Oral administration of hyaluronan prevents skin - in

Journal of Photochemistry & Photobiology, B: Biology 153 (2015) 215–221
Contents lists available at ScienceDirect
Journal of Photochemistry & Photobiology, B: Biology
journal homepage: www.elsevier.com/locate/jpb
Oral administration of hyaluronan prevents skin dryness and epidermal
thickening in ultraviolet irradiated hairless mice
Chinatsu Kawada a, Mamoru Kimura a,b, Yasunobu Masuda a, Yoshihiro Nomura b,⁎
a
b
R&D Division, Kewpie Corporation, Tokyo, Japan
Faculty of Agriculture, Scleroprotein and Leather Research Institute, Tokyo University of Agriculture and Technology, Tokyo, Japan
a r t i c l e
i n f o
Article history:
Received 3 March 2015
Received in revised form 14 September 2015
Accepted 18 September 2015
Available online 21 September 2015
Keywords:
Hyaluronan
Photoaging
Ultraviolet irradiation
Skin moisture content
Hairless mice
a b s t r a c t
Hyaluronan is a component of the extracellular matrix that plays a role in water retention in tissues. In this study,
we orally administered hyaluronans of varying molecular weights (300 k and less than 10 k) repeatedly to hairless mice exposed to ultraviolet (UV) irradiation and examined their effects on the skin of these mice. UV irradiation induces a marked increase in the epidermal thickness of the dorsal skin and a marked decrease in the skin
moisture content; however, orally administered hyaluronan, particularly that with a molecular weight of less
than 10 k, markedly reversed the increase and decrease in the epidermal thickness and skin moisture content,
respectively. Furthermore, on analyzing the mice skin, orally administered hyaluronan with a molecular weight
of less than 10 k increased the levels of the HAS2 gene expression in the skin. Based on these findings, it is assumed that orally administered hyaluronans, with molecular weight of 300 k and less than 10 k, reversed UV
irradiation-induced skin disturbance. In particular, it was considered that the increase in the skin moisture content by orally administered hyaluronan, with a molecular weight of less than 10 k, was related to the effect on
skin cells.
© 2015 Elsevier B.V. All rights reserved.
1. Introduction
Hyaluronan (HA) is a linear glycosaminoglycan that is a major component of the extracellular matrix, which is composed of repeating polymeric disaccharides of D-glucuronic acid and N-acetyl-D-glucosamine
that are linked via alternating β-1, 4 and β-1, 3 glycosidic bonds [1]. In
all vertebrates, more than 50% of the total body HA is present in the
skin [2,3]. HA is responsible for regulating the water balance in the skin
and maintaining the cell structure in the dermis [4], and it is involved
in keratinocyte proliferation and differentiation in the epidermis [5–7].
Skin aging is divided into age-related intrinsic aging and ultraviolet
(UV) irradiation-induced photoaging [8]. Photoaged skin is characterized by wrinkles, dryness, roughness, pigmented spots, histological
changes, and decreased skin barrier function [9]. These symptoms are
caused by decreased collagen [10], HA decomposition [11], increased
matrix metalloprotease [12], reactive oxygen [13], and elastin accumulation [14] in the skin. Ingested HA increases the skin moisture contents
in subjects with dry skin [15,16]. The orally administrated HA is
absorbed into the body, and the orally administrated HA is then detected in the skin [17–19]. The orally administrated HA is reportedly
absorbed intact [18] as well as in the form of its decomposed
⁎ Corresponding author at: Scleroprotein and Leather Research Institute, Tokyo University
of Agriculture and Technology, 183-8509 Saiwai-cho, Fuchu-shi, Tokyo 183-0057, Japan.
E-mail address: ny318@cc.tuat.ac.jp (Y. Nomura).
http://dx.doi.org/10.1016/j.jphotobiol.2015.09.020
1011-1344/© 2015 Elsevier B.V. All rights reserved.
metabolites by intestinal bacteria [20]. In this study, we examined the
preventive effects of orally administrated HA on skin photoaging.
2. Materials and Methods
2.1. Materials
Two types of HA that were produced by microbial fermentation at
the Kewpie Corporation (Tokyo, Japan) were used. The molecular
weights (MWs) of these HA were 300 k (Hyabest®(S) LF-P) and less
than 10 k, which were determined by the analysis of limiting viscosity.
All the other reagents used were special grade items that were produced
by Wako Pure Chemical Industries, Ltd. (Osaka, Japan).
2.2. Animal Experiments
This study was approved by the Ethics Committee of the Tokyo
University of Agriculture and Technology in accordance with the guidelines of the Swiss National Institute of Health (no. 23–29).
