessitating further trials on different extraction
methods.
DNA bands
No RNAse enzyme was
used hence the thick blobs
of RNAs
Fig. 1: Gel picture of DNA extracted from old and young leaves of three Macadamia
genotypes [ Lanes 1: Molecular Weight Marker; 2: KMB-3 (old leaves); 3: KMB-3
(young Leaves); 4:KMB-3 (young leaves); 5:MRG-20: (young leaves); 6:Tetraphylla
(old leaves); 7:Tetraphylla (young leaves)]
Comparison of Extraction protocols and age of leaves
Results showed that in small-scale extraction using CTAB method, age and
Macadamia species were not critical as all samples yielded distinct bands on agarose
gel (Fig 2).
1
2 34 5
6 7
8
DNA bands
Fig. 2: Gel picture of DNA extracted from old and young Macadamia leaves using
small scale CTAB extraction method [Lanes 1-8: DNA marker, KRG-15 (Y), KRG15 (O), KMB-3 (Y), KMB-3 (O), Tetra (Y), Tetra (O), Tetra (O); Key: O= old;
Y=young]
However, younger leaves were easier to crash in eppendorf tubes. This is in
agreement with Peace (2002) who also used young flushes which were not yet
hardened-off. Large-scale extraction did not yield distinct bands and particularly old
leaves. Critical factors included amount of starting material, age of leaves, reagents
and buffers. When weight of starting material was increased from 1-2.5 g to 3 g,
91
young leaves used and freshly made buffers and reagents used, the size of the DNA
pellet was improved and distinct bands were seen.
When large-scale extraction was done using SDS method with 3 g of starting
material, all samples showed distinct bands but of different intensity. However,
quality was still low (ratio of 1.1 spectrophotometric reading) indicating presence of
proteins. Hence, though both of these methods could be used for DNA extraction
from Macadamia they needed further optimization and a further comparison of
different methods.
Comparison of six DNA extraction methods
All methods evidently yielded DNA from all cultivars though banding patterns
differed in intensity among the methods. The results of DNA extraction using the six
methods are illustrated by Fig 3. Gel results were consistent for Dellaporta, CTAB
and SDS methods and hence could be considered good methods for DNA extraction
from Macadamia. DNA from varieties KRG-15, EMB-1 and EMB-T3 showed some
degree of smearing on the gel while KMB-3, MRU-23 and KRG-T3 showed distinct
bands indicating good quality DNA. The smear could have been as a result of DNA
shearing during extraction procedures and not as a result of extraction method.
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Dellaporta
Kit
CTAB
SDS
FTA
Sarkosyl
DNA bands
Fig 3: Gel picture of DNA extracted from six Macadamia genotypes using six
extraction methods [Lanes 1 & 8: 1Kb Molecular weight Marker; Lanes 1-7 and 914: KRG-15, EMB-1 (M. integrifolia), KMB-3, MRU-23 (M. Hybrid), KRG-T3, EMBT3 (M. tetraphylla]
The results showed that, besides the commercial kits, CTAB and Dellaporta-based
methods were the most efficient in terms of the minimum expected time and
throughput and can be recommended for DNA extraction from Macadamia species.
However, quantity of DNA extracted by Dellaporta-based method was quite low
compared to that extracted by CTAB. CTAB method has been used in several crop
plants (Chittenden et al., 1993; Peace, 2002). Similarly, by comparing two methods;
CTAB and sarkosyl, Peace (2005) also concluded that CTAB was more efficient,
90
enabling a single researcher to process 96 samples of Macadamia per day. Weising
et al. (2005) indicated that a major disadvantage of the DNA quantification method
using spectrophotometric measurement of UV absorbance at 260nm, as the one
applied in this study, is that RNA, oligonucleotides, proteins and other contaminants
interfere with the measurement. Hence, quantity of extracted DNA alone may not be
reason enough to disregard the method.
Conclusions and Recommendations
CTAB-based method is highly recommended for DNA extraction from Macadamia
as several samples can be extracted within a relatively short time. The DNA
obtained is of sufficient quantity and quality for downstream applications. Small
scale extraction or miniprep is recommended as it saves on time and reagents thus
reducing cost. Young leaves including apical buds obtained from sprouting cuttings
are suitable for DNA extraction.
They are easy to crash in eppendorf tubes and yield high quantity and quality of
DNA probably due to the high cell division and hence higher DNA replication
expected in apical shoots. Cuttings should be sprout in moist chambers 2-3 weeks
before DNA extraction is scheduled. This should be done in close proximity to the
lab or otherwise cooler boxes and reliable transport should be available to transport
intact sprouted cuttings. In the absence of these facilities, then the use of FTATM
cards to collect and store intact DNA from trees far away from lab should be
considered. Freshly made buffers and reagents should be used at all times.
Acknowledgements
The authors acknowledge the financial support from the Kenya Agricultural
Productivity Programme (KAPP) through KARI, JKUAT for the post graduate
training from which these results were obtained. Thanks also to the Director, KARI,
and the Center Director , KARI-Thika for logistical and moral support.
References
Dellaporta, S.L. and Hicks, J.B. (1983). A plant DNA mini preparation: Version II.
Plant Molecular Biology Reprint 1: pp 19-21
Edwards, K., Johnstone, C. and Thompson, C. (1991). A simple and rapid method
for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids
Research 19 (6): 1349
Hoisington, D., Khairallah, M. and Gonzalez-de-Leon, D. (1994). Laboratory
Protocols: CIMMYT Applied Molecular Genetics Laboratory. Second
Edition. Mexico, D.F.:CIMMYT
Langridge, P., Karakousis, A., Nield, J., Handford, D. and Pallotta, M. (1999).
Molecular markers in plant breeding short course. Cooperative Research
Centre Molecular Plant Breeding, Australia
Ondabu, N., Nyaga, A.N. and Tominaga, K. (1996) Macadamia clonal selection in
Kenya. 5th Biennial KARI Scientific Conference, Nairobi, Kenya
90
Peace, C. P. (2002). Genetic charactetrization of Macadamia with DNA markers.
PhD dissertation. University of Queensland, Australia
Tominaga, K. and Nyaga, A.J.N. (1997). Breeding of Macadamia nuts. Evaluation
report, 1994-1997.
Weising, K., Nybom, H., Wolff, K. and Kahl Gunter. (2000). DNA Fingerprinting in
Plants; Principles, Methods, and Aplications, Second Edition. CRC Press,
Taylor & Francis Group, 6000 Broken Sound Parkway NW, Boca Raton,
FL33487-2742
90
Developing Virus Resistant cassava for Kenya
Njagi Irene.1§§§*, Kuria Paul1, Taylor Nigel2, Bill Doley2, Gichuki Simon1
1
Kenya Agricultural Research Institute, P.O Box 57811 00200, Nairobi,
Kenya
2
Donald Danforth Plant Science Center, 975 North Warson Road, St. Louis,
Missouri, 63132 USA
Abstract
The aim of this project is to introduce resistance to CMV infection. Cassava mother
plants of five Kenyan cassava landraces were established as in vitro plantlets by
excision, sterilization and germination of axillary buds. Subsequent micropropagation
on Murashige and Skoog (1962) basal medium (MS) supplemented with 20 g/l
sucrose (MS2) resulted in production of numerous plantlets of each landrace. If all
this is successful it will improve nutrition, promote health and provide income by
creating a full range of optimal bioavailable nutrients in a marketable, diseaseresistant cassava for sub-Saharan Africa
Key Words: Cassava, Agrobacterium, genetic transformation, Embryogenesis,
regeneration
Introduction
Cassava produces bulky storage roots with a heavy concentrate of carbohydrates,
about 80% of dry weight (Zhang 2005). Over 250 million sub-Saharan Africans and
600 million persons globally rely on cassava as their major source of calories (FAO
2003). However cassava tubers have very low protein, iron, zinc, vitamin A and
vitamin E levels (Cock 1985). In some areas in Africa the diet is based on cassava.
This means that unbalanced carbohydrate diets are eaten which may result in
malnutrition especially in children (Hillocks et al., 2002). During the long culture
period (up to 18 months) of cassava, repeated attacks by various insect pests and virus
diseases can cause 20-50% yield losses world-wide, and locally they can lead to total
crop failures (Belloti et al. 1999; Thresh et al. 1994). Furthermore, cassava varieties
contain toxic levels of cyanogenic glucosides, which have to be removed by laborious
processing before cassava can be safely consumed (Akintowa et al. 1993). Cassava
suffers from postharvest physiological deterioration during transport, storage and
marketing (Wenham 1995).
A group of Scientists from various institutions have come together with the aim to
provide complete nutrition in the cassava crop by increasing six fold the levels of iron
and zinc, four fold the protein content, increase ten times bioavailable levels of
vitamin A and vitamin E, reduce ten times cyanogenic glycosides levels, reduce rapid
post-harvest physiological deterioration (PPD) and to increase shelf life to two weeks.
The aim of this project is to introduce resistance to CMV infection. If all this is
§§§
Corresponding author, irenenjagi2000@yahoo.com
91
successful it will improve nutrition, promote health and provide income by creating a
full range of optimal bioavailable nutrients in a marketable, disease-resistant cassava
for
sub-Saharan
Africa.
Plant Tissue Culture
Five Kenyan cassava landraces were collected from 3 regions in the country. Serere,
Adhiambolera and Ebwanatereka were collected from the Western province,
Kibandameno from the coast and Mucericeri from the Eastern region. 50 cuttings, 10
of each landrace were transferred to the Donald Danforth Plant Science Center at St
Louis, Missouri, USA, where they were used to establish mother plants in culture
chambers. The mother plants were used to established in vitro plantlets by excision,
sterilization and germination of nodal explants (Konan et al., 1994b). Subsequent
micropropagation was done to increase the number of in vitro plantlets so as to ensure
enough of explants for embryogenic studies. The model cassava genotype TMS60444
was supplied by the Donald Danforth Plant Science Center and used as the control.
Culture Conditions
The explants were cultured on a Murashige and Skoog (1962) basal medium
supplemented with 20 g/l sucrose (MS2) 7.8 g/l noble agar then the pH was adjusted
to 5.80. The medium was autoclaved at 15 psi, 121 oC for 15 minutes and dispensed at
25 ml per 9 cm petri dish. Incubation of explants was done at 26 ±2 oC with 16 hours
illumination at 30 µMolm-2.
Embryogenic systems
Unfolded leave lobe (Sarria et al., 2000; Siritunga and Sayre, 2003) 2-6 mm in length
were excised from in vitro plantlets and placed onto MS2 and 50 µM picloram (MS2
50P) (Taylor et al., 1996), followed by incubation for 21 – 28 days. Subculture of
Organized Embryogenic Structures (OES) resulted in proliferation of secondary
embryogenic structure (Li et al., 1995; Luong et al., 1995). When the OES were
transferred to Gresshoff and Doy basal medium (Gresshoff and Doy, 1974)
supplemented with 20 g/l sucrose and 50 µM picloram (GD2 50P) (Taylor et al.,
1996), Friable Embryogenic Callus (FEC) were formed (Raemakers et al., 1996;
1997b; Schopke et al., 1996; Taylor et al., 1996; Gonzales et al., 1998; Munyikwa et
al., 1998). Once established the FEC were maintained by a four weekly subculture on
GD medium supplemented with 60 g/l sucrose and 50 µM picloram (Taylor et al.,
2001).
Plant Regeneration
Regeneration of cassava cultivars Mucericeri, Serere, ‘Ebwanatereka and
Adhiambolera was achieved by a multiple stage germination process whereby
portions of FEC were picked from the GD2 50P medium and transferred to MS2
medium containing 10 µM 2, 4-dichlorophenoxy acetic acid (2, 4-D) for 3 weeks,
followed by subculture onto MS2 medium with the addition of 5 µM naphalene acetic
acid (NAA; Taylor et al., 2001). After a further 2-3 weeks, cotyledon-stage embryos
were removed and placed on MS2 medium supplemented with 5 µM
benzylaminopurine (BAP; Konan et al., 1994b, Li et al., 1998). Germinated plantlets
89
were maintained on MS2 medium. The regenerants were acclimatized and established
in green house following procedures described by Taylor et al., 2001.
Optimization of Transformation Conditions
Three Agrobacterium tumefaciens strains and media used are as described in
table 1
Table 3: Agrobacterium strain, antibiotics and media used in optimization for
transformation in Kenyan cassava landraces
Agro strain
Antibiotics
Solid media used
LBA 4404
Strpt (30), Kanamycin
(50), Rifampicin (25)
LB
Liquid
Media
used
YM
CRY 5
Erythromycin
Kanamycin (50)
(50),
LB, MGL
LB, MGL
EHA 105
Kanamycin
Rifampicin (25)
(50),
LB, YM
LB I
Antibiotic used in
culture (g/l)
Reference
Rifampicin (50),
Streptomycin (30)
Kanamycin (50)
Erythromycin (50),
Kanamycin (50)
(Li et
Schopke
)
(Li et
Schopke
1996)
(Li et
Schopke
1996)
Rifampicin
(50)
Kanamycin (50)
al., 1996,
et al., 1996
al., 1996,
et al.,
al., 1996,
et al.,
Transformation of FEC
Conditions to genetically transform FEC from Kenyan cassava were investigated
using the method of Taylor et al., 2001 and Hankoua et al., 2005. The uidA (GUS)
marker gene was used as the reporter gene. Variables tested included: effect of
Agrobacterium strains – LBA4404, EHA105 and Cry5; time of co-culture with
Agrobacterium – 2 and 4 days. The Agro strains were transformed with pCambia
2301 vector using the heat shock method. The agrobacterium strains were streaked on
the plate of LB media containing the appropriate antibiotics.
A colony of the agrobacterium strain was inoculated into 2 ml of appropriate liquid
medium with antibiotics early in the morning and allowed to grow for the 8- 10 hours
on a shaker at 28 oC. In the evening, tubes were removed and 0.25 - 0.5 ml of this
starter culture was used to inoculate 25 ml of the appropriate liquid medium
containing antibiotics and 100 µM of acetosyringone. The culture was grown
overnight at 28 oC, on a shaker to an OD600 of 0.5. The bacterial suspension was then
transferred to sterile 50 ml plastic tubes and centrifuged at 5000 rpm, at 4-8 oC for 15
minutes. The supernatant was poured off and the bacteria washed twice in fresh 25 ml
media. The Agro were resuspended in GD salts containing 200 µM acetosyringone.
The tubes were placed on a shaker and shaken vigorously (280 rpm) for at least 2
hours. The suspension was ten used for inoculation of the FEC.
Best quality FEC were transferred to 12 well plates such that one FEC sample covered
the bottom of one well. The FEC was used at 18- 21 days of age (since last
subculture).1 ml of Agro suspension was added onto the FEC, mixed gently and left
for 30 minutes. Using a wide bore 10 ml pipette FEC /Agro suspension was
transferred onto a sterile square of 100 µM plastic mesh sitting on an empty Petri
dish. The dish was tripped so that excess Agro was drained off from the mesh. The
FEC was spread on the mesh to form an even monolayer. The mesh was transferred
90
onto a double layer of sterile filter paper and left for 10- 15 seconds to drain off
excess fluid. The mesh was placed onto GD2 50P (pH of 5.6) medium containing 100
µM acetosyringone. Some of the cultures were incubated for 2 days and others for 4
days. Cultures were then stained for GUS.
GUS Staining
A modification of the histochemical GUS assay as described by Jefferson (1987) was
used. Tissues were placed in X-Gluc (5- bromo-4-chloro-3-indolyl β – Dglucuronide) solution in wells of microtitre plates and incubated overnight at 37 oC.
Assays were stopped by addition of 70% ethanol.
Determination of Phytotoxic Levels of Selective Antibiotic
In order to determine effective levels of paramomycin for recovery of genetically
transformed tissues in Kenyan cassava landraces, FEC of Serere, Muchericheri and
Ebwanatereka were subcultured on GD2 50P which was augmented with different
concentrations of the antibiotic Paramomycin (0, 10, 15, 20, 25, 30, 35, 40 mg/l).
Paramomycin was filter –sterilized and added to the sterilized media after it had
cooled to 45 0C. Ten clusters of FEC were used per replicate. All treatments were
placed to individual petri dish on a completely randomized manner and 5 replicates
were used per dilution. The cultures were incubated for one month and the number of
FEC clusters developing new tissues was recorded. TMS 60444 was used as the
control.
Transformation of 60444 with AC1 gene
ACI gene of the East African cassava mosaic virus- the Ugandan strain (EACMV-Ug)
was used for transformation. Danforth Plant Science Centre supplied FTA cards, onto
which EACMV-Ug infected plant material were preserved. Viral DNA was eluted
from these cards and PCR was performed to amplify the AC1 gene of EACMV-Ug
using ACI specific primers. Primers were designed to amplify the full length, Nterminal and C- terminal portions of the EACMV-Ug AC1 gene. The size of the AC1
genes used for construct prepation are as follows: AC1-NT-s (548), AC1-NT-as
(545), AC1-CT-s (567), AC1-CT-s (566), AC1-FL-s (1077) and AC1-FL-as (1077)
bp. Genetic elements included in each of the three (NT,CT and FL) constructs for
expression of the AC1 gene include: Cassava vein mosaic virus promoter (pCsVMV)
for driving the AC1 hairpin, intron, nopaline synthase 3’ terminator (nos 3’),
kanamycin resistance gene (nptII), cauliflower mosaic virus promoter
(2XpCaMV35S) for driving the nptII gene and the cauliflower mosaic virus (CaMV
3’-35S)- transcript polyA site (Figure 1).
90
A
LB CaMV3Õ
nptII
2XpCaMV3S nos3ÓAC1FL-as
intron
AC1FL-s
pCsVMV RB
CaMV3Õ
nptII
2
nos3ÓAC1NT-as
intron
AC1NT-s
pCsVMV RB
LB CaMV3Õ
nptII
2
nos3ÓAC1CT-as
intron
AC1CT-s
pCsVMV RB
B
C
Figure 4: A-C: AC1 gene construct used in transformation of 604444
All three sequences were fused to the cassava vein mosaic virus promoter and Nos
poly A sequence and cloned into a binary vector, pCambia 2300. A GFP construct
was used as a control. The process described above on regeneration of cassava plants
from FEC to embryos to in vitro plantlets and finally to greenhouse plants was
followed. A co- culture period used was 2 days and selection of the transformed FEC
was done on MS containing 30µΜ paramomycin.
Molecular analysis
Genomic DNA from leaf tissue of in vitro and green house plants was assayed for the
presence of transgene by PCR. Both the AC1 and GFP constructs used in this
transformation experiment are based on the NPTII antibiotic maker thus the
transformed plants were also tested for the presence of the NPTII gene, by PCR.
Results
Production of embryogenic tissues
Organized embryogenic structures (OES) were successfully induced from all the
landraces tested, but the frequency (ease) with which this occurred varied
(Adhiambolera (100%), Ebwanatereka (92%), Mucericeri (88%), Serere (88%) and
Kibandameno (52%; Table 2). FEC was successfully induced from Ebwanatereka
(65%), Serere (37%), Mucericeri (37%), Adhiambolera (35%) and Kibandameno 12%
(Figure 2).
Table 4: OES production in Kenyan cassava landraces on MS2 50P
Kenyan Cassava Landrace
(%) of OES production
Serere
Adhiambolera
Kibandameno
Ebwanaterek
Mucericeri
60444
88
100
52
92
88
82
89
% of leaf explant covered with
OES
46
25
53
31
40
51
Figure 5: FEC induction in four Kenyan cassava landraces
Screening for plant regeneration from FEC
The study showed that all the landraces screened regenerated plants through the
process of embryogenesis. 15 Mucericeri, 11 Serere, 12 Ebwanatereka and 12
Adhiambolera plants were established in soil from in vitro plants regenerated through
somatic embryos (Figure 3).
Figure 3: Somatic embryogenesis of selected kenyan cassava landraces
Development of genetic transformation protocols for Kenyan cassava
Testing GUS transformed tissues for transient expression of the marker genes showed
that Ebwanatereka and Adhiambolera were most efficiently transformed using Cry5
Agrobacterium stain, while Mucericeri and Serere were responsive to all three strains
(Figure 4).
90
Transformability of five cassava landraces by three
Agrobacterium strains
Number of blue spots per unit
40
35
30
25
CRY5
EHA105
LBA4404
20
15
10
5
0
Ebwanatereke
Adhiambolera
Serere
Mucericeri
60444
Figure 4: Transformability of cassava landraces with three Agrobacterium strains
Time of co-culture with Agrobacterium
Co-culture of the FECs with Agrobacterium for four days was found to result in
approximately a 50 times increase in the number of transformed cells expressing GUS
compared to a co-culture of only two days.
Transformation of TMS60444
Putative transgenic plants were obtained with each construct. Twenty with full-length,
23 with C-terminal and 9 with N-terminal AC1 gene constructs. Twenty plants were
also obtained with GFP (Table 3). Images of regeneration process of putative
transgenes in TMS60444 are shown in figure 3.
Table 5: Agro LBA4404 transformation of cultivar 60444
of Number
of
Construct used in Number
Callus obtained embryos obtained
transforming
cultivar 60444
AC1 Ug full length
130
83 (63%)
AC1 Ug C- terminal 42
30 (71%)
28 (34%)
12 (40%)
AC1 Ug N- terminal
GFP
Pc 2300
20 (86%)
24 (44%)
9 (36%)
33
90
42
23 (69%)
54 (60%)
24 (57%)
Number of plants
obtained so far
Molecular analysis of transformants
Ten of the AC1 FL transformed plants were analyzed by PCR using primers for ACI
of EACMV-Ug and (9 tested positive (90%, Figure 5). Sizes of AC1 genes in the
construct were as follows; Fl Sequences- 1080bp, NT Sequences- 540bp and CT
Sequences- 558bp. Cassava vein mosaic virus pCsVMV Promoter driving AC1
hairpin, intron, nopaline synthase 3’ terminator nos 3’, Kanamycin resistance gene
nptII, Cauliflower mosaic virus 2XpCaMV35S , - Promoter driving nptII, Cauliflower
mosaic virus - CaMV 3’-35S transcript polyA site. NPTII gene was tested on 14
putative transgenic plants; (4) transformed with ACI-FL gene, (6) transformed with
91
GFP and (4) transformed with pCAMBIA 2300(Negative control). All the plants
analyzed tested positive for this gene (100%).
Figure 5: PCR amplification of AC1- FL Gene In 60444, (1-10) AC1 FL
transformed Plants, (11) pC2300 transformed plant, (12) Non transformed 60444
plant, (13) H2O, (14) Plasmid AC1 positive control
M 1 2
3 4
5 6
7 8 9 10 11 12 13 14 M
Discussion/ conclusion/ recommendations
In this study five Kenyan cassava landraces were assessed for regeneration through
embryogenesis. The study showed that all the landraces screened are able to produce
appreciable amounts of organized embryogenic structures (88-100%), other than
Kibandameno (52%). Due to its poor OES production Kibadameno, unlike the other
four landraces was not assessed for FEC production, for plant regeneration from FEC
and for Agro transformation. The study further showed that there is Agro preference
in the transformation of cassava landraces and that a co- culture period of 4 days with
the Agro strain is preferable to a 2 day co- culture period. Whilst work is required to
further optimize the genetic transformation protocols, the ability to recover significant
numbers of transgenicTMS60444 plants indicates that the technique is usable. It only
needs to be optimized for every cassava cultivar that one would wish to improve
through transformation. Southern blot analysis ought to have been done on
TMS60444 transformants to indicate copy number of transgene but at the time of this
write-up this had not been possible. This work is considered to be an important step
90
towards establishing efficient regeneration and transformation protocols for Kenyan
cassava cultivars and therefore needs to be extended to all farmer preferred cassava
landraces in Kenya. There is therefore an urgent need to develop capacities in Africa
to transform the most important African landraces and improved varieties for each
major cassava growing regions.
Acknowledgements
This work was funded by USAID through the Danforth Center. Danforth also
provided facilities and training that made this work possible. The authors thank
Director KARI for permission to undertake the study.
References
Akintowa A, Tunwashe O & Onifade A (1993) Fatal and non-fatal acute poisoning
attributed to cassava based meal. Acta Hoticult. 375: 285-288
Belloti AC, Smith L & Lapointe SL (1999). Recent advances in cassava pest
management. Annu. Rev. Entomol. 44: 343-370
Cock JH (1985) Cassava: new potential for a neglected crop. Westview, London
FAO 2003. Crop Production data 2002. Food and Agriculture Organization of the
United Nations, Rome, Italy.
Gonzalez AE, Shopke C. Taylor N, Carcamo R., Beachy RN, Fauquet CM (1998)
Regeneration of transgenic cassava plants (Manihot esculanta Crantz)
through Agrobacterium - mediated transformation of embryogenic
suspension cultures, Plant Cell Rep 17: 827-831
Gresshoff P & Doy C (1974) Derivation of a haploid cell line from Vitis vinifera and
the importance of the stage of meiotic development of the anthers for haploid
culture of this and other genera. Z. Pflanzenphys. 73: 132-141
Hankoua BB, Ng SYC, Puonti-Kaerlas J, Fawole I, Dixon AGO, Pillay M (2005).
Regeneration of a wide range of African cassava genotypes via shoot
organogenesis from cotyledon of maturing somatic embryos and conformity
of the field-established regenerants. Plant Cell, Tiss. Org. 81(2):200-211.
Konan NK, Sangwan RS, Sangwan-Norrel BS, ( 1994b) Efficient in vitro shoot
regeneration systems in cassava (Manihot esculanta Crantz), Plant Breed
113: 227-236
Li H-Q, Huang Y-W, Liang C-Y & Gou Y (1995) Improvement of plant regeneration
from cyclic somatic embryos in cassava. p289-302. In: Cassava
Biotechnoglogy Network (ed.) Proc. Second Int. Scientific Meeting, Bogor,
Indonesia, CIAT Working Document 150
Li H-Q, Huang YW, Liang CY, Guo JY, Liu HX, Potrykus I & Puonti-Kaerlas J
(1998) Regeneration of cassava plants via shoot organogenesis. Plant Cell
Rep. 17: 410 . 414
90
Li, H. Q., Sauter, C., Portrykus, I. and Pounti-Kaerias J. (1996). Genetic
transformation of cassava (Manohot escrenta Crantz), Nature Biotech. 14:
736-740
Luong HT, Shewry PR & Lazzeri PA (1995) Transient gene expression in cassava
somatic embryos by tissue electroporation. Plant Sci. 107: 105-115
Munyikwa TRI, Raemarkers, C.J.J.M, Schreuder M, Kok R, Schippers M, Jacobson
E, Visser R.G.F (1998) Pinpointing towards improved transformation and
regeneration of cassava (Manihot esculanta Crantz) Plant Sci 135: 87-101
Murashige T. and Skoog, F. (1962). A revised medium for rapid growth and bioassays
with tobacco tissue cultures. Physiol Plant. 15: 473 – 497
Nitsch, J. P. and Nitsch, C. (1969), Haploid plants from pollen grains. Science 163: 85
- 87.
Raemarkers, C.J.J.M., Jacobson , E., Visser R.G.F.(1997b). Regeneration of plants
from somatic embryos and friable embryogenic callus of cassava (Manihot
esculanta Crantz) In: Thro AM. Akoroda MO, (ED) Pro 3rd Int Sci Meeting
Cassava Biotechnol Network. Afr J Tuber Crops 2: 238-242
Raemarkers, C.J.J.M., M. E. Sofiari, N.J.Taylor, G.G Henshaw, E. Jacobson & R.G.F.
Visser, 1996. Production of transgenic cassava by particle bombardment
using luciferase activity as the selection marker. Mol. Breeding 2: 339-349
Reamakers, C. J. J. M. Sofiari E., Jacobsen E., and Visser, R. G. F., 1997. Regeration
and transformation in cassava. Euphytica 96: 153-161
Reamakers, C. J. J. M., Amati, M., Staritsky, G., Jacobs, E., and Visser, R. G. F.,
(1993). Cyclic somatic embryogenesis and plant regeneratin in cassavas.
Ann. Bot. 71: 289-294
Schöpke C, Taylor N, Carcamo R, Konan NK, Marmey P, Henshaw GG, Beachy RN
& Fauquet C (1996) Regeneration of transgenic cassava plants (Manihot
esculenta Crantz) from microbombarded embryogenic suspension cultures.
Nature Biotechnol. 14: 731-735
Taylor NJ, Masona MV, Schopke C, Fauquet CM (2002). Transgenic cassava for food
security and economic development. In: Khachatourians GG, McHughen A,
Scorza R, Nip WK and Hui YH (eds) Transgenic Plants and Crops, New
York, pp. 523-546.
Taylor NJ, Masons MV, Carcama R, Ho T, Schopke C, & Fauquet CM (2001)
Production of Embryogenic tissue and Regeneration of transgenic plants in
cassava (Manihot esculanta Crantz) Euphytica 120: 25 -34
Taylor, NJ, M. Edwards, R. Kieman, C. Davey, D. Blakesley &G.G. Henshaw, 1996.
Development of friable embryogenic callus and embryogenic suspension
cultures in cassava (Manihot esculanta Crantz) Nature Biotech 14: 726-730
90
Thresh JM, Fargette D & Otim-Nape GW (1994) Effects of African cassava mosaic
geminivirus on the yield of cassava. Trop. Sci. 34: 26-42
Wenham J (1995) Post-harvest deterioration of cassava: A biotechnology perspective.
FAO Plant Production and Protection Paper, p130
Zhang P, Vanderschuren H, Futterer J, Gruissem W (2005). Resistance to cassava
mosaic disease in transgenic cassava expressing antisense RNAs targeting
virus replication genes. Plant Biotech. J. 3:385-397.
91
Efficacy of Bt-cotton against African bollworm (H. armigera) and
other arthropod pests
Waturu CN****, Wessels W, Kambo CM, Wepukhulu SB, Njinju SM, Njenga
GK, Kariuki JN, Karichu PM, Mureithi JM,
Abstract
A Confined Field Trial (CFT) was set up at KARI-Mwea with the objective of testing
efficacy of Bt-cotton varieties, (DP 448B and DP 404BG) on target pests including
the African bollworm and cotton semi-looper and non-target pests including the
cotton stainer, the cotton aphid and cotton red spider mite. The experiment had ten
treatments arranged in a randomized complete block design and replicated four times.
The mean counts of mites were insignificantly but consistently lower in the unsprayed
than the sprayed plots. However, observational evidence showed that the crop
remained greener for longer period than in the sprayed plots due to less damage by
mites. This suggested that reduced spraying in Bt-cotton could also reduce the
populations of mites.
Key words: Confined field trial, Bt-cotton, efficacy, target pests, non-target pests
Introduction
Cotton (Gossypium hirsutum L.) in Kenya is attacked by a complex of arthropod
pests, with four most important ones including the African bollworm (Helicoverpa
armigera Hb.), cotton stainer (Dysdercus spp.), cotton aphid (Aphis gossypii Glov.)
and cotton red spider mite (RSM) (Tetranychus telarius L.). The cotton semi-looper
(Cosmophila flava F.) is a sporadic pest of cotton in Kenya with occasional serious
damage on the leaves leading to total defoliation of the plants (Matthews, 1989). The
severity of damage on cotton crop by these pests depends on the prevailing weather
conditions as well as the control measures adopted on the earliest pest attack. In the
Central Kenya cotton-growing zone, H. armigera becomes a major problem in early
January after a lush growth during the short rains. This coincides with the formation
of squares during the bottom crop. RSM and aphids infestations occur during the dry
spell between January and March. Cotton stainers appear during splitting of the
bottom and top crop causing damage bolls.
The infestation of cotton by African bollworm at its most important reproductive
phase (squaring stage) has been shown to cause up to 100% yield loss if left
unchecked (Waturu, 2001). Most farmers use synthetic pyrethroids to manage the
African bollworm. However, such insecticides reduce natural enemies of mites and
aphids leading to resurgence of these pests later in the season (Waturu, 2001). This
implies that integrated pest management (IPM) approach that includes judicious use
of pesticides, cultural, biological and resistant cultivars would be most ideal in
managing cotton pests. Using cotton cultivars known to be resistant to damage by the
African bollworm would therefore indirectly impact positively on the management of
the other important pests. The transgenic cotton comprises of plants engineered to
express toxins of Bacillus thuringiensis (Bt) var. kurstaki in order to protect them
****
Corresponding author, karithika@africaonline.co.ke
92
from key target insect pests. The insecticidal proteins produced by Bt are toxic to
major
lepidopteran
pests
such
as
the
cotton
bollworms.
When incorporated into plants, Bt proteins are made much more persistent and
effective. The expression of Bt toxins in cotton plants can greatly reduce the need for
application of broad-spectrum insecticides. Bt-cotton is one of the insecticidal plants
approved for commercial production and its adoption has been rapid in the United
States of America (USA), Australia, China (Shelton et al., 2000) and South Africa in
1998 (Bennett et al., 2003). This has greatly reduced insecticide applications in
production of cotton in these countries. The National Biosafety Committee (NBC)
regulates introduction of any transgenic crop into the country. It requires biosafety
data that demonstrates the safety of the transgenic crop. Therefore, this research
aimed at generating field data on the impact of the Bt-cotton varieties DP 448B and
DP 404BG on target pests (African bollworm and cotton semi-looper) and non-target
arthropod pest species (aphids, mites and stainers) in a Confined Field Trial (CFT).
Materials and Method
This study was done within a CFT at KARI-Mwea, Central Kenya. The experimental
field was ploughed with a mould board plough and harrowed in preparation for the
layout. Experimental plots measuring 5 x 5 m were marked out in four blocks laid out
in a Randomized Complete Block Design (RCBD). Irrigation furrows of 30 cm depth
and 1m apart were prepared manually using fork Jembes. The furrows were blocked
each end with soil barriers to check the water flow during irrigation. Prior to planting,
the furrows were watered using a 4.0 hp water pump with 25x 2” plastic pipes from a
water canal adjacent to the CFT site. Seeds of Bt-cotton varieties DP404BG and
DP448B, isolines DP4049 and DP5415 and commercial variety, HART 89M were
planted in 7 cm deep holes dug with a panga at a spacing of 30 cm within a row and
100cm between rows. Planting exercise was done under the supervision of inspectors
from the Kenya Plant Health Inspectors (KEPHIS) as required by the National
Biosafety Committee (NBC). A total of seventy seeds were planted in each plot. The
experimental treatments included the five cotton varieties and a set of the same
varieties but with six foliar insecticide sprays applied weekly (Table. 1)
89
Table 1. Experimental treatments
Code
Treatment
Details
A
DP 448B
Transgene, unsprayed
B
DP 448B
Transgene, sprayed 6 times for sucking pests
C
DP 404BG
Transgen, unsprayed
D
DP 404BG
Transgene, sprayed 6 times for sucking pests
E
DP 5415
Isoline, unsprayed
F
DP 5415
Isoline, sprayed 6 times for sucking pests
G
DP 4049
Isoline, unsprayed
H
DP 4049
Isoline, sprayed 6 times for sucking pests
I
HART 89M
Local variety, unsprayed
J
HART 89M
Local variety, sprayed 6 times for sucking pests
To avoid bias during data collection, all treatments were denoted with letter codes
written on metallic labels and placed on each plot. Insecticides were applied with a
knapsack (Solo) sprayer fitted with a hollow cone nozzle set at a spray pressure of 4
bar. Data collected included counts of the African bollworm (larvae, eggs and
damaged squares), semi-looper larvae, aphids, mites and stainers. All data were
collected 10 weeks after crop emergence and continued at weekly interval for 12
weeks. Ten plants were randomly selected for data collection. Aphid and mite counts
were carried out using a magnifying lens by sampling 6 leaves from top, middle and
bottom levels of the plant amounting to 60 leaves per plot. An area of 2.5 cm² at the
point where the veins meet was scrutinized on each leaf. All data were transformed to
satisfy the requirements of Analysis of Variance (ANOVA) for normal distribution
and analysed in SAS.
Results
The target pests encountered in the CFT included the H. armigera and C. flava (Table
2). There were significant (p‹ 0.0001) differences on the number of ABW counted
among the treatments (Table 2). Mean counts of bollworm larvae were not
significantly different between the Bt-cotton treatments of DP 448B unsprayed,
DP448B sprayed, DP 404BG unsprayed and DP 404BG sprayed. Similarly mean
counts of bollworm larvae between treatments of the isolines DP 5415 unsprayed, DP
5415 sprayed, DP 4049 unsprayed, DP 4049 sprayed and the local commercial variety
HART 89M unsprayed and HART 89M sprayed did not show significant differences.
Mean counts of the bollworm eggs (Table 2) were not significantly different between
all treatments as expected since Bt-cotton does not affect egg laying and has no effect
on the bollworm eggs but affect the larvae when they hatch and feed on the Bt-cotton.
Table 2. Treatment means (transformed and actual ± SE) showing the effect of Btcotton on target cotton pests
Treatment
DP 448B unsprayed
Bollworms
1.31±0.10c
Bollworm eggs
4.35±0.89a
90
Damaged Squares
2.2±0.38b
Loopers
2.01±0.40b
DP 448B sprayed
DP 404BG unsprayed
DP 404BG sprayed
DP 5415 unsprayed
DP 5415 sprayed
DP 4049 unsprayed
DP 4049 sprayed
HART 89M unsprayed
HART 89M sprayed
CV
p-value
(0.75)
1.74±0.27c
(2.25)
1.18±0.18c
(0.5)
1.6±0.24c
(1.75)
3.41±0.54b
(11.5)
5.17±0.32a
(26)
3.75±0.55b
(14)
4.27±0.43ab
(17.75)
3.78±0.29b
(13.5)
4.37±0.56ab
(19)
22.17102
<0.0001
(20.25)
5.52±1.30a
(34.5)
3.98±1.37a
(20.5)
5.27±0.91a
(29.25)
4.38±1.05a
(21.5)
4.9±0.65a
(24.25)
5.18±1.18a
(30)
5.83±0.57a
(34)
5.18±1.38a
(31.5)
6.14±1.17a
19.10355
0.0813
(4.25)
2.32±0.22b
(4.5)
3.68±0.48b
(13.25)
3.35±0.30b
(10.5)
6.49±1.06a
(44.5)
8.32±1.12a
(72)
7.03±1.07a
(51.75)
8.06±1.05a
(67.25)
7.89±0.65a
(62.5)
6.74±1.40a
(50.25)
30.5227
<0.0001
(3.5)
2.72±0.34b
(6.75)
1.87±0.41b
(3)
1.96±0.24b
(3)
9.03±0.40a
(81)
9±0.54a
(80.75)
8.76±0.25a
(76)
8.37±1.03a
(72.25)
8.21±1.03a
(69.5)
9.22±0.76a
(85.75)
19.82407
<0.0001
Means (± SE) with the same letter are not significantly different, SNK at p=0.05
Differences between treatments for mean counts of damaged squares presented in
Table 2 were highly significant (p< 0.0001). There were no significant differences
among the Bt-cotton treatments and the non-Bt treatments. Differences between
treatments for mean counts of semi-looper larvae presented in Table 2 were highly
significant (p<0.0001). Like for the bollworm larvae, mean counts of semi-looper
larvae were not significantly different between the Bt-cotton treatments of DP 448B
unsprayed, DP448B sprayed, DP 404BG unsprayed and DP 404BG sprayed.
Similarly mean counts of semi-looper larvae between treatments of the isolines DP
5415 unsprayed, DP 5415 sprayed, DP 4049 unsprayed, DP 4049 sprayed and the
local commercial variety HART 89M unsprayed and HART 89M sprayed did not
show significant differences. However the semi-looper larvae counts between the Btcotton varieties and the non-Bt isolines and HART 89M were significantly different
with the Bt-cotton varieties having lower counts of the semi-looper larvae that the
non-Bt.
The results for the effect of Bt-cotton on non-target cotton pests are presented in Table
3. Non-target pests encountered in the CFT included the cotton aphid (A. gossypii),
the red spider mite (T. telarius) and the cotton stainer (Dysdercus spp.). Differences
between treatments for mean counts of aphids and stainers were highly significant
(p<0.0001). Significant differences between treatments were observed mainly
between the sprayed and unsprayed treatments for the aphids confirming that the
differences were as a result of the treatment with Actara TM 25WG and not the Btcotton. For the stainers those treatments where cotton bolls opened earlier had
significantly higher counts than those that opened later since stainers are attracted by
open cotton.
90
Table 3. Treatment means (transformed and actual ± SE) showing the effect of Btcotton on non-target cotton pests
Treatment
DP 448B unsprayed
DP 448B sprayed
DP
404BG
unsprayed
DP 404BG sprayed
DP 5415 unsprayed
DP 5415 sprayed
DP 4049 unsprayed
DP 4049 sprayed
HART
89M
unsprayed
HART 89M sprayed
CV
p-value
Aphids
16±0.92bcd
(257.5)
13.29±1.81d
(185.5)
18.74 ±1.71abc
(359)
15.25±2.32bcd
(247.75)
16.9±2.87bcd
(309.25)
12.05±1.10d
(147.75)
21.31±1.91a
(464)
15.6±1.33bcd
(247.75)
19.8±2.11ab
(404.5)
14.19±1.67cd
(208.75)
13.61556
<0.0001
Mites
12.64 ±2.26a
(174.79)
13.88±4.00a
(239.75)
11.25±2.91a
(151)
12.86±2.50a
(183)
12.72±2.37a
(177.5)
15.62±1.93a
(254.25)
12.66±3.66a
(199.5)
16.8±3.59a
(320)
11.73±2.81a
(160.25)
14.33±3.53a
(241.75)
19.53258
0.1303
Stainers
6.87±0.51bc
(47)
5.65±0.34bc
(31.25)
9.54±0.97a
(92.75)
7.19±0.62b
(51.75)
5.5±0.50bc
(30)
3.57±0.82c
(13.75)
10.46±1.24a
(113)
6.42±0.46bc
(40.75)
6.01±1.49bc
(41.75)
4.17±0.16bc
(16.5)
22.59977
<0.0001
Means (± SE)with the same letter are not significantly different, SNK at p=0.0
Conclusion
This study showed that two transgenic Bt-cotton varieties, DP 448B and DP 404BG,
effectively reduced the populations of the target pests on the crop. The result agree
with the findings of Novillo et al. (1999) who confirmed that the genetically
modified cotton was resistant to damage by the larvae of H. armigera, Pectinophora
gossypiella (saund.), Earias insulana (Boisd.). From the results it is therefore
concluded that the transgenic Bt-cotton varieties are effective in controlling the
African bollworm and consequently reduces damage of the fruiting structures of the
cotton plant. The Bt-endotoxin in the cotton has no direct effect on the non-target
cotton pests but may enhance their control through the increased activities of natural
enemies.
Acknowledgement
The authors would like to thank the Director KARI and Monsanto (K) Ltd for
permitting and funding the project. Further thanks are extended to Delta and Pineland
for providing Bt-cotton seeds that were used in the experiments. The Director ISAAA
AfriCentre, Executive Director ABSF and Chief Executive Africa Harvest for
financial and logistical support during the conduct of the trials. The regulatory
agencies KEPHIS and the NBC gave invaluable support that we greatly value. We
acknowledge the logistical input of the Centre Director KARI-Thika and the Centre
Director KARI-Mwea. Finally our gratitude is extended to the various KARI-Mwea
and KARI-Thika members of staff whose contribution made it possible to conduct the
research.
89
References
Bennett R., Buthelezi, T.J., Ismael, Y. and Morse, S. (2003). Bt-cotton, pesticides
labour and health: A case study of smallholder farmers in the Makhathini
Flats, Republic of South Africa. Outlook on Agriculture, 32(2), 123-128.
Butter, N.S., Surjit, Singh, S, S. (1996). Ovipositional response of Helicoverpa
armigera to different cotton genotypes. Punjab Agricultural University,
Ludhiana 141004, Punjab, India. Phytoparasitica, 24 (2), 97-102.
Clark D., Long T. and Pyke B. (1999). The performance of INGARD® cotton in
Australia in the 1998/1999 season. Narrabri, Aust.: Cotton R&D Corp. Occas.
Pap. 46pp.
Gary P. F., Mares, C.L. and Llewellyn D.J. (1994). Field Evaluation and Potential
Ecological Impact of Transgenic Cottons (Gossypium hirsutum) in Australia.
Biocontrol Science and Technology 4, 535-548.
Guo, X. M., Li-X. Guo, X.M. and Li, X.L. (1998). A Bt transferred bollworm
resistant short season cotton variety – CRI 30. Cotton Research Institute,
CAAS, Anyang 455112, Henan, China. China-Cottons, 25 (8), 26-27.
Hassan, S.T.S., Wilson, L.T. and Blood, P.R.B. (1990). Oviposition by Heliothis
armigera and H. punctigera (Lepidoptera: Noctuidae) on okra leaf and smooth
leaf cotton. Department of Biology, 43400 Universiti Pertanian Malaysia,
Serdang, Selangor, Malaysia. Environmental-Entomology, 19(3), 710-716.
Huang J., Ruifa Hu., Cuihui Fan, Carl E. Pray and Scott Rozelle. (2003). Bt. cotton
benefits, costs and impacts in China. Institute of Development Studies (IDA)
working paper 202, September 2003 Brighton, Sussex BNI GRE England.
Konate G. (2008). Evaluation of biological efficacy band environmental impact of Bt
cotton in West Africa (the case of Burkina Faso). Proceedings of BioVision
Alexandria 2008 Conference. Alexandria, Egypt, 12-16 April.
Kwint P. and Pyke B. (2000). The performance of INGARD cotton in Australia in the
1999/2000 season. Narrabri, Aust.: Cotton R&D Corp. Occas. Pap. 46pp.
Long A., Pyke, B. and Slack-Smith, P. (1997). The performance of INGARD® cotton
in Australia in the 1996/97 season. Narrabri, Aust.: Cotton R&D Corp. Occ. Pap.
42.
Matthews, G. A. (1989). Cotton insect pests and their management. Longman
Scientific and Technical, Longman Group UK Limited.
Novillo, C., Soto, J. and Costa, J. (1999). Results in Spain of varieties of cotton,
90
genetically modified against bollworms. Monsanto Espana, S.A. Division
Agricultura, Avda. Burgos 17, 10.a – 28036 Madrid, Spain. Boletin-de-SanidadVegetal,-Plagas, 25: (3) 383-393.
Morales A.A. (2000). The Mexican experience with insect resistance Bt. transgenic
crops. Presented at Soc. Invert. Pathol. 13-18 August 2000. Guanajuato, Mex.
(Abstr.).
Qaim M. (2003). Bt Cotton in India: Field Trial Results and Economic Projetions.
World development Vol. 31, No. 12. pp. 2115-2127.
Ramnath, S., Chitra, K. and Uthamasamy, S. (1992). Behavioural response of
Helicoverpa armigera (Hub.) to certain host plants. Department of Entomology,
Tamil Nadu Agricultural University, Coimbatore 641 003, India. Journal-ofInsect-Science, 5 (2), 147-149.
Shelton A.M, Zhao J.Z. and Rouch R.T. (2002). Economic, Ecological, Food Safety,
and Social consequence of the deployment of Bt transgenic plants. Ann. Rev.
Entomol. 47, 845-81.
Shelton M.S., Tang J.D., Roush R.T., Metz T.D and Earle E.D. (2000). Field tests on
managing resistance to Bt engineered plants. Nature Biotechnology 18, 339-342.
Shvetsova-L; Alibekova-Ch; Em-E (1989). Resistance of varieties.
Sredneaziatskii Institut Zashchity Rastenii, Uzbek SSR. Khlopok, 5, 29-30.
Waturu C.N. (2001). Role of KARI in enhancing cotton production in Kenya through
biotechnology. Opportunities for reviving cotton industry in East Africa through
biotechnology. Proceedings of the cotton stakeholders meeting. Nairobi, Kenya.
Waturu C.N., Kambo C.M., Ngigi R.G. and Muthoka N.M.(2006). Field
evaluation of transgenic Bt-cotton varieties DP 448B and DP 404BG for
efficacy on target and non-target pests and environmental impact. KARI –
Cotton Research Centre, pp. 8.
Wu, K.M. and Guo, Y.Y. (2005): The evolution of cotton pest management
practices in China. Annu. Rev. Entomol, 50:31-52.
Xia J.Y., Cui J.J., Ma L.H, Dong S.X. and Cui X.F. (1999). The role of transgenic Bt
cotton in integrated pest management. Acta Gossypii Sin. 11, 57-64.
91
Review of Farmers’ Awareness and Perceptions on Bt Cowpea in
West Africa: Case of Nigeria, Niger, Burkina-Faso, Mali and
Benin††††
Aïtchédji C. 1* and O. Coulibaly1,
1.
International Institute of Tropical Agriculture (IITA), Cotonou, Bénin
* Corresponding author, Email: c.aitchedji@cgiar.org; u.coulibaly@cgiar.org
Abstract:
This study initiated by AATF, executed by IITA/Purdue University aims to elicit
farmer and consumer preferences, acceptability, willingness-to-pay and adaptability
of GM cowpea to local conditions in West Africa. The main results show that: (1)
Information exchange and awareness are important for the adoption and large
diffusion of Bt cowpea. (2) There is a relatively high willing to pay for Bt cowpea
seeds by farmers. (3) Given the potential of reducing health hazards by lowering the
use of toxic synthetic pesticides, both farmers and consumers are willing to pay a
premium price for Bt cowpea as an alternative to harmful cotton pesticides. The
opportunity costs of using cotton insecticides include the economic losses
encountered by the farm household when a family member is sick due to the misuse
of chemical insecticides.
Background
Cowpea (Vigna unguiculata) is the most important grain legume and fodder crop in
the dry savannas of tropical Africa. It is grown in more than 12.5 million hectares of
largely smallholder farms, with an estimated production of more than 3 million metric
tones (Singh et. al., 1997; Coulibaly and Lowenberg-DeBoer, 2002). Over 60% of
cowpea area is in West and Central Africa (WCA), but a significant acreage is also
cultivated in East and Southern Africa. Nigeria and Niger account for 5 and 3 million
ha respectively. Other countries with significant areas under cowpea are Burkina
Faso, Cameroon, Ghana, Mali and Senegal (FAO, 2000). Nowadays it is a legume
widely adapted and grown throughout the world (Summerfield et al., cited by
Aveling, T., 1999), however, Africa predominates in production of cowpea with 68%,
Brazil 17%, Asia 3%, United States of America 2%, while the rest of the world
produces 10%.
Although there are high yielding varieties developed by, the International Institute of
Tropical Agriculture, (IITA) and the Bean/Cowpea CRSP (Purdue University) in
collaboration with national, regional and other international institutions, high
insecticide costs and poor continue to challenge the adoption of these varieties. To
address some of these challenges, the African Agricultural Technology Foundation
(AATF) has initiated a cowpea project, which will promote small farmers access to
††††
This study was sponsored by the African Agricultural Technology Foundation (AATF). IITA
thank the Departments of Agricultural Economics (Joan Fulton, Jayson Lusk), and Entomology (Larry
Murdock) of Purdue University (USA) for providing technical backstopping through a Ph. D study
carried-out by Dr. Sika Gbègbèlègbè.
92
conventional technologies and modern biotechnological products and create a
conducive seed policy environment to enhance the productivity of cowpea, thereby
addressing the twin problem of food insecurity and poverty among smallholder
farmers in Africa. Appropriate resistance when genetically incorporated into cowpea,
can increase its productivity and storability.
Availability of genetically improved cowpea lines with resistance to the pests that
cause the greatest damage to cowpea will contribute significantly to (1) increased
production and incomes, (2) improved nutrition and health for farmers and
consumers, and (3) enhanced soil fertility and stability and environment protection
through pesticide use.
Biotechnology may offer a cost effective and sustainable solution to cowpea pest
control and in particular Maruca vitrata through the insertion of Bacillus
thuringiensis (Bt) in cowpea varieties. Genes from the Bt bacteria have been inserted
in several other crops so that they produce their own toxins against similar insects
(e.g., Bt maize, Bt cotton). Bt proteins active against Maruca are being identified at
Purdue University with the support of the Bean/Cowpea Collaborative Research
Support Program. Significant progress is being made in developing a transgenic
cowpea with Bt gene (T.J. Higgins, personal communication). The new Bt cowpea
will be resistant to the pod borer Maruca and will decrease the numbers of insecticide
sprays and the overall costs of cowpea pest control. Earlier studies (Langyintuo, 2003)
predicted substantial benefits to be derived from Bt cowpea for producers and also
consumers in the Sahelian regions of West Africa. While Langyintuo’s analysis did
not include consumer response, there has been a consumer rejection of Bt maize in
Southern Africa. Kushwaha et al. (2004) also reported consumers’ concerns about
ethical and health problems related to GM crops in Northern Nigeria.
Experiences with transgenic crops elsewhere suggest that the economic, marketing
and consumer preferences as well as food, feed and environmental safety aspects
should be considered early in the process of developing a transgenic crop to ensure
ease of delivery, acceptability and access of the product to end users. This is a sure
way of safeguarding against a potential technology backlash among consumers as has
been demonstrated in some parts of world where some consumers have reacted
negatively to products from genetically modified plants, blocking them from certain
markets. This study aims to assess the potential regional impact of Bt cowpea through
an ex - ante analysis of farmers perceptions prior to the introduction of transgenic
cowpea in West Africa with a focus on eliciting farmers’ preferences, acceptability,
adaptability and assessment of farmers’ willingness-to-pay for Bt cowpea seed in the
main cowpea growing areas in West Africa.
Study areas and data collection
The study covers the main cowpea growing agro-ecological zones in West Africa.
Countries surveyed include Benin, Burkina Faso, Mali, Niger and Nigeria. Sample
sites include villages covered and not covered by PRONAF (Cowpea Project for
Africa) in each agro-ecological zone per country. If there are no PRONAF sites,
villages are randomly selected. In each village a sample of 15 farm households are
selected by category for decision making modeling and perceptions surveys. The
study is carried-out in two phases. The first phase has focused on a review of
89
available data and information on the key themes to be addressed in the specific
objectives. The second phase focused on interviews with producers and consumers
involved in the cowpea value chain (production, storage, marketing, demand
perceptions) to assess their views on the size, structure and main constraints and
opportunities of production and market, awareness and use of GM cowpea. Also, data
are being collected in both rural and urban markets and on costs of production.
Empirical model
To assess farmers’ preferences without actual physical products to test, willingnessto-pay (WTP) surveys have been carried-out among representative farmers in some
selected rural areas. Methodological issues in WTP are outlined by Freeman (1993),
Lusk and Hudson (2004), and Bocaletti and Moro (2000). Descriptive statistics were
used to analyze farmers and consumers WTP for Bt cowpea. Surveys and elicitation
were used to collect perceptions and to estimate farmers’ option-based WTP for Bt
cowpea seeds. Hypothetical market scenarios were explained to both farmers and
consumers for selling and buying cowpea seeds. “Cheap talk”, the main survey
method used under hypothetical scenarios consists of explaining to respondent’
market scenarios where they are invited to imagine being a customer in a market to
buy Bt cowpea seeds for the next cropping season. The seller then provides
advantages and disadvantages about conventional and Bt cowpea seeds prior to
offering these products at given prices to the client. The seller also proposes
insecticide in addition to conventional cowpea seeds and Bt cowpea seeds. When
buyers want cowpea seeds, they are asked to choose option quantities for the seeds,
i.e. the quantities of cowpea seeds they are sure to buy and plant whether the cropping
season is characterized by good rainfall or not. In some cases, farmers rather provided
option prices, i.e. the amounts of money they know they will spend on cowpea grains
regardless of the type of weather befalling over the cropping season.
Data
Secondary data were collected to do sampling and questionnaires. Those specific data
include an inventory of major cities and towns and cowpea markets. Secondary data
have been also collected on cowpea prices in markets (urban and rural) per local area
in each country over the past five years. Data on costs and benefits of farm production
and cowpea cropping have been collected. Primary data are collected from farmers,
producers and key informants through formal surveys. Samples of farmers and
consumers are determined based on typology (socio-economic characteristics) and a
random selection by cluster.
Results: Awareness and perceptions of producers and consumers on Bt Cowpea
Benin
Results for the Producers Perceptions in Benin
The average farm household exhibits a premium (higher than current price) for Bt
cowpea. The average farmer in the Oueme valley zone is willing to pay a higher price
for Bt cowpea seeds compared to conventional seeds or is willing to buy a higher
quantity of Bt cowpea seeds compared to conventional seeds when both products are
offered at the same price. With Bt cowpea, the average farm household located in
front of the valley in the valley zone would reduce the use of cotton chemical
90
insecticides to control pest infestation in cowpea, and would therefore reduce
potential health hazards to both cowpea growers and consumers. Cotton chemical
insecticides are quite effective at controlling pest infestation, but they involve health
hazards when mishandled and handling them appropriately requires expensive
equipment and training. Most cowpea growers located in front of Oueme valley
mishandle cotton chemical insecticide and are therefore subject to various health
hazards. Moreover, the residues of cotton insecticides can remain on cowpea products
and therefore cause health hazards to consumers.
Based on the expected impact analysis Bt cowpea would provide economic benefits to
cowpea growers in the valley agro-ecological zone. Bt cowpea availability would lift
a phyto-sanitary constraint for this farm household who is currently planting much
less cowpea compared to the average farm in front of the valley. The benefits
provided by Bt cowpea for the average farm household are likely to reflect the
benefits provided by health improvements due to a reduction in the use of harmful
cotton chemical insecticides. These health benefits could reflect a diminution in health
costs and/or a reduction in the opportunity costs of using harmful cotton chemical
insecticides. The opportunity costs of using cotton chemical insecticides include the
economic losses encountered by the farm household when a family member is less
productive due to the misuse of chemical insecticides.
The Perceptions of Urban and Rural Consumers: Glazoué Market (regional
market)
Consumers were surveyed to estimate their option-based WTP for Bt cowpea. Once
buyers are interested in Bt and/or conventional cowpea grains, they are asked to
provide option quantities for these products, i.e., quantities of cowpea they are sure to
buy regardless of their monthly household income. The average urban household in
regional markets of Benin (Glazoué) prefers Bt cowpea to its conventional
counterpart. Most respondents believed Bt cowpea to be safer than conventional
cowpea. This is mainly due to fact that the use of inappropriate pesticides caused
deaths among consumers in Benin in the last 10 years (Pesticides News, 2000; 2001).
Information and awareness of characteristics of the Bt cowpea will be important for
the adoption and diffusion.
Nigeria
Producers Perceptions: In Nigeria, producers (90%) are not aware of GM food.
Only 10 % of responded farmers reported some information on GM food. But, 84% of
producers would buy bt cowpea seeds at current market prices. About 70% of
producers are willing to pay a premium of 30% ($.20/kg) for Bt cowpea seeds over
the conventional cowpea seed price. A small group of farmers are willing to pay a
premium of more than 60% for Bt cowpea seeds.
Consumers Perceptions Results show that only 16% of rural consumers are aware of
GM food in rural zones compared to 33% in urban areas in northern Nigeria. Rural
consumers (82%) prefer Bt cowpea. Three main reasons were given by rural
consumers to justify their preference for GM cowpea. Their opinions are that GM
cowpea should be: Safe for human consumption (95% of consumers who accept GM
cowpea) Easy to cook for rural households (94%). Bt cowpea would increase the
91
income of the rural farm household and therefore increase its welfare: the rural
cowpea consumer tends to also be a cowpea producer. The perceptions of consumers
are similar in urban zones. About 33 % of consumers think that GM cowpea is quite
safe for human consumption while 43% reported that it is easy to cook. Consumers’
willingness to pay changes according to expected GM cowpea price. Only a small
proportion of consumers (16%) are willing to pay a premium up 30% over current
price of conventional cowpea for Bt cowpea ($.6/kg). Given the above assumption,
average urban consumers in Nigeria would like to pay for Bt cowpea. In 2 out of the 3
cities where interviews have been held, consumers prefer Bt to conventional cowpea.
For example, consumers in Maiduguri would discount Bt cowpea while consumers in
both Sokoto and Kano (two biggest towns in Northern Nigeria) tend to like Bt cowpea
and are ready to pay a premium for it.
Burkina- Faso
Producers Perceptions: The awareness of farmers on GM food is quite similar to
Nigeria; 23% of farmers interviewed have declared to be aware of the existence of
GM crops and products and mainly cotton in Burkina Faso. Friends and neighbors are
key network for information diffusion. Half of farmers (42%) expect that yields from
GM cowpea would be higher than conventional cowpea without pesticide treatment.
This is a key incentive for adopting GM cowpea. Twenty five percent of farmers are
willing to pay a premium price of at least 30% over the current price of conventional
cowpea.
Consumers Perceptions: Consumers in urban zones (42%) are more informed on
GM food than rural dwellers through various sources. 40% of urban consumers have
reported Bt cowpea may be easier to cook. One third (35%) of rural consumers report
that Bt cowpea would be safe for human consumption compared to 59% of urban
consumers. Half of the farmers (42%) are convinced that Bt cowpea would not require
the same level of pesticide spray like conventional cowpea for the same yield level.
The adoption of Bt cowpea would lead to significant reduction of pesticides and
hence potential health benefits for both cowpea growers and consumers. The majority
of rural consumers (92%) would choose to buy Bt cowpea at current conventional
cowpea prices. A significant number of rural consumers (23%) are willing to pay a
premium of 30% ($. 25/kg) over current prices ($. 80/kg)
Niger
Producers Perceptions: Cowpea producers (89%) in Niger do not know about GMO
but are willing to use the Bt cowpea seeds if they can decrease the level of pesticide
use compared to conventional cowpea and at the same price ($ 1/kg).
Consumers’ Perceptions: The average rural consumer who buys cowpea mostly for
home consumption tends to prefer Bt cowpea compared to a seller who is indifferent.
The average urban consumer prefers Bt cowpea and is ready to pay a premium for it.
Lower health risks (Bt cowpea is considered safer than conventional cowpea) could
explain this behavior.
Mali
92
Producers Perceptions: Compared to other countries, more producers (44%) are
aware of GM food in Mali. Radio and television are their key sources of information.
Many farmers (76%) would adopt Bt cowpea seeds and are willing (88%) to pay a
premium price of more than $.80/kg. The majority of producers prefer Bt cowpea
which is cost effective and safer than conventional cowpea because of lower pesticide
use. Farmers (40%) expect that yields obtained from Bt cowpea would be higher than
conventional cowpea with no sprays.
Consumers’ Perceptions: Like producers, only a small portion of consumers (25%
rural and 37% urban) is aware of GM food and are informed through local radio and
television, and newsletters. However for the knowledgeable consumers, Bt cowpea
may be safer than conventional cowpea because of lower pesticide use and related
risk to the human consumption (60% of farmers). In rural areas, 68% of consumers
find that Bt cowpea is safer for human consumption. The majority of urban
consumers (99%) are willing to pay for Bt cowpea a price margin between 0 - $1/kg.
Results from the study indicate that domestic factor costs were the most important
proportion in the total cost of cowpea production compared to tradable factors costs.
Labor costs accounted for the large share of total costs.
Conclusion
This perceptions study has covered the main cowpea growing agro-ecological zones
in West Africa, mainly in Benin, Burkina Faso, Mali, Niger and Nigeria. Results show
that the majority of producers and rural consumers are not aware of GM food or GMO
products. Only few farmers reported some information on GM food. In urban areas
the level of information and awareness of consumers is much higher. Information
exchange, sensitization and awareness are important elements for the adoption and
large diffusion of Bt cowpea when developed. The average farmer is willing to pay a
higher price for Bt cowpea seeds (premium) as it would reduce chemical pesticide use
and/or solve its non-availability. Expectations are that Bt cowpea would reduce
potential health hazards to both farmers and consumers by reducing the use of
harmful cotton pesticides. Health benefits will be linked to the reduction in health
costs and/or a decrease in the use of harmful cotton insecticides. The opportunity
costs of using cotton insecticides include the economic losses encountered by the farm
household when a family member is sick due to the misuse of chemical insecticides.
An average urban consumer believes that Bt cowpea would be safer. Bt cowpea which
is an improved variety will increase significantly the profitability for farmers and also
decrease health costs to farmers and consumers.
References
Aveling, T., 1999. Cowpea pathology research.
www.ap.ac.za/academic/microbio/plant/pr-colwpea.html
(also
available
at
Bocaletti S. and Moro D. (2000); Consumer willingness-to-pay for GM food products
in Italy in AgBioForum; v. 3 (4); online access
Coulibaly O. and J. Lowenberg-Deboer. 2002. The Economics of Cowpea in West
Africa. Pages 351-366. In Challenges and Opportunities for enhancing
sustainable cowpea production, edited by Edited by. C.A. Fatokun, S.A.
93
Tarawali, B.B. Singh, P.M. Kormawa, and M. Tamò. Proceedings of the
World Cowpea Conference III held at the International Institute of Tropical
Agriculture (IITA), Ibadan, Nigeria.
FAO. 2000. Site internet : http//www. Fao. org /statistics
Freeman A. M. (1993); The measurement of environmental and resource values:
theory and methods; Washington, D.C., Resources for the Future; p. 516
Kushwaha, S., A. S. Musa, J. Lowenberg-DeBoer and J. Fulton. 2004. Consumer
Acceptance of GMO Cowpeas in Sub-Sahara Africa. Selected paper at the
American Agricultural Economics Annual Meeting, Denver, August. On-line
at: http://agecon.lib.umn.edu/cgi-bin/pdf_view.pl?paperid=14082&ftype=.pdf
Langyintuo A. S. (2003); Cowpea Trade in west and Central Africa: A Spatial and
Temporal Analysis; West Lafayette (Indiana); Purdue University; 192 p;
available from: Economics and Management library; Thesis 48708 PhD
Langyintuo A. S. et al (2003); Cowpea Supply and Demand in West and Central
Africa in Field Crop Research 82; pages 215-231
Langyintuo, A.S., Lowenberg-DeBoer, J., Faye, M., Lambert, D., Ibro, G., Moussa,
B., Kergna, A., Kushwaha, S., Musa, S & Ntoukam, G. 2003. Cowpea supply
and demand in West and Central Africa. Field Crop Research 82 (2003): 215231. (also available at www.sciencedirect.com)
Lusk and Hudson (2004); Willingness-to-Pay Estimates and Their Relevance to
Agribusiness Decision Making in Review of Agricultural Economics; Summer
2004; v. 26, issue 2; pp. 152-69
90
Genetic and Biochemical Analyses of Cultivated Coffea Canephora
(Pierre) Diversity in In Uganda‡‡‡‡
Kahiu
Ngugi2,
MUSOLI,
Pascal1 CUBRY,
ALUKA
Pauline1
3
4
4
Philippe DAVRIEUX Fabrice , RIBEYRE Fabienne GUYOT Bernard4, DE
BELLIS Fabien3, PINARD Fabrice5, KYETERE Denis1 OGWANG James1,
DUFOUR, Magali3 LEROY Thierry3.
1
NARO-CORI P.O. Box 185 Mukono Uganda,
Faculty of Agriculture, University of Nairobi, Kenya
3
CIRAD-CP, UMR T52 PIA, TA 80/03 Avenue Agropolis 34398 Montpellier
Cedex 5 France, 4CIRAD-CP, UPR Quality of perennial products TA 80/16
Rue JF Breton 34398 Montpellier Cedex 5 France,
5
Coffee Agroforestry Systems CIRAD-ICRAF.United Nations Av. Gigiri, PO
Box 30677 00100 Nairobi, Kenya.
2
EMAIL: alukapaula@yahoo.com;kahiu@uonbi.ac.ke
Abstract
In this study, samples were collected as seed and cuttings from farms Kawanda
germplasm collection. Species diversity was evaluated using Sequence Repeats (SSR),
Near Infra Red Spectroscopy, (NIRS), biochemical titrations and cup testing after
roasting coffee beans. Control samples were included from known genetic diversity
groups of C. canephora. A diversity tree was constructed with Simple Sequence
Repeats (SSR) polymorphism by Neighbour Joining (NJ) analyses from dissimilarity
matrix. DNA results pointed out three major groups of farm trees with one group
constituting of entries from closely located districts and controls a distinct group of
their own. Four groups were derived from NIRS analyses of fruits with Erecta types
forming own group and collections from mainly one district comprising another.
Ugandan genotypes were also noted to have high sucrose and fat content.Cup test
analysis have confirming that Ugandan robusta coffee is of better quality than most
other robusta coffees. NIRS and biochemical analysis undertaken to test for caffeine
did not offer any significant discrimination between Kawanda collection collections
and samples from other districts.
Introduction
With the exception of C. arabica (2n=44), all coffees in the genus Coffea are diploid
(2n=22), with gametophytic self in-compatibility. C. canephora constituting 90% of
Ugandan production, is a major source of foreign exchange, local revenue and
employment (UCDA, 2002/03). Over 2.5 million people are involved in its
cultivation, processing and trade. Research for genetic improvement still lacks
adequate core germplasm. Consequently, low quality production has made small
farmers lose more of their revenue particularly in severe world coffee price crisis.
The purpose of this study is to understand robusta coffee genetics, biochemical and
organoleptic biodiversity at the small farm level in all traditional producing areas in
‡‡‡‡
Grateful to USDA for funding the research through ICRAF and CIRAD for technical expertise
91
Uganda. With this knowledge, it is possible that markers related to coffee quality will
be pointed out and used for breeding varieties producing high quality robustas.
C. canephora cuttings and seed were collected from farms in traditional growing areas
and Nganda, Erecta and hybrids from Kawanda germplasm collection. SSR was used to
evaluate 250 DNA samples from 10 districts after DNA extraction from leaves. A
diversity tree was constructed with SSR polymorphism by Neighbour Joining (NJ)
analyses from dissimilarity matrix (Prakash et al, 2005). NIRS electromagnetic
radiations discriminated and grouped 93 fruit samples from 5 districts based on their
seed chemical composition and fingerprint (Davrieux et al, 2003). Sixteen genotypes
representing groups determined by Malahanobis distance were evaluated by
biochemical titrations for dry matter and caffeine. Also cup testing was conducted on
40 samples after roasting. Controls used were from known genetic diversity groups of
the same species.
Results and Discussions
Figure 1:Darwin NJ tree and AFTD for Districts on DNA analysis with 18 SSR
markers
Key
Letter codes= represent different districts
DNA results pointed out three major groups of trees (Figure 1). One group was
constituted of entries from closely located districts while the other two are composed
of individuals that necessarily do not come from neighbouring districts. Controls
constituted a group of their own.
Figure 2:
Fruit analyses with Near Infrared Spectroscopy
89
Key
UE = Erecta types
UH =Hybrids
UN = Nganda types
UF = Farm collections
Four groups were derived from NIRS analyses of fruits (Figure 4). Erecta types stand
out on own group as well as some farm collections from mainly one district. The
hybrids were in another group with some farm collections. Also NIRS results (Figure
3) indicated that Ugandan genotypes have high sucrose and fat content. While cup
test analysis confirmed that Ugandan robustas are of high organoleptic quality, with
some qualities (acidity) comparable with some arabicas.
Figure 3:
Green robusta caffeine analysis using NIRS and HPLC
C A F E VER T R OB U S T A OU GA N D A A N A L YS ES D E L A C A F EI N E N I R S + H P L C
3.50
3.00
2.50
2.00
ni r s
l abo r ms
1.50
1.00
0.50
0.00
For caffeine analysis, no significant difference from NIRS and biochemical analysis
offer opportunity for analysing more samples using NIRS that is fast and cheaper.
90
Conclusion and recommendations
DNA, NIRS and biochemical analyses revealed species diversity within Ugandan
farms and collections. C. canephora in Ugandan farms is genetically diverse
providing opportunity for desirable trait selection. First results obtained pointed out
