Full article - Latin American Journal of Aquatic Research

Transcription

Latin American Journal of Aquatic Research
www.lajar.cl
ISSN 0718 -560X
www.scielo.cl
CHIEF EDITOR
Sergio Palma
Pontificia Universidad Católica de Valparaíso, Chile
lajar@pucv.cl
ASSOCIATE EDITORS
Cristian Aldea
Universidad de Magallanes, Chile
Álvaro J. Almeida-Bicudo
Universidad Federal Rural de Permambuco, Brasil
José Angel Alvarez Perez
Universidade do Vale do Itajaí, Brasil
Patricio Arana
Pontifícia Universidad Católica de Valparaíso, Chile
Eduardo Ballester
Universidade Federal do Paraná, Brasil
Sandra Bravo
Universidad Austral de Chile, Chile
Claudia S. Bremec
Instituto de Investigación y Desarrollo Pesquero, Argentina
Enrique A. Crespo
Centro Nacional Patagónico, Argentina
Patricio Dantagnan
Universidad Católica de Temuco, Chile
Enrique Dupré
Universidad Católica del Norte, Chile
Diego Giberto
Instituto de Investigación y Desarrollo Pesquero, Argentina
José Luis Iriarte
Universidad Austral de Chile, Chile
Maurício Laterça-Martins
Universidade Federal de Santa Catarina
Brasil
César Lodeiros-Seijo
Instituto Oceanográfico de Venezuela
Universidad de Oriente, Venezuela
Beatriz E. Modenutti
Universidad Nacional del Comahue
Argentina
Luis M. Pardo
Universidad Austral de Chile
Chile
Guido Plaza
Pontificia Universidad Católica de Valparaíso, Chile
Jesús T. Ponce-Palafox
Universidad Autónoma de Nayarit, México
Ricardo Prego
Instituto de Investigaciones Marinas, España
Erich Rudolph
Universidad de Los Lagos, Chile
Nelson Silva
Pontificia Universidad Católica de Valparaíso
Chile
Oscar Sosa-Nishizaki
Centro de Investigación Científica y Educación Superior
de Ensenada, México
Marcelo Vianna
Universidade Federal do Rio de Janeiro, Brasil
Fernando Vega-Villasante
Universidad de Guadalajara, México
Ingo Wehrtmann
Universidad de Costa Rica, Costa Rica
Escuela de Ciencias del Mar, Pontificia Universidad Católica de Valparaíso
Casilla 1020, Valparaíso, Chile - E-mail: lajar@pucv.cl
LATIN AMERICAN JOURNAL OF AQUATIC RESEARCH
Lat. Am. J. Aquat. Res., 44(3) 2016
CONTENTS
Reviews
Francisco Neptalí Morales-Serna, Juan Manuel Martínez-Brown, Rosa María Medina-Guerrero & Emma Josefina Fajer-Ávila
Los calígidos ¿Patógenos potenciales para el cultivo de peces marinos en México? Caligids-potential pathogens for marine finfish aquaculture in Mexico? ………….…………………………………………………………………………….....….…433-441
Research Articles
Augusto César Crespi-Abril, Agustina Ferrando & Matías Emanuel Dileo Agostino-Andrea
Estudio de macroinvertebrados en dos intermareales de fondos blandos: datos de referencia en condiciones incipientes de impacto antrópico. Study of macroinvertebrate in two intertidal soft bottoms: reference data in conditions of incipient
anthropic impact………………….…………………………………………………………………….....…………………….........442-452
Rafael Metri, Aline Rossi de Oliveira & Cassiana Baptista-Metri
Carapace shape of some aeglid crabs: plasticity at different levels. La forma del caparazón de algunos cangrejos
aeglídeos: plasticidad en distintos niveles………………………………….……………………….....……………...…….….....453-459
Manuel Mendoza-Carranza, Diego Santiago-Alarcón, Juan Carlos Pérez-Jiménez & Chrystian Carolina Hernández-Lazo
Eyeless morphotype in the southern stingray (Dasyatis americana): a non-lethal and frequent abnormality from the
southern Gulf of Mexico. Un morfotipo sin ojos de raya látigo americana (Dasyatis americana): una anormalidad frecuente
pero no letal en el sur del Golfo de México……………………………….……………………….....…………………….….......460-469
Patricia López-León, Antonio Luna-González, Ruth Escamilla-Montes, María del Carmen Flores-Miranda, Jesús A. FierroCoronado, Píndaro Álvarez-Ruiz & Genaro Diarte-Plata
Isolation and characterization of infectious Vibrio parahaemolyticus, the causative agent of AHPND, from the whiteleg
shrimp (Litopenaeus vannamei). Aislamiento y caracterización de Vibrio parahaemolyticus infeccioso, agente causal de
AHPND en camarón blanco (Litopenaeus vannamei).……..……………….…………………….....………………….….........470-479
Eugenio Alberto Aragón-Noriega
Crecimiento individual de camarón blanco Litopenaeus vannamei (Boone, 1931) y camarón azul Litopenaeus stylirostris (Stimpson, 1874) (Decapoda: Penaeidae) con un enfoque multi-modelo. Individual growth of white shrimp Litopenaeus
vannamei (Boone, 1931) and blue shrimp L. stylirostris (Stimpson, 1874) (Crustacea: Penaeidae) by multi-model
approach……………………………………………………………………….…………………….....…………………….….........480-486
Juan Pablo Alcántar-Vázquez, Hugo Skyol Pliego-Cortés, Silvie Dumas, Renato Peña-Martínez, Martín Rosales-Velázquez &
Pablo Pintos-Terán
Effects of a luteinizing hormone-releasing hormone analogue (LHRHa) on the reproductive performance of spotted
sand bass Paralabrax maculatofasciatus (Percoidei: Serranidae). Efectos de un análogo de la hormona liberadora de la
hormona luteinizante (LHRHa) en el desempeño reproductivo de la cabrilla arenera Paralabrax maculatofasciatus (Percoidei:
Serranidae)……………………………………………………………………….…………………....…………………….….........487-496
Luis Fernando Del Moral-Flores, Miguel Ángel Guadarrama-Martínez & César Flores-Coto
Composición taxonómica y distribución de los cefalocordados (Cephalochordata: Amphioxiformes) en México. Taxonomic composition and distribution of cephalochordates (Cephalochordata: Amphioxiformes) from Mexico………….......497-503
Margarita Pérez-Valdés & Ramiro Contreras-Guzmán
Efecto de la temperatura y el fotoperiodo sobre el desarrollo temprano del nudibranquio Diaulula punctuolata
(d’Orbigny, 1837) en condiciones de laboratorio. Effect of temperature and photoperiod on the early development of nudibranch Diaulula punctuolata (d’Orbigny, 1837) under laboratory conditions……….....…………………….…......................504-512
www.scielo.cl/imar.htm
www.lajar.cl
María del Carmen Alejo-Plata, Miguel Ángel Ahumada-Sempoal, José Luis Gómez-Márquez & Adrián González-Acosta
Estructura poblacional y aspectos reproductivos del tiburón piloto Carcharhinus falciformis (Müller & Henle, 1839)
(Carcharhiniformes: Carcharhinidae) en la costa de Oaxaca, México. Population structure and reproductive characteristics
of the silky shark Carcharhinus falciformis (Müller & Henle, 1839) (Carcharhiniformes: Carcharhinidae) off the coast of Oaxaca,
Mexico……………………………………………………………………….………………….....…………………….…................513-524
Diana Suarez-Salgado, José Herrera-Camacho, Ana Laura Lara-Rivera & Gaspar Manuel Parra-Bracamonte
Diversidad y origen genético de poblaciones introducidas de bagre de canal (Ictalurus punctatus Rafinesque, 1818),
en el centro occidental de México. Diversity and genetic origin of introduced channel catfish (Ictalurus punctatus Rafinesque,
1818) to central-west Mexico…………………………………………….………………….....…………………….….................525-534
Luis R. Martínez-Córdova, Teresa Gollas-Galván, Estefanía Garibay-Valdez, Rocío Valenzuela-Gutiérrez, Marcel MartínezPorchas, Marco A. Porchas-Cornejo, Arturo Sánchez-Paz & Fernando Mendoza-Cano
Physiological and immune response of Litopenaeus vannamei undergoing the acute phase of the necrotizing hepatopancreatitis disease and after being treated with oxytetracycline and FF. Respuesta fisiológica e inmune de Litopenaeus
vannamei durante la fase aguda de la enfermedad de la necrosis hepatopancreática y posteriormente tratado con oxitetraciclina y FF……………………………………………………………………….………………….....…………………….…...............535-545
Gilson Stanski, Fernando L. Mantelatto & Antonio Leão-Castilho
Hermit crab bycatch fauna (Decapoda, Anomura) off the coast of Santa Catarina State, Brazil: diversity and spatialtemporal distribution. Fauna de captura incidental de cangrejo ermitaño (Decapoda, Anomura) en la costa de Santa Catarina, Brasil: diversidad y distribución espacio-temporal……………….…………………….....…………………….…...............546-556
Luz Adriana Velasco, Silvia Carrera & Judith Barros
Isolation, culture and evaluation of Chaetoceros muelleri from the Caribbean as food for the native scallops,
Argopecten nucleus and Nodipecten nodosus. Aislamiento, cultivo y evaluación de Chaetoceros muelleri del Caribe como
alimento para los pectínidos nativos, Argopecten nucleus y Nodipecten nodosus.............................................................557-568
José Gómez-Peñaranda, Lucena Vásquez-Gamboa & Diego Valencia
Efecto de diferentes frecuencias de alimentación y ayuno, sobre el crecimiento y aprovechamiento nutritivo de Piaractus brachypomus (Cuvier, 1818). The effect of different feeding and starvation frequencies on growth utilization and nutrients,
for Piaractus brachypomus (Cuvier, 1818) ……………….…………………….....…………………….…...............................569-575
Juan I. Cañete, Carlos S. Gallardo, Carlos Olave, María S. Romero, Tania Figueroa & Daniela Haro
Abundance and spatial distribution of neustonic copepodits of Microsetella rosea (Harpacticoida: Ectinosomatidae)
along the western Magellan coast, southern Chile. Abundancia y distribución espacial de copepoditos neustónicos de Microsetella rosea (Harpacticoida: Ectinosomatidae) en la costa occidental de Magallanes, Chile.…...................................576-587
Geraldo Fóes, Dariano Krummenauer, Gabriele Lara, Luis Poersch & Wilson Wasielesky Jr.
Long term storage and the compensatory growth of white shrimp Litopenaeus vannamei in aquaculture ponds. Almacenamiento a largo plazo y el crecimiento compensatorio de camarón blanco Litopenaeus vannamei en estanques de acuicultura……………….…………………….....…………………………………………………………………..…...............................588-594
Rosalba N. Perea-Juárez, Martín G. Frías-Espericueta, Federico Páez-Osuna & Doménico Voltolina
Copper, zinc, cadmium and lead inputs and outputs in the maternity section of a commercial shrimp hatchery. Ingresos y descargas de cobre, zinc, cadmio y plomo en la sección de maternidad de un laboratorio de producción comercial de
postlarvas de camarón……………….….……………………………………..…………………………..…...............................595-601
Olimpia Chong-Carrillo, Ricardo Arencibia-Jorge, Cristina Olimpia Chávez-Chong, Shehu L. Akintola, Marcelo U. GarcíaGuerrero, Layla Michán-Aguirre, Héctor Nolasco-Soria, Fabio Cupul-Magaña & Fernando Vega-Villasante
The prawns of the genus Macrobrachium (Crustacea, Decapoda, Palaemonidae) with commercial importance: a patentometric view. Los camarones de río del género Macrobrachium (Crustacea, Decapoda, Palaemonidae) con importancia comercial: una visión patentométrica….….……………………………………..…………………………..…...............................602-609
Gabriela Lucano-Ramírez, Estrella G. Rivera-Rios, Salvador Ruiz-Ramírez, Gaspar González-Sansón & Alejandro PerezToledo
Reproducción de Carangoides vinctus (Perciformes: Carangidae) en el Pacífico central mexicano. Reproduction of
Carangoides vinctus (Perciformes: Carangidae) in the Mexican Central Pacific…………………..…..................................610-622
www.lajar.cl
J. M. Alonso Vega
Fauna asociada a discos de adhesión del complejo Lessonia nigrescens. ¿Es un indicador de integridad ecológica en
praderas explotadas de huiro negro, en el norte de Chile? Inhabiting fauna in holdfasts of Lessonia nigrescens complex. Is
it an indicator of ecological integrity in exploited kelp beds in northern Chile? …………………..…....................................623-637
Short Communications
Janaína S. Pedron, Denise S. Miron, Ricardo V. Rodrigues, Marcelo H. Okamoto, Marcelo B. Tesser & Luís A. Sampaio
Stress response in transport of juvenile cobia Rachycentron canadum using the anesthetic benzocaine. Respuesta al
estrés del transporte en juveniles de cobia Rachycentron canadum anestesiados con benzocaína..................................638-642
Juan Barile, Manuel Escudero, Juan Romero & Francisco Encina
Supervivencia embrionaria de Galaxias maculatus (Jenyns, 1842) sometida a diferentes tratamientos profilácticos.
Embryonic survival of Galaxias maculatus (Jenyns, 1842), under different prophylactic immersion bath………................643-648
Marco Agustin Liñan-Cabello, Ana Luz Quintanilla-Montoya, Cesar Sepúlveda-Quiroz & Omar D. Cervantes-Rosas
Susceptibilidad a la variabilidad ambiental del sector acuícola en el Estado de Colima, México: caso de estudio. Susceptibility to environmental variability of the aquaculture sector in the State of Colima, Mexico: case study......................649-656
Marcela Herrera, Tayler M. Clarke, Beatriz Naranjo-Elizondo, Mario Espinoza & Ingo S. Wehrtmann
Size at maturity of the Pacific bearded brotula (Ophidiidae: Brotula clarkae): a commercially exploited species in the
Pacific of Costa Rica. Talla de madurez sexual del congrio rosado (Ophidiidae: Brotula clarkae): una especie de importancia
comercial en el Pacífico de Costa Rica….….………………………………...…………………………..…..............................657-661
www.lajar.cl
Lat. Am. J. Aquat. Res., 44(3): 433-441, 2016
DOI: 10.3856/vol44-issue3-fulltext-1
Impacto de los calígidos en peces cultivados
433
Review
Los calígidos ¿Patógenos potenciales para el cultivo de peces marinos en México?
Francisco Neptalí Morales-Serna1,2,, Juan Manuel Martínez-Brown1,2
Rosa María Medina-Guerrero2 & Emma Josefina Fajer-Ávila2
1
CONACYT, 2Centro de Investigación en Alimentación y Desarrollo A.C.
Unidad Mazatlán en Acuicultura y Manejo Ambiental, Mazatlán, Sinaloa, México
Corresponding author: Francisco Neptalí Morales-Serna (francisco.morales@ciad.mx)
RESUMEN. Los copépodos parásitos de la familia Caligidae, comúnmente llamados “piojos de mar”, son
descritos como uno de los problemas más serios que afectan a la industria del salmón en la etapa de engorda en
el mar a nivel mundial, causando lesiones en la piel, crecimiento lento y mortalidad. Gran parte de los
conocimientos biológicos y ecológicos de estos organismos se han obtenido a partir de especies de aguas frías
o templadas. En México, el conocimiento de este grupo de parásitos se ha limitado a registros esporádicos de
especies nuevas o ya conocidas, pero poco se sabe sobre su biología y ecología. La diversidad de calígidos en
peces silvestres puede ser alta en las costas mexicanas, por lo que no debería descartarse su potencial riesgo
sanitario en áreas de interés para la piscicultura marina. En este artículo se resume el conocimiento actual sobre
el ciclo de vida, localización de hospedero, ecología, efecto en la salud de los peces y métodos de control de
calígidos. Mejorar el conocimiento de este grupo de parásitos facilitaría no sólo posibles estrategias de
prevención y control de enfermedades de los peces, sino también el manejo y conservación de recursos naturales,
ya que las granjas de peces pueden producir parásitos que impacten las poblaciones naturales de peces.
Palabras clave: Siphonostomatoida, calígidos, crustáceos, parasitismo, biología, ecología, Latinoamérica.
Caligids-potential pathogens for marine finfish aquaculture in Mexico?
ABSTRACT. Parasitic copepods of the family Caligidae, the so-called sea lice, may be deleterious to marine
or brackish finfish aquaculture. To date, biological and ecological studies of sea lice have been mostly restricted
to species from cold or temperate regions. In Mexico there are some records of sea lice species on marine fishes;
however, the research regarding their biology and ecology has been scarce. It is possible that a high biodiversity
of sea lice is distributed in coastal waters of Mexico; therefore, their significance as pathogenic parasites should
increase. The purpose of this review is to outline the current knowledge of the life cycle, host location, ecology,
effect on fish health, and control strategies of sea lice in order to establish supportive basis for natural resource
management and control of parasites and diseases of marine fish cultured in Mexico.
Keywords: Siphonostomatoida, caligids, crustaceans, parasitism, biology, ecology, Latin America.
INTRODUCCIÓN
Desde 1960 la acuicultura ha sido a nivel mundial la
actividad productora de alimentos con mayor tasa de
crecimiento anual. Entre los años 2000 a 2012 la
producción acuícola aumentó a una tasa media anual de
6,2% (FAO, 2014). En el 2013, el cultivo de peces
representó el 67% de la producción total de la
acuicultura y de este porcentaje, el 5% correspondió a
peces marinos (FAO, 2015). El aumento de la intensidad y densidad de cultivo en las piscifactorías marinas
__________________
Corresponding editor: Sandra Bravo
es consecuencia de la búsqueda de eficiencia productiva y aumento de la rentabilidad mediante las
economías de escala. Las principales unidades de
cultivo para la producción de peces marinos son las
jaulas flotantes (Beveridge, 2004). Estas unidades
presentan ventajas técnicas y económicas importantes
que las hacen más rentables respecto a las unidades de
cultivo en tierra (Langan, 2012; Masser, 2012). Sin
embargo, una de sus principales desventajas es la
imposibilidad de contar con un estricto control
sanitario. La exposición directa de los peces en cultivo
434
a los agentes biológicos que habitan naturalmente el
ambiente circundante puede desencadenar diversos
tipos de enfermedades, que se intensifican de manera
proporcional a la densidad del cultivo (Beveridge,
2014).
Un paso importante para establecer estrategias de
bioseguridad para la prevención y control de
enfermedades de los organismos en cultivo es
incrementar la comprensión de la biodiversidad y de los
procesos que regulan la dinámica de los agentes
patógenos (Bondad-Reantaso et al., 2005; Subasinghe,
2005). En mares tropicales la situación es más compleja
con respecto a los mares templados, ya que en latitudes
bajas hay más especies parásitas y niveles de infección
más altos que pondrían en riesgo el desarrollo de la
acuicultura (Leung & Bates, 2013). Además, el cambio
climático y la contaminación de los océanos, aunados a
un crecimiento de la acuicultura basado en prácticas de
manejo inadecuadas, puede provocar problemas
sanitarios importantes en los sistemas de producción de
peces marinos (Callaway et al., 2012; Leung & Bates,
2013). Entre los agentes patógenos que han causado los
problemas más graves en los cultivos de especies de
alto valor (e.g., Salmo salar), se encuentran los
copépodos calígidos (Copepoda: Siphonostomatoide:
Caligidae). A la fecha, el cultivo de peces marinos en
México es incipiente y en la mayoría de los casos los
esfuerzos se han realizado a escala experimental sin que
se hayan registrado problemas relacionados con los
calígidos. No obstante, el riesgo potencial de estos
parásitos podría aumentar cuando los cultivos se
realicen a gran escala, como es el caso de los peces
salmónidos. En la presente revisión se abordan aspectos
biológicos y ecológicos de estos parásitos, con un
enfoque dirigido hacia el establecimiento de las bases
para la planificación de estrategias de control de estos
parásitos en el contexto del desarrollo de la piscicultura
marina en México.
Los calígidos
Dentro de los copépodos parásitos de peces, la familia
Caligidae es la más común con 31 géneros y más de 450
especies, de las cuales 250 pertenecen al género
Caligus y 120 a Lepeophtheirus (Dojiri & Ho, 2013;
Walter & Boxshall, 2014). Los calígidos, conocidos
comúnmente como “piojos de mar”, han llamado la
atención dada su amplia distribución y sus efectos
deletéreos en peces de importancia acuícola (Johnson
et al., 2004; Costello, 2006).
Los calígidos se caracterizan por tener el cuerpo
dorso-ventralmente aplanado que se divide en cuatro
partes: cefalotórax, segmento que lleva el cuarto par de
patas, complejo genital y abdomen, las hembras
ovígeras llevan un par de sacos de huevos. En México
se conocen cerca de 50 especies, siendo Caligus bonito,
C. mutabilis, C. productus, C. serratus y Lepeophtheirus
dissimulatus las más comunes (Morales-Serna et al.,
2012, 2014). Esta es una cifra importante considerando
que en toda la región Neotropical se han registrado
alrededor de 120 especies de calígidos (datos no
publicados). Sin embargo, la biodiversidad de estos
parásitos seguramente es mayor. Por ejemplo,
recientemente se encontraron alrededor de 20 especies
de calígidos en peces silvestres de la Bahía de Chamela,
Jalisco, donde se realizan pruebas para el cultivo de
lutjánidos (Morales-Serna et al., 2014). No se descarta
la posibilidad de que alguna de estas especies se
transmita y cause daños en los peces cultivados. Dado
el interés creciente por el cultivo de peces marinos en
México, es conveniente mejorar el conocimiento sobre
su diversidad.
Ciclo de vida
Conocer el ciclo de vida de los calígidos es útil para
entender sus estrategias de infección y mejorar el
control de sus niveles de infección en la acuicultura
(González & Carvajal, 2003; Hamre et al., 2013). Estos
parásitos tienen un ciclo de vida directo (requieren de
sólo una especie hospedera). Hasta ahora se conoce el
ciclo de vida de 20 especies, incluyendo 14 Caligus (C.
centrodonti, C. clemensi, C. curtus, C. elongatus, C.
epidemicus, C. fugu, C. latigenitalis, C. minimus, C.
orientalis, C. pageti, C. punctatus, C. rogercresseyi, C.
rotundigenitalis y C. spinosus) y seis Lepeophtheirus
(L. dissimulatus, L. elegans, L. hospitalis, L. pectoralis,
L. salmonis y L. simplex) (Ho & Lin, 2004; Ohtsuka et
al., 2009; Madinabeitia & Nagasawa, 2011; VenmathiMaran et al., 2013; Morales-Serna et al., 2015).
En Lepeophtheirus y Caligus existen dos etapas de
nauplio de vida libre y seis etapas posnaupliares
parasíticas (Hamre et al., 2013; Venmath-Maran et al.,
2013). En Caligus, después del segundo nauplio sigue
una etapa de copepodito, cuatro etapas de chalimus y la
etapa adulta. En Lepeophtheirus, después del segundo
nauplio sigue una etapa de copepodito, dos etapas de
chalimus, dos etapas de preadulto y la etapa adulta. El
copepodito es una larva infectiva encargada de buscar
al hospedero para iniciar la fase parasítica. Chalimus
(chalimi, en plural) es una etapa juvenil caracterizada
por tener un filamento frontal que les sirve para
agarrarse firme y permanentemente al tejido de su
hospedero. Los adultos carecen del filamento frontal y
a diferencia de los chalimi pueden desplazarse en el
hospedero e incluso pasar de un hospedero a otro. No
es raro que los calígidos adultos se encuentren nadando
libremente, incluso especies como Caligus evelynae y
C. undulatus han sido descritas originalmente a partir
de especímenes encontrados en muestras de plancton
(Venmathi-Maran & Ohtsuka, 2008; Suárez-Morales et
al., 2012). Experimentos de laboratorio han señalado
que los adultos de C. rogercresseyi pueden estar hasta
siete días sin su hospedero (Bravo, 2010).
En especies de aguas frías, como C. elongatus,
Caligus rogercresseyi y L. salmonis, su tiempo
generacional (de huevo a adulto) varía de 40 a 50 días
a 10°C, pero puede disminuir a medida que aumenta la
temperatura (Costello, 2006); por ejemplo, en C.
rogercresseyi el tiempo generacional se reduce ~20
días a 16,7°C (González & Carvajal, 2003). Las
especies de aguas tropicales o subtropicales tienen
tiempos generacionales más cortos, como C. pageti que
requiere de ~10 a 11 días para completar un ciclo a 2426°C (Lin & Ho, 1993). Este periodo también se ha
observado en L. simplex a 22°C (Morales-Serna et al.,
2015). Estos resultados sugieren que el aumento de
temperatura en los océanos no sólo modificaría la
distribución de los copépodos parásitos (Cantatore et
al., 2012), sino también aceleraría su reproducción
alcanzando niveles de infección más altos en las
poblaciones de peces silvestres y cultivados.
Localización del hospedero
Los calígidos responden a una variedad de estímulos
para encontrar a sus hospederos, lo cual sucede
básicamente en dos pasos: orientación y reconocimiento. Sus anténulas llevan una serie de elementos
(setas y estetascos), útiles para la recepción de señales
mecánicas y químicas. El movimiento del agua
generado por el nado de los peces parece ser el factor
principal que induce las infecciones por calígidos. Esto
fue demostrado por Heuch et al. (2007), quienes
simularon la hidrodinámica de un pez y observaron que
los copépodos parásitos buscaban infectar la fuente de
movimiento del agua, mientras que por el contrario,
copépodos holoplactónicos (presas de los peces)
buscaban alejarse.
Una vez que el parásito llega al hospedero entran en
juego los semioquímicos (señales químicas emitidas
por un organismo que alteran el comportamiento de
otro organismo). Los peces emiten sustancias químicas
a través del mucus y productos de excreción que los
copépodos identifican para saber si se encuentran en el
hospedero correcto. Entre las sustancias que atraen a L.
salmonis se encuentran las kairomonas isoforona y 6metil-5-hepten-2-ona, generadas por el salmón del
Atlántico Salmo salar (Bailey et al., 2006). Una
señalización parecida fue observada entre C.
rogercresseyi y S. salar (Pino-Marambio et al., 2007).
Las bases moleculares para entender los procesos
mediante los cuales los calígidos localizan a sus
hospederos se han comenzado a dar recientemente. A
nivel transcriptómico, Nuñez-Acuña et al. (2014)
435
identificaron cuatro genes que codifican para los
receptores ionotrópicos relacionados al sistema olfatorio de C. rogercresseyi, habiendo un patrón de
expresión de acuerdo a la etapa de desarrollo del
parásito. La continuidad de este tipo de investigaciones
podría generar desarrollos biotecnológicos que permitan
inhibir la comunicación entre peces y parásitos con el
fin de reducir las infecciones.
Ecología
La abundancia de los calígidos depende de factores
intrínsecos, como la fecundidad y las tasas de crecimiento y desarrollo; y de factores extrínsecos, incluyendo la temperatura del agua y algunas características
del hospedero como tamaño, abundancia, distribución y
mecanismos de defensa (Costello, 2006). Identificar los
factores que más influyen en la dinámica de estos
parásitos podría ser de utilidad en estrategias de
prevención o control de brotes parasitarios en sistemas
de cultivo, pudiendo sugerir sitios o épocas más
convenientes para el cultivo de peces.
Tanto en peces silvestres como cultivados se ha
visto que la temperatura juega un papel preponderante
en la dinámica de los calígidos, haciendo que sus
poblaciones sean generalmente más abundantes en
verano. Por ejemplo, la prevalencia e intensidad de C.
elongatus y L. salmonis en salmones silvestres (Salmo
trutta) de Noruega tienden a aumentar en primavera y
a disminuir en invierno (Schram et al., 1998;
Rikardsen, 2004). Heuch et al. (2007) observaron que
la prevalencia e intensidad de C. elongatus en varias
especies de peces de Noruega es mayor en otoño que en
primavera. En el lenguado (Platichthys flesus) de
Portugal, la prevalencia y abundancia de L. pectoralis
fueron más altas en verano (Cavaleiro & Santos, 2009).
Igualmente, en el botete (Sphoeroides annulatus) del
Pacífico mexicano, la prevalencia e intensidad de L.
simplex fueron mayores en los meses más cálidos del
año (Morales-Serna et al., 2011).
Sin embargo, hay otros factores que pueden influir
además de la temperatura. Por ejemplo, la disminución
en la salinidad durante la etapa infectiva de L. salmonis,
trae como consecuencia que los copepoditos disminuyan su habilidad para responder y fijarse a su
hospedero, reduzcan su supervivencia y se hundan más
rápido (Bricknell et al., 2006). No obstante, se ha
sugerido que el mucus de los peces puede brindar sales
a los calígidos, favoreciendo su supervivencia ante
reducciones en la salinidad del agua (Connors et al.,
2008). En su estudio, Bravo et al. (2008) observaron
que el gradiente de salinidad influyó notablemente en
que la prevalencia e intensidad de C. rogercresseyi
variara de una localidad a otra, impidiendo detectar
patrones bien definidos; además, sugirieron que
436
individuos de lugares con amplias fluctuaciones
temporales de salinidad podrían tolerar concentraciones
menores de salinidad, que individuos de localidades
más estables.
Efectos de los calígidos en sus hospederos
Los calígidos se alimentan de mucus, piel y sangre de
sus hospederos, provocándoles daños entre sutiles y
graves. Esto depende de la fase de desarrollo en que se
encuentren los parásitos, siendo las etapas pre-adulta y
adulta las que causan mayor daño. También depende de
la especie de hospedero; así, el salmón del Atlántico (S.
salar) es de los hospederos más susceptibles a
infecciones por L. salmonis, por el contrario el salmón
coho (Oncorhynchus kisutch) es más resistente. Las
infecciones fuertes pueden producir erosión de la
epidermis, exposición del músculo, hemorragias e
infecciones secundarias por bacterias o virus que
pueden causar la muerte de los peces. En el salmón del
Atlántico, las infecciones por L. salmonis provocan
alteraciones fisiológicas que incluyen niveles altos de
cortisol plasmático y glucosa, y reducción de la
capacidad de osmorregulación y de inmunidad
inespecífica; mientras que los efectos subletales
incluyen alteración del funcionamiento cardíaco,
reducción del crecimiento, menor rendimiento
reproductivo y de nado y, daños en el sistema inmune
(Finstad et al., 2007; Wagner et al., 2008; Tveiten et
al., 2010).
Las enfermedades y mortalidad de los peces se
pueden incrementar por condiciones subóptimas en la
calidad del agua. Finstad et al. (2007, 2012) observaron
que, en comparación con peces no expuestos a la
acidificación, los peces que habían pasado por agua
dulce acidificada fueron más propensos a morir al ser
transferidos a agua marina e infectados con L. salmonis,
incluso cuando los peces pasaron por un lapso de
recuperación antes de la infección. Por lo tanto, es
recomendable evaluar las condiciones ambientales de
los sitios de importancia para la maricultura y
determinar el efecto combinado de la contaminación
acuática y los parásitos sobre los peces.
La respuesta del hospedero al ataque de calígidos
incluye inflamación, hiperplasia, proliferación de
fibroblastos e infiltración celular. La respuesta
inflamatoria del salmón del Atlántico puede ser escasa
ante juveniles y aumentar ante adultos de L. salmonis.
En el salmón coho se ha observado que las infecciones
por L. salmonis son reducidas debido a una respuesta
rápida del sistema inmune que involucra señalización e
infiltración de células/neutrófilos (etapas tempranas de
la inflamación), motilidad celular y cicatrización de la
herida, la cual no se observa en hospederos más
susceptibles; además, los peces presentan anticuerpos
específicos para los antígenos del parásito (Fast, 2014).
En las secreciones de L. salmonis hay moléculas
inmunosupresoras, como la tripsina y prostaglandina E2
(PGE2), capaces de modificar la respuesta inmune
innata del hospedero. Los peces menos susceptibles no
estimulan dichas secreciones al mismo nivel que los
peces más susceptibles (Fast et al., 2003). Macrófagos
del riñón cefálico del salmón del Atlántico incubados
con secreciones y PGE2 de L. salmonis revelaron una
inhibición importante en la expresión de la interleucina1β (IL-1β) y del gen de mayor histocompatibilidad
(MHC I) (Fast et al., 2007). Asimismo, Lewis et al.
(2014) demostraron que las secreciones de L. salmonis
afectan directamente la funcionalidad de los
macrófagos del salmón rosado (Oncorhynchus
gorbuscha), salmón chum (O. keta) y salmón del
Atlántico (S. salar). Estos autores sugieren que las
secreciones de L. salmonis provocan una activación
alternativa de los macrófagos de los peces, ya que hubo
un incremento del índice fagocítico pero escasa
explosión oxidativa en macrófagos de los salmones
chum y del Atlántico. Por el contrario, los macrófagos
del salmón rosado tuvieron mayor explosión oxidativa
pero un índice fagocítico bajo. Así, se cree que el
salmón rosado tiene la capacidad de dar una respuesta
inflamatoria contra L. salmonis, que puede ser retrasada
o impedida en el salmón del Atlántico y salmón chum,
permitiendo no sólo la permanencia del parásito sino
también el desarrollo de infecciones secundarias por
otros microorganismos.
Impacto de los calígidos en la acuicultura
En peces silvestres, los calígidos son comunes pero
generalmente sus niveles de infección son bajos y los
daños en el hospedero son sutiles. Por el contrario, estos
parásitos pueden causar daños serios en los peces en
confinamiento. Debido a su ciclo de vida directo y a la
alta densidad de peces en las jaulas, los calígidos
pueden alcanzar prevalencias e intensidades de
infección muy altas. Caligus elongatus y L. salmonis en
el hemisferio norte y C. rogercresseyi en Chile han
afectado seriamente a los salmónidos en cultivo,
generando pérdidas económicas globales que han
superado los 400 millones de dólares por año (Costello,
2009); por lo tanto, estas tres especies han sido
ampliamente estudiadas.
Otros calígidos también han afectado el cultivo de
peces. Sobresale Caligus epidemicus, considerado el
calígido más peligroso en Asia y un agente patogénico
relevante en el Indo-Pacífico, con capacidad de infectar
a varias especies de peces (36 más un híbrido), resiste
grandes variaciones en salinidad (2-30) y su
distribución abarca aguas tropicales, subtropicales y
templadas (Nagasawa, 2013). Caligus multispinosus ha
causado mortalidades en el espárido Acanthopagrus
schlegelii cultivado en Taiwán (Lin et al., 1997).
Caligus chiastos ha sido asociado a lesiones oculares
severas del atún aleta azul cultivado en Australia
(Hayward et al., 2008). Caligus sclerotinosus ha sido
abundante en el espárido Pagrus major cultivado en
Corea y Japón (Venmathi-Maran et al., 2012).
Interesantemente, C. sclerotinosus se ha encontrado,
aunque raramente, en lutjánidos cultivados en aguas
costeras del Pacífico mexicano, tanto en peces
silvestres (Morales-Serna et al., 2014) como de una
planta productora de larvas (F.N. Morales-Serna, obs.
pers.). Otra especie potencialmente riesgosa para el
cultivo de peces en el Pacífico mexicano podría ser
Caligus serratus, ya que es capaz de infectar a varias
especies de peces (Morales-Serna et al., 2013). Aunque
estos antecedentes no son suficientes para sugerir a los
calígidos como parásitos de riesgo sanitario para el
cultivo de peces marinos en México, tal posibilidad no
debería descartarse.
Los problemas con calígidos han ocurrido
principalmente en peces cultivados en jaulas, en las
cuales hay poco o ningún control sobre la calidad del
agua y sobre la presencia de otros organismos, lo que
facilita la transmisión de parásitos de los peces
silvestres a los cultivados, aumentando así los procesos
de infección y brotes de enfermedades (Nowak, 2007).
El problema aumenta si se considera que las jaulas
podrían ser una fuente de parásitos o foco de infección
para los peces silvestres, con potencial para modificar
los sistemas naturales hospedero-parásito. Este tema es
controvertido en la salmonicultura, habiendo presión
por grupos conservacionistas para mantener los
números de calígidos al nivel más bajo posible.
Krkošek et al. (2007) demostraron una diminución en
las poblaciones naturales de salmones (Oncorhynchus
gorbuscha) asociado a los parásitos L. salmonis de las
granjas. Sin embargo, Riddell et al. (2008) argumentaron que el análisis de datos de Krkošek et al. (2007),
estuvo sesgado y sus resultados fueron exagerados. De
acuerdo con Lafferty et al. (2015), para determinar si
las poblaciones naturales de peces están siendo
afectadas por los parásitos de las granjas, es importante
generar una línea base con datos de los niveles de
infección de patógenos en peces silvestres antes del
establecimiento de las granjas acuícolas.
Métodos de control
La búsqueda de métodos alternativos para combatir
parásitos o patógenos ha sido un tema prioritario en la
industria acuícola. Tradicionalmente, el control de
calígidos en la maricultura ha sido por medicamentos
suministrados a través de baños o en el alimento de los
peces. Otros métodos involucran peces limpiadores y
laser. Las sustancias químicas empleadas para controlar
437
a los calígidos son el benzoato de emamectina
(tratamiento oral); benzoil ureas, diflubenzuron y
teflubenzurón (tratamiento oral); peróxido de hidrógeno
(tratamiento en baño); azametifos (tratamiento en
baños); y piretroides, deltametrina y cipermetrina (tratamiento en baños) (Aaen et al., 2015). Sin embargo, el
uso extensivo de tratamientos químicos ha provocado
el desarrollo de resistencia de estos parásitos hacia la
mayoría de los productos medicinales aplicados y hay
indicios de que esta resistencia no desaparece a través
de las generaciones de los calígidos (Bravo et al., 2010;
Aaen et al., 2015). Por ejemplo, en Escocia se ha
observado que la eficacia del benzoato de emamectina
para combatir L. salmonis ha disminuido a través del
tiempo (Lees et al., 2008).
En Chile, la ivermectina fue un tratamiento que se
aplicó por 10 años pero fue prohibida a fines de los 90”
siendo sustituida por el benzoato de emamectina, el
único tratamiento autorizado en ese país para el control
de Caligus entre 2000 y 2007. Sin embargo, debido a
que C. rogercresseyi mostró pérdida de sensibilidad al
benzoato de emamectina, después del 2007 se permitió
el uso de otros compuestos, incluyendo deltametrina,
cipermetrina, diflubenzuron y azametifos (Bravo et al.,
2008, 2015). Antes de la entrada de estos compuestos,
el peróxido de hidrógeno fue la única alternativa al
benzoato de emamectina; pero C. rogercresseyi al igual
que L. salmonis puede recuperarse de dicho
tratamiento, incluso Caligus es más hábil para volver a
localizar hospederos sobre todo en balsas-jaulas con
mayor cantidad de peces, por lo que el uso de peróxido
de hidrógeno tiene que contemplar la colecta de los
parásitos inconscientes (Bravo et al., 2010). Asimismo,
tratamientos con baños de agua dulce no han mostrado
ser una buena opción para el control de Caligus, ya que
la eficacia general es menor del 60%, con menos efecto
en las hembras (41%), hacia las cueles deben ir
dirigidas las medidas de control (Bravo et al., 2015).
La resistencia potencial a cualquiera de los
compuestos químicos disponibles es una amenaza
contra los esfuerzos por mantener bajo control los
niveles de infección por calígidos. Por ello, se
recomienda diseñar estrategias de rotación de
medicamentos y monitorear su eficacia para detectar
casos de resistencia. Esta detección se basa generalmente en el uso de bioensayos que cuantifican la
supervivencia de los parásitos sometidos a un
determinado medicamento. Para aumentar la precisión
de los resultados se ha propuesto el empleo de métodos
moleculares, ya que estos no requieren organismos
vivos y pueden ser configurados como bioensayos
automáticos con alta precisión, que puede significar
una reducción en los costos; aunque, es necesario
realizar varios ajustes antes de establecer estos métodos
en la rutina para detectar resistencia (Aaen et al., 2015).
438
Otro problema relacionado al uso de compuestos
químicos en el control de calígidos es su efecto adverso
para el ambiente cuando no se emplean correctamente.
Por ejemplo, Ait Ayad et al. (2011) observaron que la
toxicidad de la cipermetrina altera el comportamiento
de los mejillones, retardando la apertura de las valvas.
Wang et al. (2011) demostraron que la cipermetrina
también provoca cambios en la estructura comunitaria
del fitoplancton, favoreciendo la abundancia de
dinoflagelados y posibles florecimientos de algas
tóxicas. Por tal motivo, es necesario buscar tratamientos alternativos como los inmunoestimulantes, que
ayuden a reducir las infecciones por calígidos y sean
amigables con el ambiente. Otra alternativa puede ser
el uso de vacunas. Si bien los resultados hasta ahora son
limitados, las nuevas tecnologías basadas en la
secuenciación masiva de genomas ofrecen una
oportunidad para avanzar en el desarrollo de vacunas
contra calígidos (Fast, 2014). Tal es el caso del gen
my32 aislado desde C. rogercresseyi que demostró
tener potencial para desarrollar vacunas que protejan
las infecciones causadas por calígidos (Carpio et al.,
2011).
CONCLUSIONES
Los calígidos son parásitos comunes de peces marinos
y de aguas salobres. A pesar de ello, su conocimiento
en México es limitado y probablemente, el conocimiento sobre su biodiversidad aún es insuficiente.
Además, la información referente a la ecología o
epidemiología de las especies ya conocidas es escasa.
Este conocimiento podría ser necesario dado el interés
creciente en el cultivo de peces marinos en México.
Como se ha señalado, los calígidos tienen características biológicas (e.g., ciclo de vida directo, tiempos
generacionales que disminuyen al aumentar la
temperatura y especies con baja especificidad de
hospedero) que les permiten proliferar en los sistemas
de cultivo y provocar enfermedad y muerte de peces.
Entonces, si los calígidos han sido problemáticos en
otros países, por qué no considerarlos como patógenos
potenciales para la acuicultura en México. Excepto por
la producción a una baja escala comercial de Seriola
lalandi en Baja California Sur, el cultivo de peces
marinos en México se ha mantenido en una fase de
ensayo en diferentes especies (e.g., Cynoscion
othonopterus, Lutjanus argentiventris, L. guttatus, L.
peru, Paralabrax maculatofasciatus, Seriola rivolina,
Totoaba macdonaldi). Hasta ahora no se han registrado
problemas con calígidos u otros copépodos parásitos;
sin embargo, una vez que aumente la producción a gran
escala podría aumentar el riesgo de infecciones.
Actualmente, los conocimientos biológicos y ecológicos
de los calígidos corresponden principalmente a especies
de aguas frías o templadas. Por lo tanto, el estudio de
especies tropicales, particularmente con el empleo de
información molecular y la exploración de los genomas, podría mejorar la comprensión de la diversidad y
de los procesos biológicos y ecológicos que subyacen
en las interacciones hospedero-parásito. La disponibilidad cada vez mayor de las tecnologías genómicas
influirá en que pronto se expliquen mejor los
mecanismos que regulan la abundancia y distribución
de los calígidos, con lo cual se apoyarían estrategias de
prevención o control de enfermedades en peces.
REFERENCIAS
Aaen, S.M., K.O. Helgesen, M.J. Bakke, K. Kaur & T.E.
Horsberg. 2015. Drug resistance in sea lice: a threat to
salmonid aquaculture. Trends Parasitol., 31: 72-81.
Ait-Ayad, M., M. Ait-Fdil & A. Mouabad. 2011. Effects
of cypermethrin (pyrethroid insecticide) on the valve
activity behavior, byssal thread formation, and
survival in air of the marine mussel Mytilus
galloprovincialis. Arch. Environ. Con. Toxicol., 60:
462-470.
Bailey, R.J.E., M.A. Birkett, A. Ingvarsdóttir, A.J.
Mordue (Luntz), W. Mordue, B. O’Shea, J.A. Pickett
& L.J. Wadhams. 2006. The role of semiochemicals in
host location and non-host avoidance by salmon louse
(Lepeophtheirus salmonis) copepodids. Can. J. Fish
Aquat. Sci., 63: 448-456.
Beveridge, M.C.M. 2004. Cage aquaculture. Blackwell,
Oxford, 368 pp.
Beveridge, M.C.M. 2014. Overview of cage culture. In:
P.T.K. Woo, D.W. Bruno & L.H.S. Lim (eds.).
Diseases and disorders of finfish in cage culture.
CABI, Wallingford, pp. 41-59.
Bondad-Reantaso, M.G., R.P. Subasinghe, J.R. Arthur, K.
Ogawa, S. Chinabut, R. Adlard, Z Tan & M. Shariff.
2005. Disease and health management in Asian
aquaculture. Vet. Parasitol., 132: 249-272.
Bravo, S. 2010. The reproductive output of sea lice
Caligus rogercresseyi under controlled conditions.
Exp. Parasitol., 125: 51-54.
Bravo, S., V. Pozo & M.T. Silva. 2008. The tolerance of
Caligus rogercresseyi to salinity reduced in southern
Chile. Bull. Eur. Ass. Fish Pathol., 28: 198-206.
Bravo, S., V. Pozo & M.T. Silva. 2015. Evaluación de la
efectividad del tratamiento con agua dulce para el
control del piojo de mar Caligus rogercresseyi
Boxshall & Bravo, 2000. Lat. Am. J. Aquat. Res.,
43(2): 322-328.
Bravo, S., S. Sevatdal & T.E. Horsberg. 2008. Sensitivity
assessment of Caligus rogercresseyi to emamectin
benzoate in Chile. Aquaculture, 282: 7-12.
Bravo S., S. Sevatdal & T.E. Horsberg. 2010. Sensitivity
assessment in the progeny of Caligus rogercresseyi to
emamectin benzoate. Bull. Eur. Ass. Fish Pathol., 30:
92-98.
Bravo, S., J. Treasurer, M. Sepúlveda & C. Lagos. 2010.
Effectiveness of hydrogen peroxide in the control of
Caligus rogercresseyi in Chile and implications for sea
louse management. Aquaculture, 303: 22-27.
Bricknell, I.R., S.J. Dalesman, B. O´Shea, C.C. Pert &
A.J.M. Luntz. 2006. Effect of environmental salinity
on sea lice Lepeophtheirus salmonis settlement
success. Dis. Aquat. Organ., 71: 213-223.
Callaway, R., A.P. Shinn, S.E. Grenfell, J.E. Bron, G.
Burnell, E.J. Cook, M. Crumlish, S. Culloty, K.
Davidson, R.P. Ellis, K.J. Flynn, C. Fox, D.M. Green,
G.C. Hays, A.D. Hughes, E. Johnston, C.D. Lowe, I.
Lupatsch, S. Malham, A.F. Mendzil, T. Nickell, T.
Pickerell, A.F. Rowley, M.S. Stanley, D.R. Tocher,
J.F. Turnbull, G. Webb, E. Wootton & R.J. Shields.
2012. Review of climate change impacts on marine
aquaculture in the UK and Ireland. Aquat. Conserv.
Mar. Freshw. Ecosyst., 22: 389-421.
Cantatore, D.M.P., P.E. Braicovich, A.J. Alarcos, A.L.
Lanfranchi, M.A. Rossin, D.G. Vales & J.T. Timi.
2012. New records of parasitic copepods (Crustacea,
Copepoda) from marine fishes in the Argentinean Sea.
Acta Parasitol., 57: 83-89.
Carpio, Y., L. Basabe, J. Acosta, A. Rodríguez, A.
Mendoza, A. Lisperger, E. Zamorano, M. González,
M. Rivas, S. Contreras, D. Haussmann, J. Figueroa,
V.N. Osorio, G. Asencio, J. Mancilla, G. Ritchie, C.
Borroto & M.P. Estrada. 2011. Novel gene isolated
from Caligus rogercresseyi: a promising target for
vaccine development against sea lice. Vaccine, 29:
2810-2820.
Cavaleiro, F.I. & M.J. Santos. 2009. Seasonality of
metazoan ectoparasites in marine European flounder
Platichthys flesus (Teleostei: Pleuronectidae).
Parasitology, 136: 855-865.
Connors, B.M., E. Juarez-Colunga & L.M. Dill. 2008.
Effects of varying salinities on Lepeophtheirus
salmonis survival on juvenile pink and chum salmon.
J. Fish Biol., 72: 1825-1830.
Costello, M.J. 2006. Ecology of sea lice parasitic on
farmed and wild fish. Trends Parasitol., 22: 475-483.
Costello, M.J. 2009. The global economic cost of sea lice
to the salmonid farming industry. J. Fish Dis., 32: 115118.
Dojiri, M. & J.-S. Ho. 2013. Systematics of the Caligidae,
copepods parasitic on marine fishes. Koninklijke Brill
NV, Leiden, 448 pp.
439
Food and Agriculture Organization (FAO). 2014. El
estado mundial de la pesca y la acuicultura. FAO,
Roma, 253 pp.
Food and Agriculture Organization (FAO). 2015.
Fisheries and aquaculture software. FishStatJ software for fishery statistical time series. In: FAO
Fisheries and Aquaculture Department Updated 23
June 2015 [http://www.fao.org/fishery/statistics/software/fishstatj/en]. Revisado: 26 Noviembre 2015.
Fast, M.D. 2014. Fish immune responses to parasitic
copepod (namely sea lice) infection. Dev. Comp.
Immunol., 43: 300-312.
Fast, M.D., J.F. Burka, S.C. Johnson & N.W. Ross. 2003.
Enzymes released from Lepeophtheirus salmonis in
response to mucus from different salmonids. J.
Parasitol., 89: 7-13.
Fast, M.D., S.C. Johnson, T.D. Eddy, D. Pinto & N.W.
Ross. 2007. Lepeophtheirus salmonis secretory/
excretory products and their effects on Atlantic salmon
immune gene regulation. Parasite Immunol., 29: 179189.
Finstad, B., F. Kroglund, P.A. Bjørn, R. Nilsen, K.
Pettersen, B.O. Rosseland, H.-C. Teien, T.O. Nilsen,
S.O. Stefansson, B. Salbu, P. Fiske & L.O.E.
Ebbesson. 2012. Salmon lice-induced mortality of
Atlantic salmon postsmolts experiencing episodic
acidification and recovery in freshwater. Aquaculture,
362-363: 193-199.
Finstad, B., F. Kroglund, R. Strand, S.O. Stefansson, P.A.
Bjørn, B.O. Rosseland, T.O. Nilsen & B. Salbu. 2007.
Salmon lice or suboptimal water quality - Reasons for
reduced postsmolt survival? Aquaculture, 273: 374383.
González, L. & J. Carvajal. 2003. Life cycle of Caligus
rogercresseyi (Copepoda: Caligidae) parasite of
Chilean reared salmonids. Aquaculture, 220: 101-117.
Hamre, L.A., C. Eichner, C.M.A. Caipang, S.T. Dalvin,
J.E. Bron, F. Nilsen, G. Boxshall & R. SkernMauritzen. 2013. The salmon louse Lepeophtheirus
salmonis (Copepoda: Caligidae) life cycle has only
two chalimus stages. PLoS ONE, 8: e73539.
Hayward, C.J., H.M. Aiken & B.F. Nowak. 2008. An
epizootic of Caligus chiastos on farmed southern
bluefin tuna Thunnus maccoyii off South Australia.
Dis. Aquat. Organ., 79: 57-63.
Heuch, P.A., M.H. Doall & J. Yen. 2007. Water flow
around a fish mimic attracts a parasitic and deters a
planktonic copepod. J. Plankton Res., 29: i3-i16.
Heuch, P.A., Ø. Øines, J.A. Knutsen & T.A. Schram.
2007. Infection of wild fishes by the parasitic copepod
Caligus elongatus on the south east coast of Norway.
Dis. Aquat. Organ., 77: 149-158.
440
Ho, J.-S. & C.-L. Lin. 2004. Sea lice of Taiwan (Copepoda: Siphonostomatoida: Caligidae). The Sueichan
Press, Keelung, 388 pp.
Johnson, S.C., J.W. Treasurer, S. Bravo, K. Nagasawa &
Z. Kabata. 2004. A review of the impact of parasitic
copepods on marine aquaculture. Zool. Stud., 43: 229243.
Krkošek, M., J.S. Ford, A. Morton, S. Lele, R.A. Myers &
M.A. Lewis. 2007. Declining wild salmon populations
in relation to parasites from farm salmon. Science,
318: 1772-1775.
Lafferty, K.D., C.D. Harvell, J.M. Conrand, C.S.
Friedman, M.L. Kent, A.M. Kuris, E.N. Powell, D.
Rondeau & S.M. Saksida. 2015. Infectious diseases
affect marine fisheries and aquaculture economics.
Annu. Rev. Mar. Sci., 7: 471-496.
Langan, R. 2012. Ocean cage culture. In: J. Tidwell (ed.).
Aquaculture production systems. Wiley-Blackwell,
Oxford, pp. 135-157.
Lees, F., M. Baillie, G. Gettinby & C.W. Revie. 2008. The
efficacy of emamectin benzoate against infestations of
Lepeophtheirus salmonis on farmed Atlantic salmon
(Salmo salar L) in Scotland, 2002-2006. PLoS ONE,
3: e1549.
Leung, T.L.F. & A.E. Bates. 2013. More rapid and severe
disease outbreaks for aquaculture at the tropics:
implications for food security. J. Appl. Ecol., 50: 215222.
Lewis, D.L., D.E. Barker & R.S. McKinley. 2014.
Modulation of cellular innate immunity by Lepeophtheirus salmonis secretory products. Fish Shellfish
Immunol., 38: 175-183.
Lin, C.-L. & J.-S. Ho. 1993. Life history of Caligus
epidemicus Hewitt parasitic on tilapia (Oreochromis
mossambicus) cultured in brackish water. In: G.A.
Boxshall & D. Defaye (eds.). Pathogens of wild and
farmed fish: sea lice. Ellis Horwood, Chichester, pp. 515.
Lin, C.-L., Ho, J.-S. & S.N. Chen. 1997. Development of
Caligus multispinosus Shen, a caligid copepod
parasitic on the black sea bream (Acanthopagrus
achlegeli) cultured in Taiwan. J. Nat. Hist., 31: 14831500.
Madinabeitia, I. & K. Nagasawa. 2011. Chalimus stages
of Caligus latigenitalis (Copepoda: Caligidae) parasitic on blackhead seabram from Japanese waters, with
discussion of terminology used for developmental
stages of caligids. J. Parasitol., 97: 221-236.
Masser, M.P. 2012. Cage culture in freshwater and
protected marine areas. In: J. Tidwell (ed.).
Aquaculture production systems. Wiley-Blackwell,
Morales-Serna, F.N., M. Rubio-Godoy & S. Gómez.
2011. Seasonality of parasitic copepods on bullseye
puffer, Sphoeroides annulatus (Pisces: Tetraodontidae), from the northwestern coast of Mexico. J.
Parasitol., 97: 565-573.
Morales-Serna, F.N., S. Gómez & G. Pérez-Ponce de
León. 2012. Parasitic copepods reported from Mexico.
Zootaxa, 3234: 43-68.
Morales-Serna, F.N., Z.L. Hernández-Inda, S. Gómez &
G. Pérez-Ponce de León. 2013. Redescription of
Caligus serratus Shiino, 1965 (Copepoda: Caligidae)
parasitic on eleven fish species from Chamela Bay in
the Mexican Pacific. Acta Parasitol., 58: 367-375.
Morales-Serna, F.N., C.D. Pinacho-Pinacho, S. Gómez &
G. Pérez-Ponce de León. 2014. Diversity of sea lice
(Copepoda: Caligidae) parasitic on marine fishes with
commercial and aquaculture importance in Chamela
Bay, Pacific coast of Mexico by using morphology and
DNA barcoding, with description of a new species of
Caligus. Parasitol. Int., 63: 69-79.
Morales-Serna, F.N., A.I. Rivas-Salas, S. Gómez & E.J.
Fajer-Ávila. 2015. Developmental stages and
fecundity of Lepeophtheirus simplex (Copepoda:
Caligidae) parasitic on bullseye puffer fish
(Sphoeroides annulatus). Folia Parasitol., 62: 004.
Nagasawa, K. 2013. Caligus epidemicus (Copepoda:
Caligidae), a pathogenic sea louse of wild and captive
fish in Indo-West Pacific Region: a review. Bull.
Hiroshima Univ. Mus., 5: 71-86.
Nowak, B.F. 2007. Parasitic diseases in marine cage
culture - An example of experimental evolution of
parasites? Int. J. Parasitol., 37: 581-588.
Nuñez-Acuña, G., V. Valenzuela-Muñoz, J. PinoMarambio, S. Wadsworth & C. Gallardo-Escárate.
2014. Insights into the olfactory system of the
ectoparasite Caligus rogercresseyi: molecular characterization and gene transcription analysis of novel
ionotropic receptors. Exp. Parasitol., 145: 99-109.
Ohtsuka, S., I. Takami, B.A. Venmathi Maran, K. Ogawa,
T. Shimono, Y. Fujita, M. Asakawa & G.A. Boxshall.
2009. Developmental stages and growth of
Pseudocaligus fugu Yamaguti, 1936 (Copepoda:
Siphonostomatoida: Caligidae) host-specific to puffer.
J. Nat. Hist., 43: 1779-1804.
Pino-Marambio, J., A.J. Mordue (Luntz), M. Birkett, J.
Carvajal, G. Asencio, A. Mellado & A. Quiroz. 2007.
Behavioural studies of host, non-host and mate
location by the sea louse, Caligus rogercresseyi
Boxshall & Bravo, 2000 (Copepoda: Caligidae).
Aquaculture, 271: 70-76.
Riddell, B.E., R.J. Beamish, L.J. Richards & J.R. Candy.
2008. Comment on “Declining wild salmon populations in relation to parasites from farm salmon”.
Science, 322: 1790.
Rikardsen, A.H. 2004. Seasonal occurrence of sea lice
Lepeophtheirus salmonis on sea trout in two north
Norwegian fjords. J. Fish Biol., 65: 711-722.
Schram, T.A., J.A. Knutsen, P.A. Heuch & T.A. Mo.
1998. Seasonal occurrence of Lepeophtheirus
salmonis and Caligus elongatus (Copepoda:
Caligidae) on sea trout (Salmo trutta), off southern
Norway. ICES J. Mar. Sci., 55: 163-175.
Suárez-Morales, E., H. Camisotti & A. Martín. 2012. A
new species of Caligus (Copepoda, Siphonostomatoida) from the plankton of the Caribbean coast of
Venezuela with a key to species. ZooKeys, 201: 59-71.
Subasinghe, R.P. 2005. Epidemiological approach to
aquatic animal health management: opportunities and
challenges for developing countries to increase aquatic
production through aquaculture. Prev. Vet. Med., 67:
117-124.
Tveiten, H., P.A. Bjørn, H.K. Johnsen, B. Finstad & R.S.
McKinley. 2010. Effects of the sea louse Lepeophtheirus salmonis on temporal changes in cortisol,
sex steroids, growth and reproductive investment in
Arctic charr Salvelinus alpinus. J. Fish Biol., 76: 23182341.
Received: 11 November 2015; Accepted: 14 June 2016
441
Venmathi-Maran, B.A. & S. Ohtsuka. 2008. Descriptions
of caligiform copepods in plankton samples collected
from East Asia: Accidental occurrences or a new mode
of life? Plank. Benth. Res., 3: 202-215.
Venmathi-Maran, B.A., S.-Y. Oh, H.Y. Soh, H.J. Choi &
J.G. Myoung. 2012. Caligus sclerotinosus (Copepoda:
Caligidae), a serious pest of cultured red seabream
Pagrus major (Sparidae) in Korea. Vet. Parasitol.,
188: 355-361.
Venmathi-Maran, B.A., S.Y. Moon, S. Ohtsuka, S.-Y. Oh,
H.Y. Soh, J.-G. Myoung, A. Iglikowska & G.A.
Boxshall. 2013. The caligid life cycle: new evidence
from Lepeophtheirus elegans reconciles the cycles of
Caligus and Lepeophtheirus (Copepoda: Caligidae).
Parasite, 20: 15.
Wagner, G.N., M.D. Fast & S.C. Johnson. 2008.
Physiology and immunology of Lepeophtheirus
salmonis infections of salmonids. Trends Parasitol.,
24: 176-183.
Walter, T.C. & G. Boxshall. 2014. World of copepods
database. [http://www.marinespecies.org/ copepoda].
Revisado: 25 Marzo 2015.
Wang Z.-H., X.-P. Nie & W.-J. Yue. 2011. Toxicological
effects of cypermenthrin to marine phytoplankton in a
co-culture system under laboratory conditions. Ecotoxicology, 20: 1258-1267.
Lat. Am. J. Aquat. Res., 44(3): 442-452, 2016
Estudio de macroinvertebrados en intermareales de fondo blando
Research Article
Estudio de macroinvertebrados en dos intermareales de fondos blandos:
datos de referencia en condiciones incipientes de impacto antrópico
Augusto César Crespi-Abril1,2,3, Agustina Ferrando1 & Matías Emanuel Dileo Agostino-Andrea3
1
Centro para el Estudio de Sistemas Marinos, CONICET, Puerto Madryn, Argentina
2
Universidad Nacional del Comahue, Río Negro Argentina.
3
Universidad Nacional de la Patagonia San Juan Bosco, Puerto Madryn, Chubut, Argentina
Corresponding author: Augusto Crespi (crespi@cenpat-conicet.gob.ar)
RESUMEN. Se analizó la abundancia de macroinvertebrados bentónicos intermareales en relación a las
características del sedimento en dos playas de arena del Golfo Nuevo (Patagonia, Argentina), una adyacente a
un centro urbano (Playa Mimosa: PM) y otra (Cerro Avanzado: CA) ubicada a 20 km de dicha localidad. Dentro
de cada playa, las condiciones ambientales fueron homogéneas (90% de similitud). Los valores medios de
tamaño de grano, profundidad de la capa anóxica y porcentaje de materia orgánica fueron 117,6 µm, 4,95 cm y
0,76%, y 165,2 µm, 9,50 cm y 0,63%, en PM y CA, respectivamente. Aunque las familias más abundantes en
ambas playas fueron Tellinidae, Maldanidae y Opheliidae, en PM se registraron nueve familias que no
estuvieron presentes en CA, reflejando una mayor diversidad (3,06 versus 1,77). Por lo tanto, cuando se
consideró sólo la composición faunística, la similitud entre los sitios de ambas playas fue notablemente menor
(<82%) que la obtenida según sus condiciones ambientales. La granulometría y el porcentaje de materia orgánica
fueron las variables que mejor se correlacionaron con la abundancia de macroinvertebrados. Este es el primer
estudio de macroinvertebrados y su relación con las características del sedimento considerando la extensión
completa de dos playas dentro del Golfo Nuevo. Los resultados de este trabajo constituyen una referencia para
futuros estudios de monitoreo e impacto ambiental en esa área geográfica.
Palabras clave: línea de base, comunidad bentónica, granulometría, capa anóxica, materia orgánica, Patagonia.
Study of macroinvertebrate in two intertidal soft bottoms: reference data
in conditions of incipient anthropic impact
ABSTRACT. In this study, we analyzed the relation between the abundance of benthic macroinvertebrates and
relevant environmental variables in two intertidal in Golfo Nuevo (Argentinean patagonia), one near a urban
center (Mimosa Beach, PM) and the other at 20 km from that location (Cerro Avanzado Beach, CA). Within
each beach, the environmental conditions were homogeneous (90% of similarity). Mean size grain values,
anoxic layer depth, and percent organic matter were 117.6 µm, 4.95 cm and 0.76%, and 165.2 µm, 9.5 cm and
0.63%, for PM and CA respectively. Even though three families were the most abundant in both beaches
(Tellinidae, Maldanidae and Opheliidae), nine families were exclusively observed in PM. This resulted in a
higher biodiversity in PM (3.06) in relation to CA (1.77). When faunal composition was considered, the
similarity between sites was notably low (lower than 82%) if compared with the environmental conditions.
Granulometry and organic matter were the variables with the highest correlation with macroinvertebrates
abundance. This is the first study of macroinvertebrates and their relationship with some environmental variables
throughout the complete spatial extension of two beaches in Golfo Nuevo. This is of particular relevance if we
consider that coastal regions of this gulf has been exposed to a sustained increase of anthropic activities in the
last years and baseline information is scarce.
Keywords: base-line, benthic community, granulometry, anoxic layer, organic matter, Patagonia.
__________________
Corresponding editor: Diego Giberto
442
1
443
2
INTRODUCCIÓN
La zona intermareal constituye una interface que
conforma un nexo crítico entre el sistema terrestre y
marino (Angeloni, 2003). La mayor parte de los
intermareales del mundo (casi dos tercios de todos los
intermareales sin cobertura de hielo) están caracterizados por playas arenosas (McLachlan & Brown,
2010). Estos ambientes son capaces de filtrar grandes
volúmenes de agua y de reciclar nutrientes (McLachlan
et al., 1985; McLachlan, 1989); además presentan un
alto valor ecológico ya que son considerados como una
importante zona de alimentación y cría para numerosas
especies (Burger, 1991), y un alto valor socioeconómico debido a que la población humana los
utiliza como área de recreación y de asentamiento
urbano (Whitmarsh et al., 1999; Pearson & Powell,
2001; Nordstrom, 2008; Defeo et al., 2009). Cualquier
cambio en la biodiversidad de estos ambientes como
consecuencia de las perturbaciones antrópicas, puede
alterar significativamente la estructura y funcionamiento de estos ecosistemas (Davenport &
Davenport, 2006; Defeo et al., 2009).
El sector patagónico del Mar Argentino posee
alrededor de 3.000 km de costa, con un elevado valor
en términos de biodiversidad global. Esta costa es
utilizada por aves migratorias y mamíferos marinos
para descanso, alimentación y apareamiento (Yorio,
2009). A su vez, presenta zonas de reproducción y
crianza de peces, crustáceos y moluscos, sustentando
uno de los ecosistemas marinos templados más ricos y
productivos del mundo (Vázquez, 2004). Sin embargo,
el conocimiento científico sobre los intermareales de
fondos blandos de estas costas es escaso, si se compara
con el desarrollo y diversificación de usos. El Golfo
Nuevo, localizado en Patagonia norte, presenta regiones
con diferentes grados de perturbaciones antrópicas. El
margen occidental del golfo es la región más afectada
debido a la presencia de un centro urbano (ciudad de
Puerto Madryn), con gran actividad turística y portuaria.
Diversos trabajos han detectado bajas a moderadas
concentraciones de hidrocarburos (Commendatore &
Esteves, 2007), altos niveles de TBT e incidencia de
imposex en diversas especies de gasterópodos (Bigatti
et al., 2009) y zonas enriquecidas orgánicamente
(Ferrando, 2007; Ferrando et al., 2010) como resultado
del tráfico marítimo y desarrollo industrial, respectivamente. Asimismo, evaluaciones en los sedimentos
evidenciaron procesos de bioacumulación en mejillones y almejas (Massara-Paletto, 2003) que se
extienden a lo largo de las tramas tróficas propias de
estos mares. Particularmente, algunos autores han
determinado que la concentración de contaminantes
decrece conforme aumenta la distancia a la ciudad
(Bigatti et al., 2009).
Si bien existen antecedentes donde se describe la
composición faunística de las comunidades macrobentónicas del intermareal de fondos blandos del Golfo
Nuevo (Escofet et al., 1978, 1979; Escofet, 1983;
Barón, 1995; Barón & Ciocco, 1997, 1998; Ciocco &
Barón, 1998; Lizarralde, 2002; Lizarralde & Cazzaniga,
2009), son escasos los trabajos donde se analiza su
distribución en función de las características de los
sedimentos y se evalúa el posible efecto de la
contaminación sobre estos ambientes (Ferrando, 2007;
2010). El objetivo de este trabajo es analizar la
abundancia de diferentes taxa de macroinvertebrados
bentónicos de playas con diferente grado de perturbación
antrópica, en relación con las características ambientales
de los sedimentos, considerando dos escalas espaciales
(Defeo & McLachlan, 2005): mesoescala (en una playa)
y macroescala (entre dos playas).
MATERIALES Y MÉTODOS
Área de estudio y recolección de muestras
El presente estudio se realizó en las playas arenosas
Mimosa (PM) y Cerro Avanzado (CA) (Fig. 1). Ambas
localizadas en el margen sudoeste del Golfo Nuevo,
presentan una orientación similar respecto al punto
cardinal (50°N) y se encuentran sometidas a un régimen
de exposición al oleaje equivalente de 1.500 J m-1
(Carrasco & Crespi-Abril, datos no publicados). Ambas
playas están sometidas a un ciclo de marea semidiurno
con amplitudes medias de 4,62 m. Las longitudes de
estas playas son de 4.264 y 1.020 m, respectivamente y
su pendiente es suave (aproximadamente 1,21°,
Escofet, 1983). Una diferencia importante entre ambas
playas es el grado de perturbación antrópica al que
están sometidas. Playa Mimosa está próxima a la
ciudad de Puerto Madryn y en consecuencia está
expuesta a diferentes fuentes de perturbación (e.g.,
presencia de hidrocarburos debido a la actividad
portuaria, aporte de materia orgánica a través de
efluentes industriales vertidos clandestinamente sobre
esta playa, efecto de pisoteo por parte de turistas, entre
otros). Contrariamente, CA se encuentra alejada (20
km) del mencionado centro urbano.
Las muestras se recolectaron a lo largo de los
intermareales de PM y CA, en 29 y 12 sitios, respectivamente (Fig. 1) en la estación estival 2011-2012. En
ambos casos, los sitios se distribuyeron sobre el
intermareal de manera tal de relevar este ambiente en
toda su extensión (Fig. 1). De esta forma, se aseguró
que ambos intermareales estuvieran adecuadamente
representados para realizar comparaciones entre ellos.
Con objeto de caracterizar los ambientes intermareales
de ambas playas, se midieron las siguientes variables
4443
balanza digital (0,01 g) y los datos se analizaron con el
programa Gradistat 6.0 (Blott, 2008), determinando el
cuartil de 50% (mediana), la curtosis y la asimetría en
cada sitio. Para determinar MO, se secó a 80ºC una
submuestra (2 g) hasta obtener un peso constante.
Posteriormente, se calcinó durante 4 h a 450ºC. La
cantidad de materia orgánica se calculó como (Bale &
Kenny, 2005):
(Pms-Pmc)
) *100
MO = (
Pms
Figura 1. Ubicación de los sitios de muestreo en las playas
Mimosa (PM) y Cerro Avanzado (CA). GSJ: Golfo San
José, GN: Golfo Nuevo, PV: Península Valdés.
abióticas: profundidad de la capa anóxica (PCA),
granulometría (GR) y porcentaje de materia orgánica
(MO) en el sedimento. La PCA se midió in situ con una
regla graduada cada 1 mm ya que el límite superior de
la misma es fácilmente detectable por el cambio de
color en el sedimento y por su olor característico (Lalli
& Timothy, 1997). Para determinar GR y MO, se
recolectó una muestra de sedimento en cada sitio con
un cilindro plástico de 4 cm de diámetro hasta 15 cm de
profundidad. Además se retiró una muestra con un
cilindro plástico de 25 cm de diámetro hasta 15 cm de
profundidad, para los análisis cuantitativos de la
comunidad de macroinvertebrados. Estos últimos se
tamizaron in situ utilizando una malla plástica de 1,2
mm de poro. Posteriormente, se fijaron en formol 10%
y se preservaron en alcohol 70% para su posterior
conteo e identificación en el laboratorio.
Procesamiento de muestras y análisis de datos
Datos ambientales
El análisis granulométrico de los sedimentos se realizó
utilizando técnicas de agitación mecánica a través de
una serie de seis tamices de tamaño de malla
decreciente: 4.000, 2.000, 1.000, 500, 125 y 63 µ (Bale
& Kenny, 2005). Cada muestra fue tamizada durante 30
min para separar y cuantificar las diferentes fracciones
componentes de acuerdo a la escala propuesta por
Wentworth (1922). Las mediciones se realizaron con
donde Pms es el peso seco de la muestra y Pmc es el
peso calcinado de la muestra.
Los datos de las variables ambientales fueron
interpolados dentro del polígono de estudio correspondiente a cada playa para una mejor visualización de
los patrones espaciales, utilizando el algoritmo
"Natural Neihgbor" (Sibson, 1981). Además, se
analizaron las diferencias entre las condiciones
ambientales mediante la prueba t-Student. Por último,
para detectar similitudes entre ambas playas, las
características ambientales de los datos de PCA, GR y
MO se utilizaron para realizar un análisis de
conglomerados (índice de similitud de Bray-Curtis;
método de agrupamiento promedio; Primer 5.0).
Datos biológicos
Con los datos biológicos de cada playa se calculó la
densidad de organismos de cada taxón (D) expresada
como el número de individuos por m2, la diversidad
biológica mediante el índice de Shannon (H’) (Shannon
& Weaver, 1949) y la frecuencia de ocurrencia (FO) de
cada uno de los taxa calculada como FO = e E-1, donde
"e" es el número de sitios con presencia de un taxón
determinado y "E" es el número total de sitios de
muestreo. Para determinar si las diferencias entre los
índices de diversidad calculados para cada playa fueron
significativas se utilizó la prueba t de Hutcheson (Sokal
& Rohlf, 2002). La composición faunística entre ambas
playas se comparó mediante un análisis de conglomerados, utilizando los datos de las densidades de los
taxa registrados en los 41 sitios de muestreo.
Relación entre los datos ambientales y biológicos
Para determinar qué variables influyeron en mayor
medida sobre la distribución de las comunidades
macrobentónicas en PM y CA, se realizaron los análisis
BEST/BIOENV y ACP (análisis de componentes
principales) con el programa Primer 6.0. Para ello, los
datos biológicos se transformaron (raíz cuarta) y los
datos ambientales se normalizaron. Asimismo, se realizó
un análisis de correlación de Spearman (Conover,
1999) entre la densidad de los taxa más abundantes
registrados en ambas playas y las variables ambientales
registradas en ellas.
4445
RESULTADOS
Caracterización ambiental de las playas Mimosa y
Cerro Avanzado
En CA, la profundidad media de la capa anóxica fue de
9,5 ± 1,2 cm. Los menores valores se registraron en la
zona media y noreste de la playa, mientras que los
mayores se encontraron en los niveles superiores del
intermareal (Fig. 2a). En PM, la profundidad media de
la capa anóxica fue de 4,95 ± 0,8 cm. Los menores
valores se determinaron en la zona media y sureste de
esta playa, mientras que los mayores se registraron en
la zona noreste (Fig. 2b). Las diferencias registradas
entre ambas playas para esta variable fueron
significativas (t39, P < 0,05). Con respecto a la granulometría, el tamaño medio de grano en CA fue de 165,2
µm (arenas medias) con un mínimo de 141,5 µm y un
máximo de 252,8 µm. La distribución granulométrica
presentó una asimetría de 0,052 y una curtosis de 1,429.
El tamaño de grano fue disminuyendo en dirección
norte (Fig. 3a). En PM, el tamaño medio de grano fue
de 177,6 µm (arenas medias) con un mínimo de 143,3
µm y un máximo de 525,9 µm. La distribución
granulométrica presentó una asimetría de 0,037 y una
curtosis de 1,561. Los valores mayores se determinaron
en el extremo norte de la playa, manteniendo un tamaño
relativamente constante al centro y sur de la misma
(Fig. 3b). Las diferencias del tamaño medio de grano
observadas entre ambas playas no fueron significativas
(t39, P > 0,05). El porcentaje medio de materia orgánica
en PM fue de 0,76% (DE: 0,21%). Los mayores valores
se registraron en las zonas norte y sur de esta playa,
mientras que los menores se registraron en el centro de
la misma (Fig. 4). El porcentaje medio de materia
orgánica en CA fue de 0.63% (DE: 0,18%). Los
mayores valores se registraron en el sector noreste,
mientras que los menores en el sudoeste (Fig. 4). El
porcentaje de materia orgánica entre ambas playas
mostró diferencias significativas (prueba t-Student,
gl=39, P < 0,05).
A partir del análisis de conglomerados realizado
con los datos de las variables ambientales registrados
en ambas playas, se observó que todos los sitios de
muestreo, excepto PM23, PM24 y CA3, tuvieron más
de un 95% de similitud (Fig. 5). Estos tres sitios
presentaron una mayor profundidad de la capa anóxica
(>7 cm), bajo porcentaje de materia orgánica (<0.4%)
y mayor tamaño medio de grano (>250 micras), que el
resto de los sitios analizados en ambas playas.
Abundancia de macroinvertebrados en las playas
Mimosa y Cerro Avanzado
Con respecto a la composición faunística de las playas
bajo estudio, en PM se observaron 21 familias de ma-
Figura 2. Distribución espacial de la profundidad de la
capa anóxica (cm) en las playas analizadas. a) Cerro
Avanzado, b) Mimosa.
croinvertebrados de las cuales 9 estuvieron presentes
exclusivamente en esta playa, con una diversidad
promedio de 3,06 (DE=1,02) siendo las familias más
abundantes: Tellinidae, Maldanidae, Opheliidae,
Spionidae y Tanaidae (Tabla 1). Respecto a la FO, las
familias Nassaridae, Opheliidae, y Maldanidae superaron el 50%; mientras que las familias Paraonidae, Scalibregmidae, Varunidae, Atelecyclidae y Corofioidae
fueron las menos frecuentes (FO = 3%) (Tabla 1). En
CA, se registraron 16 familias de las cuales cuatro se
presentaron exclusivamente en esta playa, la diversidad
promedio fue de 1,77 (DE=0,86) y las familias más
abundantes fueron Tellinidae, Maldanidae y Opheliidae
(Tabla 1). Respecto a la FO, las familias Tellinidae,
Phoxocephalidae y Maldanidae superaron el 30%;
mientras que Idoteidae, Inachoididae, Majidae,
Veneridae y Lineidae fueron las menos frecuentes (FO
= 8%). Las diferencias entre ambas playas en cuanto al
índice de diversidad fueron significativas (t de
Hutcheson, gl = 770; P < 0,05) (Tabla 1).
446
5
Figura 3. Distribución espacial del tamaño medio de
grano (µm) del sedimento en las playas analizadas.
a) Cerro Avanzado, b) Mimosa.
Figura 4. Distribución espacial del porcentaje de materia
orgánica en las playas analizadas. a) Cerro Avanzado,
b) Mimosa.
El análisis de conglomerados realizado con los
datos de densidad de los diferentes taxa registrados en
las playas estudiadas, evidenció escasa similitud entre
los sitios de muestreo según su composición faunística
(Fig. 6). Únicamente los sitios CA11 y CA9 presentaron una similitud de 82%, mientras que el resto
presentó una similitud inferior a este valor (Fig. 6). En
ambos sitios se registró una alta densidad de individuos
de la familia Tellinidae (>1700 ind m-2).
en los primeros dos ejes (PC1= 49,8% y PC2 = 30,2%).
En este análisis, se observó que la PCA presentó una
correlación positiva con la GR, y ambas variables
presentaron una correlación negativa respecto al
porcentaje de materia orgánica (Fig. 7). Además, los
resultados mostraron que la mayoría de los sitios de CA
se caracterizaron por un mayor tamaño de grano y una
mayor PCA respecto a los sitios de PM (Fig. 7).
Las familias Tellinidae, Maldanidae y Opheliidae
estuvieron asociadas a sedimentos constituidos por
arenas finas, con un porcentaje de materia orgánica
mayor a 0,46% y una profundidad de la capa anóxica
superior a 5 cm (Tabla 1). Sin embargo, la densidad de
las familias Tellinidae y Maldanidae sólo estuvo
correlacionada negativamente con el tamaño medio de
grano, mientras que la densidad de la familia
Opheliidae no se correlacionó significativamente con
ninguna de las variables ambientales analizadas (Tabla
2).
Relación entre la abundancia de macroinvertebrados y las condiciones ambientales de las playas
Mimosa y Cerro Avanzado
De acuerdo al análisis BEST/BIOENV, la GR y MO
fueron las variables ambientales que influenciaron en
mayor medida la distribución de las comunidades
macrobentónicas en PM y CA (r = 0,466). Sin embargo,
estas variables en conjunto con la PCA también
mostraron una alta influencia sobre la comunidad (r =
0,450). El ACP explicó el 80% del total de la variación
6447
Figura 5. Análisis de conglomerados con los datos ambientales registrados en los sitios de muestreo de las playas Mimosa
(PM) y Cerro Avanzado (CA). En el eje horizontal se indica el porcentaje de similitud.
DISCUSIÓN
Desde 1970 en adelante, en las costas del Golfo Nuevo,
se ha producido un incremento de las actividades
antrópicas asociadas al desarrollo turístico, industrial y
urbano. Dicho incremento está ocasionando perturbaciones evidentes en la zona costera (e.g., remoción de
dunas, uso de vehículos en la playa, vertido de efluentes
residuales), que aún no han sido estudiados. Si bien el
impacto antrópico sobre esta zona se puede medir en
forma puntual mediante indicadores simples obtenidos
de la columna de agua, los sedimentos o los organismos
bentónicos (e.g., materia orgánica, oxígeno disuelto,
nutrientes, abundancia total de organismos, riqueza o
diversidad específica), está ampliamente demostrado
que tales indicadores analizados individualmente, no
siempre son suficientes o confiables para detectar un
cambio causado por la contaminación (DelValls et al.,
1998). Tampoco pueden evidenciar los complejos
fenómenos de interacciones entre los componentes
abióticos y bióticos del ecosistema sujeto a impacto
ambiental. Por lo tanto, para lograr una correcta
evaluación del ambiente estudiado se requiere la
utilización de métodos multivariados que consideren
los factores abióticos y bióticos del sistema (DelValls
et al., 1998). Sin embargo, en estas costas han sido
escasos los estudios realizados hasta el momento, y
estuvieron enfocados en analizar la distribución de las
especies de macroinvertebrados en sitios específicos de
estas playas, localizados a lo largo de una transecta o en
sitios puntuales ubicados en los distintos niveles del
intermareal (Barón, 1995; Escofet, 1983; Ferrando,
2007; Lizarralde & Cazzaniga, 2009; Ferrando et al.,
2010). Los resultados obtenidos en este trabajo
contribuyen al conocimiento sobre estos ambientes, ya
que brindan una caracterización detallada de los sedimentos en cuanto a sus condiciones ambientales y
composición faunística, considerando la extensión
completa de dos playas arenosas localizadas dentro del
Golfo Nuevo.
4487
Tabla 1. Rango de variables ambientales y lista de los taxa de macroinvertebrados registrados en las playas Mimosa (PM)
y Cerro Avanzado (CA). MO: porcentaje de materia orgánica, GR: granulometría (µm), PCA: profundidad de la capa
anóxica (cm), DM: densidad media (ind m-2), DE: desviación estándar, FO: frecuencia de ocurrencia de cada taxón.
Taxa
Glyceridae
Opheliidae
Polynoidae
Maldanidae
Onuphidae
Paraonidae
Scalibregmidae
Nereididae
Spionidae
Idoteidae
Lyssianasidae
Varunidae
Tanaidae
Cylindroleberididae
Atelecyclidae
Phoxocephalidae
Corofioidae
Oediceridae
Inachoididae
Majidae
Nassariidae
Tellinidae
Veneridae
Actiniidae
Lineidae
MO
PM
0,46 - 0,48
0,46 - 0,98
0,63 - 0,98
0,51 - 0,98
0,61 - 0,98
0,68
0,65
0,61 - 1,17
0,64 - 1,58
CA
0,45 - 0,96
0,46 - 0,59
0,86 - 1,00
0,50 - 0,96
0,50 - 0,86
0,59 - 0,61
0,86
0,82 - 0,89
1,59
0,91 - 1,59
0,62 - 0,89
0,63
0,66 - 0,89 0,57 - 0,96
1,59
0,64 - 0,91 0,56 - 0,96
0,56
0,36
0,46 - 1,17 0,86 y 1,00
0,46 - 0,99 0,50 y 1,00
0,56
0,64 - 0,79 0,5 - 0,61
0,57 - 1,59 0,50
GR
PM
150,20 - 157,30
148,30 - 157,30
143,40 - 159,20
143,40 - 159,20
143,40 - 159,20
152,40
152,00
146,70 - 164,00
148,30 - 164,00
PCA
CA
147,40 - 165,00
153,70 - 165,50
147,40 - 159,90
147,40 - 159,10
157,10 - 163,00
150,20 - 163,00
157,10
146,70 - 154,30
164,00
151,70 - 164,00
149,90 - 153,00
150,20
149,90 - 156,50
164,00
150,20 - 159,20
149,90 - 157,30
146,70 - 159,20
146,70 - 159,20
146,70 - 164,00
147,40 - 161,80
147,40 - 161,80
153,70
153,70
141,50 - 157,90
141,50 - 164,80
153,70
150,20 - 159,10
164,80
A pesar que los porcentajes de materia orgánica
registrados en este trabajo fueron inferiores a los
valores típicamente encontrados en sitios impactados
(López-Jamar, 1981; Ferrando & Méndez, 2011), PM
presentó una mayor concentración de materia orgánica
y menor profundidad de la capa anóxica que CA,
probablemente como resultado de su cercanía a Puerto
Madryn. Estudios previos han demostrado que el
enriquecimiento orgánico en los sedimentos favorece
un intenso crecimiento bacteriano que consume el
oxígeno disuelto en el agua intersticial, contribuyendo
notablemente a la formación de la capa anóxica en
zonas más cercanas a la superficie (Lalli & Timothy,
1997).
Considerando la caracterización ambiental dentro
de cada playa, se observó que tanto en la región sureste
de PM como en la región norte de CA predominaron
los sedimentos más finos, los mayores valores de
materia orgánica y las menores profundidades de la
capa anóxica registrados en este estudio. Esto evidencia
que dichas regiones son zonas de acumulación, lo cual
se ve reflejado en la cantidad de algas que arriban a
PM
3,40 - 5,70
2,00 - 11,50
1,50 - 8,50
1,50 - 11,50
1,50 - 8,50
5,00
2,00
5,00 - 11,50
2,50 - 7,50
D.M. ± D.S.
CA
PM
CA
8,00 - 11,00
2,81 ± 9,00
5,10 ± 9,23
8,00 - 14,00 153,41 ± 358,35 22,11 ± 45,60
8,00 - 11,00
4,93 ± 10,43
5,10 ± 9,23
5,50 - 11,00 210,42 ± 288,21 51,02 ± 115,94
9,00 - 14,00
9,15 ± 24,75
5,10 ± 9,23
5,50 - 14,00
2,81 ± 15,16
3,40 ± 7,94
0,70 ± 3,79
42,22 ± 188,07
94,30 ± 206,36
7,50
5,10 ± 9,23
5,50 - 11,50
2,74 ± 7,75
6,00
2,81 ± 15,16
2,50 - 6,00
123,86 ± 663,07
3,00 - 5,50
2,11 ± 6,33
3,00
0,70 ± 3,79
5,50
6,00 - 8,50
3,52 ± 15,49
6,80 ± 10,05
6,00
0,70 ± 3,79
2,00 - 5,50 5,50 - 8,50
7,34 ± 13,79
3,40 ± 7,94
8,50
1,70 ± 5,89
8,50
1,70 ± 5,89
2,00 - 8,50 6,50 - 11,00 10,56 ± 24,16
5,10 ± 9,23
1,50 - 11,50 6,50 - 11,00 100,63 ± 262,77 482,99 ± 788,45
8,50
1,70 ± 5,89
3,50 - 5,50 5,50 - 9,00
6,33 ± 12,32
3,40 ± 7,94
3,50 - 11,50
8,00
4,93 ± 12,97
3,40 ± 11,78
F.O.
PM
0,10
0,55
0,21
0,83
0,21
0,03
0,03
0,10
0,28
CA
0,25
0,25
0,25
0,33
0,25
0,17
0,08
0,10
0,03
0,07
0,10
0,03
0,41 0,33
0,03
0,17 0,17
0,08
0,08
0,52 0,25
0,31 0,50
0,08
0,24 0,17
0,21 0,08
estas playas desde el submareal y se depositan sobre
ellas (Raffo, com. pers.). Estas arribazones son un
fenómeno frecuente en el intermareal del Golfo Nuevo
y constituyen una de las principales fuentes de aporte
de nutrientes de origen natural sobre estos ambientes
(Piriz et al., 2003).
Diversos estudios han demostrado que la
granulometría es una de las variables ambientales de
mayor influencia sobre los patrones de abundancia de
las especies macrobentónicas (Muniz & Pires, 2000;
Probert et al., 2001; Hernández-Arana et al., 2003;
Rodriguez-Villanueva et al., 2003; Dauvin et al., 2004;
Díaz-Castañeda & Harris, 2004; Defeo et al., 2005;
McLachlan & Dorvlo, 2005; McLachlan & Brown,
2010). La velocidad del flujo de agua sobre el sustrato
a consecuencia de la energía de las olas determina el
tipo de sedimento y disponibilidad de alimento, condicionando la composición de la comunidad bentónica
(McLachlan & Dorvlo, 2005; McLachlan & Brown,
2010). Por lo tanto, las comunidades que habitan en
áreas con flujos de agua intensos estarán dominadas por
organismos filtradores, mientras que en las áreas donde
449
8
Figura 6. Análisis de conglomerados con los datos de densidad de las diferentes familias registradas en los sitios de
muestreo de las playas Mimosa (PM) y Cerro Avanzado (CA). En el eje horizontal se indica el porcentaje de similitud.
Figura. 7. Biplot del Análisis de Componentes Principales con las variables ambientales registradas y las estaciones de
muestreos correspondientes a ambas playas. PCA: profundidad de la capa anóxica, MO: porcentaje de materia orgánica,
GR: granulometría, CA: Cerro Avanzado, PM: Playa Mimosa.
Tabla 2. Correlación entre la densidad de los taxa más
abundantes registrados en ambas playas y las diferentes
variables ambientales medidas en este estudio. PCA:
profundidad de la capa anóxica (cm), MO: porcentaje de
materia orgánica, GR: granulometría (µm), *diferencias
significativas (P < 0,05); **diferencias altamente significativas (P < 0,01).
Familia
Tellinidae
Maldanidae
Opheliidae
PCA
MO
GR
0,22
-0,35*
-0,07
0,26
0,29
-0,1
-0,31*
-0,51**
-0,1
el flujo de agua es débil, predominarán los organismos
detritívoros o alimentadores de depósito (McLachlan &
Dorvlo, 2005; McLachlan & Brown, 2010). Los
resultados obtenidos en este trabajo mostraron que las
familias Tellinidae, Maldanidae y Opheliidae fueron las
más abundantes en ambas playas y estuvieron
fundamentalmente asociadas a sedimentos finos. Como
era de esperarse, la estrategia de alimentación de estas
familias corresponde a alimentadores de depósito y por
lo tanto, son organismos que se alimentan de partículas
depositadas sobre el sedimento (Holme, 1950, 1961;
Fauchald & Jumars, 1979; Gambi & Giangrande, 1985;
Bremec & Giberto, 2006).
Además de los factores ambientales, las interacciones biológicas como la depredación (Holland et al.,
1980) y la competencia intra e interespecífica (Woodin,
1974; Levin, 1981; Beukema & Flach, 1995;
McLachlan & Brown, 2010), también son condicionantes de la distribución de especies en el intermareal
arenoso. En el presente estudio, se observó una alta
similitud entre los sitios de ambas playas cuando se
consideraron sólo las variables ambientales (tamaño de
grano, profundidad de la capa anóxica y porcentaje de
materia orgánica). Contrariamente, los sitios mostraron
escasa similitud respecto a la densidad de los taxa
presentes. En consecuencia, en los ambientes
estudiados, las interacciones biológicas podrían estar
influenciando en mayor medida que las condiciones
ambientales, la estructura de las comunidades
macrobentónicas. Este patrón es esperable en intermareales disipativos donde los individuos no están
sometidos al estrés producido por la energía del oleaje
(McLachlan et al., 1993, 1985; Defeo et al., 2001,
2005).
Los valores de riqueza de especies y de diversidad
esperables en intermareales disipativos se encuentran
entre los más altos, donde la menor energía del oleaje
permite la coexistencia de un mayor número de
especies (McLachlan et al., 1993, 1985; Defeo &
McLachlan, 2005). Los valores determinados en el
presente trabajo fueron similares a los observados en
4509
diferentes intermareales arenosos con características
similares (Defeo et al., 2005; McLachlan & Dorvlo,
2005; McLachlan & Brown, 2010). A su vez, en el
intermareal de PM se registró un alto número de
familias que no estuvieron presentes en CA y la
biodiversidad en esta playa fue significativamente
mayor. Si bien ambas playas presentan condiciones
ambientales similares, PM es aproximadamente cuatro
veces más extensa que CA, lo que posibilita el
establecimiento de un mayor número de taxa con
diferentes requerimientos nutricionales y reproductivos
(Begon et al., 2006).
Si bien el efecto de las actividades que se
desarrollan en los ecosistemas costeros del Golfo
Nuevo aún es incipiente, la información obtenida en
este trabajo constituye una referencia para futuros
estudios de monitoreo e impacto ambiental de estas
costas. Este tipo de estudios se podrían realizar como
parte de un plan de manejo integrado de los ambientes
costeros de este golfo, cuya aplicación permitiría el
desarrollo de diferentes actividades turísticas,
industriales y urbanas resguardando su integridad.
AGRADECIMIENTOS
Los autores agradecen al Laboratorio de Humedales
utilizados por Aves Playeras Migratorias, al Laboratorio
de Oceanografía Química y Contaminación de Aguas y
al Laboratorio de Peces y Mariscos de Interés
Comercial, pertenecientes al Centro para el Estudio se
Sistemas Marinos (CESIMAR-CONICET), por el acceso
al equipamiento para procesar las muestras de sedimentos.
Asimismo, agradecemos a E. Gómez Simes por su ayuda
en la identificación de los crustáceos y a M. Carrasco por
su contribución en el análisis de los datos espaciales.
REFERENCIAS
Angeloni, P.E. 2003. Impacto del uso recreativo sobre la
fauna macro bentónica de las playas arenosas de la
bahía de La Paz. Tesis de Maestría en Ciencias con
especialidad en Manejo de Recursos Marinos, Instituto
Politécnico Nacional, La Paz, 95 pp.
Bale, A.J. & A.J. Kenny. 2005. Sediment analysis and
seabed characterization. En: A. Eleftheriou & A.D.
McIntyre (eds.). Methods for the study of marine
benthos. Blackwell Publishing, Oxford, pp. 43-86.
Barón, P. 1995. Anatomía y morfología de la almeja
Tellina petitiana D’Orbigny (Pelecypoda. Tellinidae).
Tesis de Licenciatura en Ciencias Biológicas, Universidad Nacional de la Patagonia San Juan Bosco, Puerto
Madryn, pp. 195.
Barón, P.J. & N.F. Ciocco. 1997. Anatomía de la almeja
Tellina petitiana (d’Orbigny, 1846). I. Organización
451
10
general, partes duras, manto, sifones, pie y branquias
(Bivalvia, Tellinidae). Rev. Biol. Mar., 32: 95-10.
Barón, P.J. & N.F. Ciocco. 1998. Anatomía de la almeja
Tellina petitiana (d’Orbigny, 1846). III. Sistema
nervioso y gónada. (Bivalvia, Tellinidae). Rev. Biol.
Mar., 33: 139-154.
Begon, M., C.R. Townsend & J.L. Harper. 2006. Ecology:
from individuals to ecosystems. Blackwell Publishing,
Oxford, 752 pp.
Beukema, J.J. & E.C. Flach. 1995. Factors controlling the
upper and lower limits of the intertidal distribution of
two Corophium species in the Wadden Sea. Mar. Ecol.
Prog. Ser., 125: 117-126.
Bigatti, M., A. Primost, M. Cledón, A. Averbuj, N.
Theobald, W. Gerwinski, W. Arntz, E. Morriconi &
P.E. Penchaszadeh. 2009. Biomonitoring of TBT
contamination and imposex incidence along 4700 km
of Argentinean shoreline (SW Atlantic: from 38ºS to
54ºS). Mar. Poll. Bull., 58: 695-701.
Blott, S.J. 2008. GRADISTAT V6. 0. Excel Spreadsheet.
Bremec, C. & D. Giberto. 2006. Polychaete assemblages
in the Argentinean Biogeographical Province, between
34º and 38ºS. Sci. Mar., 70(S3): 249-258.
Burger, J. 1991. Foraging behavior and the effect of
human disturbance on the piping plover (Charadrius
melodus). J. Coast. Res., 7: 39-52.
Ciocco, N.F. & P.J. Barón. 1998. Anatomía de la almeja
Tellina petitiana d'Orbigny, 1846. II. Sistema
digestivo, corazón, riñones, cavidad y glándulas
pericárdicas (Bivalvia, Tellinidae). Rev. Biol. Mar.
Oceanogr., 33(1): 73-87.
Commendatore, M.G. & J.L. Esteves. 2007. An
assessment of oil pollution in the coastal zone of
Patagonia, Argentina. Environ. Manage., 40: 814-821.
Conover, W.J. 1999. Practical nonparametric statistics.
John Wiley & Sons, Nueva York, 584 pp.
Dauvin, J.C., E. Thiébaut, J.L.G. Gesteira, K. Ghertsos &
F. Gentil. 2004. Spatial structure of a subtidal
macrobenthic community in the Bay of Veys (western
Bay of Seine, English Channel). J. Exp. Mar. Biol.
Ecol., 307(2): 217-235.
Davenport, J. & J.L. Davenport. 2006. The impact of
tourism and personal leisure transport on coastal
environments: a review. Estuar. Coast. Shelf Sci., 67:
280-292.
Defeo, O. & A. McLachlan. 2005. Patterns, processes and
regulatory mechanisms in sandy beach macrofauna: a
multi-scale analysis. Mar. Ecol. Prog. Ser., 295: 1-20.
Defeo, O., J. Gomez & D. Lecari. 2001. Testing the swash
exclusion hypothesis in sandy beach populations: to
mole crab Emerita brasiliensis in Uruguay. Mar. Ecol.
Prog. Ser., 212: 159-170.
Defeo, O., D. Lercari & J. Gomez. 2005. The role of
morphodynamics in structuring sandy beach populations
and communities: what should be expected? J. Coastal
Res., 35: 352-362.
Defeo, O., A. McLachlan, D.S. Schoeman, T.A. Schalacher
& J. Dugan. 2009. Threats to sandy beach ecosystems:
a review. Estuar. Coast. Shelf Sci., 81: 1-12.
DelValls, T.A., M. Conradi, E. García-Adiego, J.M. Forja
& A. Gómez-Parra. 1998. Analysis of macrobenthic
community structure in relation to different environmental sources of contamination in two littoral
ecosystems from the Gulf of Cadiz (SW Spain).
Hydrobiologia, 385: 59-70.
Dı́az-Castañeda, V. & L.H. Harris. 2004. Biodiversity and
structure of the Polychaete fauna from soft bottoms of
Bahia Todos Santos, Baja California, Mexico. DeepSea Res. II, 51(6): 827-847.
Escofet, A. 1983. Community ecology of a sandy beach
from Patagonia (Argentina, South America). Tesis
Master of Sciences, Washington University, Washington,
122 pp.
Escofet, A., J.M. Orensanz, S.R. Olivier & V. Scarabino.
1978. Biocenología bentónica del golfo San Matías
(Río Negro, Argentina): metodología, experiencias y
resultados del estudio ecológico de un gran espacio
geográfico en América Latina. An. Inst. Cienc. Mar.
Limnol. Univ. Nac. Autón. Mex., 5: 59-82.
Escofet, A., N. Gianuca, S. Maytía & V. Scarabino. 1979.
Playas arenosas del Atlántico sudoccidental entre los
29º y 43ºLS: consideraciones generales y esquema
biocenológico. Memorias del Seminario sobre
Ecología Bentónica y Sedimentación de la Plataforma
Continental del Atlántico Sur, Mar del Plata, pp. 245258.
Fauchald, K. & P.A. Jumars. 1979. The diet of worms: a
study of polychaete feeding guilds. Oceanogr. Mar.
Biol. Annu. Rev., 17: 193-284.
Ferrando, A. 2007. Estudio de las comunidades macrobentónicas en áreas intermareales, Golfo Nuevo,
Chubut y su relación con las características del
sedimento. Tesis de Licenciatura en Ciencias
Biológicas, Universidad Nacional de la Patagonia San
Juan Bosco, Puerto Madryn, 41 pp.
Ferrando, A. & N. Méndez. 2011. Effects of organic
pollution in the distribution of annelid communities in
the coastal lagoon “Estero de Urías” (Mexico). Sci.
Mar., 75: 351-358.
Ferrando, A., N. Méndez, J.L. Esteves & R. Elías. 2010.
Intertidal macrozoobenthos in sandy beaches of Bahía
Nueva (Patagonia, Argentina) and its use as
bioindicators of environmental impact. Sci. Mar.,
74(2): 345-352.
Gambi, M.C. & A. Giangrande. 1985. Caratterizzazione e
distribuzione delle categorie trofiche dei policheti nei
fondi mobili del Golfo di Salerno. Oebalia, 11: 223240.
Hernández-Arana, H.A., A.A. Rowden, M.J. Attrill, R.M.
Warwick & G. Gold-Bouchot. 2003. Large-scale
environmental influences on the benthic macroinfauna
of the southern Gulf of Mexico. Estuar. Coast. Shelf
Sci., 58(4): 825-841.
Holland, A.F., N.K. Mountford, M.H. Hiegel, K.R.
Kaumeyer & J.A. Mihursky. 1980. Influence of
predation on infaunal abundance in upper Chesapeake
Bay, USA. Mar. Biol., 57: 221-235.
Holme, N.A. 1950. Population-dispersion in Telina tenuis
Da Costa. J. Mar. Biol. Assoc. U.K., 29(2): 267-280.
Holme, N.A. 1961. Notes on the mode of life of the
Tellinidae (Lamellibranchia). J. Mar. Biol. Assoc.
U.K. , 41: 699-703.
Lalli, M.C. & R. Timothy. 1997. Biological oceanography
an introduction. University of British Columbia,
Vancouver, 320 pp.
Levin, L.A. 1981. Dispersion, feeding behavior and
competition in two spionid polychaetes. J. Mar. Res.,
39: 99-117.
Lizarralde, Z.I. 2002. Distribución y abundancia Tellina
petitiana (Bivalvia, Tellinidae) en Cerro Avanzado,
Chubut, Argentina. Physis, 60: 7-14.
Lizarralde, Z.I. & N.J. Cazzaniga. 2009. Population
dynamics and production of Tellina petitiana
(Bivalvia) on a sandy beach of Patagonia, Argentina.
Thalassas, 25(1): 45-57.
López-Jamar, E. 1981. Spatial distribution of the infaunal
benthic communities of the Ria de Muros, North-West
Spain. Mar. Biol., 63: 29-37.
Massara-Paletto, V. 2003. Hidrocarburos en sedimentos y
organismos marinos de diferente nivel trófico. Tesis de
Grado, Universidad Nacional de la Patagonia San Juan
Bosco, Puerto Madryn, 96 pp.
McLachlan, A. 1989. Water filtration by dissipative
beaches. Limnol Oceanogr., 34(4): 774-780.
McLachlan, A. & A.C. Brown. 2010. The ecology of
sandy shores. Academic Press, Nueva York, pp. 392.
McLachlan, A. & A. Dorvlo. 2005. Global patterns in
sandy beach macrobenthic communities. J. Coastal
Res., 21(4): 674-687.
McLachlan, A., E. Jaramillo, T.E. Donn & F. Wessels.
1993. Sand beach macrofauna communities: a
geographical comparison. J. Coastal Res., 15: 27-38.
Received: 8 April 2015; Accepted: 20 November 2015
452
11
McLachlan, A., E. Jaramillo, O. Defeo, J.E. Dugan & A.
Ruyck. 1985. Adaptations of bivalves to different
beach types. J. Exp. Mar. Biol. Ecol., 187: 147-160.
Muniz, P. & A.M.S. Pires. 2000. Polychaete associations
in a subtropical environment (São Sebastião Channel,
Brazil): a structural analysis. Mar. Ecol., 21(2): 145160.
Nordstrom, K.F. 2008. Beach and dune restoration.
Cambridge University Press, Cambridge, 187 pp.
Pearson, G.R. & M. Powell. 2001. Measuring the cost of
retreat. Coast. Manage., 29(2): 91-103.
Piriz, M.L., M.C. Eyras & C.M. Rostango. 2003. Changes
in biomass and botanical composition of beach-coast
seaweeds in a disturbed costal from Argentine
Patagonia. J. Appl. Phycol., 15: 67-74.
Shannon, C.E. & W. Weaver. 1949. The mathematical
theory of communications. University of Illinois Press,
Urbana, 117 pp.
Probert, P.K., G.B. Read, S.L. Grove & A.A. Rowden.
2001. Macrobenthic polychaete assemblages of the
continental shelf and upper slope off the west coast of
the South Island, N. Z. J. Mar. Freshwater Res., 35(5):
971-984.
Rodríguez-Villanueva, V., R. Martínez-Lara & V.M.
Zamora. 2003. Polychaete community structure of the
northwestern coast of Mexico: patterns of abundance
and distribution. Hydrobiologia, 496: 385-398.
Sibson, R. 1981. A brief description of natural neighbor
interpolation. In: V. Barnett. (ed.). Interpreting.
multivariate data. Wiley, Chichester, pp. 21-36.
Sokal, R.R. & F.J. Rohlf. 2002. Introducción a la
bioestadística. Editorial Reverté, Madrid, 380 pp.
Vázquez, N.N. 2004. Biodiversidad costero marina en la
Patagonia: características, conservación e importancia.
Informe Técnico Fundación Patagonia Natural, Puerto
Madryn, 60 pp.
Wentworth, C.K. 1922. A scale of grade and class terms
for clastic sediments. J. Geol., 4: 377-392.
Whitmarsh, D., J. Northen & S. Jaffry. 1999. Recreational
benefits of coastal protection: a case study. Mar.
Policy, 23(4): 453-464.
Woodin, S.A. 1974. Polychaete abundance patterns in a
marine soft-sediment environment: the importance of
biological interactions. Ecol. Monogr., 44: 171-187
Yorio, P. 2009. Marine protected areas, spatial scales, and
governance: implications for the conservation of
breeding seabirds. Conserv. Lett., 2(4): 171-178.
Lat. Am. J. Aquat. Res., 44(3): 453-459, 2016
Carapace morphometrics of aeglids
453
Research Article
Carapace shape of some aeglid crabs: plasticity at different levels
Rafael Metri1, Aline Rossi de Oliveira2 & Cassiana Baptista-Metri1
1
Departamento de Ciências Biológicas do Campus de Paranaguá
Universidade Estadual do Paraná, Paranaguá, PR, Brazil
2
Programa de Pós Graduação em Ecologia Evolutiva
Universidade Estadual do Centro Oeste do Paraná, Guarapuava, PR, Brazil
Corresponding author: Rafael Metri (rafael.metri@unespar.edu.br)
ABSTRACT. Geometric morphometric techniques were applied for a better comprehension of inter- and intraspecific morphological variability of freshwater aeglid crabs. Carapace morphological patterns were used to
address hypothesis regarding 1) the simple existence of local adaptations or 2) actual stable evolutionary features
within the lineages studied. Two clades were included in this analysis: the former encompassing the closely
related species Aegla castro, A. parana, A. schmitti, and the latter including the closely-related species A.
ligulata, A. longirostri and A. inconspicua. Overall, distinct carapace shapes were found not only between
species but also among different populations of same species. In some cases, species belonging to distinct,
distantly related clades were more similar in carapace morphology than to closely related species of the same
clade. This meant that there was no stable carapace morphology pattern for each major lineage. Results suggest
that carapace of these crabs is plastic within lineages, although has a stable, unchangeable component readily
recognizable by the geometric morphometric analysis at the species level, plus a more plastic component that
may change according to the environment in which they inhabit.
Keywords: Aeglidae, Crustacea, adaptation, carapace shape, morphometric analysis.
La forma del caparazón de algunos cangrejos aeglídeos: plasticidad en distintos niveles
RESUMEN. Técnicas de morfometría geométrica se aplicaron para una mejor comprensión de la variabilidad
morfológica inter e intra-específica de los cangrejos aeglídeos de agua dulce. Se utilizaron patrones
morfológicos de los caparazones para hacer frente a la hipótesis sobre 1) la simple existencia de adaptaciones
locales o 2) características evolutivas estables dentro de los linajes estudiados. En este análisis, se incluyeron
dos clados estrechamente relacionados entre sí: el primero abarca las especies Aegla castro, A. parana, A.
schmitti, y el segundo incluyó a A. ligulata, A. longirostri y A. inconspicua. Se encontraron diferencias en la
forma del caparazón no solo entre especies, sino también entre las distintas poblaciones de una misma especie.
En algunos casos, especies pertenecientes a clados distintos y alejados, fueron más similares en morfología del
caparazón que especies estrechamente relacionadas del mismo clado. Esto significó que no hubo un patrón
estable de morfología del caparazón para cada linaje. Los resultados sugieren que el caparazón de estos cangrejos
exhibe plasticidad dentro de los linajes, aunque tiene un componente estable fácilmente reconocible por el
análisis morfométrico geométrico a nivel de especie, más un componente más plástico que puede cambiar de
acuerdo con el entorno en que habitan.
Palabras clave: Aeglidae, Crustacea, adaptación, forma de caparazón, análisis morfométrico.
INTRODUCTION
Individuals belonging to the same taxon tend to have
similar bauplans due to genetic and developmental
mechanisms that maintain a more or less stable macroevolutionary pattern of phenotypic expression (Carrol
et al., 2005). However, environmental conditions may
__________________
Corresponding editor: Luis Miguel Pardo
influence phenotype, causing plastic responses in body
allometry or in ontogenetic development (Rongling et
al., 2003). Phenotypic plasticity, defined as the capacity
of expressing alternative patterns of morphology,
physiology and/or behavior in response to environmental pressures, is the source of morphological variability within natural populations (Schlichting, 1986).
454
In this context, we tested the hypothesis that in
different crab lineages would be evolutionary distinct
morphological patterns. In other words, although each
species has its singular form, a group of related species
must share a general morphology due to common
evolutionary history.
Anomuran freshwater crabs of the family Aeglidae
present just one extant genus, Aegla Leach, 1820.
Those are benthic forms inhabiting under rocks, roots
and leaves on the bottom of limnic systems such as
rivers, lakes, water bodies within caves, and fastflowing rivulets. The family is endemic of South
America, occurring in Chile, Brazil, Bolivia, Uruguay,
Paraguay and Argentina (Melo, 2003). There are more
than 70 described species, and approximately 35 of
which are endemic to southern Brazil (Bond-Buckup et
al., 2008; Santos et al., 2010, 2012, 2013).
Aeglid crabs display high morphological variability
that has been subject of intense investigation. A
common conclusion emphasized in most of those
studies is the difficulty in establishing a clear-cut
distinction among species (Jara, 1986; Martin & Abele,
1986; Giri & Colins, 2004; Giri & Loy, 2008). This fact
makes the group an ideal model for morphometric
studies.
Geometric morphometries can be defined as a group
of techniques based on analysis of the contour of body
structures and establishment of anatomical reference
points that can be recognized as homologies (Zelditch
et al., 2004). It can be characterized as a cutting-edge
tool for ecological studies and evolution biology, as it
allows the investigation of ecologic or phylogenetic
causes of morphologic variation in relation to
ontogenetic stages, sexes, taxa and different populations of a same taxon (Reis, 1988).
In the present study, we applied geometric
morphometries techniques for Brazilian aeglid crabs
aiming a better comprehension of intra and interspecific variability in carapace morphology, relative to
distinct lineages. To accomplish this goal, we employed
recent and comprehensive phylogenies of the genus
Aegla by comparing two clades of closely-related
species.
MATERIALS AND METHODS
Species
Six aeglid crab species were used in this study,
belonging to two different clades in phylogeny
presented by Pérez-Losada et al. (2004, 2009). From
these, three were closely related species of subclade
“C”: Aegla castro Schmitt, 1942, A. parana Schmitt,
1942 and A. schmitti Hobs III, 1979, all with close
geographic distributions. Other three, belonging to
subclade “E” of Pérez-Losada et al. (2004) were A.
ligulata Bond-Buckup & Buckup, 1994, A. longirostri
Bond-Buckup & Buckup, 1994 and A. inconspicua
Bond-Buckup & Buckup, 1994, which also have close
geographic distribution. Individuals of different
populations for each species were included in the
analyses. The species of subclade “C” were photographed at the Natural History Museum of Capão da
Imbuia (Curitiba, Brazil). Pictures of species of
subclade “E” were obtained from aeglid crab collection
of Federal University of Rio Grande do Sul (Porto
Alegre, Brazil). These species were used to compare de
carapace shape between clades to assign if shape is
evolutionary fixed in the lineages.
Morphological analysis
Cephalothorax dorsal images of close to 30 adult males
of each species, belonging to different populations
(Table 1), were obtained. All images were captured
with same focal distance with the aid of a wooden
frame, attached to a plain board, fitted with a
mechanism that allowed height adjustment according to
the size of the crab. All images were taken with a
Samsung ES80 digital camera and grouped with
TPSUtil software version 1.44 (Rohlf, 2010).
Twenty one symmetric and homologue anatomic
landmarks (coordinates) were recognized on aeglid
carapaces in each image (Fig. 1) using TPSDig2
version 2.12 (Rohlf, 2008). In addition, each image had
their coordinates set in triplicate to reduce the error
margin. The average of coordinates was used in
subsequent analysis.
The anatomic coordinates for each species and
populations were processed using procrustes analysis,
to remove the bias introduced by size variability, and
photograph position to get standardized information on
carapace form (Rohlf & Slice, 1990). This analysis was
performed using the Morpho J software version 1.05d
(Klingenberg, 2011), and considering object symmetry.
Some outliers identified were excluded from
subsequent analysis resulting in the number of
individuals on Table 1. A canonical variable analysis
(CVA) was performed to explore the shape variations
of the six species, and to maximize visual discrimination among groups. The Mahalanobis distance was
calculated between all pairs of species. Data were then
analyzed by discriminant analysis considering species
and populations to sort out groups by their carapace
shape. For comparisons between populations, those
represented by few individuals were excluded from
analyzes.
In addition, the Morpho J software was also used to
extract the centroid size, defined as square root of the
455
Table 1. Number of individuals (n), locality and date of collection of each aeglid population obtained from the scientific
collections.
Species
Aegla parana
Aegla schmitti
Aegla castro
Aegla ligulata
Aegla inconspicua
Aegla longirostri
Population
n
1
2
3
4
1
2
3
1
2
3
4
10
5
4
7
21
4
5
5
8
7
3
1
2
3
4
1
2
3
4
1
2
3
4
5
2
14
9
3
4
9
12
5
3
3
5
Locality
Clade C
Rio Iguaçu, São Mateus do Sul-PR
Rio Iguaçu, Pinhão-PR
Rio Jordão, Pinhão-PR
Rio Jordão, Reserva do Iguaçu-PR
Rio Irai, Quatro Barras-PR
Rio Irai, Pinhais-PR
Rio Maurício, Manduituba-PR
Rio Irai-PR
Parque Estadual Cachambu, Londrina-PR
Rio Quebra Perna, Ponta Grossa-PR
Parque Estadual Cachambu, Londrina-PR
Clade E
Afluente do rio Santana, Antas-RS
Arroio Contendos, Rota do Sol-RS
Bacia Tainhas, Contendas-RS
Rio Baio Branco, Cambará-RS
Rio Lavapés, Canela-RS
Canela-RS
Arroio Cerrito, São Francisco de Paula-RS
Arroio Cerrito, Maquiné-RS
?
Novo Treviso-RS
Arroio Afluente do Rio Carneiro, Casca-RS
Arroio dos Ratos, Parte Baixa-RS
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
Date collected
02/10/1966
04/10/1987 to 10/10/1987
20/10/1992
24/04/1996
?/11/1998
27/12/1967
15/12/1972
17/08/2001
22/10/1983
28/05/1984 to 31/05/1984
21/10/1983
28/11/2004
23/09/1997
04/06/1997
27/11/2004
11/09/2004
12/09/2004
09/10/2004
19/10/2001
25/11/2009
?/?/1982
30/10/2000
03/12/2003 to 04/12/2003
Anatomic position
Rostral tip
Left orbital sinus
Tip of the left anterolateral spine
Tip of the left hepatic lobe
Tip of the left epibranchial tooth
Intersection of the left branchial line
Distal tip of the left branchial area
Posterior tip of the left dorsal longitudinal line
Posterior tip of the right dorsal longitudinal line
Distal tip of the right branchial area
Intersection of the right branchial line
Tip of the right epibranchial tooth
Tip of the right hepatic lobe
Tip of the right anterolateral spine
Right orbital sinus
Anterior tip of the left “linea aeglica dorsalis”
Posterior tip of the left “linea aeglica dorsalis”
Anterior tip of the right “linea aeglica dorsalis”
Posterior tip of the right “linea aeglica dorsalis”
Basis of the cervical groove
Tip of the posterior centre of the cephalothorax
Figure 1. Location and description of the 21 symmetric and homologous landmarks set on the digital images of the dorsal
surface of the carapace of Aegla, after Melo (2003).
456
sum of squares of the distance of each anatomic
coordinate and the centroid, the latter corresponding to
the vector of the average of coordinates x and y of all
anatomic landmarks marked on each image. This data
was obtained for each species and clade and tested in
relation to general averages using ANOVA to species
comparison and t test to clades.
RESULTS
Morphology of anterior region of aeglid carapace is
very stable, except for the rostrum. In contrast, the
morphology of posterior region is variable, as
evidenced by the overlap of procrustes as depicted in
Fig. 2.
The two clades compared did not show
morphological difference (parwise discriminant
analysis, P > 0.05). All six species compared showed
significant differences in carapace shape (parwise
discriminant analysis, P < 0.05). Three groups of
species were clearly distinguished by canonical
analysis (Fig. 3) according to their carapace
morphology: i) A. parana from clade “C “plus A.
longirostri from clade “E”, with Mahalanobis distance
= 4.2; ii) A. castro and A. schmitti, both from the clade
“C”, with Mahalanobis distance = 2.6; iii) A. ligulata
and A. inconspicua both from the clade “E”, with
Mahalanobis distance = 1.9. All the other pairs of
species presented Mahalanobis distances superior to
6.3. It was therefore found that two species belonging
to distinct clades were more similar in carapace
morphology than to the members of same clade.
First canonical axis was positively related to
rostrum length and negatively related to width of
carapace posterior region. This means that the larger
value on axis 1 would translate in a longer rostrum and
narrower back end of carapace. Second canonical axis
was related to anterolateral spines position and
carapace width. In this case, a large value on axis 2
would result in a narrow angle formed by anterolateral
spines and a broader carapace at intersection of
branchial line (Fig. 3).
Species and clades presented no significant
differences regarding centroid size in relation to overall
mean, implying that aeglid species studied had similar
carapace sizes, according with ANOVA and t-tests
performed (P > 0.05). This suggests that variability
found is related to carapace shape.
All pairwise comparisons of carapace morphology
between populations of a given species differed
significantly (discriminant analysis, P < 0.05 in all
cases), with high percentages of correct classifications.
Figure 2. Procrustes overlap showing the regions of high
variability in the carapace of the aeglid species studied (for
numbers see Fig. 1).
Figure 3. Canonical Variable Analysis (CVA) including
all aeglid species, showing the three groups sorted out by
similar carapace morphology. Each dot represents a single
individual and the colour refers to species. The 90%
confidence interval is indicated for each species. The
outlines drawn in each axis represent the gradation of form
from negative to positive values of CV.
Those results suggest the existence of a morphological pattern in aeglid carapaces.
DISCUSSION
It was demonstrated that crabs studied display carapace
shape plasticity. A great diversity of organisms
expresses phenotypical plasticity in response to biotic
and abiotic environmental factors, resulting in
variations of behavior, physiology, morphology and
growth (Karban & Baldwin, 1997; Agrawal et al.,
1999; Dewitt & Scheiner, 2004).
In this study, significant differences in carapace
shape were found between species of distinct clades
which were phylogenetically distantly-related.
Accordingly, species belonging to distinct lineages can
be more similar in carapace morphology than to ones of
closely-related species of their own clade. This
suggests that carapace morphology is not a stable
evolutionary feature within lineages. Rather, carapace
shape may reflect the phenotypical variability
associated to environment in which each species
inhabit. Also, some species can be more plastic than
others, depending on habitat characteristics, since
environmentally induced phenotypes can be favorable,
and hence selected in more dynamic environments
(Fernandes & Bichuette, 2013).
However, some stability in specific components of
carapace morphology was also identified at the species
level, suggesting that at least some parts of the carapace
morphology are conserved within each lineage, usually
the anterior portion of the carapace excluding the
rostrum, and central portions of the carapace. On the
other hand, at population level analysis, carapace shape
reflects ecological adaptations to environments where
each population lived, since populations differed in
form. The rostrum and the back end are the more plastic
portions of carapaces, and should be more subject to
environmental forcing.