Six-week-old HR-1 hairless male mice were obtained from Sankyo
Labo Service Corporation, Inc (Tokyo, Japan). The animals were kept
on a 12-h light/dark cycle at 24 °C ± 2 °C with 55% ± 5% humidity,
and they had free access to the Labo MR Stock (Nosan Corporation,
Kanagawa, Japan) and sterile distilled water.
216
C. Kawada et al. / Journal of Photochemistry & Photobiology, B: Biology 153 (2015) 215–221
2.3. Experimental Design and Oral Administration
The animals were allowed to acclimatize for a week before the start
of the experiment. Twenty-three mice were allocated to the following
four groups: the non-UV irradiated group [UV(−) control group, n =
6], which was a negative control group, the UV-irradiated group
[UV(+) control group, n = 6], the UV-irradiated and HA-treated
(MW, 300 k) group [UV(+) HA300 k group, n = 5], and the UVirradiated and HA-treated (MW, less than 10 k) group [UV(+) HA10 k
group, n = 6]. These groups were adjusted such that they had the
same average body weight and skin moisture content. The HA were dissolved in sterile distilled water, and the mice in the HA-treated groups
were administered oral HA at a dose of 200 mg/kg body weight per
day for six weeks with concurrent exposure to UV irradiation three
times and skin moisture content measurements twice per week. After
the experimental period, the mice were sacrificed by the collection
of whole blood from their hearts under the effect of anesthesia
(SEVOFRANE®; Maruishi Pharmaceutical Co., Ltd., Osaka, Japan).
Samples that were obtained from the dorsal skin were rapidly frozen
in liquid nitrogen and stored at − 80 °C. Skin biopsy samples that
were removed using a biopsy punch with a diameter of 8 mm for the
histological analysis were fixed in 10% buffered formalin.
2.4. Ultraviolet Irradiation
In accordance with the UV-irradiation method of Tanaka et al. [21],
the mice were housed in a stainless steel cage (5 × 9 × 4 cm) and subjected to UV irradiation that was emitted from a UV-B lamp (GL20SE;
Sankyo Denki Co., Ltd., Tokyo, Japan). The UV irradiation was performed
for 1 min and 30 s each time in the first week. The exposure time was
then increased to 2 min each time 3 times a week in the second week,
2 min and 30 s each time in the third week, 3 min each time in the fourth
week, 3 min and 30 s each time in the fifth week, and the final duration
of 3 min and 45 s each time in the sixth week, resulting in the total irradiation of 2.8 J/cm2 in each mouse.
2.5. Histological Analysis
Dorsal skin was fixed in formalin, embedded in paraffin, and prepared for optical microscopy. Hematoxylin & Eosin (H&E) staining was
conducted for tissue examinations and to measure the epidermal thickness. Three sites were randomly selected in the sections from each
mouse, and the thickness of the epidermis was measured in 10 points
per site under the microscope with Axio Vision software version 4.5
(Carl Zeiss Microscopy Co., Ltd., Tokyo, Japan). The mean of these
three measurements in each mouse was used to calculate the mean
for each experimental group.
skin of the waist, under anesthesia (SEVOFRANE®; Maruishi
Pharmaceutical Co., Ltd., Osaka, Japan). When the standard deviation
of five continuously measured values was under 0.1, the average of
the last five measured values was used as the TEWL value for each
mouse.
2.8. Quantitative Real-time Polymerase Chain Reaction
The skin samples were homogenized in TRIzol Reagent (Life
Technologies Corporation, Grand Island, NY, USA), and homogenates
were centrifuged at 10,000 rpm for 15 min at 4 °C. The total RNA that
was obtained from those supernatants was used for cDNA production
with a PrimeScript RT reagent Kit (Perfect Real Time; Takara Bio Inc.,
Shiga, Japan). Quantitative real-time polymerase chain reaction
(RT-PCR) was performed with the intercalater method and SYBR
Green I with the Thermal Cycler Dice Real Time System TP800
(Takara Bio Inc.). The measurement of each sample was done with
doublet holes, and the fluorograms were examined after 40 cycles
of PCR for hyaluronan Synthase 2 (HAS2) and glyceraldehyde
3-phosphate dehydrogenase (GAPDH).
The sequences of the primer pairs, 5′ and 3′, were as follows: HAS2,
gtcatgtacacagccttcagagcac and ggcagggtcaagcatagtatctgag; and GAPDH,
tgtgtccgtcgtggatctga and ttgctgttgaagtcgcaggag, respectively. The
housekeeping gene GAPDH was used for internal normalization. The
analysis of the quantitative RT-PCR data was conducted with the
machine exclusive software (Thermal Cycler Dice Real Time System
TP800 Software, Ver.1.02A).
