7th Poultry Days - Uniwersytet Rolniczy w Krakowie

University of Agriculture in Krakow
Faculty of Animal Sciences
International Conference
on Biotechnology and Welfare in Animal Science
with a session on „7th Poultry Days”
Krakow • 23–24 June 2016
Editor-in-Chief
Prof. dr hab. inż. Józef Bieniek
Scientific Committee
Chairman
Prof. dr hab. Czesław Klocek
Dean of Faculty of Animal Sciences, University of Agriculture in Krakow
Members:
Prof. Arieh Gertler, The Hebrew University of Jerusalem, Israel
Prof. dr hab. Eugeniusz Herbut, National Research Institute of Animal Production in Krakow, Poland
Prof. dr hab. Roman Kołacz, Wroclaw University of Environmental and Life Sciences, Poland
Prof. Jerzy Niedziółka, University of Agriculture in Krakow, Poland
Prof. Marek Spinka, Institute of Animal Science in Prague, Czech Republic
Prof. dr hab. Dorota A. Zięba, University of Agriculture in Krakow, Poland
Organizing Committee
Chairman
Dr hab. Piotr Micek, prof. UR
Vice Dean for Organisation and Development of Faculty of Animal Sciences, University of Agriculture in Krakow
Members:
Dr hab. inż. Marcin Lis (Secretary), University of Agriculture in Krakow, Poland
Dr Krzysztof Andres, University of Agriculture in Krakow, Poland
Dr inż. Jadwiga Flaga, University of Agriculture in Krakow, Poland
Dr inż. Małgorzata Gumułka, University of Agriculture in Krakow, Poland
Mgr Beata Majka, University of Agriculture in Krakow, Poland
Dr inż. Katarzyna Kirsz, University of Agriculture in Krakow, Poland
Dr inż. Stanisław Łapiński, University of Agriculture in Krakow, Poland
Dr inż. Ewa Ocłoń, University of Agriculture in Krakow, Poland
Dr hab. Krzysztof Pawlak, University of Agriculture in Krakow, Poland
The organizers are not responsible for the content of reports
Pre-press preparation
Publishing House of the University of Agriculture in Krakow
Cover design
Katarzyna Kirsz
ISBN 978-83-64758-38-6
Publishing House of the University of Agriculture in Krakow
31-425 Kraków, al. 29 Listopada 46
tel. (12) 662 51 57, 662 51 59
e-mail: wydawnictwo@ur.krakow.pl
www.wydawnictwo.ur.krakow.pl
Patronat Honorowy
Krzysztof Jurgiel – Minister Rolnictwa i Rozwoju Wsi
Jacek Krupa – Marszałek Województwa Małopolskiego
prof. dr hab. Włodzimierz Sady – Rektor Uniwersytetu Rolniczego w Krakowie
Partnerzy Konferencji
Miasto Kraków
Polski Oddział Światowego Stowarzyszenia Wiedzy Drobiarskiej
Krajowa Rada Drobiarstwa – Izba Gospodarcza w Warszawie
Patronat Medialny
Mecenat
Sponsorzy
Table of contents
Plenary papers...............................................................................................................................................................................
13
Invited lectures
Arieh Gertler
Resistin/adiponectin/FGF21/palmitic acid interplay in SH-SY5Y neural cells and DIO rodents:
a novel mechanism contributing to insulin resistance......................................................................................................
15
Roman Kołacz
Aktualne problemy dobrostanu drobiu • Current problems of poultry welfare............................................................
16
Andrzej Sechman, Piotr A. Antos, Dorota Katarzyńska, Anna Hrabia
Chicken ovary – a place of dioxin and polychlorinated biphenyl detoxification ..........................................................
21
Session 1. Animal welfare and product quality .......................................................................................................................
23
Plenary lectures
Piotr SJ Sowinski
Roles, tasks and responsibilities of the Designated Veterinarian under Directive 2010/63/EU..................................
25
Paweł Paraponiak
Fatty acid profile of lamb meat from highly productive breeds of sheep reared under organic conditions ..............
27
Presentations
Victoria I. Borodulina, N.A. Sadomov
The influence of mycotoxin’s adsorbent of new generation “Funginorm” on the productivity of fattening pigs......
28
Veronika Čoudková, J. Starý, Miroslav Maršálek
Mycotoxins in dairy cows diet in south-west Bohemia ....................................................................................................
30
Bogusława Długosz, Romana Augustyn, Magdalena Pieszka, Jarosław Łuszczyński, Tomasz Próchniak,
Barbara Jaklińska, Karina Świderska, Zenon Podstawski, Monika Stefaniuk-Szmukier, Weronika Pisarczyk
Selected reproductive indicators for mares of the Hucul Pony breed .............................................................................
31
Ewa Drąg-Kozak, Ewa Łuszczek-Trojnar, Magdalena Socha, Grzegorz Gosiewski, Włodzimierz Popek
Bioaccumulation and elimination of cadmium in tissues of Prussian carp (Carassius gibelio B.) under
controlled conditions.............................................................................................................................................................
33
Jan Dybała, Aleksandra Milewska, Joanna Wiśniewska, Aleksandra Cebulska, Wojciech Kapelański
The analysis of welfare Visayan warty pig (Sus cebifrons) kept in selected zoos............................................................
34
Kinga Fic, Aleksandra Woszczenko, Agnieszka Krzystanek, Natalia Sowińska
The influence of frequency of enrichments replacement on behavior of laboratory guinea pigs ...............................
35
Iwona Guja, Stanisław Łapiński, Piotr Niedbała
Is the fur chewing in animals caused by Slitrk1 gene mutation? .....................................................................................
36
6
Andrzej Kaczor, Urszula Kaczor
Effect of feeding technology on calf behaviour ..................................................................................................................
37
Andrzej Kaczor, Urszula Kaczor
Effect of watering of cows in the milking parlour on their welfare .................................................................................
38
Aldona Kawęcka, Michał Puchała, Anna Miksza-Cybulska
Effect of slaughter age on physicochemical parameters of lamb meat............................................................................
39
Aldona Kawęcka, Jacek Sikora
Effect of housing system on slaughter traits of native Świniarka lambs .........................................................................
40
Aldona Kawęcka, Ewa Sosin-Bzducha
Meat quality in lambs of native breed fed the diet supplemented with maize DDGS ..................................................
41
Agata Kokocińska
The impact of environmental enrichment on exploratory and hunting behavior of laboratory and companion
animals ....................................................................................................................................................................................
42
Stanisław Łapiński, Iwona Guja, Katarzyna Mrozicka, Piotr Niedbała, Viktor A. Ilyukha
Behaviour of Chinchilla lanigera male kept under farm conditions – preliminary studies .........................................
44
Jarosław Łuszczyński, Kinga Dobrzańska, Magdalena Pieszka, Weronika Pisarczyk, Bogusława Długosz,
Romana Augustyn, Zenon Podstawski, Monika Stefaniuk-Szmukier
The differences in the biometric dimensions of the Silesian horses depending on the share of other breeds
blood in their pedigrees .......................................................................................................................................................
45
Elena L. Mikulich
Influence of timely gutting fish on intensity of infection of muscle tissue by the Anisakis larvae .............................
47
Małgorzata Natonek-Wiśniewska, Piotr Krzyścin
The use of PCR and real-time PCR for qualitative and quantitative determination of horse meat ............................
48
Patryk Nowacki, Ewa Łuszczek-Trojnar, Ewa Drąg-Kozak, Magdalena Socha, Włodzimierz Popek
Concentration of heavy metals in increments of common carp’s scales (Cyprinus carpio L.) ....................................
49
Agnieszka Otwinowska-Mindur, Ewa Ptak
The freezing point of milk of Polish Holstein-Friesian cows ...........................................................................................
51
Paweł Paraponiak
Concentration of harmful gas components in organic sheep houses according to the season ...................................
52
Paweł Paraponiak
Variation in lamb behaviour according to the housing system .......................................................................................
53
Magdalena Pieszka, Anna Halek, Jarosław Łuszczyński, Bogusława Długosz, Romana Augustyn,
Monika Stefaniuk-Szmukier, Zenon Podstawski, Weronika Pisarczyk
Characterisation of the population of border collie dogs breed in Poland ....................................................................
54
Zenon Podstawski, Justyna Kądzior, Bogusława Długosz, Romana Augustyn, Monika Stefaniuk-Szmukier,
Magdalena Pieszka, Jarosław Łuszczyński, Weronika Pisarczyk
Characteristics of work of chosen hippotherapy centres in southern Poland ..............................................................
56
Jan B. Pyś, Zygmunt M. Kowalski, Marta Malkiewicz, Jadwiga Flaga, Łukasz Korytkowski, Vanessa Demey
The effect of bacteria addition on the chemical and microbiological composition of the whole plant
corn silage ...............................................................................................................................................................................
58
Jan B. Pyś, Zygmunt M. Kowalski, Marta Malkiewicz, Jadwiga Flaga, Łukasz Korytkowski, Vanessa Demey
The effect of bacteria addition on the fermentation quality and aerobic stability of the whole plant
corn silage ...............................................................................................................................................................................
60
Iwona Radkowska
Changes in some fat parameters during storage of butter made from the milk of cows under two feeding
systems.....................................................................................................................................................................................
61
Iwona Radkowska, Adam Radkowski
Vitamin and cholesterol content of milk depending on type of feeding ........................................................................
62
Adam Radkowski, Iwona Radkowska
Effect of foliar fertilization with silicon on quality and nutritive value of meadow sward silages .............................
63
Adam Radkowski, Iwona Radkowska
Quality and nutritive value of silages made from selected grass-legume mixtures ......................................................
64
Alicja Satoła, Ewa Ptak, Wojciech Jagusiak
Genetic relationship between conformation traits and lactose percentage and urea concentration in milk
of Polish Holstein-Friesian cows ..........................................................................................................................................
65
Ewa Sosin-Bzducha, Michał Puchała
Effect of breed and aging time on physicochemical and organoleptic quality of beef..................................................
66
Petr Tejml, Miloslav Šoch
Effect of litter size on mortality of new born cavies’ youngs ............................................................................................
68
Iwona Tomczyk-Wrona
Effect of herd size on implementation of the genetic resources conservation programme for Hucul horses ...........
69
Iwona Tomczyk-Wrona
Effect of implementing the genetic resources conservation programme on the distribution of Hucul horses
in Poland .................................................................................................................................................................................
71
Michał Tracz, Agnieszka Jackowska-Tracz, Krzysztof Anusz
Polish collection and communication of inspection results system and food chain information system
as tools for welfare improvement at slaughterhouse .........................................................................................................
73
Dorota Wojtysiak, Magdalena Górska, Joanna Wojciechowska
Effect of ageing time on microstructure and tenderness of pig semimembranosus muscle........................................
74
Justyna Żychlińska-Buczek, Edyta Bauer, Andrzej Ochrem, Elżbieta Sowula-Skrzyńska, Grzegorz Skrzyński
The effect of Pedi bolus specimen on the improvement of cows’ hooves health ...........................................................
75
Session 2. Biotechnology and animal models..........................................................................................................................
77
Plenary lectures
Viktor A. Ilyukha, Svetlana N. Sergina, Ekaterina P. Antonova, Evgeny A. Khizhkin, Lyudmila B. Uzenbaeva,
Aleksandra G. Kizhina, Tatiana N. Ilyina, Irina V. Baishnikova, Stanisław Łapiński, Piotr Niedbała,
Marcin W. Lis, Oleg V. Trapezov, Yongping Xu
Fur-bearing animals as the models in biomedical research .............................................................................................
79
Alicja Jozkowicz
Transgenic mice in cancer research .....................................................................................................................................
80
Presentations
Romana Augustyn, A. Pustuła, Bogusława Długosz, Tomasz Próchniak, Magdalena Pieszka,
Jarosław Łuszczyński, Weronika Pisarczyk, Monika Stefaniuk-Szmukier, Zenon Podstawski
Influence endurance workout on selected physiological parameters of Arabian horses .............................................
81
Agnieszka Baranowska, Beata Skowron, Katarzyna Ciesielczyk, Justyna Domagała, Piotr J. Thor
Experimental gender related obesity effect of diet ............................................................................................................
83
Aneta Bocheńska, Agnieszka Pietsch-Fulbiszewska, Natalia Sowińska, Katarzyna Kirsz
Method of positioning the catheter into cisterna magna and fourth ventricle of the brain in sheep .........................
84
Taras Chоkаn, Anna Radko, Serhiy Tarasjuk, Agnieszka Szumiec, Dominika Rubiś
Intrаbreed variability of the Ukrainian Mountain Carpathian sheep genetic structure under using
of the different types of molecular genetic markers ..........................................................................................................
85
Jarosław Chyb, Gabriela Cora, Piotr Lisowski, Magdalena Socha, Mirosława Sokołowska-Mikołajczyk
The influence of orexin B on spontaneous and GnRH-stimulated LH secretion from dispersed pituitary
cells of female Prussian carp.................................................................................................................................................
86
Iwona Dobosz, Katarzyna Knapczyk-Stwora
Prenatal exposure to anti-androgen alters expression of transcription factor forkhead L2 (Foxl2)
in the fetal porcine ovaries ....................................................................................................................................................
87
7
Ewelina Górowska-Wójtowicz, Laura Pardyak, Alicja Kamińska, Anna Hejmej, Małgorzata Kotula-Balak,
Joanna Dulińska-Litewka, Barbara Bilińska
Does 2-hydroxyflutamide affect localization of kinases involved in non-classical testosterone pathway
in prostate cancer cell line LNCaP? .....................................................................................................................................
88
Gabriela Halik, Andrzej Łozicki, Agata Koziorzębska, Mateusz Makarski, Magdalena Matusiewicz
The impact of the ration supplemented with synthetic b-carotene and silage with a pumpkin as a source
of natural b-carotene on the bioactive compounds in colostrum ...................................................................................
89
Alicja Kamińska, Laura Pardyak, Ewelina Górowska-Wójtowicz, Małgorzata Kotula-Balak, Barbara Bilińska,
Katarzyna Szczęśniak, Anna Hejmej
Effect of phosphodiesterase 8B ablation on mouse spermatogenesis and steroidogenesis ..........................................
90
Tatiana N. Ilyina, Irina V. Baishnikova, Viktor A. Ilyukha, Svetlana N. Sergina, Stanisław Łapiński
Comparison of antioxidant status in farmed raccoon dog from Poland and Russia ....................................................
91
Katarzyna Kirsz, Małgorzata Szczęsna, Dorota A. Zięba
Agonist and antagonist of 5-HT2B/2C receptor and ghrelin activate intracellular signal cascades responsible
for melatonin biosynthesis in the ovine pineal gland .......................................................................................................
92
Urszula Kaczor, Magdalena Luber, Mirosław Kucharski, Andrzej Kaczor
T FOXO3 genetic variability in selected Polish sheep breeds ..........................................................................................
93
Mirosław Kucharski, Urszula Kaczor, Katarzyna Piórkowska, Karolina Pastuszak
Identification of SNP c.*1116A > G and c.2218G > A in the SCD gene of sheep breeds raised in Poland................
94
Mirosław Kucharski, Urszula Kaczor, Katarzyna Piórkowska, Katarzyna Zemsta
Identification of SNP c.391 – 66C > T and c.529 + 27G > C in the PPARγ gene of sheep breeds raised
in Poland .................................................................................................................................................................................
95
Marta Kuchta-Gładysz, Katarzyna Andraszek, Piotr Niedbała, Agnieszka Otwinowska-Mindur,
Anna Grzesiakowska, Olga Szeleszczuk
Analysis of the structure of sperm chromatinin breeding foxes......................................................................................
96
Magdalena Mika, Agnieszka Wikiera, Anna Antończyk, Anna Starzyńska-Janiszewska
Effect of butylated hydroxytoluene on bioavailability of dietary nutritional compounds ...........................................
97
Edyta Molik, Michał Błasiak, Tomasz Misztal, Katarzyna Romanowicz, Dorota A. Zięba
The role of light and exogenous melatonin in the regulation of prolactin secretion in sheep.....................................
98
Agnieszka Mostek, Mariola A. Dietrich, Błażej Westfalewicz, G. Hołownia, Andrzej Ciereszko
Cryopreservation of bull semen produces an oxidative damage of sperm proteins .....................................................