The Family Aeglidae displays high morphological
variability which precludes clear-cut species recognition. A number of studies on aeglid crab carapace
morphology were carried thus far, including: the
morphological differentiation of A. neuquensis
carapace shape for isolated populations and with
populations living sympatrically with A. riolimayana
(Giri & Loy, 2008); description of interspecific
variation of carapace morphology of sympatric A.
uruguayana and A. platensis in La Plata River basin
(Giri & Collins, 2004); morphologic variation of adult
males carapaces of A. schmitti in rivers and rivulets
located on opposite sides of a mountain range in
southern Brazil (Trevisan & Masunari, 2010);
phenotypic expressions of carapace morphology of
different populations of A. araucaniensis along a river
basin in relation to territorialism over A. abtao and A.
denticulata in Chile (Barría et al., 2011); morphologic
457
variation of A. plana carapaces in three distinct river
basins in southern Brazil and morphological variability
of carapace shapes of natural and introduced
populations of A. schmitti in surface and cave rivulets
(Fernandes & Bichuette, 2013).
Intraspecific variations of carapace morphology in
different populations of given species inhabiting
different environments were reported in all the
aforementioned studies, in line with our findings. This
suggests that different environmentally-driven phenotypic expression of carapace morphology is a rule for
Aegla populations. In other words, characteristics of
rivers, streams or lakes, like current, depth, bottom
type, presence of predators or competitors can shape the
form of aeglid crabs as a local ecological adaptation.
Same species in a habitat with a different set of
characteristics can have different shape. Aeglid crabs
have small body sizes and benthic habitats. This causes
physical characteristics of rivers to be effective barriers
for them, isolating populations even in geographically
close regions (Marchiori et al., 2015). Aeglids also
have low dispersal potential, missing a larval stage in
its ontogenetic development, and strict environmental
requirements such as clear and oxygenated water
(Melo, 2003). These characteristics further increasing
the possibility of isolating the population.
Most differences found in the present study were
related to rostrum length and width, and extension of
carapace posterior half. It is difficult to establish the
relation of these body differences with the prevailing
environmental conditions in habitats of aeglid crabs,
especially without knowing in detail such conditions.
However, as shown by Giri & Loy (2008), studying the
carapace shape of A. neuquensis in presence and
absence of a competitor, it is clear that environment
promote character offsets. These authors point that
river populations have more variable cephalothorax
shape than lake populations, because river represent a
more dynamic environment. Probably for this reason,
Aegla carapace features are rarely used in traditional
identification keys (Melo, 2003). This means that the
use of geometric morphology tools may be one of the
best ways to discriminate species.
Our results suggest that there is not a single pattern
in carapace shape for each major lineage, and that local
adaptation may respond for a large extent of
morphological variation found for investigated aeglid
populations. This biogeographic effect has been
previously found for other aeglid species, implying that
specific micro-basin environmental conditions may
shape carapace morphology of different aeglid
populations (Hepp et al., 2012). Therefore, it may be
concluded that aeglid crabs have a stable part in
carapace morphology -that allowed us specific
458
recognition by the use of geometric morphology
techniques-, and a variable plastic component that
reflects environmental conditions of the water bodies in
which they inhabit.
Genetic studies are required for a better
understanding of morphological variability in carapace
shapes of aeglid species investigated in the present
study. In addition, morphological studies including
more species and clades (and maybe with fresh
specimens to avoid any possible deformation due to
preservative method), as well as detailed environmental
descriptions of water bodies where aeglid species can
be found should be pursued in order to identify the main
environmental factors responsible for distinct morphologies of aeglid crab carapace.
ACKNOWLEDGEMENTS
The authors thank Paulo Chaves and Marcelo Costa for
discussions on geometric morphometry; Odette Lopes
Lopez, curator of invertebrate collection of Capão da
Imbuia Museum of Natural History, for the aid;
Georgina Bond-Buckup for the loan of specimens from
collection of Federal University of Rio Grande do Sul;
Cassiana Baptista Metri for discussions and revision.
Unespar and Fundação Araucária supported this
publication. ARO had financial support from CAPES.
REFERENCES
Agrawal, A.A., C. Laforsch & R. Tollrian. 1999. Transgenerational induction of defenses’ in plants and
animals. Nature, 401: 60-63.
Barría, E.M., R.D. Sepúlveda & C.G. Jara. 2011.
Morphologic variation in Aegla Leach (Decapoda:
Reptantia: Aeglidae) from Central-Southern Chile:
interespecific differences, sexual dimorphism, and
spatial segregation. J. Crustacean Biol., 31(2): 231239.
Bond-Buckup, G., C.G. Jara, M.P. Losada, L. Buckup &
K.A. Crandall. 2008. Global diversity of crabs
(Aeglidae: Anomura: Decapoda) in freshwater.
Hydrobiologia, 595: 267-273.
Carroll, S.B., J.K. Grenier & S.D. Weatherbee. 2005. A
review of from DNA to diversity: molecular genetics
and the evolution of animal design. Blackwell Science,
Malden, 258 pp.
Dewitt, T.J. & S.M. Scheiner (eds.). 2004. Phenotypic
plasticity: functional and conceptual approaches.
Oxford University Press, Oxford, 272 pp.
Fernandez, C.S. & M.E. Bichuette. 2013. Shape variation
of Aegla schmitti (Crustacea, Decapoda, Aeglidae)
associated to superficial and subterranean stream
reaches. Subterranean Biol., 10: 17-24.
Giri, F. & P.A. Collins. 2004. A geometric morphometric
analysis of two sympatric species of the family
Aeglidae (Crustacea, Decapoda, Anomura) from the
La Plata Basin. Ital. J. Zool., 71: 85-88.
Giri, F. & A. Loy. 2008. Size and shape variation of two
freshwater crabs in Argentinean Patagonia: the
influence of sexual dimorphism, habitat, and species
interactions. J. Crustacean Biol., 28(1): 37-45.
Hepp, L.U., R. Fornel, R.M. Restello, A. Trevisan & S.
Santos. 2012. Intraspecific morphological variation in
a freshwater crustacean Aegla plana in southern
Brazil: effects of geographical isolation on carapace
shape. J. Crustacean Biol., 32(4): 511-518.
Jara, C.G. 1986. Aegla spectabilis, a new species of
freshwater crabs from the eastern slope of the
Nahuelbuta Cordillera, Chile. Proc. Biol. Soc. Wash.,
99: 34-41.
Karban, R. & I.T. Baldwin. 1997. Induced responses to
herbivory. University of Chicago Press, Chicago, 330
pp.
Klingerberg, C.P. 2011. Morpho: an integrated software
package for geometric morphometrics. Mol. Ecol.
Res., 11(2): 353-357.
Marchiori, A.B., R. Fornel & S. Santos. 2015. Morphometric variation in allopatric populations of Aegla
platensis (Crustacea: Decapoda: Anomura): possible
evidence for cryptic speciation. Zoomorphology, 134:
45-53.
Martin, J.W. & L.G. Abele. 1986. Phylogenetic relationships of the genus Aegla (Decapoda: Anomura:
Aeglidae), with comments on anomuran phylogeny. J.
Crustacean Biol., 6(3): 576-616.
Melo, G.A.S. 2003. Manual de identificação dos
Crustacea Decapoda de água doce do Brasil. São
Paulo, Loyola, 435 pp.
Pérez-Losada, M., G. Bond-Buckup, C.G. Jara & K.A.
Crandall. 2004. Molecular systematics and biogeography of the southern South American freshwater
“Crabs” Aegla (Decapoda: Anomura: Aeglidae) using
multiple heuristic tree search approaches. Syst. Biol.,
53(5): 767-780.
Pérez-Losada, M., G. Bond-Buckup, C.G. Jara & K.A.
Crandall. 2009. Conservation assessment of southern
South American freshwater ecoregions on the basis of
the distribution and genetic diversity of crabs from the
genus Aegla. Conserv. Biol., 23(3): 692-702.
Reis, S.F. 1988. Morfometria e estatística multivariada em
biologia evolutiva. Rev. Bras. Zool., 5(4): 571-580.
Rohlf, F.J. 2008. TPSDig2 version 2.12. [http//www.life.
bio.sunysb.edu.morph/software.html].
Rohlf, F.J. 2010. TPSUtil, utility program, version 1.46.
Department of Ecology and Evolution, State University
of New York at Stony Brook, available from
[http://life.bio.sunysb .edu/ee/rohlf /software.html].
Rohlf, F.J. & D. Slice. 1990. Extensions of the procrustes
method for the optimal superimposition of landmarks.
Syst. Biol., 39(1): 40-59.
Rongling, W., M. Chang-Xing, L. Xiang-Yang & G.
Casella. 2003. Molecular dissection of allometry,
ontogeny, and plasticity: a genomic view of
developmental biology. BioScience, 53(11): 10411047.
Santos, S., C.G. Jara, M. Bartholomei-Santos, M. PérezLosada & K.A. Crandall. 2013. New species and
records of the genus Aegla (Crustacea, Anomura,
Aeglidae) from the west-central region of Rio Grande
do Sul, Brazil. Nauplius, 21(2): 211-223.
Santos, S., G. Bond-Buckup, M. Perez-Losada, C.G. Jara,
K.A. Crandall & L. Buckup. 2010. New records and
description of a new species of Aeglidae (Crustacea:
Anomura) from river basins in Southern Brazil.
Nauplius, 18(1): 79-86.
Received: 8 July 2015; Accepted: 16 December 2015
459
Santos, S., G. Bond-Buckup, L. Buckup, M. PerezLosada, M. Finley & K.A. Crandall. 2012. Three new
species of Aegla (Anomura) freshwater crabs from the
upper Uruguay River hydrographic basin in Brazil. J.
Crustacean Biol., 32(4): 529-540.
Schlichting, C.D. 1986. The evolution of phenotypic
plasticity in plants. Ann. Rev. Ecol. Syst., 17: 667-693.
Trevisan, A. & S. Masunari. 2010. Geographical
distribution of Aegla schmitti Hobbs III, 1979
(Decapoda, Anomura, Aeglidae) and morphometric
variations in male populations fron Paraná State,
Brazil. Nauplius, 18(1): 45-55.
Zelditch, M.L., D.L. Swiderski, H.D. Sheets & W.L. Fink.
2004. Geometric morphometries for biologists - a
primer. Elsevier Academic Press, Boston, 443 pp.
Lat. Am. J. Aquat. Res., 44(3): 460-469, 2016
Eyeless morphotype in Dasyatis americana
4601
Research Article
Eyeless morphotype in the southern stingray (Dasyatis americana): a non-lethal
and frequent abnormality from the southern Gulf of Mexico
Manuel Mendoza-Carranza1, Diego Santiago-Alarcón2
Juan Carlos Pérez-Jiménez3 & Chrystian Carolina Hernández-Lazo1
1
El Colegio de la Frontera Sur, Manejo Sustentable de Cuencas y Zonas Costeras
Villahermosa, 86280, Tabasco, México
2
Red de Biología y Conservación de Vertebrados, Instituto de Ecología, A.C. 91070, México
3
El Colegio de la Frontera Sur, Adaptación humana y manejo de recursos en ecosistemas
Tropicales, Lerma Campeche, Campeche, México
Corresponding author: Manuel Mendoza-Carranza (mcarranza@ecosur.mx)
ABSTRACT. Elasmobranchs are active predators that depend on a highly developed visual system. The eyes
of the southern stingray, Dasyatis americana, are adapted to a changing light environment in coastal zones. In
this study we use morphological characters and molecular methods (mtDNA COI) to describe an eyeless
morphotype of D. americana from six individuals collected from commercial small-scale fisheries on the
Campeche Bank (southern Gulf of Mexico). Additionally to the eyeless characteristic, both regular (presence of
eye) and eyeless (absence of eye) morphotypes have contrasting quantitative values and qualitative features for
different phenotypic traits (color, teeth number, pelvic fin and spiracle form). Mature female and male eyeless
morphotype had functional internal reproductive structures. Using the bar code gene, we found conclusive
evidence that the eyeless morphotype belongs to the species D. americana. This is the first report
on reproductively functional eyeless individuals of this species or close relatives elsewhere, which live
sympatrically with regular D. americana individuals in the southern Gulf of Mexico.
Keywords: Dasyatidae, mutation, visual-sense, barcodingene, Campeche Bank, Gulf of Mexico.
Un morfotipo sin ojos de la raya látigo americana (Dasyatis americana): una
anormalidad frecuente pero no letal en el sur del Golfo de México
RESUMEN. Los elasmobranquios son depredadores activos que dependen de un sistema visual bien
desarrollado. Los ojos de la raya látigo americana, Dasyatis americana, están adaptados a intensidades de luz
variables en zonas costeras. En este estudio se utilizan caracteres morfológicos y métodos moleculares (ADNmt
COI) para describir el hallazgo de un morfotipo con ausencia de ojos en la raya D. americana, en un área costera
marina tropical. La descripción está basada en seis ejemplares sin ojos colectados a partir de muestreos de flotas
de pesca de pequeña escala que operan en el Banco de Campeche al sur del Golfo de México. Mediante
comparación de las diferentes características fenotípicas (color, número de dientes, forma de la aleta pélvica y
de los espiráculos) entre los morfotipos sin ojos y los morfotipos regulares, se encontraron diferencias
contrastantes. Tanto los machos como hembras de los morfotipos sin ojos presentaron órganos reproductivos
internos completos y funcionales. Utilizando los resultados obtenidos a través de análisis genéticos provenientes
del código de barras genético, se confirma que los individuos sin ojos pertenecen a D. americana. Este es el
primer reporte de individuos sin ojos de D. americana o de especies cercanas que son reproductivamente
funcionales, y que viven simpátricamente con individuos de D. americana de morfotipo regular en el sur del
Golfo de México.
Palabras clave: Dasyatidae, mutación, sentido de la vista, código de barras genético, Banco de Campeche,
Golfo de México.
__________________
Corresponding editor: Guido Plaza
2461
INTRODUCTION
The ecological role of elasmobranchs as top predators
depends on some relevant adaptations to environments
in which they occur (Jordan et al., 2013). Since
elasmobranchs are active predators, most of them
depend on a highly developed visual system (Creel &
Christianson, 2008; Heithaus et al., 2008). Furthermore,
their electroreception and chemoreception systems are
fundamental to locate and capture prey. For benthic
rays these senses are also used to avoid being predated
(Hueter et al., 2004). Elasmobranchs have adapted to
live in a variety of marine and freshwater habitats (e.g.,
estuaries and rivers (from cold temperate to tropical
waters), coral reefs and mesopelagic (200-1000 m) and
bathypelagic (1000-4000 m) zones, (Compagno, 1984,
1990). Given their ecological diversity, the eyes of
cartilaginous fishes show particular adaptations to the
light environment in which they live, as well as to their
preferred feeding strategies and predator avoidance
behaviors (Hueter et al., 2004; Lisney & Collin, 2007;
Lisney et al., 2012).
Habitat use has been associated to variable eye size
and type (Lisney & Collin, 2007; Lisney et al., 2012).
In comparison to the large eyes of oceanic and deep-sea
elasmobranchs, eyes of those elasmobranchs inhabiting
coastal benthic environments are commonly small or
medium-size in relation to body size (Lisney & Collin,
2007). The high concentration of plankton and
suspended organic and inorganic matter in shallow
coastal environments can obscure visual stimuli (Kirk,
1979; Bowmaker, 1995), and so coastal species may
rely more heavily on their non-visual senses (e.g.,
electroreception) (Raschi et al., 2001).
The eyes of the southern stingray Dasyatis
americana Hildebrand & Schroeder, 1928 (dorsally
positioned) are adapted to a changing light environment
in coastal zones, where seasonal changes in water
transparency are common due to seasonal variations in
nutrient and sediment input from rivers (Hueter et al.,
2004; Litherland et al., 2009; Lisney et al., 2012).
Additionally, vision and eye position of D. sabina
(Lesueur, 1824), a species related to D. americana, has
been shown to be beneficial in turbid shallow coastal
waters to avoid predation (McComb & Kajiura, 2008).
Moreover, this advantage is complemented with some
other behavioral strategies such as vigilance groups; in
Pastinachus sephen vigilance groups of three stingrays
are formed arranged in a rosette form increasing the
predator detection capabilities (Semeniuk & Dill,
2005). Elasmobranchs with small-eyes or eyeless are
very uncommon in nature and they have been reported
in only two deep-sea genera worldwide: Benthobatis
and Typhlonarke, both having degenerated eyes
covered by skin (Gruber, 1977; Locket, 1977) or
“almost non-existent” eyes (De Carvalho et al., 2003;
Lisney & Collin, 2007).
Here, we present a description of an eyeless
morphotype of the southern stingray based on six
specimens caught by the coastal small-scale fishery of
the southern Gulf of Mexico, collected during sampling
surveys at the San Pedro and Chiltepec ports in
Tabasco, Mexico (Fig. 1). Since eyeless organisms
presented several morphological differences, we
studied the possibility of a new species. In order to test
this hypothesis, we then used a fragment of the mtDNA
COI gene to explore the genetic similarity of the
referred eyeless morphotype with that of the regular
morphotype of the southern stingray.
Sampling process
Eyeless and regular southern stingrays were obtained
from commercial catches of the small-scale fleet from
San Pedro and Chiltepec ports, Tabasco (Fig. 1). The
fishing area of San Pedro and Chiltepec ports smallscale fleets are located on the Campeche Bank
(18º40'38"-19º05'25"N and 92º27'07"-92º05'11"W)
covering an area of 532 km2 (Fig. 1). Stingrays were
captured with bottom long-lines with tuna circle hooks
of 60 mm shank length. Catch depth ranged from 10 to
40 m. The southern stingray occurrence in this
multispecies fishery at Campeche Bank is common
throughout the year (Ramírez-Mosqueda et al., 2012).
All the stingrays used were not killed specifically
for this study; specimens are part of the commercial
catch of the artisanal anglers of San Pedro Port,
Tabasco, Mexico. Specimen and tissue collections were
under the consideration and approval of the commercial
exploitation union of San Pedro and Chiltepec ports.
Furthermore, eyeless individuals were deposited in the
ECOSUR scientific fish collection of San Cristóbal de
las Casas, Chiapas (ECOSC), under collection permit
number DGOPA.04543.060711.1761 issued by
SAGARPA (The Secretariat of Agriculture, Livestock,
Rural Development, Fisheries and Food of the Mexican
Government).
Morphology
Morphometric and morphological description of
eyeless stingrays were based on six specimens. The first
eyeless individual observed, but not collected, was a
mature male coming from catches of the small-scale
fishery fleet of Chiltepec Port, Paraíso, Tabasco on
April 2008. Subsequently, three females and two males
(one mature and one immature) were collected at San
462
3
N
Figure 1. Fishing area on the Campeche Bank (the southern Gulf of Mexico) where eyeless specimens of the southern
stingray Dasyatis americana were caught. Light-grey polygon indicates fishing area of the small-scale fleet from San Pedro
Port. The inset indicates the location of Tabasco State in Mexico, and the limit (dashed line) of the Campeche Bank.
Pedro Port, Centla, Tabasco on March 2012 and
October 2012. Characteristics of regular individuals
were based on the description of McEachran & de
Carvalho (2002). Additionally, we used morphometric
characteristics of 76 regular D. americana (i.e., with
eyes) individuals (24 females, 44 males) captured
during fishery sampling surveys from 2008 to 2012.
Disc width (DW), snout length (SL), pelvic fin length
(PL), mouth width (MW), spiracle diameter (SD) and,
in the case of males, the clasper length (CL) was
obtained; all measurements are reported in centimeters.
The number of rows of the upper jaw of four eyeless
individuals and 16 regular individuals of similar sizes
were counted (McEachran & de Carvalho, 2002).
Additionally, the morphological features (form and
size) of the pelvic fin, nasal curtain, spiracles form, and
the color of the ventral and dorsal sides of the body
were recorded. The morphometric data of eyeless and
regular individuals were compared using the DW/SL,
DW/PL, and DW/MW ratios. The non-parametric
Mann-Whitney U test (Zar, 2010) was used for comparisons between morphotypes.
Molecular laboratory methods
Small pieces (5-10 g) of muscle tissue from three
eyeless female rays and two regular males and two
regular females of D. americana individuals were
collected. Samples were placed in 100% ethanol. To
avoid DNA contamination, all tools were flamesterilized before sampling each specimen. Each eyeless
stingray was collected as a reference voucher specimen
and deposited in the Fish Collection of El Colegio de la
Frontera Sur, San Cristóbal de las Casas (ECOSC 7411,
7412, 7413).
4463
Sequence analysis was carried out at the Canadian
Centre for DNA Barcoding by using standard protocols
(Hajibabaei et al., 2005). DNA was extracted from 1
mm3 tissue plugs that were placed in vertebrate lysis
buffer with proteinase K and digested overnight at
56ºC. Genomic DNA was subsequently extracted using
a membrane-based approach on the Biomek FX
(Biomek FX, Brea, California, USA) liquid handling
station and AcroPrep 96 (AcroPrep 96, Pall Co., Port
Washington, New York, USA) filter plates with 1.0
mM PALL glass-fibre media (Ivanova et al., 2006). A
652-658bp segment of COI was amplified with
different fish primers, including FishF1, FishR1,
FishF2, FishR2 (Ward et al., 2009) or an M13-tailed
fish-primer cocktail (Ivanova et al., 2007).
PCR reaction mixes of 12.5 µL, which included:
6.25 µL of 10 percent trehalose, 2 µL of ultrapure
water, 1.25 µL of 10 PCR buffer, 0.625 µL of MgCl2
(50 mM), 0.125 µL of each primer (0.01 mM), 0.0625
µL of dNTP mix (10 mM), 0.625 µL of Taq polymerase
(New England Biolabs, Ipswich, Massachusetts, USA
or Invitrogen, Carlsbad, California, USA), and 2.0 µL
of DNA template. Amplification protocols followed
those described in Hajibabaei et al. (2005). PCR
products were visualized on agarose gels (Invitrogen)
and positive samples were selected for sequencing.
Products were labeled by using the Big Dye Terminator
v.3.1 cycle sequencing kit (Applied Biosystems,
Carlsbad, USA) as described in Hajibabaei et al.
(2005). Forward and reverse strands were sequenced
with an ABI 3730 capillary sequencer (ABI, Carlsbad,
USA), following manufacturers protocol. Sequences
were aligned using SEQSCAPE v.2.1.1 software
(Applied Biosystems). Sequence data, electropherograms, trace files, primer details, photographs, and
collection localities for specimens are available from
http:// www.barcodinglife.org. Sequence accession
numbers from bold systems v3 are eyeless (MXV51712, MXV518-12, MXV519-12) and regular (MXV51312, MXV514-12, MXV515-12, MXV520-12).
Phylogenetic analysis
Phylogenetic hypotheses were constructed using the
program Mr. Bayes v3.1.2 (Huelsenbeck & Ronquist,
2001). Two independent runs were conducted, with 4
chains in each run for a total of 2.5 million generations,
sampling every 100 generations. The first 12,500 trees
(50%) were discarded as the ‘burn-in’. In total, 12,500
trees from each run were used to build our majority-rule
consensus tree. For the analyses, a TPM2uf+I+G model
of molecular evolution was used as suggested by
jModelTest2.1.2 (Guindon & Gascuel, 2003; Darriba et
al., 2012) with shape parameter α = 2.176 and
proportion of invariable sites Pinvar = 0.625 as
calculated with the j-Model Test. To implement the
TPM2uf model in Mr. Bayes, the next more complex
available mode (GTR) was used as recommended in the
user´s manual. The different parameters (gamma shape
parameter, proportion of invariable sites, nucleotide
frequencies, and nucleotide substitution rates) were
fixed according to the values calculated with the jModel Test. Sequence divergence between the different
haplotypes was calculated using both the Jukes-Cantor
(substitutions weighed equally) and the Tamura-3
parameter (substitutions, shape parameter, and proportion of invariable sites as calculated with j-Model Test)
models of substitution that were implemented in the
program MEGA v5.1 (Tamura et al., 2011).
RESULTS
Morphology
The morphological traits between the regular and
eyeless morphotypes of southern stingrays were
different (Table 1). Besides the absence of eyes (Table
1, Figs. 2a-2b), other differences that existed between
these two morphotypes were the spiracle form and size,
in eyeless individuals spiracle is rounded and slightly
dorsoventrally depressed, whereas in the regular
individuals spiracle is like a rectangle and relatively
bigger than in eyeless morphotypes (Figs. 2a-2b). The
body color, in eyeless stingrays is spotted grey-black on
the ventral edge and the dorsal color is darker [brown,
green, olive] compared to the regular morphotype
(Table 1, Figs. 2c-2f). Nasal curtain of eyeless
specimens is short, not fleshy and limited to the upper
border of the mouth (Figs. 2c-2d). Pelvic fin shape in
eyeless female is rounded, small, and oriented to the
sides of the body, whereas in regular female stingrays,
the pelvic fin is trapezoid, larger, and oriented towards
the anteroposterior axis (Table 1, Figs. 2e-2h). There
are no marked differences between regular and eyeless
male individuals in the form of the pelvic fin.
The sizes of eyeless females were 57, 58, and 73 cm
DW, respectively, the sizes of eyeless mature males
were 64 and 73 cm DW, respectively, and the size of
the eyeless immature male was 63 cm DW. No
significant morphometric differences were observed
between regular and eyeless stingrays (Table 1). To
avoid damage to all collected specimens, we dissected
only the biggest male (73 cm DW) and female (73 cm
DW) of eyeless specimens to examine the internal
reproductive organs. Both mature eyeless male and
female had functional internal reproductive structures.
In the mature male, a pair of well-developed testis was
observed. Uterine trophonemata in the female were
abundant and long (approx. 1 cm) indicating a possible
4645
Table 1. Morphological traits for both Dasyatis americana regular and eyeless morphotypes. Size of proportions is cm.
*Data based on McEachran & de Carvalho (2002) description.
Trait
Eyes
Dorsal color
Ventral color
Snout
Nasal curtain
Pelvic fin females
Pelvic fin males
Size range
Pelvic fin length/disc width (%)
Mouth width/disc width (%)
Preoral length/disc width (%)
Snout angle
Rows number in upper jaw
Dasyatis americana
(n = 68)
Present, prominent
Light brown, olive and grey*(Our data)
Completely white, occasionally with lightgrey margins
Barely projecting* (Our data)
Fleshy, covering the upper jaw, sometimes
all the mouth
Trapezoid, anteroposterior orientation
46-97
10.00-20.91
5.67-10.53
15.28-23.52
135º*
120º-146º
39-48
Eyeless Dasyatis americana
(n = 6)
Absent
Dark green, brown and olive
White with gray-black band and spots at the
borders, except in the posterior side of disc
Not projecting
Not fleshy, not reaching the upper border of the
upper jaw
Rounded, lateral orientation
57-73
13.70-20.79
8.77-9.59
18.13-20.34
118º-130º
45-53
Figure 2. Morphological characteristic of eyeless and regular (normal) southern stingrays, Dasyatis americana, caught on
the Campeche Bank (southern Gulf of Mexico). a) eyeless, and b) eye detail of a normal individual; nasal curtain of
c) eyeless, and d) normal individual, pelvic fins of e) eyeless, and f) normal female; pelvic fins and claspers of g) eyeless,
and h) normal males.
465
6
previous gestation cycle. The largest oocyte was 19 cm
in diameter. No embryos were observed.
Phylogenetic analysis
Based on phylogenetic analysis, sequences from the
eyeless morphotype (Fig. 3) are nested within the same
clade as those sequences deriving from the regular
morphotype, indicating that they belong to the same
species (D. americana). There is a small genetic
divergence, however, between the two morphotypes
that ranges from 0.3 to 0.5 percent based on both JukesCantor and Tamura-3-parameter models. The Bayesian
majority-rule consensus phylogram indicates that COI
sequences from D. americana form a monophyletic
clade (Fig. 3).
DISCUSSION
In this study, we identified two genetic haplotypes
belonging to the species D. americana based on the bar
code gene COI. These two haplotypes correspond to
morphologically different specimens of the southern
stingray, one haplotype has functional eyes and the
other is eyeless. Eyeless specimens had fully functional
internal and external reproductive organs, indicating
that they can reproduce in nature; lack of eyes should
be rather an adaptation to low light environments (see
below). Minor abnormalities apparently do not affect
biological functions of individuals compared to major
changes commonly found in embryos, which possibly
may not survive once they are born (Devadoss, 1983;
Mnasri et al., 2010; Mejía-Falla et al., 2011). In
reference to ecologically functional “minor” changes
for D. americana, a higher teeth number and a darker
dorsal color in eyeless specimens compared to regular
individuals were recorded. During a period of six years,
the eyeless morphotype of D. americana was more
frequent than other abnormalities recorded for this
species. In our study area, only one other minor
abnormality was recorded, an albino female of D.
americana (82 cm DW) on November 2012 (Fig. 4);
two occurrence of albinism of this same species have
been reported in Palmico Sound, North Carolina
(Schwartz & Safrit, 1977) and in Tabasco, Mexico
coast (Wakida-Kusunoki, 2015).
Implications of abnormalities for the individuals
and populations are poorly understood (Capapé et al.,
2012). Origin and frequency of such abnormalities have
been attributed to several factors, including genetic
alterations, parasitic infection, tumors, predation, or
water pollution (Orlov, 2011; Rubio-Rodríguez et al.,
2011). Pollution in the Campeche back is due to crude
oil extraction (García-Cuéllar et al., 2004; WakidaKusunoki & Caballero-Chávez, 2009). One of the
world's most intense and biggest oil spills occurred in
this area, the 1979 Ixtoc oil spill. It produced a strong
and longtime environmental impact in a wide area of
the coastal marine environments of the Mexican Gulf
of Mexico (Jernelöv & Lindén, 1981), in particular the
benthic environment (Teal & Howarth, 1984), to which
D. americana is strongly associated. Despite the acute
toxicity of these events to aquatic life, the effects may
be related to multigenerational toxicant-induced
heritable mutations as presented in this research
(Cronin & Bickham, 1998). However, other possibility
is a mutation in some regulatory gene that produces
eyeless individuals in D. americana of the Campeche
Bank (Ravi & Venkatesh, 2008). We suggest that such
a mutation has no deleterious effect on these
individuals because the high turbidity of the water
makes vision a less important sense; in addition, the
well developed and functional reproductive organs
reported in this study indicate successful offspring
production.
It is important to highlight that almost all reports on
abnormalities in rays and sharks derive from one or
maximum two individuals, and usually such
abnormalities are fatal to the carriers, for example in
Amblyraja doellojuradoi (Pozzi & Bordalé, 1935),
Urotrygon rogersi (Jordan & Starks, 1895) and
Dasyatis guttata (Bloch & Schneider, 1801) (MejíaFalla et al., 2011; Ramirez-Hernandez et al., 2011;
Delpiani et al., 2012). This indicates that abnormalities
in the studied population of southern stingrays have a
higher prevalence compared to other elasmobranch
populations and apparently do not have detrimental
effects on fitness.
The study area has waters with low transparency
due to the high productivity levels of this region
generated by the strong seasonal freshwater runoff from
the Grijalva-Usumacinta basin (Monreal-Gómez et al.,
2004; Lara-Lara et al., 2008) and due to the proximity
to the Campeche canyon and the Campeche Bank,
where the influence of an important upwelling has been
observed (Zavala-Hidalgo et al., 2006). Despite the
well-adapted eyes of D. americana (dorsally positioned) to low light level environments (Hueter et al.,
2004; Litherland et al., 2009; Lisney et al., 2012), it is
known that the visual sense in elasmobranchs is
complemented by other senses such as electroreception
and chemoreception (Kotrschal et al., 1998; Lisney &
Collin, 2007). Hence, because vision may not play an
important role in prey detection by benthic
elasmobranchs (Warrant & Locket, 2004; McComb &
Kajiura, 2008), we can hypothesize that in an
environment with low levels of light as the southern
Campeche Bank, eyeless do not constitute a
disadvantage because southern stingrays can use
multiple sensory strategies (Raschi, 1986).
4667
Figure 3. Bayesian majority-rule consensus phylogram of mitochondrial DNA Cytochrome Oxydase I (mt DNA COI) bar
code gene of stingrays (Rajiformes). 650 bp of the mtDNA COI bar code gene were used. Support values on branches are
Bayesian posterior probabilities. Sequences include species name from which it derives, followed by its geographic location
and GenBankTM accession number. Sequences from Dasyatis americana are in bold font and sequences from eyeless D.
americana are highlighted in the gray-shaded square. Sequences from Myliobatis ridens Ruocco, Lucifora, Díaz de
Astarloa, Mabragaña & Delpiani, 2012 (Myliobatidae), Gymnura mycrura (Bloch & Schneider, 1801) (Gymnuridae),
Himantura gerrardi (Gray, 1851) and Urobatis jamaicensis (Cuvier, 1816) (Urotrygonidae) were used as outgroups to root
the phylogeny. AR: Argentina, MX: Mexico, SA: South Africa, IT: Italy, USA: United States of America, JAP: Japan,
AUS: Australia, CH: China, BRA: Brazil, QR: Quintana Roo, CA: California, AL: Alabama, TAB: Tabasco, ATL: Atlantic
Ocean, GMx: Gulf of Mexico. Scale indicates percentage sequence divergence among haplotypes.
Figure 4. Albino female of the southern stingray Dasyatis
americana (82 cm disc width).
We performed informal interviews with fishermen
of adjacent fishery areas of Seybaplaya, Campeche and
Magallanes ports in Tabasco (at the northeast and west
of our study area respectively) to know about possible
occurrences of eyeless stingrays. Fishermen at these
locations affirm that eyeless stingrays have not been
observed. In fact, the higher capture volumes of this
species are concentrated in the San Pedro and Frontera
ports (Ramírez-Mosqueda et al., 2012). Additionally,
no reports about eyeless individuals of this species or
close relatives have been published elsewhere. Thus,
we suggest that the distribution of eyeless southern
stingrays is restricted to a small area comprising the
southern Campeche Bank that might be also associated
with the deep waters of the Campeche Canyon (10003200 m depth). The isolated distribution of eyeless
southern stingray could be related with a philopatric
behavior observed in elasmobranchs (Hueter et al.,
2005), such behavior has been suggested for D.
brevicaudata (Hutton, 1875) (Le Port & Lavery, 2012)
and D. akajei (Müller & Henle, 1841) (Li et al., 2013).
Moreover, this potential philopatric behavior in eyeless
individuals could be related to the genetic divergence
observed between eyeless and regular individuals of the
southern stingray (Duncan et al., 2006). Thus, we
suggest that a combination of environmental (e.g., low
transparency waters) and genetic factors (e.g., genes
controlling philopatric behavior) is responsible for the
evolution of an eyeless population of D. americana in
the southern Gulf of Mexico.
8467
ACKNOWLEDGEMENTS
We are grateful to the Mexican Barcode of Life
(MEXBOL) network (particularly the Chetumal Node)
through the National Laboratory for the Barcodes
(technical support A. Martínez Arce). Sequencing was
supported by funding from the Government of Canada
through Genome Canada and the Ontario Genomics
Institute in support of the International Barcode of Life
Project. Thanks to Diego Rodríguez for his help during
sampling. This research was funded by CONACYT Tabasco State Government and ECOSUR (FOMIXTabasco), project number: 120931. Thanks to the
Aquaculture and Fishery Department of the
Wageningen University for the support in the final
stage of this research, and to CONACYT for a
sabbatical grant awarded to MMC (first author). The
comments and suggestions of anonymous referees have
improved the quality of the paper.
REFERENCES
Bowmaker, J.K. 1995. The visual pigments of fish. Prog.
Retin. Eye Res., 15(1): 1-31.
Capapé, C., O.E. Kamel-Moutalibi, N. Mnasri, M. Boumaiza
& C. Reynaud. 2012. A Case of hermaphroditism in
Tortonese's stingray, Dasyatis tortonesei (Elasmobranchii: Rajiformes: Dasyatidae) from the Lagoon of
Bizerte, Tunisia. Acta Ichthyol. Pisc., 42(2): 141-149.
Compagno, L.V.J., 1984. FAO species catalogue. Vol. 4.
Sharks of the world. An annotated and illustrated
catalogue of sharks species known to date. Part 1.
Hexanchiformes to Lamniformes. FAO Fish Synop.,
125(4): 249 pp.
Compagno, L.J.V. 1990. Alternative life-history styles of
cartilaginous fishes in time and space. Environ. Biol.
Fish, 28: 33-75.
Creel, S. & D. Christianson. 2008. Relationships between
direct predation and risk effects. Trends Ecol. Evol.,
23(4): 194-201.
Cronin, M.A. & J.W. Bickham. 1998. A population
genetic analysis of the potential for a crude oil spill to
induce heritable mutations and impact natural
populations. Ecotoxicology, 7(5): 259-278.
Darriba, D., G.L. Taboada, R. Doallo & D. Posada. 2012.
jModelTest 2: more models, new heuristics and
parallel computing. Nat. Methods, 9(8): 772-772.
De Carvalho, M.R., L.J.V. Compagno & D.A. Ebert.
2003. Benthobatis yangi, a new species of blind
electric ray from Taiwan (Chondrichthyes: Torpediniformes: Narcinidae). Bull. Mar. Sci., 72(3): 923-939.
Delpiani, G., D.E. Figueroa & E. Mabragaña. 2012.
Anomalías dentarias de la raya erizo Amblyraja
doellojuradoi (Chondrichthyes, Rajidae). Rev. Biol.
Mar. Oceanogr., 47(1): 135-140.
Devadoss, P. 1983. On some specimens of abnormal
elasmobranchs. Matsya, 9: 486-488.
Duncan, K.M., A.P. Martin, B.W. Bowen & H.G. De
Couet. 2006. Global phylogeography of the scalloped
hammerhead shark (Sphyrna lewini). Mol. Ecol.,
15(8): 2239-2251.
García-Cuellar, J.A., F. Arreguín-Sánchez, S. HernándezVázquez & D.B. Lluch-Cota. 2004. Impacto ecológico
de la industria petrolera en la Sonda de Campeche,
México, tras tres décadas de actividad: una revisión.
Interciencia, 29(6): 311-319.
Gruber, S. 1977. The visual system of sharks: adaptations
and capability. Am. Zool., 17(2): 453-469.
Guindon, S. & O. Gascuel. 2003. A simple, fast, and
accurate algorithm to estimate large phylogenies by
maximum likelihood. Syst. Biol., 52(5): 696-704.
Hajibabaei, M., N.V. Ivanova, S. Ratnasingham, R.T.
Dooh, S.L. Kirk, P.M. Mackie & P.D.N. Hebert. 2005.
Critical factors for assembling a high volume of DNA
barcodes. Philos. T. R. Soc. Lond. B, 360(1462): 19591967.
Heithaus, M.R., A. Frid, A.J. Wirsing & B. Worm. 2008.
Predicting ecological consequences of marine top
predator declines. Trends Ecol. Evol., 23(4): 202.
Huelsenbeck, J.P. & F. Ronquist. 2001. MRBAYES:
bayesian inference of phylogenetic trees. Bioinformatics, 17(8): 754-755.
Hueter, R.E., M.R. Heupel, E.J. Heist & D.B. Keeney.
2005. Evidence of philopatry in sharks and
implications for the management of shark fisheries. J.
Northwest. Atl. Fish. Sci., 35: 239-247.
Hueter, R.E., D.A. Mann, K.P. Maruska, J.A. Sisneros &
L.S. Demski. 2004. Sensory biology of elasmobranchs.
In: J.C. Carrier, J.A. Musick & M.R.Heithaus (eds.).
Biology of sharks and their relatives. CRC Marine
Biology Series, Boca Raton, pp. 325-368.
Ivanova, N.V., J.R. Dewaard & P.D.N. Hebert. 2006. An
inexpensive, automation‐friendly protocol for recovering high‐quality DNA. Mol. Ecol. Notes, 6(4):
998-1002.
Ivanova, N.V., T.S. Zemlak, R.H. Hanner & P.D.N.
Hebert. 2007. Universal primer cocktails for fish DNA
barcoding. Mol. Ecol. Notes, 7(4): 544-548.
Jernelöv, A. & O. Lindén, 1981. Ixtoc I: case study of the
world's large oil spill. Ambio, 10(6): 299-306.
Jordan, L.K., J.W. Mandelman, D.M. McComb, S.V.
Fordham, J.K. Carlson & T.B. Werner. 2013. Linking
sensory biology and fisheries bycatch reduction in
elasmobranch fishes: a review with new directions for
research. Conserv. Physiol., 1(1): cot002. doi:10.1093/
conphys/cot002.
Kirk, J.T.O. 1979. Spectral distribution of photosynthetically active radiation in some south-eastern
Australian waters. Mar. Freshwater Res., 30(1): 81-91.
Kotrschal, K., M.J. Van Staaden, R. Huber. 1998. Fish
brains: evolution and environmental relationships.
Rev. Fish Biol. Fish., 8(4): 373-408.
Lara-Lara, J.R., V.A. Fuentes, C.B. Guzmán, V.C. Díaz,
E.S. Escobar, M.C.E. García, G.C. Gaxiola, G.J.
Robles, R.A. Sosa, L.A.G. Soto, M.G. Tapia & J.E.
Valdez-Holguín. 2008. Los ecosistemas marinos.
Capital natural de México. CONABIO, México D.F.,
pp. 135-159.
Le Port, A. & S. Lavery. 2012. Population structure and
phylogeography of the short-tailed stingray, Dasyatis
brevicaudata (Hutton, 1875), in the southern hemisphere. J. Hered., 103(2): 174-185.
Li, N., N. Song, G.-P. Cheng & T.-X. Gao. 2013. Genetic
diversity and population structure of the red stingray,
Dasyatis akajei inferred by AFLP marker. Biochem.
Syst. Ecol., 51: 130-137.
Lisney, T.J. & S.P. Collin. 2007. Relative eye size in
elasmobranchs. Brain Behav. Evolut., 69(4): 266-279.
Lisney, T.J., S.M. Theiss, S.P. Collin & N.S. Hart. 2012.
Vision in elasmobranchs and their relatives: 21st
century advances. J. Fish Biol., 80: 2024-2054.
Litherland, L., S.P. Collin & K.A. Fritsches. 2009. Visual
optics and ecomorphology of the growing shark eye: a
comparison between deep and shallow water species.
J. Exp. Biol., 212(21): 3583-3594.
Locket, N.A. 1977. Adaptations to the deep-sea environment. In: F. Cresitelli (ed.). Handbook of sensory
physiology. Vol. 7, Springer-Verlag, Berlin, pp. 67192.
McComb, D.M. & S.M. Kajiura. 2008. Visual fields of
four batoid fishes: a comparative study. J. Exp. Biol.,
211(4): 482-490.
McEachran, J.D. & M.R. de Carvalho. 2002. Batoid
fishes. In: K.E. Carpenter (ed.). The living marine
resources of the Western Central Atlantic. Vol. 1.
Introduction, molluks, crustaceans, hagfishes, sharks,
batoid fishes and chimaeras. FAO Species identification guide for fisheries purposes, Rome, pp. 508589.
Mejía-Falla, P.A., A.F. Navia & L.A. Muñoz. 2011. First
record of morphological abnormality in embryos of
Urotrygon rogersi (Jordan & Starks, 1895)
(Myliobatiformes: Urotrygonidae) in the Tropical
Eastern Pacific. Lat. Am. J. Aquat. Res., 39(1): 184188.
Mnasri, N., O. El Kamel, M. Boumaïza, M.M. Ben Amor,
C. Reynaud & C. Capapé. 2010. Morphological
abnormalities in two batoid species (Chondrichthyes)
from northern Tunisian waters (central Mediterranean). Ann. Ser. Hist. Nat., 20: 181-190.
468
9
Monreal-Gómez, M.A., D.A. Salas-de-León, H. VelascoMendoza, M. Caso, I. Pisanty & E. Ezcurra. 2004. La
hidrodinámica del Golfo de México. In: M. Caso, I.
Pisanti & E. Ezcurra (eds.). Diagnóstico ambiental del
Golfo de México. Instituto Nacional de Ecología,
SEMARNAT, México D.F., 1: 47-68.
Orlov, A.M. 2011. Record of a tailless Richardson’s ray
Bathyraja richardsoni (Garrick, 1961) (Rajiformes:
Arhynchobatidae) caught off the Mid-Atlantic ridge.
Pan-Am. J. Aquat. Sci., 6(3): 232-236.
Ramirez-Hernandez, A., P. Palacios-Barreto, J.D. GaitanEspitia, F. Reyes & J. Ramirez. 2011. Morphological
abnormality in the longnose stingray Dasyatis guttata
(Myliobatiformes: Dasyatidae) in the Colombian
Caribbean. Cybium, 35(1): 79-80.
Ramírez-Mosqueda, E., J.C. Pérez-Jiménez & M.
Mendoza-Carranza. 2012. Reproductive parameters of
the southern stingray Dasyatis americana in southern
Gulf of Mexico. Lat. Am. J. Aquat. Res., 40(2): 335344.
Raschi, W. 1986. A morphological analysis of the
ampullae of Lorenzini in selected skates (Pisces,
Rajoidei). J. Morphol., 189(3): 225-247.
Raschi, W.C., C. Aadlond & E.D. Keithar. 2001. A
morphological and functional anaysis of the ampullae
of Lorenzini in geleod sharks. In: B.G. Kapoor & T.J.
Hara (eds.). Sensory biology of jawed ishes: new
insights. Science Publishers, Enfield, pp. 279-316.
Ravi, V. & B. Venkatesh. 2008. Rapidly evolving fish
genomes and teleost diversity. Curr. Opin. Genet.
Dev., 18(6): 544-550.
Rubio-Rodríguez, U., J.A. Navarro-González & F.J.
Vergara-Solana. 2011. First record of black mucus and
ocular malformations in the round stingray Urobatis
halleri (Rajiformes: Urotrygonidae) at the southern
Gulf of California, Mexico. Mar. Biodivers. Rec., 3: 13.
Schwartz, F.J. & G.W. Safrit. 1977. A white southern
stingray, Dasyatis americana (Pisces, Dasyatidae),
from Pamlico Sound, North Carolina. Chesapeake
Sci., 18(1): 83-84.
Semeniuk, C.A.D. & L.M. Dill. 2005. Cost/benefit
analysis of group and solitary resting in the cowtail
stingray, Pastinachus sephen. Behav. Ecol., 16(2):
417-426.
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei
& S. Kumar. 2011. MEGA5: molecular evolutionary
genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony
methods. Mol. Biol. Evol., 28(10): 2731-2739.
Teal, J.M. & R.W. Howarth. 1984. Oil spill studies: a
review of ecological effects. Environ. Manage., 8(1):
27-43.
469
10
Wakida-Kusunoki, A.T. 2015. Primer reporte de
albinismo total en la raya Dasyatis americana. Rev.
Biol. Mar. Oceanogr., 50(1): 135-139.
Wakida-Kusunoki, A.T. & V. Caballero-Chávez. 2009.
Efectos del derrame de hidrocarburos del pozo Kab
sobre la pesca ribereña en el litoral de Campeche y
Tabasco, México. Cienc. Pesq., 17(1): 66.
Ward, R.D., R. Hanner & P.D.N. Hebert. 2009. The
campaign to DNA barcode all fishes, FISH‐BOL. J.
Fish Biol., 74(2): 329-356.
Received: 22 April 2015; Accepted: 15 January 2016
Warrant, E.J. & N.A. Locket. 2004. Vision in the deep sea.
Biol. Rev., 79(3): 671-712.
Zar, J.H. 2010. Biostatistical analysis. Prentice-Hall,
Englewood Cliffs, 944 pp.
Zavala-Hidalgo, J., A. Gallegos-García, B. MartínezLópez, S.L. Morey & J.J. O’Brien. 2006. Seasonal
upwelling on the western and southern shelves of the
Gulf of Mexico. Ocean Dynam., 56(3-4): 333-338.
Lat. Am. J. Aquat. Res., 44(3): 470-479, 2016
Vibrio parahaemolyticus infects Litopenaeus vannamei
470
1
Research Article
Isolation and characterization of infectious Vibrio parahaemolyticus, the causative
agent of AHPND, from the whiteleg shrimp (Litopenaeus vannamei)
Patricia López-León1, Antonio Luna-González1, Ruth Escamilla-Montes1
María del Carmen Flores-Miranda1, Jesús A. Fierro-Coronado1
Píndaro Álvarez-Ruiz1 & Genaro Diarte-Plata1
1
Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional
Instituto Politécnico Nacional, Unidad Sinaloa, Sinaloa, Mexico
Corresponding author: Antonio Luna-González (aluna@ipn.mx)
ABSTRACT. Vibrio parahaemolyticus, the causative agent of acute hepatopancreatic necrosis disease
(AHPND), was isolated from the hepatopancreas of moribund whiteleg shrimp of commercial farms from
Guasave, Sinaloa, Mexico. The isolates were screened on thiosulfate citrate bile salt sucrose agar plates for the
selection of green colonies and further characterized through PCR with AP3 primers, 89F/R primers, hemolysin
genes, hemolytic and enzymatic activity, hydrophobicity, autoaggregation, and biofilm formation. Bioassays by
immersion challenge were conducted to confirm the pathogenicity of selected bacterial strains. In addition, the
LC50 was calculated for each isolate. All isolates (35) belonged to V. parahaemolyticus, but three isolates did
not correspond to strains that cause AHPND since they were negative with 89F/R primers. All isolates were αhemolytic and showed biofilm formation (from moderate to strong). Isolates were hydrophobic or hydrophilic
and showed high autoaggregation capacity. Eight strains did not kill shrimp and eleven were pathogenic, but
differences in virulence were found among them perhaps due to α-hemolysis and differences in biofilm
formation and hydrophobicity. Therefore, performed characterization may help to understand the pathogenicity
of V. parahaemolyticus. Finally, results showed that smaller shrimp are less resistant to V. parahaemolyticus
infection.
Keywords: Litopenaeus vannamei, Vibrio parahaemolyticus, AHPND, biofilm, aquaculture.
Aislamiento y caracterización de Vibrio parahaemolyticus infeccioso, agente causal de
AHPND en camarón blanco (Litopenaeus vannamei)
RESUMEN. Vibrio parahaemolyticus, el agente causante de la enfermedad de la necrosis hepatopancreática
aguda (AHPND), fue aislado del hepatopáncreas de camarón blanco moribundo proveniente de granjas
comerciales de Guasave, Sinaloa, México. Los aislados (colonias verdes) fueron seleccionados en placas de agar
TCBS, purificados y caracterizados mediante PCR con oligos AP3, 89F/R y genes de hemolisinas, actividad
hemolítica y enzimática, hidrofobicidad, autoagregación y la formación de biopelículas. Se realizaron
infecciones experimentales por inmersión para confirmar la patogenicidad de los aislados bacterianos
seleccionados. Además, se calculó la LC50 para cada aislado. Todos los aislados (35) pertenecen a V.
parahaemolyticus, pero tres de ellos no corresponden a las cepas que causan AHPND ya que fueron negativos
con los oligos 89F/R. Todos los aislados fueron α-hemolíticos y formaron biopelículas (de moderado a fuerte).
Los aislados fueron hidrofóbicos o hidrofílicos y mostraron gran capacidad de autoagregación. Ocho aislados
no mataron a los camarones pero once fueron patógenos, aunque se encontraron diferencias en la virulencia
entre ellos. Por lo tanto, la caracterización realizada puede ayudar a entender la patogenicidad de V.
parahaemolyticus. Finalmente, los resultados mostraron que los camarones más pequeños son menos resistentes
a la infección por V. parahaemolyticus.
Palabras clave: Litopenaeus vannamei, Vibrio parahaemolyticus, AHPND, biopelícula, acuicultura.
__________________
Corresponding editor: Cesar Lodeiros
471
2
INTRODUCTION
Shrimp farming has been hampered by diseases caused
by potential pathogens such as protozoa, bacteria,
fungi, and viruses (Gómez-Gil et al., 2001). However,
development of diseases is also influenced by changes
in environmental conditions and nutritional imbalances
(Kautsky et al., 2000). Worldwide, viruses are blamed
for the great losses in shrimp farming. However, there
are other pathogens such as Vibrio sp. that generate
significant production losses (Aguirre-Guzmán, 2004;
Goarant et al., 2006; Tran et al., 2013).
Vibrios belong to the family Vibrionaceae, are
Gram negative, comma-shaped, mobile, salt tolerant,
and facultative anaerobes (Thompson et al., 2004).
Diseases generated by these bacteria have been
described as: vibriosis, bacterial disease, penaeid
bacterial septicemia, penaeid luminescent vibriosis, red
legs disease (Aguirre-Guzmán, 2004), and acute hepatopancreatic necrosis disease (AHPND), also called
early mortality syndrome (EMS) (NACA, 2012). The
diseases caused by vibrios generate serious problems in
the culture of penaeid shrimp, recording mass
mortalities in both larval production labs and farms in
many countries. However, little attention has been
given to their research; so the knowledge about these
diseases and epidemiology of pathogenic vibrios in
shrimp farming is limited (Goarant et al., 2006;
Jayasree et al., 2006).
The AHPND, caused by Vibrio parahaemolyticus
strains, affects two shrimp species commonly bred in
the world, the giant tiger prawn (Penaeus monodon)
and the whiteleg shrimp (Litopenaeus vannamei)
(NACA, 2012). The disease often occurs within the
first 30 days after stocking shrimp in ponds (NACA,
2012) and the mass mortality can exceed 70%
(Kongrueng et al., 2014). The AHPND emerged in
China in 2009, causing serious losses in the shrimp
industry in Asia (NACA, 2012). In Mexico, AHPND
has affected the production of whiteleg shrimp in the
northwest of the country (Nayarit, Sinaloa, and Sonora)
since 2013 (Nunan et al., 2014; Soto-Rodriguez et al.,
2015). The clinical signs of the disease include
inactivity, slow growth, empty stomach and midgut,
and pale to white atrophied hepatopancreas (Tran et al.,
2013).
Information on the virulence factors associated with
V. parahaemolyticus strains that cause AHPND is still
limited (Kongrueng et al., 2014). Hence, research about
hemolytic activity and the presence of virulence genes
would be useful to clarify their pathogenicity in shrimp
(Kongrueng et al., 2014). In addition to the criteria
mentioned above, many other criteria have to be met,
two of the most important are the ability to adhere to
the digestive tract and the capacity of the strains to form
biofilms. Several studies have suggested that the ability
of vibrios to form biofilms is a survival mechanism
associated with their pathogenesis and stress tolerance
(Yildiz & Visick, 2009). Biofilms are complex
microbial communities associated with biotic and abiotic
surfaces and embedded in a matrix of extracellular
substances (polymers) produced by them (HallStoodley et al., 2004; Huq et al., 2008). Some bacterial
properties, such as increased hydrophobicity and the
ability to autoaggregate, are important for colonization
and biofilm formation (Decostere et al., 1999; Rickard
et al., 2004).
The aim of this work was to isolate and characterize
V. parahaemolyticus (the causative agent of APHND)
from shrimp farms of northwestern Mexico by
challenging organisms with experimental infections.
Animals and hepatopancreas samples
One hundred and ten moribund shrimp (weighing 3-6
g) from four farms (Guasave, Sinaloa, Mexico) with
mortality problems were collected from the earthen
ponds and transported to the lab facilities in plastic
containers with seawater (30-31°C) and constant
aeration. Shrimp, presumably infected with AHPND,
were alive and showed empty stomach and midgut,
inactivity, and pale to white atrophied hepatopancreas
(Tran et al., 2013) when they were analyzed visually.
Hepatopancreas of shrimp were aseptically removed,
placed in Eppendorf tubes with 400 μL of sterile saline
solution (2.5% NaCl), and homogenized with a pestle.
The volume was then adjusted to 1 mL.
Isolation of presumptive V. parahaemolyticus
The homogenate (100 μL) was inoculated into
thiosulphate citrate bile sucrose (TCBS, BD DIFCO,
Sparks, MD, USA) agar plates supplemented with 2.5%
NaCl. The plates were kept at 35°C for 24-48 h. V.
parahaemolyticus colony would be round in shape, 2-3
mm diameter, opaque, green, or bluish on TCBS agar
(Bisha et al., 2012). The initial isolation plates showed
green and yellow colonies but the green ones were
dominant. Hence, from all colonies (yellow and green),
only green colonies were selected and streaked (four
times) onto TCBS plates and incubated as above. Each
isolate was grown in tryptic soy broth (TSB, BD BBL)
supplemented with 2.5% NaCl at 35°C for 24 h, before
being stored at -70°C in the same medium supplemented with 15% glycerol.
Pre-screening of isolates with AP3 and 89F/R
primers
One hundred and twenty nine isolates (green colonies)
were analyzed by PCR with AP3 primers (Sirikharin et
al., 2014) that amplify a 336 bp fragment. The primers
are specific for V. parahaemolyticus strains causing
AHPND. Negative isolates were discarded and only
positive isolates (35) were further characterized with
89F/R primers that amplify a 470 bp fragment (Nunan
et al., 2014).
Molecular identification of isolates (detection of
total and hemolysin-producing V. parahaemolyticus)
To corroborate the previous analysis with AP3 and
89F/R primers, multiplex PCR amplifications were
done for thermolabile hemolysin (tlh), thermostable
direct hemolysin (tdh), and thermostable direct
hemolysin-related (trh) genes according to Bej et al.
(1999). PCR amplification was optimized in a 25-μL
reaction consisting of 1000 ng of purified genomic
DNA from each isolate, 1.0 μM of each of the
oligonucleotide primers for tlh, tdh, trh (1.0 μL of each
of the primers from a 10 μM stock suspension), 10 ×
reaction buffer (2.5 μL), 50 mM MgCl2 (0.7 µL), 10
mM dNTPs (0.5 μL), 0.25 µL (5 units µL-1) Biolase Taq
DNA polymerase (Bioline USA Inc., Tauton, MA,
USA), and 5.05 µL of ultrapure water (Invitrogen,
Grand Island, NY, USA).
Multiplex PCR amplifications were performed in a
DNA thermal cycler (Bioer, Model LifePro, Hangzhou
Bioer Technology Co. Ltd., Hangzhou, Binjiang,
China) as follows: initial denaturation at 94°C for 3 min
followed by 30 cycles of amplification; each cycle
consisted of denaturation at 94°C for 1 min, primer
annealing at 58°C for 1 min, and primer extension at
72°C for 1 min. Following the amplification cycles,
samples were kept at 72°C for 5 min to allow final
extension of the incompletely synthesized DNA.
Expected amplicon size was 450 bp (tlh) (Taniguchi et
al., 1985, 1986), 269 bp (tdh) (Nishibuchi & Kaper,
1985), and 500 bp (trh) (Honda et al., 1991; Honda &
Iida, 1993).
Hemolytic activity of isolates
Hemolytic activity was determined twice for each
isolate (Cowan & Steel, 2004). The 24-h culture of each
isolate in TSB (BD BBL) was obtained and tested for
its hemolytic activity on blood agar (BA, BD Bioxon)
plates prepared with 1 mL of heparinized human blood.
Two wells of 6-mm diameter were made on BA plates
for each isolate. Each well was filled with 40 µL of
bacterial culture or TSB (negative controls) and plates
were incubated at 30-33°C for 24 h. Three types of
hemolytic activity were expected: α-hemolysis (incomplete hemolysis) when the agar around the well is dark
and greenish, β-hemolysis (complete hemolysis) the
agar around the well appears lightened and transparent,
and γ-hemolysis (lack of hemolysis) when the agar
4723
around the well shows no changes. To observe the halo,
bacteria grown around the well were eliminated with an
inoculation loop.
Biofilm formation
Isolates (35) were tested for biofilm formation
according to Mandhi et al. (2010). Briefly, following
overnight incubation at 30-33ºC in TSB, 200 µL of
bacteria were transferred in triplicate to a U-bottom 96well microtiter plate and the optical density was
measured at 595 nm using a spectrophotometer
(Multiskan™ GO Microplate, Thermo Scientific, NC,
USA). The overnight culture was diluted 1:100 in TSB
with NaCl (2.5%) and glucose (2%). The diluted
sample (100 µL) was transferred to a U-bottom 96-well
microtiter plate. Each isolate was tested in triplicate.
The plates were incubated aerobically at 30-33ºC for 24
h. The cultures were removed and the microtiter wells
were washed twice (inverted plate) with 200 µL of PBS
(7 mmol L-1 Na2HPO4, 3 mmol L-1 NaH2HPO4, and 130
mmol L-1 NaCl at pH 7.4) to remove non-adherent cells,
and plates were dried in an inverted position. Adherent
bacteria were fixed with 200 µL of ethanol (95%),
decanted, dried at room temperature, and stained with
100 μL of crystal violet (Golden Bell, Jalisco, Mexico)
for 10 min. The excess stain was rinsed and poured off
and the wells were washed three times with sterile
distilled water (300 μL). The water was then cleared
and the microplates were air dried. The absorbance was
read at 595 nm in a spectrophotometer (Multiskan™
GO). Each value represents the mean of three
bioassays. Adhesion ability can be strong (OD ≥ 1),
moderate (0.1 ≤ OD595 < 1) or weak (OD595 < 0.1).
Microbial adhesion to solvents (MATS)
Microbial adhesion to solvents (p-xylene) was
performed according to Crow et al. (1995). Bacterial
isolates (35) were grown as in biofilm formation,
harvested at the stationary phase by centrifugation at
2379x g (Sigma 2-6E, Germany), for 20 min, and
suspended in PBS as above, to obtain 108 CFU mL-1.
Absorbance of the cell suspension was measured at 600
nm (A0) to obtain an optical density of 1. One milliliter
of the solvent was added to 3 mL of the cell suspension.
The sample in triplicate was incubated for 10 min at
room temperature and then the two phase system was
mixed in a vortex (2 min). The aqueous phase was
removed after 20 min of incubation at room
temperature and the absorbance at 600 nm (A1) was
measured in a spectrophotometer (Thermo Spectronic
Genesys 2, Thermo Scientific, Waltham, MA, USA).
PBS was used as a negative control. The percentage of
bacterial adhesion to solvent was calculated as follows:
A= [(1-A1/A0)] x 100. Each value represents the mean
4473
of three bioassays. Strains were considered strongly
hydrophobic when values were >50%, moderately
hydrophobic when values were in the range of 20-50%,
and hydrophilic when values were <20% (MattosGuaraldi et al., 1999).
Autoaggregation assays
The 35 isolates were tested for autoaggregation
capacity according to Kos et al. (2003). Bacteria were
grown for 18 h at 30-33ºC in TSB. The cells were
harvested by centrifugation at 2379x g (Sigma 2-6E)
for 20 min and suspended in PBS as above, to obtain
108 CFU mL-1. Cell suspensions (4 mL) were mixed in
a vortex for 10 s and then incubated at room temperature for 5 h. Every hour, 0.1 mL of the upper
suspension was transferred to another tube with 3.9 mL
of PBS and the absorbance at 600 nm (A) was read in a
spectrophotometer (Thermo Spectronic Genesys 2).
PBS was used as blank. Each value represents the mean
of three bioassays. The autoaggregation percentage was
expressed as: 1- (At/A0) x 100, where At represents the
absorbance at time t = 1, 2, 3, 4, or 5 h and A0 the
absorbance at t = 0.
Extracellular enzymatic activity
Production of extracellular enzymes was determined
qualitatively (León et al., 2000). Isolates (35) were
grown in TSB supplemented with 2.5% NaCl and
incubated at 30-33°C for 24 h. The cultures were
centrifuged at 12 000x g (Sigma 1-15PK, Germany) for
10 min to obtain the supernatant.
Petri plates were prepared with basal medium (1.5%
agar and 0.5% yeast extract) supplemented with 2%
skim milk or 1% gelatin for proteases and 1% Tween
80 for lipases. Wells of 6-mm diameter were made on
plates and filled with 50 µL of supernatant of bacteria
grown in TSB with 2.5% NaCl. TSB was used as
negative control. The plates were incubated at 30-33°C
for 24 h. For casein degradation (skim milk), isolates
with a clear halo around the well were considered as
positive. For gelatin and Tween 80 hydrolysis, isolates
with a cloudy halo around the well were considered as
positive.
Growth kinetics
Growth curves were determined for each isolate (35) to
identify growth phases, especially the log phase
because it was used for the challenging bioassays with
viable cells. Isolates were grown in 50 mL TSB
supplemented with 2.5% NaCl and incubated at 3033°C for 24 h. Absorbance (580 nm) was determined at
3, 6, 9, 12, 24, 48, 72, 96 h in a Thermo Spectronic
Genesys 2 spectrophotometer.
Bacterial count
The bacterial count was done twice on isolates selected
for challenging bioassays in L. vannamei. Isolates were
grown in TSB supplemented with 2.5% NaCl and
incubated at 30-33°C for 18 h. Samples were
centrifuged at 2379x g (Sigma 2-6E) for 20 min and cell
pellet was suspended in 1 mL of sterile saline solution
(2.5% NaCl). The bacterial solution was adjusted
spectrophotometrically to an optical density of 1 at 580
nm. Bacterial count was done with the serial dilution
method using plates with TS agar supplemented with
2.5% NaCl and incubated at 30-33°C for 24 h.
Immersion challenge tests
Bioassays were performed during 3-4 days. Shrimp
(Ecuadorian strain resistant to WSSV) weighing 10-60
mg (pathogen free) were obtained from Hatcheries of
Sinaloa (Proveedora de Larvas, S.A. de C.V. and
Acuacultura Integral, S.A. de C.V.) and grown in the
Laboratorio de Acuacultura del CIIDIR-IPN, Unidad
Sinaloa in plastic tanks (120 L) with 80 L of filtered
seawater (salinity of 30) and constant aeration. Animals
were fed twice daily (09:00 to 17:00) with a
commercial feed (Camaronina 35% Purina ®, Mexico).
Challenge bioassays with animals (weighing 30-716
mg) from the stock were done in glass aquariums (5 L)
with 3 L of filtered seawater (salinity of 30) and
constant aeration without water exchange. Ten
organisms were placed in each glass tank. Animals
were fed as above. After two days of acclimation,
uneaten food and waste material were removed.
Treatments were evaluated in triplicate. V. parahaemolyticus isolates were centrifuged at 2,379x g (Sigma
2-6E) for 20 min, the cell pellet was resuspended in 1
mL of sterile saline solution (2.5% NaCl), and then
adjusted spectrophotometrically to an optical density of
1 at 580 nm for experimental challenge bioassays. The
experimental doses were done according to the
previous bacterial count. Values of pH (HI 98127
pHep, Hanna Instruments, Woonsocket, RI, USA),
salinity (Refractometer W/ATC 300011, Sper
Scientific, Scottsdale, AZ, USA), dissolved oxygen and
temperature (YSI model 55 oxygen meter, Yellow
Spring Instruments, Yellow Springs, OH, USA) were
monitored daily. Animals were cultured under natural
photoperiod. During each bioassay, mortality was
recorded two times a day and dead shrimp were
removed. Shrimp was grown in optimal conditions
(Brock & Main, 1994); however, no cleaning of the
tanks was made during the challenging period and
temperature was maintained between 28-30°C to
promote vibrio infection. Only in one bioassay with
isolate 16, moribund shrimp were tested (72 h) after
challenge for V. parahaemolyticus according with the
method published in NACA (2012). The analyzed
shrimp were positive for V. parahaemolyticus.
LC50 determination
Mortality results from each bioassay were used to
calculate the median lethal concentration (LC 50) by
using Probit analysis (Finney, 1971) with StatPlus®
2009 professional 5.8.4.
RESULTS
Isolation and characterization of presumptive V.
parahaemolyticus isolates
One hundred and twenty nine presumptive V.
parahaemolyticus isolates were obtained from the
hepatopancreas of diseased shrimp. All the selected
isolates formed green colonies in TCBS. Thirty-five
isolates were positive with AP3 primers, showing a
fragment of 336 bp. Isolates were also positive (with
exception of isolates 1, 8, and 33) with primers 89F/R,
showing a fragment of 470 pb. Further characterization
was done only on selected isolates (35) (Table 1). All
isolates were positive for tlh but negative for tdh and
trh (Table 1). All isolates showed α-hemolysis with
halo diameters between 1.43 and 2.18 cm (Table 1).
Isolates 10, 16, 19, 29, and 33 showed strong
capacity to form biofilms (1.04-1.13 OD). The rest of
isolates showed moderate adherence (0.10-0.88 OD)
(Table 1). Results showed that 8 isolates were strongly
hydrophobic (51.46-58.24%). Twenty two isolates
were moderately hydrophobic (22.7-49.52%), and five
isolates were hydrophilic (11.6-19.9%) (Table 1).
Results of autoaggregation showed high values in
all isolates ranging from 96.0 to 98.9% (Table 1).
Results showed that isolates 11 and 12 had protease
activity (casein degradation) with a diameter of lysis
halo of 13 and 16 mm, respectively. No lipase activity
was found.
The lag phase of 35 isolates was found between 6
and 12 h, whereas the log phase was found between 12
and 96 h. Bacterial count was done only to isolates (19)
of the challenging bioassays. The CFU mL-1 of the
isolates ranged from 10.6×106 to 94×106.
Immersion challenge tests
The isolates 1, 8, 10, 13, 14, 16, 17, 18, 19, 20, and 29
were pathogenic to L. vannamei; however, isolate 16
seems to be more virulent. Isolates 9, 15, 25, 28, 32, 33,
34 and 35 were not pathogenic for white shrimp (Table
2).
LC50 determination
Probit analysis of pathogenic isolates (11) yielded LC50
values from 6×104 to 353×103 CFU mL-1 (Table 2).
474
5
DISCUSSION
Shrimp farming has been affected by viral and bacterial
diseases. Among bacterial diseases, those caused
principally by Vibrio alginolyticus, V. parahaemolyticus, and V. harveyi are of primary concern
(Rajasekar et al., 2011; Wei & Wendy, 2012; Zhou et
al., 2012; Tran et al., 2013; Nunan et al., 2014). EMS
or AHPND caused by V. parahaemolyticus appeared in
Asia in 2009 (Tran et al., 2013) causing significant
economic losses. In Mexico, it was reported since 2013
(Nunan et al., 2014; Soto-Rodriguez et al., 2014),
causing the collapse of this activity in the farms of the
northwest. In this study, 35 isolates of V.
parahaemolyticus with potential to cause AHPND in L.
vannamei were obtained. Pre-screening and identification was performed by PCR with primers AP3
(Sirikharin et al., 2014), primers 89F/R (Nunan et al.,
2014), and primers for hemolysin genes (tlh, tdh, and
trh) (Bej et al., 1999). All isolates were positive using
primers AP3. However, isolates 1, 8, and 33 were
negative using primers 89F/R. Results agree with SotoRodriguez et al. (2014), who found a false positive
strain (M0604) with primers AP3. They mentioned that
primers AP3 produced a predictive positive value of
90%. Bacterial identification was confirmed with the
gene coding for the thermolabile hemolysin (tlh) that is
specific for V. parahaemolyticus (Bej et al., 1999;
Gutiérrez-West et al., 2013). The 35 isolates were
positive for tlh and negative for human toxigenic genes
tdh and trh. The tlh hemolysin of V. parahaemolyticus
does not cause lysis in vertebrate erythrocytes (Bej et
al., 1999) as occurs with the tdh and trh hemolysins of
the same species that are considered virulence factors
in humans (Shirai et al., 1990) and animal pathogens
(Zhang & Austin, 2005). We concluded that all the
isolates belong to V. parahaemolyticus but isolates 1, 8,
and 33 do not belong to AHPND-causing isolates.
In this work, several tests were performed to select
isolates with pathogenic potential since Joshi et al.
(2014) and Soto-Rodriguez et al. (2015) mention that
strains causing AHPND may differ in virulence among
them despite the fact that two proteins have been
identified in the supernatant of a culture of pathogenic
V. parahaemolyticus (AHPND) strains from Asia
(Sirikharin et al., 2014), which have a high identity to
delta endotoxins (PirA and PirB) of the bacterium
Photorhabdus luminescens that are active against
insects (Waterfield et al., 2005). Also, the secretion
systems type III (T3SS1) and VI (T6SS1 and T6SS2)
have been demonstrated in V. parahaemolyticus,
causing AHPND (Kongrueng et al., 2014). The T3SS
system is a structure that enables, in Gram-negative
bacteria, the secretion and injection of bacterial effector
6475
Table 1. Characterization of isolates of presumptive V. parahaemolyticus obtained from the hepatopancreas of cultured
shrimp (L. vannamei). AP3 = AP3 primers. 89F/R = 89F/R primers. Tlh: thermolabile hemolysin, tdh: thermostable direct
hemolysin, trh: thermostable direct hemolysin-related. Hemolysis = lysis halo. Biofilm = strong adherence (OD ≥1),
moderate (0.1 ≤ OD595 <1) or weak (OD595 <0.1). Hydrophobicity = strong (>50%), moderate (20-50%), hydrophilic
(<20%).
Isolates
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
AP3
89F/R
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
Hemolysins
tl tdh trh
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
-
-
Hemolysis (cm)
1.65 ± 0.33
1.66 ± 0.26
1.93 ± 0.33
2.18 ± 0.33
1.80 ± 0.20
1.70 ± 0.06
1.85 ± 0.05
1.75 ± 0.15
1.75 ± 0.05
1.95 ± 0.05
1.70 ± 0.00
1.85 ± 0.05
1.50 ± 0.00
1.53 ± 0.48
1.60 ± 0.31
1.57 ± 0.12
1.43 ± 0.22
1.93 ± 0.38
1.50 ± 0.06
1.67 ± 0.13
1.67 ± 0.09
2.03 ± 0.09
1.90 ± 0.06
2.0 ± 0.25
1.55 ± 0.05
1.78 ± 0.11
1.63 ± 0.05
1.68 ± 0.08
1.55± 0.05
1.45 ± 0.05
2.43 ± 0.23
2.17 ± 0.12
2.18 ± 0.12
1.63 ± 0.19
1.33 ± 0.33
proteins in the cytoplasm of eukaryotic cells, whereas
the T6SS system is common in Gram-negative bacteria
and is associated with adhesion, cytotoxicity, invasion,
and intracellular growth, or survival and persistence
within the host (Cascales, 2008).
Biofilm (OD)
0.18 ± 0.01
0.17 ± 0.02
0.34 ± 0.02
0.33 ± 0.01
0.15 ± 0.01
0.10 ± 0.01
0.10 ± 0.01
0.13 ± 0.03
0.12 ± 0.02
1.04 ± 0.06
0.11 ± 0.04
0.19 ± 0.06
0.13 ± 0.03
0.88 ± 0.05
0.28 ± 0.01
1.10 ± 0.07
0.21 ± 0.08
0.26 ± 0.02
1.09 ± 0.01
0.12 ± 0.06
0.21 ± 0.02
0.14 ± 0.04
0.18 ± 0.06
0.21 ± 0.04
0.17 ± 0.05
0.17 ± 0.03
0.10 ± 0.02
0.28 ± 0.01
1.13 ± 0.03
0.27 ± 0.08
0.24 ± 0.01
0.27 ± 0.02
1.06 ± 0.06
0.10 ± 0.01
0.44 ± 0.01
Hydrophobicity (%)
19.35 ± 2.41
55.95 ± 0.77
36.29 ± 2.29
35.71 ± 1.79
51.46 ± 2.97
47.31 ± 0.33
53.86 ± 0.24
37.58 ± 0.74
21.77 ± 0.50
55.26 ± 0.33
26.37 ± 0.78
40.24 ± 1.64
48.66 ± 2.21
29.63 ± 1.09
30.88 ± 1.90
55.92 ± 0.08
27.12 ± 1.18
43.58 ± 0.69
55.00 ± 1.33
37.85 ± 1.58
35.06 ± 2.12
43.97 ± 2.81
56.01 ± 2.70
19.90 ± 0.07
13.30 ± 0.80
35.53 ± 1.41
39.16 ± 1.02
49.52 ± 0.68
29.01 ± 0.34
44.36 ± 1.16
22.94 ± 1.41
18.00 ± 1.97
58.24 ± 0.35
11.62 ± 0.25
32.55 ± 0.91
Autoaggregation (%)
98.73 ± 0.01
97.89 ± 1.13
96.98 ± 1.06
97.11 ± 0.41
97.88 ± 0.18
97.29 ± 0.22
98.19±0.13
98.80 ± 0.35
96.97 ± 0.17
97.65 ± 0.21
97.94 ± 0.12
97.30 ± 2.26
97.48 ± 0.27
96.46 ± 1.64
97.02 ± 1.97
97.82 ± 0.44
96.96 ± 1.87
97.58 ± 1.84
98.01 ± 0.83
98.94 ± 0.16
97.69 ± 0.14
97.86 ± 0.17
98.40 ± 0.05
96.00 ± 0.29
97.61 ± 0.17
97.78 ± 0.04
96.69 ± 0.48
96.42 ± 0.86
98.11 ± 0.19
96.68 ± 0.21
97.19 ± 0.08
97.71 ± 0.25
97.79 ± 0.41
97.66 ± 0.01
97.35 ± 0.04
Hemolytic activity is one of the virulence factors of
pathogenic vibrios (V. cholerae, V. parahaemolyticus,
V. vulnificus, V. anguillarum, and V. mimicus) (Zhang
& Austin, 2005). Hemolysis may result from the
enzymatic activities demonstrated in some bacterial
4767
Table 2. Experimental infections of L. vannamei challenged with V. parahaemolyticus isolates. Weight values are mean ±
SD. LC50: lethal concentration (colony forming units per milliliter [CFU mL-1]). ND: not determined.
Isolates
1
8
9
10
13
14
15
16
Bioassays
1
1
1
2
3
1
1
1
1
1
2
3
4
5
6
7
8
Weight (mg)
174 ± 6
100 ± 7
716 ± 30
40 ± 15
174 ± 6
174 ± 6
100 ± 7
174 ± 6
187 ± 9
200 ± 19
520 ± 26
30 ± 9
440 ± 15
80 ± 15
79 ± 21
114 ± 8
318 ± 25
LC50
270 × 103
158 × 103
ND
ND
ND
115 × 103
353 × 103
198 × 103
ND
62 × 103
144 × 103
60 × 103
175 × 103
68 × 103
71 × 103
81 × 103
96 ×103
species, including phospholipase C and D or by
forming pores (tdh) in the cytoplasmic membrane of
erythrocytes (Iida & Honda, 1997; Parker & Feil,
2005). In this study, all isolates showed α-hemolysis
(incomplete hemolysis). Results agree with those
obtained with the genetic analysis because tdh and trh
(related with β-hemolysis [complete hemolysis]) genes
were not found.
The studied isolates showed autoaggregation,
biofilm formation, extracellular enzymatic activity, and
hydrophilic or hydrophobic nature. The ability of
Vibrio spp. to form biofilms is a mechanism of survival,
pathogenesis, and stress tolerance (Yildiz & Visick,
2009). Biofilms are complex microbial communities
attached to living and nonliving surfaces and embedded
in a matrix of extracellular material (polymers)
produced by them (Hall-Stoodley et al., 2004; Huq et
al., 2008). Some properties of bacterial cells as
increased hydrophobicity and the ability of
coaggregation and autoaggregation are important for
colonization and biofilm formation (Decostere et al.,
1999; Rickard et al., 2004). Authors like Yuehuei &
Friedman (2000) and Rickard et al. (2004) mention that
the cell surface properties, compounds secreted by
microorganisms, the hydrodynamics of the aquatic
environment, the surface roughness, nutrient
availability, and speed differences in colonization
affect biofilm formation. Additionally, bacteria in
biofilms can be up to 1,000 times less susceptible to
most antibiotics and biocides (Mah et al., 2003).
Isolates
17
18
19
20
25
28
29
32
33
34
35
Bioassays
1
1
1
1
1
1
1
1
1
2
1
1
Weight (mg)
100 ± 7
114 ± 8
100 ± 7
174 ± 6
187 ± 9
200 ± 29
174 ± 6
114 ± 8
200 ± 29
187 ± 9
187 ± 9
187 ± 9
LC50
145 × 103
100 × 103
227 × 103
162 × 103
ND
ND
198 × 103
ND
ND
ND
ND
ND
Extracellular lipolytic activity of isolates (35) was
negative. These results are in agreement with Meyers et
al. (1996), who found negative results in lipolytic
activity of lactic acid bacteria. Regarding the
proteolytic activity, only isolates 11 and 12 were
positive. Some authors claim that the overproduction of
these enzymes is a virulence factor, since pathogenic
strains have high proteolytic, lipolytic, and hemolytic
activity (Quesada-Herrera & Rosa-Placencia, 2004).
However, the role of extracellular enzymatic activity as
virulence factor is not clear since most isolates studied
in challenge bioassays are pathogenic.
According to previous studies, of the 35 isolates, 19
were selected to be tested in L. vannamei challenges
based on their hemolytic activity, hydrophobicity,
autoaggregation, and ability to form biofilm. Eleven
isolates were pathogenic for white shrimp (L.
vannamei) and eight isolates were not, at least at the
concentrations tested. The clinical signs observed
included empty stomach and midgut, inactivity, and
pale to white atrophied hepatopancreas (Tran et al.,
2013). Among pathogenic isolates, those numbered as
1 and 8 did not belong to AHPND-causing strains.
Therefore, more research is needed to clarify this and
the differences in virulence found among pathogenic
strains. Regarding differences in virulence, it seems
that isolate 16 is the most virulent according to LC50.
The mentioned isolate showed α-hemolysis, strong
biofilm formation, strong hydrophobicity, and high
autoaggregation capacity. Results of virulence agree
8477
with those reported by Soto-Rodríguez et al. (2015) and
Joshi et al. (2014), who found that strains causing
AHPND may differ in virulence. Mortality in
immersion challenges of isolate 16 began in treatments
with 1×104 CFU mL-1 (5-72 h) in the smaller shrimp
(30-200 mg) as has been reported by Joshi et al. (2014)
and Soto-Rodriguez et al. (2015). In shrimp weighing
318, 440, and 520 mg, higher concentration of CFU
mL-1 of strain 16 were necessary to kill 50% shrimp
(LC50). The results show that the smaller shrimp are
less resistant to V. parahaemolyticus because fewer
bacteria per milliliter of water were required to kill 50%
of the shrimp (LC50).
In this work, it is important to note that not all the
isolates belong to V. parahaemolyticus strains that
cause AHPND, but the isolates that can cause the
disease in shrimp from Guasave farms exhibited
variable mortality percentages maybe due to αhemolysis and differences in biofilm formation and
hydrophobicity. Therefore, performed characterization
may help to understand the pathogenicity of V.
parahaemolyticus. Finally, results showed that smaller
shrimp are less resistant to V. parahaemolyticus
infection.
ACKNOWLEDGEMENTS
Authors are grateful to Secretaría de Investigación y
Posgrado del Instituto Politécnico Nacional (SIP-IPN)
for financial support. Patricia López-León acknowledges CONACYT Mexico and SIP-IPN for Master of
Science fellowships.
REFERENCES
Aguirre-Guzmán, G. 2004. ¿Los Vibrio sp. son agentes
patógenos importantes para el cultivo de camarón?
Boletín Informativo del Programa Nacional de
Sanidad Acuícola y la Red de Diagnóstico México, 1:
1-3.
Bej, A.K., D.P. Patterson, C.W. Brashera, M.C.L.
Vickerya, D.D. Jones & C.A. Kaysner. 1999.
Detection of total and hemolysin-producing Vibrio
parahaemolyticus in shellfish using multiplex PCR
amplification of tl, tdh and trh. J. Microbiol. Meth., 36:
215-225.
Bisha, B., J. Simonson, M. Janes, K. Bauman & L.D.
Goodridge. 2012. A review of the current status of
cultural and rapid detection of Vibrio parahaemolyticus. Int. J. Food Sci. Tech., 47: 855-899.
Brock, J. & K.L. Main. 1994. A guide to the common
problems and diseases of cultured Penaeus vannamei.
World Aquaculture Society, Baton Rouge, Louisiana,
242 pp.
Cascales, E. 2008. The type VI secretion tool kit. EMBO
Rep., 9: 735-741.
Cowan, S.T. & K.J. Steel. 2004. Manual for the
identification of medical bacteria. Cambridge University Press, Cambridge, 352 pp.
Crow, V.L., P.K. Gopal & A.J. Wicken. 1995. Cell surface
differences of Lactococcal strains. Int. Dair. J., 5: 4568.
Decostere, A., F. Haesebrouck, E. Van Driessche, G.
Charlier & R. Ducatelle. 1999. Characterization of the
adhesion of Flavobacterium columnare (Flexibacter
columnaris) to gill tissue. J. Fish. Dis., 22: 465-474.
Finney, D.J. 1971. Probit analysis. Cambridge University
Press, Cambridge, 333 pp.
Gómez-Gil, B., A. Roque & A.L. Guerra-Flores. 2001.
Enfermedades infecciosas más comunes en la
camaronicultura en México y el impacto del uso de
antimicrobianos. In: F. Páez-Osuna (ed.). Camaronicultura y medio ambiente. PUALICMYL- El Colegio
de Sinaloa. Sinaloa, pp. 328-334.
Goarant, C., Y. Reynaud, D. Ansquer, S. Decker, D.
Saulnier & F. Le Roux. 2006. Molecular epidemiology
of Vibrio nigripulchritudo, a pathogen of cultured
penaeid shrimp (Litopenaeus stylirostris) in New
Caledonia. Syst. Appl. Microbiol., 29: 570-580.
Gutiérrez-West, C., S.L. Klein & C.R. Lovell. 2013. The
virulence factor genes tdh, trh and tlh occur at high
frequency in Vibrio parahaemolyticus isolated from a
pristine estuary. Appl. Environ. Microbiol., 79: 22472252.
Hall-Stoodley, L., J.W. Costeron & P. Stoodley. 2004.
Bacterial biofilms: from the natural environment to
infectious diseases. Nat. Rev. Microbiol., 2: 95-108.
Honda, T., M.A. Abad-Lapuebla, Y.X. Ni, K. Yamamoto
& T. Miwatani. 1991. Characterization of a new
termostable direct haemolysin produced by a
Kanagawa-phenomenon-negative clinical isolate of
Vibrio parahaemolyticus. J. Gen. Microbiol., 137:
253-259.
Honda, T. & T. Iida. 1993. The pathogenicity of Vibrio
parahaemolyticus and the role of the thermostable
direct haemoysin and related haemolysins. Rev. Med.
Microbiol., 4: 106-113.
Huq, A., C.A. Whitehouse, C.J. Grim, M. Alam & R.R.
Colwell. 2008. Biofilms in water, its role and impact
in human disease transmission. Curr. Opin. Biotech.,
19: 244-247.
Iida, T. & T. Honda. 1997. Hemolysins produced by
vibrios. J. Toxicol. Toxin Rev., 16: 215-227.
Jayasree, L., P. Janakiram & P. Madhavi. 2006. Characterization of Vibrio spp. associated with diseased
shrimp from culture ponds of andhra pradesh (India).
J. World Aquacult. Soc., 37(4): 523-532.
Joshi, J., J. Srisala, V.H. Truong, T.I. Chend, B.
Nuangsaenge, O. Suthienkul, C.F. Lo T.W. Flegel K.
Sritunyalucksana & S. Thitamadee. 2014. Variation in
Vibrio parahaemolyticus isolates from a single Thai
shrimp farm experiencing an outbreak of acute
hepatopancreatic necrosis disease (AHPND). Aquaculture, 428-429: 297-302.
Kautsky, N., P. Rönnback, M. Tedengren & M. Troell.
2000. Ecosystem perspectives on management of
disease in shrimp pond farming. Aquaculture, 191:
145-161.
Kongrueng, J., S. Yingkajorn, N. Bunpa, K.
Sermwittayawong, K. Singkhamanan & V. Vuddhakul.
2014. Characterization of Vibrio parahaemolyticus
causing acute hepatopancreatic necrosis disease in
southern Thailand. J. Fish. Dis., 38(11): 957-966. doi:
10.1111/ jfd.12308.
Kos, B., J. Suskovíc, S. Vukovic, M. Simpraga, J. Frece &
S. Matosic. 2003. Adhesion and aggregation ability of
probiotic strain Lactobacillus acidophilus M92. J.
Appl. Microbiol., 94: 981-987.
León, J., F. Pellón, V. Unda, J. David, C. Anaya & V.
Mendoza. 2000. Producción de enzimas extracelulares
por bacterias aisladas de invertebrados marinos. Rev.
Peru. Biol., 7: 202-210.
Mah, T.F., B. Pitts, B. Pellock, G.C. Walker, P.S. Stewart
& G.A. O’Toole. 2003. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature,
426: 306-310.
Mandhi, A., B. Harbi, M. Ángeles-Esteban, K. Chaieb, F.
Kaumon & A. Bakhrouf. 2010. Using mixture design
to construct consortia of potential probiotic Bacillus
strains to project gnotobiotic Artemia against
pathogenic Vibrio. Bioc. Sci. Tecnol., 20: 983-996.
Mattos-Guaraldi, A.L., L.C.D. Formiga & A.F.B.
Andrade. 1999. Cell surface hydrophobicity of sucrose
fermenting and nonfermenting Corynebacterium
diphtheriae strains evaluated by different methods.
Curr. Microbiol., 38: 37-42.
Meyers, S., S. Cuppett & R. Hutkins. 1996. Lipase
production by lactic acid bacteria and activity on butter
oil. Food Microbiol., 13: 383-389.
Network of Aquaculture Centres in Asia-Pacific (NACA).
2012. Report of the Asia Pacific Emergency Regional
Consultation on the Emerging Shrimp Disease: Early
Mortality Syndrome (Ems)/Acute Hepatopancreatic
Necrosis Syndrome (AHPNS), 9-10 Aug 2012.
Published by the Network of Aquaculture Centres in
Asia and the Pacific, Bangkok, Thailand. August 2012.
[http://library.enaca.org/Health/Publication/ahpns
-emergency-consultation-report.pdf]. Reviewed: 30
August 2015.
4789
Nishibuchi, M. & J.B. Kaper. 1985. Nucleotide sequence
of the thermostable direct hemolysin gen of Vibrio
parahaemolyticus. J. Bacteriol., 162: 558-564.
Nunan, L., D. Lightner, C. Pantoja & S. Gómez-Jiménez.
2014. Detection of acute hepatopancreatic necrosis
disease (AHPND) in Mexico. Dis. Aquat. Org., 111:
81-86.
Parker, M.W. & S.C. Feil. 2005. Pore-forming protein
toxins: from structure to function. Prog. Mol. Biol.
Biophys., 88: 91-142.
Quesada-Herrera, A. & J. Rosa-Placencia. 2004.
Selección de probióticos bacterianos para su uso en el
cultivo de camarón. III Congreso Iberoamericano
Virtual de Acuicultura. Comunicación Técnica CIVA
2004. [http://www.civa2004.org] pp. 97-100.
Rajasekar, T., J. Usharani, M. Sakthivel & B.
Deivasigamani. 2011. Immunostimulatory effects of
Cardiospermum halicacubum against Vibrio parahaemolyticus on tiger shrimp Penaeus monodon. J. Chem.
Pharm. Res., 3: 501-513.
Rickard, A.H., A.J. McBain, A.T. Stead & P. Gilbert.
2004. Shear rate moderates community diversity in
freshwater biofilms. Appl. Environ. Microbiol., 70:
7426-7435.
Shirai, H., H. Ito, T. Hirramaya, T. Nakamoto, N.
Nakabayashi, K. Kumagai, Y. Takeda & M.
Nishibuchi. 1990. Molecular epidemiologic evidence
for association of thermostable direct hemolysin
(TDH) and TDH-related hemolysin of Vibrio
parahaemolyticus with gastroenteritis. Infec. Immunol.,
58: 3568-3573.
Sirikharin, R., S. Taengchaiyaphum, K. Sritunyalucksana,
S. Thitamadee, T.W. Flegel & R. Mavichak. 2014. A
new and improved PCR method for detection of
AHPND bacteria. [http://www.enaca.org/modules/
news/article.php?article_id=2030&title=new620].pc
r-detection-method-for-ahpnd bacteria. Reviewed: 15
July 2015.
Soto-Rodriguez, S.A., B. Gomez-Gil, R. Lozano-Olvera,
M. Betancourt-Lozano M.S. & Morales-Covarrubias.
2015. Field and experimental evidence of Vibrio
parahaemolyticus as the causative agent of Acute
Hepatopancreatic Necrosis Disease (AHPND) of
cultured shrimp (Litopenaeus vannamei) in northwestern Mexico. Appl. Environ. Microbiol., 81(5):
1689-1699.
Taniguchi, H., H. Ohta, M. Ogawa & Y. Mizuguchi. 1985.
Cloning and expression of Escherichia coli of Vibrio
parahaemolyticus thermostable direct hemolysin and
thermolabile hemolysin genes. J. Bacteriol., 162: 510515.
Taniguchi, H., H. Hirano, S. Kubomura, K. Higashi & Y.
Mizuguchi. 1986. Comparison of the nucleotide
sequences of the genes for the thermolabile hemolysin
479
10
from Vibrio parahaemolyticus. Microbiol. Pathogen.,
1: 425-432.
Thompson, F.L., T. Iida & J. Swings. 2004. Biodiversity
of vibrios. Microbiol. Mol. Biol. Rev., 68: 403-431.
Tran, L., L. Nunan, R.M. Redman, L.L. Mohney, C.R.
Pantoja, K. Fitzsimmons & D.V. Lightner. 2013.
Determination of the infectious nature of the agent of
acute hepatopancreatic necrosis syndrome affecting
penaeid shrimp. Dis. Aquat. Org., 105: 45-55.
Waterfield, N., S.G. Kamita, B.D. Hammock & R. FrenchConstant. 2005. The Photorhabdus Pir toxins are
similar to a developmentally regulated insect protein
but show no juvenile hormone esterase activity. FEMS
Microbiol. Lett., 245: 47-52.
Wei, L.S. & W. Wendy. 2012. Characterization of Vibrio
alginolyticus isolated from white legshrimp (Litopenaeus vannamei) with emphasis on its antibiogram and
heavy metal resistance pattern. Vet. Archiv., 82(2):
221-227.
Received: 4 September 2015; Accepted: 25 January 2016
Yildiz, F.H. & K.V. Visick. 2009. Vibrio biofilms: so
much the same yet so different. Trends Microbiol., 17:
109-118.
Yuehuei, H.A. & R.J. Friedman. 2000. Handbook of
bacterial adhesion. Humana Press, Totowa, pp. 30-58.
Zhang, X.H. & B. Austin. 2005. Hemolysins in Vibrio
species. J. Appl. Microbiol., 98: 1011-1019.
Zhou, J., W. Fang, X. Yang, S. Zhou, L. Hu, X. Li, X. Qi,
H. Su & L. Xie. 2012. A nonluminescent and highly
virulent Vibrio harveyi strain is associated with
“Bacterial white tail disease” of Litopenaeus vannamei
shrimp. PLoS ONE, 7(2): e29961. doi:10.1371/
journal.pone.0029961.
Lat. Am. J. Aquat. Res., 44(3): 480-486,
2016
Crecimiento
individual en Litopenaeus vannamei y Litopenaeus stylirostris
4801
Research Article
Crecimiento individual de camarón blanco Litopenaeus vannamei
(Boone, 1931) y camarón azul Litopenaeus stylirostris (Stimpson, 1874)
(Decapoda: Penaeidae) con un enfoque multi-modelo
Eugenio Alberto Aragón-Noriega1
Centro de Investigaciones Biológicas del Noroeste, Unidad Sonora, Estero Bacochibampo
Guaymas, Sonora, México
1
Corresponding autor: Eugenio Aragón-Noriega (aaragon04@cibnor.mx)
RESUMEN. Se analizó el crecimiento individual de dos especies de camarones de la familia Penaeidae, el
camarón blanco Litopenaeus vannamei y camarón azul Litopenaeus stylirostris, bajo la hipótesis de que ambas
especies tendrían un crecimiento de tipo asintótico y de forma sigmoidea. Los datos provienen de cultivo en
estanques de tierra descubiertos en una granja acuícola localizada en el Golfo de California. La densidad de
siembra fue de 25 postlarvas m-2 en estanques de 1,8 ha. A los datos de longitud promedio a la edad se aplicaron
tres modelos asintóticos: von Bertalanffy, Gompertz y Logístico. Los parámetros se obtuvieron mediante
iteraciones usando como función objetivo la máxima verosimilitud y se seleccionó el mejor modelo siguiendo
el criterio de información de Akaike. La longitud total final de camarón blanco fue de 128,8 mm y la longitud
asintótica calculada fue de 130 mm después de 140 días de cultivo. En camarón azul, la talla final a cosecha fue
de 142,2 mm y la longitud asintótica de 174 mm, después de 158 días. Para ambas especies el modelo que mejor
describió el crecimiento fue el de Gompertz, por lo tanto se concluyó que la forma de crecimiento de ambas
especies debe ser sigmoidea.
Palabras clave: Litopenaeus vannamei, Litopenaeus stylirostris, Akaike, modelos de crecimiento, acuicultura.
Individual growth of white shrimp Litopenaeus vannamei (Boone, 1931) and blue
shrimp L. stylirostris (Stimpson, 1874) (Crustacea: Penaeidae) by multi-model approach
ABSTRACT. Individual growth of two shrimp species of the family Penaeidae, the white shrimp Litopenaeus
vannamei and blue shrimp L. stylirostris were analyzed. The hypothesis was that both species would have an
asymptotic growth type with sigmoid shape. The data comes from shrimp farming in earthen ponds of an
aquaculture farm located in the Gulf of California, density was 25 post-larvae m-2 in ponds of 1.8 ha. Three
asymptotic models were applied to averaged length at age data: von Bertalanffy, Gompertz, and logistic. The
model’s parameters were computed by maximum likelihood criterion. Best model was selected according to the
Akaike information criterion. The final total length of white shrimp was 128.8 mm and the estimated asymptotic
length was 130 mm, after 140 rearing days. The blue shrimp final size was 142.2 mm, and the asymptotic length
was 174 mm, after 158 rearing days. For both species, the model which better described the growth was the
Gompertz model; consequently the conclusion was that the growth of both species must be sigmoid shape.
Keywords: Litopenaeus vannamei, Litopenaeus stylirostris, Akaike, growth models, aquaculture.
INTRODUCCIÓN
Durante mucho tiempo se ha reconocido que los
patrones de crecimiento individual (cambios en el
tamaño de un individuo con el tiempo) de los
organismos juegan un papel importante en la evolución
de las trayectorias de la edad de la fertilidad y
mortalidad. La importancia del estudio de crecimiento
individual la destaca Karkash (2006) cuando menciona
__________________
Corresponding editor: Enrique Dupré
que los estudios de historia de la vida se beneficiarían
de una mejor comprensión de las estrategias y
mecanismos de crecimiento. Hay que reconocer que,
cuando se quiere desarrollar modelos que representen
el crecimiento individual hay que preocuparse de su
cambio global a través del tiempo, pero no se tiene al
detalle todo el complejo bioquímico y de los procesos
fisiológicos (alimentación, digestión, asimilación,
respiración, excreción, etc.) o modificaciones anató-
2481
micas que conducen a esos cambios. Se requiere una
buena comprensión de las distintas curvas de
crecimiento, sus respectivas formas y propiedades, para
la administración y manejo de especies sujetas a
explotación pesquera o acuícola.
El crecimiento, caracterizado por una talla máxima,
que conforme se va alcanzando va acompañado de una
disminución en la tasa de crecimiento, que determina el
crecimiento asintótico. Dentro del patrón de crecimiento asintótico se han destacado dos patrones
distintos; uno sigmoideo y otro en forma de exponencial
invertido (Fig. 1). Las curvas sigmoideas pueden ser
representadas por los modelos de crecimiento de
Gompertz y Logístico, mientras que el exponencial
invertido es comúnmente representado por la ecuación
de von Bertalanffy (MCVB). La descripción detallada
de estos modelos se encuentran en Haddon (2001).
El modelo logístico de crecimiento individual, al
igual que el de Gompertz, es representado por una curva
sigmoidea y cuenta con un punto de inflexión. La
diferencia es que en el modelo logístico la curva es
simétrica mientras que en el de Gompertz no. Estos dos
modelos, originalmente planteados para representar el
crecimiento poblacional, se han aplicado al crecimiento
individual en erizos (Ebert et al., 1999), peces (Baer et
al., 2011) y moluscos (Cruz-Vásquez et al., 2012;
Aragón-Noriega, 2013). El MCVB (Von Bertalanffy,
1938, 1957) es el primer modelo de crecimiento
diseñado específicamente para describir el crecimiento
individual. Se basa en un simple análisis bioenergético.
Un individuo es considerado como un reactor químico
dinámico donde las entradas (anabolismo) compiten
con las salidas (catabolismo). El resultado de estos dos
flujos es el crecimiento. El MCVB no tiene ningún
punto de inflexión. El crecimiento es más rápido desde
el principio, disminuye gradualmente y finalmente
llega a cero. El crecimiento es determinado y el tamaño
no puede exceder la asíntota horizontal de la curva.
Para elegir el modelo que mejor describe el
crecimiento individual se utiliza frecuentemente el
procedimiento denominado inferencia del múltimodelo (IMM). Es un enfoque basado en la teoría de la
información y es un paradigma relativamente nuevo en
ciencias biológicas, y es muy diferente de los métodos
tradicionales basados en probar una hipótesis nula
(Schnute & Groot, 1992; Burham & Anderson, 2002;
Katsanevakis, 2006, 2007; Katsanevakis & Maravelias,
2008). Hay dos categorías de métodos para seleccionar
entre modelos candidatos, los empíricos y los hipotéticos. Entre estos últimos se encuentra el Criterio de
Información de Akaike (AIC por sus siglas en inglés).
El AIC es un estimador simple, asintótico y no desviado
de la distancia Kullback-Leibler desarrollado por
Akaike (Burnham & Anderson, 2002), que selecciona
Figura 1. Ejemplo esquemático de las curvas de
crecimiento. Exponencial invertida para el modelo de
crecimiento de von Bertalanffy (MCVB) y sigmoidea con
punto de inflexión para el modelo logístico.
el mejor modelo basado en el principio de simplicidad.
Esto significa que ante dos modelos que se ajustan igual
a los datos, se elige el más simple (menor número de
parámetros y menor número de supuestos); el modelo
con el menor AIC es el que se debe seleccionar. Al
calcular el valor de AIC se establece un equilibrio entre
la complejidad del modelo y la bondad de ajuste del
modelo; es decir, penaliza a un modelo en proporción
al número de parámetros. Esto implica que el modelo
seleccionado se caracterizará por asegurar que tiene la
complejidad y la bondad de ajuste óptimas.
En los estudios recientes sobre cultivo de camarón
blanco Litopenaeus vannamei (Boone, 1931) (CeballosVázquez et al., 2010; Sookying et al., 2011) y camarón
azul L. stylirostris (Stimpson, 1874) (Acosta-Ruiz et
al., 2011; Suresh et al., 2011), se ha encontrado que
básicamente se reporta la talla o el peso al final del
periodo de cultivo.
Estas dos especies son muy importantes en las
prácticas acuícolas a nivel mundial (Alfaro-Montoya,
2010; Andriantahina et al., 2013; Pérez-Velázquez et
al., 2013). En las pesquerías de lagunas costeras el
camarón blanco representa hasta el 97% de la captura
(Del Valle & Martín, 1995; Ramos-Cruz, 2000). Para
camarón blanco silvestre se ha descrito el crecimiento
solamente con el MCVB (Chávez, 1973; Ramos-Cruz,
2000; Rivera-Velázquez et al., 2010). En otras especies
Crecimiento individual en Litopenaeus vannamei y Litopenaeus stylirostris
de camarones (e.g., Metapenaeus macleayi, Plesionika
izumiae) se han utilizado modelos de crecimiento
alternativos al MCVB, como el modelo de Gompertz,
Pauly y Gaschütz, y Schnute (Montgomery et al., 2010;
Ahamed & Ohtomi, 2012) y se ha concluido que es
importante el uso de modelos alternativos al MCVB
para describir el crecimiento de camarones tropicales
de la familia Penaeidae.
El problema que se aborda en este trabajo parte de
la situación en que, bajo condiciones de cultivo, el
crecimiento solo se representa graficando la ganancia
en talla o peso a la edad (tiempo de cultivo) y no
ajustando un modelo de crecimiento. Esto, principalmente, porque el objetivo de los cultivos comerciales
de las especies como camarones o peces es lograr las
tallas comerciales en el menor tiempo posible. Se
entiende que este objetivo es muy diferente al ajustar
modelos de crecimiento en especies silvestres sujetas a
pesca, pero el beneficio que se puede lograr para la
acuicultura, al ajustar modelos de crecimiento, radica
en que se pueden realizar predicciones de crecimiento
más acertadas para programar una cosecha e
incrementar las ganancias del cultivo comercial. El
tema fue planteado por Ansah & Frimpong (2015) de la
siguiente manera: “Si el crecimiento de los organismos
bajo cultivo es sobreestimado, puede resultar en
pérdidas inesperadas de ingresos comerciales, mientras
que subestimar el crecimiento podría resultar en una
pobre planificación del cultivo con respecto a la
asignación de mano de obra, alimentación óptima y
tiempo de cosecha”
El objetivo principal del presente estudio fue
examinar el crecimiento individual de dos especies de
camarones de la familia Penaeidae, el camarón blanco
L. vannamei y camarón azul L. stylirostris, que son
importantes para la pesca y la acuicultura en todo el
Pacífico tropical, partiendo de la hipótesis que ambas
especies tendrían un crecimiento de tipo asintótico y de
forma sigmoidea.
Los datos provienen de un cultivo realizado en
estanques de tierra descubiertos en una granja de
cultivo de camarón localizada en el Golfo de California,
México. La densidad de siembra fue de 25 postlarvas
m-2 en estanques de 1,8 ha. El peso y talla inicial en
camarón blanco fue de 0,03 g y 11,32 mm respectivamente. En camarón azul el peso inicial fue 2,1 g y la
longitud 46 mm. Fueron mantenidos con alimento
comercial con 35% de proteína, suministrados dos veces
al día durante los primeros 20 días y posteriormente
cuatro veces al día. Para medir el crecimiento se
realizaron muestreos semanales durante 140 días para
4823
el camarón blanco y 158 en el caso del camarón azul.
Para la captura de los ejemplares se utilizó una atarraya
de 5 m de diámetro y 1 cm de luz de malla. Los lances
se realizaron en las esquinas encontradas del estanque
hasta completar un total de 100 a 120 individuos.
Para obtener la longitud total de los individuos se
midieron desde la punta del rostro hasta la punta del
telson con una precisión de 0,1 cm. Es necesario aclarar
que los datos utilizados corresponden a todos los datos
sin separar por sexos ya que en las etapas iniciales de
los camarones la separación por sexos es difícil de
realizar y una vez que las características para separar
los sexos son evidentes se tendría que asumir cual fue
la proporción sexual en las etapas anteriores. También
es importante mencionar que a pesar que existen
variadas formas de representar el crecimiento de los
organismos en condiciones de cultivo, Ansah &
Frimpong (2015) sugieren que los datos promedios son
más adecuados que el uso de datos “crudos” para la
modelación de crecimiento individual de los organismos cultivados.
Una vez obtenidos los datos de longitud promedio,
de cada muestreo, se graficaron aplicando tres modelos
asintóticos: von Bertalanffy (MCVB), Gompertz y
Logístico (Ricker, 1975) cuyas formulas se describen a
continuación:
El modelo de MCVB que se representa por la ecuación:
L(t) = L∞(1-e-k(t-t0))
El modelo Logístico: L(t) = L∞/(1+e-k2(t-t1))
El modelo de Gompertz: L(t) = L∞e-e-k3(t-t2)
Para todos estos modelos los parámetros evaluados se
describen como:
L(t): longitud a la edad t
t: edad a la longitud L(t),
L∞: longitud promedio de un organismo muy viejo
(longitud asintótica),
k: determina la rapidez para alcanzar L (parámetro de
curvatura),
t0: edad hipotética a la cual la longitud del organismo
es cero,

k2: tasa relativa de crecimiento,
t1: punto de inflexión de la curva sigmoidea,
t2: es lnλ K3,
λ: es la tasa de crecimiento relativa inicial teórica a la
edad cero (unidades de año-1),
k3: es la tasa de decaimiento exponencial de la tasa de
crecimiento relativa (unidades de año-1).
Los parámetros de los modelos se obtuvieron
mediante iteraciones utilizando el paquete computacional Excel. Para ajustar los modelos se utilizó el
483
4
criterio de máxima verosimilitud con el algoritmo de
Newton (Haddon, 2001). Se consideró solamente el
error de tipo aditivo. La ecuación de máxima verosimilitud que se utilizó como función objetivo fue:
𝑛
𝐿𝐿(𝛷 |𝑑𝑎𝑡𝑎) = − ( ) (𝑙𝑛(2𝜋) + 2 ∗ 𝑙𝑛(𝜎) + 1)
2
donde Φ representa los parámetros de cada modelo y σ
representa la desviación estándar de los errores que
fueron calculados con la siguiente ecuación:
𝜎 = √∑
(𝐿𝑡𝑜𝑏𝑠−𝐿𝑡𝑒𝑠𝑝. )2
𝑛
para error aditivo
Selección del mejor modelo
El criterio de información de Akaike fue seleccionado
como el criterio de bondad de ajuste ya que tiene
mayores ventajas estadísticas que los criterios tradicionales como el coeficiente de determinación (R2).
Además el uso de R2 ha sido criticado en estudios de
crecimiento individual de organismos en condiciones
de cultivo porque sus resultados son poco confiables
cuando se usan modelos no lineales (Ansah &
Frimpong, 2015). La selección del modelo se efectuó
mediante una forma corregida del AIC c (Burnham &
Anderson 2002). Esta corrección se realiza si la razón
n k-1 es menor a 40. Para eso, se considera el modelo
con la mayor cantidad de parámetros y se asume que las
desviaciones están normalmente distribuidas con
varianza constante. El modelo con el menor valor de
AICc (AICc,min) fue el seleccionado como el mejor.
AICc = AIC +(2 Φ (Φ +1)/n- Φ -1)
AIC = -2LL + (2Φ)
donde LL es la verosimilitud logarítmica, n es el
número de observaciones, Φ es el número de
parámetros en el modelo.
Se calcularon las diferencias entre los AICc de cada
modelo y el AICc menor o mínimo:
Δi = AICc,i - AICc,mínimo
(Fig. 2). Al ajustar los tres modelos de crecimiento al
camarón blanco se aprecia que las curvas no pasan tan
alejadas de los datos observados, pero los modelos de
Gompertz y Logístico si representan la forma
sigmoidea (Fig. 3). En el camarón azul los modelos de
Gompertz y Logístico no reflejan la misma forma que
en camarón blanco. Arbitrariamente se prolongaron las
curvas calculadas hasta los doce meses para observar
las trayectorias, pero aun así no se observa la forma
sigmoidea (Fig. 4). Con ambas especies el MCBV
presenta claramente su forma exponencial invertida.
El valor de AIC mínimo lo obtuvo el modelo de
Gompertz en ambas especies (Tabla 1), sin embargo el
valor Δi para MCVB y Logístico fue muy diferente
según la especie. En camarón blanco está por arriba de
4 y con camarón azul por debajo de 2. Por lo que el
valor de ponderación para el modelo de Gompertz en el
caso de camarón blanco es 89,9% y en el caso de
camarón azul 48%.
La talla final de camarón blanco fue de 128,8 mm
en 140 días de cultivo. La longitud asintótica calculada
con el modelo logístico fue de 130 mm. En el caso del
camarón azul la talla final a cosecha fue de 142,2 mm
y la longitud asintótica, determinada mediante la
inferencia del multi-modelo (IMM) fue de 174 mm.
DISCUSIÓN
Tanto los cultivos comerciales como los experimentales
se realizan en periodos menores a un año, de hecho los
cultivos de camarón rara vez sobrepasan los seis meses
Además de la plausibilidad (el peso de la evidencia
a favor del modelo i) mediante la “ponderación del
criterio de información Akaike” como se describe a
continuación:
Wi = e(-0.5 Δi)/Σ(-0.5 Δi)
RESULTADOS
Se observó un comportamiento distinto para ambas
especies. El camarón blanco presenta mayores tallas
promedio en los primeros días de cultivo, pero a partir
de los tres meses aparentemente disminuye la tasa de
crecimiento. El camarón azul presenta un crecimiento
casi en línea recta y no se observa que disminuya su
tasa de crecimiento hasta el momento de la cosecha
Figura 2. Datos de longitud promedio al tiempo de cultivo
para las dos especies analizadas. Nótese que los
crecimientos de ambas especies se comportan diferentes
siendo el mismo medio ambiente.
484
5
Figura 3. Curvas de crecimiento generadas para los tres
modelos aplicados a datos de longitud promedio de
acuerdo al tiempo de cultivo en Litopenaeus vannamei.
Figura 4. Curvas de crecimiento generadas para los tres
modelos aplicados a datos de longitud promedio de
acuerdo al tiempo de cultivo de Litopenaeus stylirostris.
antes de cosechar el producto. La talla determinada en
camarón blanco cultivado durante 12 semanas fue de
~130 mm (Andriantahina et al., 2013). Para un cultivo
en el que se varió la densidad de siembra de 15 a 65
camarones m-2 y desarrollado durante diez semanas se
obtuvo una talla final de 120-130 mm (Sookying et al.,
2011). En un estudio donde se cultivaron los camarones
para obtener reproductores, las tallas obtenidas a 6 y 12
meses fueron 152 y 172 mm para hembras, y 142 y 166
mm para machos, respectivamente (Ceballos-Vázquez
et al., 2010). En este estudio la talla final de camarón
blanco fue de 128 mm en 140 días de cultivo y se puede
considerar dentro del crecimiento esperado y obtenido
en otros estudios.
Para el camarón azul se obtuvo una talla final de 142
mm en 158 días de cultivo. En el caso de esta especie,
Pusceddu et al. (2011) cosecharon camarones de 140
mm en 122 días de cultivo. Acosta-Ruiz et al. (2011)
hicieron su experimento tan sólo por 5 semanas y
obtuvieron 52 mm de longitud total. En el presente
estudio se lograron 59 mm a las cinco semanas de
cultivo. Al igual que con camarón blanco, en este
estudio el crecimiento de camarón azul está dentro del
crecimiento esperado.
Es importante señalar que el valor de longitud
asintótica así como la curva que describe el crecimiento
promedio del camarón blanco, representa las dimensiones
corporales hacia las que tiende L. vannamei en los
sistemas lagunares o estuarinos, antes de emigrar a mar
abierto para completar su ciclo de vida. Este parámetro
de crecimiento es muy similar al encontrado por
Rivera-Velázquez et al. (2010) y Ramos Cruz (2000)
en lagunas costeras de Pacífico mexicano. Sin embargo,
los valores estimados en los estudios de campo fueron
ajustados a la función de crecimiento de von
Bertalanffy (MCVB).
Tabla 1. Valores de AIC, ∆i, Wi obtenidos de los modelos
ajustados con los datos promedios de longitud a la edad,
para camarón blanco y azul. AIC: Criterio de información
de Akaike, Δi : diferencias entre AICc de cada modelo y el
AICc mínimo, Wi : peso de evidencia.
Especie Modelo
L. vannamei
Gompertz
Logístico
MCVB
L. stylirostris
Gompertz
MCVB
Logístico
AIC
Δi
Wi
95.28
0 89.9
99.66 4.38 10.1
120.16 24.89 0
95.55
95.76
97.05
0
0.22
1.5
48
32
20
Lo importante de los estudios previos, tanto de
campo como de cultivo, es que demuestran que el
crecimiento obtenido en el presente estudio está dentro
de lo esperado y se pueden consideran resultados
confiables para el propósito de la presente investigación.
Según el valor obtenido de AIC, se encontró el
modelo de Gompertz como el mejor, mientras que el
menos compatible fue el MCVB en el caso del camarón
blanco. En el caso del camarón azul, el modelo
Logístico como el MCVB puede ser considerado
adecuado para describir su crecimiento (Burnham &
Anderson, 2002). Aunque el MCVB es el más
estudiado y comúnmente aplicado entre todos modelos
de longitud a la edad, su uso como el único modelo de
crecimiento no está bien soportado en el caso de
camarón blanco. Con respecto a otros estudios en
diferentes especies de camarón tampoco se seleccionó
el MCVB como el mejor para describir su crecimiento
(Montgomery et al., 2010; Ahamed & Ohtomi, 2012).
En otras especies sujetas a explotación el resultado ha
6485
sido similar; Baer et al. (2011) concluyeron que el
MCVB no es el modelo óptimo para calcular el
crecimiento del pez plano (Psetta maxima). Resultados
similares fueron encontrados por Flores et al. (2010) en
el erizo de mar (Loxechinus albus). Una crítica
completa de la aplicación a priori del MCVB en el callo
de hacha Pinna nobilis se puede consultar en
Katsanevakis (2007). En el caso del camarón azul en el
presente estudio se encontró que los tres modelos
Gompertz, MCVB y Logístico fueron seleccionados
como buenos modelos (en ese orden jerárquico).
La forma de crecimiento de ambas especies debe ser
sigmoidea ya que el mejor modelo en ambos casos fue
el de Gompertz. Los estudios en lagunas costeras con
camarón blanco solo han ajustado el MCVB, que
representa una curva exponencial invertida, sin que
necesariamente sea la verdadera forma en que crece el
camarón blanco. Simplemente, no se ajustó otro
modelo porque los objetivos de los estudios tanto de
Rivera-Velázquez et al. (2010), como Ramos-Cruz
(2000) fueron motivados por razones de manejo
pesquero y no de interés en una descripción de
comportamiento biológico. Los estudios de biología
pesquera obvian el uso de otros modelos de crecimiento
por que el MCVB es un sub-modelo de otros modelos
de manejo pesquero. Es importante resaltar que
solamente se está abordando una parte del ciclo total
del camarón, pues tanto en estuarios como en cultivos
de menos de seis meses el camarón no ha alcanzado su
etapa adulta ni su madurez.
Lo anterior es más evidente en el caso de camarón
azul donde a los 158 días de cultivo su crecimiento aún
mostraba la fase de crecimiento lineal, por esa razón y
de acuerdo al criterio propuesto por Burnham &
Anderson (2002), cualquiera de los tres modelos puede
ser utilizado para representar el crecimiento de L.
stylirsotris. De hecho, en el caso particular del crecimiento de camarón azul se probó un cuarto modelo, el
potencial y resultó con el mejor ajuste (AIC = -43). El
modelo potencial describe un crecimiento infinito sin
restricciones, y eso no es una hipótesis realista. En la
práctica, el crecimiento está limitado por los recursos
disponibles (espacio, alimento y la competencia por
ellos). Por esa razón se propuso un modelo que
contenga un término de auto limitación (asintótico). Es
necesario mencionar que el modelo potencial fue
elegido con el valor de AIC tan bajo que los Δi de los
restantes tres modelos fueron superiores a 30 y el valor
de ponderación de Akaike fue de 100% para el modelo
potencial. Indudablemente, la conclusión para camarón
azul es que se cultivó en condiciones en que aún no se
alcanzaron las limitaciones para su crecimiento y que la
etapa analizada puede ser solo una fracción del ciclo
total de la especie.
Está claro que este nuevo enfoque estadístico
basado en la teoría de la información se ha vuelto cada
vez más popular en la inferencia matemática, pero es
muy reciente en estudios biológico-pesqueros, donde
ha sido usado al menos durante una década. A pesar de
ello, Mundry (2011) sugiere usarlo con precaución en
estudios de ecología y propone una mezcla de la
utilización de pruebas de hipótesis nula y criterios de
teoría de información en circunstancias específicas. Por
lo tanto, se espera que en los estudios pesqueros
(especialmente en especies acuáticas tropicales), el uso
de AIC se convierta en una herramienta común en la
selección de modelos, pero todavía se pueden utilizar
pruebas de hipótesis nula con suficiente justificación.
La conclusión de este estudio es que la forma de
crecimiento de ambas especies debe ser sigmoidea. Sin
embargo, se debe aclarar que en camarón blanco sí se
pudo demostrar con mucha seguridad, pero que faltaría
un periodo más largo de datos de longitud a la edad en
camarón azul para incrementar la probabilidad de este
resultado.
AGRADECIMIENTOS
Este estudio forma parte del programa de ordenamiento
pesquero del noroeste de México. El autor recibió
financiamiento del proyecto CIBNOR EP0.01. Edgar
Alcántara-Razo del Laboratorio de Ecología Aplicada
y Pesquerías de la Unidad Sonora del CIBNOR mejoró
las figuras. Se agradece a los revisores anónimos que
hicieron importantes mejoras al manuscrito.
REFERENCIAS
Acosta-Ruiz, M.J., J. Paniagua-Michel, J. Olmos-Soto &
E. Paredes-Escalona. 2011. Primer registro de la
utilización de harinas de Salicornia bigelovii y
Scomber japonicus en dietas prácticas para el cultivo
súper-intensivo de camarón Litopenaeus stylirostris.
Lat. Am. J. Aquat. Res., 39(3): 409-415.