2.9. Statistical Analysis
All data are expressed as the mean ± standard error of the mean
(SEM). For the skin moisture content, TEWL, and epidermal thickness,
which were markedly affected by UV irradiation, the UV(−) control
group was considered as a reference, and Dunnett test was used as the
standard with the UV(+) control group to compare the values between
the groups. In contrast, for the HAS2 gene expression in the skin, which
was not markedly affected by UV irradiation, Tukey–Kramer's test was
used to compare the values between the groups. All statistical analyses
were performed with the SPSS software package (IBM Corporation,
Armonk, NY, USA). p values of less than 0.05 were considered statistically significant, and those less than 0.10 were considered as having a
statistically significant tendency.
3. Results
2.6. Skin Moisture Content
3.1. Histopathological Analysis of the Dorsal Skin
The skin moisture content of the dorsal skin was measured with a
Corneometer CM825 (Courage + Khazaka electronic GmbH, Colognen,
Germany) after it was kept at 20 ± 2 °C and at 50 ± 5% humidity for
1 h prior to the HA administration and twice a week during the experimental period. The final value for the day was the average of 1 s × five
measurements, and the final value for the week for each mouse was
the average of the twice-a-week measurements.
Fig. 1 shows histopathological images of the UV-irradiated dorsal
skin of hairless mice, and Fig. 2 shows the measurement results of epidermal thickness. In the skin of the UV(−) control group (Fig. 1(a)),
the epidermis was thin with a thickness of two to three cell layers
(19.14 ± 0.44 μm). A hyperplastic response with six to eight cell layers
was evident in all the skin that had been exposed to UV irradiation
(Fig. 1(b)–(d)). The UV(+) control group exhibited a significant increase in epidermal thickness compared with the UV(−) control
group (Fig. 2, p b 0.01). However, the increase in epidermal thickness
was suppressed in the UV(+) HA300 k group and the UV(+) HA10 k
group, and the epidermal thickness decreased in the UV(+) HA300 k
group by 18% and in the UV(+) HA10 k group by 26% as compared
with the epidermal thickness of the UV(+) control group. In particular,
the UV(+) HA10 k group exhibited a significant tendency for a decrease
in the epidermal thickness as compared with the UV(+) control group
(p b 0.10).
2.7. Transepidermal Water Loss
Transepidermal water loss (TEWL) of the dorsal skin was measured
with Tewameter TM300 (Courage + Khazaka electronic GmbH,
Colognen, Germany), similar to the measurement of the skin moisture
content, after it was maintained at 20 °C ± 2 °C and at 50% ± 5% humidity for 1 h on the day before the dissection at the end of test. TEWL was
measured at 1 s intervals by vertically pushing the probe into the dorsal
C. Kawada et al. / Journal of Photochemistry & Photobiology, B: Biology 153 (2015) 215–221
217
Fig. 1. Changes in the histopathological images of dorsal skin in UV-irradiated hairless mice after the oral administration of HA or control. After UV irradiation and the oral administration of
control or HA for 6 weeks, dorsal skin tissue was removed and Hematoxylin & Eosin (H&E) staining was conducted (scale bar, 50 μm); (a) UV(−) control group, (b) UV(+) control group,
(c) UV(+) HA300 k group, and (d) UV(+) HA10 k group.
3.2. Skin Moisture Content
Fig. 3 and Table 1 show the temporal changes in the skin moisture
contents in UV-irradiated hairless mice. The skin moisture content in
the UV(+) control group decreased from 1 week of UV irradiation,
and it showed a significant decrease as compared with the skin
moisture content in the UV(−) control group during this test period
(p b 0.01). Although the skin moisture content in the UV(+) HA300 k
and the UV(+) HA10 k groups after 1 week of UV irradiation significantly decreased as compared with that in the UV(+) control group
(p b 0.05 and p b 0.01, respectively), the skin moisture contents in the
UV(+) HA300 k and the UV(+) HA10 k groups after 3 weeks of UV
irradiation significantly increased compared with that in the UV(+)
control group (p b 0.05 and p b 0.01, respectively). Furthermore,
the skin moisture contents in the UV(+) HA10 k group after 4 and
5 weeks of UV irradiation significantly increased as compared with
that in the UV(+) control group (p b 0.05).
3.3. Transepidermal Water Loss
Fig. 4 reveals TEWL in the dorsal skin of UV-irradiated hairless mice
at the completion of the test. TEWL in the UV(+) control group showed
a significant increase compared with that in the UV(−) control group
(p b 0.001). The values of the UV(+) HA groups were almost the same
as those of the UV(+) control group, and there were no significant
differences between the UV(+) control and UV(+) HA groups.