that some of the collected are of very good quality. Unfortunately due to the low
number of samples regarding to the coffee area in Uganda, it is difficult to have a
complete image of robusta quality in Uganda. For good representation and
comparison, need to sample more districts and increase numbers of nganda, erecta and
hybrids for NIRS and cupping. There will be need to collect and relate environmental
information with NIRS, biochemical and cup test results to identify genetic contribution
to quality that can be used for crop improvement.
References
Davrieux Manez J.C., Durand N., and Guyot B. (2003). Determination of the content
of sixmajor biochemical compounds of green coffee using near infrared
spectroscopy. International conference on Near Infrared Spectroscopy, (11th).
Cordoba (Spain), April 2005.
Prakash N.S., Combes M.C., Dussert S., Naveen S. and Lashermes P. (2005).
Analysis of genetic diversity in Indian robusta coffee genepool (Coffea
canephora) in comparison with a representative core collection using SSRs
and AFLPs. Genetic Resources and Crop Evolution 52: pgs 333-342Uganda
Coffee Development Authority, (1999) Annual report (1st October2002 – 30th
September 2003).
89
Genetic Diversity of Groundnut Botanical Varieties Using Simple
Sequence Repeats
Asibuo, J. Y1, He, G2., Akromah, R3 ., Safo-Kantanka, O3. , Adu-Dapaah, H.
K1 Quain, M.D1.
1. CSIR-Crops Research Institute, P. O. Box 3785, Kumasi, Ghana. W/Africa
2. Centre for Plant Biotechnology Research, Tuskegee University
3 Department of Crop and Soil Science, Kwame Nkrumah University of
Science and Technology, Kumasi, Ghana
Abstract
Groundnut is a member of genus Arachis and the crop is divided into two subspecies
and six botanical varieties based on morphological characteristics. Groundnut core
collection of 831 accessions was developed from a total of 7432 US groundnut
accessions based on morphological characteristics. The large number and variability
of accessions in genebanks create problems in knowing which germplasm to select for
breeding purpose. A core collection is a fraction of accessions from the entire
collection which represent most of the available genetic diversity of the species. A
core collection can extensively be evaluated and information derived from them can
be applied to the whole collection. Identification of DNA markers associated with the
botanical varieties of groundnut would be useful in genotyping, germplasm
management and evolutionary studies. The objective of this study was to evaluate 22
groundnut genotypes representing six botanical varieties from US groundnut core
collection to determine their diversity using microsatellites. The results showed that 6
primers could amplify specific bands in particular botanical varieties. Most of the
primers could amplify two or more specific bands for the botanical varieties. The
results indicated that few primers could distinguish between botanical varieties and
individual accessions within the group. Identification of molecular markers associated
with only one botanical variety would be very useful. The cluster analysis put the
lines in their assigned specific botanical groups in agreement with available
morphological classification for groundnut. More groundnut SSR markers should be
developed to differentiate between botanical varieties and accessions.
Key words: Groundnut, diversity, hypogaea, fastigiata, microsatellites, botanical
Introduction
Groundnut is unique because the numerous diversity exhibited by the genotypes at the
morphological, physiological and agronomic traits are not reflected at the DNA level.
Earlier studies using isozymes and seed storage proteins revealed very little
polymorphism (Stalker et al., 1994; Lacks and Stalker, 1993). The use of DNA
techniques like random amplified polymorphic DNA (RAPDs) and restriction
fragment length polymorphism (RFLP) also did not detect polymorphism in the
cultivated groundnut (Kochert et al., 1991; Halward et al., 1992.; Paik-Rao at al.,
1992). The low level of polymorphism in cultivated groundnut are attributed to three
causes or combinations of them: barriers to gene flow from related diploid species to
domesticated groundnut as a consequence of the polyploidization event (Young et al.,
1996), recent polyploidization combined with self-pollination (Halwald et al., 1991)
and use of few elite breeding lines and little exotic germplasm in breeding
programmes, resulting in a narrow genetic base (Knauft and Gorbet, 1989; Isleib and
90
Wynne 1992 ). The paucity of polymorphism in groundnut at the molecular level has
led to genetic studies in the crop lagging behind compared with the progress made in
other crops.
Recent studies using novel DNA techniques like amplified fragment length
polymorphism (AFLP) and microsatellites also known as simple sequence repeats
(SSR) have revealed differences between groundnut genotypes (He and Prakash,
1997; Hopkins et al., 1999). Microsatellites are short tandem repeats (1-6 bases)
found in both prokaryotes and eucaryotes. They are abundant, evenly distributed
throughout the genome, co-dominant, highly reproducible, highly polymorphic within
and between species and easy to assay (Hopkins et al., 1999).
It is becoming more and more evident that the techniques from molecular biology
hold a promise of providing detailed information about the genetic structure of natural
population, than what has been achieved in the past (Slatkin, 1987). Molecular
markers like RFLP and a number of PCR-based markers are being used extensively
for reconstructing phylogenies of various species. The techniques have been found to
provide novel information regarding the relationship between closely related species
and the sort of genetic variations associated with species formation (Mohan et al.,
1997). Furthermore, these studies hold a great promise for revealing more about the
pattern of genetic variation within species (Avise, 1994). Identification of DNA
markers associated with the botanical varieties of groundnut would be useful in
genotyping, gerrmplasm management, genetic diversity and evolutionary studies.
Recent work has demonstrated that simple sequence repeats are applicable to the
fingerprinting of sub-species of groundnut and botanical varieties as well as mapping
studies (Hopkins et al., 1999; He et al., 2003), and have the potential to be used in
genetic diversity screening and evaluation of germplasm. The objective of this study
was to determine the usefulness of SSRs in diversity studies among 22 genotypes
representing six botanical varieties from US core collection.
Plant materials
Twenty-two cultivated groundnut accessions (Table 1) representing six botanical
varieties were obtained from Tuskegee University, Alabama, USA.
DNA extraction
Plant genomic DNA was extracted using MasterPure Leaf Purification Kit (Epicenter,
Madison, W1). The DNA tested on 0.8% agarose gel. The quality of DNA
concentration was determined by DU640B spectrophotometer (Beckman Coulter,
CA). DNA was diluted to 50 ng/µl in sterile water for PCR analysis. PCR reaction
mixture consisted of 1 µl/50ng template DNA, 1x PCR buffer, 1.5 mM of MgCl2, 0.2
mM of each dNTP, 250 nM each of forward and reverse primers, and 0.25U Taq
polymerase in a 10 µl reaction volume. PCR amplifications were carried out in a
Perkin-Elmer 9700 thermocycler as 94 oC for 3 minutes for initial denaturation: 94
o
C/30s, 65 oC/30s, 72 oC/60 s for two cycles: 94 oC/30 s, 56 oC/30 s, 72 oC/60 s for two
cycles: 94 oC/15 s, 55 oC/30 s, 72 oC/60 s for thirty cycles: and 72 oC/10 minutes for
final extension (Mellersh and Sampson, 1993). The PCR products were denatured by
heating at 94 oC for 3 minutes and immediately placed on ice. Two microlitres of
90
loading buffer (98% formamide, 10 mM EDTA, 0.005% of xylene cyanol FF and
0.005% of bromophenol blue) was added to each tube. PCR products were run on 6%
polyacrylamide gels. The gel was pre-run for 20 minutes before loading the samples.
Ten microlitres of each sample was loaded per track and electrophoresed on 6%
polyacrylamide gels (19:1 acrylamide, 7.5 M urea and 1 X TBE) for 1 h 30 min at 300
W. Plate 4.3 shows the polyacrylamide gel (PAGE) setup.
After electrophoresis, the glass plates were separated from each other and the gel
treated for 10 minutes in fixation solution (7.5% v/v acetic acid) with gentle shaking
and then washed in distilled water for 2 minutes (Plate 4.4). The fixation step was
followed with oxidation for 3 minutes (1.5% v/v nitric acid). After incubating in
staining solution (0.1% w/v silver nitrate, 750 µl formaldehyde), the gel was washed
in distilled water for 10 seconds, and then transferred to cold developing solution (3%
w/v sodium carbonate, 3 ml formaldehyde, 250 µl 1X sodium thiosulphate) to develop
the silver-stained DNA bands. The development was stopped by using a stop solution
(7.5% v/v acetic acid), and followed by detaching the gel from the glass by using
sodium hydroxide (4% w/v). The gel was transferred to a 3MM chromatography
paper and left at room temperature overnight to dry.
Table 1. The accessions used for the detection of DNA polymorphism.
Botanical variety
Plant introduction number
Fastigiata
497517
494002
493581
493536
Aequatoriana
628541
602357
497633
497615
628572
628572
628569
628571
576616
576634
494029
494053
497489
494049
476093
475982
475861
468213
Peruviana
Hirsuta
Vulgaris
Hypogaea
Cluster analysis
Gels were scored for the presence or absence of polymorphic band. Cluster analysis
was performed using clustalw
programme (http://www.ebi.ac.uk/clustalw)
91
Results
The extracted DNA was tested on 0.8% agarose gel. The results showed that all the
primers could amplify clear bands in most of the accessions. Six primers could
amplify specific bands in particular botanical varieties. The results indicated that few
primers could distinguish between botanical varieties and individual accessions within
the group. Most of the primers could amplify two or more specific bands for the
botanical varieties. Primer PM 343 amplified different size of bands in four botanical
varieties and could distinguish the four accessions within three botanical varieties
(equatoriana, fastigiata and peruviana) and two accessions in hirsute.
Primer PM 42 could identify the accession in Peruviana. Primer PM 50 was difficult
to score because of shadow (stutter) bands. This made distinction between individual
accessions within a group very difficult but could distinguish between three botanical
varieties (hypogaea, vulgaris and hirsuta.
Botanical variety
fastigiata
fastigiata
fastigiata
fastigiata
aequatoriana
aequatoriana
aequatoriana
aequatoriana
peruviana
peruviana
peruviana
peruviana
vulgaris
vulgaris
vulgaris
vulgaris
hirsuta
hirsuta
hypogaea
hypogaea
hypogaae
hypogaea
Fig. 1. Phylogenetic tree computed by the programme CLUSTALW software,
displaying the clustering relationship between 22 accessions of groundnut
representing six botanical varieties.
90
Discussion
Variation in the species Arachis hypogaea L. has been studied previously using
isozymes, RAPDs and RFLP (Halwald et al., 1992; Lacks and Stalker, 1993,
Halward,et al., 1991). These studies revealed little variations between cultivars.
However, recent studies with AFLP and microsatellites have revealed polymorphism
in cultivated groundnut (He and Prakash, 1997, Hopkins et al 1999, Gimenes et al.,
2002, He et al., 2003 The level of polymorphism observed by these authors were low.
The accessions selected for this study represent six botanical varieties which are
morphologically variable. The accessions were selected to capture the widest
variation that may be found within cultivated groundnut. Six primers could detect 5
alleles in the accessions, 5 primers could distinguish 4 alleles, 10 primers identified 3
alleles, and 1 primer could detect 2 alleles. Even though the level of polymorphism
was good, it was low when compared to the level of polymorphism in other crops.
The low level of variation in cultivated peanut has been attributed to three causes or to
combinations of them: barriers to gene flow from related diploid species to
domesticated peanut as a consequence of the polyploidization event (Young et al.,
1996), recent polyploidization combined with self-pollination (Halwald et al., 1991)
and use of few elite breeding lines and little exotic germplasm in breeding programs,
resulting in a narrow genetic base (Knauft and, Gorbet, 1989; Isleib and Wynne 1992
). The phylogenetic tree places hypogaea accessions at the outermost intra-specific
branch, put fastigiata and aequatoriana in one group, peruviana in one group and
hirsuta and hypogaea in another group. Identification of molecular markers associated
with only one botanical variety would be very useful. More groundnut SSR markers
should be developed to differentiate specific loci for botanical varieties and
accessions. The low level of polymorphism observed in groundnut is due to genetic
bottleneck brought about by the polyploidization event, which prevented gene flow
from diploid species in genus Arachis into the cultivated groundnut (Young et al.,
1996). Groundnut is also self pollinated crop, outcrossing is difficult.
The tree obtained from the cluster analysis put the lines in their assigned specific
botanical groups in agreement with available morphological classification for
groundnut (Kaprovickas and Gregory 1994). The second observation was that, the
position of the botanical groups in the clusters did not follow the same sequence as
observed by He et al. (1997) when they studied diversity within the botanical varieties
of groundnut. This observation is not unique, grouping genetically more distant lines
in the same cluster have also been reported by Powell et al. (1996). The possible
reasons for these discrepancies include underlying assumptions in calculating
pedigree data (Messmer et al., 1993), genome sampling method (Nei, 1987) and the
number of markers or probes employed (Tivang et al., 1994). Pejic et al. (1998)
observed that to obtain precision in the estimate in RFLP require 30-40 clone-enzyme
combination, 40-50 primers of RAPDs, 4-5 enzyme combination in AFLP and 20-30
SSR primers.
89
References
Avise, J. C. 1994 (ed)., Molecular Markers, Natural History and Evolution, Chapman
and Hall, New York, 1994, pp. 1–5.
Banks, D.J. 1976. Peanuts: Germplasm resources. Crop Science 16:499-502.
Gimenes, M. A., Lopes, C. A. and Vall, J. F. M. 2002. Genetic relationships among
Arachis species based on AFLP. Genetics and Molecular Biology 25:349-353
Halward T. M, Stalker H. T, Larue E. A, Kochert, G. A. 1991. Genetic variation
detectable with molecular markers among unadapted germ-plasm resources of
cultivated peanut and related wild species. Plant Molecular Biology 18:10131020.
Halward, T., Stalker, T., LaRue, E. and Kochert, G. 1992. Use of single-primer DNA
amplification in genetic studies of peanut (Arachis hypogaea L.). Plant
Molecular Biology 18: 315-325.;
He, G. and Prakash, C. S. 1997. Identification of polymorphic DNA markers in
cultivated peanut (Arachis hypogaea L.). Euphytica 97:143-149.
He, G., Meng, R., Newman, M., Guoqing, G., Pittman, R. N, and Prakash, C. S. 2003.
Microsatellites as DNA markers in cultivated peanut (Arachis hypogaea L.).
BMC Plant Biology 3:381-390.
Hopkin, M. S., Casa, A. M., Wang, T., Mitchell, S. E., Dean, R. E., Kochert, G. and
Kresovich. 1999. Discovery and characterization of polymorphic simple
sequence repeats (SSRs) in peanut. Crop Science. 39:1243-1247
Isleib T. G. and Wynne J. C 1992. Use of plant introductions in peanut
improvement.In: Use of Plant Introductions in Cultivar Development (Edited
by: Shands H. L). Madison: Crop Science Society of America, 2:75-116.
Knauft, D. A and Gorbet, D.W. 1989. Genetic diversity among peanut cultivars. Crop
Science 29:1417-1422.
Kochert, G., Halward, T., Branch, W. D. and Simpson, C. E. 1991. RFLP variability
in peanut (Arachis hypogaea L.) cultivars and wild species. Theoretical and
Applied Genetics 81:565-570.
Lacks, O. D. and Stalker, H. T. 1993. Isozyme analyses of Arachis species and
interspecific hybrids. Peanut Science 20:76-81
Mellersh, C, and Sampson, J. 1993. Simplifying detection of microsatellite length
polymorphisms. Biotechniques 15:582-584.
Messmer M. M, Melchinger A. E, Hermann R. G, Boppenmeier, J (1993)
Relationship among early European maize inbreds.II. Comparison of pedigree
and RFLP data. Crop Sci. 33: 944-950
Mohan, M., Nair, S., Bhagwat, A. Krishna, T. G., Yano, M. Bhatia, C. R., Saski, T.
90
1997. Genome mapping, molecular markers and marker-assisted selection in
crop plants. Mol. Breeding. 3:87-103
Nei, M. 1987. Molecular evolution genetics. Colombia University Press, New York.
Pp 512
Paik-Ro, O. G., Smith, R. L. and Knauft, D. A. 1992. Restriction fragment length
polymorphism evaluation of six peanut species within the Arachis section.
Theoretical and Applied Genetics 84:201-208.
Pejic, I., Ajmone-Marsan, P., Morgante, M., Kozumplick, V., Castiglioni, P.,
Taramino, G., Motto, M., 1998. Comparative analysis of genetic similarity
among maize inbred lines detected by RFLPs, RAPDs, SSRs and AFLPs.
Theoretical and Applied Genetics 97:1248-1255.
Powell, W., Machray, G. C. and Provan, J. 1996. Polymorphism revealed by simple
sequence repeats. Trends in Plant Science. 7:215-222.
Slatkin, M. 1987. Gene flow and the geographical structure of natural populations.
Science 236:787-792.
Stalker, H . T., Phillips, T. D. Murphy, J. P. and Jones, T. M. 1994. Variation of
isozyme patterns among Arachis species. Theoretical and Applied Genetics.
87:746-755
Tivang, J. G. Nienhuis, J. and Smith, O. S. 1994. Estimation of sampling variance of
molecular-marker data using the bootstrap procedure. Theoretical and Applied
Genetics 89:59-264
Young, N. D., Weeden, N.F., and Kochert, G. 1996. Genome mapping in legumes
(Family Fabaceae). In A. H. Paterson (ed.). Genome mapping in plants. T. G.
Landes Co., Austin, TX. Pp.211-227.
91
A Comparative Study of the Bacteriophage Efficiency and
Antibiotics Susceptibility against Sudanese Local Bacteria Species
Escherichia Coli and Staphylococcus Aureus
Ayman, A., E1
1
Alneelain University Faculty of Science and Technology School of
Biotechnology
Corresponding address:
Ayman Ahmed Elshayeb
Alneelain University Faculty of Science and Technology School of
Biotechnology
Zip 11111, Postal code 11121 Box 12702. Khartoum –
Sudan Telephone: + 249122974208, E- mail: ayman_elshayeb@yahoo.com
Abstract
Increasing chemotherapeutic resistance of E.coli and S. Aureus motivated the
comparison of bacteriophage efficiency and antibiotics susceptibility. In broth media
the affection of the bacteriophage interactions with bacteria showed increasing
bacteriophages and decrease of the bacteria due to culture clearance. Turbidity for the
first and second infection was significant for E. Coli and S. aureus phages samples'
transmission associated with different sampling sites. On solid media the affection of
the bacteriophage was recognised by the phage plaque formation on bacterial cultures.
The antibiotics susceptibility against the bacteria was also significant. The protein
profiles of E. Coli bacteriophage showed three major bands with different molecular
weight masses. The study showed approximately similar results for the mechanical
action of the bacteriophage on the selected bacteria species and the mode of action of
antibiotics. The study recommends manipulation of bacterial infections by the
bacteriophage therapy in case of the antibiotic resistant bacteria.
Keywords: Antibiotics/ bacteriophage/ Escherichia Coli/ Pathogenic bacteria/ Protein
profile/ Stabilisation Station /Staphylococcus Aureus/.
Introduction
Antimicrobial phage therapy trials have demonstrated phage infection of bacteria in
the peritoneal cavity, blood, muscle and embryonated hen eggs, many in the latter
group are spurred on by the increasing incidence of nosocomial (hospital-acquired)
infections of bacteria resistant against most or all known antibiotics, (Kasman, 2005).
Despite extensive intervention strategies, human E. coli infections still occur and
bacteriophages have been used successfully as antibacterial agents in both human and
veterinary medicine and are one potential preharvest E. coli control strategy,
(Fischetti, 2001). The fact that E. coli is also a normal constituent of the gut flora of
humans could present a peculiar problem for phage therapy of E. coli diarrhoea.
Therefore, the phage selection should be investigated individually for their lytic
potential on non-pathogenic E. coli strains (Chennoufi et al., 2004). Staphylococci in
general are sensitive to many antibiotics, such as benzyl penicillin, cloxacillin,
cephlosporins, tetracycline, chloramphenicol, erythromycin, fucidin, clindamycin,
vancomycin, streptomycin and gentamicin, (Breithaupt, 1999). Many of the hospitals’
strains are also resistant to several other anti- Staphylococcal antibiotics (multiresistant strains) and these strains are often responsible for hospital cross infection and
92
may be highly virulent. The multiresistant hospital Staphylococci have probably
arisen by a succession of mutations conferring resistance to these different drugs in
strains that were at first only penicillin resistant, in addition, these MRSA strains also
frequently exhibit resistance to a variety of other common antibiotics (Lowy, 2003).
The prevalence, in hospital, of strains resistant to a particular antibiotic is related to
the a mount of that antibiotic used in the hospital and the predominance of multiresistant strain may be maintained by the widespread use of any one of the antibiotics
to which it is resistant, (Deshpande et al., 2004). Since different strains of S. aureus
differ in sensitivity to different antibiotics, the choice of antibiotic for use in treatment
of a patient should be based on the results of sensitivity tests made on a culture of the
strain isolated from the patient, (Geisel et al., 2001). S. aureus, a cause of wound and
soft-tissue infection, is often resistant to all ß-lactam antibiotics, and strains resistant
to vancomycin occur surgical infections may become untreatable. (Wills et al., 2005).
The increasing prevalence of antibiotic-resistant Staphylococci has prompted the need
for antibacterial controls other than antibiotics. A lytic bacteriophage (phage K§§§§)
was assessed in-vitro for its ability to inhibit emerging drug-resistant S. aureus strains
from hospitals and other species of Staphylococcus isolated.
Bacteria isolation and identification:
Escherichia coli and Staphylococcus aureus were isolated from Soba Stabilization
Station and subjected to test against bacteriophages isolated from the same location.
The identification tests for these bacteria were done according to (Cowan, 1981),
(Harrigan and McCance, 1993), (Cheesbrough, 1994) and (Heritage et al., 1996).
Susceptibility of isolated bacteria:
Toward antibiotics:
Isolated bacteria were sub-cultured into a suitable broth medium, (nutrient broth) and
incubated at 37oC for 24 hrs. 0.1 ml of culture was poured on to the surface of
previously poured and well-dried agar plate. The culture was spread over the plate and
allowed to dry. An antibiotic disc (Axiom multi disc - Axiom Laboratories, New
Delhi India) was placed on the plate, in the centre and over the surface of the agar; a
flamed forceps with aseptic precautions was used. The plate was incubated at 37oC for
24 hrs and the presence of zones of inhibition around the tips of the disc was
recorded.
Toward bacteriophages:
The susceptibility of bacteria toward bacteriophages was determining by plaqueforming units per ml (PFU/ml) on bacterial cultures. To obtain this value, a series of
dilutions (the tubes with 9.0 ml distilled water were labeled 10-5, 10-6, 10-7, and 10-8).
One of the virus stocks was Chosen and dispended in the serial dilution the virus
sample was mixed with a dense bacterial culture and melted with soft agar and then
spread over the surface of a base agar plate and used to infect bacteria. The plaques
§§§§
Phage K, a member of the family Myoviridae, is a polyvalent phage with a broad host range,
inhibiting both coagulase-positive and -negative Staphylococci. The origin of phage K is unclear but it
is identical to phage Au2 which is derived from the H strain of S. aureus.
90
produced were then counted according to the number adjusted for the dilution to
investigate bacteriophage specificity toward the specific bacteria.
Protein profiles:
Preparation of the bacteria antigens:
According to (Ding, 2001), Bacteria were incubated at 30oC in nutrient broth with
SM buffer (for 1 litre: NaCl 5.8 g, MgSO4.7H2O 2.0 g, 2% gelatine solution , Tris
HCl 1M (pH 7.5) 50 ml. Distil water), for 2 – 3 days, then cells were removed from
media by centrifugation for 3 minutes at 15,000 rpm.
The supernatants were discards and the precipitations were filtered by Millipore filter
with a pore size of 0.45µm and stored at -50o C. afterward, the samples were crushed
by glass rod and homogenised in sterile distilled water in volume 15 times less than
their initial volume.
Preparation of the bacteriophage antigens:
E. coli and S. aureus bacteriophages were prepared by inoculating the bacteria in semi
solid medium - Tryptone Soy Agar- (TSA), after 4 hours of incubation at 4oC, the
phage – containing solution was filtered by filter paper with a pore size of 0.45µm.
Chloroform (3% v/v) was used to lyse the bacterial cells, and cellular debris were
subsequently removed by centrifugation for 5 minutes at 5000 rpm. The
bacteriophage protein was then pelted by centrifugation for 30 minutes at 5000 rpm.
The supernatant was discarded and the pellets were resuspended in 150 µl fresh SM
buffer and stored at 4oC, afterward, the samples were freeze dried and homogenised in
sterile distilled water in volume 15 times less than their initial volume.
Sodium dodocyl sulphate polyacrylamid gel electrophoresis (SDS-PAGE):
This was done according to (Laemmli, 1970)
Computational analysis:
The Microsoft Excel program was used for the statistical analysis, and the
bioinformatics programmes UN – SCAN – IT version 5 and ImageJ 136b were used
for the protein molecular mass weight analysis.
Results:
Susceptibility of isolates towards antibiotics:
E. coli showed sensitivity towards: Ciprofloxacin, Pefloxacin, Ofloxacine,
Tetracycline, Amikacin, Gentamicin, Piperacillin and Ceftizoxime, the largest
inhibition zone was shown with Ciprofloxacin as 29 mm diameter. E. coli was
resistant to Chloramphenicol, Cefotaxime, Co-Trimoxazole and Ampicillin /
Sulbactam. While the S. aureus was sensitive to Lincomycin, Cloxacillin,
Ciprofloxacin, Tetracycline, Ofloxacine, Ampicillin / Sulbactam and Cephalexin and
the largest inhibition zone was shown with Lincomycin as 42 mm diameter. S. aureus
showed resistant towards: Roxythromycin, Gentamicin, Pefloxacin, Cefotaxime, and
Co – Trimoxazole.
Comparative Statistical analysis:
91
Comparative statistics are presented in Figure 1. In broth media the affection of the
bacteriophage Interactions with their bacteria were recognised by the
spectrophotometer. The readings of the turbidity for the first and second infection
showed statistical significant of E. coli samples' transmission from the anaerobic and
facultative ponds P>0.05, facultative and maturation P<0.05 and anaerobic and
maturation P>0.05 respectively. Whilst, the S. aureus samples' transmission from the
anaerobic and facultative P<0.05, facultative and maturation P<0.05 and anaerobic
and maturation P>0.05 respectively. On solid media the affection of the bacteriophage
was recognised by the phage plaque formation on bacterial cultures, where the Miles
and Misra drop technique gives uncountable plaques on selective media Eosin
Methylene Blue for the E.coli bacteriophage and Mannitol Salt Agar for the S. aureus
bacteriophages from the titrations 10-6 and 10-7 dilutions. The antibiotics susceptibility
against the bacteria showed statistical significant P<0.05 for E.coli and P<0.05 for S.
aureus samples.
Figure 1 Samples absorbency by using Beer Lambert equation
1.2
1.0
1.0
1.0
Absorbency
0.8
0.7
0.7
0.6
0.6
0.7
0.7
0.4
1.0
0.7
0.5
0.4
1.0
1.0
0.7
1.0
0.7
0.7
0.5
0.7
0.7
0.5
0.5
0.4
0.5
0.4
0.4
0.3
0.2
I- Anaerobic pond
II-Facultative pond
Bottom
surface
Outlet
Inlet
control
Bottom
surface
0.0
Outlet
control
Bottom
surface
Outlet
0.0
Inlet
control
0.0
Inlet
0.0
III- Maturation pond
E.Samples
coli Phage Absorbency
S
Ph
Ab b
Comparison between the phage activity against E. coli and S. aureus:
E. coli showed more sensitivity towards the extracted phage than S. aureus on solid
media, the E. coli phages showed more plaques and clearness than S. aureus phages.
While in liquid media the activity of the phage was more effective against S. aureus
than E. coli, where S. aureus liquid culture showed more clearness than E. coli culture
when inoculated with phage after 48 hours according to their culture density for light
absorption, Table (1).
92
Table 1. Phage activity against corresponding bacteria in liquid media and on
solid media.
Bacteria Liquid media
Turbidity
High turbidity
E. coli
Low turbidity
S.
aureus
Absorbency
0.71
0.55
Solid media
Numbers of plaques
Many plaques
Less plaques
Zone clearness
Large
Small
Comparison between the phage and bacteria protein profiles:
The protein profiles of E. coli bacteriophage showed three bands for samples
collected from E.M.B Agar. The S. aureus bacteriophages showed only two bands in
Nutrient broth. Comparing with the molecular weight marker, the mobilised proteins
of the E. coli phage were 46, 35 and 24 kDa while for the S. aureus phage were 34
and 20 KDa. The molecular weight mass of the gel results analysis by the
bioinformatics programmes showed molecular masses of 47, 35 and 16 kDa for the E.
coli phage. The protein profile of E. coli bacteria showed clear nine bands with
molecular weight ranged between 96 and 14 KDa figure (5). The obtained bands of
the E. coli phage and the E. coli bacteria were compared, one band of 35 KDa showed
typical similarity in both E. coli phage and E. coli bacteria.
Discussion:
In this study it was clear that the isolated bacteria (Escherichia coli and
Staphylococcus aureus) were resistant to common antibiotics. The multi resistance of
these two important bacteria was well known due to hazardous factors supported by
the fact that they are commonly widely-spread in the environment as stated by
(Stewart, 2003 and Johnson et al., 2005). The resistance of S. aureus toward multiantibiotics was reported by (Breithaupt, 1999, Zimmer, et al.,2002 and Deshpande et
al., 2004). While E. coli susceptibility was reported by (Casswall et al., 2000). The
modes of action of antibiotics towards E. coli showed the bacteria were sensitive
towards; Pefloxacin, Ciprofloxacin, Ofloxacine, Tetracycline, Amikacin, Gentamicin,
Piperacillin Ceftizoxime, and Co – Trimoxazole, and were resistant to
Chloramphenicol, Cefotaxime and Ampicillin / Sulbactam this agreed with (Li et al.,
2007) who stated that antimicrobial susceptibility profiles for E. coli isolates
displayed resistance to trimethoprim-sulfamethoxazole (100%), oxy tetracycline
(100%), ampicillin (83%), enrofloxacin (83%), and ciprofloxacin (81%), respectively.
Among the phenicols, resistance was approximately 79% and 29% for
chloramphenicol and florfenicol. S. aureus bacteria showed sensitivity towards:
Roxythromycin, Gentamicin, Ciprofloxacin, Tetracycline, Pefloxacin, Cefotaxime,
Ofloxacine, Ampicillin / Sulbactam and Cephalexin,. The S. aureus was resistant to
Cloxacillin, Lincomycin and Co – Trimoxazole, this agreed with (O'Flaherty et al.,
2005) who reported that the rapid emergence of penicillin-resistant S. aureus led to
the use of methicillin and related drugs for treatment of infections, methicillinresistant S. aureus (MRSA) strains emerged and have exhibit resistance to a variety of
other common first-line antibiotics, ampicillin and penicillin and 36.8% of S. aureus
90
isolates ribotyped belonged to multidrug-resistant, oxacillin-resistant S. aureus
strains.
The efficiency of isolated phage against E. coli and S. aureus showed remarkable
inhibition of growth of the bacteria at both solid and liquid media this might be due to
physio-chemical changes and difference in motility of these two bacteria. The
mechanical action of bacteriophage on selected bacterial species depend on their
receptors that adsorb them to their hosts. The relation between the bacteria and their
corresponding phages was shown in the present study and these confirm the findings
of (Schirmer, 1998 and Wang et al., 2000) who reported that some proteins of the
bacterial outer membrane acts as the receptors for their phages. Another means of
controlling phages is through the use of strain rotation based on phage species
sensitivity and specificity on E. coli and S. aureus this agreed with (Moineau, 1999)
who explained that the biology of host-phage interactions showed the mechanisms by
which some phages may differ from others in infecting bacteria species. Growth
characteristics of E. coli phages indicate that they are adapted to live with their E. coli
hosts in the intestinal tract. S. aureus showed susceptibility towards phages as
confluent lysis or individual plaques in the bacterial lawn were incubated overnight.
This agreed with (Kasman, 2005) who found that isolates from different
compartments of the same location had identical phage susceptibility profiles that
were considered to be the same bacteria strain.
The bacteriophages and bacteria proteins were detected in this study by the Sodium
Dodecyl Poly Acrylamide Gel Electrophoresis (SDS-PAGE). The protein profiles of
the E. coli bacteria showed nine major bands more than it's phage, these result
indicated that bacterial DNA encoded proteins more than their corresponding phage
due to the fact that bacterial cell is more complicated organism than viruses and that
bacteria differ in their genetically composition, cell structure, function and size
appearance from viruses which are more simplest in their structure and size and have
no ability to produce energy or live independently, these was also reported by
(Mueller 2000 and Ucan et al., 2005). The similarity of phage protein bands to those
present in their corresponding bacteria confirmed the scientific fact that viruses
depend on their host completely for the supply of their requirement from all
macromolecules other than genome during their multiplication. The molecular weight
of bands obtained with E. coli phage was similar for phage HK97 of E. coli that
isolated and identified by (Conway et al., 1995 and Juhala, et al., 2000). Meanwhile,
the S. aureus phage protein profile showed two major bands with molecular weight
similar to the same bacterial phage reported by (Kaneko et al.,1997 and Narita et al.,
2001). On the other hand, Wills et al., (2005) isolated and identified other protein
bands with different molecular weight that were not detected in our study, these might
be due to that S. aureus have different serotypes that differ in their genetical and
antigenical structure and the failure to detect the bands that recognized by (Wills et
al., 2005), might be due to use of different serotype of S. aureus and these also
explain the difference in molecular weights and number of bands of both phages.
90
References:
Breithaupt, H., (1999). The new antibiotics. Nat. Biotechnol. 17:1165-1169.
Casswall, T.H., Sarker S.A., Faruque S.M., Weintraub A., Albert M.J., Fuchs G.J.,
Alam N.H., Dahlstrom A.K., Link H., Brüssow H., and Hammarström L., (2000).
Treatment of enterotoxigenic and enteropathogenic Escherichia coli-induced
diarrhoea in children with bovine immunoglobulin milk concentrate from
hyperimmunized cows: a double-blind, placebo-controlled, clinical trial.
Scand. J. Gastroenterol. 35:711.
Cheesbrough, M., (1994). Medical laboratory manual for tropical countries. Vol II
microbiology. University press, Cambridge England.
Chennoufi S.C., J. Sidoti, A. Bruttin, E. Kutter, S. Sarker, and H. Brüssow, (2004). In
Vitro and In Vivo Bacteriolytic Activities of Escherichia coli Phages:
Implications for Phage Therapy. Antimicrobial Agents and Chemotherapy.48:
2558-2569.
Conway, J.F., R. L. Duda, N. Cheng, R. W. Hendrix, and A. C. Steven, (1995).
Proteolytic and conformational control of virus capsid maturation: the
bacteriophage HK97 system. J. Mol. Biol. 253:86–99.
Cowan, S.T. (1981). Cowan and Steel’s Manual for the identification of Medical
Bacteria. 4th edn. Cambridge University Press, Cambridge.England.
Deshpande, L.M., T.R. Fritsche, and R.N. Jones, (2004). Molecular epidemiology of
selected multidrug-resistant bacteria: a global report from the SENTRY
antimicrobial surveillance program. Diagn. Microbiol. Infect. 49:231-236.
Ding, H., (2001). Functional characterization of Pura in vivo and in vitro - Pura
knock-out mice and Pura DNA unwinding activity. PhD Thesis. Ludwig Maximilians University Munich, Germany.
Fischetti, V.A., (2001). Phage antibacterials make a comeback. Nat. Biotechnol.
19:734-735
Geisel R, F.J. Schmitz, A.C. Fluit, and H. Labischinski,( 2001). Emergence,
mechanism, and clinical implications of reduced glycopeptide susceptibility in
Staphylococcus aureus. Eur J Clin Microbiol Infect. 20: 685–97.
Harrigan W.F. and M.E. McCance, (1993). Laboratory methods in food dairy
microbiology. Academic Press. Harcourt Brace and Company Publishers.
London U.K.
Heritage, J., Evans E.G., and R.A.,Killington, (1996). Introductory to Microbiology,
1st Edn, University press Cambridge England.
Johnson, J.R., Murray, A.C., Kuskowski, M.A., Schubert, S., Prere, M.F., and Picard
90
B., (2005). Distribution and characteristics of Escherichia coli clonal group A.
Emerg Infect Dis 11: 141-145.
Juhala, R.J., M.E. Ford, R.L Duda., A Youlton, and R.W. Hendrix, (2000). Genomic
sequences of bacteriophages HK97 and HK022: pervasive genetic mosaicism
in the lambdoid bacteriophages. J. Mol. Biol. 299:27–51.
Kaneko, J., Kimura T., Kawakami Y., Tomita T., and Kamio Y., (1997). Pantonvalentine leukocidin genes in a phage-like particle isolated from mitomycin Ctreated Staphylococcus aureus V8 (ATCC 49775). Biosci. Biotechnol.
Biochem. 61:1960–1962.
Kasman ,L.M., (2005).Barriers to coliphage infection of commensal intestinal flora of
laboratory mice. Virology Journal. 5:3610-3616.
Laemmli, U.K., (1970). Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature. 227: 680-685.
Li, X.S, G.Q Wang, X..D. Du., B.A. Cui, S.M Zhang and J.Z Shen, (2007),
Antimicrobial susceptibility and molecular detection of chloramphenicol and
florfenicol resistance among Escherichia coli isolates from diseased chickens.
J. Vet. Sci. 8(3), 243–247
Lowy, F.D., (2003). Antimicrobial resistance: the example of Staphylococcus aureus.
J. Clin. Investig. 111:1265-1273.
Moineau, S., (1999). Applications of phage resistance in lactic acid bacteria. Antonie
Leeuwenhoek. 76:377–382.
Mueller, M., (2000). Persistent bacterial infections: Identification of immunogenic
structure of Borrelia burgdorferi sensu lato and Chlamydophila pnemoniae by
phage surface display. PhD Thesis. Konstanz Univeristy Germany.
Narita, S., Kaneko J., Chiba J., Piemont, Jarraud Y., J. Etienne S., and Kamio Y.,
(2001). Phage conversion of Panton-Valentine leukocidin in Staphylococcus
aureus: molecular analysis of a PVL-converting phage, phiSLT. Gene
268:195–206.
O'Flaherty S., R.P. Ross, W. Meaney, G.F. Fitzgerald, M.F. Elbreki, and A. Coffey,
(2005). Potential of the polyvalent Anti-Staphylococcus bacteriophage K for
control of antibiotic-resistant Staphylococci from hospitals. Applied and
Environmental Microbiology. 4:1836-1842.
Schirmer, T., (1998). General and specific porins from bacterial outer membranes. J.
Struct. Biol. 121: 101-109.
Stewart, C.M., (2003). Staphylococcus aureus and Staphylococcal enterotoxins. In
foodborne microorganisms of public health significance. 6th ed, AIFST (NSW)
Branch, Sydney, pp359-380.
91
Ucan, U.S., Acik L., Celebl A., Erganis O. and Arslan E., (2005). Plasmids and
proteins patterns of Escherichia coli isolated from bovine mastitis in Konya,
Turkey. Turk Vet Anim Sci. 29: 475 – 480.
Wang, J., Hofnung, M., and Charbit A., (2000). The C-terminal portion of the tail
fiber protein of bacteriophage lambda is responsible for binding to LamB, its
receptor at the surface of Escherichia coli K-12, J. Bacteriol. 182: 508-512.
92
Sorghum Proteome Analysis*****
Bongani K. Ndimba* and Rudo Ngara
Address: Proteomics Research Group, Department of Biotechnology,
University of the Western Cape, Private Bag X17, 7535, Cape Town, South
Africa.
*Corresponding author
Email: bndimba@mail.biotech.uwc.ac.za
Telephone: +27 (0)21 959 2468
Fax: +27 (0)21 959 1551
Abstract:
This project uses proteomics tools to study and understand the complex drought and
salt stress responsive mechanisms in cereals using sorghum as a model system in
order to improve drought tolerance in other agriculturally important crops. The newly
established sorghum cell suspension culture systems and whole plant systems are used
to study both salt and osmotic stress responsive proteins. Using five different sorghum
proteomes (namely cell suspension culture total soluble proteome; cell suspension
culture secretome; as well as whole leaf; sheath; and root proteomes), the experiments
experiment demonstrate that sorghum has typical plant stress responsive features. As
expected, our data show unique protein expression profiles for each of the 5
proteomes under study, indicating specialisation in functions by the different units
within a biological system. This data will be a valuable biotechnology
research/reference resource to many sorghum and grain scientists all over the world.
Key words: Proteomics, Sorghum, Cell Cultures, Proteome, Secretome, Extracellular
matrix, galactosidase, Hsp70, MALDI-TOF MS, 2D PAGE,
*****
We are indebted to the to South African Research Foundation (NRF), the University of the
Western Cape, the Royal Society of London and Professor Jasper Rees’s grants for their financial
support. We would also like to thank Dr Ludivine Thomas, my post-doc, for the MALDI-TOF MS
information.
93
Introduction
Several high-throughput transcriptomics technologies, such as differential display,
transcript imaging and DNA microarrays (Zivy and de Vienne, 2000) have been used
to measure mRNA expression profiles of plants under various experimental
conditions. Although these technologies provide valuable information about gene
expression (Dubey and Grover, 2001), the techniques do not always provide
information about the quality and quantity of the final gene products namely proteins
(Gygi et al., 1999). This poor correlation between mRNA and protein levels may be
attributed to the different rates of degradation of individual mRNAs and proteins.
Furthermore, many proteins undergo post-translational modifications such as
phosphorylation or glycosylation thus giving rise to several isoforms from a single
gene product (Abbott, 1999; Komatsu, 2006). Since it is these post-translationally
modified proteins that are functionally active in cellular processes, only the
measurement of protein expression itself would thus give a better indication of gene
functions at specific physiological states.
Proteomics, the large-scale analysis of protein from a particular organism, tissue or
cell (Blackstock and Weir, 1999; Pandey and Mann, 2000; van Wijk, 2001) has been
used to study the global changes in protein expression of plant tissues, cells and subcellular compartments.
Cell suspension cultures are a homogenous group of undifferentiated cells grown in
liquid media (Evans et al., 2003) and have been extensively used in comparative
proteomic studies across a wide range of plant species to identify and characterise
protein expression profiles before and after stress (Okushima et al., 2000; Ndimba et
al., 2005; Oh et al., 2005). Progress has been made in plant proteomics, with studies
having had been reported on plants such as tobacco (Nicotiana tabacum) (Okushima
et al., 2000), rice (Oryza sativa) (Rakwal and Agrawal, 2003), maize (Zea mays)
(Riccardi et al., 1998) or Arabidopsis (Arabidopsis thaliana) (Ndimba et al., 2005)
among others. Other studies have targeted specific compartments such as cell walls
(Chivasa, et al., 2002; Boudart et al., 2005) or the extracellular matrix (Borderies et
al., 2003; Ndimba et al., 2003; Oh et al., 2005). Despite the economic potential of
sorghum in the semi-arid regions of Africa as well as the promising technique of
proteomic approaches in understanding plant biological systems, to our knowledge,
no global proteomics studies on sorghum have been reported to date. Following our
previous work (Ngara et al., 2008), that reported the establishment of sorghum cell
suspension cultures, here we report the application of high throughput proteomic
technologies to study proteomes of both whole plant tissues and cell suspension
culture systems.
Plant material
Sorghum seeds were surface sterilised using 70% (v/v) ethanol followed by absolute
commercial bleach (2.5% (v/v) sodium hypochlorite solution) for 20 minutes before
rinsing three times with sterile distilled water. The seeds were air-dried on filter paper
before plating on Murashige and Skoog (MS) (Murashige and Skoog, 1962) medium
supplemented with 3% (w/v) sucrose, 5 mM 2-(N-Morpholino) ethanesulfonic acid
(MES) and 0.8% (w/v) agar, pH 5.8. For the salt treatment experiment, surface
sterilised seeds were germinated on MS media with 100 mM NaCl (salinity stress) or
without NaCl (control). Seeds were left to germinate and grow for 14 days at 25°C
89
under a 16 hr light/8 hr dark regime. At day 14 post plating, the seedlings were
harvested and the leaf, sheath and root tissues were separately flash frozen in liquid
nitrogen before storing at -20°C until use in protein extraction procedures. Sorghum
cell suspension cultures were initiated and maintained as described by Ngara et al.
(2008). The cells were sub-cultured onto fresh media by transferring 40 ml of the cell
suspension into a 250 ml conical flask containing 60 ml of fresh media per fortinight.
Protein Extraction from whole plant and cell suspension culture systems and
protein quantification
All protein extraction procedures are as described by Ngara et al. (2008). Extracts
from leaves and sheaths were prepared from an average of ten 14-day old sorghum
plantlets. Extracts from roots were prepared from at least 20 so as to bulk up plant
material for protein extraction. Ten-day old sorghum cell suspension cultures were
harvested and separated from culture filtrate by filtering through four layers of
Miracloth (Merck, Darmstadt, Germany). The cells were transferred into sterile falcon
tubes, pelleted by centrifuging at 2,500 x g for 5 min, flash frozen in liquid nitrogen
and stored at -20°C until use in protein extraction procedures as described by Ngara et
al. (2008). Leaves, sheaths, roots and cell suspension culture cells were separately
ground in liquid nitrogen using pestle and mortar, and precipitated with 10% (w/v)
trichloroacetic acid (TCA). Debris and precipitated proteins were collected by
centrifugation at 13,400 x g for 10 min at room temperature.
The pellet was washed three times with 10 ml of ice-cold 80% (v/v) acetone by
centrifuging at 13,400 x g for 10 min for each wash, air dried at room temperature and
resuspended in 2 ml of urea buffer [9 M urea, 2 M thiourea and 4% 3-[(3Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS)] for at least 1 hr
with vigorous vortexing at room temperature. Soluble protein were collected by
centrifuging at 15,700 x g for 10 min. The culture medium was collected after
filtering suspension cell cultures as described above. Cell free culture filtrate was
collected by centrifuging the culture medium at 2,500 x g for 10 min. Culture filtrate
proteins (extracellular matrix proteins) were precipitated in 80% (v/v) acetone for at
least 1 hr at -20°C and collected in the pellet fraction by centrifuging at 15,700 x g for
10 min. The pellet was washed three times using ice-cold 80% (v/v) acetone, air dried
at room temperature and resuspended in 2 ml of urea buffer as described above.
Protein content of all the total soluble protein extracts was estimated by a modified
Bradford assay using BSA as standard as described by Ndimba et al. (2003). Onedimensional 12% sodium dodecyl sulphate (SDS) polyacrylamide gel electrophoresis
(PAGE) was performed to evaluate the quality of protein extracts.
Two- dimensional (2D) gel electrophoresis
The leaf, sheath, root, cell suspension culture total soluble protein (TSP) and culture
filtrate protein (CF) extracts were each separately subjected to two-dimensional (2D)gel electrophoresis as described by Ngara et al. (2008).
Mini format 2D gel electrophoresis
Protein loads of between 100-150 µg of leaf, sheath, root and culture filtrate protein
extracts were each mixed with 0.8% (v/v) DTT, 0.2% (v/v) ampholytes (BIO-RAD), a
tiny pinch of bromophenol blue and made up to a final volume of 125 µl using urea
buffer. The sample was then used to passively rehydrate linear 7 cm IPG strips either
pH range 3-10 or 4-7, (BIO-RAD) overnight at room temperature. The strips were
90
subjected to IEF on an Ettan™ IPGphor II™ (GE Healthcare) in a step wise
programme for a total of 12,000 Vhrs at 20°C. After IEF, the strips were incubated in
equilibration buffer (6 M urea, 2% SDS, 50 mM Tris/HCl, pH 8.8 and 20% glycerol),
firstly containing 2% (w/v) DTT followed by 2.5% (w/v) iodoacetamide for 15
minutes each with gentle agitation, placed on 12% SDS-PAGE and electrophoresed
using the Mini-PROTEAN® 3 Electrophoresis Cell (BIO-RAD). After the second
dimension, gels were stained with Coomassie Brilliant Blue (CBB), destained and
imaged using a Molecular Imager PharosFX Plus System (BIO-RAD).
Large format 2D gel electrophoresis
Cell suspension culture TSP samples (400 and 800 µg) were each separately mixed
with 0.8% (v/v) DTT, 0.2% (v/v) ampholytes (BIO-RAD), a tiny pinch of
bromophenol blue and made up to a final volume of 315 µl using urea buffer. The
sample was then used to passively rehydrate linear 18 cm IPG strips, pH range 4-7
(BIO-RAD) overnight at room temperature. The strips were subjected to isoelectric
focusing (IEF) on an Ettan™ IPGphor II™ (GE Healthcare, Amersham, UK) in a step
wise programme for a total of 66,000 Vhrs at 20°C. After IEF, the strips were
incubated twice in equilibration buffer as described above. Equilibrated strips were
placed on 12% (v/v) SDS PAGE gels (18 x 18 cm with 1 mm spacers) and
electrophoresed on an Ettan™ DALTtwelve System (GE Healthcare), initially at 5 W
per gel for 30 minutes and then at 17 W per gel (at a constant temperature of 25°C)
until the bromophenol blue dye reached the bottom of the gel plates as described by
Ndimba et al. (2005). The gels were stained overnight in CBB, destained and imaged
using a Molecular Imager PharosFX Plus System (BIO-RAD).
Western blotting for heat shock proteins
The control and 100 mM NaCl treated root total soluble protein (20 µg/well), were
separated on a 12% (v/v) SDS-PAGE gel and transferred onto PVDF transfer
membrane (GE Healthcare) as described by Towbin et al. (1979) using a Mini TransBlot® Electrophoresis Transfer Cell (BIO-RAD). Protein transfer was performed at 36
V, overnight at 4°C with constant stirring of the transfer buffer. All incubation steps
were performed with gentle agitation of the membrane at room temperature. After
protein transfer, the membrane was washed once in Tris-buffered saline (TBS) (50
mM Tris and 150 mM NaCl, pH 7.5) for 10 min before blocking in blocking solution
[1% (w/v) Elite fat free instant milk powder in TBS] for 1 hr. The membrane was then
incubated with the primary antibody [human HeLa cells anti-Hsp70/Hsc70
monoclonal antibody raised in mouse (Stressgen Bioreagents Corp., Victoria,
Canada)] diluted 1:2,500 in 0.5% (w/v) blocking solution for 1 hr before washing
three times with TBST [TBS containing 0.1% (v/v) Tween 20] for 10 min per wash.
The membrane was then washed with 0.5 % (v/v) blocking solution for 10 min and
incubated with the secondary antibody [Goat anti-mouse IgG (H & L) horseradish
peroxidase conjugate (Invitrogen Corp., Carlsbad, CA, USA)] diluted 1:1,000 in 0.5
% (w/v) blocking solution for 1 hr. The membrane was washed three times in TBST
for 15 min per wash. Heat shock proteins were detected using a SuperSignal® West
Pico Chemiluminescent Substrate (Pierce Biotechnology Inc., Rockford, IL, USA)
according to the manufacturer’s instructions. The X-ray film was exposed and
developed using the Curix 60 (Agfa- Gevaert, N.V., Mortsel, Belgium).
91
Protein identification using MALDI-TOF MS
Coomassie stained gels were imaged using Molecular Imager PharosFX Plus System
(BIO-RAD) and the experimental mass and pIs of the proteins of interest were
estimated. Two culture filtrate proteome spots were robotically excised with the
ExQuest (Bio-Rad) spot cutter and transferred into sterile microcentrifuge tubes. Gel
pieces were washed twice with 50 mM ammonium bicarbonate for 5 min each time
and a third time for 30 min, with occasional vortexing and then destained with 50%
(v/v) 50 mM ammonium bicarbonate and 50% (v/v) acetonitrile for 30 min twice,
vortexing occasionally. Gel pieces were dehydrated with 100 µL (v/v) acetonitrile for
5 min, and then completely dessicated using the Speed Vac SC100 (ThermoSavant,
Waltham, MA, USA). Proteins were in-gel digested with approximately 120 ng
sequencing grade modified trypsin (Promega, Madison, WI, USA) dissolved in 25
mM ammonium bicarbonate overnight at 37°C. The protein digestion was stopped by
adding 50-100 µL of 1% (v/v) trifluoroacetic acid (TFA) and incubating 2-4 hr at
room temperature before storage at 4°C until further analysis. Prior to spotting onto
MALDI-TOF plate, the samples were cleaned-up by reverse phase chromatography
using ZipTip C18® (Millipore, Billerica, MA, USA) pre-equilibrated first in 100%
(v/v) acetonitrile and then in 0.1% (v/v) TFA and eluted out with 50% (v/v)
acetonitrile. One microlitre from each sample was mixed with the same volume of αcyna-hydroxy-cinnamic acid (CHCA) matrix and spotted onto a MALDI target plate
for analysis using a MALDI-TOF mass spectrometer, the Voyager DE Pro
Biospectrometry workstation (Applied Biosystems, Forster City, CA, USA) to
generate a peptide mass fingerprint. All MALDI spectra were calibrated using
sequazyme calibration mixture II, containing angiotensin I, ACTH/1-17 clip,
ACTH/18-39 clip and ACTH/7-38 clip (Applied Biosystems). The NCBI and MSDB
peptide
mass
databases
were
searched
using
MASCOT
(http://www.matrixscience.com/search_form_select.html.
Results and Discussion†††††
Sorghum Leaf, Sheath and Root Proteomes.
As our initial attempt towards mapping of the entire Sorghum proteome, we extracted
and separated soluble proteins from three of its major organs, the leaves, sheaths and
roots. We electrophoresed between 100 µg and 150 µg of protein extracts via 2D
SDS PAGE and stained these with CBB. In all three cases the majority of soluble
proteins have pIs between pH 4 and pH 7. The approximate molecular weight of the
biggest protein spots electrophoresed in our system is 90 kDa, and the smallest protein
spots measurable are approximately 10 kDa. Within our parameters, it seems that
sheaths and roots have more proteins than leaves, with many more low abundance
protein spots towards the pH 7 side of the gel.
Salinity Stress Induces Hsp 70 spot in our Sorghum experimental system
When grown under stressful conditions, such as in media containing 100 mM NaCl,
sorghum plants express higher levels of Hsp70 protein when compared to plants that
are grown without salt. This information shows that our sorghum plant material
resembles a typical plant stress response and is therefore crucial in future experiments
as we endeavor to simulate natural physiological effects.
†††††
Figures are available on request
92
Sorghum Cell Suspension Culture Proteomes
The theoretical pI of this protein (Accession No. Q9FXT4) was calculated using the
EMBOSS pK Value Model (http://isoelectric.ovh.org/). These two proteins, which are
found migrating at the same molecular weight but having different pIs could be
different isoforms of alpha-galactosidase. Other proteomic-based studies have also
shown that some proteins may exist in multiple spots on 2D gels (Chivasa et al.,
2002; Ndimba et al., 2005; Oh et al., 2005), possibly suggesting posttranslational
modifications such as phosphorylation or glycosylation.
Alpha galactosidases are bona fide residents of plant apoplasts and it has been known
for a long time that these enzymes play an important role in the metabolism of the cell
wall and therefore plant growth and development. According to the SignalP 3.0
prediction server (www.cbs.dtu.dk/services/SignalP/), the alpha galactosidase
polypeptide, identified here (Q9FXT4) has a cleavable secretory N-terminal (33
amino
acid)
signal
peptide
sequence
domain
(MARASSSSSPPSPRLLLLLLVAVAATLLPEAAA), a further bioinformatical
evidence for its secretion to the extracellular matrix. This data, therefore, adds to the
validation of our experimental system.
Concluding Remarks
This article reports an initial study that demonstrates the optimisation of large-scale
sorghum proteome preparations from both whole plants and cell suspension cultures.
We have reported high quality 2D gels and showed hundreds of tissue specific protein
spot profiles. Using western immunoblotting with anti-Hsp70 monoclonal antibody,
we showed that our NaCl stress treatment induced typical plant stress response
features, and therefore can be used for further salinity stress response studies.
Additionally, we successful obtained data from cell suspension culture and culture
filtrate. This experimental material would be instrumental in a number of studies that
are not easily done in whole plant tissue systems, such as the mapping and
manipulation of the secretome. The cell suspension culture material provides a
uniform, unlimited supply of relatively homogeneous and undifferentiated cell mass
for studies that seek to exclude cell specialisation and tissue specificity.
The random identification of the first Sorghum galactosidase enzyme, a bona fide
apoplastic protein, further validates that our secretome is less likely to be
contaminated by cytosolic proteins. Furthermore, the identification of this enzyme in
two different protein spots demonstrates the presence of at least two posttranslationally modified isoforms, which could either be phosphorylated or
glycosylated. Our current and future work includes the large-scale identification of
sorghum protein spots towards the creation of reference maps, which will be a
valuable proteome resource database for sorghum and other cereal researchers
worldwide.
93
References
Abbott, A. (1999). A post-genomic challenge: learning to read patterns of protein
synthesis. Nature, 402: 715-720.
Blackstock, W.P., and Weir, M.P. (1999). Proteomics: quantitative and physical
mapping of cellular proteins. Trends in Biotechnology, 17: 121-127.
Borderies, G., Jamet, E., Lafitte, C., Rossignol, M., Jauneau, A., Boudart, G.,
Monsarrat, B., Esquerré-Tugayé, M.-T., Boudet, A., and Pont-Lezica, R.
(2003). Proteomics of loosely bound cell wall proteins of Arabidopsis thaliana
cell suspension cultures: A critical analysis. Electrophoresis, 24: 3421-3432.
Boudart, G., Jamet, E., Rossignol, M., Lafitte, C., Borderies, G., Jauneau, A.,
Esquerré-Tugayé, M.-T., and Pont-Lezica, R. (2005). Cell wall proteins in
apoplastic fluids of Arabidopsis thaliana rosettes: Identification by mass
spectrometry and bioinformatics. Proteomics, 5: 212-221.
Chivasa, S., Ndimba, B.K., Simon, W.J., Robertson, D., Yu, X-L., Knox, J.P.,
Bolwell, P., and Slabas, A.R. (2002). Proteomic analysis of the Arabidopsis
thaliana cell wall. Electrophoresis, 23: 1754-1765.
Dubey, H., and Grover, A. (2001). Current initiatives in proteomics research: the plant
perspectives. Current Science, 80: 262-269.
Evans, D.E., Coleman, J.O.D., and Kearns, A. (2003). Plant Cell Culture, pp. 256.
BIOS Scientific Publishers, London.
Gygi, S.P., Rochon, Y., Franza, B.R., and Aebersold, R. (1999). Correlation between
protein and mRNA abundance in yeast. Molecular and Cellular Biology, 19:
1720-1730.
Isaacson, T., and Rose, J.K.C. (2006). The plant cell wall proteome, or secretome. In:
Plant Proteomics, Annual Plant Reviews, Finnie C (eds), pp. 185-209.
Blackwell Publishing, Oxford, UK.
Komatsu, S. (2006). Plant proteomics databases: Their status in 2005. Current
Bioinformatics, 1: 33-36.
Murashige, T., and Skoog, F. (1962). A revised medium fo rapid growth and
bioassays with tobacco tissue cultures. Phyiologia Plantarum, 15: 473-497.
Ndimba, B.K., Chivasa, S., Hamilton, J.M., Simon, W.J., and Slabas, A. R. (2003).
Proteomic analysis of changes in the extracellular matrix of Arabidopsis cell
suspension cultures induced by fungal elicitors. Proteomics, 3: 1047-1059.
Ndimba, B.K., Chivasa, S., Simon, W.J., and Slabas, A. R. (2005). Identification of
Arabidopsis salt and osmotic stress responsive proteins using two-dimensional
difference gel electrophoresis and mass spectrometry. Proteomics, 5: 41854196.
90
Ngara, R., Rees, D.J.G., and Ndimba B.K. (2008). Establishment of sorghum cell
suspension culture system for proteomics studies. African Journal of
Biotechnology, 7: 744-749.
Oh, I.S., Park, A.R., Bae, M.S., Kwon, S.J., Kim, Y.S., Lee, J.E., Kang, N.Y., Lee, S.,
Cheong, H., and Park, O.K. (2005). Secretome Analysis Reveals an
Arabidopsis lipase involved in defense against Alternaria brassiciola. The
Plant Cell, 17: 2832-2847.
Okushima, Y., Koizumi, N., Kusano, T., and Sano, H. (2000). Secreted proteins of
tobacco cultured BY2 cells: identification of a new member of pathogenesisrelated proteins. Plant Molecular Biology, 42: 479-488.
Pandey, A., and Mann, M. (2000). Proteomics to study genes and genomes. Nature,
405: 837-846.
Rakwal, R., and Agrawal, G.K. (2003). Rice proteomics: Current status and future
perspectives. Electrophoresis, 24: 3378-3389.
Riccardi, F., Gazeau, P., de Vienne, D., and Zivy, M. (1998). Protein changes in
response to progressive water deficit in maize. Plant Physiology, 117: 12531263.
Sorghum Genomic Planning Workshop Participants. (2005). Toward sequencing the
sorghum genome. A U.S. National Science Foundation-sponsored workshop
report. Plant Physiology, 138:1898-1902.
Towbin, H., Staehelin, T., and Gordon, J. (1979). Electrophoretic transfer of proteins
to mitrocellulose sheets: procedure and some applications. Proceedings of
National Academy of Science of the USA, 76: 4350-4354.
van Wijk, K.J. (2001). Challenges and prospects of plant proteomics. Plant
Physiology, 126: 501-508.
Zivy, M., and de Vienne D. (2000). Proteomics: a link between genomics. Genetics
and physiology. Plant Molecular Physiology, 44: 575-580.
91
Regeneration Protocol of Aloe Vera L
Cecilia Mbithe Mweu, Justus M. Onguso, Jane Njambi Rugetho, and Aggrey
Bernard Nyende
Jomo Kenyatta University of Agriculture and Technology
Institute for Biotechnology Research,
P.O Box 62000, 00200 Nairobi, Tel (067) 52711 ext 2125
Corresponding Author Email: Mbithec@yahoo.com
Abstract
In vitro propagation to determine appropriate basal medium and growth regulators for
Aloe vera L. using apical shoot explants was done. Axilliary shoot bud proliferation
was initiated on Murashige and Skoog (MS) basal medium supplemented with
Gamborg's B5 vitamins and hormone free at 3-4 weeks subculturing. Shoot formation
and multiplication on further supplementation with different concentrations of BAP
ranging from 0.01 – 2 mg/l, BA ranging from 0.1-0.2 mg/l and Kn ranging from 0.10.2 mg/l was carried out. Medium containing 0.05 mg/l BAP proved to be the best
medium for in vitro shoot formation. At this concentration 100% rate of shoot
formation was obtained after 4-6 weeks of culturing axilliary shoot bud. A maximum
10 shoots per culture were regenerated on this medium. About 80% of root induction
occurred in MS basal medium supplemented with 0.1 % IBA in 4-6 weeks. Further
elongation of roots was obtained on the same MS Basal medium for 2- 3 weeks. The
plantlets were successfully acclimatized in soil with 90 % survival frequency and
transferred to the field.
Key words: Aloe vera, Axilliary shoot, in vitro propagation
Introduction
In vitro propagation refers to culturing of plants from plant parts (tissues, organs,
embryos, single cells, protoplasts, etc.) on nutrient media under aseptic conditions
(Altman, 2000). Plant tissue culture technology has been successfully used for the
commercial production of disease free plants (Debergh et al., 1981) and to conserve
germplasm of rare and endangered species (Fay, 1992).Techniques such as meristem
culture (Hu et al., 1983) has been used to produce plants free from pathogens. It is
now possible to propagate some plants of economic importance in large numbers by
tissue culture. Aloe vera (L.) syn A. Barbadensis Mill belongs to the family Liliaceae
mostly native to Africa, which is full of juice. It is highly valued for its beauty, health,
skin care and medicinal properties with scientists regarding it as “plant of
immortality, the wand of heaven and the universal remedy” (Mauritius Aloevera.com,
2007).
Most Aloe plants are wild populations with domestication cases on the increase for
commercial production. Due to inappropriate cultivation practices, destruction of
plant habitats, and the illegal and indiscriminate collection of plants from these
habitats, many aloe plants are severely threatened. Propagation of Aloe vera is
primarily by means of offshoots, which gives a slow growth rate as a single plant can
produce 3-4 shoots in a year hence not able to produce required number of plants for
undertaking commercial plantations (Meyer et al., 1991). Various researchers have
cultured Aloe in vitro for example Meyer et al .,1991 who reported axillary shoot
92
formation using only IBA, whereas Roy et al., 1991 , Natali et al .,1990) got shoots on
medium containing 2,4-D (2,4- dichlorophenoxyacetic acid) and Kn (Kinetin) and
Richwine et al., reported the induction of shoots using zeatin.
Thus hormonal requirement for shoot formation appears different for different from
one genotype to another of the same species. In this research, we report an efficient
regeneration system of micropropagation from shoot tip explants of juvenile Aloe
plants and establishment of plants under field conditions. The main aim of the present
study was to establish protocols for micropropagation of disease free plants of Aloe
vera so as to ensure the year round availability of identical, disease-free and high
quality planting material.
Materials And Methods
Chemicals
Murashige and Skoog medium, Sucrose, Gelrite and hormones. In all the experiments,
the chemicals used were of analytical grade (Qualigens, Duchefa and Sigma).
Plant materials
Aloe vera L. seeds selected from mature healthy and high yielding plants were sown
in plastics pots at the Institute for Biotechnology Jomo Kenyatta University green
house. Mature plants were used to produce explant.
Explant Sterilization
The explants were first washed in running tap water for 30 min and then kept in
household detergent for five minutes followed by second washing with tap water to
remove all the traces of detergent. Thereafter kept in 0.3% (w/v) Redomil (fungicide)
for 1 hour then washed thoroughly with sterile distilled water. Explants were dipped
in 70% (v/v) Ethanol for 30 sec, rinsed with sterile distilled and treated with 20%
(v/v) sodium hypochlorite with additional of one drop of Tween 20 for 20 mins and
washed 4-5 times with sterile distilled water to remove all the traces of sodium
hypochlorite. After sterilization, the explants were trimmed (1.0 cm) at the base and
cultured with the cut surface in contact with the culture medium (Fig. 1 a).
Shoot Initiation
For axillary shoot initiation, the explants were cultured on hormone free Murashige
and Skoog (MS) basal medium at full strength, supplemented with 3% (w/v) sucrose,
0.8% agar. The pH of all media was adjusted to 5.7 ± 0.1 prior to autoclaving at
121°C for 20 min. All experiments were carried out in culture tubes containing 20 ml
of culture medium. Shoot tip explants (1-1.5 cm) were inoculated on hormone free
MS medium for shoot initiation. Care was taken not to dip explants completely in the
medium and also tips of forceps not touch the agar medium. The culture tubes were
sealed immediately. The same procedure was repeated for multiple shoot formation
and rooting. Forceps, scalpels and other instruments were dipped in alcohol (70%v/v)
and flamed before use. All culture were grown under 16 hours light and 8 hours dark
period in air conditioned culture room, illuminated by 40W (watts) white fluorescent
lights. The intensity of light was regulated between 2500-3000 lux. The temperature
of culture room was maintained at 25±2°C.
90
Shoot Multiplication
After 4-6 weeks of culture the shoots on hormone free MS basal medium were
transferred to MS medium supplemented with 0.1- 0.2 mg/l BA (Benzyladenine) ,
0.01- 0.2 mg/l BAP (6- benzylaminopurine) and 0.1- 0.2 mg/l Kn (Kinetin) each alone
for raising multiple shoots. Shoot multiplication occurred at different rate for each and
was noted down.
Root Initiation
For initiation of roots, the 8- 10 weeks old shoot (6- 7 cm in length) were cultured on
MS basal medium supplemented with 0.1-0.2 mg/l Kinetin and 0.05 – 0.5 mg/l IBA
(indole -3 - butyric acid) for 4- 6 weeks .The rooted (12- 15 week old) shoots were
then transferred to same MS medium for further root elongation for 2 weeks.
Hardening
The plantlets (14- 17 week old) were removed from the medium, thoroughly washed
with water and transferred to plastic pots of 3 types (forest soil only, forest soil and
fertilizer and forest soil and sand) for acclimatization for 2 months. The 22-23 weeks
old plantlets were irrigated with tap water as and when required. This was carried out
in the green house where forest soil alone proved the best for acclimatization. Later
the plants were taken to the field on farm soil.
Results
Explants on MS medium without hormones provided initiation after two weeks. Full
shooting appeared by the third and fourth week of culture. Newly formed shoots were
cultured on BA, BAP and Kn for shoot initiation whereby all promoted shoot
proliferation as shown in Table 1 and figure 1 below. BAP provided the best response
with 10.0 ± 0 shoots per plant. The average number of shoots regenerated from an
explant was 8 with a maximum of 10 shoots. Elongated shoots cultured on IBA 0.1
mg/l proved the best hormone for rooting as shown in Table 2 and Figure 2 below.
Plantlets in the green house grew to a height of 12.0 ± 0.25 to 15.0 ± 0.50 cm after 9
months as shown in figure 3.
Conclusion
The present study describes a well- documented and reliable micropropagation
protocol of Aloe vera from apical shoot with much higher rate of multiplication .This
protocol can be used as a basic tool to commercialize cultivation of the medicinal
plant.
References
Altman A, 2000. Micropropagation of plants, principles and practice. In: SPIER, R.
91
E.Encyclopedia of Cell Technology. New York: JohnWiley& Sons, pp. 916929
Debergh, P.C. and L.J. Maene 1981. A scheme of commercial propagation of
ornamental plants by tissue culture. Scientia Horticulture 14: 335- 345.
Fay M.F. 1992. Conservation of rare and endangered plants using in vitro methods. In
Vitro cellular and development Biology . pp 1- 4 28pp.
Hu C.Y. and P.J. Wang 1983. Meristem, shoot tip and bud cultures. Plant cell tissue
and organ culture 31:75-79.
Meyer H.J. and Staden J.V., 1991. Rapid in vitro propagation of Aloe. barbadensis
Mill. Plant Cell Tissue and Organ Culture 26 167.
Murashige T. and Skoog F, 1962. A revised medium for rapid growth and bio assays
with tobacco tissue cultures. Physiol Plant 115: 493.
Natali L., Sanchez I.C. & Cavallini A. 1990. In vitro culture of Aloe Barbadensis.
Plant Cell Tissue and Organ Culture 20 71.
Roy SC & Sarkar A 1991. In vitro regeneration and micropropagation of Aloe vera L.
Scientia Hortic 47 :107.
TABLES
Table 1: - Effect of different concentrations of MS+BAP, MS+BA and MS+Kn on
shoot formation from apical shoot.
Hormone
BAP
BAP
BAP
BAP
BAP
BA
BA
BA
Kn
Kn
Kn
Abbreviation:
Conc. (Mg/l)
No. of cultures
0.01
6.5