Ahamed, F. & J. Ohtomi. 2012. Growth patterns and
longevity of the pandalid shrimp Plesionika izumiae
(Decapoda: Caridea). J. Crustacean Biol., 32(5): 733740.
Alfaro-Montoya, J. 2010. The reproductive conditions of
male shrimps, genus Penaeus, sub-genus Litopenaeus
(open thelyca penaeoid shrimps): a review. Aquaculture, 300: 1-9.
Andriantahina, F., X. Liu, H. Huang & J. Xiang. 2013.
Selection for growth performance of tank-reared
Pacific white shrimp, Litopenaeus vannamei. Chin. J.
Oceanol. Limnol., 31(3): 534-541.
Aragón-Noriega, E.A. 2013. Modelación del crecimiento
individual del callo de hacha Atrina maura (Bivalvia:
Pinnidae) a partir de la inferencia multi modelo. Rev.
Biol. Trop., 61(3): 1167-1174.
Ansah, Y.B. & E.A. Frimpong. 2015. Using model-based
inference to select a predictive growth curve for
farmed tilapia. N. Am. J. Aquacult., 77(3): 281-288.
Baer, A., C. Schulz, I. Traulsen & J. Krieter. 2011.
Analysing the growth of turbot (Psetta maxima) in a
commercial recirculation system with the use of three
different growth models. Aquacult. Int., 19: 497-511.
Burnham, K.P. & D.R. Anderson. 2002. Model selection
and multi-model inference: a practical informationtheoretic approach. Springer, Nueva York, 488 pp.
Ceballos-Vázquez, B.P., E. Palacios, J. AguilarVillavicencio & I.S. Racotta. 2010. Gonadal development in male and female domesticated white leg
shrimp, Litopenaeus vannamei, in relation to age and
weight. Aquaculture, 308: 116-123.
Chávez, E.A. 1973. Estudio sobre la tasa de crecimiento
del camarón blanco (Penaeus vannamei Boone) de la
región sur del Golfo de California. Ciencia, Mex.,
28(2): 79-85.
Cruz-Vásquez, R., G. Rodríguez-Domínguez, E. AlcántaraRazo & E.A. Aragón-Noriega. 2012. Estimation of
individual growth parameters of the Cortes Geoduck
Panopea globosa from the Central Gulf of California
using a multimodel approach. J. Shellfish Res., 31(3):
725-732.
Del Valle, I. & P. Martin. 1995. Interannual variation in
the catch and mean length of penaeid shrimp in the
lagoons and coastal waters of Sinalao, NW Mexico,
and their possible link with environmental factors.
ICES Mar. Sci. Symp., 199: 370-378.
Ebert, T.A., J.D. Dixon, S.C. Schroeter, P.E. Kalvass, N.T.
Richmond, W.A. Bradbury & D.A. Woodby. 1999.
Growth and mortality of red sea urchins (Strongylocentrotus franciscanus) across a latitudinal gradient.
Mar. Ecol. Prog. Ser., 190: 189-209.
Flores, L., B. Ernst & A.M. Parma. 2010. Growth pattern
of the sea urchin, Loxechinus albus (Molina, 1782) in
southern Chile: evaluation of growth models. Mar.
Biol., 157: 967-977.
Haddon, M. 2001. Modelling and quantitative methods in
fisheries. Chapman & Hall/CRC, New York, 406 pp.
Karkach, A.S. 2006. Trajectories and models of individual
growth. Demogr. Res., 15: 347-400.
Katsanevakis, S. 2006. Modelling fish growth: model
selection, multi-model inference and model selection
uncertainty. Fish. Res., 81: 229-235.
Katsanevakis, S. 2007. Growth and mortality rates of the
fan mussel Pinna nobilis in Lake Vouliagmeni
(Korinthiakos Gulf, Greece): a generalized additive
modeling approach. Mar. Biol., 152: 1319-1331
Received: 23 April 2014; Accepted: 10 March 2016
4867
Katsanevakis, S. & D. Maravelias. 2008. Modelling fish
growth: multi-model inference as a better alternative
to a priori using von Bertalanffy equation. Fish Fish,
9: 178-187.
Montgomery, S.S., C.T. Walsh, M. Haddon, C.L. Kesby
& D.D. Johnson. 2010. Using length data in the
Schnute Model to describe growth in a metapenaeid
from waters off Australia. Mar. Freshwater Res., 61:
1435-1445.
Mundry, R. 2011. Issues in information theory-based
statistical inference a commentary from a frequentist´s
perpective. Behav. Ecol. Sociobiol., 62: 57-68.
Pérez-Velázquez, M., M.L. González-Félix, D.A. Davis,
L.A. Roy & X. Zhu. 2013. Studies of the thermal and
haline influences on growth and survival of
Litopenaeus vannamei and Litopenaeus setiferus. J.
World Aquacult. Soc., 44(2): 229-238.
Pusceddu, A., L. Della-Patrona & B. Beliaeff. 2011.
Trophic status of earthen ponds used for semiintensive shrimp (Litopenaeus stylirostris Stimpson,
1874) farming in New Caledonia (Pacific Ocean).
Mar. Environ. Res., 72: 160-171.
Ramos-Cruz, S. 2000. Composición por tallas, edad y
crecimiento de Litopenaeus vannamei (Natantia:
Penaeidae), en la laguna Mar Muerto, OaxacaChiapas, Mexico. Rev. Biol. Trop., 48(4): 873-882.
Ricker, W.E. 1975. Computation and interpretation of
biological statistics of fish populations. Fish. Res. Bd.
Can. Bull., 191: 1-382.
Rivera-Velázquez, G., I. Salgado-Ugarte, L. Soto & E.
Naranjo. 2010. Un estudio de caso en el análisis de la
distribución de frecuencias de tallas de Litopenaeus
vannamei (Boone, 1931) mediante el uso de
estimadores de densidad por Kernel. Lat. Am. J.
Aquat. Res., 38(2): 201-209.
Schnute, J. & K. Groot. 1992. Statistical analysis of
animal orientation data. Anim. Behav., 43: 15-33.
Sookying, D., F.S.D. Silva, D.A. Davis & T.R. Hanson.
2011. Effects of stocking density on the performance
of Pacific white shrimp Litopenaeus vannamei
cultured under pond and outdoor tank conditions using
a high soybean meal diet. Aquaculture, 319: 232-239.
Suresh, A.V., K.P. Kumaraguru-Vasagam & S. Nates.
2011. Attractability and palatability of protein
ingredients of aquatic and terrestrial animal origin, and
their practical value for blue shrimp, Litopenaeus
stylirostris fed diets formulated with high levels of
poultry byproduct meal. Aquaculture, 319: 132-140.
Von Bertalanffy, L. 1938. A quantitative theory of organic
growth (inquiries of growth laws II). Hum. Biol.,
10(2): 181-213.
Von Bertalanffy, L. 1957. Quantitative laws in metabolism and growth. Quart. Rev. Biol., 32(3): 217-231.
Lat. Am. J. Aquat. Res., 44(3): 487-496, 2016 Induced spawn in the spotted sand bass using lhrha
487
Research Article
Effects of a luteinizing hormone-releasing hormone analogue (LHRHa)
on the reproductive performance of spotted sand bass Paralabrax
maculatofasciatus (Percoidei: Serranidae)
Juan Pablo Alcántar-Vázquez1a, Hugo Skyol Pliego-Cortés1b, Silvie Dumas1, Renato Peña-Martínez1
Martín Rosales-Velázquez1 & Pablo Pintos-Terán1c
1
Unidad Piloto de Maricultivos, Centro Interdisciplinario de Ciencias Marinas
Instituto Politécnico Nacional (CICIMAR-IPN). La Paz, Baja California Sur, México
1a
Laboratorio de Acuicultura, Universidad del Papaloapan (UNPA)
Loma Bonita, Oaxaca, México
1b
Departamento de Recursos de Marinos, Centro de Investigación y de Estudios Avanzados CINVESTAV-IPN
Unidad Mérida, Cordemex, Mérida, Yucatán, México
1c
Instituto de Industrias, Universidad del Mar (UMAR), Distrito de San Pedro Pochutla
Oaxaca, México
Corresponding author: Juan Pablo Alcántar-Vázquez (jupasoul@hotmail.com)
ABSTRACT. Hormonal induction of spotted sand bass Paralabrax maculatofasciatus, was investigated in order
to induce and synchronize spawning. Three experiments were conducted using wild fish captured in the Gulf of
California: 1) LHRHa (luteinizing hormone-releasing hormone analogue) induced spawning with concentrations
of 25, 50, 100 µg kg-1 and saline solution, 2) Effects of LHRHa on motility and sperm density, and 3) Induction
and incubation of spawns obtained using LHRHa. In experiments 2 and 3 using concentrations of 12.5, 25, 50
µg kg-1 and saline solution. In experiment 1, a higher spawning ratio was observed for the concentration of 25
µg kg-1; however, no significant differences were observed in the proportion of floating (viable) eggs. In
experiment 2, significant differences (P < 0.05) were observed in duration of sperm motility and sperm density,
with highest duration registered for wild fish (control group) and highest density registered for laboratory control
group and concentration of 12.5 µg kg-1. In experiment 3, significant differences (P < 0.05) were observed
between treatments in volume of spawned eggs and proportion of fertilized eggs, with higher values shown for
the concentrations of 50 and 12.5 µg kg-1, respectively. Survival at hatching and proportion of live yolk-sac larvae
were significantly higher (P < 0.05) for the concentration of 12.5 µg kg-1. LHRHa was effective in inducing and
synchronizing the spawning of spotted sand bass, a process which will be used for massive egg production.
Keywords: Paralabrax maculatofasciatus, LHRHa, spawn, survival, sperm cell density, sperm motility.
Efectos de un análogo de la hormona liberadora de la hormona luteinizante (LHRHa)
en el desempeño reproductivo de la cabrilla arenera Paralabrax
maculatofasciatus (Percoidei: Serranidae)
RESUMEN. Se analizó la inducción hormonal en la cabrilla arenera Paralabrax maculatofasciatus, para inducir
y sincronizar el desove. Se desarrollaron tres experimentos utilizando peces capturados en el Golfo de
California: 1) Inducción al desove con LHRHa, usando concentraciones de 25, 50, 100 µg kg-1 y solución salina,
2) efectos del LHRHa sobre la motilidad y la densidad espermática, y 3) inducción e incubación de desoves
obtenidos con LHRHa. En los experimentos 2 y 3 se utilizaron concentraciones de 12.5, 25, 50 µg kg-1 y solución
salina. En el primer experimento se observó una proporción de desoves más elevada utilizando la concentración
de 25 µg kg-1, pero, no se observaron diferencias significativas en la proporción de huevos flotantes (viables).
En el segundo experimento se observaron diferencias significativas (P < 0.05) en la duración de la motilidad y
densidad espermáticas, con la mayor duración en peces silvestres (grupo control), y la mayor densidad en el
grupo control de laboratorio a una concentración de 12.5 µg kg-1. En el tercer experimento se observaron diferen-
__________________
Corresponding editor: Erich Rudolph
488
cias significativas (P < 0,05) en el volumen de huevos desovados y proporción de huevos fertilizados, con los
mayores valores en las concentraciones de 50 y 12,5 µg kg-1, respectivamente. La supervivencia a la eclosión y
proporción de larvas vitelinas vivas fue significativamente mayor (P < 0,05) en la concentración de 12,5 µg kg1
. El LHRHa fue eficaz para inducir y sincronizar desoves de cabrilla arenera utilizados para la producción
masiva de huevos.
Palabras clave: Paralabrax maculatofasciatus, LHRHa, desove, supervivencia, densidad de células
espermáticas, motilidad espermática.
INTRODUCTION
Spotted sand bass Paralabrax maculatofasciatus
(Steindachner, 1868), is a protogynous hermaphrodite
species (Lluch-Cota, 1995) with a reasonable potential
for culture on the northwest coast of Mexico due to its
apparently suitable characteristics for aquaculture
(Álvarez-González et al., 2001), including its adaptability to environmental changes, low territoriality and
potential for induced spawning under controlled
laboratory conditions, all factors which allow for the
mass production of juveniles almost all year (AvilésQuevedo et al., 1995; Rosales-Velázquez, 1997;
Martínez-Brown, 2007). Additionally, several techniques involved in spotted sand bass cultivation have
been successfully developed in our laboratory,
including larval culture (Álvarez-González et al.,
2000), juvenile nutrition and grow-out in sea cages
(Álvarez-González et al., 2001; Grayeb-del Alamo,
2001). However, when reared in captivity from larvae,
sexual maturation occurs precociously before
commercial size is reached (unpublished data). This is
a major problem for fish farming because sexual
maturation is accompanied, in many species, by a
decrease in growth rate and survival (Felip et al., 2001;
Piferrer et al., 2009). Production of triploid fish could
be a solution to this problem, but first it is necessary to
develop a protocol of hormonal induction in order to
synchronize the spawning of spotted sand bass that
normally occurs in captivity and be able to obtain male
and female gametes which could be manually fertilized
in order to induce a triploid treatment.
Environmental and hormonal manipulation have
become reliable fish farming methods for inducing
gonadal maturity and synchronizing ovulation,
spermiation and spawning under culture conditions
(Donaldson & Hunter, 1983; Nagahama, 1994; Zohar
& Mylonas, 2001; Asturiano et al., 2005; BosakKahkesh et al., 2010). Superactive analogues such as
mammalian luteinizing hormone releasing hormone
(LHRHa) are widely preferred alone or in combination
with a dopamine receptor antagonist over native LHRH
and other compounds in a number of freshwater and
marine species (Ngamvongchon et al., l988; Thomas &
Boyd, l988; Alvariño et al., 1992; Carrillo et al., 1995;
Morehead et al., 1998; Brzuska, 1999; Nayak et al.,
2001; Duncan et al., 2003; Cek & Gökce, 2006).
LHRHa has suitable characteristics such as high
biological activity, low specificity, zero side effects and
reasonable price (Zohar & Mylonas, 2001) which make
it a perfect candidate for its use in the spotted sand bass.
The aim of this work is to study the effectiveness of
the LHRHa administration for inducing and synchronizing spawning in wild, spotted sand bass broodstock
in order to obtain gametes that will be used for the mass
production of juveniles and in triploidy induction
experiments.
Experimental fish
A wild broodstock of spotted sand bass was captured in
the southern part of the Gulf of California (Bay of La
Paz, Mexico, 24°9′N, 110°19′W). In total, 52 females
(150-250 g) and 90 males (300-500 g) were obtained.
The broodstock was transported to the Unidad Piloto de
Maricultivos at CICIMAR-IPN. Upon arrival, the fish
were sexed by the shape of genital papillae and stocked
separately for 14 days for acclimation in 600-L circular
fiberglass tanks organized in a closed recirculating
system under a controlled photoperiod (13L:11D) and
constant temperature (22-23ºC). They were fed ad
libitum once a day with squid and frozen fish. To avoid
circadian variations, all experiments were initiated in
the morning.
Experiment 1. LHRHa induced-spawning
Females were anesthetized with 2-phenoxyethanol
(400 mg L-1), and a 2-mm diameter polyethylene
cannula (E.D. 2 mm; I.D. 1 mm) was used to retrieve
egg samples. Mean diameter of eggs was obtained by
measuring their major axis with imaging software
(Image Pro Plus v4.5, Media Cybernetics, Jandal
Scientific, Silver Spring, Maryland, USA). Only
females that showed late-vitellogenic eggs with a
diameter over 400 µm (Ocampo, 2002) were induced to
spawn.
In total, 32 females were randomly divided into four
groups of eight fish each. Each fish´s caudal peduncle
Induced spawn in the spotted sand bass using lhrha
was individually marked with a color-coded plastic disc
(Rosales-Velázquez, 1997). Three LHRHa (des-Gly10,
[D-Ala6] LH-RH Ethylamide, Sigma-Aldrich, St
Louis, Missouri, USA) concentrations were used: 25,
50 and 100 µg kg-1. Injections of a physiological saline
solution (0.7% NaCl; 0.5 mL kg-1) were applied as
control group. Fish were injected intramuscularly into
the base of the lateral fin. LHRHa concentration for
females was divided into two injections with a 24 h
interval. Females were checked for ovulated eggs every
12 h after injection by applying gentle finger pressure
to the abdomen from the anterior-to-posterior direction.
Spawned eggs were collected by manual striping,
placed in plastic bowls and then transferred to a
graduated cylinder to volumetrically estimate the
number of eggs. Floating eggs were considered viable,
while eggs that sank were considered non-viable. Based
on volumetric estimates made by Rosales-Velázquez
(1997) on the number of eggs per mL (1800), the total
number of spawned eggs per female was obtained.
Experiment 2. Effects of LHRHa on motility and
sperm density
For this experiment, 64 males were randomly divided
into eight groups of eight males each. Three LHRHa
concentrations were used: 12.5, 25 and 50 µg kg-1 (two
groups per concentration); and as control groups, two
groups were injected with a physiological saline
solution (0.5 mL kg-1). The concentration was administered in a single intramuscular injection into the base of
the lateral fin. Twelve hours after injection, one group
per concentration was sacrificed, including a control
group. Sperm was extracted by applying gentle
pressure to the testes. Collected sperm was refrigerated
at 4ºC in a 2-mL test tube. Motility was evaluated
immediately after milt collection with the technique
described by Rodríguez-Gutiérrez (1992). In brief,
using a disposable pipette tip, 10 µL of each milt
sample was placed on a concave microscope slide and
activated by adding 30 µL of filtered seawater (2-µm
filter, UV-sterilized, chlorinated at 0.25 g 15 L-1 for 24
h, and then neutralized with sodium thiosulphate at 0.15
g 15 L-1). Sperm motility was assessed within 5 s of
dilution of semen. Each sperm sample was examined
per triplicate under an optical microscope at 40x.
Percentage of sperm cells demonstrating motility was
recorded at different times after activation in each trial.
Sperm cells were considered to be motile when forward
movement was observed. All trials were conducted at
23ºC and only with samples that exhibited initial
motilities of at least 90%.
Sperm density was determined with a hemocytometer by the technique described by Coffin (1959).
Milt was first diluted in a 20-mL test tube by adding 10
489
µL of milt to 10 mL of non-activating solution (5.0 g
NaCO2, 1 mL formaldehyde, 100 mL distilled water),
then mixed for 30 s with a vortex mixer. Triplicate
counts of five squares each were made on the
hemocytometer for each dilution. The mean of the three
counts was used to calculate actual sperm density.
Samples were left undisturbed on the hemocytometer
for five minutes prior to counting to allow sperm cells
to settle. Counts were conducted using an optical
microscope under a magnification of x40.
These procedures were repeated 24 h after injection
in the four remaining tanks. In addition, two more
control groups were used; one wild control group
(WiC) that included three males sacrificed 24 h after
their arrival from the field and one untreated control
group (laboratory control, LbC) composed of seven
males sacrificed at the time of the experiment (two
weeks after their arrival from the field), three males
sacrificed 12 h after injection of the LHRHa-treated
groups and four males sacrificed 24 h after injection of
the LHRHa-treated groups. Evaluation of sperm
motility and density was performed by one observer (in
each case) to avoid bias errors.
Experiment 3. Induction and incubation of spawns
obtained with LHRHa
For this experiment, four groups of five males and five
females each were stocked in a closed recirculating
system composed of 1000-L fiberglass circular tanks
equipped with egg collectors that received and filtered
water from the top of the broodstock tank. The LHRHa
concentrations for females were selected based on
results obtained in the first experiment (12.5, 25 and 50
µg kg-1). The concentration selected for males was 25
µg kg-1. The LHRHa concentration was administered in
a single intramuscular injection to both males and
females. Control males and females were injected as
described above.
Egg collectors were checked every day and the
proportion of floating eggs was volumetrically
evaluated. Three samples of 100 viable (floating) eggs
were collected for each LHRHa concentration and
incubated at 23ºC in plastic cylinders with aerated,
filtered seawater and a working volume of 2-L.
Survival at hatching was calculated as the number of
larvae with respect to the number of initial eggs and
expressed as a percentage. Proportion of live yolk-sac
larvae was calculated as the number of live yolk-sac
larvae/hatched larvae.
Statistical analysis
Percentage data were logarithmically transformed
(Log2 and Log10) before statistical analysis (Sokal &
Rohlf, 1998). Normality was verified using a
490
Kolmogorov-Smirnov test and homogeneity of variances using a Levene test. One-way ANOVA was used to
compare the effects of different LHRHa concentrations
in experiment 1. For experiment 2, one-way ANOVA
was used to compare the effect of different
concentrations of LHRHa on sperm density and a twoway ANOVA was used to compare the effects of
different LHRHa concentrations and time on sperm
motility. A Tukey test was used when significant
differences were detected. For experiment 3, a
Cochran´s Q test was used to compare the volume of
spawned eggs and the proportion of fertilized eggs
between days. A chi-square goodness-of-fit test was
used to compare the total volume of spawned eggs and
the proportion of fertilized eggs between groups. A
one-way ANOVA was used to compare the effects of
different LHRHa concentrations on survival at hatching
and proportion of live yolk-sac larvae. The established
level of significance for all analyses was P < 0.05.
RESULTS
LHRHa induced-spawning
Spawns were obtained 36 h after the second injection
of LHRHa applied to females in all treated groups. No
females injected with saline solution spawned. A higher
spawning ratio was observed for the concentration of
25 µg kg-1 with a greater number of spawned females
compared to the concentrations of 50 and 100 µg kg-1
(Table 1). No significant differences (P > 0.05) were
found in proportion of live embryos showed between
the three LHRHa concentrations (Table 1); however, a
tendency was observed for a higher volume of spawned
eggs in the lower concentrations.
Effects of LHRHa on motility and sperm density
The WiC group showed a significantly (P < 0.05)
longer duration of sperm motility until 90 to 100% loss
compared to the LHRHa-treated groups and the LbC
group (Table 2). Between the LHRHa-treated groups,
the concentration of 25 µg kg-1 showed a significantly
longer (P < 0.05) duration of sperm motility until 100%
loss compared to the concentrations of 12.5 and 50 µg
kg-1 both at 12 and 24 h after injection (Table 2). The
concentrations of 12.5 and 25 µg kg-1 showed a
significantly longer (P < 0.05) duration of sperm
motility until 10 to 50% loss at 12 and 24 h after
injection compared to that observed in the
concentration of 50 µg kg-1. The LbC group showed
statistically similar times of loss of sperm motility to
that registered for the concentration of 50 µg kg-1. The
lowest times of sperm motility were observed
consistently in the saline solution group, especially 24
h after injection.
Table 1. Spawning ratio, volume of spawned eggs (mL),
floating eggs (mL) and percentage of live embryos (%)
obtained 36 h after the second injection in the LHRHatreated groups and the saline solution group (Sg).
LHRHa (µg kg-1)
Sg 25 50 100
Spawning ratio 0:8 6:8 2:8 3:8
Spawned eggs 0 85 58 27
Floating eggs
0 79 56 25
Live embryos
0 93 96 96
Significant differences (P < 0.05) in sperm cell
density were observed between the LHRHa-treated
groups; however, the highest sperm cell density was
observed for the LbC group at 12 h after injection. The
concentration of 12.5 µg kg-1 showed a significantly (P
< 0.05) higher sperm cell density compared with the
concentrations of 25 and 50 µg kg-1 and the saline
solution group (Table 3). No significant differences (P
> 0.05) were detected between the LbC group and
concentration of 12.5 µg kg-1 at 12 or 24 h after
injection. The WiC group showed a statistically similar
sperm cell density to that observed for the
concentrations of 25 and 50 µg kg-1 at 12 h after
injection. Sperm cell density showed a decrease 24 h
after injection for all groups treated with LHRHa, LbC
group and saline solution-injected group. The saline
solution group showed significantly (P < 0.05) lower
values of sperm cell density at 12 and 24 h after
injection.
Induction and incubation of spawns obtained with
LHRHa
Eggs were observed for three days in the egg collectors
placed in each tank after injection of the LHRHatreated groups and saline solution group. An increase in
number of spawned eggs was observed 24 h after
injection in all LHRHa-treated groups, including the
saline group (Fig. 1a); however, the highest volume of
spawned eggs and proportion of fertilized eggs were
observed 48 h after injection in the concentrations of
12.5 and 50 µg kg-1 (Fig. 1b). Egg production decreased
by day three in all groups (Fig. 1c). No significant
differences (P > 0.05) were detected upon each daily
observation in volume of spawned eggs and proportion
of fertilized eggs. Significant differences (P < 0.05)
between treatments were observed for total volume of
spawned eggs and proportion of fertilized eggs. The
highest volume of spawned eggs was observed for the
concentration of 50 µg kg-1 (171 mL) compared with
the concentrations of 12.5 (125 mL) and 25 µg kg-1 (50
mL) and the saline solution group (87 mL); however,
the highest proportion of fertilized eggs was detected
491
Table 2. Time (s) of loss of different percentages of sperm motility obtained at 12 and 24 h after injection in the LHRHatreated groups, wild control group (WiC), laboratory control group (LbC) and the saline solution group (Sg). Values
expressed as mean ± standard error. Different superscripts in each column indicate significant differences (P < 0.05).
Time (h) Group n
12
24
WiC
LbC
12.5
25
50
Sg
LbC
12.5
25
50
Sg
3
3
7
4
6
4
4
7
6
4
4
Loss of sperm motility (%)
10
50
90
100
60 ± 5ab 132 ± 6a 233 ± 8a 943 ± 7a
57 ± 5ab
95 ± 6bc 123 ± 7bc 233 ± 22c
a
77 ± 5
118 ± 4ab 161 ± 5b 392 ± 26c
a
72 ± 6
116 ± 8ab 160 ± 9b 806 ± 15b
43 ± 2b
78 ± 4c 108 ± 5c 187 ± 7c
40 ± 2b
81 ± 6c 114 ± 3c 167 ± 8c
cd
34 ± 2
72 ± 4de 108 ± 5bc 234 ± 21cd
ab
56 ± 3
97 ± 3bc 129 ± 5bc 351 ± 10c
a
69 ± 3
115 ± 5ab 155 ± 7b 513 ± 45b
bcd
43 ± 5
79 ± 4de 125 ± 8bc 230 ± 24cd
d
28 ± 5
64 ± 1c
55 ± 5c 152 ± 6d
Table 3. Sperm cell density obtained at 12 and 24 h after
injection in the LHRHa-treated groups, the wild control
group (WiC), the laboratory control group (LbC) and the
saline solution group (Sg). Values expressed as means ±
standard error. Sp: sperm cells. Different superscripts
indicate significant differences (P < 0.05).
Time (h)
12
24
Group
WiC
LbC
12.5
25
50
Sg
LbC
12.5
25
50
Sg
Sp x 107
380 ± 44b
665 ± 77a
590 ± 45a
360 ± 36b
380 ± 31b
200 ± 20d
285 ± 29bc
265 ± 20c
170 ± 14d
225 ± 22cd
155 ± 15d
for the concentration of 12.5 µg kg-1 (32%) followed by
the concentrations of 25 µg kg-1 (18%), 50 (16.4%) and
the saline solution group (4.6%).
Incubation of fertilized eggs differed between the
LHRHa-treated groups. A significant (P < 0.05)
increase in survival at hatching and proportion of live
yolk-sac larvae were observed for the concentration of
12.5 µg kg-1 compared with the concentrations of 25
and 50 µg kg-1. A tendency toward lower survival at
hatching and lower proportion of live yolk-sac larvae
was observed in the higher LHRHa concentrations,
with a significantly lower (P < 0.05) value shown for
the concentration of 50 µg kg-1 (Table 4).
DISCUSSION
LHRHa induced-spawning
Superactive LHRH analogues have been used with
great success for inducing and synchronizing the
spawning of several teleosts (Donaldson et al., 1981;
Zohar & Mylonas, 2001). With spotted sand bass, it has
also proven to be effective in inducing and
synchronizing spawning. In our work, 25 µg kg-1 was
the most efficient LHRHa concentration for inducing
spawning, with a ratio of 6:8 females. These results are
similar to those obtained by Alvariño et al. (1992) for
European seabass (Dicentrarchus labrax), whereby a
concentration of 20 µg kg-1 was able to increase the
quantity of eggs and ovulation rate (rate of eggs that
have been released from the follicle and are ready to be
expelled). Other studies have found similar results
using low concentrations of LHRHa alone or in
combination with other hormones (Arabaci et al., 2001;
Denson et al., 2007; Bosak-Kahkesh et al., 2010).
Morehead et al. (1998) mention that for some species
the application of low concentrations is more effective
in inducing ovulation and spawning. However, for most
teleost, LHRHa is usually applied in concentrations
ranging from 1 to 600 µg kg-1 (Zohar, 1988; Zohar &
Mylonas, 2001).
Higher concentrations of LHRHa were less
effective with spotted sand bass in increasing the
number of spawned eggs or proportion of viable eggs.
It has been reported that higher concentrations of
LHRHa can cause physical stress resulting in lower egg
production due to inhibition of the maturation process
(Garcia, 1993). However, it is important to point out
that the decrease in egg production observed in our work
492
Table 4. Percentage of survival at hatching (Sh) and
proportion of live yolk-sac larvae (Ll) obtained from
spawns collected 48 h after injection of the LHRHatreated groups. Values expressed as mean ± standard error.
Er: embryos per replicate. Different superscripts in each
column indicate significant differences (P < 0.05).
LHRHa (µg kg-1)
12.5
25
50
Er
Sh
Ll
a
100 86.2 ± 2.3 77.0 ± 5.8a
100 28.4 ± 7.0b 22.0 ± 8.6b
100 10.1 ± 2.2c 5.0 ± 2.3c
pends on water temperature, physiology of species and
whether LHRHa is applied alone or in combination
with other hormones (Arabaci et al., 2001; Takushima
et al., 2004; Bosak-Kahkesh et al., 2010).
Figure 1. Volume of total and fertilized eggs obtained with
a single injection of LHRHa in the spotted sand bass.
a) volume of eggs obtained 24 h after injection, b) volume
of eggs obtained 48 h after injection, c) volume of eggs
obtained 72 h after injection. Sg: saline solution group.
was not accompanied by a decrease in egg viability.
This could be explained by the fact that LHRHa does
not cause significant side effects and manual spawning
was carried out during the optimal time period,
ensuring a high egg viability as stated by Zohar &
Mylonas (2001). Females injected with saline solution
did not spawn or show any effect caused from the
injection. This agrees with the results obtained by Barry
et al. (1995) for walleye (Stizostedion vitreum),
whereby the control group reached neither ovulation
nor spawning.
Latency period between final injection and initial
egg release for spotted sand bass was approximately 36
h. Several studies have found latency periods as early
as 14 h or as late as 48 h after injection. This period de-
Effects of LHRHa on motility and sperm density
Maximum duration of sperm motility recorded at 12
and 24 h was observed for the WiC group, which
probably was related to the fact that spotted sand bass
males were captured during breeding season (FebruaryJuly) (Ocampo, 2002). This means that the fish were
under optimal environmental conditions, including the
presence of mature females. In LHRHa-treated groups,
the concentration of 25 µg kg-1 showed the longest
duration of sperm motility, followed by the concentration of 12.5 µg kg-1. This appears to confirm that for
spotted sand bass LHRHa is more efficient in low
concentrations. On the other hand, the fact that the LbC
group had higher sperm motility values than the group
injected with saline solution shows the negative effect
caused by handling techniques since both groups
received the same treatment except for the injection.
The highest sperm motility values in the LHRHatreated groups were reached 12 h after injection for the
concentration of 25 µg kg-1. Garcia (1993) and Mylonas
et al. (1997) mention that the effect of a single injection
of LHRHa has a short duration, possibly a few hours,
but that the exact time depends on the particular species
and reproductive state of the fish. For spotted sand bass,
the effect of a single injection ended approximately 12
h after injection, since after 24 h the values of sperm
motility decreased in the LHRHa-treated groups.
According to Nagahama (1994), it is probable that
injection of LHRHa stimulates an increase of
gonadotropin hormones (GtH), which results in a
higher production of the steroid 17α20β-DP. An
increase in plasma levels of this steroid causes an
elevation of pH of sperm duct (~8.0) and accumulation
of cAMP (cyclic adenosine monophosphate) inside
sperm cells, stimulating the acquisition of sperm
motility. The higher sperm motility values found in the
LHRHa-treated groups compared to the LbC and saline
solution groups are probably the result of this process,
which allows for a potential increase in sperm motility.
However, for spotted sand bass, the increase in sperm
motility caused by the injection of LHRHa was not
enough to reach the levels observed in the WiC group.
Tvedt et al. (2001) report that the application of a
weekly injection of LHRHa in Atlantic halibut
(Hippoglossus hippoglossus) produces an increase in
sperm motility only after 40 days from the time of the
first injection.
Sperm cell density after the LHRHa injection was
higher at 12 h in all groups compared to 24 h. Mylonas
et al. (1997) report that LHRHa administrated through
injection produces an increase of the GtH II, therefore
reducing sperm cell density due to the production of
seminal fluid and testes hydration, which are processes
associated with the final stages of testes maturity and
spermiation. Similar results have been observed in
yellowtail flounder (Pleuronectes ferrugineus)
(Clearwater & Crim, 1998), plaice (P. platesa)
(Vermeirssen et al., 1998), winter flounder (P.
Americannus) (Shaangguan & Crim, 1999), Atlantic
halibut (Tvedt et al., 2001) and pejerrey (Odontesthes
bonariensis) (Miranda et al., 2005). The observed
reduction in sperm cell density 24 h after injection in
all LHRHa-treated groups is probably the result of the
increase in seminal fluid caused by the LHRHa
injection. However, it is difficult to explain the
observed decrease in sperm cell density in the LbC
group. Garcia (1993) mentions that this could be the
result of physiological stress produced by handling
techniques. Additionally, Kime (1993) mentioned that
in closed recirculating water systems the pheromones
of treated fish can affect control groups.
In spotted sand bass, the effect of a single LHRHa
injection on sperm cell density is short-lived. This is
consistent with that reported by Garcia (1993) for rabbit
fish (Siganus guttatus) in which case semen must be
collected 24 h after the first injection since beyond this
time the sperm volume decreases back to normal levels.
Mylonas et al. (1997) reported that the short duration
of the LHRHa effect is not exclusive to this neuro
hormone. Similar results have been obtained with
different species by injecting HCG or other
gonadotropin preparations. These authors also suggest
that an increase in the production of seminal fluid is the
first effect caused by the increase of plasma levels of
GtH II, and that to observe an increase in sperm cell
density, a sustained treatment is necessary through
LHRHa delivery systems or repetitive injections.
Induction and incubation of spawns obtained with
LHRHa
Using the results obtained in the first experiment, we
decided to use a lower concentration of LHRHa with
493
the purpose of increasing the number of spawned and
fertilized eggs. However in this case, only the
proportion of fertilized eggs was higher compared to
the other LHRHa concentrations used. The higher
volume of eggs obtained in all groups for several days
was probably caused by the characteristics of the closed
recirculating system used. The egg collectors of the
system provided more suitable conditions for obtaining
multiple spawns by eliminating the need to obtain
spawns manually. The system was isolated, reducing
human interference to a minimum; and the fish used
were acclimated for a period of two weeks prior to the
experiment and probably were in an advanced stage or
even had completed the process of vitellogenesis at the
moment of applying the LHRHa injection. It has been
reported that degree of ovarian development and
proximity to spawning will influence responsiveness to
hormone preparations (Denson et al., 2007).
Although we obtained spawns for three days, the
volume of unfertilized eggs was high in all LHRHatreated groups, including the saline solution group. This
was probably caused by the design used in the tanks to
collect eggs. After eggs are expelled by females, they
have only a few minutes to be fertilized before going
from the tank through the main conduct to the
recollection system. If this time is not enough to allow
for proper contact between eggs and sperm, it can cause
many viable eggs to die. Additionally, if the recirculation velocity of tank water is high, the contact time
between gametes could be reduced. However, we
cannot rule out that our results could be affected by
other factors such as lack of synchronicity between
females and males, age, nutrition and health status, and
other environmental factors due to the wild origin of the
broodstock used. The interaction of these factors can
explain the variation observed between days 2 and 3 for
the concentration of 50 µg kg-1.
Another factor that could explain the higher number
of fertilized eggs obtained 48 h after injection is the
increase in seminal fluid produced by the LHRHa
injection. This increase probably causes sperm to
become less dense thereby increasing its capacity to
fertilize mature eggs (Vermeirssen et al., 1998;
Asturiano et al., 2005). The observed reduction in
sperm cell density 24 h after injection in all LHRHatreated groups supports this.
Use of LHRHa
One reason why LHRH analogues have become widely
used is that in theory they cause no negative side
effects, even in higher concentrations. Although in the
first experiment the proportion of floating viable eggs
was not affected by the LHRHa concentration, the use
of higher concentrations in the third experiment
provoked a significant decrease in survival at hatching
494
and proportion of live yolk-sac larvae after incubation.
Alvariño et al. (1992) report that stress associated with
handling and sampling or elevated hormonal
concentrations can produce harmful effects on the
reproduction process, hatching percentage and larval
survival. This could explain the lower hatching
percentages obtained after incubation for the
concentrations of 25 and 50 µg kg-1. King & Pankhurst
(2004) report for Atlantic salmon (Salmo salar) a high
hatching rate (>80%) but a lower survival rate of fish
injected with LHRHa compared with control fish.
However, Barry et al. (1995) found in experiments with
walleye that LHRHa applied in a single injection was
enough to induce final maturation and ovulation
without causing negative effects to the fish, the
percentage of fertilized eggs or larval survival.
Additionally, Donaldson et al. (l981) report that
survival until first stages of the larval period was higher
(98%) in LHRHa-treated groups (0.1 and 0.2 mg kg-1)
compared to the control group (93%).
Hormonal stimulation is capable of inducing and
synchronizing the spawning of several females for
massive egg production, allowing for the planning and
management of farming activities. In this case, LHRHa
was highly efficient in inducing the spawning of wild
females of spotted sand bass that presented eggs of a
minimum diameter of 400 µm and for improving sperm
motility in males. According to results obtained, the
optimum concentration for spotted sand bass is 12.5 µg
kg-1 for females and 25 µg kg-1 for males. With the use
of these two concentrations it will be possible to obtain
frequent spawns without any negative side effects on
hatching rate or proportion of live yolk-sac larvae. This
will allow for the production of gametes that will be
used in triploidy induction experiments.
ACKNOWLEDGEMENTS
This project has been supported by the Consejo
Nacional de Ciencia y Tecnología (CONACYT) of
Mexico (Project 3166-B) and by the Comisión de
Operación y Fomento de Actividades Académicas
(COFAA-IPN). Special thanks to James Patrick
Killough (research professor of the Universidad del
Papaloapan) and Lyn Fuchs for editorial improvements.
REFERENCES
Álvarez-González, C.A., R. Civera-Cerecedo, J.L. OrtizGalindo, S. Dumas, M. Moreno-Legorreta & T.
Grayeb-del Alamo. 2001. Effect of dietary protein
level on growth on body composition of juvenile
spotted sand bass, Paralabrax maculatofasciatus, fed
practical diets. Aquaculture, 194: 151-159.
Álvarez-González, C.A., J.L. Ortiz-Galindo, S. Dumas, S.
Martínez-Díaz, D.E. Hernández-Ceballos, T. Grayebdel Alamo, M. Moreno-Legorreta, R. Peña-Martínez
& R. Civera-Cerecedo. 2000. Effect of stocking
density on the growth and survival of spotted sand bass
Paralabrax maculatofasciatus larvae in a closed
recirculating system. J. World Aquacult. Soc., 32: 130137.
Alvariño, J.M., M. Carrillo, S. Zanuy, F. Prat & E.
Mañanos. 1992. Pattern of sea bass oocyte development after ovarian stimulation by LHRHa. J. Fish
Biol., 41: 965-970.
Arabaci, M., Ç. Hasmet & S. Mustafa. 2001. Induction of
spawning in common carp (Cyprinus carpio) using
LHRHa ([d-ser (tbu)6, pro9-net]-LHRH) combined
with haloperidol: effects of different treatment time
and determination of latency period dependence on
temperature. Turk. J. Fish. Aquat. Sci., 1: 1-5.
Asturiano, J.F., L. Pérez, D.L. Garzón, S.D. Peñaranda, F.
Marco-Jiménez, S. Martínez-Llorens, A. Tomás & M.
Jover. 2005. Effect of different methods for the
induction of spermiation on semen quality in European
eel. Aquac. Res., 36: 1480-1487.
Avilés-Quevedo, A., U. McGregor-Pardo, R. RodríguezRamos, O. Hirales, M. Huerta-Bello & M. Iizwa.
1995. Biología y cultivo de la cabrilla arenera
Paralabrax maculatofasciatus (Steindachner, 1868).
Centro de Investigaciones Pesqueras, La Paz, B.C.S.,
85 pp.
Barry, T., J. Riebe. J. Parrish & J. Malison. 1995. 17α,
20β-dihydroxy-4-pregnen-3-one stimulates cortisol
production by rainbow trout interrenal tissue in vitro:
mechanism of action. In: F.W. Goetz & P. Thomas
(eds.). Proceedings of the V International Symposium
on the Reproductive Physiology of Fish. Austin,
Texas, 2-8 July, pp. 325-329.
Bosak-Kahkesh, F., M. Yooneszadeh-Feshalami, F. Amiri
& M. Nickpey. 2010. Effect of ovaprim, ovatide,
HCG, LHRH-A2, LHRHA2+CPE and carp pituitary
in benni (Barbus sharpeyi) artificial breeding. Global
Vet., 4: 209-214.
Brzuska, E. 1999. Artificial spawning of herbivorous fish:
use of an LHRH-a to induce ovulation in grass carp
Ctenopharyngodon idella (Valenciennes) and silver
carp Hypophthalmichthys molitrix (Valenciennes).
Aquac. Res., 30: 849-856.
Carrillo, M., S. Zanuy, F. Prat, J. Cerda, J. Ramos, E.
Mañanos & N. Bromage. 1995. Sea bass (Dicentrarchus labrax). In: N. Bromage & R. Roberts (eds.).
Broodstock management, egg and larval quality.
Wiley-Blackwell, Oxford, pp. 138-168.
Cek, S. & M.A. Gökce. 2006. The effects of [D-Ala6 Pro9
NEt]-LHRHa and LHRHa + pimozide on plasma sex
steroid profiles in adult female seabream (Sparus
aurata). Pakistan J. Biol. Sci., 9: 1486-1491.
Clearwater, S.J. & L.W. Crim. 1998. Gonadotrophin
releasing hormone-analogue treatment increases
sperm motility, seminal plasma pH and sperm
production in yellowtail flounder Pleuronectes
ferrogineus. Fish Physiol. Biochem., 19: 349-357.
Coffin, D.L. 1959. Laboratorio clínico en medicina
veterinaria. La Prensa Médica Mexicana, México,
D.F., 335 pp.
Denson, R.M., E.W. Jenkins, L.D. Berlinsky & T.I.J.
Smith. 2007. A comparison of human chorionic
gonadotropin and luteinizing hormone releasing
hormone analogue for ovulation induction in black sea
bass Centropristis striata (Linnaeus, 1758). Aquac.
Res., 38: 918-925.
Donaldson, E.M. & G.A. Hunter. 1983. Induced final
maturation, ovulation and spermation in cultured fish.
In: W.S. Hoar, D.J. Randall & E.M. Donaldson (eds.).
Fish physiology. Vol. IX, Part B: Reproduction.
Academic Press, Orlando, pp. 351-403.
Donaldson, E.M., G.A. Hunter & H.M. Dye. 1981.
Induced ovulation in coho salmon (Oncorhynchus
kisutch). II. Preliminary study of the use of LH-RH and
two high potency LH-RH analogues. Aquaculture, 26:
129-141.
Duncan, N.J., G.A. Rodríguez-Montes de Oca, D. Alok &
Y. Zohar. 2003. Effects of controlled delivery and
acute injections of LHRHa on bullseye puffer fish
(Sphoeroides annulatus) spawning. Aquaculture, 218:
625-635.
Felip, A., F. Piferrer, S. Zanuy & M. Carrillo. 2001.
Comparative growth performance of diploid and
triploid European sea bass over the first four spawning
seasons. J. Fish Biol., 58: 76-88.
Garcia, L.M. 1993. Sustained production of milt in
rabbitfish, Siganus guttatus Bloch, by weekly injection
of luteinizing hormone-releasing hormone analogue
(LHRHa). Aquaculture, 113: 261-267.
Grayeb-del Alamo, T. 2001. Efecto de la densidad en el
crecimiento de la cabrilla arenera Paralabrax
maculatofasciatus (Percoidei:Serranidae) cultivada en
jaulas flotantes. Masther´s Thesis, CICIMAR-IPN,
Mexico, 119 pp.
Kime, D.E. 1993. Classical and non-classical reproductive
steroids in fish. Rev. Fish Biol. Fisher., 3: 160-180.
King, H.R. & N.W. Pankhurst. 2004. Effect of short-term
temperature reduction on ovulation and LHRHa
responsiveness in female Atlantic salmon (Salmo
salar) maintained at elevated water temperatures.
Lluch-Cota, D. 1995. Aspectos reproductivos de la
cabrilla arenera Paralabrax maculatofasciatus (Pisces:Serranidae) en Bahía Magdalena-Almejas, Baja
California Sur, México. Masther´s Thesis, CICIMARIPN, Mexico, 174 pp.
495
Martínez-Brown, J.M. 2007. Efecto del nivel de inclusión
de ácidos grasos esenciales y proteína en el alimento
de reproductores de cabrilla arenera Paralabrax
maculatofasciatus (Percoidei: Serranidae) sobre la
calidad de las primeras fases de vida. Master´s Thesis,
CICIMAR-IPN, Mexico, 99 pp.
Miranda, L.A., M.C. Cassara & G.M. Somoza. 2005.
Increase in milt production by hormonal treatment in
the
pejerrey fish
Odontesthes bonariensis
(Valenciennes, 1835). Aquac. Res., 36: 1473-1479.
Morehead, D., N. Pankhurst & A. Ritar. 1998. Effect of
treatment with LHRH analogue on oocyte maturation,
plasma sex steroid levels and eggs production in
female striped trumpeter Latris lineata (Latreidae).
Mylonas, C.C., A. Gissis, Y. Magnus & Y. Zohar. 1997.
Hormonal changes in male white bass (Morone
chrysops) and evaluation of milt quality after treatment
with a sustained-release GnRHa delivery system.
Nagahama, Y. 1994. Endocrine regulation of
gametogenesis in fish. Int. J. Dev. Biol., 38: 217-229.
Nayak, P.K., T.K. Mishra, B.N. Singh, A.K. Pandeyab &
R.C. Das. 2001. Induced maturation and ovulation in
Heteropneustes fossilis by using LHRHa, pimozide
and ovaprim for production of quality eggs and larvae.
Indian J. Fish., 48(3): 269-275.
Ngamvongchon, S., O. Pawaputanon, W. Leelapatra & W.
Johnson. 1988. Effectiveness of an LHRH analogue
for the induced spawning of carp catfish in Northeast
Thailand. Aquaculture, 74: 35-40.
Ocampo, C.J.A. 2002. Desarrollo gonádico y actividad
reproductiva de la cabrilla arenera Paralabrax
maculatofasciatus (Teleostei: Serranidae) en la Bahía
de La Paz, Baja California Sur. Master´s Thesis,
CICIMAR-IPN, Mexico, 78 pp.
Piferrer, F., B. Beaumont, C.J.C. Falguiere, D.M.
Flajshans, P.E. Haffray & L. Colombo. 2009.
Polyploid fish and shellfish: production, biology and
applications to aquaculture for performance improvement and genetic containment, Aquaculture, 293:
125-156.
Rodríguez-Gutiérrez, M. 1992. Técnicas de evaluación
cuantitativa de la madurez gonádica en peces. AGT,
México, 79 pp.
Rosales-Velázquez, M.O. 1997. Efecto de la alimentación
sobre los desoves de la cabrilla arenera Paralabrax
maculatofasciatus (Teleostei:Serranidae) mantenida
en cautiverio. Master’s Thesis, CICIMAR-IPN,
Mexico, 70 pp.
Shaangguan, B. & L.W. Crim 1999. Seasonal variations
in sperm productions and sperm quality in male winter
496
flounder, Pleuronectes americanus: the effects of
hypophysectomy, pituitary replacement therapy and
GnRH-A. Aquaculture, 134: 19-27.
Sokal, R.R. & F.J. Rohlf. 1998. Biometry. The principles
and practice of statistics in biological research. W.H.
Freeman and Company, New York, 880 pp.
Takushima, M., R. Nozaki, K. Kadomura, S. Yasumoto &
K. Soyano. 2004. Induced ovulation using LHRHa and
artificial fertilization in devil stinger, Inimicus
japonicas. Fish Physiol. Biochem., 28: 521-522.
Thomas, P. & N. Boyd. 1988. Induced spawning of
spotted sea trout, red drum and orangemouth corvina
(Familiy: Sciaenidae) with luteinizing hormonereleasing hormone analog injection. Contrib. Mar.
Sci., 30: 43-48.
Tvedt, B.H., T.J. Benfey, D.J. Martin-Robichaud & J.
Power. 2001. The relationship between sperm density,
spermatocrit, sperm motility and fertilization success
in Atlantic halibut Hippoglossus hippoglossus.
Received: 1 October 2015; Accepted: 10 March 2016
Vermeirssen, E.L.M., A.P. Scott, C.C. Mylonas & Y.
Zohar. 1998. Gonadotrophin-releasing hormone
agonist stimulates milt fluidity and plasma concentrations of 7, 20β-dihydroxylated and 5β-reduced, 3αhydroxylated C21 steroids in male plaice (Pleuronectes
platesa). Gen. Comp. Endocr., 112: 163-177.
Zohar, Y. 1988. Gonadotropin releasing hormone in
spawning induction in teleosts: basic and applied
considerations. In: Y. Zohar & B. Breton (eds.).
Reproduction in fish: basic and applied aspects in
endocrinology and genetics. Proceedings of the
French-Israeli Symposium, Tel-Aviv (Israel) 10-12
November 1986. INRA, pp. 47-60.
Zohar, Y. & C. Mylonas. 2001. Endocrine manipulations
of spawning in cultured fish: from hormones to genes.
Lat. Am. J. Aquat. Res., 44(3): 497-503, 2016
Anfioxos de México
497
Research Article
Composición taxonómica y distribución de los cefalocordados
(Cephalochordata: Amphioxiformes) en México
Luis Fernando Del Moral-Flores1, Miguel Ángel Guadarrama-Martínez1 & César Flores-Coto2
1
Laboratorio de Zoología, Facultad de Estudios Superiores Iztacala
Universidad Nacional Autónoma de México, Tlalnepantla, Estado de México, México
2
Laboratorio de Zooplancton, Instituto de Ciencias del Mar y Limnología
Universidad Nacional Autónoma de México, Circuito Exterior, México
Corresponding autor: Luis Del Moral-Flores (delmoralfer@gmail.com)
RESUMEN. A partir de especímenes examinados, revisión de colecciones de referencia y literatura, se
determina la presencia en los mares mexicanos de cuatro especies de cefalocordados (dos géneros y una familia).
Además, se precisan las localidades de registro y una clave taxonómica para su identificación. En el Golfo de
México y Caribe mexicano se registra la presencia de tres de las cuatro especies, de las cuales Branchiostoma
caribaeum tiene la mayor área de distribución, desde la costa de Veracruz hasta la Península de Yucatán; B.
longirostrum solo está registrada en la zona occidental del Golfo de México y Asymmetron lucayanum frente a
la costa noreste de Yucatán. Branchiostoma californiense es la única registrada en la costa del Pacífico mexicano
pero tiene amplia distribución.
Palabras clave: anfioxos, protocordados, acrania, Branchiostomatidae.
Taxonomic composition and distribution of cephalochordates
(Cephalochordata: Amphioxiformes) from Mexico
ABSTRACT. Based on the number of specimens examined, review of reference collections and literature, we
determined the presence of four cephalochordates (two genera and one family) in the seas of Mexico; moreover,
the registry of the locations is denoted also a taxonomic key for their identification comes attached. The presence
of three of the four species for the Gulf of Mexico and the Mexican Caribbean is registered, of which
Branchiostoma caribaeum has the largest distributional area, from Veracruz coasts to the Yucatan Peninsula; B.
longirostrum has been registered only on the west part of the Gulf of Mexico and Asymmetron lucayanum in
front of the northeastern coast of Yucatan. Branchiostoma californiense is the only one registered on the Pacific
coast of Mexico but it counts with a wider distribution.
Keywords: acrania, anfioxus, protochordata, Branchiostomatidae.
INTRODUCCIÓN
El phylum Chordata está representado por organismos
deuterostomados, cuyas sinapomorfías más evidentes
son: presencia de notocorda, hendiduras faríngeas,
endostilo, epineuria (posición dorsal del tubo neural) y
una cola postanal (extensión corporal posterior al ano)
(Barrington, 1965; Florkin & Scheer, 1974; Gans &
Bell, 2001). Este phylum comprende tres subphylum:
Urochordata (ascidias, salpas, barrilitos de mar y
apendicularias), Cephalochordata (anfioxos o lancetas
de mar) y Vertebrata (e.g., Myxini, Cephalaspido-
__________________
morphii, Chondrichthyes, Actinopterygii, Sarcopterygii) (Kirkaldy, 1895; Parker & Haswell, 1987;
Nelson, 2006).
Los cefalocordados, comprenden una sola familia
(Branchiostomatidae) y son conocidos comúnmente
como anfioxos o lancetas de mar. Se reconocen por la
presencia de una notocorda persistente, algunas veces
visible a través de la pared corporal, que se extiende
hasta el extremo anterior del cuerpo; forma corporal
ahusada en ambos extremos (de donde deriva el
nombre de “Amphioxus”, Fig. 1); y finalmente por
498
Figura 1. Características típicas de un cefalocordado
juvenil. a) notocorda; b) aleta dorsal; c) faringe con
hendiduras; d) rostro; e) aleta caudal; f) ano; g) aleta
ventral (preanal); h) atrioporo; i) pliegues metapleurales;
j) campana oral con tentáculos (cirros).
una metamerización, marcada en los paquetes musculares corporales (miótomos) que están agrupados y
separados por tejido conjuntivo (mioseptos) (Kirkaldy,
1895). En la actualidad, se considera válidas a 35
especies de cefalocordados, todas incluídas en la
familia Branchiostomatidae, repartidas en tres géneros:
Asymmetron, Branchiostoma y Epigonichthys (Poss &
Boschung, 1996; Nishikawa, 2004; Nelson, 2006; Yu
& Holland, 2009).
Son exclusivamente marinos, con amplia distribución en aguas templadas y tropicales. La mayoría de
las especies son de hábitos bentónicos que viven en
aguas someras cercanas a la costa, aunque algunas
pueden habitar a grandes profundidades y otras pasan
la mayor parte de su vida formando parte del plancton
(Richardson & McKenzie, 1994; Gibss & Wickstead,
1996; Nishikawa, 2004). Todas las especies son dioicas
y sin dimorfismo sexual aparente. Las larvas pueden ser
bentónicas o planctónicas (Florkin & Scheer, 1974;
Poss & Boschung, 1996; Yu & Holland, 2009). Las
especies bentónicas se encuentran asociadas a fondos
arenosos donde se entierran dejando al descubierto
solamente los tentáculos orales para la captura de su
alimento; también se encuentran en sustratos
constituidos por sedimentos areno-fangosos con
tamaño grande de partícula. Sin embargo, los fondos
fangosos así como las bajas salinidades pueden ser
factores limitantes en su distribución en zonas
estuarinas (Barrington, 1965; Parker & Haswell, 1987;
Álvarez-León, 2001) y aunque se registran comúnmente en aguas libres de contaminación, pueden
distribuirse en zonas con alto impacto antropogénico
(Silva et al., 2008; Vargas & Dean, 2010).
Debido a su forma de vida, juegan un rol importante
en los recambios de energía dentro de los ecosistemas
marinos. Además tienen un alto valor en los estudios
evolutivos, por presentar características tanto del grupo
de los cordados (e.g., notocorda, hendiduras faríngeas,
epineuría), como de otros organismos menos especializados (e.g., presencia de protonefridios, carencia de
estructuras óseas y sensoriales especializadas, así como
de extremidades pareadas) (Barrington, 1965; Parker &
Haswell, 1987; Silva et al., 2008; García-Fernández &
Benito-Gutiérrez, 2009; Yu & Holland, 2009).
A pesar de su importancia, su estudio en aguas
mexicanas ha sido muy escaso. De hecho, sólo existen
tres trabajos. Chávez (1964, 1965) registra por primera
vez una especie para el Atlántico mexicano
(Branchiostoma caribaeum) en Veracruz (Isla Sacrificios), Campeche (Sonda de Campeche), y Boschung
(1986) registra la presencia de Branchiostoma
longirostrum en el sur del Golfo de México. Puede
mencionarse también la contribución de Cameron
(2009), que hizo una recopilación de los trabajos
previos pero sin actualizar la taxonomía de las especies.
Debido al escaso conocimiento sobre la composición específica de los cefalocordados que habitan en
los mares mexicanos, se presenta una sinopsis de la
información disponible sobre las especies registradas
en México, y se incluyen los registros de especímenes
revisados, así como una breve clave de identificación.
Se examinaron 3.347 especímenes recolectados en
diversas localidades de los mares mexicanos. La
mayoría de ellos (3.311) fueron capturados durante
muestreos realizados en septiembre y octubre de 2003,
en el Golfo de México. El material biológico se
recolectó mediante un muestreo vertical desde 50 m de
profundidad a superficie, usando una red cónica de 30
cm de boca y apertura de malla de 200 μm. Cada
muestra fue fijada en formalina al 4%. Además, se
revisaron 229 registros de ejemplares depositados en
colecciones científicas (CAS: California Academy of
Sciences, Ichthyological Collection; CMNFI: Canadian
Museum of Nature, Fish Collection; CNPE-IBUNAM:
Colec-ción Nacional de Peces, Instituto de Biología,
Universidad Nacional Autónoma de México; CYMXCINVESTAV-IPN: Colección de Invertebrados Bentónicos de Yucatán, Centro de Investigación y de
Estudios Avanzados-Mérida, Instituto Politécnico
Nacional; LACM: Natural History Museum of Los
Ángeles County; SIO: SCRIPPS Institution of
Oceanography Marine Vertebrate Collection; USNM:
Smithsonian National Museum of Natural History,
Vertebrate Zoology; UAIC: University of Alabama
Ichthyological Collection. Acrónimos de acuerdo con
Sabaj-Pérez (2014).
RESULTADOS
El análisis del material examinado evidencia la
presencia de dos géneros y cuatro especies de la familia
Branchiostomatidae: Asymmetron lucayanum, Branchiostoma caribaeum, B. longirostrum y B. californiense.
Anfioxos de México
499
Figura. 2. Mapa de distribución de las especies de cefalocordados registradas para las costas de México. Algunos símbolos
representan más de un registro.
Las tres primeras están presentes en el Golfo de México
y Caribe; mientras que B. californiense es la única
registrada en el Pacífico mexicano, donde está
ampliamente distribuida (Fig. 2).
Distribución y aspectos relevantes de la taxonomía
de las especies registradas en aguas mexicanas
Phylum Chordata Haeckel, 1874
Clase Leptocardii Müller, 1845
Orden Amphioxiformes Anónimo (= Pharingobranchii;
Branchiostomiformes; Amphioxi)
Familia Branchiostomatidae Bonaparte, 1846 (=
Cirrostomi)
De acuerdo a Poss & Boschung (1996) este es el
nombre correcto para la familia, pero otros autores la
refieren erróneamente como Branchiostomidae (Gill,
1893; Kirkaldy, 1895; Bigelow & Farfante, 1948;
Parker & Haswell, 1987; Cameron, 2009).
Género Branchiostoma Costa, 1834
Branchiostoma Costa, 1834: 49. Genotipo: Branchiostoma
lubricum Costa [= Branchiostoma lanceolatum (Pallas,
1774)].
Para el nombre genérico y común, en innumerables
estudios se encuentra el nombre de “Amphioxus”, para
designar a todas las lancetas o para un género típico, a
pesar que está universalmente aceptado el hecho de que
Amphioxus es una homonimia estricta de Branchiostoma.
Figura. 3. Esquema representativo de Branchiostoma
californiense. Modificado de Kirkaldy (1895).
Branchiostoma californiense Andrews, 1893 (Fig. 3)
Branchiostoma californiense Andrews, 1893: 238, 241
(descripción original; localidad tipo: San Diego,
California, U.S.A.).
Diagnosis: fórmula de miotomos: 40 (40-45) preatrioporales + 18 (14-19) del atrioporo al ano + 9 (8-9)
postanales = 67 (64-71) totales. Cámaras radiales
dorsales 355 (317-419). Cámaras radiales ventrales (o
preanales) 44 (35-59). Número máximo de gónadas =
36. Ano situado muy posteriormente de la parte media
del lóbulo inferior de la aleta caudal. Campana oral y
cirros reducidos, de menor tamaño mientras mayor sea
la edad del organismo. Rostro muy reducido. Talla
máxima = 83,5 mm, es la especie más grande dentro del
género (Poss & Boschung, 1996).
Distribución en México: se distribuye desde la costa
noroccidental de la Península de Baja California hasta
la costa de Oaxaca, incluyendo al Golfo de California.
Es posible que su distribución alcance la costa sur de
Chiapas, debido a que hay registros en Centroamérica
500
(Poss & Boschung, 1996; Vargas & Dean, 2010), pero
es evidente la carencia de estudios sobre estos
organismos.
Referencias: Jordan & Evermann (1896: 4); Beebe &
Tee-Van (1941: 89).
Registros de colección: Baja California (CAS 18770,
LACM 22402, SIO 62-169, USNM 46683); Baja
California Sur (CAS 48449, CMNFI 1968-1330.1,
LACM 21901, SIO 61-251); Jalisco (LACM 22314);
Nayarit (LACM 22418); Oaxaca (CNPE-IBUNAM
10103, LACM 23237); Sinaloa (FACIMAR s/c, SIO
59-199); Sonora (USNM 232568, SIO 59-40).
Figura. 4. Branchiostoma caribaeum, vista lateral
generalizada. Modificado de Bigelow & Farfante (1948).
Branchiostoma caribaeum Sundevall, 1853 (Fig. 4)
Branchiostoma caribaeum Sundevall, 1853: 12 (descripción original; localidad tipo: Saint Thomas, Islas
Vírgenes, Caribe).
Diagnosis: Fórmula de miótomos: 37 (27-37) peratrioporales + 15 (11-18) del atrioporo al ano + 9 (7-10)
dorsales 295 (228-341). Cámaras radiales ventrales 32
(22-50). Número máximo de gónadas = 27. Ano muy
cerca de la parte media del lóbulo inferior de la aleta
caudal. Rostro reducido, aleta rostral ligeramente
separada de la aleta dorsal por una pequeña depresión.
Talla máxima = 54,8 mm.
Distribución en México: desde la costa central de
Veracruz hasta la Península de Yucatán. Es muy
probable que se encuentre en otras localidades del
Golfo de México y costas del Caribe mexicano. Sin
embargo, la falta de estudios ha impedido conocer en
detalle sus patrones de distribución.
Referencias: Chávez (1964: 705; 1965: 153).
Registros de colección: Campeche (ICMyL s/n);
Yucatán (CYMX-27169-PR).
Figura. 5. Esquema representativo de Branchiostoma
longirostrum. Modificado de Boschung (1983).
Branchiostoma longirostrum Boschung, 1983 (Fig. 5)
Branchiostoma longirostrum Boschung, 1983: 92
(descripción original; localidad tipo: aproximadamente
24 km al sur de Mobile Bay, Alabama, 30°03Ń,
88°03´W, fondo arenoso a una profundidad de 18 m).
Diagnosis: Fórmula de miótomos: 36 (34-38) preatrioporales + 15 (15-19) del atrioporo al ano + 10 (10-12)
(26-53). Número máximo de gónadas = 30. Ano muy
cerca o posterior de la parte media del lóbulo inferior
de la aleta caudal. Rostro bien desarrollado, sobresaliente del cuerpo, aleta rostral continúa con la dorsal.
Talla máxima = 58 mm.
Referencias: Chávez (1964: 705, in parte); Boschung
(1986: 151).
Registros de colección: no existe. Distribución en
México: se distribuye en la parte occidental del Golfo
de México, y su registro más meridional corresponde a
la costa central del Estado de Veracruz. Boschung
(1986) indica que los especímenes mexicanos son los
primeros registros en el Golfo de México al sur del
Trópico de Cáncer y los primeros en profundidades <11
m.
Género Asymmetron Andrews, 1893
Asymmetron Andrews, 1893: 34. Genotipo: Asymmetron
lucayanum.
Las etapas juveniles de Asymmetron lucayanum han
sido confundidas, al punto que Gill (1895) generó una
nueva familia Amphioxididae, actualmente no válida
(Hubbs, 1922; Bigelow & Farfante, 1948; Parker &
Haswell, 1987; Gibbs & Wickstead, 1996; Poss &
Boschung, 1996). Esta etapa larvaria-juvenil puede
considerarse un parataxón, por lo que se incluye en la
clave artificial para distinguir entre las etapas larvarias
y adultos de los anfioxos.
Figura. 6. Esquema representativo de Asymmetron
lucayanum. Modificado de Andrews (1893).
Asymmetron lucayanum Andrews, 1893 (Fig. 6)
Branchiostoma pelagicum fue descrita por Günther
(1889) y se empleó como genotipo de Epigonichthys
Hubbs, 1922, por tanto Asymmetron lucayanum
descrita a su vez por Andrews (1893) había sido
relegada como sinonimia de Epigonichthys (Poss &
Boschung, 1996). Sin embargo, estudios recientes
revalidan el género Asymmetron (Nishikawa, 2004).
Hubbs (1922) separa los géneros Asymmetron y
Epigonichthys, creando para ésta su propia familia
(Epigonichthiyidae). Otros autores como Bigelow &
Farfante (1948), Nelson (2006), y Cameron (2009)
consideran que las diferencias de Asymmetron con los
otros dos géneros son suficientes para validar la
existencia de la familia Epigonichthiyidae. Aquí se
Anfioxos de México
sigue la propuesta de Poss & Boschung (1996) y por
tanto se considera válida solo a la familia Branchiostomatidae.
Asymmetron lucayanum Andrews, 1893: 34 (descripción original; localidad tipo: estación marina Johns
Hopkins, Alice Town, norte de Bimini, Bahamas, fondo
de arena calcárea).
Diagnosis: Fórmula de miótomos 36 (36-52) preatrioporales + 16 (13-18) del atrioporo al ano + 8 (7-9)
(0-68). Número máximo de gónadas = 29. Ano anterior
de la parte media del lóbulo inferior de la aleta caudal.
Gónadas presentes en una hilera, únicamente del lado
derecho del cuerpo; aleta caudal variable, donde la
notocorda sobrepasa la musculatura y se forma un
proceso urostiloide. Metapleura derecha continua con
la aleta ventral media, que pasa a la derecha del ano.
Campana preoral extensa, cirros unidos por una
membrana en la mayor parte de su longitud, con cirros
intrabucales. Proceso notocordal rostral largo, aleta
rostral muy variable en forma y en el resto de sus aletas
debido a sus hábitos pelágicos (Bigelow & Farfante,
1948). Aleta caudal reducida a ausente. Talla máxima
= 90 mm.
Distribución en México: hacia el extremo noreste de la
costa de Yucatán.
Referencias: Ninguna.
Registros de colección: Yucatán (UAIC 6244.01).
DISCUSIÓN
En México se encuentran representadas solo cuatro de
las 35 especies de cefalocordados consideradas válidas
a nivel mundial (Poss & Boschung, 1996; Cameron,
2009): Branchiostoma californiense, B. caribaeum, B.
longirostrum y Asymmetron lucayanum. La primera es
la única especie reconocida para el Pacífico mexicano,
donde está ampliamente distribuida, las otras tres
ocurren en el Golfo de México y Caribe.
Entre la literatura analizada se hace mención al
registro de Branchiostoma floridae Hubbs, 1922 en
colectas provenientes de México (Poss & Boschung,
1996; Cameron, 2009). Sin embargo, no se encontró
ningún espécimen o registro que valide su presencia en
aguas jurisdiccionales del país. De igual modo, Poss &
Boschung (1996) mencionan dos registros de B.
elongatum Sundevall, 1852 para Bahía Thurloe, Baja
California, México, ambos resguardados en la
colección del USNM. Al ser verificada su georreferencia de recolecta se encontró que ésta corresponde
a la parte baja de California, USA. La identidad de estos
501
organismos debe ser verificada, debido a que B.
elongatum sólo está registrada en las costas de Perú y
Chile, incluyendo a las islas Galápagos (Vergara et al.,
2012).
Estudios recientes evidencian que Asymmetron
lucayanum, especie de distribución circumglobal, es en
realidad un complejo de especies crípticas, representadas por poblaciones de tres regiones marinas
definidas: grupo del Atlántico, del Pacífico centrooccidental y del Indopacífico occidental (Kon et al.,
2006, 2007). Este enmascaramiento puede suceder en
ciertas especies mexicanas, como en B. californiense,
debido a que posee una amplia distribución a lo largo
de la costa del Pacífico oriental. Sin embargo, es
recomendable una revisión taxonómica detallada de
esta especie, considerando la tendencia de especiación
simpátrica en los cefalocordados (Poss & Boschung,
1996; Kon et al., 2006).
Con respecto a los caracteres anatómicos empleados
en su taxonomía, se ha considerado el uso de las
hendiduras faríngeas y cirros orales como caracteres
diagnósticos, aunque Poss & Boschung (1996) señalan
una gran variación ontogénica en el número y
disposición anatómico de estas estructuras. Se
menciona además una amplia variabilidad intraespecífica en las especies americanas. En algunas de
ellas, por ejemplo, puede variar el número de miótomos
afectando la posición relativa del atrioporo y el ano,
alteración posiblemente influenciada por la temperatura
en su desarrollo (Hubbs, 1922; Nishikawa, 1981). Esto
dificulta el establecimiento de proporciones estándar
para definir a una especie determinada, aunado a la
afectación en tamaño y forma de los caracteres como
aletas (rostral, dorsal y caudal) de los organismos que
se han fijado y permanecen preservados en colecciones
de referencia (Poss & Boschung, 1996); esta es una
problemática en la taxonomía de los cefalocordados. En
la actualidad, se ha enfatizando la importancia de los
estudios a nivel molecular, para facilitar el reconocimiento de especies (Nohara et al., 2004; Kon et al.,
2006, 2007), así como para identificar su relación
evolutiva con los cordados (Holland & Holland, 2001;
Holland et al., 2008; Yu et al., 2008).
Para verificar su estatus taxonómico actual y
elaborar una clave que permita distinguir las especies
registradas en México, se consultaron las descripciones
originales de las especies, diagnosis básicas, revisiones
sistemáticas y su contraste con ejemplares depositados
en colecciones de referencia (Costa, 1834; Andrews,
1893; Hubbs, 1922; Bigelow & Farfante, 1948;
Boschung, 1983; Richardson & McKenzie, 1994; Poss
& Boschung, 1996).
502
Clave para los anfioxos/lancetas registrados en
aguas marinas de México
1a Boca como una hendidura orientada hacia el lado
izquierdo del cuerpo, sin cirros orales; cámara atrial
abierta; hendiduras faríngeas en una sola serie, hacia la
zona ventral o lateralmente contrarias a la boca; sin
gónadas visibles o sólo cómo rudimentos .…parataxón
“Amphioxididae”, etapa larvaria
1b Boca de tamaño y posición media, con cirros orales;
cámara atrial cerrada, hendiduras faríngeas pareadas y
laterales, dentro de la cámara atrial, que presenta su
salida en un atrioporo; gónadas en ocasiones visibles a
través de la pared del cuerpo, dependiendo del estado
de maduración………………………………….……2.
2a Más de 64 miótomos; con un mínimo de 50 cámaras
radiales ventrales……………………………...……..3.
2b Menos de 64 miótomos; sin cámaras radiales
ventrales o cuando presentes menos de 50 ………..…4.
3a Más de 300 cámaras radiales dorsales. Fórmula de
miótomos: 40 a 45 (44) + 14 a 19 (16) + 8 a 9 (9);
proceso rostral corto…........................Branchiostoma
californiense (Fig. 3).
3b Menos de 300 cámaras radiales dorsales. Fórmula de
miótomos: 34 a 38 (36) + 15 a 19 (16) + 10 a 12 (10);
proceso rostral largo (2,9% de la LT)....B. longirostrum
(Fig. 5).
4a Pliegues metapleurales simétricos, terminando cerca
del atrioporo; gónadas simétricas, visibles en ambos
pliegues; sin proceso urostiloide; fórmula de miótomos:
27 a 37 (37) + 11 a 18 (15) + 7 a 10 (9) …….…….B.
caribaeum (Fig. 4).
4b Pliegues metapleurales asimétricos, el pliegue
derecho continúa con la aleta caudal, pasando a la
derecha del ano; gónadas asimétricas, sólo en el pliegue
derecho; proceso urostiloide largo; fórmula de miótomos: 36 a 52 (36) + 13 a 18 (16) + 6 a 9 (8).
………………………Asymmetron lucayanum (Fig. 6).
AGRADECIMIENTOS
Se agradece la ayuda brindada por las diferentes
instituciones y responsables de las principales colecciones ictiológicas y bentónicas de referencia. Al Dr.
Stuart G. Poss por habernos brindado amablemente una
copia de su obra. A los Dres. G.M. Torres Alfaro
(CICIMAR) y J.R. Bastida Zavala (UMAR, Puerto
Ángel) por su apoyo y préstamo de material científico.
MAGM agradece el apoyo brindado durante sus
estudios de licenciatura a J.A. Martínez-Pérez, J.L.
Tello-Musi y M.M. Chávez-Arteaga (FES-I).
REFERENCIAS
Álvarez-León, R. 2001. Branchiostoma caribeum (Pisces:
Myxinidae) en las costas del Caribe colombiano.
Dahlia, Rev. Asoc. Colomb. Ictiol., 4: 47-50.
Andrews, E.A. 1893. An undescribed acraniate:
Asymmetron lucayanum. Stud., Biol. Lab. Johns
Hopkins Univ., 5: 213-247.
Barrington, E.J.W. 1965. The biology of Hemichordata
and Protochordata. Freeman and Company, San
Francisco, 176 pp.
Beebe, W. & J. Tee-Van. 1941. Fishes from the Tropical
Eastern Pacific. From Cedros Island, Lower California,
South to the Galápagos Islands and Northern Peru Part
1. Lancelets and Hag-fishes. Zoologica, 26(14): 89-91.
Bigelow, H.B. & I.P. Farfante. 1948. Fishes of the western
North Pacific. Lancelets. Mem. Sears Found. Mar.
Res., 1: 1-28.
Boschung, H. 1983. A new species of lancelet,
Branchiostoma longirostrum (order Amphioxi), from
the western North Atlantic. Northeast Gulf Sci., 6(2):
91-97.
Boschung, H. 1986. Ocurrence of Branchiostoma
longirostrum from Veracruz, Mexico. Northeast Gulf
Sci., 8(2): 151.
Cameron, C.B. 2009. Cephalochordata of the Gulf of
Mexico. In: D.L. Felder & D.K. Camp (eds.). Gulf of
Mexico-Origins, waters, and biota. Biodiversity Texas
A&M Press, Texas, pp. 1205-1208.
Chávez, H. 1964. Branchiostoma caribaeum in Mexican
waters of the Gulf of Mexico. Copeia, 1964(4): 705.
Chávez, H. 1965. Segundo registro de Branchiostoma
caribaeum (Sundevall) en aguas mexicanas. Anal.
Inst. Nal. Invest. Biol. Pesq., 1: 153.
Costa, O.G. 1834. Cenni zoologici, ossia descrizione
somrnaria delle specie nuove di Animali discopteri in
diverse contrade del Regno nell'anno. Anu. Zool.,
1834: 1- 90.
Florkin, M. & B.T. Scheer. 1974. Chemical zoology:
deuterostomians, cyclostomes, and fishes. Academic
Press, New York, 8: 682 pp.
Gans, C. & C.J. Bell. 2001. Vertebrates, overview.
Volume 5 R-Z. In: S.A. Levin (ed.). Encyclopedia of
biodiversity. Academic Press, San Diego, pp. 755-766.
García-Fernández, J. & E. Benito-Gutiérrez. 2009. It’s a
long way from amphioxus: descendants of the earliest
chordate. BioEssays, 31: 665-675.
Gibbs, P.E. & J.H. Wickstead. 1996. The myotome
formula of the lancelet Epigonichthys lucayanum
(Acrania): can variations be related to larval dispersion
patterns? J. Nat. Hist., 30(4): 615-627.
Gill, T. 1893. Families and subfamilies of fishes. Mem.
Natl. Acad. Sci., 6(6): 125-138.
Gill, T. 1895. The genera of Branchiostomidae. Am. Nat.,
29(341): 457-459.
Anfioxos de México
Günther, A.C.L.G. 1889. Report on the pelagic fishes.
Voyage of H.M.S. “Challenger”. Zool., 31(78): 1-47.
Haeckel, E. 1874. Anthropogenie oder Entwicklungsgeschichte des Menschen. Engelmann, Leipzig, 732
pp.
Holland, L.Z. & N.D. Holland. 2001. Evolution of neural
crest and placodes: amphioxus as a model for the
ancestral vertebrate. J. Anat., 199(1-2): 85-98.
Holland, L.Z., R. Albalat, K. Azumi & E. BenitoGutiérrez. 2008. The amphioxus genome illuminates
vertebrate origins and cephalochordate biology.
Genome Res., 18(7): 1100-1111.
Hubbs, C.L. 1922. A list of the lancelets of the world with
diagnoses of five new species of Branchiostoma.
Occas. Pap. Mus. Zool., Mich., 105: 1-16.
Jordan, D.S. & B.W. Evermann. 1896. Fishes North and
Middle America: a descriptive catalogue of the species
of fish-like vertebrates found in the waters of North
America, north of the Isthmus of Panama. Part I. Bull.
U.S. Nat. Mus., 47: 1-1240.
Kirkaldy, J.W. 1895. A revision of the genera and species
of the Branchiostomatidae. Quart. J. Microsc. Sci., 37:
303-323.
Kon, T., M. Nohara, M. Nishida, W. Sterrer & T.
Nishikawa. 2006. Hidden ancient diversification in the
circumtropical lancelet Asymmetron lucayanum
complex. Mar. Biol., 149(4): 875-883.
Kon, T., M. Nohara, Y. Yamanoue, Y. Fujiwara, M.
Nishida & T. Nishikawa. 2007. Phylogenetic position
of a whale-fall lancelet (Cephalochordata) inferred
from wholw mitocondrial genome sequences. BMC
Evol. Biol., 7: 1-127.
Nelson, J.S. 2006. Fishes of the world. John Wiley &
Sons, London, 601 pp.
Nishikawa, T. 1981. Considerations on the taxonomic
status of the lancelets of the genus Branchiostoma
from the Japanese waters. Publ. Seto Mar. Biol. Lab.,
26(1-3): 135-156.
Nishikawa, T. 2004. A new deep-water Lancelet
(Cephalochordata) from off Cape Nomamisaki, SW
Japan, with a proposal of the revised system
recovering the genus Asymmetron. Zool. Sci., 21(11):
1131-1136.
Received: 7 October 2015; Accepted: 23 March 2016
503
Nohara, M., M. Nishida, V. Manthacitra & T. Nishikawa.
2004. Ancient phylogenetic separation between
Pacific and Atlantic cephalochordates as revealed by
mitochondrial genome analysis. Zool. Sci., 21(2): 203210.
Parker, T.J. & W.A. Haswell. 1987. Zoología. Cordados.
Editorial Reverté, Barcelona, 2: 238 pp.
Poss, S.G. & H.T. Boschung. 1996. Lancelets
(Cephalochordata: Branchiostomatidae): how many
species are valid? Israel J. Zool., 42(suppl.): S13-S66.
Richardson, B.J. & A.M. McKenzie. 1994. Taxonomy and
distribution of Australian cephalochordates (Chordata:
Cephalochordata). Invertebr. Tax., 8(6): 1443-1459.
Sabaj-Pérez, M.H. 2014. Standard symbolic codes for
institutional resource collections in Herpetology and
Ichthyology. [http://www.asih.org]. Reviewed: 16
January 2015.
Silva, L.F.B. da, M. Tavares & A. Soares-Gomes. 2008.
Population structure of the lancelet Branchiostoma
caribaeum (Cephalochordata: Branchiostomidae) in
the Baía de Guanabara, Rio de Janeiro, southeastern
Brazil. Rev. Bras. Zool., 25(4): 617-623.
Sundevall, C.J. 1853. Ny art af Branchiostoma
(Amphioxus caribaeum). Ofversight af Kongliga
Svenska Vetenskaps- Akademicas Forhandlingar,
Stockholm, 10(1): 11-13.
Vargas, J.A. & H.K. Dean. 2010. On Branchiostoma
californiense (Cephalochordata) from the Gulf of
Nicoya Estuary, Costa Rica. Rev. Biol. Trop., 58(4):
1143-1148.
Vergara, M., M.E. Oliva & J.M. Riascos. 2012. Population
dynamics of the amphioxus Branchiostoma elongatum
from northern Chile. J. Mar. Biol. Assoc. U.K., 92(3):
591-599.
Yu, J.K. & L.Z. Holland. 2009. Cephalochordates
(amphioxus or lancelets): a model for understanding
the evolution of chordate characters. Cold Spring
Harb. Protls., 4(9): 1084-1092.
Yu, J.K., D. Meulemans, S.J. McKeown & M. BronnerFraser. 2008. Insights from the amphioxus genome on
the origin of vertebrate neural crest. Genome Res., 18:
1127-1132.
Lat. Am. J. Aquat. Res., 44(3): 504-512, 2016 Efecto de la temperatura y fotoperiodo en nudibranquios
1
504
Research Article
Efecto de la temperatura y el fotoperiodo sobre el desarrollo temprano del
nudibranquio Diaulula punctuolata (d’Orbigny, 1837) en
condiciones de laboratorio
Margarita Pérez-Valdés1 & Ramiro Contreras-Guzmán2
1
Universidad de Los Lagos, Osorno, Chile
2
Subsecretaría de Pesca, Aysén, Chile
Corresponding author: Margarita Pérez (macepe@ulagos.cl)
RESUMEN. La temperatura juega un rol importante tanto en el desarrollo como en el crecimiento de
invertebrados marinos; de manera similar el fotoperiodo afecta significativamente la alimentación, crecimiento
y supervivencia larval. En este estudio se evaluó el efecto de la temperatura (10° y 16°C) y el fotoperiodo (8:16
y 16:8) sobre el desarrollo temprano, eclosión y supervivencia larval del nudibranquio Diaulula punctuolata, en
condiciones de laboratorio. A 16°C/8:16, la eclosión ocurrió entre 10 y 11 días post-desove (dpd); con un tiempo
fisiológico de 162,3 ± 10,1 día-grado (d°C), mientras que a 10ºC/8:16 ocurrió entre 17 y 20 dpd; 200,5 ± 27,4
d°C (F = 366,6; P < 0,05). El mayor porcentaje de eclosión 82,9% se obtuvo a 10ºC, (F = 16,63; P < 0,05)
coincidiendo con las condiciones ambientales presentes en la época de recolección de los adultos. Las larvas
obtenidas a 16°C fueron más grandes (146,3 ± 0,8 µm) que a 10°C (140,4 ± 0,5 µm) (F = 212; P < 0,05); sin
embargo, el tiempo de supervivencia fue mayor a 10°C/8:16 (21 dpd) lo que podría estar asociado a una mayor
acumulación de nutrientes durante el desarrollo embrionario. Tanto el desarrollo embrionario como larval
dependen de la temperatura pero no del fotoperiodo, un aumento de temperatura de 10º a 16°C, redujo el tiempo
cronológico hasta la eclosión en un 45,6 ± 3,4%. El fotoperiodo afectó la supervivencia larval sólo a 10°C.
Palabras clave: nudibranquios, ovipostura, larva velígera, eclosión, fotoperiodo, tiempo fisiológico.
Effect of temperature and photoperiod on the early development of nudibranch
Diaulula punctuolata (d’Orbigny, 1837) under laboratory conditions
ABSTRACT. Temperature plays an important role in both the development and growth of marine invertebrates;
furthermore, it has been observed that photoperiod significantly affects feeding, growth and larval survival. In
this study we evaluated the effect of temperatures of 10o and 16oC and photoperiods of 8:16 and 16:8 on early
development, hatching and larval survival in the nudibranch Diaulula punctuolata, under laboratory conditions.
At 16oC/8:16, hatching occurred between 10 and 11 days post-spawning (dps), with a physiological time of
162.3 ± 10.1 degree day (doC); while at 10oC/8:16, hatching took place between 17 and 20 dps; 200.5 ± 27.4
doC (F = 366.6; P ˂ 0.05). The highest hatching percentage, 82.9%, was obtained at 10oC (F = 16.63; P ˂ 0.05)
coinciding with environmental conditions present during the adult collection season. Larvae obtained at 16 oC
were larger (146.3 ± 0.8 µm) than those at 10oC (140.4 ± 0.5 µm) (F = 212; P ˂ 0.05). Nevertheless, survival
time was greater at 10oC/8:16 (21 dps), which could be associated with greater nutrient accumulation during
embryonic development. Both embryonic and larval development are dependents on temperature, but not on
photoperiod; an increase in temperature from 10º to 16oC, reduced the chronological time required up to hatching
by 45.6 ± 3.4%. Photoperiod only affected larval survival at 10oC.
Keywords: nudibranchs, spawning, veliger larvae, hatching, photoperiod, physiological time.
INTRODUCCIÓN
Para lograr un cultivo exitoso de una especie que tiene
desarrollo indirecto, es fundamental conocer las con______________________
Corresponding editor: Patricio Dantagnan
diciones ambientales que determinan los diferentes
eventos reproductivos: ciclo gametogénico (Giese &
Pearce, 1974), desarrollo de los huevos (Yang & Chen,
2005), eclosión, desarrollo larval y finalmente, asenta-
505
2
miento y metamorfosis. Las señales ambientales
controlan o sincronizan los ciclos reproductivos de
muchos invertebrados marinos. Se ha demostrado que
el fotoperiodo y la temperatura son las señales que
ajustan la reproducción ya sea en forma combinada o
individualmente, y son fundamentales para asegurar
que las larvas sean liberadas o se desarrollen durante el
período de abundancia de alimento. Esto se logra
vinculando aspectos de la reproducción al ciclo
estacional de temperatura y/o fotoperiodo, dos factores
físicos fundamentales que también influyen en los
ciclos biológicos, como la producción de fitoplancton
(Lawrence & Soame, 2004).
La temperatura es una de las variables ambientales
que juega un rol importante tanto en el desarrollo como
en el crecimiento de invertebrados marinos, ya que
bastan pequeños incrementos de temperatura de 1°C
durante la fase exponencial de crecimiento, para
generar grandes diferencias en la talla entre individuos
de una misma cohorte (Pecl et al., 2004). En numerosos invertebrados marinos, incluyendo los moluscos,
se ha observado una disminución del período de
encapsulación a medida que aumenta la temperatura,
dentro de los rangos específicos de tolerancia térmica
(Przeslawski, 2004). Al mismo tiempo, la temperatura
tiene un efecto inverso sobre los tiempos de desarrollo
larval (Davis & Calabrese, 1964; Zimmerman &
Pechenik, 1991) y sobre la supervivencia larval
(Calabrese, 1969). Mientras que el fotoperiodo afecta
significativamente la alimentación, crecimiento y
supervivencia de organismos marinos (Minagawa &
Murano 1993; Minagawa, 1994; Hart et al., 1996).
Si bien la reproducción y desarrollo de Opistobranchia se ha estudiado por más de 150 años (Wolf &
Young, 2012), la evaluación del efecto de la
temperatura sobre los tiempos de desarrollo temprano
en varias especies, se remonta solo a los últimos 30
años (Watt & Aiken, 2003) y en estos trabajos siempre
se encontró una correlación negativa entre tiempos de
desarrollo y temperatura (Thompson, 1966; Lalli &
Conover, 1973; Perron & Turner 1977; Dehnel &
Kong, 1979; Todd & Havenhand, 1985; Farfan &
Ramírez, 1988; Watt & Aiken, 2003).
Los opistobranquios son altamente variables
respecto de las épocas de desarrollo, periodos
embrionarios, modos de desarrollo, duración larval,
inductores de metamorfosis y tasas de crecimiento
(Wolf & Young, 2012). El uso de novedosos sistemas
de defensa en base a secreciones ácidas que son
producidas cuando los animales son molestados
(Edmunds, 1968; Kubanek et al., 1997); la presencia de
metabolitos secundarios como los terpenoides
obtenidos a través de la ingestión de esponjas, algas y
tunicados en nudibranquios doridos (Faulkner &
Ghiselin, 1983; Gosliner, 1987; Pawlik et al., 1988;
Pawlik, 2012) o la producción de sus propias defensas
químicas de novo (Cimino et al., 1985; Barsby et al.,
2002), permiten suponer que en el futuro, estas
sustancias podrían ser utilizadas por la industria
farmacológica. El conocimiento de aspectos reproductivos, de desarrollo larval y su relación con
variables ambientales, es indispensable cuando se desea
implementar un cultivo. Por otra parte, la fácil
aclimatación, obtención de posturas en condiciones
artificiales (Rudman, 2000; Gibson, 2003; Contreras &
Pérez, 2010), presencia de múltiples huevos por
cápsula, eclosión de larvas planctotróficas (Muniain et
al., 2001) o embriogénesis intracapsular (Bonar, 1978),
permiten utilizar a las especies de este grupo como
modelos biológicos para evaluar el efecto de factores
ambientales como la temperatura y el fotoperiodo,
ambos sujetos a modificación producto del cambio
climático (Lawrence & Soame, 2004; Przeslawski,
2004). Considerando estas características, se seleccionó
al nudibranquio Dorido, Diaulula punctuolata
(d’Orbigny, 1837), para evaluar el efecto de las variables temperatura y fotoperiodo sobre el desarrollo
temprano.
Como la mayoría de los nudibranquios, D. punctuolata es un hermafrodita simultáneo con fecundación
cruzada interna (Todd & Doyle, 1981). Se encuentra
desde el intermareal rocoso hasta 7 m de profundidad
(Zagal & Hermosilla, 2001) y se distribuye a lo largo
de las costas de Perú, Chile y Argentina (Scrhödl, 1996;
Valdés & Muniain, 2002). Antecedentes reproductivos
señalan que estos animales ponen sus ovicápsulas
embebidas en una matriz gelatinosa que forma una
cinta enrollada en espiral de aproximadamente 30-50
mm de diámetro. Cada ovicápsula, contiene de uno a
tres embriones (Contreras & Pérez, 2010). Los estados
de desarrollo embrionario descritos son: eliminación
del primer corpúsculo polar, embrión de dos células,
tétrada, mórula, trocófora intracapsular y velígera
intracapsular; eclosionando una larva en estado de
velígera planctotrófica ~20 días post-postura (Contreras
& Pérez, 2010).
De acuerdo a los antecedentes revisados se plantea
como hipótesis que: tanto el aumento de la temperatura
como del fotoperiodo acortan el período de desarrollo
embrionario y aumentan la supervivencia larval en D.
punctuolata existiendo además, un efecto combinado
de ambas variables. Para comprobar lo anterior se
formuló como objetivo determinar el efecto de la
temperatura y el fotoperiodo en el desarrollo embrionario, porcentaje de eclosión, supervivencia y crecimiento larval del nudibranquio D. punctuolata, en
condiciones de laboratorio.
Efecto de la temperatura y fotoperiodo en nudibranquios
Recolección de ejemplares y obtención de las posturas
Se recolectaron, mediante buceo, 32 ejemplares de D.
punctuolata de longitud total entre 30 y 60 mm, entre
marzo y mayo de 2006 (otoño), a una profundidad
máxima de 7 m, en la localidad de Bahía Mansa
(40°37’S, 71°48’W), Osorno, Chile. Los individuos se
trasladaron al Laboratorio de Cultivos Marinos de la
Universidad de los Lagos en Osorno, donde fueron
separados en dos grupos de ocho acuarios cada uno y
se mantuvieron entre 10 y 16ºC. En cada acuario de 1
L (n = 16) se dispuso una pareja, mantenida con agua
de mar filtrada (1,0 µm), aireación constante,
fotoperiodo 8:16 y salinidad de 33 hasta la obtención de
las oviposturas. Cuando se obtuvo una ovipostura por
pareja, los adultos se retiraron del acuario y se midió su
longitud y ancho; de cada ovipostura se obtuvo una
muestra de 5 mm2 aproximadamente, para determinar
el número de embriones por cápsula y el número de
cápsulas por postura, siguiendo la metodología descrita
por Contreras & Pérez (2010).
Desarrollo embrionario
Cada ovipostura se dejó en un acuario de 1 L con agua
de mar filtrada (0,45 µm), aireación permanente,
salinidad de 33 y recambio total de agua cada tres días.
Se trabajó con dos temperaturas 10ºC y 16°C y dos
fotoperiodos 08:16 h y 16:08 h en un diseño factorial
de 2 x 2 generando cuatro sistemas experimentales
(10°C/8:16; 10°C/16:8; 16°C/8:16; 16°C/16:8) en
triplicado. Los sistemas 10°C/8:16 y 16°C/16:8
corresponden a condiciones ambientales de temperatura y luz promedio en el período otoño-invierno y
primavera-verano respectivamente, en la zona de
muestreo. Para generar las condiciones experimentales
se utilizaron dos baños termorregulados Memmert WB14; sobre cada uno de ellos se instaló una caja negra
isométrica de 0,7 m por lado, equipada con una lámpara
de luz fría de 18 w conectada a un timer. Las
observaciones se efectuaron cada una hora desde el
término del desove hasta el estado de mórula y luego
diariamente hasta la eclosión.
Se definieron seis estados ontogenéticos, previos a
la velígera de eclosión: eliminación del primer
corpúsculo polar, embrión de dos células, tétrada,
mórula, larva trocófora y larva velígera intracapsular.
En todos los sistemas experimentales el tiempo
aproximado hasta la eclosión se expresó en días postdesove (dpd). Además, se determinó el tiempo fisiológico en función de día-grado (dºC); el cálculo se
efectuó sumando la temperatura promedio diaria desde
la ovipostura hasta la obtención de cada estado de
5063
desarrollo (°C x días) (Cingi et al., 2000; Uriarte et al.,
2012).
El porcentaje de eclosión se calculó para cada
condición experimental, basado en el número de
embriones por cápsula, número de cápsulas por
ovipostura y cantidad de larvas eclosionadas.
Efecto de la temperatura y fotoperiodo en la
supervivencia larval
Las larvas se mantuvieron en las mismas condiciones
de temperatura, fotoperiodo y salinidad que las oviposturas. Se cultivaron 0,2 larvas mL-1 en acuarios de
500 mL conteniendo agua de mar filtrada (0,45 µm),
con aireación constante y recambio total de agua cada
tres días. Diariamente se agregó alimento en exceso
consistente en una mezcla 1:1 de Isochrysis galbana y
Dunaliella tertiolecta hasta alcanzar una concentración
aproximada de 103 cél mL-1 o el equivalente a 5000 cél
larva-1 similar a la utilizada por Bickell & Chia (1979)
en larvas de Doridella steinbergae. Se utilizaron cuatro
acuarios por cada condición experimental.
La supervivencia fue estimada cada 2 días, para lo
cual se eliminaron las larvas muertas desde el fondo de
cada acuario y las larvas vivas se llevaron a un volumen
conocido utilizando una probeta de 100 mL. El
recuento de larvas se efectuó en alícuotas de 1 mL (n =
3 por acuario) y el número de larvas por acuario se
estimó extrapolando al volumen del acuario el número
promedio de larvas en las alícuotas.
Análisis estadístico
La normalidad de los datos fue verificada mediante la
prueba de Kolmogorov-Smirnov y la homocedasticidad
de varianza por medio de la prueba de Bartlett (Sokal
& Rohlf, 1969). Se aplicó una ANDEVA de dos vías,
para evaluar el efecto de la temperatura y el fotoperiodo
sobre los tiempos de eclosión y crecimiento larval
previa transformación logarítmica y sobre el porcentaje
de eclosión previa transformación arcoseno, asumiendo
un grado de significancia de P < 0,05. El efecto de la
temperatura sobre la fecundidad se evaluó con un
ANCOVA utilizando como covariable la talla de los
reproductores. Cuando existieron diferencias significativas se aplicó la prueba a posteriori de Tukey (Sokal
& Rohlf, 1969). Para los análisis se utilizó el programa
estadístico InfoStat/L.
RESULTADOS
Obtención de posturas y desarrollo embrionario
El período de obtención de las posturas, posterior a la
llegada al laboratorio de los reproductores, varió desde
4507
significativamente mayor a 10°C/8:16 (F =10,5; P <
0,05) (Fig.1).
Las larvas que eclosionaron a 16oC fueron
significativamente mayores (146,3 ± 0,8 µm) que a
10oC (140,4 ± 0,5 µm) (F = 212; P < 0,5). No se observó
efecto del fotoperiodo (F = 2; P > 0,05) ni efecto
combinado de la temperatura con el fotoperiodo (F =
1,6; P > 0,05) sobre el tamaño de eclosión.
Aun cuando no se obtuvo asentamiento ni
metamorfosis, el mayor tiempo de supervivencia larval
(21 dpe = días post-eclosión) se obtuvo en la condición
de 10ºC/8:16 (Fig. 2), mientras que en los otros
tratamientos el tiempo máximo de supervivencia fue de
11 dpe para la condición de 10°C/16:8 y 9 dpe para la
condición 16°C/8:16. El fotoperiodo afectó significativamente la supervivencia larval, pero sólo a 10°C,
siendo mayor el tiempo de supervivencia con
fotoperiodo 8:16 (F = 26,41; P < 0,05); en esta
condición experimental el 50% de la mortalidad se
produjo el día 9 post-eclosión, mientras que en las otras
tres condiciones ocurrió al día 3 post-eclosión (Fig. 2).
2 h a una semana. De las 16 parejas instaladas se
obtuvieron 12 oviposturas y la longitud mínima y
máxima de las oviposturas fue de 110 y 510 mm a 10oC
y de 220 y 560 mm a 16oC, respectivamente. La
fecundidad absoluta mínima a 10oC fue de 15.680
huevos para un ejemplar de 43,2 mm de longitud y la
máxima fue de 158.666 huevos para un ejemplar de
51,5 mm de longitud. En los ejemplares mantenidos a
16ºC el valor mínimo fue de 36.259 huevos y el
máximo de 162.400 huevos por ejemplar de 43,4 y 56,5
mm de longitud respectivamente (Tabla 1). No se
encontraron diferencias significativas al comparar la
fecundidad absoluta entre ambas temperaturas,
utilizando como covariable la talla (P = 0,066).
El tiempo de desarrollo embrionario de D. punctuolata, hasta la eclosión, no varió significativamente
con el fotoperiodo (F = 0,48; P > 0,05), pero sí con la
temperatura (F = 366,6; P < 0,05) (Tabla 2). Las
oviposturas mantenidas en el sistema experimental a
16°C eclosionaron en un período de 10-11 días (162,3
± 10,1 - 183,8 ± 10 d°C), que fue significativamente
menor que a 10°C, 17-20 días (177,9 ± 12,3 - 200,5 ±
27,4 d°C) (Tabla 2). No se observó efecto combinado
de temperatura y fotoperiodo, sobre los tiempos de
desarrollo embrionario hasta la eclosión (F = 6,05; P >
0,05).
DISCUSIÓN
La obtención de oviposturas en Diaulula punctuolata es relativamente rápida y fácil, dado que desova
un animal de cada pareja en un período menor a una
semana después de su llegada al laboratorio. Si bien D.
punctuolata, en condiciones de laboratorio, presenta
una fecundidad absoluta que varía entre 15.680 y
162.400 huevos, está por debajo del millón de huevos
registrado tanto para esta misma especie en condiciones
silvestre (Häussermann & Fösterra, 2009) como para el
nudibranquio del Mediterráneo, Spurilla neapolitana
Efecto de la temperatura y fotoperiodo en el porcentaje de eclosión, crecimiento y supervivencia larval
El porcentaje de eclosión fue significativamente mayor
a 10°C/8:16 (82,9 ± 3,4%) que en los otros sistemas
experimentales (<50%) (F = 16,6; P < 0,05) (Fig. 1). El
fotoperiodo no tuvo efecto significativo sobre el
porcentaje de eclosión (F = 0,43; P > 0,05), sin embargo
hubo efecto combinado temperatura-fotoperiodo, siendo
Tabla 1. Datos reproductivos de ejemplares de Diaulula punctuolata acondicionados a dos temperaturas, 10°C y 16°C.
*Adultos que ovipusieron.
Datos ovipostura
Talla adultos
(mm)(*)
35,6
Largo
(mm)
139
38,7
43,2
310
110
16:8
43,3
51,5
60,4
8:16
Tº
8:16
10 º
C
16 º
C
16:8
Datos reproductivos
Ancho
(mm)
4
Area
(mm2)
556
Fecundidad
absoluta
54.968
Fecundidadrelativa
(huevos/mm)
1.544,0
Densidad
(huevos/mm2)
98,9
Total larvas
velígera
47.536
Porcentaje
eclosión
86,5
4
5
1.240
550
72.330
15.680
1.869,0
363,0
58,3
28,5
57.640
12.938
79,7
82,5
200
510
450
5
5
6,5
1.000
2.550
2.925
25.296
158.666
127.842
584,2
3.080,9
2.116,6
25,3
62,2
43,7
16.688
42.507
67.347
65,9
26,8
52,7
33,2
43,4
43,5
310
220
320
3
6
3
930
1.320
960
66.843
36.259
40.175
2.013,3
835,5
923,6
71,9
27,5
41,9
24.097
8.485
1.028
36,1
23,4
2,6
45,1
46,8
220
276
6
4
1.800
1.104
60.000
52.040
1.330,4
1.112,0
33,3
47,1
26.796
16.330
44,7
31,4
56,5
560
4
2.240
162.400
2.874,3
72,5
72.934
44,9
5085
Tabla 2. Tiempo fisiológico promedio (±DE), en día-grado (d°C) requerido para alcanzar cada estado de desarrollo
embrionario hasta la eclosión, a 10ºC y 16ºC y fotoperiodos de 8:16 y 16:8.
Temperatura
Fotoperiodo
Corpúsculo polar
Segunda división
Tetrada
Mórula
Trocofora
Velígera intracapsular
Eclosión
Tiempo hasta la eclosión (días)
10ºC
8:16
16:8
1,0(0,3)
1,5(0,4)
5,4(1,9)
5,2(1,4)
8,6(1,0)
8,5(0,5)
16,3(2,5)
13,8(1,3)
93,0(5,7)
77,9(12,2)
118,0(10,2)
97,9(13,2)
200,5(27,4) 177,9(12,3)
20,1(2,7)
17,8 (1,2)
Figura 1. Porcentaje de eclosión promedio (±DE) en D.
punctuolata a dos temperaturas 10o y 16oC y dos fotoperiodos 8:16 y 16:8. Letras diferentes sobre las columnas
indican diferencias significativas (ANDEVA de dos vías
y análisis posterior de Tukey, P < 0,05).
(de le Chiaje, 1841) el cual también presenta larva
planctotrófica (Schlesinger et al., 2009). Sin embargo,
es más alta que la descrita para otras especies de
nudibranquios opisthobranquios de la zona del Caribe:
160,2 ± 20,9 huevos en Elysia tuca (Marcus & Marcus,
1967) (Krug, 2009); 1.020 en E. crispate (Morch, 1863)
y 470 para E. subornata (Verrill, 1901) (DeFreese &
Clark, 1983). A excepción de E. tuca que tiene larva
lecitotrófica, las otras dos especies presentan desarrollo
directo, por lo que claramente la alta fecundidad de D.
punctuolata está relacionada con la estrategia de
desarrollo indirecto y la presencia de larva planctotrófica que además permanece un tiempo prolongado
de al menos 19 días en el plancton. La estrategia
reproductiva de D. puntuolata se ajusta al patrón mixto
con encapsulación, desarrollo indirecto y larva planctotrófica (Brusca & Brusca, 2003). En este patrón de
desarrollo, la fuente inicial de nutrición y protección es
la cápsula, y el gasto energético en el adulto está
orientado a la producción de gametos, cápsulas y la ma-
16ºC
8:16
16:8
0,9(0,4)
1,5(0,2)
3,7(0,5)
5,0(0,5)
5,3(0,9)
8,3(2,0)
14,2(2,2)
13,7(0,5)
72,3(8,2)
64,5(2,1)
104,3(5,7)
94,5(2,7)
183,8(10,0) 162,3(10,1)
11,5(0,2)
10,7(0,9)
Figura 2. Porcentaje promedio de supervivencia (±DE) en
larvas de D. punctuolata mantenidas a dos temperaturas
10o y 16oC y dos fotoperiodos 8:16 y 16:8.
triz que las contiene además del vitelo que asegura el
desarrollo de los embriones hasta el estado de veligera.
Sin embargo, la larva planctotrófica se ve sometida a la
presión de depredación y competencia por el alimento,
por lo cual la respuesta adaptativa es la producción de
un gran número de huevos lo que redunda en una alta
fecundidad.
La talla de eclosión (140,4 ± 0.5 µm y 146,3 ± 0,8
µm) en D. punctuolata fue similar a la descrita para
otros nudibranquios con desarrollo indirecto, como
Doridiella steinbergae (Lance, 1962) con 142,0 µm
(Bickell & Chia 1979) y Janolus fuscus (O’Donoghue,
1924) con 123,0-153,8 µm (Wolf & Young, 2012), pero
aproximadamente un 50% más pequeña que la larva
lecitotrófica de E. tuca 275,8 ± 3,9 µm (Krug, 2009).
Este patrón es concordante con el modelo de desarrollo
y la inversión de energía, que en la especie analizada
está destinada a producir un gran número de larvas
pequeñas.
En D. punctuolata, tanto el tiempo de desarrollo
embrionario como larval dependen de la temperatura,
6509
Tabla 3. Comparación del tiempo acumulado hasta la eclosión y su equivalente en tiempo fisiológico para D. punctuolata
y otras especies de opistobranquios. dpd: días post-desove. *Se estimó con la temperatura promedio
Especie/autor
Diaulula punctuolata (este trabajo)
D. punctuolata (este trabajo)
Bergia verrucicornis, (Carroll & Kempf, 1990)
Elisia zuleica (Krug, 2009)
E. zuleica (Krug, 2009)
E. tuca (Krug, 2009)
Janolus fuscus (Wolf & Young, 2012)
Spurilla neapolitana (Schlesinger et al., 2009)
Doridella steinbergae (Bickell & Chia, 1979)
D. steinbergae (Bickell & Chia, 1979)
Tiempo acumulado
(DPD)
20
11
11 a 12
5-7
18,5 ± 0,5
18,0 ± 0,6
10-18
3,0 ± 0,4
7,5-8
11-12
pero no del fotoperiodo. Un aumento de 6oC, redujo el
tiempo cronológico hasta la eclosión en casi un 60%
(Tabla 2), esto representa un ventaja para la
sobrevivencia en el ambiente. El menor tiempo obtenido
a 16°C coincide con lo descrito para el opistobranquio
Berghia verrucicornis (A. Costa, 1864), que a 23,9 ±
1,3°C eclosiona a los 11 a 12 dpd (Carroll & Kempf,
1990) y con D. steinbergae, cuyo desarrollo embrionario dura 7 a 8 días a 12-15°C (Bickell & Chia, 1979).
La temperatura controla la tasa de desarrollo de
muchos organismos, especialmente poiquilotermos y
heterotermos, los cuales requieren la acumulación de
cierta cantidad de calor para pasar de un estado de
desarrollo ontogenético a otro, lo que se conoce como
tiempo fisiológico. A 10oC D. punctuolata requiere
aproximadamente un 50% más de calor acumulado o
tiempo fisiológico que a 16oC, para alcanzar cada
estado de desarrollo ontogenético hasta la eclosión
(Tabla 2). Al comparar los resultados para el tiempo
fisiológico del presente trabajo, con los obtenidos para
otras especies de nudibranquios se puede observar una
estrecha relación con el patrón de desarrollo. Así,
aquellas especies que tienen un patrón de desarrollo
indirecto con larva planctotrófica, presentan valores
<200 dºC, mientras que en las especies con un patrón
de desarrollo indirecto con larva lecitotrófica, el tiempo
fisiológico es >400 dºC (Tabla 3). Esta dependencia de
la temperatura implica que a una misma temperatura,
una especie con desarrollo directo presentaría un
tiempo de desarrollo hasta la eclosión muy superior al
de que una especie planctotrófica.
Si bien la talla de eclosión fue significativamente
mayor a 16ºC, el porcentaje de eclosión en D.
punctuolata estuvo sobre el 80% en las oviposturas
mantenidas a 10oC/8:16 que correspondería a las
condiciones de otoño-invierno, época en que fueron
capturados los reproductores. En cambio cuando las
oviposturas se mantuvieron a 16oC/16:8, equivalente a
Temperatura
(oC)
10
16
25
25
25
25
11-13
24
12-15
9-10
Tiempo fisiológico
(d°C)
162,3 ± 10,1
183,8 ± 10,0
262,9-286,9
125-175
462,5 ± 12,0
452,5 ± 15,0
120-216*
72 ± 0,96
101,3-108*
104,5-114*
Tipo de larva
planctotrófica
planctotrófica
planctotrófica
planctotrófica
lecitotrófica
lecitotrófica
planctotrófica
planctotrófica
planctotrófica
planctotrófica
las condiciones de primavera-verano el porcentaje de
eclosión alcanzó el 40% (Tabla 1). Esta respuesta se
podría asociar a que la mayor tasa de crecimiento a
mayor temperatura aumentaría el consumo total de
vitelo generando a la vez una acumulación insuficiente
de reservas para la supervivencia posterior (Liddy et
al., 2004). El acortamiento del período embrionario con
el aumento de la temperatura podría ser ventajoso si el
organismo que eclosiona primero encuentra más
alimento y crece más rápido (Uriarte et al., 2012). Sin
embargo, en el presente trabajo las larvas que
eclosionaron a 16°C presentaron una fuerte caída en la
supervivencia, que alcanzó al 50% en el día 3 posteclosión (Fig. 2). Esto podría estar relacionado a un
aumento en la demanda metabólica que se producen en
ectotermos cuando son sometidos a altas temperaturas
pudiendo experimentar déficit de oxígeno (Woods &
Moran, 2008). Al respecto, se ha demostrado que un
aumento de temperatura de 18 a 21°C aumenta el
metabolismo en embriones de Octopus mimus (Uriarte
et al., 2012), mientras que en el nudibranquio Dendronotus frondosus (Acanius, 1774) un aumento de
temperatura de 11 a 15°C detuvo el desarrollo embrionario en la eliminación del segundo corpúsculo polar
(Watt & Ayken, 2003). La mortalidad total de las larvas
mantenidas a 10ºC a los 19 días y la imposibilidad de
obtener asentamiento y metamorfosis se debería a la
dieta ofrecida, ya que las larvas de D. punctuolata
fueron alimentadas solo con microalgas y los
antecedentes entregados para Aplysia oculifera (Adams
& Reeve, 1850), muestran que se obtuvo asentamiento
y supervivencia solo cuando fueron alimentadas con
Enteromorpha intestinalis (Linnaeus) Nees, 1820,
además de microalgas (Rudman, 2000).
En varias especies se ha demostrado una fuerte
relación entre la tolerancia a la temperatura superior y
la temperatura máxima del hábitat (Sorte et al., 2011),
lo cual demuestra que hay un efecto de esta variable
sobre los patrones de distribución. En D. punctuolata
se obtuvo mayor supervivencia en larvas mantenidas a
10°C y fotoperiodo 8:16, que corresponde a las condiciones de otoño-invierno. Probablemente, la mejor
respuesta de estas larvas se debe a que las condiciones
experimentales de temperatura y fotoperiodo son
similares a las condiciones de otoño, que fue la época
de recolección de los ejemplares adultos, además los
antecedentes reproductivos sobre esta especie indican
la presencia de oviposturas en el medio natural durante
el verano y otoño austral (37ºS) (Häussermann &
Försterra, 2009).
Se puede concluir que D. punctuolata presenta un
patrón de desarrollo mixto con alta fecundidad,
presencia de cápsulas bentónicas y eclosión de una
larva planctotrófica pequeña, coincidiendo con las
características de otros nudibranquios de similar patrón
de desarrollo. Los estados tempranos son dependientes
de la temperatura ya que un aumento de ésta acorta el
período de desarrollo embrionario, pero disminuye el
porcentaje de eclosión y supervivencia larval. El
fotoperiodo tiene un efecto menos notorio, pero su
disminución mejora la supervivencia larval a 10°C
observando un efecto combinado de ambas variables
sobre el porcentaje de eclosión, el cual se incrementa
significativamente en las condiciones 10°C/8:16.
AGRADECIMIENTOS
Se agradece al Laboratorio de Cultivos Marinos de la
Universidad de Los Lagos, por el aporte en infraestructura y equipamiento para el desarrollo de las
experiencias, al proyecto FONDEF D01159 por el
financiamiento de las salidas a terreno y a Susan Angus
por el trabajo de traducción.
REFERENCIAS
Barsby, T., R.G. Linington & R.J. Andersen. 2002. De
Novo terpenoid biosynthesis by the dendronotid
nudibranch Melibe leonina. Chemoecology, 12(4):
199-202.
Bickell, L.R. & F.S. Chia. 1979. Organogenesis and
histogenesis in the planktotrophic veliger of Doridella
steinbergae (Opisthobranchia: Nudibranchia). Mar.
Biol., 52(4): 91-313.
Bonar, D. 1978. Morphogenesis at metamorphosis in
opisthobranch mollusks. In: F. Chia & M. Rice (eds.).
Settlement and metamorphosis of marine invertebrates
larvae. Elsevier, New York, pp 177-196.
Brusca, R.C. & G.J. Brusca. 2003. Invertebrates. Sinauer
Associates, Sunderland, 936 pp.
5107
Calabrese, A. 1969. Individual and combined effects of
salinity and temperature on embryos and larvae of the
coot clam, Mulinia lateralis (Say). Biol. Bull., 137(3):
417-428.
Carroll, D. & S. Kempf. 1990. Laboratory culture of the
aeolid nudibranch Berghia verrucicornis (Mollusca,
Opisthobranchia): some aspects its development and
life history. Biol. Bull., 179: 243-253.
Cimino, G.S., S. De Rosa, S. De Stefano, R. Morrone &
G. Sodano. 1985. The chemical defense of nudibranch
mollusks: structure, biosynthetic origin and defensive
properties of terpenoids from the dorid nudibranch
Dendrodoris grandiflora. Tetrahedron, 41(6): 10931100.
Cingi, S., M. Keinänen & P.J. Vuorinen. 2000. Elevated
water temperature impairs fertilization and embryonic
development of whitefish Coregonus lavaretus. J. Fish
Biol., 76: 502-521.
Contreras, R. & M. Pérez. 2010. Desarrollo embrionario y
larval temprano en Diaulula punctuolata (d’Orbigny,
1837) (Nudibranchia: Doridacea), en condiciones de
laboratorio. Amici Molluscarum, 18: 13-20.
Davis, H. & A. Calabrese. 1964. Combined effects of
temperature and salinity on development of eggs and
growth of larvae of M. mercenaria and C. virginica.
Fish. Bull., 63(3): 643-655.
DeFreese, D.E. & K.B. Clark. 1983. Analysis of
reproductive energetics of Florida Opisthobranchia
(Mollusca: Gastropoda). Int. J. Invertebr. Rep., 6: 110.
Dehnel, P.A. & D.C. Kong. 1979. The effect of
temperature on developmental rates in the nudibranch
Cadlina luteomarginata. Can. J. Zool., 57: 1835-1844.
Edmunds, M. 1968. Acid secretion in some species of
Doridacea (Mollusca, Nudibranchia). Proc. Malacol.
Soc. London, 38(2): 121-133.
Farfan, B.C. & L.F.B. Ramirez. 1988. Spawning and
ontogeny of Bulla gouldiana (Gastropoda: Opisthobranchia: Cephalaspidea). Veliger, 31: 114-119.
Faulkner, D.J. & M.T. Ghiselin. 1983. Chemical defense
and evolutionary ecology of dorid nudibranchs and
some other opisthobranch gastropods. Mar Ecol. Prog.
Ser., 13: 295-301.
Gibson, G.D. 2003. Larval development and metamorphosis in Pleurobranchaea maculata, with a review of
development in Notaspidea (Opisthobranchia). Biol.
Bull., 205: 121-132.
Giese, A.C. & J.S. Pearse. 1974. Introduction. In: A.C.
Giese & J.S. Pearse (eds.). Reproduction of marine
invertebrates. Academic Press, New York, pp. 1-49.
Gosliner, T. 1987. Nudibranchs of Southern Africa. Sea
Challenger, Monterrey, California, 135 pp.
8511
Hart, P.R., W.G. Hutchinson & G.J.Purser. 1996. Effects
of photoperiod, temperature and salinity on hatcheryreared larvae of the greenback flounder (Rhombosolea
tapirina Günther, 1862). Aquaculture, 144: 303-311.
Häussermann, V. & G. Försterra. 2009. Fauna marina
bentónica de la Patagonia Chilena: guía de identificación ilustrada. Nature in Focus, Santiago, 1000 pp.
Krug, P. 2009. Not my “type”: larval dispersal dimorphisms and bet-heding in opisthobranch life histories.
Biol. Bull., 216: 355-372.
Kubanek, J., E.I. Graziani & R.J. Andersen. 1997.
Investigations of terpenoid biosynthesis by the dorid
nudibranch Cadlina luteomarginata. J. Org. Chem.,
62: 7239-7246.
Liddy, G.C., F. Phillip & G. Maguire. 2004. Effect of
temperature and food density on the survival and
growth of early stages phyllosoma of the western rock
lobster, Panulirus cygnus. Aquaculture, 242: 207-215.
Lalli, C.M. & R.J. Conover. 1973. Reproduction and
development of Paedoclione doliiformis, and a
comparison with Clione limacine (Opisthobranchia:
Gymnosomata). Mar. Biol., 19: 13-22.
Lawrence, A.J. & J.M. Soame. 2004. The effects of
climate change on the reproduction of coastal
invertebrates. Ibis, 146(1): 29-39.
Minagawa, M. & M. Murano. 1993. Effects of prey
density on survival, feeding rate and development of
zoea of the red frog crab Ranina ranina (Crustacea:
Decapoda: Ranindae). Aquaculture, 113: 91-100.
Minagawa, M. 1994. Effects of photoperiod on survival,
feeding and development of larvae of the red frog crab,
Ranina ranina. Aquaculture, 120(1-2): 105-114.
Muniain, C., A. Marín & P.E. Penchaszadeh. 2001.
Ultrastructure of the digestive gland larval and adult
stages of the sacoglossan Elysia patagonica. Mar.
Biol., 139: 687-695.
Pawlik, J.R. 2012. Antipredatory defensive roles of
natural products from marine invertebrates. In: E.
Fattorusso, W.H. Gerwick & O. Taglilatela-Scarfati
(eds.). Handbook of marine natural products.
Springer, New York, pp. 677-710.
Pawlik, J.R., M.R. Kernan, T.F. Molinski, M.K. Harper &
D.J. Faulkner 1988. Defensive chemicals of the
Spanish Dancer nudibranch, Hexabranchus sanguineus,
and its egg ribbons: macrolides derived from a sponge
diet. J. Exp. Mar. Biol. Ecol., 119: 99-109.
Pecl, G.T., M.A. Steer & K.E. Hodgson. 2004. The role of
hatchling size in generating the intrinsic size-at-age
variability of cephalopods: extending the Forsythe
Hypothesis. Mar. Freshwater Res., 55: 387-394.
Perron, F.E. & R.D. Turner. 1977. Development, metamorphosis, and natural history of the nudibranch
Doridella obscura Verrill (Corambidae: Opisthobranchia). J. Exp. Mar. Biol. Ecol., 27: 171-185.
Przeslawski, R. 2004. A review of the effects of
environmental stress on embryonic development
within intertidal gastropod egg masses. Molluscan
Res., 24: 43-63.
Rudman, W.B. 2000. Aplysia oculifera -larval development and metamorphosis. Sea Slug Forum.
[http://www.Seaslugforum.net/aplyocdev.htm]. Reviewed: 25 June 2014.
Schlesinger, A., R. Goldshmid, M.G. Hadfield, E.
Kramarsky-Winter & Y. Loya. 2009. Laboratory
culture of the aeolid nudibranch Spurilla neapolitana
(Mollusca, Opisthobranchia): life history aspects. Mar.
Biol., 156: 753-761.
Scrhödl, M. 1996. Nudibranchia and Sacoglossa of Chile:
external morphology and distribution. Gayana Zool.,
60(1): 17-62.