3.4. Gene Expression of HAS2 in the Skin
Fig. 2. Changes in the epidermal thickness of the dorsal skin in UV-irradiated hairless mice
after the oral administration of HA or control. The epidermal thickness was measured on
the H&E-stained preparations shown in Fig. 1. The epidermal thickness was measured in
three sites per one preparation, and the average of these three values was calculated for
each mouse. The data are presented as mean ± SEM. †p b 0.10 and ⁎⁎⁎p b 0.001 vs.
UV(+) control by Dunnett's test.
Fig. 5 shows the amount of the HAS2 gene expression in the dorsal
skin, determined by quantitative RT-PCR. The amount of the HAS2
gene expression in the UV(+) control group slightly increased compared with that in the UV(−) control group; however, there was no significant difference between the UV(+) control and UV(−) control
groups. Furthermore, the amount of the HAS2 gene expression in the
UV(+) HA groups was higher than that in the UV(+) control group.
In particular, in the UV(+) HA10 k group, there was a significant
tendency for increase in the amount of the HAS2 gene expression compared with that in the UV(−) control group.
218
C. Kawada et al. / Journal of Photochemistry & Photobiology, B: Biology 153 (2015) 215–221
Fig. 3. Changes in the skin moisture content of the dorsal skin in UV-irradiated hairless mice with time following the oral administration of HA or control. The moisture content of the dorsal
skin was measured prior to the administration and twice a week during the experimental period; (a) 0 week (prior to oral administration), (b) 1 week, (c) 2 weeks, (c) 3 weeks, (d) 4
weeks, (e) 5 weeks, and (f) 6 weeks. The data are presented as mean ± SEM. a p b 0.05 and aa p b 0.01 between UV(+) control and UV(−) control by Dunnett's test. b p b 0.05 and bb
p b 0.01 between UV(+) control and UV(+) HA by Dunnett's test.
4. Discussion
Chronic UV irradiation to the skin induces wrinkles, slackness,
roughness, and pigmentation. UV irradiation is known to damage the
skin by a number of processes, including collagen degradation in the
extracellular matrix by the activation of matrix metalloproteinases,
the suppression of collagen synthesis [22], and decrease in the amounts
of HA in the dermis by downregulation of the HAS gene expression [11].
A photoaging model of hairless mice has demonstrated the symptoms of
photoaged skin, including wrinkle formation, the reduction of skin viscoelasticity [12] and the skin moisture content [21], increase of TEWL
[23], and hypertrophy of epidermal and elastic fibers [24]. In this
C. Kawada et al. / Journal of Photochemistry & Photobiology, B: Biology 153 (2015) 215–221
219
Table 1
Changes in the skin moisture content of the dorsal skin in UV-irradiated hairless mice with time following the oral administration of HA or control.
Skin moisture content
Prior to ingestion
Experimental period
1 week
UV(−) control
UV(+) control
UV(+) HA300 k
UV(+) HA10 k
57.26 ± 3.45
57.73 ± 2.02
57.96 ± 2.42
58.90 ± 2.09
2 weeks
aa
69.51 ± 1.64
61.60 ± 1.02
55.05 ± 2.70b
52.72 ± 1.69bb
67.01 ± 1.72
49.77 ± 1.48
48.88 ± 1.02
46.84 ± 1.64
3 weeks
aa
4 weeks
aa
63.01 ± 0.52
39.03 ± 1.15
44.07 ± 1.82b
45.24 ± 1.14bb
5 weeks
aa
61.52 ± 1.87
41.85 ± 1.52
46.59 ± 1.79
47.24 ± 1.65b
6 weeks
aa
66.82 ± 1.02
39.88 ± 1.30
43.45 ± 1.80
44.28 ± 1.21b
71.71 ± 2.45aa
45.56 ± 1.68
47.71 ± 2.74
44.43 ± 1.04
Mean ± SEM.
a
p b 0.05 between UV(+) control and UV(−) control by Dunnett's test.
aa
p b 0.01 between UV(+) control and UV(−) control by Dunnett's test.
b
p b 0.05 between UV(+) control and UV(+) HA by Dunnett's test.
bb
p b 0.01 between UV(+) control and UV(+) HA by Dunnett's test.
study, we examined the effects of HAs (MW: 300 k and less than 10 k)
on skin conditions in hairless mice after 6 weeks of UV irradiation.
Although the mechanisms underlying UV-irradiation induced
increases in the epidermal thickness remain unclarified, an increase in
cell death in the epidermal cells, increase in filaggrin production, and
increase in the epidermal growth factor in the MAPK pathway are all
believed to contribute [25–27]. Furthermore, UV irradiation affects the
synthesis and degradation of HA in the skin [28]. The skin moisture
content in the dermis is primarily determined by the amount of HA.
However, the amount of HA in the epidermis is responsible for the
total amount of sulfated GAGs, such as chondroitin sulfate, dermatan
sulfate, heparin, and heparin sulfate [29].