99
Maria Motal, Kamil Wartalski, Małgorzata Duda
The pre-established reserve of porcine preantral follicles – advanced method of enzymatic isolation and
identification ........................................................................................................................................................................... 101
Klaudia Nalik, Kinga Fic, Patryk Hartwich, Paweł Stręk, Michał Nowakowski
Usefullness of disected sheep heads in paranasal sinuses endoscopy for physicians.................................................... 102
Piotr Niedbała, Gabriela Lipień, Olga Szeleszczuk, Marta Kuchta-Gładysz, Stanisław Łapiński, Iwona Guja
Preliminary research of chosen biochemical compounds’ level in the semen of breeding chinchillas
(Chinchilla lanigera)............................................................................................................................................................... 103
Marta Pasternak
Analysis of KM1 allele frequency in intron 13 of the KIT gene in solid-coloured Hucul horses
with white markings .............................................................................................................................................................. 104
Magdalena Socha, Jarosław Chyb, Mirosława Sokołowska-Mikołajczyk, Ewa Drąg-Kozak,
Włodzimierz Popek
In vitro LH secretion by female common carp (Cyprinus carpio L.) pituitary cells incubated with popular
herbicide Roundup ................................................................................................................................................................ 105
Grzegorz Sokołowski, Ricardo Faundez, Zuzanna Sandowska-Markiewicz, Marta Gajewska, Anna Niwińska,
Anita Tyl-Bielicka, Marek Woszczyński, Katarzyna Kermen-Germaniuk, Sebastian Dąbrowski,
Monika Petrajtis-Golobow, Jerzy Ostrowski
Application of time-lapse monitoring of embryo development (TLMED) in different mouse strains ..................... 106
8
Natalia Sowińska, Anna Filipczyk, Katarzyna Frankowska, Klaudia Nalik, Kinga Fic
The role of cumulus cells in in vitro maturation and in vitro fertilization of oocytes of domestic cat ....................... 107
Monika Stefaniuk-Szmukier, Katarzyna Ropka-Molik, Katarzyna Piórkowska, Jarosław Łuszczyński,
Magdalena Pieszka, Tomasz Szmotała, Bogusława Długosz, Romana Augustyn, Weronika Pisarczyk,
Zenon Podstawski
Genetic variability in equine GDF9 in Arab and Thoroughbred mares ......................................................................... 108
Małgorzata Szczęsna, Katarzyna Kirsz, Dorota A. Zięba
Pregnancy-induced changes of leptin concentration in Polish Longwool ewes............................................................ 109
Magdalena Szyndler-Nędza, Katarzyna Ropka-Molik, Katarzyna Piórkowska, Aurelia Mucha, Marek Babicz,
Tadeusz Blicharski
Analysis of changes in the frequency of FST genotypes depending on inbreeding of native Puławska
sows.......................................................................................................................................................................................... 110
Aleksey R. Unzhakov, Nikolay N. Tyutyunnik, Svetlana N. Sergina, Nadezhda P. Chernobrovkina,
Ekaterina P. Antonova, Lyudmila B. Uzenbaeva, Irina V. Baishnikova, Viktor A. Ilyukha, Stanisław Łapiński,
Piotr Niedbała
Extract from pine needle enriched with L-arginine prevents the protein malnutrition of American mink
(Neovison vison) kits .............................................................................................................................................................. 112
Vasyl Vlizlo, Natalia Kuzmina, Dmytro Ostapiv, Mykola Sharan, Iryna Yaremchuk, Julia Bodnar
Glutathione peroxidase activity, respiration intensity and spermatozoa survival in bull ejaculates .......................... 113
Kamil Wartalski, Gabriela Gorczyca, Marta Hereta, Małgorzata Duda
The evaluation of the ability to differentiate of putative stem cells from mature pig ovaries ...................................... 114
Jerzy Wiater, Janusz Karasiński
Characterization and possible involvement of mesenchymal stem cells in endometrium of porcine uterus
model ....................................................................................................................................................................................... 115
Jerzy Wiater, Janusz Karasiński, Jacek Jura, Zdzisław Smorąg, Ryszard Słomski, Marek Romek
Pig with reduced expression of the Galα(1,3)Gal epitope as a potential donor of skin grafts – preliminary
study......................................................................................................................................................................................... 116
Joanna Zubel-Łojek, Anna Latacz, Ewa Ocłoń
The changes of CRP and IL-10 secretion from piglet lymphocytes in response to adiponectin ................................. 117
Session 3. ”7th Poultry Days” – current problems of poultry and ornamental bird breeding ......................................... 119
Plenary lectures
Veronika Pistová, Henrieta Arpášová, Cyril Hrnčár
The effect of the humic acid and herbal additive supplement on production and carcass parameters
of broiler chicken .................................................................................................................................................................. 121
Maria Siwek, Anna Sławińska, Katarzyna Stadnicka, Aleksandra Dunisławska, Arkadiusz Płowiec,
Giuseppe Maiorano, Marek Bednarczyk
In ovo technology – efficient method of chicken microbiome stimulation ................................................................... 122
Presentations
Michalina Adaszyńska-Skwirzyńska, Danuta Szczerbińska
Effect of lavender essential oil (Lavandula angustifolia) on production indicators of broiler chicken ..................... 123
Krisztián Balogh, Nikolett Tokodi, Erika Zándoki, Judit Szabó-Fodor, Csilla Pelyhe, Andrea Bócsai,
Miklós Mézes
Effects of fumonisin contaminated diet on glutathione redox system and lipid peroxidation processes
in broiler chickens ................................................................................................................................................................. 125
Mateusz Bucław
Seasonal changes in the behavior of emu (Dromaius novaehollandiae) under farm conditions ................................ 126
Jolanta Calik
The content of selected chemical components in hen eggs depending on egg production cycle .............................. 128
9
Jolanta Calik, Katarzyna Połtowicz, Robert Gąsior
Effect of caponizing Yellowleg Partridge (Ż-33) cockerels on meat quality .................................................................. 129
Jolanta Calik, Michał Puchała, Joanna Obrzut
Evaluation of productivity and egg quality in Sussex (S-66) laying hens during the first two years
of production ......................................................................................................................................................................... 130
Magdalena Dykiel, Zofia Sokołowicz
The welfare of hens in various systems of extensive farming .......................................................................................... 131
Małgorzata Dżugan, Monika Wesołowska, Marcin Lis, Teodora Król, Jakub Nowak, Jerzy W. Niedziółka
In ovo study on calcium protective effect against cadmium embryotoxicity ................................................................ 132
Csaba Fernye, Márta Erdélyi, Krisztián Balogh, Zsolt Ancsin, Andrea Bócsai, Miklós Mézes
Preliminary study on some parameters of meat quality and antioxidant defence of grey partridge
(Perdix perdix) ....................................................................................................................................................................... 133
Marian Foltyn, Vojtěch Rada, Martina Lichovníková
The infuence of rapeseed on growth performance in broiler diets ................................................................................ 134
Karolina Goździewska-Harłajczuk, Joanna Klećkowska-Nawrot, Karolina Barszcz
The microscopic study of the conjunctiva-associated lymphoid tissue (CALT) in Indian peafowl
(Pavo cristatus) ...................................................................................................................................................................... 135
Magdalena Graczyk, Krzysztof Andres, Ewa Kapkowska, Tomasz Szwaczkowski
Monitoring of the genetic diversity of the Zatorska goose based on the pedigree information ................................ 136
Emília Hanusová, Anton Hanus, Cyril Hrnčár, Marta Oravcová
Effect of biologically active substances on laying traits of Japanese quails .................................................................... 138
Eliska Horecka, Cenek Horecky, Lenka Kovarikova, Ales Knoll, Ales Pavlík
Single nucleotide polymorphism of PMCA genes in ISA Brown laying hens .............................................................. 139
Cyril Hrnčár, Denis Porubský, Ján Weis, Henrieta Arpášová, Veronika Pistová, Jozef Bujko
The effect of supplementation of enzyme preparation on base of pepsin on performance and carcass
characteristics of Japanese quail .......................................................................................................................................... 140
Inessa B. Izmailovich, Marcin W. Lis
The adsorbents of mycotoxins in poultry .......................................................................................................................... 141
Michał Jóźwiak, Krzysztof Wyrostek, Edyta Świętoń, Monika Olszewska-Tomczyk, Krzysztof Śmietanka,
Zenon Minta
Trends in current research on avian influenza viruses .................................................................................................... 142
Dorota Katarzyńska, Małgorzata Grzesiak, Andrzej Sechman
Selection of the best reference gene in real-time qPCR studies in ovarian tissue of hens treated with silver
nanoparticles ......................................................................................................................................................................... 143
Joanna Klećkowska-Nawrot, Karolina Goździewska-Harłajczuk, Karolina Barszcz, Artur Kowalczyk,
Ewa Łukaszewicz
Microstructural features of the Harderian gland in Common pheasant (Phasianus colchicus talischensis)
and hybrid of Italian Amber and Common pheasant ...................................................................................................... 144
Paweł A. Kołodziejski, Ewa Pruszyńska-Oszmałek, Maciej Sassek, Daniela Chałupka, Tomasz Szwaczkowski,
Paweł Maćkowiak, Leszek Nogowski
Symbiotic regulates incretin (GIP and GLP-1) expression and secretion in chicken duodenum .............................. 145
Ľubor Košťál, Mária Horváth, Katarína Pichová
Optimising behavioural tests for studying cognitive bias in poultry ............................................................................. 146
Józefa Krawczyk
Quality of native breed hen eggs stored under different conditions .............................................................................. 147
Józefa Krawczyk, Joanna Obrzut
Carcass muscling and colour in poulards from Sussex (S-66) hens ............................................................................... 148
Józefa Krawczyk, Michał Puchała
The effect of breed and free-range production system on quality of meat from hens of two native breeds ............. 149
10
Lucie Kupčíková, Martina Lichovníková, Alena Przywarová, Vojtěch Anderle
Carcass quality of fattening laying-type cockerels ............................................................................................................ 151
Martina Lichovnikova, Sarka Volna
The effect of day length on broiler breeders’ performance at suboptimal females’ weight ......................................... 152
Ewa Łukaszewicz, Martyna Lasoń
Asymmetry of roosters’ primary and secondary sexual traits ........................................................................................ 153
Ewa Łukaszewicz, Martyna Lasoń, Murray Bakst, Krzysztof Andres, Joanna Rosenberger, Artur Kowalczyk
Comparison of embryo development at the oviposition of three goose breeds ........................................................... 154
Mariana Máčajová, Monika Buríková, Ivan Čavarga, Pavel Výboh, Boris Bilčík
The use of the quail chorioallantoic membrane as an experimental in vivo model ..................................................... 155
Renata Muchacka, Ewa Sosnówka-Czajka, Iwona Skomorucha
Activity of antioxidant enzymes and degree of lipid peroxidation in eggs from Greenleg Partridge hens
depending on the housing system ...................................................................................................................................... 156
Mangesh Nakade, Krisztián Balogh, Erika Zándoki, Zsolt Ancsin, Andrea Bócsai, Márta Erdélyi, Miklós Mézes
Effects of herbal mixture and short-term aflatoxin exposure on performance, some blood lipid peroxide
and glutathione redox parameters of laying hens ............................................................................................................. 157
Joanna Nowak, Katarzyna Połtowicz, Katarzyna Piórkowska
Effect of age of broiler chickens on the expression level of genes coding for calpain (CAPN1, CAPN2, CAPN3)
and calpastatin (CAST) in breast muscles ......................................................................................................................... 158
Laura Pardyak, Alicja Kamińska, Ewelina Górowska-Wójtowicz, Anna Hejmej, Mariola Słowińska,
Małgorzata Kotula-Balak, Andrzej Ciereszko, Barbara Bilińska
Expression of aromatase in the testis, epididymis and ductus deferens of the turkey (Meleagris gallopavo)
with yellow semen syndrome .............................................................................................................................................. 159
Krzysztof Pawlak, Bartosz Bojarski, Marcin Lis, Weronika Kanik, Jerzy Niedziółka, Barbara Tombarkiewicz
The influence of electromagnetic field emitted by mobile telephony on chick hematology parameters .................. 160
Csilla Pelyhe, Benjámin Kövesi, Erika Zándoki, Miklós Mézes, Krisztián Balogh, Balázs Kovács
Combined effect of T-2 toxin and deoxynivalenol on regulation of the glutathione redox system in broiler
chicken .................................................................................................................................................................................... 161
Katarína Pichová, Boris Bilčik, Ľubor Košťál
Thermographic evaluation of feather cover damage in laying hens as a tool for welfare assessment ....................... 162
Angelika Podbielska, Anna Radko, Agnieszka Szumiec
Applications of the CHD locus in sex identification in birds ......................................................................................... 163
Katarzyna Połtowicz, Joanna Nowak
Effect of early feed restriction on liveability, rearing performance and meat quality of broiler chickens ................. 165
Andrzej Posyniak, Krzysztof Niemczuk
Effectiveness and safety of the use of antibiotics in fowl ................................................................................................. 166
Ewa Pruszyńska-Oszmałek, Paweł A. Kołodziejski, Maciej Sassek, Daniela Chałupka, Tomasz Szwaczkowski,
Paweł Maćkowiak, Leszek Nogowski
In ovo synbiotic administration affects on metabolic and hormonal profile in broiler chickens ............................... 167
Anna Radko, Agnieszka Szumiec, Angelika Podbielska, Tomasz Borkowski
Application of 10 microsatellites DNA markers for parentage control in pigeons ...................................................... 168
Joanna Rosenberger, Artur Kowalczyk, Ewa Łukaszewicz, Zenon Rzońca
Nesting behavior of Western capercaillie (Tetrao urogallus) females in the breeding aviary ...................................... 169
Maciej Sassek, Ewa Pruszyńska-Oszmałek, Paweł A. Kołodziejski, Daniela Chałupka, Tomasz Szwaczkowski,
Leszek Nogowski, Paweł Maćkowiak
In ovo synbiotic administration modulates trypsin, lipase and amylase activity in broiler chicken ......................... 171
Iwona Skomorucha, Ewa Sosnówka-Czajka
Effect of adding herb extracts to drinking water on broiler chicken productivity, corticosterone level
and heterophil: lymphocyte ratio during heat stress ........................................................................................................ 172
11
Iwona Skomorucha, Ewa Sosnówka-Czajka
Effect of housing systems on some blood parameters of broiler chickens during a period of high
temperatures .......................................................................................................................................................................... 173
Joanna Socha, Andrzej Sechman, Maria Mika, Anna Hrabia
Effect of growth hormone on estrogen receptor and egg shell-specific protein gene expression
in the chicken shell gland during pause in laying induced by fasting ............................................................................ 174
Ewa Sosnówka-Czajka, Iwona Skomorucha
Effect of adding herb extract to water on rectal and radiated temperature of laying hens during
the summer heat .................................................................................................................................................................... 175
Ewa Sosnówka-Czajka, Iwona Skomorucha
Effect of breed of laying hens on production results under organic conditions ........................................................... 176
Ewa Sosnówka-Czajka, Iwona Skomorucha, Eugeniusz Herbut
Effect of housing system on some parameters of egg quality and egg-laying behaviour in laying hens ................... 177
Kinga Stuper-Szablewska, Tomasz Szablewski, Sebastian Nowaczewski, Renata Cegielska-Radziejewska
The comparison of microbial transmission within intensive (commercial farm) and extensive housing
systems on an annual basis ................................................................................................................................................... 178
Kinga Stuper-Szablewska, Tomasz Szablewski, Sebastian Nowaczewski, Anna Ostrowska-Kołodziejczak,
Anna Matysiak, Renata Cegielska-Radziejewska
The evaluation of the effect of seasons on the microbiological contamination of selected elements
of the environment in terms of health safety of laying hens kept in extensive housing system .................................. 180
Barbara Tombarkiewicz, Karolina Trzeciak, Marcin Lis, Bartosz Bojarski, Krzysztof Pawlak, Weronika Kanik,
Zbigniew Podgórni, Jerzy Niedziółka
The effect of methionine in ovo administration on chick (Gallus gallus domesticus) embryo development ............ 182
Ján Weis, Cyril Hrnčár, Matej Rindoš, Slavomír Mindek
Effect of probiotic application as a spray to egg shell on hatchability of broiler ducks ................................................ 183
Gabriela Wójcik, Magdalena Trela, Andrzej Sechman, Marcin W. Lis
Changes in thyroid hormone concentrations in chick blood during hatching after in ovo α tocopherol
administration ........................................................................................................................................................................ 184
Anna Wyrobisz, Ewa Sosnówka-Czajka, Jerzy Kowal, Paweł Nosal
Comparison of parasite infection in laying hens kept in different housing systems .................................................... 185
Małgorzata Natonek-Wiśniewska, Piotr Krzyścin
The method of identifying species of poultry on the basis of sequence differences in the s-rRNA ........................... 186
Urszula Kaczor, Marek Stanisz, Marta Bykowska, J. Składanowska, Dorota Wojtysiak, Andrzej Kaczor
Fatty acid profile of intramuscular fat in supraspinatus, longissimus lumborum and semimembranosus
muscles of farmed fallow deer .............................................................................................................................................. 187
Dorota Wojtysiak, Marek Stanisz, Agnieszka Ludwiczak, Urszula Kaczor
Histochemical muscle fibre characteristics of fallow deer meat ...................................................................................... 188
Index of authors ............................................................................................................................................................................. 189
Plenary papers
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Resistin/adiponectin/FGF21/palmitic acid
interplay in SH-SY5Y neural cells and DIO rodents:
a novel mechanism contributing to insulin resistance
Arieh Gertler
The Institute of Biochemistry, Food Science and Nutrition, The Hebrew University of Jerusalem,
Rehovot, Israel
e-mail: arieh.gertler@mail.huji.ac.il
Obesity and type2 diabetes (T2D), the two most serious
diseases in the Western world share several features such
as insulin resistance and energy homeostasis deregulation driven by changes of adipose tissue secreted hormones. Two such adipokines: adiponectin, an insulinsensitizing hormone, and in contrast resistin known to
promote insulin resistance are thus potential links between obesity and T2D. In addition, Fibroblast Growth
Factor 21 (FGF21), predominantly produced by the
liver, has similar effects as adiponectin in regulating glucose and lipid metabolism and insulin sensitivity. High
circulating levels of saturated free fatty acids such as
palmitate promote inflammation and insulin resistance
in peripheral tissues. In contrast, polyunsaturated fatty
acids such docosahexaenoic acid (DHA) exhibit a protective action. The deleterious effects of palmitate have
been attributed to its potential action through Toll-like
receptor 4 (TLR4). However, the potential link between
palmitate and resistin regarding TLR4 signaling at the
neuronal level is unknown.
In the present study, we investigated whether central resistin promotes insulin resistance through the
impairment of adiponectin signaling and by promoting
FGF21 resistance. Chronic ICV resistin infusion to rats
down-regulated both hypothalamic and hepatic APPL1,
a key protein in adiponectin signaling, associated with
decreased Akt/APPL1 interaction and an increased Akt
association with its endogenous inhibitor TRB3. Resistin treatment also reduced the expression of adiponectin receptors in hypothalamus, liver, muscle and adipose
tissue. Furthermore central resistin acting through
TLR4 impaired insulin sensitivity consequently to the
downregulation of FGF21 and its receptor components
in the hypothalamus and peripheral tissues promoting
FGF21 resistance. We also showed that resistin effects
are abolished in TLR4 knock-out mice and in SH-SY5y
human neural cells expressing TLR4 siRNAs. In summary, our study reveals novel mechanism explaining
the link between insulin resistance and central resistin/
TLR4 pathway that impairs adiponectin signaling and in
parallel promotes FGF21 resistance. Palmitate increased
TLR4 expression promoting resistin signaling through
this receptor and its recruitment to membrane lipid
rafts. These effects were prevented when neuronal cells
were pretreated with DHA. Blocking resistin signaling
by resistin antagonist developed by our group that leads
to reduced obesity in mice fed high fat diet (HFD) and
abolishing insulin resistance may thus serve as a novel
tool for clinical intervention.
Supported by ISF grant no. 476/15.
15
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Aktualne problemy dobrostanu drobiu
Current problems of poultry welfare
Roman Kołacz
Katedra Higieny Środowiska i Dobrostanu Zwierząt, Uniwersytet Przyrodniczy we Wrocławiu
e-mail: roman.kolacz@up.wroc.pl
Polska należy do czołowych producentów mięsa
drobiowego w Europie, zajmując pierwsze miejsce
pod względem produkcji i eksportu mięsa z kurcząt
brojlerów i trzecie miejsce pod względem produkcji
i eksportu mięsa indyczego. Do 2010 r. odnotowywano w Polsce zwiększający się poziom produkcji jaj
spożywczych, który w 2010 r. wynosił 10,1 mld sztuk.
W 2012 r. udział kur niosek utrzymywanych w systemach klatkowych stanowił 87% ogółu pogłowia
kur niosek (38,37 mln sztuk). Tylko 13% kur utrzymywanych było w alternatywnych systemach chowu
(chów ściółkowy – 10,9%, chów wolnowybiegowy
– 1,8%, chów ekologiczny – 0,2%), co na tle państw
UE dało dla systemów pozaklatkowych jeden z niższych wskaźników. Powyższa struktura utrzymała się
w 2013 r. W 2014 r. produkcja jaj w Polsce wyniosła
10,26 mld sztuk, tj. o 2,1% więcej niż rok wcześniej.
Te dwa sektory produkcji drobiarskiej, tj. hodowla
brojlerów kurzych i kur niosek jaj konsumpcyjnych,
są w UE regulowane odpowiednimi przepisami dotyczącymi warunków dobrostanu tych ptaków, a intensywne metody chowu tych zwierząt wciąż jeszcze
spotykają się z krytyczną opinią społeczną. W 2006 r.
w badaniach „Eurobarometer 2006” dotyczących
świadomości i wiedzy na temat dobrostanu zwierząt gospodarskich wśród obywateli UE z 25 państw
16
wykazano, że 68% respondentów twierdziło, iż dobrostan kur jest zły lub bardzo zły, a tylko 32% badanych – że jest dobry i bardzo dobry. Również 44%
respondentów opowiedziało się za tym, aby w pierwszej kolejności poprawić dobrostan kur, a następnie
brojlerów kurzych (42%). Podstawą krytyki dotychczasowych klatek bateryjnych było ograniczenie lub
całkowite wyeliminowanie naturalnych zachowań
kur, takich jak: ruch, grzebanie, poszukiwanie i pobieranie pokarmu, siadanie na grzędzie, gniazdowanie, rozpościeranie skrzydeł i trzepotanie skrzydłami,
stroszenie piór, zażywanie kąpieli piaskowych lub
ścieranie pazurków.
Implikacje behawioralne a dobrostan kur
i brojlerów kurzych
Ograniczenie możliwości manifestowania wzorców
zachowania się drobiu utrzymywanego w intensywnych systemach, w tym również w systemie bateryjnym, może prowadzić do cierpienia ptaków zarówno
w sferze psychicznej, jak i fizycznej, co manifestuje
się patologicznymi formami zachowania lub urazami
i schorzeniami. I tak, u kur niemających możliwości
grzebania i dziobania pokarmu z podłoża obserwuje
się wzrost częstotliwości zachowań anormalnych, objawiających się wydziobywaniem piór u innych pta-
ków i kanibalizmem. Pterofagię i kanibalizm znacznie
częściej obserwuje się u kur w chowie bateryjnym niż
w innych systemach. Wydziobywanie piór jest dla ptaków bolesne, towarzyszy mu często krwawienie, a odsłonięta skóra jest bardziej narażona na liczne urazy
zewnętrzne. Nawyk ten znacznie częściej występuje
w systemach, gdzie kury pozbawione są grzędy, oraz
wtedy, gdy kurom podaje się paszę, która jest przez
nie szybko zjadana. W naturalnych warunkach kury
przeznaczają około 50% czasu na poszukiwanie i pobieranie pokarmu. Przyczyną pterofagii może być także pozbawienie kur kąpieli piaskowych. W utrzymaniu klatkowym uniemożliwiającym manifestację tego
wzorca obserwuje się tzw. puste kąpiele piaskowe, co
według Baxtera (1994) świadczy o dużej frustracji ptaków i ich obniżonym dobrostanie. Ważną przyczyną
pterofagii u drobiu jest także niedobór białka w paszy,
a głównie aminokwasów siarkowych i witaminy K.