Sokal, P. & J. Rohlf. 1969. Biometry. W.H. Freeman, San
Francisco, 775 pp.
Sorte, C.J., S.J. Jones & L.P. Miller. 2011. Geographic
variation in temperature tolerance as an indicator of
potential population responses to climate change. J.
Exp. Mar. Biol. Ecol., 400(1-2): 209-217.
Thompson, T.E. 1966. Studies on the reproduction of
Archidoris pseudoargus (Rapp) (Gastropoda Opisthobranchia). Philos. T. R. Soc. Lond. B, 250: 344-373.
Todd, C.D. & R.W. Doyle. 1981. Reproductive strategies
of marine benthic invertebrates: a settlement-timing
hypothesis. Mar. Ecol. Prog. Ser., 4: 75-83.
Todd, C.D. & J.N. Havenhand. 1985. Preliminary
observations on the embryonic and larval development
of three dorid nudibranchs. J. Moll. Stud., 51: 226-228.
Uriarte, I., V. Espinoza, M. Herrera, O. Zúñiga, A.
Olivares, P. Carbonell, S. Pino, A. Farías & C. Rosas.
2012. Effect of temperature on embryonic development of Octopus mimus under controlled conditions. J.
Exp. Mar. Biol. Ecol., 416-417: 168-175
Valdés, A. & C. Muniain. 2002. Revision and taxonomic
reassessment of Magellanic species assigned to
Anisodoris Berg, 1898 (Nudibranchia: Doridoidea). J.
Mollus. Stud., 68: 345-351.
Watt, J. & R. Aiken. 2003. Effect of temperature on
development yime in egg masses of the intertidal
Nudibranch, Dendronotus frondosus (Ascanius, 1774)
(Opisthobranchia, Dendronotacea). Northeast. Nat.,
10(1): 17-24.
Wolf, M. & C.M. Young. 2012. Complete development of
the northeast Pacific Arminacean nudibranch Janolus
fuscus. Biol. Bull., 222(2): 137-149.
Woods, H.A. & A.L. Moran. 2008. Temperature-oxygen
interactions in Antarctic nudibranch egg masses. Exp.
Biol., 211: 798-804.
Yang, Z. & Y. Chen. 2005. Effect of temperature on
incubation period and hatching success of obscure
puffer Takifugu obscurus (Abe) eggs. Aquaculture,
246: 173-179.
Zagal, C. & C. Hermosilla. 2001. Guía de invertebrados
marinos del litoral valdiviano. Quebecor World Chile,
Santiago, 217 pp.
Received: 28 August 2014; Accepted: 24 March 2016
5129
Zimmerman, K. & J. Pechenik. 1991. How do temperature
and salinity affect relative rates of growth, morphological
differentiation, and time to metamorphic competence in
larvae of de marine gastropod Crepidula plana? Biol.
Bull., 180: 372-386.
Lat. Am. J. Aquat. Res., 44(3): 513-524, 2016
Aspectos reproductivos de Carcharhinus falciformis
513
Research Article
Estructura poblacional y aspectos reproductivos del tiburón piloto Carcharhinus
falciformis (Müller & Henle, 1839) (Carcharhiniformes: Carcharhinidae)
en la costa de Oaxaca, México
María del Carmen Alejo-Plata1, Miguel Ángel Ahumada-Sempoal1
José Luis Gómez-Márquez2 & Adrián González-Acosta3
1
Universidad del Mar, Campus Puerto Ángel, Oaxaca, México
2
Facultad de Estudios Superiores Zaragoza, Universidad Nacional
Autónoma de México, D.F., México
3
Instituto Politécnico Nacional, Centro Interdisciplinario de Ciencias Marinas, La Paz, B.C.S., México
Corresponding author: José Luis Gómez-Márquez (lgomez@unam.mx)
RESUMEN. El tiburón piloto Carcharhinus falciformis es una especie oceánica abundante, que se distribuye
en zonas ecuatoriales y tropicales, con importante captura en las costas Atlántica y Pacífica de México. De
diciembre 2000 a diciembre 2007 se efectuaron muestreos en cuatro sitios de desembarco de la flota artesanal
en la costa de Oaxaca. Durante el período de estudio, se registraron 1236 individuos (602 hembras y 634 machos)
de C. falciformis. El intervalo de tallas en las hembras varió de 49 a 217 cm LT (media = 111,3 cm) y en machos
de 59 a 265 cm de longitud total (LT) (media = 111,7 cm). La proporción sexual macho: hembra fue de 1:1
(20.05 = 0.78, P > 0,05). Se estimó una talla de primera madurez sexual de 184,8 cm LT para hembras y 178,5
cm LT para machos. Las capturas estuvieron constituidas principalmente por juveniles. El número promedio de
embriones por hembra fue de siete en las 52 hembras preñadas examinadas, con un rango de 3-14 embriones.
La LT promedio de los embriones varió de 10 a 66 cm, observándose evidencia de cambios estacionales en la
talla. Los resultados obtenidos mostraron que C. falciformis da a luz la mayor parte del año, con una mayor
proporción de nacimientos durante la temporada de lluvias (mayo a octubre).
Palabras clave: Carcharhinus falciformis, pesca artesanal, talla de madurez, reproducción, Golfo de
Tehuantepec.
Population structure and reproductive characteristics of the silky shark Carcharhinus
falciformis (Müller & Henle, 1839) (Carcharhiniformes: Carcharhinidae)
off the coast of Oaxaca, Mexico
ABSTRACT. Carcharhinus falciformis is an abundant oceanic species, which occurs in equatorial and tropical
zones, with an important catch in the Atlantic and Pacific coasts of Mexico. Samples were taken from December
2000 to December 2007 in four landing sites of the artisanal fleet on the coast of Oaxaca. During the period of
study 1236 specimens (602 females and 634 males) of C. falciformis were registered. Total length (TL) ranged
from 49 to 217 cm for females (mean = 111.3 cm) and from 59 to 265 cm for males (mean = 111.7 cm). The
sex ratio of females to males was 1:1 (20.05 = 0.78, P > 0.05). The present data suggest a size at first sexual
maturity of about 184.8 cm TL for females and 178.5 cm TL for males. The catches were composed mainly of
young. In the 52 gravid females examined, the average number of embryos per female was seven; with a range
of 3-14 embryos. Mean TL of embryos ranged from 10 to 66 cm with evidence of seasonal changes in the size
structure. Results obtained showed that C. falciformis gives birth most of the year, with the highest proportion
of births during the rainy season (May to October).
Keywords: Carcharhinus falciformis, artisanal fishery, size at maturity, reproduction, Gulf of Tehuantepec.
__________________
Corresponding editor: Oscar Sosa
514
INTRODUCCIÓN
Los tiburones son organismos marinos altamente
vulnerables a la sobre-explotación pesquera, debido
entre otras cosas, a las características particulares de su
historia de vida (Watson et al., 2009). Algunas especies
como el tiburón piloto Carcharhinus falciformis han
sido explotados por décadas y actualmente se han
venido implementado medidas para regular su captura
(Smith et al., 2009). En particular, el tiburón piloto se
caracteriza por presentar un tiempo generacional entre
11 y 16 años, así como un tipo de reproducción vivípara
placentaria, con ciclos bianuales con vitelogénesis y
gestación consecutivas (Bransteter, 1987; GalvánTirado et al., 2015). El período de gestación es de ~12
meses y el número de embriones por camada varía
geográficamente (Castro, 2009). Debido a su amplia
distribución e importancia pesquera (Bonfil et al.,
2009), se han realizado estudios sobre aspectos
reproductivos de esta especie en diferentes partes del
mundo (Branstetter, 1987; Last & Stevens, 1994;
Oshitani et al., 2003; Joung et al., 2008; Hall et al.,
2012). Sin embargo, son escasos los antecedentes en
las costas Atlántica (Bonfil et al., 1993) y Pacífica de
México (Soriano et al., 2006; Cruz et al., 2011; HoyosPadilla et al., 2012; Galván-Tirado et al., 2015).
Es una de las especies más importantes en las
pesquerías artesanales ribereñas y de mediana altura en
el Pacífico mexicano. Las áreas de mayor captura son
el Golfo de California y el Golfo de Tehuantepec
(Soriano et al., 2006), este último comprende parte del
litoral de Oaxaca donde la pesca artesanal de tiburón
está constituida en un 90% por C. falciformis (AlejoPlata et al., 2006) y el Estado de Chiapas, donde Puerto
Chiapas es el puerto de mayor descarga de esta especie
de tiburón en el país (Soriano et al., 2006). Este trabajo
analiza la estructura poblacional y aspectos de la
biología reproductiva de C. falciformis en la costa de
Oaxaca y su relación con la temperatura superficial del
mar y el ciclo de lluvias-estiaje, lo cual puede
coadyuvar al mejor manejo, conservación y aprovechamiento sostenible de este recurso.
Área de estudio
La zona de estudio corresponde a la costa de Oaxaca,
que incluye la parte centro-oeste del Golfo de
Tehuantepec. Esta región se caracteriza por su plataforma continental que se ensancha hacia el este,
alcanzando una amplitud máxima de 106,8 km a los 9394°W, y se reduce hacia el oeste, con una amplitud
mínima de ~17,8 km a los 95,5°W (Fig. 1). La zona se
caracteriza por la presencia de lluvias, tormentas y
ciclones tropicales desde mayo/junio hasta septiembre/
octubre, que son los meses más cálidos del año, y por
el estiaje desde noviembre hasta abril. Un fenómeno
característico de esta región es la llegada de vientos del
norte o “Tehuanos” (Lavín et al., 1992), la presencia de
estos episodios se refleja en las aguas relativamente
productivas y frías del Golfo de Tehuantepec (Liang et
al., 2009).
Trabajo e información de campo
De diciembre 2000 a diciembre 2007 se efectuaron
recolectas en cuatro sitios de desembarco de la flota
artesanal en la costa de Oaxaca. El trabajo de campo se
realizó durante dos días a la semana en las localidades
de Puerto Escondido, Puerto Ángel-San Agustinillo y
Huatulco, y quincenalmente en la ensenada Chipehua
(Fig. 1). En la región se encuentran tres unidades
pesqueras artesanales que capturan tiburón, ya sea
como pesca dirigida (tiburonera) o incidental (pelágica
y demersal) (Tabla 1).
Los ejemplares de tiburón piloto fueron identificados con las claves de Compagno (1984). Se
clasificó a los individuos de acuerdo a los criterios de
Pratt (1979) como neonatos (individuos con cicatriz
umbilical abierta) y juveniles del año (individuos de
nado libre y con cicatriz umbilical parcialmente
cerrada).
El sexo se identificó a partir de la presencia y/o
ausencia de mixopterigios. En los machos se midió la
longitud del mixopterigio (mm) considerada desde el
inicio de la cloaca hasta la punta distal del mismo, se
observó el grado de calcificación, rotación y apertura
del rifidion (punta distal). Los machos que presentaron
mixopterigio sin calcificar se consideraron inmaduros
o juveniles; los machos que presentaron mixopterigio
calcificados que rotaban fácilmente y se abría el
rifidion fueron registrados como adultos o maduros
(Clark & Von Schmidt, 1965).
Las hembras fueron consideradas maduras cuando
se observaron ovocitos vitelogénicos y vascularizados,
glándulas oviductuales grandes y úteros bien desarrollados, o bien los úteros contenían huevos o embriones
(Liu et al., 1999). En el caso de hembras preñadas, se
contabilizó y midió los embriones (LT, cm).
Debido a las características de desembarque y
manejo del tiburón en playa, no fue posible registrar el
peso y longitud total de todos los ejemplares. Para
obtener los datos biométricos utilizados y recobrar
información de ejemplares eviscerados y sin aletas ni
cabeza (en esta región de México denominados
troncho), se registraron las siguientes medidas con una
cinta métrica flexible (al 0,5 cm más cercano): longitud
total (LT), longitud troncho (Ltr, medida entre la última
515
Figura 1. Área de estudio. PE: Puerto Escondido, PA: Puerto Ángel, Hu: Huatulco, Ch: Chipehua. El límite de la plataforma
continental está representado por la isobata de 200 m. La batimetría fue obtenida de la base de datos ETOPO2
[http://www.ngdc.noaa.gov/mgg/global/etopo2.html].
Tabla 1. Descripción de las unidades de pesca utilizadas en la pesca artesanal en la costa de Oaxaca, México, de donde se
obtuvieron las muestras del tiburón.
Unidad de pesca
Demersal
Lanchas con motor fuera de
borda 7,5 m eslora/ canoas de
madera sin motor
Pelágica
borda 7,5 m eslora
Especies objetivo
Peces óseos demersales
Equipos de pesca
-Redes de enmalle 3 a 5’’, longitud 100 m
Atún (Tunnus albacares),
barriletes (Euthynnus linneatus,
Katsuwonus pelamis)
Tiburonera
borda 10 m eslora
Tiburones (Carcharhinus
falciformis, C. limbatus C. leucas,
C. porosus, Sphrna lewini, Alopias
pelagicus, A. vulpinus, Nasolamia
velox, Mustelus lunulatus)
-Curricanes, anzuelos dobles, Nº 24 o 25
-Palangre de superficie, anzuelo noruego
recto Nº 1 ó 0, garra de águila 14/0 a 16/0
-Palangre de superficie con boyas, anzuelo
noruego recto Nº 1 ó 0, garra de águila
14/0 a 16/0; carnada viva
-Palangre de superficie, anzuelo noruego
recto 1 ó 01, garra águila 16/0, japonés
-Redes de deriva, 8 a 12’’, longitud hasta
300 m
-Palangre de superficie con boyas
abertura branquial y la foseta precaudal), peso
eviscerado (Pe) y total (PT) registrado con una balanza
digital con precisión de 5 g.
Los datos de las tallas se analizaron por temporada
de lluvias y secas; se aplicó el método no paramétrico
Kruskal-Wallis para comparar las tallas entre ambas
temporadas, debido a que los datos no presentaron
homocedasticidad (Zar, 1999).
La proporción de sexos se determinó a partir de la
relación entre el número de hembras y machos (H:M)
registrados en la población capturada. Así mismo, se
Especies incidentales
Tiburón (juveniles y neonatos),
rayas (Dasyatis, Rhinobatos,
Gymnura), Coryphaena
hippurus.
Juveniles de S. lewini y C.
falciformis, picudos (Istiophorus
platypterus, Makaira mazara, M.
indica), Coryphaena hippurus,
C. equiselis.
Picudos (Istiophorus
platypterus, Makaira mazara, M.
indica), Coryphaena hippurus,
C. equiselis.
utilizó la prueba estadística Chi cuadrado (2) para
determinar si la proporción de sexos por estado
ontogénico y por mes se desviaba de la relación 1:1
(Zar, 1999). En el caso de los embriones, se calculó la
proporción media de las hembras por camada y se
comparó con el valor teórico de 0,5; se consideró como
unidad muestral a la madre de la camada (Walker,
2005).
La longitud en que el 50% de los tiburones en la
frecuencia de clase están maduros (L50), fue estimada
para hembras y machos usando la función logística:
516
Donde, Mf es la fracción de tiburones maduros, Li la
longitud del cuerpo, los parámetros, a y b fueron
estimados ajustando una función de máxima
verosimilitud (Haddon, 2001); el valor de a representa
la pendiente de la curva que describe la tasa de cambio
en Mf y b = L50.
Para estimar la fecundidad, en cada hembra preñada
se contaron los embriones o huevos presentes en cada
útero. Para analizar el patrón estacional en el
crecimiento de los embriones, las muestras de siete
años fueron agrupadas para construir un “año tipo”.
Para establecer el período de gestación, se consideró el
crecimiento promedio mensual en longitud total de los
embriones. La talla de nacimiento se estimó del
embrión con la talla máxima observada y la talla
mínima del individuo de nado libre capturado al mismo
tiempo y lugar (Pratt & Casey, 1990).
La variabilidad mensual de la temperatura
superficial del mar (TSM) y precipitación (P) para el
periodo 2000-2007 (Fig. 2) fue estimada respectivamente de imágenes nivel 3 con resolución de 4 km del
MODIS-Aqua (http://oceancolor.gsfc.nasa.gov/) y de
la base de datos histórica de la Estación Meteorológica
Automática (EMA) del Servicio Meteorológico Nacional
(SMN), localizada en Puerto Ángel, Oaxaca (15°40'
16”N, 96°29'50”W).
RESULTADOS
Estructura de tallas y relación talla-peso
Los neonatos y juveniles del año (edad <1 año), de
tiburón piloto fueron capturados como pesca incidental
de la unidad de pesquería demersal. Los tiburones
maduros y las hembras grávidas se presentaron en las
capturas de la unidad tiburonera, mientras que los
individuos juveniles se capturaron por las unidades
tiburonera y pelágica. Las mayores capturas de
juveniles se obtuvieron de la pesquería pelágica, que
opera más cerca de la costa.
Para facilitar la comparación con otros trabajos, los
resultados se reportaron en LT, se utilizó la regresión
lineal para determinar la relación existente entre LT y
Ltr. Estas relaciones biométricas mostraron una
adecuada asociación entre ellas como lo indican los
valores de R2.
Machos LT = 1,15Ltr + 24,82 (R2 = 0,93; n = 209; P < 0,05)
Hembras LT = 1,29Ltr + 9,07
(R2 = 0,90; n = 201; P < 0,05)
La distribución de frecuencias de tallas fue estimada
sobre un total de 1,236 mediciones. Se registraron 602
Figura 2. Promedios mensuales de precipitación (P) en
una estación costera (15°40'16"N, 96°29'50"W) y la
temperatura superficial del mar (TSM) en la región
occidental del Golfo de Tehuantepec en el período 20002007.
hembras con un intervalo de tallas de 49 a 217 cm LT
(media = 111,3; DE = 34,9); 634 machos en el intervalo
de 59 a 265 cm LT (media = 111,7; DE = 29,84).
Las capturas de tiburón piloto estuvieron conformadas principalmente por juveniles (72%, 75-168 cm
LT), adultos (22,8%, >170 cm LT) y neonatos (5,2%,
65-75 cm LT). La LT de las hembras mostró tres
modas, dos correspondieron a juveniles y una a adultos
(incluyendo hembras grávidas) (Fig. 3a). Una tendencia
similar se observó en los machos (Fig. 3b).
En la estructura de tallas mensual se observó que de
mayo a octubre (temporada de lluvias, Fig. 2), la talla
promedio fue de 99,6 cm LT (DE = 23,36), con un
predominio de tallas <125 cm LT (88,5%). De
noviembre a abril (temporada de estiaje), la talla
promedio fue de 129,5 cm LT (DE= 36,46) y se observó
la presencia de adultos con tallas >170 cm LT (17,3%)
(Fig. 4). De acuerdo a la prueba de Kruskal-Wallis (P
< 0,05) se determinaron diferencias significativas entre
temporadas.
El intervalo de peso fue de 1,75 a 41,2 kg en
hembras y de 1,75 a 42,1 kg en machos. Las ecuaciones
de la relación peso-longitud fueron las siguientes:
Hembras
Machos
PT = 1x 10-5 LT2,943
PT = 1x 10-6 LT3,42
n = 32, R2 = 0,878
n = 53, R2 = 0,825
Proporción de sexos
La proporción de sexos H:M de la muestra total no
difirió significativamente de 1 (20,05 = 0.78, P > 0,05).
Sin embargo, en la proporción mensual de sexos se
presentaron diferencias significativas en noviembre
entre los sexos (1 H:1,44 M; 20,05 = 8,5; P < 0,05).
Los neonatos se observaron a lo largo del año, con
una LT promedio de 65 cm y una proporción de sexos
1H:1M (20,05 = 0,16, P > 0,05), con mayor abundancia
en mayo-junio. Los juveniles del año (edad <1 año) se
capturaron durante agosto, con una LT promedio de 75
517
Talla de madurez
Todas las hembras con LT < 160 cm fueron inmaduras.
Las hembras maduras se registraron a partir del
intervalo de clase de 160-170 cm LT. La LT50 estimada
fue de 184,8 ± 1,7 cm (intervalo de confianza 95%; Fig.
6a). Hembras con LT < LT50 incluyeron al 93% de las
hembras capturadas. La madurez sexual en machos se
observó a partir del intervalo de 120-125 cm LT, la
LT50 estimada fue de 178,5 ± 4,14 cm (intervalo de
confianza 95%; Fig. 6b); tiburones con LT < LT50
comprendieron el 94,7% del total de machos capturados.
Se observaron hembras grávidas entre 155 y 256 cm
LT (media = 195,7, DE = 21,82) de enero a junio. La
LT50 de maternidad estimada fue de 190,3 cm LT (Fig.
6a).
Figura 3. a) Frecuencia de longitud en hembras y b) machos de Carcharhinus falciformis capturados frente a la
costa de Oaxaca (México) entre 2000 y 2007.
cm. Los individuos juveniles con un intervalo de 80170 cm LT y una proporción de sexos 1:1 (20,05 = 0,38;
P > 0,05) estuvieron presentes todo el año, con mayor
abundancia de junio a noviembre (44% de la captura).
Crecimiento del mixopterigio
Machos con una LT < 120 cm tenían el mixopterigio no
calcificado y se clasificaron como inmaduros. El
comienzo de la madurez sexual se presentó alrededor
de 125 cm LT cuando la longitud del mixopterigio se
incrementó abruptamente (Fig. 5). Los machos en
maduración aparecen en el rango 125-140 cm LT, y se
registraron hasta los 150-155 cm LT. Machos maduros
con mixopterigio totalmente calcificado se observaron
a 140 cm LT y los machos >160 cm LT estaban
maduros. Individuos con mixopterigios >200 mm
tenían semen y algunos presentaron hematomas. La
relación entre la longitud del mixopterigio y la LT se
indica en la Figura 5. De la curva resultante, se infiere
que el mixopterigio experimenta un lento crecimiento
durante el período en que no hay calcificación,
aumentando notablemente en su longitud al inicio de su
calcificación.
Fecundidad, talla de embriones y nacimiento
Se registraron 52 hembras preñadas, con ovocitos en
desarrollo en el ovario y embriones o huevos en sus
úteros al mismo tiempo. El tamaño de la camada en
hembras grávidas fue de 3 a 14 embriones (media = 7,
DE = 2,58). La fecundidad y la LT de la madre no
mostró una correlación significativa (r = 0,36, P >
0,05). De diciembre a marzo se encontraron hembras
con huevos uterinos.
La LT promedio de los embriones varió entre 10 y
66 cm (Fig. 7). El coeficiente de variación de la LT de
los embriones en las camadas individuales fue de 3,3%.
Hembras con embriones >52 cm LT (que es la longitud
mínima registrada en un neonato), se observaron en
enero y marzo, abril a julio. Los neonatos con LT <67
cm se registraron en 8 de los 11 meses en que se
obtuvieron muestras (Fig. 7). De los datos anteriores se
deduce que C. falciformis presenta períodos de
nacimiento la mayor parte del año, donde la mayor
proporción de nacimientos ocurre de mayo a agosto. La
talla al nacer fue de 52 a 64 cm LT (media = 55,8, DE
= 3,33). La proporción media de las hembras por
camada fue menor a la proporción de machos, por cada
cinco hembras se presentaron seis machos (20,05 =
23,56, P < 0,05).
DISCUSIÓN
En la costa de Oaxaca el tiburón piloto es abundante y
accesible a la pesca artesanal. Esto puede estar
relacionado con las características oceanográficas de la
región, que se caracteriza por tener una plataforma
continental muy estrecha (Fig. 1). Se sabe que los
juveniles tienden a habitar aguas más costeras que los
adultos y que los recién nacidos que tienen
preferencias demersales y junto con algunos juveniles,
ocupan áreas de crianza en aguas costeras (Branstetter,
1987; Bonfil, 1997, 2008; Soriano et al., 2006). Las
518
Figura 4. Histogramas mensuales de frecuencia para hembras
aguas frente a la costa de Oaxaca (México) entre 2000 y 2007.
mayores capturas de juveniles se registraron a profundidades inferiores a 50 m (Kohin et al., 2006; Brenes et
al., 2000).
y machos
de Carcharhinus falciformis capturados en
Otro rasgo importante de la región es la TSM, que
se encuentra sobre 26°C todo el año; de octubre a enero
entre 26 y 28ºC, cuando se presentan las mayores cap-
Figura 5. Relaciones entre la longitud del mixopterigio y
la longitud total (LT) de machos Carcharhinus falciformis
capturados frente a la costa de Oaxaca (México) entre
2000 y 2007. , mixopterigio no calcificado; mixop0 calcificado;
terigio parcialmente
mixopterigio0 totalmente calcificado;0 n = 596).
0
turas. Al respecto, Kohin et al. (2006) mencionan que
C. falciformis habita en un intervalo de temperatura
muy estrecho (28-30°C); para aguas de Nicaragua,
Brenes et al. (2000) reportaron las mayores capturas a
26-28°C; mientras que Cruz et al. (2011) registraron
abundancias importantes entre 24 y 28ºC en el Pacífico
central mexicano.
Además, los resultados muestran que en la zona de
estudio los diferentes estados ontogénicos se acercan a
la costa, en estrecha relación con la alternancia del
régimen lluvias-estiaje. En la temporada de estiaje
predominaron los tiburones adultos. En cambio en la
temporada de lluvias, cuando se presentan las mayores
temperaturas del año (29-31ºC), se registraron
individuos juveniles y aumentó la proporción de
neonatos y juveniles.
Los juveniles con frecuencia se encuentran asociados a objetos flotantes (Watson et al., 2009). En la zona
de estudio estos objetos pueden ser naturales (troncos,
ramas, algas) o artificiales (cuerdas, redes, boyas), y
son originados por el transporte de vegetación costera
debido a las crecientes de los ríos y arroyos de
temporal, así como por la apertura de las boca-barra de
lagunas costeras, principalmente durante la temporada
tardía de lluvias. Es posible que C. falciformis se asocie
a los objetos flotantes con fines de alimentación.
Filmater et al. (2011) observaron que los tiburones
pueden permanecer varios días en los objetos flotantes
con fines de forrajeo y hacer excursiones cortas
durante la noche.
519
Figura 6. Proporción de individuos maduros en longitud
a intervalos de 5 cm de Carcharhinus falciformis capturados frente a la costa de Oaxaca (México) entre 2000 y
2007. a) hembras y b) machos.
Además, estos autores mencionan que durante la
asociación, el tiburón piloto ocupa los primeros 35 m
de la columna de agua, siendo más vulnerable a las
capturas.
En estudios previos realizados en otras localidades,
se registró una mayor proporción de hembras
(Branstetter, 1987; Oshitani et al., 2003; Hoyos-Padilla
et al., 2012). En este trabajo considerando todo el
período de estudio, no se observaron diferencias
significativas en la proporción de sexos. Sin embargo,
al hacer un análisis mensual, se observó un mayor
número de machos durante el periodo de lluvias. No
obstante, no se conoce porqué se presenta una mayor
proporción de hembras o machos en esta especie.
Algunos autores señalan una segregación por tallas y
sexo (Villavicencio-Garayzar, 1996; Sánchez-de Ita et
al., 2011).
Las tallas de captura a lo largo del Pacífico
mexicano presentan diferencias, que se pueden deber a
las zonas y artes de pesca, pero también a un gradiente
latitudinal. Para la costa oeste de Baja California,
Hoyos-Padilla et al. (2012) registraron tallas de 88-316
cm LT; para el Pacífico central, Cruz et al. (2011)
reportaron organismos de 65-215 cm LT y para Oaxaca
y Chiapas, Galván-Tirado et al. (2015) registraron
tallas de 69-220 cm LT. En el presente trabajo, se
observaron tallas de 49-265 cm LT, que están en el inter-
520
Figura 7. Longitud media total de embriones en el útero
de cada hembra preñada de Carcharhinus falciformis
capturados frente a la costa de Oaxaca (México) entre
2000 y 2007. Los huevos observados en el útero de cuatro
hembras se representan como embriones de LT = 0 sobre
la barra se indica el número total de embriones.
valo reportado por Soriano et al. (2006) para el golfo de
Tehuantepec (50-340 cm LT).
La talla de primera madurez (LT50) estimada fue
menor a la reportada en otras regiones (Tabla 2). La
comparación de la longitud a la madurez de varias
especies de tiburones oceánicos ha mostrado diferencias con respecto a la cual los individuos de una
población adquieren la madurez sexual en diferentes
regiones de su ámbito geográfico (Goldman & Musick,
2006). Estas variaciones en la talla de madurez han sido
relacionadas con un gradiente latitudinal (Cornello et
al., 2006; Joung et al., 2008). En general, los peces
maduran y crecen más rápido en zonas tropicales y
crecen lento y maduran tarde en zonas templadas
(Lombardi-Carlson et al., 2003). Una de las hipótesis
que puede explicar este patrón en ectotermos, es que un
tamaño corporal mayor en latitudes más altas,
permitiría una mayor cantidad de energía almacenada
para la temporada de menor disponibilidad de recursos
(Blackburn et al., 1999).
La talla media de captura en la costa de Oaxaca (112
cm LT) es menor que la longitud de primera madurez
estimada para ambos sexos, y menor que la talla de
maternidad estimada. Se determinó una elevada
proporción de hembras y machos con una longitud total
menor a sus correspondientes LT50 (93 y 94,7%,
respectivamente), esto mismo ha sido observado en
otras regiones. En el Océano Índico, Hall et al. (2012)
reportaron una alta proporción de ambos sexos con LT
< LT50 capturados con red de enmalle y palangre;
Watson et al. (2009) registraron las mayores capturas
de esta especie (LT < 90 cm) en las capturas inci-
dentales asociadas a la pesca de atún en el Pacífico
tropical oriental. En la costa de Oaxaca, las operaciones
de pesca se realizan cerca de la costa, donde los
juveniles se encuentran con más frecuencia y son más
susceptibles a la pesca. Si esto continúa, tendría
repercusiones sobre las estrategias de manejo para esta
especie, ya que la captura selectiva podría tener un
impacto en la capacidad de la población para
recuperarse.
Si bien los datos obtenidos durante el periodo de
muestreo no proporcionan información sobre la
duración completa del ciclo reproductivo de las
hembras, si indican que éstas no ovulan inmediatamente después del parto debido a que la maduración
de los ovocitos no está finalizada al momento de los
nacimientos. Sin embargo, no se encontró un patrón de
desarrollo claro y parece haber evidencia de un ciclo
reproductivo con cierta sincronicidad. La ausencia de
ovocitos en desarrollo en hembras con embriones a
término indica que los ciclos ováricos y uterinos son
secuenciales. Todo esto sugiere que en la costa de
Oaxaca, C. falciformis puede tener un ciclo bianual,
previamente reportado por Bransteter (1987) para el
golfo de México. Sin embargo, Galván-Tirado et al.
(2015) para el golfo de Tehuantepec mencionan que
puede extenderse de 3 o 4 años.
En la costa de Oaxaca las hembras pueden contener
al mismo tiempo ovocitos vitelogénicos, huevos o
embriones, que junto con la distribución mensual de la
talla de los embriones, sería indicativo que esta especie
da a luz a lo largo del año o en la mayor parte del año.
Esto se ha observado en otras regiones tropicales del
Pacífico e Índico, donde no tiene un periodo de
alumbramiento fijo (Strasburg, 1958; Bass et al., 1973;
Stevens & McLoughlin, 1991; Cruz et al., 2011;
Hoyos-Padilla et al., 2012). Sin embargo, en aguas
templadas-cálidas del Golfo de México, Branstetter
(1987) y Bonfil et al. (1993) sugieren un periodo de
gestación de 12 meses y fijan el período de nacimientos
de mayo a junio. Estas diferencias se deberían a que la
gestación en los tiburones depende principalmente de
la temperatura (Pratt & Casey, 1990).
Se estimó una fecundidad de 3 a 14 crías por
hembra, lo cual concuerda con lo señalado por Cruz et
al. (2011) para el Pacífico central mexicano, y es
similar a la registrada en otras regiones del Pacífico
(Tabla 2). La talla de nacimiento estimada para la costa
de Oaxaca (52-64 cm LT) se encuentra en el intervalo
reportado por Oshitani et al. (2003) para todo el Océano
Pacífico (65-81 cm LT) y Joung et al. (2008) para
Taiwan (63,5-75,5 cm LT), lo que sugiere que la talla
de nacimiento podría ser similar en todo el Pacífico;
mientras que para el Atlántico las tallas de nacimiento
son mayores (75-80 cm LT; Bonfil et al., 1993).
521
Tabla 2. Comparación de la talla de madurez (L50), talla de nacimiento (Lb) y tamaño de la camada de Carcharhinus
falciformis en la costa de Oaxaca, México (este estudio), con registros previos para esta especie.
Región
(periodo de muestreo)
Talla de madurez (cm)
hembras
machos
Noreste Golfo de México (1982-1985)
Golfo de México (1985-1989)
Océano Atlántico noroeste
Océano Atlántico ecuatorial (1998-2004)
Pacífico noroeste (2000-2002)
Pacífico central australiano
Océano Índico oriental (2001-2006)
Océano Pacífico (1992-1999)
Costa occidental de Baja California, México (2000-2002)
Pacífico central de México (2006-2007)
Golfo de Tehuantepec (1996-2003)
Golfo de Tehuantepec (2004-2006)
Costa de Oaxaca, México (2000-2007)
210-220
232-245
234
230
210-220
238-250
215.6
193-200
180
218
210-230
212.5
200-208
207.6
186
182
177
190
184,8
168
180
178,5
Lb (cm)
Fecundidad
Autor
75-80
2-12
5
63.5-75.5
4-15
8-10
81.1
65-80
2-14
1-16
Bransteter (1987)
Bonfil et al. (1993)
Springer (1960)
Hazin et al. (1990)
Jung et al. (2008)
Strasburg (1958)
Hall et al. (2012)
Oshitani et al. (2003)
Hoyos-Padilla et al. (2012)
Cruz et al. (2011)
Soriano et al. (2006)
Galván-Tirado et al. (2015)
Este estudio
>225
3-7
Aunque la estación y talla de nacimiento parecen ser
similares a lo largo del Pacífico mexicano, la captura de
hembras en diferentes estados de gravidez es variable.
Hoyos-Padilla et al. (2012) para la costa oeste de Baja
California encontraron hembras ovulando, con huevos
en útero y con embriones de 6-8 cm LT de julio a
septiembre, y sólo registraron una hembra con
embriones a término en junio. Para el Pacífico sur de
México, Soriano et al. (2006), Galván-Tirado et al.
(2015) y en el presente trabajo se observaron hembras
con embriones a término, lo cual sugiere que C.
falciformis utiliza las aguas costeras del suroeste de
México como zona de nacimiento y crianza, para
posteriormente migrar al norte para reproducirse.
A partir de datos que indican movimientos limitados
de individuos marcados en el Pacífico oriental (Kohin
et al., 2006) y de análisis de ADN (Galván-Tirado et
al., 2013), sugieren la existencia de diferenciación
genética entre las poblaciones de tiburón piloto, que
parece corresponder a un gradiente latitudinal en el
Pacífico. Además, se han observado diferencias en
aspectos reproductivos, edad y crecimiento entre las
regiones oriental y occidental del Pacífico (Joung et al.,
2008) y aún dentro de la misma región (Galván-Tirado
et al., 2013) (Tabla 2).
En la zona de estudio se obtuvieron de manera
simultánea, hembras grávidas con embriones terminales, neonatos y juveniles del año, que junto con una
importante abundancia de juveniles durante todo el año,
sugiere que el esfuerzo de la pesca artesanal se dirige
de manera oportunista a las zonas de reproducción. Es
probable que en la costa de Oaxaca se encuentre una
área de nacimiento y crianza, debido a que se cumplen
parcialmente los criterios para clasificar áreas de
crianza propuestos por Heupel et al. (2007): i) los
50
60-69
52-64
2-14
3-14
tiburones son más frecuentemente encontrados en el
área que en otras; la zona de estudio no cumple este
criterio, en el Golfo de Tehuantepec son comunes los
neonatos y juveniles, por lo cual su presencia no es
exclusiva de la costa de Oaxaca; ii) los tiburones tienen
la tendencia de permanecer o regresar por periodos
extensos al área; la zona de estudio lo cumple
parcialmente, en las capturas se registraron neonatos y
juveniles cercanos a la madurez, lo que indica que
permanecen por varios años en la costa de Oaxaca; iii)
el área es utilizada repetidamente a través de los años;
se han registrado en los muestreos de por lo menos seis
años, neonatos y juveniles del año, lo que sugiere que
la costa de Oaxaca es usada por neonatos y juveniles
del año repetidamente a través de los años. Sin
embargo, es necesario realizar un estudio regional,
donde se incluya un programa piloto de marcado y
recaptura de neonatos y monitoreo acústico, así como
una evaluación oceanográfica de sus hábitats costeros.
Además, se ha reportado que la mayoría de las
especies del género Carcharhinus tienen sus áreas de
crianza en aguas tropicales o subtropicales resguardadas,
como son bahías o lagunas costeras (VillavicencioGarayzar et al., 1996; Salomón-Aguilar et al., 2009).
La costa de Oaxaca presenta bahías con arrecifes,
lagunas costeras y ríos que aportan nutrientes a la costa,
estos ambientes de baja profundidad pueden proporcionar refugio a las crías de C. falciformis. En el
Pacífico mexicano se mencionan otras posibles áreas de
crianza de C. falciformis, como la costa oriental de Baja
California (Smith et al., 2009) y el Golfo de California
(Salomón-Aguilar et al., 2009).
Se reconoce que las áreas de reproducción y crianza
de tiburones son hábitats críticos, por lo que en México
la NOM-029 (SAGARPA, 2007) regula la pesca de
522
elasmobranquios, y a partir de 2012 se estableció un
periodo de veda del 1º de mayo al 30 de junio que
protege el principal periodo reproductivo. Si bien está
NOM y la veda reproductiva son un aporte favorable en
la protección a largo plazo para muchas especies, dadas
las décadas de explotación casi irrestrictas de los
elasmobranquios en aguas mexicanas, es muy probable
que ya se hayan dado restricciones en las poblaciones y
cambios en la estructura de tallas entre las especies de
menor fecundidad y mayor edad de madurez (Smith et
al., 2009). También, se debe mencionar que debido a la
reciente aplicación de las medidas de gestión, su
eficacia no ha sido evaluada.
Debido a los registros insuficientes para poder
identificar una zona como área de crianza de tiburón, y
a lo limitado de la información al momento de su
formulación, en la NOM-029 aparece un número
reducido de zonas de refugio. La ley no incluye a la
costa de Oaxaca, pero dada la información presentada
en este trabajo y la importancia de sus hábitats costeros
para los neonatos y juveniles, se sugiere su inclusión en
la regionalización de las áreas de crianza. Los
resultados de este trabajo contribuyen al conocimiento
del ciclo reproductivo de C. falciformis e identifican a
la costa de Oaxaca como un área importante para su
reproducción en el Pacífico tropical oriental.
AGRADECIMIENTOS
A los pescadores de Oaxaca. Martha Escamilla,
Jennyfer Chong, Luis Cruz y colegas del laboratorio de
Ictiología y Biología Pesquera de la UMAR por su
apoyo en el trabajo de campo. A Oscar Sosa Nishizaki
y a los árbitros anónimos por sus sugerencias que
ayudaron a mejorar el manuscrito. El trabajo fue financiado por el Fondo Sectorial SAGARPA-CONACYT
proyecto 069-2003 y el Gobierno del Estado de OaxacaCONAPESCA (2IR0502).
REFERENCIAS
Alejo-Plata, C., G. Cerdenares & G. González-Medina
2006. La pesca artesanal de tiburón en la Costa Chica
de Oaxaca, México, 2000-2003. In: S. Salas, M.A.
Cabrera, J. Ramos, D. Flores & J. Sánchez (eds.).
Memorias I Conferencia de Pesquerías Costeras en
América Latina y el Caribe. Evaluando, Manejando y
Balanceando Acciones. Mérida, Yucatán: COATFISH,
pp. 22-38.
Bass, A.J., J.D. Aubrey & N. Kistnasamy. 1973. Sharks of
the east coast of southern Africa. The genus Carcharhinus (Carcharhinidae). Oceanography Re-searching
Institute (Durban), Invest. Rep., 33: 168 pp.
Blackburn, T.M., K.J. Gaston & N. Loder. 1999.
Geographic gradients in body size: a classification of
Bergmann`s rule. Divers. Distrib., 5: 165-174.
Bonfil, R. 1997. Status of shark resources in the Southern
Gulf of Mexico and Caribbean: implications for
management. Fish. Res., 29: 101-117.
Bonfil, R. 2008. The biology and ecology of the silky
shark, Carcharhinus falciformis. In: M. Camhi, E.K.
Pikitch & E.A. Babcock (eds.). Sharks of the open
ocean. Blackwell Publishing, Oxford, pp. 114-127.
Bonfil, R., R. Mena & D. de Anda. 1993. Biological
parameters of commercially exploited silky sharks,
Carcharhinus falciformis, from the Campeche Bank,
Mexico. NOAA Technical Report NMFS. Circular,
115: 73-86.
Bonfil, R., A. Amorim, C. Anderson, R. Arauz, J. Baum,
S.C. Clarke, R.T. Graham, M. González, M. Jolón,
P.M. Kyne, P. Mancini, F. Márquez, C. Ruiz & W.
Smith. 2009. Carcharhinus falciformis In IUCN Red
List of Threatened Species. Disponible en línea:
[www.iucnredlist.org].
Branstetter, S. 1987. Age, growth and reproductive
biology of the silky shark, Carcharhinus falciformis,
and the scalloped hammerhead, Sphyrna lewini, from
the northwestern Gulf of Mexico. Environ. Biol. Fish.,
19: 161-173.
Brenes, C.L.A., A. Hernández & J. Campos. 2000.
Distribución espacial de las capturas de tiburón en el
Océano Pacífico nicaragüense y su relación con
algunas variables oceanográficas. Rev. Biol. Trop.,
48(2-3): 399-411.
Castro, J.I. 2009. Observations on the reproductive cycles
of some viviparous North American sharks. Aquacult.
Int. J. Ichthyol., 15: 205-222.
Clarck, E. & K. Von Schmidt. 1965. Shark of the central
Gulf of coast Florida. Bull. Mar. Sci., 15: 13-83.
Compagno, L. 1984. FAO Species Catalogue. Vol. 4.
Sharks of the World. An annotated and illustrated
catalogue of shark species known to date. Part 2.
Carcharhiniformes. FAO Fish. Synop., Roma, 125 pp.
Cornello, H.H., L.O. Lucifora & A.M. Massa. 2006.
Reproduction of the angular angel shark (Squatina
guggenheim): geographic differences, reproductive
cycle, and sexual dimorphism. ICES J. Mar. Sci., 64:
131-140.
Cruz, A., S.R. Soriano, H. Santana, C.E Ramírez & J.J.
Valdez. 2011. La pesquería de tiburones oceánicoscosteros en los litorales de Colima, Jalisco y
Michoacán. Rev. Biol. Trop., 59(2): 655-667.
Filmater, J.D., L. Dagorn, P.D. Cowley & M. Taquet.
2011. First descriptions of the behavior if silky sharks,
Carcharhinus falciformis, around drifting fish aggre-
gating devices in the Indian Ocean. Bull. Mar. Sci.,
87(3): 325-337.
Galván-Tirado, C., P. Díaz-Jaimes, F.J. García de León, F.
Galván-Magaña & M. Uribe-Alcocer. 2013. Historical
demography and genetic differentiation inferred from
the mitochondrial DNA of the silky shark
(Carcharhinus falciformis) in the Pacific Ocean. Fish.
Res., 147: 36-46.
Galván-Tirado, C., F. Galván-Magaña & R.I. OchoaBáez. 2015. Reproductive biology of the silky shark
Carcharhinus falciformis in the southern Mexican
Pacific. JMBA, 95(3): 561-567.
Goldman, K.J. & J.A. Musick. 2006. Growth and maturity
of salmon sharks (Lamna dutropis) in the eastern and
western North Pacific, and comments on backcalculation methods. Fish. Bull., 104: 278-292.
Haddon, M. 2001. Modeling and quantitative methods in
fisheries. Chapman and Hall, Florida, 402 pp.
Hall, N.G., C. Bartron, W. White, T. Dharmadi & I.C.
Potter. 2012. Biology of the silky Carcharhinus
falciformis (Carcharhinidae) in the eastern Indian
Ocean, including an approach to estimating age when
timing of parturition is not well defined. J. Fish Biol.,
80: 1320-1341.
Hazin, H.V., A. Couto, K. Kihara, K. Otsuka & M. Ishino.
1990. Distribution and abundance of pelagic sharks in
the South-Western Equatorial Atlantic. J. Tokyo Univ.
Fish., 77: 51-64.
Heupel, M.R., J.K. Carlson & C.A. Simpfendorfer. 2007.
Shark nursery areas: concepts, definition, characterization and assumptions. Mar. Ecol. Prog. Ser., 337:
287-297.
Hoyos-Padilla, M., P. Ceballos-Vázquez & F. GalvánMagaña. 2012. Reproductive biology of the silky shark
Carcharhinus falciformis (Chondrichthyes: Carcharninidae) off the west coast of Baja California Sur,
Mexico. Aquacult. Int. J. Ichthyol., 18: 1-15.
Joung, S.J., C.T. Chen, H.H. Lee & K.M. Liu. 2008. Age,
growth, and reproduction of silky sharks,
Carcharhinus falciformis, in northeastern Taiwan
waters. Fish. Res., 90: 78-85.
Kohin, S, R. Arauz, D. Holts & R. Vetter. 2006.
Preliminary results: behavior and habitat preferences
of silky sharks (Carcharhinus falciformis) and a big
eye thresher shark (Alopias superciliosus) tagged in
the Eastern Tropical Pacific. Memoria 1er SeminarioTaller del Estado del Conocimiento de la Condrictiofauna de Costa Rica. Instituto Nacional de Biodiversidad
INBIO, Costa Rica, 3 pp.
Last, P.R. & J.D. Stevens. 1994. Sharks and rays of
Australia. CSIRO, Australia, 523 pp.
523
Lavin, M.F., J.M. Morales, M.L. Argote, E.D. Barton, R.
Smith, J. Brown, M. Kosro, A. Traviña, H.S. Vélez &
J. García. 1992. Física del Golfo de Tehuantepec.
Cienc. Des., 12: 97-108.
Liang, J.H., J.C. McWilliams & N. Gruber. 2009. Highfrequency response of the ocean to mountain gap
winds in the northeastern tropical Pacific. J. Geophys.
Res., 114, C12005. doi:10.1029 /2009JC005370.
Liu, K.M., C.T. Chen, T.H. Liao & S.J. Joung. 1999. Age,
growth, and reproduction of the pelagic thresher shark
Alopias pelagicus in the northwestern Pacific. Copeia,
1999(1): 68-74.
Lombardi-Carlson, L.A., E. Cortés, G.R. Parsons & C.A.
Mainire. 2003. Latitudinal variation in life-history
traits of bonnethead sharks, Sphyrna tiburo
(Carcharhiniformes: Sphyrnidae) from the eastern
Gulf of Mexico. J. Mar. Freshwater Res., 54: 875-883.
Oshitani, S., S. Nakano & S. Tanaka. 2003. Age and
growth of the silky shark Carcharhinus falciformis
from the Pacific Ocean. Fish. Sci., 69: 456-464.
Pratt, H.L. Jr. 1979. Reproduction in the blue shark,
Prionace glauca. Fish. Bull., 77: 445-469.
Pratt, H. & J. Casey. 1990. Shark reproductive strategies
as a limiting factor in directed fisheries, with a review
of Holden`s method of estimating growth parameters.
NOAA. Technical Reports, U.S. Nat. Mar. Fisher.
Serv., 90: 97-109.
Secretaría de Agricultura, Ganadería, Desarrollo Rural,
Pesca y Alimentación (SAGARPA). 2007. Norma
Oficial Mexicana NOM-029-PESC-2006. Pesca
responsable de tiburones y rayas: Especificaciones
para su aprovechamiento. México: Diario Oficial de la
Federación. [http://dof.gob.mx/nota_detalle.php?codigo=4962277&fecha=14/02/2007]. Revisado: 10 Enero
2016.
Salomón-Aguilar, C.A., C.J. Villavicencio-Garayzar & H.
Reyes-Bonilla. 2009. Zonas y temporadas de reproducción y crianza de tiburones en el Golfo de
California: estrategia para su conservación y manejo
pesquero. Cienc. Mar., 35(4): 369-388.
Sánchez-de Ita, J.A., C. Quiñonez-Velázquez, F. GalvánMagaña, N. Bocanegra-Castillo & R. Félix-Uraga.
2011. Age and growth of the silky shark Carcharhinus
falciformis from the west coast of Baja California Sur,
Mexico. J. Appl. Ichthyol., 27(1): 20-24.
Smith, W.D., J.J. Bizzarro & G.M. Cailliet. 2009. La pesca
artesanal de elasmobranquios en la costa oriental de
Baja California, México: características y consideraciones de manejo. Cienc. Mar., 35: 209-236.
Soriano, V.S., D.S. Acal, L. Castillo-Géniz, N.G. Vázquez
& E.S. Santiago. 2006. Tiburón del Golfo de
Tehuantepec. In: S.F. Arreguín, M.J. Meléndez, M.I.
Gómez-Humaran, S.R. Solana & D.C. Rangel (eds.).
Sustentabilidad y pesca responsable en México:
524
evaluación y manejo 1990-2000. INP, SAGARPA,
México, pp. 325-364.
Springer, S. 1960. Natural history of the sandbar shark,
Eulamia milberti. Fish. Bull., 61: 1-38.
Stevens, J.D. & K.J. McLoughling. 1991. Distribution,
size and sex composition, reproductive biology and
diet of sharks from northern Australia. Aust. J. Mar.
Freshwater Res., 42(2): 151-199.
Strasburg, D.W. 1958. Distribution, abundance, and habits
of pelagic sharks in the central Pacific Ocean. Fish.
Bull., 58: 335-361.
Villavicencio-Garayzar, C. 1996. Reproducción de
Carcharhinus obscurus (Pisces: Carcharhinidae), en el
Pacífico nororiental. Rev. Biol. Trop., 44(1): 287-289.
Received: 9 April 2015; Accepted: 29 March 2016
Walker, T.I. 2005. Reproduction in fisheries science. In:
W.C. Hamlett. (ed.). Reproductive biology and
phylogeny of chondrichthyes: sharks, batoids and
chimaeras. Science Publisher, Enfield, 562 pp.
Watson, J., T. Essington, C. Lennert-Cody & M. Hall.
2009. Trade-offs in the design of fishery closures:
management of silky shark by catch in the Eastern
Pacific Ocean tuna fishery. Conserv. Biol., 23(3): 626635.
Zar, J.H. 1999. Biostatistical analysis. Prentice Hall, New
Jersey, 663 pp.
Lat. Am. J. Aquat. Res., 44(3): 525-534, 2016
Diversidad y origen genético de bagre de canal introducido
525
Research Article
Diversidad y origen genético de poblaciones introducidas de bagre de canal
(Ictalurus punctatus Rafinesque, 1818), en el centro occidental de México
Diana Suarez-Salgado1, José Herrera-Camacho2
Ana Laura Lara-Rivera3 & Gaspar Manuel Parra-Bracamonte1
1
Instituto Politécnico Nacional, Centro de Biotecnología Genómica, Reynosa, Tamaulipas, México
2
Universidad Michoacana de San Nicolás de Hidalgo, Instituto de Investigaciones
Agropecuarias y Forestales, Morelia, Michoacán, México
3
Instituto de Ciencias Agrícolas, Universidad Autónoma de Baja California
Valle de Mexicali, B.C., México
Corresponding author: Gaspar Manuel Parra-Bracamonte (gparra@ipn.mx)
RESUMEN. El bagre de canal es una especie importante en la acuacultura de México y se produce en sistemas
tradicionales. El estado de Tamaulipas ha sido el origen de diversas poblaciones de bagre de canal en el país.
Por ello, el objetivo del presente trabajo fue evaluar el origen genético de poblaciones de bagre de canal
(Ictalurus punctatus) introducidas en el centro occidental de México mediante marcadores de ADN. El estudio
comprendió cuatro poblaciones de Michoacán, Zacatecas y Jalisco, y se utilizaron como referencia fundadora
dos poblaciones correspondientes a Tamaulipas y Coahuila. El análisis se realizó con un panel de 13
microsatélites previamente reportados. Se evaluaron diversos parámetros de diversidad y estructura poblacional.
Las seis poblaciones presentaron exceso de heterocigotos y un coeficiente de endogamia FIS ≤ -0,014. El análisis
de la estructura genética se determinó mediante una comparación pareada de poblaciones e identificó un 5,92%
explicado por la variación entre poblaciones (FST = 0,059, P < 0,001). Mediante las aproximaciones de análisis
se identificó a la población de Tamaulipas como el origen genético más probable de las poblaciones de bagre en
los estados evaluados.
Palabras clave: Ictalurus punctatus, diversidad genética, microsatélites, estructura poblacional, acuicultura.
Diversity and genetic origin of introduced channel catfish
(Ictalurus punctatus Rafinesque, 1818) to central-west Mexico
ABSTRACT. The channel catfish is an important aquaculture species in Mexico mostly managed in traditional
production systems. The state of Tamaulipas has been the source of diverse populations of channel catfish in the
country, however there is no documentary evidence of this. Therefore, the objective of this study was to confirm
the genetic origin of populations of channel catfish (Ictalurus punctatus) of west central Mexico by
microsatellite DNA markers. The study included four domestic populations from Michoacán, Zacatecas and
Jalisco and two reference founder populations from Tamaulipas and Coahuila. The analysis was performed with
a panel of 13 microsatellites. Some parameters of diversity and population structure were evaluated. The six
populations showed excess of heterozygotes and a coefficient endogamy F IS ≤ -0.014. The analysis of gene
structure was determined by a paired comparison populations, and indicated the 5.92% of variation among
populations (FST = 0.059, P < 0.001). The assessment approaches identified the population of Tamaulipas as the
most likely genetic origin of channel catfish populations currently used in the evaluated states.
Keywords: Ictalurus punctatus, genetic diversity, microsatellites, population structure, aquaculture.
INTRODUCCIÓN
El bagre de canal (Ictalurus punctatus) es una de las
principales especies en la acuacultura de México (De la
Rosa-Reyna et al., 2014; Lara-Rivera et al., 2015). El
área de distribución nativa del bagre comprende parte de
__________________
Norteamérica y de Centroamérica (Sur de Canadá, Este
de los Estados Unidos y Noreste de México) (Jackson,
2004). Pese a ser un pez nativo en México, los
organismos actualmente utilizados con fines comerciales se introdujeron por primera vez en 1943 desde
Estados Unidos (Ceballos-Orozco & Vázquez-Escobar,
526
1988). A partir de esa fecha se han reportado otras cinco
introducciones del mismo origen hacia México a través
de Tamaulipas (Parra-Bracamonte et al., 2011; LaraRivera et al., 2015). Los primeros registros sobre
sistemas de producción datan de la década del 70’ en
granjas de Tamaulipas y Sinaloa (De la Rosa-Reyna et
al., 2014). Tamaulipas, por sus características geográficas y climatológicas ha presentado un acelerado
ritmo de crecimiento, con excelentes perspectivas de
desarrollo, consolidándolo como el principal productor
de bagre de canal en el país (Parra-Bracamonte et al.,
2011).
La identificación de líneas y grupos genéticos es
fundamental para el manejo correcto de la acuicultura
(De la Rosa-Reyna et al., 2014). Por su potencial de
adaptabilidad y producción, el bagre de canal ha sido
introducido en diversas entidades del país. La Carta
Nacional Pesquera (2013) señala su cultivo en
Aguascalientes, Chihuahua, Coahuila, Guanajuato,
Nuevo León, San Luis Potosí, Sinaloa, Sonora, Colima,
Guerrero y Michoacán. En 2014, Lara-Rivera et al.
(2015) identificaron también su presencia en Durango,
Baja California, Estado de México, Hidalgo, Querétaro,
Aguascalientes, Jalisco, Morelos, Zacatecas y Veracruz.
Pese a esto, no existe información precisa sobre el
tamaño efectivo, o de las movilizaciones (introducciones
o reintroducciones) de estas poblaciones de bagre de
canal.
La producción de bagre de canal en México es de
~1.900 ton (FAO, 2015) y se realiza en sistemas
tradicionales, en unidades de producción poco
tecnificadas y su manejo no se encuentra estandarizado
(Lara-Rivera et al., 2015). Las granjas se caracterizan
por tener estanques rústicos y ausencia de registros de
producción. La selección de individuos y su cruzamiento se realiza en base a su fenotipo (aspecto, talla y
peso). El sistema de manejo reproductivo se efectúa con
reemplazo de reproductores elegidos de la progenie,
para mantener el acervo genético original (CeballosOrozco & Vázquez-Escobar, 1988; De la Rosa-Reyna
et al., 2014).
Actualmente, diferentes herramientas moleculares
se aplican con diferentes propósitos en el área acuícola.
Los marcadores microsatélites, por sus características
de alto polimorfismo y su naturaleza co-dominante,
permiten estimar la diversidad genética dentro y entre
poblaciones, son ampliamente usados para estudios de
identidad de poblaciones, paternidad e inclusive,
permite distinguir entre individuos estrechamente
relacionados (Chistiakov et al., 2006). Los marcadores
microsatélites, han sido utilizados para caracterizar las
poblaciones de bagre de canal en Tamaulipas, México.
Perales-Flores et al. (2007), en diferentes granjas
productoras y Parra-Bracamonte et al. (2011), en una
población reproductora, observaron bajos índices de
diversidad genética y bajos niveles de heterocigosidad.
Recientemente, De la Rosa-Reyna et al. (2014)
evaluaron la diferenciación entre poblaciones
domésticas incluyendo la línea comercial NWAC103
que presumiblemente ha sido introducida al país,
reportando similitud genética entre las poblaciones y
concluyendo en dos posibles orígenes ancestrales
derivados de introducciones originales hasta Tamaulipas.
En la región occidental de México, algunas granjas
productoras han introducido el bagre de canal presumiblemente desde Tamaulipas. Sin embargo, no se conoce
con exactitud su origen después de un tiempo
considerable de manejo y mantenimiento de las poblaciones. De la misma manera, programas gubernamentales a través de centros acuícolas que no mantienen una
producción constante son fuentes potenciales de la
especie, aunque hasta hoy no se ha realizado algún
monitoreo para comprobarlo. De esta manera, el
objetivo del presente estudio fue analizar indicadores
de diversidad genética y verificar el origen genético
más probable de cuatro poblaciones de bagre de canal
(Ictalurus punctatus) introducidas en el occidente de
México.
Se analizaron 248 muestras de bagre de canal de cuatro
granjas del centro occidental de México: Jalisco 1 (JSY,
n = 31), Jalisco 2 (JLB, n = 47), Michoacán (MCH, n =
53) y Zacatecas (ZCT, n = 50), utilizando dos poblaciones
fundadoras de referencia, una de Tamaulipas (STM, n =
43) y otra de un Centro Acuícola Gubernamental de
Coahuila (LRS, n = 24) (Fig. 1). La población STM ha
sido descrita por Parra-Bracamonte et al. (2011) como
el principal reproductor y proveedor de crías de bagre
en México; LRS, como Centro Acuícola oficial es el
único sitio con financiamiento gubernamental que
posee y comercializa crías de bagre de canal para
engorde; el origen de su material genético consiste en
temporadas de auto-remplazo e introducción de
organismos de origen extranjero (Parra-Bracamonte et
al., 2010).
Se obtuvo ~50 mg de aleta anal o adiposa. Las
muestras se conservaron en etanol al 96%, para su
almacenamiento y posterior procesamiento, en el banco
de muestras del Laboratorio de Biotecnología Animal
del Centro de Biotecnología Genómica del IPN en
Reynosa, Tamaulipas. La extracción de ADN genómico de las muestras, se realizó mediante el Kit
comercial Genelute Mammalian Genomic DNA
Miniprep (SIGMA Aldrich). El ADN obtenido, se
visualizó por electroforesis en gel de agarosa al 1,5% a
65-80 volts por 35 min sobre solución buffer y se cuan-
527
Figura 1. Localización de las granjas de bagre de canal de México, incluidas en el estudio. JSY: Jalisco 1, JLB: Jalisco 2,
MCH: Michoacán, STM: Tamaulipas, LRS: Centro Acuícola Gubernamental de Coahuila.
tificó en un espectrofotómetro Nano Drop 2000c de
Thermo Scientific v1.1. Se utilizó un panel de 13
microsatélites: IpCG0032, IpCG0035, IpCG0038,
IpCG0070, IpCG0128, IpCG0189, IpCG0195, IpCG
0273, Ip070, Ip265, Ip427, Ip591 y Ip607 analizados
bajo las condiciones previamente reportadas (Tan et al.,
1999; Waldbieser et al., 2001; Waldbieser & Wolters,
2007; Parra-Bracamonte et al., 2011). La técnica de
reacción en cadena de la polimerasa se realizó
conforme a lo señalado por la literatura con las
variaciones de ADN molde, cloruro de magnesio,
temperatura, dNTPs y Taq polimerasa. Según el
microsatélite a amplificar, las reacciones se efectuaron
en un volumen de 10 µL de acuerdo a las condiciones
optimizadas por Parra-Bracamonte et al. (2011). Se
utilizó un termociclador (MJ Research) en programas
de PCR en modalidad Touch Down, con una
temperatura de desnaturalización inicial de 95°C por 5
min seguida de 30 ciclos con alguna de las siguientes
opciones: 1) 95°C por 45 s, 62°C por 45 s
disminuyendo 2°C por ciclo y 72°C por 45 s; 2) 95°C
por 45 s, 65°C por 45 s disminuyendo 2°C por ciclo y
72°C por 45 s; y 3) 95°C por 45 s, 58°C por 45 s
disminuyendo 2°C por ciclo y 72°C por 45 s;
finalmente, con una temperatura de 72°C por 10 min.
Las amplificaciones fueron examinadas por
visualización en geles de agarosa 2,5% y 3,5% y
posteriormente se analizaron en un secuenciador
automático (ABI DNE 3130). Los electroferogramas
obtenidos fueron analizados con el software
GeneMapper Applied Biosystems, para determinar los
genotipos.
Se evaluó el contenido de información polimórfica
(PIC), y la probabilidad de exclusión individual (PE-I)
como indicadores de informatividad del panel microsatélite estudiado (Tabla 1). El PIC, expresa la
posibilidad de detectar polimorfismos debido a la
distribución de los alelos dentro de una población; y la
PE-I expresa la probabilidad de encontrar un individuo
con el mismo genotipo en un locus determinado dentro
de una población al seleccionarlo aleatoriamente
(Kalinowski et al., 2007). Además, se estimaron las
heterocigosidades observada (HO) y esperada (HE), para
cada locus y población usando el programa FSTAT
v.2.9.3 (Goudet, 2001).
Se determinó la estructura genética mediante un
análisis de varianza molecular (AMOVA) y se
estimaron los índices de fijación (FIS, FST y FIT), que
describen la variación genética a nivel intrapoblacional
(FIS), entre poblaciones (FST) y total (FIT). Como
criterios de evaluación del origen genético se utilizaron
dos aproximaciones. Primero, se determinaron los
índices de diferenciación por medio de los valores de
FST y el número de migrantes por análisis pareado
usando el software Arlequin v.3.5 (Excoffier &
Lischer, 2010), considerando después de la corrección
de Bonferroni una P ≤ 0,0083 para considerarla signifi-
528
Tabla 1. Características del panel de microsatélites utilizado en el estudio de bagre de canal. PE-I: probabilidad de exclusión
individual, PIC: contenido de información polimórfica.
Loci
IpCG0032
IpCG0035
IpCG0038
IpCG0070
Ip077
IpCG0128
IpCG0189
IpCG0195
Ip265
IpCG0273
Ip427
Ip591
Ip607
Secuencia
(5´-3´)
VIC-TAAGATGCGTATGAAGACAA/
GTTACAATATTTAGAACGGTATAAGC
VIC-AACCACTAAGCCTAGCACGTTC/
AGTATGGGTACTGCAACAAA
VIC-GTGTGCCTGATTTACTAATGATAAG
TGTATTGGTATAGAACACATTAGCC
FAM-ATCATTTTCTGCTTCTTATACATAGGCT
CCTTTAGATGAACTCACCTGCC
VIC-GAAACACAATGTACAGTAAGCTG
GCTGCTTCTTATGGAATCTC
VIC-GATCCACTGAGAAATAAGAGCACA
GGAGTATAGCACAGAAACACGAA
FAM-GATCCTGTGCTAAAGAAACCAAG
GTGCCGCAGTGTGTTGTAAA
FAM-AACTGTCATTTACACACATTCATCTA
GCAGGTCTGTCGTCATCTA
NED-AGAGGTTGAAATAAAACACAGCC
AAGACCCCACTTCCATCATC
NED-CGTTTTACTTCCTCATACAGCAC
GCACCAAGAGACCTGTGACA
FAM-CATTTTGCTAGGTGCGCGCACG
GGTGCCTTTATATGTATATAC
NED-FCTGCTTTAGGTCCACCCACTGC
AGGCACTTGACATTTAGCCTGC
NED-CAGGCACAAATCTTGTGATGG
TTGTAGTTCTGCCTCTAACCGC
cativa. Posteriormente, se aplicó un análisis de
asignación grupal considerando las poblaciones JSY,
JLB, MCH y ZCT para evaluación, utilizando las
poblaciones de STM y LRS como referencia, con un
nivel de error en las asignaciones de P = 0,01. En
general, los métodos de asignación utilizados asignan
cada individuo de acuerdo a su probabilidad (basada en
su genotipo) de pertenecer a cualquiera de las
poblaciones de referencia (Piry et al., 2004). Para la
asignación se utilizaron cuatro métodos: un análisis
Bayesiano propuesto por Baudouin & Lebrun (2000),
el método basado en frecuencias (Paetkau et al., 1995),
el método de las distancias standard de Nei (Nei, 1972)
y una aproximación filogenética (Cavalli-Sforza &
Edwards, 1967) para confirmar las asignaciones. Todos
estos procedimientos fueron realizados utilizando el
programa Geneclass 2.0 (Piry et al., 2004).
Complementariamente, se analizaron los datos para
tener una perspectiva gráfica en un árbol calculado por
el método de Neighbor-joining basado en valores de
fijación (FST) estimados previamente y visualizadas en
el programa Evolview (Zhang et al., 2012).
Motivo
Rango reportado Rango encontrado
PE-I
(pb)
(pb)
PIC
ATAG
270-326
154-322
0,44
0,769
ATAG
281-349
157-349
0,61
0,870
ATAG
102-161
80-164
0,41
0,746
ATAG
218-355
147-319
0,72
0,769
(GT)15
69-115
93-127
0,41
0,752
AAAG
252-325
251-323
0,59
0,860
AAT
201-261
147-261
0,61
0,868
AAT
220-249
218-251
0,49
0,800
(CA)32
141-220
99-277
0,78
0,936
AAG
143-254
113-188
0,63
0,877
(CA)24
221-254
219-315
0,74
0,921
(GT)7 (GA)20
117-149
93-231
0,62
0,868
(GA)24
102-174
86-180
0,73
0,917
RESULTADOS
La probabilidad de exclusión individual (PE-I) de los
microsatélites se encontró de 0,41 a 0,78 con una
probabilidad conjunta conjunta del panel microsatelite
>0,999. Los loci más informativos (PE-I >0.5) fueron:
IpCG0035, IpCG0070, IpCG0128, IpCG0189, Ip265,
IpCG0273, Ip427, Ip591 y Ip607. La evaluación de la
variabilidad genética de las poblaciones mostró una
riqueza alélica (Ar) en un rango de 3,99 a 22 alelos en
los 13 loci, el Ip077 se observó con valores bajos (3,99
a 8,1) y el Ip265 fue el más polimórfico (6,5 a 22). LRS
a nivel poblacional tuvo la menor Ar (<8,59) (con
excepción del Ip607 con 11,57) y MCH la mayor Ar
(7,9 a 21,7).
Las heterocigosidades tuvieron un rango de H O =
0,763-0,887 y HE = 0,752-0,860. En general, su promedio por población fue mayor para la HO con respecto a
HE (Tabla 2). En los locus IpCG0035 e Ip077 las seis
poblaciones presentaron mayor HO que la HE, además
en cuatro de las seis poblaciones se encontró un locus
con HO igual a 1,0 (excepto JSY y LRS). Solo las
poblaciones JLB y MCH mostraron HE = HO en el locus
IpCG0032 e Ip607, respectivamente. El análisis
AMOVA indicó un FST de 0,050 (P < 0,001) e indicó
que la variación entre individuos corresponde al
98,74% y solo el 5,03% a diferencias entre poblaciones
(Tabla 3).
La comparación pareada del índice de fijación (FST)
en las seis poblaciones (P ≤ 0,001) se estimó en un
rango de 0,014 a 0,104 (Tabla 4). La menor divergencia
se estimó entre STM con las poblaciones: JSY, JLB y
MCH (con 0,014, 0,018 y 0,020, respectivamente), y en
general menor similitud con LRS (FST = 0,068-0,104).
Los niveles de endogamia (FIS) estimados fueron muy
bajos para todas las poblaciones, con valores cercanos
a cero.
En las poblaciones también se evaluó el número de
migrantes (Nm) observándose un rango de 4,26-34,98
individuos. La población LRS mostró el menor Nm
(4,26-6,74) y STM los valores mayores con las poblaciones restantes (ZAC 7,37; MCH 24,08; JLB 26,9 y
JSY 34,98).
La evaluación de las probabilidades de asignación
realizada mediante los métodos bayesianos y el basado
en las frecuencias, mostraron el 100% de las
poblaciones JLB, JSY, MCH y ZCT asignadas a la
población de referencia STM (Tabla 5). Las distancias
de Nei mostraron que con >73% se asignaron las
poblaciones a STM con excepción de ZCT (con 61,2%
a STM). La aproximación filogenética también mostró
asignación mayoritaria a STM nuevamente con la
excepción de ZCT que se observó menos concluyente
con 54,2% a STM y 45,8% LRS. De acuerdo a los
índices de fijación se observó gráficamente que las
poblaciones de JLB y JSY tienen mayor relación con
STM, la de MCH posee relación a esta ramificación y
las poblaciones de ZCT y LRS mostraron que
comparten una ramificación diferente (Fig. 2).
DISCUSIÓN
El panel de marcadores microsatélites utilizado en el
presente estudio, confirmó su utilidad y puede ser usado
para realizar distintos análisis como paternidad,
cartografía genética, determinación de variabilidad o
estructura gracias a su PIC ≥0,746. El rango alélico en
las seis poblaciones con los marcadores microsatelites
son más amplios a los reportados por Tan et al. (1999),
Waldbieser et al. (2001) y Waldbieser & Wolters
(2007), esto podría ser el resultado del alto
polimorfismo de los marcadores, la introducción de
nuevos especímenes en un corto periodo de tiempo, el
flujo génico o el resultado de la distancia genética sobre
un determinado tiempo (Waldbieser & Bosworth, 2012;
De la Rosa-Reyna et al., 2014).
529
El indicador de riqueza alélica (Ar) mostró que
MCH tiene un promedio de alelos de 13,29 y LRS
posee el menor valor con solo 7,09. Parra-Bracamonte
et al. (2011) reportaron para poblaciones domésticas de
I. punctatus una Ar = 10,60 y 10,84 en muestras
obtenidas entre 2005 y 2009 en Tamaulipas. De
acuerdo a la literatura, es común encontrar valores
menores de riqueza alélica en poblaciones domésticas,
debido a que experimentan una pérdida de variación
genética al pasar de silvestres a domésticas (Lamkom
et al., 2008). Durante este proceso, básicamente una
muestra de la población original es mantenida cautiva,
posiblemente sometida a selección artificial y una
consecuencia posterior en generaciones subsecuentes,
es la pérdida del pool genético original por deriva
genética. Sin embargo, en condiciones naturales,
también puede ser el resultado de loci relacionados con
la adaptación medioambiental de la especie. Además,
los sistemas productivos de bagre de canal en México
están a reserva del conocimiento empírico de los
productores y del manejo basado en el escaso
conocimiento del acervo genético de las poblaciones.
La literatura ha señalado que en poblaciones sobreexplotadas se puede presentar una pérdida de la
variación genética, que es subestimada en muchas
poblaciones. Además, se señala que se podría
considerar una reducción de la Ar hasta en 12% y 2%
en heterocigosidades (Allendorf et al., 2014).
En este estudio, los niveles de heterocigosidad en
general responden a HO>HE para todas las poblaciones
y a nivel de loci, cuatro mostraron HO = 1,0 mientras
que su HE fue de 0,850-0,885. Dos loci (IpCG0035 e
Ip077) se muestran en todas las poblaciones con HO por
encima de la HE. Perales-Flores et al. (2007), en seis
granjas productoras de la misma especie en Tamaulipas
reportaron heterocigosidad baja con valores de H O =
0,57-0,77 y HE = 0,69-0,84 (HO<HE), con solamente
cinco microsatelites. Posteriormente Parra-Bracamonte
et al. (2011), confirmaron un exceso de homocigotos en
la misma región. Recientemente De la Rosa-Reyna et
al. (2014), en poblaciones de Tamaulipas comparando
la cepa NWAC103, reportaron diferenciación entre
poblaciones locales, junto a un aumento de la
variabilidad con respecto a estudios anteriores, pero
con índice de homocigosis por encima de los
heterocigotos. Ha et al. (2009) con bagre rayado
(Pangasianodon hypophthalmus) de Vietnam, reportaron heterocigocidades de poblaciones domésticas surgidas de vida silvestre y compararon ambas poblaciones reportando: H O = 0,62-0,65 y HE = 0,62-0,64 en
silvestres, H O = 0,61-0,66 y HE = 0,61-0,64 en
domésticas, ambas sin desviación significativa. Ellos
asumen que se requiere que transcurra más tiempo para
mostrar una diferenciación en las poblaciones que pro-
Tabla 2. Parámetros de variabilidad genética de cuatro poblaciones de bagre de canal (Ictalurus punctatus) en el centro occidental de México y dos de referencia,
con un panel de 13 microsatélites. Ar: riqueza alélica, HO: heterocigosidad observada, HE: heterocigosidad esperada.
530
531
Tabla 3. Análisis de varianza molecular (AMOVA) entre las seis poblaciones de bagre de canal analizadas con el panel de
13 microsatélites. gl: grados de libertad, *P < 0,001.
Fuente de variación
gl
Entre poblaciones
Entre individuos dentro de poblaciones
Entre individuos
Total
5
242
248
495
Suma de
cuadrados
118,61
1043,66
1158,00
2320,26
Tabla 4. Comparación pareada de parámetros de índice de
fijación (FST, sobre la diagonal), coeficiente de endogamia
(FIS, diagonal) y número de migrantes (debajo la diagonal)
entre las seis poblaciones estudiadas de bagre de canal
(Ver siglas en Fig. 1).
Poblaciones
JSY
JLB
MCH
ZCT
STM
LRS
JSY
JLB
MCH
-0,023 0,020 0,032
23,99 -0,047 0,020
15,01 23,42
-0,014
6,1
7,22
7,25
34,98 26,9
24,08
4,91
6,49
5,77
ZCT STM
0,075 0,014
0,064 0,018
0,064 0,020
-0,062 0,063
7,37 -0,032
4,26
6,74
LRS
0,092
0,071
0,079
0,104
0,068
0,006
vienen del mismo origen. Aunque sin duda, la principal
fuente de variación en poblaciones domésticas se
relaciona con el manejo particular de los reproductores
y su diseminación. Dado que la heterocigosidad varía
generalmente en función del tamaño de población, los
resultados del presente trabajo sugieren la posibilidad
de estar analizando poblaciones que han experimentado
recientemente grandes introducciones de progenitores.
Sin embargo, la disponibilidad de bitácoras de
movilización o registro de introducciones es escasa.
Yousefian et al. (2012), con trucha arcoíris (Oncorhynchus mykiss) en Irán, evaluaron una población
doméstica formada con individuos de tres orígenes
(Francia, Noruega y Turquía), que reportaron H O =
0,049-0,053 y HE = 0,050-0,058, señalaron que un
pequeño tamaño del número efectivo de la población y
un mal manejo es la causa de la pérdida de la diversidad
genética. En el presente estudio, el resultado puede ser
respuesta de recientes introducciones o movilizaciones
no documentadas que habrían producido un incremento
en los niveles de heterocigosidad.
Los valores estimados de FIS revelaron que no existe
endogamia en las seis poblaciones ya que se observaron
valores bajos y cercanos a cero (0,006 a -0,062), con la
población de LRS presentando el único valor positivo.
Estos valores, difieren de los niveles de endogamia
reportados por Parra-Bracamonte et al. (2011), quienes
determinaron valores de aumento positivo en el FIS de
Componentes de
varianza
0,2378
-0,1784
4,6694
4,7288
Porcentaje
de variación
5,03
-3,77
98,74
Índices
de fijación
FST: 0,050*
FIS: -0,039
FIT: 0,013
0,23 a 0,27 resultado de las prácticas de manejo en
generaciones subsecuentes (2005 a 2009). Además,
sugieren que aunque los productores están familiarizados
a los posibles riesgos de endogamia, mantienen el
mismo sistema de selección y reproducción tradicional,
concluyendo que la mejora en el flujo genético y la
implementación de un monitoreo genético con
estrategias moleculares ayudaría a evitar los riesgos
futuros dentro de la población. Los valores de FIS en el
presente estudio, sugieren que no existe evidencia de
riesgo por depresión endogámica en las poblaciones
estudiadas.
En el AMOVA se observó que el 98,74% de la
variación estimada se atribuyó a diferencias entre los
individuos (FIT), solo el 5,03% de la variación estimada
es explicada por la diferenciación entre las poblaciones
(FST) y un valor de diferencia entre individuos dentro
de las poblaciones (FIS) de -3,77%. Perales-Flores et
al. (2007) reportaron en granjas de I. punctatus de
Tamaulipas, que la mayor variación se encontró entre
individuos, y un bajo porcentaje de diferencias entre
poblaciones (FIT 79,6%, FST 3,83% y FIS 16,56%),
estimando un FST de 0,038, un poco menor al estimado
en el presente estudio con un 0,05 (P < 0,001). Dado
que este nivel de la variación entre subpoblaciones fue
significativo, este indicador sugirió que las diferencias
entre al menos dos de las poblaciones analizadas es
estadísticamente importante. Considerando los criterios
propuestos por Hartl et al. (1997), este nivel indica una
moderada diferenciación entre al menos dos poblaciones.
El FST pareado muestra indicios del posible origen
de las poblaciones, y menor diferenciación de STM con
las poblaciones JSY, JLB y MCH (0,014, 0,018 y
0,020, respectivamente). Los mayores valores de
diferenciación fueron de LRS con JSY, JLB, ZCT y
STM (0,092, 0,071, 0,079 y 0,104, respectivamente),
revelando el posible origen de la mayoría de las
poblaciones hacia STM. Yousefian et al. (2012)
obtuvieron un FST = 0,62-0,080 entre las poblaciones
pareadas lo que indica que para algunas poblaciones
aunque en sus inicios posean diferentes orígenes (e.g.,
tres orígenes, Francia, Noruega y Turquía), las
consecuencias de un flujo genético entre ellas es la con-
532
Tabla 5. Probabilidades (%) de asignación de poblaciones en granjas del centro occidental de bagre de canal a las
poblaciones de referencia (STM/LRS). 1Baudouin & Lebrun (2000); 2Paetkau et al. (1995); 3Nei (1972); 4Cavalli-Sforza &
Edwards (1967).
Poblaciones
JSY
JLB
MCH
ZCT
Método
Bayesiano
100/0
100/0
100/0
100/0
1
Basado en frecuencias2 Distancias de Nei3 Filogenética4
100/0
80,2/19,8
61,8/38,2
100/0
73,5/26,5
58,6/41,4
100/0
74,7/25,3
59,2/40,8
100/0
61,2/38,8
54,2/45,8
Figura 2. Gráfico de árbol estimado por el método de Neighbor-joining, basado en índices de fijación (FST) entre las seis
poblaciones de bagre de canal de México. JSY: Jalisco 1, JLB: Jalisco 2, MCH: Michoacán, STM: Tamaulipas, LRS: Centro
Acuícola Gubernamental de Coahuila.
formación de una menor diferenciación y consolidación de una sola población. Por el contrario, el
aislamiento puede producir diferenciación, como en el
caso de trucha arcoíris doméstica (Oncorhynchus
mykiss) en Australia, donde se ha señalado diferenciación genética sustancial con un FST = 0,19 entre
cuatro poblaciones silvestres y domésticas (Ward et al.,
2003). En las poblaciones estudiadas, puede hablarse de
consecuencias de flujo genético para el caso de las
menos diferenciadas, y de aislamiento temporal (ZCT)
o de un origen diferente posiblemente (LRS), lo que
contribuye a aumentar los valores de diferenciación.
En este sentido, en cuanto al número de migrantes,
se encontraron valores bajos (4,26-6,74) en la
población de LRS señalando posible diferenciación con
el resto de las poblaciones como un origen distinto del
resto de las poblaciones, contrario a esto STM mostró
elevados niveles de migrantes con ZCT, MCH, JLB y
JSY (7,37, 24,08, 26,9 y 34,98, respectivamente). En
bagre de canal como en otras especies es importante la
comprensión del origen de las poblaciones, así como el
conocimiento de su diversidad y estructura genética;
más aún en poblaciones abastecedoras de cría y
reservorios, como son varias granjas en Tamaulipas
(STM es la principal), en algunas de ellas se ha sugerido
la presencia de endogamia (De la Rosa-Reyna et al.,
2014), opuesto a lo encontrado en el presente trabajo en
Zacatecas, Jalisco y Michoacán.
El análisis de asignación en el enfoque bayesiano y
el método basado en frecuencias estimó el 100% de
asignación a STM como origen de JSY, JLB, MCH y
ZCT. El método de distancias de Nei y la aproximación
filogenética distribuyó en contraste la asignación entre
ambos orígenes posibles, pero se observó que las
probabilidades son más altas a STM como población de
referencia. En su conjunto se puede considerar que el
origen más probable para las poblaciones introducidas
sea Tamaulipas. Lo que confirma a su vez la utilidad
del panel para monitorear y documentar el flujo
genético artificial entre poblaciones originales e
introducidas de bagre de canal efectuado entre los
productores de estas poblaciones domésticas.
Es necesario mencionar que aunque en los últimos
años se ha invertido una mayor atención en el bagre de
canal, las organizaciones locales y cooperativas aun no
poseen un programa de mejoramiento genético
regional, ni nacional que considere el origen y las
movilizaciones, debido al riesgo de pérdida de
diversidad genética. Una de las utilidades de los
métodos moleculares como el utilizado en este estudio
es precisamente el monitoreo de las condiciones
genéticas de las poblaciones actuales de las especies
acuícolas en ausencia de registros, sobre todo
considerando que aunque hace tan solo tres décadas la
localización nativa del bagre de canal era el noreste de
México, actualmente se encuentra introducido en los
cuerpos reservorios de agua dulce de la mayor parte del
país (Lara-Rivera et al., 2015). Por tal razón, la utilidad
de este monitoreo no solamente puede proveer
información útil para las poblaciones domesticas
actuales en las cuales se han distinguido dos líneas
genéticas (De la Rosa-Reyna et al., 2014), sino también
para la planificación de programas de conservación o
control, toda vez que algunos investigadores han
llegado a considerar a la especie I. puntatus como
invasora (Mendoza et al., 2014)
CONCLUSIONES
Este trabajo es el primer reporte sobre I. punctatus
considerando las poblaciones introducidas en los
estados de Michoacán, Zacatecas y Jalisco. El estudio
demostró que el panel de marcadores microsatelites
utilizado puede ser muy informativo para el monitoreo
de la variabilidad y diversidad genética de poblaciones
de bagre de canal. Se comprobó que las poblaciones
introducidas son diversas genéticamente, con elevados
índices de riqueza alélica y heterocigosidad, y se
identificó la población de referencia STM del estado de
Tamaulipas como el origen más probable de
introducción en las granjas de bagre de canal del centro
occidente de México.
A pesar que los acuicultores en México no
consideran estudios genéticos poblacionales, para
coadyuvar un buen manejo de las granjas, poseen el
conocimiento básico de los resultados negativos que
conlleva el apareamiento entre consanguíneos, ya que
promueven la introducción de nuevos reproductores
533
para evitar la endogamia. El estudio periódico y
documentación de las movilizaciones de bagre de canal
son necesarios para predecir posibles consecuencias en
la diversidad genética de la especie y para determinar
el manejo en los programas de introducción y
reproducción con fines de mejoramiento genético y/o
conservación. Así mismo, sería necesario promover
técnicas de biología molecular para un mejor manejo de
las granjas acuícolas y las poblaciones naturales.
AGRADECIMIENTOS
La primera autora agradece a la Universidad
Michoacana de San Nicolás de Hidalgo. Los autores
agradecen el apoyo económico obtenido a través del
Proyecto FOMIX Tamaulipas 150598, y al Instituto
Politécnico Nacional por su apoyo a través del Proyecto
SIP20143982.
REFERENCIAS
Allendorf, F.W., O. Berry & N. Ryman. 2014. So long to
genetic diversity, and thanks for all the fish. Mol.
Ecol., 23(1): 23-25.
Baudouin, L. & P. Lebrun. 2000. An operational bayesian
approach for the identification of sexually reproduced
cross-fertilized populations using molecular markers.
In: D. Dosba & H. Baril (eds.). Proceedings of
International Symposium on Molecular Markers, Acta,
546: 81-94.
Carta Nacional Pesquera. 2013. Diario Oficial de la
Federación DOF, 2012. Acuerdo de actualización de la
carta nacional acuicola. [https://dof.gob.mx/nota_
detalle_popup.php?codigo=5249902]. Revisado: 20
marzo 2015.
Cavalli-Sforza, L.L. & A.W.F. Edwards. 1967. Phylogenetic analysis: models and estimation procedures.
Am. J. Hum. Genet., 19: 233-257.
Ceballos-Orozco, M.L. & M.A. Velázquez-Escobar.
1988. Perfiles de la alimentación de peces y crustáceos
en los Centros y Unidades de Producción Acuícola en
México. SEPESCA, Organización de las Naciones
Unidas para la Agricultura y la Alimentación. Pachuca,
Hgo., 112 pp. [http://www.fao.org/3/contents/c8c5
4743-f46e-508b-a712-dfba6f6a1d95/AB460S00.htm]. Revisado: 12 diciembre 2015.
Chistiakov, D.A., B. Hellemans & F.A.M. Volckaert.
2006. Microsatellites and their genomic distribution,
evolution, function and applications: a review with
special reference to fish genetics. Aquaculture, 255: 129.
De la Rosa-Reyna, X.F., A.M. Sifuentes-Rincón, G.M.
Parra-Bracamonte & W. Arellano-Vera. 2014. Identification of two channel catfish stocks, Ictalurus
534
punctatus, cultivated in northeast Mexico. J. World
Aquacult. Soc., 45(2): 104-114.
Excoffier, L. & H.E. Lischer. 2010. Arlequin suite 3.5: a
new series of programs to perform population genetic
analyses under Linux and Windows. Mol. Ecol. Res.,
10(3): 564-567.
Food and Aquiculture Organization (FAO). 2015.
FishStatJ a tool for fishery statistical analysis. Release:
2.12.4. [http://www.fao.org/fishery/statistics/software/fishstatj/en]. Revisado: 17 diciembre 2015.
Goudet, J. 2001. FSTAT, a program to estimate and test
gene diversities and fixation indices (version 2.9.3).
[http://www2.unil.ch/popgen/softwares/fstat.htm]. Revisado: 10 septiembre 2015.
Ha, H.P., T.T.T. Nguyen, S. Poompuang & U. Na-Nakorn.
2009. Microsatellites revealed no genetic differentiation between hatchery and contemporary wild
populations of striped catfish, Pangasianodon hypophthalmus (Sauvage, 1878) in Vietnam. Aquaculture,
291(3): 154-160.
Hartl, D.L., A.G. Clark & A.G. Clark. 1997. Principles of
population genetics. Sinauer Associates Publishers,
Sunderland, 116: 565 pp.
Jackson, D.C. 2004. Natural history and fisheries. In: C.S.
Tucker & J.A. Hargreaves (eds.). Biology and culture
of channel catfish. Elsevier, New York, pp. 15-35.
Kalinowski, S.T., M.L. Taper & T.C. Marshall. 2007.
Revising how the computer program CERVUS
accommodates genotyping error increases success in
paternity assignment. Mol. Ecol., 16(5): 1099-1106.
Lamkom, T., H. Kucuktas, Z. Liu, P. Li, U. Na-Nakorn, S.
Klinbunga, A. Hutson, A. Chaimongkol, J. Ballenger,
G. Umali & R.A. Dunham. 2008. Microsatellite
variation among domesticated populations of channel
catfish (Ictalurus punctatus) and blue catfish (I.
furcatus). KU. Fish. Res. Bull., 32(2): 37-47.
Lara-Rivera, A.L., G.M. Parra-Bracamonte, A.M.
Sifuentes-Rincón, H.H. Gojón-Báez, H. RodríguezGonzález & I.O. Montelongo-Alfaro. 2015. El bagre
de canal (Ictalurus punctatus Rafinesque, 1818):
estado actual y problemática en México. Lat. Am. J.
Aquat. Res., 43(3): 424-434.
Mendoza, R., C. Ramírez-Martínez, C. Aguilera & M.A.
Meave. 2014. Principales vías de introducción de las
especies exóticas. In: R.E. Mendoza & P. Koleff.
(coords.). 2014. Especies acuáticas invasoras en
México. Comisión Nacional para el Conocimiento y
Uso de la Biodiversidad, México D.F., pp. 44-67.
Nei, M. 1972. Genetic distance between populations. Am.
Nat., 106: 283-291.
Received: 28 April 2015; Accepted: 1 April 2016
Paetkau, D., W. Calvert, I. Stirling & C. Strobeck. 1995.
Microsatellite analysis of population structure in
Canadian polar bears. Mol. Ecol., 4(3): 347-354.
Parra-Bracamonte, G.M., A.M. Sifuentes-Rincón, X.F. De
la Rosa-Reyna, W. Arellano-Vera & B. Sosa-Reyes.
2010. Desarrollo tecnológico para el mejoramiento de
especies acuícolas de interés comercial. Recurso bagre
de canal. Informe Final de Proyecto. SAGARPACONAPESCA, 144 pp.
Parra-Bracamonte, G.M., A.M. Sifuentes-Rincón, X.F. De
la Rosa-Reyna, W. Arellano-Vera & B. Sosa-Reyes.
2011. Inbreeding evidence in a traditional channel
catfish (Ictalurus punctatus) hatchery in México. Elec.
J. Biotechnol., 14(6): 11-11.
Perales-Flores, L.E., A.M. Sifuentes-Rincón & F.J. García
de León. 2007. Microsatellite variability analysis in
farmed catfish (Ictalurus punctatus) from Tamaulipas,
Mexico. Genet. Mol. Biol., 30(3): 570-574.
Piry, S., A. Alapetite, J.M. Cornuet, D. Paetkau, L.
Baudouin & A. Estoup. 2004. Geneclass2: a Software
for genetic assignment and first-generation migrant
detection. J. Hered., 95: 536-539.
Tan, G., A. Karsi, P. Li, S. Kim, X. Zheng, H. Kucuktas,
B.J. Argue, R.A. Dunham & Z.J. Liu. 1999.
Polymorphic microsatellite markers in Ictalurus
punctatus and related catfish species. Mol. Ecol.,
8(10): 1758-1760.
Waldbieser, G.C. & B.G. Bosworth. 2012. A standardized
microsatellite marker panel for parentage and kinship
analyses in channel catfish, Ictalurus punctatus. Anim.
Genet., 44: 476-479.
Waldbieser, G.C. & W.R. Wolters. 2007. Definition of the
USDA103 strain of channel catfish (Ictalurus
punctatus). Anim. Genet., 38(2): 180-183.
Waldbieser, G.C., B.G. Bosworth, D.J. Nonneman &
W.R. Wolters. 2001. A microsatellite-based genetic
linkage map for channel catfish Ictalurus punctatus.
Genetics, 158(2): 727-734.
Ward, R.D., K.E. Jorstad & G.B. Maguire. 2003.
Microsatellite diversity in rainbow trout (Oncorhynchus mykiss) introduced to Western Australia.
Aquaculture, 219(1): 169-179.
Yousefian, M., F. Laloei, M. Hedayatifard, M.
Bahrekazemi, M.J. Tagavi, M. Irani, V. Azizifar V. &
E. Khasaesi. 2012. Microsatellite diversity in rainbow
trout (Oncorhynchus mykiss) stocks of different origin.
Middle-East J. Sci. Res., 11(9): 1196-1201.
Zhang, H., S. Gao, M.J. Learcher, S. Hu & W.H. Chen.
2012. EvolView an online tool for visualizing,
annotating and managing phylogenetic trees. Nucleic
Acids Res., 40(W1): 569-572.
Lat. Am. J. Aquat. Res., 44(3): 535-545, 2016 Physiological response of shrimp infected with NHP
535
Research Article
Physiological and immune response of Litopenaeus vannamei undergoing the
acute phase of the necrotizing hepatopancreatitis disease and after being treated
with oxytetracycline and FF
Luis R. Martínez-Córdova1, Teresa Gollas-Galván2, Estefanía Garibay-Valdez1
Rocío Valenzuela-Gutiérrez1, Marcel Martínez-Porchas2*, Marco A. Porchas-Cornejo3
Arturo Sánchez-Paz4 & Fernando Mendoza-Cano4
1
Departamento de Investigaciones Científicas y Tecnológicas de la Universidad de Sonora
Hermosillo, Sonora, México
2
Centro de Investigación en Alimentación y Desarrollo, Hermosillo, Sonora, México
3
Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Unidad Guaymas, Guaymas, Sonora, México
4
Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Laboratorio de Referencia, Análisis y
Diagnóstico en Sanidad Acuícola Los Angeles, Hermosillo, Sonora, México
Corresponding author: Marcel Martínez-Porchas (marcel@ciad.mx)
ABSTRACT. The physiological and immune responses of adult shrimp (Litopenaeus vannamei) undergoing
the acute phase of the necrotizing hepatopancreatitis (NHP) disease and the efficiency of oxytetracycline (OXI)
and florfenicol (FF) to eliminate the pathogen were evaluated. Four shrimp groups were considered: three groups
infected with necrotizing hepatopancreatitis bacteria (NHP-B) (two treated with antibiotics and a positive
control) and one group non-infected (negative control). Hemolymph concentration of glucose, lactate,
acylglycerides, cholesterol, total protein, aminotransferases, superoxide dismutase, and the transcriptional
expression of several immune related genes were monitored at the acute phase of the disease, and at 15 and 20
days after administration of antibiotics (daa). Shrimp from the positive control registered a mortality of 100%.
NHP-B infection affected the immu-nophysiological response of shrimp; herein, most of the parameters were
significantly up regulated in infected shrimp before the use of antibiotics, compared to the negative control.
Increased transcriptional levels of clotting protein, lipopolysaccharide and β-1-3-glucan binding protein
(LGBP), serine protease, peroxinectin, lysozyme, heat shock proteins (HSP) 60 and 70 were detected in shrimp
treated with OXI. At 20 daa NHP-B was still detected in FF-treated shrimp, but not in OXI-treated shrimp. It is
hypothesized that despite none of the antibiotics per se eliminated the bacterium, both had a negative effect on
its virulence. OXI seems to have a greater effect, allowing shrimp to integrate a better immune response at 15
daa.
Keywords: Litopenaeus vannamei, gene expression, shrimp disease, necrotizing hepatopancreatitis, immune
system, Rickettsia, intracellular pathogen, necrosis.
Respuesta fisiológica e inmune de Litopenaeus vannamei durante la fase aguda de la
enfermedad de la necrosis hepatopancreática y posteriormente tratado
con oxitetraciclina y FF
RESUMEN. Se evaluaron respuestas fisiológicas e inmunes de camarones adultos (Litopenaeus vannamei)
durante la fase aguda de la enfermedad de la necrosis hepatopancreática, y la eficacia de oxitetraciclina (OXI)
y florfenicol (FF) para eliminar el patógeno causante de la enfermedad. Se consideraron cuatro grupos de
camarones: tres grupos infectados con NHP-B (tratado con OXI, con FF y un control positivo) y un grupo no
infectado (control negativo). Se monitoreó la concentración hemolinfática de glucosa, lactato, acilglicéridos,
colesterol, proteína total, aminotransferasas, superóxido dismutasa (SOD), y la expresión de varios genes
relacionados con el sistema inmune durante la etapa aguda de la enfermedad y 15 y 20 días después de la
administración de antibióticos (dda). Los camarones del control positivo registraron una mortalidad de 100%.
La mayoría de los parámetros evaluados se incrementó en camarones infectados antes del uso de antibióticos.
Al día 15 dda, lactato y SOD siguieron registrando altos niveles en ambos camarones tratados, mientras que se
detectaron altos niveles de transcripción de proteína de coagulación, proteína unidora de lipopolisacáricos, serin
proteasa, peroxidasa, lisozima y proteínas del choque térmico 60 y 70, en camarones tratados con OXI. Al día
20 dda NHP-B se siguió detectando en camarones tratados con FF, pero no en los tratados con OXI. Se sugiere
536
que aunque ninguno de los antibióticos per se eliminó a la bacteria, ambos tuvieron un efecto negativo sobre su
virulencia. Además, es posible que OXI haya tenido un mejor efecto, permitiendo que los camarones integraran
una mejor respuesta inmune a los 15 dda.
Palabras clave: Litopenaeus vannamei, enfermedad del camarón, necrosis hepatopancreática, sistema inmune,
Rickettsia, patógeno intracelular.
INTRODUCTION
Because of its high tolerance to a wide range of
environmental conditions, greater resistance to various
diseases, and its excellent aquacultural performance,
the Pacific white shrimp Litopenaeus vannamei is
actually the most extensively farmed shrimp species
worldwide. However, the global culture of this shrimp
has recently faced serious problems, especially those
related to the prevalence and severity of a number of
viral and bacterial diseases (Lightner, 2011).
Vibrio-like species, as well as intracellular
rickettsia-like organisms (RLO), are considered among
the most important pathogens affecting shrimp health.
Among the RLO diseases, that caused by the
necrotizing hepatopancreatitis bacterium (NHP-B) is
the most important affecting penaeids. Since its
identification in 1985 as a shrimp pathogen, the NHPB has caused devastating economic losses to shrimp
farming industry (Vincent & Lotz, 2007), and
mortalities over 95% have been reported.
Recent evidence has revealed that the transmission
of the bacterium may occur either by horizontal or
vertical pathways. The NHP-B has been detected
associated with zooplankton samples from the Gulf of
California (Mendoza-Cano et al., 2013); moreover,
Avila-Villa et al. (2011), suggested that this pathogen
has been associated to live feeds as Artemia.
The NHP-B is an intracellular RLO thriving in the
cytoplasm of epithelial cells from hepatopancreas
tubules. Previous studies have reported that once the
host has been infected, it is practically unable to
eradicate the pathogen without antibiotics, despite the
response exhibited by the host´s innate and non-specific
immune system (Roch, 1999; Ávila-Villa et al., 2012).
This immune response is constituted by cellular and
humoral components, which jointly protect the host
against invaders (Rendón & Balcázar, 2003). However,
this particular RLO has become a very aggressive
pathogen since it affects the cells of a key organ in the
physiology of shrimp, the hepatopancreas, causing a
malfunction of the organ with the resulting physiological imbalances and followed by tissue necrosis.
The most evident clinical signs of the disease
include a reduction in feeding activity, empty
intestines, flaccid muscles and exoskeleton, the
presence of epicomensals, darkened gills and pleopods,
paleness and atrophy of hepatopancreas, and erratic
swimming, among others (Vincent & Lotz, 2005). The
acute phase of the disease is observed 16-20 days after
the infection, which is considered as the point of no
return for infected organisms (Vincent & Lotz, 2005);
at this phase the use of antibiotics is almost indispensable to avoid massive mortalities.
Oxytetracycline (OXI) is probably the most used
antibiotic worldwide to treat bacterial infections in
aquatic organisms, mainly because of its acceptable
effectiveness, low cost and acceptance by the
international animal health control agencies. It is a
wide-spectrum bacteriostatic compound produced by
fungi (Streptomyces spp.), which is efficient against
Gram positive and Gram negative pathogens as well as
intracellular pathogens and it is used to treat systemic
bacterial infections in aquacultural organisms (MoralesCovarrubias et al., 2012). OXI binds to the union site
of the 30 S ribosomal subunit, inhibiting thus the
protein translation process (Chopra & Roberts, 2001).
Tetracyclines have been used to eradicate diverse RLO
in animals (Hussain et al., 2014)
Another antibiotic product used in the aquaculture
industry, and approved by the FDA, is (FF), which is a
structural analogue of chloramphenicol, but with a
better antibacterial effectiveness; it is also considered
as a wide-spectrum antibiotic including Gram positive
and Gram negative bacteria, and inclusively intracellular bacteria such as RLO (Reda et al., 2013). FF
penetrates into the cell through facilitated transport
(Boxall & Ericson, 2012), blocking the union site of the
50S ribosomal subunit. However, despite the
effectiveness of chloramphenicol analogues against
RLO, the use of FF is not widespread in shrimp
aquaculture.
This study aimed to evaluate the effectiveness of
single recommended doses (COSAES) of OXI and FF
on eradicating the NHP-B of the Pacific white shrimp,
L. vannamei undergoing the acute phase of the disease,
and to evaluate its physiological and immune responses
before and after the use of antibiotics.
Experimental organisms
Healthy juveniles of L. vannamei (10 ± 0.5 g) were
obtained from a commercial shrimp farm near to the
Physiological response of shrimp infected with NHP
laboratory facilities. Before acclimation shrimp were
provided with OXI (3 mg kg-1 of shrimp biomass)
during three consecutive days to eradicate any possible
pathogen. Thereafter, shrimp were maintained for 15
days at a density of 40 org m-2 in plastic containers (80
L) with filtered seawater (~35 of salinity), continuous
aeration (OD ≥5 mg L-1), water exchange (25% per
day), constant temperature (30°C), and supplementation of a commercial feed twice a day (4%
biomass/day; Purina, Mexico, 35% crude protein).
Subsequently, shrimp were diagnosed as free of
bacterial and viral pathogens (NHP, EMS, IHHNV,
TSV, WSSV) by molecular diagnostic tests in feces and
hepatopancreas and intestine of randomly sacrificed
organisms, by using the services of CIBNOR
diagnostic laboratory.
Bioassay
Shrimp were divided into four groups and distributed in
plastic aquaria at the same density considering three
units per treatment. Three of the groups were infected
with necrotizing hepatopancreatitis bacterium (NHP-B)
by forced feeding with 40 µL of a homogenate of
hepatopancreas (1:1 w/v, hepatopancreas:glycerol)
from shrimp confirmed as PCR positive to NHP-B
(homogenate was confirmed as free of other pathogens
as well). NHP-B strain was collected from a shrimp
farm at Sonora, Mexico and reproduced in vivo in
healthy shrimp. The fourth group was not infected
(negative control) and NHP-B free homogenate was
used for these shrimp.
Feeding inoculation was performed by using a
micropipette adapted to a flexible plastic cannula that
was inserted into the oral cavity, loading the required
volume.
After infection, the organisms were maintained for
20 days under the above mentioned conditions to reach
the acute phase of the disease. This period was
established based on previous studies (Vincent & Lotz,
2005) and experiences in our laboratory.
The success of the infection was confirmed by
performing daily PCR to the DNA extracted from feces
of the experimental shrimp. DNA was extracted by a
commercial kit FastDNATM Spin Kit (MP Biomedicals,
USA).
Primers designed by Nunan et al. (2008) (Fwd: 5′CGT TGG AGG TTC GTC CTT CAG T-3′ and Rv: 5′GCC ATG AGG ACC TGA CAT CAT C-3′) were used
to detect the presence of NHP-B under the following
conditions: 1 cycle at 95°C during 5 min, 30 cycles at
94°C for 30 s, 53°C/30 s and 72°C/1 min and a final
cycle of 72°C/5 min (Figueroa-Pizano et al., 2014).
NHP-B was detected in all treatments (except the
control) at 5th day post infection.
537
After the 20 days period, the administration of
antibiotics was initiated. One of the infected groups was
treated with OXI (oxi-blend® AQUA), the second with
FF (flor-blend® AQUA) and the third was untreated
(positive control). The dose was estimated considering
the protocols performed by semi-intensive shrimp
farms and 3 mg of antibiotic/kg shrimp/day were used.
Each antibiotic was dissolved into water + glycerol
(1:1) mixture. The antibiotic mixture was applied to
each group by force-feeding during three consecutive
days. Shrimp from the positive and negative controls
were fed with the water + glycerol mixture without the
antibiotic.
Afterward, shrimp were maintained under controlled laboratory conditions during other 20 days. This
period was considered as an additional time for the
development of the disease in which all infected shrimp
were supposed to be dead according to previous reports
(Vincent & Lotz, 2005; Ávila-Villa et al., 2012); in
addition, the antibiotic would be eliminated by that time
according to previous kinetic studies (Wang et al.,
2004). Thus, survivors (if any) were sampled.
Hemolymph and hepatopancreas samples were
extracted from ten individuals of each treatment (10
shrimp/replicate) after 20 days post-infection (before
the use of antibiotics), and samples were also taken at
15th and 20th after the use of antibiotics. Hemolymph
was utilized for the evaluation of biochemical parameters
such as glucose, lactate, acylglycerides, cholesterol,
and protein, enzymatic activities such as aspartate- and
alanine-aminotransferases, superoxide dismutase and
gene expression (details provided below). Hepatopancreas was exclusively used for the evaluation of
gene expression.
The hemolymph was extracted from the base of the
5th pereiopod using an insulin syringe (1 mL)
containing 0.5 mL of cold anticoagulant (10 mM
HEPES, 20 mM EDTA, 10 mM KCl and 450 mM
NaCl) (Vargas-Albores et al., 1993). Hemolymph
samples were centrifuged at 800x g for 10 min at 4°C,
and the precipitated hemocytes were used for gene
expression analyzes, whereas the supernatant was used
for the quantification of hemolymph metabolites.
Hemocytes were suspended in 250 µL of guanidine
thiocyanate (TRI Reagent, SIGMA) and stored at -20°C
for further analyzes. The hepatopancreas was carefully
dissected and divided into two longitudinal sections
(vertical cut); one fragment was used for molecular
diagnostic, and mixed with 250 µL of lysis solution
(100 mM NaCl, 50 mM Tris, 100 mM EDTA, and 1%
SDS) and maintained at room temperature. The resting
fragment was immediately mixed with 500 µL of TRI
Reagent and stored at -20°C for further analyzes of
gene expression. Samples were stored for five days and
thawed at 4°C.
538
Evaluation of hemolymph parameters
The concentration of total protein was evaluated by the
Biuret method adapted to microplate (HernándezLópez, 2001) and read at 550 nm using a Multiskan FC
equipment (Thermo Scientific, USA).
The superoxide dismutase activity (SOD) was
estimated by the commercial Kit Ransod (Randox,
Crumlin, RU), based on the methods described by Liu
et al. (2004) and Biagini et al. (1995), which consider
the inhibition grade on the formation of the colorant
formazan red by the reaction of 2-(4-iodophenyl)-3-(4nitrophenol)-5-phenyl tetrazolium (INT) chloride with
the free superoxide radicals in the oxidation of xanthine
catalyzed by xanthine oxidase.
The concentration of glucose, lactate, cholesterol,
acylglycerides, and the activity of aspartate and
analine-aminotrasferase (AST and ALT) were measured by the use of commercial kits (Randox
Laboratories Ltd., USA) adapted to a microplate.
Gene expression
RNA was isolated from hepatopancreas and hemocytes.
Samples were previously homogenized in a tissue
homogenizer (FastPrep 5G, MP Biomedicals, USA)
using plastic vials containing zirconium spheres
(Lysing matrix A; MP Biomedicals, USA); after that,
the guanidinium thiocyanate-phenol-chloroform method
was used for the extraction (Chomczynski & Sacchi,
2006). The concentration and purity of total RNA were
determined spectrophotometrically in a NanoDrop ND8000 (Thermo, USA) at a wavelength of 260 nm,
considering only samples with a value near to 2. DNA
traces have been previously detected after the use of the
above technique, using microfluidic DNA detections
(Genomic and High Sensitivity DNA Screentape,
Agilent, USA); however, any possible contamination
with DNA was eliminated by treating the samples with
DNase I (DNase I; Roche, Germany).
The synthesis of complementary DNA (cDNA) was
performed with the enzyme reverse transcriptase
following the specifications of a commercial kit and
using 1 µg of total RNA (QuantiTect Reverse
Transcription Kit, Qiagen, USA).
The evaluation of gene expression by a quantitative
PCR (qPCR) protocol was performed, and the method
of relative quantification 2−ΔΔCT (Livak & Schmittgen,
2001) was used. For the amplification and detection of
specific fragments, the iTaqTM Universal SYBR Green
Supermix (Biorad, USA) containing enhancers,
stabilizers and a passive reference (ROX) was used in
combination with the specific primers for each gene
(Table 1). The qPCR reactions were done in a thermal
cycler StepOnePlus™ Real-Time PCR System
(Applied Biosystems, USA) considering a final volume
of 20 µL for each reaction. The conditions of
amplification and detection were: 1 cycle at 95°C for 5
min; 30 cycles at 94°C for 30 s, at 60°C for 30 s and
72°C for 1 min, and one final cycle at 72°C for 5 min.
Gene expression or transcripts codifying for
prophenoloxidase (proPO; 116 bp), transglutaminase
(TGase; 150 bp), α-2-macroglobulin (α-2-M; 204 bp)
and peroxinectin (PE; 56 bp) were monitored in
hemocytes; whereas clotting protein (CP; 169 bp),
lipopolysaccharide-and β-1,3-glucan binding protein
(LGBP; 64 bp), lysozyme (LYS; 126 bp) and serine
protease (SP; 61 bp) were quantified in hepatopancreas.
The expression of the heat shock proteins (HSP) 60
(138 bp), 70 (120 bp) and 90 (109 bp) was monitored
in both, hemocytes and hepatopancreas. The
constitutive gene β-actin (142 bp) was used as internal
control or reference for all the selected genes; the
constitutive expression of this gene was previously
validated in organisms challenged with different doses
of NHP-B inoculum. Efficiencies of the PCR reactions
were calculated from the slope a standard curve derived
from a dilution series (Efficiency 95-100%). In
addition, a melt curve analysis considering the interval
55-95°C, with increments of 0.5°C min-1, was
performed to demonstrate the specificity of the PCR
products.
After confirming that data were normal and homoscedastic, were analyzed by an analysis of variance,
considering time and treatments as factors. Nonhomoscedastic or abnormal data were submitted to logtransformation. A Dunnett post-hoc analysis was
performed for multiple comparisons between groups. A
significance level of P ≤ 0.05 was considered and the
statistical software NCSS 7.0 was used.
RESULTS
Infection
The infection with NHP-B was successfully detected by
PCR in all treatments (Table 2). The bacterium was not
eliminated by the use of both OXI and FF and was still
detected after 15 days of the administration of
antibiotics (daa). NHP-B was still detected at 20 daa in
shrimp treated with FF, but not detected in shrimp
previously treated with OXI (Table 2). As expected,
shrimp from the positive control registered a mortality
of 100% at 22th day from the infection.
Hemolymph parameters
Before the use of antibiotics the concentrations of
glucose, lactate and AST in infected shrimp were signifi-
539
Table 1. Primers used in the amplification of specific genes of white shrimp, Litopenaeus vannamei.
Gene
Sequence of primers (5’-3’)
β-actin
Fw 5ĆCACGAGACCACCTACAAC3´
Rv 5ÁGCGAGGGCAGTGATTTC3´
Fw 5´GCCTTGGCAACGCTTTCA3´
Rv 5ĆGCGCATCAGTTCAGTTTGT3´
Fw 5´TCGCCTCTGCACACGACACC3´
Rv 5´TCCACACGTCATTCCAAACGT3´
Fw 5´GCACGTAATCAAGATCCG3´
Rv 5ĆCCATCTCATTAGCACAAAC3´
Fw 5ĆATGTCCAACTTCGCTTTCAGA3´
Rv 5ÁTCACCGCGTGGCATCTT3´
Fw 5´TGGCGTCACCGAAACCAACA3´
Rv 5´RTGCCAGCGTGAGGAAAGCGA3´
Fw 5´TGGACCTCGCGGGAGAT3´
Rv 5´GACCGATAGCCACCATGCTT3´
Fw 5ĆGTCGTTAGGTTAAGTGCGTTCT3´
Rv 5´TTTCAGCGCATTAAGACGTGTT3´
Fw 5´ TGGTGTGGCAGCGATTATGGCAAG3´
Rv 5´ GCCCTTGTAGCGTTCGGTGTCG3´
Fw 5´TGCCAACAACACCAACGAAG3´
Rv 5´GCCAACATAACTCCACGCCT3´
Fw: 5ĆTCCTGCGTGGGTGTGTT3´
Rv 5´GCGGCGTCACCAATCAGA3´
Fw 5´TGGGCTTCTACTCCGCCTACC3´
Rv 5ÁCGGTGAAAGAGCCTCCAGCA3´
Prophenoloxidase
Transglutaminase
α-2-macroglobuline
LGBP
Coagulation protein
Peroxinectin
Serine
Lysozyme
HSP 60
HSP 70
HSP 90
Accession
Number
AF300705.2
EU373096.1
EU164849
EF073268
EU102286.1
DQ984182
KC708021.1
AY368151.1
AF5394663
FJ710169.1
AY645906.1
HQ008268.1
Table 2. Detection of NHP-B in shrimp from the different treatments before and after the use of antibiotics (3 mg of
antibiotic/kg shrimp/day). Results are expressed as positive or negative detection after PCR reaction.
Shrimp acclimation
Shrimp Infection
Antibiotic
administration
Time
DNA sample
Negative control
Positive control
Oxytetracycline
FF
Day 0
Day 3
Day 5
Day 7
Day 15
Day 20
Day 0
Feces + shrimp hepatopancreas
Feces
Feces
Feces
Feces
Feces
Feces + shrimp hepatopancreas
Negative
Negative
Negative
Negative
Negative
Negative
Negative
Negative
Negative
Positive
Positive
Positive
Positive
Positive
Negative
Negative
Positive
Positive
Positive
Positive
Positive
Negative
Negative
Positive
Positive
Positive
Positive
Positive
Day 5
Day 10
Day 15
Day 20
Feces
Feces
Shrimp hepatopancreas
Shrimp hepatopancreas
Negative
Negative
Negative
Negative
Dead organisms
Dead organisms
Dead organisms
Dead organisms
Positive
Positive
Positive
Negative
Positive
Positive
Positive
Positive
cantly higher (P < 0.05) compared to the negative
control, whereas the concentration of cholesterol, was
significantly lower in the infected shrimp (Fig. 1). In
particular, glucose increased by ≥450%, lactate ≥ 400%
and AST ≥ 300% in infected shrimp compared to the
negative control.
After the use of OXI and FF, no significant
differences (P > 0.05) at any sampling time (15th or 20th
daa) were detected for any hemolymph parameter
regarding the negative control (except for SOD and
AST) (Fig. 1). SOD activity was significantly higher in
shrimp previously treated with OXI at 15th and 20th daa,
and AST was significantly higher in shrimp treated
with FF at 20th daa (Fig. 1).
Gene expression
Up-regulation of proPO and α-2-M was detected in
hemocytes of NHP-B-infected shrimp before the use of
antibiotics (Fig. 2). However, the number of proPO
transcripts decreased at 15 and 20 daa of both antibio-
540
Figure 1. Concentration of hemolymph parameters in NHP-B infected shrimp before (W/O OXI and W/O FF), and 15 and
20 days after the use of OXI (OXI 15 and OXI 20) and FF (FF 15 and FF 20). Shrimp considered as negative control for
each sampling date is expressed as “C”. AST: aspartate aminotransferase, ALT: alanine aminotransferase, SOD: superoxide
dismutase. Non-infected shrimp were considered as negative control (C0, C15 and C 20). Asterisks indicate gene up
regulation, whereas vertical bars indicate standard deviation.
Figure 2. Relative expression (respect to β-Actin) of
prophenoloxidase (proPO), transglutaminase (TGasa), α
2-macroglobuline and peroxidase in hemocytes of shrimp
infected with NHP-B before being treated with
oxytetracycline (W/O OXI) or FF (W/O FF), and after 15
and 20 days from being treated with both OXI (OXI 15
and OXI 20) and FF (FF 15 and FF 20). Non-infected
shrimp (control group, C 0, C 15 and C 20) with a relative
value of 1. Asterisks indicate gene up regulation, whereas
vertical bars indicate standard deviation.
tics, although the over transcription continued at 15 daa
(Fig. 2). The α-2-M remained up-regulated at 15 daa in
organisms treated with OXI (~3 fold-times), but the
transcription level was significantly higher (~20 foldtimes) in shrimp medicated with FF. At 20 daa the
transcription levels of α-2-M were down-regulated to
those detected in the negative control.
Peroxinectin was also up-regulated (15 fold times)
in the infected shrimp before the use of antibiotics and
remained highly expressed (30 fold) in shrimp treated
with OXI at 15 daa (Fig. 2).
No changes in the expression of TGase were
observed in hemocytes of shrimp infected with NHP-B
and neither after being treated with both antibiotics;
however, a decline in the number of transcripts was
recorded at 20 daa for shrimp treated with both antibiotics (Fig. 2).
Up-regulation of CP, LGBP, SP and lysozyme
genes from hepatopancreatic tissue was observed in
infected shrimp before the use of the antibiotics (Fig.
3). The transcription levels of these genes (except for
lysozyme) was significantly increased in shrimp treated
with OXI at 15 daa, whereas no transcriptional regulation was recorded in shrimp treated with FF (except
for lysozyme up-regulation). At 20 daa no overtranscription was detected for the genes monitored in
shrimp treated with OXI (except for LGBP upregulation), whereas lysozyme was up-regulated in
shrimp treated with FF (Fig. 3).
Regarding transcription of heat shock proteins, a
significant over-expression of HSP60 was detected in
hemocytes and hepatopancreas (~30 and ~80 fold-times
respectively) of shrimp infected with NHP-B before
being treated with antibiotics (Fig. 4). At 15 daa the
transcription levels of HSP60 remained up-regulated in
hemocytes of shrimp treated with both antibiotics;
however only shrimp medicated with OXI registered an
up-regulation in hepatopancreas at 15 daa. At 20 daa,
the transcription levels of HSP60 in shrimp treated with
Figure 3. Relative expression (respect to β-Actin) of
coagulation proteins, lipo-polysaccharides and β-glucan
binding protein (LGBP), serine and lysozyme in
hepatopancreas of shrimp infected with NHP-B without
being treated with oxytetracycline (W/O OXI) or FF (W/O
FF), and after 15 and 20 days from being treated with both
OXI (OXI 15 and OXI 20) and FF (FF 15 and FF 20). Noninfected shrimp (control group, C 0, C 15 and C 20) with
a relative value of 1. Asterisks indicate gene up regulation,
whereas vertical bars indicate standard deviation.
both antibiotics decreased to similar levels of those
observed in negative controls (Fig. 4). HSP70 was
regulated at lower scale compared to HSP60; no
transcription changes were detected for HSP70 in
hepatopancreas before and after the use of antibiotics.
However, up-regulation was detected in shrimp
hemocytes before and after the use of antibiotics,
except in shrimp previously medicated with FF at 15
daa (Fig. 4).
Finally, the transcription of HSP90 was upregulated in the hepatopancreas of shrimp infected with
NHP-B before the use of antibiotics. At 15 daa a similar
up-regulation was observed for both groups (Fig. 4).
However, no over transcription was detected at 20 daa
for shrimp previously treated with OXI.
DISCUSSION
The high concentrations of plasmatic glucose and
lactate observed in NHP-B infected shrimp before the
administration of antibiotics suggest an alteration in the
metabolism of infected shrimp, which suggests an
activation of anaerobic pathways to compensate the
high energy demand necessary to achieve an effective
immune response. Similar metabolic alterations have
been observed in L. vannamei during the course of
infection with a strain of the Gram-negative bacteria
Vibrio campbellii. An slight, but significant, accumu-
541
Figure 4. Relative expression (respect to β-Actin) heat
shock proteins 60 (HSP60), 70 (HSP70) y 90 (HSP90) in
hepatopancreas and hemocytes of shrimp infected with
NHP-B without being treated with oxytetracycline (W/O
OXI) or FF (W/O FF), and after 15 and 20 days from being
treated with both OXI (OXI 15 and OXI 20) and FF (FF
15 and FF 20). Non-infected shrimp (control group, C 0,
C 15 and C 20) with a relative value of 1. Asterisks
indicate gene up regulation, whereas vertical bars indicate
standard deviation.
lation of lactate was found in Vibrio-injected shrimp,
which suggests that the normal metabolism may be
altered to meet the energy requirements to accomplish
the immune response against the bacterial infection,
leading to depression of oxygen due to an increased
consumption and a consequent shift to anaerobic
metabolism, resulting in increasing concentrations of
lactate (Scholnick et al., 2006). These responses
suggest an altered physiological response of shrimp,
probably because of the action of the pathogen and the
consequent damage in the hepatopancreas.