    
0.05    
0.1     
 
8.1    
 
5.2        
0.1
4.5

   
0.15
5.0
   
0.2
5.4
    
0.1
3.3


  
0.15
4.0


 
0.2
4.8

  
Standard error of means
% shooting
Table 2: - Effect of different concentrations of MS+Kn and MS+IBA on root
formation
Hormone
rooting
Kn
Kn
Kn
IBA
Conc. (Mg/l)
0.1
0.15
0.2
0.08
No. of cultures
3.3
4.0
4.8
6.9
90


  
 
 
   


  
%
IBA
IBA
IBA
     
0.15
0.2
Abbreviation:
FIGURES

5.3
4.8
 
 
   
Standard error of mean
a.)
b.)
Fig. 1 a.) Shoot explant of Aloe vera after 3 weeks of initiation. b.) Profuse
multiplication of shoots after 10- 12 weeks of culturing.
a.)
Fig. 2. Shoots elongation and root initiation
d.)
b.)
e.)
Fig 3 d.) Complete plantlets (18- 20 weeks old) grown under green house conditions.
91
EVALUATING A map-1 GENE FROM THE CHIVHU ISOLATE OF
COWDRIA RUMINANTIUM AS A POTENTIAL DNA VACCINE
CANDIDATE
1
1
E Chitsungo‡‡‡‡‡, 2A Nyika
Department of Medical Laboratory Sciences, College of Health sciences,
University Of Zimbabwe. Box A178 Avondale, Harare, Zimbabwe
e.chitsungo@yahoo.com
2
Department of Biochemistry, Faculty of Science, University Of Zimbabwe
Abstract
Heartwater is a disease affecting both wild and domestic ruminants. The only
effective vaccination method “infection and treatment” is fraught with problems.
DNA vaccines have been shown to induce protective cell-mediated immunity as they
can mimic natural infection for intracellular pathogens. However, before a gene can
be used as a vaccine, tests have to be carried out to assess if the recombinant protein
produced is similar or identical to the native one from the pathogen. This is the
purpose of the following study. The map-1 gene of the Chivhu isolate of C.
ruminantium was amplified using Polymerase Chain Reaction (PCR). Immunoblots
confirmed that the epitopes on the rMAP-1 protein were similar to those on native
MAP-1.The Chivhu isolate map-1 gene can be used as a DNA vaccine candidate that
can also cross protect against different strains of C.ruminantium.
Key words: heartwater, C. ruminatium, MAP-1, DNA vaccine, immunoassays
‡‡‡‡‡
Corresponding author e.chitsungo@yahoo.com, panvac@ethionet.et
92
Introduction
Heartwater is a disease affecting both wild and domestic ruminants. Mortality rate in
domestic ruminants has been shown to range between 20-90%. The causative agent is
Cowdria ruminantium; a Rickettsia transmitted by the ticks of the genus Amblyomma.
Of importance are the A. variegatum and A. hebraem species. Different strains of C.
ruminantium exist in different geographical areas. The most characterised in
Zimbabwe are the Crystal springs and the Mbizi strain. The Chivhu isolate being
investigated in this project is not fully characterised (Reddy et al. 1996).
This is achieved through regular dipping of animals in acaricides, with increased
frequency during the rainy season (Sutherst 1987, Camus & Barre 1988). The current
mode of immunisation used in the field is the ‘infection and treatment’ method, which
has many disadvantages (Camus and Barre 1988). The organism is highly labile and
requires a cold chain; this is not very practical in the field. When it is not well
monitored, disease may occur. DNA vaccines are capable of stimulating both cell
mediated and humoral immune pathways. They have been presented in association
with liposomes or with calcium salts. They have also been presented in association
with live vectors or simply as naked DNA (McDonnell & Askari 1996). This study
was set up to produce an recombinant protein from a construct of the Chivhu map-1
gene with a plasmid. An assessment of the protein was then carried out to find out if
the epitopes on recombinant protein produced are identical to those on the native
protein from the pathogen. This was carried out through the use of immunoassays,
sera from naturally infected animals being reacted with recombinant protein. The
antibodies produced from experimental animals after immunisation with the
recombinant protein was reacted with the wild type protein.
PCR amplification of map-1 gene from the Chivhu isolate
C. ruminantium genomic DNA was obtained from elementary bodies from an animal
known to be infected with the Chivhu Strain. DNA purification was done using the
phenol chloroform extraction method as per Sambrook et al 1989 except for the initial
extraction were the phenol and the elementary bodies were incubated for 1 hour at –
20oC follows by 3 freeze thaw cycles at the same temperature. Reagents were
prepared as per Molecular Cloning Manual (Sambrook et al. 1989). The presence of
DNA was confirmed by running a 1-% agarose gel containing 5µg/ml ethidium
bromide. PCR kits and primers were obtained from Roche Diagnostics. Primers
AN5F and AN6R were used to amplify the map-1 gene. The forward primer (AN5R)
sequence is ATCACATGGATGTAATACAGGAAGACAGCAACCCA. The reverse
primer, AN6R is ACGCTCTTAGACTGGTAATATTAGCCAATTAT. These
primers were derived from the conserved region of the map-1 gene, crystal springs
strain (Nyika et al. 2002, Reddy et al. 1996). The PCR conditions used were
denaturing at 94oC for one minute, annealing 45OC for a minute and extension 72OC
for two minute for 35 cycles. Additional extension for 7 minutes at 72OC was done at
the end of the cycle. The PCR product was run on low melting point agarose. Gel
pieces containing the amplicon were cut off. DNA was purified by phenolchloroform extraction as by Sambrook et al. 1989 except that the gel was incubated
overnight at –20oC with phenol.
89
Cloning and Transformation
The InvitrogenTM Living Science TOPO® Cloning kit for Taq amplified DNA with the
pTrcHis2-TOPO vector was used. This is a prokaryotic expression vector. Cloning
of the Chivhu isolate map-1 gene was into the TOPO® cloning site. The vector has a
trc (trp-lac) promoter, a pBR322 origin of replication, polyhistidine downstream of
the TOPO®cloning site and ampicillin resistance gene for selection of colonies. The
trc promoter contains the –35 region of the trp promoter together with the –10 region
of the lac promoter (InvitrogenTM Living Science). Taq has a terminal transferase
activity that adds a single 3´-A overhang to each end of the PCR product. TOPO®
Cloning involves the use of the enzyme DNA topoisomerase I, which functions as
both a restriction enzyme and a ligase. Vectors are provided linearised with
topoisomerase I covalently bound to each 3´ phosphate. Ligation of DNA sequences
with compatible ends takes 5 minutes at room temperature. Transformation into
competent TOP10 E. coli was done as per manufacturer’s instructions. Transformed
E. coli were plated onto LB-agar plates with ampicillin for selection of colonies.
Single colonies were inoculated into 5ml of LB broth with ampicillin and incubated
overnight. Plasmid DNA was prepared from some of the cultures according to a
miniprep protocol by Zhou et al. 1990. Restriction enzyme digestions with EcoRI
were done to confirm successful cloning and transformation. EcoRI has one site on
the vector and one on the insert. Two fragments approximated 1kb and 4kb were
therefore expected. Stabilates were made from successfully transformed clones in
10% volume/volume (v/v) glycerol stored at –80oC. A pure form of plasmid was
purified by the Qiagen plasmid purification method.
Protein expression
Start-up cultures of 100ml (using LB broth with ampicillin) were made from the
stabilates and incubated with shaking overnight at 37oC. The 100ml of start-up culture
were transferred into 500ml of LB broth in another flask. Incubation was done at
37oC with shaking until an optical density of 0.6 at 600nm was obtained. Isopropyl βD-1-thiogalactopyraniside (IPTG) at a final concentration of 1mM was added to the
culture (to induce protein expression) and further incubation done for 3.5 hours.
Protein purification was done using the Invitrogen® ProbondTM Xpress kit for
6xHistagged protein using both the denaturing and native conditions. The vector used
pTrcHis2-TOPO, leads to production of recombinant proteins fused at the C-terminus
to six tandem histidine residues. Fusion proteins have a high affinity for divalent
cations. In this procedure nickel bound to nitriloacetic acid (Ni-NTA) was used for a
one step purification of recombinant proteins from crude cell lysates (Fig 2.2.) NTA
is a chelating agent. The eluate from the column was collected into 1ml aliquots. A
total of 11 tubes for native and 7 tubes for denaturing conditions were collected.Ultra
violet (UV) measurements at 280nm were done to assess aliquots with protein. Three
tubes each from native and denaturing conditions were run on native and denaturing
sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE)
respectively. They were then electroblotted onto nitrocellulose membrane (see 2.4
below). The tubes with highest protein concentration from denaturing conditions
were then pooled. Protein measurement using the Lowry method was done on this
pool (Sigma diagnostics Protein assay kit. Cat. No. P5656).
90
Immunoassays
Denaturing and native continuous SDS-PAGE were done on the denatured and native
proteins, respectively. Small 12% acrylamide gels were run on the Amersham
Pharmacia Biotech AB Mighty small SE250/SE260 mini-vertical unit and the
electrotrasfer to nitrocellulose using the TE22 tank transphor unit. Nitrocellulose with
a pore size of 0.2µm was used. Transfers were done for 2 hours. Armersham rainbow
molecular weight marker was used. Methanol was added to transfer buffer to improve
the binding of protein to nitrocellulose membrane. SDS-PAGE was also done for
sonicates of the elementary bodies material from Crystal springs, Mbizi and Chivhu
strains. Large 12% polyacrylamide gels were run using LKB 2001 Vertical
Electrophoresis Unit using continuous PAGE. A HETO lab equipment, HETOFRIG
KØLEBAD TYPE CB11 thermostatic bath and cooling circulator was used for
cooling the system. The temperature was set to 10oC. Gels were run at 300 fixed
voltage reduced to 250 volts when protein has entered the separation gel. Electrotransfers of big gels were done using the KEM EN TEC Resourceful Science SEMIDRY BLOTTER II. DBA2 inbred mice were obtained from the University of
Zimbabwe animal house and maintained according to the animal house protocols.
Mice were used as models as pathogenicity of C. ruminantium resembles that in
ruminants but may vary with the strain of C. ruminantium, the mouse strain and route
of inoculation. Studies done using the Crystal springs strain of C. ruminantium have
shown that it is pathogenic to both Balb/c and DBA/2 mice (Byrom et al. 1993).
PCR amplification of map-1 gene from the Chivhu isolate
Amplification yielded an approximate 800 base pair fragment, which is the size that is
expected of the map-1 gene of C. ruminantium. The exact size in unknown since it
has not yet been sequenced and there is variation in the size of the gene between
different strains (Reddy et al. 1996). Another PCR was run with an irrelevant DNA,
genomic DNA of Theileria parva to check the specificity of the primers. Specificity
of the primers was shown when they did not amplify T. parva genomic DNA (Fig
1)§§§§§.
Cloning and Transformation
The presence of plasmid DNA was confirmed by running on ethidium bromide
stained agarose gel. Restriction enzyme digestions confirmed successful cloning and
transformation. Digestions were with EcoRV. EcoRV has one site on the insert and
one on the vector. Digestion of the insert alone with EcoRV yielded 2 fragments of
approximate sizes 300 and 500bp. Digestion of the vector with EcoRV yielded of
4061bp and 321bp. Successful cloning resulted in 2 fragments of about 4000bp and
1200bp (Fig 2). For further confirmation, three more enzymes were used for
digestion. These were EcoRI, HindIII and SnaBI. Since Chivhu isolate map-1 gene
has not yet been characterised, the same enzymes were used to digest the PCR
product (fig 3). EcoRI and SnaBI do not cut the insert. HindIII has one site leading
to 2 fragments approximately 150bp and 650bp. The same enzymes were used on
insert. EcoRI and SnaBI linearised the construct as they had only one site on the
§§§§§
Figures available on request from authors
91
vector and none on the insert. HindIII has one site on the vector giving 2 fragment,
one 436bp and another 3945bp.
Protein expression
After protein purification using native and denaturing conditions, the eluate was
collected into 1ml aliquots. Eluates with the highest optical densities at 280nm
wavelength (3 tubes from each purification condition) were run on SDS-PAGE.
Many bands were obtained on coomassie blue stained acrylamide gel (picture not
shown). Other different proteins were also obtained. This indicated that the
purification system needs optimising to reduce non-specific binding. Total protein
concentration 1mg/ml was obtained using the Lowry method.
Immunoassays
Immunoblotting was carried out for the electroblots of the protein purified under
native and denaturing conditions. This was done using antiserum obtained from
naturally infected animals from the field (field sera). The field sera did not react with
any protein under native conditions but with an approximately 32kD protein purified
under denaturing conditions, (Fig 5). This is the expected protein size (Jongejan et
al., 1988, Barbet et al., 1994). This confirmed that the right gene has been amplified
by the PCR reaction and has been successfully cloned and then expressed. This
confirms the presence of a recombinant major antigenic protein 1 (rMAP-1). The
epitopes identified by the immune response are identical to those exposed under
denaturing conditions. When mouse serum was incubated with recombinant rMAP-1
blots. Numerous bands were obtained (Fig 6).
These corresponded to the numerous protein bands seen on the coomassie blue stained
gel. This served to confirm that the mice had sero-converted to most of the proteins
in the immunogen including rMAP-1. When blots from Crystal springs and mbizi
strains elementary bodies were tested against field serum, multiple bands were
obtained (Fig 7). When mouse serum was reacted with blots from Crystal springs and
mbizi strains elementary bodies, a single band corresponding to the 32kD protein was
obtained(Fig 8). This confirmed the specificity of the immune response to rMAP-1.
Similarities in the map-1 genes of different strains of Cowdria ruminantium especially
looking at the conserved region of the gene have been shown by being able to amplify
the map-1 gene of the Chivhu isolate (Mahan et al. 1992, Reddy et al. 1996).
The isolate has not yet been fully characterised, and its map-1 gene not yet sequenced.
However confirmation of the recombinant protein by immunoblotting assays
highlights the specificity of the primers, which have the same sequence as that for the
Crystal springs strain (Nyika et al. 2002). Serum from animals naturally infected by
C. ruminantium reacted with rMAP-1. This showed that the PCR amplification had
amplified the correct gene. This has been cloned successfully and in the right
orientation. The right protein had been expressed. The study also shows that the
epitopes identified by the natural immune response to C. ruminantium are those
exposed by the denatured form of the rMAP-1. Cross-reactions with of the Chivhu
isolate with the Crystal spring and Mbizi isolates indicate that cross protection may be
possible with these strains. The above results confirm the candidacy of the Chivhu
strain map-1 gene as a DNA vaccine.
92
References
Amara RR, Villager F, Altman JD, Lydy SL, O’Neil, Staprans SI, Montefiori DC, Xu
Y, Herndon JG, Wyatt LS, Candido MA, Kozyr NL, Earl PL, Smithe JM, Ma
H, Grimm B D, Hulsey ML, Miller J, McClure HM, McNicholl JM, Moss B,
Robinson HL (2001). Control of mucosal challenge and prevention of AIDS
by a multiprotein DNA/MVA vaccine. Science 292 69-74.
Barbet AF, Semu SM, Chigagure N, Kelly PJ, Jongejan F, Mahan SM (1994). Size
variation of the Major Antigenic Protein of Cowdria ruminantium. Clinical
and Diagnostic Laboratory Immunology 1 (6) 744-746.
Byrom B, Mahan SM, Barbet AF (1993). The development of antibody to Cowdria
ruminantium in mice and its role in heartwater disease. Revue Ēlev. Mēd. Vēt.
Pay Trop. 46 (1-2) 197-201.
Camus E, Barre N (1988). Heartwater- a review. Office International Des Epizooties.
Paris, France.
Du Plessis JL, Bezuidenhout JD, Brett MS, Camus E, Jongejan F, Mahan SM,
Martinez D (1993). The serodiagnosis of heartwater: a comparison of five
tests. Revue Ēlev. Mēd. Vēt. Pay Trop 46 (1-2) 123-129.
Jongejan F, Uilenberg G, Franssen FFJ (1988). Antigenic differences between stocks
of Cowdria ruminantium. Research in Veterinary Science 44 186-189.
Mahan SM, Allsopp B, Kocan KM, Palmer GH, Jongejan F (1999). Vaccine
trategies for Cowdria ruminantium infections and their application to other
Ehrlichial infections. Parasitology Today 15 (7) 290-294.
Mahan SM, Waghela SD, McGuire TC, Rurangirwa FR, Wassink LA, Barbet AF
(1992). A cloned DNA probe for Cowdria ruminantium hybridizes with eight
heartwater strains and detects infected sheep.
Journal of Clinical
Microbiology 30 (4) 981-986.
Manthorpe M, Cornefert-Jensen F, Hartikka J, Felgner J, Rundell A, Margolith M,
Dwarki V (1993). Gene therapy by intramuscular injection of plasmid DNA:
studies on firefly luceferase gene expression in mice. Human Gene Therapy 4
419-431.
McDonnell WM, Askari FK (1996). DNA vaccines. The New England Journal of
Medicine 334 (1) 42-45.
Nyika A, Barbet AF, Burridge MJ, Mahan AM (2002). DNA vaccination with map 1
gene followed by protein boost augments protection against challenge with
Cowdria ruminantium, the agent of heartwater. Vaccine 20 1215-1225.
Nyika A, Mahan SM, Burridge MJ, McGuire TC, Rurangirwa F, Barbet AF (1998).
A DNA vaccine protects mice against the Rickettsial agent Cowdria
ruminantium. Parasite Immunology 20 111-119.
89
Reddy RM, Sulsona CR, Harrison RH, Mahan SM, Burridge MJ, Barbet AF (1996).
Sequence heterogeneity of the Major antigenic Protein 1 Genes from Cowdria
ruminantium isolates from different geographical areas. Clinical and
Diagnostic Laboratory Immunology 3 (4) 417-422.
Sambrook J, Fritsch EF, Maniatis T (1989). Molecular cloning manual-a laboratory
manual. 2nd edition. Cold spring harbour laboratory press. USA
Sutherst RW (1987). Ticks and tick borne diseases. ACIAR proceedings No 17.
Australian centre for international agricultural research. Argyle press Pvt Ltd.
Mentone.
Thomason DB, Booth FW (1990). Stable invorporation of bacterial gene into adult
rat skeletal muscle in vivo. American Journal of Physiology 258 C578-C581.
Tottė P, Bensaid A, Mahan SM, Martinez D, McKeever DJ (1999). Immune
responses to Cowdria ruminantium infections. Parasitology Today 15 (7)
286-290.
van Kleef M, Gunter NJ, MacMillan H, Allsopp BA, Shkap V, Brown W (2000).
Identification of C. ruminantium antigens that stimulate proliferation of
lymphocytes from cattle immunised by infection and treatment or the
inactivated organisms. Infection and Immunity 68 (2) 603-614.
van Kleef M, Neitz AWH, de Waal DT (1993). Isolation and characterisation of
antigenic proteins of Cowdria ruminantium. Review Élev. Méd. Vét. Pays trop
46 (1-2) 157-164.
90
Agro-Morphological and AFLP Markers for Cotton (Gossypium
Hirsutum L.) Genetic Diversity Studies******
Everina P. Lukonge1*, Liezel Herselman2* & Maryke T. Labuschagne2
1
Agriculture Research Institute Ukiriguru, P.O. Box 1433, Mwanza, Tanzania.
Tel. +255 744 430 675; fax. +255 28 2501079, Email address:
elukonge@yahoo.com
2
Department of Plant Sciences, University of the Free State, P.O. Box 339,
Bloemfontein, 9300, South Africa. Tel. +27 51 4019567; fax. +27 51 4446318;
Email address: *Corresponding author E-mail: herselmanl.sci@ufs.ac.za
Abstract
The objectives of this study were to assess the genetic diversity of cotton varieties
using agro-morphological and AFLP markers and to compare the efficiency of the
two methods. Morphological markers in cotton are insufficient for providing detailed
coverage of most genomes. Molecular markers are numerous and are not affected by
the environment. AFLP has proved powerful for identification of large numbers of
potential polymorphic loci in diverse cotton germplasm. The average genetic
similarity for agro-morphological analysis was low (0.500) compared to AFLP
analysis (0.939). Agro-morphological and AFLP dendrograms presented different
patterns of grouping. AFLP analysis reflected the true expression of genotype, while
morphology encompassed the expression of genotype, environment and their
interaction. Due to their valuable services to farmers, breeders and genetic resource
curators both methods should be used in genetic diversity studies.
Keywords: Characterisation, genetic similarity, environment, molecular markers,
Tanzanian cotton varieties
******
Acknowledgements We are grateful to the Principle Secretary, the Ministry of Agriculture Food and Cooperatives
Tanzania for the permission. Third World Organization for Women Scientists, University of Free State and Tanzania Cotton
Board are thanked for sponsoring this study and the Director Agriculture Research Institute Mikocheni is appreciated for the
biotechnology laboratory used in this study.
91
Introduction
Morphological and agronomical characteristics of cotton have traditionally been used
to distinguish varieties and provide useful information to users. Adugna (2002), Wu et
al. (2001) have all used morphological characteristics in their studies and obtained
conflicting results between AFL and morphological characterization. However this
may be depended on the variety of crop since Federici et al. (2001) Bie et al. (2001)
reported similar results on weedy rice based on AFLP analysis and morphological
characteristics. The expression of the majority of these characteristics is significantly
influenced by the environment, causing problems for consistent identification
(Lukonge and Ramadhani 1999). Morphological markers cannot distinguish
heterozygotes and is time-consuming (Swanepoel 1999; Rungis et al. 2001).
Depending on the insect population, between five and 32% cross-pollination is
expected for cotton, which may lead to pollen contamination, adding to difficulties in
genetic uniformity and stability assessment. These factors limit the use of
morphological markers compared to molecular markers which are numerous, less
time-consuming and the molecular marker system have the ability to identify
heterozygotes (Meredith 1995).
Molecular markers provide a number of practical applications including variety
identification through DNA fingerprinting, development of genetic maps in
facilitating indirect selection of economical traits like disease resistance, cloning of
important genes and in evolutionary and phylogenetic studies (Guthridge et al. 2001;
Altaf Khan et al. 2002). Tanzanian Agricultural Research Institutes use agromorphological characteristics during parental selection for hybridisation. Therefore
the main objectives of this study were to assess the genetic variation among 26 cotton
varieties using agro-morphological and AFLP markers and compare the efficiency of
these characterisation methods in cotton genetic diversity studies.
Morphological characteristics
Twenty-six cotton varieties (five developed in Tanzania and 21 exotics from other
countries) were evaluated at Ukiriguru Agriculture Research Institute, Tanzania to
study their diversity. These varieties have been extensively used in the cotton
breeding programme in Tanzania. A randomised complete block design replicated
four times was used. Fertilizer and insecticides were applied according to cotton
growing recommendations. Morphological characterisation included qualitative and
quantitative characters. Data on pollen colour, petal colour, stigma position, hairiness,
leaf colour, leaf shape and stem colour were collected at 50% flower formation. Plant
height, bolls per plant and plant shape were characterised at harvesting. Seed cotton,
ginning outturn (GOT) and fibre quality were obtained after harvesting. Modified
International Board for Plant Genetic Resources (IBPGR) descriptors for cotton were
applied for variety characterisation.
AFLP characterisation
Two plants of each variety were grown in two pots in a glasshouse at the University
of the Free State (UFS) in Bloemfontein, South Africa and at the Mikocheni
Agriculture Research Institute, Dar es salaam, Tanzania for DNA extraction. DNA
extraction was done using a modified monocot extraction procedure (Edwards et al.
89
1991) as described by Adugna (2002). DNA concentration and purity was determined
by measuring absorbencies at 260 nm and 280 nm. The quality, integrity and
concentration of the DNA were confirmed by electrophoresis in a 0.8 % (w/v) agarose
gel. AFLP reactions were performed according to Vos et al. (1995) with minor
modifications as described by Herselman (2003). Genomic DNA was digested using
EcoRI and MseI. EcoRI- and MseI- adapter, pre-amplification primers and selective
primers sequences as given in Herselman (2003) were used. A total of eight primer
combinations were used. EcoRI-ACA and EcoRI-AAC were used in combination
with MseI-CAT while EcoRI-ACT and EcoRI-ACC were used in combination with
MseI-CTG, MseI-CTA and MseI-CAC. Primers were selected based on literature
(Abdalla et al. 2001; Rana and Bhat 2004). AFLP fragments were resolved using a
Perkin Elmer Prism ABI 310 automatic capillary sequencer (PerkinElmer Applied
Biosystems 2002) using a GENESCAN-1000 ROXTM standard.
Data analysis
Genetic similarities, clustering and Spearman correlation analysis
AFLP fragments and agro-morphological data were coded as present (1) and absent
(0) and entered into a binary data matrix. Coded data (both unique and shared
fragments) were subjected to analysis using the NTSYS-pc version 2.02i (Rohlf 1998)
computer programme.
Similarity matrices were compiled for all pairs of varieties using the Dice similarity
coefficient (Dice 1945). Cluster analyses were performed using unweighted pair
group method of arithmetic averages (UPGMA) clustering (Sokal and Michener
1958) and utilised to construct a dendrogram using the SAHN programme of NTSYSpc. For each dendrogram, co-phenetic coefficients between the matrix of genetic
similarities and the matrix of co-phenetic values were computed using appropriate
routines of the COPH and MXCOMP programme of NTSYS-pc. The significance of
the co-phenetic correlation observed was tested using the Mantel matrix
correspondence test (Mantel 1967). Calculations for polymorphic information content
(PIC) was done using the formula of the expected heterozygosity (Smith et al. 2000)
as: PIC=1-∑f2i, where f is the percentage of genotypes in which the fragment is
present. This was used to identify primers that would distinguish varieties most
efficiently. The NCSS computer package (Hintze 2000) was used to determine the
Spearman’s rank correlation coefficient between agro-morphological and AFLP
genetic similarities.
Results
Agro-morphological characterisation
Some morphological characteristics were common for all 26 varieties. For example,
all varieties had cream petal colour, nectars and lacked petal spot. The lack of petal
spot is associated with G. hirsutum and distinguishes it from G. barbadence.
However, clear variation was observed for pollen colour, stigma position, leaf shape,
leaf colour, leaf hair, stem hair, stem colour, bract dentition, boll shape, boll
prominence, boll peduncle and plant shape. These characteristics were used for
characterisation. The observed differences among varieties indicated the possibility of
using morphological markers to differentiate varieties for germplasm collection and
maintenance and for selection of suitable parents from the population.
90
The mean values for six agronomical characteristics namely seedcotton yield, GOT,
boll/plant, fibre length, fibre strength and micronaire values, indicated a high variation
among the 26 varieties. Variation of agronomical characteristics showed that some
varieties out performed their respective means. For example, NTA 93-15, SG 125,
IL85, Cyto 12/74, HC-B4-75, Frego bract, UK82, Dixie King and Guazuncho, had
higher values than the means for four and more characteristics, in contrast to High
gossypol, Delcot 344, Okra leaf, Des 119 and IL74 that had less than three
characteristics having values above average.
AFLP characterisation
Eight selected AFLP primer combinations produced a total of 835 fragments varying
in size from 40 to 538 bp, with an average of 104 bp per primer combination. A total
of 309 fragments were polymorphic with an average of 39 polymorphic fragments per
primer combination equivalent to 37% polymorphisms. Primer combinations E-AAC/
M-CAT, E-ACA/M-CAT and E-ACT/M-CTA produced the highest numbers of
amplified fragments compared to other combinations (132, 126 and 119 respectively).
E-ACC/M-CTG (76) amplified the lowest number of fragments compared to other
primer combinations followed by E-ACC/M-CAC (95) and E-ACT/M-CAC (96).
Even though some of the primer combinations amplified low numbers of fragments,
they were able to distinguish some of the varieties. For example, E-ACT/M-CAC
uniquely identified Delcot 344 and E-ACC/M-CTG High gossypol and Delcot 344.
Primer combination E-AAC/M-CAT uniquely identified eight varieties followed by
E-ACT/M-CTA (6), E-ACA/M-CAT (4), E-ACC/M-CTA (4) and E-ACC/M-CAC
(4). Delcot 344 was uniquely identified from other varieties by almost all primer
combinations. High levels of polymorphism were observed for primer combinations
E-ACC/M-CAC (51.6%), E-ACT/M-CTG (45.5%) and E-ACC/M-CTA (39.4%). PIC
values ranged from 0.37-0.57 with an average of 0.47.
Estimates of genetic similarities
Genetic similarities for all pairs (N = 325) ranged from 0.222 to 0.800 for agromorphological and from 0.894 to 0.979 for AFLP analysis, with means of 0.500 and
0.939 respectively. Agro-morphological data indicated that some varieties were
morphologically similar while others were different. The most similar varieties based
on agro-morphological data were Aubarn 56 and UK82, MZ 561 and IL74 followed
by UK82 and UK91, Delcot 344 and McNaire 235 and UK82 and IL72. The lowest
similarity values were observed for Super okra leaf and Reba B50, Super okra leaf
and HC B4 75, Frego bract and McNaire 235 and NTA 88-6 and High gossypol.
Genetic similarities based on AFLP data were high between some varieties including
McNair 235 and MZ561 (0.979), Frego bract and Reba W296 (0.978) and SG 125 and
DP 4049 (0.977). The lowest genetic similarity value was observed between High
gossypol and Cyto 12/74 (0.894). Generally, High gossypol, Cyto 12/74, Delcot 344,
Super okra leaf and Reba B50 had low similarities with the other varieties. The
correlation coefficient for agro-morphological and AFLP analyses genetic similarity
values was 0.03 at p < 0.63 indicating low correlation among them.
Cluster analysis
91
A dendrogram for agro-morphological data revealed two major groups A and B. Most
of the varieties obtained from the United States (HC-B4-75, Dixie King, Delcot 344,
McNair 234, Stoneville 506, DP 4049 and SG 125) clustered together in group B,
although three others (Frego bract, Auburn 56 and Acal SJ-2) clustered in group A.
Generally cluster B contained varieties from the USA and their relations from
Argentina. The four varieties from Tanzania (MZ561, IL74, IL85, UK82 and UK91)
clustered together in cluster A. Reba W296 (Allen 51 x Coker 100) and BJA 592 used
as parental pedigree material for Tanzanian varieties clustered also into cluster A but
into a different subcluster from the Tanzanian varieties. The two varieties from Mali
(NTA material), NTA 93-15 and NTA 88-6, clustered closely together in cluster B.
Cluster A contained all varieties that originated from Africa (Tanzania, Central Africa,
Nigeria, Cameroon and Chad). Based on agro-morphological characteristics, Auburn
56 and UK82 were the most similar varieties while Acala SJ-2 and Super okra leaf
were the most dissimilar to the rest of the varieties.
The dendrogram based on AFLP markers reveale five main clusters (I - V). Cluster I
contained 12 varieties, which was further divided into two subclusters. The one
subluster contained HC-B4-75 (drought tolerant and susceptible to fusarium wilt), DP
4049, SG 125 and NTA 88-6. This group contained varieties from the USA except for
NTA 88-6, which is from Mali. These varieties had high GOT values ranging from
40.5% to 43.9% (data not shown). The second group contained four varieties,
Guazuncho (from Argentina, drought tolerant), Stoneville 506 (bacterial blight
resistance from the USA), IL74 and IL85 (bacterial blight resistant from Tanzania).
The second subcluster contained four varieties, McNair 235, Des 119, Auburn 56 (all
from the USA and resistant to fusarium wilt) and MZ561 from Tanzania. Cluster II
contained seven varieties; NTA 93-15 from Mali, BJA 592 (short staple), UK82,
UK91, Acala SJ-2 (large bolls), Super okra leaf (okra leaf type and early maturing)
and Irma 1243. NTA 93-15, BJA 592 and Irma 1243 originated from West/Central
Africa (might have shared some genes). NTA 93-15 and Irma 1243 are susceptible to
bacterial blight and fusarium wilt and have high GOT values. UK82 and UK91 are
Tanzanian varieties for the Western Cotton Growing Areas clustered with BJA 592,
their ancestor for bacterial blight and fusarium wilt resistance.
Cluster III contained High gossypol [(A333xFoster) x Allen MP-2 (a selection from
Zaria Allen)] from Chadi and has resistance to insects due to high gossypol content.
Cluster IV composed of five varieties; Frego bract (insect resistant) and Reba W296
(Coker 100 x Allen 51-296) clustered together with a genetic similarity of 0.978.
Others were Dixie King (resistant to fusarium wilt) and Reba B50 (Stoneville B 1439
x A50T) and Cyto 12/74 (from Pakistan) joined them as a separate group with a
genetic similarity of 0.944. RebaW296 and Reba B50 are bacterial blight and
fusarium wilt resistant, have weak fibres and both originated from Central Africa.
Cluster V contained Delcot 344 with reddish green coloured leaves and no leaf hairs.
The most similar varieties based on AFLP data were MZ561 and McNair 235 while
Delcot 344 was the most dissimilar to the rest of the varieties. The two dendrograms
of agro-morphological and AFLP analyses presented different grouping patterns
although some varieties clustered similarly in all methods. For example, HC-B4-75,
DP 4049, Stoneville 506, Des 119 and McNair 235 always clustered in the same main
group as well as UK82 and UK91. This indicated some relationship among these
characterisation methods of genetic diversity studies based on dendrogram analyses.
92
The overall findings from this study indicated that AFLP analysis and to a certain
extent qualitative and quantitative traits, sufficiently detected genetic diversity to
differentiate Tanzanian cotton varieties. Although both methods did not provide
exactly the same description of relationships between varieties, there existed some
consistency in discriminating varieties. Although molecular markers like AFLPs
analysis are more efficient and provide exciting insights (Kumar 1999), their
application is limited in developing countries due to initial costs, inadequate
infrastructure and expensive chemicals. Gossypium hirsutum has low levels of genetic
diversity, therefore AFLP analysis may offer a powerful tool for analysing the
inheritance and relationships of important traits in cotton breeding programmes. Thus
future research should focus on comparing the two methods in terms of feasibility,
efficiency, accuracy, costs and benefits by involving more tests over different
environmental trials and years (for agronomic and morphological characterisation),
more primer combinations and different molecular marker systems.
In conclusion, based on genetic similarities low levels of correlation existed between
agro-morphological and AFLP analyses in the current study. AFLP analysis reflected
the true expression of genotypes, while agro-morphological analysis encompassed the
expression of genotype, environment and their interaction. Agro-morphological
characteristics are inconsistent and few, whereas AFLP analysis appeared to provide
more accurate estimates and utility of genetic diversity measurements. Both methods
have advantages and disadvantages for practical applications under different
circumstances. Consequently, both methods should continue rendering valuable
services to farmers, breeders and genetic resource curators.
References
Abdalla AM, Reddy OUK, EL-Zik KM, Pepper AE (2001) Genetic diversity and
relationship of diploid and tetraploid cottons revealed using AFLP. Theor
Appl Genet 102:222-229
Adugna WG (2002) Genetic diversity of linseed (Linum usitatissimum L.) in different
environments. PhD Thesis, University of the Free State, Bloemfontein, South
Africa, pp 183-201
Altaf Khan M, Myers GO, Stewart JMcD (2002) Molecular markers, genomics and
cotton Improvement. In: Kang MS (ed) Crop Improvement, Food products
Press, New York, pp 253-284
Barret BA, Kidwell KK (1998) AFLP based genetic diversity assessment among
wheat cultivars from the Pacific Northwest. Crop Sci 38:1261-1271
Ben-Har A, Charcosset A, Bourgoin M, Guard J (1995) Relationships between
genetic markers and morphological traits in maize inbred lines collection.
Euphytica 84:145-154
Bie S, Kong FL, Zho YY, Zhang GM, Zhang OY, Wang XG (2001) Genetic diversity
93
analysis of representative elite cotton varieties in three main cotton regions in
China by RAPD and its relation with agronomic characteristics. Scientia
Agricultura Sinica 34:597-603
Dice LR (1945) Measures of amount of ecologic association between species.
Ecology 26:297-302
Edwards K, Johnstone C, Thompson C (1991) A simple and rapid method for the
preparation of plan genomic DNA for PCR analysis. Nucleic Acids Res
19:1349
Federici MT, Vaughan D, Tomooka N, Kaga A, Wang XW, Doi K (2001) Analysis of
Uruguayan weedy rice genetic diversity using AFLP molecular markers.
Research article, Molecular Biology and Genetics, Universidad Catolica de
Valparaiso, Chile, pp 8
Guthridge KM, Dupal MP, Kolliker R, Jones ES, Smith KF, Forster JW (2001) AFLP
analysis of genetic diversity within and between populations of perennial
ryegrass (Lolium perenne L.). Euphytica 122:191-201
Herselman L (2003) Genetic variation among Southern African cultivated peanut
(Arachis hypogaea L.) genotypes as revealed by AFLP analysis. Euphytica
133:319-327
Hintze JL (2000) Number Cruncher Statistical System (NCSS). Statistical System for
Windows, Kaysville, Utah
Kumar LS (1999) DNA markers in plant improvement. An overview. Biotechnology
Advances 17:43-182
Lukonge E, Ramadhani OS (1999) Review of Plant Breeding and agrobiodiversity in
the Lake Zone. In: Breeding and Agrobiodiversity workshop proceedings,
Agricultural Research and Development Ukiriguru, Mwanza, Tanzania, pp 611
Mantel N (1967) The detection of disease clustering and a generalized regression
approach. Cancer Res 27:209-220
Meredith WRJr (1995) Strength and limitations of conventional and transgenic
breeding. In: Brown JM (ed.) In: Proceedings of the Beltwide Cotton
Conference, National Cottton Council, Memphis, TN, pp 166-168
Rana MK, Bhat KV (2004) A comparison of AFLP and RAPD markers for genetic
diversity and cultivar identification in cotton. J Plant Biochem Biotech 13:1924
90
Gene Flow by Pollen Transfer from Herbicide Resistant (HR) Maize
to Conventional Maize
1
G. Kyalo, 1J. Bisikwa, 2N. Holst, 3T. P. Hauser and 1R. Edema
Department of Crop Science, Makerere University, P.O Box 7062, Kampala
2
University of Aarhus, Faculty of Agricultural Sciences, Department of
Integrated Pest Management, 4200 Slagelse, Denmark
3
Denmark
Corresponding author:Gerald Kyalo, Coffee Research Center, P.O Box 185,
Mukono, Kituza, Uganda. Phone: 256 392700725, Mob: 256 774 431623 Fax:
256 392 250729, Email: gpkyalo@yahoo.com, geraldpaul@agric.mak.ac.ug
1
Abstract
The objective of this study was to determine Gene flow by pollen transfer from HR
maize to conventional maize. To establish whether the HR maize was cross
compatible with the conventional maize variety, reciprocal crosses were made
between HR maize and a conventional maize variety in the screen house at the
Makerere University Agricultural Research Institute Kabanyolo, after which crossing
between HR maize and the conventional variety was allowed to take place naturally in
the field in October to December, 2007. There were generally few hybrids from
crosses made in the screen house and the resulting F1s were herbicide resistant
irrespective of the parents. The crossing frequency between HR maize and
conventional maize was between 74-100%. In conclusion HR maize is crosscompatible with conventional maize giving viable hybrids, indicating a possibility of
contamination for existing crop varieties and their landraces may have serious
consequences in the long run.
Key words: Herbicide resistant maize, Imidazolinone resistant maize, Geneflow
Introduction
Several studies have shown gene flow to occur from genetically modified (GM) crops
to their weedy relatives or land races and conventional varieties. For example oil seed
rape (Brassica napus) has been shown to hybridise with its weedy relatives Brassica
campestris (Mikkelsen et al., 1996) and wild radish (Raphanus raphanisrum L.)
(Baranger et al., 1995). Gene flow between cultivated rice, wild and weedy relatives
have been recently reviewed by Ellstrand et al. (1999) and Messeguer et al. (2001)
with the latter recording a gene flow rate slightly lower than 0.1% when conventional
rice was planted 1m from transgenic rice. Gene flow rates detected using transgenic
rice plants, clearly demonstrate that gene escape from transgenic to non-transgenic
plants or to red rice takes place to some extent. Gene flow between improved open
pollinated varieties of maize and hybrids and landraces has also been shown to occur
in Mexico and Central America (Bellon and Risopoulos, 2001).
Gene flow through cross-pollination can also take place between GMOs and
conventional maize (Messequer, 2003). Treu and Emberlin (2000) described GM
maize as presenting a medium to high level risk for cross pollination with other maize
crops due to the ability of the pollen to spread on the air flow. Because maize is wind
pollinated and predominantly out crossing (Hamrick and Godt, 1997), the eventual
91
introgression of transgenes from commercial cultivars into pure lines and other
varieties is likely if grown together (Christou, 2002).
Gene flow is measured in various ways, the most direct one for plants being the
observation of seed and pollen movement which gives an estimate of potential gene
flow, defined as the depositions of pollen from a source as a function of distance
(Levin and Kerster, 1974). Assuming sexual compatibility between a GM crop and
the non GM crop, the entry and subsequent spread of a transgene into natural
populations will be determined to some extent by pollen movement. From an
agronomic point of view, the transfer of novel genes from one crop to another could
have a number of implications, including depletions in the quality of conventional and
organic crop seed leading to a change in their performance and marketability.
Unwanted gene pollution from a GM crop to nearby non-GM crops could also create
conflict between the farmer who does not want GM crops and the farmer planting GM
crops or the company selling GM seeds (Woong Kwon and Kim, 2001). In Uganda,
there are no wild relatives of maize, so the transgene flow to wild relatives is not a
concern. It is not however clear to what extent HR maize hybridizes with
conventional maize varieties, and the nature of resulting hybrids is not known. This
study focuses on investigating the extent with which HR maize hybridizes with
conventional maize in the farmers’ setting where the fields are separated by 20m.
Plant material and Experimental site
Herbicide resistant maize used in this experiment is Ua kayongo, an imidazolinone
resistant maize which is not transgenic. Ua kayongo was used because it is HR but
non transgenic although it works in the same way as GM HR maize. In addition, GM
crops are illegal in Uganda, thus they can not be accessed. The conventional maize
used is Longe 5 which is an open pollinated variety released by NARO. Longe 5 was
used because it is open pollinated and it is the one frequently grown by farmers.
Experiments were set up at Makerere University Agricultural Research institute,
Kabanyolo (MUARIK) (0°28’ N, 32° 37’ E). Climate is classified as moist tropical
with moderate temperatures. Annual rain fall is about 1300mm and maximum and
minimum temperatures of about 30°C and 15°C respectively. Soil is classified as deep
red soil typical of the Buganda catena, acidic (pH about 5.0) with about 2-3% of
organic matter in the surface horizon.
Inheritance of HR
To establish whether the HR maize was cross compatible with the conventional maize
variety, reciprocal crosses were made between Ua kayongo and Longe 5 in the screen
house at the Makerere Universty Agricultural Research Institute Kabanyolo
(MUARIK). Ua kayongo and Longe 5 were planted each in buckets (diameter=
27.5cm) in a screen house. Sixty plants were planted in total, 30 of each cultivar.
Plants were fertilized and watered. At flowering, all tassels and silks were covered
with bags to prevent pollen contamination. Reciprocal crosses were then made
between Ua kayongo and Longe 5. During this process, pollen was transferred from
the tassels of Ua kayongo to the silks of Longe 5 and vice versa. After crossing, the
silks were covered with the tassel bags that carried the pollen and were clearly
labeled. At maturity, F1s from the crosses were harvested and sowed in seedling
90
boxes (1m×0.5m) together with parents to test for resistance to the herbicide,
Imazamox. . Due to limited space, the F1s were evaluated using two experiments. The
first experiment involved planting 23 seeds from the cross Longe 5(♀)*Ua kayongo
(♂) as well as 23 seeds of each parent. The second experiment involved planting 37
seeds of the cross Ua kayongo (♀)*Longe 5 (♂) as well the same numbers of seeds of
each parent. Two weeks after planting, the plants were sprayed with imazamox (3.7%
W/W) at a rate of 700ml/ha and observed. As a control, all the cross types were
planted in seedling boxes as above and sprayed with water. After 1 month, the
surviving seedlings were counted and recorded. Percentage survivorship was
computed to indicate the % of seeds that had taken up the gene from Ua kayongo.
Gene flow experiment
Crossing between HR maize and the conventional variety was allowed to take place
naturally in October to December, 2007. HR maize was planted in the centre of the
field at a spacing of 75cm * 50cm, 2 seeds per hole with a total area of 33.75m2.
Conventional maize was planted at a spacing of 30 cm between plants at distances of
5, 10, 15 and 20m in rows of 30 plants from the pollen source in the North Eastern,
South Western, North Western and South Eastern directions respectively.The field
was fertilized and weeded whenever required. At flowering, all conventional maize
plants were detassled to allow only pollen from HR maize to pollinate. At maturity,
seeds from the conventional plants were harvested and labeled. One hundred seeds
from each distance were germinated in a seedling box as before and sprayed with
Imazamox when they were 2 weeks old. The surviving seedlings were counted and
recorded. Percentage survivorship was computed. Mean comparisons were made by
Fisher’s Protected LSD test at 5% level of significance.
Results and discussion
Inheritance of HR
There were generally few hybrids from crosses made in the screen house. A total of
186 seeds from 21 plants were harvested from L5 (♀)* Ua kayongo (♂) cross, while
300 seeds from 18 plants were harvested from the Ua kayongo (♀) * Longe 5 (♂)
cross. It is not clear why this happened but pollen viability is affected by length of
time and humidity (Fonseca and Westgate, 2005). For example, below 30% moisture
content, maize pollen will not germinate. In most studies, pollen longevity overall has
ranged from hours to days. A combination of these factors could have led to pollen
failing to germinate. After spraying with imazamox, hybrids had a survival rate of
100% for both L5*IR and IR*L5 crosses. The parents had a survival rate of 100% for
IR-maize and 1% for Longe 5 (Table 1). Thus the resulting F1s were herbicide
resistant irrespective of the parents. Hybridisation rates recorded in this experiment
confirm that the trait for resistance to imidazolinones in maize is homozygous and can
therefore be used as a direct measure of geneflow in the field experiment.
91
Table 1: Survival of F1s and their parents after Imazamox application
Maize variety
F1 (IR*L5)
F1 (L5*IR)
IR-maize
Longe 5
Number
of Number
of Proportion
of
seedlings screened seedlings resistant seedlings resistant
(%)
145
145
100
88
88
100
46
46
100
97
1
1.0
Gene flow experiment
All F1s from all directions considered were viable except the North West which did
not produce enough seed for subsequent trials due to poor germination of maize seeds
planted. In all directions, the proportion of seeds surviving the herbicide was 74 –
99% (table 2) and there was a difference in % survivorship in all the three directions
(P<0.05) with the North East recording the highest survivorship, and the South East
recording the least. There was no difference in survivorship at all distances from the
pollen source indicating that pollen dispersal does not fall drastically as distance from
the source increases as other researchers have indicated (e.g. Goggi et al., 2007;
Stanley- Horn, 2000; Pleasants et al., 1999). In this experiment however, all receptor
plants were detassled, thus there was no competition between pollen unlike in
previous experiments. This may have contributed to the high percentages of HR
plants recorded in this experiment. HR gene is homozygous in HR cultivars, thus
offspring plants in the geneflow experiment that die are sired by pollen from out side
the experiment, which represents long distance dispersal.
The difference between hybridization frequencies recorded in the field experiment
and the screen house experiment shows that there was some level of contamination
with pollen from other conventional maize varieties probably from distant farmers’
fields 500m away, considering that maize pollen can move as far as 800m from the
source (Treu and Emberlin, 2000). These results are consistent with earlier studies
that maize pollen would move to as far as 800 m from the source (Treu and Emberlin,
2000) but contradicts with Sears and Stanley- Horn (2000) and Pleasants et al. (1999)
who noted that regardless of the direction from the field, most of the pollen fell with
in 5m from the source of pollen. In Uganda where farmers’ fields are fragmented,
results from this experiment show that even at a separation distance of 20m, there
would be hybridization of over 98%, further exacerbating the problem of
contamination if GM maize was planted near to conventional maize although this will
depend to some extent on the size of both fields.
Klein et al. (2000) conducted a similar experiment to measure hybridization using
seed colour markers and noted that the pollen flow and cross pollination frequency
from one field to another depends on the size of both fields and that the distance at
which a given rate of cross-pollination is reached depends on the size of the field.
Similarly, experiments carried out to monitor movement of pollen (Sears and StanleyHorn, 2000) or record crossing (Messean, 1999) have shown pollination to be
directionally-oriented with a much higher incidence down wind of the emitting crop.
This explains the high proportion of seeds resistant to the herbicide in the North East
direction. Jones and Brooks (1950) recorded mean hybridization adjacent to the crop
90
at 25.4% reducing to 0.2% at 500m. Likewise Salamov (1940) recorded mean
hybridization of 3.3% at 10m falling to 0.2% at 800m.
The hybridization figures recorded in this experiment are higher than those recorded
in previous experiments but they are closer to Weekes et al. (2007) who recorded a
maximum level of gene flow of 60% for samples taken 0-2m from the source and
Bateman (1947) who recorded an out crossing rate of 40% at 2.5m from the source.
The difference in hybridization rates may be due to differences in experimental
design, wind speeds and other natural conditions. Baltazar and Schoper (2002)
indicated that under very arid conditions and low wind speeds, cross pollination rarely
exceeded 200m. Like other studies (Goggi et al., 2007; Weekes et al., 2005; Baltazar
and Schoper, 2002), this study has indicated that HR maize hybridizes with
conventional maize producing HR hybrids. The study further shows that pollen comes
in from the out side, indicating long distance dispersal. Thus, if GM maize is grown
near conventional maize, they will hybridize producing HR hybrids.
Table 2: Proportion of F1 seeds surviving after application of imazamox
Direct
ion
Distance
5
Tota
l no.
of
seed
s
teste
d
10
Total Propor Tota
no. of tion of l no.
seeds seeds
of
survi survivi seed
ving
ng (%) s
teste
d
15
Total
Propor Tota
no. of tion of l no.
seeds
seeds
of
survivi survivi seed
ng
ng (%) s
teste
d
20
Total
Propo Tota
no. of rtion l no.
seeds
of
of
survivi seeds seed
ng
survi s
ving
teste
(%)
d
Tota
l no.
of
seed
s
survi
ving
N.E
332
329
99.0
347
333
95.9
361
342
94.7
363
359
S.E
346
291
84.1
360
309
85.8
344
273
79.3
343
257
S.W
97
81
83.0
94
80
85.1
95
79
83.1
96
78
N.E-North East, S.E-South East S.W-South West
References
Al-Khatib, K., Baumgartner, J. R., Peterson, D. E. and Currie, R. S., 1998.
Imazethapyr resistance in common sunflower (Helianthus annuus). Weed Sci
46: 403–407.
Altieri, M. A., 2000. The ecological impacts of transgenic crops on agroecosystem
health. Ecosystem Health, 6, 13-23.
Arriola, P. E., Ellstrand, N. C., 1996. Crop-to-weed gene flow in the genus Sorghum
90
Pro
port
ion
of
see
ds
surv
ivin
g
(%)
98.
8
74.
9
81.
2
(Poaceae): spontaneous interspecific hybridization between johnsongrass,
Sorghum halepense, and crop sorghum, S. bicolor. Am J Bot 83:1153–1160
Baltazar, B. M., Schoper, J. B., 2002. Crop-to-crop gene flow: dispersal of transgenes
in maize, during field tests and commercialization. Proceedings of the 7th
international symposium on the biosafety of genetically modified organisms
Baltazar, M. B., Sanchez-Gonzalez, J., de J, de la Cruz-Larios, L., Schoper, J. B.,
2005. Pollination between maize and teosinte: an important determinant of
gene flow in Mexico. Theor Appl Genet 110:519–526
Baranger, A., Che`vre, A. M., Eber, F. and Renard, M., 1995. Effect of an oilseed
rape genotype on the spontaneous hybridization rate with a weedy species: an
assessment of transgene dispersal. Theor. Appl. Genet. 91: 956–963
Bartsch, D., Cuguen, J., Biancardi, E. and Sweet, J., 2003. Environmental
implications of gene flow from sugar beet to wild beet—current status and
future research needs. Environmental Biosafety Resources 2:105–115.
Bateman, A. J., 1947. Contamination in seed crops. II. Wind pollination. Heredity 1:
235-246.
Bellon, M. R. and Risopoulos, J., 2001. Small-scale farmers expand the benefits of
improved maize germplasm: A case study from Chiapas, Mexico. World
Development. Vol. 29(5):799-811.
Bernasconi, P., Woodworth, A. R., Rosen, B. A., Subramanian, M. V., Siehl, D. L.,
1995. A naturally occurringpoint mutation confers broad range tolerance to
herbicides that target acetolactate synthase. J. Biol. Chem. 270, 17381–17385.
Buckler, S. E. and Natalie, M. S., 2006. Maize origins, domestication and selection.
In: J. Motley, J. T., Zerega, N. and Hugh, C., 2006. Darwin's Harvest: New
Approaches to the Origins, Evolution, and Conservation of Crops. Columbia
University Press, New York. 2006. 390 pp
Burris, J. S., 2001. Adventitious pollen intrusion into hybrid maize seed production
fields. In: Proceedings of the Corn Sorghum Research Conference, vol 56.
American Seed Trade Association, pp 98–115
Christou, P., 2002. No credible scientific evidence is presented to support claims that
transgenic DNA was introgressed into tradi-tional maize landraces in Oaxaca,
Me´xico. Transgenic Res. 11: 3-5.
Devlin, B. and Ellstrand, N. C., 1990. The development and application of a refined
method forestimating gene flow from angiosperm paternity analysis. Evolution
44:248–259
Dietrich, G. E., 1998. Imidazolinone resistant AHAS mutants, US Patent 5: 767 361.
Dow, B. D. and Ashley, M. V., 1998. High levels of gene flow in bur oak revealed by
paternity analysis using microsatellites. J Hered 9:62–70
90
Ehrlich, P. R. and Raven, P. H., 1969. Differentiation of populations. Science
165:1228–1232.
Ellstrand, N. C. and Marshall, D. L., 1985. Interpopulation gene flow by pollen in
wild radish, Raphanus sativus. American Naturalist 126:606–616.
Ellstrand, N. C., 2003. Current knowledge of gene flow in plants: implications for
transgene flow. Philos Trans R Soc Lond B 358:1163–1170
Ellstrand, N. C., Prentice, H. C. and Hancock, J. F., 1999. Gene flow and
introgression from domesticated plants into their wild relatives. Annu. Rev.
Ecol. Syst. 30: 539–563
Elsevier’s Dictionary of Plant Genetic Resources: In English (With Definitions).
1991. Compiled by the International Board for Plant Genetic Resources
(IBPGR). Elsevier Science Ltd., Amsterdam, The Netherlands.
Emberlin, J., 1999. A report on the dispersal of maize pollen. Research paper
commissioned by the Soil Association, http://www.soilassociation.org
FAO, 2003. Plant production and protection, food and agriculture organization of the
United Nations: procedures for ecological risk assessment of herbicide and
insect resistant crops –focus on weed aspects.
Gepts, P. and Papa, R., 2003. Possible effects of (trans) gene flow from crops on the
genetic diversity from landraces and wild relatives. Environmental Biosafety
Resources 2:89–103.
Gethi, J. G., Smith, M. E., Mitchell, S. E. and Kresovich, S., 2005. Genetic diversity
of Striga hermonthica and Striga asiatica populations in kenya. Weed
Reseasrch, 45, 64-73
Goggi, A. S., Lopez-Sanchez, H., Caragea, P., Westgate, M., Arritt, R. and Clar, C.
A., 2007. Gene flow in maize fields with different local pollen densities. Int J
Biometeorol (2007) 51:493–503
Gray, A. J. and Raybould, A. F., 1998. Reducing transgene escape routes. Nature
392:653–654.
Gressel, J., 1995. Creeping resistances: the outcome of using marginally effective or
reduced rates of herbicides, in Proc Brighton Crop Prot Conf—Weeds, BCPC,
Farnham, Surrey, UK, pp 587–589.
Gressel, J., 1996. The potential role of herbicide resistant crops in world Agriculture.
In: Duke, S. O. (Ed.), herbicide resistant crops: agricultural, economic,
enviromental, regulatory and technological aspects. Lewis publishers, Chelsea
MI, 231-250.
Gressel, J., Segel, L. E. and Ransom, J. K., 1996b. Managing the delay of evolution of
herbicide resistance in parasitic weed. Int. J. Pest Mgt 42, 113-129.
91
Groot, M. H. M., van de Wiel, C., van Tienderen, P. H. and den Nijs, H. C. M., 2003.
Hybridization and introgression between crops and wild relatives: current
knowledge and research priorities in lieu of impending introduction of GM
crops. COGEM research 2003–02. University of Amsterdam and Plant
Research International, Amsterdam, The Netherlands.
Hamrick ,J. L., Godt, M. J. W., 1997. Effects of life history traits on genetic diversity
in plant species. In: Silvertown, J., Franco, M., Harper, J. L. (eds) Plant life
histories. Ecology, phylogeny and evolution. Cambridge University Press,
Cambridge, pp 102–118
Hancock, J. F., 1992. Speciation, plant evolution and the origin of crop species.
Prentice-Hall, Englewood Cliffs, New Jersey, USA.
Henry, C. D., Morgan, D., Weekes, R., Daniels, R., Boffey, C., 2003. Farm scale
evaluations of GM crops: monitoring gene flow from GM crops to non GM
equivalent crops in the vicinity. Part I: forage maize. Report No. EPG 1/5/138.
Available at http://www.defra.gov.uk/environment/gm/research/pdf/epg_1-5138.pdf.
Jones, M. D. and Brooks, J. S., 1950. Effectiveness of distance and border rows in
preventing outcrossing in corn. Oklahoma Agricultural Experimental Station,
Technical Bulletin No. T-38.
Jones, M. D. and Newell, L. C., 1948. Longevity of pollen and stigmas of grasses:
buffalograss, Buchloe dactyloides (NUTT) Engelm., and corn, Zea mays L. J
Am Soc Agron 40:195–204
Jorgensen, R. B., Hauser, T., Mikkelsen, T. R. and Ostergard, H., 1996. Transfer of
engineered genes from crops to wild plants. Trends Plant Sci. 1, 356–358.
Kenta, T., Isagi, Y., Nakagawa, M., Yamashita, M., Nakashizuka, T., 2004. Variation
in pollen dispersal between years with different pollination conditions in a
tropical emergent tree. Mol Ecol 13:3575–3584
Klein, E., 2000. Estimation de la fonction de dispersion du pollen. Application a´ la
disse´ mination de trange` nes dans l’environnement. Ph.D. Thesis, University
of Paris Sud, France, 80 pp.
Langevin, S. A, Clay, K. and Grace J. B., 1990. The incidence and effects of
hybridization between cultivated rice and its related weed red rice (Oryza
sativa L.). Evolution 44:1000–1008.
Levin, D. A. and Kerster, H. W., 1974. Gene flow in seed plants. Evol. Biol. 7, 139–
220.
Messean, A., 1999. Impact du development des plantes transgeniques dans les
systemes de culture: rapport final. Dossier No. 96/15- B: Impact des plantes
transgeniques.
92
Messeguer, J., 2003. Gene flow assessment in transgenic plants. Plant Cell, Tissue
and Organ Culture 73: 201–212, 2003.
Messeguer, J., Fogher, C., Guiderdoni, E., Marfa`, V., Catala`, M. M., Baldi, G. and
Mele´, E., 2001. Field assessments of gene flow from transgenic to cultivated rice
(Oryza sativa L.) using a herbicide resistance gene as tracer marker. Theor.
Appl. Genet. 103: 1151–1159
Mikkelsen, T. R., Jensen, J. and Jorgensen, R. B., 1996. Inheritance of oilseed rape
(Brassica napus) RAPD markers in a backcross progeny with Brassica
campestris. Theor. Appl. Genet. 92: 492–497
Moore, P., 1976. How far does pollen travel? Nature 260:280–281.
NRC (National Research Council), 2002. Environmental effects of transgenic plants:
The scope and adequacy of regulation. Washington, D.C.: National Academy
Press.
Odhiambo, G. D., and Ransom, J. K., 1997. On-farm evaluation of an integrated
approach to Striga control in western Kenya. African Crop Sci. Conference
Proceedings, Pretoria, 13-17 January 1997. pp887-893.
Ottaviano, E., San-Gorla, M. and Villa, M., 1988. Pollen competitive ability in maize:
Within population variability and response to selection. Theorical and Applied
Genetics 76: 601–608.
Pleasants, J. M., Hellmich, R. L. and Lewis, L. C., 1999. Pollen deposition on
milkweed leaves under natural conditions (presentation at the Monarch
Butterfly Research Symposium, Chicago).
Pleasants, J. M., Hellmich, R. L., Dively, G. P., Sears, M. S., Stanley-Horn, D. E.,
Mattila, H. R., Foster, J. E., Clark, P., Jones, J. D., 2001. Corn pollen
deposition on milkweeds in and near corn fields. Proc Natl Acad Sci USA
98:11919–11924
Raybould, A. F. and Gray, A. J., 1993. Genetically modified crops and hybridization
with wild relatives: A UK perspective. Journal of Appl Ecol 30:199–219.
Rees, M. and Paynter, Q., 1997. Biological control of scotch broom: modeling the
determinants of abundance and the potential impact of introduced insect
herbivores. Journal of Applie Ecology 34, 1203-1222.
Salamov, A. B., 1940. About isolation in corn. Sel. I. Sem., 3. (Russian translation by
Michael Afanasiev in 1949).
Sano, Y., 1993. Constraints in using wild relatives in breeding: lack of basic
knowledge on crop gene pools. Intern. Crop Sci. 1:437–443.
Scott, R. K., 1970. The effect of weather on the concentration of pollen within sugar-
93
beet crops. Ann. of Appl. Biol. 66:119–127
Sears, M. K. and Stanley-Horn, D., 2000. Impact of Bt corn pollen on monarch
butterfly populations. In: Fairbairn, C., Scoles, G. & McHughen, A. (Eds.)
Proceedings of the 6th International Symposium on The Biosafety of
Genetically Modified Organisms. University Entension Press, Canada.
Sears, M. K., Helmich, R. L., Stanley-Horn, D. E., Oberhauser, K. S., Pleasants, J. M.,
Mattila, H. R., Siegfried, B. D., Dively, G. P., 2001. Impact of Bt maize pollen
on monarch butterfly populations: a risk assessment. Proc Natl Acad Sci
98:11937–11942
Slatkin, M., 1987. Gene flow and the geographic structure of natural populations.
Science 236:787–792.
Stevens, W. E., Berberich, S. A., Sheckell, P. A., Wiltse, C. C., Halsey, M. E., Horak,
M. J., Dunn, D. J., 2004. Optimizing pollen confinement in maize grown for
regulated products. Crop Sci 44:2146–2153
Treu, R. and Emberlin, J., 2000. Pollen dispersal in the crops Maize (Zea mays), Oil
seed rape (Brassica napus ssp oleifera), Potatoes (Solanum tuberosum), Sugar
beet (Beta vulgaris ssp vulgaris) and wheat (Triticum aestivum). Soil
Association.
Weekes, R., Allnutt, T., Boffey, C.,Morgan, S.,Bilton, M., Daniels, R., Henry, C.,
2007. A study of crop to crop gene flow using farm scale sites of fodder maize
(Zea mays L.) in the UK. Transgenic Res (2007) 16: 203-211.
94
Comparison of BBTV infected with in-vitro derived bananas under
field conditions
Ikram-ul-Haq
Institute of Biotechnology and Genetic Engineering (IBGE), University of
Sindh, Jamshoro, Pakistan. rao.ikram@yahoo.com
Abstract
The effect of Banana Bunchy Top Virus (BBTV) on the development of banana was
assessed in comparison to control banana plants, which were developed under in-vitro
conditions. The infected samples were collected from the Nawabshah vicinity of the
Sindh province. Banana micro-propagation was carried out by culturing sucker as an
explant on MS (Murashige and Skoog) basal medium supplemented with 2.0mg/l
indole acetic acid (IAA), 1.5mg/l 6-benzyl amino-purine (BAP) and solidified with
3.60g/l phytagel. Shoot induction and multiplication were done in the presence of
2.0mg/l BAP and 2.0g/l phytagel. After 4-weeks, the banana plantlets were shifted to
the field conditions after hardening. Both of infected and control plants were grown in
wire-house for 1-month than different morpho-biochemical aspects were studied. The
nitrate reductase activity (NRA) in the BBTV infected plants was significantly low in
comparison to control/normal plants. A significant effect of BBTV was also observed
on certain bio-chemical contents. The Ca2+ and K+ ionic contents were lower in the
field collected samples than control ones and conversely, Na+ and Cl- contents lower.
Total protein and carbohydrate contents were decreased in infected plants (infected or
non-infected?), while proline and reducing sugar contents were increased
significantly. The chlorophyll content was not significantly affected by BBTV
infestation. Therefore, BBTV is a major biotic factor for banana growth, under which
variant characteristics were observed to behaving just like under abiotic stresses.
Key words: In-vitro; Musa spp.; Micro-propagation; BBTV; Ionic contents; Total
proteins; Reducing sugars; Betaine; Meristematic shoot tip culture.
Introduction
Generally banana crop is affected by five growth limiting viruses (Stover, 1972)
including Banana bunchy top virus (BBTV). It has been considered to be one of the
most important plant viral diseases around the world (Dale, 1987; Moffat, 2001),
transmitted with vegetative planting materials or banana aphids (Pentalonia
nigronervosa). Aphids are acting as a vector (Allen, 1987; Harding et al 1991; Magee,
1940; Wu and Su, 1990) its spreading. The viral infection vary from plant to plant,
while the main symptoms of the BBTV infected plants are characterized through its
congested rosette or branch like appearance of the upright aerial leaves; giving rise to
the common name bunchy top. Dark green streaks are present on the midrib and
petiole of the leaves, extending down into the pseudostem. A more diagnostic
symptom is the presence of short, dark green dots and dashes along the minor leaf
veins, which are best observed when the leaf is viewed. Uninfected (banana)
pseudostem would produce a bunch of yellow, green, or even red bananas before
dying but plants infected at an early stage remain stunted and do not produce fruit
(Thomas and Iskra-Caruana, 2000).
95
During plant development, the viral symptoms may or may not be expressed.
However such symptoms are appearable, during its growth under different
environmental stresses like temperature, light and fertilizers (Balachandran and
Osmond, 1994).
However, stunted growth, deformation of young leaves and bunched at the top of the
plant are frequently observed under severe viral infection or unfavorable growth
conditions (Chia et al., 1992 & 1995). The virus free plants may be able to grow faster
in the field and produced much larger inflorescences, being over a meter in length.
Overall the plants can show relatively better growth performance but it reduces under
viral infection because virus infection in plant is associated with a decrease in
photosynthetic as well as respiration rates (Balachandran et al., 1997a & b; Radwana
et al., 2007; Milavec et al., 2001; Shalitin and Wolf, 2000; Miteva et al., 2005; Guo et
al., 2005; Chandlee and Scandalios, 1984) on which all other plant growth attributes
are dependent. During plant growth from seed germination to maturity peroxidases
playing an integral role, while during senescence it is highly active (Siegel, 1993;
Kadiodlu and Durmus, 1997).The plant defense system dominantly dependent on
peroxidases in response to pathogen attack, such responses are the results of hosts
reacting hypersensitivity. The systemic infection may lead to increase in defense
activity (Candela et al., 1994; Lagrimini and Rothstein, 1987; Ye et al., 1990). Wound
repairing is also an important role of the peroxidases. Meanwhile, necrosis or
chlorosis appearance is the result of viral infection (Wood, 1990).
In this paper the growth related attributes are studied in the virus infected and virusfree plants of the banana (Musa spp) cv Sindhri Banana (Basrai). The virus infected
and un-infected plants were established in soil (wire-house) under natural conditions.
The response of plants to such conditions were analyzed on plant growth related
aspects including some physiological parameters were studied during this experiment.
Such findings may be helpful in future for developing BBTV resistance in banana
crop of the world.
An experiment was established to determine the effect of BBTV on the plant growth.
The banana plants i.e BBTV infected and non-infected were grown in wire-house for
forty five days. a) Healthy or non-infected banana samples were developed under invitro according to Haq and Dahot (2007a&b). b) BBTV infected samples were
collected from newly propagating plantlets of about 7-10cm in height they were tested
with DAS-ELISA (Thomas and Dietzgen, (1991) based on Clark and Adams (1977).
The 3rd leaf from top to bottom of the developing banana plants were used for
anatomical (Gielwanowska et al., 2005; Johansen, (1940) and various bio-chemical
studies. The plant bio-mass was measured and chlorophyll contents were determined
as by Arnon (1949). Peroxidases were determination (de Jaegher et al., 1985) as well
as praline, as described by Bates et al., (1973). Total carbohydrates were extracted by
homogenizing 100mg dried plant material (Ciha and Brun, 1978; Dubois et al., 1956),
while according to Miller’s method (1959), reducing sugars contents were determined
by taking absorbance at 540 nm. The nitrate contents were determined as by Morris
and Riley (1963), while nitrate reductase activity (NRA) was determined according to
Klepper et al., (1971). According to Bradford (1976), protein contents were
determined by taking absorbance at 570nm against bovine serum albumin as standard.
90
According to Ozyigit et al., (2007) phenol contents were determined by O.D 760nm
against 95% ethanol. The Na+, K+, Ca2+ contents, as described by Malavolta et al.,
(1989). The data collected during this experiment was computed for ANOVA by
using a COSTAT computer package (CoHort Software, Berkeley, USA).
Results††††††
To determine the effect of BBTV on the growth of the banana cv., Sindhri banana
(Basrai) both infected and healthy banana plants were grown in the green house. The
viral infected plants were observed to be deficient in propagation efficiency. With the
passage of time, plant multiplication rate and their heights were suppressed in infected
plants than healthy or non-infected plants significantly. Visual color difference was
observed in BBTV infected plants only, this variation is due to the deficiency or
abundance of certain pigments (chl a, chl b). The chlorophyll contents are also acting
as the markers for the severity of viral infection. The general appearance of the leaves
of BBTV infected banana plants had showed the severe symptoms, as its early
infection led to stunted growth, latterly may be caused to of its sterility. The
distinguishing symptoms includes congested rosette at the top of plant and dark green
streaks on the midrib and petiol were also seen. The stunted leaves with dark-green
dots and dashes along with the minor leaf veins were the distinguishing
morphological and characteristic markers for the infection or non-infection of BBTV.
The total protein and carbohydrates in the leaves of viral infected plants and noninfected plants are shown in Table 1/C. Both were slightly increase in the viral
infected plants. Interestingly, it was observed that total carbohydrate contents were
decreased in them in comparison to control plants. From the results of phenolic
content analysis significant increase was observed in infected plants than control ones.
Proline contents in the viral infected leaves were also determined. A significant
increase in it was observed, as the obvious results are shown in Table 1/C. So the viral
infection in the plants has been caused the accumulation of proline in the leaves. All