Zaburzenia behawioralne u kur prowadzą w intensywnych hodowlach do kanibalizmu manifestującego
się wydziobywaniem fragmentów ciała (odsłonięta
skóra, palce, stek, grzebień, dzwonki, a u indyków
korale), którego przyczyny bywają bardzo zróżnicowane i są często następstwem pterofagii. Należy podkreślić, że częstość występowania kanibalizmu u kur
w systemie bateryjnym jest niższa niż w systemach
podłogowych. Jedną z dyskusyjnych metod zapobiegania kanibalizmowi jest obcinanie dziobów u kurcząt, powodujące zarówno ostry, jak i chroniczny ból
u ptaków oraz objawy depresji. Zgodnie z obowiązującym ustawodawstwem unijnym, w celu uniknięcia
pterofagii i kanibalizmu państwa członkowskie mogą
zezwolić na przycinanie dziobów pod warunkiem, że
wykonuje je odpowiednio wykwalifikowany personel, a wiek kurcząt przeznaczonych do użytkowania
nieśnego lub kurcząt brojlerów nie przekracza 10 dni.
Obecnie toczy się ożywiona dyskusja w krajach UE
dotycząca wprowadzenia przez poszczególne kraje
członkowskie dobrowolnego zakazu skracania dziobów. Taki zakaz obowiązuje już w Szwecji, Norwegii i Austrii, a 1 sierpnia 2016 r. będzie wprowadzony w Niemczech. Zakazu takiego nie wprowadziła
Wielka Brytania, uzasadniając to tym, że skutki jego
wprowadzenia byłyby gorsze dla dobrostanu ptaków.
Zaleca się natomiast stosowanie w skracaniu dziobów
metody mniej bolesnej: lasera podczerwieni zamiast
rozżarzonego noża. James V. Craig pisał w „Domestic
Animal Behavior” (1981), że „okaleczenie, stosowane
w praktyce hodowlanej, takie jak np. przycięcie dzioba kurzego, jest opisywane z dużym ładunkiem emocji, jednak mimo że powoduje chwilowy ból osobnikom, daje wiele korzyści dla dobra całej grupy”.
Innym objawem frustracji, a jednocześnie zachowaniem rekompensującym zachowanie normalne,
jest tzw. pseudogniazdowanie lub inaczej zachowanie
nieśne „puste”, obserwowane u kur utrzymywanych
w klatkach bateryjnych. Pozbawienie kur możliwości
gniazdowania wywołuje u nich duży niepokój, jest
przyczyną ich cierpienia psychicznego i stanowi jeden z ważniejszych problemów behawioralnych kur.
Implikacje zdrowotne a dobrostan kur
i brojlerów kurzych
Stan zdrowia kur zawsze świadczy o poziomie dobrostanu, ale i dobrostan ptaków wpływa na ich zdrowotność. Schorzenia będące następstwem obniżonego poziomu dobrostanu, a jednocześnie wynikające
z systemu czy technologii utrzymania nazywane są
technopatiami. Do najczęściej wyliczanych technopatii u drobiu należą schorzenia kończyn. Schorzenia
te są opisywane u tych kur, które utrzymywano w systemach ograniczających im niezbędną powierzchnię
do takich ćwiczeń ruchowych, jak spacer, bieganie,
rozpościeranie skrzydeł.
Wykazano, że wytrzymałość kości na złamania
u kur z chowu bateryjnego jest o 41% niższa w porównaniu do kości kur z chowu tradycyjnego. Syndrom „klatkowego zmęczenia kur” będących w dobrej nieśności i kondycji, u których następuje nagłe
przewrócenie się na grzbiet z towarzyszącym paraliżem, jest często opisywany literaturze naukowej.
U kur tych obserwuje się kruchość i łamliwość kości
długich, deformację mostka i żeber.
Ograniczenie swobody ruchu widoczne szczególnie w klatkach bateryjnych jest główną przyczyną
słabości kończyn, które manifestują się jako deformacje, osteoporoza, złamania czy dyschondroplazje
oraz słabość mięśni. Konsekwencjami słabości kończyn może być zwiększona częstotliwość złamań, kulawizny, silny ból, niemożność pobierania pokarmu
i wody, a przez to cierpienie z powodu głodu i pragnienia, wycieńczenie organizmu i śmierć.
Do schorzeń kończyn powstających na tle warunków utrzymania należy zaliczyć uszkodzenia palców
i stopy. Stwierdzono, że u kur w klatkach bateryjnych
częściej występują: rogowacenia stopy, liczne jej pęknięcia, niekontrolowany przerost pazura i złamania
lub zwichnięcia palców. Wyposażenie klatek w taśmy
ścierne służące do ścierania pazurów oraz w gniazda
i grzędy znacznie redukowało te uszkodzenia. Zdrowotność stóp i palców nie budzi natomiast żadnych
zastrzeżeń w systemie ściółkowym, chyba że dochodzi do pogorszenia się jakości ściółki. Typowym
schorzeniem występującym u brojlerów kurzych i indyczych jest zapalenie skóry podeszwy stopy (Foot
Pad Dermatitis – FPD). Jest to stan zapalny przechodzący w zmiany nekrotyczne na powierzchni podeszwy stopy ptaka. Zmiany te powodują ból i obniżają
17
dobrostan. Ptaki dotknięte pododermatitis mogą kuleć, w przypadku bólu obserwuje się u nich niechęć
do poruszania się oraz oszczędzanie chorej nogi. Przy
zajęciu chorobą obu nóg ptaki leżą, zmniejsza się pobieranie pokarmu, następuje ich chudnięcie i osłabienie.
Najważniejszym czynnikiem etiologicznym tego
schorzenia jest jakość ściółki. Wilgotna ściółka powyżej 30%, powstająca w wyniku wadliwego systemu
poidełek lub występujących biegunek, powoduje rozmiękczenie skóry podeszwy, co wpływa na jej większą podatność na uszkodzenia. Czynnikiem sprzyjającym podrażnieniom skóry jest także za niskie lub
za wysokie pH ściółki. Na wysokie pH ma wpływ
zwiększone stężenie amoniaku w powietrzu i ściółce,
a na niskie – kwas moczowy pochodzący z odchodów
lub podawanie w pokarmie większej ilości kwasów.
Zarządzanie mikroklimatem w budynkach dla brojlerów w zakresie temperatury, wilgotności i wartości
amoniaku w powietrzu jest ważnym elementem prewencji FPD. Niektórzy autorzy twierdzą, że zwiększona obsada brojlerów na m2 podłogi także może
być czynnikiem ryzyka w etiologii pododermatitis,
głównie ze względu na większe zawilgocenie ściółki
i emisję amoniaku.
Przedstawione zaburzenia behawioralne, liczne
urazy i schorzenia powodujące cierpienie i śmierć kur
w systemach bateryjnych nie były akceptowane przez
opinię publiczną. W Europie organizowano częste
protesty przeciwko systemowi klatkowego utrzymania kur. W wyniku tych protestów oraz licznych raportów naukowych wskazujących na cierpienie kur
utrzymywanych w systemach bateryjnych, a także
braku stosownych przepisów dotyczących warunków
utrzymania kurcząt brojlerów Parlament Europejski
dokonał rewizji dotychczasowych przepisów utrzymania kur niosek, wydając w 1999 r. nową dyrektywę oraz ustanawiając w 2007 r. dyrektywę dotyczącą
utrzymania brojlerów kurzych.
Prawne i ekonomiczne aspekty ochrony
dobrostanu drobiu w UE i w Polsce
Przepisy prawa europejskiego i polskiego w zakresie
ochrony dobrostanu drobiu dotyczą:
• warunków utrzymania,
• warunków transportu,
• warunków uboju i uśmiercania.
W Unii Europejskiej prawo dotyczące utrzymania
drobiu jest regulowane przez trzy dyrektywy:
1. Dyrektywa UE 1998/58 ustanawiająca minimalne
standardy utrzymania zwierząt gospodarskich (tą
dyrektywą objęty jest inny drób niż nioski i brojlery kurze).
18
2. Dyrektywa UE 1999/74 ustanawiająca podstawowe standardy utrzymania kur nieśnych, która zastąpiła obowiązującą do końca 2002 r. dyrektywę
88/166.
3. Dyrektywa Rady 2007/43/WE z dnia 28 czerwca
2007 r. w sprawie ustanowienia minimalnych zasad dotyczących ochrony kurcząt utrzymywanych
z przeznaczeniem na produkcję mięsa.
Dyrektywa Rady 1999/74/EC nie obowiązuje
w stosunku do ferm użytkujących do 350 kur niosek i ferm utrzymujących zarodowe stada nieśne.
Jednakże w stosunku do wspomnianych wyżej ferm
obowiązują odpowiednie przepisy Dyrektywy 98/58/
EC, a w Polsce Rozporządzenie Ministra Rolnictwa
i Rozwoju Wsi z dnia 28 czerwca 2010 r. w sprawie
minimalnych warunków utrzymywania gatunków
zwierząt gospodarskich innych niż te, dla których
normy ochrony zostały określone w przepisach Unii
Europejskiej (Dz. U. z 2010 r. Nr 116, poz. 778).
Dyrektywa 99/74 określa warunki, jakim muszą
odpowiadać klatki udoskonalone (często nazywane
umeblowanymi), wprowadzane w miejsce dotychczas
istniejących lub nowo budowanych ferm od 1 stycznia 2012 r. Kury w klatkach udoskonalonych muszą
mieć zapewnione przynajmniej 750 cm2 powierzchni
klatki na kurę, w tym 600 cm2 powierzchni dostępnej, niezabudowanej, a ogólna powierzchnia klatki
nie może być mniejsza niż 2000 cm2. Ponadto klatki
powinny być wyposażone w:
• gniazdo,
• ściółkę, umożliwiającą grzebanie i dziobanie,
• grzędy (15 cm na kurę),
• karmidła z dostępem bez ograniczeń (długość nie
mniejsza niż 12 cm/kurę),
• co najmniej dwa poidła kropelkowe lub kubeczkowe, dostępne dla każdej z kur znajdujących się
w klatce lub 12 cm poidła rynienkowego przypadającego na 1 kurę,
• urządzenia do skracania pazurów.
Wymienione wyposażenie klatek powinno w pewnym stopniu zabezpieczać podstawowe potrzeby behawioralne kur.
Wprowadzenie klatek udoskonalonych nie było
automatyczną zamianą systemu klatek starego typu na
nowe. W państwach UE spowodowało to duży spadek
liczby kur utrzymywanych w systemach bateryjnych.
W 25 państwach UE przed 2012 r. w klatkach bateryjnych starego typu (550 cm2/kurę) utrzymywanych
było 79,6% kur, a obecnie utrzymywanych jest w systemach klatek wzbogaconych 56% kur. Na głębokiej
ściółce utrzymywanych jest 26%, na wolnych wybiegach 14%, a w systemie ekologicznym 4%. W Polsce
nadal obserwuje się wysoki wskaźnik utrzymania kur
w systemie bateryjnym (88%), na głębokiej ściółce
2%, na wolnym wybiegu 10%, a w systemie ekologicznym zaledwie 0,002% kur. Obowiązek wdrożenia
od 1 stycznia 2012 r. Dyrektywy 99/74 był znacznym
obciążeniem finansowym dla hodowców. Modernizacja jednego stanowiska dla kury kosztowała 10–15
euro. Wzrósł także koszt produkcji, powodując nierówną konkurencję cenową na rynku europejskim,
np. w zakresie proszku jajecznego importowanego
z krajów trzecich, gdzie standardy utrzymania kur
w bateriach są dalekie od europejskich. Minimalna
powierzchnia klatki w USA i Kanadzie wynosi 430
cm2/kurę, a w Brazylii, Indiach i na Ukrainie zaledwie od 350 do 400 cm2 na kurę, czyli prawie dwa razy
mniej niż w UE. Kolejne negocjacje WTO z Komisją
Europejską zmierzające do zniesienia barier celnych
ze względu na dobrostan zwierząt oraz 13. runda negocjacji w sprawie porozumienia handlowego pomiędzy UE a USA o wolnym handlu (TTIP) mogą być
niekorzystne dla rolnictwa europejskiego, a szczególnie sektora drobiarskiego. Sytuacja ta dotyczy także
mięsa drobiowego.
Poubojowa ocena dobrostanu kurcząt brojlerów
Przepisy Dyrektywy Rady 2007/43/WE w sprawie ustanowienia minimalnych zasad dotyczących
ochrony kurcząt utrzymywanych z przeznaczeniem
na produkcję mięsa weszły w życie w Polsce 30 czerwca 2010 r. na mocy Rozporządzenia Ministra Rolnictwa i Rozwoju Wsi (Dz. U. z 2010 r. Nr 56, poz. 344).
Najważniejszym wymogiem tej dyrektywy jest zapis,
aby maksymalna obsada kurcząt brojlerów w kurniku w żadnym momencie nie przekraczała 33 kg/m2.
W formie odstępstwa od powyższej zasady zezwala
się na zwiększenie obsady do 39 kg/m2 lub 42 kg/m2
pod warunkiem spełnienia dodatkowych wymogów
określonych w dyrektywie. Zwiększona obsada do
42 kg/m2 wymaga zgody Powiatowego Lekarza Weterynarii, która może być wydana tylko wtedy, gdy
wszystkie kontrole dobrostanu w kurniku są pozytywne, gdy skumulowany wskaźnik śmiertelność kurcząt nie przekracza wymaganej dyrektywą wartości
oraz gdy zdrowotność kurcząt w badaniach poubojowych oceniana przez urzędowego lekarza weterynarii w rzeźni, na podstawie m.in. zmian na podeszwie
łapek powstałych w wyniku pododermatitis, nie budzi jego zastrzeżeń. Ocenę tych zmian przeprowadza
się na podstawie badania jednej łapki od 100 ptaków
z jednego stada utrzymywanego w tym samym kurniku. Skala oceny to:
• 0 – brak zmian,
• 1 – powierzchowne zmiany, przebarwienia,
• 2 – głębokie zmiany ze strupem i owrzodzeniem.
Po dokonaniu oceny zmian według powyższego
kryterium sumuje się liczbę punktów otrzymanych
z poniższych iloczynów dla całej przebadanej partii
100 łapek:
• liczba łapek ocenianych na 0 jest mnożona przez 0,
• liczba łapek ocenianych na 1 jest mnożona przez
0,5,
• liczba łapek ocenianych na 2 jest mnożona przez 2.
Końcowa ocena partii łapek zależy od ogólnej liczby punktów. Jeżeli ogólna liczba punktów:
• < 40 – bez uwag,
• 41–80 – niski poziom nieprawidłowości,
• 80 – wysoki poziom nieprawidłowości.
Końcową ocenę poziomu dobrostanu odstawionych do ubojni kurcząt brojlerów przyjmujemy jako:
• dobry poziom dobrostanu, gdy: skumulowany
wskaźnik śmiertelności jest zgodny z przepisami
(1% + 0,06% pomnożony przez wiek stada w dniu
uboju podany w dniach) i ocena zmian na łapkach
wynosi mniej niż 40 pkt,
• średni poziom dobrostanu, gdy: skumulowany
wskaźnik śmiertelności dziennej jest mniejszy
od 5%, przy braku uzasadnienia takiego poziomu
śmiertelności, lub/i ocena zmian na łapkach wynosi 41–80 pkt,
• niski poziom dobrostanu, gdy: skumulowany
wskaźnik śmiertelności dziennej jest wyższy niż
5%, przy braku uzasadnienia takiego poziomu
śmiertelności, lub/i ocena zmian na łapkach jest
większa niż 80 pkt.
W przypadku stwierdzenia średniego lub niskiego poziomu dobrostanu urzędowy lekarz weterynarii
informuje powiatowego lekarza weterynarii nadzorującego rzeźnię o wynikach badania i przesyła komplet
dokumentacji dla badanej partii. Powiatowy lekarz
weterynarii nadzorujący rzeźnię informuje powiatowego lekarza weterynarii nadzorującego gospodarstwo pochodzenia kurcząt o wynikach badania,
przesyłając otrzymaną dokumentację. Po otrzymaniu
powyższej informacji powiatowy lekarz weterynarii
właściwy dla gospodarstwa pochodzenia kurcząt:
• w przypadku stwierdzenia po raz pierwszy średniego poziomu dobrostanu w stadzie pochodzącym
z danego gospodarstwa rozważa konieczność przeprowadzenia kontroli dobrostanu kolejnego stada
utrzymywanego w danym gospodarstwie, biorąc
pod uwagę dotychczasowe wyniki kontroli, wysokość zagęszczenia brojlerów oraz wielkość stada,
• w przypadku stwierdzenia średniego poziomu dobrostanu po raz drugi dla przesyłki pochodzącej
z innego stada brojlerów z tego samego gospodarstwa lub w przypadku stwierdzenia niskiego po-
19
ziomu dobrostanu przeprowadza kontrolę dobrostanu kolejnego stada utrzymywanego w danym
gospodarstwie.
Dobrostan drobiu a bezpieczeństwo żywności
Utrzymanie wysokiego standardu dobrostanu zarówno kur, jak i kurcząt brojlerów ma szczególne znaczenie ze względu na bezpieczeństwo żywności. Chociaż
na pozór związek pomiędzy poziomem dobrostanu
drobiu a bezpieczeństwem żywności wydaje się odległy, to zagadnienia dobrostanu zwierząt zarówno w prawodawstwie UE, jak i w świadomości oraz
oczekiwaniach konsumentów wysuwają się obecnie
na pierwszy plan. Należy stwierdzić, że obniżonemu
poziomowi dobrostanu zwierząt towarzyszy zawsze
obniżona ich zdrowotność, i odwrotnie: chore zwierzę charakteryzuje się zawsze obniżonym dobrostanem. Jeżeli zatem przyjmiemy, że bezpieczna żywność może pochodzić tylko od zdrowych zwierząt,
to zależność między dobrostanem zwierząt a bezpieczeństwem żywności nie jest ani pozorna, ani odległa.
Obniżony poziom dobrostanu drobiu sprzyja zawsze
powstawaniu chorób zakaźnych, warunkowo zakaźnych lub technopatii. Wysoki poziom dobrostanu to
jednocześnie gwarancja dobrego stanu zdrowia zwierzęcia, a także eliminacja antybiotyków czy innych
20
lekarstw stanowiących potencjalne zagrożenie dla
bezpiecznej żywności.
Obniżenie poziomu dobrostanu drobiu ze względu
na nieodpowiednie warunki utrzymania czy transportu może w wyniku immunosupresji doprowadzić do
zakażenia całego organizmu drobnoustrojami żyjącymi w przewodzie pokarmowym, stwarzając kolejny
element ryzyka dla bezpiecznej żywności. Generalnie
stwierdza się, że produkowana obecnie żywność nie
jest całkowicie bezpieczna. Ale jednocześnie nigdy
wcześniej nie była bezpieczniejsza niż teraz, chociaż jej
bezpieczeństwo nie było kwestionowane bardziej niż
obecnie. Ta nieufność konsumentów nie jest bezpodstawna. Liczne doniesienia epidemiologiczne z ostatnich lat w Europie i na świecie wskazują, że wzrasta
liczba czynników ryzyka zdrowia zwierząt, a przez to
i liczba ognisk chorobowych. Równocześnie wprowadzane ostatnio daleko idące zmiany w systemie
produkcji drobiarskiej nie dają całkowitej gwarancji,
że mięso i jaja będą pozbawione zarazków oraz pozostałości po antybiotykach i substancjach obcych obecnych często w skażonym środowisku. Dlatego ochrona
dobrostanu drobiu odgrywa podstawową rolę w produkcji bezpiecznej żywności, a przez to i w ochronie
zdrowia publicznego.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Chicken ovary – a place of dioxin
and polychlorinated biphenyl detoxification
Andrzej Sechman, Piotr A. Antos, Dorota Katarzyńska, Anna Hrabia
Department of Animal Physiology and Endocrinology, University of Agriculture in Krakow, Poland
e-mail: rzsechma@cyf-kr.edu.pl
Dioxins and polychlorinated biphenyls (PCBs) are
chloroorganic compounds which belong to persistent
environmental pollutants and endocrine disruptors.
In the domestic hen (Gallus domesticus) they exhibit
a diverse spectrum of unfavourable effects in the embryonic [3] and adult ovary [1, 2, 5]. In a target cell,
dioxin and PCBs bind to the aromatic hydrocarbon
receptor (AHR), translocate to the nucleus and induce
a cytochrome P-4501A monooxygenase system which
is involved in the first step of xenobiotic metabolism
[4, 6]. To clarify whether chicken ovarian follicles may
participate in dioxin and PCB detoxification, the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD),
3,3’,4,4’,5-pentachlorobiphenyl (PCB 126; co-planar
PCB congener) and 2,2’, 4,4’,5,5’-hexachlorobiphenyl
(PCB 153; non-coplanar PCB congener) on mRNA expression of AHR1, CYP1A5 and CYP1A5 genes as well
as their activity (measured by EROD and MROD activities) in chicken ovarian follicles were investigated.