The increase of AST activity indicates a possible
damage in the hepatopancreatic tissue, considering that
these enzymes are incorporated to the hemolymph after
cellular lysis occurs in any organ (Najafabadi et al.,
1992). The decline in the cholesterol levels of infected
shrimp could be associated with a starving condition
and/or to impaired absorption of this nutrient from the
supplemental feed since it cannot be synthesized de
novo by this species. Previous reports have documented
empty stomachs in shrimp confirmed as positive to this
pathogen (Ávila-Villa et al., 2012). Moreover, empty
intestines were observed in shrimp undergoing the
acute phase of the disease.
542
In addition, NHP-B infection caused an effect over
SOD activity levels. This parameter can be considered
as an indicator of stress in aquatic organisms and as an
indirect indicator of the activation of the immune
response. Besides being one of the main antioxidant
defense pathways in response to oxidative stress, SOD
promotes the generation of immunoproteins (Fridovich
1995; Campa-Córdova et al., 2002). Microbiocidal
metabolites generated by the immune response can also
be harmful to the host; thus antioxidant mechanisms
such as the generation of SOD are used by the cell to
convert the excess of these metabolites into hydrogen
peroxide that passes freely through membranes. The
antioxidant superoxide dismutase (SOD) converts this
microbiocidal metabolite into hydrogen peroxide
whereas catalase and glutathione peroxidase remove
the hydrogen peroxide from cells (Campa-Córdova et
al., 2002). The observed elevation of SOD in this study
may be associated to the activation of the immune
response in shrimp challenged with NHP-B while the
elevated SOD activity at 15 daa in shrimp treated with
both antibiotics suggests that shrimp may have elicited
a protective immune response against the pathogen.
Most of the SOD responses in penaeid shrimp have
been studied after the use of immunosimulators;
however, Ji et al. (2009) reported up-regulation of SOD
in L. vannamei after being challenged with pathogenassociated molecular patterns.
The up-regulation of α-2-M, proPO and
peroxinectin genes seems as a plausible evidence of the
participation of hemocytes in the immune response of
shrimp against NHP-B, considering that α-2-M
impedes the union of proteases with their substrates and
it can affect serine-, aspartate-, cysteine- and metalproteases, either from the pathogens or the host
(Armstrong 2006, 2010). Additionally, α-2-M is
considered a regulator of the proPO system which, in
its active form (PO), participates in the melanization
process of pathogens and damaged tissues. In addition,
peroxinectin communicates through hemocytes to
activate phagocytosis, encapsulation and nodule
formation (Lu et al., 2006).
The activation of CP is dependent from the action of
TGase (Maningas et al., 2008). This is a key factor in
the gelling process of hemolymph because the cross
joint of their molecules forms stable clots (Morales &
Cuéllar-Anjel, 2008). There was a significant overexpression of the CP and LGBP transcriptions observed
in hepatopancreas of infected shrimp. The presence of
minute amounts of compounds of microbial origins,
such as β-1,3-glucans, activates the immune response
while LGBP participates in the recognition of these
molecules (Cerenius & Söderhäll, 2004). There is
ample evidence that these molecules are capable of
triggering the proPO-activating system in crustaceans.
The immune response of infected shrimp was also
observed in the hepatopancreas, indicated by the upregulation of serine protease (an enzyme that activates
the proPO system), (Sritunyalucksana et al., 2001), and
lysozyme (an antibacterial protein which hydrolyzes
peptidoglycans from invader cells).
Finally, the immune response included the upregulation of heat shock proteins in hemocytes and
hepatopancreas. The higher up-regulation level of
HSP60 compared to HSP70 and HSP90 could be
associated to the fact that the first is involved in the
innate immune response of crustaceans, while HSP60
is a mitochondrial protein playing a role in the folding
process of key proteins after import into the
mitochondria (Huang et al., 2011). The chaperone
activity of this protein is involved in the major roles of
defense against pathogen infection and response to
stress.
The immune system of crustaceans is not a linear
process, but a complex network which includes
hundreds of interconnections (Johansson & Soderhall,
1989). Evidence of the activation of this network was
detected when shrimp was infected with NHP-B.
However, the immune system of shrimp per se has been
reported as incapable to eliminate NHP-B, and only
delays the death of organisms if antibiotics are not used
(Ávila-Villa et al., 2012).
Despite none of the antibiotics were capable to
eradicate the bacteria, the high survival observed in the
treated organisms (≥80%) compared to the positive
control (100% of mortality) indicates a positive effect
of both antibiotics; probably because antibiotics
diminished the virulence of the bacteria or decreased
the bacterial load, allowing shrimp to exhibit the
immune response to cope with the infection during the
trial.
Hemolymph parameters at 15 and 20 daa suggest
that the stress level of shrimp decreased after the use of
both antibiotics; however, the immune response
remained active at 15 daa in hemocytes of shrimp
medicated with both antibiotics; but particularly in the
hepatopancreas of shrimp treated with OXI. Herein, the
absence of NHP-B in shrimp treated with OXI at 20
daa, suggest that the use of the antibiotic and the
posterior increase of the immune response (either in
hemocytes and hepatopancreas) contributed to the
control of the pathogen, probably affecting its
development and diminishing its virulence. Herein,
tetracycline and its analogs have demonstrated to
inhibit proteinases of Gram-negative bacteria (Imamura
et al., 2001).
In addition, there is evidence suggesting that subinhibitory concentrations of antibiotics (including FF)
interfere with microbial adherence to host cells
(Blickwede et al., 2004), affecting thus the capacity of
the pathogen to colonize any particular host. Despite
only one antibiotic concentration was tested in this
experiment, there is evidence to conclude that it was a
sub-inhibitory concentration; however, further research
is required to have more precise data about inhibitory
and lethal concentrations.
The diminished pathogenicity of NHP-B exposed to
OXI could provide the time required for shrimp to
mount an effective immune response against this
pathogen; for instance, a more efficient immune
response and higher resistance against pathogens has
been recorded in shrimp previously challenged with
non- or low-pathogenic agents, which suggests the
existence of a “specific immune memory” in
crustaceans, including shrimp (Johnson et al., 2008).
Although none of the two antibiotics fully
eradicated the NHP-B at these particular doses, it seems
logical that OXI had a greater negative effect on the
lifecycle of the pathogen, which allowed shrimp to
“fight back” the disease. Besides the OXI mode of
action, its better antibiotic effect, when compared to FF,
could be hypothetically explained by the penetration
mode of both antibiotics into the cells. OXI penetrates
the cells by simple diffusion and facilitated transport
(active efflux from cell), whereas FF penetrates
exclusively by facilitated transport (reduced uptake into
cell) (Davies & Webb, 2003). However, in spite of the
resistance of shrimp treated with OXI, the noncomplete elimination of the bacteria represents a
potential risk of developing antibiotic resistance by the
pathogen such as has been documented in some other
cases (Rebouças et al., 2011; Gao et al., 2012).
On the other side, the use of FF is a not allowed in
some countries, because it is a fluorinated derivative of
chloramphenicol, which may cause adverse effects on
human health. In this context, OXI could be a better
option in the treatment against NHP-B. However, it is
necessary to take in consideration that FF is much safer
than chloramphenicol, due to the substitution of the
nitro-group attached to the benzene ring, by a
sulphomethyl group (Khalil et al., 2012). Despite the
above, the perception of sanitary authorities, which
regulate some practices in aquaculture, remains
negative for the utilization of FF. Although the
occurrence of NHP-B has been cleared by using OXI
and FF from shrimp, the doses administrated so far are
extremely high (6 and 1 g kg-1 of shrimp respectively)
and are unacceptable for shrimp aquaculture, because
of the elimination of these antibiotics to the
environment and because of potential risks to human
543
health due to the consumption of shrimp with high
concentrations of antibiotics in shrimp tissue. In this
context, the use of natural products with antibacterial
activity may be an adequate alternative considering that
shrimp can withstand NHP-B infections if the
pathogenicity of the bacterium is negatively affected, as
hypothetically occurred during the trial.
ACKNOWLEDGEMENTS
Special thanks to Consejo Nacional de Ciencia y
Tecnología (CONACYT) for the financial support for
this experiment allowed to project 168614; convocatoria de Ciencia Básica.
REFERENCES
Armstrong, P. 2006. Proteases and protease inhibitors: a
balance of activities in host–pathogen interaction.
Immunobiology, 211: 263-281.
Armstrong, P. 2010. Role of α2-macroglobulin in the
immune responses of invertebrates. Invertebr. Surv. J.,
7: 165-180.
Ávila-Villa, L., D. Fimbres-Olivarria, G. García-Sánchez,
T. Gollas-Galván, J. Hernández-López & M.
Martínez-Porchas. 2012. Physiological and immune
responses of white shrimp (Litopenaeus vannamei)
infected with necrotizing hepatopancreatitis bacterium. Aquaculture, 324: 14-19.
Avila-Villa, L., M. Martínez-Porchas, T. Gollas-Galván,
J. López-Elías, L. Mercado, Á. Murguia-López, F.
Mendoza-Cano & J. Hernández-López. 2011.
Evaluation of different microalgae species and
Artemia (Artemia franciscana) as possible vectors of
necrotizing hepatopancreatitis bacteria. Aquaculture,
318: 273-276.
Biagini, G., D. Sala & I. Zini. 1995. Diethyldithiocarbamate, a superoxide dismutase inhibitor, counteracts
the maturation of ischemic-like lesions caused by
endothelin-1 intrastriatal injection. Neurosci. Lett.,
190: 212-216.
Blickwede, M., P. Valentin-Weigand & S. Schwarz. 2004.
Subinhibitory concentrations of FF enhance the
adherence of FF-susceptible and FF-resistant Staphylococcus aureus. J. Antimicrob. Chemother., 54: 286288.
Boxall, A. & J. Ericson. 2012. Human pharmaceuticals in
the environment. Springer, New York, pp. 63-83.
Campa-Córdova, A., N. Hernández-Saavedra & F.
Ascencio. 2002. Superoxide dismutase as modulator
of immune function in American white shrimp
(Litopenaeus vannamei). Comp. Biochem. Physiol. C:
Toxicol. Pharmacol., 133: 557-565.
544
Cerenius, L. & K. Söderhäll. 2004. The prophenoloxidaseactivating system in invertebrates. Immunol. Rev.,
198: 116-126.
Chomczynski, P. & N. Sacchi. 2006. The single-step
method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction: twentysomething years on. Nat. Protoc.,1: 581-585.
Chopra, I. & M. Roberts. 2001. Tetracycline antibiotics:
mode of action, applications, molecular biology, and
epidemiology of bacterial resistance. Microbiol.
Molec. Biol. Rev., 65: 232-260.
Davies, J. & V. Webb. 2003. Antibiotic resistance in
bacteria. Desk Encyclop. Microbiol., 3: 25-46.
Figueroa-Pizano, M.D., A.B. Peregrino-Uriarte, G.M.
Yepiz-Plascencia, M. Porchas-Martínez, T. GollasGalván & L.R. Martínez-Cordova. 2014. Gene
expression responses of white shrimp (Litopenaeus
vannamei) infected with necrotizing hepatopancreatitis bacterium. Aquaculture, 420-421: 165-170.
Fridovich, I. 1995. Superoxide radical and superoxide
dismutases. An. Rev. Biochem., 64: 97-112.
Gao, P., D. Mao, Y. Luo, L. Wang, B. Xu & L. Xu. 2012.
Occurrence of sulfonamide and tetracycline-resistant
bacteria and resistance genes in aquaculture
environment. Water Res., 46: 2355-2364.
Hernández-López, J. 2001. Diseño de técnicas para la
cuantificación de moléculas plasmáticas de camarón,
Tesis Doctorado en Ciencias, CIBNOR, La Paz, 49 pp.
Huang, W.-J., J.-H. Leu, M.-T. Tsau, J.-C. Chen &
L.L.Chen. 2011. Differential expression of LvHSP60
in shrimp in response to environmental stress. Fish
Shellfish Immunol., 30: 576-582.
Hussain, T., M. Jamal, F. Nighat & S. Andleeb. 2014.
Broad spectrum antibiotics and resistance in nontarget bacteria: an example from tetracycline. J. Pure
Appl. Microbiol., 8: 2667-2671.
Imamura, T., K. Matsushita, J. Travis & J. Potempa. 2001.
Inhibition of trypsin-like cysteine proteinases
(Gingipains) from Porphyromonas gingivalis by
tetracycline and its analogues. Antimicrob. Agents
Chemoter., 45: 2871-2876.
Ji, P.-F., C.-L. Yao & Z.Y. Wang. 2009. Immune response
and gene expression in shrimp (Litopenaeus
vannamei) hemocytes and hepatopancreas against
some pathogen-associated molecular patterns. Fish &
Shellfish Immunol., 27: 563-570.
Johansson, M. & K. Soderhall. 1989. Cellular immunity
in crustaceans and the proPO system. Parasitol. Today
5: 171-176.
Johnson, K., M. Van Hulten & A. Barnes. 2008.
Vaccination of shrimp against viral pathogens: phenomenology and underlying mechanisms. Vaccine, 26:
4885-4892.
Khalil, S., E. Hamed & O. Hassanin. 2012. Residue
withdrawal of FF from the serum and edible tissues of
broiler chickens. J. Am. Sci., 8: 514-524.
Lightner, D. 2011. Virus diseases of farmed shrimp in the
Western Hemisphere (the Americas): a review. J.
Invertebr. Pathol., 106: 110-130.
Liu, C.-H., S.-T. Yeh, S.-Y. Cheng & J.C. Chen. 2004.
The immune response of the white shrimp Litopenaeus
vannamei and its susceptibility to Vibrio infection in
relation with the moult cycle. Fish Shellfish Immunol.,
16: 151-161.
Livak, K. & T. Schmittgen. 2001. Analysis of relative
gene expression data using real-time quantitative PCR
and the 2-CT method. Methods, 25: 402-408.
Lu, K.-Y., Y.-T. Huang, H.-H. Lee & H.H. Sung. 2006.
Cloning the prophenoloxidase cDNA and monitoring
the expression of proPO mRNA in prawns
(Macrobrachium rosenbergii) stimulated in vivo by
CpG oligodeoxynucleotides. Fish Shellfish Immunol.,
20: 274-284.
Maningas, M.B., H. Kondo, I. Hirono, T. Saito-Taki & T.
Aoki. 2008. Essential function of transglutaminase and
clotting protein in shrimp immunity. Molec.
Immunol., 45: 1269-1275.
Mendoza-Cano, F., A. Sánchez-Paz, T. Encinas-García,
D. Galván-Álvarez, D. Coronado-Molina & J.
Hernández-López. 2013. First record of necrotizing
hepatopancreatitis bacterium (NHP-B) associated with
the zooplankton samples from the Gulf of California,
Mexico. Mar. Biodivers. Rec., 6: e85.
Morales, V. & J. Cuéllar-Anjel. 2008. Guía técnicaPatología e inmunología de camarones peneidos.
Programa CYTEC Red II-D Vannamei. Panamá, 253
pp.
Morales-Covarrubias, M., L. Tlahuel-Vargas, I. MartínezRodríguez, R. Lozano-Olvera & J. Palacios-Arriaga.
2012. Necrotising hepatobacterium (NHPB) infection
in Penaeus vannamei with FF and oxytetracycline: a
comparative experimental study. Rev. Cient., 22: 7280.
Najafabadi, A.K., R. Ellender & B. Middlebrooks. 1992.
Analysis of shrimp hemolymph and ionic modification
of a Penaeus cell culture formulation. J. Aquat. Anim.
Health, 4: 143-148.
Nunan, L., C. Pantoja & D. Lightner. 2008. Improvement
of a PCR method for the detection of necrotizing
hepatopancreatitis in shrimp. Dis. Aquat. Organ., 80:
6973.
Rebouças, R.H., O.V. de Sousa, A.S. Lima, F.R.
Vasconcelos, P.B. de Carvalho & R.H.S. dos
Fernandes-Vieira. 2011. Antimicrobial resistance
profile of Vibrio species isolated from marine shrimp
farming environments (Litopenaeus vannamei) at
Ceará, Brazil. Environ. Res., 111: 21-24.
Reda, R., R. Ibrahim, E.-N. Ahmed & Z. El-Bouhy. 2013.
Effect of oxytetracycline and FF as growth promoters
on the health status of cultured Oreochromis niloticus.
Egyptian J. Aquat. Res., 39: 241-248.
Rendón, L. & J. Balcázar. 2003. Inmunología de
camarones: conceptos básicos y recientes avances.
Rev. AquaTIC, 19: 27-33.
Roch, P. 1999. Defense mechanisms and disease
prevention in farmed marine invertebrates. Aquaculture, 172: 125-145.
Scholnick, D., K. Burnett & L. Burnett. 2006. Impact of
exposure to bacteria on metabolism in the penaeid
shrimp Litopenaeus vannamei. Biol. Bull., 211: 44-49.
Sritunyalucksana, K., K. Wongsuebsantati, M. Johansson
& K. Söderhäll. 2001. Peroxinectin, a cell adhesive
protein associated with the proPO system from the
black tiger shrimp, Penaeus monodon. Develop.
Comp. Immunol., 25: 353-363.
Received: 26 November 2015; Accepted: 14 April 2016
545
Vargas-Albores, F., M. Guzmán & J. Ochoa. 1993. An
anticoagulant solution for haemolymph collection and
prophenoloxidase studies of penaeid shrimp (Penaeus
californiensis). Comp. Biochem. Physiol. PT. A, 106:
299-303.
Vincent, A. & J. Lotz. 2005. Time course of necrotizing
hepatopancreatitis (NHP) in experimentally infected
Litopenaeus vannamei and quantification of NHPbacterium using real-time PCR. Dis. Aquat. Organ.,
67: 163-169.
Vincent, A. & J. Lotz. 2007. Advances in research of
necrotizing hepatopancreatitis bacterium (NHPB)
affecting penaeid shrimp aquaculture. Rev. Fish. Sci.,
15: 63-73.
Wang, W., H. Lin, C. Xue & J. Khalid. 2004. Elimination
of chloramphenicol, sulphamethoxazole and oxytetracycline in shrimp, Penaeus chinensis following
medicated-feed treatment. Environ. Int., 30: 367-373.
Lat. Am. J. Aquat. Res., 44(3): 546-556, 2016 Hermit crab bycatch fauna in Santa Catarina State, Brazil
546
1
Research Article
Hermit crab bycatch fauna (Decapoda, Anomura) off the coast of Santa Catarina
State, Brazil: diversity and spatial-temporal distribution
Gilson Stanski1, Fernando L. Mantelatto2 & Antonio Leão-Castilho1
1
NEBECC (Núcleo de Estudos de Biología, Ecología e Cultivo de Crustáceos)
Departamento de Zoología, Instituto de Biociências de Botucatu
Universidade Estadual Paulista, São Paulo, Brasil
2
Laboratório de Bioecologia e Sistemática de Crustáceos (LBSC)
Departamento de Biologia, Faculdade de Filosofia, Ciências e Letras de RibeirãoPreto Universidade de
São Paulo (USP), RibeirãoPreto, São Paulo, Brasil
Corresponding author: Gilson Stanski (stanski@ibb.unesp.br)
ABSTRACT. Biodiversity and spatial-temporal distribution of hermit crabs captured as bycatch in the nonselective fishery of shrimp were analyzed in this study from July 2010 through June 2011 off coast Santa
Catarina State (southern Brazil). Ecological indexes and redundancy analyses were conducted to understand the
hermit community and their relationship with environmental factors. In total, 644 specimens were collected,
representing two families, five genera, and six species, demonstrating remarkable species richness in the study
area, mainly because Santa Catarina is a subtropical region. Isocheles sawayai showed the highest abundance,
followed by Loxopagurus loxochelis. Both species demonstrated correlation with temperature (positive) and
sediment grain size (negative). The highest richness and evenness values were estimated at the deeper area (17
m). However, in 5 m deep area showed the lowest evenness because of the high dominance of I. sawayai,
resulting in a lower estimated diversity. During a period of lower temperature and higher salinity (July), higher
levels of diversity were registered, probably because of the lower dominance of tropical species (I. sawayai) and
the presence of some species distributed in offshore regions (Petrochirus diogenes, Dardanus insignis and
Pagurus exilis). Thus, we detected that the capture effort designated in the shrimp fishery activities had a strong
influence in the diversity of hermit crabs and other associated fauna, especially because of catch specimens in
expressive abundance at various stages of development, including juveniles. This profile makes us argue in favor
of constant monitoring of bycatch resources in order to preserve the marine fauna.
Keywords: hermit crab, habitat selection, fishery, Babitonga Bay, Brasil.
Fauna de captura incidental de cangrejo ermitaño (Decapoda, Anomura) en la costa de
Santa Catarina, Brasil: diversidad y distribución espacio-temporal
RESUMEN. Se analizó la biodiversidad y distribución espacio-temporal de los cangrejos ermitaños, como
descartes en la pesca no selectiva de camarón, entre julio de 2010 y junio de 2011 en la costa del Estado de
Santa Catarina. Los índices ecológicos y análisis de redundancia se analizaron para describir el desarrollo de la
comunidad de ermitaños y su relación con los factores ambientales. Se encontró una notable riqueza específica
en una región subtropical, como fue la de Santa Catarina, donde se obtuvieron 644 individuos pertenecientes a
dos familias, cinco géneros y seis especies. Isocheles sawayai presentó la mayor abundancia, seguida de
Loxopagurus loxochelis; ambas especies mostraron correlación con la temperatura y tamaño de las partículas
del sedimento. Los mayores valores de riqueza y uniformidad se dieron en la zona más profunda estudiada (17
m). Sin embargo, a 5 m de profundidad se encontró la equirepartición más baja debido al predominio de I.
sawayai. Durante un período de baja temperatura y mayor salinidad (julio) se registraron altos valores de
diversidad, probablemente debido la baja dominancia de especies costeras tropicales (I. sawayai) y presencia de
algunas especies de aguas oceánicas (Petrochirus diogenes, Dardanos insignis y Pagurus exilis). Se detectó que
el esfuerzo de captura aplicado en las pesca del camarón tuvo una fuerte influencia en la diversidad de los can-
__________________
Corresponding editor: José A. Álvarez-Pérez
2547
grejos ermitaños y fauna asociada, especialmente debido a que en las muestras se observaron diversas etapas de
desarrollo de las especies, incluyendo juveniles. Estos resultados son argumentos a favor de una vigilancia
constante de los descartes a fin de preservar la fauna marina.
Palabras clave: cangrejo ermitaño, selección del hábitat, pesquería, Bahía Babitonga, Brasil.
INTRODUCTION
The highest mortalities of marine species are associated
with shrimp trawling, activity that possesses, as a main
characteristic, low selectivity (Escobar-Toledo et al.,
2014). Such activity causes indirect impacts on the
physical environment, with changes in the marine
substrate (Pilskaln et al., 1998), as well as direct
impacts, with the extraction of species that are
accidentally captured (bycatch) (Alverson et al., 1994).
The biological impact is so significant, it is estimated
that for every 1 kg of shrimp harvested, 11 kg of other
species are caught and discarded (Connoly, 1986;
Severino-Rodrigues et al., 2002).
However, little is known about the ecology and life
cycle of bycatch species when compared to commercially profitable species. In the case of hermit crabs,
crustaceans with a significant level of diversity of over
1,100 species (Mclaughlin et al., 2010), have an
important role in the marine food web (McLaughlin et
al., 2007; Fantucci et al., 2009), but are often captured
in this type of activity.
In addition, for our knowledge about diversity of
these animals, it is necessary to study and understand
their interactions with the environment and its features.
In this sense, it is known that some components have a
large influence on the occurrence and distribution of
benthic marine species. Among these the sediment,
water temperature and salinity are cited as the most
important factors for hermit crabs (Abele, 1974;
Negreiros-Fransozo et al., 1991; Bertini et al., 2004;
Mantelatto et al., 2004; Fantucci et al., 2009).
In the case of hermit crabs, in particular, another
variable that plays a crucial role in the interaction with
the environment is the existence of gastropod shells that
modulate diversity, which is directly related with the
lifestyle of these organisms. The empty shell of the
gastropod has a structure that is essential to growth,
reproduction and protection from predators and
mechanical abrasion, which commonly occur in the
natural environment competition during the intra or
interspecific by this shelter (Bach et al., 1976; Elwood
et al., 1995; Teoh et al., 2014).
Thus, the purpose of this study was to characterize
the structure of temporal and spatial richness, and
diversity of hermit crabs species obtained as bycatch in
shrimp fishing, in the region adjacent to Babitonga Bay
in Santa Catarina State. We also analyzed the distri-
bution of the species related to abiotic factors, such as
salinity, water temperature, organic matter and grain
size of the sediment.
The anomurans and environmental factors were
sampled monthly from July 2010 through June 2011 at
five sites (stations) parallel to the shoreline and at
different depths (5, 8, 11, 14 and 17 m) in adjacent areas
of Babitonga Bay (Fig. 1). This bay is located on the
northern coast of Santa Catarina near the towns of
Joinville, Itapoá and São Francisco do Sul (Fig. 1). In
the southern hemisphere, the seasons are separated as
follows: July, August and September (winter); October,
November and December (spring); January, February
and March (summer); April, May and June (autumn).
Biological collection
Biological sampling was conducted in 30 min trawls
using a shrimp boat outfitted with double-rig nets (see
Grabowski et al., 2014). Specimens were packed in an
insulate box containing crushed ice for later analyses.
In the laboratory, hermit crabs were carefully removed
from their shells, identified according to Melo (1999)
procedures, counted (numbers absolute) and number
caught per standard trawl (catch per unit effort CPUE),
i.e., hermit crabs collected for 60 min (2 nets 30 min)
in each month. The animals were preserved in 80%
ethyl alcohol and were deposited in the Crustacean
Collection of the Department of Biology, Faculty of
Philosophy, Sciences and Letters at Ribeirão Preto,
University of São Paulo (CCDB/FFCLRP/USP).
Abiotic factors collection and analysis
In general, the methodology used for collection and
analysis followed the protocols developed by Fransozo
et al. (1992) and Santos et al. (1994). Bottom water
samples were taken using a Van Dorn bottle to measure
salinity and temperature, for which an optical refractometer and a mercury thermometer were used. An
ecobathymeter coupled with a GPS was used to record
depth (m) at sampling sites.
Sediment was obtained using a Petersen grab. The
samples were packed individually and frozen to
minimize loss of organic matter. At the laboratory, the
sediment was dried in a 70ºC oven for 72 h. From each
sample, a 100 g subsample was ash-weighed to deter-
Hermit crab bycatch fauna in Santa Catarina State, Brazil
548
3
Figure 1. Map of the study area, highlighting the five sampled stations in an area adjacent to Babitonga Bay, Santa Catarina,
Southern Brazil (source: Grabowski et al., 2014).
mine the grain-size distribution. Sediments were sieved
through 2 mm (gravel), 2.0-1.01 mm (very coarse sand),
1.0-0.51 mm (coarse sand), 0.50-0.26 mm (medium
sand), 0.25-0.126 mm (fine sand), and 0.125-0.063 mm
(very fine sand); smaller particles were classified as
silt-clay (Suguio, 1973; Hakanson & Jansson, 1983).
Grain size categories followed the American
standard, and fractions were expressed on the phi ()
scale, i.e., using the formula  = - log2d, where d = grain
diameter (mm) (Tucker, 1988), e.g., -1=  < 0 (very coarse
sand); 0 =  < 1 (coarse sand); 1 =  < 2 (intermediate
sand); 2 =  < 3 (fine sand); 3 =  < 4 (very fine sand) and
 ≥ 4 (silt+clay). Finally,  was calculated by
cumulative particle-size curves were plotted on a
computer using the  scale, with values corresponding
to 16th, 50th, 84th percentiles being used to determine the
mean diameter of the sediment using the formula Md =
(16+50+84)/3. The organic matter content (%) was
obtained by ash-weighing: three aliquots of 10 g each
per station were placed in porcelain crucibles, heated
for 3 h at 500oC, and then weighed again (Tucker, 1988).
Environmental data on rainfall was obtained
monthly from Epagri/Ciram/Inmet (Centro de Informações de Recursos Ambientais e de Hidrometereologia
de Santa Catarina) using weather stations located near
the study site (Itapoá City).
Ecological indexes were applied to measure the
dynamics of studied species, including richness,
dominance, diversity and evenness, using the software
PAST, version 2.06 (Hammer et al., 2001). The
richness (S’) was represented by the number of species
present in the community (Mcintosh, 1967). Dominance (d) was determined using the Berger & Parker
Index (1970), which considered the major proportion of
the species with the best individual abundance,
expressed by the formula d = Nmax/Ntotal, where: Nmax is
the number of specimens of the more abundant species
and Ntotal is the total number of specimens in the sample.
Diversity and species richness were quantified using
the Shannon-Wiener (1949) diversity index and
Pielou’s evenness index (1966). Diversity (H') was
expressed as H' = -∑ pi(log pi), taking into account the
richness and the relative abundance of the species,
where pi is the result of the number of specimens of
species i in the sample, divided by the total number of
specimens (S). Pi is the importance value and log = base
2 (bits). Evenness (J') was estimated by the equation: J'
= H'/log2S.
A redundancy analysis (RDA) was used to test the
relationship of species abundance with environmental
factors (Legendre & Legendre, 1998). However,
Petrochirus diogenes (Linnaeus, 1758), Dardanus
insignis (Saussure, 1858), Pagurus exilis (Benedict,
1892), and Pagurus leptonyx (Forest & Saint Laurent,
1968) were not incorporated into the RDA because they
were present in less than 10% of the monthly samples.
Previous analysis of the main species showed a
linear response in their abundance in relation to the
environmental variables used, and the use of the RDA
offers a greater percentage of the variance explained in
comparison with the canonical correspondence analysis
(CCA), which is more suitable when there is a
unimodal response (Gotelli & Elison, 2011). The set of
environmental variables used in RDA calculations
comprised bottom salinity and bottom temperature,
4549
organic matter content and grain size of sediments. The
routine Vegan was used, embedded in the software R
(R Development Core Team, 2009). Tests for homoscedasticity (Levene tests) and normality (Shapiro-Wilk
tests) were first performed as prerequisites for the
statistical test. Data were log-transformed prior to
analysis (Zar, 1999). All of the data sets were normally
distributed with homogeneous variances.
bottom water temperature were recorded (Fig. 4). The
last two mentioned species were found only in the
winter and P. exilis only in autumn (Table 1).
The rainy season began in October, with highest
average rainfall during the spring seasons (185 ± 31
mm) and during summer (451 ± 27 mm), coinciding
with the greatest amount of dominant individual
species, I. sawayai and L. loxochelis (Tables 1-2).
RESULTS
Redundancy analysis-Isocheles sawayai and Loxopagurus loxochelis
The species with the greatest number of specimens, I.
sawayai and L. loxochelis, were found during the whole
year and with greater occurrence during spring and
summer, especially in months with temperatures
between 21-23°C, and in sites with sediment composed
of high silt+clay concentration (Fig. 5).
Both I. sawayai (96%) and L. loxochelis (57%)
presented the greatest occurrences in depths of 5 m.
Therefore, the Redundancy Analysis (RDA) was
performed temporarily only at this depth. The RDA
analysis demonstrated the relationship between species
and environmental variables. Variations of the data
were mainly explained by the first axis (i.e., 62% of the
variance), representing primarily the bottom temperature and Phi (Fig. 6, Table 3).
Ecological indexes and spatial-temporal distribution
Throughout of the year, 644 animals were collected (11
animals by trawl hour), of which 352 (54.7%) were
males, 188 (29.2%) females without embryos, and 104
(16.1%) females with embryos, belonging to two
families (Paguridae and Diogenidae), five genera, and
six species. Isocheles sawayai had the greatest number
of specimens (575), followed by Loxopagurus
loxochelis (56), Petrochirus diogenes (9), Dardanus
insignis (2), Pagurus exilis (1), and Pagurus leptonyx
(1) (Table 1).
The stations at depths of 5 and 17 m presented the
lowest and highest rates of diversity, respectively. In
depths where the dominance increased, the evenness
decreased, resulting in low diversity (Fig. 2).
Temporally, July presented highest diversity index
(H' = 1.4 bits) and high evenness (E = 0.9). November
recorded the greatest number of specimens and the
highest index of dominance during the study (D = 0.9).
The number of specimens increased during the spring
and summer seasons, which are periods with higher
temperatures. On the other hand, the species richness
was higher in seasons with lower temperatures (Tables
1-2).
The majority of I. sawayai was found at 5 m deep,
while L. loxochelis showed larger plasticity in the occupation of sampled stations (Fig. 3). On the other hand,
P. diogenes and P. leptonyx were found only at depths
of 14 and 17 m, D. insignis and P. exilis in depth of 17
m, where the highest salinity values and lower values
DISCUSSION
Bycatch
Considering that Santa Catarina is subtropical region,
and therefore, trends naturally towards the present
pattern with lower species richness in comparison with
tropical regions, because is influenced by the presence
of larger amplitudes in the environmental parameters,
mainly water temperature (Thorson, 1950; Gray, 2007),
the region of the Babitonga Bay presented a significant
richness of hermit crabs higher than the five found by
Branco et al. (2015) along the coast of the State of Santa
Catarina.
Table 1. Composition and absolute number of individuals collected and catch per unit effort (CPUE) by season during July
2010 to June 2011 in the region adjacent to the Babitonga Bay, Santa Catarina. Winter: July-September, and subsequently
to other seasons.
Species
Winter 2010 (CPUE)
Spring
Summer 2011 Autumn Total (CPUE)
Isocheles sawayai
34
(0.57)
422 (7.0) 107 (1.8)
12 (0.2) 575 (9.5)
Loxopagurus loxochelis
6
(0.1)
26 (0.4)
20 (0.3)
4 (0.06) 56 (0.9)
Petrochirus diogenes
3
(0.05)
1 (0.01)
4 (0.06)
1 (0.01) 9 (0.15)
Dardanus insignis
2
(0.03)
0 (0)
0 (0)
0 (0)
2 (0.03)
Pagurus exilis
1
(0.01)
0 (0)
0 (0)
0 (0)
1 (0.01)
Pagurus leptonyx
0
(0)
0 (0)
0 (0)
1 (0.01) 1 (0.01)
Total
46
(0.8)
449 (7.4) 131 (2.2)
18 (10.7) 644 (10.7)
5505
Figure 2. Shannon-Wiener, evenness and dominance Berger-Parker indexes, in the five depths studied during the period
from July/2010 to June/2011.
Table 2. Mean and standard deviation (mean ± SD) by
season, of bottom water temperature, bottom salinity,
dissolved organic matter in the substrate, and rainfall for
the period from July 2010 to June 2011, in the region
adjacent to Babitonga Bay, Santa Catarina.
Season
Winter
Spring
Summer
Autumn
Temp.
(°C)
19.0 ± 0.7
22.4 ± 2.4
25.5 ± 0.8
21.2 ± 1.1
Salinity
33.1 ± 1.6
32.3 ± 0.1
32.9 ± 0.8
35.2 ± 0.4
M.O.
(%)
3.2 ± 3.0
5.9 ± 1.8
2.7 ± 0.9
2.2 ± 0.2
Rainfall
(mm)
101.3 ± 37
185.5 ± 31
451.9 ± 27
79.2 ± 19
On the other hand, the observation of expressive
amounts of hermits crabs caught by fishing equipment
assumes alarming proportions because Santa Catarina
is the greatest producer of national fishery (Sedrez et
al., 2013). Therefore, if significant diversity and
abundance were observed in 30 min of sampling (this
study), it would be assumed that the amount that has
been captured by bycatch in the commercial trawl by
boat lasting up to 4 h consecutive (Haimovici &
Mendonça, 1996) and for longer periods, must be much
higher with repetitions made throughout the day,
removing significant concentrations of these organisms
and causing habitat modification of benthic species.
A constant extraction pressure impacting recruitment, reproduction and growth of specimens, can damage
the maintenance of the population, as well as the
perpetuation over time (Severino-Rodrigues et al.,
2002). Small animals (many juveniles) and females
with embryos were captured in the sampling conducted
for this study, during shrimp fishing process,
demonstrating that shrimp fishing captures individuals
in various stages of development given the unselective
fishing methods, negatively affecting abundance of
benthic populations.
Some trawling characteristics are crucial to
generating large amounts of bycatch, such as the type
of beam-trawl, that are made exclusively targeting the
highest yield of shrimp catches without any concern
regarding the escape of other species that share the
same habitat (Sá Paiva et al., 2009). The fishing effort
carried out on stocks of profitable species is beyond the
tolerable maximum, causing exploitation of bycatch
species (small or big individuals), as Artemesia
longinaris (Spence Bate, 1888) and Pleoticus muelleri
(Spence Bate, 1888) shrimps (Costa et al., 2004;
Castilho et al., 2007).
In addition, loss of biological diversity, disturbance
or elimination of local species cause direct changes in
predator-prey relationships and impair the delicate
balance of the marine ecosystem, causing harmful
effects on its structure and functioning (Alverson et al.,
1994). So, minimizing bycatch catches during fishing
activity becomes vital to the socioeconomic development of the region in which fishing is carried out;
otherwise, the frequent bycatch capture and changes in
the coastal ecosystem structure will endanger the
sustainability of the target species and the entire
associated biological community (Wallace et al., 2013).
Biological environmental framework
Variations in the abundance and diversity of hermit
crabs throughout the year is a consequence of
heterogeneous environmental conditions from a wide
variety of microenvironments related to environmental
complexity (Wenner et al., 1983; Abelló et al., 1988),
and during seasonal changes in the environment, diffe-
6551
Figure 3. Spatial distribution of the most abundant species collected during the period from July 2010 to June 2011, in the
region adjacent to the Babitonga Bay, Santa Catarina.
Figure 4. Variation of the temperature and bottom salinity in the five sampled depths during the period of July 2010 to June
2011, in the region adjacent to the Babitonga Bay, Santa Catarina.
rent species can adapt to the conditions in different
seasons. Thus, it is expected that more species may
coexist in environments that show seasonal changes
than in those that are at a constant ambient condition
(Begon et al., 2006).
The greatest diversity of species recorded in July
(winter) was intimately related to water temperature
and organic matter decrease, and the increased salinity.
It is proposed that variation of these environmental
factors may have caused a decrease in the abundance of
dominant species, such as I. sawayai, directly influencing the Shannon-Wiener diversity index, which takes
into account not only species richness, but also their
abundance (Magurran, 2004). Linked to this, it is
proposed that reduction in temperature values in the
sampled sites promotes migration to coastal regions
(shallower) of species inhabiting preferable places
offshore (deep), such as P. exilis, D. insignis, and P.
diogenes. Fransozo et al. (1998) found similar results
on the coast of São Paulo (23oS, 45oW), under similar
environmental conditions, with a greater diversity
index during winter, proposing that decreases in water
temperature benefit species that are adapted to this
environment, providing them with abiotic conditions
near the coast. Consequently, during warmer periods,
such as summer, cold stenothermal species return to the
deepest sites, reducing diversity and increasing the
presence of dominant species.
Spatially, higher rates of evenness and richness
were recorded in the 17 m by the low dominance of
species and representativeness of those usually found at
greater depths, such as P. exilis, D. insignis, and P.
diogenes, which are hermit crabs that occur mainly in
regions that present low water temperature and
sediment with lower prevalence of silt+clay (Fransozo
et al., 2008). On the other hand, at 5 m, lower values of
equitability and high dominance of I. sawayai were
recorded because high abundance of a species leads to
low diversity, and consequently, to low local evenness
(Magurran, 2004). The fitness of dominant species is
higher or not according to the abiotic features and
potential competitors that exist or not in their habitat
5527
Figure 5. Average number of Isocheles sawayai and Loxopagurus loxochelis individuals, for each Phi classes collected by
trawling from July 2010 to June 2011, in the region adjacent to the Babitonga Bay, Santa Catarina.
Figure 6. Redundancy Analysis (RDA). Spatial variation axes biplot of observations regarding data of species and
environment variables during the period from July 2010 to June 2011 in an area adjacent to Babitonga Bay, Santa Catarina.
The arrows indicate strength of the relationship between axes and environmental factors.
(Negreiros-Fransozo et al., 1997; Sant'Anna et al.,
2006). For example, I. sawayai showed dominance
(great abundance) in places with temperatures around
22°C, low salinity and the prevalence of thin substrate,
which are favorable condition for its development
(Fantucci et al., 2009).
Isocheles sawayai is adapted to low salinity and
elevated water temperatures, which may explain their
abundance during the warmer seasons of the year
(Negreiros-Fransozo & Hebling, 1983; Fantucci et al.,
2009). In addition, it is proposed that increases of
organic materials in suspension in the regions near the
coast favored the presence of suspension-feeder species
(Bertness, 1981), such as I. sawayai, especially during
the spring and summer periods, which presented high
rainfall indexes (1,700 mm year) (data from National
Institute of Meteorology, 1939-1983; Hardt, 2005).
This can lead to increased material in suspension.
Rainfall elevates the river discharge to the coastal
region, mediated by the estuary, providing the
entrainment of organic suspended matter or associated
with the substrate for marine regions (Abreu, 1980;
Schettini, 2002).
On the other hand, L. loxochelis have occurred in
colder waters with geographical distribution to
Argentina (38oS), where the species has significant abun-
8553
Table 3. Redundancy Analysis (RDA). Summary results
of hermit crabs and environmental variables collected,
during the period from July/2010 to June/2011, in the
region adjacent Babitonga Bay, Santa Catarina. Phi: mean
grain size. Significance was inferred using α (P < 0.05):
0*** 0.001**, 0.01* 0.05, 0.1 P value based on 9999
permutations.
Axes
Proportion explained
% organic matter
Bottom temperature
Phi
Bottom salinity
RDA1
0.6223
0.6612
0.7081
0.7539
-0.4914
RDA2
0.2331
0.2764
-0.1326
-0.2539
-0.4981
R2
P
0.3270
0.5526
0.3956
0.2319
0.1667
0.0228*
0.0594
0.3104
dance during periods when the water temperature is
lower (Mantelatto et al., 2004; Ayres-Peres &
Mantelatto, 2008). Bertini et al. (2004) and Mantelatto
et al. (2004) found larger amounts of L. loxochelis at
temperature ranges of 16-22°C and 17-23°C, respectively. These authors stated that low water temperature
and locations that do not have much of an influence on
freshwater, especially above 15 m deep in the Ubatuba
Region, are mainly modulators in the distribution of
species.
However, in the present study, the species was the
only one that showed spatial distribution at all depths
sampled, with a significant number of specimens at 5
m, even during periods of the year with temperatures
above 23°C. Although there are previous records of L.
loxochelis in places with cold waters and high salinity
(Bertini et al., 2004; Ayres-Peres & Mantelatto, 2008),
it is proposed that the species possesses plasticity in
ambient occupation when food conditions benefit their
development because the species has suspension-feeder
habits (Melo, 1999). These include sites with substrate
consisting mainly of finer sediments, such as those
found at five meters and have a higher organic matter
content (Burone et al., 2003), favoring feeding. The
granulometry and level of organic matter in the
sediment have been postulated as the most relevant
factors in the distribution of Anomura (NegreirosFransozo et al., 1997; Fransozo et al., 1998).
Moreover, areas with predominance of medium
sand would be unfavorable for the behaviour of burying
hermit crabs, as L. loxochelis which is frequently
captured in areas compound by fine sediment and
favourable for its behavior (Mantelatto et al., 2004). In
addition, it is proposed that with increased rainfall
during the spring and summer months, there is an
increase in the entry of food particles in places near the
coast, benefiting the development of suspension-feeder
species. According to Melo (1985), decapod species
alter their limits of bathymetric distribution, depending
on environmental conditions and their physiological
needs.
The constant impact of fishing equipment on
species of no commercial value, such as hermit crabs,
is harmful to the ecosystem and, over time, this
situation tends to worsen irreversibly, negatively
affecting the balance of the marine biological
community as a whole. As shrimp fishing is essential to
the survival of hundreds of fishermen in the northern
region of the Santa Catarina State, since the activity
contributes to reducing poverty and promoting food
security (Béné, 2003; Branco & Verani, 2006; Ye et al.,
2012), it is fundamental that substantial changes should
be implemented in the fishing pattern currently used.
Shorter bottom trawling and adjustments to the
networks allowing for the escape of tiny animals are
some strategies that may favor the survival of the target
species or bycatch, benefiting the biotic balance as a
whole. Particularly for hermits, the bycatch impact is
certainly minimized by the presence of shells that act as
protection and allows for greater survival until discard.
Thus, it is essential to study the role of this variable in
the more abundant species in areas of bycatch.
ACKNOWLEDGEMENTS
The authors are indebted to foundations that provide
financial support during field collections, visiting
activities and scholarships: Fundação de Amparo à
Pesquisa do Estado de São Paulo-FAPESP (2010/
50188-8), CAPES CIMAR II (23038.004310/2014-85
and 23038.004308/2014-14), CAPES (post-graduation
scholarships), CNPq (Research Scholarships PQ 304
968/2014-5 and PQ 308653/2014-9), Fundação para o
Desenvolvimento da Unesp-FUNDUNESP (1214/
2010-DFP), and the Pró-Reitoria de Pesquisa (PROPE).
We thank many colleagues from the NEBECC group
who helped with sampling and laboratory analyses; and
the “Instituto Brasileiro do Meio Ambiente e dos
Recursos Naturais Renováveis” (IBAMA) for granting
permission to collect the shrimp.
REFERENCES
Abele, L.G. 1974. Species diversity of decapods crustaceans in marine habitats. Ecology, 55(1): 156-161.
Abelló, P., F.J. Valladares & A. Castellón. 1988. Analysis
of the structure of decapod crustacean assemblages off
the Catalan coast (North-West Mediterranean). Mar.
Biol., 98: 39-49.
Abreu, J. 1980. Distribuição e ecologia dos Decapoda
numa área estuarina de Ubatuba (SP). Bolm. Inst.
Oceanogr., 29(2): 1-3.
Alverson, D.L., M.H. Freeberg, J.G. Pope & S.A.
Murawski. 1994. A global assessment of fisheries
bycatch and discards. FAO Fish.Tech. Pap., 339: 233
pp.
Ayres-Peres, L. & F.L. Mantelatto. 2008. Análise
comparativa da estrutura populacional do ermitão
endêmico do Atlântico Ocidental Loxopagurus
loxochelis (Decapoda, Anomura) em duas regiões do
Estado de São Paulo, Brasil. Iheringia, Sér. Zool.,
98(1): 28-35.
Bach, C.B., B. Hazlett & D. Rittschof. 1976. Effects of
interspecific competition on fitness of the hermit crab
Clibanarius tricolor. Ecology, 57: 579-586.
Begon, M., C.R. Townsend & J.L. Harper. 2006. Ecology
from individuals to ecosystems. Blackwell Publishing,
London, 700 pp.
Béné, C. 2003. When fishery rhymes with poverty: a first
step beyond the old paradigm on poverty in small-scale
fisheries. World Develop., 31(6): 949-975.
Berger, W.H. & F.L. Parker. 1970. Diversity of planktonic
foraminifera in deep sea sediments. Science, 68: 13451347.
Bertini, G., A. Fransozo & A.A. Braga. 2004. Ecological
distribution and reproductive period of the hermit crab
Loxopagurus loxochelis (Anomura, Diogenidae) on
the northern coast of São Paulo State, Brazil. J. Nat.
Hist., 38(18): 2331-2344.
Bertness, M.D. 1981. The influence of shell-type on
hermit crab growth rate and clutch size (Decapoda,
Anomura). Crustaceana, 40(2): 197-205.
Burone, L., P. Muniz, A.M.S. Pires-Vanin & M.
Rodrigues. 2003. Spatial distribution of organic matter
in the surface sediments of Ubatuba Bay (Southeastern
Brazil). An. Acad. Bras. Ciênc., 75(1): 77-90.
Branco, J.O. & J.R. Verani. 2006. Análise qualiquantitativa da ictiofauna acompanhantena pesca do
camarão sete-barbas, na Armação do Itapocoroy,
Penha, Santa Catarina. Rev. Bras. Zool., 23(2): 381391.
Branco, J.O., F. Freitas Júnior & M.L. Christoffersen.
2015. Bycatch fauna of seabob shrimp trawl fisheries
from Santa Catarina State, southern Brazil. Biota
Neotrop., 15(2): 1-14.
Castilho, A.L., M.A. Gavio, R.C. Costa, E.E. Boschi, R.T.
Bauer & A. Fransozo. 2007. Latitudinal variation in
population structure and reproductive pattern of the
endemic South American shrimp Artemesia longinaris
(Decapoda: Penaeoidea). J. Crustacean Biol., 27: 548552.
Costa, R.C., A. Fransozo & A.P. Pinheiro. 2004.
Ecological distribution of the shrimp Pleoticus muelleri
Bate, 1888 (Decapoda: Penaeoidea) in southeastern
Brazil. Hydrobiologia, 529: 195-203.
554
9
Connoly, P.C. 1986. Status of the Brazilian shrimp fishing
operations and results of related research. FAO
General Contribution, 3: 1-28.
Elwood, R.W., N. Marks & J.T.A. Dick. 1995.
Consequences of shell-species preferences for female
reproductive success in the hermit crab Pagurus
bernhardus. Mar. Biol., 123(3): 431-434.
Escobar-Toledo, F., M.J. Zetina-Rejón & L.O. Duarte.
2014. Measuring the spatial and seasonal variability of
community structure and diversity of fish by-catch
from tropical shrimp trawling in the Colombian
Caribbean Sea. Mar. Biol. Res., 11(5): 528-539.
Fantucci, M.Z., R. Biagi, A.L. Meireles & F.L.
Mantelatto. 2009. Influence of biological and
environmental factors on the spatial and temporal
distribution of the hermit crab Isocheles sawayai
Forest & Saint-Laurent, 1968 (Anomura, Diogenidae).
Nauplius, 17(1): 37-47.
Fransozo, A., G. Bertini, A.A. Braga & M.L. NegreirosFransozo. 2008. Ecological aspects of hermit crabs
(Crustacea, Anomura, Paguroidea) off the northern
coast of São Paulo State, Brazil. Aquat. Ecol., 42: 437448.
Fransozo, A., F.L. Mantelatto, G. Bertini, L.C. FernandezGóes & J.M. Martinelli. 1998. Distribution and
assemblages of anomuran crustaceans in Ubatuba Bay,
north coast of São Paulo State, Brazil. Acta Biol.
Venez., 18(4): 17-25.
Fransozo, A., M.L. Negreiros-Fransozo, F.L. Mantelatto,
M.A.A. Pinheiro & S. Santos. 1992. Composição e
distribuição dos Brachyura (Crustacea, Decapoda) do
sublitoral não consolidado na enseada da Fortaleza,
Ubatuba (SP). Rev. Bras. Biol., 52(4): 667-675.
Gotelli, N.J & A.M. Ellison. 2011. Princípios de estatística
em ecologia. Artmed, Porto Alegre, 528 pp.
Grabowski, R.C., S.M. Simões & A.L. Castilho. 2014.
Population structure, sex ratio and growth of the
seabob shrimp Xiphopenaeus kroyeri (Decapoda,
Penaeidae) from coastal waters of southern Brazil.
ZooKeys, 457: 253-269.
Gray, J.S. 2007. Marine biodiversity: patterns, threats and
conservation needs. Biodivers. Conserv. 6: 153-175.
Hammer, Ø., D.A.T. Harper & P.D. Ryan. 2001. PAST:
Paleontological statistics software package for
education and data analysis. Palaeontol. Electron.,
4(1): 1-9.
Haimovici, M. & J.T. Mendonca. 1996. Descartes da
fauna acompanhantena pesca de arrasto de tangones
dirigida a linguados e camarões na plataforma
continental do sul do Brasil. Atlântica, 18: 161-177.
Hakanson, L. & M. Jansson. 1983. Principles of lake
sedimentology. Springer-Verlag, Berlin, 316 pp.
555
10
Hardt, F.A.S. 2005. Padrões de residência do golfinho
Sotalia guianensis, na Baía da Babitonga, litoral norte
de Santa Catarina. Brasil. Dissertação Mestrado em
Ciências Biológicas, AC: Zoologia, Universidade
Federal do Paraná, Paraná, 120 pp.
Legendre, P. & L. Legendre. 1998. Numerical ecology,
Elsevier Science, Amsterdam, 853 pp.
Magurran, A.E. 2004. Measuring biological diversity.
Blackwell Science, Oxford, 256 pp.
Mantelatto, F.L., J.M. Martinelli & A. Fransozo. 2004.
Temporal-spatial distribution of the hermit crab
Loxopagurus loxochelis (Decapoda, Anomura,
Diogenidae) from Ubatuba Bay, São Paulo State,
Brazil. Rev. Biol. Trop., 52(1): 47-55.
McIntosh, R.P. 1967. An index of diversity and the
relation of certain concepts to diversity. Ecology,
48(3): 392-404.
McLaughlin, P.A., R. Lemaitre & U. Sorhannus. 2007.
Hermit crab phylogeny: a reappraisal and its “fallout”. J. Crustacean Biol., 27(1): 97-115.
McLaughlin, P.A., T. Komai, R. Lemaitre & D.L.
Rahayu. 2010. Annotated checklist of anomuran
decapod crustaceans of the world (exclusive of the
Kiwaoidea and families Chirostylidae and Galatheidae
of the Galatheoidea) Part 1. Lithodoidea, Lomisoidea
and Paguroidea. Raff. Bull. Zool., 23: 5-107.
Melo, G.A.S. 1985. Taxonomia e padres distribucionais e
ecológicos dos Brachyura (Crustacea: Decapoda) do
litoral sudeste do Brasil. Ph.D. Thesis. Universidade
de São Paulo, São Paulo, 215 pp.
Melo, G.A.S. 1999. Manual de identificação dos
Crustacea Decapoda do litoral brasileiro: Anomura,
Thalassinidea, Palinuridea e Astacidea. Editora
Plêiade, São Paulo, 551 pp.
Negreiros-Fransozo, M.L. & N.J. Hebling. 1983.
Desenvolvimento pós-embrionário de Isocheles
sawayai Forest e Saint Laurent, 1968 (Decapoda,
Diogenidae), em laboratório. Pap. Avul. Zool., 35(4):
41-53.
Negreiros-Fransozo, M.L., A. Fransozo, M.A.A. Pinheiro,
F.L. Mantelatto & S. Santos. 1991. Caracterização
física e química da Enseada da Fortaleza, Ubatuba, SP.
Rev. Bras. Geociê., 21(2): 114-120.
Negreiros-Fransozo, M.L., A. Fransozo, F.L. Mantelatto,
M.A.A. Pinheiro & S. Santos. 1997. Anomuran
species (Crustacea, Decapoda) in their ecological
distribution at Fortaleza Bay sublittoral, Ubatuba, São
Paulo, Brazil. Iheringia, Sér. Zool., 83: 187-194.
Pielou, E.C. 1966. The measurement of diversity in
different types of biological collections J. Theor. Biol.,
13: 131-144.
Pilskaln, C.H., J.H. Churchill & L.M. Mayer. 1998.
Resuspension of sediment by bottom trawling in the
Gulf of Maine and potential geochemical consequences. Conserv. Biol., 12(6): 1223-1229.
R Development Core Team. 2009. R: a language and
enviroment for statistical computing. R Foudation for
Statistical Computing, Vienna, Austria. ISBN 3900051-07-0. htt://www.R-Project.org.
Sá Paiva, K., J.A.N. Aragão, K.C.A. Silva & I.H.A.
Cintra. 2009. Fauna acompanhante da pesca industrial
do camarão-rosa na plataforma continental norte
brasileira. Bol. Téc. Cient. Cepno. Belém, 9: 25-42.
Sant'Anna, B.S., C.M. Zangrande, A.L.D. Reigada & E.
Severino-Rodrigues. 2006. Spatial distribution and
shell utilization in three sympatric hermit crabs at nonconsolidated sublittoral of estuarine-bay complex in
São Vicente, São Paulo, Brazil. Rev. Biol. Mar.
Oceanogr., 41(2): 141-146.
Santos, S., M.L. Negreiros-Fransozo & A. Fransozo.
1994. The distribution of the swimming crab Portunus
spinimanus Latreille, 1819 (Crustacea: Brachyura:
Portunidae) in Fortaleza Bay, Ubatuba, SP, Brazil.
Atlântica, 16: 125-141.
Sedrez, M.C., J.O. Branco, F. Freitas Junior, H.S.
Monteiro & E. Barbieri. 2013. Ictiofauna acompanhante na pesca artesanal do camarão sete barbas
(Xiphopenaeus kroyeri) no litoral sul do Brasil. Biota
Neotrop., 13(1): 1:11.
Severino-Rodrigues, E., D.S.F. Guerra & R. Graça-Lopes.
2002. Carcinofauna acompanhante da pesca dirigida
ao camarão-sete-barbas (Xiphopenaeus kroyeri)
desembarcada na Praia do Perequê, Estado de São
Paulo, Brasil. Bol. Inst. Pesca, 28(1): 33-48.
Shannon, C.E. & W. Weaver. 1949. The mathematical
theory of communication. University Illinois Press,
Urbana, 117 pp.
Schettini, A.C. 2002. Caracterização física do estuário do
Rio Itajaí-Açu, SC. Rev. Bras. Recur. Hídr., 7: 123142.
Suguio, K. 1973. Introdução à sedimentologia. Editora da
Universidade de São Paulo, São Paulo, 317 pp.
Teoh, H.W., M.S.H. Hussein & V.C. Chong. 2014.
Influence of habitat heterogeneity on the assemblages
and shell use of hermit crabs (Anomura: Diogenidae).
Zool. Stud., 53(67): 1-9.
Thorson, G. 1950. Reproductive and larval ecology of
marine invertebrates. Biol. Rev. Camb. Philos. Soc.,
25: 1-45.
Tucker, M. 1988. Techniques in sedimentology.
Blackwell Scientific Publications, Oxford, 394 pp.
Wallace, B.P., C.Y. Kot, A.D. Di Matteo, T. Lee, L.B.
Crowder & R.L. Lewison. 2013. Impacts of fisheries
bycatch on marine turtle populations worldwide:
toward conservation and research priorities. Ecosphere,
4(3): 40.
Wenner, E.L., D.M. Knott, R.F. Van Dolah & V.G. Jr.
Burrell. 1983. Invertebrate communities associated
with hard bottom habitats in the South Atlantic Bight.
Estuar. Coast. Shelf Sci., 17: 143-158.
Received: 15 July 2015; Accepted: 22 April 2016
556
11
Ye, Y., K.L. Cochrane, G. Bianchi, R. Willmann, J.
Majkowski & M.T.F. Carocci. 2012. Rebuilding
global fisheries: the world summit goal, costs and
benefits. Fish. Fish., 14(2): 174-185.
Zar, J.H. 1999. Biostatistical analysis. Prentice-Hall, New
Yersey, 663 pp.
Lat. Am. J. Aquat. Res., 44(3): 557-568, 2016
Diatom from the Caribbean as food for native scallops
557
Research Article
Isolation, culture and evaluation of Chaetoceros muelleri from the Caribbean
as food for the native scallops, Argopecten nucleus and Nodipecten nodosus
Luz Adriana Velasco1, Silvia Carrera1 & Judith Barros1
Laboratorio de Moluscos y Microalgas, Universidad del Magdalena
Taganga, Santa Marta, Colombia
Corresponding author: Luz A. Velasco (molmarcol@gmail.com)
ABSTRACT. The potential of the Caribbean strain Chaetoceros muelleri (CHA-C-04) to be produced and used
as diet of two commercially important native scallops (Argopecten nucleus and Nodipecten nodosus) was
assessed, using the non-indigenous Chaetoceros calcitrans strain, as a control. Growth and biomass of both
diatoms were compared under different culture environments (indoor and outdoor) and culture media (F/2,
organic fertilizer triple 15 and humus extract). In addition, their bromatological composition and effect on the
physiological condition of the scallops fed with both diatoms were compared. The growth and biomass
production of C. muelleri and C. calcitrans were higher under indoor conditions and using the F/2 media.
Although the content of proteins, lipids and energy was higher in C. muelleri than in C. calcitrans, its size,
organic content, growth and biomass values were not different. Scallops fed with both diatoms strains shows
similar values for all of the physiological variables measured, including rates of absorption, oxygen
consumption, ammonia excretion and scope for growth. Results suggest that the local strain C. muelleri can be
successfully produced and used in the diet of A. nucleus and N. nodosus, but do not offer productive advantages.
Keywords: Chaetoceros, bivalves, physiology, nutritive value, microalgae culture, aquaculture.
Aislamiento, cultivo y evaluación de Chaetoceros muelleri del Caribe como alimento
para los pectínidos nativos, Argopecten nucleus y Nodipecten nodosus
RESUMEN. Se evalúa el potencial de la cepa del Caribe Chaetoceros muelleri (CHA-C-04) para ser producida
y utilizada como dieta de dos pectínidos nativos de importancia comercial (Argopecten nucleus y Nodipecten
nodosus) usando la cepa foránea Chaetoceros calcitrans como control. El crecimiento y biomasa de ambas
diatomeas se compararon en diferentes ambientes (interior y exterior) y medios de cultivo (F/2, fertilizante
orgánico triple 15 y extracto de humus). Además, se comparó su composición bromatológica y efecto sobre la
condición fisiológica de los pectínidos alimentados con ambas diatomeas. El crecimiento y la producción de
biomasa de C. muelleri y C. calcitrans fueron superiores en ambientes cerrados y usando el medio F/2. Aunque
el contenido de proteínas, lípidos y energía fue mayor en C. muelleri que en C. calcitrans, sus valores de tamaño,
contenido orgánico, crecimiento y biomasa no fueron diferentes. Los pectínidos alimentados con ambas cepas
presentaron valores similares para todas las variables fisiológicas medidas, incluyendo las tasas de absorción,
consumo de oxígeno, excreción de amonio y crecimiento potencial. Los resultados sugieren que la cepa local C.
muelleri puede ser producida con éxito y utilizada en la dieta de A. nucleus y N. nodosus, pero no ofrece ventajas
productivas.
Palabras clave: Chaetoceros, bivalvos, fisiología, valor nutritivo, cultivo de microalgas, acuicultura.
INTRODUCTION
Alive planktonic diatoms are essential components in
the diets supplied to bivalve mollusks in hatchery
conditions (Albentosa et al., 1997; Ponis et al., 2003).
Among the most used and nutritive diatoms are Chae_____________________
Corresponding editor: Mauricio Laterça
toceros calcitrans (Paulsen) Takano and C. muelleri
Lemmermann 1898 (Brown et al., 1997; MartínezFernández et al., 2004; Cerón-Ortiz et al., 2009; Liu et
al., 2009; Petersen et al., 2010; Ragg et al., 2010),
which have been isolated from the eastern Pacific or the
north-eastern Atlantic, respectively. Those strains are
558
commonly imported by the hatcheries around the
world, which could present some problems such as the
risk of species introduction into natural ecosystems (De
Pauw et al., 1984; Andersen & Kawachi, 2005), lower
production parameters due to lack of adaptation to local
environmental conditions (Andersen & Kawachi, 2005)
and/or lesser nutritional quality for the local bivalves
(Brown et al., 1998; Gouda et al., 2006).
Argopecten nucleus and Nodipecten nodosus are
two Caribbean commercially important scallop species
which have been produced in hatchery using as food the
traditional strains C. calcitrans and Isochrysis galbana
(Velasco, 2008). Nevertheless, higher values of growth
and reproductive conditioning of A. nucleus and N.
nodosus has been obtained in sea suspended culture
instead in hatchery conditions and it has been attributed
to the higher nutritional quality of local microalgae
and/or a higher diversity of food items (Rupp et al.,
2005; Velasco & Barros, 2007, 2009; Velasco, 2008).
Then, the use of local strains as food for the Caribbean
scallops could be more suited considering environmental,
productive and/or nutritional parameters.
Although there are some studies about isolating,
culture and nutritional evaluation of local marine
microalgae strains as food for bivalves (Ewart &
Epifanio, 1981; Brown et al., 1998; Knuckey et al.,
2002; Gouda et al., 2006). Local marine microalgae
strains are not easily available in the Caribbean zone
and there are only a few studies about its isolation
and/or culture (Bermúdez et al., 2002; Angarita &
Sánchez, 2003; Prieto et al., 2005), but there are no
published studies about their nutritional evaluation for
bivalves. In order to use local microalgae strains as
food in aquaculture it is necessary to isolate them and
find ways to produce high biomass using simple and
inexpensive techniques.
Culture media and environment of culture are
among the principal factors affecting the microalgal
growth and the production costs (Coutteau &
Sorgeloos, 1992; Borowitzka, 1999; López-Elías et al.,
2005; Banerjee et al., 2011; Lananan et al., 2013).
There are a variety of suitable culture media, including
enriched seawater media (Walne, 1966; Guillard, 1975;
Harrison et al., 1980) or synthetic media (i.e., ASW,
Algal-1). Nevertheless, their use is highly expensive in
massive microalgae cultures still using commercial
grade reagents (López-Elías & Voltonina, 1993).
Alternative media such as agricultural fertilizers
extracts of soils or macrophytes and/or treated waste
waters have been used with different results (Fabregas
et al., 1987; Sánchez-Saavedra & Voltolina, 1994;
Nieves et al., 1996, 2000; Godínez et al., 2000;
Valenzuela-Espinoza et al., 2002). On the other hand,
in tropical and subtropical countries microalgae may be
grown at indoor conditions, under relatively stable
conditions, or at outdoor environments, under variable
temperature and irradiance conditions, and at a lower
cost (Borowitzka, 1999; López-Elías et al., 2003,
2005).
Direct determination of the microalgae value on the
reproductive conditioning and/or growth of bivalves
require numerous long-term experiments which place
important demands on physical facilities, time, labor,
and economic resources. The use of physiological
measurements is an alternative method for estimating
comparative value among diets, with greater simplicity
and in less time, as well as providing more information
on the factors responsible of the organism's responses
(Widdows, 1985a). The scope for growth is very
precise and sensible index of stress conditions when the
measurements are made carefully (Widdows, 1985a;
Grant & Cranford, 1991) which is positively correlated
with the bivalve growth rate (Bayne et al., 1979;
Riisgård & Randløv, 1981) and gonadic ripeness
(MacDonald & Bourne, 1987; Navarro et al., 2000).
This index has been used successfully in A. nucleus and
N. nodosus in order to select the appropriate
temperature and diet hatchery conditions (Velasco,
2006, 2007).
This study was performed in order to evaluate the
value of a Colombian Caribbean microalgae strain to be
used as live food for native commercially important
scallops. First, the strain C. muelleri Lemmermann,
1898 (CHA-C-04) was isolated in the Colombian
Caribbean. Then, its growth and biomass production
were assessed under different culture conditions, using
the traditional strain, C. calcitrans, as a control. Finally,
we analyze their bromatological composition and
compared the physiological responses of the scallops,
A. nucleus and N. nodosus, fed with both microalgal
strains.
Microalgae isolation
The local microalgae strain were obtained from
phytoplankton samples, extracted on March 24 2004
(2-4 pm), by means of 3 sub-superficial haulages with
a mesh of 56 µm in the Bay of Taganga, Santa Marta,
Colombia (11°16′03″N, 74°11′24″W). In this region
water temperatures are between 26 and 31ºC, salinities
between 32 and 36 (Velasco & Barros 2007, 2009;
Velasco et al., 2009a). Phytoplankton samples were
located in 200 mL flasks and translated to the
Laboratorio de Moluscos y Microalgas of the
Universidad de Magdalena, Taganga (11°16’03”N,
74°11’24”W). They were diluted with microfiltered
water (1 µm), sieved using 10 µm mesh sizes, enriched
with the culture media F/2 (Guillard, 1975), maintained
indoor in glass flasks (500 mL) with constant
fluorescent illumination (45 µmol quanta m-2 s-1), at
24ºC and salinity of 35. The diatom, C. muelleri, was
isolated after 45 days of this mixed cultivation using the
techniques of serial dilutions and streaking in plates
(Guillard, 1973; Hoshaw & Rosowski, 1973). Scanning
electron microscopy (SEM) was used to identify the
diatom isolated. Three samples of C. muelleri cultures
(10 mL) were concentrated and rinsed with a tamponed
sodium phosphate solution (pH = 7.3) by centrifugation. Samples were fixed adding aldehyde glutamate
(2.5%). Fixed cells were rinsed with distilled water,
dehydrated in ethanol (30, 50, 70 and 100%) and
mounted on stubs. Mounted samples were dried by
critical point drying and sputter coated with gold before
viewing using a FEI SEM Quanta 200-r. Diatom
species were identified following the keys in Hustedt
(1930) and Rines & Hargraves (1988). The C.
calcitrans (Paulsen) strain was obtained from the
Centro de Investigaciones Biológicas del Noroeste
(CIBNOR), México.
Microalgae culture experiments
A factorial culture experiment (2x2x3) was done with
two microalgal strains: a) Caribbean strain, C. muelleri,
and b) traditional strain, C. calcitrans; testing two
culture environments: a) indoor at 24 ± 0.5ºC, and b)
outdoor at 28 ± 2ºC; and three culture media: a)
Guillard f media (F/2; Guillard 1975), b) triple 15 (T15;
Nutrimon®, Monomeros, Colombia), and c) humus
extract (H; Nutrimon®, Monomeros, Colombia). All of
those 12 treatments were realized by triplicate using
200 mL glasses containers, water at 35 of salinity,
compressed air injected and constant fluorescent
illumination of 45 µmol quanta m-2 s-1 and initial
density of 0.6x103 cell µL-1. The outdoor treatments
were exposed to the same conditions, excepting at the
daytime, when artificial lighting were replaced by the
solar irradiance, with values as high as 160 µmol quanta
m-2 s-1. Appropriated quantities of T15 and H were
diluted in distilled water, sterilized (15 PSI per 60 min)
and microfiltered (1 µm), in order to prepare the stock
solutions for media culture with the same total nitrogen
of the F/2 stock solution (75 mg L-1; Guillard, 1975).
The composition of each medium is presented in Table
1.
The same parental exponential phase culture
maintained in the experimental conditions for two
generations was used as inoculums in each one of the
treatments. Cellular density was determined daily from
three samples (1 mL) collected at the same hour (4 pm)
from each of the replica after homogenization. Optical
analysis was performed using a Neubaeur plate (0.1
mm of deep) under a microscope.
559
Table 1. Composition of media cultures tested. Guillard
f media (F/2; Guillard, 1975), triple15 (T15; Nutrimon®,
Monomeros) and humus extract (H; Nutrimon®,
Monomeros).
Constituents
Formula
Sodium nitrate
Ammonia nitrogen
Nitric nitrogen
Sodium phosphate
Phosphoric oxide
Potassium
Potassium oxide
Sodium silicate
Cupric sulfate
Zinc sulfate
Cobalt chloride
Manganese chloride
Sodium molybdate
Ferric chloride
Disodium EDTA
Biotin
Cyanocobalamin
Thiamine
Magnesium
Boron
NaNO3
NH4+
NO3NaH2PO4
P2O5
K
K2O
Na2SiO3
CuSO4.5H2O
ZnSO4.7H2O
CoCla.6H2O
MnCl2.4H2O
Na2MoO4.2H2O
FeCl3.6H2O
Na2EDTA
C10H16N2O3S
C63H58CoN14P
C12H17CIN4OS
Mg
B
Relation N:P
F/2 (%) H (%) T15 (%)
63.69
4.25
-
40.10
5.15
33.70
25.48
0.01
0.02
0.01
0.149
0.01
2.65
3.70
0.001
0.01
0.02
15:1
20.45
0.6
8:1
22.90
10.44
33.33
33.33
1:1
D (cel mL-1) = FD x C x 10,000 mL-1
where D: cell density, DF: dilution factor and C: media
number of cells in each quadrant.
Culture volume lost in each replica by effect of
sampling and evaporation was replaced daily with
distilled and sterilized water. Specific growth rate (K)
was calculated using the equation proposed by Fogg
(1965):
K = (LnNf - LnNi) / t
where N is the initial (i) and final (f) cellular density
and t is the duration of the culture until the stationary
phase.
Dry biomass of each replica was determined from a
daily culture sample (10 mL) filtered on a glass fiber
filter (1.5 µm) and dried at 70ºC for 24 h, following the
gravimetric method described by Strickland & Parsons
(1972).
Microalgae characterization
Bromatological composition of both diatoms were
determined from triplicate cultures (3 L), using F/2
medium, under the same indoor conditions described
above, and using an initial density of 0.2x103 cell µL-1.
Three samples of each microalgae culture (500 mL) in
exponential phase (4 days) were analyzed in terms of cell
diameter by microscopy, total particulate matter (TPM)
and organic content (POM) following the gravimetric
method described by Strickland & Parsons (1972). Each
subsample was filtered on glass-fiber filters (diameter =
0.45 μm; Millipore) which had been previously washed
560
with distilled water, ashed at 450°C for 4 h, and weighed.
The filtrate was washed with 3% ammonium formate,
dried at 70°C for 48 h, and weighed; and finally the
filters were ashed at 450°C for 4 h and re-weighed.
Protein quantification was carried out according to
Lowry et al. (1951), total lipids using the protocol of
Dubinsky (1979) and total carbohydrates was calculated
from the difference between organic matter and the sum
of protein and lipid content (AOAC, 1995). The
energetic content of the diets was estimated from three
samples (0.5 g dry weight) of each strain using a microcalorimeter (IKA® C200, precision 0.0001 J mg-1).
Bivalve physiological measurements
About 30 specimens of Argopecten nucleus (length 40
 0.1 mm and dry tissue weight 0.93  0.2 g) and 30
specimens of Nodipecten nodosus (length 83 + 0.8 mm
and dry tissue weight 5.55 + 1.6 g) were obtained at the
INVEMAR bivalve culture station at Neguanje Bay
(11º20’N, 74.05’W), in the Tayrona National Natural
Park (PNNT), Colombia. The scallops were transported
in humid condition to the Laboratorio de Moluscos y
Microalgas where their shells were cleaned of encrustations and each individual was marked for identification. Acclimation to laboratory conditions was
achieved by holding the scallops in an aerated 250 L
seawater tank for one week at 25°C and salinity of 36,
while feeding them a microalgal suspension of
laboratory-cultured Isochrysis galbana and C.
calcitrans (1:1) at a rate of 3% (dry biomass) of their
dry body weight daily.
Two dietary treatments with monoalgal cultures of
C. muelleri and C. calcitrans were tested. Each
experimental diet was administered under constant
conditions of temperature (25°C), salinity (35), and
microalgae concentration, a number of cells equivalent
to 4.36 ± 0.08 mg L-1 of dry weight (17.3 ± 0.4x106 cells
of C. calcitrans per mL and 13.1 ± 0.7x106 cells of C.
muelleri per mL). Seven test scallops were selected
haphazardly for each feeding trial, and the trials were
run for 15 h, which included 12 h for feeding
determinations and 2 h for the oxygen consumption and
excretion measuring.
The experimental diets were administered using a
flow-through system consisting of 16 chambers (0.8 L
for A. nucleus and 1.6 L for N. nodosus), designed
following Riisgård (1977). A constant flow (150 ± 10
mL min-1) of the experimental diet was directed by
gravity from a mixing tank into each chamber; 14
chambers were used for individual bivalves (7
individuals of each species) and two chambers
contained empty valves which served as controls.
Valve opening by test specimens was continually
observed and individuals which failed to open normally
were eliminated from the experiment.
The experimental diets were prepared by mixing
appropriate volumes of 1 μm microfiltered seawater
and microalgae which had been cultured in Guillard F/2
medium (Guillard, 1975) at 24ºC and the conditions of
light and salinity previously described, and used in the
exponential phase.
The absorption rate (AR) was determined by the
biodeposition method described by Iglesias et al.
(1998), validated by Navarro & Velasco (2003), using
the ‘flow-through chamber method’ described by
Riisgård (2001). Feces were quantitatively collected
every hour using Pasteur pipettes. The mass and
organic content of the feces produced by each test
bivalve were estimated separately using the gravimetric
method described above for the diet samples.
Oxygen consumption (OCR: mL O2 h-1) and
ammonium excretion (UR: μg NH4-N h-1) of both
scallops were determined for each treatment on just fed
animals by placing them in individual chambers (0.8
and 3 L for A. nucleus y N. nodosus, respectively) after
rinsing the chambers with a 25% HCl and filling with
<1 μm filtered and aired seawater. Chambers were
sealed and incubated for 2 h at the same temperature at
which they were fed, alongside a control chamber
devoid of specimens. Then two water samples were
taken from each experimental chamber to determine
oxygen consumption rates and rates of excretion.
Oxygen consumption was never measured at ambient
oxygen tension lower than 70% saturation. Oxygen
concentration was estimated following the Winkler
method as modified by Carritt & Carpenter (Strickland
& Parsons, 1972) and ammonia excretion was determined by the phenol-hypochlorite method (Widdows,
1985b).
Scope for growth (SFG) was calculated from the
equation given by Widdows (1985a) after converting
all the physiological rates to energy equivalents (J h-1):
SFG (J h-1) = A - (R + U)
where A = energy absorbed (J h-1) = AR mg h-1 x energy
content of each microalgae J mg-1 (Table 2), R =
oxygen consumption (J h-1) = OCR mL O2 x 20.08 J
(Gnaiger, 1983), U = ammonium excretion (J h-1) = UR
mg NH4-N h-1x 24.8 J (Elliot & Davison, 1975).
The physiological rates were converted to a
standard individual of 1 g dry tissue weight and with a
macroscopic gonadal stage of I (immature animals).
For this, the soft tissues were dried at 70°C for 48 h,
and then individually weighed. Standardization
employed the equation of Bayne et al. (1987):
Yst = (1 / We)b x Ye
561
Table 2. Characterization of Chaetoceros muelleri and C. calcitrans and one-way ANOVA analyses results. Values are
means  standard error. Different superscripts indicate significant differences between species.
Chaetoceros calcitrans Chaetoceros muelleri
Particulate organic matter (%)
Size (µm)
Proteins (%)
Lipids (%)
Carbohydrates (%)
Energetic content (J mg-1)
81.4  6.0
5.0  2a
40.3  0.8b
23.0  1.4b
37.0  1.1a
22.9  0.4b
where Yts = standardized physiological rate, Ye = non
standardized physiological rate, We = experimental
animal weight (g), b = dependence of the physiological
rate to the size of the animals. b values used were those
determined previously for the studied scallops
(Velasco, 2007).
Factorial repeated measures ANOVA was applied to
determine the existence of significant differences of
growth and biomass production of the microalgae
strains among factors (species, media culture and
environment culture). One-way ANOVA analyses were
carried out to compare the bromatological contents of
the microalgae strains as well as the scallop’s
physiological variables fed with both diatoms. Tests for
normality (Kolmogorov-Smirnov) and homoscedasticity (C of Cochran) were carried out on all
dependent variables. Excretion rates were ln transformed, and absorption rates, oxygen consumption rate
and scope for growth were transformed to square roots.
The statistical analyses were carried out following Zar
(1999) considerations and using Statgraphics-plus 5.0®
and IBM SPSS 20 software, with a 0.05 alpha for the
decisions.
RESULTS
Microalgae characterization
Cells of Chaetoceros muelleri (CHA-C-04) are similar
to Chaetoceros calcitrans with rectangular shape in
girdle view and elliptical shape in valve view. But local
strain is slightly larger (between 4 and 9 µm), setae are
longer (two times the pervalvar length) and straighter.
C. muelleri presented significantly higher values of
proteins, lipids and energy in comparison with C.
calcitrans, but lower content of carbohydrates. The
organic content, as well as the size of both microalgae
were statistically similar.
Microalgae culture experiment
C. muelleri cultures with initial values of 0.6x103 cell
µL-1 and 0.3 mg mL-1 obtained densities as high as
a
79.7  12.0
5.5  1.5a
59.0  0.9a
31.0  1.3a
10.0  0.9b
25.1  0.3a
a
F
P
0.04
0.99
17.31
23.06
32.80
58.08
0.8427
0.3500
0.0141
0.0086
0.0000
0.0016
8.7x103 cell µL-1, as well as maximum biomasses of 3.8
mg mL-1, in 6 days (Fig. 1). While C. calcitrans cultures
with initial densities of 0.6x103 cell µL-1 and biomasses
of 0.3 mg mL-1, after 7 days reached values of 8.5x103
cell µL-1 and 3.7 mg mL-1, respectively (Fig. 2).
Specific growth rate (K) was among 0.14 and 0.38 div
day-1 in C. muelleri (Fig. 1), and between 0.07 and 0.32
div day-1 in C. calcitrans (Fig. 2). Excepting in H
treatments, the density and biomass of C. muelleri and
C. calcitrans had an exponential increase along the first
six days of the culture (Figs. 1-2); after that, the values
were stabilized; and finally, they decreased (between
days 7 and 10 of the culture). None of the H treatments
presented any significant increment in density nor in
biomass (P = 1.00).
Repeated measures ANOVA analyses showed that
the density and biomass of C. muelleri and C. calcitrans
(df = 1; F = 0.33; P = 0.5765) were statistically similar.
Additionally, they demonstrated a significant effect of
the culture environment (df = 1; F = 13.33; P = 0.0011)
and media (df = 2; F = 39.36; P = 0.0000), and the
interaction of both factors on the growth parameters.
The density and biomass of C. muelleri maintained in
F/2 were significantly higher than those of the other
media (P < 0.001); while the values presented in the H
media were significantly lower (P < 0.001). Both
species growth was significantly higher under indoor
conditions in comparison with outdoor treatments (P <
0.003), except in the humus as well as in the C. muelleri
with T15 treatments, where the culture environments
did not affect growth parameters (P > 0.063).
Bivalve physiological analysis
The AR of Argopecten nucleus and Nodipecten
nodosus were between 6.1 and 20.6 mg h-1 g-1 (Fig. 3a),
OCR among 0.54 and 1.95 mL O2 h-1 g-1 (Fig. 3b), and
UR varied between 126.3 and 296.7 μg NH3-H h-1 g-1
(Fig. 3c). SFG values were between 107.1 and 456.2 J
h-1 g-1 (Fig. 3d). The type of microalgae strain does not
have a significant effect over the AR (df = 1; F = 0.02;
P > 0.8962), OCR (df = 1; F = 3.68; P = 0.0686), UR
(df = 1; F = 1.37; P = 0.2543) and SFG (df = 1; F =
0.01; P = 0.9437).
562
Figure 1. a) Growth in cell density and b) Biomass production of Chaetoceros muelleri cultured under different
environment and culture media. F/2: Guillard f media, T15: triple15 (Nutrimon®, Monomeros, Colombia), H: humus extract
(Nutrimon®, Monomeros, Colombia) and K: growth rate values. Values are means  standard error.
Figure 2. a) Growth in cell density and b) Biomass production of Chaetoceros calcitrans cultured under different
environment and culture media. F/2: Guillard f media, T15: triple15 (Nutrimon®, Monomeros, Colombia), H: humus extract
(Nutrimon®, Monomeros, Colombia) and K: growth rate values. Values are means  standard error.
DISCUSSION
The higher growth of the local strain Chaetoceros
muelleri cultured with the F/2 media in comparison
with organic fertilizers (T15 and H) agrees with the
results obtained in some studies (Newmark et al., 1988;
Voltolina et al., 1998; González et al., 1999; Godinez
et al., 2000; Prieto et al., 2005), but contradicts the
positive results obtained with of organic fertilizers in
other studies (Nieves et al., 1996; Valenzuela-Espinoza
et al., 2002, 2005; Piña et al., 2007). The lack of
micronutrients and/or the low values of N:P in the orga-
563
Figure 3. Physiological responses of Argopecten nucleus and Nodipecten nodosus feed with Chaetoceros calcitrans and
Chaetoceros muelleri. a) Absorption rate, b) oxygen consumption rate, c) ammonium excretion rate, and d) scope for
growth. Values are means  standard error.
nic fertilizers media (Table 1) could limit the
photosynthesis and/or growth of both microalgae as
have been reported previously in phytoplankton
(Menzel & Ryther, 1961) and benthic microalgae
(Hillebrand & Soomer, 1999). According to Takeda
(1970) and Khoi et al. (2006), the optimal N:P value for
Chaetoceros calcitrans growth is among 12 and 23. In
this study, the F/2 treatments had a similar ratio at the
beginning of the experiment, but the N:P values of H
and T15 treatments were lower (Table 1). These results
suggest that the organic fertilizers media tested are
inappropriate for the production of the diatoms strains
studied.
The lower growth values densities and biomass
production of C. muelleri under F/2 and outdoor
conditions contradicts similar studies results (LópezElías et al., 2005; Banerjee et al. 2011) and the positive
effect of high values of temperature and lighting on the
tropical microalgae growth reported before (Rhee &
Gotham, 1981; Bermúdez et al., 2002; Renaud et al.,
2002; Velasco et al., 2009b; Hemalatha et al., 2012).
Considering that microalgal growth is affected by light
and thermal acclimation (Karsten et al., 2006; Staehr &
Birkeland, 2006), it is possible that the two generations
of previous microalgae exposition to the outdoor
conditions were insufficient. So, the higher values of
temperature and lighting under outdoor conditions
could cause lower uptake of nutrients and/or photoinhibition as has been previously reported (Durbin,
1974; Vonshak & Guy, 1992; Singh et al., 2015), in
addition, microalgae cultures under outdoor conditions
are more exposed to bacteria and protozoa
contamination (Hu & Gao, 2006; Sandnes et al., 2010),
increasing the resource competence (Grossart, 1999)
and the energetic costs for antimicrobial agents
production (Fukami et al., 1997, Steinberg et al., 1997;
Gross, 2003). On the other hand, the low and similar
densities and biomass production of C. muelleri at
indoor and outdoor conditions with organic fertilizers,
suggests that under suboptimal media culture
conditions, the culture environment is not important.
Then, if the use of F/2 media culture and/or indoor
facilities is not economically feasible, C. muelleri can
be produced under outdoor conditions and using T15
media, obtaining around the half of the production
showed in the optimal conditions.
The similar or higher cell and biomass production
values of C. muelleri compared with C. calcitrans in
this study and with those reported for the species and
genera in other studies performed without the injection
of CO2 (Table 3), indicates that the local strain can be
produced using the same standard microalgae culture
techniques.
Despite the higher protein, lipid and energy content
of C. muelleri compared to C. calcitrans, the physiological rates of Argopecten nucleus and Nodipecten
nodosus fed with these two diatoms were not different.
Similar results have been reported for the physiological
variables and/or growth of bivalves fed with microalgae
strains from the same genus such as Isochrysis (Ewart
& Epifanio, 1981) and Chaetoceros (Velasco, 2007) or
564
geographical origin (Brown et al., 1998). However,
other studies have found that growth and/or survival
variables of bivalves are higher when fed with some
local algae strains such as Crassostrea gigas fed with
Pavlova pinguis (Brown et al., 1998), Attheya
septentrionalis, and Entomoneis cf punctulata (Knuckey
et al., 2002) isolated in Australia, Placopecten
magellanicus fed with Navicula pelliculosa, Chaetoceros septentrionalis and Prymnesium sp. isolated in
Canada (Gouda et al., 2006). Those results are
apparently related to their higher content of some polyunsaturated fatty acids, proteins and/or carbohydrates.
Our results suggest that C. muelleri and C. calcitrans
have similar nutritive values for A. nucleus and N.
nodosus and that the protein, lipid and/or energetic
content of these strains did not affect the scallops’
physiological performance.
The higher somatic and gonadic growth values
reported previously for A. nucleus and N. nodosus
under sea suspended culture in comparison with those
maintained in hatchery conditions (Rupp et al., 2005;
Velasco & Barros, 2007, 2009) do not appear be related
with the presence of local microalgae such as C.
muelleri in the diet. Other studies that have compared
the nutritional value of local and traditional microalgae
strains in bivalves have found different results. Brown
et al. (1997) found that juveniles of C. gigas have a
higher growth rate when fed with the local microalga P.
pinguis in comparison with the non-indigenous strain,
Isochrysis sp., similar results were obtained by Gouda
et al. (2006) in P. magellanicus fed with local strains.
On the other hand, Knuckey et al. (2002), obtained
higher growth of C. gigas fed with the non-indigenous
Thalassiosira pseudonana than when it was fed with
the local algae Attheya septentrionalis and Entomoneis
cf punctulata. Our results suggest that the nutritive
value of the diatoms studied to be used as native
scallops food does not be related to their geographical
origin.
In conclusion, higher growth and biomass of the
local strain C. muelleri were obtained using the F/2
media under indoor conditions as well as was verified
in the traditional strain C. calcitrans. Both microalgae
can be produced and used as feed for scallops with
similar performance in microalgal growth, biomass
production and scallops physiological condition. Then,
C. muelleri could be produced and used as food for the
Caribbean scallops, avoiding the microalgae
importation and introduction risk of exotic species into
the natural ecosystems, but do not offer any productive
advantage.
ACKNOWLEDGEMENTS
The authors thanks L.A. Vidal, S. Sánchez, D. Vega,
W. Barbosa, A. Barreto and E. Acosta for their help
during the microalgae isolation and culture experiments. Finally, we thank B. Eizaga and S. Sarkis for
their language and editorial corrections. This study was
supported by University of Magdalena, projects
FONCIENCIAS 012-2013 and 013-2011.
REFERENCES
Albentosa, M., A. Pérez-Camacho, U. Labarta & M.J.
Fernández-Reiriz. 1997. Evaluation of freeze-dried
microalgal diets for the seed culture of Ruditapes
decussatus using physiological and biochemical
parameters. Aquaculture, 154: 305-321.
Andersen, R.A. & M. Kawachi. 2005. Traditional
microalgae isolation techniques. In: R.A. Andersen
(ed.). Algal culturing techniques. Academic Press,
New York, P: 83-99.
Angarita, R.C. & G.E. Sánchez. 2003. Efecto de la
temperatura, salinidad y medio de cultivo en el
crecimiento de Cyclotella glomerata (Bacillariophyceae), proveniente de la Ciénaga grande de
Santa Marta (CGSM), Caribe colombiano. X
Congreso Latinoamericano de Ciencias del Mar, Santa
Marta, pp: 1-6.
Association of Official Analytical Chemist (AOAC).
1995. Official methods of analysis. The Association of
Official Analytical Chemist, Arlington, 1234 pp.
Banerjee, S., W. Hew, H. Khatoon, M. Shariff & F.
Yusoff. 2011. Growth and proximate composition of
tropical marine Chaetoceros calcitrans and Nannochloropsis oculata cultured outdoors and under
laboratory conditions. Afr. J. Biotechnol., 10(8): 13751383.
Bayne, B.L., A.J.S. Hawkins & E. Navarro. 1987. Feeding
and digestion by the mussel Mytilus edulis L.
(Bivalvia: Mollusca) in mixtures of silt and algal cells
at low concentrations. J. Exp. Mar. Biol. Ecol., 111: 122.
Bayne, B.L., M.N. Moore, J. Widdows, D.R. Living-Stone
& P. Salked. 1979. Measurement of the individuals to
environmental stress and pollution: studies with
bivalve mollusks. Philos. T. R. Soc. Biol. Lond. B,
286: 563-581.
Bermúdez, J.L., C. Lodeiros & E. Morales. 2002.
Producción de biomasa de la microalga marina
Chroomonas sp. en función del pH, intensidad
luminosa y salinidad. Bol. Invemar, 31: 167-182.
Borowitzka, M.A. 1999. Commercial production of
microalgae: ponds, tanks, tubes and fermenters. J.
Biotechnol., 70: 313-321.
Brown, M.R., M. McCausland & K. Kowalski. 1998. The
nutritional value of four Australian microalgal strains
fed to Pacific oyster Crassostrea gigas spat.
Brown, M.R., S.W. Jeffrey, J.K. Volkman & G.A.
Dunstan. 1997. Nutritional properties of microalgae
for mariculture. Aquaculture, 151: 315-331.
Cerón-Ortiz., A., B. Cordero, B. Arredondo-Vega & D.
Voltonina. 2009. Effect of algal diet and temperature
on survival, growth and biochemical composition of
spat of the lion's paw scallop Nodipecten subnodosus.
Coutteau, P. & P. Sorgeloos. 1992. The use of algal
substitutes and the requirement for live algae in the
hatchery and nursery rearing of bivalve mollusks: an
international survey. J. Shellfish Res., 11: 467-476.
De Castro, S. & G. Tavano. 2005. Growth and biochemical composition of the diatom Chaetoceros cf.
wighamii Brightwell under different temperature,
salinity and carbon dioxide levels. I. Protein,
carbohydrates and lipids. Aquaculture, 246: 405-412.
De Pauw, N., J. Morales & G. Persoone. 1984. Mass
culture of microalgae in aquaculture systems: progress
and constraints. Hydrobiology, 116: 121-134.
Durbin, H. 1974. Studies on the autecology of the marine
diatom Thalassiosira nordenskioeldii Cleve. 1. The
influence of day length, light, intensity and
temperature on growth. J. Phycol., 10: 220-225.
Dubinsky, Z. 1979. Increase of lipid yields from some alga
by acid extraction. Phytochemistry, 18: 51-52.
Elliot, S.M. & W. Davison. 1975. Energy equivalents of
oxygen consumption in animal energetics. Oecologia,
19: 195-201.
Ewart, J.W. & C.E. Epifanio. 1981. A tropical flagellate
food for larval and juvenile oysters, Crassostrea
virginica Gmelin. Aquaculture, 22: 297-300.
Fabregas, J., L. Toribio, J. Abalde, A. Cabezas & C.
Herrero. 1987. Approach to biomass production of the
marine microalgae Tetraselmis suecica (Kylin) Butch
using common garden fertilizer and soil extract as
cheap nutrient supply in batch cultures. Aquacult.
Eng., 6: 141-150.
Fogg, G.E. 1965. Algal cultures and phytoplankton
ecology. University of Wisconsin Press, Wisconsin,
1266 pp.
Fukami, K., T. Nishijima & Y. Ishida. 1997. Stimulative
and inhibitory effects on bacteria on the growth of
microalgae. Hidrobiologia, 358: 185-191.
Gnaiger, E. 1983. Calculations of energetic and
biochemical equivalents for respiratory oxygen
consumption. In: E. Gnaiger & H. Forstner (eds.).
Polarographic oxygen sensor. Springer, Berlin, pp.
337-345.
565
Godínez, D., D. Voltolina, M. Nieves & P. Piña. 2000.
Organic fertilizers as nutrient sources for microalgae
cultures. Riv. Ital. Acquacolt., 35: 75-80.
González, B., E. Buitrago & K. Frontado. 1999.
Evaluación de medios nutritivos para el crecimiento de
tres microalgas marinas de uso común en acuicultura.
Fundación la Salle Ciencias Naturales, 151: 75-84.
Gouda, R., E. Kenchington, B. Hatcher & B. Vercaeme.
2006. Effects of locally-isolated micro-phytoplankton
diets on growth and survival of sea scallop
(Placopecten magellanicus) larvae. Aquaculture, 259:
169-180.
Grant J. & P.J. Cranford. 1991. Carbon and nitrogen scope
for growth as a function of diet in the sea scallop
Placopecten magellanicus. J. Mar. Biol. Assoc., 71:
437-450.
Gross, E. 2003. Allelopathy of aquatic autotrophs. Crit.
Rev. Plant. Sci., 22: 313-339.
Grossart, H.P. 1999. Interactions between marine bacteria
and axenic diatoms (Cylindrotheca fusiformis,
Nitzschia laevis, and Thalassiosira weissflogii)
incubated under various conditions in the lab. Aquat.
Microbiol. Ecol., 19: 1-11.
Guillard, R.R.L. 1973. Division rates. In: J.R. Stein (ed.).
Handbook of phycological methods, culture methods
and growth measurements. Cambridge University
Press, Cambridge, pp. 289-312.
Guillard, R.R.L. 1975. Culture of phytoplankton for
feeding marine invertebrates. In: W.L. Smith & M.H.
Chanley (eds.). Culture of marine invertebrate
animals. Plenum Publishing Corporation, NewYork,
pp. 29-60.
Harrison, P.J., R.E. Waters & F.J.R. Taylor. 1980. A
broad spectrum artificial sea water medium for coastal
and open ocean phytoplankton. J. Phycol., 16: 28-35.
Hemalatha, A., P. Karthikeyan, K. Manimaran, P.
Anantharaman & P. Sampathkumar. 2012. Effect of
temperature on the growth of marine diatom,
Chaetoceros simplex (Ostenfeld, 1901) with different
nitrate: silicate concentrations. Asian Pac. J. Trop.
Biomed., 24: 1817-1821.
Hillebrand, H. & U. Soomer. 1999. The nutrient
stoichiometry of benthic microalgal growth: Redfield
proportions are optimal. Limnol. Oceanogr., 44(2):
440-446.
Hoshaw, R.W. & J.R. Rosowski. 1973. Methods for
microscopic algae. In: J.R. Stein (ed.). Handbook of
phycological methods: culture methods and growth
measurements.
Cambridge
University Press,
Cambridge, pp. 53-68.
Hu, H. & K. Gao. 2006. Response of growth and fatty acid
compositions of Nannochloropsis sp. to environmental
566
factors under elevated CO2 concentration. Biotechnol.
Lett., 28: 987-992.
Hustedt, F. 1930. Die Kieselalgen Deutschlands,
Österreichs und der Schweiz. Dr. L. Rabenhorsts
Kryptogamen-Flora von Deutschland, Österreich und
der Schweiz, 7(1): 1-920.
Iglesias, J.I.P., M.B. Urrutia, E. Navarro & L. Ibarrola.
1998. Measuring feeding and absorption in
suspension-feeding bivalves: an appraisal of the
biodeposition method. J. Exp. Mar. Biol. Ecol., 219:
71-86.
Karsten, U., R. Schumann. S. Rothe, I. Jung & L. Medlin.
2006. Temperature and light requirements for growth
of two diatom species (Bacillariophyceae) isolated
from an Arctic macroalga. Polar Biol., 29(6): 476-486.
Khoi, C.M., V.T. Guong & R. Merck. 2006. Growth of the
diatom Chaetoceros calcitrans in sediment extracts
from Artemia franciscana ponds at different concentrations of nitrogen and phosphorus. Aquaculture, 25:
250-269.
Knuckey, R., M. Brown, M. Barretta & G. Hallegraeff.
2002. Isolation of new nanoplanktonic diatom strains
and their evaluation as diets for juvenile Pacific oysters
(Crassostrea gigas). Aquaculture, 211: 253-274.
Lananan F., A. Jusoh, N. Ali, S. Shiung & A. Endut. 2013.
Effect of Conway medium and f/2 Medium on the
growth of six genera of South China Sea marine
microalgae. Bioresource Technol., 141: 75-82.
Liang, Y., J. Beardall & P. Heraud. 2006. Effects of
nitrogen source and UV radiation on the growth,
chlorophyll fluorescence and fatty acid composition of
Phaeodactylum tricornutum and Chaetoceros muelleri
(Bacillariophyceae). J. Photochem. Photobiol. B., 82:
161-172.
Liu, W., C.M. Pearce, A.O. Alabi & H. Gurney-Smith.
2009. Effects of microalgal diets on the growth and
survival of larvae and post-larvae of the basket cockle,
Clinocardium nuttallii. Aquaculture, 293: 248-254.
López-Elías, J.A. & D. Voltolina. 1993. Cultivos
semicontinuos de cuatro especies de microalgas con un
medio no convencional. Cienc. Mar., 19: 169-180.
López-Elías, J.A., D. Voltolina, F. Enríquez-Ocaña & G.
Gallegos-Simental. 2005. Indoor and outdoor mass
production of the diatom Chaetoceros muelleri in a
Mexican commercial hatchery. Aquacult. Eng., 33:
181-191.
López-Elías, J.A., D. Voltolina, C.O. Chavira-Ortega,
B.B. Rodríguez, L.M. Sáenz-Gaxiola, B. CorderoEsquivel & M. Nieves. 2003. Mass production of
microalgae in six commercial shrimp hatcheries of the
Mexican northwest. Aquacult. Eng., 29: 155-164.
Lowry, O.H., J. Rosebrough, A.L. Farr & R.L. Randall.
1951. Protein measurement with the folin phenol
reagent. J. Biol. Chem., 193: 265-275.
MacDonald, B.A. & F. Bourne. 1987. Growth,
reproductive output, and energy partitioning in
weathervane scallop, Patinopecten caurinus from
British Columbia. Can. J. Fish. Aquat. Sci., 44: 152160.
Marín, N., C. Lodeiros & R. Verginelli. 1994. Cultivo de
microalgas y el rotífero Brachionus pliacatilis en gran
escala. Acta Cient. Venez., 45: 226-230.
Martínez-Fernández, E., H. Acosta-Salmo & C. RangelDávalos. 2004. Ingestion and digestion of 10 species
of microalgae by winged pearl oyster Pteria sterna
(Gould, 1851) larvae. Aquaculture, 230: 417-423.
Menzel, D.W. & J.H. Ryther. 1961. Nutrients limiting the
production of phytoplankton in the Sargasso Sea with
especial reference to iron. Deep-Sea Res., 7: 276-281.
Navarro, J.M., G.E. Leiva, G. Martinez & C. Aguilera.
2000. Interactive effects of diets and temperature on
the scope for growth of the scallop Argopecten
purpuratus during reproductive conditioning. J. Exp.
Mar. Ecol., 247: 67-83.
Navarro, J.M. & L.A. Velasco. 2003. Comparison of two
methods for measuring filtration rate in filter feeding
bivalves. J. Mar. Biol. Assoc., 83: 553-558.
Newmark, F., M. Criales & J. Blanco. 1988.
Estandarización de seis cepas de microalgas con cuatro
medios de crecimiento. Memorias III Reunión, Red
Nacional de Acuicultura, Cali, pp. 149-161.
Nieves, M., D. Voltolina, J. López-Ruiz, M.A. Cisneros &
P. Piña. 2000. Cultivo de microalgas marinas con
medios enriquecidos con productos de naturaleza
zeolítica. Hidrobiológica, 10(1): 1-6.
Nieves, M., D. Voltolina, M.T. Sapién, H. Gerhardus,
A.L. Robles & M.A. Villa. 1996. Culturing microalgae
with agricultural fertilizers. Riv. Ital. Acquacolt., 31:
81-84.
Pernet, F., R. Tremblay, E. Demersc & M. Roussy. 2003.
Variation of lipid class and fatty acid composition of
Chaetoceros muelleri and Isochrysis sp. grown in a
semicontinuous system. Aquaculture, 221: 393-406.
Pettersen, A., M. Giovanni, S. Jahangard, A. Brett, B.
Ingram & D.H. Craig. 2010. Effects of different
dietary microalgae on survival, growth, settlement and
fatty acid composition of blue mussel (Mytilus
galloprovincialis) larvae. Aquaculture, 309: 115-124.
Piña, P., A. Medina, M. Nieves, S. Leal, J. López-Elías &
M. Guerrero. 2007. Cultivo de cuatro especies de
microalgas con diferentes fertilizantes utilizados en
acuicultura. Rev. Invest. Mar., 28(3): 225-236.
Ponis, E., R. Robert & G. Parisia. 2003. Nutritional value
of fresh and concentrated algal diets for larval and
juvenile Pacific oysters (Crassostrea gigas) Aquaculture, 221: 491-505.
Prieto, M.J., M.J. Mogollón, A.L. Castro & L.A. Sierra.
2005. Efecto del medio y condiciones de cultivo en la
productividad de tres diatomeas marinas con potencial
acuícola. Facultad de Medicina Veterinaria y Zootecnia, Universidad de Córdoba, Córdoba, pp. 544554.
Ragg, L.C., N. King, E. Watts & J. Morrish. 2010.
Optimising the delivery of the key dietary diatom
Chaetoceros calcitrans to intensively cultured
Greenshell™ mussel larvae, Perna canaliculus.
Renaud, S.M., L.V. Thinh & D. Parry. 1999. The gross
chemical composition and fatty acid composition of 18
species of tropical Australian microalgae for possible
use in mariculture. Aquaculture, 170: 147-159.
Renaud, S.M., L.V. Thinh, G. Lambrinidis & D.L. Parry.
2002. Effect of temperature on growth, chemical
composition and fatty acid composition of tropical
Australian microalgae grown in batch cultures.
Rhee, G.Y. & I.J. Gotham. 1981. The effect of
environmental factors on phytoplankton growth:
temperature and the interactions of temperature with
nutrient limitation. Limnol. Oceanogr., 26(4): 635648.
Riisgård, H.U. 1977. On measurements of the filtration
rates in suspensions-feeding bivalves in a flow system.
Ophelia, 16: 167-173.
Riisgård, H.U. 2001. On measurement of filtration rates in
bivalves-the stony road to reliable data: review and
interpretation. Mar. Ecol. Prog. Ser., 211: 275-291.
Riisgård, H.U. & A. Randløv. 1981. Energy budgets,
growth and filtration rates in Mytilus edulis at different
algal concentration. Mar. Biol., 61: 227-234.
Rines, J.E.B. & P.E., Hargraves, 1988. The Chaetoceros
Ehrenberg (Bacillariophyceae) flora of Narragansett
Bay, Rhode Island, U.S.A. Bibl. Phycol., 79: 1-196.
Rupp, G., J. Parsons, R. Thompson & M. Bem. 2005.
Influence of environmental factors, season and size at
deployment on growth and retrieval of postlarval
lion’s paw scallop Nodipecten nodosus (Linnaeus,
1758) from a subtropical environment. Aquaculture,
243: 195-216.
Sánchez-Saavedra, M.P. & D. Voltolina. 1994. The
chemical
composition
of
Chaetoceros
sp.
(Bacillariophyceae) under different light conditions.
Comp. Biochem. Physiol. B., 107: 39-44.
Sánchez-Saavedra, M.P. & D. Voltonina. 2006. The
growth rate, biomass production and composition of
Chaetoceros sp. grown with different light sources.
Aquacult. Eng., 35: 161-165.
Sandnes, J.M., J.M.T. Källqvist, D. Wenner & H.R.
Gislerød. 2010. Combined influence of light and
temperature on growth rates of Nannochloropsis
oceanica: linking cellular responses to large-scale
biomass production. J. Appl. Phycol., 17(6): 515-525.
567
Singh, S.P. & P. Singh. 2015. Effect of temperature and
light on the growth of algae species: a review.
renewable and sustainable energy reviews, 50: 431444.
Staehr, P.A. & M.J. Birkeland. 2006. Temperature
acclimation of growth, photosynthesis and respiration
in two mesophilic phytoplankton species. Phycologia,
45(6): 648-656.
Steinberg, P., R. Schneider & S. Kjelleberg. 1997.
Chemical defenses of seaweeds against microbial
colonization. Biodegradation, 8: 211-220.
Strickland, J.D.H. & T.R. Parsons. 1972. A practical
handbook of seawater analysis. J. Fish. Res. Bd. Can.,
167: 310 pp.
Takeda, S. 1970. Influence of iron availability on nutrient
consumption ratio of diatoms in oceanic waters.
Nature, 393: 774-777.
Valenzuela-Espinoza, E., R. Millán-Núñez & F. NúñezCebrero. 2002. Protein, carbohydrate, lipid and
chlorophyll-a content in Isochrysis aff. galbana (clone
T-Iso) cultured with a low cost alternative to the f/2
medium. Aquacult. Eng., 25: 207-216.
Valenzuela-Espinoza, E., F. Lafarga-De la Cruz, R.
Millan-Nuñez & F. Nuñez-Cerebro. 2005. Crecimiento, consumo de nutrientes y composición proximal de Rhodomonas sp. cultivada con medio f/2 y
fertilizantes agrícolas. Cienc. Mar., 31: 79-89.
Velasco, L.A. 2006. Effect of microalgal concentration
and water temperature on the physiology of the
Caribbean scallops Argopecten nucleus and Nodipecten nodosus. J. Shellfish Res., 25(3): 823-831.
Velasco, L.A. 2007. Energetic physiology of the
Caribbean scallops Argopecten nucleus and Nodipecten
nodosus fed with different microalgal diets.
Velasco, L.A. 2008. Acondicionamiento reproductivo de
los pectínidos de interés comercial de Colombia. En:
L.A. Velasco (ed.). Biología y cultivo de los pectínidos
de interés comercial de Colombia. Fondo de
Publicaciones de la Universidad del Magdalena, Santa
Marta, pp. 65-86.
Velasco, L.A. & J. Barros. 2007. Potential for hatchery
broodstock conditioning of the Caribbean scallops
Argopecten nucleus and Nodipecten nodosus.
Velasco, L.A. & J. Barros. 2009. Survival and growth of
hatchery-produced postlarvae and spat of the
Caribbean scallops Argopecten nucleus and
Nodipecten nodosus. Aquacult. Res., 40: 362-375.
Velasco, L.A., J. Barros & A. Guerrero. 2009a. Effect of
the density on the growth and survival of the Caribbean
568
scallops Argopecten nucleus and Nodipecten nodosus in
suspended culture. Aquacult. Res., 40: 687-695.
Velasco, L.A., J. Barros, G.H. Ospina-Salazar & C.
Trujillo. 2009b. Efecto de la intensidad lumínica,
temperatura, y salinidad sobre el crecimiento de la
microalga Isochrysis galbana (clon T-ISO). Intropica,
4: 96-99.
Volkman, J.K., S.W. Jeffrey, P.D. Nichols, G.I. Rogers &
C.D. Garland. 1989. Fatty acid and lipid composition
of 10 species of microalgae used in mariculture. J. Exp.
Mar. Biol. Ecol., 128: 219-240.
Voltolina, D., M. Nieves, G. Navarro, T. Oliva & D.
Peraza. 1988. The importance of acclimation for the
evaluation of alternative media for microalgae growth.
Aquacult. Eng., 19: 7-15.
Vonshak, A. & R. Guy, 1992. Photoadaptation,
photoinhibition and productivity in the blue-green
alga, Spirulina platensis grown outdoors. Plant Cell
Environm., 15: 613-616.
Received: 27 January 2015; Accepted: 26 April 2016
Walne, P.R. 1966. Experiments in the large scale culture
of the larvae of Ostrea edulis L. Fish. In. Min. Fish.
Food, 24(4): 8-14.
Widdows, J. 1985a. Physiological ecology mussel larvae.
Widdows, J. 1985b. Physiological procedures. In: B.L.
Bayne (ed.). The effects of stress and pollution on
marine animals. Praeger, New York, pp. 161-178.
Zar, J. 1999. Biostatistical analysis. Prentince Hall, New
Yersey, 570 pp.
Zhukova, N. & N. Aizdaicher. 1995. Fatty acid
composition of 15 species of marine microalgae.
Phytochemistry, 39: 351-356.
Lat. Am. J. Aquat. Res., 44(3): 569-575,
2016
Efecto de
diferentes frecuencias de alimentación y ayuno en Piaractus brachypomus
569
Research Article
Efecto de diferentes frecuencias de alimentación y ayuno, sobre el crecimiento y
aprovechamiento nutritivo de Piaractus brachypomus (Cuvier, 1818)
José Gómez-Peñaranda1, Lucena Vásquez-Gamboa1 & Diego Valencia1
Grupo de Investigación en Recursos Zoogéneticos, Universidad Nacional de Colombia
Sede Palmira, Valle del Cauca, Colombia
1
Corresponding author: José Gómez-Peñaranda (joagomezpe@unal.edu.co)
RESUMEN. Se analizó una posible utilización práctica del crecimiento compensatorio, sometiendo Piaractus
brachypomus a diferentes frecuencias de alimentación semanal y ayuno. Para este fin, se utilizaron 450
individuos con un peso medio inicial de 20 g dispuestos en cinco tratamientos con tres réplicas. T1 =
alimentación a saciedad 5 días y ayuno de 2 días; T2 = alimentación a saciedad 6 días y ayuno de 1 día; T3 =
alimentación a saciedad 7 días; T4 = Ayuno 14 días y posterior realimentación a saciedad y T5 = alimentación
siguiendo las tablas recomendadas por el fabricante del alimento. Los individuos del tratamiento T1 presentaron
los resultados más bajos de peso final y tasa de crecimiento instantánea, respecto a los tratamientos T2 y T3.
Esto significó que ayunar dos días a la semana influyó negativamente sobre el crecimiento, pero el ayuno de un
día (T2), no lo afectó. La mayor tasa de alimentación diaria se presentó con el tratamiento T4 pero solo con
respecto a T3 y T5, debido a un incremento voluntario de ingestión de alimento tras el periodo de ayuno. Por el
contrario, no observaron diferencias entre los tratamientos T1, T2 y T3, lo que indica que los individuos de los
tratamientos T1 y T2, incrementaron voluntariamente la ingesta tras los días de ayuno igualando la ingesta del
tratamiento T3. La composición corporal de los peces no se afectó por los tratamientos, por lo que, tras la
realimentación, todas las reservas utilizadas durante el ayuno se restablecieron. Los valores de retenciones de
proteína y energía fueron mejores con el tratamiento T5, pues utilizó menor cantidad de alimento y su
crecimiento fue similar al resto de tratamientos. Estos resultados indican que sería posible eliminar la
alimentación en un día pero aumentando la ración durante el resto de la semana. Sin embargo, los resultados del
T5 son relevantes para el cultivo de la especie, ya que el costo de la producción por kilogramo es bajo y la
ganancia neta es mayor.
Palabras clave: Piaractus brachypomus, alimentación, ayuno, crecimiento, acuicultura.
The effect of different feeding and starvation frequencies on growth utilization and
nutrients, for Piaractus brachypomus (Cuvier, 1818)
ABSTRACT. A possible practical use of compensatory growth, subjecting Piaractus brachypomus at different
weekly feeding and fasting frequencies was sought. For this purpose, 450 individuals with an initial average
weight of 20 g, arranged in five treatments with three replicates, were used. T1 = feed to satiation 5 days and
fasting for two days; T2 = feed to satiation 6 days and fasting one day; T3 = feed to satiation 7 days; T4 = fasting
14 days and subsequent feedback to satiety and T5 = power following the manufacturer's recommended food
tables. Individuals of T1 treatment had the final weight and instantaneous growth rate lowest results compared
to T2 and T3. This meant that fast two days a week influenced growth negatively, but the one-day fast (T2), did
not affect it. The daily highest feeding rate was present with treatment T4 but only relative to T3 and T5, due to
a voluntary increase in food intake after the fasting period. By contrast, there were no differences between the
T1, T2 and T3, which indicate that individuals of T1 and T2 treatments, voluntarily increased intake after fasting
days equaling intake T3 treatment. The body composition of the fish was not affected by the treatments, so that
after refeeding, all reserves used during fasting were restored. The values of protein and energy retention were
better with treatment T5, because it used less food and its growth was similar to the other treatments. These
results indicated that feeding could be deleted in one day but increasing ration during the rest of the week.
However, the T5 results are relevant to the cultivation of the species, since the production cost of each kilogram
is low and net profit is higher.
Keywords: Piaractus brachypomus, feeding, fasting, growth, aquaculture.
___________________
570
INTRODUCCION
La tasa de crecimiento de los peces suele estar limitada
por la disponibilidad de alimento en el medio que puede
ser escaso o inexistente (Wootton, 1998; Biler et al.,
2007). Cuando el suministro de alimento se reanuda
después de un período de ayuno o de restricción de
alimento, los peces y otros animales muestran un
crecimiento acelerado que se describe como crecimiento
compensatorio (Jobling, et al., 1994; Ali et al., 2003;
Jobling, 2010). El crecimiento compensatorio puede
manifestarse en diferentes formas como: exceso de
compensación (Hayward et al., 1997), compensación
total (Nikki et al., 2004), compensación parcial (Heide
et al., 2006), o compensación nula (Hayward et al.,
1997). A su vez, es un incremento en la ingesta de
alimento lo que provoca un comportamiento llamado
“hiperfágico” y una mejora en la eficiencia de la
conversión alimenticia en el periodo de restablecimiento
de la alimentación (Russell & Wootton, 1992; Gaylord
& Gatlin, 2001; Eroldogan, 2006a). Sin embargo, otros
autores manifiestan que la respuesta compensatoria del
crecimiento aumenta la ingesta de alimento sin ninguna
mejora en la eficiencia de la conversión del alimento
(Hayward et al., 1997; Nikki et al., 2004; Eroldogan,
2006b). La compensación alimenticia en el periodo de
realimentación es muy variable, dependiendo de la
especie y de la estrategia de alimentación, incluida la
duración e intensidad de la privación del alimento. Un
estudio preliminar en Piaractus mesopotamicus indicó
que esta especie incrementa su tasa de crecimiento
durante el periodo de realimentación posterior a un
ayuno prolongado (Souza et al., 2000). Para entender
este comportamiento, es necesario determinar la ingesta
de alimento y el crecimiento después de un período de
restricción del alimento. Muchos estudios de crecimiento compensatorio en peces han usado una sola fase
de ayuno seguido de una alimentación a saciedad para
obtener una respuesta compensatoria (Dobson &
Holmes, 1984; Paul et al., 1995; Nicienza & Metcalfe,
1997; Egea-Nicolás et al., 2002). Otros estudios han
utilizados ciclos de ayuno y de realimentación a
saciedad para investigar la dinámica del crecimiento
compensatorio (Kindschi, 1988; Jobling et al., 1993;
Henriette et al., 2012; Kocabas et al., 2013). Un
régimen de alimentación posterior a un periodo de
ayuno temporal, se podría utilizar como una estrategia
alimenticia para reducir los costos de producción en
algunas especies de peces (Sung-Yong et al., 2013).
La respuesta del crecimiento compensatorio puede
ser influenciada por la composición de la dieta, el sexo
y estado de madurez del animal, severidad de la
restricción alimentaría, temperatura y salinidad
(Quinton & Blake, 1990; Fernández-Borras et al.,
1995). Rueda et al. (1995), con Pagrus pagrus,
observaron un incremento en la hiperfagia cuando los
periodos de ayuno fueron mayores. En diferentes
especies de salmón se ha conseguido una compensación
total del peso perdido después de un período de ayuno
(30 días), respecto a animales alimentados sin restricción
(Jobling et al., 1994; Nicienza & Metcalfe, 1997).
Egea-Nicolás et al. (2002), estudiaron el comportamiento de Diplodus puntazo sometido a un ayuno de
17 días seguido de un periodo de alimentación de 18
días respecto a un grupo no ayunado. Durante el
periodo de ayuno la tasa específica de crecimiento se
hace negativa, pero tras el periodo de realimentación,
esta tasa se duplica, la tasa de alimentación relativa
aumenta y el índice de conversión mejora con respecto
a los no ayunados. Sin embargo, aunque la evolución
de los pesos a lo largo del experimento puso de
manifiesto la tendencia a la recuperación del peso por
parte de los animales que estuvieron en ayuno, estos no
consiguieron igualar el peso de los no ayunados.
El objetivo del presente estudio fue analizar el
efecto de diferentes frecuencias de alimentación
semanal, alternadas con periodos de ayuno temporal,
sobre una respuesta del crecimiento compensatorio en
Piaractus brachypomus, para determinar un régimen de
alimentación óptimo y rentable.
Se utilizaron 450 individuos de Piaractus brachypomus
con un peso medio de 20 g, distribuidos en 15 estanques
experimentales de 1000 L de capacidad, con 30 peces
por tanque. El estudio se realizó en el Laboratorio
Agropecuario Mario González Aranda de la Universidad
Nacional de Colombia Sede Palmira. El fotoperiodo se
mantuvo en forma natural (12 h/12 h). Las condiciones
del agua en los estanques fueron: 28°C, 6,0 mL -1 de
oxígeno disuelto, nitrógeno amoniacal <0.1 mg L-1 y
recambio total de los estanques cada 4 h en circuito
abierto. El periodo experimental fue de 150 días. Se
definieron cinco tratamientos distribuidos al azar en
quince unidades experimentales, de la siguiente forma:
(1) T1 = alimentación a saciedad durante 5 días y ayuno
de 2 días, (2) T2 = alimentación a saciedad durante 6
días y ayuno de 1 día, (3) T3 = alimentación a saciedad
durante 7 días, (4) T4 = ayuno 14 días a partir del día
28 de inicio del estudio y posterior realimentación a
saciedad, y (5) T5 = alimentación siguiendo la tabla
recomendada por el fabricante del alimento (cuando la
tasa de alimentación diaria era superior a la necesidad
de alimento de los peces, se detenía la alimentación y
el sobrante no se registró como ingerido).