the environmental stresses including BBTV among the biotics were also being created
an imbalance situation for certain ionic contents in the developing plants. The Na+ in
the leaves of control plant was observed to be significantly higher than the virus
infected plants (Table 1/D). Interestingly, K+ and Ca2+ were decreased in the viral
infected plants in comparison to control plants. All of the observed bio-chemical as
well as visible statuses in the developed plants are markers for indication of which
biotic or abiotic stress on the developing individual plants were acting on them.
Discussion
The BBTV spreading is mostly dependent on the infection rate of banana-aphids.
Generally it’s not possible for the insects to infect banana in the aseptic conditions.
The production of pathogen free plants under in-vitro from the meristem culturing
techniques is the basic need at present. Meanwhile, micropropagation is considered as a tool; allowing to produce a mass of plantlets from a
small piece of live plant (explant) in relatively short period of time. Rooted and
††††††
Figures and tables available on request
91
micro-propagated plantlets of any species have been possible to establish them, which
have been grown successfully in either containers or open fields (Oluf, 2002). During
the development of the infected plants, many alterations in the physiological,
biochemical, and metabolic processes have been occurring within the plant (Fraser,
1987). Such alterations lead to the appearance of symptoms for the specific
pathogen’s infection during plant development (Tecsi et al., 1996). The characteristics
developing because of the plant-pathogen interactions are very little which have been
known to us. During our work, few variations in certain morphological and metabolic
processes of banana leaves infected by BBTV have been observed.
The newly developing plants show deformation and stunted growth pattern of the
leaves because of the severity of the BBTV infection in comparison to the control
plants. The abnormal leaf morphology is the result of the reduction in foliage growth.
Virus infection causes to decrease in various pigments (Table 1) of the healthy plants
(Técsi et.al., 1996). The systemic chlorosis due to BBTV infection is accompanied
with a decrease in gas exchange characteristic or the rate photosynthetic process in the
leaves. Net photosynthetic rate decreases, which is often accompanied with the
decrease in chlorophyll contents. From the data it is concluded that Chl b is more
sensitive than chl a to BBTV infection. Obviously, the systemic infection caused by
plant viruses may be acting as inhibitors for certain enzymes, which are particularly
involved in the bio-synthesis of chlorophyll synthesis (Sutic and Sinclair, 1990).
Accumulation of proline contents among the plants is the well known indicator for a
number of environmental stresses (Csonka and Hanson, 1991). The increase in proline
contents in plants under the environmental stresses can occur, that lead to decrease the
deleterious effect of stress. Such applying stress may be able to develop a limited
plant growth such as pathogen stresses (Dorffling et al., 1990). Similarly the BBTV
infected plants in our work, have also been showed higher levels of proline contents
than healthy plants (Metzner et al., 1965) as well as viruses. In higher plants, both
biotic and abiotic stresses are producing a number of characteristic changes in
physiological as well as metabolic processes. The various environmental stresses in
the plant tissues increase the activity of peroxidases (Espelie et al., 1986; Edreva,
1989; Shimoni et al., 1991; Miteva et al., 2005), especially under the influence of
toxic elements (Vangronsveld and Clijsters, 1991; Stroinski, 1995; Mocquot et al.,
1996; Weeckx and Clijsters, 1996; Miteva and Peycheva, 1999), due to the BBTV
infection raises the activity of peroxidase (Kondakova and Hristova, 1986).
A number of variant characters especially organic components have been observed in
the infected in comparison to non-infected or healthy plants. Total protein and sugar
contents have been observed. Each of them significant increased in response to BBTV
infection (Milavec et al., 2001). The increase in organic contents may occur in the
already synthesized protein or may be newly synthesized. The new polypeptides may
be appeared in response to BBTV infection. The synthesis of new proteins and their
accumulation in the viral infected plants is considered as theses proteins may be
involved in developing pathogen resistance in the plants.
92
References
Allen, R.N., 1987. Further studies on epidemiological factors influencing control of
banana bunchy top disease and evaluation of control measures by computer
simulation. Aus. J. Agric. Res. 38:373–382.
Balachandran, S., Hull, R.J., Martins, R.A., Vaadia, Y., Lucas, W.J., 1997a. Influence
of environmental stress on biomass partitioning in transgenic tobacco plants
expressing the movement protein of tobacco mosaic virus. Plant Physiol. 114,
475–481.
Balachandran, S., Hurry, V.M., Kelley, S.E., Osmond, C.B., Robinson, S.A.,
Rohozinski, J., Seaton, G.G.R., Sims, D.A., 1997b. Concepts of plant biotic
stress. Some insights into the stress physiology of virus-infected plants, from
the perspective of photosynthesis. Physiol. Plant. 100, 203–213.
Balachandran, S., Osmond, C.B., 1994. Susceptibility of tobacco leaves to
photoinhibition following infection with two strains of tobacco mosaic virus
under different light and nitrogen nutrition regimes. Plant Physiol. 104, 10511057.
Bates, L.S., R.P. Waldren and I.D. Tear. 1973. Rapid determination of free proline for
water stress studies. Plant Soil 39: 205-207.
Bradford, M.N., 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anals of
Biochemistry 72: 248-254.
Candela M.E., Munoz R., Alcázar M.D., Espín A., 1994. Isoperoxidase involvement
in the resistance of Capsicum annuum to infection by cucumber mosaic virus,
Plant Physiol. 143: 213-217.
Chandlee J.M. and Scandalios J.G. 1984. Analysis of variants affecting the catalase
development program in maize scutellum, Theor Appl Genet 69: 71–77.
Chia, T.F., Chan, Y.S., Chua, N.H., 1992. Detection and localisation of viruses in
orchids by tissue print hybridisation. Plant Pathol. 41, 355–361.
Chia, T.F., Chan, Y.S., Chua, N.H., 1995. Tissue print hybridization for the detection
and localisation of plant viruses. In: Singh, R.P., Singh, U.S. (Eds.), Molecular
Methods in Plant Pathology. CRC Press, Boca Raton, FL, pp. 145–149.
Ciha, A.J. and W.A. Brun. 1978. Effect of pod removal on nonstructural carbohydrate
concentration in soybean tissue. Crop Sciences 18: 773-776.
Clark M.F. and Adams, A.N. 1977. Characteristics of the microplate method of
enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen.
Viol 34: 475-483.
Csonka L.N. and A.D. Hanson, Prokaryotic osmoregulation: genetics and physiology,
90
Annul. Rev. Microbiol. 45 (1991), pp. 569–606.
Dale, J. L. 1987. Banana bunchy top: an economically important tropical plant virus
disease. Adv. Virus Res. 33:301–325.
de-Jaegher G., Boyer N. and Gaspar T. 1985. Tigmomorphogenesis in Bryonia dioica:
Changes in soluble and wall peroxidases, phenylalanine ammonia-lyase
activity, cellulose, lignin content and monomeric constituents, Plant Growth
Regul. 3: 133-148.
Dorffling K., Schulenburg S., Lesselih G. and Dörffling H. 1990. Abscisic acid and
proline levels in cold hardened winter wheat leaves in relation to variety –
specific differences in freezing resistance, J. Agro. Crop Sci. 165: 230–239.
Dubois, M., K.A. Gilles, J.K. Hamilton, P.A. Rebers and F. Smith 1956. Colorimetric
method for determination of sugars and related substances. Anals of
Chemistry 28: 350-356.
Edreva, A., 1989. Stress and pathogenesis in plants – involvement of peroxidase
system and endogenous elicitors. Genet. Breed. 22, 354–365.
Espelie, K., Franceschi, V., Koattukudy, P., 1986. Imunocytochemical localization
and time course of appearance of an anionic peroxidase associated with
suberization in wound healing potato tube tissue. Plant Physiol. 81, 487–492.
Fraser R.S.S. 1987. Biochemistry of Virus Infected Plants, Research Studies
Press, Letchworth/John Wiley and Sons, New York, USA.
Gielwanowska I., Szczuka E., Bednara J. and Gorecki R. 2005. Anatomical features
and ultrastructure of Deschampsia antarctica (Poaceae) leaves from different
growing habitates. Annals of Botany 96: 1109-1119.
Guo D., Guo Y., Zhao J., Liu H., Peng Y. and Wang Q. 2005. Photosynthetic rate and
chlorophyll fluorescence in leaves of stem mustard (Brassica juncea var.
tsatsai) after turnip mosaic virus infection. Plant Sci 168: 57–63.
Haq, I. and M.U. Dahot. 2007a. Bio-chemical contents and micro-propagation
efficiency in banana. Journal of Biological Sciences 10: 726-733.
Haq, I. and M.U. Dahot. 2007b. Micro-propagation efficiency in banana (Musa spp)
under different immersion systems. Pakistan Journal of Biological Sciences
10: 726-733.
Harding, R. M., T. M. Burns, and J. L. Dale. 1991. Virus-like particles associated
with
banana bunchy top disease contain small single-stranded-DNA. J. Gen.
Virol. 72:225–230.
Johansen, D. A. (1940) Plant microtechnique. New York, USA: McGraw-Hill.
Kadiodlu A., Durmus¸ N. (1997) Effect of benzyladenin on peroxidase activity during
91
senescence of squash (Cucurbita pepo L.) cotyledons, Plant Perox. Newslett.
10 51–57.
Klepper, L., Flesher D. and Hageman R.H. 1971. Generation of reduced Nicotinamide
Adenine Dinucleotide for nitrate reduction in green leaves. Plant Physiology
20: 580-590.
Kondakova, V., Hristova, D. 1986. A newmethod of testing meristem strawberry
plants. Genet. Select. 5: 391–393
Lagrimini L.M., Rothstein S. 1987. Tissue specificity of tobacco peroxidase isozymes
and their induction by wounding and tobacco mosaic virus infection, Plant
Physiol. 84 438–442.
Magee, C.J.P. 1940. Transmission studies on the banana bunchy top virus. J. Austr.
Inst. Agric. Sci. 6: 109–110.
Malavolta, E., Vitti G.C. and Oliveira S.A. 1989. The evaluation of the nutritional
state of the plants: principles and applications. Piracicaba, Brazilian
Association for Research of Potash and Phosphate. pp 201.
Metzner H., Rau H. and Senger H. 1965. Untersuchungen zur Synchronisierbakeit
einzelner Pigmentmangel-Mutanten von Chlorella. Planta 65: 186–194.
Milavec M, Ravnikar M. and Kovac M. 2001. Peroxidases and photosynthetic
pigments in susceptible potato infected with potato virus YNTN. Plant Physiol
Biochem 39: 891–898.
Miller G.L. 1959. Use of dinitrosalicylic acid reagent for the determination of
reducing sugar. Anal of Chemistry 31: 426-429.
Miteva E, Hristova D., Nenova V. and Maneva S. 2005. Arsenic as a factor affecting
virus infection in tomato plants: changes in plant growth, peroxidase activity
and chloroplast pigments. Scientia Horticulturae 105: 343-358.
Miteva E. and Peycheva S. 1999. Arsenic accumulation and effect on peroxidase
activity in green bean and tomatoes. Bulg. J. Agric. Sci. 5: 737–740.
Mocquot B. and Vangronsveld J. Clijsters H. and Mench, M. 1996. Copper toxicity in
young maize (Zea mais L.) plants: effect on growth, mineral and chlorophyll
content and enzyme activities. Plant Soil 182: 287–300.
Moffat A. S. 2001. Finding new ways to fight plant diseases. Science 292: 2270–
2273.
Morris A.W. and J.P. Riley. 1963. The determination of nitrate in sea water. Anals of
chemica Acta 29: 272-279.
Oluf G. 2002. Plant tissue culture. Biotechnology. Milestones In Vitro Cellular and
Development Biology - Plant, 38: 84-92.
92
Ozyigit I.I., Kahraman M.V. and Ercan O. 2007. Relation between explant age, total
phenols and regeneration response in tissue cultured cotton (Gossypium
hirsutum L.) African Journal of Biotechnology 6: 3-8.
Radwana D.E.M., Lua G., Fayezb K.A., Mahmoud S.Y. 2007. Protective action of
salicylic acid against bean yellow mosaic virus infection in Vicia faba leaves.
J Plant Physiol, doi:10.1016/j.jplph.2007.07.012
Shalitin D. and Wolf S. 2000. Cucumber mosaic virus infection affects sugar transport
in melon plants. Plant Physiol 123: 597–604.
Shimoni, M., Bar-Zur, A. and Reuveni, R. 1991. The association of peroxidase
activity and resistance of maize to Exserobilum triticum. J. Phytopathol. 131:
315–321.
Siegel B.Z. 1993. Plant peroxidases - an organismic perspective, Plant Growth Regul.
12: 303-312.
Stover R.H. 1972. Banana, Plantain and Abaca Diseases. Common wealth Mycological Institute, Kew, Surrey, United Kingdom, pp: 316.
Stroinski A. 1995. Effect of cadmium and Phytophtora infestans on peroxidase
activity in potato leaves and tubers. Roczniki AR w Poznaniu CCLXXVI,
Ogrodn 23: 53–61.
Sutic D.D. and J.B. Sinclair, Physiology of diseased plants. In: D.D. Sutic and J.B.
Sinclair, Editors, Anatomy and Physiology of Diseased Plants 2, CRC Press,
Boca Raton (1990), pp. 157–221.
Tecsi L., Smith A.M., Maule A.J. and Richard C. 1996. A spatial analysis of
physiological changes associated with infection of cotyledons of marrow
plants with cucumber mosaic virus. Plant Physiol. 111: 975–985.
Thomas, J. E. and Dietzgen R.G. 1991. Purification, characterization and serological
detection of virus-like particles associated with banana bunchy top virus in
Australia. J. Gen. Virol. 72: 217–224.
Thomas, J.E. and Iskra-Caruana M.L. 2000. Bunchy top. Pages 241–253 in diseases
of banana, Abaca and Ensete, edited by D.R. Jones. CAB International,
Wallingford, UK.
Vangronsveld J. and Clijsters, H. 1991. A biological test system for the evaluation of
metal phytotoxicity and immobilization by additives in metal contaminated
soils. In: Merian, E. (Ed). Metal Compounds in Environment and Life 4: 117–
125.
Weeckx J. and Clijsters H. 1996. Oxidative damage and defence mechanisms in
primary leaves of Phaseolus vulgaris as a result of root assimilation of toxic
amounts of copper. Physiol. Plantarum 96: 506–512.
Wood K.R. 1990. Pathophysiological alternations, in: Mandahar C.L. (Ed.), Plant
93
Viruses, vol. 2, Pathology, CRC Press, Boca Raton, pp. 30-52.
Wu, R.Y. and Su H.J. 1990. Purification and characterization of banana bunchy top
virus. J. Phytopathol. 128: 153-160.
Ye X.S., Pan S.Q. and Kuc J. 1990. Activity, isozyme pattern, and cellular
localization of peroxidase as related to systemic resistance of tobacco to blue
mould (Peronospora tabacina) and tobacco mosaic virus, Physiol. Biochem.
80 1295-1299.
94
Competition between cultivated rice (Oryza sativa) and wild rice
(Oryza punctata)‡‡‡‡‡‡ in Kenya
*Jane T. Munene1, Jenesio I. Kinyamario1, Niels Holst2 and John K. Mworia1
1*
Corresponding author School of Biological Sciences, University of Nairobi,
P.O. Box 30197-00100 Nairobi, Kenya. Tel. +254722294936 Email address:
jateimu@yahoo.com
2
University of Aarhus, Faculty of Agricultural Sciences, Flakkebjerg Research
Centre, Slagelse, Denmark
Abstract
This greenhouse study examined the effect of competition on the growth performance
of cultivated (Oryza sativa) and wild (Oryza punctata) rice species in Kenya. Growth
was assessed for the two species, grown together and separately, by measuring plant
height and tiller number through the growing season, and flag leaf area and above and
below-ground biomass at the end of the growing season. O. punctata grew to a higher
final height (116.00±13.628cm), attained higher tiller number (9 tillers /plant) and
accumulated more biomass (16.68±0.501g ) than O. sativa while O. sativa attained a
higher flag leaf area (26.1±0.67cm2 ) than O. punctata (P<0.05). For both species,
interspecific competition was detected only as a reduction in flag leaf area, which is
known to relate directly to grain yield. Due to its aggresive vegetative growth we
concluded that O. punctata is a stronger competitor than O. sativa (P<0.05).
Key words: Competition, growth, Oryza sativa, Oryza punctata, cultivated rice, wild
rice
Regards are due to DANIDA ENRECA through the BiosafeTrain Project who funded this work.
We also acknowledge the School of Biological Sciences, University of Nairobi for providing
experimental facilities and vehicle transport.
‡‡‡‡‡‡
95
Introduction
The genus Oryza has 25 species distributed throughout tropical and subtropical
regions of all continents (Veasey et al., 2004). The cultivated species of rice are O.
sativa Linn and O. glaberrima Staud. O. sativa originates from South-East Asia and is
grown worldwide whereas O. glaberrima is grown solely in West Africa, its area of
origin (Linares, 2002; Fageria and Baligar, 2003). Rice is an important staple food for
more than 50% of the world’s population (Fageria and Baligar, 2003). In Kenya, it is
the third most important cereal crop after maize and wheat. It forms part of the larger
diet for urban populations and it is gaining popularity in the rural areas. About 95% of
the rice in Kenya is grown under irrigation paddy schemes managed by the National
Irrigation Board (NIB). The remaining 5% is rain fed. Most of the rain fed rice is
grown in Kwale, Kilifi, and Tana River districts in the Coast Province, and Bunyala
and Teso districts in the western Kenya (Anonymous, 2005). Kenya’s rice production
comes from cultivated rice (O. sativa) and meets only 60% of the demand (Wanjogu
and Mugambi, 2001). There is therefore, a strong need not only to increase the current
rice production levels, but also to come up with supplements for the cultivated rice
using wild varieties such as O. punctata (Vaughan, 1994).
Wild rice, O. punctata is commonly found in the cultivated rice fields in the coastal
region of Kenya. It has been cited as a potential food supplement for O. sativa during
famine in Kenya (Vaughan, 1994). Advantages of O. punctata over O. sativa include
faster maturity rate (100 days) compared to O. sativa (130 days), it can grow in saline
conditions (Fisher and Ramirez, 1993), it grows in swampy areas but does not need as
much water as O. sativa (Diarra et al., 1985b). Since it thrives in diverse
environmental conditions, it can be grown in a wider geographical area than O. sativa.
Despite the above advantages, O. punctata is considered important only as one of the
most problematic weeds in Kenya. It grows together in competition with O. sativa.
Weed-crop competition is one of the major causes of crop yield loss (Cao et al.,
2007). Weedy rice commonly causes a considerable reduction in cultivated rice yield
because of its competition for resources. The extent of yield losses depend on weed
density (Fisher and Ramirez, 1993), type of weedy plants (Diarra et al., 1985b), the
variety of rice grown (Eleftherohorinos et al., 2002) and competition duration (Kwon
et al., 1991). Yield loss due to weedy rice can be expressed not only in the quantity of
the rice harvest (Estorninos et al., 2000) but also in a decreased quality of the grain
(Kwon et al., 1991; Pantone and Baker, 1991).
Studies on competition between cultivated and wild rice are lacking in Kenya. This
study therefore dealt with competition between wild rice, Oryza punctata and the
cultivated rice, Oryza sativa, and its effect on the plant growth of the two species. An
improved understanding of the growth characteristics of O. punctata and its impact on
the growth of cultivated rice has two benefits: (1) It will make it possible to
recommend the best cropping system if O. punctata is introduced in farming systems
as a supplement to O. sativa. This is very important to small-scale farmers who do not
own large farms for rice cultivation. This will enable them to supplement their low O.
sativa production. (2) With the potential advent of herbicide-resistant O. sativa, there
is a risk that O. punctata will acquire the resistance gene from the crop and turn it into
a weed that is difficult to control. It has been reported (Estorninos et al., 2002; Gealy
et al., 2003a) that the genetic, physiological, and morphological similarities in
cultivated and wild rice provide opportunities for the transfer of the herbicideresistant traits, especially if flowering is synchronous. To assess the importance of
89
that risk, it is important to know how harmful O. punctata is as a weed in a field of O.
sativa.
Biomass accumulation is a good measure of competitive success, because it reflects
resource capture under the interference of neighbours (Fernando et al., 2006; Gaudet
and Keddy, 1988; Roush and Radosevich, 1985). Above-and below-ground biomass
accumulation was therefore used in this study as a measure of competitive success.
The objective of this study was to compare the growth performance of O. sativa and
O. punctata when grown together and when grown separately under similar
conditions. O. punctata was found to be the stronger competitor as it grew faster and
attained a higher above- and below-ground biomass than O. sativa.
Plant materials
The Oryza sativa (Basmati 370-Pishori) seeds used in this study were obtained from
Tana Delta Irrigation Scheme in Tana River District, Coast Province of Kenya (2° 11’
S, 40° 10’ E). This rice variety has been grown in Kenya since the 1960s. Oryza
punctata seeds were randomly collected from the fields within the Tana Delta
Irrigation Scheme. The site was chosen since the two species naturally occur together
within this region. The close proximity of the material collecting sites for the two
species ensured that the seeds were exposed to similar conditions before the start of
the study.
Greenhouse experiment
The study was conducted from January 2007 to October 2007 in a greenhouse at
Chiromo campus, University of Nairobi (1° 16' S, 36° 48' E). Although there were
differences in latitudes between the material collection site (Coast Province) and the
experimental site (Nairobi), the objective of the study was to compare the basic
biological characteristics of wild and cultivated rice under the same environmental
conditions. Therefore the difference would not affect the basic conclusions.
Three treatments were designed for the experiment namely; O.sativa grown
separately, O. punctata grown separately and O.sativa grown together with O.
punctata. Each treatment included three replicates that were arranged in plastic basins
of 0.70m diameter each. The experiment therefore included a total of 9 replicates per
block which were arranged in a randomized complete block design (Steel et al.,
1997). A total of six blocks was used. The seeds of the two species were sown into
separate basins on the same day. The soil type used was black clay (Vaughan, 1994)
which was similar to the soil in the area from where the seeds were collected. Each
basin was three-quarter filled with the soil. Twenty-one-day-old seedlings were
transplanted into the experimental basins on 27 March and harvested on 20 October
2007. Twenty seedlings were transplanted into each basin at a spacing of 10cm by
10cm and sowing depth of 3cm. The total number of seedlings per block for each
treatment was 180. Six blocks were used giving a total of 1080 seedlings per
treatment for the whole experiment. In the mixed planting, the two species were
planted in an alternating manner.
Ten seedlings from each basin were marked and used for all subsequent sampling.
Data were collected on plant height, number of tillers per plant, flag leaf area of the
90
first tiller, and above- and below-ground dry phytomass. Plant height was taken on a
weekly basis. For seedling, vegetative and reproductive stages, height was measured
from base to the tip of the tallest leaf. At ripening and maturity stages, it was
measured from the base to the tip of the tallest panicle (Yoshida, 1981). Number of
emerging tillers was counted weekly from first tiller emergence to maximum tillering
stage. Flag leaf area (A) was determined at maturity by measuring the length (L) and
width (W) of the leaf to a precision of 1 mm. Flag leaf area (A) was then calculated as
A=0.67LW (Yoshida, 1981). At the end of the experiment, all the plants from each
basin were uprooted labelled and the roots washed to remove any adhering soil
particles. The 10 marked plants from each basin were sorted out and separated into
above- and below-ground dry material by cutting with a sharp knife at 15cm above
the soil surface mark (Pande, 1994). The mass of each sample was then determined to
a precision of 0.05g after oven drying at 80°C to a constant mass.
Statistical Analyses
The growth curves of plant height and tiller number were found by regression using
the least squares method (TableCurve software, SYSTAT, Richmond, California).
Among the sigmoid equations provided by this software, one was chosen that gave the
overall least bias when studying the residuals. The parameters describing the growth
curve were compared between treatments using a t-test with α=5% for each
comparison. Flag leaf area and above- and below-ground phytomass data analysis was
carried out by analysis of variance using the statistical program SPSS version 14. The
significantly different parameters at 5% significance level were separated using the
Student-Newman-Keuls test (Steel et al., 1995).
Results
Although there were differences in latitudes between the material collection site
(Coast Province) and the experimental site (Nairobi), the objective of the study was to
compare the basic biological characteristics of wild and cultivated rice under the same
environmental conditions. Therefore the difference would not affect the basic
conclusions.
Plant height and tiller number
Of the sigmoid functions tested, including the Gompertz and the logistic functions
(Peters, 1993), most resulted in biased residuals. In this respect, the asymmetric
sigmoid function yielded the best fit to the height and tiller number measurements:
y inc
y = y init +
,
(Eq. 1)
α
⎡
⎧ x − w ln 21 / α − 1 − x mid ⎫⎤
⎢1 + exp⎨−
⎬⎥
w
⎭⎦⎥
⎩
⎣⎢
(
)
Where, y is height or tiller number, and x is the number of days after transplanting.
The five parameters of the curve have this interpretation,
yinit: initial height (cm) or tiller number;
yinc: final increment in height (cm) or tiller number;
xmid: the time at which half the final height or tiller number is achieved (days);
w:
width of the growth curve (days), smaller values giving a steeper curve;
91
α:
curve asymmetry (dimensionless); α=1 for symmetric curves; α>1 when the
first bend of the curve is sharper than the second bend; α<1 when the second bend is
sharper.
The only significant P< 0.001) differences found in the parameters of Eq. 1 were
between the two species: O. punctata grew to a larger final height and it produced
more tillers than O. sativa. The species also differed in development rate, O. punctata
flowering and reaching maturity about 1 month before O. sativa. There was a seeming
reduction of growth, both in terms of height and tiller number, caused by competition;
i.e. compare OP vs. OPOS and OS vs. OSOP (OP O. punctata grown alone, OPOS O.
punctata grown together with O. Sativa, OS O. sativa grown alone, OSOP O. sativa
grown together with O. Punctata). However, a large variance, especially in O.
punctata made it impossible to detect any effects of competition statistically. At
maturity O. punctata produced grain that shattered quickly, while O. sativa did not
produce any grains. Lack of grain production by O. sativa was possibly due to the
generally cool greenhouse climate that prevailed due the period of the study.
Flag leaf area
O. sativa whether grown alone or in the mixture attained a higher flag leaf area than
O.punctata (P<0.001. For both species, the monocultures attained higher flag leaf area
than the mixtures (P<0.001). Flag leaf area of the two species was therefore reduced
by competition.
Phytomass
Phytomass at harvest showed the same pattern in the above- ground as that in the
below-ground, whereby O. punctata grown alone grew to a higher height than when
in competition with O. sativa, whereas O. sativa was not affected by competition
(P>0.001), and O. punctata attained higher mass than O. sativa both with and without
competition.
Discussion
The wild rice (O. punctata) had stronger vegetative growth than the cultivated rice (O.
sativa). This was expressed both in terms of final plant height and final plant biomass.
This in itself will make O. punctata the stronger competitor in the growing season.
Moreover it developed quicker (cf. De Datta, et al., 1981, 1985a, Kwon et al., 1991),
and its seeds, which shattered readily, would be cast in the field before crop harvest.
This makes O. punctata a difficult weed to control in the long run; after the seeds
have entered the seed bank they can remain dormant for many years (Naredo et al.,
1998). Grain yield was not measured directly due to quick shattering of O. punctata
seeds and no grain production by O. sativa. Lack of grain production by O. sativa was
possibly due to the generally cool greenhouse climate that prevailed during the period
of study (Fig 2). However, flag leaf area provides a good indirect measurement, as it
is well correlated with grain yield (Yoshida, 1981; Dutta et al., 1998). Under this
assumption, O. sativa would give a higher yield than O. punctata, which just confirms
that O. sativa has been bred for a high yield. Flag leaf area was the growth trait most
responsive to competition: for both species the area was reduced by interspecific
competition. Thus weeds in rice are more likely to cause a reduction in yield than in
vegetative growth traits, such as height, tillering and biomass.
90
The wild O. punctata was in general more variable than the bred O. sativa. This made
it more cumbersome to work with, and it introduced variance in the results that made
it difficult to separate averages. We recommend that future experiments be designed
with more replicates for wild species than for bred cultivars. Tall rice cultivars are in
general more competitive than those with short stature (McGregor et al., 1988; Kwon
et al., 1991; Fischer et al., 1995), as are cultivars with a high tillering ability
(McGregor et al., 1988; Fischer et al., 1995; Gealy et al., 1998; Estorninos et al.,
2002). The stronger vegetative growth of O. punctata would thus give it an advantage
over O. sativa in competition for light. Higher tiller production increases the ability of
a rice plant to expand rapidly into an available space (Johnson et al., 1998), in
addition to its ability to produce more panicles. Estorninos et al., (2002) pointed out
that rice cultivars that produced more tillers also produced higher biomass. In this
study, O. punctata produced a higher biomass both above and below-ground. High
tillering capacity, as demonstrated by O. punctata, should therefore be considered
when breeding for rice cultivars that are competitive against weeds. This agronomic
characteristic of rice may improve the success of reduced herbicide rate application
programs. It has been reported (Roush and Radosevich, 1985; Gaudet and Keddy,
1988; Kwon et al., 1991; Fernando et al., 2006) that phytomass accumulation is a
good measure of competitive success, because it reflects resource capture under the
interference of neighbours. Fleming et al. (1988) reported that the more aggressive
species in a mixture increased in shoot weight more than the less aggressive. In this
perspective, the aggresive growth form of O. punctata would make it a stronger
competitor than O. sativa. However, we found no effect of interspecific competition
on O. sativa phytomass. In contrast, Johnson et al. (1998) found interspecific
competition to decrease O. sativa shoot phytomass.
With higher below-ground mass, O. punctata is likely to be a better competitor for
water and nutrients than O. sativa. The average root lengths in this study were 20 cm
for O. sativa and 50 cm for O. punctata. It has been reported (Flinn and Garrity, 1986;
Dingkuhn et al., 1990; Fofana and Rauber, 2000) that root growth is a dominant
characteristic associated with weed competition. Additionally, Fischer et al. (1995)
pointed out that early competition in upland rice would be for soil resources, as it
occurs before rice and weed canopies overlap. Effects of root competition have been
cited by a few other authors (Donald, 1958; Exley and Snaydon, 1992; Perera et al.,
1992) as possibly being more important than shoot competition. We have confirmed
farmers’ knowledge that O. punctata, a widespread weed of cultivated rice in Kenya
and elsewhere, can cause serious yield losses due to its aggresive growth and early
seed cast. Its rapid growth could make it a valuable crop as it is likely to be more
robust: developing quicker and attaining a larger root depth than cultivated rice. If
introduced as supplement for O.sativa, we recommend a monoculture farming system
to avoid competition. Obstacles to grow O. punctata as a crop include its tendency to
grain shattering and its severe ness as a weed in cultivated rice. If herbicide-resistant
rice varieties are taken up there is the additional risk of resistance genes spreading to
O. punctata, which would make it an even more difficult weed to control.
91
References
Anonymous (2005). Grain production in Kenya. Export Processing Zones Authority.
Nairobi, Kenya.
Cao QJ, Li B, Song ZP, Cai XX, and Lu B (2007). Impact of weedy rice populations
on the growth and yield of direct-seeded and transplanted rice. Weed Biology
and Management 7: 97-104.
De Datta SK (1981). Principles and Practice of Rice Production. John Wiley and
Sons, New York, pp 146-170.
Diarra ARJ, Smith ARJ, Talbert RE (1985). Interference of red rice with rice (Oryza
sativa). Weed Sci. 33: 644-649
Donald CM (1958). The interaction of competition for light and for nutrients.
Australian Journal of Agricultural Research. 9: 421-435.
Dutta RK, Baset Mia MA, Khanam S (1998). Plant architecture and growth
characteristics of fine grain and aromatric rices and their relation with grain
yield. Research and Applied Technology.
Elefhterohorinos IG, Dhima KV, Vasilakoglou IB (2002). Interference of red rice in
rice grown in Greece. Weed Sci. 50:167–172.
Estorninos LE, Gealy DRJr, Talbert RE (2000). Interference between red rice and
rice in the replacement series studies. Research series Arkansas Agricultural
Experiment Station. PP 463-468.
Estorninos LE, Gealy DRJr, Talbert RE (2002). Growth response of rice (Oryza
sativa) and red rice (O. sativa) in a replacement series study. Weed Technol.
16: 401-406.
Exley DM, Snaydon RW (1992). Effect of nitrogen fertilizer and emergence date on
root and shoot competition between wheat and blackgrass. Weed Research.
32:175-182.
Fageria NK, Baligar VC (2003). Upland rice and allelopathy. Commun. Soil Sci.
Plant Anal. 34:1311-1329.
Fernando BP, Laca EA, Mackill DJ, Fernandez GM, Fischer AJ (2006). Relating rice
traits to weed competitiveness and yield: a path analysis. Weed Sci. 54: 11221131.
Fischer AJ, Ramirez A (1993). Red rice (O. sativa) Competition studies for
management decisions. Int. J. Pest Management. 39:133-138.
Fischer A, Chatel M, Ramirez H, Lozana J, Guimarase E (1995). Components of early
competition between upland rice (O. sativa ) and Brachiaria brizantha
(Hochst. Ex a. Rich ) Stapf. Int. J. Pest Management. 41: 100-103.
Fleming GF, Young FL, Ogg AG (1988). Competitive relationships between winter
90
wheat (Tritichum Aestivum), jointed goatgrass (Aegilops cylindrical ),and
downy brome (Bromus tectorum). Weed Sci. 36:476-486.
Flinn JC, Garrity DP (1986). Yield stability and modern rice technology. International
Rice Research Institute (IRRI) – Research Paper Series 122: 1-18.
Fofana B, Rauber R (2000). Weed suppression ability of upland rice under low-input
conditions in West Africa. Weed research 40:271-280.
Gaudet CL, Keddy PA (1988). A comparative approach to predicting competitive
ability from plant traits. Nature 334: 242-243.
Gealy DR, Mitten DH, Rutger JN (2003a). Gene flow between red rice (Oryza sativa)
and herbicide resistant rice (O.sativa): implications for weed management.
Weed Technol.17: 627-645.
Gealy DR, Dilday RH, Rutger JN (1998). Interaction of flush irrigation timing and
suppression of barnyardgrass with potentially allelopatheic rice lines. In
Estorninos, L.E. Jr., Gealy, D. R. and Talbert, R.E. (2002) Weed Technol. 16:
401406.
Johnson, P., Dingkuhn, M., Jones, K., and Mahamane, L. (1998) The influence of rice
plant type on the effect of weed competition on Oryza sativa and oryza
glaberrima. Weed Research, 38(3): 207-216.
Kwon SL, Smith RJJr, Talbert RE (1991). Interference of red rice (Oryza sativa)
densities in rice (O. sativa). Weed Sci. 39: 169-174.
Linares OF (2002). African rice (Oryza glaberrima): history and future potential.
Proceedings of the National Academy of science of the United States of
America. 99:16360-16365.
McGregor JT, Roy JR, Smith JR, Talbert RE (1988). Broadleaf signalgrass
(Brachiaria platyphylla) duration of interference in rice (Oryza sativa). Weed
Sci.36: 747-750.
Naredo MEB, Juliano AB, Lu BR, Guzman Fde, Jackson MT (1998). Response to
seed dormancy-breaking treatments in rice species (Oryza L.) Seed Sci. and
Tecnol., 26: 675-689.
Pande HK (1994). Improved upland rice farming systems. Food and agriculture
organization of the United Nations, Rome, pp 31-108.
Pantone DJ, Baker JB (1991). Reciprocal yield analysis of red rice (O. sativa)
competition in cultivated rice. Weed Sci.39: 42-47.
Perera KK, Ayres PG, Gunasena HPM (1992). Root growth and relative importance
of root and shoot copmpetition between rice (Oryza sativa) and Echinochloa
crus-galli. Weed Research. 32: 67-76.
91
Peters RH (1983). The ecological implications of body size. Cambridge University
Press, New York, pp 118-146.
Roush ML, Radosevich SR (1985). Relationships between growth and
competitiveness of four annual weeds. J. Appl. Ecol. 22: 895-905.
Steel RGD, Torrie JH, Dicke DA (1997). Principles and procedures of statistics. A
Biometrical Approach. 3rd ed. McGraw-Hill Inc. New York, pp 193-194.
Vaughan DA (1994). The wild relatives of rice. A genetic Resources Handbook, IRRI
Manila, Philippines, pp 58-59
Veasey EA, Karasawa PP, Santos MS, Rosa E, Mamani E, Oliveira CX (2004).
Variation in the Loss of Seed Dormancy during After- ripening of Wild and
Cultivated Rice Species. Annals of Botany 94/6.
92
Haplotype Sharing for Fine Mapping Quantitative Trait Loci
Controlling Trypanotolerance in Mice
J. M. Kamau 1,3, P. W. Amwayi 2,3, O. A. Mwai 1, 2, M.K Limo 2, P.W.
Kinyanjui 3, M. Agaba 2, S.J. Kemp 4, J. P. Gibson 5 and F. A. Iraqi2
1
Department of Animal Production, University of Nairobi, P.O BOX 29053,
Nairobi, Kenya, Corresponding Email: jmuiruri@uonbi.ac.ke
2
Department of Biochemistry and Molecular Biology, Egerton University P.O
BOX 536 Njoro
3
International Livestock Research Institute, P.O BOX 30709, Nairobi, Kenya
4
Department of Biochemistry, University of Nairobi, P.O BOX 30197,
Nairobi, Kenya
5
School of Biological Sciences, Donnan Laboratories, University of Liverpool
L69 7ZD, UK
5
The Institute for Genetics and Bioinformatics, UNE, Armidale, NSW 235,
Australia
Abstract
Quantitative trait loci (QTL) mapping and fine mapping in mouse models
demonstrates the possibility of localizing genes that determine genetic variations in
inbred strains. Previously, three quantitative trait loci (QTL), Tir1, Tir2 and Tir3 on
chromosome 17, 5 and 1 respectively associated with resistance to trypanosomosis,
were mapped in two F2 resource populations, (C57BL/6J x A/J) and (C57BL/6J x
BALB/cJ). The QTL were mapped within 10-40cM genomic intervals (CI).
Subsequently, using F6 advanced intercross lines (AILs), the QTL were fine mapped
to a smaller CI, but not sufficient for positional cloning. C3H/HeJ and 129/J mouse
strains are relatively susceptible, however, it is not known if this is due to
‘susceptible’ alleles at the previously identified QTL. To determine this, an F2 cross
(C57BL/6J x C3H/HeJ) and (C57BL/6J x 129/J) were developed and challenged with
Trypanosoma congolense and the response and survival time monitored. Interval
mapping identified significant QTL on chromosomes 17 and 1, however, Tir2 was not
confirmed. Following the confirmation of the QTL on chromosome 1 and 17, the
conserved susceptible/resistance (QTLs) regions between A/J, BALB/cJ, C3H/HeJ,
129/J and C57BL/6J were explored using single nucleotide polymorphism (SNP)
haplotypes for fine mapping these QTL. The QTL precision was increased
significantly from 30-40cM to less than 1cM which is now adequate for positional
cloning.
Introduction
Traits that show continuous variation in a population are referred to as complex traits
or quantitative traits. Quantitative trait loci mapping involves the use of evenly spaced
polymorphic DNA markers to correlate between marker alleles and the phenotype
variation (Yan et al., 2004). This work has attracted considerable research interest for
several years and efforts are being undertaken to map genes that determine
quantitative genetic variation with little success. This is mostly as a result of current
detection methods which place quantitative trait loci (QTLs) within very large interval
not adequate for positional cloning. Recently, an in silico SNP haplotype mapping
strategy has been proposed to accelerate the identification of genes associated with
93
complex traits (Grupe et al., 2001). With the availability of various web-accessible
murine SNP databases, the chromosomal regions that most likely contribute to
trypanotolerance could be narrowed down thus the potential candidate gene list.
Evaluation of genetic variation patterns has been reported in two recent studies
(Frazier et al., 2004; Yalcin et al., 2004) based on fine resolution haplotype structure
across multiple strains. These findings suggest that a high resolution SNP map is
required to obtain an accurate description of the genetic variations in the laboratory
mouse genome. Therefore, a detailed exploration of common ancestral regions that lie
between strains can hasten QTL mapping by identification of shared regions for
consideration as candidate loci (Wade et al., 2002). Furthermore, examination of the
haplotype structure across the QTL candidate region might reveal regions that
segregate appropriately with the phenotype of the strains.
In a recent study, three loci, Tir1, Tir2 and Tir3 were identified and mapped on
chromosome 17, 5 and 1 respectively, with confidence intervals (CIs) in the range 1040cM that control significant genetic differences between resistant and susceptible
mice after linkage mapping studies on two F2 crosses (C57BL/6 x A/J and C57BL/6 x
BALB/c strains). However, the confidence interval report was too large to facilitate
positional cloning. A subsequent fine mapping of the Tir1, Tir2 and Tir3 loci was
carried out using advanced intercross lines (AIL) created by crossing the C57BL/6
strain with the A/J and BALB/c strains respectively. Darvasi and Soller (1995)
introduced AIL approach where random mating over a number of generations from
the F2 is used to accumulate meiosis for the purpose of high resolution mapping of
QTL by the time F6 to F8 generation is attained. Consequently, Tir1, Tir2 and Tir3
loci showed significant improved resolution revealing a single region in each,
however, the AIL analyses revealed a degree of complexity at the Tir3 which
appeared to resolve into three distinct region (Clapcott, 1998, Iraqi et al., 2000).
The foregoing highlights the need to utilize haplotype mapping to achieve very fine
localization of the QTL that will enhance positional cloning or position candidate
gene identification. Here, single nucleotide polymorphisms (SNP) database were used
to predict variation in the mouse genome, where the recently assembled genome
sequence of C57BL/6J (resistant) strain is aligned with sample sequences of other
susceptible strains. The existence of common haplotype patterns in the four
susceptible strains, A/J, BALB/cJ, C3H/HeJ, and 129/J will be a reflection of recent
evolutionary origins, thus representing ancestral haplotypes. The identification of
haplotypes can be effective in reducing QTL intervals to sizes amenable to analysis of
the candidate gene (Wiltshire et al., 2003).
Generation of F2 resource population
Parental lines C57BL/6J (trypanosomosis resistant), 129/J and C3H/HeJ (susceptible)
were obtained from Harlan Ltd, UK. From each cross, 120 mice of FI (C3H/HeJ X
C57BL/6J) and (129/J X C57BL6J) were developed by mating 20 (10 males and 10
females) C3H/HeJ mice with 20 (10 males and 10 females) C57BL/6J mice. Then 60
breeding pairs of the F1 generation were intercrossed to produce 345 F2s in each
cross (C3H/HeJ X C57BL/6J) and (129/J x C57BL6J) generation, which were used in
this study. The breeding of the F2 population and subsequent phenotyping was done
at the small animal unit, International Livestock Research Institute (ILRI), Kenya.
90
Trypanosomosis challenge, Phenotyping and Genotyping
The F2 (129/J x C57BL/6J) and (C3H/HeJ X C57BL/6J) resource populations
together with the control parental mouse strain mice were challenged at 12 weeks of
age by intraperitoneal inoculation of 4X104 blood stream forms of T. congolense
clone IL1180 (Masake et al, 1983 and Nantulya et al, 1984). In the following 14 days,
blood sample were collected daily from the tail tip of all challenged mice and
examined for evidence of infection by parasitemia observation by microscope.
Phenotypic data was defined as survival time in days following the day of challenge.
The first group to succumb were taken as the most susceptible (S), while the last one
to succumb to infection were presumed to be resistant (R), and those ones in between
were taken as the intermediate group (I). The mouse that was not parasitemic was
excluded from further analysis. DNA was extracted from mouse tail and genotyped
with microsatellite markers, which previously confirmed to be informative between
C57BL/6J, C3H/HeJ and 129/J mouse strains and located within the six previously,
mapped (trypanotolerance) QTL intervals. A selective genotyping approach was used
in this experiment (Ronin et al., 2003 and Darvasi, 1997).
Linkage analysis and QTL mapping
Genotype frequencies in resistant and susceptible groups of mice were checked
against Hard-Weinberg equilibrium (HWE) (Deng et al., 2000, 2003; Deng and Chen
2000). Multipoint analysis was performed with MAPMAKER/EXP version 3.0
(Lincoln et al., 1992a), and map distances were calculated with the Haldane function.
QTL interval mapping analysis were performed with the maximum likelihood (ML)
approach of MAPMAKER/QTL version 1.1 (Lincoln et al., 1992b) and with the least
Square (LS) approach of QTL express (Seaton et al., 2002). The significant LOD
score in Mapmaker/QTL was defined as the interval above the two LOD scores;
however in QTL express permutation test was run 1000 times randomly across the
data and significant F value (LOD score) was defined by the software. QTL express
was used with marker orders and distances from the sequenced mouse genome
(Waterston et al., 2002). The markers that used were first test for linkage analysis as
described by Lincoln and Lander (1992). The QTL position and significance was
confirmed by maximum likelihood estimation method using Mapmaker/QTL
programs by incorporating marker order (Lander et al., 1987).
Single Nucleotide Polymorphism
(SNP) haplotype analysis
Markers flanking each QTL were identified by the linkage analysis and subsequently
mapped on the mouse genome sequence database. These markers were used to
identify the reference SNP positions within the assembled genome sequences for
database query. The mapped QTL region in five different mouse strains (i.e. 129/J,
BALB/cJ, A/J, C3H/HeJ and C57BL/6J was aligned to the sequenced mouse genome
to identify the shared single nucleotide polymorphism (SNP) for the purpose of fine
mapping and possible candidate gene(s) identification. The mouse SNP database
http://mousesnp.roche.com/cgi-bin/msnp_public.pl and the Jackson Laboratory
database http://aretha.jax.org/pub-cgi/phenome/mpdcgi?rtn-docs/home was screened
91
for SNPs within each QTL for total SNPs available, and then filtered to keep only the
SNPs for 129/J, A/J, BALB/cJ, C3H/HeJ and C57BL/6J.
Results And Discussion
Phenotyping
The survival time of the F2 (129J x C57BL/6) and (C3H/HeJ X C57BL/6J)
population and the parental lines were recorded and analysed. The A/J strain was most
susceptible and all mice had died by day 100 post challenge. The mean survival times
in days were 60, 79, 82 and 140 for A/J, 129/J, C57BL/6J and F2 respectively. The F2
population had a higher survival time of 140 days comparing with the parental lines.
The F2 group showed higher survival rate than the resistant parental C57BL/6 mouse
strain. A high proportion of the susceptible group (F2) were found to be more
resistant than the parental 129/J mouse strain, while A/J mouse - the most susceptible
of all the mice strains had the lowest survival mean of 60 days. In this particular
study, the 129/J mouse strain behaved phenotypically less like the C57BL/6J. This
observation is postulated to the fact that 129/J mouse strain was obtained from
Jackson Laboratory and maintained at ILRI small animal unit for five years before
using in this experiment. As a result of this, 129/J might have acquired some form of
immunity. However, the survival time of F2 (C3H/J x C57BL/6J) cross, the scenario
was different. Though the F2 mice showed the highest survival rate compared with
the other strains (parental), in this case the C3H/HeJ and C57BL/6J were statistically
different. In addition, the resistance/ susceptibility status of C57BL/6J and C3H/HeJ
were confirmed phenotypically in this study; C57Bl/6J had a higher survival time than
C3H/HeJ and A/J mouse strains (Morrison et al., 1978). The mean survival times of
the mice were: A/J (53 days), C3H/HeJ (63 days), C57BL/6J (87 days) and F2 (97
days). None of the C3H/HeJ and A/J mice survived the challenge.
Linkage analysis
The QTL analysis revealed presence of loci that influence survival of mice under
trypanosome challenge on chromosome 1 and 17, which was consistent with earlier
reports by Kemp et al., (1997). The threshold obtained with least square method was
comparable to the two LOD score level of significance assigned to the mapmaker
results. The statistical test for the QTL showed evidence of Tir1 and Tir3 on
previously mapped region as reported by Kemp et al., (1997). The summary of the
QTLs mapped is as indicated in Table I. The results of regression analysis carried out
on the web based QTL express were comparable to those obtained with maximum
likelihood results as analyzed by Mapmaker/QTL (Figures 1a, b, c and d).
The QTLs Tir1 and Tir3 mapped on Chr 17 and 1 QTLs, Tir1 and Tir3 comprised a
single locus with LOD scores of 3.276 and 2.588 in F2 (129/J x C57BL/6J); 4.864 and
4.59 in C3H/HeJ x C57BL/6J respectively. Tir1 and 3 mapped in 129/J x C57BL/6J
cross was weaker than that observed in A/J, BALB/c x C67BL/6J cross previously
mapped by kemp et al., (1997). This is consistent with survival data of 129/J x
C57BL/6J cross and may partly explain why the LOD score were low comparing to
A/J, BALB/c whose mean survival was significantly different from C57BL/6J. The
mapped QTLs confirmed that 129/J and C3H/HeJ mouse strain to
92
carry the susceptible alleles at Tir1 and 3 which were previously mapped in A/J and
BALB/c mouse strains on both F2 (Kemp et al., 1997) and F6 AIL (Iraqi et al., 2000)
populations. This is an important finding as it further to illustrates that these two (Tir1
and Tir3) in conferring trypanotolerance trait.
Table IA: Locations and statistics for putative QTL in F2 129/JxC57BL/6J cross.
A
Chr Fvalue
17 6.42
5
1
3.99
7.64
P<0.05 P<0.01 LOD LOD
Position Flanking
score* Score** (cM)
markers
5.06
7.02
2.66
3.40
15cM
D17Mit68D17Mit184
4.75
6.99
1.23
0.82
5.71
7.61
3.04
3.27
78cM
D1Mit425D1Mit206
Table I B: Locations and statistics for putative QTL in F2 C3H/HeJxC57BL/6J
cross.
Chr Fvalue
17 11.4
P<0.05 P<0.01 LOD LOD
Position Flanking marker
score* Score** (cM)
B
4.815
6.724
4.38
4.59
10cM
D17Mit78D17Mit184
5 1.58
5.623
7.534
0.506 0.419
1 12.44 5.238
7.383
4.733 4.864
92.3cM D1Mit425D1Mit155
* Least square analysis, ** Maximum likelihood
Chr5 (Tir2) was not mapped in F2 129J x C57BL/6J and C3H/HeJ X C57BL/6J
crosses as previously found in F2 by Kemp et al., 1997. Earlier studies also showed
no evidence of chromosome 5 QTL in (BALB/cJ x C57BL/6) F6 population and it
was proposed that it could have been due to loss of the allele due to many
recombination events during the development of the AIL (Iraqi et al., 2000). In this
study, this is unlikely since at F2 level, recombinations are very limited (Darvasi and
Soller, 1995). Lack of confirmation of chromosome 5 QTL on the Tir2 region might
be due to small genetic variation between 129/J, C3H/HeJ and C57BL/6J hence
resulting to less significant LOD scores, hence the QTL was too weak to be detected.
In addition, it was postulated that this apparent loss of Tir2 from F2 129J x C57BL/6
and C3H/HeJ X C57BL/6J crosses may have been due to an allele in chromosome 5
within C57BL/6, C3H/HeJ and 129J mouse strains having the same function, meaning
chromosome 5 in 129/J and C3H/HeJ does not carry the susceptible allele of
trypanotolerance. This was postulated with the fact that it might have been inherited
from either one of three wild mouse strains where the inbred lines were developed
from and or that an allele in C57BL/6 in this particular locus is not yet completely
developed.
Chromosomes 2, 3 and 15 did not show any significant QTL in both crosses (Table II
below). The LOD scores were below the threshold of LOD Score 2, though these
QTLs had been confirmed to exist from previous work done by McLeod et al., 2002
using the FDR approach on F2 and F6 Mouse populations. From this, it is then
89
possible that the genome-wide (maximum-likelihood) approach used in the analysis
was too restrictive whereby the LOD score of 2 in the analysis was too high to detect
QTL with very small effects (LOD score bellow two).
Table II Chromosome 2, 3 and 15 least square QTL analysis results
F2
(129/J
C57BL/6J)
F2
(C3H/HeJ
C57BL/6J)
Chr F-value
LOD
score
P<0.05 P<0.01
Significance
2
3
15
0.50
3.67
0.86
1.471
1.553
0.371
4.537
5.696
4.888
7.537
7.858
7.110
Not significant
Not significant
Not significant
2
3
15
0.50
3.51
1.70
0.216
1.467
0.724
4.763
5.209
4.814
7.188
8.078
7.564
Not significant
Not significant
Not significant
X
X
Haplotype scans
This method was predicted by Grupe et al., 2001 where of murine single nucleotide
polymorphism (SNP) database are scanned and on the basis of known mice
phenotypes and genotypes; one can predict the chromosomal regions that most likely
contribute to complex traits. The QTL on chromosome 17 and 1 were confirmed in
C3H/HeJ and 129/J study and were found at similar positions as those previously
mapped in A/J and BALB/cJ. This was followed by searching the publicly available
SNP database for regions within the fine mapped QTL interval (Iraqi et al., 2000)
where allelic sharing is concordant with the phenotypic differences among the strains.
These were incorporated from the Roche database http://mousesnp.roche.com, the
and
Jackson
laboratory
database
http://aretha.jax.org/phenome
the
National
centre
of
http://www.ncbi.nlm.nih.gov/SNP/MouseSNP.cgi,
Biotechnology institute (NCBI).
Shared haplotypes were defined by identifying the longest regions of contiguous
strain pair identity and also by taking all other strain with same allele and coloring
them as shared haplotypes within that region. The conserved haplotype regions
obtained in A/J, BALB/cJ, C3H/HeJ, 129/J comparing with C57BL/6J was used to
refine these QTL. The location of the gene underlying this QTL was narrowed down,
however, the regions resolved into many sub regions where the resistant and
susceptible strains differed. This study is consistent with Bonhomme et al., 1987
where, the genome of laboratory inbred mice were predicted to be a ‘mosaic’ of
regions with origins in the different subspecies, but a clear description of this
variation has remained largely elusive due to lack of high resolution data across the
genome. This work, therefore, indicates that the use of haplotype mapping approach
as a high resolution mapping tool increasing the resolution of the QTLs leading to
consideration of possible candidate genes. Thus, the decreased pool of positional
candidate genes potentially represents the genes controlling resistance to
trypanosomosis.
90
Conclusion
This study was undertaken to refine the position of trypanotolerance QTL, Tir1, Tir2
and Tir3 mapped previously (Kemp et al., 1997; Iraqi et al., 2000). This study
indicates that in silico SNP haplotype analysis might be a useful strategy for mapping
complex traits. Although a controversial idea (Chesler et al 2001; Darvasi 2001),
combining the developing of mouse SNP databases with experimental crosses has
provided an important tool in narrowing the large list of potential candidate genes to a
handful of genes for further analysis. However, these genes still need to be examined
further, using different techniques and strategies to reduce the number of high priority
candidate genes. A survey of literature for genes lying in the haplotype regions that
are likely to be involved in the pathology of trypanosomosis need to be undertaken.
This study further shows us that genetic approaches are still be the best optimism of
identifying genes for trypanotolerance to allow MAS and MAI breeding schemes to
improve livestock productivity. The only difficulty it faces is reducing the list of
candidate genes to the smallest number possible and quickly identifying those that
have the greatest likelihood of influencing the phenotype being studied.
References
Bonhomme, F., Guénet, J. L., Dod, B., Moriwaki, K. & Bulfield, G. (1987). The
polyphyletic origin of laboratory inbred mice and their rate of evolution. J.
Linn. Soc. 30:51-58.
Clapcott, S.J. (1998). Localisation of genes controlling resistance to trypanosomiasis
in mice (Mus musculus). The University of Liverpool. PhD Thesis.
Chelser, E. J., Rodriguez-Zas, S. L. & Mogil, J. S. (2001). In silico mapping of
mouse quantitative trait loci. Science 294:2423.
Darvasi, A. (2001). In silico mapping of mouse quantitative trait loci. Science 294:
2423.
Darvasi, A. & Soller, M. (1995). Advanced intercross lines, an experimental
population for
Darvasi, A. (1997). The effect of selective genotyping on QTL mapping accuracy.
Mammalian Genome 8(1): 67-8
Deng, H. W. and Chen, W. M. (2000). QTL fine mapping, in extreme samples of
finite populations, for complex traits with familial correlation due to
polygenes. American Journal of Human Genetics 67(1): 259-62
Deng, H. W., Chen, M. W. and Recker, R. R (2000). QTL fine mapping by measuring
90
and testing for Hardy-Weinberg and linkage disequilibrium at a series of
linked marker loci in extreme samples of populations. American Journal of
Human Genetics 66(3): 1027-45
Deng, H. W., Li, Y. M. Li, M. X. and Liu, P. Y (2003). Robust indices of HardyWeinberg disequilibrium for QTL fine mapping. Human Heredity 56(4): 1605
Fine genetic mapping. Genetics 141:1199–1207.
Frazer, K. A., Wade, C.M., Hinds, D. A., Patil, N., & Cox, D. R. (2004). Segmental
phylogenetic relationships of inbred mouse strains revealed by fine-scale
analysis of sequence variation across 4.6mb of mouse genome. Genome Res
14:1493-1500.
Grupe, A., Germer, S., Usuka, J., Aud, D., Belknap, J.K., Klein, R.F., Ahluwalia,
M.K., Higuchi, R., & Peltz, G. (2001). In silico mapping of complex diseaserelated traits in mice. Science 292: 1915–1918.
Haley, S.C. and Knott, A.S. (1992). A simple regression method for mapping
quantitative trait loci in line crosses using flanking markers. Heredity 69, 315324
Iraqi, F., Clapcott, S.J., Kumari, P., Haley, C.S., Kemp, S. & Teale, A.L. (2000). Fine
mapping of trypanosomiasis resistance loci in murine advanced intercross
lines. Mammalian Genome 11:645-648..
Kemp, S.J., Iraqi, F., Darvasi, A., Soller, M. & Teale, A.J. (1997). Localization of
genes controlling resistance to trypanosomiasis in mice. Nat Genet 16:193196.
Lander, E., Green, P., Abrahamson, J., Barlow, A and Darley, M. (1987).
MAPMAKER: An interactive computer package for constructing primary
genetic linkage maps of experimental and natural populations. Genomics
1:174-181
Lincoln, S. E, Daly, M, and Lander E. S. (1992b). Mapping genes controlling
quantitative traits with MAPMAKER/QTL 1.1 Whitehead Institute Technical
Report, Cambridge, Mass
Lincoln, S.E Daly, M and Lander E.S. (1992a). Constructing genetic maps with
MAPMAKER/EXP 3.0 Whitehead Institute Technical Report, Cambridge,
Mass
Macleod, K. A., Iraqi, F., Haley, S. C. and Gibson, P. J. (2002). Using the false
discovery rate in the detection of QTL for trypanosomosis resistance in mice.
Proceeding for the 7th World Congress on Genetics applied to livestock
production (7TH WCGALP), Montpellier, France August 19-23. 32:753-756.
Masake, R.A., Musoke, A.J. and Nantulya, V.M. (1983). Specific antibody responses
90
to the variable surface glycoproteins of trypanosome congolense in infected
cattle. Parasite immunology (oxf) 5: 345-355
Nantulya, V.M., Musoke, A.J., Rurangirwa, F.R. and Moloo, S.K. (1984). Resistance
of cattle to tsetse- transmitted challenge with trypanosome brucei or
trypanosome congolense after spontaneous recovery from syringe passed
infections. Infection and immunity 43: 735-738
Ronin, Y., Korol, A., Shtemberg, M. Nevo, E. and Soller, M. (2003). High-resolution
mapping of quantitative trait loci by selective recombinant genotyping.
Genetics 164(4): 1657-66
Seaton, G., Haley, C. S., Knott, S. A., Kearsey, M. & Visscher PM (2002). QTL
Express: mapping quantitative trait loci in simple and complex pedigrees.
Bioinformatics 18:339–340.
Wade, C. M., Kulbokas III, E. J., Kirby, A. W., Zody, M. C., Mullikin, J. C., Lander,
E. S., Lindblad-Toh, K. &Daly, M. J. (2002). The mosaic structure of
variation in the laboratory mouse genome. Nature 420: 574-578.
Waterston, R. H., Lindblad-Toh, K., Birney, E., Rogers, J., Abril, J. F., Agarwal, P.,
Agarwala, R., Ainscough, R., Alexandersson, M. et al. (2002). Initial
sequencing and comparative analysis of the mouse genome. Nature
420(6915): 520-62
Wiltshire, T., Pletcher, M.T., Batalov, S., Barnes, S.W., Tarantino, L.M., Cooke,
M.P., Wu, H., Smylie, K., Santrosyan, A., Copeland, N.G., Jenkins, N.A.,
Kalush, F., Murai, R.J., Glynne, R.J., Kay, S.A., Adams, M.D. & Fletcher,
C.F. (2003). Genome-wide single-nucleotide polymorphism analysis defines
haplotype patterns in mouse. Proc Natl Acad Sci 100(6):3380-5.
Yalcin, B., Fullerton, J., Miller, S Keays, D. A., & Brady, S. (2004). Unexpected
complexity in the haplotypes of commonly used inbred strains of laboratory
mice.Proc. Natl. Acad. Sci USA 101:9734-9739.
91
Assessment of Pollen-Mediated Gene Flow of Bt-Cotton to Local
Commercial Variety, Hart 89m in Kari-Mwea Station
`Kairichi MN1*, Waswa BW1, Waturu CN2, Wiesel W3 Ngigi RG4, Njenga
GK5, Njinju SM5
*Corresponding author, Kenya Agricultural research Institute, Biotechnology
Centre P.O. Box 12406 00100-Nairobi. Tel: 0733 79499: Email:
Mbogori_mercy@yahoo.com
1 Kenya Agricultural research Institute, Biotechnology centre
2 Kenya Agricultural research Institute, RRC, Thika
4 Kenya Agricultural research Institute, Head Quaters
5 Kenya Agricultural research Institute, RRC, Mwea
Abstract
The principal objectives of this study were two fold: to assess the possibility of out
crossing between the bt and non-bt cultivars and second, to assess whether natural
gene flow will occur from bt-cotton lines to cultivated local commercial lines. Pollenmediated gene flow was assessed in four directions from bt source over a distance of
15 meters over a period of one season. Seed cotton samples were taken from HART
89M at varying distances of 1 meter to 15 meters in all four directions and assessed
for presence of bt-protein. Btk test strips were used to assess gene flow from the East
direction only using a sample size of either 64 (Rows 1-6, 15) or 36 (Rows 7-14)
seeds due to limited supply of test strips. Positive seeds were recovered from rows 14 and 7. Results showed that pollen mediated gene flow can occur between
transgenic - bt cotton and local non transgenic commercial variety HART 89M.
Presence of positive seeds in distances as long as 7 meters showed that natural gene
flow does occur and may be caused by wind, insect pollinators and mechanical
means. Furthermore, gene flow incidence reduces with increased distance from the bt
source.
Key words: Gene flow, bt-cotton, pollen-mediated, Btk test strips, outcrossing
Introduction
Approval of three insect resistant crops (Bt-Cotton, Bt-corn, Bt-potato) for
commercializaton by US regulatory bodies markeed a majour milestone for
agricultural biotechnology in general, and more specific crop protection (insect
resistance) (Ref 1 on release)GDevelopm,ent of this technology and subsequent
studies to prove its safety and benefits cost Monsanto Company fourteen years of
intensive research and millions of dollars (2). Bt-cotton (Bollgard®) contained the
lepidopteron specific Bollgard® Bt-gene, Cry1AC that targeted cotton bollworms.
Foowloing commercialization in the US, the Bt-cotton was subsequently introduced
to other countries including Colombia and India (200);Mexico and South Africa
(1998); Argentina and China (1997); Australia (1996).
The greatest challenge that is given highest priority in the development and release of
transgenic crops and other biotech products by both official regulatory authorities and
product registrants is the safety assessment and risk managemt. Of particular
concerns to the Bt-cotton are the potential impacts to environment and safety
including potential of cry proteins to cause toxicity and allergenicity, cross pollination
92
gene flow, fate of Bt protein in soil, and effects on non-target organisms. Transgenes
are associated with the potential impact to environment arising from possible
gebnflow of the transgene to its cultivated non-transgenic crop, related species, and
wild species as well as the possibility of horizontal gene flow. (6-9 9a). It is true that
most cultivated plants mate with one or more wild relatives and many crops have been
known to naturalize and persist as ferel weed populations (10,11). Before adoption of
commercialized crops, each country must develop national biosafety guidleins to be
strictly followed. Additionally, there are international efforts that have been
developed and formulated as guidelins including the Cartagena (12) protocol whose
aim is to bring all the regulators on the same platform. The Bt-cotton has undergone
very comprehensive assessment processes in countries that have adopted the
technology to demonstrate the safety and benefits and has passed such tests so far.
Cross pollination often occurs althou cottoni considered a self-pollinating crop, with
majority of cultivers being a mixture of closely cultivated pure lines. Various insects
such as honeybees, bumblebees (Bombus spp.), and melissodes of wind on pollinator
movement. As the advent of Bt
(Melissodes spp.) bees visit cotton flowers. Reported studies have shown that
provision of honey bees increased both seed and lint yield of cotton by improving
pollination and outcroosing rates were affected by the bee activity. (13) Various
factors affect outcrosing rates that have been reported for cotton including location,
time period, and methods of measurements. In the early years of the 50s, studies were
based on visual phenotypic traits and reported 10% outcrossing rates in texas to 47%
in temnnessee(14, 15). Similar studies reported 28% in Mississippi but a mean of 25
was reported in the same location in mississippi twenty years later.(16) Pollen
transfer to non-transgenic rows of cotton planted upto 25M from a 4 ha field of cotton
carrying the nptIIgenes showed a pollen mediated geneflow (PGF) of below 1% at
distances beyond 7 M, but continued to be detected at distances of 25M (17). Studies
have shown that wind is not an effective carrir of cotton pollen, but my affect
pollinator movement. (13) In areas where Bt-cotton has been introduced and
cultivazted for long, reduced use of insecticide applications has the effect of
increasing pollinator activity in fields hence increased outcrossing. (19)
The transgenic Bt-cotton has been genetically modified by the insertion of one or
more genes from a common soil bacterium, Bacillus thuringiensis. These genes
encode for the production of insecticide proteins, and thus, genetically transformed
plants produce one or more toxins as they grow. The genes that have been inserted
into cotton produce toxins that are limited in activity almost exclusively to the larvae
of Lepidopteran pests. Bollgard-I cotton was the first Bt-cotton to be marketed in the
United States in 1996. The original Bollgard-I cotton produces a toxin Cry 1Ac which
has excellent activity on tobacco bud worm and pink bollworm (3). These two insects
are extremely important caterpillar pests of cotton, and both are difficult and
expensive to control with traditional insecticides. Consequently in USA, Bt-cotton
was widely adopted by growers in the Western Cotton Belt, for pink bollworm, and in
the Mid-south and Southeast, primarily for tobacco budworm. Bollgard-I toxin also
has moderate activity on bollworm, and to a lesser extent on loopers, fall armyworm,
and beet armyworm. Bollgard II was introduced in 2003, representing the next
generation of Bt-cotton. Bollgard II contains a second gene from the Bt bacteria
which encodes for the production of Cry 2Ab.(4) WideStrike (a Trademark of
DowAgrosciences) was registered for use in the fall of 2004. Like Bollgard II,
90
WideStrike cotton expresses two Bt toxins (Cry1Ac and Cry1F). Both Bollgard II and
WideStrike have better activity on a wider range of caterpillar pests than the original
Bollgard technology.(5) Bt-cottons from other companies are currently under
development but have not been commercially introduced. Inspite of safety
assessments carried out in other countries, its nmandatory that each country carry
such evaluations before introduction of commercial transgenic crops. It was therefore
a requirement by the various Kenyan regulatory bodies that crosspollination and gene
flow studies be conducted in a confined quarantined field before introduction of BTcotton. Isolation distance is an important aspect in ensuring purity of a variety.
Although cotton is largely self pollinated, there is about 10% out-crossing. It is
therefore necessary to separate any two different varieties to avoid out-crossing.
Studies were therefore conducted using natural out-crossing between Bt-cotton and
HART 89M. The distances were as indicated below. It was also found necessary to
study the degree of manual out-crossing through hand pollination. The objective was
to establish whether the two varieties are compatible.
Genotypes used
Monsanto provided two Bt cotton lines (DP448B, DP404BG) and two non isolines
(DP5415, DP4049) while KARI provided a commercial line HART89M.
Experimental Field layout
Plots of bt cotton lines DP448B and DP404BG were planted at the centre of the
quarantined field plot with HART89M lines planted at intervals of one meter for 15
rows on all four sides of the Bt-lines (Fig.1)
Figure 1. Field layout
Manual crossing
For manual crossing, the flowers of the Bt-cotton were used as males to provide
pollen and vise versa for HART 89M. Early in the morning the Bt-cotton flowers
were tied at the tip with a fine string. In the evening the pollen was ready for
fertilization. The HART 89M flowers were used as females. They were emasculated
early in the morning. During emasculation, in order to gain access to the anthers,
scissors were used to cut round the base of the corolla, then lifted away to expose the
stamina column. The anthers were then pulled off in ones or twos by gripping the
stalks of the stamens with forceps. The forceps were periodically dipped in
91
methylated spirit to kill any pollen grains which may have been released accidentally.
The stigma was then washed with distilled water and a soda drinking straw inserted to
prevent contamination. In the evening, the Bt-cotton string tied flower was then
removed and the pollen deposited on the stigma of the emasculated HART 89 M
flowers. This way, fertilization was effected. The manually pollinated flowers were
labeled.
Seeds used for testing ware obtained from the CFT at KARI- Mwea. All the guard
rows (buffer zone) in all four directions were sampled and consisted of HART 89M.
For each direction (North, South, East, and West) all bolls were collected and pooled
for each row per direction. East direction consisted of 15 rows one meter apart, West
consisted of 3 meter space not planted immediately after the transgenic plots followed
by 12 rows I meter apart of HART 89M, with West and South consisting of 12 rows I
meter apart. The selfed HART 89M and crosses of HART 89M X Bt were removed
from the guard rows before harvesting and pooling of bolls for each row. For
negative and positive controls, bolls were collected from two iso-lines (DP5415,
DP4049) and two Bt lines (DP448B, DP404BG).
Seed cotton samples were transported to KARI Biotechnology Centre and ginned
using a prototype ginning machine. For each sample (row/direction), seeds were
mixed together after ginning and 64 (rows 1-6, 8) or 36 (rows 7-14) seeds randomly
picked for protein assay. For seed samples, seed coat was excised and discarded to
expose the cotyledon. Monsanto provided seed Btk test strip kit that was used to
detect the Bt-protein. The cotyledon was put in a 1.5ml microfuge tube. Ten (10) X
sample buffer was diluted to 1X and 500ul added to seed sample, and crushed using
thick meat skewers to create a sample extract. The labelled filter cover of the seed
Btk test strip was inserted into each sample extract with the arrows on the filter cover
pointing inside the tube. Test strips were allowed to remain in the tube for about 5
minutes in an upright position, and then removed and placed on a clean Whatman
paper on the bench. Test strips were allowed about ten minutes and observed for