The white (WF) and yellowish (YF) nonhierarchical
follicles and fragments of the theca (TL) and granulosa
(GL) layers of the 3 largest yellow preovulatory follicles
(F3–F1) were isolated from the chicken ovary and incubated in a medium supplemented with 1, 10 or 100
nM TCDD (n = 6), PCB 126 (n = 6) or 1, 10 or 100
µM PCB 153 (n = 6). In the collected tissues, expression of AHR1, CYP1A5 and CYP1A5 was measured by
real-time qPCR while EROD and MROD activities by
fluorescence methods. Results were statistically evaluated by ANOVA followed by Tukey test at P < 0.05. The
experiment confirmed that chicken ovarian follicles
express AHR1, CYP1A5 and CYP1A5. In WF and YF
a stimulatory effect of all three xenobiotics on AHR1
mRNA levels was found. On the other hand, in the TL
and GL of F3-F1 follicles a down-regulation of AHR1
following TCDD exposition was observed. PCB 153
stimulated AHR1 expression in the WF and the GL of
F1 follicle. A strong stimulatory effect of TCDD and
PCB 126 on CYP1A5 in the YF, and the TL and GL
of F3–F1 follicles was noticed; the effects of these two
chemicals on CYP1A5 expression were relatively lower. PCB 153 was able to stimulate these genes expression but only in the GL of the F1 follicle. All investigated chemicals in dose-dependent manner increased
EROD and MROD activities in the chicken ovary in
the following order: TCDD > PCB 126 > PCB 153. In
summary, data of this experiment revealed that the
chicken ovarian follicles express AHR1, CYP1A5 and
CYP1A5 genes, and dioxin and PCBs modulate their
transcription and stimulate EROD and MROD activity. It is suggested that chicken ovarian follicles are
a place of dioxin and PCB detoxification.
Supported by grants: N N303 561 339 and DS-3243/
KFiEZ.
21
References
[1] Antos P.A., Błachuta M., Hrabia A., Grzegorzewska
A.K., Sechman A. 2015. Toxicol. Lett., 237, 100–111.
[2] Sechman A., Antos P., Katarzyńska D., Grzegorzewska
A., Wojtysiak D., Hrabia A. 2014. Toxicol. Lett., 225,
264–274.
[3] Sechman A., Hrabia A., Lis M.W., Niedziółka J. 2011.
Toxicol. Lett., 205, 190–195.
22
[4] Sorg O. 2014. Toxicol. Lett., 230, 225–233.
[5] Wójcik D., Antos P.A., Katarzyńska D., Hrabia A.,
Sechman A. 2015. Toxicol. Lett., 239, 73–80.
[6] Yasui T., Kim E.Y., Iwata H., Franks D.G., Karchner S.I.,
Hahn M.E., Tanabe S. 2007. Toxicol. Sci., 99,101–117.
Session 1
Animal welfare and product quality
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Roles, tasks and responsibilities of the Designated
Veterinarian under Directive 2010/63/EU
Piotr SJ Sowinski
European Society Laboratory Animal Veterinarians (ESLAV) P Sowinski, DVM, LAVA
Department of Bioengineering, Royal School of Mines Building, Imperial College London,
South Kensington Campus, United Kingdom
e-mail: p.sowinski@imperial.ac.uk
Work and use of animals has been recently regulated
on a European level by a new legislative act called
Directive 2010/63/EU. The Directive requires that
a range of veterinary services should be provided at
all level and at all time. Directive 2010/63/EU provides for veterinarians a legal frame work to continue
fulfilling this responsibility. Laboratory Animal Veterinarians are involved in a broad range of activities
related to the functions of Ethical Committees, facility management, health monitoring, research projects, compliance with legislation and the training
of personal and researchers. Considering the variety
of sizes of establishments, the range of species, and
the type of experiments for which animals may be
used, it is in the view of European professional organisations, i.e.: the European Society of Laboratory
Animal Veterinarians and the European College of
Laboratory Animal Medicine that the veterinary care
programme and the training of the designated veterinarian should be tailored to the specific needs of the
environment in which they work. This presentation
will be in the form of a discussion regarding whether
the veterinarians are able to fulfil the obligations of
the Directive as well as the expectations of animal users without compromising animal welfare.
25
Rola, zadania i odpowiedzialność wyznaczonego
lekarza weterynarii w świetle Dyrektywy 201063/EU
Piotr SJ Sowinski
European Society Laboratory Animal Veterinarians (ESLAV) P Sowinski, DVM, LAVA
Department of Bioengineering, Royal School of Mines Building, Imperial College London, South Kensington
Campus, Wielka Brytania
e-mail: p.sowinski@imperial.ac.uk
Nowa europejska Dyrektywa 2010/63/EU wymaga
od organizacji pracujących ze zwierzętami laboratoryjnymi udziału służby weterynaryjnej, regulując
zadania i odpowiedzialność w zakresie doradczym.
Z danych dostępnych z europejskich organizacji zawodowych wynika, że obecnie ponad 1000 lekarzy
jest zatrudnionych w sektorze medycyny zwierząt laboratoryjnych. Zasiadają oni w komisjach etycznych,
są członkami kierownictwa zwierzętarni, zajmują
się monitoringiem zdrowia zwierząt, biorą udział
w opracowaniu projektów naukowych, kontrolują
przestrzeganie zapisów legislacyjnych, są członkami
komisji bezpieczeństwa i higieny pracy, a także zajmują się szkoleniem zawodowym. Powinnością zawodową, etyczną i prawną weterynarza jest ochrona
zdrowia zwierzęcia i jego dobrostanu. Istnieje zatem
26
potrzeba, aby lekarz weterynarii był włączony w opracowanie i wdrażanie programów odpowiedniej opieki
nad zwierzętami. Biorąc pod uwagę wielkość placówek naukowych, złożoność prowadzonych tam prac
badawczych, a także rozpiętość używanych gatunków
zwierząt, rodzi się pytanie, czy lekarz wykształcony
w zawodzie weterynaryjnym może sprostać tym wymaganiom, czy też program specjalistycznego kształcenia lekarza weterynarii powinien być dopasowany
do potrzeb środowiska, w jakim przyjdzie mu pracować. Prezentacja jest formą dyskusji na temat funkcji
i odpowiedzialności lekarza weterynarii w placówkach naukowo-badawczych, jego roli w ocenie projektów badawczych, a także w szkoleniu personelu
i doradzaniu pracownikom naukowym.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Fatty acid profile of lamb meat from highly productive
breeds of sheep reared under organic conditions
Paweł Paraponiak
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: pawel.paraponiak@izoo.krakow.pl
The aim of the study was to compare the fatty acid
content of meat from highly productive breeds of
Suffolk and Pomeranian sheep, reared in an organic
production system. The profile of fatty acids, including conjugated dienes of linoleic acid (CLA), was
analysed in the samples of longissimus dorsi muscle
collected from Suffolk (S) and Pomeranian sheep
(P) ram-lambs (14 animals per group; experimental
slaughter at 120 days of age). The lambs were pastured
from late April/early May and forage formed the basis of their diet. The animals were also supplemented
with ground cereals (approx. 0.40 kg/day/animal).
The results showed similar values for both groups as
well as a higher proportion of unsaturated fatty acids (in the region of 60 g/100 g of all analysed fatty
acids) compared to saturated fatty acids (more than
40 g/100 g of all analysed fatty acids). The most abundant saturated fatty acids (SFA) were palmitic acid
(C6, 23–24%) and stearic acid (c18, 12–13%). Oleic
acid (c18-1) showed the highest concentration among
both monounsaturated fatty acids (MUFA, 95%) and
unsaturated fatty acids (UFA, 67–72%). The meat of P
lambs had a significantly higher proportion of PUFA,
PUFA-6 (P ≤ 0.05) and PUFA-3 (P ≤ 0.01). PUFA 6/3
was 7.6 in group S and 6.8 in group P. CLA content of
S and P meat was rather low at 1.084 and 1.147 g/100 g
of all analysed fatty acids, respectively. The average
configuration of the health-promoting parameters of
meat from experimental ram-lambs was probably the
outcome of the considerable proportion of concentrates in the ration and the relatively short period of
feeding pasture forage (higher weight gains and, as
a consequence, the earlier achievement of required
preslaughter weight reduced the pasture rearing period).
27
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The influence of mycotoxin’s adsorbent
of new generation “Funginorm” on the productivity
of fattening pigs
Victoria I. Borodulina, N.A. Sadomov
The Belarusian State Agricultural Academy, Gorki, Belarus
e-mail: helenamikulich1971@gmail.com
The infection of grain and animal’s feed with mycotoxins is currently a major problem of modern pig
breeding. This problem causes considerable economic damage to the industry. Mycotoxins are products
of the metabolism of fungi that infect corn and other
feed crops. The pollution of grain with mycotoxins is
possible at all stages of its production.
The prevalence of mycotoxins in nature is considered as a global problem. However, in some regions
of the world, some mycotoxins occur more often than
others.
In conditions of man-made stresses an urgent task
is to find ways and means to increase the protective
forces of an organism of animals, contributing to increase the efficiency.
To carry out scientific experiment on the principle
of analogues were selected 80 pigs.
Fattening pigs were divided into 4 groups of 20
animals each. Average live weight of pigs was 55.9–
57.8 kg.
In the control group used only the basic diet for
feeding fattening pigs. In the 1st test group in the basic ration was added 0.5 kg/ton of “Funginorm” is an
adsorbent of a new generation. In the 2nd test group
was added – 1.0 kg/ton of adsorbent and in the third
experimental group was added – 1.5 kg/ton of adsor-
28
bent. As the main diet for guinea pigs used the SC-26
feed.
“Funginorm” is adsorbent of a new generation for
poultry and pigs, used to suppress the development of
molds and neutralization of mycotoxins in feed.
As controlled indexes for fattening pigs of all experimental groups used their body weight, average
daily gains and feed conversion.
Results of researches for 1st month indicate that
the most pronounced advantage in growth rate of
pigs was detected in the second and the third experimental groups. The average daily weight gain of
pigs second and third experimental groups through
the study month was 580 g and 577 g, which is 11.5%
and 11.0% was significantly higher than in the control
group.
The average daily weight gain was 550 g, which is
higher than in the first test group than in control at
30 g. For the second month of the test to maintain the
achieved advantage intensity body weight gain guinea
pigs for fattening. The second experimental group of
fattening pigs had average daily gain – 661 g, 12.2%
was significantly higher than in the control group.
The third test group average daily weight gain was
642 g, which was significantly higher than in the control group of 54 g, respectively.
Preservation of fattening pigs all experimental
groups was 100%.
In general, for the entire period of the experience
the average daily weight gain in the second test group
was 622 g, which is 11.9% significantly higher than in
control group. In the third test group average grain
was 611 g, an increase of 9.9% was significantly higher compared with the control group.
The inclusion of adsorbent in fattening pigs diet at
doses of 0.5–1.5 g/kg of feed conversion and reduced
feed conversion ratio increased feed of 3.5–12.4%
compared with the control group.
Throughout the experiment, the growth of the
most energy intensive fattening pigs had two and
three experimental groups that received a new generation of adsorbent “Funginorm” in an amount of
1.0 g/kg and 1.5 g/kg feed. They were superior to their
peers in the control group to 11.9% and 9.9% respectively.
The feeding of fattening pigs, in order to prevent,
reduce the action of mycotoxins in feeds and enhance
the productive performance.
We recommend the use of a new generation of adsorbent «Funginorm» in doses of 1.0–1.5 g/kg of feed.
29
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Mycotoxins in dairy cows diet
in south-west Bohemia
Veronika Čoudková, J. Starý, Miroslav Maršálek
Department of Animal Husbandry Sciences, Faculty of Agriculture,
University of South Bohemia in České Budějovice, Czech Republic
e-mail: nika.13@seznam.cz
Mycotoxins may caused problems with health and
production especially in the transition period of
dairy cows. The aim of the study was to determine
the amount of the risk of contamination of feed for
dairy cows by three most surveyed mycotoxins, also
find and indicate the type of feed with the potentially
highest risk. Three major groups of mycotoxins were
studied, Zearalenone (ZEA) for its hyperoestrogenic
effects, T- toxin and Deoxynivalenol (DON) for immunosuppressive effects, epitheliotoxicity and hepatotoxicity. A total of 226 feed samples were provided
by farmers from South-west region of the Czech Republic. The material was divided into four groups:
grain mixes (n = 49), corn silage (n = 65), grass silage
(n = 86) and hay (n = 26). Mycotoxin analyses were
performed by ELISA method. All of samples were
positive for the monitored mycotoxins. The highest
levels of mycotoxins were detected in DON: 1529 µg/
kg feed in grain mixes, 1329 µg/kg feed in corn silage;
T-2 was 968 µg/kg feed in grain mixes, 932 µg/kg feed
in corn silage and 924 µg/kg feed in grass silage. The
highest rate of overlimit concentrations of all studied
mycotoxins was detected in corn silage, where 46%
of the samples contained overlimit amount of DON
30
(limit 200 µg/kg feed), 35% samples of T-2 (limit 200
µg/kg feed) and 22% of ZEA (limit 100 µg/kg feed).
The observed levels of mycotoxins correspond to occurence of appropriate mycotoxins in other areas of
Europe. Based on the results the estimation of theoretical intake of mycotoxins in daily ration can be done.
With model ration (14 kg grass silage, 22 kg corn silage and 5 kg grain mixes) dairy cows can consume
up to 48.027 mg of DON per day, what demonstrate
risk of total daily amount of consumed mycotoxin,
which may caused decrease in production and feed
intake The maximum acceptable levels of mycotoxins
contamination must be strict regarding at the material used in animal nutrition, especially in roughage.
Regular measurements of mycotoxins levels and early
elimination of contaminated feed leads to reduction
of the negative impacts on the health and production
of dairy cows.
This work would not have been possible without the financial support of Grant Agency of University of South
Bohemia GAJU-019/2016/Z „Výživa a technika chovu
jako cesta k pohodě zvířat a kvalitě produktů”.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Selected reproductive indicators for mares
of the Hucul Pony breed
Bogusława Długosz1, Romana Augustyn1, Magdalena Pieszka1,
Jarosław Łuszczyński1, Tomasz Próchniak2, Barbara Jaklińska3, Karina Świderska1,
Zenon Podstawski1, Monika Stefaniuk-Szmukier1, Weronika Pisarczyk1
1
Department of Horse Breeding, Institute of Animal Sciences, University of Agriculture in Krakow, Poland
2
Department of Biological Bases of Animal Production, University of Life Sciences in Lublin, Poland
3
Agriculture Farm „Kietrz” Sp. z o.o., Hucul Horse Stud „Gładyszów”
e-mail: b.dlugosz@ur.krakow.pl
Mares females are seasonally polyestral and showing
reproductive activity during the long day, and loss of
activity in the winter. Knowledge of the course of the
seasonal cycles of sex mare is very important from the
point of view of breeding, as appropriate determination of the time of ovulation increases the chances of
fertilization of mares in the first estrus and foals, prior
and following weaning from their mothers at the beginning of the grazing season. Foals with access for
a long time for a fresh, green feed are stronger and
more resistant and have better overall condition.
The main objective of this thesis is to calculate
each of the reproductive indicators for 238 mares of
the Hucul Pony breed in years the 2000–2009 in the
Hucul Stud “Gładyszów”.
The pregnancy rate for the last 10 years is 87.3%,
that is 10.9% more than in previous years. The fertility indicator reached 81.2%, and that value is also
8.3% larger than in previous years, but unfortunately
the miscarriage indicator increased as well, reaching the average value of 4.6% – that is 0.6% more in
comparison to calculations made in years the 1990–
2000. In 2001 the number of ponies separated from
their mothers was the biggest – it reached 97.2%. The
worse year in context of the results was 2009, because
the number of unfertilized mares was the largest and
the number of resorptions and registered dead ponies
younger than 6 months was greater than in previous
years as well.
31
Wybrane wskaźniki rozrodowe klaczy huculskich
Bogusława Długosz1, Romana Augustyn1, Magdalena Pieszka1,
Jarosław Łuszczyński1, Tomasz Próchniak2, Barbara Jaklińska3, Karina Świderska,
Zenon Podstawski1, Monika Stefaniuk-Szmukier1, Weronika Pisarczyk1
Zakład Hodowli Koni, Instytut Nauk o Zwierzętach, Uniwersytet Rolniczy w Krakowie
Katedra Biologicznych Podstaw Produkcji Zwierzęcej, Uniwersytet Przyrodniczy w Lublinie
3
Kombinat Rolny „Kietrz” Sp. z o.o., Stadnina Koni Huculskich „Gładyszów”
1
2
e-mail:
Klacze to samice sezonowo poliestralne, wykazujące
aktywność rozrodczą w czasie długiego dnia, a następnie zanik tej aktywności w zimie. Znajomość
przebiegu sezonowości cykli płciowych klaczy jest
bardzo istotna z punktu widzenia hodowlanego, ponieważ właściwe określenie terminu owulacji zwiększa szanse na zapłodnienie klaczy już w pierwszych
rujach i wcześniejsze uzyskanie źrebiąt, a w następstwie odsadzenie ich od matek na początku trwania
sezonu pastwiskowego. Źrebaki mające dostęp przez
dłuższy czas do świeżej, zielonej paszy są silniejsze
i bardziej odporne oraz mają lepszą ogólną kondycję.
Celem pracy było obliczenie poszczególnych wskaźników rozrodu u 238 klaczy rasy huculskiej w Stadninie Koni Huculskich „Gładyszów”. Analizie zostały poddane dane dotyczące rozrodu klaczy w latach
2000–2009 pochodzące z dokumentacji hodowlanej
stadniny takiej jak: karty klaczy, wykazy wyźrebień
i stanówki. Określono następujące wskaźniki: źrebność, płodność, odsadzenia, jałowość, poronienia.
32
W badanym okresie średni wskaźnik źrebności wyniósł 87,3% i w stosunku do lat poprzednich uległ
znacznemu podwyższeniu. Wskaźnik płodności,
którego średnia w badanym okresie wyniosła 81,2%,
zwiększył się w stosunku do uprzedniego dziesięciolecia, co świadczy o odpowiednim określeniu terminu krycia i dobrym doborze ogiera kryjącego. Średni wskaźnik odsadzeń dla badanych 10 lat wyniósł
87,8%. Niekorzystnie wzrósł wskaźnik poronień,
kształtując się na średnim poziomie 4,6%, wyższym
o 0,6% w stosunku do wskaźnika obliczonego w latach 1990–2000 (Osinka 2001). Najgorszym rokiem
pod względem badanych wyników był rok 2009,
kiedy to najwięcej klaczy jałowiło. W stosunku do
lat ubiegłych również najwięcej było resorbcji i strat
wśród źrebiąt do 6. miesiąca życia. Należy zwrócić
większą uwagę na przyczynę wzrostu poronień, martwych urodzeń i upadków źrebiąt. Średnią wartość
wskaźników rozrodu u klaczy z SKH „Gładyszów”
można uznać za dobrą.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Bioaccumulation and elimination of cadmium
in tissues of Prussian carp (Carassius gibelio B.)
under controlled conditions
Ewa Drąg-Kozak, Ewa Łuszczek-Trojnar, Magdalena Socha,
Grzegorz Gosiewski, Włodzimierz Popek
Department of Ichthyobiology and Fisheries, University of Agriculture in Krakow, Poland
e-mail: e.drag-kozak@ur.krakow.pl
Cadmium (Cd) is widely distributed in the aquatic
environment and can cause severe damage to aquatic
vertebrates. The aim of the work was to determine the
accumulation level of Cd in scales and bone of Prussian carp (Carassius gibelio B.) during 7 weeks period
of the exposure to three doses (0.04, 0.4 and 4 mg/L)
of that metal in the water, and the effect of 3 weeks
elimination period (after the previous 4 weeks exposure to that metal). Fish were divided into 4 groups:
one control group (in water without the cadmium)
and 3 experimental groups with addition of cadmium
(0.04, 0.4 and 4 mg/L). After the period of 4 weeks of
exposure all experimental groups were divided into
two groups. One of them was still in Cd-polluted water (the same concentration), and the second one was
transferred into un-polluted water for 3 weeks. After
the every week of the experiment a random sample of
8 fish of each group were taken to measure Cd level
in tissues. All samples were analyzed by AAS method
using an atomic absorption spectrometer ATI UNICAM 929.