Oral administered HAs, with MWs ranging from 5 k to 1000 k, are assumed to be absorbed and transferred to the skin [17–19]. Low-MW
HAs are absorbed primarily through the Caco-2 cell monolayer after
oral administration [17]. On the other hand, after oral administration,
the comparatively high-MW HAs are believed to be decomposed into
low-MW molecules by intestinal bacteria and are absorbed [20] while
intact high-MW HA is partly absorbed by the lymphatic system [18].
Therefore, we postulated that both HA types used in the present study
were transferred to the skin after ingestion. Moreover, HA oligosaccharides (MW, 1–2 k) increase HA production in human fibroblasts, probably by displacing endogenous HA from receptors [30]. Because highMW HA (MW, 1500 k) decreases UV-induced apoptosis in the human
epithelial corneal cells [31], orally administered HA may also suppress
UV-induced apoptosis in epidermal cells, preventing increase in the
epidermal thickness. Further, high-MW HA (MW, 1100 k) stimulate
human fibroblast proliferation within a collagen matrix [32]. Therefore,
orally administered HAs reversed the UV-irradiation induced decrease
in the skin moisture content not only by directly increasing HA synthesis but also by increasing the fibroblast number. As far as the amount of
the HAS2 gene expression in the skin is concerned, only the UV(+)
Fig. 4. Changes in TEWL in the dorsal skin of UV-irradiated hairless mice after the oral administration of HA or control. After UV irradiation and oral administration of HA or control
for 6 weeks, TEWL was measured on the day before the dissection at the end of test. The
average of the last five measured values was used as the TEWL value for each mouse
when the standard deviation of five continuously measured values was under 0.1. The
data are presented as mean ± SEM. ***: p b 0.001 vs UV(+) control by Dunnett's test.
HA10 k group showed the tendency for it to be increased compared
with the UV(−) control group. Therefore, we suggest that the increase
in HA production in the skin contributed to the suppression of decrease
of the skin moisture content in the UV(+) HA10 k group. On the other
hand, we postulated that the effect on the other sulfated GAGs related
to skin moisture content in the skin contributed to that in the UV(+)
HA300 k group. The amount of HA in the skin after UV irradiation
depended on the balance of the synthesis and decomposition of HA
[28]. Therefore, in order to examine in more detail the underlying
mechanism by which orally administered HA reverses UV-induced decrease in the skin moisture, further studies evaluating the effects of
oral administration of HA on hyaluronidase expression in the skin
should be conducted.
There were no significant differences between the UV(+) control
and UV(+) HA groups in the skin moisture content after 6 week of UV
irradiation (Fig. 3(e)). We presumed that this result didn't contribute
to the disappearance of the effect of orally administrated HA on skin
moisture content, but to the resistance to UV irradiation by repetition
of comparatively high-intense UV irradiation. Epidermal barrier disruption by UV irradiation induces the increase of TEWL [33,34]. In this
study, TEWL in the UV(+) control group markedly increased by UV irradiation compared with TEWL in the UV(−) control group (Fig. 4).
The decreased expression of tight junction-related molecules by UV irradiation, such as Rac1 and protein kinase C, which play an important
role in the epidermal barrier function, induced the increase of TEWL
[34]. HA-mediated CD44 interaction in the epidermis activates Rac1
[35]. However, TEWL in the UV(+) HA groups was not suppressed the
increase by UV irradiation compared with that in the UV(+) control
group. It is known that the skin barrier function is mainly localized to
the stratum corneum, which consists of a cornified envelope and intercellular multilamellar lipids. However, the effect on these skin barrier
factors by HA has not been clarified. Therefore, we considered that orally administered HAs with molecular weight of 300 k and less than 10 k
did not reverse the disruption of the skin barrier function by UV irradiation because they had less effect on the factors associated with this
function.
In this study, we examined the effects of the oral administration of
HA (MW; 300 k and less than 10 k) on UV-irradiated skin. Both HAs revealed similar preventive effects on UV-irradiated skin damage. However, there were differences between the UV(+) HA300 k and UV(+)
HA10 k groups in the amount of the HAS2 gene expression in the skin.
Only the UV(+) HA10 k group showed a marked tendency to increase
the HAS2 gene expression compared with the UV(−) control group.
The physiological activities of HA differ according to its MW [36–39].
In particular, low-MW HA (MW; 150 k and 50 k) have higher free
radical-scavenging and antioxidant activities than high-MW HA (MW;
1050 k) [40]. This study suggests that both the partially depolymerized
and the fully intact HA (MW; 300 k and less than 10 k) absorbed after
oral administration reduces oxidative stress to the skin by UV irradiation. Furthermore, HA with a MW of 150 k have higher antioxidant activities compared with that with a MW of 50 k [40]. Differences in the
220
C. Kawada et al. / Journal of Photochemistry & Photobiology, B: Biology 153 (2015) 215–221
Fig. 5. Change in the HAS2 gene expression in the dorsal skin of UV-irradiated hairless mice after the oral administration of HA or control. As described in Materials and Methods, the total
RNA was extracted from the dorsal skin tissue of UV-irradiated hairless mice, and the HAS2 gene expression in the skin was measured by quantitative real-time polymerase chain reaction.