presence or absence of bands. For each sample, the numbers of bands observed on
the test strip were recorded.
Results
The results for the pollen mediated gene flow are presented in Table 1. The test strips
are designed with a test line on top where a red line on top of the test strip is the
control line and indicates the assay has run well. All the strips tested showed positive
for this line indicating that the assay was working. The two seeds from iso-lines
(DP5415, DP4049) showed a single line indicating no Bt protein while those from Bt
lines (DP448B, DP404BG) showed two lines indicating presence of Bt protein. These
two served as negative and positive controls respectively. All the seeds from the
cross between HART 89M and Bt lines (DP448B, DP404BG) showed two lines
indicating presence of Bt protein. HART 89M selfed showed a single line indicating
no Bt protein. Row1 showed 3 positive seeds, while rows 2-4 and 7 showed one
positive seed. All the other rows (5-6, 8-15) showed negative for Bt protein.
90
Table 1 Results for the pollen mediated gene flow tests
Sample ID
Sample
direction
Row 1
East
Row 2
East
Row3
East
Row 4
East
Row 5
East
Row 6
East
Row 7
East
Row 8
East
Row 9
East
Row 10
East
Row 11
East
Row 12
East
Row 13
East
Row 14
East
Row 15
East
+ve Bt seed
Centre
-ve Bt–Isoline seed
Centre
DP448B♀x HART 89M ♂ East
DP404BG♀x HART 89M East
♂
HART 89M selfed
East
# of seeds # of positive
tested
samples
64
3
64
1
64
1
64
1
64
0
64
0
36
1
36
0
36
0
36
0
36
0
36
0
36
0
36
0
64
0
2
2
2
0
2
2
2
2
# of negative
samples
61
63
63
63
64
64
35
36
36
36
36
36
36
36
64
0
2
0
0
2
2
0
Cotton is considered as a self-pollinating crop, but it is often cross-pollinated with
majority of cultivars being a mixture of closely related pure lines. Cotton flowers are
visited by honey bees, bumblebees and other insects. Studies reported elsewhere
indicate that provision of honey bee’s increase out-crossing rates. Results of this
experiment showed that pollen-mediated gene flow can occur between transgenic Btcotton and the non transgenic local commercial cotton variety HART 89M. Manual
crossing of Bt and non Bt-cotton showed that they are compatible and out-crossing
between these varieties is possible. Furthermore, presence of positive seeds in rows
1-4 and 7 indicates that natural gene flow does occur and may be caused by wind,
insect pollinators and mechanical means. Various factors affect the rate of outcrossing and these have been reported to include location, time period, and methods
of measurements. Results of this experiment showed no gene flow above row 8 (8 m
meters away from Bt source), whereas more PGF was reported at I meter (row1) away
from the Bt source. This clearly indicates that PGF reduces with increasing distance
from Bt-cotton. This is in agreement with other reports that showed that PGF was
independent of direction from the source plot and reduced exponentially with
increasing distance from 7.65% at 0.3m to less than 1% beyond 9m (Allen et al.,
2005).
Pollen mediated gene flow will occur between Bt-cotton and non-Bt-cotton. This is
mediated mainly through mechanical, insect and wind mechanism. Unless for seed
90
production purposes, transgenic cotton cultivars are not separated from non transgenic
cultivars once the introduced trait has been approved by government agencies in the
USA as it poses no danger. Isolation is only necessary for purposes of seed
production and is in line with other plants to ensure pure line for seed multiplication
purposes. Other concerns for isolation are trade concerns in which case PGF or other
source of adventitious presence (seed contamination or mechanical mixtures) may
pose problems for export of cottonseed into countries which have trade barriers to
transgenic cotton.
90
Effect of Bt-Cotton on Arthropod Diversity in a Confined Field Trial§§§§§§
Kambo CM, Waturu CN, Wessels W, Wepukhulu SB, Njinju SM,
Njenga GK, Kariuki JN, Karichu PM and Mureithi JM.
Contact Author: Kambo CM
Postal address: P.O. Box 298-10300, Kerugoya, Kenya.
Tel. Nos: 0202028216, Mobile – 0722836911
E-mail: karimwea@yahoo.com
Abstract
A Confined Field Trial (CFT) was set up at KARI Mwea with the objective of
establishing the effect of Bt - cotton varieties, DP 448B and DP 404BG on beneficial
arthropods species and general arthropod diversity. The experiment had 10 treatments
arranged in a Randomized Complete Block Design with four replicates. Five of the
experimental plots were treated with ActaraTM 25WG to control general sucking pests
while the remaining five plots received no pesticide treatment. Water, sticky and
pitfall traps were set up in four stations across the field, each made up of 3 traps. The
results obtained from the trial revealed that the plots treated with ActaraTM 25WG had
a negative effect on the ladybird beetle population. The results obtained from this
study confirm that transgenic Bt-cotton enhanced population growth of non-target
beneficial arthropods and had no detrimental effect on general arthropod species
diversity and the environment.
Keywords: Bt-cotton, confined field trial, arthropods diversity
Introduction:
Since its introduction, Cotton (Gossypium hirstum L.) has been characterized by
fluctuating production trends. Between 1965 and 1984, the annual national lint
production grew from 20,000 to 70,000 bales and by mid-1990’s the lint production
declined to an average of 20,000 bales annually till 2004. This was far below the
country’s potential of about 300,000 bales annually. In 2006, the country produced
51,000 bales of lint (MOA, 2006). In Kenya, up to 4,345 kg ha¯¹ and 900 kg ha¯¹ of
seed cotton have been recorded in research centre and farmers fields respectively
(Ikitoo,et al., 1989). This wide yield difference is probably due to poor agronomic
practices, low soil fertility, rainfall patterns, diseases and arthropod pests (Munro,
1987, Ikitoo, et al., 1989). Pest management and its related activities account for
about 32% of the total cost of production. In Kenya, the major arthropod pests causing
§§§§§§We would like acknowledge, the Director KARI for granting us permission to conduct the the current study. The authors
would also like to thank Monsanto (K) Ltd for the funding of the project. Further thanks are extended to Delta and Pineland for
providing Bt-cotton seeds that were used in the experiments. Special thanks go to the Director ISAAA and Executive Director
ABSF for their financial and logistic support for advocacy. Special thanks go to the Members of Parliament who for two
occasions found time to visit the Confined Field Trial at KARI-Mwea We are grateful to the regulatory agencies KEPHIS and the
NBC who gave invaluable support. Finally, we acknowledge the logistical input of the Centre Director, KARI-Mwea and the
entire staff whose contribution made it possible to conduct the research and compile this report.
90
low yield and poor quality cotton include the African bollworm (Helicoverpa
armigera), cotton stainer (Dysdercus spp.), cotton aphid (Aphis gossypii) and cotton
red spider mite (RSM) (Tetranychus telarius).
The severity of damage on cotton crop by these pests depends on weather and control
methods applied on the earliest pests. African bollworm, Helicoverpa armigera is the
earliest and most important reproductive phase pest in cotton, appearing at the
squaring stage and causes up to 100% yield loss if unchecked (Waturu, 2001).
Intervention with synthetic pyrethroids often leads to a resurgence of aphid and mite
populations later in the season due to adverse effect of the synthetic pyrethroids on
natural enemies. One of the most important natural enemies of aphids and mites is
Ladybird, Chilomenes spp beetle (Family Coccinellidae) which comprises of a large
family of about 5000 species, mostly brightly coloured, of medium size and convex
shape. This family is of worldwide importance to agriculture because nearly all its
members are carnivorous and the majority of them predatory on two of the major
groups of plant pests, Aphididae and Coccoidea. The most common ladybirds to be
found among aphids in East Africa are the red, black and yellow Chilomenes spp.
(Muthamia, 1971, De Pury, 1974). In undisturbed environment the natural enemies
would contain the aphid and mite populations to non-damaging levels. An integrated
pest management (IPM) approach including chemical, cultural, biological and
resistant cultivars would be most ideal in managing cotton pests. Therefore, the
introduction of cotton cultivars resistant to damage by the African bollworm would
also indirectly impact positively on the management of the other important pests.
Transgenic cotton comprises of plants engineered to express toxins of Bacillus
thuringiensis (Bt) in order to protect them from key target insect pests. The
insecticidal proteins produced by Bt are toxic to major lepidopteran pests. When
incorporated into plants, Bt proteins are made much more persistent and effective. The
expression of Bt toxins in cotton plants can greatly reduce the need for application of
broad-spectrum insecticides. Bt-cotton is one of the insecticidal plants approved for
commercial production and its adoption has been rapid in the United States of
America (USA), Australia, China (Shelton et al., 2000) and South Africa in 1998
(Bennett et al., 2000), greatly reducing insecticide dependence in these countries.
Work done by US Environmental Protection Agency (EPA) reveal that Bt endotoxins
have no adverse effect on birds, fish, honey bees, ladybugs, parasitic wasps,
lacewings, springtails, aquatic invertebrates and earthworms (EPA, 1995). The study
concluded that there were no adverse effects to humans, non-target organisms or the
environment. Since registration, reports have indicated that consumption of corn
pollen by lacewing larvae has a detrimental effects on the development and mortality
of this important biological agent. This has created a discussion focusing on the
compatibility of Bt plants and biological control (Hilbeck et al., 1998a). Hilbeck et al.
(1998a) reported increased mortality and prolonged development when lacewing
larvae were reared on either the European corn borer (ECB) or Spodoptera littoralis
that had ingested corn leaves expressing Cry1 Ab. Cannon (2000) reported that the
use Bt- maize and cotton reduced need for pesticide application and significantly
increase yields and profits. In the current study, Bt-cotton is expected to reduce the
use of synthetic pesticides and hence increase the activity of natural enemies (Waturu,
et al. 2007). On the other hand, a baseline survey to determine the diversity of
arthropod species before the introduction of transgenic Bt-cotton was conducted in
Kirinyaga, Meru, Kitui and Malindi districts. Arthropod Orders recorded from cotton
91
ecosystems in these areas using pitfall, sticky and water traps include; Hymenoptera,
Coleoptera, Homoptera, Isoptera, Lepidoptera, Neuroptera, Acarina, Hemiptera,
Diptera, Orthoptera and Thysanoptera (Ngari, et al. 2003).
The objective of the current work was to establish the effect of transgenic Bt-cotton
on general non-target arthropods species. To meet the objective, the trial was divided
into 2 categories namely, the assessment of the effect of transgenic Bt-cotton on non –
target arthropods and determination of the effect of transgenic Bt-cotton on general
arthropod species diversity in a cotton ecosystem.
Materials and Methods:
Efficacy of Bt-cotton on beneficial arthropod
An experiment to establish the efficacy of transgenic Bt-cotton on non-target
arthropod pests and their natural enemies was conducted in a confined field at KARIMwea during the 2005-2006 cotton growing season. Cotton varieties namely,
transgenic Bt-cotton varieties DP 448B and DP 404BG, isolines DP 4049 and DP
5415 and commercial variety HART 89M were planted in 7cm deep holes. Six seeds
were planted in each hole at a spacing of 30 cm within rows and 100 cm between
rows, the crop was planted in plots measuring 5 by 5 m and arranged in a Randomized
Complete Block Design (RCBD) with 4 replicates. The ten treatments which included
treated and untreated plots were separated by 2 m paths between blocks and 1 m path
between plots. The crop was grown both under furrow irrigation and rain fed
conditions using the currently recommended agronomic practices. Cotton pests and
their natural enemies were allowed to establish on the crop naturally. To avoid bias
during data collection, all the treatments were denoted with letter codes written on
metallic labels and placed in each plot. The experimental treatment details were as
shown in Table 1 below:
Table 1:
Treatment
Code
Details
Treatment Plots
A
DP 448B
Untreated
4A, 20A, 25A, 37A
B
DP 448B
*Treated 6 times for sucking pests
10B,11B, 24B, 39B
C
DP 404BG
Untreated
8C, 13C, 30C, 36C
D
DP 404BG
6D,14D,29D, 32D
E
DP 5415
Untreated
1E, 12E, 26E, 38E
F
DP 5415
3F, 16F, 22F, 34F
G
DP 4049
Untreated
2G, 17G, 28G, 31G
H
DP 4049
7H, 15H, 21H, 33H
I
HART 89M
Untreated
5I, 19I, 27I, 35I
J
HART 89M
9J, 18J, 23J, 40J
*Treated - Denotes the plots sprayed with Actara TM 25WG
Thiamethoxam (Actara TM 25WG).
Actara TM 25WG was used in the trial to control general sucking pests. It is a broad
spectrum insecticide used as a foliar and soil drench. The product as described by
Hoppe, 1998, do not control the African bollworm which was the target arthropod in
this particular experiment. In the entire experimental period six foliar applications
90
were made on weekly basis starting from 10 weeks after crop emergence using a 15 L
(Solo) knapsack sprayer fitted with a hollow cone nozzle set at a spray pressure of 4
bar. To assess the effect of Bt cotton on non-target arthropod species, 10 plants were
randomly selected in each plot from 3 central rows. The number of beneficial
arthropods namely, ladybird beetles, syrphid, spiders, parasitic wasps, ants and
African bees per plant were recorded according to plots. During sampling the
numbers of beneficial arthropods per plant were counted every week and their
numbers recorded according to treatments. The data of arthropod species on each of
the sampled plants were recorded on data sheets which were earlier designed for the
current work. The collected data was transformed using √x+1, where x = number of
arthropod species per plant (Montgomery, 1976) and subjected to 2-way analysis of
variance(ANOVA) and statistical mean separation to determine the effect of different
treatments was done by Student Newman Keuls (SNK) test using SAS statistical
package.
Assessment of general arthropod species
To assess the effect of transgenic Bt-cotton on general arthropod species diversity,
three different types of traps namely water trap, sticky trap and pitfall trap were set
diagonally across the entire CFT site. The traps were arranged in four stations set
across the field where a station comprised of 3 sets of traps including one water trap,
one sticky trap and one pitfall trap all set similarly in each station. Water traps
comprised of a green plastic basin containing an aqueous solution of one litre of
preservative Formaldehyde 4% and 50 ml of detergent (Teepol) positioned 1.5 m
above the ground. The stick traps were made of a clear glass pane (15 x 15 cm) coated
on one side with grease and positioned 1.5m above the ground. The pitfall traps were
made of a plastic cup of diameter 10 cm and a depth of 10 cm. The cup was fitted
into a hole in the ground such that the tip of the cup was level with the ground
surface. To preserve the arthropods, 250 ml of aqueous solution of Formaldehyde 4%
was put in a cup while 20 ml of (Teepol) detergent was added to break the surface
tension of the preservative solution. A 15 x 15 cm metal cover was placed above each
trap supported by wooden stands to prevent entry of rain water, reduce evaporation
and prevent vertebrates from falling into the trap. After setting all the 3 different types
of traps, different types of arthropods within the confined field trial cotton ecosystem
were trapped on weekly basis for one month. The trapped arthropods were preserved
in 70% alcohol and were submitted to KARI-Kabete laboratory for identification.
Voucher specimens of each of the various taxa identified were preserved at KARIKabete and KARI-Mwea for future reference.
Results and Discussion:
Beneficial arthropods
The results of the effect of transgenic Bt-cotton against beneficial arthropods are
presented in Table 2. Beneficial arthropods encountered in the CFT included the
ladybird beetles, bees, ants, spiders and syrphids. Mummified (parasitized) aphids
were also considered. Differences between treatments for mean counts of the ladybird
beetle were highly significant (p<0.0001). Significant differences between treatments
were observed mainly between the sprayed and unsprayed treatments for the ladybird
beetle confirming that the differences were as a result of the treatment with Actara TM
25WG and not the transgenic Bt-cotton. Significantly higher mean counts of the
90
ladybird beetle were recorded in the un-sprayed treatments of the Bt-cotton, isolines
and the commercial variety HART 89M than the sprayed which had lower mean
counts of the ladybird beetle. The mean counts of the bees, ants, spiders, syrphids and
mummified aphids did not show significant differences.
Effect of transgenic Bt-cotton on general arthropod species diversity
The results on arthropod species diversity in the CFT are presented in Table 4 below.
Table 4: Arthropod diversity within the CFT
Order
Hymenoptera
Family
Fomicidae
Common name
Ants
Coleoptera
Staphylinidae
Rove beetles
Coleoptera
Coccinellidae
Ladybird beetles
Homoptera
Aphididae
Aphid
Lepidoptera
Noctuidae
Moths
Neuroptera
Chrysopidae
Lacewings
Acarina
Tetranychidae
Mites
Hemiptera
Phyrochorridae
Stainers
Diptera
Syphididae
Syphids
Orthoptera
Tetigoniidae
Longhorn grasshoppers
Hymenoptera
Scoliidae
Scoliids
Hymenoptera
Scelionidae
Scelionids
Hemiptera
Cercopidae
Spittle bugs
Coleoptera
Geotrupidae
Dung beetles
Coleoptera
Tenebrionidae
Darkling beetles
Hemiptera
Cydinidae
Stone /dead leaves bug
Hemiptera
Reduvidae
Sting bugs
Coleoptera
Rutelidae
Root feeding beetles
Diptera
Muscidae
House flies
Hymenoptera
Ichneumonidae
Ichneumonid wasp
Hymenoptera
Vespidae
True wasp
Diptera
Sacrophagidae
Biting flies
Hymenoptera
Scoliidae
Parasitic wasp
Hemiptera
Coreidae
Coreid bugs
Diptera
Tabanidae
Biting flies
Thysanoptera
Thripidae
Thrips
The arthropods captured in the pitfall, sticky and water traps included members of the
Orders Hymenoptera, Coleoptera, Homoptera, Lepidoptera, Neuroptera, Acarina,
91
Hemiptera, Diptera, Orthoptera and Thysanoptera. The species diversity fall within
the diversity recorded during the baseline survey before introduction of transgenic Btcotton as reported by (Ngari, et al., 2003). The results obtained from the current work
reveal that transgenic Bt-cotton has no significant effect on non target cotton pests and
other arthropod species studied. It was obvious that the pesticide Actara TM 25WG
had a negative effect on the populations of the non-target pests and beneficial
arthropods as exemplified by significantly lower mean counts of the aphids and
ladybird beetle in the sprayed treatments. However, transgenic Bt-cotton had no
significant effect on the populations of the non-target arthropods as compared to the
isolines and the commercial variety HART 89M. The noticeable effect of Actara TM
25WG on the ladybird beetle and not on the other beneficial species may be due to the
fact that all the developmental stages of ladybird beetle are always found on the
cotton foliage where they feed on aphids. On the other hand the larval stage is highly
mobile increasing chances of coming into contact with the pesticide. The ants, bees
and the parasitic wasps visit the plants occasionally reducing the chances of being in
contact with pesticides. The syrphid larvae is found on the underside of the leaves and
its mobility is limited reducing its chances of getting into contact with the pesticide.
The species diversity falls within the diversity established in the baseline study
conducted before the introduction of the transgenic Bt-cotton.
Conclusion
The results obtained from the current work reveal that transgenic Bt-cotton varieties
DP 448B and DP 404 BG had no negative effect on the populations of general
arthropods species diversity. However, Actara TM 25WG which is a synthetic
pesticide reduced the population of the ladybird beetles where it was applied on the
transgenic Bt-cotton and non- transgenic Bt-cotton. Results from the reported study
show that, in the absence of pesticides, transgenic Bt-cotton varieties DP 448B and
DP 404BG have no negative effect on the common natural enemies of major pests of
cotton, but rather enhance the population growth of beneficial arthropod species. The
results obtained in the current study are similar to those obtained by EPA, (1995), in
that Bt-cotton had no adverse effect on honey bees, ladybugs, parasitic wasps and
lacewings.
The results obtained from the current work reveal that transgenic Bt-cotton varieties
DP 448B and DP 404 BG had no significant effect on beneficial arthropods. From the
results of the reported study, it can be concluded that transgenic Bt-cotton varieties
DP 448B and DP 404BG have no negative effect on non target arthropods in the
cotton ecosystem, but rather enhance their population growth in the absence of
pesticides which have a negative impact on the populations. The arthropod catches
from pitfall, sticky and water traps show that the transgenic Bt-cotton had no
significant effect on general non-target arthropod species diversity. This is supported
by the fact that arthropod orders recorded after the introduction of the transgenic Btcotton in the confined field trials were not significantly different from those recorded
during the baseline survey ( Ngari, et al., 2003).
90
References:
Bennett R., Buthelezi, T.J., Ismael, Y. and Morse, S. (2003). Bt-cotton, pesticides
labour and health: A case study of smallholder farmers in the Makhathini
Flats, Republic of South Africa. Outlook on Agriculture, 32(2), 123-128.
Cannon R.J.C. (2000). Bt transgenic crops: risks and benefits. Integrated Pest
Management Reviews. 5 (3), 151-173.
Daily Nation, (2005). Revive cotton farming says World Bank study Article by
Geoffrey Irungu, Daily Nation of 19th October 2005.
DePury J.M.S. (1974). Predators. Ladybirds. In crop pests of East Africa. Pp159.
EPA (Environmental Protection Agency) (1995). Bacillus thuringiensis
CryIA(b) delta 39 Field Evaluation of Transgenic Bt cotton endotoxin and the
genetic material necessary for its production (plasmid vector PCIB4431) in
corn. Pesticide Fact Sheet (unnumbered). EPA, Washington, DC.
Hilbeck A., Baumgaertner M., Freid P.M. and Bigler F. (1998a). Effects of Bacillus
thuringiensis corn-fed prey on mortality and development time of immature
Chrysoperla carnae. Environ. Entomol. 27, 480-87.
Ikitoo E.C., Onzere B.B., Karani E.W. and Maobe S.N. (1989). Cotton agronomy
research in Eastern Kenya and Kerio valley. In KARI-NFRC Annual Report
pp.23-35.
Luttrell R.G., Fitt G.P., Ramalho F.S. and Sugonyaev E.S. (1994). Cotton pest
management. Annu. Rev. Entomol. 39:517-91 Management of Helicoverpa
armigera resistance to transgenic Bt-cotton in Northern China. Res. Pest
Manag. Newsl. 11 (1), 28-31
MOA ,(2006). Ministry of Agriculture, Production Statistics,2006.
Muthamia J.B. (1971). Cotton pests and their control. Entomology section, Kenya.
Ngari B.M., Waturu C.N., Nzeve D.N., Kagito S.K., Njeru C.T., Kilii G.K. and Omari
B.K. (2003). Characterisation and quantification of arthropods in cotton production
systems in Central, Eastern and Coastal regions of Kenya. KARI- Mwea, Ann.
Report, 2003., pp 98-115.
Parker C.D. Jr. and Luttrell R.G. (1998). Oviposition of tobacco budworm
(Lepidoptera: Noctuidae) in mixed plantings of non-transgenic and transgenic
cottons expressing delta-endotoxin protein of Bacillus thuringiensis (Berliner).
Southwestern-Entomologiest, 23: 3, 247-257; 26.
Terer J. (1999). Policy and legal framework for cotton revitalisation. Keynote address
41
Field Evaluation of Transgenic Bt cotton by the Permanent Secretary, Ministry of
90
Agriculture. Proceedings of stakeholders' workshop on cotton research and
development. Nakuru. 24 May 1999.
Waturu C.N. (2001). Role of KARI in enhancing cotton production in Kenya through
biotechnology. Opportunities for reviving cotton industry in East Africa
through biotechnology. Proceedings of the cotton stakeholders meeting.
Nairobi, Kenya.
Waturu C.N., Kambo C.M., Ngigi R.G. and Muthoka N.M.(2007). Field evaluation of
transgenic Bt-cotton varieties DP 448B and DP 404BG for efficacy on target
and non-target pests and environmental impact. KARI – Cotton Research
Centre, pp. 20.
91
Table 2: Effect of transgenic Bt-cotton on beneficial arthropods in the cotton
ecosystem
Treatment Ladybird
Bees
Mummified Ants
Spiders
Syrphids
beetles
aphids
DP 448B 5.78±0.44ab 3.86±0.18a 4.27±0.65a 2.33±0.72a 3.19±0.67a 1.35±0.24a
(14.00)
(18.50)
(6.00)
(10.50)
(1.00)
\Untreated (33.00)
DP 448B 2.87±0.32c 3.18±0.22a 4.02±0.18a 1.68±0.47a 3.33±0.37a 1.18±0.18a
(9.25)
(15.25)
(2.50)
(10.50)
(0.50)
Treated
(7.50)
DP 404BG 5.03±0.29ab 2.95±0.33a 4.68±0.36a 1.64±0.43a 3.22±0.23a 1.66±0.28a
(8.00)
(21.25)
(2.25)
(9.50)
(2.00)
Untreated
(24.50)
DP 404BG 3.19±0.33c 2.91±0.11a 4.53±0.57a 1.54±0.22a 3.20±0.31a 1.25±0.25a
(7.50)
(20.50)
(1.50)
(9.50)
(0.75)
Treated
(9.50)
DP 5415
4.56±0.48b 2.68±0.34a 5.07±0.32a 1.64±0.14a 3.75±0.39a 1.49±0.30a
(6.50)
(25.00)
(1.75)
(13.50)
(1.50)
Untreated
(20.50)
DP 5415 2.82±0.30c 3.16±0.30a 5.65±0.59a 1.54±0.22a 3.49±0.67a 1.29±0.18a
(9.25)
(32.00)
(1.50)
(12.50)
(0.75)
Treated
(7.25)
DP 4049
5.45±0.34ab 2.94±0.35a 5.72±0.88a 1.41±0.29a 3.25±0.26a 1.62±0.21a
(8.00)
(34.00)
(1.25)
(9.75)
(1.75)
Untreated
(29.00)
DP 4049 3.50±0.07c 2.93±0.37a 6.43±0.47a 1.72±0.12a 3.46±0.43a 1.10±0.10a
(8.00)
(41.00)
(2.00)
(11.50)
(0.25)
Treated
(11.25)
HART
6.00±0.51a 2.98±0.46a 6.93±0.63a 1.97±0.20a 3.13±0.27a 1.49±0.08a
(8.50)
(48.00)
(3.00)
(9.00)
(1.25)
89M
(35.75)
Untreated
HART
2.61±0.39c 2.95±0.43a 5.82±1.02a 1.99±0.30a 3.26±0.21a 1.10±0.10a
(8.25)
(36.00)
(3.25)
(9.75)
(0.25)
89M
(6.25)
Treated
CV
15.52
20.11
23.63
30.46
17.40
21.05
P-Value
<0.0001
0.4231
0.0438
0.4117
0.9114
0.0730
Means in the same column followed by the same letter are not significantly different,
SNK test at p=0.05. Figures in parenthesis denote actual insect numbers
92
The Effect of Various Densities on Growth, Yield; Yield Components
of Three Soybeans [Glycine Max (L.)Merr.] Cultivars in Kermanshah
Province
Keyvan shamsi1,,3,Sohil Kobraee2, Hamid Mehrpanah2
1
-Islamic Azad University.Kermanshah Branch.Iran and Yerevan State
University.Armenia
2
--Islamic Azad University.Kermanshah Branch.Iran and Agrarian State
University.Armenia
3
Keyvan Shamsi. Department of Agronomy and plant breeding.I slamic Azad
University.PoBox 67155-1774. Baghe nai street. Kermanshah. Iran. Phone :
98-831-8247901 fax : 98-831-8237775 Email : shams 2 _k@yahoo.com
Abstract
To study the effect of different densities on growth yield and its components, of three
varieties of soybean, an experiment was planted at Mahidasht and Kermanshah
Agricultural Research Center in the year 2002. The experiment was laid out as in a
factorial manner in a random complete block design of four replications. Varieties
were planted as blocks at three levels which included Williams, Zan, and Clark
cultivars whereas density as the second factor was included in the blocks at three
levels of three (D1), five (D2) and seven (D3) cm row spacing. According to the
results, Clark variety gave the highest dry weight Comparison of dry material trend at
different densities indicated that with increasing density, dry weight decreased. On
the other hand, leaf area index in different densities increased with increasing density.
Crop Growth Rate (CGR) increased slightly with increase in density. In this study,
increasing, density increase increased a number of agronomic characteristics namely;
plant height; inter node length; the number of nodes in main branch; the number of
grain in pod in plant, grain yield and biological yield performance. The percentages of
protein and oil, harvest index, 100-grain weight on the main branch and sub branch
and plant and the number of grains were not affected by plant density. In summary,
treatment V1D1 gave the highest grain yield.
Key words: planting density .variety .yield .yield components.
Introduction
Producing sufficient food stuffs is considered as one of the most momentous human
issues in today's globe. In many developing countries produced food does not suffice
consumption; so it will find larger dimensions again in future, as projected. Studies
show that 90% calori and 80% protein needed for human are directly supplied by
plant sources. In this sense, oily grains are important as one of momentous crops with
their various products to supply a part of human community needs. Among oily
grains, soybean plays an important role to provide calori and protein needed for
humans. Soybean importance in agriculture industry relies on much oil (20%) and
plenty of protein (40%) of grains. (1). Given to studies previously performed, planting
density seems to have meaningful effects on, as one of important agromomical
factors, the growth process, yield components, and ultimately on the yield of different
soybean cultivars. Amony these studies we can point to experiments by Majidi, (5)
Egli, (8) Taqizade. (2) These researchers believe that although yield components per
93
plant decreases with increase of planting density, reduction of yield components can
be compensated by rising number of plants per area unit; there fore, the yield
increases.
This experiment was carried out on Mahidasht research field, Kermanshah, on May
2000. To perform this research, factorial test was employed in the form of complete
random blocks layout with 4 repeats in which cultivar factor at3 levels including
Williams (V1), Zan (V2), Clark (V3) and density factor at 3 levels including 3 spacings
of plants on rows (D1) 3 cm, (D2) 5 cm, (D3) 7 cm were examined. Thus, the
experiment contained 9 treatments placed on 36 test plots. Storage operations were
timely and ordinarily done such as campaign against pests and diseases, fertilization,
weeding and campaign against weeds, and irrigation. To investigate soybean cultivars
growth process at various desities, sampling was conducted one time on every 16th
day that is, 20 days after planting to physiological maturity (R8) Sampling area on
each plot was 0.3 m2. Plants were harvested by shears from soil surface. Having
measured leaf area, we attempted to isolate various parts of any plants and noted dry
weights of any one separately.
An area equal to 3.6m2 was removed from midst of all plots with eliminating two
marginal rows and 1.5 m from ends of rows in order to calculate final yield, biological
yield as well as harvest index.Also, in order to access to yield components at final
harvesting time, 5 plants were randomly taken out from the harvesting area of any
plots and specifications as well as morphological parameters were measured and
recorded for each plant. Analyzing data variances was performed based on factorial
test in the shape of complete random blocks layout.Duncan method was employed to
compare averages, and Harvard GRAPHIC, STATG, MSTATC programs were used
to analyze statistical data.
To study changes of dry weight (1) and leaf area index,(2) mathematical equations
with different degrees were used, but the best equation obtained was quadratic, as
follow : y = Exp (a + bx + cx2). Results showed that dry weight of plant shoots
decreased with increase of density so that the minimal accumulation of total dry
matter of plant was observed with density D1. On the other hand, with increasing the
density, leaf area index rised and the greatest leaf area index pertained to density D1
among different densities. Among various cultivars, Clark enjoyed the largest rates of
dry weight of shoots and leaf area index. This cultivar possesses maximum duration
of leaf area. Shibles et al. (11), Paruez et al. (10), and Ganjali (4) have reported
similar results during their experiments. For cultivars V1 and V3, crop growth speed
was nearly the same and equal, but V3 reached maximal quantity of CGR with more
time lag from planting. For all cultivars, crop growth speed became negative at the
end of growth season due to leaves shedding and consequent reduction of dry matter
accumulation. Among different densities, D2 had the most and D3 had the teast CGR.
In this experiment, enhancement of density from D3 to D2 caused CGR to increase but
with further increase in density the quantity of CGR decreased slightly.
90
The results of comparing the changes trend of RGR showed that Williams cultivar
among others and density D3 possessed maximum quantity of RGR. RGR quantity
was lower and its reduction trend was faster for D1 compared to 2 other densities.
Enyi (7) and Shojaii Noferest (3) also reported that with increase in density, the
amount of RGR is reduced so that they measured the highest and lowest amounts of
RGR in minimum density and maximum density, respectively.
The experimental results also show that with increase in density following items are
enhanced: plant height, spacing of the formation of the first subbranch from soil
surface, the length of mid nod us, the number of gnarls on major stem, the number of
grains per pod per sub-branches per plants, grain yield per area unit and physiological
yield; and following items are reduced : the number of sub- branches, the number of
gnarls per sub-branches per plants, the number of pods per sub-branches per plants,
the number of grains per sub-branches per plants, grain dry weight per sub-branches
per plants. In this experiment, protein percentage; oil percentage harvest index ; 100grain weight per major branches, per sub-branches, and per plants ; the number of
grains per pods on major- sub- branch were not affected by planting density. These
results show some features are further affected by genetic factors rather than
environmental factors. For low densities, the number of sub-branches and hence their
shares per yield are raised due to less competition.
But in any case and according to obtained equations, the most significant components
of the yield entered the model before others were the number of plants per area unit
and the number of nodes per plants. Leumman and Lambert (9) have tested the effect
of density on the yield and its components at row spacing of 50, 100 cm and planting
spacing on rows of 7.5, 3.75, 1.87, 1.25 cm and concluded that with an increase in
density higher yields are obtained while the number of sub-branches and the number
of pods per plant are reduced. Also, Ablett et al. (6) suggested that soybean yield
components are reduced with an increase in density.During his experiment, Majidi (5)
stated that although reduction of planting density could improve grain yield per plant,
it failed to compensate yield reduction caused by deficiency of plants per area unit.
Conclusions
The results of this research ultimately showed that among different treatments,V1D1
treatment (Williams cultivar and 3 cm plant spacing on row) produces the highest
yield per area unit.Williams cultivar had the largest spacing of formation of the first
sub-branch from soil surface, on the other hand, which can facilitate its mechanized
harvesting. It also had higher harvest index in comparison with other cultivars.
Reduction of yield components is compensated by increasing the plants per area unit;
therefore, the yield increases, although with high densities the enhancement of density
leads to the reduction of yield components per plant style.
91
References
Alyari. H, Shekari, F. 1998. "Oily grains" (phyisoagro). Amidi press.
Ta Qizade. M 1992. "Evaluating the effects of different seed to plant density ratios in
mixed farming on the yield, its components, and qualitative specifications of
soybean cultivars". Thesis of agronomy MS. Ferdawsi university of Mashhad.
Iran.
Shojaii No ferest. K, 1993. "Studying the effects of plant density on physiological
properties, of water use efficiency, grain yield and its components of two
limited unlimited growth soybean cultivars." Thesis of agronomy MS.
Agriculture college of Esfahan industrial university. Iran.
Ganjali, A. 1992. "Examining the effects of different plant density patterns on
soybean yield and photosynthetic potential in Karaj region". Thesis of
agronomy MS. Tehran teacher training university. Iran.
Majidi, Ganjali. A. 1997. "The effects of planting and plant density patterns on the
yield, its components, and superficial features of soybean Williams cultivar in
Karaj". Magazine of sapling and seed. No2, 15th pp 142-155 year. Iran.
ablett, G. R. G. C. Schleihauf, and A. D. Maclaren. 1984. Effect of row width and
population on soybean yield in south western Ontario. Can. J. Ptant Sci. 64 : 915.
Enyi, B. A. C. 1973. Effect to plant population on growth and yield of soybean
(Glycin Max). J. Agric. Sci. Carb. 81 : 130-138.
Egli, D. B. 1988. Plant density and soybean yield. Crop Sci. 28 : 977- 981.
Lehman, W.F., and J. W. Lambert. 1960. Effect of spacing of soybean plant between
and within rows on yield and its components. Agron., 52 : 84- 86.
Paruez, A. Q. F. P. Gardner. And K. J. Boote. 1989. Determinate and indeterminate
type soybean cultivar responses to pattern, density and planting date. Crop Sci.
22: 150-157.
Shibles, R., I. C. Anderson., and A. H. Gibson. 1975. Soybean p. 151-190. int. evans
(ed). Crop physiology. Cambridge university press, Cambridge.
90
The Ecosystem Services Concept Provides a Conceptual Basis for
Biosafety Tests of Genetically Manipulated Plants in the Developing
Countries
Gábor L. Lövei1, Jenesio I. KINYAMARIO2
1
Faculty of Agricultural Sciences, University of Aarhus, Flakkebjerg Research
Centre,
DK-4200 Slagelse, Denmark; 2School of Biological Sciences, University of
Nairobi,
P.O. Box 30197-00100, Nairobi, Kenya.
Corresponding Author: Jenesio I. Kinyamario (jkinyamario@yahoo.com;
jenesiok@uonbi.ac.ke)
Abstract
Many farmers in the developing countries are vulnerable to natural agents and the
importance of natural factors. New technologies can have significant impact on
natural ecosystem processes and because of humankind’s large impact on all
ecosystems, a special focus should be on the environmental impact of any new
technology. The ecosystem services concept provides a framework for GMO
environmental impact assessment and should be used when developing biosafety
testing procedures in the developing countries. For pre-release biosafety tests, suitable
organisms have to be selected and the impact of GM plants on ecosystem services
need to be evaluated. This is, however, compounded by a knowledge impediment,
because those ecosystems are less well known than similar ones in developed
countries. The BiosafeTrain Project is active in developing practical methods for
ecological impact assessment in East Africa, through infrastructural developments,
and specialist training.
Keywords: biosafety, ecosystem services, environmental impact assessment,
transgenic crops
Introduction
The risks and overall impact of genetic engineering is complex bearing in mind that
genetic engineering introduces new combinations of genes that may irreversibly be a
part of future evolution, and affect the environment and biodiversity. Genetically
modified (GM) crops have been commercially grown now for about 10 years. The
reliance on natural agents and the importance of natural factors: rainfall, natural soil
fertility, natural pest and pathogen control, pollination is higher in developing
countries than developed countries. Therefore, agricultural productivity in developing
countries more profoundly depends on ecosystem services than in the developed
countries. Added to this is that a) biodiversity is important asset in tropical countries,
b) agriculture is significant at several levels of society and economy. We therefore
need to ask ourselves: what is the potential environmental impact of GMOs on
biodiversity and ecosystem services which are so important to our basic survival in
developing countries? In this paper, we will explore the concept of ecosystem
services, how they can provide a framework for GMO environmental impact
assessment and can be used when developing biosafety testing procedures in the
91
developing countries. Recent assessments (Millennium Ecosystem Assessment
(MEA) 2005) have shown that mankind’s total impact on ecosystem services from
previous introductions of new technologies has been substantial (and include habitat
destruction, introduction of exotic species, chemical pollution, and global warming,
all of which, in themselves and in combination, not only lead to loss of biodiversity,
but also to substantial pressure on all kinds of ecosystems services).
Why ecosystem services?
Ecosystem services are ecological processes that cannot be replaced by current
technologies which operate on vast scales from which we derive substantial benefits.
These services include production of goods such as fish and timber, generation of
soils and maintenance of soil fertility, decomposition, detoxification of wastes, clean
environments, mitigation of climatic extremes, biological control of potential pests,
weeds and pathogens, and crop pollination. Though ecosystem services were treated
as inexhaustible, high increases in human populations and their use of natural
resources have reached a point where ecosystem services now show clear signs of
strain.
Modern Agriculture
Agriculture is a human activity with a huge “ecological footprint” (Wackernagel and
Rees 1997), and has a crucial role in global ecology, especially in driving many
aspects of environmental quality. Due to this, agricultural activities impact heavily on
ecosystem services, in terms of pesticides, carbon and water balances, changes in
natural biodiversity including plants, animals and microbes, etc.
Ecosystem services
Ecosystem services are ecological processes beneficial to humankind and are
irreplaceable with current technologies. They ensure agricultural productivity,
including soil formation, decomposition of plant residues, pollination, and natural pest
control. They also include removal of waste products through detoxification,
decomposition, air and water purification; contain numerous valuables to humans and
human culture; provision of aesthetic beauty, cultural and spiritual inspiration,
scientific discovery, and recreation. We have to consider these services in any GM
plants impact assessments. Hence, GM crops and their potential impact on ecosystem
services must be tested for any negative impacts (Lövei 2001). Modern high-input
agricultural practices use several external inputs that at least partially replace
ecosystem services (fertilizers, pesticides, irrigation, and even pollination) but these
external inputs are often not available to farmers in many developing countries, hence
these farmers have to rely more on natural ecosystem services. Since GM crops will
be grown outdoors, in contact with surrounding ecosystems, and they certainly have
the potential to substantially modify current agricultural practices (Hawes et al. 2003),
their impacts on ecosystem services will have to be examined thoroughly and
critically (Hails 2002).
90
Incorporating ecosystem services into risk/impact assessment
Including ecosystem services into a GMO risk/impact assessment posses several
fundamental challenges: structure and function in relevant ecosystems and food-webs
have to be recognized, e.g. predator-prey relationships that keep a number of pests
under control and also where productivity may depend on insect pollination services
(e.g. cotton); significant functional links must be established where structure and
function are reasonably well understood, for example it may turn out that pollination
is much more significant than pest control for productivity in the ecosystem where a
GM crop is to be introduced. Most important species fulfilling identified relevant
ecological roles that should be subjected to pre-release testing have to be identified
without forgetting that even the most important functions will typically be performed
by numerous species, for example pollination services may be provided by more than
30 insect species, but the most important could be just one, or a handful of them.
Pre-release testing should focus on these functionally important species and when
such species are identified, suitable testing and monitoring methods must be
developed for them. If there is no option to identify species responsible for the
execution of important ecological services, for instance the case with most soil microorganisms, the relevant processes must be identified and a potential adverse impact of
the GMO tested. Where there may not be suitable laboratory systems or field
monitoring methods available for these functional processes, or such tools are lacking,
these should be developed.
Current regulatory regimes for GM Plants
Does the current regulatory testing actually address the issues of GMO impacts on
ecosystem services? Currently applicants applying for approval of GM plants follow
basic guidelines originally developed for testing the environmental effects of
pesticides or chemicals (pesticide model). The strategy used in ecotoxicology testing
of chemicals is to expose single species (standard set) to single chemicals in a
hierarchical tiered system. Tests commence with simple inexpensive range finding
tests on single species and measure acute toxicological response to a chemical
stressor. If first-tier experiments yield results of concern, that proceeds to more
expensive higher tiered levels (including some chronic toxicity tests). For example, in
the case of a GM plant producing the Bacillus thuringiensis toxin, microbially
produced Bt-toxins (Bt plant) are fed directly to testing organisms (bi-trophic
exposition) in an experimental set-up originally developed to assess acute toxicity of
synthetic chemicals. Acute toxicity measures the physiological toxicological response
of an organism after being directly exposed to the isolated test substance within a
short period of time (normally hours rather than days).
This pesticide model as a testing guideline for insecticidal GM plants is problematic
for a number of reasons. For one, plants are different from chemicals: In GM plants,
the plant-expressed transgene product is an integral component of the whole plant and
is expressed essentially in all plant parts throughout the entire growing season. It is
also coupled to its metabolism leading to variable expression levels of the transgene
product that is additionally modulated by environmental conditions, including
seasonal changes in temperature, soil type, moisture, and light. When compared with
pesticides, this is equivalent to a long persistence of the pesticidal substance and an
91
almost complete coverage of the plant. ii) The other fundamental difference to
chemicals is also that GM plants are capable of self-reproduction.
Because of this capability, biological traits and organisms can increase in the
environment and potentially spread and exist for unlimited time. In contrast,
chemicals cannot reproduce and, thus, their absolute amount will, at best (or worst),
remain stable for a long time, but over time will always decline. Most disappear due
to degradation. GMOs and their transgene products can actively spread. In addition,
all passive mechanisms of spread for chemicals also apply to transgene products
released into the environment from the living GM plants (e.g. exudates, leaching from
living and dead material). The potential of human-aided spread of seeds, plants and
animals should not be underestimated (Baskin 2002).
Table 1: Some standardized guidelines for ecotoxicological testing of pesticides and
GMOs (OECD 2006)
OECD
Durati
Test organism
Test method
Guideline
on
No.
Water fleas, Daphnia
Acute immobilization/toxicity 24-96h 202
Fish sp. (rainbow trout)
Acute toxicity
24-96h 203
Eisenia foetida (compost Acute toxicity
7-14d 207
worm)
Honey bees
Acute toxicity (oral and 4-24h 213 & 214
contact)
http: ecb.jr.it/testing-methods, www.oecd.org/dataoecd/9/11/33663321.pdf
It is therefore more difficult, if not impossible, to determine the exact exposure
concentrations in a given environmental compartment for GM plants as compared to
chemical toxins. In contrast, chemical pesticides applications in the field are
controlled by the applicator, including the timing, the point location, etc. Degradation
begins immediately after application and the mode of action is typically acute (also
affects non-target species). Therefore a scientifically sound testing strategy and
methodology for GM plants require case-specific risk assessment and must account
for the whole transgenic organism. It must also treat a GM plant within an integrated
biological system consisting of the plant, the novel trait and the receiving
environment.
Test organisms selection
Test organisms must be of same trophic levels because the test substance is often not
ingested directly by higher trophic level organisms but is ingested via one or several
intoxicated prey species. We know that persistent chemicals, such as DDT, can
accumulate and even become more toxic along the food chain, meaning that they can
reach concentrations and toxicity levels that, at the end of the food-chain, are multifold above the levels originally introduced into the ecosystem. Research on insectplant interactions has shown that insects can use toxic proteins in their host plants to
turn them into defence mechanisms against their enemies. For example, the monarch
butterfly (Danais plexippus) larvae accumulate an alkaloid from the host plant,
92
milkweed, which makes them unpalatable. It is not known how herbivore species,
which are not affected by novel transgene compounds, may be using them against
their enemies. These complications make it currently unlikely that a few selected
species could universally be used for pre-release risk assessment of GM plants.
Test materials
In toxicological and ecotoxicological testing of pesticidal GM plants, high
concentrations of the microbially produced transgene product, e.g. the Bt-toxin, are
applied. However, toxicity depends on the size of the Bt-toxin molecule released
after being cleaved by trypsin to create the toxic fragments of different size (Höfte
and Whiteley 1989; Müller-Cohn et al. 1996; Andow and Hilbeck 2004). This means
that the Bt-toxins expressed in GM plants may vary significantly in size and activity
from the test substances used to assess safety, i.e. in standard toxicological and
ecotoxicological testing. As we have pointed out earlier, a GM plant is not a chemical
and any environmental testing must therefore account for the difference.
Test strategies must be case-specific and should include the transgene product, the
transformed plant and the environment of deployment as an integrated system. This is
even more important in the case of GM plants that do not express a toxin, but have,
for example, an altered metabolism (e.g. herbicide tolerant plants). In these cases, the
adoption of test principles from chemical testing is even less relevant because
environmental effects of these GM plants may become evident on other levels
altogether. For pre-release biosafety tests, suitable organisms have to be selected and
the impact of GM plants on ecosystem services need to be evaluated. This is,
however, compounded by a knowledge impediment, because those ecosystems are
less well known than similar ones in developed countries.
A new approach for environmental impact testing
Conceptual frameworks on GM plant impact assessments have been proposed (see for
example Hill 2005). Hill correctly noted that the methodology was adapted from the
existing paradigm for environmental risk assessment, which was developed for
chemicals and other type of environmental stressors. This framework included 5
steps: Hazard identification, Exposure assessment, Consequences assessment, Risk
characterization, and Mitigation options (that fed back to previous steps). Conceptual
and methodological uncertainties of studying the ecological effects of GM crop plants
on non-target arthropods have raised several interesting general problems. In contrast
to toxicological and ecotoxicological methods for addressing these problems, assessment of the impacts of GM crop plants must be case specific and contextualized to the
environment in which they will be used. The approach should combine ideas and
methods from a “community approach”, which emphasizes analysis of intact
biodiversity, a “functional approach”, which emphasizes community reactions, a “key
species approach”, which emphasizes the individuality of species, and an “indicator
species approach”, which is central in ecotoxicological testing. The process should
rank and select species into functional groups (herbivores, decomposers, natural
enemies, and pollinators), and allow the identification and prioritization of non-target
species for some key ecological groups. It should also reflects the current state of
knowledge and expertise available, and identify gaps in knowledge and uncertainties.
90
The BiosafeTrain Project
This is a collaborative project between some key institutions of higher learning and
research in the three East African countries (Kenya, Uganda and Tanzania) and
Denmark funded by the Danish Government through DANIDA. These institutions
include the Kenya Agricultural Research Institute (KARI), the University of Nairobi,
the University of Dar es Salaam, Makerere University, the University of Copenhagen
and the University of Aarhus. The major objective of this project is to build capacity
in biosafety in East Africa through specialised training and infrastructural
development. The project targets training of students at postgraduate level (M.Sc. and
Ph.D.) as well as holding short courses for interested institutions in East Africa.
During the 1st Phase of the project running from 2005 to 2007, six and four students
were trained at M.Sc. and Ph.D. levels respectively. A similar number is targeted
during the 2nd Phase (2007 to 2010). The project also collaborates with African Union
and UNEP-GEF in offering specialised biosafety risk assessment seminars and
training workshops/courses to member countries and regions. Four training
workshops were held in East Africa and two in Eritrea and Mali (West Africa) under
this collaboration during the 1st Phase. We plan to hold more biosafety risk
assessment seminars and training during the 2nd Phase of the project.
References
Andow, D.A. and Hilbeck, A. (2004) Science-based risk assessment for non-target
effects of transgenic crops. Bioscience, 54: 637-649.
Baskin, Y. (2002) A plague of rats and rubber vines. Island Press, Washington, D.C.
330 pp.Bøhn, T. and Amundsen, P. A. (2004) Ecological interactions and
evolution: Forgotten parts of biodiversity? – Bioscience, 54: 804-805.
Hails, R.S. (2002) Assessing the risks associated with new agricultural practices.
Nature, 418, 685-688.
Harremoës, P., Gee, D., MacGarvin, M., Stirling, A., Keys, J., Wynne, B. and Guedes
Vaz, S. (2002): Late lessons from early warnings: the precautionary principle
1896-2000. – 22. – Copenhagen, Denmark (European Environment Agency):
211 S.
Hawes C., Haughton A.J., Osborne J.L., et al. (2003) Responses of plants and
invertebrate trophic groups to contrasting herbicide regimes in the Farm Scale
Evaluations of genetically modified herbicide-tolerant crops. Philosophical
Transactions of The Royal Society of London Series B-Biological Sciences,
358: 1899-1913.
Hill, R.A. (2005) Conceptualizing risk assessment methodology for genetically
modified organisms. Environ. Biosafety Research, 4: 67-70.
Höfte, H. and Whiteley, H.R. (1989) Insecticidal crystal proteins of Bacillus
thuringiensis. Microbiological Reviews, 53, 242-255.
91
Loreau, M., Naeem, S., Inchausti, P. (Eds.) (2002) Biodiversity and ecosystem
functioning. Oxford Univ. Press.
Lövei, G. L. (2001) Ecological risks and benefits of transgenic plants. New Zealand
Plant Protection, 54:93-100.
Lövei, G. L., Bøhn, T. And Hillbeck, A. (2007). Biodiversity, ecosystem services and
genetically modified organisms. Pp. 169-188. In Traavik, T. and Ching, L.L.
(Eds.) Biosafety First – holistic approaches to risk and uncertainty in
genetically engineering and genetically modified organisms. Tapir Academic
Press. Trondheim.
Millennium Ecosystem Assessment (MEA) (2005) Ecosystems and human wellbeing: our human planet. Island Press.
Müller-Cohn, J., Chaufaux, J., Buisson, Ch., Gilois, N., Sanchis, V. and Lereclus, D.
(1996) Spodoptera littoralis (Lepidoptera: Noctuidae) resistance to CryIC and
cross-resistance to other Bacillus thuringiensis crystal toxins. Journal of
Economic Entomology 89, 791-797.
Vitousek, P.M., D'Antonio, C.M., Loope, L.L., Rejmanek, M., and Westbrooks, R.
(1997) Introduced species: A significant component of human-caused global
change Nz J Ecol 21,1–16. Wackernagel, M., Rees, W.E. (1997) Perceptual
and structural barriers to investing in natural capital: economics from an
ecological footprint perspective, Ecol. Econ., 20:3–24.
Wackernagel, M., and Rees, W.E. (1997) Perceptual and structural barriers to
investing in natural capital: economics from an ecological footprint
perspective, Ecol. Econ., 20:3–24.
Wardle, D.A., and van der Putten, W.H. (2002) Biodiversity, ecosystem functioning
and above-ground/below-ground linkages. Pp 155-168 in: Loreau M, Naeem
S, Inchausti P. Eds., Biodiversity and ecosystem functioning. Oxford Univ.
Press
90
amygdalina Del.
Lewu FB1*, AJ Afolayan2
1. Department of Agriculture, University of Zululand, KwaDlangezwa, 3886,
South Africa. Address: Internal Box 56, Private Bag X1001, University of
Zululand, KwaDlangezwa, 3886, South Africa.Phone: Office: +2735
9026067Fax: +2735 9026056 Email: flewu@pan.uzulu.ac.za
2. Department of Botany, University of Fort Hare, Alice, 5700, South Africa.
Abstract
This study investigates the influence of hormones and temperature on the
micropropagation Vernonia amygdalina and further elucidates the importance of
transfer techniques in the overall survival of the planets Vernonia amygdalina. Due to
the recent discovery of the medicinal value of the herb by several communities in the
province, a high demand for the local use of the species has recently increased.
Increasing the production of V. amygdalina is faced by several challenges namely
limited rainfall, susceptiblity to frost, due to an annual phenomenon of the winter
season of the region. Limited populations of the species also constrained vegetative
propagation. Tissue culture propagation has been found to be an available tool to
increasing the population of this species. In our effort to increase the population of the
species within the province, a micropropagation approach through tissue culture
technology was employed.
Keywords: Hormones; Temperature; micropropagation; Vernonia amygdalina;
Eastern Cape medicinal vegetable
Introduction
Vernonia amygdalina Del. belongs to the plant family Compositae and it is a species
commonly consumed by West Africans as a vegetable and as a good source of
medicine to treat several diseases (Akinpelu, 1999; Masaba, 2000; Abosi, 2003;
Iwalokun et al., 2006). It is a tropical species found growing in several African
countries from West to Central Africa and in the tropical climates of Zimbabwe in
Southern Africa. In the Eastern Cape Province, V. amygdalina is used as a medicinal
plant for the treatment of diabetics (Erasto et al., 2005); a disease that has increased
steadily among black and India populations of South Africa within the last decade
(Omar et al., 1993; Erasmus et al., 2001). Due to the recent discovery of the medicinal
value of the vegetable by several communities in the province, a high demand for the
local use of the species has increased.
However, the Eastern Cape Province is characterized by limited rain fall and
prolonged winter season of over six months per annum. These critical climatic
conditions pose a great threat to the survival of V. amygdalina which is a tropical
species susceptible to frost, an annual phenomenon of the winter season of the Eastern
Cape Province of South Africa. Although, the species is cultivated through vegetative
propagation, this method is labour intensive and few propagules are produced from a
single stock plant. The limited populations of the species produced through this
method in the province, dieback during the winter period; there by making large scale
91
cultivation impossible. Tissue culture propagation has been found to be an available
tool to increasing the population of this herb. In our effort to increase the population
of the species within the province, a micropropagation approach through tissue culture
technology was employed.
Plant materials
The experiments were carried out in the phytomedicine laboratory of the Department
of Botany, University of Fort Hare, South Africa. Explants for this study were
collected from a vigorously growing healthy mother plant of V. amygdalina growing
in the medicinal garden of the Teaching and Research Farm of the University of Fort
Hare. Leaf and stem explants were collected and surface sterilized with 70% ethanol
for two minutes and shaked in 0.1% mercuric chloride for 5 minutes. The sterilized
explants were rinsed in several changes of double distilled sterile water. In order to
ensure efficient culturing, brown portions of the sterilized explants were removed
using sterile scalpel before culturing.
Callus induction
The callus induction medium contained Murashige and Skoog’s (1962) basal salts,
supplemented with 1.0 - 4.0 mg l–1 6-Benzylaminopurine (BA) or αNaphthaleneacetic acid (NAA), Na2EDTA (7.4g.l-1), myoinositol (20 g l-1), thiamineHCl (0.1 g l-1), 2.0 mg l–1 glycine, 690 mg l–1 proline, sucrose (30 g l-1) and was
solidified with 5 g l–1 Difco bacto-agar. The pH was adjusted to 5.8 and the media
were sterilized by autoclaving at 121°C for 20 min. All the explants were incubated
for callus induction in the media at 25 ±3°C under continuous illumination with a
photosynthetic photon flux density of 184.8 (±5) µmol m−2 s−1 provided by coolwhite fluorescent lamps. The same experiment was duplicated under continuous dark
condition in five replicates.
For each part of the plant samples used, thirty explants were inoculated per treatment
making a total of 60 samples for both light and dark experiments. Explants kept under
dark experiment produced both calli and prolific shoot organogenesis after 10 days in
induction medium. the percentage of explants producing primary calli were
determined, and the calli were then cut into smaller sizes and transferred to the same
medium for another one week under continuous light condition. Where calli were not
produced, the percentage of explants producing direct shoot organogenesis from stem
explants was also determined.
Shoot differentiation and micropropagation of plantlets
The basal composition of the subculture medium was the same as that of the induction
medium. Each callus was cut into smaller pieces (approximately 0.5g fresh weight)
during transfer and subcultured two times. The cultures were transferred onto fresh
subculture medium every week and were maintained at 25 ±3°C under continuous
illumination. After three weeks, the percentages of calli forming shoots were
recorded. Micropropagation of shoots was also conducted on plantlets to determine
the rate of direct shoot proliferation under different hormone concentrations.
90
At about 6 cm height and with nine visible leaves, plantlets with healthy looking roots
were removed from culture, rinsed in water (to remove media) and transplanted into a
mixture of equal parts (v/v) of sterilized soil and vermiculite. They were watered with
half-strength MS salts solution and acclimatized under 60 – 70% relative humidity in
plastic pots. The acclimatizing procedure was maintained under two day and night
temperature regimes of 15±3°C -10±3°C and 27±3°C - 23 ±3°C respectively.
Plantlets were transferred to the field after 21 days in glass chambers (Figure 3b)
Data analysis
The callus induction experiment was analyzed in a factorial pattern with hormones
and light condition being the main factors. Two hormones 6-Benzylaminopurine (BA)
and α-Naphthaleneacetic acid (NAA) at four levels each were tested under continuous
darkness and light conditions. The first data were analyzed using the proc GLM
model of SAS package in a factorial arrangement. Duncan multiple range test (P<
0.01) was used for multiple mean comparisons of the interactions between the
different levels of hormones used and the two photogenic conditions. In the second
experiment, the two hormones were analyzed at the four levels of concentration and
the mean separation was also conducted using Duncan multiple range test of SAS
package (SAS, 1999).
Result
Generally, callus formation and direct shoot organogenesis were more successful
under continuous dark than continuous light condition (Table 1 and Figure 1a). Most
of the samples obtained under continuous light showed necrotic condition and were
subsequently discarded. Explants used for further studies were obtained from samples
under continuous dark condition. The highest percentage production of callus was
formed in the medium containing 1 mg l–1 BA with a mean callus yield of 8.0
representing 26.7% of the explants tested. The same medium at the same
concentration also gave the best response to direct shoot organogenesis with a mean
of 17.80 explants representing 59.33% of the explants cultured. Increasing
concentration of the hormone above 1 mg l–1 showed progressive decrease in response
to callus formation (Table 1). This is also true for direct shoot organogenesis up to 3
mg l–1 with a significant increase of 8.6 (P< 0.01) explants at 4 mg l–1 (Table 1).
Direct shoot organogenesis was generally more successful with BA at 1 mg l–1 than
NAA and the result showed a sharp drop in response (from 1 mg l–1) with progressive
increase in the levels of concentration across both hormones used (Table 1).
Leaf explants generally showed poor response to callus formation and the friable calli
formed did not develop under continuous light condition. In the second experiment,
direct micropropagation of shoot in both hormones and the four levels of
concentration showed similar response as the callus induction study. Plantlets cultured
in 1 mg l–1 BA showed superior (91%) response to shoot organogenesis compared
with NAA and other concentrations used in the study (Table 2 and Figure 1b). The
micropropagation study did not show any distinct pattern of response to hormone
treatments above 1 mg l–1 BA. Except for 3 mg l–1 BA, all the other concentrations did
not show any significant (P< 0.01) difference in yield across both hormones used in
the experiment (Table 2). Over 90% of the plantlets produced a pair of long healthy
roots which gave the plantlets great opportunity for establishment during
91
acclimatization study (Figure 2a). Plantlets established under 27±3°C - 23 ±3°C
temperature regimes gave 82% rate of survival (Figure 2b and 3a) while those
transferred at lower temperature range of 15±3°C -10±3°C gave a significant (P<
0.01) low response of 19% rate of success. Plantlets were successfully established on
the farm with 100% survival rate (Figures 3b). In these experiments, BA generally
demonstrated the optimum hormonal condition for the micropropagation of V.
amygdalina under continuous darkness for callus induction and direct shoot
organogenesis, while direct micropropagation under continuous light condition at 1
mg l–1 BA showed the best result.
Discussion
Protocols for the induction of callogenesis and direct shoot regeneration have been
developed for V. amygdalina. BA generally showed good response to callus formation
in this species. With the result obtained from this study, it appears that callus
formation in this plant could be impaired from any concentration above 1 mg l–1 as the
explants produced limited number of callus above this concentration in BA medium.
This may be due to high physiological response of plants cells to cytokine growth
regulators (Torres, 1989). Cytokinins have been reported to stimulate shoot
proliferation in many species (Theim, 2001; Martinussen et al., 2004). The
physiological influence of BA on the callus formation and direct shoot organogenesis
of
the
herb
is
consistent
with
early
studies
on
other
species (Hussey, 1977; Glendon et al., 2007). The source of explants used determines
the relative success of most in vitro propagation protocols. Rapid multiplication of
this species using intact shoot was best on medium containing BA 1 mg l–1 compared
with leaf explant. This result is in conformity with early findings that the source of
explants determines the relative success of in vitro culture of several plant species
(Ziv and Lilien-Kipnis, 2000; Nhut et al., 2004).
Micropropagation techniques have been fund to be one of the cheapest and more
successful available tools for the rapid multiplication of threatened or endangered
plant species (Castillo and Jordan, 1997; Saxena et al., 1997; Murch et al., 2000;
Lewu et al., 2007a). With the increasing preference for herbal based medicine in the
local markets of South Africa (Cunningham, 1988; van Wyk et al., 1997; van Wyk
and Gericke, 2003; Lewu et al., 2007b), micropropagation technique has become a
necessary tool to reverse the decimation of medicinal plants in the wild through the
development of rapid multiplication protocols for economically important plant
species (McCartan and van Staden, 2002; 2003; Rani et al. 2003; Afolayan and
Adebola, 2004; Lewu et al., 2007a). Our study revealed that the optimal response for
callus induction and the rapid in vitro propagation of V. amygdalina is obtainable
using BA 1 mg l–1. This finding will serve a as baseline information for the
propagation of the species in the Eastern Cape Province of South Africa.
92
Acknowledgement
The authors thank the National Research Foundation of South Africa for financial
support.
References:
Abosi AO, Raseroka BH, 2003. In vivo antimalarial activity of Vernonia amygdalina.
British Journal of Biomedical Science. 60 (2):89–91.
Afolayan AJ, Adebola PO, 2004. In vitro propagation: A biotechnological tool
capable of solving the problem of medicinal plants decimation in South
Africa. African Journal of Biotechnology 3 (12): 683-687.
Akinwande AI, 2006. Hepatoprotective and Antioxidant Activities of Vernonia
amygdalina on Acetaminophen-Induced Hepatic Damage in Mice. Journal of
Medicinal Food. 9 (4): 524-530.
Castillo, JA, Jordan, M, 1997. In vitro regeneration of Minthostachys andina (Brett)
Epling- a Bolivia native species with aromatic and medicinal properties. Plant Cell,
Tissue and Organ Culture 49:157-160.
Erasmus, RT, Blanco E, Okesina, AB, Arana J, Mesa GZ, Matsha T, 2001.
Importance of family history in type 2 black South African diabetic patients.
Postgraduate Medical Journal 77: 323-325
Erasto P, Adebola PO, Grierson DS, Afolayan AJ, 2005. An ethnobotanical study of
plants used for the treatment of diabetes in the Eastern Cape Province, South
Africa. African Journal of Biotechnology 4 (12): 1458-1460
Glendon DA, Erwin J, van Staden J, 2007. In vitro propagation of four Watsonia
species. Plant Cell Tissur and Organ Culture 88:135–145
Hussey G, 1977. In vitro release of axillary shoots from apical dominance in
monocotyledonous plantlets. Annals of Botany 40:1323–1325
Iwalokun, BA, Efedede BU, Alabi-Sofunde JA, Oduala T, Magbagbeola OA,
Akinpelu AI, David A, 1999. Antimicrobial activity of Vernonia amygdalina
leaves. Fitoterapia 70 (4): 432-434.
Lewu FB, Grierson, DS, Afolayan AJ, 2007a. Micropropagation of Pelargonium
sidoides. Proceedings of the second international conference on the role of
genetics and biotechnology in conservation of natural resources, Ismailia,
Egypt, July 9-10, 2007. CATRINA 2 (1): 77 -81.
Lewu, FB, Adebola, PO, Afolayan AJ, 2007b. Commercial harvesting of
Pelargonium sidoides in the Eastern Cape, South Africa: Striking a balance
between resource conservation and rural livelihoods. Journal of Arid
Environments 70: 380–388
90
Martinussen I, Nilsen G, Svenson L, Junttila O, Rapp K, 2004. In vitro propagation of
cloudberry (Rubus chamaemorus). Plant Cell Tissue and Organ Culture
78:43–49
Masaba SC, 2000. The antimalarial activity of Vernonia amygdalina Del
(Compositae) Trans R Soc Trop Med Hyg.; 94:694–695.
McCartan SA, Van Staden J, 2002. Micro propagation of Scilla kraussii and Scilla
dracomontana. South African Journal of Botany. 68: 223-225.
McCartan SA, Van Staden J, 2003. Micro propagation of the endangered Kniphofia
leucocephala Baijnath. In vitro Cellular and Developmental Biology - Plant 39
(5): 496–499.
Murashige T, Skoog F, 1962. A revised medium for rapid growth and bio-assays with
tobacco tissue cultures. Physiologia Plantarum 15: 473-497.
Murch, SJ, KrishnaRaj S, Saxena PK, 2000. Phytomaceuticals: mass production,
standardization and conservation. Sci. Rev. Alternative Med 4:39-43.
Nhut DT, Teixeira DA, Silva JA, Huyen PX, Paek KY, 2004. The importance of
explant source on regeneration and micropropagation of Gladiolus by liquid
shake culture. Scientia Horticulturae 102:407–414
Omar MAK, Seedat MA, Motala AA, Dyer RB, Becker P, 1993. The prevalence of
diabetes mellitus and impaired glucose tolerance in a group of urban South
African blacks. South African Medical Journal 83: 641-643
Rani G, Virk GS, Nagpal A, 2003. Callus induction and plantlet regeneration in
Withania somnifera (L.) Dunal. In vitro Cellular and Developmental Biology Plant 39 (5): 468-474.
SAS INSTITUTE, 1999. SAS (Statistical Analysis System) user’s guide statistic. SAS