Cadmium has been accumulated in the scales and
bone since the beginning of the exposure because
already after one week, the level of Cd significantly
increased in all groups. The highest levels of cadmium were observed in the scales after one week of exposure (1.37 mg/kg) while in the bone after 5 weeks
(1.32 mg/kg). The decrease of cadmium concentration in the scales and bone was observed after two
and three weeks of exposure.
A clear depuration of scales and bone was already
observed at one week after termination of exposure.
The low elimination was observed for the bone. Until the end of the experiment highly significant differences were observed in the scales and bone in the
group which was exposed to the highest level of cadmium. Scales collected from live fish can be used for
monitoring contamination of fish.
This research was financed by the Ministry of Science
and Higher Education of the Republic of Poland.
33
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The analysis of welfare Visayan warty pig
(Sus cebifrons) kept in selected zoos
Jan Dybała, Aleksandra Milewska, Joanna Wiśniewska,
Aleksandra Cebulska, Wojciech Kapelański
Department of Swine and Horses Breeding, University of Science and Technology in Bydgoszcz, Poland
e-mail: dybala@utp.edu.pl
Among the many tasks of zoos, the most important
are: keeping rare animals, even of endangered species and their protection, as well. The reproduction
of these animals determines maintenance of species
and even their introduction to natural environment.
The aim of the study was to assess the welfare of
Visayan warty pig in zoos in Łódź and in Poznań and
compare them with the applicable law in Poland.
In both zoos 4 Visayan warty pigs were kept. The
area of internal enclosures in Łódź and in Poznań was
12 m2. The area of external enclosures was respectively 280 m2 and 800 m2. The feed rations in both zoos
were very similar: carrots, apples, beetroot, potatoes,
seasonal fruits (eg. strawberries, plums), pears, oat
flakes, boiled rice and corn, minced meat or one day
old chicks, boiled eggs (2 pieces), cottage cheese were
in their composition.
34
Visayan warty pig is quite rare species because
lives only on two Philippine islands. The natural habitat of occurrence of this animal are dense forests. This
animal is omnivorous, eating fruits, leaves, and animals, generally invertebrate.
According to the Regulation of the Polish Minister
of the Environment (Dz. U. 2005, Nr 5, poz. 32) the
area of internal enclosure should be of 6 m2 for a couple + 10% for each additional animal. In both zoos the
ground of enclosure is soft, allowing digging. There
are also tree trunks, snag, that allow animals for hiding. The feed ration has very similar composition in
both zoos, corresponding to their natural food preferences. Respectively in zoo in Łódź and in Poznań
the animals have permanent access to water.
These data shows that the welfare of Visayan warty
pig in both analyzed zoos is fully preserved.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The influence of frequency of enrichments
replacement on behavior of laboratory guinea pigs
Kinga Fic, Aleksandra Woszczenko, Agnieszka Krzystanek, Natalia Sowińska
Center of Experimental and Innovative Medicine, University Centre of Veterinary Medicine UJ-UR,
Krakow, Poland
e-mail: kinga.fic07@gamil.com
Ensuring an appropriate level of animal welfare is an
important element that has a direct impact on the animals and thereby affects the outcome of animal experiments. Enriching the environment of the animals
through various items is a compulsory part of their
maintenance. Adequate organization of the rotation
of the enriching elements provides behavioral stimulation of animals and thus maintain a high level of
animal welfare. The aim of the study was to determine
how the frequency of replacement of three types of enrichments: berry discs, rolls of cardboard and wooden
blocks contributed on the behavior of the guinea pigs.
For 30 days, two groups of animals of 10 individual
each, were recorded. In the first group items were exchanged with a higher frequency (four times a week),
in the second with lower frequency (twice a week). In
total, 33 hours of video materials were collected. Recordings were carried out in an irregular manner at
different times of the day. The occurrence of particu-
lar behaviors have been marked as number of events
per group (e/g). Particular behaviors of guinea pigs,
were classified as: positive, negative and sexual, based
on the available literature. Data were compared with
the Mann–Whitney U test, probabilities of less than
0.05 were considered statistically significant. Result
of the present study showed that frequent exchange
of enriching items did not influenced the frequency
of positive behaviors like locomotion and popcorn.
Social sniffing, also classified as positive, was twice as
common in the lower frequency group (228 vs. 101
e/g, p < 0.05). Negative behaviors as biting, attacking
and threatening intensified significantly in the group
with higher frequency of items exchange, amounting
4 vs. 10, 3 vs. 13 and 7 vs. 23 e/g (p < 0.05), respectively. Based on our results we can conclude that too
frequent rotation of enrichments items produces an
increase of negative behaviors and reduces some positive behaviors of laboratory guinea pigs.
35
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Is the fur chewing in animals caused
by Slitrk1 gene mutation?
Iwona Guja, Stanisław Łapiński, Piotr Niedbała
Department of Swine and Small Animal Husbandry, University of Agriculture in Krakow, Poland
e-mail: iwona.guja@ur.krakow.pl
Research on fur chewing in animals are carried out
for years and did not explain the reason of occurring this obsessive compulsive spectrum disorder so
far. Scientists all over the world try to discover what
underlies the problem, which affects almost all vertebrate species. There are few genetic animal models of
obsessive- compulsive disorders (OCD), like Hoxb8
knockout mice which manifests phenotype similar to
trichotillomania or Slitrk5 knockout model which reveals OCD-like behavior, including anxiety and selfgrooming. Recent studies on Slitrk1 gene carried out
on patients with OCD shows few mutations which
could have impact in the disease development. Zuchner et al. (2006) characterized two non-synonymous
sequence changes – G > A transition resulted in substitution of arginine for lysine (c.1751G>A, R584K)
and replacement of serine by glycine (c.1777A > G,
S593G). Ozomaro et al. (2013) described three mutations – L63L, T416S and N400I. First, L63L, does
36
not change the coding protein, but might have functional effect such as decreasing translation or impact
on posttranslational modifications of protein. Second
mutation, T416S, probably occurs in all people population without OCD and is functionally tolerated.
The most interesting seems to be the third mutation,
N400I, which is the missense change where asparagine is replaced by isoleucine. The functional effect of
this mutation was proved in rat hippocampal neurons
and mice cortical neurons (impact on neurite growth,
which is stimulated by wild type Slitrk1). The most
important is fact that both – Slitrk1 gene sequence
and N400I mutations are conservative and occurs in
many species. It gives a chance to repeat the research
carried out by Ozomoro and Zuchner teams on animals in which OC spectrum disorders are observed,
for example chinchillas. There would be a big chance
to explain and understand a basis of fur chewing.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of feeding technology on calf behaviour
Andrzej Kaczor1, Urszula Kaczor2
1
Department of Technology, Ecology and Economics of Animal Production, The National Research Institute
of Animal Production, Balice near Krakow, Poland
2
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
e-mail: andrzej.kaczor@izoo.krakow.pl
Rearing of calves is one of the most difficult stages
of cattle husbandry. The management system and
also the scale of production largely determine the
way milk or liquid feed is administered to calves. The
introduction of automatic calf feeders enabled feeding calves in a group with an individual liquid feed
ration formulated to meet their needs. Ethological
studies provide valuable cognitive information about
the usefulness of certain technological solutions from
the perspective of animal comfort. The objective of
the study was to determine the effect of management
system and liquid feeding method on the behaviour
of calves.
The study was conducted with 30 Holstein-Friesian calves (Black-and-White variety) between 5 and
70 days of age. The control group (K) of 10 female
calves were kept exclusively in individual igloo hutches with outside pens and fed 3 times daily with liquid
feed from nipple buckets. The experimental group
(D) of 20 female calves were kept in individual igloo
hutches and then (until day 70) in group pens in an
open-type calf shed, where they were fed from automatic calf feeders at all times. In the sixth week of life,
24-hour behavioural video observations were conducted to record lying (resting), standing and walking activities as well as liquid feed and concentrate intake. Frequency of feeder visits was also determined.
During that period, animals received 6 kg of liquid
feed and concentrate feed ad libitum. The results were
statistically analysed with SAS ver. 10.
The mean 24-h lying time of calves was 1005.6
min in group D (group pen) and 1055.2 min in group
K. Calves from group D spent significantly more time
standing and walking per 24 h (357.6 min) than did
calves from group K (320.4 min) (P ≤ 0.05). The duration of concentrate feeding was 37.6 min/day in
group D, being significantly shorter than in group
K (52.4 min) (P ≤ 0.01). Calves from group D spent
significantly more time on liquid feed intake (43.2
min) compared to those from group K (12.0 min)
(P ≤ 0.01). The mean frequency of feeder visits was
12 times per day (range of 4 to 36 times).
The management and liquid feeding systems did
not significantly affect the total resting time of calves
per day, but had a significant effect on differences in
the duration of other activities. The greater range of
movement, staying in a group and more frequent
feeder visits in group D pen have increased standing and walking times as well as liquid feeding time
during 24 h. Whereas shorter concentrate intake
time was related to the management system, because
group-housed animals compete for feed and consume it more quickly.
37
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of watering of cows in the milking parlour
on their welfare
Andrzej Kaczor1, Urszula Kaczor2
1
Department of Technology, Ecology and Economics of Animal Production, The National Research Institute
of Animal Production, Balice near Krakow, Poland
2
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
e-mail: andrzej.kaczor@izoo.krakow.pl
During milking, cows lose considerable amounts of
water with milk. This could lead to water deprivation,
which causes discomfort in animals, especially those
milked in parlours with no drinking bowls in the
stalls. Cows that stand idle when being milked, focus
their attention, among others, on udder handling and
undesired movements. The aim of the study was to
determine the effect of using drinking bowls in milking parlour on the behaviour of cows during milking
and on water intake.
The study was conducted with Holstein-Friesian
cows of Black-and-White variety with daily yield of
25–35 kg milk. Cows were milked in a 2 × 6 herringbone milking parlour. Drinking bowls were placed
in the milking stalls. The control group (K) were 76
cows milked in the parlour with no drinking bowls,
and the experimental group (D) consisted of the same
cows after placing the bowls in the milking parlour.
Ethological studies were performed with video camera 1 day before and 30 days after the animals were
watered during milking in the summer period. The
study accounted for restless milking behaviours such
as stepping and kicking the milking unit. Frequency
and amount of water intake during milking was also
38
accounted for. The results were statistically analysed
using Statistica ver. 9, based on one-way analysis variance.
The total stepping behaviour of 76 cows during afternoon milking on day 30 of watering in the milking
parlour (62 stepping events) was significantly lower
than in cows milked on the day before the water
bowls were placed in the parlour (89 stepping events)
(P ≤ 0.01). Also Kicking of the milking unit by cows
on day 30 of watering during milking also was much
less frequent (4 kicking events) than in cows milked
on the day before water bowl placement (12 kicking
events). During milking the 76 cows drank water 73
times on day 30 after bowl placement. A single water
intake by the cows was 8 sec and the amount of water
intake was approx. 2 l/cow.
The use of water bowls in the milking parlour had
a positive effect on behaviour of cows in the parlour,
thus improving their welfare. Giving animals access
to water in the milking parlour to quench their thirst
has made them less restless and nervous during milking. For this reason, the frequency of restless milking
behaviour, such as stepping and kicking the milking
unit has considerably decreased.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of slaughter age on physicochemical
parameters of lamb meat
Aldona Kawęcka, Michał Puchała, Anna Miksza-Cybulska
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: aldona.kawecka@izoo.krakow.pl
Wrzosówka is a native breed of pelt sheep with characteristic grey wool, high prolificacy and very good
adaptation to harsh environmental conditions. Despite its low slaughter parameters, Wrzosówka lamb
meat is considered a delicacy and many consumers
compare it to game meat due to unique taste, aroma
and colour of the meat. The objective of this study
was to determine the effect of lamb slaughter age on
physicochemical and organoleptic properties of meat
obtained from Wrzosówka ram lambs.
Six-month-old ram lambs were kept indoors under semi-intensive feeding conditions. Slaughter was
performed on two dates: at 8 and 10 months of age.
Raw leg muscle (m. biceps femoris) was analysed for
pH of meat 24 and 48 h post mortem, drip loss from
muscle sample during 24-storage, and L*, a* and b*
coordinates 48 h postmortem using a Minolta CR
400. Roasted leg muscle was organoleptically evaluated for aroma, taste, juiciness and tenderness.
The results of this study showed that slaughter age
created significant differences in most of the physicochemical traits. pH measured after 48 h was higher
(6.4 vs. 5.9), and drip loss was lower in the meat of
older lambs. Meat from this group was darker (lower
L* value) compared to that in the group of younger
lambs (43.7 vs. 52.3), with a greater proportion of
redness (higher a* value) – 20.0 vs. 16.8. The organoleptic evaluation of roasted leg showed significant differences in juiciness and tenderness. According to the
testers, these parameters were more favourable for
lamb meat obtained from younger animals.
39
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of housing system on slaughter traits
of native Świniarka lambs
Aldona Kawęcka, Jacek Sikora
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: aldona.kawecka@izoo.krakow.pl
The native breed of Świniarka sheep is very well
adapted to local environmental conditions and is
undemanding in feed. Świniarka sheep perform well
in an extensive management system, on set-aside
land, and are used with success for management of
landscape, including environmentally valuable areas. Świniarka sheep provide very flavoursome meat,
similar to game meat in taste. Lamb carcass known as
Jagnięcina ze świniarki has been included in the List
of Traditional Products.
The purpose of the study was to compare meat
performance of Świniarka ram lambs kept indoors
and on pasture. The experiment was performed in
Subcarpathia at a farm keeping native Świniarka
sheep. Evaluation was made of 20 ram lambs aged 4
months, which were divided into two feeding groups.
Ram lambs in the control group were kept in a sheep
house; they received meadow hay and straw ad libitum as well as around 0.3 kg of crushed oats per lamb.
In the second group, ram lambs remained on pasture
throughout fattening and also received crushed oats.
After reaching 7 months of age, the animals were
40
slaughtered and their carcasses subjected to slaughter
analysis.
At the start of the experiment, the body weight
of 4-month-old lambs averaged 16.5 kg. At the end
of the experiment (3 months later), the body weight
was higher in the group of pastured lambs at 26.2 kg.
Lambs reared indoors were 1.5 kg lighter. Dressing
percentage was 38.2% in the control group and 39.2%
in the pastured group, with a non-significant difference. The pastured group was superior for most of
the carcass measurements except for carcass and loin
length, which were greater in the confined lambs.
The proportion of valuable cuts in the carcasses of
ram lambs from both groups averaged 41%. Slaughter analysis showed that the lamb carcasses differed
in the weight of cuts. The weight of leg, chump and
shoulder was higher for the pastured group with
highly significant differences. Also the meat content
was significantly higher for pastured lambs at 993.3 g
compared to 836.0 g in the control group. It is concluded that pasture management of Świniarka lambs
had a positive effect on the slaughter parameters.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Meat quality in lambs of native breed fed
the diet supplemented with maize DDGS
Aldona Kawęcka, Ewa Sosin-Bzducha
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: aldona.kawecka@izoo.krakow.pl
The rapid development of biofuel production has increased the availability of plant processing by products, mainly rapeseed meal and cake, as well as dried
distiller’s grains (DDGS). Due to their high nutritive
value and relatively low price, these feeds are considered an excellent component of concentrate mixtures
for farm animals. Maize DDGS is most widely used in
sheep nutrition and it is characterized by a high content of crude protein, including a high proportion of
ruminal bypass protein, as well as a high energy value. DDGS can successfully replace both energy and
protein components in the concentrate mixture, and
due to a high content of polyunsaturated fatty acids
it can also modify fatty acid profile of the meat. The
objective of the experiment was to determine meat
quality of Wrzosówka lambs receiving a concentrate
diet containing DDGS.
The control group received a standard diet based
on cereal components and soybean meal, and in the
experimental group soybean meal and part of barley
were replaced with DDGS. The fattening was carried
out for 60 days (up to 8 months of age). Chemical
composition was determined based on the samples
of longissimus dorsi muscle. The composition of fatty
acids was analysed with a VARIAN 3400 gas chromatograph.
The meat of native Wrzosówka lambs fed the
DDGS diet was characterized by a significant increase
in the fatty acids content of C18:2 n-6 (9.73 vs. 6.59%,
respectively) and CLA (1.59 vs. 0.58%, respectively).
The meat of control lambs was found to contain more
of linolenic acid C18:3 (n-3), which was reflected in
a higher proportion of n-3 PUFA in the overall fatty
acid pool. The introduction of DDGS into the concentrates had a beneficial effect on the CLA content
but also caused a deterioration in n-6/n-3 PUFA in
relation to the control group (13.61 vs. 7.06). Our
study shows that the presence of DDGS in lamb concentrates allows modifying the fatty acid profile of
meat fat.
41
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The impact of environmental enrichment
on exploratory and hunting behavior of laboratory
and companion animals
Agata Kokocińska
Institute of Genetics and Animal Breeding of the Polish Academy of Sciences, Jastrzębiec, Poland
e-mail: a.kokocinska@ighz.pl
Environmental enrichment significantly prevents
from various kinds of behavioral disorders, such as
obsessive – compulsive disorder, stereotypy, depression or anxiety and phobias. Exploratory behavior is
a basic need of all animals, and inability to provide it,
prevents the fulfillment of one of the five freedoms,
namely the freedom to express normal behavior. Despite the confined space, which is limited to companion and laboratory animals by the human, this needs
can be satiated to a certain extent. The best type of enrichments for macrosmatic animals (such is the vast
42
majority of laboratory and companion animals) is olfactory stimuli, stimulating the sense of smell. In addition, we distinguish a lot of environmental enrichments using the desire to gain the food (exploration
and hunting behavior) which require a logical action
(mental stimulation) and those that involve animal
physically. Such solutions have a positive impact on
the behavior of animals and prevent to psychosis, that
in the case of laboratory animals should be considered an indirect effect of additional elements on the
test results.
Wpływ wzbogaceń środowiska na zachowania
eksploracyjne i łowieckie zwierząt laboratoryjnych
i towarzyszących
Agata Kokocińska
Instytut Genetyki i Hodowli Zwierząt Polskiej Akademii Nauk, Jastrzębiec
e-mail: a.kokocinska@ighz.pl
Wzbogacenia środowiska w znacznym stopniu zapobiegają różnego rodzaju zaburzeniom behawioralnym, takim jak zaburzenia obsesyjno-kompulsywne,
stereotypie, depresja czy też lęki i fobie. Zachowania
eksploracyjne są podstawową potrzebą wszystkich
zwierząt. Brak możliwości jej zaspokojenia uniemożliwia osiągnięcie jednej z pięciu wolności, czyli wolności do wyrażania naturalnego zachowania. Mimo
zamkniętej przestrzeni, którą człowiek stwarza zwierzętom towarzyszącym i laboratoryjnym, można tę
potrzebę w pewnym stopniu zaspokoić. Najlepszym
typem urozmaiceń dla zwierząt makrosmatycznych
(a do takich należy zdecydowana większość zwierząt
laboratoryjnych i towarzyszących) są bodźce zapachowe, stymulujące węch. Ponadto można wyróżnić
całą gamę urozmaiceń środowiska wykorzystujących
chęć zdobycia pożywienia (eksploracja, zachowania łowieckie), wymagających logicznego działania
(stymulacja psychiczna), oraz takie, które angażują
zwierzę fizycznie. Tego typu rozwiązania wpływają
pozytywnie na behawior zwierząt i zapobiegają psychozom. Jednak w przypadku zwierząt laboratoryjnych należy mieć na uwadze pewien pośredni wpływ
dodatkowych elementów na wyniki badań.
43
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Behaviour of Chinchilla lanigera male kept
under farm conditions – preliminary studies
Stanisław Łapiński1, Iwona Guja1, Katarzyna Mrozicka1,
Piotr Niedbała1, Viktor A. Ilyukha2
Department of Swine and Small Animal Husbandry, University of Agriculture in Krakow, Poland
Institute of Biology, Karelian Research Centre, Russian Academy of Science, Petrozavodsk, Russia
1
2
e-mail: s.lapinski@ur.krakow.pl
Chinchilla breeding in Poland has 60 years of tradition. During this time, not only the scale of production, but also technology and attitude to animals have
changed. Nowadays welfare is one of the most important aspects in modern animal production. Breeders
need to take care not only of good feeding, health and
housing area but also mental comfort. It is necessary
to keep high level of welfare. Modern fur animals
breeding should develop in the way of adapting production technologies to improve quality of animals
life.