A los peces se les suministró un alimento comercial
con 34% proteína, 8% grasa, 6% fibra, 12% ceniza, y
Efecto de diferentes frecuencias de alimentación y ayuno en Piaractus brachypomus
12% humedad. El alimento se proporcionó manualmente en dos raciones (9:00 y 15:30 h), y se llevó
registro diario de ingesta de alimento. Durante el
periodo experimental, los peces fueron pesados
individualmente en cinco ocasiones, a los 30, 60, 87,
117 y 150 días. Luego de cada muestreo se ajustó
semanalmente la tasa de alimentación para el grupo T5,
de acuerdo al modelo matemático para simular el
crecimiento, Pf = [Pi1/3 + (CCT Suma grados día)]3 ,
donde CCT = [(Pf1/3 - Pi1/3)/Suma grados día] propuesto
por Cho & Bureau (1998). Los parámetros utilizados
para evaluar el crecimiento y el aprovechamiento nutritivo fueron: peso final, tasa de crecimiento instantánea
(TCI), tasa de alimentación diaria (TAD) e índice de
conversión del alimento (ICA). Los análisis de
composición corporal se realizaron siguiendo la
metodología de la AOAC (1990) para materia seca,
cenizas, proteína y grasa bruta. Los resultados del
componente económico fueron analizados mediante el
índice de conversión económica (ICE) e índice de
rentabilidad económica (IRE).
Para comparar los resultados entre los tratamientos
se aplicó un análisis ANOVA con medidas repetidas
empleando como factores el tratamiento y tiempo,
siendo cada réplica la unidad experimental. Se utilizó
el programa estadístico SAS® (Statistical Analysis
System Institute, 2006).
RESULTADOS
En la Figura 1, se observa la evolución de los pesos
medios, alcanzando pesos finales entre 462 y 500 g. La
supervivencia al final del estudio no fue inferior al 95%
en todos los tratamientos, produciéndose las bajas al
inicio del estudio. En la Tabla 1 se muestran los valores
de crecimiento y eficiencia nutritiva al final del estudio.
Tanto el peso final como la TCI presentaron diferencias
significativas, de forma que los individuos alimentados
5 días a la semana y ayuno de 2 días (T1), obtuvieron
el menor valor pero solo respecto a T3; entre los demás
tratamientos no se presentaron diferencias significativas. Los valores más altos de TAD e ICA, se
presentaron en los individuos del T4, los cuales
sufrieron pérdidas promedio de 2,2 g en el periodo de
ayuno de 14 días, esto influyó negativamente sobre el
aprovechamiento alimenticio pero no sobre el
crecimiento al igualar los pesos de los demás
tratamientos. Los mejores valores de ICA se obtuvieron
con el tratamiento T5 que suministraba la tabla de
alimentación recomendada por el fabricante toda la
semana, esta observación se evidencia, si se compara
con el tratamiento que alimentaba a saciedad los
mismos días (T3).
571
Figura 1. Evolución de los pesos medios (g), durante el
periodo de estudio.
Las frecuencias de alimentación no influyeron
significativamente sobre la composición corporal
(Tabla 2). El régimen de alimentación influyó en la
retención de proteína y energía, el grupo T5 fue el que
mayor retención de proteína y energía obtuvo, respecto
a los demás que no presentaron diferencias entre sí
(Tabla 2).
El costo en la alimentación que significó
incrementar un kg de peso (ICE), fue mayor en el T4
que sometió los individuos a un ayuno severo, a
diferencia del tratamiento T5 que resultó menor en
comparación con los demás tratamientos que no
presentaron diferencias entre sí. Al considerar el peso
final, el precio de venta y el ICE, se calculó el IRE para
evaluar la rentabilidad en términos económicos de cada
tratamiento. Los tratamientos T2, T3 y T5 produjeron
la mayor rentabilidad (Tabla 3).
DISCUSIÓN
Los resultados demostraron que la frecuencia de
alimentación afectó de forma significativa tanto al peso
medio final como al TCI (Tabla 1). Los individuos del
tratamiento T1, presentaron un valor más bajo de TCI,
respecto a los demás tratamientos, este comportamiento
indicó que ayunar los peces dos días a la semana influyó
negativamente sobre el crecimiento, pero el ayuno de
un día (T2), no afectó dicho crecimiento. Por otra parte,
el ayuno prolongado de 14 días (T4), no tuvo un efecto
negativo sobre el peso medio final, ya que la pérdida de
peso en el periodo de ayuno no fue alto (2,2 g) y el
periodo de realimentación fue suficiente para recuperar
el peso perdido. Estos resultados coinciden con Power
et al. (2000), que tras ayunar lotes de Sparus aurata
durante 21 días y ofreciendo una posterior realimentación, incrementaron de forma rápida su peso,
pero no llegaron a igualar a los lotes no ayunados.
Takahashi et al. (2011) determinaron los efectos de ci-
572
Tabla 1. Crecimiento y aprovechamiento nutritivo de Piaractus brachypomus. Media de tres réplicas por tratamiento. Letras
diferentes indican diferencias estadísticas entre las medias. P < 0,05). Covariable: peso medio inicial. wTasa de crecimiento
instantáneo (% día-1), TCI: 100 x ln (peso final / peso inicial) / días xTasa de alimentación diaria (g 100 g ind-1 día-1), TAD:
100 x ingesta total (g) / biomasa media (g) x día. yÍndice de conversión del alimento, ICA: ingesta total de alimento (g) /
incremento de la biomasa (g).
Parámetros
Peso inicial (g)
Peso final (g)
TCIw (% día-1)
TADx (g 100 g ind-1 día-1)
ICAy
T1
20
462b
2,09b
1,44ab
1,41ab
T2
20
492ab
2,14a
1,48ab
1,39ab
Tratamientos
T3
T4
20
20
500a 475ab
2,15a 2,11ab
1,42b 1,53a
1,35b 1,47a
T5
20
482ab
2,12b
1,34c
1,28c
P
0,11
0,05
0,01
0,02
0,02
Tabla 2. Composición corporal (media de tres réplicas por grupo). Letras diferentes indican diferencias estadísticas entre
las medias P < 0,05). yRetención de proteína (%) = (incremento de proteína corporal, g) x 100 / (ingestión proteica, g),
z
Retención de energía (%) = (incremento de energía corporal, KJ) x 100 / (ingestión de energía, KJ).
Parámetros
Composición corporal
Materia seca (%)
Proteína (% wm)
Grasa (% wm)
Cenizas (% wm)
Retención de nutrientes
Retención de proteínay (%)
Retención de energíaz (%)
Tratamientos
T3
T4
T5
P
40,7
45,7
47,5
10,6
0,79
1,02
1,5
0,9
T1
T2
39
46,1
48,5
10,9
40,8
46,9
48,9
10,1
41
46,4
48,8
10
28,7b
36,13b
28,9b
38,74ab
29,4b 28,08b 32,67a
38,85ab 35,31b 41,58a
clos repetitivos de restricción de alimentos y realimentación durante 36 días, en individuos de Piaractus
mesopotamicus. Los resultados indicaron que los peces
sometidos a períodos cíclicos de ayuno de 3 días y
realimentación restringida por 3 días en uno de los
tratamiento y realimentación a saciedad 3 días en el
otro, los peces ayunados no pudieron alcanzar el peso
de los peces alimentados diariamente a saciedad,
presentando un valor menor de TCI. Kocabas et al.
(2013) evaluaron el crecimiento y aprovechamiento
nutritivo de individuos de Salmo trutta labrax,
sometidos a regímenes de ayuno de 5, 10 y 15 días y
alimentación 10 días; parámetros como el peso final y
TCI fueron significativamente más bajos en los
tratamientos ayunados respecto al tratamiento control
(no ayunados). A su vez, los resultados de este estudio,
contrastan con los resultados obtenidos por Marlyn et
al. (2014), donde individuos de Chanos chanos
sometidos a periodos de ayuno cortos, mostraron igual
crecimiento que los no ayunados (control), mientras
que individuos ayunados en periodos más largos,
exhibieron pesos más bajos. Por el contrario, no
coinciden con los obtenidos por Rueda et al. (1995), los
cuales sometieron Pagrus pagrus a cuatro diferentes
39,8
45,8
48
10,3
0,04
0,05
ayunos (0, 7, 14 y 28 días); que tras la realimentación,
alcanzaron el peso medio final de los no ayunados no
observándose diferencias significativas.
Los valores de tasa de alimentación diaria (TAD),
mostraron diferencias significativas entre algunas de
las frecuencias de alimentación. El mayor valor de
TAD se presentó con el tratamiento T4 pero solo
respecto a T3 y T5, debido a un incremento excesivo de
la ingestión de alimento voluntario tras el periodo de
ayuno. Al respecto, el tratamiento T5, presentó el
menor valor, debido a que no se consideró el exceso de
alimento en los días en que los peces no consumían la
ración total, cuantificando solo el alimento ingerido y
no el total de la ración recomendada por el fabricante.
Por el contrario, no surgieron diferencias de TAD entre
los tratamientos T1, T2 y T3, lo que indica que los
individuos de los tratamientos T1 y T2, que ayunaban
uno y dos días respectivamente, incrementaron
voluntariamente la ingesta tras los días de ayuno
igualando la ingesta de los individuos no ayunados (T3)
(Tabla 1). Este hecho tiene una gran importancia
práctica, pues sería posible eliminar la alimentación dos
días, pero aumentando la ración durante el resto de la
573
Tabla 3. Parámetros económicos de Piaractus brachypomus. Media de tres réplicas por tratamiento, Letras diferentes
indican diferencias estadísticas entre las medias P < 0,05. yÍndice de conversión económica, ICE = ingesta total del
concentrado (kg) x *costo del alimento ($ kg-1) / incremento de la biomasa (kg), *Costo del alimento: 1250 ($ kg-1) Fuente:
DANE. zÍndice de Rentabilidad Económica, IRE = peso final (kg) x *precio de venta ($ kg-1) - ICE ($ kg-1 ind) x incremento
de peso (Kg); *Precio de venta calculado para Piaractus brachypomus: 6,180 ($ kg-1). Fuente: DANE.
Parámetros
Tratamientos
T1
T2
T3
T4
T5
P
ICE y ($ kg ind-1) 1762,5ab 1737,5b 1687,5b 1837,5a 1600c 0,05
IRE z ($ ind1)
2052,1b 2194,9a 2254,0a 2074,7b 2214,5a 0,02
semana. En cuanto al ICA, el tratamiento T5 presentó
los mejores valores, mientras que el tratamiento de
individuos sometidos al ayuno prolongado T4 los
peores, pero sólo frente a T5 y T3, debido a que el
ayuno provocó un comportamiento hiperfágico al
principio de la realimentación con una mayor TAD que
no causó un mejor crecimiento. Egea-Nicolás et al.
(2002), ayunando lotes de Diplodus puntazzo durante
17 días seguidos de una realimentación, ponen de
manifiesto la rápida recuperación del peso por parte de
los peces ayunados, aunque no consiguen igualar al de
los no ayunados, al respecto, otros valores como TAD
e ICA fueron superiores en los tratamientos ayunados.
La composición corporal de los peces no resultó
afectada por la frecuencia de alimentación (T1, T2 y
T3) ni por el ayuno prolongado (T4), por lo que, tras la
realimentación, todas las reservas utilizadas durante el
ayuno se restablecieron. Los valores de retenciones de
proteína y energía fueron mejores con el tratamiento T5
frente a los demás, resultando del todo razonable
considerando que los peces utilizaron menor cantidad
de alimento, lo aprovecharon mejor y el crecimiento fue
similar al resto de tratamientos, como lo demuestra su
ICA más bajo. Divanach et al. (1997) realizaron el
seguimiento sobre la concentración de lípidos y
proteínas totales en Pagrus pagrus tras un ayuno de 42
días, la recuperación de los valores previos al ayuno se
ve influenciada por su duración y por los días
destinados a la realimentación. Ling-Qing et al. (2014)
demostraron que un ayuno prolongado de 32 días en
Silurus meridionalis, afectó su contenido de lípidos,
carbohidratos y proteínas, y que la realimentación
permite una recuperación parcial de todos los
componentes. Los porcentajes de lípidos en el músculo
en Piaractus mesopotamicus, presentaron una
tendencia a disminuir en los tratamientos que se
sometieron a ciclos de ayuno y realimentación durante
36 días (Takahashi et al., 2011).
El ICE fue superior con el tratamiento que sometió
los individuos a un ayuno severo (T4), debido a que el
consumo de alimento fue más alto en comparación con
los demás tratamientos, sin lograr un mejor crecimiento; incrementando el costo de la alimentación
como era de esperarse. Al considerar la rentabilidad de
cada tratamiento mediante el IRE, los tratamientos que
alimentaron los individuos 6 y 7 días (T2 y T3) y el
tratamiento (T5) que distribuyó la tasa recomendada
por el fabricante de manera restringida, fueron los que
alcanzaron una mayor rentabilidad. Los valores de TCI
e ICA, fueron significativamente inferiores en los
grupos de individuos ayunados en periodos largos.
Los resultados de este experimento sugieren una
aplicación práctica del crecimiento compensatorio. Es
posible dejar de alimentar Piaractus brachypomus
durante un día a la semana (periodos cortos) sin afectar
el crecimiento ni los parámetros nutritivos y económicos, siempre que los peces puedan incrementar la
ración durante los días siguientes. Por otra parte, la
alimentación restringida mostró los mejores resultados
económicos, siempre y cuando no se considere el
exceso de alimento en los días en que los peces no
consumen la ración total, cuantificando solo el alimento
ingerido y no el total de la ración recomendada por el
fabricante.
AGRADECIMIENTOS
Al laboratorio experimental “Mario González Aranda”
de la Universidad Nacional de Colombia sede Palmira
por sus instalaciones para el desarrollo de este estudio.
REFERENCIAS
Ali, M., A.G. Nicieza & R.J. Wootton. 2003. Compensatory growth in fishes: a response to growth depression. Fish Fish., 4(2): 147-190.
Association of Official Analytical Chemists (AOAC).
1990. Official methods of analysis. Association of
Official Analytical Chemists, Arlington, 1298 pp.
Biler, P.U., J.D. Dutil, H. Lemieux, F. Belanger & L.
Bitetera. 2007. Phenotypic flexibility of digestive
574
system in Atlantic cod Gadus morhua. Comp.
Biochem. Physiol. B, 146: 174-179.
Cho, C. & D. Bureau. 1998. Development of bioenergetic
models and the Fish-PrFEQ software to estimate
production, feeding ration and waste output in
aquaculture. Aquat. Living Resour., 11(4): 199-210.
Departamento Administrativo Nacional de Estadisitcas
(DANE). 2014. [http://www.dane. gov.co/index.php/
índices-de-precios-y-costos/indice-de-precios-alproductor-ipc]. Reviewed: 16 March 2016.
Divanach, P., F.M. Rueda, F.J. Martínez, S. Zamora, P.Y
Le Bail & M. Kentouri. 1997. Influencia del ayuno y
la realimentación sobre diversos metabolitos y la
hormona del crecimiento en el Pargo, Pagrus pagrus.
Actas del VI Congreso Nacional de Acuicultura,
Cartagena, pp. 375-379.
Dobson, S.H. & R.M. Holmes. 1984. Compensatory
growth in the rainbow trout, Salmo gairdneri. J. Fish
Biol., 25: 649-656.
Egea-Nicolás, M.A., F. Rueda-González, F.J. MartínezLópez & B. García-García. 2002. Efecto de la
realimentación tras un periodo de ayuno sobre el
crecimiento en el sargo picudo Diplodus puntazzo
(Cetti, 1777). Bol. Inst. Esp. Oceanogr., 18(4): 357362.
Eroldogan, O.T., M. Kumlu, G.A. Kiris & B. Sezer.
2006a. Compensatory growth response of Sparus
aurata following different starvation and refeeding
protocols. Aquacult. Nutr., 12: 203-210 .
Eroldogan, O.T., M. Kumlu & B. Sezer. 2006b. Effects of
starvation and re-alimentation periods on growth
performance and hyperphagic response of Sparus
aurata. Aquacult. Res., 37: 535-537.
Fernández-Borras, J., A. Requena & I. Marimon. 1995.
Efecto de un corto ayuno y realimentación en el
metabolismo de la dorada. Actas de V Congreso
Nacional de Acuícultura, Barcelona, pp. 487-491.
Gaylord, T.G. & D.M. Gatlin. 2001. Dietary protein and
energy modifications to maximize compensatory
growth of channel catfish Ictalurus punctatus.
Hayward, R.S., D.B. Noltie & N. Wang. 1997. Use of
compensatory growth to double hybrid sunfish growth
rates. T. Am. Fish. Soc., 126: 316-322.
Heide, A., A. Foss, S.O. Stefansson, I. Mayer, B. Norberg,
B. Roth, M.D. Jenssen, R. Nortvedt & A.K. Imsland.
2006. Compensatory growth and fillet crude
composition in juvenile Atlantic halibut: effects of
short term starvation periods and subsequent feeding.
Henriette, H., A.K. Imsland, A. Foss, E. Vikingstad, M.
Bjørnevik, C. Solberg, B. Roth, B. Norberg & M.
Powell. 2012. Effect of different feeding regimes on
growth in juvenile Atlantic cod, Gadus morhua L.
Jobling, M. 2010. Are compensatory growth and cátchup
growth two sides of the same coin. Aquacult. Int., 18:
501-510.
Jobling, M., E.H. Jorgensen & S.T. Siikavuopio. 1993.
The influence of previous feeding regime on the
compensatory growth response of maturing and immature Arctic charr Salvelinus alpinus. J. Fish Biol.,
43: 409-419.
Jobling, M., O.H. Meloy, J. Dos Santos & B. Christiansen.
1994. The compensatory growth response of the
Atlantic cod: effects of nutritional history. Aquacult.
Int., 2: 75-90.
Kindschi, G.A. 1988. Effect of intermittent feeding on
growth on rainbow trout, Salmo gairdneri. Aquacult.
Fish Manage., 19: 213-215.
Kocabas, M., N. Bascinar, M. Kayim, H. Er & H. Sahin.
2013. The effect of different feeding protocols on
compensatory growth of black sea trout salmo trutta
labrax. N. Am. J. Aquacult., 75(3): 429-435.
Ling-Qing, Z., F. Shi-Jian, L. Xiu-Ming, L. Feng-JiE, L.
Bin, C. Zhen-Dong & Z. Yao-Guang. 2014. Physiological and morphological responses to the first bout
of refeeding in southern catfish Silurus meridionalis.
J. Comp. Physiol. B., 184: 329-346.
Marlyn, Ll. & A. E. Serrano. 2014. Effect of cyclic
feeding on compensatory growth in milkfish Chanos
chanos juveniles. Elba Bioflux, 6(1): 22-28.
Nicienza, A.G. & N.B. Metcalfe. 1997. Growth
compensation in juvenile Atlantic salmon: responses
to depressed temperature and food availability.
Ecology, 78: 2385-2400.
Nikki, J., J. Pirhonen, M. Jobling & J. Karjalainen. 2004.
Compensatory growth in juvenile rainbow trout,
Oncorhynchus mykiss (Walbaum) held individually.
Paul, A.J., J.M. Paul & R.L. Smith. 1995. Compensatory
growth in Alaska yellowfin sole, Pleuronectes asper,
following food deprivation. J. Fish Biol., 46: 442-448.
Power, D., M.J. Melo & C.R. Santos. 2000. The effect of
food deprivation and refeeding on the liver, thyroid
hormones and transthyretin in sea bream. J. Fish Biol.,
56: 374-387.
Quinton, J.C. & W. Blake. 1990. The effects of feed
cycling and ration level on the compensatory growth
response in rainbow trout, Oncorhynchus mykiis. J.
Fish Biol., 37: 34-41.
Rueda, F.M., F.J. Martinez-Lopez, S. Zamora-Navarro, P.
Divanach & M. Kentouri. 1995. Crecimiento compensatorio en Pagrus pagrus en la re-alimentación
después del ayuno. Actas del VI Congreso Nacional de
Acuicultura, Cartagena, pp. 447-452.
Russel, N.R. & R.J. Wootton. 1992. Appetite and growth
compensation in the European Minnow, Phoxinus
phoxinus (Cyprinidae), following short periods of
restriction. Environ. Biol. Fish., 34: 227-285.
Souza, V.L., E.G. Oliveira & E.C. Urbinati. 2000. Effects
of food restriction and refeeding on energy stores and
growth of pacu, Piaractus mesopotamicus (Characidae). J. Aquacult. Trop., 15(4): 371-379.
Received: 28 January 2015; Accepted: 2 May 2016
575
Sung-Yong, O., K. Min-Suk, K. Joon & B.A. Venmathi.
2013. Effects of feed restriction to enhance the
profitable farming of blackhead seabream Acanthopagrus schlegelii schlegelii in Sea Cages. Ocean
Sci. J., 48(3): 263-268.
Takahashi, L.S., J.D. Biller, E. Criscuolo-Urbinati & E.C.
Urbinati. 2011. Feeding strategy with alternate fasting
and refeeding: effects on farmed pacu production. J.
Anim. Physiol. Anim. Nutr., 95: 259-266.
Wootton, R.J. 1998. Ecology of teleost fishes. Chapman
and Hall, London, 392 pp.
Lat. Am. J. Aquat. Res., 44(3): 576-587, 2016
Microsetella rosea in the Chilean Magellan neuston
5761
Research Article
Abundance and spatial distribution of neustonic copepodits of Microsetella rosea
(Harpacticoida: Ectinosomatidae) along the western
Magellan coast, southern Chile
Juan I. Cañete1, Carlos S. Gallardo2, Carlos Olave3, María S. Romero4
Tania Figueroa1 & Daniela Haro5
1
Laboratorio de Oceanografía Biológica Austral (LOBA), Facultad Ciencias
Universidad de Magallanes, Punta Arenas, Chile
2
Instituto Ciencias Marinas y Limnológicas, Facultad de Ciencias
Universidad Austral de Chile, Valdivia, Chile
3
Centro Regional de Estudios, CEQUA, Punta Arenas, Chile
4
Departamento de Biología Marina, Facultad Ciencias del Mar
Universidad Católica del Norte, Coquimbo, Chile
5
Laboratorio Ecología Molecular, Facultad Ciencias, Universidad de Chile, Santiago, Chile
Corresponding author: Juan I. Cañete (ivan.canete@umag.cl)
ABSTRACT. The pelagic harpacticoid copepod Microsetella rosea inhabits the cold waters along the temperate
southern coast of Chile, where its population biology and ecological role in the neuston are unknown. During a
CIMAR 16 Fiordos cruise realized in the Magellan Region, 26 neustonic samples were collected to analyze the
abundance, spatial distribution of copepodits and oceanographic conditions (temperature, salinity, and dissolved
oxygen). M. rosea copepodits, the most abundant holoneustonic taxa (30% of total abundance), were present at
all sampled stations and were 0.5 times more abundant than calanoids. These copepodits inhabited waters
ranging between 6.5-8.5oC and salinity of 26-33, with maximum abundances (1,000-10,000 ind/5 min horizontal
drag) at means of 7.2 ± 0.6ºC and salinities of 30.7 ± 0.9. Froward Cape, Almirantazgo Sound, and Inútil Bay
stations accounted for 65% of total M. rosea abundance, whereas Beagle Channel stations present the lowest
abundances (<4%). The entire sampling area was as an oxygenated estuary (7.4 ± 0.4 mL L-1). Given the
abundance and recurrence of M. rosea in the Magellanic neuston, future research should assess the ecological
functions of this species. Finally, M. rosea could also be used as a biotracer for processes of aggregation in other
estuarine neustonic communities of southern Chile.
Keywords: Microsetella rosea, Copepoda, neuston, subantarctic zooplankton, estuaries, oximax zone, southern
Chile.
Abundancia y distribución espacial de copepoditos neustónicos de Microsetella rosea
(Harpacticoida: Ectinosomatidae) en la costa occidental de Magallanes, Chile
RESUMEN. El copépodo harpacticoide pelágico Microstella rosea habita las aguas frías a lo largo de la costa
templada del sur de Chile, donde se desconoce su biología poblacional y rol ecológico en el neuston. Durante el
crucero CIMAR 16 Fiordos realizado en la región de Magallanes, se recolectaron 26 muestras neustónicas para
analizar la abundancia, distribución espacial de los copepodítos y condiciones oceanográficas (temperatura,
salinidad y oxígeno disuelto). Los copepoditos de M. rosea, el taxa holoneustónico más abundante (30%), se
encontraron en todas las estaciones analizadas y fueron 0,5 veces más abundantes que los copépodos calanoides.
Los copepoditos habitaron aguas de 6.5-8.5oC, con salinidades de 26-33, con máximos de abundancia (1.00010.000 ind/5 min arrastre horizontal) con promedios de 7,2 ± 0,6ºC y 30,7 ± 0,9 de salinidad. En las estaciones
localizadas en Cabo Froward, Seno Almirantazgo y Bahía Inútil se colectó el 65% de la abundancia total de
copepoditos; mientras que en las estaciones del Canal Beagle se registraron las menores abundancias (<4%).
Toda el área de muestreo representa un estuario oxigenado (7,4 ± 0,4 mL L-1). Dada la abundancia y
recurrencia
__________________
Corresponding editor: Sergio Palma
577
2
de M. rosea en el neuston magallánico, se deberían efectuar futuras investigaciones para evaluar las funciones
ecológicas de este copépodo. Finalmente, M. rosea podría ser utilizado como un biotrazador para procesos de
agregación en otras comunidades estuarinas neustónicas del sur de Chile.
Palabras clave: Microsetella rosea, Copepoda, neuston, zooplancton subantárctico, estuarios, zonas Oximax,
sur de Chile.
INTRODUCTION
While harpacticoid copepods are primarily benthic
crustaceans, a small proportion (<0.5%) of harpacticoid
species inhabit the pelagic zone during their life cycle
(Boxshall, 1979; Uye et al., 2002). These pelagic
species, which include Microsetella spp. and
Macrosetella spp., have relatively strong swimming
abilities and unique structural features, such as an
elongated worm-like body and long caudal setae that
delay sinking velocity. These copepods also show a
close resemblance to floating substrates (e.g., the
colonial cyanobacterium Trichodesmium; Calef &
Grice, 1966; Tokioka & Bieri, 1966; O’Neil, 1998), and
suspended organic matter (Alldredge, 1972; Ohtsuka et
al., 1993; Green & Dagg, 1997; Uye et al., 2002;
Zaitsev, 2005).
Microsetella rosea is widely distributed in subantarctic waters (5-10°C), ranging from the southern
end of South America to western Antarctica, in addition
to inhabiting the warm, subtropical waters of the South
China Sea, Mediterranean Sea, and Black Sea (Razouls
et al., 2005-2014) (http://copepodes.obs-banyuls.fr).
Adult females can reach a dry weight of 0.02 mg and a
length of 800 µm.
Compared to the vast information available on the
population and production dynamics of marine
planktonic calanoid copepods, there are relatively few
studies that focus on marine and estuarine planktonic
non-calanoid copepods, particularly for Microsetella
species (Sabatini & Kiørboe, 1994; Uye & Sano, 1998;
Uye et al., 2002). One study focusing on a non-calanoid
copepod was conducted by Uye et al. (2002). Specifically, these authors researched the population and
production dynamics of Microsetella norvegica in the
Sea of Japan and found that reproductive activities of
this species occur in the early fall and that brooding sacs
contain a maximum of 16 eggs/sac. In the Magellan
Strait, typical pelagic calanoid and cyclopoid copepods
have been previously studied (Marín & Antezana,
1985; Mazzocchi et al., 1995; Hamamé & Antezana,
1999; Marín & Delgado, 2001), and there are some
references to pelagic harpacticoids (Aguirre et al.,
2012). However, work on pelagic harpacticoid
copepods is limited in regards to the waters of South
America (Palma & Kaiser, 1993; Boltovskoy, 1999).
In addition to the lack of studies on non-calanoid
species, there is also little available research regarding
neustonic communities along the Chilean coast (Palma
& Kaiser, 1993). In the neuston, especially in coastal
waters, members of the Microsetella genus are
numerically dominant and highly abundant (Anraku,
1975; Dugas & Koslow, 1984; Uye et al., 2002;
Zaitsev, 2005). The community structure and biodiversity of the neuston, including copepodits of species
such as M. rosea, are particularly relevant when
considering the number of roles that neuston plays in
the marine environment.
The neuston forms a boundary between the air and
water that, although only of few centimeters thick
(Hardy, 1991; Upstill-Goddard et al., 2003), covers
71% of the planet’s surface. Moreover, in temperate
zones the neuston plays an important trophic role as a
food source for meso and macrozooplankton, in
addition to being a key component in the production of
marine snow and in the vertical transport of organic
material from the ocean surface to greater depths
(Conte et al., 1998; Hays et al., 2005; Zaitsev, 2005;
Koski et al., 2007). The neuston is also important to the
early and larval life cycle stages of a number of
commercially valuable and/or ecologically significant
species in Chile, particularly in regards to larval
dispersion (Scheltema, 1986; Gallardo et al., 2012;
Cañete et al., 2012a).
Nevertheless, the impact of latitudinal differences
on the functions of the neuston in the fragmentation and
transport of organic matter to greater depths is not fully
understood (Zaitsev, 2005; Koski et al., 2007). Further
information is also needed to enhance the understanding on how the neuston is influenced by
environmental and oceanographic factors, such as
temperature, solar radiation, marine pollution, water
salinity and density, UV radiation, acidification, and
climate change, among others (Hardy, 1991; Rodríguez
et al., 2000; Zaitsev, 2005). Therefore, the goals of the
present study were to: i) record the abundance and
spatial distribution of M. rosea neustonic copepodits
along the western coast of the Magellan region; ii)
connect these ecological observations with oceanographic parameters (temperature, salinity, and dissolved oxygen) in order to define the conditions under
which the M. rosea population develops; and iii)
compare M. rosea abundances against those of other
5783
collected neustonic taxa, thus determining their biological contributions as biotracers for processes
associated with the aggregation of Magellan neustonic
communities.
Sampling was conducted onboard the RV Abate Molina
as part of the CIMAR 16 Fiordos cruise during the
austral spring of 2010 (October 11 to November 19).
Twenty six stations were used for sampling. These
stations were located along the western mouth of the
Magellan Strait (Sta. 7-15) to Navarino Island in the
Beagle Channel (Sta. 37-43). At stations close to
Dawson Island, samples were primarily collected from
the Almirantazgo Sound, Whiteside Channel, and Inútil
Bay (Sta. 51-60). Additionally, the sampling area
included stations near channels and islands with
proximity to the Pacific Ocean (Sta. 27-35) (Fig. 1).
Sampling was originally planned to include stations
along the eastern margin of the Magellan Strait;
however, rough weather conditions did not allowed
sample collection (Sta. 1-6, not shown).
At each station, sampling was done with a neuston
net (80 cm wide and 30 cm deep) with a 50 µm mesh
size zooplankton net (Kršinić, 1998). The net was
dragged along the surface at a speed of 0.77-1.03 m s-1.
At stations 7-9, the net was dragged for 8 min, but given
the high amount of plankton collected, this was reduced
to 5 min for all subsequent sampling stations.
According to the layer classification established by
Hardy (2005), the sampled layers corresponded to the
centilayer and surface layer (1-100 cm depth). Only one
haul per station was collected. Samples were fixed with
5% neutralized formalin.
Vertical profile of oceanographic conditions for
each stations were obtained by a rosette equipped with
a Sea-Bird CTD deployed to different depths according
to the bottom depth of each site (Data Report CIMAR
16 Fiordos cruise). Since the neuston is in the surface
layer, data for temperature, salinity, and dissolved
oxygen content were recorded as average of readings
between 1 to 2 m depths.
Due to the lack of a flow-meter, abundance and
biomass data were standardized to the number of
individuals or biomass wet-weight (g) per 5 min drag.
To determine biomass wet-weight, which included
phytoneuston and zooneuston, samples were filtered on
a 30 µm sieve. Mainly micro- to mesoneuston (20 µm20 mm) (Hardy, 2005) samples were collected. Folsom
fractioning was used to further divide the collected
biomass into 1/8th subsamples, thereby facilitating the
counting of neuston holoplankton and M. rosea
copepodits.
The copepod stages of M. rosea were identified
following Uye et al. (2002). Abundance data only
considered the copepodit stages of the M. rosea
lifecycle, while nauplius and adult stages were
excluded. Additionally, the methodology described by
Davies & Slotwinski (2012) was used to discriminate
individuals of M. rosea from M. norvegica. Other
zooplankton components were identified based on
Palma & Kaiser (1993) and Boltovskoy (1999).
Samples were stored at the Austral Biological
Oceanography Laboratory (LOBA), Department of
Sciences & Natural Resources, Faculty of Sciences,
Universidad de Magallanes, Punta Arenas, Chile.
The Kruskal-Wallis test was used to detect different
trends in M. rosea abundance and differences in trends
between the sampled stations, which were grouped into
four geographic zones located along the Magellan and
Fuegian channels (Antezana, 1999). The relationship
between M. rosea copepodit abundance and the
oceanographic parameters of temperature, salinity, and
dissolved oxygen content were tested using Spearman’s
Rank-Order Correlation Coefficient (rs) (Zar, 1999;
Daniel, 2000).
Magellan plankton can be used to establish
distributional trends of bio-physical interactions in
estuarine ecosystems. In relation to this study, assessing
only the thin neuston layer reduced the number of
spatial components (x,y) and prevented constraints
associated with vertical water stratification. Additionally, the spatial area of sampling was sufficiently
large to cover meso-scale patterns (10-1000 km; Mann
& Lazier, 1991; Garçon et al., 2001). Finally, the
sampled area, a heterogeneous coastal system,
represents a natural laboratory for studying the
population dynamics and topographic mechanism that
could to produce the aggregation or clumping of the
plankton (Downing, 1991).
To classify the type of spatial distribution presented
by M. rosea copepodits within the study area, a
dispersal index (Id) was applied. This index is based on
the variance to mean ratio (s2/x̅) and describes a trend
of spatial distribution. If Id = 1.0, there is random
distribution (s2 = x̅); if Id < 1, there is uniform or regular
distribution (s2 < x̅); and if Id > 1, there is clumped
distribution (s2 > x̅) (Ludwig & Reynolds, 1988;
Hulbert, 1990).
RESULTS
Oceanography
The spatial variability of ocean temperature, salinity,
and dissolved oxygen content were measured for the
surface layer of the analyzed stations. Water temperature
4579
Figure 1. Geographical position of neuston sampling stations in the Magellan Region, CIMAR 16 Fjords cruise (OctoberNovember 2010).
fluctuated between 6.16oC (St 52) and 8.42oC (St 56),
with an average water temperature of 7.2 ± 0.6oC within
the study area. The highest temperatures were detected
in the Whiteside Channel and Inútil Bay, while the
lowest temperatures were detected along the western
side of the Magellan Strait and in Almirantazgo Sound,
near the glacial discharge from the Darwin Ice Field.
Salinity was the most variable among all measured
parameters. Salinities ranged from 26.4 (Sta. 10) to
32.78 (Sta. 15), with an average salinity of 30.7 ± 0.91.
Based on the classification criteria proposed by
Valdenegro & Silva (2003) for southern Chile, all
samples in the study area were taken from estuarine (132) or modified subantarctic waters (32-33). Values
corresponding to 32-33 were recorded for stations in
the Magellan and Fuegian channels.
Dissolved oxygen content ranged from 6.65 mL L-1
(Sta. 15) to 8.27 mL L-1 (Sta. 55), with an average of
7.4 ± 0.4 mL L-1. The surface layer was oxygenated
throughout the study area, with a maximum value
recorded in a glacial area of the Almirantazgo Sound.
According to Cañete et al. (2012b), the surveyed area
can be classified as an oximax or normoxic condition
(maximum oxygen zone; values > 2 mL O2 L-1).
Neuston biomass and abundance
The collected neuston biomass fluctuated by up to two
orders of magnitude, ranging from 0.7 g 5 min-1 of
horizontal drag (Mhd) (Sta. 39) to 31.89 g 5 Mhd (Sta.
52), with an average of 8.55 ± 7.33 g 5 Mhd (Fig. 2).
Neuston biomass was highest in wind protected areas,
such as in Froward Cape, Almirantazgo Sound, and
Inútil Bay (average = 12.3 g 5 Mhd-1) and along the
western arm of the Magellan Strait, between Capitán
Aracena Island and the western mouth of Magellan
Strait (average = 11.1 g 5 Mhd-1). The lowest neuston
biomass measurements were recorded along the Beagle
Channel (average = 5.5 g Mhd-1; Table 1).
5805
Figure 2. Neustonic biomass (g 5 Mhd-1) and neustonic abundance (ind 5 Mhd-1) in the western Magellan coast. Both
measurements are expressed in log scale and include phytoneuston and zooneuston together. The average and standard
deviation of neustonic biomass and abundance were 8.55 ± 7.33 g 5 Mhd -1 and 9,179 ± 10,281 ind 5 Mhd-1, respectively.
The function log (x+1) was applied to the original abundance data to obtain only values >0 in the axis. Mhd: minutes of
horizontal dragging.
Table 1. Total neustonic biomass and abundance and Microsetella rosea abundance collected from four macrozones along
the western margin of the Magellan Region during the CIMAR 16 Fjord cruice (Oct-Nov 2010). Average values ± standard
deviation. Mhd: minutes of horizontal drag. Significant differences (*) were detected between macrozones using the
Kruskal-Wallis test (F3, 25 = 8.63; P < 0.05).
Macrozones
Almirantazgo Sound to Inútil Bay (7 stations; 29.6 ± 1.64)
Western arm of the Magellan Strait (8 stations; 30.6 ± 0.46)
Western islands between Dawson Island and the Pacific Ocean
(4 stations; 30.7 ± 0.17)
Southern branch of the Beagle Channel and Navarino Island
(7 stations; 31.1 ± 0.92)
The spatial pattern of neuston abundance followed
a trend similar to that of biomass, with maximum
abundances in the Almirantazgo Sound and Inútil Bay
(average = 18,350 ind 5 Mhd-1), and minimum abundances in the Beagle Channel (average = 3,358 ind 5
Mhd-1). The average abundances of stations located
along the western arm of the Magellan Strait and
between the western side of Dawson Island and the
Pacific Ocean varied between 7,172 and 7,337 ind 5
Mhd-1 (Table 1). Average neuston abundance for the
entire study area was 9,179 ± 10,281 ind 5 Mhd-1,
which is indicative of clumped distribution with a
variation coefficient of 112% (Fig. 3).
12.4 ± 9.4
6.7 ± 8.2
4.7 ± 2.7
Neuston
abundance
(ind 5 Mhd-1)
18,350 ± 11,594
7,172 ± 3,888
7,337 ± 5,263
Microsetella rosea
abundance
(ind 5 Mhd-1)
6,307 ± 5,993*
2,225 ± 3,693*
1,210 ± 1,226*
5.8 ± 3.2
3,358 ± 4,321
342 ± 264 *
Neuston biomass
(g 5 Mhd-1)
Abundance and spatial distribution of Microsetella
rosea
Copepodits of M. rosea were collected at all studied
stations (Fig. 3). However, there were evident
differences between zones that indicated wide spatial
variability along the western margin of the Magellan
Region. Specifically, maximal abundance of M. rosea
was recorded in the Almirantazgo Sound, Inútil Bay,
the Paso Ancho zone, and Froward Cape (midMagellan Strait, average = 6307 ± 5993 ind 5 Mhd-1),
while the lowest abundances were recorded at stations
along the Beagle Channel and in open areas near
Navarino Island (average = 362 ind 5 Mhd-1; Table 1).
6581
Figure 3. Spatial distribution of Microsetella rosea copepodits collected along the western margin of the Magellan coast.
Abundances are expressed as ind 5 Mhd-1 (minutes of horizontal dragging). The average and standard deviation of M. rosea
copepodit abundances were 2,761 ± 4,278 ind 5 Mhd-1.
M. rosea copepodits accounted for 30% of all
recorded neustonic taxa (238,673 ind; Table 2).
Almirantazgo Sound, Inútil Bay, the Paso Ancho zone,
and Froward Cape accounted for 61.5% of total M.
rosea abundance, while sites near the Beagle Channel
accounted for <4%. The western margin of the
Magellan Strait accounted for nearly 25% of total M.
rosea abundance, and the zone west of Dawson Island
accounted for 10% (Fig. 3). The abundance of M. rosea
copepodits showed a geographic trend in terms of
abundance, with significant differences found mostly
between the Paso Ancho microbasin and the Beagle and
Fuegian Channels (Antezana, 1999) (Table 1).
The distribution pattern of M. rosea copepodits
varied up to four orders of magnitude. Therefore, the
spatial distribution pattern of copepodits along the
western margin of Magellan Region was classified as
clumped (Ludwig & Reynold, 1988; Hulbert, 1990;
Downing, 1991) (Figs. 4a-4b). A similar trend was
observed for total neuston abundance and biomass
(Table 1).
Oceanographic conditions and habitat of Microsetella
rosea copepodits
M. rosea copepodits were found inhabiting the neuston
at ocean temperatures ranging between 6.5°C (Sta. 40)
and 8.4°C (Sta. 56), but maximum abundance (1,000 to
10,000 ind 5 Mhd-1) was only detected at stations 7, 55,
and 60, which presented surface temperatures between
6.79°C and 7.69ºC. In turn, Spearman’s Rank-Order
Correlation Coefficient between surface temperature
and M. rosea copepodit abundance produced a significant, negative trend between both parameters (rs =
-0.36; P < 0.05; n = 26) (Table 1; Figs. 2-3). The
average and standard deviation of M. rosea copepodit
abundances was 2,761 ± 4,278 ind 5 Mhd-1.
Table 2. Comparative analysis of neustonic zooplankton
collected along the western margin of the Magellan
Region during the CIMAR 16 Fjord cruise (Oct-Nov
2010). A: Total abundance (%; n = 238.673 individuals).
Larval type refers to the number of different families or
orders for polychaetes and crustaceans, respectively. The
total percentage of abundances is less than 100% as some
larval types were unidentified or scarce.
A (%)
Frequency
(number of cases)
0.200
0.002
0.008
16.395
29.993
4.291
0.082
5
1
1
26
26
13
5
Nemertea (Müller)
Polychaeta (11 types)
Sipunculida (pelagosphaera)
Barnacles (nauplius + cypris)
Decapod crustaceans
Bryozoa (cyphonaute)
Gastropoda (bilobed larvae)
Bivalvia (right charnel + umbonated)
Echinodermata (pluteus)
0.002
16.446
0.002
0.606
0.258
2.410
0.007
21.118
0.419
1
24
1
11
11
19
2
18
11
Total
92.243 %
TAXA
Holoneuston
Cnidaria
Ctenophora
Pelagic Polychaeta
Calanoid copepods
M. rosea copepodits
Appendicularia
Fishes eggs
Meroneuston (larvae)
Additionally, M. rosea copepodits were found in
salinity levels between 26.4 (Sta. 10) and 32.777 (Sta.
15) (average = 30.7 ± 0.9), with the highest M. rosea
copepodit abundances found in waters with salinity
levels between 30.37 (Sta. 55) and 30.53 (Sta. 7). The
relationship between salinity and the copepodit
abundance produced a significant, positive trend
between both parameters (rs = 0.22; P < 0.05; n = 26).
Finally, the area inhabited by M. rosea copepodits
was classified as an oxygenated estuary (mean = 7.4 ±
0.4 ml O2 L-1) (Table 1). There was a significant,
negative trend in the relationship between dissolved
oxygen content and M. rosea copepodit abundance in
Magellan waters (rs = -0.19; P < 0.05; n = 26).
Overall, the limited ranges of oceanographic
variables at the stations where M. rosea was found
indicate that this pelagic harpacticoid copepod is
adapted to specific estuarine environmental conditions.
This situation was evidenced along of the western
margin of the Magellan Region and within the limits of
the Magellan Strait, where much of the water is near
Dawson Island or enclosed between the Paso Ancho
microbasin and the Forward Cape Channel (Fig. 3).
Contribution of Microsetella rosea to the neuston
During the CIMAR 16 Fjords cruise, 238,673 ind were
counted from the meroplankton and holoplankton taxa
5827
(41.3% and 51.0%, respectively; Table 2). Of the
holoplankton, calanoide and harpacticoide copepods,
including M. rosea, were the most abundant. The
abundance of M. rosea copepodits was nearly twice that
of calanoide copepods (Table 2). Additionally, an
important percentage of juvenile appendicularians was
collected (4.3%).
Among the collected meroplankton, the numerically
dominant groups included mytilid larvae (21.12%),
unidentified polychaete larvae (tentatively identified as
a Polygordiid exolarvae; P. Ramey-Balci, com.pers.
from the Polygordiidae family) (16.5%), and cyphonaute larvae (2.4%). Cypris of barnacle (0.6%) and
pluteus of echinoderms (0.42%) were also detected
(Table 2). Decapod crustacean larvae were scarce
(<0.26%). A total of seven holo- and nine meroplankton taxa of the neuston could be used as biotracers
in the western Magellan Region (Table 2).
In summary, holoplankton numerically dominated
meroplankton in the neuston communities along the
western margin of the Magellan Region during spring
oceanographic conditions.
DISCUSSION
Presence of Microsetella rosea in western Magellan
waters
Microsetella rosea was found inhabiting the surface
waters of all studied stations along the western margin
of the Magellan Region, Chile. This species was the
most numerically dominant species of the identified
copepods, in addition to being the most dominant taxa
of the neuston. These findings have not been previously
reported, possibly due to the use of large net meshes
(generally >200 µm) (Mazzocchi et al., 1995;
Antezana, 1999; Defren-Janson et al., 1999; Marín &
Delgado, 2001; Biancalana et al., 2007; Guglielmo et
al., 2014). M. rosea copepodits may only inhabit
surface layers of the water column, which would be
mostly missed by vertical tows (Kršinić & Grbeco,
2012). Additionally, population density of M. rosea in
the neuston was greater than that of the detected
calanoid pelagic copepods. Similar abundance
magnitudes were found for M. norvegica in the Japan
Sea (Uye et al., 2002), where M. norvegica biomass can
reach up to 100 mg C m-3 in the fall. In contrast,
copepodit and adult Microsetella spp. in the Adriatic
Sea were less abundant than calanoid and cyclopoid
(oncaeids, oithonids) copepods (Kršinić & Grbeco,
2012). Altogether, these findings represent opportunities to study mesoscale spatial variabilities of
important biological phenomena arising from
interactions between the physical processes, physiology,
and behavior of estuarine neuston organisms (Garçón et
8583
al., 2001) along southern Chile. Additionally, the
typical morphological features of the M. rosea copepodits could ease the identification and justify their use
as biotracer.
Microsetella rosea copepodits as biotracer of
brackish estuaries
Neuston spatial distribution can be influenced by
diverse environmental and oceanographic factors, such
as temperature, solar radiation, marine pollution, ocean
salinity and density, UV radiation, acidification, and
climate change (Zaitsev, 2005). Therefore, understanding the physiological requirements of the neuston,
particularly in regards to salinity, is key to explaining
the spatial distribution of Magellan estuarine taxa.
The observed spatial distribution of M. rosea
appears to be regulated by changes in salinity, with
greater abundances at salinities between 29 and 31 and
lower numbers at salinities >31. Similar tendencies
have been found for other members of the Microsetella
genus. For example, M. norvergica inhabits areas near
bay mouths rather than sites close to river mouths or
other freshwater inputs (Yamazi, 1956). Likewise, Uye
& Liang (1998) found low M. norvegica densities at
salinities <30, which is further supported by Uye et al.
(2002), who indicated that M. norvegica is a
stenohaline species intolerant to large salinity
variations.
The wide surface salinity variations (0-32) recorded
for the Magellan Region (Valdenegro & Silva, 2003;
Palma et al., 2014b), together with the limited salinity
range (≈29-32) detected by the present study, suggest
that M. rosea copepodits could be stenohaline
organisms. Nevertheless, new experimental studies on
the physiological responses to oceanographic and
thermal parameters are needed to confirm.
Microsetella rosea copepodits as biotracer of neustonic
aggregation
Abundant patches of small copepods could be
influenced by a frontal zone (Zervoudaki et al., 2007).
In the western Magellan, frontal zones are detected
through the accumulation of ice, strings of detached
macroalgae, such as of the kelp Macrocystis pyrifera;
color changes in surface waters; and the accumulation
of foam in the surface layer (Valle-Levinson et al.,
2006). The high abundance of M. rosea copepodits
(1,000-10,000 ind 5 Mhd-1) found at some stations of
the present study, especially near Dawson Island, could
be due to the presence of frontal zones, especially when
considering the wide differences in abundances
between stations or, as previously described, the deep
sill in the Whiteside Channel (Palma et al., 2014b).
Analyses of other meteorological, oceanographic,
and topographic variables are needed to fully explain
the abundance and spatial distribution patterns of the
Magellan neuston (Owen, 1989), knowledge which is
relevant to determining the aggregation, dispersal, and
transport of small plankton in this pelagic environment.
The high concentration of neustonic biomass, and of M.
rosea in particular, near Dawson Island, may be due to
the island wake effect and a coast predominantly
protected from spring winds (Mann & Lazier, 1991),
and future neuston sampling programs should be
established for this area. Further related to the
importance of Dawson Island, temperature, salinity,
and dissolved oxygen content data from the present
study showed uniform spatial distributions, but total
neuston biomass and abundance, as well as Microsetella abundance, showed a clumped spatial
distribution around this island. These contrasting
distributions between environmental factors and
neuston communities indicate that around Dawson
Island may dominate processes of planktonic
aggregation.
Apart from depth, another aspect that could explain
the spatial pattern of Microsetella copepodits is the
spatial distribution of chlorophyll-a. Indeed, four stages
of chlorophyll production have been detected along the
western margin of the Magellan Strait (Hamamé &
Antezana, 1999) in relation to salinity, temperature, and
water column stratification. These stages are as
follows: i) the Paso Ancho microbasin and Magdalena
Sound area, with a shallow chlorophyll maximum (≈5
mg m-3 at 0-20 m) in a vertically homogeneous cold and
brackish water column; ii) the Magdalena, Cockburn,
and Brecknock Channels area, with relatively low
chlorophyll concentrations (2-3 mg m-3 at 0-50 m),
minor salinity stratification and a surface lens of
warmer water directly influenced by the Pacific Ocean;
iii) the Ballenero Channel and western arm of the
Magellan Strait, with high chlorophyll concentration in
the subsurface layer (>4 mg m-3) and a vertically
stratified water column with two salinity layers and
three temperature layers; and iv) the Beagle Channel
area, with maximum subsurface chlorophyll concentrations (>4 mg m-3) extending to the ocean floor and
vertically homogeneous salinity and temperature
distribution. In the present study, maximum M. rosea
abundance was recorded in the Paso Ancho microbasinMagdalena Sound area, including in the zone of
Froward Cape (Fig. 3), where there is a shallow
chlorophyll maximum, a vertically homogeneous cold
and brackish water column.
Another aspect that should be considered is the
ability of M. rosea and other members of the same
genus to preserve the normal behaviors of harpacticoid
584
9
Figure 4. Temperatures and salinities recorded for the neustonic layer along the western Magellan coast. These data were
used to determine the oceanographic requirements of Microsetella rosea copepodits. Abundances are expressed as ind 5
Mhd-1 (minutes of horizontal dragging). The average temperature and salinity of the neustonic layer in the study area were
7.2 ± 0.6°C and 30.7 ± 0.9, respectively.
copepods that inhabit the benthos. Recently, Pacheco et
al. (2013) detected two Microsetella species in subtidal
soft bottom zones of northern Chile. These species
emerge from the sediment into the water column, a
process defined as diel migration. Therefore, it is
possible that spatial variations in the Magellan
abundance of the copepod M. rosea could be affected
by sampling time (day/night), wide of channels and
bathymetry. Indeed, the M. rosea neuston population in
Magellan waters could be supplied by shallower waters
through horizontal transport due to the deepest of each
microbasin (Valdenegro & Silva, 2003; Palma et al.,
2014b).
Applications of the Magellan neustonic studies
In the present study, no direct relationship between
salinity and M. rosea abundance was observed, a
situation possibly associated with low local variability
in temperature and salinity. Cañete et al. (2013)
demonstrated a positive and significant lineal relationship between neuston biomass and salinity (5-33 range)
and abundance in southern Chile. Furthermore Johan et
al. (2012) detected that the spatial distribution of
copepods follows the salinity gradient in the tropical
estuary of the Perai River, Malaysia. The neuston could
be an important monitoring tool to track the flow of
585
10
estuarine, brackish waters into the inner channels of
southern Chile (Palma et al., 2014a).
The actual spatial pattern of the estuarine neuston
communities from Magellan waters could be modified
if global warming directly affects the rate of melting ice
and rainy conditions along the southern Chilean coast,
and specifically affect to stenohaline species such as M.
rosea. Therefore, a permanent monitoring of subantarctic
neustonic communities is highly recommended.
ACKNOWLEDGEMENTS
The authors would like to thank the Servicio
Hidrográfico y Oceanográfico (SHOA), Chilean Navy,
the financial support grant by CONA C16F 10-014, the
assistance given by the crew of RV Abate Molina, and
the Instituto de Fomento Pesquero, Chile (IFOP) for
providing the facilities necessary for collecting neuston
samples. We would also like to thank GAIA Antártica
(MAG1203), Contract MINEDUC-UMAG, for assisting in the translation of the original manuscript.
Special thanks are also given to the UMAG Research
Grant N° PR-F2-01CRN-12, CIMAR 18 and CIMAR
20 Programs for providing partial funds supporting the
publication of this study. We also thank Ms. Sc. Jaime
Ojeda for collecting the neuston samples.
REFERENCES
Aguirre, G.E., F.L. Capitanio, G.A. Lovrich & G.B. Esnal.
2012. Seasonal variability of metazooplankton in
coastal sub-Antarctic waters (Beagle Channel). Mar.
Biol. Res., 8: 341-353.
Alldredge, A.L. 1972. Abandoned larvacean houses: a
unique food source in the pelagic environment.
Science, 177: 885-887.
Anraku, M. 1975. Microdistribution of marine copepods
in a small inlet. Mar. Biol., 30: 79-88.
Antezana, T. 1999. Hydrographic features of Magellan
and Fuegian inland passages and adjacent SubAntarctic waters. Sci. Mar., 69(Suppl. 1): 23-34.
Biancalana, F., M.S. Barría de Cao & M.S. Hoffmeyer.
2007. Micro and mesozooplankton composition
during winter in Ushuaia and Golondrina bays (Beagle
Channel, Argentina). Braz. J. Oceanogr., 55: 83-95.
Boltovskoy, D. 1999. South Atlantic zooplankton.
Backhuys, Publishers, Leiden, 1706 pp.
Boxshall, G.A. 1979. The planktonic copepods of the
northeastern Atlantic Ocean: Harpacticoida, Siphonostomatoida, and Mormoniloida. Bull. Brit. Mus. Nat.
Hist. (Zool.), 35: 201-264.
Calef, G.W. & G.D. Grice. 1966. Relationship between
the blue-green alga Trichodesmium thiebautii and the
copepod Microsetella gracilis in the plankton of South
America. Ecology, 47: 855-856.
Cañete, J.I., C.S. Gallardo, T. Césped, C.A. Cárdenas &
M. Santana. 2012a. Encapsulated development,
spawning and early veligers of the ranellid snail
Fusitriton magellanicus (Röding, 1798) in the cold
waters of the Magellan Strait, Chile. Lat. Am. J. Aquat.
Res., 40(4): 914-928.
Cañete, J.I., M. Palacios & C.A. Cárdenas. 2012b.
Presencia de Cistenides elhersi Hessle, 1917 (Polychaeta:
Pectinariidae) en aguas someras magallánicas habitadas
por praderas de Ruppia filifolia: evidencia de euribatía,
eurihalinidad y euritermia? An. Inst. Pat. Chile, 40:
125-139.
Cañete, J.I., M.S. Romero, T. Figueroa & F. Ovando.
2013. Biodiversidad, abundancia y estructura comunitaria del neuston recolectado en el crucero Cimar 18
Fiordos (CONA C18F 12-04). Resumen Informes
Preliminares, Comité Oceanográfico Nacional, Valparaíso, pp. 47-62.
Conte, M.H., J.C. Weber & N. Ralph. 1998. Episodic
particle flux in the deep Sargasso Sea: an organic
geochemical assessment. Deep-Sea Res. I, 45: 18191841.
Daniel, W.W. 2000. Bioestadística. Bases para el análisis
de las ciencias de la salud. Editorial Uteha Noriega,
México, 3: 878 pp.
Davies, C.H. & A.S. Slotwinski. 2012. Microsetella
norvegica (Boeck, 1865). IMOS-integrated marine
observing system, CSIRO, Australia, Plate 1-2.
[http://www.imas.utas.edu.au/zooplankton/references].
Reviewed: 5 March 2016.
Defren-Janson, K., S.B. Schnack-Schiel & C. Richter.
1999. Mesozooplankton communities in the Magellan
region. Sci. Mar., 63: 43-50.
Downing, J.A. 1991. Biological heterogeneity in aquatic
ecosystems. In: J. Kolasa & S.T.A. Pickett (eds.).
Ecological heterogeneity. Springer-Verlag, New York,
pp. 160-180.
Dugas, J.C. & J.A. Koslow. 1984. Microsetella norvegica:
a rare report of a potentially abundant copepod on the
Scotian shelf. Mar. Biol., 84: 131-134.
Gallardo, C.S., D. Haro, C. Wagner, O. Garrido & J.I.
Cañete. 2012. Egg laying behavior and intracapsular
development of Argobuccinum pustulosum (Gastropoda: Ranellidae) in temperate waters at the south
coast of Chile. Mar. Biol. Res., 8: 815-828.
Garçon, V., A. Oschlies, S. Doney, D. McGillicuddy & J.
Waniek. 2001. The role of mesoscale variability on
plankton dynamics. Deep Sea Res. II, 48: 2199-2226.
Green, E.P. & M.J. Dagg. 1997. Mesozooplankton association with medium to large marine snow aggregates
in the northern Gulf of Mexico. J. Plankton Res., 19:
435-447.
Guglielmo, R., M.C. Gambi, A. Granata, L. Guglielmo &
R. Minutoli. 2014. Composition, abundance and
distribution of holoplanktonic polychaetes within
the Strait of Magellan (southern America) in austral
summer. Polar Biol., 37: 999-1015.
Hamamé, M. & T. Antezana. 1999. Chlorophyll and
zooplankton in microbasins along the Magellan StraitBeagle Channel passage. Sci. Mar., 63(Suppl.1): 3542.
Hardy, J.T. 1991. Where the sea meets the sky. The
ocean’s skin is the richest, most extensive habitat of
all. Nat. Hist., Am. Mus. Nat. Hist., pp. 1-3.
Hardy, J.T. 2005. Biological effects of chemicals in the
sea-surface microlayer. In: P.S. Liss & R.A. Duce
(eds.). The sea surface and global change. Cambridge
University Press, Cambridge, pp. 339-370.
Hays, G.C., A.J. Richardson & C. Robinson. 2005.
Climate change and marine plankton. Trends Ecol.
Evol., 20: 337-344.
Hulbert, S.H. 1990. Spatial distribution of the montane
unicorne. Oikos, 58: 257-271.
Johan, I., W.O. Wasnah, M. Mashhor, M.K. Abu Hena &
S.M.N. Amin. 2012. Spatial distribution of copepods
along the salinity gradient of Perai River Estuary,
Penang, Malaysia. Pak. J. Biol. Sci., 15: 647-652.
Koski, M., E.F. Møller, M. Maar & A.W. Visser. 2007.
The fate of discarded appendicularian houses:
degradation by the copepod, Microsetella norvegica,
and other agents. J. Plankton Res., 29: 641-654.
Kršinić, F. 1998. Vertical distribution of protozoan and
microcopepod communities in the South Adriatic Pit.
J. Plankton Res., 20: 1033-1060.
Kršinić, F. & B. Grbeco. 2012. Spatial distribution of
copepod abundance in the epipelagic layer of the south
Adriatic Sea. Acta Adriat., 53: 57-70.
Ludwig, J.A. & J.F. Reynolds. 1988. Statistical ecology: a
primer on methods and computing. John Wiley and
Sons, New York, 354 pp.
Mann, K.H. & J.R. Lazier. 1991. Dynamics of marine
ecosystems: biological-physical interactions in the
oceans. Blackwell, Massachusetts, 466 pp.
Marín, V.H. & T. Antezana. 1985. Species composition
and relative abundance of copepods in Chilean fjords.
J. Plankton Res., 7: 961-966.
Marín, V.H. & L.E. Delgado. 2001. La taxocenosis de
copépodos calanoídeos en los canales magallánicos:
un patrón anidado. Cienc. Tecnol. Mar, 24: 81-89.
Mazzocchi, M.G., G. Zagami, A. Ianora, L. Guglielmo, N.
Crescenti & J. Huré. 1995. Copepods. In: L.
586
11
Guglielmo & A. Ianora (eds.). Atlas of marine zooplankton straits of Magellan. Springer-Verlag, Berlin,
253 pp.
O’Neil, J.M. 1998. The colonial cyanobacterium
Trichodesmium as a physical and nutritional substrate
for the harpacticoid copepod Macrosetella gracilis. J.
Plankton Res., 20: 43-59.
Ohtsuka, S., S. Ohaye, A. Tanimura, M. Fukuchi, H.
Hattori, H. Sasaki & O. Matsuda. 1993. Feeding
ecology of copepodid stages of Eucalanus bungii in
the Chukchi and northern Bering Seas in October
1988. Proceeding of the NIPR Symposium Polar
Biology, 6: 27-37.
Owen, R.W. 1989. Microscale and finescale variations of
small plankton in coastal and pelagic environments. J.
Mar. Res., 47: 197-240.
Pacheco, A.S., G.E. Gómez & J.M. Riascos. 2013. First
records of emerging benthic invertebrates at a
sublittoral soft-bottom habitat in northern Chile. Rev.
Biol. Mar. Oceanogr., 48: 387-392.
Palma, S. & K. Kaiser. 1993. Plancton marino de aguas
chilenas. Ediciones Universitarias de Valparaíso,
Valparaíso, 151 pp.
Palma, S., M.C. Retamal, N. Silva & C. Silva. 2014a.
Horizontal and vertical distributions of siphonophores
in relation to oceanographic conditions in Chilean
Patagonian fjords. Sci. Mar., 78: 339-351.
Palma, S., P. Córdova, N. Silva & C. Silva. 2014b.
Biodiversity and spatial distribution of medusae in the
Magellan Region (Southern Patagonian Zone). Lat.
Am. J. Aquat. Res., 42(5): 1175-1188.
Razouls, C., F. de Bovée, J. Kouwenberg & N.
Desreumaux. 2005-2014. Diversity and geographic
distribution of marine planktonic copepods. Available
at [http://copepodes.obs-banyuls.fr/en]. Reviewed: 20
December 2014.
Rodríguez, C.A., H.I. Browman, J.-F. St-Pierre. 2000.
High survival of neustonic zoea I larvae of american
lobster Homarus americanus following short-term
exposure to ultraviolet (280 to 400 nm). Mar. Ecol.
Prog. Ser., 193: 305-309.
Sabatini, M. & T. Kiørboe. 1994. Egg production, growth
and development of the cyclopoid copepod Oithona
similis. J. Plankton Res., 16: 1329-1351.
Scheltema, R.S. 1986. Long-distance dispersal by
planktonic larvae of shoal-water benthic invertebrates
among Central Pacific islands. Bull. Mar. Sci., 39:
241-256.
Tokioka, T. & R. Bieri. 1966. Juveniles of Microsetella
gracilis (Dana) from the clumps of Trichodesmium in
the vicinity of Seto. Publ. Seto Mus. Biol. Lab., 14:
275-282.
587
12
Upstill-Goddard, R.C., T. Frost, G.R. Henry, M. Franklin,
J. Colin Murrell & N.J.P. Owens. 2003. Bacterioneuston
control of air-water methane exchange determined
with a laboratory gas exchange tank. Global
Biogeochem. Cicle., 17: 19-15.
Uye, S. & D. Liang. 1998. Copepods attain high
abundance, biomass and production in the absence of
large predator but suffer cannibalistic loss. J. Mar.
Syst., 15: 495-501.
Uye, S. & K. Sano. 1998. Seasonal variation in biomass,
growth rate and production rate of the small cyclopoid
copepod Oithona davisae in a temperate eutrophic
inlet. Mar. Ecol. Prog. Ser., 163: 37-44.
Uye, S., I. Aoto & T. Onbé. 2002. Seasonal population
dynamics and production of Microsetella norvegica, a
widely distributed but little studied marine planktonic
harpacticoid copepod. J. Plankton Res., 24: 143-153.
Valdenegro, A. & N. Silva. 2003. Caracterización
oceanográfica física y química de la zona de canales y
fiordos australes de Chile entre el estrecho de
Magallanes y cabo de Hornos (Cimar 3 Fiordos).
Cienc. Tecnol. Mar, 26: 19-60.
Received: 18 August 2015; Accepted: 5 May 2016
Valle-Levinson, A., J.L. Blanco & M. Frangopulos. 2006.
Hydrography and frontogenesis in a glacial fjord off
the Strait of Magellan. Ocean Dynamics, 56: 217-227.
Yamazi, I. 1956. Plankton investigation in inlet waters
along the coast of Japan. XIX Regional characteristics
and classification of inlet waters based on the plankton
communities. Publ. Seto Mar. Biol. Lab., 5: 24-64.
Zaitsev, Y. 2005. Neuston of seas and oceans. In: S.P. Liss
& R.A. Duce (eds.). The sea surface and global
change. Cambridge University Press, Cambridge, pp.
371-382.
Jersey, 663 pp.
Zervoudaki, S., E.D. Christou, T.G. Nielsen, I. SiokouFrangou, G. Assimakopoulou, A. Giannakourou, M.
Maar, K. Pagou, E. Krasakopoulou, U. Christaki & M.
Moraitou-Apostolopoulou. 2007. The importance of
small-sized copepods in a frontal area of the Aegean
Sea. J. Plankton Res., 29: 317-338.
Lat. Am. J. Aquat. Res., 44(3): 588-594, 2016 Compensatory growth after long term storage in nursery
588
1
Research Article
Long term storage and the compensatory growth of white shrimp
Litopenaeus vannamei in aquaculture ponds
Geraldo Fóes1, Dariano Krummenauer1, Gabriele Lara1
Luis Poersch1 & Wilson Wasielesky Jr.1
1
Laboratório de Carcinocultura, Instituto de Oceanografia, Universidade Federal do Rio Grande
Rio Grande, Brasil
Corresponding author: Geraldo Fóes (geraldofoes@gmail.com)
ABSTRACT. Effects of shrimp confinement in a situation of high density stocking in a long term nursery on
their growth performance in grow out ponds. Were analized two nurseries with a density of 2000 shrimp m-2
were stocked at two different times. The first nursery (LTN) lasted 144 days, and the SGR of the animals was
3.0% day-1. The second nursery (STN) lasted 18 days and the specific growth rate (SGR) was 19.9% day-1. On
the same day, shrimps were transferred to six lined ponds at a density of 20 shrimp m-² where they remained for
101 days. In the first biometry, the SGR in the LTN treatment, increased to 6.7% day-1 and in the STN it
decreased to 5.0% day-1. At the end, shrimps of the LTN and STN treatments reached weights of 8.46 and 6.72
g and had productivities of 1287 and 1015 kg ha-1, respectively. Shrimps reared in nurseries for long periods
showed growth and survival rates similar to those obtained using conventional management practices in grow
out structures.
Keywords: Litopenaeus vannamei, culture density, grow-out, long confinement, subtropical shrimp culture.
Almacenamiento a largo plazo y el crecimiento compensatorio de camarón blanco
Litopenaeus vannamei en estanques de acuicultura
RESUMEN. Se analizó el efecto del confinamiento de camarones en una situación de alta densidad de población
en una pre-engorda, sobre su crecimiento a largo plazo en los estanques de engorde. Dos estanques de preengorda con densidad de 2,000 camarones m-2 fueron sembrados en dos momentos diferentes. La primera
crianza de largo plazo (LTN) duró 144 días, y la tasa de crecimiento específico (SGR) de los animales fue 3,0%
día-1. La segunda crianza de corto plazo (STN) duró 18 días y el SGR fue 19,9% día -1. En el mismo día, los
camarones fueron trasladados a seis estanques en una densidad de 20 camarones m-², donde permanecieron
durante 101 días. En la primera biometría, la SGR en el tratamiento LTN aumentó a 6,7% día -1 y STN disminuyó
a 5,0% día-1. Al final, los camarones de los tratamientos LTN y STN llegaron a 8,46 y 6,72 g con productividad
de 1.287 y 1.015 kg ha-1, respectivamente. Los camarones cultivados en pre-engorda durante largos períodos
presentaron crecimiento y supervivencia similares a los obtenidos mediante prácticas de manejo convencionales
en los estanques de engorda.
Palabras clave: Litopenaeus vannamei, densidad de cultivo, engorde, confinamiento prolongado, acuicultura
subtropical.
INTRODUCTION
In aquaculture farms, there is a constant need to
improve stocking techniques that encourage the storage
of larger and healthier juveniles. One of these
techniques consists in the management of post-larvae in
nurseries for a certain time period and later transferring
juveniles to grow out structures (Garza de Yta et al.,
__________________
Corresponding editor: Eduardo Ballester
2004). The use of nurseries allows the storage of larger
shrimps, which are more tolerant to environmental
changes, in ponds, resulting in higher growth rates and
also reducing the period of culture (Sturmer et al.,
1992; Cohen et al., 2005; Cavalli et al., 2008; Mishra
et al., 2008). In addition, another advantage is an
increase in the favorable period for shrimp culture in
the subtropics, where it is typically limited due to seaso-
2589
nal low temperatures in these areas. The increase of this
period takes place with the storage of early post-larvae
in tanks inside greenhouses, which enables the transfer
of larger animals to the ponds for growth when
temperatures are more appropriate (Kumlu et al.,
2010). The reduction in time needed for grow out could
increase the number of harvests, as well as extend the
duration of grow out in a single crop; in both cases there
is the potential for incremental productivity. In
addition, this procedure enhances biosecurity because
it has been recognized as an important tool in
minimizing the risk of disease introduction and
reducing mortality in farms already infected (Samocha
et al., 2000; Fegan & Clifford, 2001).
Shrimps usually remain in nurseries for 10 to 25
days (Stern & Letellier, 1992) in some cases, up to 71
days (Mishra et al., 2008). In this period, it is
recommended that the animals are fed at frequent
intervals and the water quality parameters are strictly
monitored. However, situations may occur in which the
permanence of juvenile shrimps for more prolonged
periods in nurseries is required. There are some
problems, such as the reduction of growth for shrimp
that are still in grow out ponds (low temperatures, high
stocking densities), commercialization problems of
shrimps ready for sale, structural problems in the
facilities, the occurrence of disease in ponds, and
stocking juveniles to overwinter.
There is another interesting issue in terms of farm
management as a result of the use of nurseries. During
the first weeks after transfer to grow out ponds, it is
usual that shrimp present high growth values. This is
known as "compensatory growth," a term used to
describe situations in which organisms achieve
accelerated growth after suffering some stressful factor,
such as starvation, food and protein restriction, or
hypoxia, and then returning to their normal condition,
(Wilson & Osbourn, 1960; Wu et al., 2001; Ali et al.,
2003; Zeigler, 2012). Since the 1970s, studies on
compensatory growth in aquatic animals have been
intensified because in addition to its ecophysiological
importance, there are also implications for aquaculture.
For example, the possibility to decrease the amount of
food supplied resulting in a reduction in the cost of
purchasing inputs and manpower, as well as a reduction
in effluent emissions during the period of restricted
food (Jobling et al., 1994; Hayward et al., 1997).
However, although there are several studies on this
theme, the most common target species are fish (Wilson
& Osbourn, 1960; Jobling et al., 1994; Ali et al., 2003),
while only a few studies use shrimps (Wu et al., 2001;
Wei et al., 2008; Wasielesky et al., 2013).
The present study was conducted to analyze the
possibility of compensatory growth of L. vannamei
stocked in grow out ponds after a short and long period
time nursery phase.
The experiment was conducted in the facilities of the
Marine Station of Aquaculture, Institute of Oceanography of Federal University of Rio Grande (FURG),
Rio Grande do Sul, Brazil (32°12'15"S, 52°10'41"W).
The experimental period lasted 245 days and was
carried out in two steps - the nursery phase and the
grow-out phase. In the first step, post-larvae (PL20)
were stocked in two different seasons: winter, during
which the shrimps were maintained for 144 days
(treatment (LTN) 'Long Term Nursery'); and spring in
which post-larvae (PL20) were maintained for 18 days
(treatment (STN) ‘Short Term Nursery’). For this
phase, two tanks (area of 20 m²) in a greenhouse were
used; the stocking density was 2000 shrimp m-², the
water exchange was 25% per day and the animals were
fed ad libitum using commercial extruded feed (40%
crude protein, 10% humidity, 7.5% ethereal extract,
5.0% fibrous matter, 13% mineral matter).The feed
were supplied in feeding trays to evaluate and correct
the amount of food to be provided. In the second step,
shrimps from both nurseries were transferred to six
HDPE lined ponds, each pond with an area of 600 m²
and average depth of 1.0 m, with a stocking density of
20 shrimp m-². The grow-out period in the ponds lasted
101 days.
The temperature, dissolved oxygen, salinity and pH
were monitored daily using the YSI 556 multiparameter
device. The water transparency was measured every
three days using a Secchi disk. Total ammonia nitrogen
(UNESCO, 1983) was sampled weekly. The water
exchange in the ponds was 1.0% per day. Commercial
extruded feed (35% crude protein, 10% humidity, 7.5%
ethereal extract, 5.0% fibrous matter, 13% mineral
matter) was provided twice a day. The feeding rate was
equivalent to 4.0% of the estimated biomass in the first
half of the experiment and 3.0% in the final half; also a
tray was used for feed control and to observe the shrimp
in ponds. Samples were collected every 14 days for
evaluation of shrimp growth. After each sample, the
amount of feed was adjusted according to the mean
weight and the estimated biomass. In the final sample,
average weights, weekly growth rate, survival rate,
productivity, specific growth rates (SGR) and feed
conversion rate (FCR) were determined.
The specific growth rate was calculated using the
following formula:
SGR (% day-1) = 100 x (ln WF – ln WI)/T
Compensatory growth after long term storage in nursery
where, WF e WI are the live final weight and initial
weight (g) of shrimps inside a time interval (days).
The feed conversion rate was calculated using the
following formula:
FCR = amount of feed/total biomass produced
The data were analyzed using the Student-t test,
where (P < 0.05) values were considered indicative of
significant differences. All tests were conducted after
confirmation of normal distribution of the data
(Kolmogorov-Smirnov's test) and homoscedasticity of
variances (Levene's test). Before analysis of shrimp
survival, the data were transformed into arcsine square
root values.
Grow-out period
The average values of the water quality parameters did
not differ significantly (P > 0.05) between treatments.
Values are shown in Table 2. The results of the
zootechnical performance of shrimps in LTN and STN
treatments are shown in Table 3. In the first phase
(nursery), the shrimps had lower growth rates, mainly
due to the high densities supported. In the second phase,
the shrimps were transferred to grow out ponds, which
resulted in higher growth values (Fig. 1). The values of
the specific growth rate (SGR) in the treatments during
the experimental period (nursery and grow-out) are
shown in Figure 2.
DISCUSSION
RESULTS
Nursery period
The average temperature of the water in the LTN
nursery was 18.9°C (9.5°C minimum and 24.1°C
maximum). The average temperature of the water in the
STN treatment was 22.9°C (21.3°C minimum and
24.1°C maximum). The salinities of the LTN and STN
treatments were 28.2 and 29.0, respectively. There were
no significant differences (P > 0.05) between
treatments. The average pH values of the LTN and the
STN treatments were 7.70 and 7.85, respectively. No
significant differences (P > 0.05) were observed
between treatments. The average values of ammonia in
the LTN and STN treatments were 0.45 and 0.31,
respectively. Additionally, no significant differences (P
> 0.05) were found. The results of the zootechnical
performances obtained during the nursery phase for
both treatments are shown in Table 1.
Table 1. Days in the nursery, average initial and final
weights, survival rates, weekly growth, and specific
growth rates (SGR), productivity and feed conversions
apparent of Litopenaeus vannamei post-larvae in
treatment long term nursery (LTN) and short term nursery
(STN).
Nursery days
Initial average weight (g)
Final average weight (g)
Survival (%)
Weekly growth (g)
SGR (% day-1)
Productivity (kg m-²)
Feed conversion rate
5903
Nursery period
LTN STN
144
18
0.008 0.010
0.600 0.360
79.7
93.0
0.03
0.14
2.98 19.91
0.96
0.67
1.5
1.3
Nursery period
Throughout the nursery period, the water quality
parameters, except for temperature, were maintained
within the ideal ranges for growth and survival of L.
vannamei (Van Wik & Scarpa, 1999). Studies have
shown that temperature affects the behavior of penaeid
shrimp in subtropical areas. During the winter, shrimp
become lethargic and remain buried in the substrate
most of the time; this behavior reduces their food intake
and growth rate (Soares et al., 2012). Analyzing the
effect of temperature on the larval development of
shrimp Farfantepenaeus californiensis, Villarreal &
Llamas (2005) concluded that the duration of each
larval stage was inversely related to temperature.
Kumlu & Kir (2005) evaluating food consumption for
shrimp P. semisulcatus in relation to molt stage and
survival during winter, observed a trend of reduced
specific growth rate (SGR) with the decrease of
temperature. In the current study, the difference in SGR
between the two treatments clearly demonstrates the
influence of a high stocking density but is primarily
heightened by the low temperatures, which contribute
to the low growth of shrimp in the LTN treatment
compared to the STN treatment.
In nurseries, the survival must be higher than 70%
to ensure that this strategy is effective (Stern &
Letellier, 1992; Sturmer et al., 1992; Moss & Moss,
2004). However, high stocking densities in nurseries
tend to negatively affect the growth and survival of
shrimps. The crowding associated with high stocking
densities generates adverse behaviors, such as
aggression and cannibalism that rapidly degrade water
quality and increase the accumulation of undesirable
sediments (Kumlu & Kir, 2005). The shrimps in the
STN treatment remained stocked for just 18 days and
this resulted in a higher survival rate. Nevertheless, the
survival of the shrimps in treatment LTN was high,
4591
Table 2. Average values (±standard deviation) of water quality parameters of ponds stocked with Litopenaeus vannamei
for long term nursery (LTN) and short term nursery (STN) treatments during the grow-out period. There were no significant
differences between treatments (P > 0.05).
Morning temperature (°C)
Afternoon temperature (°C)
Morning dissolved oxygen (mg L-1)
Afternoon dissolved oxygen (mg L-1)
pH morning
pH afternoon
Salinity
Transparency (cm)
Total ammonia (mg L-1)
Table 3. Results of zootechnical performance of shrimps:
grow out days, initial and final weight, survival, weekly
growth, specific growth rate (SGR), productivity and
apparent feed conversion of Litopenaeus vannamei in long
term nursery (LTN) and short term nursery (STN)
treatments in the grow-out period. *Superscript (a and b)
indicate significant differences (P < 0.05).
Initial weight (g)
Final weight (g)
Survival (%)
Weekly growth (g)
SGR (% day-1)
Productivity (kg ha-1)
Feed conversion rate
Grow out period
LTN
STN
0.60 ± 0.31 0.36 ± 0.09
8.46 ± 1.56a 6.72 ± 1.42b
76.0 ± 9.3
75.9 ± 14.0
0.54 ± 0.3
0.42 ± 0.3
2.62 ± 0.3
2.90 ± 0.05
1287a ± 182 1015b ± 125
1.66 ± 0.14
1.50 ± 0.07
especially in light of the longer confinement time and
the low temperatures noted in this treatment.
Grow out period
The values of water quality registered did not differ
significantly (P > 0.05) between treatments and
apparently did not affect shrimp growth in the grow-out
period because the growth rates remained within the
optimal range for penaeid shrimp (Van Wyk & Scarpa,
1999).
Several advantages are related to the use of
nurseries (Garza de Yta et al., 2004). However, there is
little information about the effect of the time of shrimp
permanence in the nursery and subsequent performance
in the grow-out period. In this study, at the time of
transfer from the nursery to the grow-out ponds, the
average shrimp weights were significantly different (P
< 0.05) between the treatments. However, there is a
common practice of using animals with a wide size
range in specific experiments. For example, Williams
LTN
24.9 ± 1.6
27.2 ± 1.8
5.76 ± 2.17
8.19 ± 2.45
7.99 ± 0.21
8.12 ± 0.18
34 ± 2.5
45 ± 21
0.46 ± 0.32
STN
24.8 ± 1.6
27.4 ± 1.7
5.81 ± 1.56
8.18 ± 1.54
8.14 ± 0.27
8.29 ± 0.23
36 ± 2.4
51 ± 27
0.52 ± 0.46
et al. (1996) comparing the growth of shrimps Penaeus
setiferus and P. monodon in ponds have used average
initial weights of 0.24 and 0.12 g, respectively. Garza
de Yta et al. (2004) compared the performance of
shrimps that were stocked directly with shrimps that
remained 10 and 20 days in nurseries. Zelaya et al.
(2007), comparing the growth of L. vannamei juveniles
stocked at three different ages, simultaneously
populated shrimps with initial weights of 0.001 g
(direct stocking), 0.01 g (14 days in a nursery) and
0.016 g (21 days in a nursery). In the present study,
although the average weight was smaller in the STN
treatment, the values of weekly growth and specific
growth rate (SGR) were higher at the time of transfer,
demonstrating that density and prolonged culture time
strongly affected the growth of shrimp in the LTN
treatment.
The survival rates of shrimp in both treatments did
not show significant differences (P > 0.05). Barbieri &
Ostrensky (2002) reported a survival rate of
approximately 65% in L. vannamei commercial pond
farming in Brazil. In this study, the feed conversion
rates did not show statistically significant differences
between LTN and STN treatments (1.66 and 1.50,
respectively).
In semi-intensive production systems, the values of
weekly growth can vary between 0.80 g to 0.94 g
(Sandifer et al., 1993; Garza de Yta et al., 2004). In the
same ponds used in this work, Peixoto et al. (2003),
comparing growth between species, achieved average
weekly growth of 0.84 g for L. vannamei and 0.78 g for
Farfantepenaeus paulensis using stocking densities of
15 shrimp m-². In the present study, the weekly growth
rates in both treatments were lower than the values
reported above. The lower growth may be due to
temperature values lower than the ideal (between 28
and 32°C) (Van Wik & Scarpa, 1999). However, during
the first weeks after the transfer, growth rates were
592
5
Figure 1. Shrimp growth in LTN (long term nursery) and STN (short term nursery) treatments during the complete
experimental period. The arrow indicates the day of transfer from nursery to grow out ponds (day 144°).
Figure 2. Specific growth rates (SGR) of Litopenaeus
vannamei in treatments LTN (long term nursery) and STN
(short term nursery) during the experimental period
(nursery and grow out). *The SGR of day 0 (zero)
corresponds to the average values during the nursery
period for each treatment.
higher than average, especially in the LTN treatment
(weekly growth of 1.0 g in the first month after
transfer). This high growth rate suggests that this
species achieved compensatory growth, a term used to
describe an acceleration of growth due to the return of
favorable conditions after a period of stress (food
restriction or some other unfavorable environmental
condition). Likewise, the growth can be identified as
being significantly higher than the growth in the STN
treatment, in which shrimp did not experience an
induced stressful condition (Jobling et al., 1994; Ali et
al., 2003; Nicieza & Alvarez, 2009). Moss et al. (2005)
in an experiment on partial harvests of L. vannamei at
high densities, achieved growth values of 0.95 g weekly
until the first harvest, after which there was a weekly
increas6e of 2.6 g for two weeks.
The specific growth rate (SGR) is a parameter
typically used to identify compensatory growth. For
example, Wu et al. (2001) used SGR in an experiment
on food restriction and refeeding and also in an
experiment on protein restriction of Fenneropenaeus
chinensis; Ostrensky & Pestana (2000) used SGR to
evaluate growth rates of F. paulensis in grow out
ponds; Kumlu & Kir (2005) used SGR to evaluate
growth and survival of Penaeus semisulcatus in
temperate climates.
The SGR values showed that the compensatory
growth occurred after the transfer from the nursery to
grow out ponds. The growth of shrimp in the long term
nursery was 2.1% day-1. The growth of shrimp in the
STN treatment was 19.9% day-1. However, in the first
biometry after the shrimps have been transferred to
ponds, the SGR value increased to 7.9% day-1 in the
LTN treatment. In the STN treatment, the SGR value
for the nursery was 19.9% day-1 and decreased to 7.7%
day-1 in first biometry in the ponds. From the second
biometry until the end of the experiment, daily growth
rates were similar between treatments. Normally, the
absolute growth rates and the weight percentage are
inversely proportional (Ostrensky & Pestana, 2000).
This was evident in the present study, especially in the
first biometry, when the compensatory growth was
observed in shrimps of the LTN treatment.
Generally, the values of accelerated growth
observed after a period of stress tend to decline to rates
typical of control animals (Ali et al., 2003). Wu et al.
(2001), studying the compensatory growth of F.
chinensis under food restriction, found that after
normalization of food supply the SGR of the treatment
with dietary restrictions increased significantly (P <
6593
0.05) compared to the control treatment. However, this
increase in growth lasted only ten days. This result may
have been determined by a physiological and
behavioral characteristic of shrimps -the ecdisys
activity. Bordner & Conklin (1981) have also detected
this phenomenon for Homarus americanus juveniles. In
crustaceans that have a large and inelastic exoskeleton,
growth is a discontinuous process. There is a succession
of molts (ecdisys) separated by intermolt periods
throughout the life cycle. Food consumption by shrimp
is greatly affected by pre and post molt phases, which
are characterized by loss of appetite before and after the
exchange of the exoskeleton (Hartnoll, 1982). Thus, it
seems reasonable to infer that the duration of the
compensatory growth response in this experiment was
discontinued due to this characteristic of "voluntary
starvation" during molt period.
The productivities were significantly different (P <
0.05) between treatments because the LTN treatment
achieved productivity 26% greater than the STN
treatment.
The results show an important capability of L.
vannamei juveniles; even after a long period of
confinement at high densities, when placed in a new
less stressful environment, the juveniles react and
present similar growth to individuals stocked in
conventional farming protocols. It was also observed
that storage in the nursery allows the maintenance of
shrimps for long periods of time at high stocking
densities, serving as a tool for reducing the growth rate
without increasing productivity too much. The results
confirm the possibility of maintaining shrimp in
nurseries and fractionation of storages over time and
achieve full compensatory growth.
ACKNOWLEDGEMENTS
The authors are grateful for financial support provided
by the National Council for Scientific and Technological Development (CNPq) and Coordination for the
Improvement of Higher Level Personnel (CAPES). W
Wasielesky and LH Poersch are CNPq research fellows.
REFERENCES
Ali, M., A. Nicieza & R.J. Wooton. 2003. Compensatory
growth in fishes: a response to growth depression. Fish
Fish., 4: 147-190.
Barbieri, R.C. & A. Ostrensky. 2002. Camarões marinhos,
engorda. Aprenda Fácil, Viçosa, 370 pp.
Bordner, C.E. & D.E. Conklin. 1981. Food consumption
and growth of juvenile lobsters. Aquaculture, 24: 285300.
Cavalli, R.O., T.G. Lehnen, M.T. Kamimura & W.F.
Wasielesky. 2008. Desempenho de pós-larvas do
camarão-rosa Farfantepenaeus paulensis alimentadas
com diferentes frequências durante a fase de berçário.
Acta Sci. Biol. Sci., 30(3): 231-236.
Cohen, J., T.M. Samocha, J.M. Fox, R.L. Gandy & A.L.
Lawrence. 2005. Characterization of water quality
factors during intensive raceway production of
juvenile Litopenaeus vannamei using limited
discharge and biosecure management tools. Aquacult.
Eng., 32(3-4): 25-442.
Fegan, D.F. & H.C. Clifford III. 2001. Health
management for viral diseases in shrimp farms. In:
C.L. Browdy & D.E. Jory (eds.). The new wave.
Proceedings of the Special Session on Sustainable
Shrimp Culture, Aquaculture 2001. World
Aquaculture Society, Baton Rouge, pp. 168-198.
Garza de Yta, A., D.B. Rouse & D.A. Davis. 2004.
Influence of nursery period on the growth and survival
of Litopenaeus vannamei under pond production
conditions. J. World Aquacult. Soc., 35(3): 357-365.
Hartnoll, R.G. 1982. The biology of crustacea. Growth. In:
D.E. Bliss (ed.). Academic Press, New York, 2: 111196.
Hayward, R.S., D.B. Noltie & N. Wang. 1997. Notes: use
of compensatory growth to double hybrid sunfish
growth rates. T. Am. Fish Soc., 126: 316-322.
Jobling, M., O.H. Meløy, J.D. Santos & B. Christiansen.
1994. The compensatory growth response of the
Atlantic cod: effects of nutritional history. Aquacult.
Int., 2: 75-90.
Kumlu, M. & M. Kir. 2005. Food consumption, molting
and survival of Penaeus semisulcatus during overwintering. Aquacult. Res., 36: 137-143.
Kumlu, M., M. Kir, Ö. Yilmaz, M. Göçer & O.T.
Eroldoğan. 2010. Growth of over-wintered and preseasonally produced post-larvae of Penaeus semisulcatus in the subtropics. Turk. J. Fish Aquat. Soc., 10:
269-276.
Mishra, J.K., T.M. Samocha, S. Patnaik, M. Speed, R.L.
Gandy & A.M. Ali. 2008. Performance of an intensive
nursery system for the pacific white shrimp, Litopenaeus vannamei, under limited discharge condition.
Aquacult. Eng., 38: 2-15.
Moss, K. & S. Moss. 2004. Effects of artificial substrate
and stocking density on the nursery production of
pacific white shrimp Litopenaeus vannamei. J. World.
Aquacult. Soc., 35(4): 536-542.
Moss, S.M., C.A. Otoshi & P. Leung. 2005. Bigger
shrimp: optimizing strategies for growing larger
Litopenaeus vannamei. Global Aquacult. Adv., 8: 6869.
Nicieza, A.G. & D. Àlvarez. 2009. Statistical analysis of
structural compensatory growth: how can we reduce
the rate of false detection? Oecologia, 159: 27-39.
Organización de las Naciones Unidas para la Educación,
la Ciencia y la Cultura (UNESCO). 1983. Chemical
methods for use in marine environmental monitoring.
Manual and guides. Vol. 12. Intergovernmental
Oceanographic Commission, Paris, 53 pp.
Ostrensky, A. & D. Pestana. 2000. Avaliação das taxas de
crescimento de Farfantepenaeus paulensis (PérezFarfante, 1967) em viveiros de cultivo. Arch. Vet. Sci.,
5: 5-15.
Peixoto, S., W.J. Wasielesky & L.J. Louzada. 2003.
Comparative analysis of pink shrimp Farfantepenaeus
paulensis and pacific white shrimp, Litopenaeus
vannamei, culture in extreme southern Brazil. J. Appl.
Aquacult., 14: 101-111.
Samocha, T.M., J. Cordova, T. Blacher & A. Wind. 2000.
High-density nursery of Litopenaeus vannamei in
white-spot infected area utilizing raceway system with
limited water discharge in Ecuador. Global Aquacult.
Adv., 3: 66-68.
Sandifer, P.A., J.S. Hopkins, A.D. Stokes & C.L. Browdy.
1993. Preliminary comparisons of the native Penaeus
setiferus and Pacific Penaeus vannamei white shrimp
for pond culture in South Carolina, USA. J. World
Aquacult. Soc., 24(3): 295-303.
Soares, R., S. Peixoto, A. Bianchini, R. Cavalli & W.
Wasielesky. 2012. Efeito da temperatura na sobrevivência, consumo alimentar e crescimento de póslarvas do camarão-rosa Farfantepenaeus paulensis.
Atlântica, 34(1): 23-30.
Stern, S. & E. Letellier. 1992. Nursery systems and
management in shrimp farming in Latin America. In:
J. Wyban (ed.). Proceedings of the Special Session on
Shrimp Farming. World Aquaculture Society, Baton
Rouge, pp. 106-109.
Sturmer, L.N., T.M. Samocha & A.L. Lawrence. 1992.
Intensification of penaeid nursery systems. In: A.W.
Fast & L.G. Lester (eds.). Culture of marine shrimp:
principles and practices. Elsevier Scientific Publishing, Amsterdam, pp. 321-344.
Received: 3 July 2015; Accepted: 16 May 2016
5947
Van Wik, P. & J. Scarpa. 1999. Water quality
requirements and management. In: P. Van Wyk, M.
Davis-Hodgkins, R. Laramore, J.K. Main, L. Mountain
& J. Scarpa (eds.). Farming marine shrimp in
recirculating freshwater systems. Florida Department of
Agriculture and Consumer Services, Tallahassee, pp.
141-162.
Villarreal, H. & A.H. Llamas. 2005. Influence of
temperature on larval development of Pacific brown
shrimp Farfantepenaeus californiensis. Aquaculture,
249: 257-263.
Wasielesky, W., C. Fróes, G.K. Fóes, D. Krummenauer,
G. Lara & L. Poersch. 2013. Nursery of Litopenaeus
vannamei reared in a biofloc system: the effect of
stocking densities and compensatory growth. J.
Shellfish Res., 32(3): 799-806.
Williams, A.S., D.A. Davis & C.R. Arnold. 1996.
Density-dependent growth and survival of Penaeus
setiferus and Penaeus vannamei in a semi-closed
recirculating system. J. World Aquacult. Soc., 27(1):
107-112.
Wilson, P.N. & D.F. Osbourn. 1960. Compensatory
growth after under nutrition in mammals and birds.
Biol. Rev., 35: 324-363.
Wei, L.Z., X.M. Zhang, J. Li & G.Q. Huang. 2008.
Compensatory growth of Chinese shrimp, Fenneropenaeus chinensis following hypoxic exposure.
Aquacult. Int., 16: 455-470.
Wu, L., S. Dong F. Wang X. Tian & S. Ma. 2001. The
effects of previous feeding regimes on the
compensatory growth response in Chinese shrimp,
Fenneropenaeus chinensis. J. Crustacean Biol., 21(3):
559-565.
Zeigler, T.R. 2012. Compensatory gains yield hidden
profits. Global Aquacult. Adv., 15: 18-19.
Zelaya, O., D.B. Rouse & D.A. Davis. 2007. Grow out of
Pacific white shrimp Litopenaeus vannamei stocked
into production ponds at three different ages. J. World
Aquacult. Soc., 38(1): 92-101.
Lat. Am. J. Aquat. Res., 44(3): 595-601, 2016
Metals in a shrimp hatchery
Research Article
Copper, zinc, cadmium and lead inputs and outputs in the maternity
section of a commercial shrimp hatchery
Rosalba N. Perea-Juárez,1 Martín G. Frías-Espericueta2
Federico Páez-Osuna3 & Doménico Voltolina4
1
Posgrado en Recursos Acuáticos, Universidad Autónoma de Sinaloa
Mazatlán, Sinaloa, México
2
Laboratorio de Estudios Ambientales, Facultad de Ciencias del Mar
Universidad Autónoma de Sinaloa, Mazatlán, Sinaloa, México
3
Unidad Académica Mazatlán, Instituto de Ciencias del Mar y Limnología
Universidad Nacional Autónoma de México, Mazatlán, Sinaloa, México
4
Laboratorio UAS-CIBNOR, Centro de Investigaciones Biológicas del Noroeste
Mazatlán, Sinaloa, México
Corresponding author: Doménico Voltolina (voltolin04@cibnor.mx)
ABSTRACT. The aim of this work was to determine the amounts of copper, zinc, cadmium and lead which
enter the tanks of the maternity section of a Mexican commercial hatchery, and those that are discharged to the
environment. The most important inputs of Cu were chemicals for water treatment and disease prevention, feeds
and the metal dissolved in influent water. Suspended solids and feeds were the two most important inputs of Zn,
and feeds and chemicals were the main sources of Pb and Cd. Most metal concentrations may be considered
safe for shrimp culture, but the concentrations of Cd of three formulated diets were close or above safe levels.
The annual 2013 output of this hatchery was approximately 1.3x109 post-larvae, and the estimated metals
discharged to the environment by the maternity section were 351 g of Cu, 1,190 g of Zn and 1.35 and 0.02 g of
Pb and Cd, respectively. The amounts of Pb and Cd are equivalent to those of the fertilizers spread on between
0.5 and 1.5 ha of the agricultural land of Sinaloa State.
Keywords: shrimp hatcheries, shrimp feeds, metal inputs, metal discharges, environmental impact.
Ingresos y descargas de cobre, zinc, cadmio y plomo en la sección de maternidad
de un laboratorio de producción comercial de postlarvas de camarón
RESUMEN. El objetivo de este estudio fue determinar las cantidades de cobre, zinc, cadmio y plomo que entran
a los estanques de la sección de maternidad en un laboratorio comercial de producción de postlarvas en México,
así como aquéllas descargadas al ambiente. Los principales ingresos de Cu fueron los productos químicos usados
en el tratamiento y prevención de enfermedades, alimentos y metal disuelto en el agua que ingresa. Los sólidos
suspendidos y los alimentos fueron los dos principales ingresos de Zn, mientras que los alimentos y los productos
químicos de los tratamientos fueron los principales ingresos de Pb y Cd. La mayoría de las concentraciones de
metales pueden ser consideradas como seguras para la producción de postlarvas de camarón, pero las
concentraciones de Cd de tres dietas formuladas estuvieron cercanas y por encima de los niveles de seguridad.
La producción anual de este laboratorio en el 2013 fue aproximadamente 1,3x109 post-larvas, y la descarga
estimada de metales al ambiente por la sección de maternidad fue de 351 g de Cu, 1,190 g de Zn y 1,35 y 0,02
de Pb y Cd, respectivamente, que es comparable a la cantidad de Cd y Pb usados para fertilizar entre 1,5 y 0,5
hectárea de la superficie agrícola del Estado de Sinaloa.
Palabras clave: producción de postlarvas, alimento, ingresos de metales, descargas de metales, impacto
ambiental.
__________________
Corresponding editor: Ricardo Prego
595
596
INTRODUCTION
Mexican commercial shrimp culture relies on hatcheryproduced post-larvae (PLs) and the Sinaloa State, with
more than 22 hatcheries, is the main supplier of this
commodity (Industria Acuícola, 2013). For their
operation, these hatcheries obtain water from natural
sources, such as wellpoints, artesian wells or nearby
water bodies, which may be significant metal sources.
Additionally, metals are contained in formulated
shrimp feeds (Lacerda et al., 2009; Soares et al., 2011),
and any other substance which enters the culture system
is a possible additional source. Apart from their effects
on survival and growth, metals will be eventually
discharged into the aquatic environment, and might
become an environmental threat.
In this study we measured the inputs and outputs of
Cd, Cu, Pb and Zn in two of the >40 holding tanks of
the maternity section of a commercial hatchery
(outdoors area of the hatchery where PL (post-larvae)
are held for hardening from stage PL6 to the date of
harvest and shipping), in order to identify the most
important sources of potentially toxic substances
supplied to post larvae during daily routines, and to
determine if the operation of these laboratories might
be a significant source of impact for the environmental
quality of Mexican coastal systems.
The field phase of this study lasted 13 days and was
carried out in spring 2013 in the maternity section of
the hatchery Aquapacific SA de CV (Agua Verde, El
Rosario Municipality, Sinaloa, Mexico). The day
before stocking (March 25, 2013), the two 45 m3 tanks
used for this work (Tanks 36 and 40) were filled to the
35 m3 mark. Water samples (5 L) were obtained and
filtered through 47 mm Whatman GF-C filters, acid
washed and of known weight. Residues of sea salt were
removed with 3-5 mL of distilled water and filters were
kept frozen at -20°C. The particle-free water was
acidified to pH < 7 adding the appropriate amount of
nitric acid (trace metal grade) and preserved in separate
containers until analysis.
The day after filling, 2 m3 of microalgae culture
(Chaetoceros sp., approximately 106 cells mL-1) were
added to each tank, the PL (post-larvae) were stocked
into the tanks, which were filled to full capacity. The
daily maintenance routine started on that day, with the
exception of the 30% daily water changes that began on
April 1st, at post-larval stage PL11.
Three samples of 100 post-larvae and of the
microalgae culture (50 mL concentrated on Whatman
GF-C filters) were stored at -20°C until processing and,
starting on that day, triplicate samples of all items (feed,
probiotics, water and preventive treatments) entering
each tank were obtained and preserved in labeled
containers, annotating at the same time the amount used
for each tank.
Samples (1 g, in triplicate) were obtained of the
multivitamin product, of the seven types of formulated
feeds, and of the probiotics and sugar which were
applied daily excepting the days of preventive (antibiotic or antimycotic) treatment. Four different
products were used for treatment during this work, each
provided once on different days (type and manufacturer
of feeds and treatments not mentioned due to our
agreement to protect the hatchery’s trade secrets).
Starting on the date of continuous daily water
replacements (mean salinity 36 ±1, flow rate: 12 L min-1,
equivalent to 17,280 L day-1 and to a daily renewal of
38.4%), water samples (5 L) were obtained at 8 h
intervals from the inflow and outflow. The three daily
samples of inflow and outflow were pooled to obtain
one composite sample of the inflow and outflow of each
tank. These were filtered through GF-C filters. Particlefree water and filters were preserved as the samples
obtained on the day of tank filling.
Tank 36 was harvested after 10 days of culture
(April 4), two days earlier than tank 40. In both cases,
samples of organisms and water were obtained at the
time of harvest, after which we proceeded to scrape the
walls to obtain samples (1 g in triplicate) of the
adhering biofilm. The same amount of sediment was
collected in triplicate from the bottom of each tank.
The percentages of each metal retained by postlarvae biomass (%MS) were calculated as
%MS = 100 (FM-IM)/TI
where FM and IM = final and initial metal content (mg)
of post-larvae and TI = total inputs-IM
The concentrations of dissolved metals in the water
samples were determined with a GFAAS, VARIAN
SpectrAA220 atomic absorption spectrometer, injecting directly the sample into the detection system with
flame atomic absorption spectroscopy (FAAS).
Graphite furnace analysis (GFAAS) was used for
samples with readings below the limit of detection for
FAAS (Páez-Osuna et al., 2015). Pb and Cd were not
detected with GFAAS even after concentration of 1 L
sample on NH4OH-pretreated Chelex 100 columns and
elution with 40 mL of HNO3 (2 M). Metals in the
particulate samples were determined after acid
digestion of freeze dried samples of known dry weight
according to Ruelas-Inzunza & Páez-Osuna (2007). As
for water, FAAS or GFAAS were used depending on
concentrations. All glassware and containers were acid-
washed as in Moody & Lindstrom (1977). Blanks were
used for accuracy (ranges: Cu = <0.013; Zn = <0.312;
Pb = 0.310-0.420; Cd = 0.014-0.33 mg L-1, respectively) and for detection limits, which were 0.012 µg g-1
for Cd (organic solids) and 0.034 µg L-1 for water
samples; 0.03 µg L-1 for Pb, 0.09 µg g-1 for Cu and
0.009 µg g-1 for Zn (GFAAS). Analysis of certified
reference material DOLT-4 (National Research
Council of Canada) gave recovery values of 91.5% for
Cu, 96.2% for Cd, 103.4% for Zn and 105.6% for Pb (n
= 3 in all cases).
Results are given in µg g-1 (dry weight) with the
exception of water samples (µg L-1).
RESULTS
Inputs
Tank 36 was harvested two days earlier than tank 40.
For this reason, with the notable exception of postlarvae (3.2 and 3.0x106 PL, equivalent to 13.95 and
13.08 kg, wet weight, for tanks 36 and 40, respectively)
all inputs to tank 36 were lower than in 40. Therefore,
in view of the lower stocking density, the final biomass
harvested in tank 40 was lower than that obtained in
tank 36 (Table 1).
The concentrations of dissolved Pb and Cd of the
water used for tank filling and daily water renewals
were consistently below the respective limits of
detection. The mean value determined in the case of
dissolved Cu was two orders of magnitude or higher
than that of dissolved Zn, while Zn was the most
abundant metal determined in the suspended solids of
incoming and effluent water. Concentrations of both
metals were highly variable, with coefficients of
variation >50% (Table 2).
Reflecting their role as essential metals, the contents
of Cu and Zn of the post-larvae were more than two
orders of magnitude higher than those of Cd and Pb
(Table 2). Apart from the initial addition of microalgae,
both tanks received daily four types of formulated feed
from stocking to PL11. One of these was supplied also
after this stage, while the remaining three were
discontinued and substituted by three different feeds.
With the exception of feed F4 (decapsulated, freeze
dried Artemia cysts) all feeds were rich sources of the
essential Cu and Zn. Feeds F2, F4 and F6 had Pb
contents close or higher than 0.2 µg g-1 while F1, F3,
F5 and F7 had high amounts (≥0.4 µg g-1) of the nonessential Cd (Table 2).
Each type and brand of antibacterial or antifungal
treatments was used only once in each tank, presumably
to minimize the possibility of generating resistant
strains; other treatments (EDTA, vitamins, probiotics)
597
Table 1. Total inputs and outputs to tanks 36 and 40
(water in L, solids in g). SS: suspended solids; PL: postlarvae
Water
SS
PL
Biofilm
Sediment
Feed 1
Feed 2
Feed 3
Feed 4
Feed 5
Feed 6
Feed 7
Microalgae
Treatment 1
Treatment 2
Treatment 3
Treatment 4
Vitamin mix
Probiotics
Sugar
EDTA
Tank 36 Tank 40
Inputs
111,240 145,800
530
544
14,930
14,630
6,380
7,720
5,350
7,400
3,180
3,530
2,170
2,240
4,910
10,370
2,970
6,450
2,500
5,060
438.2
438.2
180
180
200
200
100
100
525
525
1,000
1,200
140
180
1,060
1,320
1,750
2,150
Tank 36 Tank 40
Outputs
111,240 145,800
6,525
10,390
32,240
27,060
7.21
8.80
462
168
-
were suspended on that date. Treatment T1 stands out
for its high Cu and Cd contents. Cd was high also in
treatment T2, and Zn was not detected in any of these
products (Table 2).
Outputs
As in the influent, concentrations of dissolved Pb and
Cd were below the respective limits of detection in
effluent water; Zn values remained unchanged while
those of Cu increased to more than twice the value of
the influent. In the case of post-larvae, final
concentrations of the four metals were not different
from those determined at the time of stocking (Table 2).
Among solid outputs, biofilm and post-larvae had
the highest concentration of Cu, while suspended solids
were the most important output in the case of Zn, Pb
and Cd. However, values determined in the suspended
solids of the effluents were significantly lower than
those of the influent and the most notable decreases
were those detected for Zn and Pb, which were
equivalent to 13.3 and 16.1% of the respective values
of influent water (Table 2).
Tank 36
In terms of mass, the most important input of Cu was
due to preventive treatments (27.7%), followed by postlarvae, feeds and dissolved Cu of influent water (26.4,
598
Table 2. Mean concentrations (± standard deviation) in µg g-1 (water in µg L-1) of Cu, Zn, Pb and Cd in the influent and
effluent water, in suspended solids (SS), feeds and chemical and biological treatments and post-larvae (PL) cultured in tanks
36 and 40. Feeds F1 to F7 and treatments T1 to T4: brand protected by trade secret; n: number of triplicate samples.
Cu
Water (n = 24)
SS (n =24)
PL (n = 3)
Feeds
F1 (n = 2)
F2 (n = 2)
F3 (n = 2)
F4 (n = 2)
F5 (n = 2)
F6 (n = 2)
F7 (n = 2)
Microalgae
Treatments
T1 (n = 1)
T2 (n = 1)
T3 (n = 1)
T4 (n = 1)
Vitamin mix (n = 3)
Probiotic (n = 3)
Sugar (n = 3)
EDTA (n = 3)
6.62 ± 4.04
28.7 ± 15.0
58.0 ± 4.8
28.90 ± 0.48
9.89 ± 0.53
35.80 ± 0.25
3.69 ± 0.30
29.90 ± 0.08
55.3 ± 1.7
33.50 ± 0.26
7.98 ± 2.37
Zn
Pb
Inputs
0.04 ± 0.03
<LD
17,800 ± 12,800
28.6 ± 15.1
78.4 ± 5.3
0.12 ± 0.09
163.0 ± 4.3
131.0 ± 6.8
169.0 ± 1.9
85.7 ± 3.5
159.0 ± 0.7
295.0 ± 9.2
163.0 ± 4.9
74 ± 27
9.670 ± 1.880
0.103 ± 0.034
0.27 ± 0.15
0.091 ± 0.008
884 ± 120
0.162 ± 0.066
0.200 ± 0.063
0.112 ± 0.031
<LD
<LD
<LD
<LD
<LD
<LD
<LD
<LD
Outputs
Cd
<LD*
3.37 ± 1.85
0.08 ± 0.03
0.140 ± 0.039
0.230 ± 0.049
0.066 ± 0.007
0.199 ± 0.023
0.166 ± 0.011
0.347 ± 0.055
0.046 ± 0.005
3.770 ± 1.620
0.394 ± 0.026
0.125 ± 0.006
0.446 ± 0.102
<LD
0.52 ± 0.11
0.136 ± 0.004
0.510 ± 0.051
1.11 ± 0.48
0.092 ± 0.013
0.088 ± 0.045
0.041 ± 0.004
0.084 ± 0.015
0.104 ± 0.007
0.041 ± 0.009
0.081 ± 0.034
0.243 ± 0.062
0.149 ± 0.062
0.131 ± 0.078
0.010 ± 0.001
0.083 ± 0.056
0.006 ± 0.001
0.003 ± 0.002
<LD
<LD
Water (n = 24)
15.7 ± 5.20
0.04 ± 0.03
<LD
<LD
SS (n = 24)
14.2 ± 15.3
2,370 ± 950
4.59 ± 5.18
1.06 ± 0.18
Biofilm (n = 3)
62 ± 10
142 ± 10
0.35 ± 0.05
0.23 ± 0.01
Sediment (n = 3)
21.7 ± 4.8
132 ± 26
0.47 ± 0.14
0.13 ± 0.05
PL (n = 3)
58.0 ± 4.8
78.4 ± 5.3
0.12 ± 0 .09
0.08 ± 0.03
-1
-1
-1
LD: detection limits: Pb = 0.03 µg L ; Cd = 0.012 µg g and *0.034 µg L ; Zn = 0.009 µg g-1
23.0 and 22.4%, respectively), while 61% of the total
Zn input was due to suspended solids and 31.1% to
formulated feeds, most of the balance being due to PL.
The inputs of Pb to tank 36 were mainly due to
suspended solids (42.9%), followed in equal parts
(≈25%) by preventive treatments (mainly EDTA for
water treatment) and feeds, while the most important
source of Cd were feeds (76.4%), followed by
suspended solids and post-larvae (Table 3).
The major outputs of Cu were post-larvae and the
dissolved Cu of effluent water (50.7 and 47.3%,
respectively), while suspended solids and post larvae
made up almost 100% of the outputs of Zn (78.3 and
21.1%, respectively). Suspended solids contained most
of the outputs of the non essential Pb and Cd, with
percentages higher than 80% for both metals (Table 3).
Tank 40
The PL of tank 40 remained in this section two days
longer than those of tank 36. For this reason, feeds
contained 32.4% of the total Cu inputs of this tank.
Other important sources of Cu were preventive
treatments (25.8%) and suspended solids, which
represented 22.4% of the total inputs of this metal. As
in the case of tank 36, suspended solids were the highest
input of Zn (57%), and feeds (36.9%) and preventive
treatments made up the remainder 43%.
Suspended solids were also the main contributors
(41.3%) to the total inputs of Pb to tank 40, followed by
feeds and in a slightly lower proportion by preventive
treatments, while the most important sources of Cd
were feeds with 81.7%, followed by suspended solids
and post-larvae, in almost equal parts.
Table 3. Total Cu, Zn, Cd and Pb inputs and outputs (mg)
in tank 36 of the post-larvae maternity section. SS:
suspended solids, PL: post-larvae, ND: not detected.
Cu
Water
SS
Feeds
PL
Treatments
Total
736
15.2
757
866
909
3.284
Water
SS
Biofilm
Sediment
PL
Total
1.746
64
0.45
10.03
1.870
3.691
Zn
Pb
Inputs
4.07
ND
8940
11.01
4.551
6.40
1.171
1.81
ND
6.45
14.665
25.67
Outputs
4.65
ND
9.387
20.12
1.02
0.003
60.98
0.22
2.528
3.90
11.981 24.24
Table 4. Total Cu, Zn, Cd and Pb inputs and outputs (mg)
in tank 40 of the post-larvae maternity section. SS:
suspended solids, PL: post-larvae, ND: not detected.
Cu
Cd
ND
1.29
9.35
1.13
0.46
12.23
Water
SS
Feeds
PL
Treatments
Total
ND
8.48
0.002
0.06
2.43
10.97
Water
SS
Biofilm
Sediment
PL
Total
The most important Cu outputs were the dissolved
fraction and the post-larvae (55.5 and 38%, respectively) while, in the case of Zn, suspended solids and
post-larvae (90 and 9.9%, respectively) were practically the only outputs. As in tank 36, data show that the
internal concentrations of the non-essential Cd and Pb
of post larvae remained unchanged, increasing their
total load of these metals by amounts equivalent to the
increase of their dry mass. For this reason, suspended
solids were the main output of Pb and Cd, with
percentages of 91.4 and 84.1%, respectively (Table 4).
DISCUSSION
Copper
The mean copper concentration determined in the water
used for tank filling and water exchanges was more
than twice the concentration of 3.1 µg L-1, that EPA
(2013) suggests as acceptable for long term exposure of
marine or brackish water organisms (CCC: criterion
continuous concentration) and the difference was even
higher in the case of the mean value recorded in effluent
water (15.7 µg L-1). However, according to Boyd
(2009), the maximum tolerable concentration for the
culture of aquatic organism in hard or marine water is
70 µg L-1, which is five and ten times higher than the
values detected in influent and effluent water,
respectively.
With the exception of feeds F2 and F4, the mean Cu
concentration determined in foods was from three to
almost five times higher than the 10-11 µg g-1
recommended by Piedad-Pascual (1989) and Ikem &
Egilla (2008) for shrimp and fish feeds, although this
did not seem to affect post-larvae survival since, accor-
599
965
17.5
1.404
848
1.116
4.327
2.289
264
0.54
3.65
1.569
4.127
Zn
Pb
Inputs
5.34
ND
10.803 13.59
6.997
9.32
1.147
1.77
ND
8.23
18.952 32.91
Outputs
6.09
ND
19.280 35.71
1.25
ND
22.2
0.08
2.121
3.27
21.431 39.06
Cd
ND
1.61
12.66
1.10
0.12
15.49
ND
10.88
ND
0.02
2.04
12.94
ding to the estimates of the biologist in charge, survival
in both tanks was >80% and final biomass was 200%
or higher than the initial value.
In the case of tank 36, post-larvae retained close to
41% of all Cu inputs in their biomass and most of the
rest was discharged as dissolved Cu, while the percentage retained in tank 40 was only 21%. The
remaining was discharged with the effluent water, most
as dissolved and the remaining as particle-associated
Cu.
Zinc
The Zn content of most feeds was close or within the
range of values (100-150 µg g-1) indicated by PiedadPascual (1989) and Davis & Kurmaly (1993) as
adequate for fish and shrimp culture, with the exception
of F6, which had twice the highest of these values.
Water concentration was well below the CCC value (81
µg L-1) indicated by EPA (2013) as acceptable for
aquatic communities, and post-larvae of tanks 36 and
40 retained 10.1 and 5.5% of all Zn inputs, respectively,
equivalent to approximately 30 and 14% of the amount
supplied as shrimp feeds. Most of the excess was
discharged as suspended solids.
Lead
As a non essential, potentially toxic metal, Pb should
not be present in animal feeds or in the substances
introduced into the culture system. However, its
presence as contaminant is unavoidable and tolerated in
concentrations even higher than those found in this
study. For instance, Pb was detected in feeds used in
U.S. federal hatcheries, where the mean Pb content was
0.78 µg g-1 (Maule et al., 2007) and values between
600
0.35 and 0.37 µg g-1 were determined by Anhwange et
al. (2012) in feeds for cultured fish, and even higher
values (3.58 µg g-1) were found in shrimp feeds
(Shamshad et al., 2009). All these values, which are
higher than the upper limit of the range found in this
study, are below the tolerable limit (5 µg g-1)
established by European Union legislation on
undesirable substances in formulated animal feeds (EU,
2013), and are far lower than the 30 µg g-1 allowed by
the American Association of Feed Control Officials
(Hanks, 2000).
For this reason, although it is highly unlikely that
these amounts might represent a threat for postlarval
shrimp health, between 25 and 28% of the total Pb
which entered the shrimp tanks came from shrimp
feeds. This might raise some concern, especially
considering that similar or slightly lower (88%, for tank
40) input was due to preventive treatments, which are
supposed to preserve shrimp health.
One additional consideration is that only between 9
and 5% of the Pb inputs were retained within the shrimp
biomass of tanks 36 and 40, respectively. The
remaining was discharged as particulate suspended
matter with the effluent water, thus becoming a
potential environmental threat.
Cadmium
Microalgae had the highest Cd content of all feeds, but
in view of the small amount supplied their contribution
to total Cd of larval feeds was only 5.2 and 3.8% for
tanks 36 and 40, respectively. Three out of the seven
types of formulated feeds (F3, F5 and F7) used in this
hatchery had mean Cd concentrations close or higher
than the maximum admissible level (0.5 µg g-1, dw)
established by European legislation (EU, 2013) and
mentioned by Hanks (2000) for the U.S. food industry.
These and suspended solids to a lower extent (close to
10%), were practically the only Cd inputs, between
11.7 and 6.5% of which were incorporated in postlarval biomass of tanks 36 and 40, respectively, while
the remaining was discharged with the effluents as
particulate Cd.
In this case therefore, unlike Pb, the Cd content of
formulated feeds might become a double threat, to the
health of shrimp post-larvae as well as to the
environment, which receives the remaining 89-92% of
the Cd input.
Discharges to the environment
The two tanks used for this study yielded
approximately 9.5x106 post-larvae ready for the
market. To achieve this production, this laboratory
discharged 4.38 g of Cu, 2.63 g of which added to the
original concentration, 28.8 g of Zn (with an
enrichment of 8.92 g), 0.06 g of Pb, which represents a
100% increase in comparison to the influent, while 95%
of the 0.02 g of Cd discharged to the environment came
from shrimp feeds and treatments.
By the end of 2012, the total production of this
hatchery was 1.267x109 post-larvae, equivalent to
25.4% of the total produced in Sinaloa and 13.14% of
the national production (4.99x109 and 9.64x109 postlarvae, respectively: Industria Acuícola, 2013). Under
the assumption that inputs and outputs remained
unchanged, the estimated total amount discharged
during 2012 by that particular production area of this
hatchery would have been in the order of 584 g of Cu,
3,840 g of Zn, and 7.5 and 2.5 g of Pb y Cd,
respectively. Once corrected for the original concentrations, these amounts would mean an estimated total
addition to the environment of 350.8 g of Cu, 1,190 g
of Zn and 4.2 and 2.2 g of Pb and Cd, respectively.
According to national statistics, close to 50% of the
1.3x106 ha of agricultural land of Sinaloa State is
dedicated to intensive agriculture, including irrigation
and fertilization (INEGI, 2007), and its estimated
consumption of phosphatic fertilizers in 2010 was
0.12x106 Mg, equivalent to 10.2% of the apparent
national consumption (1.16x106 Mg: Claridades
Agropecuarias, 2013). Therefore, the average application rate would be 0.2 Mg (200 kg) ha-1yr-1.
Phosphatic fertilizers contain several metals in
amounts that depend on their origin as well as on
production techniques. Cu contents range from 22 to
130 mg kg-1, with a mean value of 58 ± 45 mg kg-1; Zn
varies from 13.3 to 515 mg kg-1 (mean 245 ± 174 mg
kg-1). The contents of Cd are 0.1 to 60 mg kg-1 (mean
21.0 ± 24.6 mg kg-1) and those of Pb range from 3 to
44.5 mg kg-1, with a mean content of 14.5 ± 17.1 mg
kg-1 (Pezzarossa et al., 1990; Chandrajith &
Dissanayake, 2009; Ahialey et al., 2014). The amounts
discharged by this hatchery would seem to represent a
tolerable impact, since they are lower than those
contained in the fertilizers used in 25 to 30 ha in the
case of the essential Cu and Zn, and in between 0.5 and
1.5 ha for Cd and Pb, respectively.
ACKNOWLEDGMENTS
Supported by projects PROFAPI-UAS 2013/065,
PROMEP/103.5/13/9354 and CONACYT INFRA
2012-01-188029. The first author was the recipient of a
CONACYT M.Sc. studies scholarship, H. Bojórquez
helped with metal analysis. The cooperation of the
owner and staff of the hatchery Aquapacific, S.A. de
C.V. is gratefully acknowledged.