Institute, N.C.
Saxena, C, Palai SK, Samantaray S, Rout GR, Das P, 1997. Plantlet regeneration from
callus cultures of Psoralea corylifolia Linn. Journal of Plant Growth
Regulation 22:13-17,
Thiem B, 2001. Micropropagation of cloudberry Rubus chamaemorus L. by initiation
of axillary shoots. Acta Societatis Botanicorum Poloniae 70:11–16
90
Table 1. Mean number of stem explants (n=30) which produced callus and direct shoot
organogenesis and the number of callus derived from leaf source under two hormones and
light regimes.
Number
of Direct shoot Callus
Type of hormones and the Light
levels of concentration
condition callus formed organogenesis formed
from
stem from
stem from leaf
sa
explant
± explant
± explants ±
SDev*
SDev
SDev
0
1
2
3
4
1
2
3
4
0
1
2
3
4
1
2
3
4
+
+
+
+
+
-
3.00 ± 0.67d
8.0 ± 1.58a
6.20 ± 0.84b
4.60 ± 1.14c
3.20 ± 0.84d
0.40 ± 0.52f
1.80 ± 0.84e
0.80 ± 0.84f
0.60 ± 1.55f
5.20 ± 0.79e
17.80 ± 0.84a
10.40 ± 1.14b
5.80 ± 1.30e
8.60 ± 1.14c
7.00 ± 1.22d
3.00 ± 0.71f
1.80 ± 0.84g
2.20 ± 0.84f
1.80 ± 1.23c
0.60 ± 0.89d
4.00 ± 0.71a
2.0 ± 1.22c
3.20 ± .84b
0.00 ± 00e
0.20 ± 0.45d
0.20 ± 0.45d
0.40 ± 0.55d
+
+
+
+
+
-
0.40 ± 0.55fg
2.20 ± 1.30de
1.20 ± 1.30e
1.80 ± .084e
1.60 ± 1.14e
0.20 ± 0.45g
0.20 ± 0.45g
0.20 ± 0.45g
0.20 ± 0.45g
2.30 ± 0.82f
3.00 ± 0.71f
1.80 ± 0.84f
1.80 ± 0.84f
2.40 ± 1.14f
0.40 ± 0.55h
0.40 ± 0.55h
0.40 ± 0.55h
0.40 ± 0.55h
0.60 ± 0.89d
0.60 ± 0.89d
0.00 ± 00e
0.60 ± 0.89d
0.00 ± 00e
0.00 ± 00e
0.00 ± 00e
0.00 ± 00e
0.00 ± 00e
a
+ indicates continuous darkness and – indicates continuous light condition.
*Standard deviation. Means with the same letter along the same column are not
significant different (P< 0.01).
Table 2. Percentage response of micropropagation of V. amygdalina using intact
shoots cultured under two hormone conditions at different levels of concentration
Type of hormones and the levels of concentration
Percentage shoot yield (%)
1
91.11 ± 1.92a
3.33 ± 2.00c
2
6.67 ± 2.00b
3
3.33 ± 2.00c
4
3.33 ± 2.00c
1
1.90 ± 2.00c
2
1.92 ± 2.00c
3
3.33 ± 2.00c
4
Means with the same letter along the same column are not significant different (P<
0.01).
91
a
b
Figure 1a. Callus and direct shoot organogenesis after 10 days in continuous dark
condition (1b). Direct micropropagation of shoot under continuous light condition
a
b
Figure 2a. Pair of roots formed in over 90% of in vitro plantlets. (2b). Front view of
the acclimatization chamber showing plantlets ready for transfer to the field
a
b
Figure 3a. Side view of plantlets in acclimatization chamber prior to transfer to the
field. (3b). Established plantlet on the field.
92
Status of Biotechnology in Zimbabwe
Ester Mpandi Khosa1 and Wilson Parawira2
1
Biotechnology Research Institute, Scientific and Industrial Research and
Development Center, P. O. Box 6640, Harare, Zimbabwe. Tel: +263 4
860359; Fax +263 4 860350; Cell +263 11 635580.
2
Department of Biotechnology, Lund University, P. Box 124, SE-221 00,
Lund, Sweden.
Tel: +46 46 2220806; Fax: +46 46 2224713 Cell:+46 76 1392148
Abstract
This study focuses on assessing the status of biotechnology in Zimbabwe.
Zimbabwe’s biotechnology Research and Development activities focus on the
application of biotechnological techniques and provision of new knowledge, in the
fields of agricultural, industrial, food, environmental and medical biotechnologies.
Current projects in agricultural biotechnology are mainly carried out at universities
and research institutes and are aimed at improving sustainable and economic crop and
livestock production through plant and animal breeding of varieties and breeds
adapted to various environments, and the use biotechnology for crop and livestock
improvement and expansion of the genetic stock base. The National Biotechnology
Authority is responsible for transcribing the National Science and Technology policy
document whose mandate is the promotion of national scientific and technological
advancement. There has been some limited research into industrial enzymes. Limited
infrastructure, human resources and funding are the major challenges to modern
biotechnology development in Zimbabwe.
Key words: Biotechnology, research capacity, genetic engineering, Biotechnology
Policy, Zimbabwe
Introduction
In Zimbabwe, Biotechnology has applications in agriculture, medicine, food industry,
and environmental management. It has the potential to provide solutions to many
economic, social, and environmental problems that Zimbabwe, like the rest of Africa,
is confronted with. The technology involves the use of living cells from plants,
animals and micro-organisms (yeasts, moulds and bacteria) as well as enzymes,
antibiotics, vitamins, vaccines and proteins from living cells. Biomass from
agricultural, municipal, and industrial waste can be used to produce biodegradable
plastics, bioethanol, bio-diesel and biogas. Biotechnology teaching and research is
mainly done in local universities and research institutes. Several scientists have
acquired biotechnology expertise within Zimbabwe and abroad and most are actively
involved in the research in laboratories in developed countries. Zimbabwe has strong
science base which is one of the strongest factors for start-ups in life sciences.
Moreover, Zimbabwe has strategic advantage in having several natural biological
resources that can be exploited for their development, the indigenous technical
knowledge, and local field ecosystem for product development. The challenge is to
ensure that these ideas are marketable as value-added products.
93
Biotechnology Research In Zimbabwe
Agricultural and Industrial Biotechnology
The main area in which biotechnology is applied in Zimbabwe is agriculture and the
major thrust is crop improvement. Table 1 shows a summary of agricultural
biotechnology research and application in Zimbabwe (adapted from Falconi, 1999;
Sithole-Niang, 2001. Industrial biotechnology has involved the isolation of various
enzymes such as cellulases, lipases and polysaccharides for use in different fields
while Table 2 shows industrial biotechnology research. In the past few years, there
has been a significant research to explore potential industrial enzymes from various
biological and natural resources within the country
2.2 Food Biotechnology
Biotechnology application in food processing and preservation includes numerous
traditional methods for making fermented foods and beverages such as bread, beers
and wines, and fermented milk products. In Zimbabwe, fermented foods are produced
at household level from various raw materials such as cereals, milk and fruits. A
wealth of information has been generated on traditional fermented foods and
beverages in the documentation, characterisation and basic research of these
traditional products and processes. There are a variety of traditional fermented foods
and beverages of Zimbabwe and has been reviewed by many authors because of their
importance in country’s diet. Some of these household fermented products have been
upgraded to an industrial scale such as mahewu, chibuku and lacto. The area where
biotechnology has been applied in food processing in Zimbabwe is quite large and
involves shelf-life extension (food preservation), starter culture development, value
addition to indigenous foods, and food safety. Other potential areas include
preparation of food flavours, supply and maintenance of starter cultures, and
exploitation of antioxidants, prebiotics and probiotics.
Environmental Biotechnology
In environmental biotechnology, areas of investigation include decolouration of
textile dyes, wastewater treatment and biogas production from municipal, industrial
and agricultural waste. The contribution of biotechnology in environmental
monitoring and management is enormous. Pollution is a major problem in Zimbabwe.
Harare, the capital city of Zimbabwe is facing serious water and wastewater
management problems. Wastewater treatment plants in Harare are overloaded owing
to rapid population growth and rapid industry expansion among other factors. There
is a serious need to research and develop technologies to minimise many of the
environmental problems Zimbabwe is facing.
Biotechnology Policy and Regulation In Zimbabwe
Scientific Research in Zimbabwe is governed by the Research Council of Zimbabwe
(RCZ) Mandate. The overall function of the RCZ is to advise the government on
issues of science and technology. According to the RCZ draft policy document of
1990, the broad priority of policy as regards to agriculture were (i) sustainable and
90
economic crop and livestock production, (ii) plant and animal breeding varieties and
breeds adapted to various environments, and (iii) the use biotechnology for crop and
livestock improvement and expansion of the genetic stock base. In Zimbabwe the
emphasis on biotechnology started in 1992, with the Special Programme on
Biotechnology in order to promote and improve access to biotechnological products
and tools in the areas of sustainable agriculture, environmental management and
health care. Biotechnology Forum (BF) was formed in 1992, which lead to the
national planning in biotechnology in Zimbabwe.
The BF was a group of researchers, non-governmental organisations (NGOs) working
with farmers and farmers’ representatives and representatives of the RCZ and
Ministry of Agriculture. The BF carried out a national survey to identify crop
production constraints, institutional biotechnology capabilities and priorities.
Table 1:Summary Of Agricultural Biotechnology Research And Application In
Zimbabwe (adapted from Falconi, 1999; Sithole-Niang, 2001)
Institution
Type of research
Crops
Purpose
Uinversity
of Tissue culture
Zimbabwe
Crop Science Depart Molecular marker
Molecular
diagnostics
assisted selection
Cassava, banana, coffee Resistance
to
African
Sweet potatoes,
mosaic virus
Grain & legumes
Resistance to sweet potato
Cassava, maize, tobacco feathery mottle virus
sweet potato
Weed resistance to Striga
asiatica
UZ Soil
Depart
Science Fixation
Biological
nitrogen
UZ
Biological Biological
Sciences
control of pests
Mushroom
production
using
insect
viruses
UZ
Biochemistry Genetic
Dept
modification
PCR techniques
Legumes
Rhizobium-inoculant
small farmers
Mushroom
Small-scale farmers
Sorghum
Cowpea
Africa University
Grasslands
Laboratories
Govt
Institute
Horticulture
Research (HRI)
Chemistry & Soils
CSRI
Research Institute
Cross breeding
Biological
nitrogen
fixation
Tissue culture
Maize
Legumes
Undesirable metabolites of
sorghum
Virus
and
herbicide
tolerance
Dwarf drought tolerant
Rhizobium-inoculant
Vegetables & ornamental crops
Viral resistance
Biological
nitrogen
fixation
Legumes
Rhizobium-inoculant
Cotton
Research Trials
with Cotton
Institute CRI
transgenic cotton
91
for
Control
red-bollworm,
heliothis ballworm, spiny
BRI- SIRDC
Tissue culture
Genetic
modification
Mushroom
production
Sweet potatoes
Mushroom
Maize
Laboratories
Central Veterinary
Vaccines
Molecular
diagnostics
Livestock
worm
Virus resistance for smallscale farmers
Spawn production for smallscale farmers
Drought tolerance and insect
and viral resistance
Cattle reproductive diseases
UZ Vet science
Animal
diagnostics
vaccines,
Genetic
engineering
Livestock
Animal disease treatment
Board (TRB)
Tobacco Research
Genetic
modification
PCR techniques
Tissue culture
Tobacco
Damping off disease of
seedlings
Virus resistance
Herbicide tolerance, and
disease resistance
Tissue-Cult
(private)
Tissue culture
Fruits and orna
mental plants
Viral resistance
Agri-Biotech
(private)
Tissue culture
cassava, paprika
Potato, sweet potato
Viral resistance
As a follow-up the Zimbabwe Biotechnology Advisory Committee (ZIMBAC) was
established in 1996, with the mandate of advising the government and the Dutch
supported special programs on developing agricultural biotechnology through
identification, management and implementation of high priority projects. ZIMBAC
was composed of policy makers, researchers and NGOs and farmers’ representatives.
The need for the development and implementation of biosafety guidelines for the
release of GMOs into the environment was recognised in 1993. Following this, biosafety regulations were established in 1998. These regulations consisted of general
consideration, regulated products, application requirements, application procedures,
rights and obligation, monitoring and reporting on all aspects concerning the
development, production, use or application and release of GMOs.
The Biosafety Board to mandate the above was established in 1999 by RCZ. In April
2002, the Government of Zimbabwe formally launched the National Science and
Technology policy document, with the overall objective of promoting national
scientific and technological advancement. Biotechnology was identified as one of the
tools that could provide the country with an opportunity for advancing science and
technology. The Zimbabwe National Biotechnology Bill was passed into law and
appeared in the Government Gazettee of 1 September 2006, and the Biosafety Board
was changed to the National Biotechnology Authority
90
Challenges to Biotechnology Research And Application In Zimbabwe
Biotechnology research in Zimbabwe faces a number of challenges. Limited
infrastructure, human resources and funding are some of the factors that are stifling
biotechnology development. The requirement for adequate infrastructure is a critical
factor for the advancement of biotechnological research and development and this
include laboratory facilities, research equipment and other physical aspects in
Zimbabwean universities and research institutes. There is also a need to improve
human and resource capacity to drive the research. Zimbabwe once had adequate
number of people with biotechnology expertise, but is currently suffering from
massive brain drain, with trained personal moving to the neighbouring countries and
abroad. Returning PhD graduates find laboratories with limited equipment and
resources, leading to many of them seeking alternative options outside the country.
Biotechnology is also collaboration-intensive, both domestically and internationally,
and therefore collaboration between research institutes, government and private sector
needs to be improved. More public investment is needed and new public-private
collaboration to make biotechnology beneficial.
The occasional negative view of biotechnology, especially about genetically modified
organism in newspapers and other media could be a contributing factor to hampering
of biotechnology development and acceptability. To counteract this antibiotechnology, local scientists should be more involved in societal issues and write
simplified articles in these newspapers to maintain public confidence.
Conclusion
Zimbabwe is endowed with rich natural biological and non-biological resources
which can be exploited using biotechnology. What is required is apply the scientific
knowhow to convert our abundant raw materials into value added products.
Biotechnology has the potential to transform the country’s economy into a hub of
innovative ideas and development if more resources are put aside for its development.
It can offer Zimbabwe an opportunity to improve agricultural production and health
delivery, enhance environmental conditions and establish new industries in the food
production and processing. Zimbabwe has the human resources, genetic resources and
institutions for research, the enabling legislation to guide the research, and the
National Biotechnology Authority to supervise the research and field trials. Because
of this, and despite current challenges, the future of Biotechnology in Zimbabwe is
therefore bright.
References
Benhura MAN, Chidewe C (2002). Some properties of a polysaccharide preparation
that is isolated from the fruit Cordia abyssinica. Food Chem. 76: 343-347.
Benhura MAN, Katayi-Chidewe C (2002). The emulsifying properties of a
polysaccharide isolated from the fruit of Cordia abyssinica. Internat. J. Food
Sci. Technol. 39:579-583.
Benhura MAN, Marume M (1993a). The mucilaginous polysaccharide material
isolated from ruredzo (Dicerocaryum zanguebarium). Food Chem 46: 7-11.
90
Benhura MAN, Marume M (1993b). Emulsifying properties of the mucilage extracted
from ruredzo (Dicerocaryum zanguebarium). Biosci. Biotech. Bioche. 57:
1995-1998.
Benhura MAN, Mavhudzi I (1996). Use of crosslinked mucilage prepared from
ruredzo (Dicerocaryum zanguebarium) in the purification
polygalacturonase extracted from tomato. Food Chem. 56: 433-437.
of
Benhura MAN, Marume M (2006). Viscosity behaviour of the mucilage extracted
from ruredzo (Dicerocaryum zanguebarium). Starch 46: 106-108.
Bvochora J M, Danner H, Miyafuji H, Braun R, Zvauya R. (2005). Variation of
sorghum phenolic compounds during the preparation of opaque beer. Process
Biochem. 40: 1207-1213.
CBD Secretariat (2000). Cartagena Protocol on Biosafety to the Convention on
Biological Diversity. 29 January 2000, Montreal: Secretariat to the
Convention on Biological Diversity.
Chetsanga C J (1991). Current status of agricultural biotechnology in Zimbabwe. The
Hague: International Service for National Agricultural Research.
Chikwamba R (1995). State of the art of biotechnology research in Zimbabwe.
African Crops Science 3(2): 24-31.
Chivero ET, Mutukumira AN, Zvauya R (2001). Partial characterisation and
characterisation of a xylanase enzyme produced by a microorganism isolated
from selected indigenous fruits of Zimbabwe. Food Chem. 72:179-185.
Dlamini N. R, Taylor J R N, Rooney L W (2007). The effect of sorghum type and
processing on the antioxidant properties of African sorghum-based foods.
Food Chem. 105: 1412-1419.
Feresu S, Nyati H (1990). Fate of pathogenic and non-pathogenic Escherichia coli
strains in two fermented milk products. J. Appl. Bacteriol. 69(8): 814-821.
Gadaga T H, Mutukumira A N, Narvhus J A, Feresu S B (1999). A review of
fermented foods and beverages of Zimbabwe. Inter. J. Food Microbiol. 53: 111.
Gadaga T H, Mutukumira A N, Narvhus J A (2000). Enumeration and identification
of yeast isolated from Zimbabwean traditional fermented milk. Inter. Dairy J.
10: 459-466.
Gadaga T H, Viljoen B C, Narvhus J A (2007). Volatile organic compounds in
naturally fermented milk and milk fermented using yeasts, lactic acid bacteria
and their combinations as starter cultures. Food Technol. Biotechnol. 45: 95200.
90
Gran H M, Gadaga T H, Narvhus J A (2003). Utilisation of various starter cultures in
the production of Amasi, a Zimbabwean naturally fermented raw milk
product. Inter. J. Food Microbiol. 88: 19-28.
Mawadza C, Mpandi-Khosa E, Zvauya R, Gopo J, Holzapfel W (1999).
Microbiological changes in production of Mutwiwa, a fermented maize meal
of Zimbabwe. In: Proceedings of the Regional seminar on Traditional
Fermented Food Processing in Africa, Accra, Ghana, July 1998. page 34-42.
Makaya E, Hoko, Parawira W, Svotwa E (2007). An assessment of effectiveness of
biological nutrient removal from wastewater: a case for Hatcliffe sewage
treatment works in Zimbabwe. EJEAFChe 6: 2409-2419.
Manhokwe S (2007). Evaluation of biological treatment methods for potato
wastewater. MSc thesis. Department of Biochemistry, University of
Zimbabwe.
Muchuweti M, Moyo E, Mushipe S (2005). Some properties of the polygaturonase
from four Zimbabwean wild fruits (Uapaca kirkiana, Zizphus mauritiana,
Tamarindus indica and Berchemia discolour fruits). Food Chem. 90: 655-661.
Muzariri CC, Mazorodze JH, Mapingire J (2002). Spectrophotometric monitoring of
the decolourisation of pulp and paper effluent water and the simultaneous
production of lignolytic enzymes. 3rd WATERNET/WARFSA symposium
“Water Demand Management for Sustainable Development”, Dar es Salaam,
Tanzania. 30-31 October.
Nyanhongo GS, Gomes J, Gubtz GM, Zvauya R, Read J, Steiner W (2002a).
Production of laccase by a newly isolated strain of Trametes modesta.
Bioresour. Technol. 84: 259-263.
Nyanhongo GS, Gomes J, Gubtz GM, Zvauya R, Read J, Steiner W (2002b).
Decolorization of textile dyes by laccases from a newly isolated strain of
Trametes modesta. Water Res. 36: 1449-1456.
Nhapi I, Dalu J, Siebel MA, Gijzen HJ (2003). An evaluation of duckweed-based
pond systems as an alternative option for decentralised treatment and reuse of
wastewater in Zimbabwe. Wat. Sci. Technol. 48: 323-330.
Nhapi I (2004). Potential for the use of duckweed-based pond systems in Zimbabwe.
WaterSA 30: 115-120.
Nyanga L K, Nout M J R, Gadaga T H, Theelen B, Boekhout T, Zwietering M H
(2007). Yeast and lactic acid bacteria microbiota from masau (Ziziphus
mauritiana) fruits and their fermented fruit pulp in Zimbabwe. Inter. J. Food
Microbiol. 120: 159-166.
Parawira W (2008) The status and trends in food, industrial and environmental
biotechnology research in Zimbabwe. Afr. J. Biotechnol. 7(10): 1377 – 1384.
Parawira W, Murto M, Zvauya R, Mattiasson B (2004). Anaerobic digestion of solid
91
potato waste alone and in combination with sugar beet leaves. Renew. Energ.
29: 1811-1823.
Parawira W (2004). Anaerobic treatment of agricultural residues and wastewater:
Application of high-rate reactors. Doctoral thesis. Department
Biotechnology, Lund University, Sweden.
of
Parawira W, Kudita I, Nyandoroh MG, Zvauya R (2005). A study of industrial
anaerobic treatment of opaque beer brewery wastewater in a tropical climate
using a full-scale UASB reactor seeded with activated sludge. Process
Biochem. 40: 593-599.
Simango C Rukure G (1992). Survival of bacteria enteric pathogens in traditional
fermented foods. J. Appl. Bacteriol. 73: 37 – 40.
Sithole-Niang 1, Cohen J and Zambrano P (2004). Putting GM technologies to work:
public research pipelines in selected African countries. Afr. J. Biotechnol
3(11): 564-571.
Tekere M, Read JS, Mattiasson B (2005). Polycyclic aromatic hydrocarbon
biodegradation in extracellular fluids and static batch cultures of selected subtropical white rot fungi. J. Biotechnol. 115: 367-377.
Zvauya R, Mugochi T, Parawira W (1997). Microbial and biochemical changes
occurring during production of masvusvu and mangisi, traditional
Zimbabwean beverages. Plant Foods Hum. Nutr. 51: 43 – 51.
Zvidzai CJ, Zvauya R (2001). Purification of a protease from an alkalophilic Bacillus
subtilis CHZ1 isolated from a Zimbabwean hot spring. J. Food Biochem. 25:
1-13.
92
THEME II:
POLICY AND BIOSAFETY, COMMUNICATION,
AWARENESS AND NETWORKING
93
RECONSTRUCTING BIOTECHNOLOGY AND SOCIAL
PATHWAYS: INTERPLAY OF CULTURAL, SCIENCE AND
BIOTECHNOLOGY
W. Quaye1*******, I. Yawson1 and I. E. Williams2
1
Food Research Institute (CSIR) Box M20, Accra
2
University of Ghana, Legon
Abstract
Despite major scientific progress in the application of biotechnology in agriculture,
public attitudes towards biotechnology and genetically modified (GM) food products
in particular remain mixed in Africa. To develop unbiased attitudes towards
agricultural biotechnology in Africa, there is the need to substitute the dominant
approaches to biotechnology research with tailor-made methodologies in developing
countries. This paper examines the social dynamics of food with a focus on the need
for social shaping of biotechnology to reflect regional needs. The results indicate that
people perceive food not just as a commodity to be consumed but also attach cultural
and national identities to it. Thus, the biotechnology research agenda should be set in
the context of social choices; social scientific coalition of biotechnology with
endogenous development pathways’ as opposed to ‘exogenous biotechnology
research’. There is also need for capacity building to address ethical and moral issues
associated with biotechnology research.
Keywords: Biotechnology, Survey, Acceptability, Social shaping and Ghana
*******
Corresponding author. TEL: +233-218132401. Email: quayewilhemina@yahoo.com
94
Introduction
The application of biotechnology in the production of food, fiber and pharmaceutical
is a major development of the late 20th century. This emerging technology is often
viewed as the next revolution which has the potential to fundamentally alter the way
society organizes its production and distribution of food. Many GM products (e.g. rice
with enhanced vitamin A, long lasting fruits and vegetables) have already entered the
world’s food supply chains. These products have the potential to not only meet our
basic needs, but also bring a wide range of economic, environmental and health
benefits. However, the current debate on biotechnology/GM Foods is, at best,
confusing, even to the better informed sections of the public. There are advocates for
and critics against GM Foods.
Biotechnology advocates emphasize the potential benefits to society via reduction of
hunger and malnutrition, prevention and cure of diseases, and promotion of health and
general well being (Isserman, 2001; UNDP 2001). Despite its promise to bring
significant benefits to society, public acceptance of food biotechnology has been with
mixed feelings (Einsiedel, 1997; Gamble et al., 2000). It has been argued that modern
genetic technologies may allow developed countries produce commodities that are
currently imported from developing countries. Such developments, it is claimed, will
have significant negative effects on poverty situation in the Third world and lead to
global instability (Junne 1991; Galhardi, 1995).
Critics of biotechnology/GM Foods insist that such foods could pose risks to health
and the environment though genetically modified crops produce better yields.
Opponents view its use as a needless interference with nature that may lead to
unknown and potentially disastrous consequences (Rohrmann and Renn 2000). Some
resist the use of genetic technologies in agricultural production alleging (perceived)
risks to humans and environment, while others oppose it citing moral, ethical and
social concerns (Waterfeldt and Edwards 1984). Biotechnology is often criticized on
the ground that its use in plants and animals, especially gene transfer across species,
take us to “realms of God” and against “Law of Nature”. Some argue that since genes
are naturally occurring entities that can be discovered (not invented), granting patent
ownership to genetic findings and processes is morally and ethically untenable
(Hallman et al., 2002).
This paper presents some findings on the level of acceptance of biotechnology/GM
Foods in Ghana. The specific objectives were, first, to investigate the level of public
acceptance of biotechnology/GM foods and the social implications. Secondly, to
examine the extent of usefulness of biotechnology in solving R&D problems in Africa
as perceived by the public. Thirdly, to establish the level of interest in biotechnology
debates among the public. And finally, to recommend ways to improve public
acceptance of biotechnology.
Methodology
A total of 100 people were interviewed from a target sample frame of Ghanaian adult
civilian population (18 years or older). Purposive sampling was used to select
interviewees to ensure that people who are expected to be knowledgeable about the
subject are captured in the survey. The approach used allows conducting a survey on
public risk perception in a country with low awareness of agricultural biotechnology.
A structured questionnaire was designed for data collection. All the respondents were
89
located in the Greater Accra Region of Ghana. The stakeholders covered include
academia, NGO’s, business community, government and others. Statistical Package
for the Social Sciences (SPSS) and Microsoft Excel were used to analyze the data
collected for discussion. Percentage distribution of respondent by occupation is shown
in figure 1.
Percentage Distribution of Respondent by Occupation
45
40
%Response
35
30
25
20
15
10
5
0
Academia
NGO
Government
Business
Other
Stakeholders
Figure 1 Percentage Distribution of Respondents by occupation
Survey Findings and Discussions
Over 95 percent of the respondents were had knowledge on Biotechnology and GM
foods. This was very impressive, suggesting that respondents were in a good position
to give good judgment/views on the research topic and did not depend on hearsay. On
the issue of whether Ghana should accept GM foods, close to 50 percent of the sample
interviewed were not in favour (figure 2). More people in academia were against the
idea of Ghana accepting GM foods while the reverse was true for respondents from
government institutions who deal with biotechnology on a daily basis. Some of the
perceived health and economic benefits of biotechnology/GM Foods included the
production of better tasting fruits and vegetables, less expensive foods, insulin and
rice with enhanced vitamin A.
Acceptance of GM Foods in Ghana
Pooled
Other Stakeholders
Business
Yes
Government
No
NGO
Academia
0
20
40
60
80
% Response
Figure 2. Level of acceptance of Biotechnology/GM Foods in Ghana
90
100
Those against GM foods intimated that farmers will loose focus on the traditional way
of cultivating putting the whole nation at the mercy of profit driven foreign
companies. Another fear mentioned was the issue of farmers in the developing
countries being adversely affected by foreign seed dependence syndrome. This group
believed that farming will become extremely capital intensive out of reach of the
small scale farmer.
Social-cultural
It is assumed biotechnologies are developed in advanced countries while its
application is supposed to be universal. A technology, which is perceived not just as
an imported technology but also as a fruit of the country’s own research and
development, tends to be more accepted in developing countries. Biotechnologies
need to be developed with the intended users in mind and tailored to the needs of the
communities in developing countries. Respondents in favour of GM Foods argued
that such technologies should be developed with intended users. Generally, people are
identified by their consumption and nutrition lifestyle and therefore take pride in what
they eat. They perceive food as not just a commodity to be consumed but one with
cultural and national identities. Biotechnology need to be developed in the context of
social choices; social scientific coalition of biotechnology with endogenous
development pathways’ as opposed to ‘exogenous biotechnology research’.
Usefulness of biotechnology in solving problems in Research and development
The results of the survey showed that respondents recognize biotechnology as having
a significant potential to solve the problem of lack of research and development, pest
infestation, plant disease and other important agronomic problems such as, reduced
soil fertility and high use of pesticides. After all, developing countries should have a
strong desire to get access to these technologies in order to increase productivity,
relieve the pressure on natural resources and stimulate economic growth
Potential of biotechnology solving problems in Research and
Development in Africa
60
%Response
50
No Potential
40
Small Potential
30
Potential
High Potential
20
Very High Potential
10
P
oo
le
d
S
ta
ke
ho
ld
er
s
O
th
er
B
us
in
es
s
G
ov
er
n
m
en
t
N
G
O
A
ca
d
em
ia
0
Figure 3 The level of potential of biotechnology in solving problems in R&D in
Africa
Level of interest in biotechnology debates among the public
90
Approximately 80 percent of the sample interviewed showed interest in participating
in public debate on GM related issues as illustrated in figure 4. This shows the level
of importance the public attach to this subject. Respondents were of the view that GM
risks are not being exaggerated and therefore strongly recommended extensive
awareness strategies to educate the public. Respondents suggested TV and radio as
useful media for the dissemination of information concerning this issue.
% Response
Willingness to participate in GM Public Debates
100
90
80
70
60
50
40
30
20
10
0
No
Yes
Academ ia
NGO
Governm ent
Business
Other
Stakeholders
Pooled
Figure 4 Willingness to participate in public debates on GM technologies
Confidence in Government Regulatory System
Lack of confidence in government regulatory system in the area of biotechnology was
a worry to the majority of respondents. Most of respondents were of the view that the
government institutions are not well equipped to handle GM technology hence the
high positive response to the need to establish a special body to regulate ethical and
moral issues associated with biotechnology research. Close to 50 percent of the
sample interviewed lacked confidence in research institutions in handling GM Foods.
The pattern of response is well illustrated in Figure 5.
90
Need for Regulations on GM Foods
100
90
% Response
80
70
60
50
No
Yes
40
30
20
10
0
Academ ia
NGO
Government
Business
Other
Stakeholders
Pooled
Figure5 Responses on the need for strengthening government regulatory body
Conclusions and Recommendations
There has been tremendous breakthroughs in biotechnology research and
development in the recent times especially in the advanced countries. The application
of biotechnology in agriculture has become hot issue for public debate in the wake of
current sharp increases in the world food prices. Public attitudes towards
biotechnology in general and GM food products in particular remain mixed. On the
one hand, the public remains optimistic about the prospect of new and improved food
and fiber that can bring a wide range of health and economic benefits. On the other
hand, they are concerned about the perceived health, safety and environmental risks as
well as socio-cultural implications often associated with the use of this technology
particularly in Africa. Thus, the biotechnology research agenda should be set in the
context of social choices; social scientific coalition of biotechnology with endogenous
development pathways’ as opposed to ‘exogenous biotechnology research’. There is
also need for capacity building to address ethical and moral issues associated with
biotechnology research.
References
Baker, G. A. and T. A. Burnham. 2001. Consumer Response to Genetically Modified
Foods: Market Segment Analysis and Implications for Producers and Policy
Makers. Journal of Agricultural and Resource Economics, 26: 387-403.
Einsiedel, F. F. 1997. Biotechnology and the Canadian Public. Report on a 1997
National Survey and Some International Comparison. University of Calgary,
Calgary, Canada.
Feenberg, A (2005) Critical theory of Technology: An Overview: Potentialities,
Actualities and Spaces Vol.1. Issue 1, p47-64
90
Feenberg, A. (1999), Questioning Technology, New York: Routledge.
Feenberg, A. (2002), Transforming Technology, New York. Oxford University
Galhardi, R. M. 1995. “Employment Impacts of Agricultural Biotechnologies in Latin
America: Coffee and Cocoa in Costa Rica”. In Assessing the Impacts of
Agricultural Biotechnologies, edited by B. Herbert-Copley, Proceedings of
Meeting of International Development Research Center (IDRC), May 15-16,
Ottawa, Canada.
Sakellaris, H. Torgersen, T. Twardowski, and W. Wagner. 2000. “Biotechnology and
the European public”. Nature Biotechnology, 18(9): 935-938.
Hallman, W., A. Adelaja, B. Schilling, and J. T. Lang. 2001. Consumer Beliefs,
Attitudes and Preferences Regarding Agricultural Biotechnology. Food Policy
Institute Report, Rutgers University, New Brunswick, New Jersey.
Hamstra, I. A. 1998. Public Opinion about Biotechnology: A Survey of Surveys.
European Federation of Biotechnology Task Group on Public Perceptions on
Biotechnology, The Hague, The Netherlands. 19.
Isserman, A. M. 2001. Genetically Modified Food: Understanding the Social
Dilemma. American Behavioral Scientist, 44:1225-1232.
Juma, C. 2002. “The Global Sustainability Challenge: From Agreement to Action”.
Int. J. Global Environmental Issues 2, 1/2 : 1-14.
Junne, G. 1991. The Impacts of Biotechnology on International Trade. In
Biotechnology in Perspective: Socio-economic Implications for Developing
Countries, Edited by A. Sasson and V. Costarini, Paris: United Nations
Educational, Scientific and Cultural Organization (UNESCO).
Rohrmann, B. and Renn, O. (2000) Risk Perception Research – An Introduction.
In: O. Renn and B. Rohrmann (eds) Cross-Cultural Risk Research. A Survey
of Empirical Studies. Dordrecht: Kluwer Academic Publishers
Ruivenkamp. G. (2005). Between Bio-Power and Sub-Politics Tailoring
Biotechnologies: Potentialities, Actualities and Spaces Vol.1. Issue 1, p11-32
United Nations Development Program (UNDP). 2001. “Human Development Report:
Making new technologies work for human development”. New York: Oxford
University Press
Wanatabe, S. 1985. Employment and Income Implication of the “Bio-Revolution”: A
Speculative Note. International Labor Review, 124:227-247.
Winterfeldt von, D. and Edwards, W. (1984) Patterns of conflict about risk
technologies. Risk Analysis, 4: 55-68.
90
BUILDING CAPACITIES FOR BIOSAFETY IN WEST AFRICA
Walter S. Alhassan
Abstract
The potential contribution of biotechnology to food security and poverty reduction
has been recognized and is attested to by the phenomenal global growth in the
cultivation of genetically modified (GM) crops. However, the use of GM crops poses
potential risks to the environment and human health necessitating the building of
capacity for the safe application of biotechnology. A legislative framework is
necessary for the safe acquisition and use of GM products. In West Africa, it is only
Burkina Faso that has passed a biosafety law and can commercialize GM products.
Burkina Faso, Ghana and Nigeria have the necessary legislative framework to conduct
confined field trials. The acquisition of the capacity for biosafety legislative
development and implementation should be encouraged but should not be an end in
itself but a means to the acquisition of the capacity for the safe application of modern
biotechnology to agriculture and other biosciences related problems
Introduction
Current global trends in climate change and its impact on food security, rising fossil
fuel costs and inherent low grain yields in Africa have fueled the call for greater
investment in biotechnology as complement to traditional practices in meeting up to
the challenges.
The African Union (AU) summit of January 2007 endorsed the November 2006 Cairo
recommendation of the African Ministerial Council on Science and Technology
(AMCOST) for a 20-year African Biotechnology Strategy with specific regional
technology goals, and to develop and harmonize national and regional regulations that
promote the application and safe use of modern biotechnology.
The world is witnessing a rapid increase in the cultivation of GM crops. The 2007
global report (James, 2007) indicates a current level of 114.3 million hectares under
GM crops. The key biotech crops are roundup ready soybean, Bt maize, Bt cotton
and Bt canola. Some of these crops have both insect resistance and herbicide tolerant
genes engineered into them. In Africa, it is only South Africa that is producing GM
crops, namely, Bt maize, Bt cotton and Roundup Ready Soybean on a commercial
basis. Recently, Egypt and Burkina Faso have announced the commercialization of Bt
cotton and Bt maize respectively. There is the need to broaden the scope of GM crops
available to include staple African crops faced with production challenges.
The use of biotechnology products like genetically modified organisms or products of
these organisms has potential risks to the environment and human health for which
precaution is advocated in the use of the technology. The legislative framework for
biosafety developed by many countries in West Africa has been under the UNEP-GEF
support. This prescribes measures that must be adhered to in order to address any
perceived or real risk associated with the use of GM technology. The taking of safety
measures is binding on all countries that are signatory to the Cartagena Protocol on
Biosafety of the Convention on Biological Diversity.
91
Status of Biosafety Legislative Framework in West Africa
The most important constraint to the acquisition of capacity in biotechnology for
Africa is the lack of effective biosafety legislation to permit the safe access to the
technology. The status of biosafety in various countries of the sub-region is as
tabulated (Table 1).
Table 1. Status of biosafety in West African countries
Country
Cartagena
Protocol
Biosafety Status
Ratified
Ratified
Completed
National
Biosafety
Framework
Yes
Yes
Operational
Biosafety
Regulatory
System in place
No
Yes
Benin
Burkina Faso
Cape Verde
Côte d’Ivoire
Accession
Ratified
No
Yes
No
No
Gambia
Ghana
Ratifed
Ratified
Yes
Yes
No
Yes
Draft Biosafety Bill,
Regulations
or
Decree on Biosafety
Primary Biosafety
Regulatory Agency
Yes
Yes. Law passed in
2006
No
Yes
Min. Env.
National
Biosafety
Agency (Min Env)
Min Env
National
Biosafety
Commission
(Min
Env)
Min Env
National
Biosafety
Committee
(Min
Educ. Sci. & Sports)
Min. Env.
Min. Env
Yes
Yes.
Biosafety
cabinet
No
No
Bill
at
Guinea -Bissau
GuineaConakry
Liberia
Mali
Ratified
Accession
No
No
No
No
Accession
Ratified
No
Yes
No
No
Niger
Accession
Yes
No
Nigeria
Ratified
Yes
Yes
Senegal
Ratified
Yes
No
Yes
Ministerial
Committee
authorized conduct of
CFTs. Bill pending in
Min Env.
Yes
Sierra Leone
Togo
Accession
Ratified
Yes
Yes
No
No
No
Yes
No
Yes (both draft bill
and draft decree for
confined field trials)
Yes
?
Min. Env (draft bill)
Min. Agric (draft
decree)
National
Biosafety
Agency (Min Env)
Ministry
of
the
Environment
National
Biosafety
Authority (Min Env)
Min Env?
Min Env
Source: Linacre et al. 2006., W. S. Alhassan 2008 Updated
Out of the 15 countries in West Africa, only Burkina Faso, Ghana and Nigeria have
operational regulatory systems for review of applications for confined field trials.
Neither Ghana nor Nigeria has reviewed any application for confined field trials. Only
Burkina Faso can review applications for commercial release. The following countries
have draft bills or decrees at the level of the sector Ministry, Cabinet or Parliament:
Benin, Côte d’Ivoire, Gambia, Ghana, Mali, Niger, Nigeria, Senegal and Togo.
Pipeline applications for confined field trials in the 3 countries that can receive such
applications are: Burkina Faso: Bt cowpea, biofortified sorghum, Ghana: Biofortified
orange flesh sweet potato, Bt cowpea, Bt maize, ACMV cassava and Nigeria: Bt
cowpea, biofortified sorghum, ACMV cassava.
Institutional Initiatives for Capacity Building
A number of institutions in the sub-region have drawn out plans for the building of
the needed capacity in biosafety that will ensure the safe use of biotechnology. Other
90
institutions routinely conduct training in biosafety in West Africa. Those with
advanced plans for capacity building are CORAF/WECARD, CILSS/INSAH,
ECOWAS, WAEMU, FARA and the NEPAD’s WABNet. Those routinely offering
training include PBS, ISAAA and AfricaBio that cover risk communication.
CORAFWECARD
The Conseil Ouest et Centre Africain pour le Recherche et le Developpement
Agricoles (CORAF)/West and Central African Council for Agricultural Research and
Development (WECARD) is a sub-regional research organization (SRO). It
developed in 2004, an Agriculture Biotechnology and Biosafety Program (ABBP) for
its 21 member countries from West and Central Africa. The ABBP was adopted by
the ECOWAS at its Ministerial meeting in Bamako, Mali in 2005. The action plans
for this were adopted by these Ministers at the Accra ECOWAS biotechnology
meeting in March 2007. The biosafety component is being handled by CILSS/INSAH
for the ECOWAS.
CILSS/INSAH
CILSS is the permanent Inter-State Committee for Drought Control in the Sahelian
Zone. Its research wing is the Institut du Sahel (INSAH). CILSS/INSAH has
developed a Biosafety Convention (Pray et al. 2007) which sets forth a regional
regulatory system where: (1) each country establishes its own national biosafety
regulatory system using the procedures, definitions, and responsibilities for their
national competent authority set out in the convention; (2) the national authorities
make most of the decisions regarding authorization of activities using GMOs; (3) the
CILLS/INSAH has a Regional Coordinating Committee (RCC) that reviews and
advises on proposed national decisions on particular GMOs and provides general
technical and policy support to the national competent authorities; and (4) the RCC
makes decisions for countries without a regulatory framework or when products will
be marketed throughout the region.
ECOWAS PLAN
The Economic Community of West African States (ECOWAS), a 15 member body,
endorsed its plan for biotechnology and biosafety at its 3rd Ministerial Meeting on
Biotechnology held in Accra, Ghana on March 30th 2007. The objective of the
ECOWAS plan is to establish a regional approach to biotechnology and biosafety. On
biosafety, ECOWAS has endorsed creating a regional framework for biosafety that
will harmonize biosafety regulations in the sub-region. Work on this is advanced. The
implementing agent for this, on behalf of ECOWAS, is the CILSS/INSAH.
WAEMU “West Africa Regional Biosafety Project” (PRBAO)
The West African Economic and Monetary Union (WAEMU) and the World Bank
have prepared a proposal for a “West Africa Regional Biosafety Project” (PRBAO:
Projet Régional sur la Biosécurité en Afrique de l’Ouest), which is to be funded by
GEF and covers 5 of the 8 countries in the WAEMU. The 5 countries are Benin,
Burkina Faso, Mali, Senegal and Togo. The proposed WAEMU project (Linacre et al
2006) has two major objectives, an environmental and a development objective.
90
The environmental objective is to protect West Africa’s biodiversity against the
potential risks that are associated with the introduction of genetically modified
organisms (GMOs) in this region. The development objective of the project is to
establish a regional biosafety framework to ensure the safe conduct of confined or
experimental field trials for research purposes and the collection of agronomic and
risk assessment data needed for regulatory risk assessments for possible
commercialization of genetically modified crops, starting with cotton. To achieve its
objectives, the proposed project will support the establishment of an enabling
regulatory environment, capacity building and public outreach. It will consist of three
components: Component A will adapt and disseminate regional methods of risk
evaluation and management. Component B aims at developing and establishing a
regional biosafety framework in the WAEMU region. Component C will support the
implementation at the national level in each of the five countries.
FARA
The Forum for Agricultural Research in Africa (FARA) is an umbrella body for
coordinating activities of the Sub-Regional Research Organisationa (SROs) in Africa.
FARA’s Mission is the creation of broad-based improvements in agricultural
productivity, competitiveness and markets by supporting Africa’s sub-regional
organisations in strengthening capacity for agricultural innovation. FARA has
developed five Networking Support Functions that correspond to the Results that
FARA envisions to achieve. These functions inter-relate and are: advocacy and
resource allocation (NSF 1), access to knowledge and technologies (NSF 2), regional
Policies and Markets (NSF 3), capacity Strengthening (NSF 4) and partnership and
Strategic Alliances (NSF 5). Details of these can be found under the FARA website
(www.fara-africa.org).
The African Biotechnology and Biosafety Policy Platform (ABBPP) is a project
developed under the Regional Policies and Markets (NSF 3) function. Under the
ABBPP, FARA will: help sub-regions to prepare for significant international events
concerned with biotechnology and biosafety. This will enable African policy makers
to take a unified informed position on issues of biotechnology and biosafety.
Secondly, FARA will build the necessary political awareness on the potential role of
biotechnology in alleviating hunger in Africa and the need for biosafety policies,
legislation and regulations. Finally, FARA will support capacity building in
biotechnology by initiatives such as the integration of biotechnology into the
Comprehensive African Agricultural Development Program (CAADP.
ABNE of NEPAD/ABI
The African Biosafety Network of Expertise (ABNE) is an initiative of the NEPAD
African Biosciences Initiative (ABI) funded by the Bill and Melinda Gates
Foundation with the Michigan State University (MSU), Development Alternatives,
Inc as executing partners. The purpose of ABNE is to “help regulators access the
most up-to-date training, data, and resources needed to properly regulate
biotechnologies, ensuring countries are able to take full advantage of advances while
safeguarding consumers and the environment”. The regulatory agencies targeted for
support are the National Biosafety Committees (NBCs), Institutional Biosafety
Committees (IBCs) and Plant Quarantine agencies (PQs).
91
ABNE met last month in Ougadougou to validate the needs of regulatory agencies
earlier surveyed for these needs. ABNE is completing the planning phase this year
and will enter the implementation phase next year. It is expected that the central node
for ABNE will be in Ougadougou, Burkina Faso.
PBS efforts
The Program for Biosafety Systems (PBS) is an initiative funded by the USAID and
coordinated globally by the International Food Policy Research Institute (IFPRI) to
help countries in Africa, South Asia and South East Asia to develop the capacity to
make science-based decisions on the development and use of modern biotechnology
(GM) products. It is a 5-year project that was launched in May 2003. It ended this
year (2008) for West Africa. In West Africa, PBS operates in Ghana, Mali and
Nigeria.
The objectives of PBS in these countries are: to facilitate the development and
implementation of biosafety legislation, to build the needed capacity to be able to
conduct field trials on GM products as well as conduct environmental and food safety
assessments, to create the necessary awareness on issues of biotechnology in a crosssection of stakeholders to enable the taking of informed decisions on biotechnology,
to develop a biotechnology/biosafety policy for the country and to train in biosafety
and food safety. Ghana and Mali have been adequately prepared by the PBS to
conduct field trials. The PBS website is www.ifpri.org/themes/pbs/components.htm.
Training and other capacity building needs
The priority area identified by countries in West Africa (Alhassan, 2003) and Africa
at large for biosafety training is risk assessment and management. Crucial supporting
areas of training are food safety, GM product sampling and analysis and molecular
biology. A strong manpower base and supporting infrastructure are crucial for the
success in risk assessment and management of GM products. A complement of staff
with expertise in ancillary subjects (Alhassan, 2001) will enhance the effectiveness in
biosafety monitoring and management:
Funding challenges
The AU, ECOWAS, the Conference of the Parties serving as Meeting of the Parties
(COP-MOP) to the Cartagena Protocol have all urged African countries to provide
financial resources and other support for training and education in biosafety, including
the provision of scholarships and fellowships for students from developing countries.
Various donor initiatives also exist to support the capacity in biosafety through
training. These include the USAID support to the PBS and MSU, the recently
announced Bill & Melinda Gates Foundation support to capacity building in biosafety
and training under ABNE and announcements from European institutions such as
Geneva University and from African institutions such as BioSafeTrain. The most
sustainable funding source will be the initiative from African governments to actually
fund the plans for capacity building it draws.
92
Suggested Integrated Approach to Capacity Building
There is the need to harmonise the activities of the various agencies supporting
biosafety capacity building in Africa. FARA is in a central position to be able to
coordinate these diverse capacity building efforts through its ABBPP. FARA’s SROs
have a crucial role to play in the execution of the harmonized tasks.
Conclusion
There is the need to quicken the pace of biosafety legislative development and
implementation in West Africa than is currently experienced to allow the countries to
take up an even bigger challenge for the development of capacities in modern
biotechnology research, development and commercialization to meet the challenges of
stagnation in agricultural productivity and the reduction of rural poverty that is
endemic in the sub-region. Biosafety capacity development should not be an end in
itself but a means to realizing the bigger goal for the sustainable exploitation of
modern biotechnology for the good of the sub-region.
References
Alhassan, W. S. 2001. The Status of Agricultural Biotechnology in Selected West and
Central African Countries. IITA, Ibadan, Nigeria. 57 pp)
Alhassan, W. S. 2003. Agrobiotechnology application in West and Central Africa.
IITA, Ibadan. 107 pp.
James, Clive. 2007. Global Status of Commercialized Biotech/GM Crops: 2007.
ISAAA Brief No. 37. ISAAA, Ithaca, NY).
Linacre, N. A., Jaffe, G., Birner, R. Dieng, P. M., Quemada, H, and Resnicks, D.
2006. Final Report for the World Bank. West Africa Biosafety Stocktaking
Assessment. World Bank, Washington, DC
Pray, C., Paarlberg, R., & Unnevehr, L. (2007). Patterns of political response to
biofortified varieties of crops produced with different breeding techniques and
agronomic traits. AgBioForum, 10(3), 135-143. Available on the World Wide
Web: http://www.agbioforum.org.
93
BACKGROUND ECOLOGICAL STATUS OF SOIL MICROBIAL
COMMUNITY BEFORE EXPOSURE TO BT COTTON FARMING
Swilla J†††††††1 and M. S.T Rubindamayugi1
University of Dar es Salaam, Department of Molecular Biology and
Biotechnology
P.O.Box 35179, Dar es Salaam, Tanzania
Abstract
Microorganisms dominate soil borne communities accounting for 80% of the total
biomass (excluding roots) and largely determine ecosystem functions such as nutrient
cycling and decomposition. This study examines the current rhizospheric microbial
community structure in the previously cotton growing southern Tanzania which is
under a quarantine. Rhizospheric soils from four different places obtained at 0-15 cm
depth were collected in Chunya district for laboratory analysis. The soil organic
matter content ranged between 3.1 to 5.3 % while soil pH ranged between 6.92 and
7.38. The total microbial abundance in soils were enumerated by the pour plate
method ranged from 264x108 to 304x108 colony forming units per gram (wet weight)
of soil (cfu/g) for bacteria and 20x108 to 36x108 cfu/g for fungi. The highest bacterial
and fungal of 304x108 and 30 x108 cfu/g soil respectively were enumerated in
Magamba village.
Key words: Ecosystem function, rhizosphere ecosystem, soil microbes, biomass, Bt
toxin, roots and cotton
†††††††
Corresponding Author: Joseph Swilla; rexswillaj@yahoo.com, +255 741 509 705
90
Introduction
The use of recombinant DNA technology to develop transgenic or geneticallymodified (GM) crops is regarded as a significant breakthrough for food production.
Many crops have been transformed to provide enhanced resistance against pests and
diseases. The most widely grown GM crops are expressing endotoxins of Bacillus
thuringiensis (Bt) active against Lepidopteran and Coleopteran insect pests (James,
2004). However, the majority of the general public remains doubtful about the
advantages and is concerned about the potential risks of this new technology
(Crawley, 2001; Poppy, 2000).
Studies addressing concerns about the environmental risks associated with the release
of transgenic crops including the potential impact on non target organisms, such as
beneficial insects, soil bacteria, and fungi have been done. However most studies have
been concentrated on upper part of the plants and few studies have focused on the
under soil part of the plants (Castaldini et al., 2005). Soils contain the most diverse
eco-systems with many thousands of different species of bacteria, protozoan, fungi,
micro and macro-fauna. Numbers and activities are both temporally and spatially very
variable. The bacterial groups and fungal communities perform many functions and
transformations such as transformation of mineral nitrogen for plant growth
promotion, pathogen inhibition and nutrient mobilization (van Elsa et al., 1997).
Laboratory and field studies have demonstrated that B. thuringiensis toxin is released
in soil through three main pathways: (i) root exudates (Saxena and Stotzky, 2000) (ii)
plant residues plowed into the soil (Zwahlen et al., 2003) and (iii) pollen falling down
(Losey et al, 1999). In soil, B. thuringiensis toxin does not change its conformation
(Lee et al., 2003) and remain active, protected from bacterial degradation by
adsorption to clays or linkage to humic acids (Koskella and Stotzky, 1997). Moreover,
B. thuringiensis toxin released through corn root exudates retains its activity for 180
to 234 days in both laboratory and soil experiments (Saxena and Stotzky, 2001), thus
representing a potential risk for non target organisms and soil ecosystem (Lee et al.,
2003; Zwahlen et al., 2003).
Tanzania cotton growing soils (belts) are estimated to cover more than 450,000
hectares annually. Cotton soils are particularly important for millions of farmer’s
communities as they support subsistence, cash (forex) and provide other ecological
and social economic benefits. Of the three cotton growing areas, the Western and
Eastern cotton growing zones are the major zones where cotton is grown. There is a
third zone (Western cotton growing zone), is under quarantine due to the Red
Bollworm infestation since 1968. This zone is in the southern Tanzania stretching
from Lindi through Mbeya (Temu and Mrosso, 1999). This is the area where
Tanzania plans to introduce Bt cotton to lift the quarantine with the main goal of
expanding the area under cotton production.
Introduction of Bt cotton raise concerns on its impact on soil biodiversity, ecological
processes and ecosystem functioning (REF). Therefore a prior study on impact of Bt
cotton on soil ecosystem insight on Bt cotton and ecological interaction of these units
and hence an establishment of non target effects of cultivating Bt cotton is important
and will contribute towards understanding of the functioning of transgenic cotton in
Tanzanian soil. The objective of this study was to understand the impact of Bt toxin
89
on tropical soil microbial communities within the rhizosphere of conversional cotton
and on interaction of beneficial microbes.
Study site
Chunya is among the five districts in Mbeya region. The district landform is
characterized by gentle undulating plains with inselbergs. Altitude ranges between
100-1500 m above sea level. Rain season starts in November and ends in Arpil or
early May with an annual average rain of 750-900 mm. Chunya temperature regimes
is isothermic. Generally soils are characterized by deep sands, sandy clay and over
sandy loam ((Albic, Arenosol, Fine sodic, Eutic Gleysol).
Sample Collection
Samples (soil) were collected from the four villages between S 08o 36′ 16.5′′ and E
033o 56′ 090′′ in Chunya district between September 5th and 10th 2007. These villages
are on cotton growing trial plots, to monitor the occurrence of red bollworm. The soils
represent a range of physico-chemical properties and climatic zones of Chunya
district and were collected down to a depth of 0-15 cm. At each site, 3 samples were
taken from different spots which were bulked to obtain a representative sample for the
site.
Plate count (Colony forming units)
The microbial count was carried out by the pour plate method. About 15-20 ml of
culture medium 450C was added in 1 ml of sample and mixed well. Each sample was
then incubated both at 360C for 4 hours as well as 22 0C for 68 hours. Finally the
colonies per plate were counted for each inoculation temperature and the microbial
count per milliliters calculated
Extraction of DNA from bacterial communities in rhizosphere
The 0.3g of sediment samples was bottled on filter paper being transferred into a 2 ml
vial containing 0.5 g of sterile glass beads (0.1 mm).A total of 0.8 ml extraction buffer
was gradually added to make homogeneous slurry. Vials were then shaken in the
beater (Mkiro dismembrator B.Braun Biotech International) for 2 min at 2000rpm.
60µl of 20% SDS was added, contents mixed by vortex and incubated at 60oC for 1
hr. During incubation tubes are inverted every 20 minutes. About 600µl of
Phenol/Chloroform/Isoamyl alcohol (25:24:1) was added and tubes incubated at 65oC
for another 20 min (mix by inversion every 7 minutes). Vials were finally vortexed
briefly (10 seconds) and centrifuged for 10 minutes at 14000 at room temperature.
Aqueous phase was then transferred to a fresh tube and mixed with one volume of
Chloroform/Isoamyl alcohol (24:1) vortexed again for 20 seconds and centrifuged for
10 min at 14000rpm at room temperature (as above). Aqueous phase was again
transferred to a fresh tube and DNA precipitated by mixing with ice cold 0.6 volume
iso-propanol and incubated at -20 oC for 20 minutes. A DNA pellet was obtained by
centrifugation at 14000rpm at 4oC for 5 minutes. The pellets were washed by
90
centrifugation at 14000rpm with 300 µl of 70% ethanol and air dried at room
temperature for about 10 minutes. DNA pellets were finally re-suspended in 50µl
TE/Water and stored at -20 oC.
Results
The soil sample was homogenized under a fume hood to prevent contamination from
exogenous bacteria. Determination of the total microbial count was carried out by the
pour plate method (using Peptone Yeast Extract Agar).
Fig. 1 Culture plate showing densely diverse microbial colonies from the soil samples
Table 1: Plate count of CFU/10g (Bacterial and Fungal)
Village (sample
source)
Mbala
Magamba
Galula
Ifumbo
Bacterial CFU
(mean)
300 x 108
304 x 108
289 x 108
264 x 108
Fungal CFU
(mean)
20 x 108
36 x 108
24 x 108
32 x 108
Table 2: The soil represents a range of physico-chemical properties
Village (sample
source)
Mbala
Magamba
Galula
Ifumbo
Soil pH
(Mean)
7.28±0.04
7.29±0.08
7.21±0.09
6.93±0.03
91
% OM (mean)
4.32±0.92
4.75±0.09
3.55±0.07
3.08±0.03
Microbial Community Structure
Genomic DNA was extracted from the four samples according to a modified Zhou et
al 2002 method for DNA extraction. Potassium acetate was used to purify it (three
times) before PCR analysis.
PCR results
Amplification of partial 16S rDNA genes from directly extracted DNA
The extracted community DNA was amplified using primers Com1 (5’ CAG CAG
CCG CGG TAA TAC 3’) and Com2Ph (5’ CCG TCA ATT CCT TTG AGT TT 3’)
(Schwieger and Tebbe 1998), with the latter primer be phosphorylated at the 5'-end, to
result in PCR products corresponding to positions 519–926 of the 16S rRNA gene of
Escherichia coli (Brosius et al. 1978). The PCR mixture contained 1 µl of each
primer (Fermentas) and 1.25 µl of Taq polymerase with the corresponding 1 × PCR
buffer containing 1.25 µl MgCl2.
All reagents, including the Taq polymerase, were prepared as a master solution and
were pipetted into the PCR tubes. Template DNA (1 µl) was added to a final volume
of 25 µl for each PCR. The thermocycling will be done in a Biometra 96 cycler
(MWG Biotech). An initial denaturation step at 95 °C for 15 min will be followed by
30 cycles of 60 s at 94 °C, 60 s at 50 °C, and 70 s at 72 °C, and a final extension of 5
min at 72 °C. Resting stage will be at 4°C. The PCR amplifications for each sample
was carried out in duplicates and the PCR products analyzed for size and quantity by
agarose gel electrophoresis and staining with ethidium bromide (Sambrook et al.
1989).
Fig. 2 Eppendorf tubes showing genomic DNA extracts suspended in TE buffer
(brown color shows the humus)
Reagents
The PCR mixture (25 µl total volume) contained the following: x1 PCR buffer (2.5
µl); 10mM MgCl2 (1.25 µl); 10mM dNTP (0.5 µl); Taq Polymerase (0.125 µl);
Primer Forward +Backward (1+1) (2.0 µl); Template DNA (1.0 µl) and MQ (18.62
µl)
90
PCR Conditions (30 cycles)
According to Coughlin et al, 1999, the thermal cycler condition were as follows:-94
0
C for 30 seconds (preparation stage/pre-denaturation); 94 0C for 2 min (initial
denaturation); 55.5 0C for 1 min (denaturation); 72 0C for 1.30 min (Extension); 72 0C
for 10 min (final extension); 4 0C for 24 hrs (resting stage)
Fig 3.Community PCR product showing positive products at well number 3 and 4 (band size
1300-1400 bp) with primers 27F and 1492R. The DNA was resolved on a 1.5% agarose gel.
Diversity analysis
The purified DNA was the template for PCR amplification of the 16S rDNA genes.
The oligonucleotides chosen have been shown to amplify most eubacterial 16S
rDNA; 27F and 1492R primers (Fig 6) (Fermentas Inc. 798 Cromwell Park Drive.
Glen Burnie, MD 21061, Sweden). The amplified sequences have been cloned into a
torpor vector and sequenced (Inqaba, South Africa). The 16S rDNA gene sequences
will be identified using BLAST (Basic Local Alignment Search Tool,
http://www.ncbi.nih.gov/BLAST)
91
Fig 4. Completed Biosafety laboratory (Level II) where confined experimental Bt
cotton will take be grown once importation permits are completed (University of Dar
es Salaam)
Discussion
Pour plate method revealed a densely diverse microbial population in the soil samples
from Chunya district (Fig. 1). The colony forming units per units (cfu/g) results
reported from this study (Table 1) are within the range of other findings already
reported by others .Turco et al., 1995 and Hazen et al., 1991 reported that under
optimal growing conditions, total microbial abundance in soils can exceed about 106
to 108 colony forming units per gram (dry weight) of soil (cfu/g) for bacteria; 106
cfu/g for actinomycetes, and 105 cfu/g for fungi. Moreover it has been reported that,
due to relatively low recovery efficiencies from soils, population densities of total
recoverable heterotrophs within soils usually range between about 104 and 107 cfu/g
(Turco et al., 1995).
In this study the number of soil microbes (bacteria and fungi) vary slightly within
sampled sites. This can be attributed by the slight nutrient and organic matter
variability of the soil (Table 2). According to Zhou et al (2002) spatial and resource
factors influence microbial numbers and diversity in soil. Competition also has been
reported to drive the structure of the aqueous maintained microbial communities
(Rashit and Bazin, 1987). Moreover, both theoretical and empirical studies suggest
that in plant, microbial and animal communities competitive interaction is the key
determinant of species abundance and diversity (Huston, 1994). The universal primers
used to amplify the 16S rDNA Com1 and Com2Ph didn’t gave results (Fig. 3) well
numbers 1 and 2 while well 3 and 4 gave results (primers 27F and 1492R) with bands
at 1400 bp. Although purification was done, interference from humic acids and humic
acid complexes could probably hampered primers attachments and hence
amplification. Kuske et al, (1998), reported that the variability in detection sensitivity
due to uncontrollable factors, such as background DNA and inhibiting materials such
as humic acids that co extract with the DNA needs an internal control.
90
Conclusion
Our results clearly signifies the southern Tanzanian soil (under quarantine) is very
diverse microbiologically and our on going study will contribute to our understanding
of vast reservoirs of the Tanzania tropical microbes. Moreover any change that will be
detected in the Biosafety laboratory (Fig. 4) experiments due to Bt toxin exposure will
give a crucial information prior to acceptance and hence cultivation.
Acknowledgements
Thanks are due to Dr Rubindamayugi of the University of Dar es Salaam for
supervising and the BioSafe Train for Funding. Dr K. Hosea for molecular technical
assistance, Inqaba Biotech (South Africa) for the sequencing part.
References
Castaldini M., A. Turrini, A. Fabiani, S. Landi, F. Santomassimo and C. Sbrana
(2005). Impact of Bt Corn on Rhizospheric and Soil Eubacterial Communities
and on Beneficial Mycorrhizal Symbiosis in Experimental Microcosms. Appl.
Environ. Microbiol 71 (11): 6719-6729
Coughlin M.F., B.K. Kinkle and P.L. Bishop (1999). Degradation of Azo dyes
containing aminopaphtol by sphingomonas spp. stain ICX Ind. Microbiol
Biotechnol 23: 314-346
Crawley M.J., S.L. Brown, R.S. Hails, D.D. Kohn and M. Rees (2001). Transgenic
crops in natural habitats. Nature 409:682-683.
Hazen, T.C., L. Jimenez, G. Lopez de Victoria and C.B. Fliermans (1991).
Comparison of Bacteria from Deep Subsurface Sediment and Adjacent
Groundwater. Microbial Ecology. 22: 293-304.
Heuer H. M. Krsek, P. Baker, K. Smalla and E.M. Wellington (1997). Analysis of
actinomycetes communities by specific amplification of 16S rDNA and gel
electrophoretic separation in gradient. Appl. Environ. Microbiol 63: 32333241
Huston, M. A. (1994). Biological diversity: the coexistence of species on changing
landscapes. Cambridge University Press, New York, N.Y.
James C. (2004). Preview Global status of commercialized transgenic crops,
International Service for Acqisition of Agri-Biotech Applications.
Koskella and Stotzky (1997). Lavicidal toxins from Bacillus thuringiensis subsp.
kurstaki, morrisoni (strain tenebrionis) and israelensis have no microbicidal or
microbiostatic activity against selected bacteria, fungi and algae in vitro. Can.
J. Microbiol. 48:262-267
Lee L., D. Saxena and G. Stozky (2003). Activity of free and clay bound insecticidal
90
protein from Bacillus thuringiensis sbsp. Israelensis against the mosquito
Culex pipiens. Appl Environ Microbiol 69: 4111-4115
Losey J.E., L.S. Rayor and L.S. Carter (1999). Transgenic pollen harms monarch
larvae. Nature 399: 214.
Milling A., K. Smalla, F.X. Maidl, M. Schloter, J.C. Munch (2004). Effects of
transgenic potatoes with an altered starch composition on the diversity of soil
and rhizosphere bacteria and fungi. Plant and Soil. 226: 26-39
Poppy (2000). GM crops: Environmental risks and non-target effects. Trends Plant
Sci. 5:4-6
Rashit, E. and M. Bazin (1987). Environmental fluctuation, productivity and species
diversity-an experimental study, Microb. Ecol 14:101-112
Saxena D. and G. Stotzky (2000). Insecticidal toxin from Bacillus thuringiensis
released from roots of transgenic Bt corn in-vitro and in-situ. FEMS
Microbiology Ecology 33: 35-39
Schwieger F. and C. Tebbe (1998). A New Approach to utilize PCR-Single-StrandConformation Polymorphism for 16S rRNA Gene-Based Microbial
Community Analysis. Applied and Environmental Microbiology, 64(12) 48704876
Sambrook J., E.F. Fritsch, T. Maniatis (1989). Molecular Cloning: A Laboratory
Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
New York.
Temu E.E. and F.P Mrosso (1999) The Cotton red bollworm (Diparopsis castanea
Hmps) (Lepidoptera) and the quarantine area in southern Tanzania. Ministry
of Agriculture and Cooperatives, The United Republic of Tanzania, June-July
1999.
Turco, R.F. and M.J. Sadowski (1995). The Microflora of Bioremediation. In Skipper
H.D. and R.F. Turco (ed), Bioremediation, Science and Applications. 87-103.
Soil Science Society of America Special Publication 43.
Van Elsa J.D., L.S. Van Overbeck, J.A. Van Veen (1997). Fate and Activity of
microorganisms into soil. Mol. Biol. Rev. 61:121-133
Weisburg W.G., S.M. Bams, D.A. Pelletier, D.G. Lane (1991). 16S rDNA
amplification for phylogenetic analysis. Journal of Bacteriology 173: 697-703.
Wilson, I. G. (1997). Inhibition and facilitation of nucleic acid amplification. Appl.
Environ. Microbiol. 63:3741-3751
Zhou J., M.A. Bruns and J.M. Tiedje (2002). DNA recovery from soils of diverse
composition. Appl. Environ. Microbiol. 62(2): 316-322
Zwahlen C., A. Hilbeck, R. Howald and W. Nentwig (2003) Effects of transgenic Bt
corn litter on the earthworm Lumbricus terrestris. Molecular Biology 12: 1077-1086.
90
REVIEW PAPER ON THE STATUS BIOTECHNOLOGY IN
NIGERIA: A CASE STUDY OF NABDA AND ROAD MAP MODEL.
Solomon, B.O.1‡‡‡‡‡‡‡, Gidado, R.S.M.1, and ADETUNJI, O.A.1
National Biotechnology Development Agency (Nabda),
No. 16 Dunukofia Street, Former C.A.C Building, Area 11,
P.M.B. 5118, Wuse-Abuja, Nigeria.
1
Abstract
In an attempt to latch on the fast moving biotechnology wagon, the Federal
Government of Nigeria put in place a National Biotechnology Policy (NBP) in April;
2001. In a move towards effective implementation of this policy, the Government
took a step further to establish the National Biotechnology Development Agency
(NABDA) in November, 2001. The agency oversees the biotechnological activities in
the Country. The need to disseminate and showcase information about
biotechnologies prompted the preparation of this review paper in which a clear review
of biotechnologies in the world scene, activities of NABDA are also presented with
major emphasis on the programmes and the road map model for the status of the
development of biotechnology in Nigeria.
‡‡‡‡‡‡‡
Corresponding author: E-mail:bosconsult@yahoo.com and roxydado@yahoo.com
91
Introduction
In an attempt to latch on the fast moving biotechnology wagon, the Federal
Government of Nigeria put in place a National Biotechnology Policy (NBP) in April;
2001.In a move towards effective implementation of this policy, the Government took
a further step to establish the National Biotechnology Development Agency
(NABDA) in November, 2001. The agency has been in existence for six years
overseeing the biotechnological activities in the Country. The need to disseminate and
showcase information about biotechnologies prompted the preparation of this review
paper. In this paper, a review of the activities of NABDA are presented with major
emphasis on the programmes for the development of biotechnology in Nigeria.
Biotechnology has been classified into Traditional and Modern based on the premise
that biotechnology is not a new field of endeavour rather it dates back to antiquities.
All people have their unique ways of food processing, fermentation of food and
beverages, selective breeding of plants and animals, Pest Control, Different
Agronomic methods such as Shifting Cultivation, Bush fallow, mixed cropping,