The presented study concerned the behavior of
chinchilla male in the polygamous breeding system.
Chinchillas were kept on two farms with different
experience in family life of animals (2 months and
2 years). In both farms the behavior of males was
observed in the variant with access or no access to
an individual cage. Using data from video recording, ethograms were prepared in order to analyse
daily activities for each individual, different farms
or breeding system (with or without individual cage
44
for a male). It was determined that neither farm nor
breeding system had any influence on chinchillas’
daily activities. It was observed that male chinchillas
spent 80% of their time resting and only 20% intaking food and water or other activities. Their activity
levels increased during evening and night hours, and
decreased during the day. Whether they had access to
individual cages or not, male chinchillas spent most
of time in the corridor. In older and more mature
families, where animals were more familiar with each
other, male chinchillas spent less time in the corridor
(approximately 50%) than males in younger families
(approximately 88%). The experiment proved that
male chinchillas with unlimited access to their individual cages spent only 10% of the time in there.
This proves that access to individual cage for a male
in polygamous system is not required for improving
welfare of chinchillas.
Financed by DS-ZHTChiDI 3266/2015.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The differences in the biometric dimensions
of the Silesian horses depending on the share
of other breeds blood in their pedigrees
Jarosław Łuszczyński, Kinga Dobrzańska, Magdalena Pieszka,
Weronika Pisarczyk, Bogusława Długosz, Romana Augustyn,
Zenon Podstawski, Monika Stefaniuk-Szmukier
Department of Poultry Breeding, Institute of Animal Science, University of Agriculture in Krakow, Poland
e-mail: m.pieszka@ur.krakow.pl
The aim of the study was to analyze the biometric
dimensions of Silesian mares and stallions depending on the participation of blood of other breeds in
their pedigrees. We analyzed 838 silesian horses (459
mares, 379 stallions) registered in the I volume of VII
section of the Stud Book of Silesian Horses. Depending on the percentage share of Oldenburg and Thoroughbred horses blood in pedigrees studied horses
were divided into 6 groups. It was found that in the
study population 52.9% mares and 57.7% stallions
had in their pedigrees infusion of other breeds blood.
The height at withers among mares and stallions with
infusion of Oldenburg and Thoroughbred blood was
highly significantly and significantly higher compared
respectively to mares with 12.5% of Oldenburg blood
and Silesian stallions and mares without the addition
of blood of other breeds. Together with increasing of
blood of Oldenburg and Thoroughbred horses decreasing of girth circumference among Silesian stallions was noted. The largest girth circumference was
found in Silesian stallions without the share of foreign
blood what was highly significantly and significantly
different in comparison to other groups of stallions.
The lowest cannon circumference was characterized
for Silesian mares and stallions with 12.5–50% share
of Thoroughbred blood. According to the exterior
evaluation the highest notes were obtained by mares
with 12.5–75% share of Thoroughbred and Oldenburg blood and stallions with 25% share of Oldenburg blood g which highly significantly and significantly different compared to other analyzed groups
of horses. The criteria given in the breed pattern for
horses of old type was met by mares without any share
of foreign blood or only 25% Oldenburg blood share
as well as stallions without any share of foreign blood,
with Oldenburg blood or stallions with share of Oldenburg and Thoroughbred blood together. Horses
in new type were represented only by the Silesian
mares with pedigrees containing more than 25% of
the Oldenburg blood, in the case of stallions none of
the groups did not meet the established requirements.
45
Różnice w wymiarach biometrycznych
koni śląskich w zależności od udziału
w ich rodowodach krwi koni innych ras
Jarosław Łuszczyński, Kinga Dobrzańska, Magdalena Pieszka,
Weronika Pisarczyk, Bogusława Długosz, Romana Augustyn,
Zenon Podstawski, Monika Stefaniuk-Szmukier
Zakład Hodowli Koni, Instytut Nauk o Zwierzętach, Uniwersytet Rolniczy w Krakowie
e-mail: m.pieszka@ur.krakow.pl
Celem pracy była analiza wymiarów biometrycznych
klaczy i ogierów śląskich w zależności od udziału
w rodowodach krwi koni innych ras. Analizie poddano 838 koni śląskich (459 klaczy, 379 ogierów)
wpisanych do I działu VII tomu Księgi Stadnej Koni
Śląskich. W zależności od procentowego udziału
krwi koni oldenburskich i pełnej krwi angielskiej
w rodowodach koni śląskich, klacze i ogiery tej rasy
podzielono na 6 grup. Stwierdzono, że w badanej populacji 52,9% klaczy oraz 57,7% ogierów miało w rodowodach dolew krwi koni innych ras. Wzrost klaczy
i ogierów z dolewem krwi oldenburskiej oraz pełnej
krwi angielskiej okazał się wysoce istotnie i istotnie większy w porównaniu odpowiednio do klaczy
z 12,5% dolewem krwi oldenburskiej i do ogierów
i klaczy śląskich bez dolewu obcej krwi. Wraz ze
zwiększającym się dolewem krwi koni oldenburskich
i pełnej krwi angielskiej zmniejszał się obwód klatki piersiowej ogierów śląskich. Największy obwód
klatki piersiowej stwierdzono u ogierów śląskich bez
dolewu obcej krwi, co wysoce istotnie i istotnie róż-
46
niło się w porównaniu z pozostałymi grupami ogierów. Najmniejszym obwodem nadpęcia cechowały
się zarówno klacze, jak i ogiery śląskie, u których
w rodowodach stwierdzono udział koni pełnej krwi
angielskiej na poziomie 12,5–50%. Pod względem
pokroju najwyżej oceniono klacze z 12,5–75% dolewem krwi oldenburskiej i pełnej krwi angielskiej oraz
ogiery z 25% dolewem krwi oldenburskiej, co wysoce
istotnie i istotnie różniło się w porównaniu z innymi
grupami badanych koni. Kryteria podane we wzorcu
rasowym dla koni w starym typie spełniały klacze bez
dolewu obcej krwi lub z dolewem krwi oldenburskiej
nie większym niż 25% oraz ogiery bez dolewu obcej
krwi, z krwią oldenburską lub ogiery z jednoczesnym
dolewem krwi oldenburskiej i pełnej krwi angielskiej.
Konie w nowym typie były reprezentowane tylko
przez klacze śląskie, w rodowodach których płynęło więcej niż 25% krwi oldenburskiej, w przypadku
ogierów żadna z grup nie spełniała ustalonych wymagań.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Influence of timely gutting fish on intensity
of infection of muscle tissue by the Anisakis larvae
Elena L. Mikulich
The Belarusian State Agricultural Academy, Gorki, Belarus
e-mail: helenamikulich1971@gmail.com
The Republic of Belarus has not a sea access and imports marine fish mainly from the Atlantic, Arctic
and Pacific. The fish are mostly stored frozen (about
80%).
The fish inhabit the natural fisheries can be infected by various types of parasites e.g. nematodes of
genus Anisakis (Dujardin 1845). The most common
representative of this genus is A. simplex, which larvae infect the internal organs and skeletal musculature of host.
The aim of this work was to study of the intensity
of the salmon muscle infection by A. simplex larvae in
dependent to term and manner of gutting.
The frozen carcass of pink salmon (weight 820–
970 g), five ungutted and ten gutted undecapitated
fish, were examined parasitologically.
The Anisakis larvae were found in all analyzed carcasses. However, they were found more often in ungutted fish. The largest number of larvae was detected
in the muscle tissue of abdominal walls (in a single
case even 135 pieces), on the surface of the abdominal
cavity and internal organs (5–9 pieces) and few (1–2
pieces) in the head end of the muscles of the abdominal wall. Quite another picture of infection intensity
was in the gutted salmons. There were found 10–16
parasites on the fish. This can be explained the fish are
emptied as soon as possible and less larvae can penetrate from the abdomen through into the muscles.
The obtained data confirm opinion that post-harvest Anisakis larvae migrate from the body cavity in
contiguous muscle tissue, resulting in lost value of the
raw materials.
47
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The use of PCR and real-time PCR for qualitative
and quantitative determination of horse meat
Małgorzata Natonek-Wiśniewska, Piotr Krzyścin
Department of Animal Genomics and Molecular Biology, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: malgorzata.natonek@izoo.krakow.pl
The authenticity of the food is now a serious problem for scientists, consumers and the food industry
at all levels of the production process. In this sector,
there is time to counterfeiting or unfair supplementation products not complying with the declaration.
EU rules very strictly and regulate in detail the issues
which necessitates the development of techniques
that can catch the prohibited practice. In recent years,
attention has been paid to the possibility of using
molecular methods to identify the species because of
their high sensitivity and specificity, as well as short
and low costs of analysis.
The aim of the work undertaken to develop a sensitive and specific method of qualitative and quantitative determination of the component horse contained
in meat and dairy products.
48
Qualitative identification method was developed
using PCR technology, and the TaqMan probe qPCR
and were used to identify quantitative. The study was
carried out with DNA from horse meat at 100%, 12%,
1.5%, 0.5%, 0.05%. Detection and quantification limits are 0.005% and 0.05%. The results obtained for
quantitation of independent isolation of DNA from
the same samples are reproducible (RSDcT ≤ 0.21%).
Designated concentrations are accurate (for c ≥ 0.05
DC is ≤ 5.01%).
The method enables the determination of DNA
horse food, regardless of the degree of processing of
the sample.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Concentration of heavy metals in increments
of common carp’s scales (Cyprinus carpio L.)
Patryk Nowacki, Ewa Łuszczek-Trojnar, Ewa Drąg-Kozak,
Magdalena Socha, Włodzimierz Popek
Department of Ichthyobiology and Fisheries, University of Agriculture in Krakow, Poland
e-mail: e.trojnar@ur.krakow.pl
The aim of the study was to determine the concentration of heavy metals Cu, Cd, Zn, Ni, Mn, Fe and
Pb in scales of carp coming from two different fish
farms: Experimental Station in Mydlniki supplied
with the Rudawa River and private carp farm in Ludynia supplied with underground water source, and
located at area used for hunting. An additional goal
was to verify thesis that the level of metals in scales
is a permanent indication of environmental contamination. After the decapitation of 3-year-old carp all
their scales were collected for heavy metals analysis.
Some of scales were left as the whole, but the rest of
them were divided precisely into three parts accord-
ing to annual growth rings. Additionally the hepatopancreas and kidney were taken for metal level analysis. In all samples the concentration of studied metals
were determined by atomic absorption method using
the spectrometer ATI UNICAM 929. There were significant differences between concentration of metals
in the scales of carp coming from Ludynia and from
Mydlniki. Statistically significant differences between
metal contents in particular increments of scales were
observed in fish coming from both farms. Obtained
results confirm usefulness of fish scales as the indicator of environmental contamination with heavy metals.
49
Koncentracja metali ciężkich w pierścieniach
przyrostów rocznych łusek trzyletnich karpi
(Cyprinus carpio L.)
Patryk Nowacki, Ewa Łuszczek-Trojnar, Ewa Drąg-Kozak, Magdalena Socha,
Włodzimierz Popek
Katedra Ichtiobiologii i Rybactwa, Uniwersytet Rolniczy w Krakowie
e-mail: e.trojnar@ur.krakow.pl
Celem pracy było określenie koncentracji metali ciężkich, takich jak Cu, Cd, Zn, Ni, Mn, Fe i Pb, w łuskach
karpi pochodzących z dwóch gospodarstw rybackich:
z Rybackiej Stacji Doświadczalnej UR w Mydlnikach,
której stawy są zasilane wodą z rzeki Rudawy, i z prywatnego gospodarstwa karpiowego w Ludyni, którego
stawy zasilane z podziemnych źródeł znajdują się na
terenach wykorzystywanych do polowań. Dodatkowym celem tej pracy była próba weryfikacji tezy, że
poziom metali w łuskach jest trwałym odzwierciedleniem stanu skażenia środowiska. Od trzyletnich
karpi pobrano wszystkie łuski, z których część pozostawiono w całości, natomiast pozostałe podzielono
50
precyzyjnie według pierścieni przyrostów rocznych
na 3 części. Poziom metali określono metodą AAS
przy użyciu spektrometru ATI UNICAM 929. Wykazano istotne różnice w poziomie stężenia metali
w łuskach pomiędzy grupami karpi z gospodarstwa
w Ludyni i w Mydlnikach. Analiza statystyczna wykazała też istotne różnice średnich koncentracji metali
w poszczególnych pierścieniach przyrostów rocznych
łusek ryb z obu gospodarstw. Metale ciężkie trwale
akumulują się w pierścieniach przyrostów rocznych
łusek, co potwierdza przydatność tej tkanki jako
wskaźnika zanieczyszczenia środowiska metalami
ciężkimi.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The freezing point of milk of Polish
Holstein-Friesian cows
Agnieszka Otwinowska-Mindur, Ewa Ptak
Department of Genetics and Animal Breeding, University of Agriculture in Krakow, Poland
e-mail: rzmindur@cyf-kr.edu.pl
The objective of this study was to estimate the influence of milk composition on the freezing point of
first-lactation milk of Polish Holstein-Friesian cows.
Data comprised 1,612,419 milk samples from the
first lactations of 313,744 Polish Holstein Friesian
cows and were made available by the Polish Federation of Cattle Breeders and Dairy Farmers. The cows
calved in 19,402 herds in 2013 and 2014. Six-factor
analysis of variance using the GLM procedure in SAS
was applied to milk freezing point. The following factors were included in the analysis: daily milk yield
(up to 16 kg, 16–24 kg, > 24 kg), fat content (up to
3.6%, 3.6–4.4%, > 4.4%), protein content (up to 3.1%,
3.1–3.5%, > 3.5%), urea content (up to 150 mg/L,
150–270 mg/L, > 270 mg/L), lactose content (up to
4.75%, 4.75–5.00%, > 5.00%) and somatic cell count
(up to 400,000 in mL, > 400,000 in mL).
The mean freezing point of milk (–0.5351ºC) –
and more than 95% of all milk samples – did not exceed the quality limit for the freezing point of cow’s
raw milk, which, following Polish standards, was set
at –0.52ºC. The effects of all examined milk components on the freezing point of milk (fat, protein, urea
and lactose content, somatic cell count) were highly
significant (P < 0.001). Only daily milk yield class did
not affect it significantly (P = 0.0662). On average,
the freezing point was highest for lower daily milk
yield and for lower fat, protein, urea and lactose content. Milk with somatic cell counts over 400,000 had
a slightly higher freezing point (–0.5337ºC) than milk
qualified to the “extra” class, i.e. up to 400,000 somatic
cells in mL (–0.5354ºC).
51
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Concentration of harmful gas components in organic
sheep houses according to the season
Paweł Paraponiak
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: pawel.paraponiak@izoo.krakow.pl
The objective of the study was to evaluate the concentration of harmful gases in organic sheep houses during the summer and winter seasons. Above-normal
concentrations of harmful gas components, especially
in the winter period, could have a direct negative effect
on animal productivity and on the quality of products
obtained. The concentration of CO2, NH3 and H2S
was recorded (Dräger Multiwarn 2 gas analyser) in
four organic sheep houses (hall-type construction,
deep litter, gravity ventilation, normal stocking density) in 6 measurement series. In all the facilities, no
presence of the most harmful compound (H2S) was
found in both the summer and winter periods. CO2
content varied considerably between 0.04 and 0.20%
(P ≤ 0.01), as did NH3 concentration, which ranged
from 1 to 8 ppm (P ≤ 0.05). The measurements were
52
significantly higher in the winter period (0.11‒0.20%
and 4‒8 ppm, respectively) than in the summer period (0.04‒0.14% and 1‒6 ppm, respectively), which
was due to weaker air circulation during this period.
A concentration map of different gases in the buildings showed that their highest accumulation was in
the central part and near the walls deprived of inlet
ventilation holes, whereas in the regions nearer the
walls with ventilation holes their concentration was
lower. In conclusion, the concentration of the analysed gases did not exceed the acceptable limits, and
most of the measurements, especially those taken in
summer, showed much lower levels, which indicates
that stocking density, flooring quality and efficiency
of the ventilation system inside the house were appropriate.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Variation in lamb behaviour according
to the housing system
Paweł Paraponiak
Department of Technology, Ecology and Economics of Animal Production, National Research Institute of
Animal Production, Balice near Krakow, Poland
e-mail: pawel.paraponiak@izoo.krakow.pl
The aim of the study was to determine the effect of
housing lambs in open and semi-open systems on
their behaviour. Behaviour was recorded and analysed for a total of 60 Świniarka ram-lambs of uniform
age. Equal sized groups (20 animals per group) were
kept in three different housing systems: open on pasture (O; permanent pasture with access to overhead
shelter, permanent grazing system); open rotational
grazing on pasture (K; permanent pasture, variable
rotational grazing system); and semi-open backyard
[P; animals kept on green area (not a pasture) with
free 24-hour access to the sheep house]. The results of
the study show considerable (even 10%) differences
in the basic types of observed sheep behaviour depending on the housing system (P ≤ 0.01). In general,
the large pasture area along with greater distribution
of feed (forage) stimulated the higher walking activity of ram-lambs from groups O and K in terms of
pasture exploration – movement of animals and feed
intake itself (25.0, 31.9% and 24.1, 34.2%, respectively). With the increasing pasture area and the simultaneously decreasing proportion of the most palatable
plants (legumes and herbs), animals were engaged in
greater walking activity, spreading into a larger area
in search of the most palatable food, leaving as a result part of the sward ungrazed (this was considerably limited under the rotational system). The lower
walking activity of lambs from group P (19.3%, P ≤
0.01) resulted from the smaller outdoor area available
(which in practice mainly extended the living space
of animals but in terms of fodder base its contribution was marginal) and above all the easier access to
roughage deposited in feeders translated into both
shorter eating time (24.0%) and relatively smaller
mobility of the animals. As a result, animals from the
semi-open system were engaged in less walking activity and spent considerably more time lying down and
standing (36.4 and 20.3%, respectively, P ≤ 0.01).
53
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Characterisation of the population
of border collie dogs breed in Poland
Magdalena Pieszka, Anna Halek, Jarosław Łuszczyński,
Bogusława Długosz, Romana Augustyn, Monika Stefaniuk-Szmukier,
Zenon Podstawski, Weronika Pisarczyk
Department of Horse Breeding, Institute of Animal Science, University of Agriculture in Krakow, Poland
e-mail: m.pieszka@ur.krakow.pl
Border collie, dogs bred in the UK to herding sheep,
well find themselves also in canine sports and field
and rubble rescue. Amazing is their help for people
with disabilities or with depressive disorders. Border
collie, both in the utility and exhibition type, are increasingly popular around the world. In our country
most of the breeding is based on obtaining a dog with
a beautiful conformation and correct body structure,
free from genetic diseases. The first dogs of this breed
were imported into Poland in 1996, since then, the
number of dogs increases together with the number
of kennels, there are now more than 100. In 2014, the
population of dogs registered by the Polish Kennel
Club has increased compared to 2009, almost double
the largest increase was seen in the number of bitches
(2009: 271, 2014: 511) and breeding bitches (2009:
93, 2014: 206). According to statistics, the number
of litters increased from 37 to 82 and also puppies
54
born: the number of males born in 2014 was twice
as high (229) than in 2009 (114). Also the number
of females since 2009 (108) increased to 209, but in
the last two years, it remained at similar level. Among
the provinces with the largest number of representatives of border collie following can be distinguished:
Wielkopolskie, Dolnośląskie, Śląskie, Mazowieckie
and Małopolskie. Most breeding females were recorded in the province Mazowieckie (96), sires in
Śląskie (18 pcs.) and the maximum number of litters
was found in Dolnośląskie (16 litters). Kennels having the largest number of dogs of this breed are: Energizer, Alderaan, Never Never Land, Q’Celtic, Forest Land Chilabo, Alchera, Legendary Star Dust and
Viva La Tia. The most beautiful dogs in the exhibition
were Alderaan PALO ALTO, Trucharm MY Brillantino, Locheil I’M THE DIVA and Tehya DESTINY
OF HER OWN.