The results of UV(−) and UV(+) control groups, (a) UV(+) HA 300 k and (b) UV(+) HA 10 k groups are shown. The data are presented as mean ± SEM. †: p b 0.10 vs. UV (−) control by
Tukey–Kramer's test.
effects on UV-irradiated skin between orally administered intact HA of
MWs of 300 k and less than 10 k were believed to depend on differences
in the antioxidant activity.
Recent investigations have demonstrated that ingestion of HA with
other compounds led to a significant reduction of skin dryness and
wrinkles [41,42]. However, the amount of HA including daily supplementation in these studies was only 40–100 mg, and test supplement
made of different ingredients such as collagen and coenzyme Q 10.
Therefore, it would be insufficient to confirm the solitary effect of HA,
and we should study the effect of ingestion of HA alone on aged skin
in clinical trial.
5. Conclusion
In order to improve the aging symptom of skin such as wrinkles and
dryness, HA has been extensively used for local treatment such as
mesotherapy. Although this treatment of HA injection promotes skin
rejuvenation immediately, the effect gradually disappears by decomposition of injected HA in the skin. This study showed that the oral administration of HA for 6 weeks reversed the reduction in the skin moisture
content and the increase in epidermal thickness in UV-irradiated mice.
In addition, orally administrated HA (MW; less than 10 k) increased
the amount of HAS2 gene expression in the skin. Therefore, oral administration of HA can prevent the photoaged symptom internally by having an effect on the skin cells. In order to use HA as a functional food
for the prevention of skin photoaging, further studies on the effect of
oral administration of HA are needed.
Abbreviations
HA
UV
MW
H&E
TEWL
RT-PCR
HAS2
GAG
SEM
hyaluronan
ultraviolet
molecular weight
Hematoxylin & Eosin
Transepidermal water loss
real-time polymerase chain reaction
hyaluronan synthase2
glucosaminoglycan
standard error of the mean
References
[1] J.R. Fraser, T.C. Laurent, U.B. Laurent, Hyaluronan: its nature, distribution, functions
and turnover, J. Intern. Med. 242 (1997) 27–33.
[2] R.K. Reed, K. Lilja, T.C. Laurent, Hyaluronan in the rat with special reference to the
skin, Acta Physiol. Scand. 134 (1988) 405–411.
[3] U.B.G. Laurent, L.B. Dahl, R.K. Reed, Catabolism of hyaluronan in rabbit skin takes
place locally, in lymph nodes and liver, Exp. Physiol. 76 (1991) 695–703.
[4] R. Stern, H.I. Maibach, Hyaluronan in skin: aspects of aging and its pharmacologic
modulation, Clin. Dermatol. 26 (2008) 106–122.
[5] M. Brecht, U. Mayer, E. Schlosser, P. Prehm, Increased hyaluronate synthesis
is required for fibroblast detachment and mitosis, Biochem. J. 239 (1986)
445–450.
[6] W.Y. Chen, M.E. Grant, A.M. Schor, S.L. Schor, Differences between adult and foetal
broblasts in the regulation of hyaluronate synthesis: correlation with migratory
activity, J. Cell Sci. 94 (1989) 577–584.
[7] A.F. Wells, A.E. Lundin, G. MichaeÈlsson, Histochemical localization of hyaluronan in
psoriasis, allergic contact dermatitis and normal skin, Acta Derm. Venereol. 71
(1991) 232–238.
[8] N. Puizina-Ivić, Skin aging, Acta Dermatovenerol. Alp. Panonica Adriat. 17 (2008)
47–54.
[9] J.H. Chung, Photoaging in Asians, Photodermatol. Photoimmunol. Photomed. 19
(2003) 109–121.
[10] G.J. Fisher, Z.Q. Wang, S.C. Datta, J. Varani, S. Kang, J.J. Voorhees, Pathophysiology of
premature skin aging induced by ultraviolet light, N. Engl. J. Med. 337 (1997)
1419–1428.
[11] G. Dai, T. Freudenberger, P. Zipper, A. Melchior, S. Grether-Beck, B. Rabausch, J. de
Groot, S. Twarock, H. Hanenberg, B. Homey, J. Krutmann, J. Reifenberger, J.W.
Fischer, Chronic ultraviolet B irradiation causes loss of hyaluronic acid from mouse
dermis because of down-regulation of hyaluronic acid synthases, Am. J. Pathol.