REFERENCES
Ahialey, E.K., E.A. Kaka, D. Denutsui, R.K. Yankey, E.
Quarshie, D.K. Sarfo, D.K. Adotey & S. Enti-Brown.
2014. Evaluation of metal composition of phosphate
fertilizers in Ghana. Global Adv. Res. J. Agr. Sci., 3:
152-157.
Anhwange, B.A., K. Asemave, B.C. Kim & D.T.
Nyiaatagher. 2012. Heavy metals contents of some
synthetic fish feeds found within Makurdi metropolis.
Int. J. Food Nutr. Saf., 2: 55-61.
Boyd, C.E. 2009. Trace metals toxic at high concentrations. Global Aquacult. Adv., 2009: 24-26.
Chandrajith, R. & C.B. Dissanayake. 2009. Phosphate
mineral fertilizers, trace metals and human health. J.
Nat. Sci. Foundation Sri Lanka, 37: 153-165.
Claridades Agropecuarias. 2013. El mercado de los
fertilizantes 2011-2012. ASERCA-SAGARPA, Secretaría de Agricultura, Ganadería, Desarrollo Rural,
Pesca y Alimentación, Ciudad de México, pp. 45-48.
Davis, D.A. & K. Kurmaly. 1993. Advances in mineral
nutrition for aquatic species. Proceedings of the
VICTAM International Conference Feed Production
Tomorrow II. October 1993, Bangkok, pp. 1-16.
Environmental Protection Agency (EPA). 2013. National
recommended water quality criteria. Environmental
Protection Agency. Washington, DC, USA. [http://
water.epa.gov/scitech/swguidance/standards/criteria/c
urrent/index.cfm] Reviewed: 28 January 2016.
European Union (EU). 2013. Directiva 2002/32/ce del
Parlamento Europeo y del Consejo de 7 de Mayo de
2002 sobre sustancias indeseables en la alimentación
animal. Diario Oficial de la Comunidad, pp. European
Union (EU). [http://data.europa.eu/eli/dir/2002/32/201312-27]. Reviewed: 14 February 2016.
Hanks, A. 2000. Mineral feed contaminants. Association
of Feed Control Officials, Official Publication,
Ikem, A. & J. Egilla. 2008. Trace element content of fish
feed and bluegill sunfish (Lepomis macrochirus) from
aquaculture and wild source in Missouri. Food Chem.,
110: 301-309.
Industria Acuícola. 2013. Producción de postlarvas de
camarón durante 2012 en México. Ind. Acuícola, 9: 6
pp.
Received: 18 August 2015; Accepted: 16 May 2016
601
Instituto Nacional de Estadística y Geografía. Aguascalientes (INEGI). 2007. Censo agrícola, ganadero y
forestal. Instituto Nacional de Estadística y Geografía.
Aguascalientes, México. [http://www3. inegi.org.mx/
sistemas/tabuladosbasicos/default.aspx?c=17177&s=
est]. Reviewed: 27 December 2015.
Lacerda, L.D., J.A. Santos & D.V. Lopes. 2009. Fate of
copper in intensive shrimp farms: bioaccumulation
and deposition in pond sediments. Braz. J. Biol., 69:
851-858.
Maule, A.G., A.L. Gannam & J.W. Davis. 2007. Chemical
contaminants in fish feeds used in federal salmonid
hatcheries in the USA. Chemosphere, 67: 1308-1315.
Moody, J.R. & R.N. Lindstrom. 1997. Selection and
cleaning of plastic containers for storage of trace
elements samples. Anal. Chem., 49: 2264-2267.
Páez-Osuna F., H. Bojórquez-Leyva, M. Bergés-Tiznado,
O.A. Rubio-Hernández, J.F. Fierro-Sañudo, J. RamírezRochín & J.A. León-Cañedo. 2015. Heavy metals in
waters and suspended sediments affected by a mine
tailing spill in the upper San Lorenzo River,
Northwestern Mexico. Bull. Environ. Contam.
Toxicol., 94: 583-588.
Pezzarossa, B., F. Malorgio, L. Lubrano, F. Tognoni & G.
Petruzzelli. 1990. Phosphatic fertilizers as a source of
heavy metals in protected cultivation. Commun. Soil
Sci. Plant. Anal., 21: 737-751.
Piedad-Pascual, F. 1989. Mineral requirements of
penaeids. Actes de Colloque: advances in tropical
aquaculture. [http://archimer.ifremer.fr/doc/1989/acte
-1454.pdf]. Reviewed: 29 January 2016.
Ruelas-Inzunza, J.R. & F. Páez-Osuna. 2007. Essential
and toxic metals in nine fish species for human
consumption from two coastal lagoons in the Eastern
Gulf of California. J. Environ. Sci. Health, 42A: 14111416.
Shamshad, B.Q., R.K. Shahidur & R.C. Tasrena. 2009.
Studies on toxic elements accumulation in shrimp
from fish feed used in Bangladesh. Asian J. Food
Agro-Industry, 2: 440-444.
Soares, T.M., D.A. Coutinho, L.D. Lacerda, M.O. Moraes
& M.F. Rebelo. 2011. Mercury accumulation and
metallothionein expression from aquafeeds by
Litopenaeus vannamei Boone, 1931 under intensive
aquaculture conditions. Braz. J. Biol., 71: 131-137
Lat. Am. J. Aquat. Res., 44(3): 602-609, 2016
Pantentometry of the genus Macrobrachium
602
1
Research Article
The prawns of the genus Macrobrachium (Crustacea, Decapoda, Palaemonidae)
with commercial importance: a patentometric view
Olimpia Chong-Carrillo1, Ricardo Arencibia-Jorge2, Cristina Olimpia Chávez-Chong3
Shehu L. Akintola4, Marcelo U. García-Guerrero5, Layla Michán-Aguirre6
Héctor Nolasco-Soria7, Fabio Cupul-Magaña1 & Fernando Vega-Villasante1
1
Laboratorio de Calidad de Agua y Acuicultura Experimental, Departamento de Biología
Centro de Investigaciones Costeras, Universidad de Guadalajara, Puerto Vallarta, Jalisco, México
2
Centro Nacional de Investigaciones Científicas, Playa La Habana, Cuba
3
Centro de Estudios de Matemática para las Ciencias Técnicas, Instituto Superior Politécnico
“José Antonio Echeverría”, Cuba
4
Fisheries Department, Lagos State University, PMB 0001, LASU, Ojo, Lagos, Nigeria
5
Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional-Instituto Politécnico Nacional
(CIIDIR-IPN) Unidad Oaxaca, México
6
Laboratorio de Cienciometría, Información e Informática Biológica, Facultad de Ciencias
UNAM. Coyoacán, Distrito Federal, México
7
Centro de Investigaciones Biológicas del Noroeste. La Paz, B.C.S. México
Corresponding author: Fernando Vega-Villasante (fernandovega.villasante@gmail.com)
ABSTRACT. The scientific interest in the genus Macrobrachium was not only from a biological aspect, but
also from economic aspect. This paper analyzed the patents identified in several databases using the keyword
Macrobrachium. Patents were selected when a species of Macrobrachium was mentioned in main title. The total
number of identified patents was 131, of which Chinese authors and institutions have produced more than 90%.
Topics addressed refer to culture technologies (41%), nutrition and feeding (26%), reproduction technologies
(19%) and pathological diagnosis and treatments (14%). Patents are mainly directed for M. rosenbergii (71%),
M. nipponense (28%) and M. superbum (1%). Until now, it has not been attempts to generate patents to American
continent species.
Keywords: Macrobrachium, prawn, patents, technology, innovation, aquaculture.
Los camarones de río del género Macrobrachium (Crustacea, Decapoda,
Palaemonidae) con importancia comercial: una visión patentométrica
RESUMEN. El interés científico por las especies del género Macrobrachium no ha sido solo desde el aspecto
biológico, sino también económico. El presente trabajo analiza las patentes detectadas en diversas bases de datos
utilizando la palabra clave “Macrobrachium”. Se incluyeron las patentes que mencionaran en el título principal
a alguna especie de Macrobrachium. Se encontraron 131 patentes, de las cuales instituciones y autores chinos
han producido más del 90%. Las temáticas abordadas se refieren a las tecnologías de cultivo (41%), nutrición y
alimentación (26%), tecnologías de reproducción (19%), y diagnóstico patológico y tratamientos (14%). Las
especies a las que son dirigidas las patentes son M. rosenbergii (71%), M. nipponense (28%) y M. superbum
(1%). No se ha publicado ninguna patente para especies del continente americano.
Palabras clave: Macrobrachium, camarón de río, patentes, tecnología, innovación, acuicultura.
INTRODUCTION
Among the infraorden Caridea, the family Palaemonidae includes 125 genera with 239 species (De Grave
__________________
Corresponding editor: Erich Rudolph
et al., 2009). Macrobrachium (Bate, 1868) constitutes
the most diverse genus among the palaemonids, distributed in tropical and subtropical streams and rivers
around the world (Bauer, 2011). These shrimps are co-
2603
lloquially called prawns, acamayas, cauque, langostino
or shrimp, depending on the region in which they are
found (García-Guerrero et al., 2013). The scientific
interest in the genus Macrobrachium is not limited to a
biological point of view, but also includes social and
economic aspects. Many of these species are subject of
traditional fisheries and culture (García-Guerrero et al.,
2013). According to New (2009), production of prawns
reaches hundreds of thousands of tons per year, most
of which are M. rosenbergii (De Man, 1878), which is
originally from Asia. This species known as
“Malaysian shrimp" or “giant river prawn” has been the
most studied one, and its farming production
technology has been exported to many countries
outside their original distribution area.
Since 1980, after the first meeting in Thailand on the
culture of M. rosenbergii, there has been increased
scientific research directed towards establishing
optimal conditions for controlled production of this
species, as well as native Macrobrachium species of
economic importance (New & Nair, 2012).
Chong-Carrillo et al. (2015) showed development
on the research of this important genus of crustaceans,
highlighting where efforts of research groups and
countries are going, and what knowledge gaps remain
unfulfilled. However, information addressing the
phenomenon of published science transfer towards
generating technologies or (protected as patents)
innovations aimed at improving Macrobrachium
culture (which is the final goal in the development of
technology in aquaculture) is yet to be addressed.
According to Schmoch (1993), an obvious method to
track the knowledge transfer from science to
technology is patent analysis. In this sense, Plaza &
Albert-Martínez (2009) noted that the indicators
derived from these studies are effective ways to assess
the impact of scientific research on technological
development.
This paper aimed to contribute to the development
of Macrobrachium genus research, through scientometric study of patents granted and registered in the
main international patent databases in the past three
decades and the present, in order to establish where the
technology generation efforts are directed, and if there
is a direct relationship between patents and published
science.
The study is based on the collection of patents from the
following databases: Patentscope ® of the World
Intellectual Property Organization (WIPO) and ISI
(Institute for Science Information®). Patents were
selected when a species of Macrobrachium was
mentioned in the main title. From the information
obtained, a database with EndNote software was
created for handling and processing the data. For the
standardization of data card patent were made
containing the following information: Title of the
patent, main inventor (according to WIPO or ISI), date
of publication, patent number, assignment and
summary. Based on the records, the classification of
patents held four themes: i) culture, ii) nutrition/
feeding, iii) pathology diagnosis/treatments, and iv)
reproduction. Within each theme, patents were
classified in turn into subtopics to highlight areas of
innovation with greater productivity. The resulting data
were transferred to spreadsheets for handling and
processing of graphics.
RESULTS
Since the early ‘70s to 2015, 131 patents were detected
using the title keyword Macrobrachium.
Countries
Only five countries worldwide have developed patents
for the prawns of the Macrobrachium genus. The
results showed that China leads the production of
patents for Macrobrachium with 123 patents (over 90%
of patents record) in all subject areas, Israel (2%),
Russia (2%), Malaysia (1%), and the United States of
America (1%) distantly follow it (Fig. 1a).
Out of the ten most productive institutions (those
that have generated at least three patents), nine are
Chinese. The maximum number of patents produced by
a single institution is 23 and corresponds to China. The
institutions included in the result shown in Figure 1b,
generated 66 patents, corresponding to 50% of the total
number of registered patents. This phenomenon is also
reflected in the number of more productive authors
(those with at least three patents). Eight Chinese
technologists produced 37 patents (alone or in
collaboration), almost 30% of 123 for that country. The
most productive are those that have produced 3 to 7
patents. Among the most productive authors was just
one, from Israel, who generated (alone or in collaboration) three patents.
Relationship between published science and patents
generation
Number of patents granted and the number of scientific
articles published on the subject Macrobrachium have
a dissimilar trend in the growth of both over time. Only
a few patents were generated from the 80s to the middle
of the first decade of XXI century. The production of
604
3
a
b
Figure 1. a) Main countries and institutions, b) producing patents on Macrobrachium at a global scale. CN: China, ISR:
Israel.
specific patents, for prawns of the Macrobrachium
genus, begins to increase in 2008, an increase sustained
to date. In the case of scientific manuscripts, production
began moderately from the ’80s to early XXI century,
showing, in the following years, a significant increase,
however has suffered significant declines (Fig. 2).
Between 2008 to 2011 and 2014 there were abrupt
decreases in the number of published articles, and a
dramatic increase of patents generated particularly in
2011 (the same year of the most pronounced fall of
publications).
Species
The technologies developed directly for this genus of
crustacean totaled 71% for M. rosenbergii, 28% for M.
nipponense (De Haan, 1849), and 1% for M. superbum
(Heller, 1862).
Thematic area
The theme culture, has the highest number of patents
(41%), followed by nutrition/feeding (26%). Both
subjects far exceeded 50% of total production, while
the other issues, pathology diagnosis/treatments and re-
4605
Figure 2. Number of granted patents and scientific papers published from 1980 to 2015, on Macrobrachium.
production have remained at a lower level (Fig. 3).
Only China has generated technologies on all main
areas.
Subthemes
The results show for the case of the culture theme, that
the subtheme innovation of culture technologies is the
one most patents generated (44%). This included
changes in traditional farming technologies through
management of water and organisms in culture as well
as harvest time, among other topics aimed at improving
culture yields. The subtheme equipment (24%)
included designs of filtration, recirculation, and
recycling systems, as well as innovative devices. The
techniques that deal with two species-polyculture
management have also been subject of protection
(20%) as well as those aimed at innovating monosex
culture (12%) (Fig. 4a).
For the nutrition thematic, most patents are directed
to the protection of whole food formulations, for the
development of organisms in culture (49%) and special
dietary formulations that meet a specific function in the
metabolism of organisms (27%). The protection of
methodologies for the production of biofilms (biobed)
also showed significant progress (15%), and it is the
emerging subtopic within this knowledge area.
Attention has been devoted to additives, designed to
increase the nutritional quality of feeds (6%), and
formulations of larvae diets (3%) which are essential
for the efficient start of the production process of prawn
species (Fig. 4b).
Figure 3. Main themes on Macrobrachium patents.
In the reproduction main theme, two sub-themes
were included and involving the protection of breeding
techniques (75%), in which traditional hybridization
methods were established and the reproduction management through molecular tools. Patents, which protect
the optimum management of mature organisms, that
ensures a higher reproductive performance (25%) (Fig.
4c) have also main attention.
In pathology, subtopic diagnosis is the most
prevalent (65%). In this, traditional test using immunelogical techniques or molecular biology were included.
All directed at the identification of etiologic agents of
6065
a
b
c
d
Figure 4. a) Percentage of patents on Macrobrachium according the subthemes within the main themes addressed.
a) Culture, b) nutrition/feeding, c) reproduction, d) pathology diagnosis/treatments.
organisms in culture. In the subtopic prevention/
increasing resistance, technologies developed through
molecular biology and food additives, designed to
prevent specific infections through stimulation of
defense systems (17%) were included. In the subtopic
treatment/control, methodologies or products developed
for the treatment of established diseases and its control
(18%) were included (Fig. 4d).
DISCUSSION
Only China has generated technologies in all main
areas. The rapid development in recent decades,
molecular biology techniques and genomics have also
impacted the development of patents directed to
practically all culture areas related to crustaceans with
commercial importance, including the genus Macro-
brachium. In our first classification in this study,
patents including such techniques were selected along
the traditional genetics (crosses and desirable heritable
characteristics) to form a separate thematic section.
However, since them all address culture, pathology,
and reproduction technologies, we finally included
them within these main themes. The thematic areas:
culture and nutrition/feeding covered by patents
matched two of the areas mentioned by Chong-Carrillo
et al. (2015) as the most productive in terms of
scientific publications in academic journals, a phenomenon repeated in the generation of patents.
However, it should be noted that the generation of
patents on reproduction and pathology diagnosis/
treatment exceeded proportionately the production of
manuscripts on these areas. This was possible because
greater research effort is aimed at generating techno-
6607
logies that can be protected and commercialized. The
generation of patents on various topics, rose
dramatically from the later 2000s and follows a
sustained increase to date.
When the relationship between the number of
patents granted and the number of scientific articles
published on the subject Macrobrachium was analyzed,
it was found a dissimilar behavior in its development.
At several times in the timeline, the production of
scientific papers presented serious increases and
decreases (Fig. 3), a phenomenon that was commented
by Chong-Carrillo et al. (2015) as the possible
consequence of the global economic crisis that hit all
sectors of the global development, including science
(Chinn, 2010). Contradictorily, a dramatic increase of
patents generated particularly in 2008 (the same year of
the first pronounced fall of publications). The same
phenomenon, and certainly more accentuated, observed
in 2014, in which the production of scientific
manuscripts drops abruptly, while production patent
remains on the rise. It is probable that this event can be
explained as part of the global crisis, when scientific
publication in the area was unattractive compared to
generating technologies for potential commercial
applications (and thus the possibility of being sold) was
more financially rewarding for scientists and technologists. It is noteworthy that sustained increment of
patent production has not been a cumulative global
effect, but because of just one country, China. This is
undoubtedly a clear demonstration of the interest of the
Asian giant to address the technological production in
virtually all areas of aquaculture, including Macrobrachium culture. At present times, China continues to
dominate overall aquaculture production (Van Dam et
al., 2015). Its higher technology production on this area
could be the explanation of this. It is also necessary to
note the abysmally poor patents, in the field of study on
the genus Macrobrachium by Latin American and
African countries. In the case of Latin America, Brazil,
which leads in the production of published scientific
research on the genus Macrobrachium, at continental
level (Chong-Carrillo et al., 2015), and the generation
of patents on many of the thematic subspecialties of the
International Patent Classification (Díaz-Pérez et al.,
2010), the production of patents directed to
Macrobrachium is zero. Because of its contributions
with native species, according to Chong-Carrillo et al.
(2015), Latin America, as a whole, is the geo-economic
region with the highest productivity as demonstrated in
published science on the genus Macrobrachium.
However, this has not resulted in protection
technologies through the generation of patents. This
same phenomenon is observed with India leading the
scientific production published in the world (mainly
working with M. rosenbergii) (Chong-Carrillo et al.,
2015), but has not a single patent registered.
According to Guzmán-Sánchez (1999), where there
is little scientific research there is no state-oriented
support system, therefore lacked adequate technological protection laws and patent collections do not exist
or are deficient. However, the above should not be
applied to countries such as India and Brazil, as its
scientific production (combined) for the Macrobrachium genus, represents more than 35% of the world
total, but do not have a proportional number of patents.
In this sense the comparison with China is necessary
because even though this country is below the
aforementioned India and Brazil, with respect to
scientific production on Macrobrachium published in
scientific journals (9.4% of world total) (ChongCarrillo et al., 2015), dramatically surpasses the above
mentioned countries.
This phenomenon may be the product of different
but not mutually exclusive factors: i) governments have
failed to stimulate the generation of technologies for the
culture of native species, including Macrobrachium
species, ii) researchers in the field have no interest in
developing patents but scientific publications instead,
as patents do not result in a direct or short-term benefit,
iii) there is an idiosyncrasy from researchers to their
peers, based on sharing, in a solidary manner,
technological advances in the culture of native species
(W.C. Valenti, com. pers.).
Although the study of global patents is a tool to
assess the generation of knowledge in a determined
area or topic, it does not necessarily reflect the scientific
and technological capacity of a country. Patent
production certainly carries an interest for the
protection of technologies with potential to be
commercialized, while science and technology
publication in journals of varying public access (open
access or subscription) showed a liberal sense for
transfer of results derived from a research process.
Certainly, this attitude of sharing new knowledge to a
global community is what has evolved in the case of
science at current levels. The non-generation of patents,
on river shrimp culture technologies in Latin America,
does not suggest the inability of scientists and
technologists but a lack of interest of the same, or of the
institutions of science and technology to stimulate
protection by patents, despite the great development in
scientific research on the subject-genus Macrobrachium by some countries in this region.
The case of China remains a peculiar scenario of
aquaculture worldwide, as it is not only a leading
producer with amounts that dwarf those of other
countries, but it is already a reference also in generating
technologies in virtually all areas of Macrobrachium
6087
culture. Although M. nipponenseis is not subjected to
global culture, as M. rosenbergii, and the amount of
published science is not comparable, Chinese
technologists have produced, in a short time, a large
number of patents for M. nipponense. If this trend
continues, it is likely that culture technologies for M.
nipponense will exceed those of M. rosenbergii in the
near future.
The China's experience in patenting should be
studied, and if necessary, adapted especially for
emerging economies. The current technological and
economic power of this Asian nation has been a project
designed for that purpose and not random. As Faust
(1990) mentioned that, the early detection of changes in
technological development, both in terms of direction
and intensity, was gaining importance in making
political and economic decisions. The Asian giant is a
prime example of this. This type of documents,
understood as a science-based product, has the essential
information for stable technological development. Also
constitutes a fundamental reference for technologists
and researchers to create technical solutions that
modify, facilitate, and enforce the tools to ensure
optimal development of productive processes, in this
case the culture of Macrobrachium with commercial
interest.
CONCLUSSIONS
Just 131 patents were detected since the early ’70s to
the 2015, using the keyword Macrobrachium. Only six
countries worldwide have developed patents for the
river shrimp of the Macrobrachium genus. Only China
has generated technologies on all main areas. The
results showed that China leads the production of
patents for Macrobrachium with 123 patents in all
subject areas. Specifically, patents technologies were
developed directly only for M. rosenbergii and M.
nipponense. The theme culture, has the highest number
of patents followed by nutrition/feeding with both
recording more than half of the patents. Macrobrachium research in Latin America has not resulted in
protected technologies. China's experience in patents
should be adapted especially for emerging economies.
Patents are essential documents for full understanding
the state of the art of a determined scientific area.
ACKNOWLEDGEMENTS
We thank the National Council for Science and
Technology of Mexico for the doctoral scholarship
granted to the first author of this paper. Special thanks
for the anonymous reviewers of our manuscript.
REFERENCES
Bauer, R.Tiven. 2011. Amphidromy and migrations of
freshwater shrimps. I. Costs, benefits, evolutionary
origins, and an unusual case of amphidromy. In: A.
Asakura (ed.). New frontiers in crustacean biology.
Proceedings of the Crustacean Society Summer
Meeting. Tokyo, 20-24 September 2009, Brill, Leiden,
pp. 145-156.
Chong-Carrillo, O., F. Vega-Villasante, R. ArencibiaJorge, S.L. Akintola, L. Michán-Aguirre & F.G.
Cupul-Magaña. 2015. The research on the river
shrimps of the genus Macrobrachium (Bate, 1868)
with known or potential economic importance:
strengths and weaknesses shown through scientometrics. Lat. Am. J. Aquat. Res., 43(4): 684-690.
Chinn, L.W. 2010. The global state of science funding.
ASBMB today, May: 18-19. [http://http://www.
asbmb.org/asbmbtoday/asbmbtoday_article.aspx?id=
7350]. Reviewed: 3 March 2016.
De Grave, S., N.D. Pentcheff, S.T. Ahyong, T.Y. Chan,
K.A. Crandall, P.C. Dworschak, D. Felder, R.M.
Feldmann, C.H.J.M. Fransen, L.Y.D. Goulding, R.
Lemaitre, M.E.Y. Low, J.W. Martin, P.K.L. Ng, C.E.
Schweitzer, S.H. Tan, D. Tshudy & R. Wetzer. 2009.
A classification of living and fossil genera of decapods
crustaceans. Raffles Bull. Zool., Suppl. 21: 1-109.
Díaz-Pérez, M., S. Rivero-Amador & F. Moya-Anegón.
2010. Producción tecnológica latinoamericana con
mayor visibilidad internacional: 1996-2007. Un estudio
de caso: Brasil. Rev. Esp. Doc. Cient., 33: 34-62.
Faust, K. 1990. Early identification of technological
advances on the basis of patent data. Scientometrics,
19: 473-480.
García-Guerrero, M.U., F. Becerril-Morales, F. VegaVillasante & L.D. Espinosa. 2013. Los langostinos del
género Macrobrachium con importancia económica y
pesquera en América Latina: conocimiento actual, rol
ecológico y conservación. Lat. Am. J. Aquat. Res.,
41(4): 651-675.
Guzmán-Sánchez, M.V. 1999. Patentometría herramienta
para el análisis de oportunidades tecnológicas. Universidad de La Habana, La Habana, [bvv.finlay.edu.
cu/download.php?url=documentos/119566413228.pd
f]. Reviewed: 3 March 2016.
New, M. 2009. History and global status of freshwater
prawn farming. In: M.B. New, W.C. Valenti, J.H.
Tidwell, L.R. D'Abramo & M.N. Kutty (eds.).
Freshwater prawns: biology and farming. Wiley
Blackwell, New York, pp. 1-11.
New, M. & M. Nair. 2012. Global scale of freshwater
prawn farming. Aquacult. Res., 43: 960-969.
8609
Plaza, L.M. & A. Albert-Martínez. 2009. Análisis de la
producción científica española citada en patentes
biotecnológicas en EE.UU. Rev. Esp. Doc. Cient., 27:
212-220.
Schmoch, U. 1993. Tracing de knowledge transfer from
science to technology as reflected in patent indicators.
Scientometrics, 26: 193-211.
Received: 24 December 2015; Accepted: 18 May 2016
Van Dam, A.A., W.C. Valenti, W. Zhang, B. Austin,
J.A.H. Benzie, B.A. Costa-Pierce, A.P. Farrell, D.M.
Gatlin, G. Hulata & D.C. Little. 2015. Introducing:
aquaculture reports. Aquacult. Rep., 1: A1-A2.
Lat. Am. J. Aquat. Res., 44(3): 610-622, 2016
Reproducción de Carangoides vinctus
Research Article
Reproducción de Carangoides vinctus (Perciformes: Carangidae)
en el Pacífico central mexicano
Gabriela Lucano-Ramírez1, Estrella G. Rivera-Rios1, Salvador Ruiz-Ramírez1
Gaspar González-Sansón1 & Alejandro Perez-Toledo1
1
Departamento de Estudios para el Desarrollo Sustentable de Zonas Costeras
Universidad de Guadalajara, Jalisco, C.P. 48980 México
Corresponding author: Gabriela Lucano-Ramírez (lucanorg@costera.melaque.udg.mx)
RESUMEN. El presente estudio tiene como objetivo conocer algunos aspectos de la reproducción de
Carangoides vinctus, una especie capturada por la pesquería artesanal en la costa sur de Jalisco. Las capturas se
realizaron mensualmente con redes agalleras desde enero de 1998 a diciembre de 2008. El intervalo de longitud
total de los ejemplares analizados fue de 17,0 a 41,2 cm; las hembras con promedio de 30,1 cm y los machos de
30,5 cm. La proporción sexual fue de 1,0:1,1 en machos y hembras, y no se diferenció significativamente de la
esperada 1:1. Se utilizó una escala de cuatro estadios de madurez gonadal en ambos sexos (inmaduros, en
desarrollo, capaz de reproducirse y post-evacuado o desovado). En los tres primeros estadios de desarrollo del
ovario, se observó un septo que divide cada lóbulo. En el análisis de la ovogénesis se identificaron siete fases
de desarrollo de los ovocitos, las cuales se desarrollaron de manera asincrónica dentro del ovario. Según las
características microscópicas observadas en el testículo, se determinó un desarrollo de tipo lobular. Los valores
máximos del índice gonadosomático, porcentaje de gónadas maduras y diámetro de los ovocitos, indican que C.
vinctus presenta un período reproductivo de marzo a mayo. La longitud de madurez sexual (L50) estimada fue
de 26,04 cm para hembras y 23,77 cm para machos; estas longitudes son menores a las tallas promedio de
captura en ambos sexos, lo que sugiere que gran parte de los organismos ya han alcanzado la madurez sexual al
momento de ser capturados comercialmente.
Palabras clave: Carangoides vinctus, periodo reproductivo, talla de madurez, proporción sexual, Pacífico
mexicano.
Reproduction of Carangoides vinctus (Perciformes: Carangidae)
in the Mexican Central Pacific
ABSTRACT. This study aims to determine some aspects of the reproduction of Carangoides vinctus, a species
caught by the artisanal fishery on the south coast of Jalisco. The captures were made monthly with gillnets from
January 1998 to December 2008. The organisms had total length of 17.0 to 41.2 cm, with females averaging
30.1 cm and 30.5 cm males. The sex ratio was 1.0: 1.1 males per females, which is not significantly different
from the expected 1:1. A gonadal maturity scale of four stages for both sexes (immature, developing, spawning
capable and post-spawning or spent) was used. In the first three stages of the ovary’s development, a septum
dividing each lobe was present. In the analysis of oogenesis, seven oocyte development phases were identified
and the oocytes developed asynchronously within the ovary. Based on the microscopic characteristics observed
in the testis, it showed a lobular type development. The maximum values of the gonadosomatic index, the
percentage of mature gonads and the oocyte diameter suggest that C. vinctus has a reproductive period from
March to May. The length at sexual maturity (L50) was estimated at 26.04 and 23.77 cm for females and males,
respectively; these sizes are lower than the average catch size in both sexes, suggesting that organisms are caught
commercially when they have reached sexual maturity.
Keywords: Carangoides vinctus, reproductive period, length at sexual maturity, sex ratio, Mexican Pacific.
__________________
Corresponding editor: Claudia Bremec
6101
2611
INTRODUCCIÓN
La familia Carangidae presenta una gran diversidad de
especies y habita aguas tropicales y subtropicales de los
océanos Atlántico, Pacífico e Índico, son peces carnívoros que alcanzan tallas grandes y son de alta
importancia económica (Allen & Robertson, 1994;
Nelson, 2006). Muchas especies son objetivo de
pesquerías; sin embargo, son escasos los trabajos que
tienen relación con la biología, ecología o algún otro
aspecto sobre estas especies.
Entre las especies de carángidos cuyas características reproductivas han sido investigadas, al menos
parcialmente, están Seriola dumerili (Marino et al.,
1995), Trachurus mediterraneus (Viette et al., 1997;
Demirel & Yüksek, 2013), T. ovatus (Assem et al.,
2005), Caranx crysos (Sley et al., 2012) para el Mar
Mediterráneo; Pseudocaranx dentex (Guirao et al.,
2005; Afonso et al., 2008) para las islas Canarias e islas
Azores; y Decapterus punctatus (McBride et al., 2002)
para el golfo de México. En el Océano Índico se ha
estudiado Carangoides chrysophrys en el mar Arábico
(Al-Rasady et al., 2012) y Scomberoides lysan en Sri
Lanka (Thulasitha & Sivashanthini, 2013a, 2013b). En
el Océano Pacífico se ha estudiado Caranx caballus en
bahía de Navidad, México, Chloroscombrus orqueta y
Selene peruviana en el golfo de Tehuantepec, Oaxaca y
Chiapas, México (Tapia-García, 1997); Caranx hippos,
C. latus, Chloroscombrus chrysurus y Oligoplites
saurus en el Caribe Colombiano (Ospina-Arango et al.,
2008; Caiafa et al., 2011); Trachurus murphyi en Perú
(Perea et al., 2013; Sánchez et al., 2013) y Chile (Leal
et al., 2013).
En la búsqueda bibliográfica, no se encontraron
referencias sobre aspectos reproductivos de Carangoides
vinctus (Jordan & Gilbert, 1882). Esta especie solo se ha
mencionado en aspectos pesqueros (Rojo-Vázquez &
Ramírez-Rodríguez, 1997; Arreguín-Sánchez & ArcosHuitrón, 2011), listados faunísticos (Lucano-Ramírez
et al., 2001a) y relación talla-peso (Rojo-Vázquez et
al., 2009). Esta especie, conocida comúnmente como
jurel de castilla o jurel rayado, se distribuye desde Baja
California Sur y Golfo de California, México, hasta
Perú. En México, es una especie que se ha reportado en
localidades continentales como Sinaloa, Oaxaca y
Chiapas (Castro-Aguirre et al., 1999), Jalisco (RojoVázquez & Ramírez-Rodríguez, 1997; LucanoRamírez et al., 2001a) y es considerada abundante en la
costa de Colima (Chávez-Comparan et al., 2008).
Para la biología reproductiva y proporcionar
subsidios para el manejo y conservación de este
importante recurso pesquero, el presente trabajo tiene
como objetivos conocer la distribución de tallas de
ambos sexos, proporción sexual, características
microscópicas de las gónadas, variación temporal del
índice gonadosomático, factor de condición, diámetro
promedio de los ovocitos y estimar la talla promedio de
madurez gonadal en Carangoides vinctus en una región
del Pacífico central mexicano.
El área de estudio se localiza al sur de la costa de
Jalisco, en el Pacífico central mexicano, entre
19º10’30”-19°12’50”N y 104º42’45”-104º41’30”W.
En esta región se pueden encontrar sustratos con fondos
rocosos, fondos blandos y fondos blandos con rocas
pequeñas (Rojo-Vázquez & Ramírez-Rodríguez, 1997).
Se realizaron muestreos mensuales durante cinco días
consecutivos desde enero de 1998 a diciembre de 2008
(excepto entre febrero y octubre 2001). Los organismos
analizados provinieron de la pesca comercial,
capturados con redes agalleras de 3; 3,5; 4 y 4,5
pulgadas. En cada ejemplar se midió la longitud total
(Lt) (± 0,1 cm), peso total (Pt) (± 0,1 g) y se le
extrajeron las gónadas a las cuales se les asignó el grado
de madurez correspondiente (Everson et al., 1989). En
el laboratorio, se determinó el sexo de los ejemplares y
las gónadas se pesaron (Pg) (±0,01 g) y guardaron en
formol neutro al 10% para su análisis histológico, el
cual se realizó mediante deshidratación en alcohol,
inclusión en paraplast, cortes de 6 µm de grosor y
tinción con hematoxilina-eosina. La asignación de las
fases de desarrollo de los ovocitos se basó en las
características descritas por Yamamoto & Yamazaki
(1961); Lucano-Ramírez et al. (2001b); BrownPeterson et al. (2011) y Lowerre-Barbieri et al. (2011).
Para determinar el desarrollo del testículo se
consideraron los trabajos de Hyder (1969), LucanoRamírez et al. (2001a), Brown-Peterson et al. (2011) y
Lowerre-Barbieri et al. (2011). Para el análisis mensual
del diámetro de los ovocitos (DO), se tomaron cinco
cortes histológicos de cada uno de los estadios
macroscópicos obtenidos en los meses del año tipo. De
cada corte se midieron 10 ovocitos de las distintas fases
observadas, mediante una cámara digital AxioCam
ERc5s (Zeiss), acoplada a un microscopio Axiostar
Plus (Zeiss). Dichos diámetros resultaron del promedio
entre el diámetro mayor y menor de cada ovocito; solo
se midieron los ovocitos donde se observó el núcleo
(West, 1990).
La temporada reproductiva se determinó con tres
métodos: en el primero se utilizó la escala morfocromática de Everson et al. (1989), considerando los
mayores porcentajes de organismos en estadios de
mayor maduración por mes. Para el segundo método,
𝑃𝑔
]∗
se utilizó el índice gonadosomático 𝐼𝐺𝑆 = [
𝑃𝑡−𝑃𝑔
100 que supone que los valores promedios máximos,
indican la mayor madurez gonádica (Sánchez-Cárdenas
612
3
Se obtuvo el factor de condición relativo (𝐹𝐶 =
𝑃𝑡
(𝐿𝑡 2,92) ∗ 100) como indicador del bienestar de la
población, donde 2,92 = coeficiente de la relación
longitud-peso (𝑃𝑡 = 𝑎 ∗ 𝐿𝑡𝑏 ). Además se calculó el
140
120
100
Frecuencia
et al., 2011). El tercer método consistió en conocer la
variación mensual del diámetro promedio de los
ovocitos, suponiendo que a un mayor diámetro le
corresponde mayor grado de maduración ovárica.
80
60
40
20
0
𝑃𝑡−𝑃𝑔
El ajuste se realizó mediante una aproximación no
lineal (algoritmo de Levenberg-Maquart).
Análisis estadístico
Se utilizó la prueba de bondad de ajuste Chi cuadrado
(2) con corrección para continuidad de Yates (Zar,
2010) para determinar si la proporción de sexos difiere
del valor esperado 1:1. Se calculó el valor promedio y
error estándar mensual y se realizó un análisis de
varianza (ANDEVA) para las variables IGS, FC y
diámetro promedio de los ovocitos. Cuando se encontró
diferencia significativa en el ANDEVA, se utilizó la
prueba de contrastes múltiples de Student-NewmanKeuls (SNK). Se realizaron análisis de correlación no
paramétrica por rangos de Spearman (rs) entre el IGS y
el FC de cada sexo, y entre el IGS de hembras y el
diámetro promedio de ovocitos. En todos los análisis,
el nivel de significancia fue de α = 0,05; además todos
los parámetros estudiados se analizaron mensualmente
por la agrupación de todo el periodo de la muestra
(todos los años).
RESULTADOS
Distribución de la longitud total
En total se capturaron 484 organismos, que presentaron
un intervalo de tallas entre 17,0 y 41,2 cm de Lt, con un
promedio de 30,1 (±0,16) cm (Fig. 1). Las hembras y
los machos presentaron longitudes promedio de 30,1
(±0,19) cm y 30,5 (±0,24) cm, respectivamente; el
intervalo de longitud en hembras fue de 21,5 a 40,3 cm
y en machos de 23,0 a 41,2 cm. Tres clases de
longitudes centrales (28, 30 y 32 cm) presentaron las
18 20 22 24 26 28 30 32 34 36 38 40 42
Longitud total (cm)
Figura 1. Distribución de las frecuencias de talla del total
de organismos capturados de Carangoides vinctus en el
Pacífico central mexicano.
Frecuencia
factor de condición somático (𝐹𝐶𝑆 = ( 𝐿𝑡 2,92 ) ∗ 100)
(Possamai & Fávaro, 2015).
Se analizó la variación mensual del IGS, FC y FCS
por sexo. Además, se calculó la proporción sexual para
la muestra total, por mes y clase de talla. Luego, se
calculó la longitud a la cual el 50% de los individuos
han alcanzado la madurez sexual (L50), ajustando el
porcentaje de organismos adultos (en desarrollo, capaz
de reproducirse y desovados) en cada clase de talla (PLt)
1
al modelo logístico, 𝑃𝐿𝑡 = [1+𝑒 (𝑏𝐿𝑡+𝑎)] ∗ 100
80
70
60
50
40
30
20
10
0
Hembras
Machos
18 20 22 24 26 28 30 32 34 36 38 40 42
Longitud total (cm)
Figura 2. Distribución de las frecuencias de tallas de
hembras y machos de Carangoides vinctus en el Pacífico
central Mexicano.
mayores frecuencias (>40%), con ligero dominio de las
hembras (Fig. 2).
Descripción microscópica de las gónadas
Los ovarios están envueltos por una túnica ovárica, que
penetra en el ovario y lo divide en dos, formando un
septo. Al interior se dererminaron ovocitos en
crecimiento primario (56,3 ± 1,9 µm), que fueron los
más abundantes en todos los estadios de madurez y que
se identificaron principalmente en ovarios inmaduros.
También se identificaron ovocitos con alvéolos corticales (110,8 ± 4,3µm), ovocitos en diferentes fases de
la vitelogénesis, primaria (185,7 ± 3,8µm), secundaria
(270,0 ± 5,9 µm), terciaria (257,6 ± 7,6 µm); y ovocitos
con vesícula germinal en migración (259,13 ± 6,6 µm).
Por la variedad de fases de crecimiento de los ovocitos
observados dentro de los ovarios capaces de reproducirse, se puede decir que el tipo de desarrollo es
asincrónico (Fig. 3).
Los testículos están envueltos por la túnica albugínea, en su interior se identificaron lóbulos integrados
por cistos, observándose células en diferentes fases de
la espermatogénesis. En la parte central, se observó un
4613
Figura 3. Corte transversal del ovario de C. vinctus.
a) Ovario inmaduro con pared ovárica (OW) y ovocitos en
crecimiento primario (PG) (5x), b) ovario capaz de
reproducirse con ovocitos en alveolos corticales (CA),
ovocitos en vitelogénesis primaria (Vtg1), vitelogénesis
secundaria (Vtg2) y vitelogénesis terciaria (Vtg3) (2,5x).
Figura 4. Corte transversal del testículo de C. vinctus.
a) Testículo inmaduro con túnica albugínea (Ta) y epitelio
germinal continuo (CGE) (5x), b) testículo capaz de reproducirse túnica albugínea (Ta), epitelio germinal tardío
(GE) y espermatozoides (Sz) (2,5x).
conducto espermático formado por tejido intersticial,
donde se concentraron los espermatozoides; el
desarrollo de los testículos es de tipo lobular (Fig. 4).
poral muy parecida entre estos dos factores en ambos
sexos, principalmente en marzo y abril, cuando se
determinaron los mayores valores de índice gonadosomático (IGS) (Fig. 6).
Estadios de madurez gonádica
En las hembras el estadio capaz de reproducirse se
presentó en varios meses con porcentajes importantes,
los mayores ocurrieron en abril, mayo y julio; el estadio
en desarrollo también se observó en varios meses
aunque los mayores porcentajes se obtuvieron en
marzo, agosto y septiembre. Los mayores porcentajes
del estadio inmaduro se registraron en febrero, junio y
octubre. Noviembre y diciembre presentaron los
porcentajes más altos del estadio desovado (Fig. 5a).
En los machos el estadio capaz de reproducirse se
presentó en varios meses y los mayores porcentajes se
observaron en marzo y abril; en el estadio en desarrollo
ocurrieron en marzo, agosto y septiembre; mientras que
el estadio post-evacuado, ocurrieron en mayo, y de
octubre a diciembre (Fig. 5b).
Relación factor de condición y factor de condición
somático
Comparando los valores del factor de condición
relativo (FC) y el factor de condición somático (FCS)
de hembras y machos, se observó una variación tem-
Índice gonadosomático (IGS)
Los valores promedios máximos del IGS se encontraron en marzo, abril y mayo tanto en hembras como
en machos, posteriormente se registró un máximo
secundario en julio para las hembras y en septiembre
para los machos (Fig. 7). El ANDEVA mostró
diferencias significativas entre los valores mensuales
promedio del IGS en hembras (F11,213 = 8,56, P < 0,001)
y machos (F11,193 = 10,24, P < 0,001). La prueba de
SNK en las hembras definió dos grupos con algunos
traslapos, el primero y más bajo, incluye varios meses
excepto octubre, y el segundo considera los valores
mayores, marzo, abril y mayo (Tabla 1). En los machos
se identificaron tres grupos con algunos traslapos; el
primero y menor asoció varios meses y excluyó marzo
y abril; el segundo incluyó enero, abril, mayo,
septiembre y noviembre; y el tercer grupo con valores
más altos estuvo conformado solo por marzo, abril y
mayo (Tabla 1). Como podría esperarse, se encontró
corre-lación temporal entre el IGS de hembras y
machos.
614
5
Figura 5. Frecuencia mensual de los estadios de madurez gonádica en hembras (a) y machos (b) de Carangoides vinctus
en el Pacífico central mexicano.
Factor de condición (FC)
En marzo y abril se determinaron los valores máximos
del FC tanto en hembras como en machos y los
mínimos se observaron en enero y febrero en ambos
sexos (Fig. 8). El ANDEVA mostró diferencias
significativas entre las medias mensuales del FC de
hembras (F11,213 =5,99; P < 0,001) y machos (F11,193 =
4,07; P < 0,001). No obstante, la prueba de SNK mostró
un solo grupo en ambos sexos (Tabla 1). Se encontró
correlación entre los valores promedios mensuales del
FC de hembras y machos.
Variación conjunta entre el IGS y FC
Aunque se distingue que el IGS y FC en hembras
presentaron cierta correspondencia temporal, no se
encontró correlación significativa (rs = 0,531; P =
0,075; n = 12), aunque estos valores fueron muy
próximos a los valores críticos. Mientras que en
machos, si se encontró correlación temporal entre los
valores del IGS y FC (rs = 0,629; P = 0,028; n = 12).
Diámetro de los ovocitos
La variación mensual del diámetro promedio de los
ovocitos mostró diferencias estadísticas entre éstos
(F11,1068 =3.71, P < 0,001). La prueba de contrastes
múltiples identificó dos grupos (a y b) con traslapos en
algunos meses; el grupo (a) con el menor diámetro
incluyó enero, febrero y septiembre, mientras que el
mayor diámetro (b) incluyó abril y mayo, los meses
restantes tienen valores promedio intermedios que no
difieren de los dos grupos previos (a y b; Tabla 1). El
análisis de correlación no paramétrico mensual entre el
diámetro promedio de ovocitos e IGS, encontró correlación entre éstos, ya que los valores altos de ambos se
presentaron en los mismos meses (Fig. 9).
Proporción sexual
De todos los ejemplares analizados 225 fueron hembras
(H), 205 machos (M) y a 54 no se les identificó el sexo.
La proporción sexual para el total de ejemplares fue de
6615
1,60
1,65
1,55
1,60
1,50
1,55
1,40
1,50
1,35
1,45
1,30
Machos
Hembras
1,45
1,40
1,25
1,35
1,20
1,15
1,30
En
Fb
Mr
K Hembras
Ab
My
Jn
K' Hembras
Jl
Ag
Sp
Oc
K Machos
Nv
Dc
K' Machos
Figura 6. Variación mensual (± error estándar) del factor de condición (K) y el factor de condición somático (K’) de
hembras y machos de Carangoides vinctus en el Pacífico central mexicano.
5,0
4,5
Índice gonadosomático
4,0
Hembras
Machos
3,5
3,0
2,5
2,0
1,5
1,0
0,5
rs = 0,692; P = 0,013; n = 12
0,0
En Fb Mr Ab My Jn
Jl
Ag Sp Oc Nv Dc
Figura 7. Promedio mensual (±error estándar) del índice gonadosomático para hembras y machos de Carangoides vinctus
en el Pacífico central mexicano.
1,1:1,0 (H:M), la cual no difiere significativamente de
la proporción esperada 1:1 (2 = 0,71; P = 0,40). En la
mayoría de los meses (diez) no se observó diferencia
estadística significativa en la proporción de sexos (con
excepción de marzo y octubre) (Tabla 2).
cm, respectivamente. El 50% de las hembras alcanzó la
madurez sexual a 26,04 cm y los machos a 23,77 cm
(Fig. 10).
Talla de madurez sexual (L50)
La hembra y el macho de menor longitud con gónadas
maduras fueron de 24,1 y de 24,0 cm Lt, respectivamente. En contraparte, la hembra y el macho más
grande con gónadas inmaduras presentaron 38,5 y 30,0
La distribución de longitudes es de gran relevancia en
el contexto del manejo de las pesquerías, ya que permite
conocer la composición de la población que habita en
un área determinada y analizar sus cambios en función
de la explotación. En este trabajo, los individuos de C.
DISCUSIÓN
6167
1,60
Hembras
Factor de condición
1,55
Machos
1,50
1,45
1,40
1,35
1,30
rs = 0,629; P = 0,028; n = 12
1,25
En
Fb
Mr
Ab
My
Jn
Jl
Ag
Sp
Oc
Nv
Dc
Figura 8. Promedio mensual (± error estándar) del factor de condición relativo para hembras y machos de Carangoides
vinctus en el Pacífico central mexicano.
Tabla 1. Valores promedios mensuales y resultados de los
contrastes de la prueba de Student-Newman-Keuls, del
índice gonadosomático (IGS), factor de condición relativo
(FC), diámetro de ovocito (DO) de hembras (H) y machos
(M). En cada columna los valores promedio que no tienen
la misma letra son significativamente diferentes.
IGS
(H)
Enero
1,60ab
Febrero
1,61ab
Marzo
3,25a
Abril
3,01a
Mayo
3,33a
Junio
1,26ab
Julio
2,40ab
Agosto
1,91ab
Septiembre 2,13ab
Octubre
0,69b
Noviembre 1,72ab
Diciembre 1,63ab
IGS
(M)
1,77ab
1,22a
4,25c
3,66bc
2,68abc
1,42a
1,54a
1,46a
2,26ab
1,39a
1,93ab
1,51a
FC
(H)
1,41a
1,41a
1,50a
1,54a
1,44a
1,46a
1,47a
1,47a
1,45a
1,53a
1,38a
1,40a
FC
(M)
1,40a
1,40a
1,51a
1,49a
1,45a
1,45a
1,46a
1,41a
1,41a
1,40a
1,44a
1,45a
DO
101a
104a
146ab
153b
152b
131ab
124ab
124ab
103a
129ab
119ab
123ab
vinctus presentaron un intervalo de tallas entre 17,0 y
41,2 cm Lt, con un valor promedio de 30,1 cm Lt. Este
intervalo es muy similar al observado por RojoVázquez et al. (2009) en la misma zona de estudio (16,0
a 41,2 cm). Sin embargo, el promedio obtenido en el
presente trabajo, fue menor a los registrados en Allen
& Robertson (1994) (35 cm), Chávez-Comparan et al.
(2008) (37cm) y Froese & Pauly (2011) (37 cm). La
diferencia entre los estudios se puede deber a las
características de los muestreos realizados: tamaño de
Tabla 2. Proporción sexual total y mensual de Carangoides
Hembras Machos
Enero
Febrero
Marzo
Abril
Mayo
Junio
Julio
Agosto
Septiembre
Octubre
Noviembre
Diciembre
Total
22
10
81
39
5
17
10
8
5
1
14
13
225
24
9
52
45
6
16
12
8
6
8
10
9
205
Proporción
sexual
1:0,9
1:1,1
1:1,6
1:0,9
1:0,8
1:1,1
1:0,8
1:1,0
1:0,8
1:0,1
1:1,4
1:1,4
1:1,1
χ2
P
0,09
0,05
6,32
0,43
0,09
0,03
0,18
0,00
0,09
5,44
0,67
0,73
0,93
0,76
0,82
0,01
0,51
0,76
0,86
0,67
0,97
0,76
0,02
0,41
0,39
0,33
muestra, esfuerzo de muestreo y arte de pesca, entre
otros.
Varios trabajos realizados en diferentes especies de
peces de las aguas mexicanas analizan aspectos
microscópicos del ovario (Lucano-Ramírez et al., 2012,
2014; Ruiz-Ramírez et al., 2012), pero son pocos los
estudios en el grupo de los carángidos que describen las
características de los ovocitos; en estos, se mencionan
en total entre seis y nueve fases de ovocitos identificadas. En este trabajo, se identificaron seis fases de
ovocitos (con crecimiento primario hasta ovocitos con
la vesícula germinal en migración). Para Pseudocaranx
dentex, Guirao et al. (2005) mencionan seis fases (ovo
617
8
180
4
Diámetro
3,5
IGS
140
3
120
2,5
100
2
80
1,5
60
1
40
Índice gonadosomático (IGS)
Diámetro de ovocitos (µm)
160
0,5
20
0
0
En
Fb
Mr
Ab
My
Jn
Jl
Ag
Sp
Oc
Nv
Dc
Figura 9. Promedio mensual (± error estándar) del diámetro de los ovocitos e índice gonadosomático de de Carangoides
Frecuencia de madurez (%)
100
75
Hembras
PLT = [1/1 + exp (-0,538LT + 14,027)]*100
r2 = 0.96
50
25
Machos
PLT = [1/1 + exp (-0,418LT + 9,941)]*100
r2 = 0.99
0
10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42
Longitud total (cm)
Figura 10. Porcentaje acumulado de individuos con gónadas maduras en hembras y machos de Carangoides vinctus en el
Pacífico central mexicano. Las líneas verticales indican el valor de L50 para cada sexo.
gonias, cromatina nucleolar, glóbulos lipídicos,
gránulos de vitelo, gránulos fusionados y atrésicos),
aunque estos autores no describen con detalle el
desarrollo de los ovocitos. En Trachurus murphyi se
observaron cinco fases de ovocitos (inmaduros,
ovocitos en previtelogénesis, ovocitos en vitelogénesis,
ovocitos maduros y ovocitos hidratados) (Sánchez et
al., 2013). En Scomberoides lysan, se identificaron
ocho fases del desarrollo de ovocitos (cromatina
nucléolo, perinucléolo, alveolo cortical, ovocitos
previtelogénicos, ovocitos glóbulos de vitelo, ovocito
con vitelo avanzada, ovocito núcleo migratorio y
ovocitos hidratados) (Thulasitha & Sivashanthini,
2013a).
C. vinctus presenta un ovario donde los ovocitos se
desarrollan en forma asincrónica (sensu Yamamoto &
Yamasaki, 1961), ya que en los ovarios con capacidad
reproductiva presentan una amplia gama de crecimiento de los ovocitos (Brown-Peterson et al., 2011;
Lowerre-Barbieri et al., 2011), donde se identificaron
hasta seis fases de ovocitos. Este mismo tipo de
desarrollo también se encontró en otro carángido,
Trachurus mediterraneus (Demirel & Yüksek, 2013).
En contraste, para Seriola dumerilii que pertenece a la
misma familia, los autores mencionan que la especie
presentó ovocitos con desarrollo sincrónico por grupo,
al observar más de un grupo de ovocitos (Marino et al.,
1995). Se ha encontrado variación en el patrón de
desarrollo de los ovocitos incluso dentro una misma
especie, es el caso de Mugil curema; para esta especie
se identificaron dos grupos de ovocitos, en el sur del
Atlántico (Albieri et al., 2010), mientras que para el
Caribe se encontraron tres grupos de ovocitos
(Solomon & Rammarine, 2007).
Microscópicamente, el testículo es de tipo lobular,
está organizado por lóbulos que se encuentran
separados por tejido conectivo, dentro de cada lóbulo
se puede identificar cistos donde se realiza el proceso
de la espermatogénesis, y todas las células se
encuentran sincronizadas, por lo que se observan en la
misma fase de desarrollo. Al alcanzar las células la fase
de espermatozoide, el cisto se rompe, liberándolos y
reagrupándolos en el conducto espermático (Billard,
1986; Lucano-Ramírez et al., 2014). En C. vinctus se
observaron lóbulos con cistos en su interior y el
conducto principal con espermatozoides en la fase de
maduración. Lo mismo se registró en dos especies de la
misma familia por Leal et al. (2013), quienes señalan
que las células espermáticas se encuentran dentro de los
lóbulos testiculares en Trachurus murphyi y por
Thulasitha & Sivashanthini (2013a), que aunque no
describen en detalle el tipo de desarrollo de las células
del testículo de Scomberoides lysan, mencionan que las
criptas de espermatocitos se limitan a la región más
externa de cada lóbulo.
La observación macroscópica de los cambios en el
desarrollo de las gónadas es un método válido para
definir un ciclo reproductivo en peces (Karlou-Riga &
Economidis, 1997) ya que la presencia de gónadas
maduras, es un indicador de la temporada de
reproducción (West, 1990). En C. vinctus, se observaron gónadas maduras durante todo el período de
estudio, pero los mayores porcentajes se presentaron en
marzo y abril, tanto en hembras como en machos.
Varios autores han utilizado el índice gonadosomático (IGS) para establecer el período reproductivo en
diferentes especies de peces (Lucano-Ramírez et al.,
2012; Ruiz-Ramírez et al., 2012; Lucano-Ramírez et
al., 2014), así como en especies de carángidos (TapiaGarcía, 1997; Viette et al., 1997; Assem et al., 2005;
Guirao et al., 2005; Al-Rasady et al., 2012; Sley et al.,
2012; Leal et al., 2013; Perea et al., 2013). Htun-Han
(1978), menciona que la mayor actividad reproductiva
está asociada con valores altos de este índice, mientras
que valores mínimos estarían relacionados con épocas
de reposo gonadal.
6189
En este trabajo, los valores máximos del IGS de las
hembras se presentaron de marzo a mayo y de los
machos en marzo y abril, lo que sugiere que el proceso
de maduración de las gónadas es simultáneo en ambos
sexos. Además, en este periodo también se registraron
los mayores porcentajes de gónadas maduras en ambos
sexos, por lo que el periodo reproductivo se ubicaría en
estos meses. Se ha reportado para dos especies de la
misma familia, Trachurus mediterraneus (Viette et al.,
1997) y T. ovatus (Assem et al., 2005), una estación
reproductiva corta similar a C. vinctus. Para otras dos
especies de la misma familia, se ha observado un
período de desove más amplio, en C. chrysophrys se
extiende de septiembre a febrero (Al-Rasady et al.,
2012) y T. murphyi presentó máximos de septiembre a
diciembre (Perea et al., 2013). Las diferencias en la
amplitud del periodo reproductivo se deberían a la
adaptación de cada especie en respuesta a las
variaciones ambientales locales (Kaiser, 1973).
El factor de condición (FC), explica el estado
nutricional general de los organismos en relación con
el cambio de corpulencia, crecimiento y madurez
sexual, y depende de la edad, sexo, temporada, tipo de
alimento consumido, cantidad de reservas de grasa y
grado de desarrollo muscular (Rodríguez-Gutiérrez,
1992; Barnham & Baxter, 1998). En C. vinctus ambos
sexos presentaron los máximos del FC en marzo y abril
(periodo de reproducción) y su variación mensual
presentó diferencias significativas en ambos sexos, en
cambio, para C. chrysophrys la variación mensual del
FC no mostró diferencias significativas (Al-Rasady et
al., 2012).
Se ha observado que en algunas especies de peces el
IGS se relaciona de forma inversa con el FC, es decir,
valores altos del IGS, se asocian con valores bajos del
FC o viceversa. Esto se debería principalmente al gasto
de energía utilizado en el proceso reproductivo o a la
alternancia entre períodos de acumulación de reservas
de energía y períodos de agotamiento debido a la
reproducción. También se ha observado un mayor gasto
energético para la formación de la gónada en hembras
que en machos (West, 1990; King, 1995; González &
Oyarzún, 2002; Guirao et al., 2005). Aunque en
algunas especies esto es claro, no es una regla general,
y se pueden encontrar variaciones en la relación entre
el IGS y el FC. En el presente trabajo se observó una
relación directa entre estos dos índices, y lo mismo se
ha encontrado en Brycon amazonicus (Arias et al.,
2006), Girardinichthys multiradiatus (Cruz-Gómez et
al., 2010) y Rastrelliger kanagurfa (Rahman &
Hafzath, 2012). Una probable explicación de la
coincidencia temporal del IGS y FC en C. vinctus (este
trabajo), puede sustentarse en que en la región ocurren
periodos de intensas surgencias (febrero-mayo;
619
10
Ambriz-Arreola et al., 2012), con un doble beneficio
para los adultos y la progenie, debido a la mayor
disponibilidad trófica.
La proporción sexual es un elemento importante en
el análisis de la estructura poblacional; que puede
cambiar considerablemente entre especies y entre
poblaciones (Nikolsky, 1963). Para C. vinctus se
obtuvo una la proporción cercana al equilibrio, tanto en
el análisis mensual como por clase de longitud. Esta
misma tendencia se ha encontrado en varias especies de
la familia Carangidae, como Pseudocaranx dentex
(Afonso et al., 2008), Gnathamodon speciosus y C.
bajad (Grancourt et al., 2004), Trachurus trachurus
(Eltink, 1991; Karlou-Riga & Economidis, 1996;
Abaunza et al., 2003); mientras que en C. crysos (Sley
et al., 2012) y Atule mate (Clarke, 1996) los machos
dominaron sobre las hembras. Sin embargo, OspinaArango et al. (2008) registraron más hembras que
machos en Oligoplites saurus.
Además, se ha observado que en C. vinctus, los
machos alcanzaron la madurez sexual antes (23,77 cm)
que las hembras (26,04 cm), esto también se observó en
C. crysos (Sley et al., 2012) ya que a los 24,59 y 25,98
cm machos y hembras, respectivamente, alcanzaron la
madurez sexual. Esto se debería a que las hembras
necesitan más energía para la formación y madurez del
ovario y demoran más en madurar. El hecho que los
machos maduren antes que las hembras, también se ha
reportado para otros peces tropicales como A.
interruptus (Ruiz-Ramírez et al., 2012), L. inermis
(Lucano-Ramírez et al., 2012) y L. argentiventris
(Lucano-Ramírez et al., 2014).
La talla de madurez gonadal puede variar entre
especies, y entre una misma especie en diferentes
ambientes (Saborido-Rey, 2008). Grimes (1987)
mencionó que las especies de la familia Lutjanidae
alcanzan la madurez sexual entre el 40 y 50% de la
longitud máxima. En este estudio las hembras de C.
vinctus alcanzaron la madurez sexual entre el 55 y 65%
de su longitud máxima. Estos porcentajes son similares
a los encontrados en los carángidos Carangoides
chrysophrys, C. hippos y Seriola dumerilii donde se ha
observado una tendencia a madurar sexualmente
cuando la longitud está entre 50 y 70% de longitud
máxima (Marino et al., 1995; Caiafa et al., 2011; AlRasady et al., 2012). Por el contrario, en otras especies
de esta familia como Caranx crysos, Pseudocaranx
dentex, Trachurus mediterraneus y T. murphyi la
madurez se ha alcanzado cuando los individuos miden
entre 20 y 40% de su longitud máxima (Afonso et al.,
2008; Sley et al., 2012; Demirel & Yüksek, 2013; Leal
et al., 2013).
También, como las tallas promedio de madurez
sexual son menores que las tallas promedio de captura
en los dos sexos, permite suponer que más del 50% de
los individuos capturados de C. vinctus habrían tenido
al menos un evento reproductivo.
C. vinctus es una especie que se comercializa en la
región, si bien no es muy abundante y carece del
estigma de otras especies de primera calidad, es un
hecho que se ha venido aprovechando en la región, y
hasta el momento no se cuenta con información básica
de su biología y en consecuencia el estado de su
explotación. Este trabajo es el primero en abordar
aspectos de la biología reproductiva de C. vinctus, que
de manera conjunta con información pendiente de
obtener sobre la fecundidad, edad, crecimiento y
dinámica poblacional, entre otros, contribuyen para
formular e implementar estrategias de manejo en este
recurso pesquero.
AGRADECIMIENTOS
Este estudio fue financiado por la Universidad de
Guadalajara. Los autores agradecen a Daniel Kosonoy,
Gerardo Kosonoy y Manuel Díaz, su ayuda en la
realización de las actividades de pesca; a las cooperativas “Rivera Melaque” y “Punta Farallón” por el uso
de sus instalaciones y a los estudiantes que colaboraron
en los muestreos.
REFERENCIAS
Abaunza, P., L. Gordo, C. Karlou-Riga, A. Murta,
A.T.G.W. Eltink, M.T. García-Santamaría, C.
Zimmermann, C. Hammer, P. Lucio, S.A. Iversen, J.
Molloy & E. Gallo. 2003. Growth and reproduction of
horse mackerel, Trachurus trachurus (Carangidae).
Rev. Fish Biol. Fish., 13: 27-61.
Afonso, P., J. Fontes, T. Morato, K.N. Holland & R.S.
Santos. 2008. Reproduction and spawning habitat of
white trevally, Pseudocaranx dentex, in the Azores,
central north Atlantic. Sci. Mar., 7: 373-381.
Albieri, R.J., F.G. Araújo & T.P. Ribeiro. 2010. Gonadal
development and spawning season of white mullet
Mugil curema (Mugilidae) in a tropical bay. J Appl.
Ichthyol., 26: 105-109.
Allen, G.R. & R.D. Robertson. 1994. Fishes of the
Tropical Eastern Pacific. University of Hawaii,
Hawaii, 332 pp.
Al-Rasady, I., A. Govender & S.M. Al-Jafaili. 2012.
Reproductive biology of longnose trevally (Carangoides
chrysophrys) in the Arabian Sea, Oman. Environ. Biol.
Fish., 93: 177-184.
Ambriz-Arreola, I., J. Gómez-Gutiérrez, C. FrancoGordo, B.E. Lavaniegos & E. Godínez-Domínguez.
2012. Influence of coastal upwelling-downwelling
variability on tropical euphausiid abundance and
community structure in the inshore Mexican central
Pacific. Mar. Ecol. Prog. Ser., 451: 119-136.
Arias, C.J.A., E. Zaniboni-Filho & B.E. Aya. 2006.
Indicadores del ciclo reproductivo del yamú Brycon
amazonicus, en cautiverio. Orinoquia, 10: 24-34.
Arreguín-Sánchez, F. & E. Arcos-Huitrón. 2011. La pesca
en México: estado de la explotación y uso de los
ecosistemas. Hidrobiológica, 21: 431-462.
Assem, S.S., S.S. El-Serafy, M.M. El-Garabawy, M. ElG. Absawy & S.K. Kaldus. 2005. Some biochemical
aspects of reproduction in female Trachinotus ovatus
(Carangidae). Egypt. J. Aquat. Res., 31: 1-13.
Barnham, C.P. & A. Baxter. 1998. Condition factor, K, for
salmonid fish. Fish. Notes, 5: 1-3.
Billard, R. 1986. Spermatogenesis and spermatology of
some teleost fish species. Reprod. Nutr. Develop., 26:
877-920.
Brown-Peterson, N.J., D.M. Wyanski, F. Saborido-Rey,
B.J. Macewicz & S.K. Lowerre-Barbieri. 2011. A
standardized terminology for describing reproductive
development in fishes. Mar. Coast. Fish. Dyn.
Manage. Ecosyst. Sci., 3: 52-70.
Caiafa, H.I., B.J. Narváez & F.S. Borrero. 2011. Algunos
aspectos de la dinámica poblacional del jurel Caranx
hippos (Pisces: Carangidae) en Bocas de Ceniza,
Caribe colombiano. Rev. Med. Vet. Zool., 16: 23242335.
Castro-Aguirre, J.L., P.H. Espinosa & J.J. Schmitter-Soto.
1999. Ictiofauna Estuarino- Lagunar y Vicaria de
México. Editorial Limusa, Mexico D.F., 711 pp.
Chávez-Comparan, J.C., G.G. Galeana-Lemus, I, ManzoVargas & J.A. Salinas-Sánchez. 2008. Catálogo de
peces de arrecifes rocosos-coralinos de Punta
Carrizales. Facultad de Ciencias Marinas, Universidad
de Colima, Colima, 114 pp.
Clarke,T. A. 1996. Reproductive biology and egg
abundance of the yellowtail scad or 'Omaka, Atule
mate (Carangidae), in Kane'ohe Bay, Hawaii. Pac. Sci.
50: 93-107.
Cruz-Gómez, A., A.C. Rodríguez-Varela & H. VázquezLópez. 2010. Madurez sexual y reproducción de
Girardinichthys multiradiatus (Meek, 1904) en un
embalse del poblado de San Martín, Queretaro,
México. Biocyt, 3: 94-106.
Demirel, N. & A. Yüksek. 2013. Reproductive biology of
Trachurus mediterraneus (Carangidae): a detailed
study for the Marmara-Black Sea stock. J. Mar. Biol.
Assoc. U.K., 93: 357-364.
620
11
Eltink, A.T.G.W. 1991. Batch fecundity and fraction
spawning of horse mackerel (Trachurus trachurus L.).
EC Study Contract, N BO-1990-207, 71 pp.
Everson, A.R., H.A. Williams & B.M. Ito. 1989.
Maturation and reproduction in two Hawaiian eteline
snappers, uku, Aprion virescens, and onaga, Etelis
coruscans. Fish. Bull., 87: 877-888.
Froese, R. & D. Pauly. 2011. FishBase. World Wide Web
electronic publication. [www. fishbase.org]. Reviewed: 5 November 2015.
González, P. & C. Oyarzún. 2002. Variabilidad de índices
biológicos en Pinguipes chilensis Valenciennes 1833
(Perciformes, Pinguipedidae): ¿Están realmente
correlacionados? Gayana, 66: 249-253.
Grandcourt, E.M., T.Z. Al Abdessalaam, F. Francis & A.
Al Shamsi. 2004. Population biology and assessment
of representatives of the family Carangidae
Carangoides bajad and Gnathanodon speciosus
(Forssal, 1775), in the southern Arabian Gulf. Fish.
Res., 69: 331-341.
Grimes, C.B. 1987. Reproductive biology of the
Lutjanidae: a review. In: J.J. Polovina & S. Ralston
(eds.). Tropical snappers and groupers: biology and
fisheries management. Westview Press, Boulder, 659
pp.
Guirao, R., J. Socorro, T. Reyes, J. Roo, H. FernándezPalacios & M.S. Izquierdo. 2005. Estudio del desarrollo gonadal del jurel dentón Pseudocaranx dentex
(Bloch & Schneider, 1801) en aguas costeras de las
islas Canarias. Bol. Inst. Esp. Oceanogr., 21: 253-264.
Htun-Han, M. 1978. The reproductive biology of the dab
Limanda limanda (L) in the North sea: gonadosomatic
index, hepatosomatic index and condition factor. J.
Fish Biol., 13: 369-378.
Hyder, M. 1969. Histological studies on the testis of
Tilapia leucosticta and other species of the genus
Tilapia (Pisces: Teleostei). T. Am. Microsc. Soc., 88:
211-231.
Kaiser, C.E. 1973 Gonadal maturation and fecundity of
horse mackerel Trachurus murphy (Nichols) off the
coast of Chile. T. Am. Fish. Soc., 102: 101-108.
Karlou-Riga, C. & P.S. Economidis. 1996. Ovarian atretic
rates and sexual maturity of horse mackerel, Trachurus
trachurus (L.) in the Saronikos Gulf (Greece). Fish.
Bull., 94: 66-76.
Karlou-Riga, C. & P.S. Economidis. 1997. Spawning
frequency and batch fecundity of horse mackerel,
Trachurus trachurus (L.), in the Saronikos Gulf
(Greece). J. Appl. Ichthyol., 13: 97-104.
King, M.G. 1995. Fisheries biology, assessment and
management. Fishing News Books, Oxford, 400 pp.
621
12
index of Indian mackerel (Rastrelliger kanagurta)
captured from Kuantan coastal water. J. Biol. Sci., 12:
426-432.
Leal, E., E. Díaz, J.C. Saavedra-Nievas & G. Claramunt.
2013. Ciclo reproductivo, longitud y edad de madurez
de jurel Trachurus murphyi, en la costa de Chile. Rev.
Biol. Mar. Oceanogr., 48: 601-611.
Lowerre-Barbieri, S.K., N.J. Brown-Peterson, H. Murua,
J. Tomkiewicz, D.M. Wyanski & F. Saborido-Rey.
2011. Emerging issues and methodological advances
in fisheries reproductive biology. Mar. Coast. Fish.
Dyn. Manage. Ecosyst. Sci., 3: 32-51.
Rodríguez-Gutiérrez, M. 1992. Técnicas de evaluación
cuantitativa de la madurez gonádica en peces. AGT
Editores, México, 79 pp.
Lucano-Ramírez, G., S. Ruiz-Ramírez, B. AguilarPalomino & J.A. Rojo-Vázquez. 2001a. Listado de las
especies de peces de la región costera de Jalisco y
Colima, México. Ciencia y Mar, 15: 13-20.
Lucano-Ramírez, G., C. Villagrán-Santa, S. Ruiz-Ramírez
& T. López-Murillo. 2001b. Histología de los ovocitos
de Lutjanus peru (Nichols & Murphy, 1922) (Pisces:
Lutjanidae). Cienc. Mar., 27: 335-349.
Rojo-Vázquez, J.A., G. Lucano-Ramírez & S. RuizRamírez. 2009. Length-weight relationships for
coastal fish species from the artisanal gillnet fishery in
the central Mexican Pacific. J. Appl. Ichthyol., 25:
497-498.
Lucano-Ramírez, G., S. Ruiz-Ramírez, G. GonzálezSansón & B.P. Ceballos-Vázquez. 2012. Biología
reproductiva del pargo Lutjanus inermis (Perciformes:
Lutjanidae), en el Pacífico central mexicano. Rev.
Biol. Trop., 60: 303-403.
Lucano-Ramírez, G., S. Ruiz-Ramírez, G. GonzálezSansón & B.P. Ceballos-Vázquez. 2014. Reproductive
biology of the yellow snapper, Lutjanus argentiventris
(Pisces, Lujanidae), from the Mexican central Pacific.
Cienc. Mar., 40: 33-44.
Marino, G., A. Mandich, A. Massari, F. Andaloro, S.
Porello, M.G. Finoia & F. Cevasco. 1995. Aspects of
reproductive biology of the Mediterranean amberjack
(Seriola dumerilii Risso) during the spawning period.
J. Appl. Ichthyol., 11: 9-24.
McBride, R.S., F.J. Stengard & B. Mahmoudi. 2002.
Maturation and diel reproductive periodicity of round
scad (Carangidae: Decapterus punctatus). Mar. Biol.,
140: 713-722.
Nelson, J.S. 2006. Fishes of the world. John Wiley &
Sons, London, 624 pp.
Nikolsky, G. 1963. The ecology of fishes. Academic
Press, London, 352 pp.
Ospina-Arango, J.F., F.I. Pardo-Rodríguez & R. ÁlvarezLeón. 2008. Madurez gonadal de la ictiofauna presente
en la Bahía de Cartagena, Caribe Colombiano. Bol.
Cient. Mus. His. Nat., 12: 117-140.
Perea, A., J. Mori, B. Buitrón & J. Sánchez. 2013.
Aspectos reproductivos del jurel Trachurus murphyi
en el Perú. Rev. Peru. Biol., 20: 29-34.
Possamai, B. & L.F. Fávaro. 2015. Using mariculture as a
breeding site: reproduction of Hypleurochilus fissicornis
(Actinopterygii: Blenniidae). Sci. Mar., 79: 335-343.
Rahman, M.M. & A. Hafzath. 2012. Condition, lengthweight relationship, sex ratio and gonadosomatic
Rojo-Vázquez, J.A. & M. Ramírez-Rodríguez. 1997.
Composición específica de la captura con redes de
enmalle en bahía de Navidad, Jalisco, México.
Oceánides, 12: 121-126.
Ruiz-Ramírez, S., G. Lucano-Ramírez, G. GonzálezSansón, J.A. Rojo-Vázquez & M. Arellano-Martínez.
2012. Biología reproductiva de Anisotremus
interruptus (Perciformes: Haemulidae) en el Pacífico
central mexicano. Rev. Biol. Trop., 60: 709-720.
Saborido-Rey, F. 2008. Ecología de la reproducción y
potencial reproductivo en las poblaciones de peces
marinos. Instituto de Investigaciones Marinas (CSIC),
Curso de Doctorado, Universidad de Vigo, Vigo, 71
pp.
Sánchez, J., A. Perea, B. Buitrón & L. Romero. 2013.
Escala de madurez gonadal del jurel Trachurus
murphyi Nichols, 1920. Rev. Peru. Biol., 20: 35-44.
Sánchez-Cárdenas, R., M. Arellano-Martínez, M.C.
Valdez-Pineda, R.E. Morán-Angulo & B.P. CeballosVázquez. 2011. Reproductive cycle and sexual
maturity of Sphoeroides annulatus (Jenyns, 1842)
(Tetraodontiformes, Tetraodontidae) from the coast of
Mazatlan, Sinaloa, Mexico. J. Appl. Ichthyol., 27:
1190-1196.
Sley, A., O. Jarboui, M. Ghorbel & A. Bouain. 2012.
Annual reproductive cycle, spawning periodicity and
sexual maturity of blue runner Caranx crysos (Pisces,
Carangidae) from the Gulf of Gabes (Tunisia, Eastern
Mediterranean). J. Appl. Ichthyol., 28: 785-790.
Solomon, F.H. & I.W. Rammarine. 2007. Reproductive
biology of white mullet, Mugil curema (Valenciennes)
in the southern Caribbean. Fish. Res., 88: 133-138.
Tapia-García, M. 1997. Diversidad dinámica y patrones
reproductivos en la comunidad de peces demersales
del Golfo de Tehuantepec. Universidad Autónoma
Metropolitana. Unidad Iztapalapa. Informe finalCONABIO. México D.F., pp. 95-117.
Thulasitha, W.S. & K. Sivashanthini. 2013a. Microscopic
staging system used in the identification of gonad
developmental stages of Scomberoides lysan. J. Fish.
Aquat. Sci., 8: 355-366.
Thulasitha, W.S. & K. Sivashanthini. 2013b. Reproductive characteristics of doublespotted Queenfish,
Scomberoides lysan (Actinopterygii: Perciformes:
Carangidae), from Sri Lankan waters: implications for
fisheries management. Acta Ichthyol. Piscat., 43: 7-13.
Viette, M., P.G. Giulianini & E.A. Ferrero. 1997. Reproductive biology of scad, Trachurus mediterraneus
(Teleostei, Carangidae) from The Gulf of Trieste. J.
Mar. Sci., 54: 267-272.
Received: 6 October 2015; Accepted: 23 May 2016
622
13
West, G. 1990. Methods of assessing ovarian development
in fishes: a review. Aust. J. Mar. Freshwat. Res., 41:
199-222.
Yamamoto, K. & M. Yamazaki. 1961. Rhythm of
development in the oocyte of the gold-fish, Carassius
auratus. Bull. Fac. Fish. University Hokkaido, 12: 93114.
Jersey, 960 pp.
Lat. Am. J. Aquat. Res., 44(3): 623-637, 2016Fauna asociada a Lessonia como indicador ecológico
Research Article
Fauna asociada a discos de adhesión del complejo Lessonia nigrescens.
¿Es un indicador de integridad ecológica en praderas explotadas
de huiro negro, en el norte de Chile?
J. M. Alonso Vega1,2
Departamento de Biología Marina, Facultad de Ciencias del Mar
2
Programa de Doctorado en Biología y Ecología Aplicada
1
Corresponding author: Alonso Vega (avega@ucn.cl)
RESUMEN. Los discos de adhesión del complejo Lessonia nigrescens son hábitats de residencia para una gran
diversidad de invertebrados. La fauna asociada es sensible a la pesquería del recurso huiro negro en el norte de
Chile porque una de las recomendaciones de manejo es cosechar la planta completa. Considerando lo anterior,
y el rol ecológico que cumplen las algas pardas como especies fundacionales, este estudio propone el uso de la
fauna asociada a los discos de adhesión como un indicador ecológico para monitorear la integridad de praderas
explotadas de L. nigrescens. Para cumplir esto se evaluó la morfología de las plantas y discos de adhesión, junto
con la composición, abundancia y estructura de las comunidades asociadas en tres tipos de estrategias de
conservación de recursos basados en la administración pesquera espacialmente explícita: áreas de libre acceso
y áreas de manejo (con cosecha), y áreas marinas protegidas (sin cosecha) en Atacama y Coquimbo (26-32ºS).
Los resultados mostraron que una alta presión de cosecha en las praderas explotadas transforma la morfología
de las plantas y de los discos de adhesión, alterando el proceso de colonización y agregación de especies predicho
para estos hábitats biogénicos, modificando la biodiversidad esperada. Así, la fauna asociada a discos de área
de libre acceso tiene menor riqueza de especies, abundancia de organismos y biodiversidad que sus contrapartes
procedentes de áreas de manejo ó áreas marinas protegidas. Además, las estructuras de las comunidades
asociadas a los discos son más variables en áreas de libre acceso. Los resultados sugieren que los discos de
adhesión son microecosistemas representativo del ambiente intermareal, y pueden ser utilizados como unidades
de muestreo replicables y comparables para monitorear la integridad de praderas explotadas de Lessonia en
áreas de libre acceso a la pesquería. Este indicador ecológico es fácil de evaluar y difundir entre los usuarios de
la cadena productiva del huiro negro.
Palabras clave: Lessonia nigrescens, pesquería, indicador ecológico, conservación, biodiversidad.
Inhabiting fauna in holdfasts of Lessonia nigrescens complex. Is it an indicator of
ecological integrity in exploited kelp beds in northern Chile?
ABSTRACT. Lessonia nigrescens complex holdfasts habitats are home to a wide diversity of invertebrates.
The holdfasts associated fauna is sensitive to the kelp fishery in northern Chile because one of the management
recommendation is to harvest the whole plant. Considering the above, and the ecological role play by brown
algae as foundation species, this study proposes the use of fauna inhabiting the holdfasts as an ecological
indicator to monitor the integrity of exploited kelp beds. To accomplish this objective, the morphology of plants
and holdfasts was evaluated together with the composition, abundance and community structure associated in
three types of resource conservation strategies based on fishery management spatially explicit: open access areas
and management areas (to harvest), and marine protected areas (with no harvest), in Atacama and Coquimbo
(26-32°S). The results show that high harvest pressure on exploited kelp beds transforms the plant morphology
and holdfast, altering the colonization process and species aggregation predicted for these biogenic habitats
modifying the expected biodiversity. Thus, associated fauna in open access areas has lower species richness,
abundance and biodiversity of organisms than their counterparts in management areas or marine protected areas.
__________________
623
624
Moreover, the structure of the holdfast associated communities, are more variables in open access areas. The
results suggest that holdfasts are representative micro-ecosystems of the intertidal environment, and can be used
as sampling replicable and comparable units to monitor exploited kelp beds integrity in fisheries open access
areas. This ecological indicator is easy to evaluate and disseminate among users of the kelp productive chain.
Keywords: Lessonia nigrescens, kelp fisheries, ecological indicator, marine conservation, biodiversity.
INTRODUCCIÓN
Las algas pardas chilenas son explotadas para la
producción de polímeros naturales (Bixler & Porse,
2011). Esta actividad económica está focalizada en el
norte de Chile (18°-32°S), donde se desarrolla a través
de una compleja cadena productiva de alto impacto
social y bajo valor agregado (Vásquez, 2008). De las
especies de algas pardas comercializadas en Chile, el
recurso huiro negro, conformado por el complejo de
especies Lessonia nigrescens Bory (Laminariales),
representa casi el 70% de la biomasa desembarcada
anualmente (Vega et al., 2014). Recientemente, un
análisis morfológico y molecular demostró que L.
nigrescens, es un complejo conformado por dos
especies crípticas, morfológicamente similares; donde
las poblaciones distribuidas al norte de Coquimbo
(30°S) corresponden a Lessonia berteroana Montagne,
y las ubicadas al sur de esta latitud corresponden a
Lessonia spicata (Suhr) Santelices (González et al.,
2012). Sin embargo, en este estudio se ha mantenido el
binomio taxonómico Lessonia nigrescens porque es el
nombre científico utilizado en la cadena productiva del
recurso huiro negro. Del total de la biomasa
desembarcada, el 95% proviene de la cosecha de
praderas naturales en áreas de libre acceso (ALA) a la
pesquería donde cualquier pescador que tenga inscrito
el recurso algas pardas puede realizar cosecha; mientras
que el resto proviene de áreas de manejo y explotación
de recursos bentónicos (AMERB), donde las
organizaciones de pescadores tienen derechos de uso
territorial al recurso y la explotación está basada en el
co-manejo (Vásquez et al., 2012).
Desde la perspectiva ecológica, las algas pardas son
especies fundacionales que sostienen un ecosistema
productivo, diverso y representativo de las costas
temperadas del mundo (Christie et al., 2009), que
además, es muy sensible a la pesquería (Bracken et al.,
2007; Stagnol et al., 2013). Distintos estudios han
evaluado los efectos ecológicos de la pesquería de algas
pardas en Chile (Vásquez & Santelices, 1990; Vásquez,
1995). Con dicha información se establecieron las
bases biológicas para la explotación sustentable del
recurso que, para Lessonia, se resumen en las siguientes
recomendaciones de manejo: ralear la pradera, cosechar
plantas adultas completas y rotar áreas (Vásquez et al.,
2012). En un contexto de pesca responsable y de bajo
impacto, que permiten la explotación comercial de las
praderas naturales en ALA, sin alterar los atributos que
estas algas tienen como especies fundacionales e
ingenieras de ecosistemas (Bracken et al., 2007; Stagnol
et al., 2013).
En el año 2013, la administración pesquera estableció un plan de manejo para algas pardas en ALA con
un enfoque ecosistémico y precautorio (Tapia et al.,
2013). Este plan de manejo es regional, participativo,
adaptativo y multidisciplinario, que requiere de
indicadores ecológicos que permitan monitorear las
acciones de manejo propuestas para la sustentabilidad
de las praderas explotadas de L. nigrescens. La
integridad ecológica es una manera práctica de evaluar
la efectividad del plan de manejo de un recurso a través
de indicadores comprensibles y comunicables a la
sociedad (Carignan & Villard, 2002). Así, un indicador
ecológico en el ámbito del manejo con enfoque
ecosistémico es una o varias variables o índices, o un
modelo que permita estimar la integridad ecológica del
ecosistema (Niemi & McDonald, 2004), en este caso,
el de las praderas explotadas de algas pardas. Además,
es importante que el indicador posea relevancia social,
sea simple y fácil de entender, que tenga validez
científica y legal, y que pueda ser cuantitativamente
medible y económicamente viable de implementar
(Dale & Beyeler, 2001).
En el norte de Chile, las praderas de L. nigrescens
forman un conspicuo cinturón en la zona intermareal
baja de ambientes rocosos expuestos al oleaje, donde
las plantas alcanzan un gran tamaño (hasta 4 m de largo
y 50 cm de diámetro del disco de adhesión; Vásquez &
Santelices, 1990). Las plantas aumentan la heterogeneidad ambiental, modifican el movimiento del agua
y regulan la luz en los estratos inferiores de las praderas
(Santelices & Ojeda, 1984). Además, una gran variedad
de invertebrados usan los discos de adhesión como
hábitat (Cancino & Santelices, 1981, 1984; Vásquez &
Santelices, 1984), donde encuentran refugio y alimentación, utilizándolos también como áreas de reproducción, desove, asentamiento larval, crianza de
juveniles y muda (Thiel & Vásquez, 2000; Vásquez et
al., 2001). La cosecha del huiro negro es efectuada
durante la marea baja removiendo la planta completa
con una barreta de fierro (Vásquez, 2008). Pero, si la
cosecha trasgrede alguna de las recomendaciones de
manejo, por ejemplo, la talla mínima legal de captura
(>20 cm de diámetro del disco de adhesión para L.
nigrescens; Vásquez et al., 2012; Tapia et al., 2013),
Fauna asociada a Lessonia como indicador ecológico
entonces se pone en riesgo la integridad ecológica de
las poblaciones naturales. Así, este estudio propone el
uso de la fauna asociada a los discos de adhesión de L.
nigrescens (Cancino & Santelices, 1984), de manera
que su monitoreo determine un indicador ecológico de
fácil evaluación in situ.
Numerosos estudios han propuesto el uso de la
fauna asociada a discos de algas pardas como un
biomonitor de perturbaciones ambientales de origen
natural o antrópico (e.g., Smith, 2000; Anderson et al.,
2005; Vásquez & Vega, 2005). Un análisis de la fauna
asociada a estas estructuras de fijación sugiere una
explotación sustentable de las praderas de L. nigrescens
en el norte de Chile (Vásquez et al., 2012). Considerando lo anterior, y la información base disponible
sobre el tema (Santelices et al., 1980; Cancino &
Santelices, 1981, 1984; Santelices, 1982; Vásquez &
Santelices, 1984, 1990; Vásquez et al., 2001; Ortega et
al., 2014), este estudio evalúa el uso de la fauna
asociada a discos de adhesión como un indicador de
integridad ecológica de praderas explotadas de L.
nigrescens. En consecuencia, se realizó un experimento
natural, comparando la composición, biodiversidad y
estructura de las comunidades asociadas a discos de
Lessonia en tres tipos de estrategias de conservación de
recursos sobre la base de la administración pesquera
territorialmente explícita: áreas de libre acceso (ALA),
áreas de manejo y explotación de recursos bentónicos
(AMERB), y áreas marinas protegidas (AMP).
Además, las plantas y discos de adhesión se caracterizaron morfológicamente para simplificar la
evaluación in situ del indicador ecológico basado en la
fauna asociada.
El estudio se realizó en praderas de L. nigrescens
ubicadas en distintas localidades de las regiones de
Atacama y Coquimbo (ca. 26° y 32°S respectivamente,
Fig. 1), donde se desarrolla la mayor parte de la
pesquería de algas pardas (Vásquez, 2008). Los
ambientes rocosos litorales expuestos al oleaje en estas
localidades, representativos del área de estudio, están
conformados por plataformas, farellones, barras e
islotes configurando una costa heterogénea interrumpida por playas de bolones (Vega et al., 2014). La
extensión vertical y abundancia relativa de L.
nigrescens dependen del grado de exposición al oleaje
e inclinación de las rocas. En farellones y paredones la
pradera se adelgaza, y se ensancha en plataformas y
playas de bolones con menor pendiente (Vega, 2015).
En noviembre y diciembre de 2013, se recolectaron
discos de adhesión en plataformas rocosas de ALA y
AMERB adyacentes, en: Totoral Bajo, Caleta Angosta,
625
Lagunillas y Talquilla; y de AMP en: Isla Grande de
Atacama e Isla Choros (Tabla 1), donde no hay cosecha
de algas pardas.
En cada sitio de estudio (Tabla 1), se muestrearon
cinco plantas adultas desde el centro de la pradera
durante las mareas más bajas del mes. Una planta se
considera adulta cuando el diámetro mayor del disco de
adhesión es ≥20 cm (Vásquez, 2008; Vásquez et al.,
2012), por sobre este tamaño la riqueza de especies de
la fauna asociada no cambia significativamente
(Vásquez & Santelices, 1984, 1990). Además, este
tamaño del disco representa la talla mínima legal de
captura del recurso en el plan de manejo (Tapia et al.,
2013). Las plantas fueron caracterizadas morfológicamente in situ midiendo el diámetro mayor del disco y
el largo total. Luego de cortar, contar y pesar los
estipes, el disco de adhesión fue desprendido del
sustrato rocoso con una barreta de hierro, depositado en
una bolsa plástica rotulada con código de identificación, fijado en formalina diluida al 10% en agua de
mar y almacenado hasta su análisis. En el laboratorio,
los organismos fueron removidos de las cavidades en
los discos con agua y retenidos en un tamiz de 0,5 mm
de malla. Después de estimar peso y volumen, los
discos fueron fraccionados para extraer los individuos
remanentes (Vásquez & Santelices, 1984). El volumen
del disco se midió por desplazamiento de agua
(Vásquez & Santelices, 1984). Los organismos fueron
identificados hasta el nivel taxonómico más bajo
posible usando las fuentes citadas en Vásquez et al.
(2001).
El ensamble de invertebrados asociados a los discos
se caracterizó usando distintos parámetros univariados
de diversidad biológica: riqueza de especies (S),
abundancia estandarizada (n° individuos 100 g disco-1),
índice de diversidad de Shannon-Wiener H’ e índice de
dominancia de Simpson λ’ (Vásquez & Santelices,
1984). Estos parámetros junto con los descriptores del
disco y de las plantas fueron comparados con Análisis
de Varianza Anidada (ANDEVA) usando el tipo de
estrategia de conservación de recursos pesqueros como
factor principal (ALA, AMERB, AMP) y el sitio donde
se ubicó la pradera como factor anidado (Tabla 1),
previa comprobación de normalidad de los datos y
homogeneidad de varianzas (Quinn & Keough, 2002).
También se realizaron análisis multivariados para
identificar cambios en la composición y abundancia de
la fauna asociada a los discos de acuerdo al tipo de
estrategia de conservación. Se calculó una matriz de
similitud entre pares de muestra usando el índice de
Bray-Curtis, previa transformación de los datos usando
la ecuación log (x+1) (Clarke et al., 2006). La
estructura del ensamble por tipo de estrategia de
conservación y sitio de estudio, se representó gráfica-
626
Figura 1. Área de estudio y localidades (ver Tabla 1).
mente usando escalamiento no métrico multidimensional (nMDS) y se comparó estadísticamente con un
Análisis de Similitud (ANOSIM). Los valores “P” se
calcularon usando una correlación de Spearman con un
máximo de 9.999 permutaciones sin restricción (Clarke
& Gorley, 2006). Para identificar las especies que más
contribuyen a las diferencias en las estructuras de la
fauna asociada en ALA, AMERB y AMP se efectuó un
Análisis de Similitud Porcentual (SIMPER) utilizando
el software PRIMER v6 (Clarke & Gorley, 2006).
RESULTADOS
El diámetro de los discos de adhesión de Lessonia
recolectados para el análisis de la fauna asociada oscila
en torno al tamaño promedio estimado para el área de
estudio (25 ± 3 cm, n = 50; Vásquez et al., 2012), sin
diferencias entre tipo de estrategia de conservación
(Fig. 2a, Tabla 2). Sin embargo, los discos provenientes
de ALA son más sólidos y compactos, y tienen menos
cavidades, en comparación con aquellos recolectados
en AMP ó AMERB, cualidades que se reflejan en un
significativo mayor peso y volumen promedio de los
discos en ALA (Tabla 2, Figs. 2b-2c). Adicionalmente,
las plantas evaluadas en ALA son significativamente
más largas y más livianas que en AMP y AMERB
(Largo total: F(2,40) = 19,0004, P < 0,001; peso total:
F(2,40) = 7,3992, P < 0,001; Fig. 2d).
La fauna asociada a los discos en el área de estudio
comprendió 94 taxa distribuidos en 10 Phyla (Anexo
1): anélidos (poliquetos), artrópodos (principalmente
crustáceos), moluscos, cnidarios, equinodermos,
urocordados, platelmintos, nematodos, esponjas y
nemertinos. Los poliquetos están representados por
varias familias. En AMP se registró un total de 83 taxa
(28 órdenes y 16 clases), en AMERB fueron 89 taxa (29
órdenes y 17 clases), y en ALA se hallaron 74 taxa (23
órdenes y 14 clases).
Los índices de diversidad biológica muestran
diferencias significativas entre tipo de estrategia de
conservación (Tabla 2). En los discos procedentes de
ALA se detectó una menor riqueza de especies,
abundancia de organismos, y biodiversidad (i.e.,
Diversidad H’, Dominancia λ’) en comparación con
aquellos provenientes de AMERB y AMP (Tabla 2,
Fig. 3). Los discos en AMP presentaron riqueza de
especies, abundancia de organismos y dominancia λ’
significativamente mayor que los discos en AMERB,
pero la diversidad H’ no difiere significativamente
entre ambos tipos de estrategias de conservación (Tabla
2, Fig. 3).
627
Tabla 1. Ubicación geográfica de las localidades (Fig. 1) y nomenclatura de los sitios de estudio según tipo de estrategia
de conservación (ALA: Área de Libre Acceso, AMERB: Área de Manejo, y AMP: Área Marina Protegida). Se indica la
especie críptica del complejo L. nigrescens presente en cada localidad.
Región
Atacama
Atacama
Atacama
Coquimbo
Coquimbo
Coquimbo
Localidad
Latitud °S Longitud °W AMP AMERB ALA
Especie
Isla Grande de Atacama
27,248
70,974
AMP1
L. berteroana
Totoral Bajo
27,757
71,064
AMERB1 ALA1 L. berteroana
Caleta Angosta
28,250
71,163
Isla Choros
29,259
71,535
AMP2
L. berteroana
Lagunillas
30,103
71,383
Talquilla
30,864
71,683
AMERB4 ALA4 L. spicata
Tabla 2. Análisis de Varianza (ANDEVA) usando el tipo de estrategia de conservación (ALA: Área de Libre Acceso,
AMERB: Área de Manejo, y AMP: Área Marina Protegida) como factor principal y sitio de estudio (Tabla 1) como factor
anidado para evaluar la hipótesis que la morfología del disco adhesivo y la estructura de la comunidad asociada a discos de
L. nigrescens es modificada por la presión de cosecha en ALA. El valor P destacado en negrita indica diferencias
significativas.
Parámetro
Diámetro del disco de adhesión (cm)
Peso del disco de adhesión (g)
Volumen del disco de adhesión (g)
Riqueza de especies
Abundancia total (n° individuos por 100 g disco)
Índice de Shannon-Wiener H'
Índice de Simpson λ'
Factor
GL
CM
Valor F
Valor P
Prueba de Tukey
Tipo
Sitio (Tipo)
Error
Tipo
Sitio (Tipo)
Error
Tipo
Sitio (Tipo)
Error
Tipo
Sitio (Tipo)
Error
Tipo
Sitio (Tipo)
Error
Tipo
Sitio (Tipo)
Error
Tipo
Sitio (Tipo)
Error
2
7
40
2
7
40
2
7
40
2
7
40
2
7
40
2
7
40
2
7
40
15,6150
2,5357
9,0100
1,259
0,511
0,337
1,5648
0,5032
0,3037
1.893,81
24,04
20,06
7.712
686
102
0,384
0,048
0,056
0,0806
0,0018
0,0031
1,733
0,281
0,190
0,958
AMP=AMERB=ALA
3,739
1,519
0,032
0,189
(AMERB=ALA)>AMP
5,153
1,657
0,010
0,148
AMERB=(AMP>ALA)
94,407
1,199
0,001
0,326
AMP>AMERB>ALA
75,639
6,728
0,001
0,001
AMP>AMERB>ALA
6,893
0,856
0,003
0,549
(AMP=AMERB)>ALA
25,624
0,587
0,001
0,762
AMP>AMERB>ALA
La estructura de las comunidades asociadas a los
discos de adhesión varió significativamente entre tipos
de estrategia de conservación (ANOSIM; R global =
0,219; P = 0,0001). El análisis de ordenamiento
multidimensional (nMDS), mostró una estructura más
homogénea en la comunidad asociada a discos de AMP
en comparación con los discos de AMERB y ALA,
donde la ordenación fue más dispersa (Fig. 4). El
análisis de similitud (ANOSIM) indicó diferencias
significativas en la composición de la fauna asociada a
discos de AMP con respecto AMERB y ALA, así como
al comparar entre discos de AMERB y ALA (Tabla 3).
No obstante en AMERB y ALA, la fauna asociada fue
semejante, con algunas diferencias en composición y
abundancia (0,1 < R < 0,25).
El análisis SIMPER mostró una mayor similitud en
la composición y abundancia de las especies asociadas
entre discos de AMP (66,53%), que entre discos de
AMERB (41,82%) ó de ALA (32,38%) (Fig. 4). Al
comparar la estructura de las comunidades entre tipos
de estrategia de conservación, la fauna asociada a los
discos de AMP tuvo una mayor disimilitud con
respecto a los discos de ALA (79,77%) que con los de
AMERB (63,39%), mientras que la disimilitud en la
628
Figura 2. a) Diámetro, b) peso y c) volumen de los discos de adhesión, d) relación talla-peso de las plantas de Lessonia
nigrescens recolectadas en Áreas Marinas Protegidas (AMP), Áreas de Manejo (AMERB) y Áreas de Libre Acceso (ALA).
La barra representa la desviación estándar y las letras los grupos homogéneos obtenidos de la prueba de Tukey (Tabla 2).
estructura de las comunidades entre AMERB y ALA
fue de 68,12% (Tabla 4).
Los taxa que más contribuyeron a las diferencias en
abundancia entre los ensambles de invertebrados
fueron: un cnidario (Actinaria indet. sp.1), un crustáceo
(Pachycheles grossimanus), un anfípodo (Jaeropsis
sp.), dos moluscos bivalvos (Brachidontes granulata,
Semimytilus algosus), y dos poliquetos (Spionidae
indet., Syllidae indet.) (Tabla 4). Estos taxa
representativos de las comunidades asociadas a discos,
mostraron una menor abundancia en los ensambles de
ALA que de AMP y AMERB. La mismo ocurrió con el
patelogastrópodo Scurria scurra y el poliqueto
Nereididae indet., pero la menor abundancia sólo se
detectó al contrastar la fauna en discos de ALA con
AMP o AMERB (Tabla 4). En cambio, el bivalvo
Aulacomya atra, un gusano nemertino (Nemertina
indet. sp.1), un poliqueto (Cirratulidae indet.), y un
copépodo (Harpacticoidea indet.) fueron más comunes
en discos de AMERB que en aquellos provenientes de
AMP (Tabla 4).
DISCUSIÓN
Los discos de adhesión de algas pardas son “microecosistemas” (sensu Ortega et al., 2014), que han sido
usados como una herramienta de monitoreo para
evaluar estrés ambiental (Smith et al., 2000; Anderson
et al., 2005; Vásquez & Vega, 2005). Este estudio
demuestra la sensibilidad de estos microecosistemas a
la presión de cosecha en praderas explotadas de L.
nigrescens y su utilidad como unidades de muestreo
replicables y comparables. Al parecer, hay una
compleja relación entre la fauna asociada a los discos y
la dinámica demográfica de las praderas explotadas. La
renovación post-cosecha en esta alga parda es a través
de reclutamiento intenso y continuo, y del crecimiento
de plantas juveniles (Vega et al., 2014). Sin embargo,
629
Figura 3. a) Riqueza de especies, b) abundancia estandarizada, c) índice de Shannon-Wiener H’, d) índice de Simpson λ’
de la fauna asociada a discos de adhesión de Lessonia nigrescens recolectados en Áreas Marinas Protegidas (AMP), Áreas
de Manejo (AMERB) y Áreas de Libre Acceso (ALA). La barra representa la desviación estándar, y las letras los grupos
homogéneos obtenidos de la prueba de Tukey (Tabla 2).
en ALA la constante remoción de plantas desde el
sistema ha modificado el crecimiento modular de los
juveniles de manera que cuando alcanzan tallas adultas,
tienen frondas más largas y livianas que una planta
encontrada en AMP o AMERB. En algas pardas, este
tipo de morfología aparece cuando la agregación de
plantas adultas en la pradera es diezmada (Milligan &
DeWreede, 2000; Wernberg, 2005); tal como ocurre en
sitios ALA con alta presión de cosecha (Vega et al.
2014). En bajas densidades de plantas adultas, los
discos de adhesión son más sólidos y compactos para
poder resistir la mayor fuerza de arrastre que produce
el oleaje sobre las frondas más largas (Koehl, 1999),
proceso que en Lessonia se acelera por la fusión de
discos entre juveniles (Oróstica et al., 2014, Rodríguez
et al., 2014). En consecuencia, el crecimiento modular
acelerado y densodependiente de las plantas juveniles
modifica el proceso normal de colonización de la fauna
descrito para este tipo de hábitats, que consiste en la
agregación de especies a medida que el disco crece en
tamaño y volumen (Santelices et al., 1980; Santelices,
1982; Vásquez & Santelices, 1984). La fauna asociada
a estos discos sólidos y compactos está representada
principalmente por especies pioneras y algunas
accesorias, que de acuerdo a Vásquez & Santelices
(1984) caracterizan discos medianos en volumen (ca.
500 cc) y peso (ca. 0,5 kg). La conexión entre los
procesos demográficos en las praderas y los ecológicos
de la fauna asociada parece ser determinante en la
estructura y organización de la comunidad de
invertebrados que habitan los discos de adhesión de L.
nigrescens en áreas de libre acceso, por lo que requiere
de más evidencia experimental.
La composición y abundancia de la fauna asociada
en AMP, coincide con lo descrito en la literatura antes
del comienzo de la explotación intensiva de L. nigres-
630
2D Stress: 0,13
ALA2
AMERB4
ALA2
ALA3
ALA2
ALA3
ALA4
AMERB2
ALA2
ALA2
AMERB2
AMERB4
AMERB2
AMERB3
AMERB2AMERB2
AMERB3
AMP2
AMP2 AMP2
AMP1
AMP2 AMP2
AMERB3
AMP1
AMP1
AMP1
AMP1
ALA4
ALA4
ALA3
ALA3
ALA1
AMERB4
AMERB1
AMERB1
AMERB1
AMERB1
AMERB3
AMERB1
AMERB3
AMERB4
ALA3
ALA1
AMERB4
ALA1
ALA1
ALA1
ALA4
ALA4
Figura 4. Representación gráfica (nMDS) de la similitud entre los ensambles de fauna asociada a discos de adhesión de
Lessonia nigrescens por tipo de estrategia de conservación (Áreas Marinas Protegidas: AMP, Áreas de Manejo: AMERB,
Áreas de Libre Acceso: ALA), y sitio de estudio (ver nomenclatura de la Tabla 1).
Tabla 3. Resultado del Análisis de Similitud (ANOSIM)
comparando los ensambles de la fauna asociada a discos
de adhesión de L. nigrescens entre estrategias de
conservación (ALA: Área de Libre Acceso, AMERB:
Área de Manejo, y AMP: Área Marina Protegida). El valor
P destacado en negrita indica diferencias significativas.
Comparación entre tipo
de administración
pesquera
AMP vs ALA
AMP vs AMERB
AMERB vs ALA
Estadístico
R
Nivel de significancia
(valor P)
0,657
0,341
0,193
< 0,001
< 0,001
< 0,001
cens (Santelices et al., 1980; Santelices, 1982; Cancino
& Santelices, 1981, 1984; Vásquez & Santelices, 1990;
Thiel & Vásquez, 2000; Vásquez et al., 2001), y es
representativa de discos grandes (volumen >1.250 cc;
Vásquez & Santelices, 1984). En cambio, la
composición y abundancia de la fauna asociada en
ALA estaría significativamente modificada debido a la
alta presión de cosecha que se ejerce sobre las praderas
de L. nigrescens en estas áreas del norte de Chile (Vega
et al., 2014). La fauna asociada a los discos en AMERB
mantiene una biodiversidad y estructura comunitaria
relativamente similar a la encontrada en los discos de
AMP, con algunas diferencias relacionadas con el
proceso de agregación gradual de especies en los discos
que puede ser afectado por la estacionalidad y el
biotopo donde crece la planta (Thiel & Vásquez, 2000;
Vásquez et al., 2001; Vásquez & Vega, 2005). En
general, la correcta aplicación de las recomendaciones
de manejo (i.e., ralear la pradera, cosechar plantas
adultas completas y rotar áreas), permite la
sustentabilidad del recurso y la conservación de la
fauna asociada a las praderas en AMERB. Este
resultado concuerda con lo señalado por otros estudios,
donde se muestra que las áreas de manejo contribuyen
a la conservación de la biodiversidad de las praderas de
algas pardas; en áreas de libre acceso a la pesquería, en
cambio, la biodiversidad está en constante riesgo por
sobre-explotación del hábitat al cual se asocian
(Almanza & Buschmann, 2013; Molina et al., 2014).
Un total de 33 especies de invertebrados contribuyen al 90% de las diferencias en la composición y
abundancia de la fauna asociada a discos de L.
nigrescens proveniente de los sitios con distinto tipo de
estrategia de conservación de recursos pesqueros. En
general, los discos en ALA tienen una menor riqueza
de especies, biodiversidad y abundancia de organismos
que los discos en AMERB y AMP, y la estructura
comunitaria es más variables en estos hábitats
biogénicos. No obstante, en AMERB y ALA la fauna
asociada presenta algún grado de sobreposición de
especies debido a que la sucesión ecológica en los
discos sigue un patrón común de agregación gradual de
especies (Vásquez & Santelices, 1984; Thiel &
Vásquez, 2000; Ortega et al., 2014). Las comunidades
con escasa riqueza de especies, biodiversidad y
abundancia de organismos son características de discos
de plantas juveniles de L. nigrescens (Santelices, 1982;
631
Tabla 4. Análisis de Similitud Porcentual (SIMPER) de las especies que aportan diferencias en composición y abundancia
de invertebrados asociados a discos de Lessonia nigrescens entre estrategias de conservación (ALA: Área de Libre Acceso,
AMERB: Área de Manejo, y AMP: Área Marina Protegida). El porcentaje de corte entre pares de comparaciones fue mayor
al 50%. x Dis: disimilitud promedio; % Contrib: contribución porcentual de disimilitud general entre discos según tipo de
estrategia de conservación.
Especie
Syllidae indet.
Brachidonthes granulata
Semimytilus algosus
Anthozoa indet. sp. 1
Spionidae indet.
Pachycheles grossimanus
Jaeropsis sp.
Scurria scurra
Nereididae indet.
Harpacticoidea indet.
Cirratulidae indet.
Nematoda indet. sp. 1
Aulacomya atra
Total
AMP vs ALA
x Dis
% Contrib
6,48
9,31
6,74
9,69
5,18
7,45
4,03
5,80
4,22
6,07
2,74
3,94
1,97
2,84
2,18
3,14
1,92
2,76
51,00
Vásquez & Santelices, 1984, 1990). Considerando que
las plantas adultas en ALA corresponden en su mayoría
a discos juveniles fusionados (Oróstica et al., 2014), es
posible que los ensambles de invertebrados asociados
representen estados sucesionales más tempranos que
los encontrados en AMERB ó AMP. La fauna asociada
en ALA está caracterizada por especies pioneras dentro
de la sucesión ecológica descrita para este tipo de
hábitats, como bivalvos (e.g., B. granulata, S. algosus),
porcelánidos (e.g., P. grossimanus), anfípodos y
poliquetos (Vásquez & Santelices, 1984), configurando
una fauna típica de discos juveniles (Ortega et al.
2014). En cambio en AMERB y AMP, otros
organismos representativos en abundancia dentro de los
discos coexisten con las especies pioneras, tales como
patelogastrópodos (e.g., S. scurra), decápodos (e.g.,
Acanthocyclus gayi), y gusanos nemertinos caracterizando discos grandes con una fauna diversa y propia
de plantas adultas (Santelices, 1982; Vásquez &
Santelices, 1984). En discos grandes también es común
encontrar diferentes especies residentes que tienen
abundancias relativas altamente variables entre discos
de una misma localidad (e.g., peracáridos; Thiel &
Vásquez, 2000). Estas especies accesorias aumentan la
variabilidad en composición y abundancia de la fauna
asociada en ALA, y es otra evidencia de la modificación del proceso de colonización y agregación gradual
de especies predicho para este tipo de hábitats, lo cual
también requiere de más investigación.
AMERB vs ALA
x Dis
% Contrib
4,21
6,76
2,89
4,64
4,98
7,99
3,59
5,76
3,25
5,22
2,12
3,41
2,27
3,64
2,32
3,72
2,58
4,13
3,09
4,96
50,23
AMP vs AMERB
x Dis
% Contrib
3,97
7,61
4,80
9,20
2,78
5,33
3,37
6,46
2,56
4,91
1,43
2,74
1,63
3,12
1,33
1,48
1,46
1,35
2,54
2,84
2,79
2,58
50,12
Las características del biotopo (e.g., pendiente,
fuerza del oleaje, disponibilidad de nutrientes) determinan el crecimiento de las algas en la pradera
(Santelices, 1982, Santelices & Ojeda, 1984), y el
tiempo requerido para que la colonización y agregación
gradual de especies alcance niveles de saturación en los
discos de Lessonia (Thiel & Vásquez, 2000; Vásquez
et al., 2001). Estas cualidades son sensibles a
perturbaciones antrópicas locales (e.g., descarga al mar
de aguas servidas, riles y residuos mineros; Smith et al.,
2000; Anderson et al., 2005; Vásquez & Vega, 2005),
que junto al uso estacional y diferencial de este hábitat
biogénico por los invertebrados (e.g., reproducción,
desove, reclutamiento), pueden modificar espacial y
temporalmente la composición y abundancia de la
fauna asociada a discos de L. nigrescens (Vásquez &
Santelices, 1984). En cambio, la cosecha está dirigida
exclusivamente a la fracción adulta de la población, que
bajo un escenario de alta presión extractiva modifica la
dinámica de las poblaciones, morfología de las plantas
y sucesión ecológica de la fauna asociada al disco.
Aunque varios estudios han demostrado experimentalmente las implicancias ecológicas de la remoción de
Lessonia (Santelices, 1982; Vásquez & Santelices,
1990; Oróstica et al., 2014), el barreteo de plantas
adultas es una de las recomendaciones del plan de
manejo (Vásquez et al., 2012; Tapia et al., 2013). En
términos pesqueros, la biota asociada a algas pardas
clasifica como fauna acompañante (Subsecretaria de
Pesca y Acuicultura, 2001), y dada su condición
incidental corresponde a un caso muy particular de
632
descarte pesquero que no está catalogado. Así, este es
el primer estudio que documenta el efecto de la
pesquería de algas pardas sobre la fauna acompañante,
el cual es severo en áreas de libre acceso. La manera
más adecuada de mitigar este impacto pesquero es
aplicando correctamente las recomendaciones y
acciones establecidas en el plan de manejo, y
monitoreando la integridad de las praderas con
indicadores ecológicos fáciles de medir y comunicar a
los usuarios.
¿Es la fauna asociada a discos de adhesión un
indicador de integridad ecológica de praderas
explotadas de L. nigrescens? Los discos de adhesión de
algas pardas representan una extensión del paisaje
(Cancino & Santelices, 1981, 1984; Christie et al.,
2009); que en el caso de L. nigrescens, alberga casi el
80% de las especies de invertebrados que habitan el
entorno intermareal rocoso de la pradera (Vásquez et
al., 2001). Lo anterior, junto con la sensibilidad de este
microecosistema a la presión de cosecha permiten
utilizarlo como un indicador ecológico para monitorear
la integridad de praderas explotadas de Lessonia. Hay
varias razones para proponer esto: a) el disco de
adhesión es una unidad de muestreo natural
representativa de la fauna intermareal, replicable y
comparable (Vásquez & Vega, 2005); b) las especies
que usan este hábitat son relativamente fáciles de
identificar y de contar en el laboratorio (Vásquez et al.,
2001), al menos a nivel de taxa superiores o más
representativos (Anderson et al., 2005); c) es una
comunidad ecológica que puede adquirir interés
público a través de procesos participativos de ciencia
ciudadana y educación escolar (Thiel et al., 2014); y d)
las respuestas de algunos parámetros comunitarios
(e.g., riqueza de especies) y del disco de adhesión (e.g.,
volumen) a la presión de cosecha son relativamente
fáciles de reconocer in situ (e.g., discos adhesivos
sólidos y compactos con baja biodiversidad).
Aunque todavía se requiere investigar diversos
aspectos que podrían potenciar a este indicador
ecológico (e.g., especies indicadoras, grupos
funcionales), su aplicación in situ es simple y rápida de
ejecutar. El indicador puede ser evaluado estimando la
frecuencia porcentual de plantas barreteadas con discos
sólidos y compactos en los tendederos de algas
comúnmente ubicados en la playa frente a la pradera.
La compactación del disco es una representación
cualitativa de la disminución de la fauna asociada a L.
nigrescens como consecuencia de la presión de
cosecha. Por ejemplo, la frecuencia de discos con
morfología compacta en tenderos de algas ubicados en
distintas áreas de libre acceso en Atacama fluctuó entre
47 y 55% (Vega, 2015), sugiriendo una potencial
pérdida de la integridad ecológica en las praderas
explotadas de L. nigrescens en esta región. Para
establecer la magnitud del efecto se utilizó como punto
de referencia límite una pradera ubicada en AMP (i.e.,
Isla Chañaral), donde la frecuencia de discos compacto
es mínima, representa el 5% de la población, y sólo
aparece en plantas juveniles (Vega, 2015). La
implementación de este indicador ecológico requiere de
un presupuesto mínimo, y el seguimiento puede ser
ejecutado por los propios pescadores ó por cualquier
persona interesada en realizar el monitoreo, después de
un breve entrenamiento básico.
Este estudio proporciona nuevos antecedentes sobre
el efecto que producen las perturbaciones antrópicas
como la explotación comercial de algas pardas en las
comunidades litorales marinas. Los resultados
muestran que los discos de adhesión de Lessonia en
praderas explotadas mantienen las propiedades
descritas para estos microecosistemas, siempre y
cuando se apliquen las recomendaciones de manejo
indicadas en el plan (e.g., AMERB, Vásquez et al.,
2012). Ignorarlas pone en riesgo la sustentabilidad del
recurso, la conservación de la biota asociada y la
integridad ecológica de las praderas explotadas. La
explotación de algas pardas en áreas de libre acceso
cubre extensas zonas costeras del norte de Chile
(Vásquez, 2008) y la presión de cosecha que se ejerce
sobre las praderas allí ubicadas podría inducir a
cambios desconocidos en la estructura y organización
de las comunidades litorales. En el futuro, el uso de la
fauna asociada a los discos de adhesión de L.
nigrescens como un indicador ecológico para
monitorear la integridad de praderas explotadas de
algas pardas permitiría explicar mejor las implicancias
ecológicas que esta actividad pesquera artesanal tiene
sobre las praderas naturales, considerando también que
la cosecha de algas pardas está en expansión hacia las
costas de la zona centro y sur de Chile.
AGRADECIMIENTOS
JMAV agradece a la Universidad Católica del Norte
(UCN) y a la Comisión Nacional de Investigación
Científica y Tecnológica (CONICYT, Beca N°
21110630) la beca de estudio en el Programa de
Doctorado en Biología y Ecología Aplicada – UCN
(Coquimbo, Chile). JMAV agradece a los equipos de la
consultora ECOS y al Centro de Estudios de Sistemas
Sociales-CESSO la ayuda prestada en terreno. Este
estudio fue financiado por la Subsecretaria de Pesca y
Acuicultura a través de los Proyectos: ID N° 4728-132LE13, ID N° 4728-133-LE13 y FIP 2014-17.
REFERENCIAS
Almanza, V. & A.H. Buschmann. 2013. The ecological
importance of Macrocystis pyrifera (Phaeophyta)
forests towards a sustainable management and
exploitation of Chilean coastal benthic co-management areas. Int. J. Environ. Sustain. Develop., 12(4):
341-360.
Anderson, M.J., C.E. Diebel, W.M. Blom & T.J. Landers.
2005. Consistency and variation in kelp holdfast
assemblages: spatial patterns of biodiversity for the
major phyla at different taxonomic resolutions. J. Exp.
Mar. Biol. Ecol., 320(1): 35-56.
Bixler, H.J. & H. Porse. 2011. A decade of change in the
seaweed hydrocolloids industry. J. Appl. Phycol.,
23(3): 321-335.
Bracken, M.E., B.E. Bracken & L.D. Rogers-Bennett.
2007. Species diversity and foundation species:
potential indicators of fisheries yields and marine
ecosystem functioning. CalCOFI Rep., 48: 82-91.
Cancino, J. & B. Santelices. 1981. Ecological importance
of kelp-like holdfasts as a habitat of invertebrates in
central Chile. II. Factors affecting community
organization. In: T. Levring (ed.). Xth International
Seaweed Symposium. Walter de Gruyter & Co, New
York, pp. 241-246.
Cancino, J.M. & B. Santelices. 1984. Importancia
ecológica de los discos adhesivos de Lessonia
nigrescens Bory (Phaeophyta) en Chile central. Rev.
Chil. Hist. Nat., 56: 23-33.
Carignan, V. & M.A. Villard. 2002. Selecting indicators
species to monitor ecological integrity: a review.
Environ. Monit. Assess., 78: 45-61.
Clarke, K.R. & R.N. Gorley 2006. Primer v6: user
manual/tutorial. PRIMER-E. Plymouth, 193 pp.
Clarke, K.R., P.J. Somerfield & M.G. Chapman. 2006. On
resemblance measures for ecological studies,
including taxonomic dissimilarities and a zeroadjusted Bray-Curtis coefficient for denuded
assemblages. J. Exp. Mar. Biol. Ecol., 330: 55-80.
Christie, H., K.M. Norderhaug & S. Fredriksen. 2009.
Macrophytes as habitat for fauna. Mar. Ecol. Prog.
Ser., 396(9): 221-233.
Dale, V.H. & S.C. Beyeler. 2001. Challenges in the
development and use of ecological indicators. Ecol.
Indic., 1(1): 3-10.
González, A., J. Beltrán, L. Hiriart‐Bertrand, V. Flores, B.
de Reviers, J.A. Correa & B. Santelices. 2012.
Identification of cryptic species in the Lessonia
nigrescens complex (Phaeophyceae, Laminariales). J.
Phycol., 48(5): 1153-1165.
Koehl, M.A.R. 1999. Ecological biomechanics of benthic
organism: life history, mechanical design and temporal
patterns of mechanical stress. J. Exp. Biol., 202: 34693476.
Milligan, K.L.D. & R.E. DeWreede. 2000. Variations in
holdfast attachment mechanics with developmental
stage, substratum-type, season, and wave-exposure for
633
the intertidal kelp species Hedophyllum sessile (C.
Agardh) Setchell. J. Exp. Mar Biol. Ecol., 254: 189209.
Molina, P., F.P. Ojeda, M. Aldana, V.M. Pulgar, M.R.
García-Huidobro & J. Pulgar. 2014. Spatial and
temporal variability in subtidal macro invertebrates
diversity patterns in a management and exploitation
area for benthic resources (MEABRs). Ocean Coast.
Manage., 93: 121-128.
Niemi, G.J. & M.E. McDonald. 2004. Application of
ecological indicators. Ann. Rev. Ecol. Evol. Sci., 35:
89-111.