Composting, planting of Nitrogen fixing trees all these activities fall under traditional
biotechnology (Persley & Doyle, 1999 and Per-Pinstrup Andersen 2001). The Modern
Biotechnologies started around 1950s with the following major components,
Genomics & Proteomics, Bioinformatics, Genetic Transformation, Biodiagnostics,
Vaccine Technology, Recombinant DNA Technology, Regenerative Technology,
Nanobiotechnology and Micro array.
Recently, the biotechnology programmes in Nigeria were holistically restructured and
handled by the five technical departments namely: (i) Agricultural Biotechnology and
Bioresources Development (ii) Food and Industrial Biotechnology (iii) Medical
Biotechnology (iv) Environmental Biotechnology and Bioresources Conservation and
(v) Molecular Biology and Bioinformatics.
The key programmes of each technical department are:
Food and Industrial Biotechnology Department
The development of the bioprocess industry including the production of alcohol,
bioplastics, enzymes, citric acid, baker’s yeast, soy yoghurt (Adetunji, et al. 2006,
Rose, 198; Sasson, 1989; Rimington et al., 1992; Linden, 1982; Eveleigh, 1981 &
Kenney et al., 1983) glucose syrup & maltose syrup at commercial scale using locally
available substrates (e.g. cassava, corn & sorghum) is currently being pursued by this
department. In addition, the department is also promoting the production of
biopesticides, biofertilizer, recombinant DNA products, e.g monoclonal antibodies
and therapeutic proteins. The department is also promoting Bioentre-preneurship with
a view of transferring most innovation/invention in various Nigerian Universities into
commercialization.
Molecular Biology and Bioinformatics
The polymerase chain reaction (PCR)-based diagnostics are the most common tool in
the molecular biology and bioinformatics. The main focus of this department is the
acquisition of the cutting-edge technology for use in genomics and proteomics studies
and drug development as well as the development of molecular biology techniques for
89
application in plant & animal improvement and in the health care sector. This
Programme addresses diseases such as the rampaging HIV virus and the emerging
avian flu virus H5N1 strain (http://BIOBiotechnologyIndustryFacts.htm ; Walgate,
1983 and Nwangwu M., 1993). The development of relevant national databases is
also part of the responsibility of this department. Recombinant DNA activities to be
pursued include Cloning gene constructs in Escherichia coli and Mini-preparation of
gene constructs
Agricultural Biotechnology and Bioresources Development:
This department is set up to elaborate mechanisms for exploitation of the Nation’s
rich agricultural bioresources as economically viable environmentally sustainable and
socially acceptable means for our agricultural stewardship (Persley, 1992; Senez,
1987; Borlang, 1983; Hollo, 1995; Ketchum et al 1987, Sasson 1986, 1987; Butengo
and Shamina, 1987; Leemans, 1993; Wilkinson, 1997; Cooke 1982, Raman and
Krattiger, 1995; Raines, 1988 & Vasil et al, 1992).
Environmental Biotechnology and Bioresources Conservation:
This department focuses on the promotion and conservation of indigenous microbes
capable of utilizing waste in industrial gas emission, as well as waste water. To
coordinate biodegradability studies and selection of adapted microbial communities
for bioremediation of Oil polluted Niger Delta region of Nigeria. (Okpokwasili, 1993,
Solomon et al, 1986 and Layokun et al, 1987, Oboirien et al, 2005 & Ojumu, et al.
2005).
Key areas of Research in environmental biotechnology are: (a) Bio-remediation of oil
and pesticide polluted sites (Solomon et al, 1986 and Layokun et al, 1987), (b)
Isolation of microbes for resource recovery in waste mines, (c) Identification and
patenting of indigenous oil licking micro-organism, (d) Development of bio-sensors
for environmental monitoring of contaminant transport, (e) Development of plant
species suitable for erosion control and for afforestation, (f) Identification and
Patenting of waste degrading bacteria, (g) Enhancing habitat suitability index (HSI) of
habitats for trading in waste, (h) Metal recovery from waste water using microbes and
(i) Ecosanitation.
Medical Biotechnology:
A major responsibility of biotechnologists in the 21st century will be to develop lowcost, affordable, efficient, and easily accessed health care systems. Genetic
engineering promises to treat a number of mono-genetic disorders, and unravel the
mystery of polygenetic disorders. Based on this premise, the main activity of this
department is to coordinate and promote the development of various vaccines and
drugs for diseases that are found in Nigeria such as: HIV/AIDS, malaria, hepatitis B&
C, meningitis, Cholera, Infectious diseases. T
Project Initiatives and Road Map Model
Improved Crops and Economic Trees using Genetic Engineering tools.
NABDA plans to focus on facilitating the development of improved crops such as
Cotton, Cowpea, Corn, Rubber, Palmtree, Cassava, Cocoa and Rice using various
90
genetic manipulation techniques. This is to obtain improved varieties of crops with
higher yields and with resistance to pests, diseases and environmental stresses. This
project will be carried out in collaboration with SHESTCO, IAR and NACGRAB, our
seventh zonal center located at Ibadan. Presently, under the Nigeria Agriculture
Biotechnology Project (NABP), the agency is collaborating with the USAID &
I.I.T.A on Cassava and Cowpea projects. The agency aims at delivering Bt-Cotton,
Bt-Corn, and Bt-Rice into the agricultural sector within the next two years.
Aqua Culture and Mushroom Production techniques
The Agency has commenced to aggressively pursue the acquisition and deployment
of high tech aqua culture techniques and mushroom production and the proliferation
of these in various parts of the Country in other to empower youth and women so as
to fulfill the NEEDS & MDG objectives. Human Capacity building are also being
given high priority since currently the Chinese experts at our BIODEC, Odi is on
contract, six scientific officers of the agency have been sponsored for six months to
undergo training on the mushroom production technology and the aquaculture, after
which, the capacity will be utilized in any other part of the country.
Iimproved breeds of animals for livestock industry.
The livestock industry will also gain attention as we intend to improve on the various
types of livestock’s e.g Cattle, Goat & Sheep with capacity to grow fast and be
meatier and with ability to produce more milk for ailing diary industry through
genetic improvement of our local breeds, this will be in collaboration with National
Livestock Research Institute, (NLRI, ABU, Zaria).
Promotion and development of Bioprocess industries in the Country.
The institutions shall come up with laboratory scale results and the agency shall look
for investors both within and outside the country for commercialization. The
bioreactor is the vessel in which the biochemical reactions take place. This vessel
constitutes only a part of the total equipment used for production in a typical
biochemical process. A typical 5-L bioreactor costs about N4,000,000.00. Therefore,
it is imperative that the agency shall develop a package for locally producing and fully
commercializing this equipment.
Vaccines & Drugs for Nigerian teeming population.
NABDA in collaboration with other major stake holders in Health sector will focus on
ways of finding solution to diseases that are found in Nigeria.
The agency has been spearheading the private-public partnership in this area,
especially on the production of vaccines capable of preventing diseases like malaria,
hepatitis B & C and AIDS. The joint venture between Federal government of Nigeria
and Trinity Biotech of Ireland, on the manufacture of HIV and Malaria Diagnostic
Kits in Nigeria at SHEDA, Abuja, Nigeria is another mile stone in the development of
Medical Biotechnology in Nigeria.
Microorganisms for Bioremediation of Crude oil spillage.
91
NABDA in collaboration with other parastatals under Federal Ministry of Science and
Technology will study the different types of waste (both domestic and industrial)
generated in Nigeria. Indigenous microbes capable of utilizing waste shall be isolated,
characterized and studied to determine their efficiency. Biological treatment of
Volatile Organic Compounds (VOC) in industrial gas emission, as well as
wastewater, biodegradability studies and selection of adapted microbial communities,
bioprocess development (cultivation techniques and process control) shall also be
established so that affected industries can seek the service of the agency.
Coordination and development of Nigerian Human Capacity in Bioinformatics.
This is the science of informatics as applied to biological research. Informatics is the
management and analysis of data using advanced computing techniques.
Bioinformatics is particularly important as an adjunct to genomics and proteomics
research, because of the large amount of complex data this research generates. The
agency will work towards setting up a national databases on malaria, trypanosomiasis,
HIV / AIDS etc that will be accessible globally.
Establishment of Collection Centre for Micro organisms
This will be patterned towards the German Micro organisms Collection Centre
(DSMZ), Braunschweig. All micro organisms isolated and characterised in Nigeria
shall be submitted to this centre. The agency will be generating money from this kind
of venture by selling to those who wish to make use of the micro organisms. Those
seeking information on any micro organism in Nigeria for bio-remediation,
conversion of urban waste to organic fertilizer / bio-gas and especially for the
Pharmaceutical Company will be able to get them from the agency.
Development of Bioethics regulatory framework.
The agency will put in place regulatory mechanism for all biotechnological matters in
the country. The agency shall, therefore, come up with policy for the nation on
genetically modified foods and products. Any laboratory or industry wishing to work
on genetic engineering related products shall be investigated by the agency and
approved before commencement of such work.
Development of Centres of Excellence
The agency is already driving the mechanism to develop six zonal centres of
excellence in each geopolitical zones of the country. The following zones were
selected for equity and effectiveness South East Zone at University of Nigeria,
Nsukka, South-West zone located at University of Ibadan, South- South zone located
at University of Port-Harcourt, North East Zone, located at university of Maiduguri,
North- West zone located at Ahmadu Bello University, Zaria and North Central zone
located at University of Jos. The biotechnology advanced laboratory (BAL), will
serve as the main hub to other centers (Figure 2).
Figure 2: The National Biotechnology Network connecting the centres of
excellence
92
NATIONAL BIOTECHNOLOGY
DEVELOPMENT AGENCY
(NABDA) ABUJA
NW–ZBC
SW–ZBC
NC–ZBC
NE–ZBC
SE–ZBC
SS–ZBC
Ahmadu
Bello
University,
Zaria
University of
Ibadan,
Ibadan
University
of Jos,
Jos
Universit
y of
Maidugu
University of
Nigeria, Nsukka
University of
Port Harcourt,
Port Harcourt.
BAL,SHEDA
Zaria
Sokoto
Kaduna
Kebbi, etc
Ibadan;
Abeokuta
Oyo;
Ogbomosho
Akure; Ife
Lagos;
Akungba
Jos;
Badeggi
Idah;
Bida
Vom;
Kainji
Minna;
Maidu
guri
Yola
Bauchi
etc
Nsukka;
Owerri
Enugu;
Umuahia
Abakiliki;
Uturu
Awka; Nnewi
Port Harcourt;
Auchi
Benin City; Warri
Yenagoa; Odi
Calabar; Uyo
etc
Promotion of investment in biotechnology
As part of fulfilling the agency’s mandate on the promotion of investment in
biotechnology, several consultations are currently going on with some potential
investors from abroad to attract investment in the area of biotechnology into the
country. This is being done in collaboration with local investors and will definitely
ushered in an era whereby new technologies from abroad will be transferred to our
teeming willing local investors for adaptation into the local community.
Deploring of Biotechnology into Non-formal Education Sector
The Non-formal Education sector is currently being taken care of by the agency’s Bio
resources Development Center (BIODEC) located in Bayelsa State. While the zonal
centres of excellence are set up to take care of the training of graduates in all the
various field of biotechnology in Nigerian higher institution, the non-formal education
sector comprising of women, youth and aged adults will be empowered through the
deployment of biotechnological tools vis-à-vis utilisation of bio resources for profit
making, trainings were organised for 300 youths and women of Niger Delta region of
Nigeria on the domestication of grass cutter, aqua culture and mushroom production.
Identification of Various Nigerian Bio resources based on Genetics.
It is worthy of mentioning that the Country is blessed with abundant bio resources of
immense values. Some of the bio resources are being used as food, medicine and for
other aesthetic values. However, most of these bio resources are being threatened by
extinction whereas they were not fully identified. Therefore, all the Nigerian Bio
resources
will
be
identified
using
the
modern
genetics.
90
References
Adetunji, O.A.; Betiku, E.; Ojo, A and B.O. Solomon (2006). “Effect of some selected
processing routes on nuitritional value of soy yoghurt”. Journal of Applied
Sciences 6(1): 527-530.
Aharonowitz, Y. and Cohen, G. (1981): The Microbiological Production of
Pharmaceuticals. Scientific American Vol 245, No. 3.
Bigelis, A. (1992): Food enzymes. In D.B. Finkelstein and c Ball, ed. Biotechnology
of Filamentous Fungi Technology and Product Butter Worth- Heinemann,
Stoneham MA, pp 361-415
Butenko, R.G. and Shamina Z.B., (1987): Hybrids for the Year 2000. In
Biotechnology, Agriculture and Development. The Courier Publication of
United Nations Education, Scientific and Cultural Organisation Paris.
Eveleigh, D.E. (1981): The Microbial Production of Industrial Chemicals. Scientific
American Vol. 245. No. 3
Emmons, D.B and Binns, M.R., (1991): Milk Clotting enzymes IV. Proteolysis during
Cheddar Cheese making in relation to estimated losses in basic yield using
chymosin derived by fermentation (A. niger) and modified enzyme from M.
miehei. Milchevisensschaft 46: 341-408.
Kennedy, R.C.; Melnick, J.L and Dreesman, G.R (1986): Anti-idiotypes and
immunity. Scientific American (New York) 255(1): 40-48.
Linden, H (1982): Immobilized alpha-D-alactosidase (EC 3.2.1.22) in the Sugar beet
industry. Enz. Microb. Technol 4: 130-136.
Mahoney R.R., (1985): Modification of Lactose and Lactose- Containing Dairy
Products with beta-galactosidase. Dev. Dairy Chem 3: 69-109
OTA, (1984): Commercial Biotechnology: An international Analysis (OTA-BA-218).
Washington D.C., U.S. Government Printing Office.
Persley, G.J. and Doyle, J.J. (1999): Overview. Biotechnology for- developing
country agriculture: Problems and Oppurtunities Focus 2. Brief 1 of 10. A
2020 Vision Brief. International Food Policy Research Institute, Washington
DC, USA.
Per-Pinstrup, A. (1999): Developing appropriate policies. Biotechnology for
Developing Country Agriculture: Problems and Oppurtunities. Brief 9 of 10.
A 2020 Vision brief. International Food Policy Research Institute, Washington
DC, USA.
Teeri, T.T.; Pentilla, M.; Nevalainen H.; and Knowles J.K.C. (1992): Structure,
89
Function and Genetics of Cellulases. In Finklestein, D. and Ball. C. (ed):
Biotechnology of Filamentous Fungi. Bulterworth Heinman, Stoneham MA.
Pp 419-445.
Vasil, I.K. (1986): Cell Culture and Somantic Cell Genetics of Plants Vol 3. Plant
Regeneration and Genetic Variability, New York, London Academic Press.
Young, R.A.; Mehra, V.; Sweetser. D.; Buchanan, T., Clark-Curtis, J.; Davis, R.W.;
Bloom, B.R. (1985): Genes for the major Protein Antigens of the Leprosy
Parasite Mycobacterium leprae. Nature (London), 316: 450-452.
Zambrysky, P.; Joos, H.; Genetello, C.; Leemans, J.; Van Mantagy, M. And Schell, J.
(1983): Ti plasmid vector for the introduction of DNA into plant cells without
alteration of their normal regeneration capacity Embo J2. 2143-2150.
90
Sorghum grain mold: challenges and benefits of risk assessment for food and
feed safety
S.S. Navi1§§§§§§§, X.B. Yang1, R.P. Thakur2, and V.P. Rao2
1
Department of Plant Pathology, College of Agriculture, and Life Sciences,
Iowa State University, Ames, Iowa 50011, USA,
2
ICRISAT, Patancheru, A.P. 502 324, India
Abstract
In a collaborative study between ICRISAT and ISU, we analyzed more than 900
isolates of Fusarium associated with sorghum grain mold samples collected from five
Indian locations for their speciation and fumonisins production potential. The isolates
were identified, based on their morphological characteristics, into six distinct species.
The frequency of occurrence of these species varied across locations and years
depending on the weather conditions. Among the six species of Fusarium,
isolates/strains of F. proliferatum produced the highest levels of fumonisins B1
(2.318–7.560 µg/g grain) followed by F. thapsinum, F. sacchari, F. verticillioides and
F. andiyazi (0.848 µg/g) in High-performance liquid chromatography. Further
research on identification of genetic resistance to fumonisins-producing isolates,
mechanisms, and role of weather variables is in progress to improve the risk
assessment and developing management practices of sorghum grain mold.
Key words: Fusarium spp., sorghum, grain mold, fumonisins, risk assessment
Introduction
Sorghum is one of the most important staple food crops in the semi-arid tropics of
Asia and Africa. Improvements in production, accessibility, storage, utilization, and
consumption of this food crop will significantly contribute to the food security of the
inhabitants of these areas (FAO 1995). Grain mold is one of the most important biotic
constraints to sorghum improvement and production worldwide. Production losses
due to sorghum grain mold range from 30% to 100% depending on cultivar, time of
flowering and prevailing weather conditions during flowering to harvesting (Singh
and Bandyopadhyay 2000).
Certain grain mold pathogens have consistently been associated with losses in seed
mass (Castor and Frederiksen 1980; Indira et al., 1991; Somani and Indira 1999),
grain density (Indira and Rana 1997; Castor 1981; Ibrahim et al., 1985), and
germination (Castor 1981; Maiti et al., 1985). Other types of damage that arise from
grain mold relate to storage quality (Hodges et al., 1999), food and feed processing
quality, and market value. Recently, Ravinder Reddy et al. (2007) have synthesized
information on seed system innovations in the semi-arid tropics that include storage
mold fungi, their frequency in rainy- and post rainy-season harvests, storage
structures, and cultivars. In India, more than 70% of the food grain production is
stored in bulk in different storage structures. Some of the storage structures are neither
rodent proof nor secure from fungal and insect attack. Inadequate storage methods
lead to substantial grain losses, about 6% in such storage structures, about 3% due to
§§§§§§§
Corresponding author: email: ssnavi@iastate.edu; fax: 515-294-9420
91
rodents, insects and fungi (Gwinner et al., 1996). The mycoflora associated with
sorghum grain pose the risk of contamination by mycotoxins (Gonz´alez, et al., 1997).
Fungi belonging to more than 40 genera are reported to be associated with sorghum
grain mold (Navi et al., 1999). In India, of the major fungi involved in grain mold
complex, F. verticillioides, C. lunata, and A. alternata are more pathogenic than
others and frequency of occurrence of these fungi varies with location and
environmental conditions during the cropping season (Thakur et al., 2003). A recent
study on variability among grain mold fungi through multi-location evaluation of
selected sorghum genotypes at five Indian locations for three rainy seasons revealed
predominance of F. verticillioides at Parbhani (Maharashtra state), of C. lunata and P.
sorghina at Patancheru (Andhra Pradesh state), and of A. alternata at both Parbhani
and Patancheru (Thakur et al., 2003 and 2006).
Some of the previous investigations conducted at ICRISAT or its collaborators’
locations that support this article include but are not limited to (i) effects of
temperature and humidity regimes on grain mold sporulation and seed quality in
sorghum (Tonapi, et al. 2007); (ii) effects of wetness duration and grain development
stages on sorghum grain mold infection (Navi, et al. 2005); (iii) effects of dew and
post inoculation incubation temperatures on sorghum grain mold infection (Navi, et
al. 2003), (iv) fumonisins production in molded sorghum grain (Navi, et al. 2005a),
(v) variation in occurrence and severity of major sorghum grain mold pathogens in
India (Thakur, et al. 2006), (vi) variability in sorghum grain mold complex (Thakur,
et al. 2003), and (vii) general information on sorghum grain mold (Thakur, et al.
2006a). Placing some of these studies in background we have aimed to developing a
risk assessment system/analysis for grain mold and managing the risk through
deployment of suitable host-plant resistance, to improve food/feed safety.
Identification of Fusarium species
From 30 molded samples at ICRISAT, 47 isolates of Fusarium were obtained and
purified by hyphal-tip culturing. One set each of the 47 cultures were sent to
PROMEC unit, Medical Research Council, P.O. Box 19070, South Africa, and to
Department of Plant Pathology, Kansas State University (KSU), U.S.A. for
identifying potential fumonisins-producing species of Fusarium and the third set was
stored at –5±1ºC at ICRISAT. Of the 47 cultures, 17 were identified into five
different species based on morphological traits at PROMEC. Speciation of the 13
cultures was confirmed at KSU through crosses using mating types A-1, B-2, D-1, D2 and F-2; one using amplified fragment-length polymorphism (AFLP), and three
could not be identified because of the infertile crosses (Table 1). Based on the
identification reports, a set of 47 isolates that were stored at ICRISAT were retrieved,
and photomicrographs were taken using Olympus Camedia C-4000 zoom on
Olympus Binocular Sz-PT and Olympus BH 2 at ICRISAT in 2004 (Fig. 3).
Based on morphological traits (Leslie, and Summerell, 2006) ICRISAT isolate
numbers 1, 2, 7, 8, 10, and 79 were identified as Fusarium proliferatum; 61, and 62 as
F. sacchari; 57, 65-2, 70, and 107 as F. thapsinum; 31, and 38 as F. verticillioides
and ICRISAT isolate number 76 was identified as F. andiyazi. These results,
however, are based on a very small number of isolates. Therefore, during 2002-04,
948 cultures of Fusarium spp. were obtained from molded sorghum grains from
Sorghum Grain Mold Variability Nursery conducted at five locations in India (Fig. 2).
92
Of these, 682 cultures were characterized by comparing the growth patterns and
pigmentation (images of abaxial and adaxial surfaces on PDA plates) with those of
the above identified cultures, and suitable publications to group into several species.
Fumonisins assessment
Soon after the identification reports were made available to ICRISAT, the
cultures/strains from KSU were imported to ISU through USDA-APHIS permit No.
61250 in 2003. In 2004, 12 representative isolates of five different species were
increased separately on steam sterilized sorghum grain, incubating at 25±1°C for 13
days with 12h photoperiod. Fumonisin B1 and B2 were estimated using HPLC
following the standard extraction and analysis procedures (Hopmans and Murphy
1993). Fumonisins data analysis was performed using the general linear means
procedure and multiple Scheff’s multiple comparison procedure using the SAS
package (Cary, NC). Similarly, fumonisin B1 of 682 isolates from the nurseries was
estimated using the direct competitive ELISA (Devi, et al., 1999).
ICRISAT isolate 79 (F. proliferatum) produced the highest levels of FB1 and FB2,
followed by other strains and several strains of each of the species produced FB1 in
various levels, but those of F. sacchari, and F. andiyazi, and some strains of F.
proliferatum, and F. verticillioides did not produce FB2 (Table 2). None or
insignificant amounts of FB2 were detected in other cultures or strains of Fusarium
species used (Table 2). Among the 682 isolates assayed, the FB1 production levels
across the five locations varied from 0–811 µg kg-1 by F. sacchari to 0–476540 µg kg1
grain by F. proliferatum, followed by 0–323604 µg kg-1 grain by F. thapsinum.
Again levels of FB1 production depends on the likely influence of weather variables.
Further research on identification of genetic resistance to fumonisins producing
isolates, role of plant morphological and biochemical traits and weather variables is in
progress to improve the risk assessment following classification and regression tree
(CART) analysis.
Weather-mold relationship
A Sorghum Grain Mold Variability Nursery (SGMVN) was established at five Indian
locations; Akola and Parbhani in Maharashtra, and Palem and Patancheru in Andhra
Pradesh and Surat in Gujarat. This nursery consisted of l0 sorghum lines that had
shown moderate to high levels of tolerance to grain mold in previous field screenings
at ICRISAT, and possessed desirable agronomic traits, and a resistant and a
susceptible check lines. Grain mold severity of panicles in the field and grains after
threshing was recorded (Thakur, et al. 2003). Weather variables, temperature, relative
humidity, and rainfall from the flowering stage of an early-maturing line to post
physiological maturity stage of a late-maturing line were recorded at all locations to
determine the influence of weather variables on predominance of mold fungi. Molded
grains were examined under stereo binocular for the presence of Fusarium species.
The typical Fusarium colonies were aseptically transferred from the grains to PDA
plates and incubated at 28ºC for 5 days for colony growth and further purification. The
information generated from this relationship was used in CART analysis to
understand how the weather variables help predicting mold severity at various grain
development stages.
90
Risk assessment
Among the various risk factors involved in farming industry with many uncertainties
that affect its success, plant disease is one of them due to its close relation to climate
and yield. Outbreaks of diseases reduce yield and cut profit margins. Understanding
and assessing disease risk reduce the uncertainties and, therefore, are critical to
effective management of plant diseases and, ultimately, to the success of the particular
farming venture (Yang 2003). The disease risk prediction often is made at the farm
level or at the level of a specific area, but for risk assessment, prediction has a spatial
scale as large as a country or a continent. Generally, the framework for disease risk
assessment was simplified to a five-step process; risk determination, data and
information collection, system synthesis, prediction of risk probability, and risk
interpretation and communication. Unlike disease risk prediction, risk assessment
does not have validation as a critical step in its framework because large-scale
historical data is scarce for validation (Yang, 2003).
A good possibility of predicting grain mold incidence was done by feeding dependant
variable mold ratings (severity rates at physiological maturity, post physiological
maturity, and threshed grain mold rating) and independent weather variables (RFd =
Rainy days fraction, RFt= Total rain fall, RHx= Relative humidity maximum, RHn=
Relative humidity minimum, Tx= Air temperature maximum, Tn= Air temperature
minimum) from flowering to maturity in to the classification and regression tree
(CART) analysis using JMP. The CART analysis creates a series of “if-then” rules in
a tree shape (Breiman et al. 1984). The variables of the decision tree appear in the
order of CART table and or sequence of these variables is in the order of their
dominant nodes as observed in CART tables of individual genotypes (Tables 3–5).
There were three resistant/tolerant genotypes (IS18758C-618-2, IS 30469C-140, and
IS 8545); six moderately resistant/tolerant (ICSV91008, ICSV95001, SEPON78-1,
CS3541, ICSV96101, IS18522) and three susceptible genotypes (SPV351, CSH9, and
SPV 104). The R2 values varied based on mold scores recorded at different panicle
development stages of cultivars with diverse resistance background. Grain mold
severity at physiological grain maturity of SPV 104 was a good predictor followed by
ICSV 95001 and IS 18758C-618-2; and the grain mold severity at post-physiological
maturity and after threshing, ICSV 95001 was a good predictor followed by SPV 104
and IS 18758C-618-2. However, the relative contributions of cultivar morphological
traits, infection rates of fumonisins-producing Fusarium spp. and quantification of
fumonisins produced in infected grains need further investigation for developing
strategy for better risk assessment and management of grain mold at individual
locations.
Summary/Remarks
Since the mold contamination occurs primarily during pre-harvest and/or in storage,
significant reduction under field conditions is possible if cultivars resistant to
potential fumonisins producing Fusarium spp are made available to growers. In
addition, Fusarium resistant sorghum may prove useful to lower dietary intake of
fumonisins, particularly in regions of the world where chronically high exposures
persist. Among the genotypes tested in CART, ICSV 95001 was a good predictor for
grain mold severity at physiological maturity, post-physiological maturity and the
91
mold severity after grains are threshed. Risk management, based on wellcharacterized germplasm and better environmental predictors, could certainly help
grain producers make the best choices for disease/mycotoxin management. Other
tools, including quantitative screening assays and biomarkers for resistance, could
potentially be exploited as well. Overall, with the information and technologies now
available, prospects for improving the level of Fusarium and FB resistance appears to
be encouraging. However, the rate at which advances can be made and the ultimate
resistance achieved may not match the requirements for FB-free sorghum.
References
Bhat, R.V., Shetty, H.P.K., Amruth, R.P., and Sudershan, RV. 1997. A food borne
disease outbreak due to consumption of moldy sorghum and maize containing
fumonisin mycotoxins. Journal of Toxicology – Clinical Toxicology 35:249–255.
Bhat, R.V., Shetty, H.P.K., and Vasanthi, S. 2000. Human and animal health
significance of mycotoxins in sorghum with special reference to fumonisins.
Pages 107–115 in: Technical and Institutional Options for Sorghum Grain Mold
Management: Proceedings of an International Consultation. A. Chandrashekar, R.
Bandyopadhyay, and A. J. Hall, eds. International Crops Research Institute for the
Semi- Arid Tropics, Patancheru 502 324, Andhra Pradesh, India.
Breiman, L., Friedman, J.H., Olshen, R.A., and Stone, C.J. 1984. Classification and
regression trees. Chapman & Hall, New York, NY.
Castor, L.L. 1981. Grain mold histopathology, damage assessment, and resistance
screening within Sorghum bicolor (L.) Moench lines. PhD thesis, Texas A&M
University, College Station, Texas, USA. 192 pp.
Castor, L.L., and Frederiksen, R.A. 1980. Fusarium and Curvularia grain mold in
Texas. Pages 93-192 in Sorghum diseases, a world review: proceedings of the
International Workshop on Sorghum Diseases, 11-15 Dec 1978, ICRISAT,
Hyderabad, India (Williams RJ, Frederiksen RA and Mughogho LK, eds.).
Patancheru 502324, Andhra Pradesh, India: International Crops Research Institute
for the Semi-Arid Tropics.
Devi, K.T., Mayo, M.A., Reddy, K.L.N., Delfosse, P., Reddy, G., Reddy, S.V. and Reddy,
D.V.R. 1999. Production and characterization of monoclonal antibodies for aflatoxin
B1. Letters in Applied Microbiology 29:284–288.
FAO. 1995. Sorghum and millets in human nutrition. FAO Food and Nutrition Series,
No. 27. Food and Agriculture Organization of the United Nations, Rome, 1995
Frederiksen, R.A., and Odvody, G.N., eds. 2000.
Diseases, 2nd ed. APS Press, St. Paul, Minnesota.
Compendium of Sorghum
Gonz´alez, H.H.L., Mart´ýnez, E.J., and Resnik, S.L. 1997. Fungi associated with
sorghum grain from Argentina. Mycopathologia. 139: 35–41.
92
Gwinner, J., Harnisch, R., and Mück, O. 1996. Manual of the prevention of post
harvest grain losses. Eschborn, 1996 Published in 1996 by: Post-Harvest Project,
Deutsche Gesellschaft für Technische Zusammenarbeit (GTZ) GmbH, Postfach
5180, D - 65726 Eschborn, pages 338. FRG© 1996 GTZ
Hodges, R.J., Hall, A.J., Jayaraj, K., Jaiswal, P., Potdar, N., Yoganand, B., and Navi,
S.S. 1999. Quality changes in farm-stored sorghum grain grown in the wet or dry
season in South India – A technical and social study. NRI Report 2412. Chatham
Avenue, Kent ME4 4TB, UK: Natural Resources Institute. 33 pp.
Hopmans, E.C., and Murphy, P.A. 1993. Detection of fumonisin B1, B2, and B3 and
hydrolyzed fumonisin B1 in corn-containing foods. J. Agric. Food Chem. 41, 1655–
1658.
Ibrahim, O.E., Nyquist, W.E., and Axtell, J.D. 1985. Quantitative inheritance and
correlations of agronomic and grain quality traits of sorghum. Crop Science
25:649–654.
ICRISAT (International Crops Research Institute for the Semi-Arid Tropics). 1992.
Medium Term Plan 1994-98. Research theme datasets. Volume 3. Patancheru
502324, Andhra Pradesh, India: International Crops Research Institute for the
Semi-Arid Tropics 229 pp.
Indira, S., and Rana, B.S. 1997. Variation in physical seed characters significant in
grain mold resistance of sorghum. Pages 652-653 in Proceedings of the
International Conference on Genetic Improvement on Sorghum and Pearl Millet,
held at Lubbock on 23–27 September, 1996. INTSORMIL and ICRISAT.
Indira, S., Mohan, J., and Rana, B.S. 1991. Genotype × environmental interaction for
grain mold resistance and seed weight in sorghum. Indian Phytopathology
44:523–525. ISBN 92-9066-488-6. Order code IBE 072.
Leslie, J. F. 1999. Genetic status of the Gibberella fujikuroi species complex. Plant
Pathol. J. 15:259–269.
Leslie, J.F., and Summerell, B.A. 2006. The Fusarium Laboratory Manual. Blackwell
Publishing, 2121 State Avenue, Ames, Iowa 50014, USA. 388 pp.
Leslie, J.F., Zeller, K.A., Lamprecht, S.C., Rheeder, J.P., and Marasas, W.F.O. 2005.
Toxicity, pathogenicity and genetic differentiation of five species of Fusarium from
sorghum and millet. Phytopathology 95:275–283
Maiti, R.K., Raju, P.S., and Bidinger, F.R. 1985. Studies on germinability and some
aspects of preharvest physiology of sorghum grain. Seed Science and Technology
13:27–35.
Marasas, W.F.O., Rheeder, J.P., Lamprecht, S.C., Zeller, K.A. and Leslie, J.F. 2001.
Fusarium andiyazi sp. nov. a new species from sorghum. Mycologia 93:1203–1210.
90
Navi, S.S. 2005. Fungi associated with sorghum grain in rural Indian storages. Journal
of New Seeds 7:51–68.
Navi, S.S., Bandyopadhyay, R. and Hall, A.J. 2002. Effects of crop season, storage
conditions, cultivars and fungicide on post harvest fungal profile of sorghum grain.
International Sorghum and Millets Newsletter 43:65–68.
Navi, S.S., Bandyopadhyay, R., Hall, A.J., and Bramel-Cox, P. 1999. A pictorial
guide for the identification of mold fungi on sorghum grain. Inf. Bull. 59 (in Eng,
Fr). International Crops Research Institute for the Semi-Arid Tropics, Patancheru
502 324, Andhra Pradesh, India.
Navi, S.S., Bandyopadhyay, R., Reddy, R.K., Thakur, R.P., and Yang, X.B. 2005.
Effects of wetness duration and grain development stages on sorghum grain mold
infection. Plant Dis. 89:872–878.
Navi, S.S., Bandyopadhyay, R., Thakur, R.P., Yang, X.B., and Reddy, R.K. 2003.
Effects of dew and post inoculation incubation temperatures on sorghum grain
mold infection. (Abstr.) Phytopathology 93:S65.
Navi, S.S., Yang, X.B. Thakur, R.P., Murphy, P.A., and Bandyopadhyay, R. 2005a.
Fumonisins in molded sorghum grain. Phytopathology 95:S74.
Nelson, P.E., Toussoun, T.A., and Marasas, W.F.O. 1983. Fusarium species: an illustrated
manual for identification. Pennsylvania State University Press, University Park,
Pennsylvania. 192p.
Onyike, N.B.N., Nelson, P.E., and Marasas, W.F.O. 1991. Fusarium species associated
with millet grain from Nigeria, Lesotho and Zimbabwe. Mycologia 83:708–712.
Ravinder Reddy, Ch., Tonapi, V.A., Bezkorowajnyj, P G., Navi, S.S., and
Seetharama, N. 2007. Seed System Innovations in Semi-Arid Tropics of Andhra
Pradesh, International Livestock Research Institute (ILRI), ICRISAT, Patancheru,
Andhra Pradesh 502 324, India ISBN: 978-92-9066-502-1. 224pp
Rheeder, J.P., Marasas, W.F.O., Thiel, P.G., Sydenham, E.W., Shephard, G.S. and van
Schalkwyk, D. J. 1992. Fusarium moniliforme and fumonisins in corn in relation to
human esophageal cancer in Transkei. Phytopathology 82:353–357.
Singh, S.D., and Bandyopadhyay, R. 2000. Grain mold. Pages 38-40 in Compendium
of Sorghum Diseases. Second Edition, The American Phytopathological Society,
(Frederiksen RA and Odvody GN, eds.). St. Paul, MN, USA. APS Press.
91
STATUS OF BIOTECHNOLOGY IN AFRICA
Monty Jones
ABNETA-ABSF
Introduction
One way to increase food security in Africa is to promote the use of biotechnology in
agriculture on the continent. Given the phenomenal growth in the production of
biotech crops over the past 11 years and the realization that the safety level of GM
products in agriculture is at least equivalent to those on non-GM products (thanks to
the use of more precise technology and the greater regulatory scrutiny), greater
advocacy has gone into the use of the technology as a complement to traditional
agriculture. Leaders of the Group of Eight (G8) industrial nations in the July, 2008
meeting in Japan agreed that biotechnology could help farmers to increase crop
productivity and provide more healthful food around the globe. They have agreed to
"promote science-based risk analysis including on the contribution of seed varieties
developed through biotechnology." (www.isis.com). Initiatives herein reported will
reveal the growing awareness on of modern biotechnology in Africa’s agriculture.
Policy Initiatives
Numerous policy decisions on the use of modern biotechnology in agriculture have
been taken at the African Union (AU), AU-NEPAD, sub-regional and country levels.
These policy decisions underline the strategies for biotechnology in Africa by the
identified institutions. In 2005, the AU-NEPAD established the High Level African
Panel on Modern Biotechnology with a mandate to advise Africa on matters of
modern biotechnology and its implications for agriculture, health and the
environment;
At the AU Commission level serious commitment to the issues of
biotechnology/biosafety started with the AU Biosafety Project supported by the
BMZ/GTZ in 2006 supposed to last 3 years. So far the project has achieved the
following (www.africa-union.org): The establishment of the Biosafety Unit within the
(Human Resources Science and Technology) HRST Department, Sponsored the
preparatory meetings to COP-MOP (3 and 4) meetings in Curitiba, Brazil in 2006 and
Bonn, Germany in 2008, The development of the African Model Law on Safety on
Biosafety and the revision process to adapt it to current technical developments and
The development of the African Strategy on Biosafety.
The deliberations of the High Level African Panel on Biotechnology led to the
African Ministerial Committee on Science and Technology and subsequently to the
AU Heads State taking the far-reaching recommendation to: (i) declare 2007 as the
launching year of building constituencies and champions for science, technology and
innovation (STI) and the development of a 20-year African biotechnology strategy
with specific regional technology goals; and (ii) to develop and harmonize national
and regional regulations that promote the application and safe use of modern
biotechnology.The recommendations of the African Panel on Biotechnology (APB)
(Juma and Serageldin, 2008) involve the establishment of the following ‘Regional
92
Innovation Communities’, among others: Southern Africa: Health Biotechnology,
Central Africa: Forest Biotechnology, East Africa: Animal Biotechnology, West
Africa: Crop
Biotechnology
and North Africa: Bio-pharmaceuticals
The innovation communities may be anchored by geographically-defined “Local
Innovation Areas” with the clustering of universities, professional associations,
enterprise and other actors with critical capabilities in agricultural, health, industrial
and environmental biotechnologies. Such areas will draw on the capabilities within
the regions and serve as focus points for international partnerships. The strategies will
be implemented through Regional Economic Communities (RECs) whose capacity
will in turn need to be strengthened. The APB recommended the adoption of the “coevolutionary” approach to biosafety in which the function of regulation is to promote
innovation, while at the same time safeguard human health and the environment.
AU-NEPAD
Africa Biosciences Initiative under
AU-NEPAD has created 4 bioscience network centers to drive the development of
biotechnology and other biosciences in Africa. These centers are the BecaNet
(Biosciences East and Central Africa Network) in Nairobi, Kenya, SanBio (South
Africa Biosciences Network) in Pretoria, South Africa, WABNet (West African
Biosciences Network) in Dakar, Senegal and NABNet (North African Biosciences
Network) in Cairo, Egypt. These networks will support centers of excellence for
biotechnology activities in the various regions as well as allow the collaboration of
the networks. They will also coordinate various biotechnology projects.
REC INITIATIVES
The Regional Economic Communities of Africa (RECs) except the one for North
Africa have taken various initiatives to advance capacity in the use of modern
biotechnology.
SADC
The Southern Africa Development Community (SADC) is one of the first RECs to
develop guidelines to address issues of GMOs and Biotechnology. The Guidelines
focus on 4 general areas: Handling of Food Aid; Policy and Regulations; Capacity
Building; and Public Awareness and Participation
COMESA
Common Market for Eastern and Southern Africa (COMESA) has recommendations
that cover the following: Commercial planting of GM crops, Commercial trade policy
and Food aid policy. For the above the general option is for central guidelines,
assessment or information followed by implementation at national level. This allows
for transparency, sharing of expertise and information leading to a cost reduction.
ECOWAS
The Economic Community of West African States (ECOWAS) has held 3 meetings
from 2004 resulting in the following recommendations: A regional approach for
89
biosafety; An information and communication strategy and policy in biotechnology;
The institutionalisation of a ministerial conference on biotechnology to be held once
in 2 years. Efforts are far advanced to develop the regional approach to biosafety and
to implement the strategy on biotechnology. It is expected that the next ministerial
conference in biotechnology will be in 2009 at the Côte d’Ivoire following the 2007
meeting in Ghana.
EAC
The East African Community (EAC) has held 2 meetings and formulated policies to
guide Harmonization in Biosafety; Research and Development; and Regional
Regulatory Approach. Apart from the AU and the REC strategies, there exist
complementary efforts at national level. These efforts are geared towards the
development of Bio-safety clearing houses and in building capacities for bio-safety
regulatory systems. They are funded through the UNEP-GEF.
SROs
The Sub-Regional Organisations (SROs) operational in biotechnology are the
CORAF/WECARD (West African Council for Agricultural Research and
Development), ASARECA (Association for the Support of Agriculture in Eastern and
Central Africa) and the SADC/FANRPAN (Southern Africa Development
Community/Food Agriculture and Natural Resources and Policy Analysis Network).
The one for North Africa (Association of Agricultural Research Institutions in the
Near East and North Africa -AARINENA) is still in the formative stages.
SADC/FANRPAN biotechnology/biosafety initiative, though in the formative stage is
more advanced than that of AARINENA. As at 2005, three pilot countries, Malawi,
Mauritius and South Africa were selected as the pilot countries for a southern Africa
sub-regional policy initiative on biotechnology/biosafety.
ASARECA
ASARECA is the Association for the Strengthening of Agricultural Research in
Eastern and Central Africa. It has a competitive grant program in agricultural
biotechnology research for member countries. It is the most advanced SRO in
collaborative biotechnology research. Website: www.asarec.org.
CORAF/WECARD
The implementing institution for the ECOWAS biotechnology plan is the
CORAF/WECARD. CORAF, the French acronym for the West and Central African
Council for Agricultural Research and Development (WECARD) is a 21 member
country Sub-Regional Research Organisation (SRO). The institution to assist with the
implementation of the ECOWAS biosafety plan is the CILSS/INSAH (Comite
Permanent Inter-Etats de Lutte Contre la Secheresse dans le Sahel) - the Permanent
Inter-States Committee for Drought Control in the Sahel. INSAH (Institut du Sahel) is
the implementation wing of CILSS. The CILSS biosafety harmonisation effort is far
advanced.
Country Status of Biosafety Legislation
90
Most countries in Africa have ratified the Cartagena Protocol on Biosafety (CPB) and
have been assisted through the UNEP-GEF to formulate their biosafety frameworks.
Only a few have functioning biosafety legislation that allows the conduct of trials on
GM products in containment, confinement and subsequent commercial release (Table
1). Recently (2008) Ghana and Malawi have announced the approval of biosafety
legislative frameworks that will allow the conduct of field trials on GM products.
Morocco demonstrates a unique commitment to the issues of biotechnology and
biosafety with the Prime Minister as Chair of the National Biosafety Committee.
Another country with a unique provision for biosafety is Libya where there is a
National Committee for Bioethics and Biosafety. Only Burkina Faso, Egypt and
South Africa have legislation that will allow the full commercialization of GM crops.
Table 1. Biosafety Status of Various African Countries
Status
Country
Signed onto UNEP
development
project/Ratified CPB
Algeria, Benin, Botswana, Burkina Faso, Cameroon, Cape Verde, Côte
d’Ivoire, Democratic Republic of the Congo, Djibouti, Egypt, Eritrea,
Ethiopia, Gambia, Ghana, Kenya, Lesotho, Liberia, Libyan Arab Jamahiriya,
Madagascar, Mali, Mauritania, Mauritius, Mozambique, Namibia, Niger,
Nigeria, Rwanda, Senegal, Seychelles, South Africa, Sudan, Swaziland,
Togo, Tunisia, Uganda, United Republic of Tanzania, Zambia, Zimbabwe (38
Countries)
Tunisia, Morocco, Mauritania,
Have
guidelines
biosafety
Remarks
Have draft biosafety
legislation
Have draft legislation
Kenya, Uganda
Have functioning GM
legislation
Burkina Faso, Egypt, South Africa, Zimbabwe
Cameroon, Malawi, Ghana, Nigeria
Conduct field trials and
do transformation in
containment
Field trials in progress
No field trials yet on GM
crops
Currently only South
Africa
is
commercializing
GM
crops.
Source: www.cbd.org ; W.S. Alhassan (personal communication).
Country Biotechnology Research and Development Status
The biotechnology tools that may be used in research are tissue culture and molecular
techniques. The molecular techniques are DNA fingerprinting or characterization,
marker assisted selection (MAS), molecular diagnostics and genetic
engineering/transformation/genetic modification. Genetic engineering (GE) is applied
in the production of genetically modified crops or recombinant vaccine. Specific ongoing biotechnology research in select countries is as tabulated (Table 2).
Table 2. On-going biotechnology research in select countries
Country
Institution/Lab
Area of Research
Commodity
Purpose
Libya
Biotech
Center
Tripoli
Date Palm
Planting
material,
drought tolerance
Morocco
Institute de Recherche
Agronomique (INRA)
All biotech tools in use but
mainly active in Medical
and
Pharmaceutical
biotech
Tissue culture, MAS,
Genetic Engineering
Sudan
National
Research
Center, Min of Sci &
Tech
Laboratory,
Soba, Khartoum.
Pasteur Institute of
Tunis (IPT)
Tissue culture, Molecular
diagnostics, GE
Sorghum,
Sesame,
Date Palm
Microbiology
Molecular
Medical
enzymes
Tunisia
Research
(BTRC),
91
and
genetics,
Date
Wheat
Palm,
Wheat,
products,
Germplasm
characterization,
Drought tolerance in
wheat
Germplasm
characterisation,
planting material
rVaccines, diagnostics,
insect and drought
Center
of
Biotechnology of Sfax
(CBS),
Center
of
Biotech of Borj Cedria
(CBBC)
Agriculture
and
Genetic Engineering
Reaearch
Institute
(AGERI)
Molecular diagnostics.
CBS focus on Industrial
Biotech e.g. fermentation
CBBC focus on plant
biotechnology.
All biotech tools especially
molecular breeding and GE
Olives, Wheat
tolerance.
Maize, Irish Potato,
Cotton
Burkina Faso
INERA, CIRDES
Marker Assisted Selection
(MAS),
DNA
fingerprinting,
Recombinant
Vaccine
(rVaccine)
Cotton,
Livestock
and Poultry
Ghana
CSIR-Crops Research
Institute, Univ of
Ghana
Biotech
Research
Center,
Kwame
Nkrumah
Univ of Sci & Tech.
(KNUST),
Cocoa
Research Institute of
Ghana (CRIG), Cape
Coast Univ. and Univ
of
Development
Studies (UDS)
Institute de Economie
Rurale (IER), Univ of
Mali
Molecular
Biology
Institute,
IPR/IFPRA
(Rural
Polytech Institute/Inst.
of Applied Research,
Katibougou)
Biotechnology
Advanced Laboratory
at SHESTCO (Sheda
Sci
and
Tech
Complex),
National
Vet Research Inst.,
Various universities.
Backstopped by: IITA
Ethiopian Institute of
Agric Research, Addis
University
Biology
Dept.,
National
Veterinary Institute
Kenya
Agric.
Research Inst. (KARI),
Jomo Kenyatta Univ.,
Univ of Nairobi.
Backstopping:
ILRI,
BeCA,
CIMMYT,
ICIPE,
IITA
Tissue Culture (anther
culture; cryopreservation),
DNA fingerprinting, MAS,
DNA extraction protocols,
Molecular diagnostics,
Rice, bananas, yam,
cassava, cocoyam,
sweet
potato,
pineapples, livestock
and poultry
Insect resistance, Bt
potato research done
but no release, Bt
maize (Mon 810 x
local variety) released
Insect resistant cotton
(Bt cotton-Bollgard II,
Characterized
germplasm, pests and
parasites, rVaccines for
tick-borne
diseases,
Heat tolerant vaccines
for Newcastle and
Peste
de
Petit
Ruminants (PPR)
Planting
material,
characterized animal
and plant germplasm,
increased crop yield.
Tissue
Culture,
fingerprinting,
MAS
DNA
Irish
Potato,
Sorghum, Tomato
Planting
material,
characterized varieties,
Tomato Yellow Leaf
Curl Virus (TYLCV)
resistant material.
Tissue culture (anther
culture, micropropagation),
DNA fingerprinting, MAS,
Molecular diagnostics
Bananas, roots and
tubers,
cereals,
livestock
Variety development,
germplasm
characterization, clean
planting material,
Tissue
culture,
DNA
characterization, MAS
Sorghum,
livestock
tef,
Characterized
crops,
proper diagnoses of
diseases
All biotech tools engaged:
Tissue Culture, Marker
Assisted Selection (MAS),
Genetic Engineering (GE),
Molecular Diagnostics
Maize, Sweet Potato,
Bananas,
Cotton,
Cassava, Livestock
(Cattle)
Univ
of
Dar,
Mikocheni
Agric
Research
Institute
(MARI),
Tropical
Pesticide
Research
Institute (TPRI)
National Agricultural
Research Organisation
(NARO)
institutes:
Kawanda
Agric
Tissue
Culture,
fingerprinting,
MAS
Maize, Cotton
Bt
Maize
(Insect
Resistant Maize for
Africa-IRMA),
Feathery Mottle Virus
and Weevil Resistant
Sweet Potato, Clean
Planting
Material,
Recombinant Vaccine
(East Coast Fever).
Various Confined Field
Trials (CFTs) of GM
crops.
Insect resistant maize
and cotton.
Egypt
Mali
Nigeria
Ethiopia
Kenya
Tanzania
Uganda
DNA
All biotech tools in use:
tissue
culture,
DNA
fingerprinting, molecular
diagnostics,
genetic
90
Bananas,
maize
cassava,
Insect, fungal and virus
resistant material.
South Africa
Zimbabwe
Research
Institute
(KARI), Namulonge
Crop
Resources
Research
Institute
(NaCRRI). Makarere
University
Agricultural Research
Council (ARC), CSIR,
Monsanto, Pioneer.
University
of
Zimbabwe: Crop Sci
and Biotech Depts.,
Scientific
and
Industrial
Research
and
Development
Center-Biotech
Research
Institute
(SIRDC-BRI)
engineering
All biotech tools in usetissue
culture,
DNA
fingerprinting,
MAS,
diagnostics, GE
Tissue culture, Molecular
diagnostics,
Genetic
Engineering
Maize, cotton, Irish
potato,
sorghum,
bananas, livestock
Cassava,
sweet
potato,
maize,
cowpea, sorghum
Insect and herbicide
tolerance, Bt potato,
SPUNTA2, ready for
release.
Viral resistance and
drought tolerance.
Source: www.cbd/bch.org . Various conférences and compilations (W.S. Alhassan, Personal
Communication).
Regional Biotechnology Support Organisations
FARA
The Forum for Agricultural Research in Africa (FARA) is the umbrella organization
for coordinating agricultural research activities in Africa. FARA’s mission is to create
broad-based improvements in agricultural productivity, competitiveness and markets
by supporting the SROs in strengthening Africa’s capacity for agricultural innovation.
FARA seeks to advance the achievement of the CAADP Pillar IV by providing
strategic continental and global networking support to reinforce the capacities of the
SROs and the NARS. FARA does not undertake research but facilitates it at the SRO
and NARS level.
AATF
AATF is a non-profit Foundation designed to facilitate and promote public/private
partnerships for the access and delivery of proprietary agricultural technologies for
use by resource-poor smallholder farmers in Sub-Saharan Africa. Its key strength is in
negotiating for proprietary technologies of use on a royalty-free basis by small-holder
farmers in Africa. AATF ensures the stewardship of the sub-licensed technologies.
AATF is currently implementing the following projects: Striga control in Maize,
Cowpea productivity improvement, Protecting Bananas and Plantain from Bacterial
Wilt Disease and Water Efficient Maize for Africa (WEMA)
PBS
PBS (Program for Biosafety Systems) is a USAID initiative to build capacity for
science-based decisions on GMO’s. It assists in policy formulation, regulatory
approval strategies development and awareness creation in sub-Sahara Africa, Asia
and S.E. Asia. In Africa, PBS has greatly assisted in the building of biosafety
capacity through assistance with biosafety legislation development, development of
biosafety regulations, training in risk assessment, biotechnology communication, the
conduct of confined field trials and drafting of standard operating procedures (SOPs)
or manuals for biosafety activities. Countries of PBS operation in Africa are Ghana,
Mali, Kenya, Uganda and Mali.
91
ABSPII
The Agricultural Biotechnology Support Project II (ABSPII), funded by the USAID
and coordinated by Cornell University is the sister project to the PBS. It complements
national/regional efforts to develop and commercialize safe and effective bioengineered crops in South Asia (India and Bangladesh), South East Asia (Philippines
and Indonesia) and Africa (Mali, Kenya and Uganda). The focus is support for the
development of bioengineered products to improve farmer productivity.
NGOs
Some of the prominent NGOs in Africa that support biotechnology are presented.
They include AfricaBio, ISAAA, ABSF and AHBFI. A few such as Greenpeace,
GRAIN are active in many African countries against the introduction of GM
technologies.
AfricaBio
AfricaBio is based in South Africa. It is specialized in biotechnology communication
issues and the safe use of biotechnology. Website: www.africabio.com.
ISAAA
This is the International Service for the Acquisition of Agri-biotech Applications. The
Africa center is based in Nairobi, Kenya. In Africa, ISAAA has played a significant
role in the introduction of tissue culture to banana growing farmers in East Africa,
notably, Kenya and risk communication activities. ISAAA shares knowledge on crop
biotechnology, reporting annually on its global status. ISAAA is famous for the
authoritative annual Biotech Briefs it publishes.
ABSF
ABSF is the African Biotechnology Stakeholders Forum. This NGO based in Nairobi,
Kenya, undertakes education and awareness creation on biotechnology and biosafety.
It has been instrumental in organizing the 1st All Africa Biotechnology Congress in
Nairobi, Kenya over the September 22-26, 2008 period.
AHBFI
AHBFI is the Africa Harvest Biotechnology Foundation International. It promotes
biotechnology in Africa’s agriculture. It is based in Nairobi, Kenya. It currently
coordinates the Africa Biofortified Sorghum (ABS) project funded by the Gates
Foundation to the tune of $16.9 million over five years, beginning July 1, 2005. The
project seeks to produce sorghum with 50% higher lysine content, better balance in
amino acids and a highly fortified product with enhanced iron and zinc availability
and elevated levels of select vitamins including vitamin E.
Public-Private Partnership and International Trade Requirements
90
To ensure the application of modern biotechnology on a sustainable basis, private
sector initiative is required to produce and market products successfully with the
linkage and support of public sector research institutions to ensure the continuous
flow of new technologies. The projects coordinated by the AATF benefit from viable
public-private sector collaboration for the support of resource-poor farmers.
Conclusions and Way Forward
The African Union Commission through its various councils has made various
recommendations for building capacity in biotechnology and biosafety at the regional,
sub-regional and country levels. Institutions like the RECs and the technical agencies
like the AU-NEPAD and FARA exist to coordinate and support the implementation of
the AU strategies drawn. To move modern biotechnology forward African countries
should endeavor to get their regulatory frameworks for biosafety in place followed by
the building of the needed capacity through training in risk assessment, management
and how to effectively communicate in biotechnology to policy makers and other
stakeholders. A vigorous training scheme in biotechnology followed by the provision
of the needed laboratory and field infrastructure is needed on the continent.
References
Juma, C. and Seragelding, I. (Lead Authors). 2007. ‘Freedom to Innovate:
Biotechnology in Africa’s Development’, A report of the High Level African
Panel on Modern Biotechnology. African Union (AU) and New Partnership
for Africa’s Development (NEPAD). Addis Ababa and Pretoria. www.Africaunion.org. www.nepadst.org.
Kulani Machaba. 2008. Industry’s role in plant biotechnology development in Africa.
African Biotechnology Conference. Tripoli, Libya. 22-24 June, 2008
91
Baseline Survey of Farmers perception of TYLCV disease and their
control measures in the Ashanti region of Ghana
M.K.Osei1, R.Akromah2 ,S.K.Green3, S. L. Shih,3 C.K.Osei2
1
CSIR-Crops Research Institute
Kwame Nkrumah University of Science and Technology
3
AVRDC- The World Vegetable Center
2
Abstract:
Tomato farmers in Ghana face pests and diseases constraints that affect tomato
production.Among them is the Tomato Yellow Leaf Curl Virus (TYLCV) which is of
economic importance. Relevant studies are however lacking on the causal agents of
the disease in Ghana. Likewise, information on incidence and severity of major
tomato leaf curl virus diseases on tomato fields and farmers perceptive of the disease
(TYLCV) and their control measures in Ghana is lacking. A baseline survey was
conducted in five tomato growing areas in Ashanti to obtain information on tomato
yellow leaf curl virus diseases encountered by tomato farmers. The results of the
survey indicated that male farmers within the age group of 31-40 constitute the main
tomato growers. TYLCV was listed as an important disease of tomato and is causing
severe yield losses in the growing areas. Farmers control measures which is mainly
through spraying of chemicals is partially effective or not effective at all.
Introduction
Tomato is one of the major vegetables grown in Ghana. The fruit is an important
source of vitamins. It has high levels of vitamin A.B.C.E and Nicotinic acid (Davis
and Hobson, 1981). In Ghana, tomato is produced in the semi-arid zone (Tono and
Pwalugu), the forest savannah transition (Akomadan and Derma), forest zone of
Ashanti (Agogo and Nkawie-Toasi) and Sege in the Greater Accra Plains. Tomato is
produced during both the rainy and dry seasons. Despite its importance in Ghana,
local production is not able to meet the domestic demand and tomatoes are often
imported, from neighboring Burkina Faso (Horna et al., 2006). This situation is
attributed to a number of constraints in the tomato production and marketing chain.
One such constraint is the pests and diseases that affect tomato production in Ghana.
Among them is the Tomato Yellow Leaf Curl Virus (TYLCV) which is of economic
importance. It is, however, not clear whether the causal agents, which are found in
other African countries or worldwide also, infect the tomato in Ghana although
similar characteristic symptoms are usually observed. Likewise, information on
incidence and severity of major tomato leaf curl virus diseases on tomato fields and
farmers perceptive of the disease (TYLCV) and their control measures in Ghana is
lacking. This study (an objective of the main study) sought to obtain baseline
information on tomato yellow leaf curl virus diseases encountered by tomato farmers
in Ghana with the transitional and forest zones in the Ashanti Region as focal point.
90
Methodology
The study was undertaken in July and August 2008 in five locations in the forest and
forest-savannah transitional zones of the Ashanti Region namely Akomandan, Agogo,
Afari, Nkawie- Toase and Aduman. These locations were chosen based on the
intensive small-holder production of tomato and high incidence of diseases.
The target population consisted of all tomato farmers in the five locations. Twenty
farmers were purposively selected from each of the five communities bringing the
total to hundred tomato farmers. Data were collected by administering questionnaires
to hundred participants in the 5 selected locations after pretesting with farmers at
Nkekenso in the Akumadan District. Parameters considered in the questionnaire
included background of farmers, common tomato diseases encountered and farmers
control methods, Incidence and Severity of TYLCV and relationship of TYLCV
disease at plant stage and planting season.
Table 1. Background of Tomato Farmers
Area
Akumandan
Agogo
Afari
Gender
(M)
(F)
13
7
(65%)
(35%)
19 (95%)
1 (5%)
Age
(years )
20-30
31-40
41-50
51-60
<1
1&2
2&3
>3
Local
Exotic
Both
1-5
6-10
11-15
16-20
Above 20
1
8
10
1
1
11
4
4
1
1
18
1
6
4
7
2
(5%)
(40%)
(50%)
(5%)
(5%)
(55%)
(20%)
(20%)
(5%)
(5%)
(90%)
(5%)
(30%)
(20%)
(35%)
(10%)
1
15
2
2
0
17
2
1
2
0
18
2
8
5
3
2
20
(100%)
0
(0%)
3
(15%)
11 (55%)
5
(25%)
1
(5%)
2
(10%)
14 (70%)
2
(10%)
2
(10%)
10 (50%)
1
(5%)
9
(45%)
2
(10%)
6
(30%)
8
(40%)
1
(5%)
3
(15%)
Acres
Variety
grown
Farmers
experience
(years)
(5%)
(75%)
(10%)
(10%)
(0%)
(85%)
(10%)
(5%)
(10%)
(0%)
(90%)
(10%)
(40%)
(25%)
(15%)
(10%)
Nkawie
Toase
16 (80%)
4 (20%)
Aduman
1
14
4
1
5
10
3
2
13
0
7
5
8
3
2
2
3
6
5
6
2
9
3
6
5
0
15
5
9
3
3
0
(5%)
(70%)
(20%)
(5%)
(25%)
(50%)
(15%)
(10%)
(65%)
(0%)
(35%)
(15%)
(40%)
(15%)
(10%)
(10%)
17 (85%)
3 (15%)
(15%)
(30%)
(25%)
(30%)
(10%)
(45%)
(15%)
(30%)
(5%)
(0%)
(75%)
(15%)
(45%)
(15%)
(15%)
(0%)
Male farmers dominated in tomato production in all the study areas. Table 1 indicates
that males accounted for 65%, 95%, 100%, 80% and 85% of farmers from
Akomandan, Agogo, Afari, Nkawie- Toase and Aduman respectively. In Akumandan
where there were quite a number of female farmers (35%), involved in tomato
production they received assistance from their male partners. Olympio and Abu
(2003) indicated that the male dominance in tomato production in Ghana may be
attributed to the labour intensiveness of production. They also contended that it may
also be due to the fact that in most of the tomato farming communities, the most
economically viable venture opened to the male youth is tomato farming. Women
from especially Afari, and Nkawie-Toase were rather involved in the sale of the
tomato produced.
90
Table 1 shows that farmers involved in tomato production in the study areas are
within the age group of 31-40 years. However at Akumandan, 50% of the respondents
were within the ages of 41-55 years. They however contended that due to the labour
intensiveness of tomato production, they used hired labour for production. Majority of
the farm sizes in the study areas are between 1-2 acres. The low acreages cultivated
by majority of the tomato farmers is attributed to many factors including few water
Tomato diseases
Akumandan
Agogo
Afari
Nematode
19 (95%)
14
(70%)
11
Damping off
2
8
(40%)
TYLCV
16 (80%)
Late Blight
7
(10% )
(35%)
Aduman
(55%)
Nkawie
Toase
14
(70%)
14
(70%)
-
(0%)
1
(5%)
-
(0%)
20 (100%)
13
(65%)
12
(60%)
20
(100%)
15 (75%)
13
(65%)
6
(30%)
12
(60%)
bodies for irrigation, land tenure constraints and high cost of inputs.
Almost all the farmers from the five areas grow both local and exotic type of tomato
varieties. However, Akomandan and Afari were the only
communities among the five communities that reported 5% respectively for growing
only exotic type of tomato. Nevertheless most of the exotic type sometimes cannot
survive the numerous pest and diseases in Ghana
Table 2. Common Tomato diseases encountered
Respondents in the study areas listed common diseases of tomato in the following
order: TVLCV, nematode, late blight and damping off. When questioned about
control measures for the diseases encountered, respondents in the 5 communities
indicated that they controlled the diseases through the spraying of pesticides and the
removal of infested plants from the field (Table 4).
Table 4. Farmers’ Control Measures
Area
Akumandan
Agogo
Afari
Nkawie Toase
Aduman
Intervention
Pesticides application
=
8
(40%)
Removal of infested plants = 8
(40%)
Other
=
2
(10%)
=
14
(70%)
(15%)
Other
=
3
(15%)
=
16
(80%)
(40%)
Other
=
0
(0%)
Pesticides application =
17
(85%)
(10%)
Other
=
0
(0%)
=
18
(90%)
(5%)
Other
=
1
(5%)
90
Effectiveness of Intervention
Yes
=
3 (15%)
No
= 10 (50%)
Partial
= 5
(25%)
Yes
= 4
(20%)
No
= 6
(30%)
Partial
= 10 (50%)
Yes
=
4
(20%)
No
=
6 (30%)
Partial
= 10 (50%)
Yes
=
7 (35%)
No
=
0 (0%)
Partial
=
12 (60%)
Yes
=
6 (30%)
No
=
6 (30%)
Partial
=
8 (40%)
Source: Survey results by M.K.Osei, 2008
Majority of respondents across the study areas observed the incidence of the TYLCV
disease in their tomato farms. Tomato loss due to TYLCV disease was highest at
Akumadan followed by Afari which are noted for their large scale tomato production.
When respondents were asked about the season in which (TYLCV incidence is severe
) of TYLCV Incidence & Severity, majority of them indicated that both the wet and
dry seasons are supportive of the TYLCV disease.
Table 3. Incidence and Severity of TYLCV in the Study areas
Area
TYLCV
(Incidence)
% Loss of TYLCV
(severity)
Season of TYLCV
Incidence
&
Severity
Akumandan
Yes
= 18
< 10%
=
0
Wet Season
=4
Plant stage of
TYLCV
Incidence
&
Severity
Seedling = 0
No
= 2
10-20%
=
0
Dry Season
=4
Flowering = 8
30-40%
=
0
Both Seasons = 10
Fruiting
= 10
Wet Season
=9
Seedling
= 6
=8
Flowering = 10
Agogo
Afari
Nkawie Toase
Aduman
Yes
= 20
50 %or above =
18
< 10%
= 2
No
= 0
10-20%
=
3
Dry Season
30-40%
=
6
Both Seasons = 3
Fruiting
= 4
= 4
Yes
= 20
50 or above =
< 10%
=
9
1
Wet Season
=9
Seedling
No
= 0
10-20%
=
2
Dry Season
=9
Flowering = 12
30-40%
=
6
Both Seasons = 2
Fruiting
= 4
= 1
Yes
= 19
50 or above =
< 10%
=
11
8
Wet Season
=7
Seedling
No
= 1
10-20%
=
5
Dry Season
=1
Flowering = 11
30-40%
=
1
Both Seasons = 11
Fruiting
= 7
= 0
Yes
= 20
50 or above =
< 10%
=
5
3
Wet Season
=7
Seedling
No
= 0
10-20%
=
6
Dry Season
=5
Flowering = 15
30-40%
=
6
Both Seasons = 8
50 or above =
5
Fruiting
Table 5 shows that majority (>90%) of the respondents have heard or observed the
occurrence of TYLCV disease in their tomato farms. They indicated that the TYLCV
disease is encountered most during the flowering stage, followed by the fruiting stage
irrespective of the planting season. The least occurrence of TYLCV was observed
during the seedling stage irrespective of the planting season. The whitefly which is the
90
= 5
main vector of the TYLCV disease are usually attracted by yellow colours.Tomato
flowers are also yellow and this could probably be one of the reasons why they attract
Which of the tomato
season
do
you
encounter TYLCV?
At what stage of the
plant does the disease
set in?
Major Season (rainy)
Seedling
Flowering
Fruiting
Yes
4
12.5%
18
56.3%
8
25%
30
93.8%
No
1
3.1%
0
0%
1
3.1%
2
6.3%
3.1%
0
0%
1
3.1%
2
6.3%
Count
% ot total
Count
% of total
6
20.7%
16
55.2%
1
3.4%
0
1
3.4%
0
Count
% of total
6
20.7%
0%
0
0%
0
Count
% of total
Count
% of total
Count
% of total
Count
Count
28
96.6%
2
5.7%
20
57.1%
12
34.3%
34
97.1%
3
0%
1
3.4%
1
2.9%
0
0%
0
0%
1
2.9%
1
0%
1
3.4%
1
2.9%
0
0%
0
0%
1
2.9%
1
% of total
75.0%
25.0%
25.0%
count
% of total
count
% of total
count
% of total
TOTAL
Minor Season (dry)
Seedling
Flowering
Fruiting
TOTAL
Both Seasons
Seedling
Flowering
Fruiting
TOTAL
N/A
Have you heard or encountered TYLCV
disease before?
Total
N/A
5
15.6%
18
56.3%
9
28.1%
32
100%
7
24.1%
16
55.2%
6
20.7%
29
100.0%
3
8.6%
20
57.1%
12
34.3%
35
100.0%
4
100.0%
a lot of whiteflies which transmit the virus and cause TYLCV disease. It must also be
noted that after infection, it takes between 2-3 weeks before symptoms of the disease
are observed. Hence the stage at which the disease is often encountered may also
depend
on
the
time
of
infection
by
the
whiteflies.
Table 5 Relationship of TYLCV disease at plant stage and planting season
Conclusion
Tomato farmers from the five communities are mainly Men in the age group 3140years with farm size 1-2 acres. Tomato yellow Leaf curl virus disease was reported
to be widespread causing severe yield loss. Farmers’ intervention is mainly spraying
pesticides but this is to no avail.
References
Clark, G.(1994): Onions Are My Husband; Survival and Accumulation by West
African Market Women.Chicago,University of Chicago Press
90
Davies JN, Hobson GE. 1981. The constituents of tomato fruit—the influence of
environment, nutrition, and genotype. Critical Reviews of Food Science and
Nutrition 15: 205–280.
Olympio, N.S. and Abu M (2003). Fresh Tomato Fruit Packaging-Field Studies of
Some Selected Major Growing/Marketing areas in Ghana. Ghana Journal of
Horticulture 3.108-115
90
BIOTECHNOLOGY APPLICATIONS IN ANIMAL HEALTH AND
PRODUCTION IN SUB-SAHARAN AFRICA: SCIENTIFIC, SOCIAL,
ECONOMIC AND CULTURAL LIMITATIONS, AND PROSPECTS
Mbassa1 G. K., Luziga1 C., Mgongo2 F. O. K., Kashoma2 I. and
Kipanyula1 M. J.
Department of Veterinary 1Anatomy and Cell Biology, 2Surgery and
Theriogenology, Faculty of Veterinary Medicine, Sokoine University of
Agriculture, P. O. Box 3016 Morogoro Tanzania, mbassa@suanet.ac.tz,
gabriel_mbassa@yahoo.com
Abstract
There are many scientific, social, cultural and economic limitations to development
and use of biotechnology in animal health and production in Africa. The prerequisite
for heavy laboratory investment, concurrent development of biosafety measures,
procedures for risk assessment and management, information dissemination to
eliminate hazards of transgenic, cloned or other biotechnology derived animals and
products, economic capability, and the social and cultural confines constitute major
constraints to animal biotechnology. Investment in animal biotechnology addressing
the identified constraints to animal biotechnology development and application
provides very high prospects to greatly improve animal health and production.
Introduction
Elimination of food insecurity and poverty in Sub-Saharan Africa SSA, where human
population is growing in fixed land, is achievable only by use of modern
biotechnology to increase animal health and productivity. Biotechnology maximizes
livestock productivity using high producing genotypes, disease and drought resistant
breeds, early maturing animals, high nutritional value and long shelf life products, and
efficient disease control. Biotechnology has improved animal health and production in
Europe, Asia (China, India, South East) and America (USA, Canada, Brazil, Chile,
Argentina, Cuba), but has made no impact in SSA. Minimal use of biotechnology will
persist, unless the limitations are addressed. This paper addresses the scientific, social,
cultural and economic limitations to animal biotechnology applications, and overall
prospects of animal biotechnology to improve animal health and production.
Biotechnology Uses in Animal Health and Production
Biotechnology uses in animal health and production provide environment preserving
and safe foods, and nontraditional or novel products in the following areas;
Animal disease control and eradication
1.
Current vaccines are prepared from modified live, attenuated or killed
organisms, biotechnology produces molecular sub-units; DNA and protein
immunogens and non pathogenic vectors. Sub-unit vaccines are purified antigens
from bacteria and virus cultures or pure native molecular (protein or DNA) of original
microorganisms. Antigen purification from live pathogens requires large scale
90
production facilities and costly downstream processes, risking pathogen
2.
escape to environment. New molecular vaccines involve cloning genes encoding
protective antigens into secondary non pathogenic organisms, which express the
immunogenic proteins in native form. The protein epitopes are harvested by
traditional bacterial methods. Cloning genes avoids risks of handling pathogens or
reverting
of
live
or
killed
products
to
pathogenic
state.
3.
Biotechnology derived immunogens are delivered in adjuvants as for conventional
vaccines, to enhance immunogenicity of antigens, thereby vaccine efficacy. Adjuvants
include aluminium salts, mineral oil, connective tissue, E. coli labile toxin,