Charakterystyka populacji psów rasy
border collie w Polsce
Magdalena Pieszka, Anna Halek, Jarosław Łuszczyński,
Bogusława Długosz, Romana Augustyn, Monika Stefaniuk-Szmukier,
Zenon Podstawski, Weronika Pisarczyk
Zakład Hodowli Koni, Instytut Nauk o Zwierzętach, Uniwersytet Rolniczy w Krakowie
e-mail: m.pieszka@ur.krakow.pl
Border collie, psy wyhodowane w Wielkiej Brytanii
do pasienia owiec, świetnie odnajdują się też w sportach kynologicznych oraz w ratownictwie terenowym i gruzowym. Zadziwiająca jest także ich pomoc
osobom niepełnosprawnym lub z zaburzeniami depresyjnymi. Psy rasy border collie, zarówno w typie
użytkowym, jak i wystawowym, są coraz bardziej
popularne na całym świecie. W Polsce większość hodowli opiera się na uzyskaniu psów o pięknym eksterierze i prawidłowej budowie ciała, wolnych od chorób genetycznych. Pierwsze psy tej rasy sprowadzono
do Polski w 1996 roku. Od tego czasu zwiększa się
nie tylko ich liczba, ale również liczebność hodowli, których obecnie jest już ponad 100. W 2014 roku
populacja psów rejestrowanych przez ZKwP wzrosła
w porównaniu do roku 2009 prawie dwukrotnie, przy
czym największy wzrost był widoczny w liczbie suk
(2009: 271 szt., 2014: 511 szt.) i suk hodowlanych
(2009: 93 szt., 2014: 206 szt.). Według statystyk, z 37
do 82 wzrosła liczba miotów oraz szczeniąt w nich
urodzonych: liczba urodzonych samców w 2014 roku
była dwukrotnie wyższa (229 szt.) niż w 2009 roku
(114 szt.). Także liczba suczek od 2009 roku (108 szt.)
zwiększyła się do 209 szt., jednak w ostatnich dwóch
latach utrzymywała się ona na podobnym poziomie.
Wśród województw z największą liczbą przedstawicieli rasy border collie można wyróżnić: wielkopolskie, dolnośląskie, śląskie, mazowieckie oraz małopolskie. Najwięcej suk hodowlanych odnotowano
w woj. mazowieckim (96 szt.), reproduktorów w woj.
śląskim (18 szt.), a najwyższa liczba miotów została
stwierdzona w woj. dolnośląskim (16 miotów). Hodowle posiadające największą liczbę psów tej rasy to:
Energizer, Alderaan, Never Never Land, Q’Celtic, Forest Land Chilabo, Alchera, Legendary Star Dust oraz
Viva La Tia. Najbardziej utytułowane psy wystawowe
to Alderaan PALO ALTO, Trucharm MY BRILLANTINO, Locheil I’M THE DIVA oraz Tehya DESTINY
OF HER OWN.
55
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Characteristics of work of chosen hippotherapy
centres in southern Poland
Zenon Podstawski, Justyna Kądzior, Bogusława Długosz,
Romana Augustyn, Monika Stefaniuk-Szmukier, Magdalena Pieszka,
Jarosław Łuszczyński, Weronika Pisarczyk
Department of Horse Breeding, Institute of Animal Science, University of Agriculture in Krakow, Poland
e-mail: z.podstawski@ur.krakow.pl
One of the most popular methods used in the therapy
of children is treatment involving horses. While hippotherapy has been known for many years, the availability of the literature and research on the subject is
still very limited.
The horse has served the man in different ways.
In addition to the use for military, transportation and
agriculture purposes, we recognized the therapeutic
relevance of this animal. The impact of hippotherapy,
established through a continuous dialogue between
the patient and the horse’s movement, almost always
is properly coupled with the psychological aspect –
communication with the living creature. Through
direct contact with the body of the horse the sensormotor sphere is activated, allowing the feeling of heat,
56
odors, body awareness, current position in space,
planning movements. The variety of texture in the
construction of the outer horse hair softness, roughness mane and tail, to a large extent contribute to the
proper sphere of sensory stimulation.
The aim of the study was to analyse the activity and
organization of centres of Horse Assisted Therapy.
The analysis included the activity of four randomly selected centres. Based on interviews and observations results demonstrated that: They were wellorganized institutions, the purpose of their activities
was primarily to help disabled patients, all centres
were established timetables, employed highly specialized staff.
Charakterystyka działalności wybranych ośrodków
hipoterapeutycznych w Polsce południowej
Zenon Podstawski, Justyna Kądzior, Bogusława Długosz, Romana Augustyn, Monika
Stefaniuk-Szmukier, Magdalena Pieszka, Jarosław Łuszczyński, Weronika Pisarczyk
Zakład Hodowli Koni, Instytut Nauk o Zwierzętach, Uniwersytet Rolniczy w Krakowie
e-mail: z.podstawski@ur.krakow.pl
Jedną z coraz popularniejszych metod stosowanych
w terapii dzieci są zajęcia z udziałem koni. Chociaż
hipoterapia jest znana od wielu lat, dostępność do literatury oraz badań na ten temat bywa wciąż bardzo
ograniczona.
Od zarania dziejów człowiek wykorzystywał konie. Koń służył i pomagał człowiekowi na różne sposoby. Oprócz wykorzystywania do celów militarnych,
transportu osób i ładunków czy pracy na roli, bardzo
wcześnie dostrzeżono również znaczenie terapeutyczne tego zwierzęcia. Oddziaływanie hipoterapii, odbywające się poprzez ciągły dialog pomiędzy pacjentem
a koniem, jego ruchem, praktycznie zawsze jest odpowiednio sprzężone z aspektem psychologicznym
– komunikacją z żywą istotą. Poprzez bezpośredni
kontakt z ciałem konia aktywizowana zostaje sfera
sensomotoryczna oznaczająca odczuwanie ciepła,
zapachów, świadomość ciała, jego aktualnego położenia w przestrzeni, planowania ruchów. Różnorodność faktury w budowie zewnętrznej konia, miękkość
sierści, szorstkość grzywy i ogona, w dużym stopniu
sprzyjają właściwej stymulacji sfery czuciowej.
Celem pracy była analiza działalności i organizacja ośrodków prowadzących działalność z zakresu hipoterapii. Analizą objęto działalność czterech, losowo
wybranych ośrodków. Na podstawie przeprowadzonych wywiadów i obserwacji własnych wykazano, że:
ośrodki były dobrze zorganizowanymi instytucjami,
celem ich działania była przede wszystkim pomoc
pacjentom, wszystkie ośrodki miały ustalone plany
zajęć, zatrudniano wyspecjalizowaną kadrę psychologiczną, lekarsko-terapeutyczną.
57
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The effect of bacteria addition on the chemical
and microbiological composition of the whole
plant corn silage
Jan B. Pyś1, Zygmunt M. Kowalski1, Marta Malkiewicz1, Jadwiga Flaga1,
Łukasz Korytkowski1, Vanessa Demey2
1
Department of Animal Nutrition and Dietetics, University of Agriculture in Krakow, Poland
2
Lallemand Animal Nutrition, Blagnac, France
e-mail: rzpys@cyf-kr.edu.pl
During this study, the whole maize was ensiled (Pioneer 9400, FAO 270, dry matter 419,7 g ∙ kg–1, particles length 8–10 mm) and the following silages were
prepared: C0 – without addition of bacterial inoculant and CI – CIII with addition of bacterial inoculant (1g of preparation). Inoculants used in the study
contained respectively: CI – Lactobacillus plantarum
6.0 × 104, Pediococcus acidilactici 3 × 103, P. pentosaceus 1 × 104; CII – L. plantarum 2.0 × 105, P. acidilactici 1 × 105, P. pentosaceus 1 × 105, Propionibacterium acidipropionici; CIII – P. acidilactici 1 × 105,
P. acidipropionici 1.5 × 105 CFU∙ g of fresh forage.
The lowest (P < 0.05) DM (402.9 g ∙ kg–1) was found
in the silage CIII, while in the other silages the DM
content equaled: C0 – 409.9, CI – 410.4 and CII –
58
408.3 g ∙ kg–1. Bacterial additives used in the study did
not affect ash, crude protein, NDF and ADF content
in all silages, but decreased (P < 0.05) water soluble
carbohydrates in CI – 2.3, CII – 1.3 and CIII – 1.1 g ∙
kg–1 DM silage, in comparison to the control (C0 – 3.8
g ∙ kg–1). After opening of the container, the amount
of lactic acid bacteria differed significantly (P < 0.05)
between silages and equaled as follows: C0 – 4.9065,
CI – 3.9164, CII – 5.2829 and CIII – 4.6013 log10CFU ∙ g–1 of fresh matter. The highest (P < 0.05) amount
of yeast was found in CIII silage (4.9607), comparing
to the other silages: C0 (4.5694), CI (4.5195) and CII
(4.7556) log10CFU ∙ g–1 of fresh matter. Molds, in the
amount of 0.8000 log10CFU ∙ g–1 of fresh matter, was
isolated only from C0 silage.
Table 1. Chemical and microbiological composition of whole plant maize silage
Item
C0
CI
CII
CIII
Dry matter g · kg–1
409.9b
408.3b
414.2a
402.9c
g · kg–1 of dry matter
Crude ash
39.0a
40.3a
36.7b
37.5ab
Crude protein
81.2
79,0
79,5
79.6
NDF
319.7b
327.1a
316.9b
315.1b
ADF
192.3
192.0
192.9
193.3
WSC
3.8a
1.3a
1.1a
1.1a
log10 jtk · kg–1 of fresh matter
a, b, c, d
LAB
4.9065b
5.2892a
4.4046c
3.9164d
Yeast
4.5694b
4.7556a
3.9543c
4.51195b
Molds
0.8000b
0.0000b
0.0000b
0.0000b
– numbers marked with different letters differ significantly P < 0.05.
59
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The effect of bacteria addition
on the fermentation quality and aerobic stability
of the whole plant corn silage
Jan B. Pyś1, Zygmunt M. Kowalski1, Marta Malkiewicz1, Jadwiga Flaga1,
Łukasz Korytkowski1, Vanessa Demey2
1
Department of Animal Nutrition and Dietetics, University of Agriculture in Krakow, Poland
2
Lallemand Animal Nutrition, Blagnac, France
e-mail: rzpys@cyf-kr.edu.pl
During this study, the whole maize was ensiled (Pioneer 9400, FAO 270, dry matter 419.7 g ∙ kg–1, particles length 8–10 mm) and the following silages were
prepared: C0 – without addition of bacterial inoculant and CI – CIII with addition of bacterial inoculant
(1 g of preparation). Inoculants used in the study contained respectively: CI – Lactobacillus plantarum 6.0
× 104, Pediococcus acidilactici 3 × 103, P. pentosaceus
1 × 104; CII – L. plantarum 2.0 × 105, P. acidilactici
1 × 105, P. pentosaceus 1 × 105, Propionibacterium
acidipropionici; CIII – P. acidilactici 1 × 105, P. acidipropionici 1.5 × 105 CFU ∙ g of fresh forage. The lowest (P < 0.05) DM content (402.9 g ∙ kg–1) was found
60
in the silage CIII. Bacterial additives used in the study
did not affect the pH and NDF content in silages. The
lowest (P < 0.05) amount of N-NH3 (59.8 g ∙ kg–1 of
total-N) and ethanol (19.9 g ∙ kg–1 DM) was found in
silage CIII. Used additives increased (P < 0.05) lactic
acid content (62.4 g ∙ kg–1 DM) and reduced (P < 0.05)
acetic acid content (14.8 g ∙ kg–1 DM) in the silage
CIII, comparing to the concentration of this acids in
the silage C0 (54.4 i 29.1 g ∙ kg–1 DM, respectively).
The aerobic stability period of CI, CII and CIII silages
was significantly longer (P < 0.05) than that of the C0
silage (121 h) and equaled respectively: 168, 162 and
141 h.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Changes in some fat parameters during storage
of butter made from the milk of cows
under two feeding systems
Iwona Radkowska
Department of Technology, Ecology and Economics of Animal Production,
The National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: iwona.radkowska@izoo.krakow.pl
The main determinant of the technological process of
butter making and of the quality and shelf life of the
end product is the quality milk. Raw material quality
is largely determined by feeding method and housing
conditions of the cows, their health, and the hygienic
quality of milk. The aim of the study was to evaluate
parameters of butter made from the milk of cows under two feeding systems: TMR (group I) and pasture
(group II). During control milkings, milk for butter
making was collected three times per season from 10
cows in each group. The properly prepared cream was
churned in a batch-type butter churn for 45‒60 minutes until the granules were the size of 2‒3 mm. After
separation of buttermilk, butter granules were rinsed 3
times with water at 11°C, and then kneaded until water
droplets were evenly distributed. Butter was analysed
after 1, 15 and 30 days of storage. The basic composition, acid value, peroxide value, TBA, iodine value, fat
melting point and fat solidification point were determined at the Department of Animal Product Processing of the University of Agriculture in Cracow.
Butter made from the milk of cows from group II
was characterized by significantly (p ≤ 0.05) higher
acid number, peroxide value, TBA, and iodine number. Peroxide value was slightly exceeded in fat samples after 15-day storage of butter from group II (0.36
meq oxygen ∙ kg‒1 fat) and after 30-day storage of
butter from group I (0.35 meq oxygen ∙ kg‒1 fat). It is
accepted that oxidative rancid smell and flavour are
perceptible with peroxide values above 1. An important quality criterion of milk fat is the proportion of
unsaturated fatty acids expressed as iodine number.
Butter made from the milk of cows from group II
was characterized by higher iodine number at every
stage of storage. The unsaturation index of milk fat is
the main factor determining its nutritive and healthpromoting value, as well as butter consistency. In the
present study, butter from group II had significantly
(p ≤ 0.05) lower melting and solidification temperature. Excessively hard butter consistency, which often
occurs during the winter feeding of cows, is caused,
among others, by the low content of unsaturated fatty
acids. Fat melting and solidification points illustrate
changes in fat consistency depending on temperature,
and butter spreadability depends on their value.
61
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Vitamin and cholesterol content
of milk depending on type of feeding
Iwona Radkowska1, Adam Radkowski2
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
2
Department of Grassland Management, Institute of Plant Production,
University of Agriculture in Krakow, Poland
1
e-mail: iwona.radkowska@izoo.krakow.pl
Milk is an important and well-studied source of fatsoluble vitamins, in particular vitamins A and E. The
concentration of these vitamins in milk depends on
various factors, including feeding season, management conditions, stage of lactation, herd yield, udder health, and genetic factors. Feeding cows with
green roughages has a positive effect on increasing
the content of vitamins A, E, C and b-carotene in
milk. The aim of the study was to determine the effect
of Simmental dairy cow feeding system on the vitamin A and E and cholesterol content of milk. Cows
were divided into three experimental groups. Cows
in group I were kept in a barn and fed TMR, cows in
group II were pastured for approximately 6 h and fed
in a barn with TMR (half the diet of cows from group
I), and cows in group III were kept on pasture and
their feeding was based on pasture sward. The experiment was conducted from May to October. During
control milkings, milk for chemical analyses was collected three times per season from 10 cows in each
group. Vitamins A and E were determined according
to SOP M.001 methodology ver. 6 of 19 March 2012
“Simultaneous determination of vitamins A and E in
62
solid or bulk materials”, and cholesterol according to
SOP M.023a ver. 1 of 20 October 2011 “GC determination of cholesterol in meat and milk”.
Vitamin A content was the lowest in group I (0.36
µg ∙ ml‒1), followed by 0.40 ug ∙ ml‒1 in group II and
significantly higher (p ≤ 0.05) in group III (0.50 ug ∙
ml‒1). Similar relationships were observed for vitamin
E. The lowest content was found in group I (1.01 ug ∙
ml‒1), followed by 1.16 ug ∙ ml‒1 in group II and 1.39
ug ∙ ml‒1 in group 3. Milk cholesterol content showed
considerable variation. Significantly (p ≤ 0.05) the
lowest content was found in the milk of cows from
group III (13.86 mg ∙ 100 g‒1), followed by 15.84 mg ∙
100 g‒1 in group II and the highest (p ≤ 0.05) cholesterol content in the milk of cows from group I (17.71
mg ∙ 100 g–1).
In summary, it is concluded that pasture feeding of
cows has a positive effect on the milk vitamin content
and contributes to reducing milk cholesterol. Fresh
pasture sward is characterized by higher levels of vitamin E and provitamin A compared to conserved
feeds, which is why the milk of grazed cows contains
more vitamins than the milk of cows fed TMR.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of foliar fertilization with silicon on quality
and nutritive value of meadow sward silages
Adam Radkowski1, Iwona Radkowska2
Department of Grassland Management, Institute of Plant Production,
University of Agriculture in Krakow, Poland
2
Department of Technology, Ecology and Economics of Animal Production,
The National Research Institute of Animal Production, Balice near Krakow, Poland
1
e-mail: a.radkowski@ur.krakow.pl
An important criterion for evaluating the quality of
roughages for ruminants is the energy and protein
value. Feed which are given to animals should meet
the requirement for maintenance and production. In
turn, a major concern in plant production is to reduce the effects of adverse environmental factors, especially drought periods. These negative effects can
be attenuated by using preparations that stimulate
processes in plants, which allow for activating stresscoping mechanisms. Silicon is a component that
stimulates the growth and development of plants.
This element is not considered as the components
necessary for the life of plants, or to macronutrients or
micronutrients, however, it is in significant quantities
in most of the plants (especially in monocotyledons)
and this amount is comparable with the contents of
calcium, magnesium and phosphorus. Silicon reduces the toxic effect of excess manganese and iron, positive effects on the ionic balance in plants. It strengthens the cell walls, increases the resistance of plants to
fungal diseases and adverse environment, including
very low temperature and water stress. However, an
excessive amount of silicon decreases the digestibility
of plants. This relationship is important with respect
to the grass, which are used as the only feed in animal
nutrition. Species of the grass family are characterized by differences in silicon content.
The objective of the study was to determine the
effect of foliar fertilization of meadow sward with silicon on nutritive value of silage as well as quality and
basic chemical composition of milk. Analysis of the
silage for chemical composition showed that higher
crude protein content and lower crude fibre content
were obtained for silages made from meadow sward
fertilized foliarly with silicon compared to control
silages. The silage obtained from silicon-fertilized
plants was characterized by higher PDIN and PDIE
values as well as higher energy value (UFL, UFV).
Foliar fertilization of meadow vegetation with silicon
had a positive effect on cow productivity and improved the microbiological quality of milk.
63
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Quality and nutritive value of silages made
from selected grass-legume mixtures
Adam Radkowski1, Iwona Radkowska2
Department of Grassland Management, Institute of Plant Production,
University of Agriculture in Krakow, Poland
2
Department of Technology, Ecology and Economics of Animal Production,
The National Research Institute of Animal Production, Balice near Krakow, Poland
1
e-mail: a.radkowski@ur.krakow.pl
The aim of the study was to compare the chemical
composition and nutritive value of three types of clover-grass mixtures differing in the proportion of red
clover (10, 20 and 40%) and perennial meadow sward
as a control object. The field trial was performed in
2013–2015 in a private farm. The experiment was
conducted on acid brown soil (pHKCl 5.2) of class V.
Each plot had an area of 1200 m2. The experimental
silages were prepared from first cut. The material was
harvested in two stages, first the forage was cut with
a rotary mower at the heading-flowering stage, and
then it was dried by a single tedding. The dry matter
content ranged 35–40%.
After six weeks from preparation of silages were
started feeding. Before feeding, representative samples for chemical analyses were taken from silages to
determine the content of basic components according to the Weende method, pH on a pH meter, and
ammonia level using Conway’s method. The organic
acids content was determined by gas chromatography. Nutritive value was estimated with INRA units
using Winwar software.
64
The grass-legume mixtures were characterized
by significantly higher content of organic and mineral components compared to the control mixture.
The crude protein and crude fat content of the silages
from grass-legume mixtures (average for these three
objects) was higher by 16 and 21%, respectively, and
the content of P, K, Ca, Mg and Na was higher (average values for the three objects grass-legume mixtures) by 12, 15, 19, 13 and 14%, respectively, compared to the control.