Oróstica, M.H., M.A. Aguilera, G.A. Donoso, J.A.
Vásquez & B.R. Broitman. 2014. Effect of grazing on
distribution and recovery of harvested stands of
Lessonia berteroana kelp in northern Chile. Mar. Ecol.
Prog. Ser., 511: 71-82.
Ortega, K.J., C.A. Sáez & E.C. Macaya. 2014. Changes in
invertebrate assemblages inhabiting Lessonia spicata
(Phaeophyceae) holdfasts after the 2010 earthquakemediated coastal uplift in Chile. Rev. Biol. Mar.
Oceanogr., 49(1): 129-134.
Quinn, G.P. & M.J. Keough. 2002. Experimental design
and data analysis for biologists. Cambridge University
Press, Cambridge, 553 pp.
Rodríguez, D., M.H. Oróstica & J.A. Vásquez. 2014.
Coalescence in wild organisms of the intertidal
population of Lessonia berteroana in northern Chile:
management and sustainability effects. J. Appl.
Phycol., 26(2): 1115-1122.
Santelices, B. 1982. Bases biológicas para el manejo de
Lessonia nigrescens (Phaeophyta, Laminariales) en
Chile central. Monogr. Biol., 2: 135-150.
Santelices, B. & F.P. Ojeda. 1984. Recruitment, growth
and survival of Lessonia nigrescens (Phaeophyta) at
various tidal levels in exposed habitats of central
Chile. Mar. Ecol. Prog. Ser., 19(1): 73-82.
Santelices, B., J.C. Castilla, J. Cancino & P. Schmiede.
1980. Comparative ecology of Lessonia nigrescens
and Durvillaea antarctica (Phaeophyta) in central
Chile. Mar. Biol., 59(2): 119-132.
Stagnol, D., M. Renaud & D. Davoult. 2013. Effects of
commercial harvesting of intertidal macroalgae on
ecosystem biodiversity and functioning. Estuar. Coast.
Shelf Sci., 130: 99-110.
Smith, S.D. 2000. Evaluating stress in rocky shore and
shallow reef habitats using the macrofauna of kelp
holdfasts. J. Aquat. Ecosyst. Stress Recovery, 7(4):
259-272.
Subsecretaria de Pesca y Acuicultura. 2001. Fauna
acompañante y descarte: revisión y caracterización.
Propuesta de una política nacional. Informe Técnico
(R. Pesq.), Nº36: 15 pp.
634
Tapia, C., C. Olivares, H. Herrera, I. Núñez, L. Rodríguez
& A. Vega. 2013. Diseño, operación y asesoría al plan
de manejo de algas pardas, III Región de Atacama,
2012. Subsecretaría de Pesca y Acuicultura, Informe
Final, 183 pp.
Thiel, M. & J.A. Vásquez. 2000. Are kelp holdfasts
islands on the ocean floor? Indication for temporarily
closed aggregations of peracarid crustaceans. Hydrobiologia, 440(1-3): 45-54.
Thiel, M., M.P. Penna-Díaz, G. Luna-Jorquera, S. Salas,
J. Sellanes & W. Stotz. 2014. Citizen scientists and
marine research: volunteer participants, their
contributions, and projection for the future. Oceanogr.
Mar. Biol., 52: 257-314.
Vásquez, J.A. 1995. Ecological effects of brown seaweed
harvesting. Bot. Mar., 38(1-6): 251-258.
Vásquez, J.A. 2008. Production, use and fate of Chilean
brown seaweeds: re-sources for a sustainable fishery.
J. Appl. Phycol., 20(5): 457-467.
Vásquez, J.A. & B. Santelices. 1984. Comunidades de
macroinvertebrados en discos adhesivos de Lessonia
nigrescens Bory (Phaeophyta) en Chile central. Rev.
Chil. Hist. Nat., 57: 131-154.
Vásquez, J.A. & B. Santelices. 1990. Ecological effects of
harvesting Lessonia (Laminariales, Phaeophyta) in
central Chile. Hydrobiologia, 204(1): 41-47.
Received: 3 April 2015; Accepted: 13 June 2016
Vásquez, J.A. & J.M.A. Vega. 2005. Macroinvertebrados
asociados a discos de adhesión de algas pardas:
biodiversidad de comunidades discretas como
indicadora de perturbaciones locales y de gran escala.
In: E. Figueroa (ed.). Biodiversidad marina: valoración, uso y perspectivas. ¿Hacia dónde va Chile?
Editorial Universitaria, Santiago, pp. 429-450.
Vásquez, J.A., D.A. Véliz & L.M. Pardo. 2001.
Biodiversidad bajo las grandes algas. In: K. Alveal &
T. Antezana (eds.). Sustentabilidad de la biodiversidad. Un problema actual, bases científicotécnicas, teorizaciones y perspectivas. Ediciones
Universidad de Concepción, Concepción, pp. 293-308.
Vásquez, J.A., N. Piaget, J.M.A. Vega. 2012. The
Lessonia nigrescens fishery in northern Chile: “how
you harvest is more important than how much you
harvest”. J. Appl. Phycol., 24(3): 417-426.
Vega, J.M.A. 2015. Indicadores para el monitoreo de la
integridad ecológica de huirales explotados del
complejo Lessonia nigrescens en el norte de Chile.
Tesis, Universidad Católica del Norte, Coquimbo, 249
pp.
Vega, J.M.A., B.R. Broitman & J.A. Vásquez. 2014.
Monitoring the sustainability of Lessonia nigrescens
(Laminariales, Phaeophyceae) in northern Chile under
strong harvest pressure. J. Appl. Phycol., 26(2): 791801.
Wernberg, T. 2005. Holdfast aggregation in relation to
morphology, age, attachment and drag for the kelp
Ecklonia radiata. Aquat. Bot., 82: 168-180.
635
Anexo 1. Fauna asociada a discos de adhesión de Lessonia nigrescens por tipo de estrategia de conservación (ALA: área
de libre acceso, n = 20; AMERB: área de manejo, n = 20; AMP: área marina protegida, n = 10). (x: promedio, DS: desviación
estándar, números en superíndice: 1juveniles, 2larvas).
TAXA
x
AMP
PORIFERA
Porifera indet.
0,1
CNIDARIA
Anthozoa
Anthothoe chilensis (Lesson, 1830)
Phymactis clematis (Drayton, 1846)
0,6
Anthozoa indet. sp.1
85,5
Anthozoa indet. sp.2
0,3
PLATYHELMINTHES
Turbellaria
Turbellaria indet.
NEMATODA
Nematoda indet.
18,1
NEMERTINA
Anopla
Nemertina indet. sp.1
4,5
Nemertina indet. sp.2
0,5
Lineus atrocaeruleus (Schmarda, 1859)
0,2
ANNELIDA
Polychaeta
Cirratulidae indet.
16,4
Eunicidae indet.
1,1
Glyceridae indet.
Hesionidae indet.
4,3
Lumbrineridae indet.
5,0
Nereididae indet.
26,7
Orbiniidae indet.
1,8
Phragmatopoma virgini Kinberg, 1866
1,8
phyllodocidae indet.
6,6
Polynoidae indet.
2,1
Sabellidae indet.
9,8
Spionidae indet.
82,1
Syllidae indet.
186,6
Terebellidae indet.
0,1
MOLLUSCA
Bivalvia
Aulacomya ater (Molina, 1782)
13,9
Brachidonthes granulata (Hanley, 1843)
182,1
Entodesma cuneata (Gray, 1828)
0,1
Perumytilus purpuratus (Lamarck, 1819)
Semimytilus algosus (Gould, 1850)
159,8
Veneridae indet.1
0,3
Gastropoda
Acanthina monodon (Pallas, 1774)
0,1
Calyptraea trochiformis Lamarck, 1804
8,8
Concholepas concholepas (Bruguière, 1789)
0,5
Fissurella costata Lesson, 1831
Fissurella crassa Lamarck, 1822
0,2
Fissurella sp.1
0,4
Prisogaster niger (Wood, 1828)
1,2
DS
AMERB
x
DS
x
ALA
DS
0,3
0,1
0,3
0,1
0,2
1,1
71,8
0,7
0,4
0,2
47,4
0,1
1,1
0,5
110,8
0,3
0,1
0,2
16,9
0,2
0,4
27,7
0,1
0,2
8,3
9,5
22,4
5,2
5,9
4,7
0,8
0,4
1,4
0,4
0,2
1,9
1,0
0,4
1,5
2,7
0,1
0,3
10,5
2,0
3,8
1,6
0,1
1,6
6,2
22,8
9,1
3,6
1,7
0,9
13,9
43,9
63,0
8,4
3,7
0,2
4,2
8,2
23,3
13,4
7,5
3,6
1,2
14,7
54,1
55,7
3,1
1,2
8,0
3,1
0,6
2,9
10,7
3,7
0,9
1,5
0,5
3,9
9,5
18,6
1,4
3,9
13,0
6,6
1,2
2,8
0,8
5,4
7,0
13,9
1,9
33,7
0,3
0,2
75,6
0,3
5,1
37,3
0,7
0,7
65,1
1,3
2,9
12,4
0,1
0,1
33,0
6,3
10,9
0,2
0,2
56,9
1,4
0,4
0,3
0,1
0,7
1,8
1,9
0,9
0,4
0,2
1,7
4,0
1,3
0,2
2,1
0,4
0,1
0,2
0,2
0,4
3,2
6,0
16,7
2,6
2,1
4,7
2,0
4,8
41,7
25,0
0,3
7,7
72,6
0,3
132,0
0,9
0,3
9,1
0,7
0,4
0,5
2,1
636
Continuación
TAXA
Scurria scurra (Lesson, 1831)
Scurria variabilis (Sowerby, 1839)
Scurria viridula (Lamarck, 1822)
Tegula atra (Lesson, 1830)
Tegula luctuosa (d'Orbigny, 1841)
Polyplacophora
Acanthopleura echinata (Barnes, 1824)
Chaetopleura peruviana (Lamarck, 1819)
Chiton granosus Frembly, 1827
Chiton magnificus Deshayes, 1827
Chitonidae indet.1
Enoplochiton niger (Barnes, 1824)
Tonicia atrata (Sowerby, 1840)
Tonicia sp. 1
ARTHROPODA
Malacostraca
Decapoda
Acanthocyclus gayi Lucas, 1844
Acanthocyclus hassleri Rathbun, 1898
Allopetrolisthes angulosus (Guérin, 1835)
Allopetrolisthes punctatus (Guérin, 1835)
Alpheus inca Wicksten & Méndez, 1981
Betaeus truncatus Dana, 1852
Betaeus emarginatus (Milne Edwards, 1837)
Brachiura indet.1
Porcelanidae indet.1
Pachycheles grossimanus (Guérin, 1835)
Petrolisthes tuberculatus (Guérin, 1835)
Petrolisthes tuberculosus (Milne Edwards, 1837)
Pilumnoides perlatus (Poeppig, 1836)
Synalpheus spinifrons (Milne-Edwards, 1837)
Taliepus marginatus (Bell, 1835)
Amphipoda
Corophiidae indet.
Gammaridea indet. sp.2
Isopoda
Jaeropsis sp.
Sphaeromatidae indet.
Limnoria chilensis Menzies, 1962
Amphoroidea typa H. Milne Edwards, 1840
Munnidae indet.
Tanaidacea
Tanaidacea indet. sp.1
Cirripedia
Austromegabalanus psittacus (Molina, 1788)
Verruca laevigata (Sowerby, 1827)
Balanus laevis Bruguière, 1789
AMP
x
23,8
0,2
0,2
2,9
0,5
DS
9,3
0,4
0,4
6,3
1,1
AMERB
x
DS
18,2 10,5
0,1
0,3
ALA
x
DS
4,7
5,3
0,7
1,2
0,1
0,3
0,5
0,4
0,6
0,7
1,6
0,8
0,3
5,1
0,1
0,3
0,2
0,1
0,3
0,3
0,7
0,2
0,4
1,3
0,4
0,6
0,5
0,7
0,7
1,6
3,4
0,3
2,9
0,5
0,5
1,0
0,2
0,2
0,3
0,3
1,3
0,3
0,1
1,5
15,9
3,4
3,3
5,5
0,1
0,2
0,1
8,9
10,5
33,9
8,6
1,2
5,5
9,2
0,7
9,0
1,7
3,7
5,3
0,3
0,4
0,3
9,0
11,7
19,3
6,0
1,4
6,2
4,2
1,1
8,4
0,7
0,2
1,5
0,2
0,2
0,1
3,7
3,3
16,4
9,1
0,4
0,9
2,4
0,3
4,5
1,2
0,7
3,2
0,5
0,5
0,3
5,0
6,6
10,4
6,4
1,1
1,5
3,3
0,5
2,4
0,3
0,1
0,6
0,1
2,4
0,7
0,4
1,1
0,3
0,1
0,3
0,6
4,3
2,6
0,1
0,2
1,0
0,3
0,2
0,9
1,5
4,5
2,6
0,2
0,4
1,3
0,5
10,9
0,3
17,0
3,6
7,3
1,6
5,4
0,9
14,9
8,3
12,5
5,1
4,8
1,6
12,8
4,9
1,4
0,2
4,0
6,9
21,4
15,2
2,5
0,9
1,5
0,2
4,7
0,8
7,5
0,8
2,0
0,7
12,0
1,9
12,3
3,6
24,3
4,8
2,0
21,2
5,5
3,3
0,6
0,8
23,4
4,8
0,3
0,3
1,9
40,1
4,9
0,6
0,7
3,1
8,3
2,3
0,2
1,0
0,3
8,9
4,2
0,9
1,7
1,1
5,8
4,3
6,9
7,9
26,3
5,0
96,3
10,8
3,8
1,1
0,7
6,8
2,9
1,7
1,2
5,9
4,5
1,6
6,5
3,8
0,9
0,2
3,3
1,5
0,7
4,9
0,2
0,2
2,6
0,5
0,7
3,2
Continuación
TAXA
Maxillopoda
Copepoda Harpacticoidea indet.
Copepoda Cyclopoidea indet.
Insecta
Insecta indet.2
Pygnogonida
Pygnogonida indet.
ECHINODERMATA
Holothuroidea
Athyonidium chilensis (Semper, 1868)1
Echinoidea
Tetrapygus niger (Molina, 1782)1
Loxechinus albus (Molina, 1782)1
Asteroidea
Heliasther helianthus (Lamarck, 1816)1
Meyenaster gelatinosus (Meyen, 1834)1
Stichaster striatus Müller & Troschel, 18401
UROCHORDATA
Ascidiacea
Pyura chilensis Molina, 1782
Ascidiacea indet.
x
AMP
DS
637
AMERB
x
DS
10,6
2,2
10,9
3,8
27,4
2,4
35,4
9,0
0,1
0,3
0,1
0,2
x
ALA
DS
3,7
7,6
0,2
0,4
0,5
1,2
0,4
0,5
0,7
1,1
0,1
0,3
0,4
0,3
1,0
0,7
0,4
0,2
1,3
0,5
0,1
0,1
0,2
0,3
0,1
0,3
0,2
0,4
0,1
0,1
0,1
0,2
0,3
0,3
0,1
0,2
1,0
0,7
1,5
1,6
0,9
0,4
2,0
0,7
0,1
0,3
0,2
1,1
Lat. Am. J. Aquat. Res., 44(3): 638-642, 2016
Transport of cobia with benzocaine
6381
Short Communication
Stress response in transport of juvenile cobia Rachycentron canadum
using the anesthetic benzocaine
Janaína S. Pedron1, Denise S. Miron1, Ricardo V. Rodrigues1, Marcelo H. Okamoto1
Marcelo B. Tesser1 & Luís A. Sampaio1
1
Instituto de Oceanografia, Laboratório de Piscicultura Estuarina e Marinha
Universidade Federal do Rio Grande-FURG, Rio Grande, Brazil
Corresponding author: Janaína S. Pedron (janainapedron@gmail.com)
ABSTRACT. This experiment evaluated the efficacy of benzocaine to reduce stress response during transport
of juvenile cobia. Fish (30 g) were packed in bags and transported for 8 h (stocking density = 10 g L-1). Three
concentrations of benzocaine were evaluated: 0, 2, and 6 mg L-1. Blood samples were taken for glucose and
hematocrit before transportation, and then at 0, 2, 24, and 48 h after. Water quality parameters were verified. No
mortality was observed. Total ammonia nitrogen was higher (2.46 mg L-1) and pH was lower (6.92) at 2 mg
benzocaine L-1. There was an increase in blood glucose for all treatments on arrival, and it was higher for those
exposed to benzocaine at 6 mg L-1, although at 48 h they were all similar. The hematocrit did not differ among
treatments. The results suggest: 1) the density 10 g L-1 is considered safe for juvenile cobia transport; 2)
benzocaine did not mitigate stress response on cobia during transport, therefore its use is not recommended for
this purpose.
Keywords: Rachycentron canadum, Rachycentridae, anesthesia, physiology, hematology, water quality, marine
fish.
Respuesta al estrés del transporte en juveniles de cobia Rachycentron canadum
anestesiados con benzocaína
RESUMEN. En este experimento se evaluó la eficiencia de la benzocaína para reducir la respuesta al estrés
durante el transporte de juveniles de cobia. Los peces de 30 g se almacenaron en bolsas y se transportaron
durante 8 h (densidad de almacenaje = 10 g L-1). Se evaluaron tres concentraciones de benzocaína: 0, 2 y 6 mg
L-1. Se tomaron muestras de sangre para glucosa y hematocrito antes del transporte y después de 0, 2, 24 y 48 h.
Se verificaron los parámetros de calidad de agua. No se observó mortalidades. La concentración de amoníaco
total fue alta (2,46 mL-1) y el pH fue bajo (6,92) a 2 mg de benzocaína L-1. Al término del transporte se determinó
un aumento de glucosa en la sangre en todos los tratamientos, siendo mayor en los peces expuestos a 6 mg de
benzocaína L-1, aunque a las 48 h todos fueron similares. El hematocrito no mostró diferencias entre los
tratamientos. Los resultados sugieren que: 1) la densidad de10 g L-1 es segura para el transporte de juveniles de
cobia; y 2) la benzocaína no redujo la respuesta de estrés en cobia durante el transporte, por lo tanto no se
recomienda su uso para este propósito.
Palabras clave: Rachycentron canadum, Rachycentridae, anestesia, fisiología, hematología, calidad del agua,
peces marinos.
Fish transport is a common procedure that exposes the
animals to adverse stimuli, being recognized as a
potential physiological stressor (Benovit et al., 2012).
It has been reported that benzocaine may minimize the
stress caused by transport in some species such as
Brycon amazonicus (5 to 20 mg L-1) and Puntius fila__________________
Corresponding editor: Jesús Ponce-Palafox
mentosus (20 mg L-1) (Carneiro et al., 2002; Pramod et
al., 2010).
Cobia, Rachycentron canadum (L.), is an important
species for aquaculture, due to its fast growth, high feed
efficiency, and high quality flesh (Webb Jr. et al.,
2007). Cobia weighting 1-3 g have been transported in
2639
closed systems at densities between 5 and 25 g L-1
(Colburn et al., 2008; Stieglitz et al., 2012). However,
Liao et al. (2004) recommended cobia should weigh at
least 30 g prior to stocking in cages. Considering
benzocaine at 150 mg L-1 is an effective anesthetic for
juvenile cobia (298 g) (Trushensky et al., 2012), the
aim of this study was to evaluate the effect of
benzocaine on the stress response of juvenile cobia (30
g) transported in a closed system.
Juvenile cobia used in this study was reared for
seven weeks in a recirculating aquaculture system
(RAS) maintained at 26.5°C and salinity of 30. Fishes
were fed three times daily with a commercial diet
containing 57% crude protein and 14.5% lipid (NRD,
INVE, USA) and fasted for 24 h before transport.
In order to evaluate the stress mitigating
effectiveness of benzocaine, the concentrations of 0, 2
and 6 mg L-1 were tested. Stock solutions were prepared
from the dilution of benzocaine (Henrifarma Produtos
Químicos e Farmacêuticos Ltda., Brazil) in commercial
alcohol (96%) in a proportion of 1:9 (w:v). All
treatments were run in triplicate.
Fish (30.9 ± 9.3 g; 17.3 ± 2.0 cm) were placed in 60
L polyethylene bags filled with 10 L of seawater and 20
L of pure oxygen. The bags, with stocking density of
10 g L-1, were packed in styrofoam boxes to keep the
temperature stable (22.4 ± 0.2°C). The fish were then
transported by truck for 8 h. Three bags filled only with
water (Without Fish) were also transported, and served
as a control for water quality.
Before the transport, nine fish were sampled for
blood collection as a control group. Fish were also
sampled at 0, 2, 24, and 48 h after transport. The blood
was collected from the caudal vein with a heparinized
syringe (1 mL). Glucose was measured with a portable
glucometer (Accu Cheek Advantage, Roche Diagnostics®, Germany) and hematocrit was determined
centrifuging blood for 10 min at 16,128 xg (Hematocrit
Centrifuge H-240, Hsiang Tai Machinery Industry Co.,
Taiwan). Fish survival was observed throughout the
experimental period.
Water samples were collected at the end of
transportation to verify temperature, dissolved oxygen
(DO), carbon dioxide (CO2), alkalinity, total ammonia
nitrogen (TAN), gaseous ammonia (NH3-N) and pH.
Temperature and DO were measured with YSI Model
550A m (Yellow Springs Instruments, USA) and the
pH with pH meter FE20-FiveEasyTM (Mettler Toledo,
Switzerland). Alkalinity was measured following
APHA (1998) and CO2 was calculated with the
software CO2 Analysis Salt® (Timmons & Ebeling,
2010). TAN was verified accordingly to Solorzano
(1969) and NH3-N was calculated using the equations
of Ostrensky et al. (1992).
The statistical analysis of water quality parameters
and hematological parameters were done by one-way
ANOVA Tukey test was used when significant differences were detected. All analyzes were performed
with a significance level of 5% (Sokal & Rohlf, 1995).
There was no mortality during or after transport.
The water quality parameters after 8 h of transport are
shown in Table 1. The final oxygen concentration at 2
mg L-1 was lower than those transported with benzocaine at 6 mg L-1 (P < 0.05). (Table 1).
Alkalinity did not differ among treatments (P >
0.05), but pH reached the lowest level at 2 mg L-1 (P <
0.05), differing from Without Fish and 0 mg L-1.
Therefore, CO2 concentrations were higher at 2 mg L-1
when compared to 0 mg L-1 (P < 0.05). However, pH
and CO2 did not differ (P > 0.05) between 0 and 6 mg
L-1. All treatments showed higher CO2 levels than the
treatment Without Fish (P < 0.05). Regarding the
concentrations of TAN, cobia transported at 2 mg L-1
produced more ammonia than in the other treatments (P
< 0.05). However, for NH3-N, no significant difference
was found among treatments (P > 0.05).
The values observed for glucose up to 48 h after
transport are shown in Fig. 1. Immediately after
transport (0 h), glucose concentrations were all higher
than control. Glucose was higher (P > 0.05) for cobia
transported with 6 mg L-1, while there was no
significant difference (P < 0.05) between the treatments
0 and 2 mg L-1. There was a reduction of glucose
concentration after 24 h in all treatments, and there was
no significant difference among them (P > 0.05), but
fish transported with 0 and 2 mg L-1 had glucose levels
still higher than the control (P < 0.05). After 48 h, the
situation remained unaltered and only fish on
treatments 0 and 6 mg L-1 showed the same glucose
level to the control (Fig. 1). There were no significant
differences (P > 0.05) for the hematocrit values among
times or treatments, varying from 20 to 40%.
During transport, water deterioration process is
initiated within the first hour after packing the bags
(Paterson et al., 2003). The increase of the CO2
concentration in the water can result in hypercapnia,
decreasing the carrying capacity of oxygen by
hemoglobin due to the Bohr effect (Souza & BonilaRodriguez, 2007). The oxygen transport to tissues is
reduced in environments where CO2 levels are higher
than 40 mg L-1 (Wedemeyer, 1996). In the present
study, the CO2 concentrations were higher at the
treatment with 2 mg L-1, reaching 13 mg L-1, but still
lower than the upper limit (40 mg L-1) recommended by
Wedemeyer (1996).
Accordingly to Rodrigues et al. (2015), pH down to
6.5 is considered safe for cobia. Therefore, pH levels
probably did not cause blood and histopathology distur-
6403
Table 1. Water quality parameters (mean ± SD) measured immediately after 8 h of transport of juvenile cobia Rachycentron
canadum using benzocaine. Different letters on the same line indicate significant differences (P < 0.05) among treatments
(Without Fish, 0, 2 and 6 mg benzocaine L-1), determined by one-way ANOVA and Tukey test. DO: dissolved oxygen (O2
L-1); alkalinity (mg L-) as CaCO3; CO2 (mg L-1); TAN: total ammonia nitrogen (mg L-1 NH4+ + NH3-); NH3-N (mg L-1).
Parameters
DO
pH
Alkalinity
CO2
TAN
NH3-N
Benzocaine (mg L-1)
Without Fish
24.40 ± 0.43a
8.31 ± 0.06a
126.66 ± 2.88a
0.00 ± 0.58a
0.08 ± 0.02a
0.006 ± 0.001a
0
17.57 ± 3.15bc
7.19 ± 0.19a
125.91 ± 3.02a
7.00 ± 3.77b
0.96 ± 0.8 a
0.007 ± 0.005a
2
17.33 ± 3c
6.92 ± 0.08b
123.75 ± 3.11a
13.00 ± 2.44c
2.46 ± 0.42b
0.008 ± 0.001a
6
20.37 ± 1.96b
7.03 ± 0.08ab
125.00 ± 0.00a
10.50 ± 1.98bc
1.28 ± 0.63ab
0.006 ± 0.002a
Figure 1. Glucose levels (mg dL-1) for juvenile cobia Rachycentron canadum transported in a closed system with different
concentrations of benzocaine (0, 2, and 6 mg L-1) along different times: control (before transport), and 0, 2, 24, and 48 h
after transport. Different lowercase letters indicate significant differences (P < 0.05) among different treatments at each
time interval, and different capital letters indicate significant differences (P < 0.05) for the same treatment along time, both
determined by one-way ANOVA and Tukey test.
bances in this study, where the lowest pH was 6.9.
Although TAN concentrations were higher at 2 mg L-1,
no differences were found to NH3-N, since pH was
lower at the highest TAN levels and the equilibrium
between gaseous and ionic ammonia is regulated
mainly by the pH level (Ip, 2010). Hence, NH3-N
remained within safe concentrations for cobia
(Rodrigues et al., 2007).
It was observed for Atlantic salmon (Salmo salar)
that the use of anesthetics reduced activity and stress
during transport (Iversen et al., 2009). However,
studies indicate that some anesthetics can itself induce
stress response (Zahl et al., 2010). Brazilian flounder
Paralichthys orbignyanus (Valenciennes) showed
mortality when transported with the essential oil of
Aloysia gratissima (Benovit et al., 2012).
The sedative effect of anesthetics could reduce
metabolic rate, general activity and stress response
during transport (Husen & Sharma, 2014). Trushenski
et al. (2010) exposed cobia to stress challenges and one
hour after air exposure, glucose concentration reached
its peak at 189 mg dL-1. In the present study, fish
exposed to 6 mg L-1 had elevated blood glucose (up to
120 mg dL-1) until 2 h after transport, but after 48 h,
their blood glucose was similar to control. The
ornamental fish P. filamentosus transported for 48 h
with benzocaine at 20 mg L-1 presented lower glucose
levels (165 mg dL-1) and no mortality when compared
4641
to unsedated fish (180 mg dL-1; 30% of mortality)
(Pramod et al., 2010). However, these authors verified
that glucose levels did not reach the baseline levels at
the end of 48 h, showing the magnitude and duration of
the stress response can be different for a given species,
or among species.
The catecholamine release promotes an increase in
the number of red blood cells, increasing the
hemoglobin concentration in the blood (WendelaarBonga, 1997). However, in the present study, there
were no differences for the values of hematocrit among
times or treatments. Cobia (298 g) anesthetized with
benzocaine at 150 mg L-1 also did not present
differences in its hematocrit percentage between
recovery times, varying from 27 to 41% (Trushenski et
al., 2012). For adults of B. amazonicus, the hematocrit
did not differ for fish transported at 5, 10, and 20 mg
benzocaine L-1 either (Carneiro et al., 2002).
Colburn et al. (2008) and Stieglitz et al. (2012)
studied the transport of juvenile cobia weighting 1 to 3
g, while Liao et al. (2004) recommended the size of 30
g for cobia cage stocking. Although benzocaine has not
been an effective anesthetic to reduce the stress
response for cobia transport, this study is the first to
disclosure transport of 30 g cobia in a closed system.
According to the results shown in this work,
transporting juvenile cobia (30 g) at the density 10 g L-1 is
considered safe. The use of benzocaine did not mitigate
the stress response. Actually, blood glucose was higher
for fish transported with benzocaine up to 2 h after
transport. However, it is important to notice that fish
transported with benzocaine at 6 mg L-1 had glucose
levels similar to the control 24 h after the transport, and
fish transported without benzocaine recovered only at
48 h. Nevertheless, future investigations should focus
on transport with different anesthetics at higher
stocking densities in order to optimize the transport of
juvenile cobia to cage sites.
ACKNOWLEDGMENTS
This study was supported by the research fund from
MCT/CNPq/CT-Agronegócio/MPA Edital 036/2009
(Project #559741/2009) and Edital 25/2010 (Project
#562078/2010-0), MCTI/CNPq Edital 14/2013 (Project
#481093/2013-3), CAPES, FAPERGS, and Ministério
da Pesca e Aquicultura, Brazil. L.A. Sampaio and M.B.
Tesser are research fellows of Brazilian CNPq.
REFERENCES
American Public Health Association (APHA). 1998.
Standard methods for the examination of water and
wastewater. American Public Health Association/
American Water Works Association/ Water Environment Federation, Washington DC, 541 pp.
Benovit, S.C., L.T. Gressler, L.L. Silva, L.O. Garcia, M.H.
Okamoto, J.S. Pedron, L.A. Sampaio, R.V. Rodrigues,
B.M. Heinzmann & B. Baldisserotto. 2012. Anesthesia
and transport of Brazilian flounder, Paralichthys
orbignyanus, with essential oils of Aloysia gratissima
and Ocimum gratissimum. J. World Aquacult. Soc.,
43(6): 896-900.
Carneiro, P.C.F., E.C. Urbinati & M.L. Martins. 2002.
Transport with different benzocaine concentrations
and its consequences on hematological parameters and
gill parasite population of matrinxã Brycon cephalus
(Günther, 1869). Acta Sci., 24(2): 555-560.
Colburn, H.R., A.B. Walker, D.L. Berlinsky & G. Nardi.
2008. Factors affecting survival of cobia, Rachycentron canadum, during simulated transport. J. World
Aquacult. Soc., 39: 678-683.
Husen, M.A. & S. Sharma. 2014. Efficacy of anesthetics
for reducing stress in fish during aquaculture practices
- a review. Kathmandu Univ. J. Sci. Eng. Tech., 10(1):
104-123.
Ip, Y.K. 2010. Ammonia production, excretion, toxicity
and defense in fish: a review. Front. Physiol., 1(134):
1-20.
Iversen, M., R.A. Eliassen & B. Finstad. 2009. Potential
benefit of clove oil sedation on animal welfare during
salmon smolt, Salmo salar L. transport and transfer to
sea. Aquacult. Res., 40: 233-241.
Liao, I.C., T.S. Huang, W.S. Tsai, C.M. Hsueh, S.L.
Chang & E.M. Leano. 2004. Cobia culture in Taiwan:
current status and problems. Aquaculture, 237: 155165.
Ostrensky, A., M.A. Marchiori & L.H. Poersch. 1992.
Toxicidade aguda da amônia no processo produtivo de
pós-larvas de Penaeus paulensis, Pérez-Farfante,
1967. An. Acad. Bras. Ciênc., 64: 383-389.
Paterson, B.D., M.A. Rimmer, G.M. Meikle & G.L
Semmens. 2003. Physiological responses of the Asian
sea bass, Lates calcarifer to water quality deterioration
during simulated live transport: acidosis, red-cell
swelling, and levels of ions and ammonia in the
plasma. Aquaculture, 218: 717-728.
Pramod, P.K., A. Ramachandran, T.P. Sajeevan, S.
Thampy & S.S. Pai. 2010. Comparative efficacy of
MS-222 and benzocaine as anesthetics under
simulated transport conditions of a tropical ornamental
fish Puntius filamentosus (Valenciennes). Aquacult.
Res., 41: 309-314.
Rodrigues, R.V., M.H. Schwarz, B.C. Delbos & L.A.
Sampaio. 2007. Acute toxicity and sublethal effects of
ammonia and nitrite for juvenile cobia Rachycentron
canadum. Aquaculture, 271: 553-557.
Rodrigues, R.V., J.S. Pedron, L.A. Romano, M.B. Tesser
& L.A. Sampaio. 2015. Acute responses of juvenile
cobia Rachycentron canadum (Linnaeus, 1766) to acid
stress. Aquacult. Res., 46: 2241-2247.
Sokal, R.R. & F.J. Rohlf. 1995. Biometry. W.H. Freeman
and Company, New York, 887 pp.
Solorzano, L. 1969. Determination of ammonia in natural
waters by the phenol hypochlorite method. Limnol.
Oceanogr., 14: 799-801.
Souza, P.C. & G.O. Bonilla-Rodriguez. 2007. Fish
hemoglobins. Braz. J. Med. Biol. Res., 40: 769-778.
Stieglitz, J.D., D.D. Benetti & J.E. Serafy. 2012.
Optimizing transport of juvenile cobia (Rachyecentron
canadum): effects of salinity and shipping biomass.
Aquaculture, 364-365: 293-297.
Trushenski, J., M. Schwarz, R. Takeuchi, B. Delbos &
L.A. Sampaio. 2010. Physiological responses of cobia
Rachycentron canadum following exposure to low
water and air exposure stress challenges. Aquaculture,
307: 173-177.
Trushenski, J., J.C. Bowser, J.D. Bowker & M.H.
Schwarz. 2012. Chemical and electrical approaches to
sedation of cobia: induction, recovery, and physiological responses. Mar. Coast. Fish. Dynam. Manag.
Ecosys. Sci., 4: 639-650.
Received: 11 August 2015; Accepted: 16 January 2016
6425
Timmons, M.B. & J.M. Ebeling. 2010. Recirculating
aquaculture. Cayuga Aqua Ventures, Ithaca, New
York, 998 pp.
Webb Jr., K.A., G.M. Hitzfelder, C.K. Faulk & G.J. Holt.
2007. Growth of juvenile cobia, Rachycentron
canadum, at three different densities in a recirculating
aquaculture system. Aquaculture, 264: 223-227.
Wedemeyer, G.A. 1996. Physiology of fish in intensive
culture systems. Chapman and Hall, New York, 232
pp.
Wendelaar-Bonga, S.E. 1997. The stress response in fish.
Physiol. Rev., 77: 591-625.
Zahl, I.H., A. Kiessling, O.B. Samuelsen & R.E. Olsen.
2010. Anesthesia induces stress in Atlantic salmon
(Salmo salar), Atlantic cod (Gadus morhua) and
Atlantic halibut (Hippoglossus hippoglossus). Fish
Physiol. Biochem., 36: 719-730.
Lat. Am. J. Aquat. Res., 44(3): 643-648,
2016 individual en Litopenaeus vannamei y Litopenaeus stylirostris
Crecimiento
643
Short Communication
Supervivencia embrionaria de Galaxias maculatus (Jenyns, 1842)
sometida a diferentes tratamientos profilácticos
Juan Barile1, Manuel Escudero1, Juan Romero1 & Francisco Encina2
Escuela de Acuicultura, Universidad Católica de Temuco, Temuco, Chile
2
Escuela de Ciencias Ambientales, Universidad Católica de Temuco, Temuco, Chile
1
Corresponding author: Juan Barile (jbarile@uct.cl)
RESUMEN. Se evaluó el uso de antifúngicos para mejorar la supervivencia embrionaria de Galaxias maculatus.
Se diseñaron tres tratamientos utilizando formalina en dosis de 250 ppm; yodo en dosis de 100 ppm y sal de mar
en dosis de 30 ups y un tratamiento control. Para cada tratamiento y el control se utilizaron 15 réplicas con 100
embriones por réplica. El tratamiento correspondió a sumergir los embriones en un baño profiláctico por una
hora cada dos días y el control sólo en agua de salinidad 10. Posteriormente se evaluó la supervivencia larval de
cada tratamiento y control a los 15 días de vida. En el tratamiento con sal se obtuvo la mayor supervivencia
embrionaria y larval, mejorando en un 27,4 y 11,6% (P < 0,05) por sobre el control. En el tratamiento con
formalina se obtuvo supervivencia embrionaria y larval de 9,8 y 4,0% respectivamente sobre el control (P <
0,05) y en el caso del yodo se obtuvo una supervivencia embrionaria de 2,6% por sobre el control (P > 0,05) y
supervivencia larval de un 16,4% menor al control (P < 0,05). En conclusión la sal muestra mayor efectividad
como tratamiento profiláctico para mejorar la supervivencia embrionaria de G. maculatus.
Palabras clave: Galaxias maculatus, peces, embriones, profilaxis, hongos, acuicultura.
Embryonic survival of Galaxias maculatus (Jenyns, 1842), under
different prophylactic immersion bath
ABSTRACT. The use of antifungals was assessed to improve embryo survival of Galaxias maculatus. Three
treatments using formalin dose of 250 ppm, iodine dose of 100 ppm, and sea salt in doses of 30 ups were
designed, and a control treatment under 10 of salinity water. For each treatment and control, 15 replicates were
used, with 100 embryos in each replicate. Embryos were immersed into each treatment solution for one hour
every two days. Larval survival after 15 days old was assessed. Higher embryonic and larval survival was
obtained in sea salt treatment improving by 27.4 and 11.6% (P < 0.05) respectively over control results. Formalin
treatment resulted in embryonic and larval survival of 9.8 and 4.0% respectively more than control (P < 0.05)
and in the case of iodine embryonic survival, 2.6% more than control (P > 0.05) and larval survival of 16.4%
lower than the control (P < 0.05). In conclusion, sea salt shows greater effectiveness as a prophylactic treatment
to improve the embryonic survival of G. maculatus.
Keywords: Galaxias maculatus, fish, embryo, profilaxis, fungi, aquaculture.
La sanidad juega un papel cada vez mayor en la
industria piscícola en general y en especial en granjas
intensivas de producción, impidiendo que los agentes
patógenos ataquen a huevos, larvas y peces sanos
(Mifsud & Rowland, 2008). En este contexto el manejo
sanitario representa una actividad prioritaria para
garantizar un producto de calidad en todas las fases del
cultivo, más aún durante la incubación de los embriones
considerando lo fundamental que resulta la provisión de
“semilla” en el proceso productivo. A lo anterior se
__________________
Corresponding editor: Guido Plaza
suma que en especies nuevas para la acuicultura, como
es el caso de Galaxias maculatus, especie nativa de
interés comercial y de repoblamiento (Mitchel, 1989;
Barile et al., 2003, 2013a, 2013b, 2015), las enfermedades se intensifican debido al escaso grado de
domesticación al cautiverio especialmente cuando los
progenitores son obtenidos directamente desde la
naturaleza.
El tratamiento profiláctico es dependiente de las
características biológicas de los distintos estadios de
644
desarrollo de los peces, de su resistencia al manejo en
cautiverio y del grado de domesticación que posean. En
el caso de G. maculatus, el embrión posee dos
características biológicas importantes de considerar:
etapa embrionaria extensa (25 a 35 días), y una capa
externa altamente adhesiva que lo rodea (Benzie, 1968;
Mitchell, 1989), incapaz de ser removida (Barile et al.,
2003) por los tratamientos habituales utilizados en la
piscicultura de peces con ovas adhesivas (Mizuno et al.,
2004; Huysentruyt & Adriaens, 2005). Las características del embrión de G. maculatus facilitan la
proliferación de organismos patógenos en el sistema de
cultivo tales como bacterias, protozoos y hongos que
hacen necesario implementar medidas profilácticas
preventivas que atenúen su presencia y por consiguiente, mejoren la supervivencia embrionaria en
cultivo. En este contexto Saprolegnia sp. es el patógeno
más frecuente y agresivo en atacar las ovas de peces en
las piscifactorías (Yamamoto et al., 2001; Zaror et al.,
2004; Mifsud & Rowland, 2008), que se potencian
cuando ocurren cambios ambientales bruscos o se
realizan manejos inadecuados de la población en
cultivo (Mischke & Wise, 2008).
En el caso de G. maculatus, no hay estudios
relacionados con el tema pero en referencia a las
características del embrión, su manejo durante la
incubación es distinta a lo realizado en la salmonicultura donde las especies poseen ovas grandes y no
adhesivas, lo que permite realizar la extracción manual
de huevos muertos (Barnes et al., 2002a, 2002b; Sutela
et al., 2007), manejo que junto a los baños profilácticos
realizados en “estado de ojo” permiten mantener
controlada la proliferación de hongos. En cambio, las
ovas y embriones de G. maculatus por su pequeñez y
adhesividad forman masas de ovas gelatinosas que
hacen inviable el “picaje” durante la incubación. Esta
capa aglutina los embriones y asfixia a los que quedan
al interior de estos racimos; además, atrapa partículas
de material orgánico, generando la rápida colonización
de micro-organismos y zoosporas de hongos
provocando la infección de los embriones sanos.
Existe amplia variedad de antifúngicos para
controlar la presencia del hongo Saprolegnia sp.
(Hussein et al., 2000; Chutima et al., 2005; Aller et al.,
2007; Wagner et al., 2008). Entre ellos, está la
formalina, uno de los compuestos más efectivos y de
fácil manejo (Rowland et al., 2006, 2008; Barnes &
Soupir, 2007). Otro componente de amplio uso es la sal
de mar, varios estudios han demostrado su efectividad
para eliminar la infestación de hongos en ovas de peces
favoreciendo los porcentajes de eclosión, de bajo costo,
fácil disponibilidad, poco tóxica y bajo riesgo
ambiental (Kitancharoen et al., 1998; Mifsud &
Rowland, 2008). Otro producto es el yodo de uso
generalizado para la desinfección de ovas en la
industria salmonera. Este producto cubre un amplio
espectro de acción contra bacterias, hongos y virus
(Jodun & Millard, 2001; Khodabandeh & Abtahi, 2006;
Wagner et al., 2008), estimando que su uso incrementa
los porcentajes de eclosión y controla de manera
efectiva la saprolegniasis.
El presente trabajo pretende contrastar la hipótesis
que la aplicación de tratamientos profilácticos
preventivos y periódicos mejoran la supervivencia
embrionaria y larval de G. maculatus, para este efecto
el objetivo planteado fue evaluar el uso de la formalina,
sal y yodo como compuestos antifúngicos para mejorar
la supervivencia embrionaria y larval y mejorar la
producción masiva de larvas para fines comerciales y/o
de repoblamiento de la especie.
Las ovas se obtuvieron de reproductores provenientes de una población migratoria de G. maculatus
criada en cautiverio con agua dulce en estanques de
tierra de 600 m3, con flujo abierto, alimentados con
extruido para salmones con frecuencia de tres veces al
día a saciedad. En época reproductiva, se seleccionaron
20 hembras y 10 machos maduros mediante una escala
macroscópica de madurez sexual adaptada para esta
especie (Barile et al., 2003). Los ejemplares fueron
desovados mediante masaje abdominal y las ovas
fertilizadas utilizando el método seco e hidratado por
60 min en agua dulce. Las ovas fertilizadas se
incubaron a temperatura constante de 10 ± 0,8°C y
humedad mediante aspersión de tres veces por día con
agua de salinidad 10, preparada con sal de mar
comercial de acuerdo a lo señalado por Barile et al.
(2003). Una vez alcanzado el estado de “ova con ojo”
(Fig. 1) aproximadamente con 140 a 160 unidades
térmicas acumuladas, se seleccionaron los embriones e
iniciaron los distintos tratamientos profilácticos.
Los baños profilácticos correspondieron a la inmersión
de los embriones en la solución profiláctica por 1 h, el
control se sumergió sólo en agua de salinidad 10 por el
mismo periodo de tiempo. Posterior a cada baño, los
Figura 1. Embriones de Galaxias maculatus en “estado
de ojos”, con 220 UTA de desarrollo.
embriones fueron lavados con agua de salinidad 10 para
sacar los restos del profiláctico empleado, luego
drenados y mantenidos en incubación. De cada
tratamiento los embriones muertos fueron retirados y
contabilizados diariamente.
Para evaluar el efecto preventivo y periódico de los
profilácticos en la supervivencia embrionaria y larval,
se diseñaron tres tratamientos utilizando formalina
(37% de formaldehido) en dosis de 250 ppm; yodo
(1,5% de yodo activo y pH neutro) en dosis de 100 ppm
y sal de mar gruesa (NaCl 99,15% min.; sulfatos 0,50%
máx.; Ca 0,09% máx.; Mg 0,03% máx. e insolubles
0.07% máx.) en dosis de 30 de salinidad, contrastados
con un tratamiento control. La periodicidad de los
tratamientos fue cada dos días totalizando siete baños
preventivos durante el período de incubación. Para cada
tratamiento y el control se utilizaron cinco réplicas con
100 embriones cada uno dispuestos en placas Petri,
totalizando 500 embriones por tratamiento y control.
Para evaluar el efecto tardío de los profilácticos en las
larvas, se mantuvieron 100 larvas recién nacidas
obtenidas al azar por cada tratamiento y control en
vasos de precipitado de 1 L por 15 días, con agua de 10
de salinidad, provistas de aireación y alimentadas con
rotíferos (Brachionus plicatilis) enriquecidos a una
concentración de 10 rot. mL-1 día-1. El biensayo se
repitió tres veces en el tiempo.
Para cuantificar el efecto de los tratamientos
profilácticos se determinó: supervivencia embrionaria,
que correspondió a la diferencia entre el número total
de embriones al inicio del periodo experimental y el
número total de embriones eclosionados al final de
dicho periodo, expresados en porcentaje, y supervivencia larval a los 15 días post-eclosión, que
correspondió a la diferencia entre el número total de
larvas al inicio y el número total de larvas sobrevivientes al décimo quinto día, expresada en porcentaje.
Los datos de supervivencia embrionaria y
supervivencia larval a los 15 días de vida, de los
distintos tratamientos profilácticos y control se
presentaron como media matemática y desviación
estándar. Las diferencias estadísticas entre las medias
de los tratamientos fueron probadas mediante ANOVA
de una vía (P < 0,05) y el test de comparaciones
múltiples de Tukey para determinar diferencias a
posteriori. Los tests de Shapiro-Wilks y Levene se
emplearon para evaluar los supuestos de normalidad y
homocedasticidad respectivamente. Los datos porcentuales se transformaron mediante la transformación
angular (Sokal & Rohlf, 1980). Los análisis
anteriormente señalados se realizaron empleando el
software SPSS 21.
Saprolegnia sp. formó en los embriones muertos un
revestimiento de filamentos fungosos que, en ausencia
645
de tratamiento profiláctico (control), se traspasaron a
los embriones sanos más próximos favorecidos por la
adhesividad de la ova y la extensión del desarrollo
embrionario de esta especie (Fig. 2).
La supervivencia embrionaria en los tratamientos
profilácticos de sal (94,6% ± 3,83) y formalina (77,0%
± 3,10) fueron significativamente mayor (P < 0,05), con
respecto del control (67,2% ± 5,67), en cambio en el
tratamiento con yodo (69,8% ± 3,25), no hubo
diferencias significativas con respecto del control (P >
0,05). En el tratamiento con sal se obtuvo en promedio,
la mayor supervivencia a eclosión con diferencias
significativas (P < 0,05) respecto a los restantes
tratamientos y el control (Fig. 3).
Posterior a la eclosión, la mayor supervivencia
larval se obtuvo en los embriones que provinieron del
tratamiento con sal, cuyo promedio fue de 86,3% ±
4,19, con diferencias significativas con los otros
tratamientos y el control (P < 0,05) demostrando que,
además de mejorar la supervivencia embrionaria, el uso
de la sal no afecta posteriormente la supervivencia
larval.
Al contrario, el tratamiento con yodo afectó
negativamente la supervivencia larvaria alcanzando un
58,3% ± 4,54 significativamente inferior al resto de los
tratamiento y al control donde se obtuvo una
supervivencia de 74,7% ± 1,25 (P < 0,05). Del mismo
modo en el caso de los embriones tratados con
formalina se obtuvo una supervivencia larval de 70,7%
± 2,49 sin diferencias significativas respecto del control
(P > 0,05; Fig. 3).
Figura 2. Embriones muertos de G. maculatus cubiertos
de hifas de Saprolegnia sp.
646
Figura 3. Promedios y desviación estándar de la supervivencia embrionaria y supervivencia larval a los 15 días posteclosión de Galaxias maculatus.
Los tratamientos profilácticos con sal y formalina
inhibieron la presencia de hifas de hongos y alcanzaron
supervivencias embrionarias significativamente superiores al control. Entre ambos, el tratamiento con sal
alcanzó la mayor supervivencia embrionaria (94,6%),
significativamente diferente a los tratamientos con
empleo de formalina y yodo. La alta supervivencia
embrionaria obtenida con sal se correlacionó con una
alta supervivencia larvaria (86,3%) promedio, significativamente diferente al resto de los tratamientos
incluido el control, demostrando que el uso de la sal
como agente profiláctico durante la incubación del
embrión no tuvo efectos negativos en las larvas. En
cambio, la supervivencia larval con el empleo de
formalina no mostró diferencias respecto del control.
En el caso del yodo, la supervivencia larval fue
significativamente menor respecto del control. Los
bajos resultados obtenidos con la formalina y
especialmente con el yodo, se explicarían por la
alteración de la calidad del agua que estos químicos,
dependiendo de la concentración empleada, podrían
provocar durante la fase embrionaria, que luego se
expresan en la viabilidad de las larvas (Fowler &
Banks, 1990; Howe et al., 1995; Buchmann et al.,
2004; Meinelt et al., 2005; Pedersen & Pedersen, 2006;
Rowland et al., 2006; Oplinger & Wagner, 2009;
Chalupnicki et al., 2011).
En el caso de la formalina, independiente de su
toxicidad, este químico como funguicida evita la
saprolegniosis obteniendo altos porcentajes de eclosión
(Barnes et al., 2001, 2003; Gieseker et al., 2006; Small
& Chatakondi, 2006; Soupir & Barnes, 2006; Barnes &
Soupir, 2007; Rasowo et al., 2007; Rowland et al.,
2008; Rodriguez et al., 2011). En el caso del yodo hay
evidencias de su capacidad como control de hongos
(Pravecek & Barnes, 2003; Tendencia, 2003). Sin
embargo, Khodabandeh & Abtahi (2006) y Wagner et
al. (2008) concluyeron que el yodo no supera en
eficiencia a la sal y formalina, lo cual es concordante
con los resultados obtenidos en el presente trabajo.
Respecto del uso de la sal, ésta genera comparativamente mejores supervivencias embrionarias
(Phelps & Walser, 1993; Marking et al., 1994; Schreier
et al., 1996; Kitancharoen et al., 1998), posiblemente
debido a que la sal, entre otros, es un elemento poco
tóxico para los peces (Taylor & Bailey, 1979; Froelich
& Engelhardt, 1996) y que Saprolegnia es una
enfermedad de agua dulce incapaz de sobrevivir en
salinidades mayores a 3,5% (Zaror et al., 2004).
Debido a la larga extensión del periodo de
embrionario de G. maculatus, aproximadamente 30
días y la adhesividad del corión que aumenta la
susceptibilidad de infecciones fúngicas fue necesario
realizar periodicamente baños profilácticos a los embriones para evitar la saprolegniosis. La frecuencia de un
baño cada dos días generó un total de siete baños
profilacticos previo a su eclosión, la eficiencia de los
baños se demostró al compararlos con el tratamiento
control que no recibió baños profilácticos, siendo
infectado por los hongos y afectando significativamente la sobreviencia embrionaria.
En conclusión, de los tres tratamientos profilácticos
empleados, el tratamiento con sal presentó el mayor
porcentaje de supervivencia embrionaria mejorando un
27,4% por sobre el control. En cambio la formalina
obtuvo supervivencias embrionaria de 9,8% sobre el
control y en el caso del yodo se obtuvo sólo una
supervivencia embrionaria de 2,6% por sobre el
control. El efecto de la sal y formalina no afectó
posteriormente la supervivencia larval, en cambio el
yodo en la concentración empleada si afectó la
sobrevivencia larval de G. maculatus.
REFERENCIAS
Aller, J. & J. Fregeneda. 2007. Comparative efficacy of
Pyceze (bronopol) in controlling mortality of brown
trout Salmo trutta eggs. Aquacult. Res., 38: 618-624.
Barile, J., M. Escudero & E. Carreño. 2013a. Efecto
combinado de la temperatura y salinidad sobre la
supervivencia embrionaria de G. maculatus. Rev. Biol.
Mar. Oceanogr., 48(3): 641-645.
Barile, J., E. Carreño, M. Escudero & A. Bello. 2013b.
Efecto de la temperatura en la sobrevivencia
embrionaria del puye G. maculatus (Jenyns, 1842).
Lat. Am. J. Aquat. Res., 41(5): 839-845.
Barile, J., M. Escudero, E. Carreño & D. San Martín.
2015. Efecto de la salinidad en la supervivencia
embrionara de puye G. maculatus (Jenyns, 1842). Lat.
Am. J. Aquat. Res., 43(2): 282-286.
Barile, J., A. Bórquez, P. Dantagnan, A. Mardones, J.
Quevedo, I. Salgado, I. Valdebenito & R. Vega. 2003.
Antecedentes para el Cultivo del puye Galaxias
maculatus
(Pisces:
Galaxiidae).
Ediciones
Universidad Católica de Temuco, Temuco, 144 pp.
Barnes, M. & C. Soupir. 2007. Evaluation of formalin and
hydrogen peroxide treatment regimes on rainbow trout
eyed eggs. N. Am. J. Aquacult., 69: 5-10.
Barnes, M., W. Sayler & R. Cordes. 2001. Use of formalin
treatments during incubation of eyed eggs of brown
trout. N. Am. J. Aquacult., 63: 333-337.
Barnes, M., W. Sayler & R. Cordes. 2002a. Formalin and
handpicking regimes during rearing in vertical-flow
tray incubators. N. Am. J. Aquacult., 64: 129-135.
Barnes, M., W. Sayler & R. Cordes. 2002b. Survival of
rainbow trout yolk sac fry subjected to various
formalin and handpicking regimes during rearing in
vertical-flow tray incubators. N. Am. J. Aquacult., 64:
129-135.
Barnes, M., H. Stephenson & M. Gabel. 2003. Use of
hydrogen peroxide and formalin treatments during
incubation of landlocked fall Chinook salmon eyed
eggs. N. Am. J. Aquacult., 65: 151-154.
Benzie, V. 1968. Stages in the normal development of
Galaxias maculatus attenuatus (Jenyns). N. Z. J. Mar.
Freshwater Res., 2: 606-627.
Buchmann, K., J. Bresciani & C. Jappe. 2004. Effects of
formalin treatment on epithelial structure and mucous
cell densities in rainbow trout, Oncorhynchus mykiss
(Walbaum), skin. J. Fish. Dis., 27: 99-104.
Chalupnicki, M., H. Ketola, C. Starliper & D. Gallagher.
2011. Efficacy and toxicity of iodine disinfection of
647
Atlantic salmon eggs. N. Am. J. Aquacult., 73: 124128.
Chutima, K., K. Shuichi, K. Masaaki & Y. Motoi. 2005.
Fungicidal effects of sodium hypochlorite solution on
Saprolegnia isolated from eggs of chum salmon
Oncorhynchus keta. Fish. Sci., 71: 1188-1190.
Fowler, L. & J. Banks. 1990. Iodophor toxicity to eggs and
fry of fall Chinook salmon. Prog Fish-Cult., 52: 176178.
Froelich, S. & T. Engelhardt. 1996. Comparative effects
of formalin and salt treatments on hatch rate of koi carp
eggs. Prog. Fish-Cult., 58: 209-211.
Gieseker. C., S. Serfling & R. Reimschuessel. 2006.
Formalin treatment to reduce mortality associated with
Saprolegnia
parasitica
in
rainbow
trout,
Oncorhynchus mykiss. Aquaculture, 253: 120-129.
Howe, G., L. Marking, T. Bills & T. Schreier. 1995.
Efficacy and toxicity of formalin solutions containing
paraformaldehyde for fish and egg treatments. Prog.
Fish-Cult., 57: 147-152.
Hussein, A., S. Wada, K. Hatai & A. Yamamoto. 2000.
Antimycotic activity of eugenol against selected water
molds. J. Aquat. Anim. Health, 12: 224-229.
Huysentruyt, F. & D. Adriaens. 2005. Adhesive structures
in the eggs of Corydoras aeneus (Gill, 1858;
Callichthyidae). J. Fish. Biol., 66: 871-876.
Jodun, W. & M. Millard. 2001. Effect of yodophor
concentration and duration of exposure during water
hardening on survival of Atlantic salmon eggs. N. Am.
J. Aquacult., 63: 229-233.
Khodabandeh, S. & B. Abtahi. 2006. Effects of sodium
chloride, formalin and iodine on the hatching success
of common carp, Cyprinus carpio, eggs. J. Appl.
Ichthyol., 22: 54-56.
Kitancharoen, N., A. Yamamoto & K. Hatai. 1998. Effects
of sodium chloride, hydrogen peroxide and malachite
green on fungal infection in rainbow trout eggs.
Biocontrol. Sci., 3: 113-115.
Marking, L., J. Rach & T. Schreier. 1994. Evaluation of
antifungal agents for fish culture. Prog. Fish-Cult., 56:
225-231.
Meinelt, T., M. Pietrock, K. Burnison & C. Steinberg.
2005. Formaldehyde toxicity is altered by calcium and
organic matter. J. Appl. Ichthyol., 21: 121-124.
Mitchell, C. 1989. Laboratory culture of Galaxias
maculatus and potential applications. N. Z. J. Mar.
Freshwater Res., 23: 325-336.
Mifsud, C. & S. Rowland. 2008. Use of salt to control
ichthyophthiriasis and prevent saprolegniosis in silver
perch, Bidyanus bidyanus. Aquacult. Res., 39: 11751180.
Mischke, C. & D. Wise. 2008. Tolerance of channel
catfish fry to abrupt pH changes. N. Am. J. Aquacult.,
70: 305-307.
648
Mizuno, S., Y. Sasaki, N. Omoto & K. Imada. 2004.
Elimination of adhesiveness in the eggs of shishamo
smelt Spirinchus lanceolatus using kaolin treatment to
achieve high hatching rate in an environment with a
high iron concentration. Aquaculture, 242: 713-726.
Oplinger, R. & E. Wagner. 2009. Toxicity of common
aquaculture disinfectants to New Zealand mud snails
and mud snail toxicants to rainbow trout eggs. N. Am.
J. Aquacult., 71: 229-237.
Pedersen, L. & P. Pedersen. 2006. Temperaturedependent formaldehyde degradation in trickling
filters. N. Am. J. Aquacult., 68: 230-234.
Phelps, R. & C. Walser. 1993. Effects of sea salt on the
hatching of channel catfish eggs J. Aquat. Anim.
Health, 5: 205-207.
Pravecek, J. & M. Barnes. 2003. Lack of effect of
lodophor on survival of westslope cutthroat trout eggs
during water hardening. N. Am. J. Aquacult., 65: 266268.
Rasowo, J., O. Okoth & C. Ngugi. 2007. Effects of
formaldehyde, sodium chloride, potassium permanganate, and hydrogen peroxide on hatch rate of African
catfish Clarias gariepinus eggs. Aquaculture, 269:
271-277.
Rodriguez, L., M. Abdo, C. Padilla, V. Zepeda, G.
Velasco & N. Garcia. 2011. Effect of formalin,
acriflavine and glutaraldehyde on disinfecting and
hatching of the bullseye puffer fish Sphoeroides
annulatus. Rev. Biol. Mar. Oceanogr., 46: 59-65.
Rowland, S., C. Mifsud, M. Nixon, P. Read & M. Landos.
2008. Use of formalin and copper to control
ichthyophthiriosis in the Australian freshwater fish
silver perch (Bidyanus bidyanus Mitchell). Aquacult.
Res., 40: 44-54.
Rowland, S., M. Nixon, M. Landos, C. Mifsud, P. Read &
P. Boyd. 2006. Effects of formalin on water quality
and parasitic monogeneans on silver perch (Bidyanus
bidyanus Mitchell) in earthen ponds. Aquacult. Res.,
37: 869-876.
Received: 7 May 2015; Accepted: 7 March 2016
Schreier, T., J. Rach & G. Howe. 1996. Efficacy of
formalin, hydrogen peroxide, and sodium chloride on
fungal-infected rainbow trout eggs. Aquaculture, 140:
323-331.
Small, B. & N. Chatakondi. 2006. Efficacy of formalin as
an egg disinfectant for improving hybrid catfish
(channel catfish x blue catfish) hatching success. N.
Am. J. Aquacult., 68: 9-13.
Sokal, R. & J. Rohlf. 1980. Introducción a la
bioestadística. Editorial Reverté, Madrid, 362 pp.
Soupir, C. & M. Barnes. 2006. Reduced formalin and
hydrogen peroxide treatments during walleye egg
incubation. N. Am. J. Aquacult., 68: 276-280.
Sutela, T., P. Pasanen, P. Louhi & A. Maki-Petays. 2007.
Impacts of water quality and handpicking of dead eggs
on the survival of brown trout and Atlantic salmon
eggs. N. Am. J. Aquacult., 69: 235-238.
Tendencia, E. 2003. Iodine disinfection of grouper
Epinephelus coioides eggs. Bull. Eur. Assoc. Fish.
Pathol., 23: 191-196.
Taylor, S. & J. Bailey. 1979. Saprolegnia: control of
fungus on incubating eggs of pink salmon by treating
with seawater. Prog. Fish-Cult., 41: 181-183.
Yamamoto, A., S. Toyomura, M. Saneyoshi & K. Hatai.
2001. Control of fungal infection of salmonid eggs by
hydrogen peroxide. Fish. Pathol., 36: 241-246.
Wagner, E., R. Arndt, E. Billman, A. Forest & W.
Cavender. 2008. Comparison of the efficacy of iodine,
formalin, salt, and hydrogen peroxide for control of
external bacteria on rainbow trout eggs. N. Am. J.
Aquacult., 70: 118-127.
Zaror, L., L. Collado, H. Bohle, E. Landskron, J. Montana
& F. Avendano. 2004. Saprolegnia parasitica in
salmon and trout from southern Chile. Arch. Med.
Vet., 36: 71-78.
Lat. Am. J. Aquat. Res., 44(3): 649-656, 2016 Factores de riesgo en acuicultura: caso de estudio
649
Short Communication
Susceptibilidad a la variabilidad ambiental del sector acuícola en el
Estado de Colima, México: caso de estudio
Marco Agustin Liñan-Cabello1*, Ana Luz Quintanilla-Montoya2
Cesar Sepúlveda-Quiroz1 & Omar D. Cervantes-Rosas1
1
Facultad de Ciencias Marinas, Universidad de Colima, Manzanillo, Colima, México
2
Centro Universitario de Gestión Ambiental, Universidad de Colima, Colima, México
Corresponding author: Marco Agustín Liñan-Cabello (linanmarco@hotmail.com)
RESUMEN. En México, como en muchos otros países de Latino América, la carencia de un plan de desarrollo
y/o prevención en acuicultura ante la variabilidad ambiental es evidente. En el Estado de Colima, la acuicultura
presenta rezagos en cuanto a la capacidad técnica-productiva, en especial para el cultivo de tilapia Oreochromis
spp. Se practicaron encuestas a acuicultores y expertos, además de consultar fuentes bibliográficas científicas,
y la identificación de diferentes factores de riesgo emanados de la práctica de la actividad acuícola para valorar
la vulnerabilidad del sector. El principal factor de riesgo se asoció a fenómenos hidrometeorológicos, para lo
cual se reconoce la necesidad de delimitar zonas de mayor riesgo, más aún, ante la incertidumbre de los mismos
debido al cambio climático global. El presente estudio propone implementar un programa integral de
reconversión tecnológica y medidas de control para especies exóticas que, además, considere esquemas de
producción acuícola basadas en el uso eficiente del agua, y considere para ello el uso de especies endémicas
para su cultivo.
Palabras clave: acuacultura, políticas públicas, vulnerabilidad costera, cambio climático.
Susceptibility to environmental variability of the aquaculture sector
in the State of Colima, Mexico: case study
ABSTRACT. In Mexico, as in many other Latin American countries, the lack of a development plan and/or
prevention in aquaculture to environmental variability is evident. In the State of Colima, aquaculture presents
lags in terms of technical and productive capacity especially for growing tilapia Oreochromis spp. Surveys were
performed to farmers and experts, in addition to consulting scientific literature sources, and identifying different
risk factors arising from the practice of aquaculture in order to assess the vulnerability of the sector. The main
risk factor associated with hydrometeorological phenomena, for which the need to define high-risk areas, even
more, given the uncertainty of the same due to global climate change is recognized. This study proposes to
implement a comprehensive program of technological conversion and control measures for alien species that
also consider aquaculture production schemes based on the efficient use of water, and to consider using this
endemic species for cultivation.
Keywords: aquaculture, fishery public policies, coastal vulnerability, climate change.
En México como en muchos otros países de Latino
América, la acuacultura se ha desarrollado como una
gestión por actividades y no a partir de un esquema de
desarrollo integral (Edwards, 2015). De acuerdo a las
proyecciones realizadas para México por Magaña
(1999), a mediados del siglo XXI, el clima será más
cálido (2º-3ºC). Estudios específicos han referido que
en los estados mexicanos de Colima y Guerrero, por
cada grado de incremento de temperatura ambiental, los
__________________
Corresponding editor: Jesús Ponce-Palafox
casos de dengue han aumentado entre 1,5 y 2% (SSA,
2001; Espinoza-Gómez et al., 2013), mientras que los
casos de paludismo podrían afectar principalmente a
poblaciones rurales de difícil acceso (INE, 2006). Otros
autores han referido que específicamente con la
práctica de la acuicultura de agua dulce, se potencializa
la absorción de sustancias tóxicas y metales pesados en
organismos acuáticos, debido a que el incremento de
temperatura acelera su ritmo metabólico pudiendo ori-
650
ginar problemas relacionados con la seguridad
alimentaria, certificación de productos, y en otros casos
potenciar la virulencia de organismos mantenidos en
cultivo (Marcogliese 2001; Ficke et al., 2007).
De acuerdo a la FAO (2008), a nivel mundial
existen tres grupos y/o especies principales que han
sido diseminados en diversas regiones geográficas y
han llegado a jugar un papel importante en la
producción acuícola: en aguas tropicales se encuentra
la tilapia (Oreocromis sp.) y el camarón blanco
Penaeus vannamei (Boone, 1931), mientras que en
aguas templadas están los salmónidos (familia
Salmonidae). En el caso particular de Colima, las
últimas dos especies referidas dominan en el esquema
de producción, en el caso de la tilapia, corresponde a
una especie exótica, mientras que el camarón blanco es
una especie de origen marino, que sin embargo, se
puede considerar como exótica por cultivarse
principalmente en aguas interiores de baja salinidad
(Miranda et al., 2010; Castillo-Soriano et al., 2011).
Independientemente de los efectos ocasionados por las
especies exóticas, el ejercicio de la acuicultura por sí
misma, promueve cambios en el uso del suelo que
modifican el ambiente físico y biológico, trasformando
el hábitat, las interacciones biológicas de sus
poblaciones silvestres, el comportamiento animal y los
procesos ecosistémicos (Cabrera, 2009).
El objetivo principal del presente estudio es
identificar las expectativas de la actividad acuícola,
frente a los escenarios de riesgo y variabilidad
ambiental. Del mismo modo, se pretende contribuir al
conocimiento para lograr un mejor desarrollo de la
acuicultura, bajo un esquema de adaptación para el
aprovechamiento sustentable de los recursos acuáticos,
considerando los atributos del entorno, el desarrollo
tecnológico y las potencialidades de desarrollo
acuícola.
La mayoría de las granjas acuícolas de Colima están
ubicadas en zonas de temperatura cálida (26°C), donde
se localizan los municipios de Manzanillo, Tecomán,
Colima y Coquimatlán. En Colima fundamentalmente
se cultiva la tilapia (Oreochromis niloticus Linnaeus
1758, variedad Stirling) y el camarón blanco (Penaeus
vannamei).
Los principales ríos de Colima son el Marabasco
que limita con Jalisco por el oeste; el Armería que
desciende de la Sierra de Cacoma, Jalisco y cruza el
estado de norte a sur y en la zona sureste los ríos Boca
de Pascuales y Coahuayana. Estos sistemas fluviales
descargan sus aportes continentales a lo largo de la
costa Pacífica. En la zona costera se localiza la Laguna
Potrero Grande, ubicada en el municipio de
Manzanillo, al igual que la de Miramar y la de San
Pedrito, y como cuerpo lacustre de menor capacidad, la
Laguna del Valle de las Garzas. También se encuentran
las lagunas de Alcuzahue y Amela, ubicadas en el
municipio de Tecomán; y la laguna Cuyutlán que es la
de mayor extensión (7.200 ha) localizada en los
municipios de Armería y Manzanillo (INAFED, 2010).
Colima presenta una recurrencia de penetración de
ciclones de 5 a 7 años, y tiene la segunda probabilidad
más alta en presentar este tipo de fenómenos en su
territorio con un valor de 0,36%, por esta razón está
catalogado como un estado donde la presencia de
ciclones es muy alta (CENAPRED, 2007; Constantino
et al., 2011).
Los principales acuíferos subterráneos se localizan
a lo largo de la costa, donde los ríos Armería y
Marabasco y otros de menor caudal, han acumulado
sedimentos deltaicos permeables que reciben importantes recargas debido a la precipitación abundante y a
sus propios escurrimientos (INAFED, 2010). La
precipitación promedio anual es de 983 mm y aumenta
en zonas de mayor altitud. En general, la mayoría de las
granjas acuícolas se encuentran ubicadas en los
alrededores del río Armería y al sur del estado, en el
valle de Tecomán, principalmente debido a que son
zonas con buen abastecimiento de agua, tanto de tipo
superficial y/o acuíferos subterráneos.
Durante 2013 se realizaron encuestas en las
diferentes unidades de producción acuícola (UPAs) del
Estado de Colima, asimismo, se realizaron dos talleres
consultivos con productores de tilapia y camarón para
reconocer la problemática de mayor relevancia respecto
a eventos hidrometeorológicos, mareas rojas, desecación,
lluvias intensas, afectaciones por patógenos y sus
posibles soluciones, Adicionalmente, se realizaron búsquedas en bases de datos especializados, y consulta de
reportes técnicos gubernamentales. También, se
practicaron encuestas a expertos en el estudio del
Cambio Climático Global (CCG), para identificar
posibles evidencias/registros de anomalías ambientales
y estimaciones sobre el grado de impacto de cambios
ambientales en el Estado de Colima y particularmente,
al sector acuícola.
Para la determinación de la vulnerabilidad (V), se
utilizaron los componentes definidos por el IPCC
(2001), exposición (E), sensibilidad (S) y capacidad de
adaptación (CA), usando la relación:
V = (E + S) – CA
De acuerdo a dicha propuesta metodológica, el rango
en los valores de vulnerabilidad es de 0-1, correspondiendo a 1, el valor de máxima vulnerabilidad. Para
el cálculo de este indicador, se consultaron bases de
datos oficiales (INEGI, 2009; SAGARPA-CONAPESCA, 2013). La selección de indicadores se realizó
tomando en consideración aspectos sociales, económicos y ambientales involucrados en las actividades
Factores de riesgo en acuicultura: caso de estudio
pesqueras y acuícolas. Los datos obtenidos fueron
estandarizados, según lo propuesto por Barsley et al.
(2013).
En la presente investigación se realizaron 65
encuestas que correspondieron al 75% de las 91
unidades productivas existentes. Los principales municipios donde se practica la acuicultura son
Coquimatlán, Colima, Manzanillo y Tecomán, los
cuales conformaron el 72% de las granjas existentes
(Fig. 1).
La mayor parte de las UPAs se localizaron en aguas
interiores y muchas de ellas en lugares de difícil acceso.
De acuerdo a los actores, los eventos de mayor
exposición al riesgo se asociaron a eventos de lluvias
intensas y/o vientos. Es importante destacar que
únicamente el 73% del sector, cuenta con servicios
médicos, los cuales se encuentran localizados en
algunos casos, a más de 2 h de trasportación, y sólo un
26% de los granjeros cuenta con seguro de vida.
Contrariamente a la actividad agrícola, el 60% de
los acuicultores no recibe ningún tipo de subsidio por
consumo eléctrico y existen algunas UPAs, que no han
sido electrificadas; su lejanía con respecto a la red
eléctrica ha sido un factor determinante para impedir la
tecnificación, el acceso a recursos y a estar incomunicados respecto a los boletines oficiales de seguridad.
En cuanto al abasto de alevines de tilapia, existen
proveedores locales que aportan el 88% de la cría
cultivada en el Estado y utilizan la técnica de reversión
sexual a partir de hormonas (17α metil-testosterona), a
fin de producir organismos monoicos; únicamente un
12% selecciona manualmente los machos o realiza
bicultivos con tilapia-camarón.
La mayoría de las granjas de tilapia registran baja
productividad respecto a los rendimientos reportados
por algunas UPAs (7-8 ton ha -1). Adicionalmente y de
acuerdo a información obtenida con los actores, fue
posible reconocer un escaso o nulo conocimiento del
dominio de la técnica de cultivo. En el caso particular
del cultivo del camarón, se presentan mejores indicadores productivos. En este sentido se presenta un menor
nivel de vulnerabilidad del cultivo de este crustáceo en
la mayoría de los rasgos referidos.
En base a las encuestas aplicadas a productores, los
principales problemas asociados al desarrollo de la
acuicultura en el Estado, fueron: a) alto grado de
burocracia principalmente asociada a los trámites para
obtener permisos, certificaciones, concesiones, entre
otros, b) deficiente suministro eléctrico, c) exceso en el
uso de agroquímicos y pesticidas por el sector agrícola,
d) conflictos por el uso de agua con la agricultura, y e)
problemas relacionados con la obtención de insumos y
comercialización del producto.
651
De acuerdo a la información obtenida, la actividad
agrícola genera contaminación por exceso y/o uso
inadecuado de agroquímicos (Fracchia-Durán & LiñanCabello, 2013). Incluso en Colima, se reconoce la
existencia de políticas inadecuadas que promueven la
adquisición y uso de agroquímicos, que representan
vectores persistentes, que promueven la contaminación
de cuerpos costeros (Anguiano-Cuevas et al., 2015),
pudiendo tener efectos en la salud, supervivencia y
calidad de los organismos acuáticos susceptibles a ser
cultivados.
De acuerdo a fuentes oficiales (SAGARPA, 2013)
y los resultados obtenidos por las 14 encuestas a
especialistas en CCG, las altas precipitaciones derivadas de fenómenos hidrometeorológicos fueron
considerados como una de las causas de mayor peligro
por provocar inundaciones, aumento de cauces de ríos
y deslave de material rocoso. Un ejemplo de lo anterior
se presentó en octubre de 2011, en las costa de Colima,
que fue afectada por el paso del huracán Jova (Fig. 2).
Según fuentes oficiales (SAGARPA, 2013), los daños
en el sector acuícola causados por dicho evento
ascendieron a US$454,000 relacionados con la erosión
de bordes, pérdida o fuga de organismos, y afectaciones
en insumos y equipos operativos. Los principales daños
se presentaron en UPAs del municipio de Colima,
seguidos por Tecomán y Manzanillo. Una problemática
subsecuente del impacto del huracán Jova, fue la fuga
incontrolada de organismos de cultivo, a diversos
entornos acuáticos. Se estima que casi ocho millones de
organismos se escaparon al medio. Tecomán fue el
municipio con el mayor registro de especímenes
liberados, con 76% del total.
Se encontró que los municipios con mayor nivel de
vulnerabilidad fueron Manzanillo, Colima y Tecomán,
y en menor proporción Villa de Álvarez, Armería y
Coquimatlán (Tabla 1, Fig. 3). Se destaca además que
en estos municipios se localiza el 82% de las granjas
acuícolas. En general, la tendencia en los componentes
S, E y CA fue similar, correspondiendo los mayores
valores a los mismos municipios de Manzanillo,
Colima y Tecomán.
El Cambio Climático Global presenta serias
amenazas para la sostenibilidad del sector acuícola, con
base a los impactos de orden biológico, económico y
social (Magaña et al., 2004 en Flores-Nava, 2010). No
obstante, de acuerdo a la FAO (Cochrane et al., 2009),
solo se ha documentado un efecto directo en la
acuicultura por acción del CCG promovido por causas
antropogénicas, como la niebla tóxica que se extendió
sobre Asia sudoriental durante el fenómeno El Niño, de
2002. En este sentido este evento ambiental tuvo por
consecuencia la reducción de un 10% de la propagación
de la luz solar y anomalías térmicas en la atmósfera y el
652
Colima, México
104030´´
104000´´
103030´´
19o30´´
19o30´´
Minatitlán
Cómala
Villa de
Álvarez
Cuauhtémoc
Coquimatlán
Tecomán
Manzanillo
7%
Colima
Colima
7%
19o30´´
19o30´´
Armería
Ixtlahuacán
29%
7%
Tecomán
Villa de Alvárez
11%
24%
18%
Comála
Minatitán
Otros
10 Km
18o30´´
Manzanillo
Coquimatlán
7%
104030´´
104000´´
103030´´
18o30´´
Figura 1. a) Localización de las Unidades de Producción Acuícola (UPAs) en el Estado de Colima, b) porcentajes de
UPAs en el Estado.
Dólares (USA)
500.000
400.000
300.000
200.000
100.000
0
Tec
Col
Mzo
Arm
Com
Coq
Total
Municipios
Figura 2. Relación de daños por el huracán Jova (2011)
en la infraestructura interna (erosión de bordos, pérdida de
organismos, afectaciones en insumos y equipos
operativos) y externa (daños en caminos/accesos y red
eléctrica) en algunos de los municipios con actividad
acuícola. Tec: Tecomán, Col: Colima, Mzo: Manzanillo,
Arm: Armería, Com: Comala, Coq: Conquimatlán.
(Fuente: Secretaría de Desarrollo Rural del Estado de
Colima 2013).
océano. De acuerdo a Swing (2003), dicho fenómeno
contribuyó a un episodio de floración de dinoflagelados
que perjudicó la acuicultura en zonas costeras desde
Indonesia hasta la República de Corea causando daños
por millones de dólares. No obstante, las repercusiones
directas del cambio climático a propagar un fenómeno
específico, los efectos indirectos al sector acuícola
pueden ser de mucha mayor complejidad ya que existen
relaciones de competencia por agua con agricultura y
dependencia de insumos derivados de la actividad
pesquera, entre otros.
En Colima la actividad acuícola está relacionada
con cultivo de camarón y tilapia, observando un
crecimiento proporcional muy próximo al 8,7% anual,
(FAO, 2008), que muestra un mayor nivel de
tecnificación en el cultivo de camarón en aguas
interiores; mientras que el cultivo de tilapia, en general
mantiene rasgos asociados a escasa tecnificación y bajo
rendimiento. No obstante, el crecimiento de esta
actividad en el Estado, como en otras partes del país, se
ha dado sin los elementos de planeación requeridos ante
diversas contingencias de tipo ambiental y/o
antropogénico. Como evidencia principal, se puede
considerar los efectos observados a consecuencia del
huracán Jova, que causó múltiples daños a la
infraestructura y efectos biológicos en granjas asociadas a los municipios de Colima Tecomán y Manzanillo.
Igualmente, con base a la información obtenida sobre
las granjas, se observó que en el cultivo de la tilapia,
es común el empleo de la hormona 17 alfa-metilestosterona para obtener monosexo machos, que si bien
evita la reproducción temprana de esta especie y con
Tabla 1. Exposición, sensibilidad, capacidad de adaptabilidad y vulnerabilidad en los municipios del estado de
Colima. E: exposición, S: sensibilidad, CA: capacidad de
adaptación, V: vulnerabilidad.
Municipio
Armería
Colima
Comala
Coquimatlán
Cuauhtémoc
Ixtlahuacán
Manzanillo
Minatitlán
Tecomán
Villa de Alvarez
E
0,13
0,26
0,09
0,12
0,11
0,09
0,34
0,09
0,23
0,15
S
0,03
0,16
0,02
0,02
0,03
0,01
0,18
0,01
0,13
0,13
CA
0,03
0,13
0,02
0,02
0,02
0,00
0,14
0,01
0,10
0,11
V
0,13
0,28
0,09
0,12
0,11
0,09
0,38
0,09
0,26
0,17
ello optimiza los tiempos de cultivo y empleo de
alimento, tiene la limitante de impedir la comercialización a escalas nacional/internacional ya que la
“Agencia de Alimentos y Medicamentos” (FDA) de
USA, no aprueba el uso de éstos compuestos
hormonales durante el cultivo en peces, debido al
posible impacto de los derivados hormonales en el ser
humano y en el medio (Phelps & Popma, 2000). Este
rasgo distintivo en el cultivo de tilapia en Colima como
en otros estados de México y países en desarrollo,
denota una afectación a la fragilidad sanitaria y a los
atributos de bioseguridad que en asociación sinergística
con el bajo nivel de desarrollo tecnológico y fragilidad
financiera -entre otros indicadores- hacen que el cultivo
de este pez sea una actividad de alta vulnerabilidad
(Tabla 2), y por ello, requiere un plan de reordenamiento por las autoridades correspondientes, a fin de
disminuir los impactos ecológicos de estas especies
bajo un escenario de forzamiento ambiental.
En un estudio realizado por Seingier et al. (2010),
se analizó la vulnerabilidad de las regiones costeras de
México al 2030, encontrando al Municipio de Tecomán
con mayor riesgo (0,69) y al de Manzanillo con menor
riesgo (0,35). El alto índice en Tecomán estaría
asociado con la mayor planicie costera y baja altitud
respecto al nivel medio del mar, que cobra mayor
relevancia si se considera que el municipio de Tecomán
tiene la mayor cantidad de granjas camaroneras del
Estado. Al analizar la relación de sensibilidad y
capacidad de adaptación se encontró que los municipios
de Manzanillo, Colima, Tecomán y Villa de Álvarez se
ubicaron en un grupo con mayor sensibilidad y mayor
capacidad de adaptación, en relación a los demás del
Estado de Colima. Los municipios con menor
sensibilidad y menor capacidad de adaptación o mínima
capacidad de respuesta fueron Minatitlán e Ixtlahuacán.
Al respecto, Padilla-Lozoya (2007) reportó para los
municipios de Armería, Coquimatlán y Minatitlán, que
653
pertenecen a este grupo, registros históricos de daños
ocasionados por lluvias intensas y huracanes, el más
desbastador de estos fenómenos fue el “Ciclón de 59”
que durante 1959 impactó la costa del Pacífico y
provocó la muerte de más de mil personas.
La laguna de Cuyutlán, con una extensión de 7.200
ha, representa el cuerpo de agua de mayor potencialidad
para el cultivo de especies marinas, que se extiende a lo
largo de la costa separada del mar por una barra de 34
km. Actualmente, existen diversos factores que
convergen en la laguna Cuyutlán, tales como diversas
fuentes de contaminación urbana -por ubicarse próxima
a centros de población humana-, giro industrial por la
presencia de una central termo-eléctrica, y recientemente, la instalación de un canal artificial con
propósitos de uso portuario al interior de la laguna,
conlleva a suponer la necesidad de realizar estudios de
mayor profundidad que permitan evaluar la verdadera
capacidad acuícola de este cuerpo de agua.
De acuerdo a proyecciones oficiales (INECC,
2015), al menos el 60% de la costa del Estado de
Colima está expuesta a riesgo de inundación derivada
del aumento del nivel del mar. En este contexto, se
considera que las granjas dispuestas al sur de Tecomán,
Armería y la zona circundante a la laguna Cuyutlán,
exhiben un mayor riesgo ante fenómenos hidrometeorológicos. Adicionalmente, es importante reconocer
que el grupo de acuicultores de este cuerpo de agua, no
cuenta con más infraestructura que los propios cercos y
en la mayoría de los casos, no existe un permiso formal
de las autoridades gubernamentales para realizar el
ejercicio de la acuacultura, de tal forma que al existir
una contingencia ambiental, sería muy limitada su
capacidad de gestión de apoyos gubernamentales. Se
considera imperativa la necesidad de profundizar sobre
estudios orientados a evaluar factores de riesgo e
identificar acciones para minimizar el grado de
vulnerabilidad no solo del sector acuícola, sino de los
pescadores de al menos cinco sociedades cooperativas
que operan en este cuerpo lagunar.
Vivanco-Aranda et al. (2011) analizaron los escenarios y estrategias hacia el año 2018, en el sistema de
producción de tilapia en Colima, señalando que, a pesar
de que en dicho estado, la capacidad de infraestructura
existente podría redundar más en el plan de mejora
productivo, existen importantes carencias en lo relativo
a los atributos de control sanitario, lo que repercute
negativamente en los esquemas de pro-ducción. En este
sentido, se reconoce que la liberación al ambiente de
organismos exóticos tratados hormo-nalmente por
acción de malas prácticas y/o a consecuencia de algún
evento de inundación en las granjas acuícolas, es sin
duda un problema que ha repercutido de manera
importante en los ecosistemas existentes, particularmen-
654
Figura 3. Vulnerabilidad de la actividad acuícola en los municipios del Estado de Colima. Mzo: Manzanillo, Col: Colima,
Tec: Tecomán, VA: Villa de Alvarez, Arm: Armería, Com: Comala, Min: Minatitlán, Coq: Coquimatlan, Cua: Cuauhtémoc,
Ixt: Ixtlahuacan (Elaboración propia, con datos de INEGI, 2013).
Tabla 2. Rasgos comparativos del nivel de desarrollo en el cultivo de camarón y de tilapia en Colima y su nivel de
vulnerabilidad a contingencias asociadas al cambio climático. Nivel de indicadores: 1) elevado, 2) medio, 3) básico,
4) limitado, 5) muy limitado-nulo.
Rasgo
Nivel de desarrollo tecnológico
Disponibilidad de capital
Robustez de infraestructura ante eventos extremos
Flexibilidad y capacidad de adaptación a cambios
Fragilidad sanitaria
Nivel de bioseguridad
Fragilidad financiera ante volatilidad de precios de insumos
Posibilidad de reiniciar en caso de destrucción
Nivel general de vulnerabilidad
te en el reemplazo de especies endémicas. Lo anterior
no solo se limita al caso tilapia, como especie invasiva,
sino a otras más. Al respecto, de acuerdo a
observaciones, estadísticas oficiales y encuestas
realizadas en campo, se pudo comprobar un importante
aumento de caimanes de las especies Crocodylus
acutus (Cuvier, 1807) y Crocodylus moreletii (Duméril
& Bibron, 1851), éste último originario de la costa del
Golfo y Caribe de México; así como el efecto invasivo
del pez diablo (Hypostomus sp.) en las lagunas de
Alcuzahue y Amela del municipio de Tecomán. De
acuerdo a los acuicultores y pesca-dores de la Laguna
Amela, el efecto de Hypostomus sp. fue más
significativo a partir la 2011 que corresponde al año
donde el huracán Jova provocó fuertes inundaciones en
la región. Actualmente, en este cuerpo de agua no es
posible realizar el cultivo en jaulas de tilapia que por
Cultivo de camarón
2
2
3
3
2
2
2
2
Media
Cultivo de tilapia
3
5
4
4
3
4
4
5
Alta
más de 15 años se realizó exitosamente, debido a la
gran abundancia del pez diablo y al incremento en la
población de caimanes. Este mismo efecto se
incrementa en la Laguna de Alcuzahue, por efecto de
interconexión de canales de riego e inundación del
municipio de Tecomán con mayor número de granjas
para cultivo de camarón.
Igualmente durante el huracán Jova, se reportaron
lluvias máximas, de gran abundancia por 24 h, de 374,4
mm en Coquimatlán, siendo la mayor precipitación a
nivel nacional durante el 2011 (Servicio Meteorológico
Nacional, 2011). Además, las características fisiográficas de la superficie del Estado de Colima hacen
que las zonas con mayores probabilidades de
huracanes, sean las poblaciones de los municipios de
Tecomán, Armería y Manzanillo, mismas que han sido
históricamente afectadas por este tipo de fenómenos
(Padilla-Lozoya, 2007). Independientemente de las
características ambientales/fisiográficas, y considerando los rasgos socioeconómicos de los sub-sectores
referidos por Rivera-Arriaga et al. (2010) se observó
una marcada diferencia en cuanto a niveles de
adecuación, siendo el sector tilapia el más vulnerable
respecto al sector camarón (Tabla 2), sobre todo en lo
relacionado con la carencia de infraestructura necesaria
para el procesamiento del producto, tales como plantas
de luz, maquinaria, congeladores, así como la
comercialización vía cosecha y preparación para el
consumo, lo que limita su capacidad de diversificar y
comercializar el producto.
De acuerdo a los esquemas de riesgo y factores de
vulnerabilidad identificados en el Estado de Colima, se
identificó como principal factor la incidencia de
huracanes y/o lluvias intensas. En el caso particular de
sistemas salobres y marinos se considera necesario
implementar un esquema para disminuir descargas de
contaminantes orgánicos e inorgánicos. Adicionalmente, debe existir una mayor restricción al
otorgamiento de permisos para cultivo en cuerpos de
agua de influencia marina. Respecto a la actividad
acuícola en aguas interiores, es imperativa la necesidad
de delimitar zonas con potencial de riesgo y en su caso
proyectar obras ingenieriles de protección; se requiere
instrumentar un programa de reconversión tecnológico
para el uso integral del pez diablo, y la implementación
de medidas de control para su confinamiento en los
cuerpos ya existentes, así como la creación de una
unidad de manejo para el cocodrilo de pantano y evitar
su extensión a ambientes lagunares con potencial
acuícola; es necesario implementar un programa de
reconversión tecnológica basado en sistemas
alternativos de uso eficiente del agua como sería el caso
de sistemas de recirculación, paralelo a un plan de
tecnologías alternas para el cultivo de especies
(preferentemente endémicas) con mayor resistencia a la
variabilidad ambiental y que a su vez, no representen
riesgos al ambiente y la biodiversidad. Finalmente, se
debe implementar tecnologías alternas de la reversión
sexual por compuestos hormonales para la producción
de tilapia monosexo, como el sexado manual y cultivo
de supermachos.
AGRADECIMIENTOS
Este estudio fue realizado dentro del proyecto:
“Estrategia regional para reducir la vulnerabilidad y
mejorar la capacidad de adaptación al Cambio
Climático, en la región occidente de México”, que
recibió financiamiento del FORDECYT, mediante el
convenio 174538.
655
REFERENCIAS
Anguiano-Cuevas, J.R., A. Olivos-Ortiz, O. Cervantes, I.
Azuz-Adeath, N. Ramírez-Álvarez, M.C. RiveraRodríguez. 2015. Evaluation of trophic state in the
Palo Verde Estuary (Colima, México), action to
regulating agricultural activities. J. Integr. Coast. Zone
Manage., 15(4): 507-522.
Barsley, W., C. De Young & C. Brugère. 2013.
Vulnerability assessment methodologies: an annotated
bibliography for climate change and the fisheries and
aquaculture sector. FAO Fish. Aquacult. Circ., 1083,
Rome, 43 pp.
Cabrera, L.B.A. 2009. Implicaciones del cambio de uso de
suelo en la biodiversidad de los matorrales xerófilos:
un enfoque multiescalar. Invest. Amb. Cienc. Polit.
Pub., 1(1): 6-16.
Castillo-Soriano, F.A., V. Ibarra-Junquera, A. OlivosOrtiz, F.J. Barragan-Vasquez & A.O. Meyer-Willerer.
2011. Influence of water supply chemistry on white
shrimp (Litopenaeus vannamei) culture in low-salinity
and zero water exchange ponds. Pan. Am. J. Aquatic.
Sci., 5(3): 376-386.
Centro Nacional de Prevención de Desastres (CENAPRED). 2007. Riesgos hidrometeorológicos. Ciclones
tropicales y huracanes. Gobierno de México. [http://
www.cenapred.unam.mx]. Revisado: 23 septiembre
2015.
Cochrane, K., C. De Young, D. Soto & T. Bahri. 2009.
Climate change implications for fisheries and
aquaculture. FAO Fish. Aquacult. Tech Pap., 530,
Rome, 212 pp.
Constantino, T., M. Roberto, I. Dávila & R. Hilda. 2011.
Una aproximación a la vulnerabilidad y la resiliencia
ante eventos hidrometeorológicos extremos en
México. Polit. Cult., 36: 15-44.
Edwards, P. 2015. Aquaculture environment interactions:
past, present and likely future trends. Aquaculture,
447: 2-14
Espinoza-Gómez, F.J., I. Arredondo-Jiménez, A.
Maldonado-Rodríguez, C. Pérez-Rentería, Ó.A.
Newton-Sánchez, E. Chávez-Flores & E. GómezIbarra. 2013. Distribución geográfica de mosquitos
adultos (Diptera: Culicidae) en áreas selváticas de
Colima, México. Rev. Mex. Biodivers., 84(2): 685689.
Ficke, A.D., C.A. Myrick & L.J. Hansen. 2007. Potential
impacts of global climate change on freshwater
fisheries. Rev. Fish Biol. Fish., 17(4): 581-613.
Food and Agriculture Organization (FAO). 2008.
Perspectivas alimentarias. [http://www.fao.org/docrep/010/ai466e/ai466e00.htm]. Revisado: 21 septiembre
2015.
656
Flores-Nava, A. 2010. Una reflexión sobre el impacto del
cambio climático en las actividades acuícolas costeras
de México. Universidad Autónoma de Campeche,
CETY-S Universidad, Gobierno del Estado de
Campeche, pp. 319-334.
Fracchia-Durán, A. & M.A. Liñán-Cabello. 2013. Diversificación y desarrollo sustentable de la acuicultura en
Colima. Uso de un modelo multicriterio para la
diversificación y manejo sostenible de la acuicultura:
caso de estudio. Editorial Académica Española,
Saarbruken, Deutschland/Alemania, 357 pp.
Intergovernmental Panel on Climate Change (IPCC).
2001. Climate Change 2001: the scientific basis.
Houghton, J.T., Y. Ding, D.J. Griggs, M. Noguer, P.J.
van der Linden, X. Dai, K. Maskell & C.A. Johnson
(eds.). Contribution of Working Group I to the Third
Assessment Report of the Intergovernmental Panel on
Climate Change. Cambridge University Press,
Cambridge, 881pp.
Instituto Nacional Electoral (INE). 2006. México. Tercera
comunicación nacional ante la convención marco de
las naciones unidas sobre el cambio climático, INESEMARNAT, México, 208 pp.
Instituto Nacional de Ecología y Cambio Climático
(INECC). 2015. [http://www2.inecc.gob.mx/cclimatico/edo_sector/estados/amenaza_colima. html]. Revisado: 18 septiembre 2015.
Instituto Nacional de Estadística, Geografía e Informática
(INEGI). 2009. Boletín de los sistemas estadísticos y
de información geográfica. Aguascalientes, 2(3): 62
pp.
Instituto Nacional para el Federalismo y el Desarrollo
Municipal (INAFED). 2010. [http://www.inafed.gob.
mx/]. Revisado: 25 agosto 2015.
Magaña V., J. Matías-Méndez, R. Morales & C. Millán.
2004. Consecuencias presentes y futuras de la
variabilidad del cambio climático en México. In: J.
Martínez & A. Fernández. Cambio climático: una
visión desde México. Instituto Nacional de Ecología.
Secretaría de Medio Ambiente y Recursos Naturales,
Ciudad de México, pp. 204-213.
Magaña, V. (ed.). 1999. Los impactos de El Niño en
México. Universidad Autónoma de México y la
Secretaría de Gobernación, México, 229 pp.
Marcogliese, D.J. 2001. Implications of climate change
for parasitism of animals in the aquatic environment.
Can. J. Zool., 79(8): 1331-1352.
Miranda, I., J.L. Valles, R. Sánchez & Z. Álvarez, 2010.
Cultivo del camarón marino Litopenaeus vannamei
(Boone, 1931) en agua dulce. Rev. Cient., 20(4): 339346.
Received: 12 December 2015; Accepted: 9 April 2016
Padilla-Lozoya, R.P. 2007. El huracán del 59: historia del
desastre y reconstrucción de Minatitlán, Colima.
Editor UCOL, 180 pp.
Phelps, R. & T.J. Popma. 2000. Sex reversal of tilapia. In:
B.A. Costa-Pierce & J.E. Rakocy (eds.). Tilapia
aquaculture in the Americas. The World Aquaculture
Society, Baton Rouge, Louisiana, 2: 34-59.
Rivera-Arriaga, E. & I.A. Azuz-Adeath. 2010. La
gobernanza de las costas y océanos de México en un
clima cambiante. Cambio climático en México: un
enfoque costero y marino. Elementos ambientales para
tomadores de decisiones, Universidad Autónoma de
Campeche-CETyS-Universidad-Gobierno del Estado
de Campeche, Campeche, pp. 739-772.
Secretaria de Agricultura, Ganadería, Desarrollo Rural,
Pesca y Alimentación (SAGARPA). 2013. Programa
de apoyo a la inversión en equipamiento e infraestructura. Evaluación Estatal del funcionamiento y
la operación 2012, en el Estado de Colima. [http://
www.sagarpa.gob.mx/Delegaciones/colima/Docume
nts/Matrices%20de%20Indicadores/MIR%202013/Ev
aluaci%C3%B3n%20%20PAIEI%202012%20Colima.pd
f]. Revisado: 19 septiembre 2015.
Secretaria de Agricultura, Ganadería, Desarrollo Rural,
Pesca y Alimentación-Comisión Nacional de Acuacultura y Pesca (SAGARPA-CONAPESCA). 2013.
Anuario Estadístico de Pesca y Acuicultura. [http://
www.conapesca.sagarpa.gob.mx/wb/cona/cona_an
uario_estadistico_de_pesca].
Revisado:
21
septiembre 2015.
Seingier, G., I. Espejel, J.L. Fermán & O. Delgado. 2010.
Vulnerabilidad de las poblaciones costeras ante la
peligrosidad natural, enfoque estatal y municipal. In:
E. Rivera-Arriaga, I. Azuz-Adeath, L. Alpuche-Gual
& G.J. Villalobos-Zapata. (eds.). Cambio climático en
México, un enfoque costero y marino. Universidad
Autónoma de Campeche, Cetys-Universidad, Gobierno del Estado de Campeche, pp. 669-688.
Servicio Meteorológico Nacional. 2011. Reporte del clima
en México. Reporte anual, CONAGUA, México, 16
pp.
Secretaría de Salud México (SSA). 2001. Programa de
acción: enfermedades transmitidas por vector. Secretaría de Salud, México D.F., 74 pp.
Swing, T.G. 2003. What future for the oceans? New York,
USA. Foreign Affairs September-October, pp.139-52.
Vivanco-Aranda, M., F.J. Mojica & F.J. MartínezCordero. 2011. Foresight analysis of tilapia supply
chains (Sistema Producto) in four states in Mexico:
scenarios and strategies for 2018. Technol. Forecast.
Soc. Change, 78(3): 481-497.
Lat. Am. J. Aquat. Res., 44(3): 657-661, 2016 Size at maturity of Brotula clarkae in Costa Rica
657
Short Communication
Size at maturity of the Pacific bearded brotula (Ophidiidae: Brotula clarkae):
a commercially exploited species in the Pacific of Costa Rica
Marcela Herrera1,2, Tayler M. Clarke1,2, Beatriz Naranjo-Elizondo1,2
Mario Espinoza1,2,3 & Ingo S. Wehrtmann1,2
1
Unidad de Investigación Pesquera y Acuicultura (UNIP) of the Centro de Investigación en Ciencias del Mar
y Limnología (CIMAR), Universidad de Costa Rica, San José, Costa Rica
2
Escuela de Biología, Universidad de Costa Rica, San José, Costa Rica
3
Centre for Sustainable Tropical Fisheries and Aquaculture, School of Earth and Environmental Sciences
James Cook University, Townsville, Australia
Corresponding author: Marcela Herrera (marcela.herrerasarrias@kaust.edu.sa)
ABSTRACT. The deep-water shrimp fishery is of great commercial importance along the Pacific coast of Latin
America. In Costa Rica, shrimp resources have declined considerably over the last decade. Therefore, fisheries
have shifted towards teleost species such as the Pacific bearded brotula Brotula clarkae. Little is known about
the biology and life history of this species, which is becoming increasingly valuable to artisanal and semiindustrial fishers in Costa Rica. A sample of 348 B. clarkae was obtained along the Pacific coast of Costa Rica
between March 2011 and July 2012 to obtain baseline information of this species. The results revealed that the
size at sexual maturity of B. clarkae was 71.9 cm TL, considerably higher than previously reported for South
American populations. Since the size at maturity may vary between populations in different geographic
locations, detailed information of the reproductive biology of widely distributed species such as B. clarkae is
critical for developing effective management approaches.
Keywords: Brotula clarkae, size at maturity, reproductive aggregations, latitudinal variation, Eastern Tropical
Pacific, Costa Rica.
Talla de madurez sexual del congrio rosado (Ophidiidae: Brotula clarkae): una especie
de importancia comercial en el Pacífico de Costa Rica
RESUMEN. La pesca de camarón de aguas profundas es de gran importancia comercial en la costa Pacífica de
Latinoamérica. En Costa Rica, el recurso camarón ha disminuido considerablemente durante la última década.
Como consecuencia, la pesquería ha comenzado a explotar otras especies como, el congrio rosado Brotula
clarkae. Poco se sabe de la biología de esta especie con valor comercial en las pesquerías artesanales e
industriales de Costa Rica. Una muestra de 348 B. clarkae fue obtenida a lo largo de la costa Pacífica de Costa
Rica entre marzo 2011 y julio 2012 para obtener información base de esta especie. La talla de madurez sexual
fue 71.9 cm TL, siendo considerablemente mayor que la reportada previamente para poblaciones de Sudamérica.
Dado que la talla de madurez sexual puede variar entre poblaciones de diferentes áreas geográficas, información
acerca de la biología reproductiva de una especie tan ampliamente distribuida es crucial para diseñar estrategias
adecuadas de manejo.
Palabras clave: Brotula clarkae, talla de madurez sexual, agregaciones reproductivas, variación latitudinal,
Pacífico Tropical Oriental, Costa Rica.
The Pacific bearded brotula, Brotula clarkae Hubbs,
1944, is endemic to the Eastern Tropical Pacific and
occurs from Palos Verdes, California to Paita, Peru
__________________
(Lea et al., 2009). The species inhabits soft mud
bottoms as adults, and epipelagic waters as juveniles. It
can be found at depths between 40 and 650 m (Nielsen
658
et al., 1999). Juvenile B. clarkae feeds on shrimps and
crabs, while the diet of adults is mainly composed of
teleosts and stomatopods (Muñoz, 1999; Peña, 2003;
Naranjo-Elizondo et al., 2016), echinoderms and
mollusks (Chávez-Cevallos & Caballero-Vergara,
2008).
Populations of the commercially exploited deepwater shrimps Heterocarpus vicarius (Decapoda:
Caridea: Pandalidae) and Solenocera agassizzii
(Decapoda: Penaeoidea: Solenoceridae) have declined
considerably over the past 10 years (Wehrtmann &
Nielsen-Muñoz, 2009; Villalobos-Rojas & Wehrtmann,
2011; Wehrtmann et al., 2012). Consequently, the fleet
has shifted their effort towards shallow-water resources.
Brotula clarkae, locally known as “congrio rosado”, is
one of the species that has recently become an
important target of the shrimp-trawling fishery in Costa
Rica and the Central American region (R. Villalobos,
pers. obs.).
Despite its increasing commercial importance, both
for commercial and artisanal fishers in Costa Rica,
basic biological and ecological data on B. clarkae is
limited (Espinoza & Nielsen, 2006; Naranjo-Elizondo
et al., 2016). In fact, the International Union for
Conservation of Nature (IUCN) lists the species as data
deficient (Lea et al., 2010). Moreover, the few studies
available on the species’ reproductive biology are
restricted to Colombia (Acevedo et al., 2007) and
Ecuador (Chávez-Cevallos & Caballero-Vergara,
2008) in South America. The present study estimated
the size at first maturity of B. clarkae along the Pacific
coast of Costa Rica. The size at maturity is a key
population parameter and a valuable tool for managing
this species both locally and regionally. This information can be used to develop management measures,
such as regulations for size restrictions, catch quotas
and size selectivity of fishing gear (i.e., to minimize the
capture of individuals that have not reached sexual
maturity).
Samples of B. clarkae were collected between
March 2011 and July 2012 as part of an ongoing shrimp
fishery-monitoring program conducted along the
Pacific continental shelf of Costa Rica (Fig. 1).
Specimens were sexed, measured (total length - TL,
cm), and weighed (total weight - TW, g) (Bussing &
López, 1993; Allen & Robertson, 1994). Sex and
maturity stage were assessed based on macroscopic
observations of the reproductive tract (Brown-Peterson
et al., 2011). Males were classified as immature when
the testes were thread-like and transparent, smooth and
uniformly textured. When mature, testes were large,
firm, highly convoluted, and during the spawning
season, extruded sperm when compressed. Females
were classified as immature when the ovaries were
small, clear, and lacking conspicuous blood vessels;
mature females had large and pink ovaries with
extensive vascularization of the ovary wall. During the
spawning season, ovaries had a granular texture and
were full of eggs.
The size at first sexual maturity was defined as the
size at which 50% of the individuals matured. Size at
maturity was estimated by fitting a logistic regression
(-a/b) (Conrath, 2005). The proportion of mature
individuals in each 2 cm class intervals was fitted using
the following equation:
where TL is the total length, a is the intercept and b is
the slope (Conrath, 2005). However, due the insufficient number of samples of each sex, size at maturity
could not be calculated for males and females
separately. Size differences between males and females
were examined by plotting the relationship between TL
and TW. A Student t-test was subsequently applied to
corroborate possible differences between slope values
of both sexes. If no differences were detected, the size
at maturity was estimated for both sexes together.
From the 348 B. clarkae collected, 42% of the
individuals were males, 40% females, and 18% were
undetermined. Size of males ranged from 14.4 to 92.8
cm TL (mean ± SD; 33.7 ± 17.7), and from 14.5 to 93.0
cm TL (mean ± SD; 30.9 ± 15.7) for females. Immature
individuals (n = 302, 87%) varied in size from 14.4 to
76.3 cm TL (mean ± SD; 33.3 ± 14.6), and mature
individuals from 67.2 to 98.4 cm TL (mean ± SD; 82.2
± 7.8). The relationship between TL and TW was similar
for both males and females (t-test = 0.098, P = 0.922)
(Fig. 2a). Size at maturity for B. clarkae was estimated
at 71.9 cm TL (68.5-74.5) (Fig. 2b).
Acevedo et al. (2007) reported a size at maturity for
B. clarkae from the Pacific of Colombia of 62.3 cm TL
(60.7-63.8), which is substantially lower than our
estimate (71.9 cm TL). It has been demonstrated that life
history traits, such as age and size at maturity,
longevity, fecundity, and egg size can change with
prolonged periods of exploitation (Rochet, 1998; Law,
2000; Hutchings, 2002). Significant reductions in age
and length at maturity have been found in different fish
stocks (see reviews by Kuparinen & Merila, 2007;
Sharpe & Hendry, 2009). Examples of such changes of
life history traits include the Pacific Salmon
(Oncorhynchus sp.; Ricker, 1981), the North Sea plaice
(Pleuronectes platessa; Rijinsdorp, 1993), Northwest
Atlantic cod (Gadus morhua; Hutchings, 2005), and the
Scotian shelf haddock (Melanogrammus aeglefinus;
Neuheimer & Taggart, 2010). In most of these cases,
the authors attributed these changes to a genetic
response to fishing pressure. Brotula clarkae has been
exploited for almost 20 years in Colombia (Acevedo et
Size at maturity of Brotula clarkae in Costa Rica
659
Figure 1. Trawling locations sampled between March 2011 and July 2012 along the Pacific coast of Costa Rica. Depth
contours of 50, 200 and 500 m are given.
Figure 2. a) Total weight and total length relationship of Brotula clarkae (n = 318); b) estimate of size at maturity of B.
clarkae
Histograms display the sample size structure (n = 328).
al., 2007), while in Costa Rica this species has only
recently become a valuable resource (R. Villalobos,
pers. obs.). Therefore, these differences in size at
maturity between geographically distinct populations
might be interpreted as an indicator of an early
exploitation stage of the B. clarkae population in Costa
Rica.
Age and size at sexual maturity can vary between
and within populations because of genotypic and
environmental differences between regions (Morgan &
Colbourne, 1999; Morgan, 2008). These variations in
maturity schedules have been associated with
differences in abundance, growth and mortality rates,
fishing pressure, and selectivity of fishing gear
(Morgan, 2008; Jorgensen et al., 2009). At low
population sizes, fish growth rates increase in response
to the large abundance of available resources, and
therefore mature at younger ages. Likewise, higher
660
mortality rates can cause a selective pressure towards
younger maturation ages (Morgan & Colbourne, 1999).
Latitudinal clines in size at maturity have been
previously reported in several fish species (Heibo et al.,
2005; Lassalle et al., 2008; Chavarie et al., 2010).
Therefore, a single report of the size at maturity of such
a widely distributed species as B. clarkae should not be
used to recommend broader management strategies
throughout the distribution range of the species.
The vast majority of the specimens obtained in our
study were immature individuals of B. clarkae (Fig.
2b). Although this species inhabits deep-waters of up to
650 m deep (Nielsen et al., 1999), seasonal
reproductive aggregations have been observed to occur
in shallow waters, where they are commercially
exploited (Clarke et al., 2011). It is likely that the high
number of immature individuals captured was during
these aggregations, but also due to the non-selectivity
of the fishing gear. Jorgensen et al. (2009) stated that
size selectivity has important evolutionary effects in
fisheries as fish that survive pass on their genes to the
next generation, then having consequences for the size
structure and dynamics of the exploited stocks. For
example, trawl-like gears, which are primarily sizeselective and remove large fish, tend to select for earlier
maturation at smaller size and faster growth (Boukal et
al., 2008). Gear that only remove fish within a certain
size class, such as gillnets, can instead lead to delayed
maturation (Boukal et al., 2008). This highlights how
the regulation of gear selectivity is critical for fisheries
management.
Further studies on the reproductive ecology of B.
clarkae should focus on analyzing spatial and temporal
aggregation patterns, as well as identifying essential
habitats and spawning seasons. Since B. clarkae is
currently being targeted by both commercial and
artisanal fisheries in the Pacific of Latin America
(Puentes et al., 2007; Pro-Ecuador, 2013), including
Costa Rica, an adequate knowledge of its distribution
and reproductive ecology must be addressed in future
studies to achieve sustainable exploitation levels.
ACKNOWLEDGEMENTS
This study was possible by a partnership between the
Unidad de Investigación Pesquera y Acuicultura
(UNIP-CIMAR, Universidad Costa Rica) and The
Rainbow Jewels S.A. (Puntarenas, Costa Rica). We are
grateful to the captain Rigoberto Villalobos and the
crew of the ONUVA for their collaboration. We thank
Jaime Nivia and Juliana Herrera for their fieldwork
assistance, and to Fabricio Vargas, Juan Sebastian
Vargas, Natalia Sandoval, Vivian Sanabria and Juan
Carlos Azofeifa for their collaboration with the analysis
of the samples. ISW was supported by funds from the
Universidad de Costa Rica (VI project N° 808-B0-536;
111-A4-508), ME acknowledges funds received by the
Consejo Nacional de Ciencia y Tecnología (CONICIT),
and MH is thankful to IDEA WILD for field
equipment.
REFERENCES
Acevedo, J., W. Angulo, M. Ramírez & L.A. Zapata.
2007. Reproduction of the fish Brotula clarkae
(Pisces: Ophidiidae) in the Colombian Pacific. Rev.
Biol. Trop., 55(3-4): 957-967.
Allen, G.R. & D.R. Robertson. 1994. Fishes of the
Tropical Eastern. Pacific University of Hawaii Press,
Honolulu, 332 pp.
Boukal, D.S., E.S. Dunlop, M. Heino & U. Dieckmann.
2008. Fisheries-induced evolution of body size and
other life history traits: the impact of gear selectivity.
ICES CM2008/F:07.
Brown-Peterson, N., D. Wyanski, F. Saborido-Rey, B.
Macewicz & S. Lowerre-Barbieri. 2011. Standardized
terminology for describing reproductive development
in fishes. Mar. Coast. Fish., 3(1): 52-70.
Bussing, W. & M. López. 1993. Peces demersales y
pelágicos costeros del Pacífico de Centro América
Meridional. Guía ilustrada. Publ. Esp. Rev. Biol.
Trop., San José, 164 pp.
Chavarie, L., J.B. Dempson, C.J. Schwarz, J.D. Reist, G.
Power & M. Power. 2010. Latitudinal variation in
growth among Arctic charr in eastern North America:
evidence for counter gradient variation? Hydrobiologia, 650: 161-177.
Chávez-Cevallos, J.M. & J.A. Caballero-Vergara. 2008.
Análisis del contenido gastrointestinal de la corvina de
roca (Brotula clarkae, Hubbs, 1994) desembarcados
en la Playa de Tarqui, Cantón Manta, Provincia de
Manabí. Tesis de Grado, Universidad Laica Eloy
Alfaro de Manabí, Manta, 84 pp.
Clarke, T., M. Espinoza, F. Villalobos & I.S. Wehrtmann.
2011. Summary of demersal elasmobranch studies in
the continental platform of the Pacific of Costa Rica
with management and conservation strategies. Tech.
Rep. CIMAR, MAR VIVA, CI, San José, 12 pp.
Conrath, C. 2005. Reproductive biology. In: J. Musick &
R. Bonfil (eds.). Management techniques for
elasmobranch fisheries. FAO Fish. Tech. Pap., 474:
103-126.
Espinoza, M. & V. Nielsen. 2006. Especies comerciales.
I. Peces. In: V. Nielsen-Muñoz & M.A. QuesadaAlpízar (eds.). Ambientes marinos costeros de Costa
Rica. Comisión Interdisciplinaria Marino Costera de la
Zona Económica Exclusiva de Costa Rica, Informe
Técnico. CIMAR, CI, TNC, San José, pp. 87-104.
Size at maturity of Brotula clarkae in Costa Rica
Heibo, E., C. Magnhagen & L.A. Vollestad. 2005.
Latitudinal variation in life-history traits in Eurasian
perch. Ecology, 86(12): 3377-3386.
Hutchings, J.A. 2002. Life histories of fish. In: P.J.B. Hart
& J.D. Reynolds (eds.). Handbook of fish biology and
fisheries. Vol. 1. Fish biology. Blackwell, Oxford, pp.
149-174.
Hutchings, J.A. 2005. Life history consequences of
overexploitation to population recovery in Northwest
Atlantic cod (Gadus morhua). Can. J. Fish. Aquat.
Sci., 62: 824-832.
Jorgensen, C., B. Ernande & O. Fiksen. 2009. Sizeselective fishing gear and life history evolution in the
Northeast Arctic cod. Evol. Appl., 2: 356-370.
Kuparinen, A. & J. Merila. 2007. Detecting and managing
fisheries-induced evolution. Trends Ecol. Evol.,
22(12): 652-659.
Lassalle, G., T. Trancart, P. Lambart & E. Rochard. 2008.
Latitudinal variations in age and size at maturity
among allis shad Alosa alosa populations. J. Fish.
Biol., 73: 1799-1809.
Law, R. 2000. Fishing, selection, and phenotypic
evolution. ICES J. Mar. Sci., 57: 659-669.
Lea, R.N., M.J. Allen & W. Power. 2009. Records of the
Pacific bearded brotula, Brotula clarkae, from
Southern California. Bull. South. Calif. Acad. Sci.,
108(3): 163-167.
Lea, B., P. Béarez & J. McCosker. 2010. Brotula clarkae.
The IUCN Red List of Threatened Species. Version
2014.3. [http://www.iucnredlist.org/details/183970/0].
Reviewed: 30 March 2015.
Morgan, M.J. 2008. Integrating reproductive biology into
scientific advice for fisheries management. J. Northwest. Atl. Fish. Sci., 41: 37-51.
Morgan, M.J. & E.B. Colbourne. 1999. Variation in
maturity-at-age and size in three populations of
American plaice. ICES J. Mar. Sci., 56: 673-688.
Muñoz, O.F. 1999. Aspectos de la biología (crecimiento,
hábitos alimenticios y reproducción) de Brotula
clarkae (Pises: Ophidiidae) en el PNN Gorgona,
Colombia. Tesis de grado, Universidad del Valle, Cali,
60 pp.
Naranjo-Elizondo, B., M. Espinoza, M. Herrera, T.M.
Clarke & I.S. Wehrtmann. 2016. Feeding habits of the
Pacific bearded brotula Brotula clarkae Hubbs, 1944
(Ophidiidade) along the Pacific coast of Costa Rica,
Central America. J. App. Ichtyol., 32(3): 439-447.
Doi: 10.1111/ jai.13029.
Received: 3 April 2015; Accepted: 5 May 2016
661
Neuheimer, A.B. & C.T. Taggart. 2010. Can changes in
length-at-age and maturation timing in Scotian Shelf
haddock (Melanogrammus aeglefinus) be explained
by fishing? Can. J. Fish. Aquat. Sci., 67(5): 854-865.
Nielsen, J.G., D.M. Cohen, D.F. Markle & C.R. Robins.
1999. FAO species catalogue. Ophidiiform fishes of
the world (Order Ophidiiformes). An annotated and
illustrated catalogue of pearlfishes, cusk-eels, brotulas
and other ophidiiform fishes known to date. FAO Fish.
Synop., 125(18): 178 pp.
Peña, I.I. 2003. Aspectos reproductivos y ecología trófica
de Lutjanus argentiventris, Lutjanus guttatus (Pisces:
Lutjanidae) y Brotula clarkae (Pisces: Ophidiidae) en
el Parque Nacional Gorgona (Pacífico colombiano).
Tesis de grado, Universidad del Valle, Cali, 138 pp.
Pro-Ecuador (Instituto de Promoción de Exportaciones e
Inversions). 2013. Análisis del sector pesca. [http://
www.proecuador.gob.ec/wpcontent/uploads/2013/11/
PROEC_AS2013_PESCA.pdf]. Reviewed: 30 March
2015.
Puentes, V., N. Madrid & L.A. Zapata. 2007. Catch
composition of the deep-sea shrimp fishery
(Solenocera agassizi Faxon, 1983; Farfantepenaeus
californiensis Holmes, 1900 and Farfantepenaeus
brevirostris Kingsley, 1878) in the Colombian Pacific
Ocean. Gayana, 71(1): 84-95.
Ricker, W.E. 1981. Changes in the average size and
average age of Pacific salmon. Can. J. Fish. Aquat.
Sci., 38: 1636-1656.
Rijinsdorp, A.D. 1993. Fisheries as a large-scale
experiment on life-history evolution: disentangling
phenotypic and genetic effects in changes in
maturation and reproduction of North Sea plaice,
Pleuronectes platessa. Oecologia, 96: 391-401.
Rochet, M.J. 1998. Short-term effects of fishing on life
history traits of fishes. ICES J. Mar. Sci., 55: 371-391.
Sharpe, D.M.T. & A.P. Hendry. 2009. Life history change
in commercially exploited fish stocks: an analysis of
trends across studies. Evol. Appl., 2(3): 260-275.
Villalobos-Rojas, F. & I.S. Wehrtmann. 2011. Gonad
development in the commercially exploited deepwater shrimp Solenocera agassizii (Decapoda:
Solenoceridae) from Pacific Costa Rica, Central
America. Fish. Res., 109(1): 150-156.
Wehrtmann, I.S. & V. Nielsen-Muñoz. 2009. The deepwater fishery along the Pacific coast of Costa Rica,
Central America. Lat. Am. J. Aquat. Res., 37(3): 543554.
Wehrtmann, I.S., P.M. Arana, E. Barriga, A. Gracia &
P.R. Pezzuto. 2012. Deep-water shrimp fisheries in
Latin America: a review. Lat. Am. J. Aquat. Res.,
40(3): 497-535.

Full article - Latin American Journal of Aquatic Research

Transcription

Similar documents

paraguay biodiversity paraguay biodiversität

escapulario?

Senhores - Bass fishing trips at Amazing Lake El Salto Mexico by

Nivel 2 - Aspectos Culturales

Evangelizando el Mundo Evangelizing the World

FALL 2006 149 II Festival Internacional de Artes