isostimulatory complexes (ISCOMs); liposomes, virusomes and microparticles.
Adjuvants act by (1) depot effect, presenting the antigen by physically associating
with immunologic cells (2) targeting innate immune pathways to activate them to
quantitatively and qualitatively direct immunologic responses towards the antigen and
(3) others alter properties of antigen to increase ability to effect either depot or innate
immune system pathway tagetting (Bowersock and Martin, 1999). Aluminium
hydroxide adjuvant is safe and cheap depot and physical formulation, surface area,
charge, morphology, inducing IgG and IgE antibodies.
Breeding for disease resistance
Biotechnology is providing molecular markers to enhance resistance of livestock to
disease, which is important in low input production systems. Improving resistance
allows genetic improvement. Molecular marker selection involves selection of genetic
resistance based on effectiveness, genetic variation, economic and social benefits,
selecting and testing markers, detecting genes that control disease resistance and
mapping livestock genetic diversity.
Diagnostic kits
Biotechnology also enables development of rapid diagnostic tests. Using nanoscience
and nanotechnology, miniature implants are used to detect abnormal secretions prior
to onset of fever or other clinical signs leading to early diagnosis and targeted
treatment. Other materials produced biotechnologically are used for therapy against
diseases, for example animal bioreactors (transgenic animals). Nanotechnology is
research to understand, work with, see, measure and manipulate matter, molecular
supra molecules, atoms or other secretions to detect disease before clinical signs
appear (Scott, 2005). Nanotechnology is applied in disease diagnosis, food
preservation, animal breeding, diagnostics, biosensors and proteomics.
Reproduction biotechnology and marker assisted selection in animal breeding
Biotechnology improves genes to enhance food production through high productivity.
Artificial insemination (AI), estrus synchronization, super-ovulation, ovum pick up
from immature females and embryo transfer (ET), together with in-vitro embryo
production, sex sorted sperms, marker assisted selection, functional deletion or
addition of specific genes to offspring genome or somatic cell nuclear transfer for
cloning are all biotechnological tools that improve genes for animal production.
Biotechnology also diagnoses diseases of reproduction that have genetic source. AI is
the collection of semen from superior sires and insemination to superior female
89
animals to obtain high producing offsprings. ET is the wide application of collection
of mature oocytes from superior cows, fertilize them in vitro using semen from high
genetic quality bulls and implant the resulting embryos to superior recipient cows for
incubation to term.
Animal feeds
Biotechnology enables the production of high nutritive value feeds through GM grass,
fodder, forages and legumes.
Transgenic (genetically modified) and cloned animal for various uses
Transgenesis introduces specific genes into genomes, targeting high growth rates,
carcass quality, high milk composition and yield, and disease resistance. Transgenic
farm animals (genetically modified) are produced by injection of DNA constructs
onto pronuclei of fertilized egg, somatic cell transfer and use of vectors such as
lentivirus. Sequence information and genome maps are defined followed by removal
or modification of genes. Animal cloning is the transfer of adult cell nucleus to
enucleated metaphase II stage oocytes to produce genetic clones (copies) of the
animal that donated the nucleus (Wilmut et al., 1997). The clones are genetically
identical to donor cells. Somatic cell nuclear transfer and transgenesis are quick in
genetic improvement. Successful nuclear transfer (NT) clones provide superior sires
from genetically elite bulls for use in natural service and AI. Clones are produced by
either microinjection of nuclear material or NT. Natural cloning in animals occurs in
identical twins or multiples on nuclear split after fertilization (Wells et al., 2005).
Cloning efficiency is, however, low. More than 94% of cloned embryos transferred to
recipient cows die in utero, others die before maturity, only 6% are healthy and
survive long. Losses occur in gestation due to failure of placental development
because of incorrect epigenetic reprogramming of donor genome and defective gene
expression. These lead to abnormal developments, prolonged gestation and loss of
reconstructed somatic cell nuclear transfer (SCNT) complexes leading to early
embryonic death. There are also high birth abnormalities, oversize foetuses, high
postnatal abnormalities; spinal fractures, multiple abnormalities and high calf-hood
deaths. The solutions to these problems are to develop efficient technology to
minimize abnormalities, use right clones and recipients, good culture media, control
genome reprogramming and use molecular markers.
Wild Animal Domestication
Biotechnology has the power to identify the genes for neurohormonal compounds that
are essential for domestication of wild animals using secretions from the adrenal
glands, blood and brain. Extremely large autonomic ganglia have been found to be
associated with adrenal glands in wild birds, their functions have not been determined
precisely although they are postulated to be involved in parasympathetic activities
(Shalua and Mbassa, 1995).
90
Scientific and Social Limitations to Animal Biotechnology
There are several scientific factors and social concerns that limit the application of
biotechnology in animal health and production. Animal clones are produced without
sexual reproduction, transgenic ones (GM animals) are. Both transgenic and cloned
animals may reproduce sexually if not securely confined, thus spread in human food
chain, animal feeds and environment. Public perceptions on benefits and risk of
biotechnology products is influenced by religion, political, social and cultural factors,
risks being viewed in the context of threats to humankind, environment and survival
of life on earth. Consumers are not confident of their health after consuming GM or
cloned animals or their products. People demand safe food, good animal welfare,
legal, ethical, aesthetical and moral values to sustain environment and world livestock
trade, unthreatened by dangerous biotechnology products of uncertain safety, posing
risks and dangers to animals, plants and human health. Responses to biotechnology
depend on biotechnology type, purpose and benefits of GM animal, means of genetic
modification and many other factors.
Reactions vary from distaste, dislike, fears, doubts, uncertainty, suspicious,
reservation, qualm, trepidation, apprehension, uneasiness, anxiety, nausea, revolt,
revulsion, disgust, horror, revolt and repulsion. Transgenic animals, GM organisms
(GMO), GM microorganisms (GMM) and cloned animals are accepted for purposes
of medical benefits for large populations, but people are skeptical if it is for food or
animal feed. If the species being manipulated is a microorganism people do not mind,
but are worried and resist if a plant or an animal is being modified, and very resistant
to modification of human beings. There are fears that biotechnology can be used as
weapon to destroy certain populations, environment (e.g. herbicide sprays on land).
Concerns arise on changing animals and human beings, on future biological behaviour
of GMOs, GMMs, cloned and transgenic animals in the short and long term health,
health risk to other animals in contact with the GMOs, GMMs, transgenic or cloned
animal and effects on the environment.
Natural boundaries are stringent, once are broken, worries and revulsion arise in
people because of offending human dignity (e.g. human – animal chimera). Genetic
modifications may be positively viewed if they are cheap, better, nutritious or
medicinal, but negatively if they pose potential risks, behavior or results of long term
impacts are uncertain e.g. GM animal (GMA) suffering, modified genes express,
health of GMA progeny uncertain and that the many diseases require many transgenic
animals for medicinal purposes. It is feared that transgenic and GM animals may be
patented. Patenting of genes and gene sequences is accepted but not
biotechnologically produced animals and plants. The policy on transgenic animals
(beyond safety and benefits) is that if the clone and GM animal is for commercial
reason it must be approved internationally before production, confined in use not to
spread, follow post-manufacturing process and marketing scrutiny.
Economic Limitations on Animal Biotechnology in SSA
Animal biotechnology is a multistage process involving research, development,
testing, registration, production and marketing (Madan, 2005), the economies of SSA
do not allow completion of this process. Animal transgenesis and cloning require
expensive laboratories, equipment, tissue media, chemicals and reagents, which most
91
SSA countries cannot afford. Until these economic constraints are solved,
biotechnology applications in animal health and production will continue to be
negligible in most of SSA countries.
Institutional Limitations to Biotechnology Applications
Application of biotechnology for the purpose of improving animal health and
production in SSA is hampered by many institutional constraints including Lack of
information about livestock farmers, 96% of livestock is reared under mobile /
nomadic pastoralism, impossible to locate; There is no uniformity in animal
production and animal breeds; The broad biodiversity demands stringent conservation
rules, prohibiting uncontrolled introduction of GMO; Scarcity of scientists and
technicians; Conditions for biotechnology research and development not conducive;
Industries supportive to biotechnology product development and production are
lacking; Failure to address issues of biosafety and risk analysis on new biologicals,
genes, products, transgenics and GM foods; Lack of clear policy on biotechnology,
development, research and product marketing; and Lack of proper investment in
biotechnology.
Cultural Factors Limiting Animal Biotechnology Use
Every cultural group has its own list of animals used for food, any gene mixture e.g.
goat-sheep chimera, cow-sheep, cattle-donkey, chicken-fish, reptile-fish are ethically,
aesthetically and unsafe as food. There are also certain religious restrictions among
different groups of people on types of animals for use as food. Cultural resistance to
biotechnology derived animals and their products are very strong especially in SSA
because of strong cultural and ancestral bondage.
Biosafety Regulations of Biotechnology uses in Food Animals
Use of biotechnology in animal health and production in SSA requires concurrent
development of procedures for risk assessment and management, information
dissemination to eliminate hazards of transgenic, cloned or biotechnology derived
products (McCrea, 2005). As described above there are many scientifically risks of
biotechnologically derived animals and products to humans, animals and plant health,
and the environment. The basic principle on biosafety is to understand those risks and
dangers and develop strategies and procedures to be followed for maximum safety.
Effective communication on new technologies, biotechnology uncertainties and
cautions are essential. The policy must be to promote awareness, openness,
understanding, consultation, consistency, transparency, efficiency and developing
good effective strategies, education programmes, trust of methods and information
exchange.
Prospects of Animal Biotechnology Applications In SSA
Biotechnology provides very high prospects to greatly improve animal health and
production. To increase the application of biotechnology in animal health and
production it is essential to address the limiting scientific, institutional and economic
factors. Biotechnology focus areas in SSA are improvement of feeds and nutrition to
animals, vaccines, diagnostics, management and breeding by AI and ET.
92
In conclusion, biotechnology is a scientific tool very useful to enhance human, animal
and plant lives, and environment, providing opportunities for improved animal health
and production. There are, however, uncertain short and long term effects to
consumers of biotech-produced species (or consumers’ offspring), that require
development of non-flexible stringent biosafety laws. There are high prospects of
biotechnology uses in Sub-Saharan Africa, giving great opportunities to improve
livestock health and production.
Acknowledgements
Authors are very grateful to the Norwegian Agency for Development Cooperation to
supporting this study in the Programme for Agricultural and Natural Resource
Transformation for Improved Livelihoods (PANTIL) and the African Biotechnology
Stakeholders Forum for sponsoring the first author to present the paper at the
Conference in Nairobi.
References
Bowersock, T. and Martine S. 1999. Vaccine delivery to animals. Adv. Drug Deliv.
Rev. 38:167-194.
Hiendleder, S., Bauersachs, S., Boulesteix, A., Blum, H., Anold G. J., Frohlich T, and
Wolf E. 2005, Functional genomics: tools for improving farm, animal health and
welfare Rev Sci Tech Off Int Epiz 24:355-377.
Honda, Y., Waithaka, M., Taracha, E. L., Ducchateau, L., Musoke, A. J., and McKeever,
D. J., 1998. Delivery of the Theileria parva p67 antigen to cattle using recombinant
vaccinia virus:IL-2 enhances protection. Vaccine 16:1276-1282.
Kelly, L. 2005. The safety assessment of foods from transgenic and cloned animals
using the comparative approach. Rev. Sci. Tech. Off. Int. Epiz 24:61-74.
Kues, W. and Niemann H. 2004. The contribution of farm animals to human health.
Trends Biotech 22:296-294.
Madan, M. L. 2005. Animal biotechnology: applications and economic implications
in developing countries. Rev. Sci. Tech. Off. Int. Epiz. 24:127-139.
McCrea, D. 2005. Risk communication related to animal products derived from
biotechnology. Rev Sci. Tech. Off: Int. Epiz. 24:141‐148.
Moreau, P. and L. T. Jordan 2005, Rev Sci. Tech Off. Int. Epiz. 24:56-60.
Niemann, H., Kues W. and Carnwath J. W. 2005. Transgenic farm animals; present
and future, Rev Sci Tech Off Internat. Epiz 24:285-298.
Norimine, J., Mosqueda, J., Suarez, C., Palmer, G. H., McElwain T. F., Mbassa, G. K.
and Brown W. C., 2003. Stimulation of T helper cell IFN-gamma and IgG
93
responses specific for Babesia bovis rhoptry associated protein 1 (RAP-1) or a
RAP-1 protein lacking the carboxy terminal repeat region is insufficient to
provide protective immunity against virulent B. bovis challenge Infection and
Immunity 71:5021-5032.
Platt, J. L. and Lin S. S. 1998. The future promises of xenotransplantation. Ann NY
Acad Sci 862:5-18.
Rogan, D. abd Babiuk, L. A. 2005. Novel vaccines from biotechnology Rev Sci Tech
Off Int. Epiz. 24:159-174.
Scott, N. R. 2005. Nanotechnology and animal health. Rev Sci Tec Off Int Epiz
24:425-432.
Shalua L. D. and Mbassa G. K. 1995. Histomorphology of the domestic chicken and
other African birds. Tanzania Vet J. 15:109-120.
Takeuchi, Y., Magre S. and Patience C. The potential hazards of xenotransplantation;
an overview. Rev Sci Tech Off Int Epiz 24:323-334.
Wells, D. N. Forsyth J. T., McMillan V. and Oback B. 2004 Review; the health of
somatic cell cloned cattle and their offspring. Cloning Stem Cells 6:101-110.
Whitelaw, C. B. A. and Sang, H. M. 2005. Disease resistant genetically modified
animals. Rev. Sci. Tech. Off. Int. Epiz. 24:275-280.
Williams, J. L. 2005. Use of marker assisted selection in animal breeding and
biotechnology, Rev Sci Tech Off Int Epiz 24:379-391.
Wilmut, I., Schrieke, A. E., MCWhirl J., Kind .A. J. and Campbell, K. H. 1997.
Viable offspring derived from foetal and adult mammalian cells. Nature 385:810813.
90
COMMUNICATION, PUBLIC UNDERSTANDING AND ATTITUDES
TOWARD BIOTECHNOLOGY IN DEVELOPING NATIONS: A
SYNTHESIS OF RESEARCH FINDINGS
Lulu Rodriguez and Eric Abbott
Abstract
This study synthesizes the results of empirical studies that examined the factors that
influence media coverage of genetic engineering, and research works that explored the
impact of media coverage on public understanding of and attitudes toward biotechnology
issues in the developing world. Data were gathered by compiling available empirical
studies that deal with the communication of biotechnology topics in the developing world.
Seven electronic databases were searched for relevant journal articles, books, book
chapters, conference papers, research reports, policy papers, master’s theses and doctoral
dissertations. A content analysis of a total of 50 titles found was conducted. Results reveal
the dearth of empirical works in this area and the preponderance of economics-oriented
reports that utilized consumer survey methodology. A proposed communication research
agenda that addresses the exigencies of developing countries is outlined.
Introduction
Although the benefits and risks of agricultural biotechnology are now under debate in
many parts of the world, such discussions often focus on the trans-Atlantic corridor
between the United States and Europe. The concerns of the “Third World,” which may
have the most to gain or the most to lose from the adoption of genetic engineering, have
largely been ignored. Over time, however, policy analysts have decried the concentration
of studies regarding public opinion and the political dimensions of agricultural
biotechnology within industrialized countries. Considering that the greatest percentage of
people who derive income directly or indirectly from agriculture reside in developing
countries, an examination of the actors or agents involved in mapping the course this
technology should take in these nations is in order.
There is wide agreement that the mass media are an important source of representations of
biotechnology in the public sphere. There is less agreement, however, about the exact
nature of mass media influence. Because public opinion drives policy choices regarding
intellectual property rights, biosafety, food safety and consumer choice, trade, and public
research investments with regard to GM foods, it is useful to investigate how the mass
media influence people’s understanding of and attitudes toward this innovation. This
paper examines the coverage of biotechnology by the mass media in developing countries,
and the patterns of public understanding and attitudes toward biotechnology resulting from
exposure to such coverage. It synthesizes the results of existing empirical studies from the
developing world to develop generalizations about how the mass media function to shape
public understanding of and attitudes toward biotechnology issues.
Conceptual Framework
The conceptual framework for this study draws on insights from social systems theory
(Luhmann, 1995) and social representation theory (Wagner, 1996). Biotechnology is seen
here as a coalition of different actors, institutions and interests that compete to gain control
91
of public support and policy mechanisms. In this complex of actors and institutions,
we see the mass media as a major agent that acts upon (and is in turn acted upon by)
other actors to shape research and development efforts on biotechnology within a
country.
The scientific community, industry, national governments, advocacy groups and
international institutions are all involved in different ways in the development,
implementation and regulation of technological innovations. Among these sectors, the
mass media are the source of most of the information the public receives about risk issues
related to these innovations. They serve as important conduits and amplification or
attenuation stations for risk At the same time, however, social-structural and/or
organizational factors influence the way the media report what they consider to be
newsworthy. In the case of genetic engineering, these may include the extent to which the
mass media system is free to discuss controversial topics, the national stance or general
policy on biotechnology, national trade and agriculture priorities, and other ideological or
organization-related variables. Because the mass media can be considered as vehicles for
both presenting and comprehending social issues, two areas of research can be specified:
(1) studies that deal with the factors that influence media coverage of genetic engineering,
and (2) studies that examine the impact of media coverage on audiences. Both types of
studies were analyzed in this report.
Methodology
Data for this study were gathered by compiling available empirical studies that deal
with the communication of biotechnology topics in the developing world. The
literature search covered journal articles, books, book chapters, conference papers,
research reports, policy papers, master’s theses and doctoral dissertations. The
database searches were supplemented by general catalog searches for books, book
chapters, conference proceedings, convention and seminar archives, and policy
statements. From these sources, reports that contain the words “genetically modified
organisms” or “GMOs,” “transgenic crops,” “agricultural biotechnology” and
“genetic engineering” were compiled. From this compilation, only those that
discussed
biotechnology
development,
implementation,
regulation
and
communication in the developing countries of Asia, Africa and Latin America were
included for analysis.
The units of analysis are complete journal articles, books, book chapters, conference
papers, policy papers, master’s theses and doctoral dissertations published about the
topic. Included in this analysis were all empirical works about the GM issue published
from January 1, 1997 to December 30, 2007, a period of peak coverage in the
Western hemisphere following several landmark events in genetic engineering as
applied to agriculture and food production throughout the globe.To check inter-coder
reliability, half of the total sample of 50 articles was generated and two coders
analyzed all items according to a coding scheme. Using the formula from North,
Holsti, Zaninovich, and Zinnes (1963), the following inter-coder reliability scores
were obtained: research methodology, 97.4%; focus, 96.8%; scope of the study,
97.1%; and findings, 96.2%.
89
Results
Over a ten-year span, only 50 such studies were retrieved from seven electronic
databases (Table 1). This scant body of work indicates that the topic has yet to capture
the attention of communication research scholars or emerge as a research priority in
many parts of the world, especially in countries where agriculture constitutes a
substantial percentage of gross national income. A majority of the studies (31 of the
50) employed the survey method of gathering data mainly from local and national
samples of urban consumers, major agricultural regions within nations, and
economically affluent districts.
Ten used the qualitative approach (such as in-depth interviews, case studies, discourse
analysis and network analysis); seven employed content analysis. Two were policy
papers; none used experimental or longitudinal designs. The methodologies applied
reflect the countries’ immediate need to understand consumer acceptance, principally
measured through purchasing intentions and propensities, which may also explain the
dominance of economics and policy experts as authors.
An analysis of the study sample reveals the following most frequently occurring
research findings:
1.
Over the last decade, empirical evidence has been building in support of the
contention that decision makers and citizens of the developing world see
genetic engineering from a different lens. For instance, Aerni (2001) notes that
majority of his Mexican and Philippine policymaker-respondents consider
biotechnology a powerful new tool to address problems in agriculture,
nutrition and the environment although their attitudes toward risks and
benefits of specific crops, such as transgenic rice, are ambivalent. This view is
not shared by Europeans who generally find the potential health risks in GM
foods highly unacceptable. While developing countries are more concerned
about corporate control of the technology, the potential impact of GM crops
on their countries’ biodiversity, and primary export market loss, Europeans
generally view the technology as “not being useful, as morally unacceptable
and as a risk to society” (Eurobarometer, 2005, p. 4).
2.
What does the general public think about genetic modification? In 2000,
Environics International conducted an extensive study of public perceptions of
biotechnology through a survey of about 35,000 people in 34 countries in
Africa, Asia, the Americas, Europe and Oceania. The findings reveal
important differences in whether respondents agreed or disagreed with the
statement, “The benefits of using biotechnology to create genetically modified
food crops that do not require chemical pesticides and herbicides are greater
than the risk.” Results showed that people in higher-income countries tend to
be more doubtful of the benefits of biotechnology and more concerned about
the potential risks, although there are exceptions to this pattern. On the other
hand, the study found that in general, people in developing countries were
more likely to support the application of genetic engineering to reduce the use
of chemical pesticides and herbicides and to feed their growing populations.
3.
Consistently, the findings indicate very low levels of public knowledge of GM
crops in general, either of their advantages or disadvantages. Empirical evidence
for this has been established in China where Lan (2006) obtained a very high rate
90
of “don’t know” answers to survey questions, suggesting that many do not have
settled attitudes about biotechnology and that overall public attitude is somewhat
unstable; in Southwest Nigeria where Adeoti and Adekunle (2007) found little
awareness of GM crops such as Bt maize, Bt corn and golden rice although their
respondents tended to favor their introduction and would try them if they are more
nutritious than non-GM foods; in Trinidad, West Indies where a sizeable chunk of
Badrie et al.’s (2006) respondents reportedly had not heard of GM foods at all; in
Latin America and the Caribbean where efforts to remedy poor public perception
often seem inadequate and do not reflect a well-designed strategy (Traynor et al.,
2006); in Iran where more than 95% of Sheikhha et al.’s (2006) sample of
university students and non-university educated respondents demand more
information about biotechnology. Especially lacking is locally relevant knowledge
that focuses on specific local crops and situations.
4.
What do farmers think about GM crops? Chong (2003) and Mula (2006)
report that awareness and knowledge of golden rice among Philippine farmers
and farming community leaders is almost nonexistent. Indeed, most of the
farmers in these studies’ sample knew next to nothing about agricultural
biotechnology. In the Philippines (Juanillo, 2003), Colombia (Pachico and
Wolf, 2004), and South Africa (Pouris, 2003), most farmers were generally
unaware of the existence of biotech crops. But if farmers were convinced that
these crops are healthy to eat, marketable, and provides good yields, many say
they would consider growing them.
5.
A few studies (i.e., Curtis et al., 2004; Veeck and Veeck, 2000) have
examined the motivations for consumer attitudes toward genetically modified
foods in developing nations. These studies generally conclude that while
consumer attitudes are largely negative in many of the developed countries in
the European Union as well as in Japan (entailing smaller benefits and higher
perceived risks), those in the developing world have a positive perception of
GM foods largely stemming from more urgent needs in terms of food
availability and nutritional content. Additionally, perceived levels of risk are
smaller due to trust in science, confidence in government regulatory bodies,
and positive media influences.
6.
Mass media coverage of GM crops in most developing countries is minimal at
best and often totally lacking. Overall, coverage was sporadic, with regular
stories appearing only during times of regulatory and scientific interest when
publicists and press officers were able to get these materials past gatekeepers.
One study in the Philippines (Mula, 2006) showed that while the national elite
media occasionally print GM-related articles, coverage tended to be much less
than in Europe and the United States, and often reflects agendas set in
developed countries or by NGOs. At the local level, coverage in the
Philippines was almost completely absent, even in provinces where local
decrees have banned GM crops. The Philippine study also shows that media
portrayals tend to be heaviest when a GM crop is actually released
commercially, rather than when it is only being tested in experimental plots.
7.
By and large, media monitoring studies reveal that the tone of GM coverage is
positive and supportive of government and private sector initiatives guided by
social and cultural interests (Navarro and Villena, 2004; Juanillo, 2003). In
91
South Africa, the local press was also found to be well disposed toward
science and technology in general (Pouris, 2003; van Rooyen, 2004) although
coverage has been sporadic throughout the continent. Content analysis
findings based on longer timeframes, however, reveal that early coverage of
GMOs in developed nations was largely positive, but give way to periods of
more intense and more negative coverage following anti-GM campaigns by
advocacy groups (Rodriguez and Kappmeyer, 2003).
8.
The results of studies that have examined how the media have framed
biotechnology stories reveal that while coverage in the West often discusses it
with a focus on food safety, the developing world coverage is more concerned
with the need for food security. Scientific leaders and environmental
contamination frames dominate the European coverage. The Third World
press, on the other hand, framed the debate more in terms of poverty
alleviation, economics, biodiversity and national control of the technology
(Yamaguchi and Harris, 2004; Rodriguez and Zheng, 2007
9.
Whether in Asia or Africa, the media have featured multiple sources to explain
developments in genetic engineering to their publics. Most studies that
attempted to analyze newspaper coverage identified the sources of information
and attributions explicitly mentioned in the news stories. The most commonly
identified sources can be categorized as (1) scientists primarily operating
within academic institutions and research centers, (2) government agencies,
officials and policy-makers, (3) industry or commodity groups, (4)
international non-profit and non-governmental organizations and foundations,
(5) environmental and consumer groups, (6) local non-profit nongovernmental organizations, and (7) private individuals and businesses.
10.
The immediate context for most studies, especially those that attempt to assess
the impact of risk perception and public response in economic terms, is often
provided by survey studies of public perceptions. Although these surveys
provide a unique resource for national and comparative international studies of
public perception, survey data seldom provide a sufficiently detailed picture
from which to adequately interpret either national or international trends.
Ideally, survey research should be carried out alongside complementary
contextual studies such as qualitative research intended to explore people’s
understandings and images of the new technology, longitudinal media
analyses designed to reveal significant patterns of reporting, and policy studies
documenting significant features of the political and regulatory systems that
are responsible for public policy.
Agenda for research
The findings outlined above thus far suggest research attention in the following
areas:
1.
National entities that monitor the agriculture sector need science-based locally
relevant policy studies that compare existing crop choices with possible GM
crop alternatives. Training and assistance in preparing such policy studies and
using them to increase local knowledge and decision-making capabilities are
needed.
92
2.
3.
4.
5.
6.
7.
Additional studies will be needed to confirm this finding, and to provide
guidance for local officials on how to weigh the food needs of local
populations versus possible environmental or commercial impacts.
The low coverage of GM crops in developing countries demand more studies
that assess patterns of media coverage in both the national and local levels.
Crawley (2005) found that in the United States, the regional media actually
offered more diverse views of the GM debate than the national media
coverage.
Although a number of studies have examined the factors involved in farmer
consideration and adoption of GM crops in the United States and Europe, few
have been carried out in other countries. The possible impacts of sciencebased research, how NGOs amplify GM risks, scandals such as Starlink,
concerns about corporate control of seed and genetic materials, and marketing
issues need to be investigated.
How advocacy groups campaign for their causes and in so doing capture
newspaper headlines and front pages is worth studying because these
organizations have become a force to contend with in public debates about
controversial issues, including biotechnology use.
Implicit in the process of risk analysis and management is the critical role of
communication. If public bodies are to make good decisions about regulating
potential hazards, citizens must be well informed. There must be a concerted
effort to make the science of risk assessment accessible to the audience.
The perspective of the audience must be considered and entered into the whole
risk equation because public reaction invariably becomes intertwined with the
risk condition itself.
Clearly, more studies should attempt to evaluate current efforts at enabling
members of the public to make informed decisions about appropriate uses of
biotechnology by providing science-based information about benefits, risks
and impacts.
The proposed research agenda outlined above indicates a need for much more
support for individual developing countries and their national research
institutes as they assess their interest in biotechnology and as they map out the
course to take regarding this innovation. The findings show that the exigencies
of the developing world are left unaddressed by trans-Atlantic debates.
Strengthening national capacities to develop regulatory mechanisms should
therefore go in tandem with the expansion of local capabilities to conduct
communication research to understand public concerns, facilitate information
sharing among various stakeholders, and answer communication problems
relevant to particular national needs.
References
Crawley, C. E. (2005). Framing the genetic engineering debate:
An examination of
frames and sources in local newspaper reporting. Unpublished doctoral
dissertation, University of Tennessee, Knoxville.
European Commission. (2005). Eurobarometer 2005.
Europeans and biotechnology in
93
2005: Patterns and trends. Retrieved Jan. 10, 2007.
Evenson, R. E., & Santaniello, V. (Eds). (2004). Consumer acceptance of genetically
modified foods. Cambridge, MA: CAB International.
Friedlander, B. P. (2003, Aug. 29). Despite benefits of golden rice to vitamin Adeficient children, few Filipino farmers know about it. Cornell News.
Kasperson, R. (1992). The social amplification of risk: Progress in developing an
integrative framework. In S. Krimsky & D. Golding (Eds.), Social theories of
risk. Wesport, CT: Praeger.
Luhmann, N. (1995). Social systems. Stanford, CA: Stanford University Press.
North, R. C., Holsti, O., Zaninovich, M. G., & Zinnes, D. A. (1963). Content
analysis: A handbook with applications for the study of international crisis.
Evanston, IL: Northwestern University Press.
Sander, L. S. (2006). Genetically engineered foods in the public sphere: Interaction
between the mass media and the socio-political environment. Unpublished
doctoral dissertation, University of California, Irvine.
Thomas, S., & Schmidt, H. (2006, June-July). The use of GM crops in developing
countries: Scientific and policy-related developments affecting agriculture and
livelihood. Paper presented to the 10th International Conference on
Agricultural Biotechnology: Facts, Figures and Policies, Ravello, Italy.
Veeck, A., & Veeck, G. (2000). Consumer segmentation and changing food patterns
in Nanjing, China. World Development, 28(3), 457-471.
Wagner, W. (1996). Queries about social representation and construction. Journal for
the Theory of Social Behavior, 26, 95-120.
Wolf. M. M., & Domegan, C. (2002). A comparison of consumer attitudes toward
genetically modified foods in Europe and the USA: A case study over time. In
V. Santaniello, R. E. Evenson, & D. Zilberman (Eds), Market development for
genetically modified food. Wallingford, UK: CAB International.
90
Freedom to Innovate and the Cartagena Protocol on Biosafety
Worku Damena Yifru
Secretariat, Convention on Biological Diversity
Abstract
The risks associated with living modified organisms are not, however, the same as
those associated with other industrial goods and so biotechnology should go hand in
hand with biosafety. The Cartagena Protocol on Biosafety is an international
agreement that contains regulatory procedures aimed at ensuring safety in the transfer,
handling and use of living modified organisms. The governance of modern
biotechnology needs flexibility and transparency and the Biosafety Protocol offers
both. Its procedures are not ends in themselves and their application is always flexible
such that they allow the convergence of the values and interests of the research, trade
and environment sectors. As an increasing number of African countries move to
embrace biotechnology, their regulatory frameworks need to keep pace and the
standards of the Biosafety Protocol represent the bare minimum.
Introduction
The purpose of this Congress as stated in the relevant documents is “to improve
public understanding of biotechnology through the provision of accurate and balanced
information” to the African public. The objective of this note is to contribute to that
purpose by way of extending the effort of improving public understanding to the
Cartagena Protocol on Biosafety. This paper contains some views and observations on
why Africa needs to embrace biotechnology with appropriate regulatory oversight and
describes how the Cartagena Protocol on Biosafety provides a transparent and flexible
framework that takes into account both environmental and economic considerations.
The paper concludes with a few suggestions that may, hopefully, generate discussions
at this Congress and beyond. Finally, the paper presents a few facts and figures
relevant to Africa for your information.
Embracing biotechnology
The development and expansion of science and technology has been one of the major
public policies that have guided Africa since independence. Public institutions have
been created to provide funding and leadership for science and technology
development. After more than four decades, however, there is limited technical
change and innovation is very low in much of Africa. Why? There is no single answer
to this question. Perhaps one of the main reasons is because more effort has gone into
importing products of technology from outside the continent instead of acquiring the
techniques, processes and the know-how at home. Precedents have shown that
meaningful progress in science and technology is mostly achievable in societies or
countries that have the capacity to generate and apply knowledge that responds to
their real problems. Knowledge creation requires probing into one’s own doubts,
questions and problems with a view to satisfying ones own needs and aspirations.
91
Therefore, it is imperative for Africans to define their own needs and problems, pose
their own questions and express their own doubts, and try to solve them using their
own thinking methods and values. This is not to imply that one should always try to
re-invent the wheel for every technological innovation. This also does not mean that
science and technologies developed outside of Africa are not of much use to Africa.
The point I am making here is, knowledge and technology should not be mimicked
but mediated in Africa’s context and used as a means for solving Africa’s own
problems. In order to score real change in this respect, revitalization of research and
development in African universities and research institutions is a key. Research in
biological sciences and biotechnological innovation has to be deeply Africa-specific
more than any other field of knowledge and technology. Factors such as climate,
genetic diversity, endemism, farming and tenure systems require approaches and
innovations in biotechnology specifically designed for Africa.
It was to this end that in June 2005, the African Union (AU), in collaboration with the
New Partnership for Africa’s Development, designated a high-level African advisory
panel on modern biotechnology. In 2007, the Panel submitted its report entitled
“Freedom to innovate: Biotechnology in Africa’s Development”. The report is
comprehensive. It analyses Africa’s needs, potentials, and priorities in biotechnology
and the role that biotechnology can play for development. The overall message of the
report is Africa should embrace biotechnology and build the necessary capacity to
harness its potential to improve agricultural productivity, public health, industrial
development, economic competitiveness and environmental sustainability.
While the report brings forward the promises and the potentials of biotechnology,
questions and doubts about whether and how the adoption of genetically modified
(GM) crops would be compatible or beneficial to Africa continue to linger. These
questions and doubts include: (i) could GM plants be more invasive? Could they lead
to the development of resistant insects, weeds and diseases? (ii) whether the
conservation and sustainable use of Africa’s rich genetic diversity is not a better
strategy for long-term food security, poverty reduction and environmental safety
rather than increased dependence on a few GM varieties; (iii) whether the high tech
GM crops that are being developed mostly for large scale mechanised farming and to
reduce labour costs are appropriate for African agriculture that is carried out on small,
fragmented land holdings by resource poor farmers in a context where labour is cheap
and plentiful; (iii) whether GM technology can be appropriate for Africa when it is
largely driven by the private sector and controlled by a few powerful transnational
corporations who protect their products with patents while agricultural research and
development for much of African continent is still the domain of the public sector and
African farmers rely on seed saving and free exchange of seeds for planting from one
season to the next; and (iv) whether and to what extent could modern biotechnology
help improve indigenous or underutilized African crops.
Despite the above questions and doubts, biotechnology is still hoped to offer the
promise of transformation or revitalisation of agriculture, improvement of food
security and meeting some of the challenges of poverty and marginalisation. Africa
has been cautiously keen to understand the unique and enormous challenges and
opportunities brought by the new knowledge-based life sciences and biotechnology.
However, a number of countries are now expressing willingness to embrace modern
89
biotechnology as a development imperative. In the last decade or so, a number of
public and non-profit entities with a mission to promote biotechnology have been set
up; workshops and symposiums have been organized; biotechnology policies and
programmes have been developed and debated.
What role, then, for biotechnology in Africa’s development. The Nobel Laureate
Amartya Sen has described development as freedom (2001). The notion of “freedom
to innovate” implies a fight to defeat the tyranny of hunger, disease, ignorance and
overall backwardness using innovative technologies. Biotechnology could no doubt
be part of the arsenal. But Africa should use this arsenal in a way that will not
compromise the sustainability of its vast biological resource base. The dire poverty
and food insecurity that prevail in much of Africa is unacceptable and has to be
addressed. But not at the expense of environmental safety standards that are found to
be appropriate for other parts of the world. Biotechnology products are not like other
ordinary industrial goods that could easily spread, if available, throughout rural Africa
with little to no worry about potential long term adverse impacts. Rural Africa is rich
in biological resources and the population depends, almost entirely, on the goods and
services that biological diversity offers. Africa should, therefore, be cautious in the
way it chooses and handles biotechnological products that contain living modified
organisms. In this regard, the High Level Panel’s report, “Freedom to Innovate” also
recommends that the development of biotechnologies should be undertaken “with
appropriate safeguards to the best internationally-agreed standards”.
Regulating biotechnology
The potential benefits and risks associated with modern biotechnology have given rise
to intense public debate over the last decade. Governments have been trying to
mediate these debates through, among other things, the establishment of regulatory
oversight. Products of modern biotechnology, in particular genetically modified crops
entered the international market just about the same time as the debates on their safety
on the one hand and the distribution of benefits on the other reached their height. The
issues involved in these two major aspects of biotechnology are broadly framed in the
Convention on Biological Diversity, an international environmental treaty adopted in
May 1992 here in Nairobi.
The Convention recognizes how access to and transfer of technology including
biotechnology among Parties could help to attain the objectives of the Convention. It
specifies the importance of providing such access to and transfer of technology to
developing countries under fair and most favourable terms. The Convention calls
upon Parties to take legislative, administrative or policy measures to provide for the
participation, in biotechnological research activities, of developing country Parties
which provide the genetic resources for such research. It demands such research be
conducted, where feasible, in countries that provide the genetic resources. Is this
happening now? You the researchers know first hand the how much and what quality
of research is actually taking place in Africa using genetic materials of Africa. Parties
to the Convention were also required to consider the need for a biosafety protocol that
sets out appropriate procedures for the safe transfer, handling and use of living
modified organisms resulting from biotechnology.
90
While Parties to the Convention are still negotiating a possible international regime on
access to genetic resources and the fair and equitable sharing of the results and
benefits arising from biotechnologies, the need for a binding international biosafety
protocol was agreed to in 1995, followed by the launching of the formal negotiations
in July 1996. The negotiations were concluded and the Cartagena Protocol on
Biosafety was adopted in January 2000. The Protocol entered into force in September
2003.
Throughout the negotiations African countries showed not only a remarkable interest
in the subject but also developed a common position from time to time as the
negotiations progressed and spoke in one voice. Representatives of African
governments, including public sector researchers and institutions took part in the
negotiations and were instrumental in shaping the final outcomes. To date 41 African
countries are Parties to this international treaty.
The Cartagena Protocol on Biosafety
The Cartagena Protocol on Biosafety (“Protocol on Biosafety” or “Biosafety
Protocol”) is a supplementary agreement to the 1992 Convention on Biological
Diversity. The Protocol aims at protecting biological diversity from the potential risks
posed by living modified organisms (commonly known as GMOs). The central
regulatory mechanism adopted by the Protocol in this regard is a procedure that
requires exporters of GMOs intended for introduction into the environment of the
importing country to provide information to the latter and to obtain its agreement
prior to transferring the GMO in question. This is known as advance informed
agreement procedure. It applies essentially to GM seeds and similar propagating
materials, and only to the first shipment of any particular GMO in this category. The
importing Party’s decision is required to be based on a scientific risk assessment.
The Protocol makes an exception in the case of GMOs intended for direct use as food,
feed or for processing. A Party that approves the commercialization of such GMOs is
required to inform the rest of the world of its decision through the Protocol’s
information-sharing mechanism known as the Biosafety Clearing-House (BCH). The
procedures in the Protocol are not ends by themselves and their application is always
flexible. Parties can use their domestic regulatory frameworks in place of the decision
procedure of the Protocol; they can enter into bilateral, regional or multilateral
agreements or arrangements regarding matters covered by the Protocol and may apply
the rules of these agreements and arrangements; and they can have transactions with
non-Parties as long as they meet the minimum conditions specified. In this respect,
the Protocol is objective or result oriented. The primary goal is to ensure safety in the
transfer, handling and use of GMOs. As long as the potential risks are considered,
studied or assessed and risk management measures are in place, any other modality
and administrative procedure that an importing Party may wish to apply or pursue is
not excluded by the Protocol.
Furthermore, the Protocol includes, in its advance informed agreement procedure,
rules that set out timeframes when the importing country has to respond to
notifications from an exporter and when to communicate its decision. There is an
option for a simplified procedure where a cross border transfer of a GMO may take
place at the same time as the transfer is notified to the recipient or imports could be
exempted from the advance informed agreement procedure altogether as long as
91
adequate safety measures are put in place. Import decision taking is also required to
be consistent with other international obligations. There is a provision on the
protection of confidential information. Clauses like these are intended to facilitate
trade; to eliminate or reduce the possibility of undue restriction to trade in GMOs
while also protecting the environment. Given this flexibility, how could the Biosafety
Protocol affect the progress in biotechnology development or disrupt trade in safe
GMOs? It rather facilitates the adoption of the technology by providing options for
decision-taking and by making decision-taking more predictable.
While the underlying policy consideration for having the Biosafety Protocol is
precaution, the operation of the Protocol is not based on precaution any more than is
the Sanitary and Phytosanitary Agreement of the World Trade Organization. In both
cases, decisions are taken on science-based risk assessments, and in both cases,
Parties may take measures, including import prohibitions if the scientific information
is insufficient. The only exception is the requirement in the case of the SPS
Agreement to review the sanitary or the phytosanitary measure taken on the grounds
of insufficiency of information, within a reasonable period of time. Although no
timeframe is specified for resolving any decision taken on the grounds of insufficient
information, the Biosafety Protocol also has a provision on review of decisions as a
change in circumstances has occurred and additional relevant scientific or technical
information has become available.
Other key features of the Biosafety Protocol include: (a) identification of GMO
shipments, (b) information sharing, and (c) capacity building.
(a)
Identification of GMO shipments
The Protocol requires transboundary GMO shipments to be identified as such
in accompanying documents. Such information is expected to enable importers
and users of GMOs to know what they are receiving, to continue to monitor
the organisms and to implement safe methods in handling the organisms in a
way that is appropriate to the level of risk involved.
(b)
Information sharing
The Biosafety Protocol has institutionalized information-sharing among
Parties as well as non-Parties through what is known as the Biosafety Clearing
House (BCH). This information sharing tool brought transparency to trading
in GMOs. Information such as the type of GMOs that have been approved for
cultivation and commercialisation by any country, the summary of risk
assessment reports, and existing national and regional biosafety laws,
regulations and guidelines, is being shared through the BCH. Access to this
kind of information facilitates also the implementation of the Biosafety
Protocol.
(c)
Capacity building
Capacity building is clearly a high priority issue in the field of biosafety.
Parties to the Biosafety Protocol have agreed to cooperate in this area. In the
wake of the adoption of the Protocol, the Council of the Global Environment
Facility (GEF) approved a global project to assist eligible countries to develop
92
national biosafety frameworks. The objective of the project was to prepare
countries for the entry into force and the implementation of the Biosafety
Protocol. A number of African countries have benefitted from this project.
The project was implemented by the United Nations Environment Programme
(UNEP). Other regional as well as sub-regional projects are still underway
across Africa. But there is still more to be done in building capacities
necessary to assess and manage risks associated with products of modern
biotechnology. Building capacity in the safe development and use of modern
biotechnology is building confidence in regulatory decision taking.
Conclusion
Africa is still assessing the implications of modern biotechnology to its environment,
public health and socio-economic circumstances. It is in the process of formulating its
strategic vision. There is, however, a general recognition that modern biotechnology
has great potential for improving the lives of Africans if developed and used with
adequate safety measures that take into account the physical, biological, ecological,
social and economic realities of Africa. An increasing number of African countries
are building some GM research and development capacity and a few are in fact
conducting field trials. The adoption of supporting regulatory frameworks needs to
keep pace with these developments.
One of the reasons for the slow pace of adopting clear policies and regulatory
oversight is the internal as well as external pressure. African countries like several
other countries around the world that are still in a dilemma are under pressure to water
down their biosafety policies and laws, to lift restrictions on field trials, to approve
imports and commercial releases of genetically modified organisms. Biotechnology
development and biosafety should go hand-in-hand. Standards should not be set lower
than those of the Biosafety Protocol, at least.
African scientists and their partners have a key role to play in achieving
biotechnology with a functioning biosafety system. Among other things, you may:
• Contribute to communicating the scientific and technical issues involved in the
safe use of biotechnology in a language that is understandable and accessible
to many different groups, farmers in particular;
• Stand for greater policy coherence in sectors like agriculture, health,
environmental protection, and international trade;
• Contribute to the efforts in building regulatory and scientific capacities for
biosafety.
• Support the adoption of national biosafety frameworks that are consistent with
the Cartagena Protocol on Biosafety.
The flexible and transparent regulatory approach presented by the Biosafety Protocol
will benefit us all by benefitting the environment, research and trade interests. At its
heart the Cartagena Protocol on Biosafety not only supports but also encourages
freedom to innovate.
93
H. Adu-Dapaah********, M.D. Quain, J.Y. Asibuo, E.O. Parkes, R. Thompson,
P. Adofo-Boateng, J.N. Asafu-Agyei and S. Addy.
CSIR - Crops Research Institute, P.O.Box 3785, Kumasi – Ghana
Abstract
This paper outlines the progress, utilization or the extent to which Ghana has engaged
modern biotechnologies especially in agricultural production. It focuses on work done
with reference to tissue culture and micro-propagation, molecular breeding or marker
assisted selection, genetic engineering, human resource and institutional capacity
building and policy issues. There are about 13 institutions currently applying
biotechnology in Ghana. Currently, the legislative instrument on biosafety framework
has been passed. This will pave the way for the development and testing of
genetically modified living organisms in Ghana. This paper also identifies the
priorities for biotechnology research in the near future in Ghana.
Introduction
Biotechnology involves a range of tools and enabling techniques of varying levels of
technical complexity, ranging from small scale traditional fermentation of foods and
beverages through to cutting-edge recombination DNA technology (Klu et al., 1999,
Kitch et al., 2002). Unlike a single scientific discipline, biotechnology draws from a
wide range of relevant fields such as biology, microbiology, biochemistry, molecular
biology, genetics, cell biology, immunology, protein engineering, enzymology,
classified breeding techniques and a full range of bioprocess technologies.
Developments in modern biotechnology need high inputs of finance and skilled work
force. Capacity building of modern biotechnology in Ghana therefore critically
involves harnessing expertise from various disciplines, developing managerial skills
and establishing a wide range of technical facilities. It also involves formulating
policies and regulating guidelines which will facilitate the effective and efficient use
of available resources. Not withstanding public concerns, it is felt that the major
increase in agricultural productivity will be achieved through the direct use of genetic
improvement and biotechnology (Villalabos, 1995). This country report focuses on
activities, achievements and to what extent Ghana has gained control of modern
biotechnology in the various institutional capacities and using it for the purpose of
food security.
Food Security in Ghana
The right to food is a basic human right and therefore households in any part of the
world need to have a reliable supply of food to maintain good health. Unlike other
parts of the world which registered drops in number of hungry people, countries in
sub – Saharan Africa such as Ghana is the only region where the number of hungry
people has risen by over 19% during the last decade (Meade B. et al., 2008). This
********
Corresponding author. Email hadapaah@cropsresearch.org/hadapaah@yahoo.com
94
increase was obtained despite strong growth in food production across the region.
Creating an adequate food supply for Ghana poses two challenges. The first is to
provide enough food to meet the needs of Ghana’s expanding population, without
destroying
natural
resources
needed
to
continue
producing
food.
The second challenge is to ensure food security—that is, to make sure all people have
access to enough food to live active, healthy lives. Producing enough food does not
only guarantee that the people who need it are able to get it. If people do not have
enough money to buy food—or to buy the land, seeds, and tools to grow food—or if
natural or human-made disasters such as war prevent them from getting food, then
people are at risk of undernutrition even when there is adequate food supply. While In
the industrialized countries, poverty typically prevents people from obtaining food; in
developing countries such as Ghana, the circumstances that cause food insecurity
include poverty, inefficient agricultural techniques, low crop yields, adverse biotic
and abiotic factors and unproductive economic policies. Biotic constraints to
agriculture include pest and diseases while abiotic constraints include drought, soil
acidity, soil alkalinity and low soil fertility. Yield losses attributed to these constraints
range from 20 to 100%.
Agricultural Biotechnology in Ghana
Many aspects of modern biotechnology are now being applied increasingly to
agriculture. As a result, agriculture is undergoing a major strategic restructuring to
enable the vital integration between production and ultimate utilization. While the use
of biotechnology in agriculture has achieved significant results in the more advanced
countries, many poor countries lack the ability to take full advantage of new
biotechnological developments in advancing agricultural production and utilization.
Some applications of biotechnology that are being used in Ghana in agriculture
include Tissue and micro-propagation and molecular breeding. Various institutions
that undertake these aspects of biotechnology can be found in different locations in
the country. These institutions and organizations work in close collaboration and
partnership among themselves towards the achievement of their respective aims and
objectives. Strong concerns have also being expressed with regard to policy issues,
that is, the biotechnology policy and biosafety framework as well as human resource
and infrastructural capacity building.
Application of Tissue Culture
The application of tissue culture in Ghana can be traced back to the late 1980’s. This
is exhibited by various institutions in the country that undertake the application of
Tissue culture. Since then, encouraging developments can be observed mainly in
serving research purposes as well as the production of “clean” planting materials.
There have been improvements in the formulation and optimization of protocols
which can be adapted for various aspects of tissue culture. Tissue Culture laboratories
in the various research institutions in the country have been the receiving post for
germplasms for projects on musa, cassava, yam, cocoyam and sweet potato obtained
from collaborating institutions outside the country.
Presently, the tissue culture activities in the Crop Research Institute laboratory
include; receiving in-vitro material, rapid multiplication of induced mutation cassava
plantlets, rapid multiplication of clonally propagated crops, in-vitro conservation of
89
germplasm using slow growth techniques, cryopreservation techniques and efficient
post-flask management. In-vitro plantlets of Dioscorea rotundata are being multiplied
to produce “clean” planting material for production. Sweet potato collections in the
breeding programme are being introduced in-vitro for virus elimination and rapid
multiplication of varieties in a collaborative work between the Crop Research Institute
(CRI) and the University of Ghana.
Application of Molecular Breeding
The tool of molecular finger printing has been applied in crops including cassava,
yam, frafra potato, cowpea, groundnut, musa species and cocoa. The technique of
marker assisted selection for the traits of interest, genotyping and characterization
have been well utilized. Some of the PCR-based techniques that have been applied
include Randomly Amplified Polymorphic DNA (RAPD), Inter Simple Sequence
Repeats (ISSR), and Simple Sequence Repeats (SSR). Other research activities
include the study of genetic diversity of cocoa germplasm collections of Ghana using
microsatellite markers, and determination of phenolic compounds for
resistance/susceptibility to Phytophthora pod rot in cocoa. The biotechnology tools
have been applied to several crops in the institute, including cocoyam (Xanthosoma
sp.). Cocoyam is noted to have a narrow genetic base posing a challenge for its
improvement. However, using phenotypic characterization, 101 collections were
assessed and molecular characterization is presently being used to establish its genetic
diversity leading to its improvement. Work on establishing the diversity within the
released varieties and local landraces of groundnut using microsatellite markers is
underway. In addition, work on determining the progenitors of the cultivated
groundnut using wild Arachis species and cultivated lines and construction of genetic
linkage map of the crop is also in progress.
Cassava is an important staple and industrial crop in Ghana and as such the Crops
Research Institute over the years has released improved cassava varieties to farmers in
the country. However, most of these improved varieties (used mainly for industrial
purposes) are high yielding, tolerant to most diseases and pests compared to the local
landraces. These local landraces which are preferred by farmers due to its mealy
properties are not only low yielding but also exhibit high postharvest physiological
deterioration and susceptible to pest and diseases (cassava green mites, Africa cassava
mosaic virus - ACMV). Several research interventions to address this include the use
of low cost technologies (Marker Assisted Selection) for pyramiding useful genes
from wild relatives of cassava into elite progenitors to develop landraces with
prolonged shelf life, pest and disease resistance.
Using biotechnologies, scientists at the Animal Research Institute (ARI) of the
Council for Scientific and Industrial Research (CSIR) have developed molecular
techniques for sex determination. They have been involved in the development of
recombinant vaccines, the molecular identification of rumen microflora in domestic
and wild ruminants and the identification of major genes for uterine capacity for
littering pigs.
90
Application of Genetic Engineering
The application of genetic engineering is yet to register any research activity since
Ghana’s biotechnology policy to inform the country on biosafety framework and
guidelines has remained non existent until the recent passage of the legislative
instrument. This has paved way for confined field trials of genetically modified
organisms (GMOs) although the country has not at yet developed its own genetically
transformed crop varieties. It is envisaged that with the passage of the biosafety
framework and structure, genetic engineering techniques such as somatic
embryogenesis would be initiated.
Human Resource Development and Capacity Building
Strengthening Ghana’s technological competence to acquire, assimilate, further
develop, and effectively apply the technology for enhanced agricultural production
requires the services of a highly skilled human resource. Consequently, Ghana is
consistently making efforts to build a national capacity in modern biotechnology
under three areas: physical, human and organizational/institutional resources. The
pool of stakeholders in the biotechnology field comprising educators, researchers,
policy makers, regulatory agencies, legislators, civil society organizations and donors
is needed for the success of the application of biotechnology in Ghana (Table 2).
These occupy placements in key institutions playing integral roles to assist with
generating and transferring of knowledge and products. All these categories of
stakeholders do not function in isolation but have their functions interconnected.
However, all functions of the stakeholders need to be further addressed for the
realization of the systematic synergy required for making the desired output.
Ghana is relatively endowed with a high level of skilled human resource in
biotechnology and its related disciplines such as molecular biologists, virologists,
plant breeders, geneticists, pathologists, microbiologists, physiologists, entomologists
and tissue culture specialists. The Crops Research Institute (CRI) which is mandated
to carry out research on all crops except cocoa, cola nut, oil palm, coconut, sorghum,
and millet. The institute has a multi-disciplinary team of human resource comprising
28 members with PhD, 35 MSc/ MPhil/ MA, 10 BSc. qualifications, technicians and
other supporting staff. In a survey involving 50 scientists in the country, over 65%
had PhD degrees and are specialized in crop breeding, biochemistry, physiology,
molecular biology and tissue culture. Although, majority of these scientists received
their graduate training from outside Ghana due to lack of biotechnology programmes
offered in the nation’s universities, currently, three of the nation’s public universities
offer undergraduate and post-graduate courses in plant biotechnology. These
universities include University of Ghana – Crop Science and Botany Departments,
Biochemistry, Biological sciences department of the University of Cape Coast and
Crop Science Departments of Kwame Nkrumah University of Science and
Technology.
Various institutions have a wide range of facilities to address their respective
functions and these can be found in all the institutions that apply biotechnology. There
are 13 institutions in Ghana that apply biotechnology to aspects of agriculture. Out of
this number, 11 organizations offer plant biotechnology research involving a wide
range of crops such as cereals, legumes, fruits, roots and tubers, oilseeds, forage, fibre
91
crops, tree crops etc. Majority of these institutions have been equipped with facilities
for molecular biology, tissue culture, analytical and general biotechnology.
Biotechnological Policy and Biosafety Framework
Ghana has recently passed a legislative instrument on biosafety framework and
structure and awaiting the passage of the biotechnology policy. The policy will
outline the framework for specific initiatives including biotechnology development
and biosafety. The passage of the biosafety legislative instrument has paved way for
the conduction of confined field trials on GMOs in Ghana. Biosafety committees have
been established and trained to oversee all issues related to GMOs at both national
and institutional levels. Since the success of the biosafety framework does not only
depend on the committees, various stakeholders of biotechnology have been
sensitized on the concepts and prospects of the use of biotechnologies and GMOs in
particular. These stakeholders include farmers, policy makers, the media, scientists
and students. In the mean time, biotechnology capacity development is the
responsibility of the National Science and Technological Policy (NSTP). The NSTP
seeks to promote the research and application of new technologies including
biotechnology and genetic engineering as well as promote scientific knowledge and
development of technologies in the new and emerging sciences such as plant
biotechnology (MES, 2000). The short coming of the NSTP is that it is not abundantly
explicit on what and how the country intends to apply biotechnology to enhance
national development. The thrust of Ghana’s development policy concerns the
achievement of equitable economic growth and accelerated poverty reduction (GoG,
2001). Appropriate laws and legislative instruments are needed to provide incentives
and guidance to the involvement of the private sector in the development and
application of biotechnology. Government should also encourage banks to provide
venture capital for commercializing various aspects of biotechnology such as tissue
culture.
Intellectual property mechanisms in the Ghana Patent Law which currently provides
protection for some biotechnology novel applications need to be up-dated and
streamlined to cover patenting of living organisms to give protection for technical
inventors. Although the Protection of Plant Varieties Bill seeks to implement the
UPOV act in Ghana in consonance with Ghana’s obligations under the World Trade
Organization (WTO) agreement, the UPOV convention does not sufficiently address
the use of the potentially negative impact on subsistence farmers especially when the
protected materials is foreign. This implies that Ghana has the option of a sui generic
system for the protection of biotechnology inventors as a way of stimulating research
and development and an incentive for investment could be employed. The national
biosafety framework is a combination of policy, legal, administrative and technical
instruments developed to ensure an adequate level of protection in the safe transfer,
handling and use of living modified organisms. The scope of the biosafety bill (2007)
draft law regulates all activities in biotechnology including contained use, releases in
the environment, placement on market, export and transit of GMOs.
Future Role Of Agricultural Biotechnology In Ghana
Ghana can benefit from previous experiences and results achieved in other developing
regions in obtaining benefits from the applications of plant biotechnology. This can be
done through proper planning, interactive cooperation among and between
92
stakeholders. Opportunities to conserve and develop the natural resources of Ghana’s
wild relatives of commercial crops, neg

Congress _Proceedings_Publication

Transcription

Similar documents

Biotechnology Overview Presentation.

DEPARTMENT of BIOTECHNOLOGY DEPARTMENT of

Commercialising early stage agbiotechnology from

o d1"t

Gene Regime - Philosophy

New Designs!

BIOVAL - Instituto de Investigación Sanitaria La Fe

H2020 Biyoteknoloji

Editorial Board Chairman KSRCT. Principal KSRCT. Professor

The VanDries Travel to Washington, D.C.