171 (2007) 1451–1461.
[12] S. Inomata, Y. Matsunaga, S. Amano, K. Takada, K. Kobayashi, M. Tsunenaga, T.
Nishiyama, Y. Kohno, M. Fukuda, Possible involvement of gelatinases in basement
membrane damage and wrinkle formation in chronically ultraviolet B-exposed
hairless mouse, J. Investig. Dermatol. 120 (2003) 128–134.
[13] S.H. Ibbotson, M.N. Moran, J.F. Nash, I.E. Kochevar, The effects of radicals compared
with UVB as initiating species for the induction of chronic cutaneous photodamage,
J. Investig. Dermatol. 112 (1999) 933–938.
[14] B. Starcher, R. Pierce, A. Hinek, UVB irradiation stimulates deposition of new elastic
fibers by modified epithelial cells surrounding the hair follicles and sebaceous
glands in mice, J. Investig. Dermatol. 112 (1999) 450–455.
[15] C. Kawada, T. Yoshida, H. Yoshida, R. Matsuoka, W. Sakamoto, W. Odanaka, T. Sato, T.
Yamasaki, T. Kanemitsu, Y. Masuda, O. Urushibata, Ingested hyaluronan moisturizes
dry skin, Nutr. J. 13 (2014)http://dx.doi.org/10.1186/1475-2891-13-70.
[16] C. Kawada, T. Yoshida, H. Yoshida, W. Sakamoto, W. Odanaka, T. Sato, T. Yamasaki, T.
Kanemitsu, Y. Masuda, O. Urushibata, Ingestion of hyaluronans (molecular weights
800 k and 300 k) improves dry skin conditions: a randomized, double blind, controlled study, J. Clin. Biochem. Nutr. 56 (2015) 66–73.
[17] N. Hisada, H. Satsu, A. Mori, M. Totsuka, J. Kamei, T. Nozawa, M. Shimizu, Lowmolecular-weight hyaluronan permeates through human intestinal Caco-2 cell
monolayers via the paracellular pathway, Biosci. Biotechnol. Biochem. 72 (2008)
1111–1114.
[18] L. Balogh, A. Polyak, D. Mathe, R. Kiraly, J. Thuroczy, M. Terez, G. Janoki, Y. Ting, L.R.
Bucci, A.G. Schauss, Absorption, uptake and tissue affinity of high-molecular-weight
hyaluronan after oral administration in rats and dogs, J. Agric. Food Chem. 56 (2008)
10582–10593.
[19] M. Oe, K. Mitsugi, W. Odanaka, H. Yoshida, R. Matsuoka, S. Seino, T. Kanemitsu, Y.
Masuda, Dietary hyaluronic acid migrates into the skin of rats, ScientificWorldJournal
2014 (2014) 378024, http://dx.doi.org/10.1155/2014/378024.
[20] B. Lee, J.H. Lee, H.S. Lee, E.A. Bae, C.S. Huh, Y.T. Ahn, D.H. Kim, Glycosaminoglycan
degradation-inhibitory lactic acid bacteria ameliorate 2,4,6-trinitrobenzenesulfonic
acid-induced colitis in mice, J. Microbiol. Biotechnol. 19 (2009) 616–621.
[21] M. Tanaka, Y. Koyama, Y. Nomura, Effects of collagen peptide ingestion on UV-Binduced skin damage, Biosci. Biotechnol. Biochem. 73 (2009) 930–932.
[22] G.J. Fisher, S. Kang, J. Varani, Z. Bata-Csorgo, Y. Wan, S. Datta, J.J. Voorhees, Mechanisms
of photoaging and chronological skin aging, Arch. Dermatol. 138 (2002) 1462–1470.
[23] H.B. Pyun, M. Kim, J. Park, Y. Sakai, N. Numata, J.Y. Shin, H.J. Shin, D.U. Kim, J.K.
Hwang, Effects of collagen tripeptide supplement on photoaging and epidermal
skin barrier in UVB-exposed hairless mice, Prev. Nutr. Food Sci. 17 (2012) 245–253.
[24] L.H. Kligman, Symposium on models for the study of human photoaging: American
Society for Photobiology, Photochem. Photobiol. 50 (1989) 903–905.
[25] J.K. Lee, J.H. Kim, K.T. Nam, S.H. Lee, Molecular events associated with apoptosis
and proliferation induced by ultraviolet-B radiation in the skin of hairless mice,
J. Dermatol. Sci. 32 (2003) 171–179.
C. Kawada et al. / Journal of Photochemistry & Photobiology, B: Biology 153 (2015) 215–221
[26] H. Kambayashi, M. Yamashita, Y. Odake, K. Takada, Y. Funasaka, M. Ichihashi, Epidermal changes caused by chronic low-dose UV irradiation induce wrinkle formation in
hairless mouse, J. Dermatol. Sci. Suppl. 1 (2001) S19–S25.
[27] T.B. El-Abaseri, S. Putta, L.A. Hansen, Ultraviolet irradiation induces keratinocyte
proliferation and epidermal hyperplasia through the activation of the epidermal
growth factor receptor, Carcinogenesis 27 (2006) 225–231.
[28] M. Averbeck, C.A. Gebhardt, S. Voigt, S. Beilharz, U. Anderegg, C.C. Termeer, J.P.
Sleeman, J.C. Simon, Differential regulation of hyaluronan metabolism in the epidermal and dermal compartments of human skin by UVB irradiation, J. Investig.
Dermatol. 127 (2007) 687–697.
[29] J.H. Oh, Y.K. Kim, J.Y. Jung, J.E. Shin, K.H. Kim, K.H. Cho, H.C. Eun, J.H. Chung, Intrinsic
aging- and photoaging-dependent level changes of glycosaminoglycans and their
correlation with water content in human skin, J. Dermatol. Sci. 62 (2011) 192–201.
[30] H.J. Lüke, P. Prehm, Synthesis and shedding of hyaluronan from plasma membranes
of human fibroblasts and metastatic and non-metastatic melanoma cells, Biochem. J.
343 (1999) 71–75.
[31] T. Pauloin, M. Dutot, F. Joly, et al., High molecular weight hyaluronan decreases UVBinduced apoptosis and inflammation in human epithelial corneal cells, Mol. Vis. 15
(2009) 577–583.
[32] R.M. Greco, J.A. Iocono, H.P. Ehrlich, Hyaluronic acid stimulates human fibroblast
proliferation within a collagen matrix, J. Cell. Physiol. 177 (1998) 465–473.
[33] T. Yamamoto, M. Kurasawa, T. Hattori, T. Maeda, H. Nakano, H. Sasaki, Relationship
between expression of tight junction-related molecules and perturbed e pidermal
barrier function in UVB-irradiated hairless mice, Arch. Dermatol. Res. 300 (2008)
61–68.
[34] T. Yuki, A. Hachiya, A. Kusaka, P. Sriwiriyanont, M.O. Visscher, K. Morita, M. Muto, Y.
Miyachi, Y. Sugiyama, S. Inoue, Characterization of tight junctions and their
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
221
disruption by UVB in human epidermis and cultured keratinocytes, J. Investig.
Dermatol. 131 (2011) 744–752.
L.Y. Bourguignon, Matrix hyaluronan-activated CD44 signaling promotes
keratinocyte activities and improves abnormal epidermal functions, Am. J. Pathol.
184 (2014) 1912–1919.
R. Stern, A.A. Asari, K.N. Sugahara, Hyaluronan fragments: an information-rich system,
Eur. J. Cell Biol. 85 (2006) 699–715.
H. Xu, T. Ito, A. Tawada, H. Maeda, H. Yamanokuchi, K. Isahara, K. Yoshida, Y.
Uchiyama, A. Asari, Effect of hyaluronan oligosaccharides on the expression of
heat shock protein 72, J. Biol. Chem. 277 (2002) 17308–17314.
J. Hodge-Dufour, P.W. Noble, M.R. Horton, C. Bao, M. Wysoka, M.D. Burdick, R.M.
Strieter, G. Trinchieri, E. Pure, Induction of IL-12 and chemokines by hyaluronan
requires adhesion-dependent priming of resident but not elicited macrophages,
J. Immunol. 159 (1997) 2492–2500.
D.C. West, I.N. Hampson, F. Arnold, S. Kumar, Angiogenesis induced by degradation
products of hyaluronic acid, Science 228 (1985) 1324–1326.
C. Ke, L. Sun, D. Qiao, D. Wang, X. Zeng, Antioxidant activity of low molecular weight
hyaluronic acid, Food Chem. Toxicol. 49 (2011) 2670–2675.
S.R. Schwartz, J. Park, Ingestion of BioCell Collagen(®), a novel hydrolyzed chicken
sternal cartilage extract; enhanced blood microcirculation and reduced facial
aging signs, Clin. Interv. Aging 7 (2012) 267–273, http://dx.doi.org/10.2147/CIA.
S32836.
A. Di Cerbo, C. Laurino, B. Palmieri, T. Iannitti, A dietary supplement improves facial
photoaging and skin sebum, hydration and tonicity modulating serum fibronectin,
neutrophil elastase 2, hyaluronic acid and carbonylated proteins, J. Photochem.
Photobiol. B 144 (2015) 94–103, http://dx.doi.org/10.1016/j.jphotobiol.2014.12.025.