The silages contained (in 1kg of DM) in terms of
energy value from 0.77 to 0.92 UFL and from 0.68
to 0.83 UFV and the protein value from 82 to 98 for
PDIN and from 80 to 93 for PDIE. The results show
that 20 and 40% participation of red clover significantly improves the nutritional value of the obtained
silages. The nutritional value will depend on the species composition of sward because not all plants have
the same value as forage. In agricultural practice
should be greater use for the production of silages
grassy-clover sward.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Genetic relationship between conformation traits
and lactose percentage and urea concentration
in milk of Polish Holstein-Friesian cows
Alicja Satoła, Ewa Ptak, Wojciech Jagusiak
Department of Genetics and Animal Breeding, University of Agriculture in Krakow, Poland
e-mail: a.satola@ur.krakow.pl
The objective of this study was to estimate the genetic
correlations of lactose percentage and urea concentration in milk with conformation traits related to udder
and legs of Polish Holstein-Friesian cows. Data consisted of 5.813 test-day records and type scores of 791
primiparous cows. Two descriptive traits (udder, feet
and legs, scored from 50 to 100) and 11 linearly scored
traits (describing udder: fore udder height, rear udder
height, central ligament, udder depth, udder width,
fore teat placement, teat length, rear teat placement;
describing legs: rear legs – side view, foot angle, rear
legs – rear view, on a scale of 1 to 9) were included
in the analysis. Genetic correlations were calculated
based on (co)variances estimated using the Bayesian
method via Gibbs sampling and the multitrait animal
model. Genetic correlations between lactose content
and conformation traits ranged from –0.18 to 0.23.
Genetic correlations between milk urea concentration and conformation traits ranged from 0.02 to
0.39. Average genetic correlations with daily lactose
percentage were higher than 0.15 (ignoring sign) only
for udder (descriptive trait) and a few linearly scored
traits: central ligament, udder depth, rear teat placement, and rear legs – rear view. Milk urea content
was weakly or moderately genetically correlated with
six type traits: udder, and five linearly scored traits:
fore udder height, central ligament, udder width, teat
length, and rear legs – side view. Genetic correlations
between these traits were higher than 0.15 (ignoring
sign). Our results showed that type traits connected
with udder were more highly correlated with both
lactose and milk urea content than leg conformation
traits. Selection for improvement of legs will not affect lactose percentage and milk urea content, but increases in both lactose percentage and milk urea concentration may be expected as an indirect response to
selection for better udder.
65
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of breed and aging time on physicochemical
and organoleptic quality of beef
Ewa Sosin-Bzducha, Michał Puchała
Department of Animal Genetic Resources Conservation,
The National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: ewa.sosin@izoo.krakow.pl
The experiment used the meat of 16 Polish Red-andWhite and Simmental bulls slaughtered at the age of
24 months. Bulls received maize silage and hay or
ensiled hay supplemented with concentrate. Animals
were kept in breed groups in a free-stall building on
straw, and had constant access to water. Physicochemical and organoleptic analyses were carried out
on meat (m. thoracis, n = 64) aged for 1, 7, 14 and
21 days in vaccum bags. Analysis of physicochemical properties include changes in pH, loss during
ripening, the heating loss, color (CIE Lab system)
and shear force (V-blade, Warner-Bratzler). Meat
with a different degree of maturity undergo thermal
treatment was evaluated by a sensory changes in the
intensity and specificity of odor and taste, as well as
discoloration of meat, juiciness and tenderness. Statistical analysis was performed with Statistica ver. 9.1
66
software (2009). The meat from the Polish Red-andWhite breed was characterized by more yellow colour
(5.96 vs. 4.79) and distinctly higher chroma (21.93
vs. 21.06) compared to Simmental meat. The meat
from the conserved breed was more tender (69.28 vs.
93.61 N). During aging, lightening of muscle colour,
increased redness and chroma, and improved tenderness were observed. High scores were given for aroma intensity and taste desirability. The highest scores
were awarded to meat aged for 7 and 14 days. The
evaluation showed that meat tenderness and delicate
texture steadily improved until day 14, after which
they remained at a similar level or slightly deteriorated after 21 days of aging. Meat from the conserved
breed generally had better scores, which could be influenced by better component scores for delicate texture and juiciness, as well as taste intensity.
Wpływ rasy i czasu dojrzewania na jakość
fizykochemiczną i organoleptyczną wołowiny
Ewa Sosin-Bzducha, Michał Puchała
Dział Ochrony Zasobów Genetycznych Zwierząt, Instytut Zootechniki PIB, Balice k. Krakowa, Polska
e-mail: ewa.sosin@izoo.krakow.pl
Materiał doświadczalny stanowiło mięso pochodzące
od 16 buhajków rasy polskiej czerwono-białej i simentalskiej, ubitych w wieku 24 miesięcy. Buhajki żywione były standardowo, kiszonką z kukurydzy i sianem
lub sianokiszonką uzupełnianą paszą treściwą. Zwierzęta utrzymywano w grupach rasowych, alkierzowo,
systemem wolnostanowiskowym na słomie ze stałym
dostępem do wody. Analiza fizykochemiczna i organoleptyczna została przeprowadzona na mięsie (m. thoracis, n = 64) dojrzewającym w workach próżniowych
przez 1, 7, 14 i 21 dni. Analiza cech fizykochemicznych
obejmowała zmiany pH, ubytku podczas dojrzewania,
ubytku termicznego, barwy (system CIE Lab) oraz siły
cięcia (V-blade, Warnera-Bratzler). Mięso o różnym
stopniu dojrzałości poddane obróbce termicznej oceniano sensorycznie pod względem zmian intensywności i swoistości smaku oraz zapachu, a także zmian
barwy mięsa, soczystości i delikatności. Analizę statystyczną przeprowadzono za pomocą programu Statistica ver. 9,1 (2009). Mięso pochodzące od rasy polskiej
czerwono-białej charakteryzowało się bardziej żółtą
barwą (5,96 vs. 4,79) oraz zdecydowanie większym natężeniem barwy (21,93 vs. 21,06) w stosunku do mięsa
pochodzącego od rasy simentalskiej. Mięso pochodzące od rasy zachowawczej charakteryzowało się większą
kruchością (69,28 vs. 93,61 N). W trakcie dojrzewania
obserwowano rozjaśnienie barwy, wzrost wysycenia
w kierunku czerwieni i zwiększenie natężenia barwy,
a także poprawę kruchości mięsa. Wysoko oceniono
intensywność zapachu mięsa oraz pożądalność smaku. Najlepiej oceniano mięso dojrzewające przez 7 i 14
dni. Ocena wykazała poprawę kruchości i delikatności
mięsa następującą stopniowo do 14. dnia, a następnie
utrzymanie parametru na zbliżonym poziomie lub nieznaczny spadek jego oceny po 21 dniach dojrzewania.
Mięso pochodzące od rasy zachowawczej zostało lepiej
ocenione ogólnie, na co wpływ mogły wywrzeć lepsze
oceny cząstkowe w zakresie delikatności i soczystości,
a także intensywności smaku.
67
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of litter size on mortality
of new born cavies’ youngs
Petr Tejml, Miloslav Šoch
Faculty of Agriculture, University of South Bohemia in České Budějovice, Czech Republic
e-mail: tejml@seznam.cz
These days breeding of guinea pig pets is very popular
in Europe and other continents. It has a big potential
to the future, because guinea pigs can be kept and bred
also in town flats. Cavia sows have in one litter from
one to six youngs. The embryonal sacs are very solid
and have to be ruptured by their mothers. This is one of
big problems in a cavy breeding, because due to it up to
40% of youngs are suffocated during the birth.
The aim of this study was to find out the effect of
litter size on mortality new born youngs. The moni-
68
toring was carried out in four cavy studs of hobby
cavies with different animal hygiene conditions and
various type of breeding technology. From the obtained results we can see that mortality of new born
youngs was statistically significant in small and large
litters. The lowest mortality was proved in middle
size litters with three or four youngs. The factor of
breeding technology did not have any influence on
the mortality.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of herd size on implementation
of the genetic resources conservation
programme for Hucul horses
Iwona Tomczyk-Wrona
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
email: iwona.wrona@izoo.krakow.pl
Hucul is a primitive breed of horses, which means
that their development has been strongly influenced
by the natural environment. Because of this, the natural, stable and feeding conditions are of utmost importance to the breed, which is included in the genetic resources conservation programme. Essential
for horses, which are a social species, is the size of
the group in which they live. It is an important factor
influencing not only the physical development, but,
perhaps more importantly, the mental development
of these animals. Polish and foreign authors emphasize the role of herd and its size on the ontogenic
development of the horses. The possibility of living
in a herd allows young horses to develop their herd
instinct, which is particularly important for stallions.
Where horses are only tethered under stable management, the visual and olfactory contact with more
animals itself has a positive effect on maintaining the
relatively normal mental state of the animals. The best
solution would be to keep horses only in large herds,
preferably in the open systems. Unfortunately, for
economic reasons, the realities most often look completely different.
Herd size and the possibility of living in a herd is
particularly important for primitive horses such as
Huculs. The first formal programme for conservation of the breed was developed in 2000 and provided
for a limited number of 210 jobs (allocated each year
in advance) for mares aged 1 year old and above, as
well as for stallions owned by the herds included in
the conservation programme. The payment scheme
has changed since 2005. It was required to own at
least three adult mares that have been entered into
the studbook and selected for the conservation programme. Since 2008, the limit of mares has been decreased to 2 per herd. This met the expectations of
herd owners applying for subsidy, but was detrimental to the horses and their breeding, where 5 brood
mares per herd is considered the minimum for breeding and selection work.
In 2005, 505 mares from 85 herds were selected
for the conservation programme. Most herds (45.9%)
had 4 to 10 mares, 41.2% herds had 3 mares, 5.9%
herds had between 11 and 20 mares, and 3.5% of the
herds had more than 20 mares.
In 2015, 1225 mares in 264 herds were included
in the Hucul horse conservation programme. This
means that in 2015 the number of eligible mares increased 2.4-fold and the number of herds increased
3.1-fold compared to 2005. The number of mares in
69
the herds (2015) is as follows: 58.0% herds have 2 or
3 mares, 35.6% herds have from 4 to 10 mares, 4.9%
herds have from 11 to 20 mares, and 1.5% herds have
more than 20 brood mares. The number of herds with
4 to 10 mares increased from 45.9% in 2005 to 58.0%
in 2015, but the proportion of herds with 11–20 and
more than 20 mares has decreased. The increase in
the population of Hucul horses participating in the
conservation programme is a highly beneficial outcome of the conservation programme, but unfortunately it is not paralleled by an increase in the number
of mares in the herd. The introduction of such a low
70
minimum number of two mares per herd caused that
not only breeders, but also horse “keepers” joined
the conservation programme, which is not good for
the horses themselves. The incomplete herd impact
coupled with inadequate knowledge of the methods
of primitive Hucul horse breeding among the owners, may adversely influence the physical and mental
development of the horses.
Work done as part of the multiannual programme 17–
1.10.9.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of implementing the genetic resources
conservation programme on the distribution
of Hucul horses in Poland
Iwona Tomczyk-Wrona
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: iwona.wrona@izoo.krakow.pl
Huculs, the small primitive mountain horses are
considered one of the oldest Polish breeds with fixed
genotype. The breed originated in the East Carpathian Mountains (Wooded Carpathians), in the upper
reaches of the Cheremosh, Prut, Putylka, Moldova,
Suceava and Tysa Rivers and in the area of Bukovina.
They are descendants of various horse types: Tatar,
Oriental, Arabian, Turkish, Przewalski’s, as well as
horses with Noric blood. However, the exact origin of
the Hucul breed is unknown until today. Importantly,
the breed has developed under the influence of the
environment – harsh mountain climate, scarce feed,
and primitive living conditions.
Their name comes from Hucul highlanders, people with unique culture for whom horses played
a very important role in their daily lives. The first
literary reference to Hucul horses dates from 1603
when Dorohostajski described them in “Hippika”
[Equestrianism] as excellent mountain horses that
perform very well in the harshest conditions. Since
1979, they have reached the status of a conservation
breed and are considered as the national cultural and
breeding heritage.
Work on the domestic conservation programme
for farm animal genetic resources was begun in Poland in 1999. In May 2000, the Ministry of Agriculture accepted the implementation of conservation
programmes for different populations, including the
Hucul horse population. The subsidy granted at that
time as part of the biological fund covered only 210
jobs. The conditions changed in 2005, when the Hucul
conservation programme was expanded to include
505 mares (32.3% from the Małopolskie province,
24.9% from the Podkarpackie province, 10.1% from
the Śląskie and Opolskie provinces, and 8.5% from the
Wielkopolskie province). The least Hucul mares (below 1%) were in the Dolnośląskie, Mazowieckie and
Pomorskie provinces. Zachodnio-Pomorskie and
Podlaskie were the only provinces with no Hucul horses participating in the conservation programme.
The year 2015 has brought major changes, because the number of Hucul mares increased 2.4-fold
to 1225 in relation to 2005. The distribution has also
changed because now the Hucul horses are found
in all the provinces and the number of mares under
71
the conservation programme is comparable in each
province. Today most Hucul mares are found in the
Podkarpackie pro-vince (25.9%) followed by the Małopolskie (20.6%), Lubelskie (10.0%), Łódzkie (7.1%),
Wielkopolskie (6.3%), Warmińsko-Mazurskie (5.6%)
and Mazowieckie (4.9%) provinces. It should be noted that the Hucul breed is perfectly compatible with
conditions of the conservation programme. The fact
72
that Huculs are found in all regions of Poland is indicative of the excellent adaptability of the breed to various environmental conditions, from native mountain
areas to lowlands.
Work done as part of the multiannual programme 17–
1.10.9.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Polish collection and communication of inspection
results system and food chain information system
as tools for welfare improvement at slaughterhouse
Michał Tracz, Agnieszka Jackowska-Tracz, Krzysztof Anusz
Department of Food Hygiene and Public Health Protection, Warsaw University of Life Science, Poland
e-mail: michal_tracz@sggw.pl
Official veterinarians are essential part of a modern
meat inspection model which important part deals
with animal welfare protection. Task in area of welfare protection are divided between official veterinarians, food business operators and livestock producers. Exchange of information between these actors is
important to support them in making inform decisions in area of animal welfare and health.
Food chain information and collection and communication of inspection results (FCI/CCIR) are
key points in modernization of meat inspection at
a slaughterhouse level. FCI and CCIR were designed
to support data exchange between all parties responsible for animal health and welfare. FCI is provided by
livestock suppliers and consist of information on animals health and welfare status. CCIR is an important
task of official veterinarians. Quality data provided by
official veterinarians through CCIR supports animal
health, welfare and food safety as well as environmental protection and sustainability.
Aim of the study was to determine if Polish legal
system and procedures of data exchange performed
by official veterinarians at slaughterhouse are compliant to European Union legal requirements in area of
animal welfare.
Current Polish legal system do not fully facilitate
the ability to share and use food chain information
up and down the food chain. Analysis of polish legal requirements in area of FCI and CCIR leads to
the conclusion that a formal system is compliant with
the requirements of the law but in practice technical
solutions do not fully enable the realization of the set
goals of animal welfare protection.
73
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of ageing time on microstructure
and tenderness of pig semimembranosus muscle
Dorota Wojtysiak, Magdalena Górska, Joanna Wojciechowska
Department of Animal Anatomy, University of Agriculture in Krakow, Poland
e-mail: wojtysiakd@wp.pl
One of the most important meat traits for consumer
satisfaction is meat tenderness. Meat tenderness depends on several factors such as muscle fibre composition, sarcomere length, pH, intramuscular fat content and rate of tenderization. An important role in
shaping meat tenderness is also played by connective
tissue, which has been shown to be a critical factor
in meat tenderness. Therefore, the aim of the current
study was to investigate the effect of ageing time on
muscle fibre traits, structural properties of intramuscular connective tissue and tenderness of m. semimembranosus in pigs.
The study used 12 Polish Landrace × Polish Large
White pigs slaughtered at 105 kg body weight. The
muscle samples of m. semimembranosus were collected immediately after slaughter (45 min) and after storage of meat for 24 h, 96 h and 168 h at +4°C.
Muscle samples were taken to categorize muscle fibre
types (I, IIA and IIB) according to their NADH-TR
activity and immunohistochemical determination of
slow myosin heavy chain. The collagen architecture of
74
the muscles was examined under a scanning electron
microscope JSM-5410. Fibre type percentage, fibre
size and the following meat quality parameters, such
as shear force and collagen content were determined.
The current finding indicate that m. semimembranosus is a typical white muscle, rich in type IIB
glycolytic fibers. Moreover, it was found that after 24
h storage the diameter of type I, IIA and IIB fibres
decreases significantly. The analysis of intramuscular connective tissue under scanning electron microscopes demonstrated that, with ageing time, the
arrangement of collagen fibrils in the perimysium
become looser and less regular and form a loose network structure. In the case of meat quality parameters, no effect of meat storage time on the amount of
total collagen was observed. In contrast, the amount
of soluble collagen and shear force decreased gradually with time of storage.
Funded by DS-3253.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The effect of Pedi bolus specimen
on the improvement of cows’ hooves health
Justyna Żychlińska-Buczek1, Edyta Bauer2, Andrzej Ochrem1,
Elżbieta Sowula-Skrzyńska3, Grzegorz Skrzyński1
1
Department of Cattle Breeding, Institute of Animal Science, University of Agriculture in Krakow, Poland
2
Department of Genetics and Animal Breeding, University of Agriculture in Krakow, Poland
3
Department of Technology, Ecology and Economics of Animal Production,
The National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: jzychlin@ar.krakow.pl
The main goal of every dairy farmer is to achieve
maximum profits. Issues related to the diseases of the
hoof are nowadays one of the three main reasons for
culling cows from the herd. What in addition generates supplementary costs of breeding.
The aim of this thesis was to determine the effect
of Pedi bolus specimen on the reduction the amount
of lameness and improvement of selected reproductive indicators of dairy cows in the herd. The con-
ducted research shows that the using of bolus Pedi
has a beneficial effect on increasing hoofs health.
Period between pregnancies for animals treated with
Pedi bolus was satisfying, whereas ratio for OMW related to the calving period exceeded normative value
(above 405 days). It has been reported a 14% effectiveness increase of the first fertilization and decrease
about a half of the cows number requiring three-time
insemination.
75
Wpływ preparatu Pedi bolus
na poprawę zdrowotności racic krów
Justyna Żychlińska-Buczek1, Edyta Bauer2, Andrzej Ochrem1,
Elżbieta Sowula-Skrzyńska3, Grzegorz Skrzyński1
1
Zakład Hodowli Bydła, Instytut Nauk o Zwierzętach, Uniwersytet Rolniczy w Krakowie
Katedra Genetyki i Metod Doskonalenia Zwierząt, Uniwersytet Rolniczy w Krakowie
3
Dział Technologii, Ekologii i Ekonomiki Produkcji Zwierzęcej,
Instytut Zootechniki – Państwowy Instytut Badawczy, Balice k. Krakowa
2
e-mail: jzychlin@ar.krakow.pl
Głównym celem każdego hodowcy bydła mlecznego jest osiągnięcie maksymalnego zysku. Problemy
związane z chorobami racic to obecnie jeden z trzech
powodów brakowania krów ze stada, co generuje dodatkowe koszty. Celem pracy było określenie wpływu
preparatu Pedi bolus na zmniejszenie liczby kulawizn
oraz poprawę wybranych wskaźników reprodukcyjnych krów mlecznych w stadzie. Z przeprowadzonych badań wynika, że preparat Pedi bolus wpływa
76
korzystnie na poprawę zdrowotności racic. Okres
międzyciążowy u zwierząt, u których zastosowano
preparat, kształtował się na zadowalającym poziomie, natomiast wartość okresu międzywycieleniowego (OMW) przekraczała wartości normatywne (powyżej 405 dni). Zanotowano 14-procentowy wzrost
skuteczności pierwszego zapłodnienia. Natomiast
o połowę zmniejszyła się liczba krów wymagająca
trzykrotnego zabiegu inseminacji.
Session 2
Biotechnology and animal models
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Fur-bearing animals as the models
in biomedical research
Viktor A. Ilyukha1, Svetlana N. Sergina1, Ekaterina P. Antonova1,
Evgeny A. Khizhkin1, Lyudmila B. Uzenbaeva1, Aleksandra G. Kizhina1,
Tatiana N. Ilyina1, Irina V. Baishnikova1, Stanisław Łapiński2, Piotr Niedbała2,
Marcin W. Lis2, Oleg V. Trapezov3, Yongping Xu4
Institute of Biology, Karelian Research Centre, Russian Academy of Science, Petrozavodsk, Russia
2
Faculty of Animal Science, University of Agriculture in Krakow, Poland
3
Institute of Cytology and Genetics, Siberian Branch, Russian Academy of Sciences, Novosibirsk, Russia
4
Dalian University of Technology, China
1
e-mail: ilyukha@bio.krc.karelia.ru
Restriction of crossing, gene drift, and a certain degree of inbreeding in the course of industrial domestication of the fur animals resulted in that many
recessive mutations brought to specialized fur farms
“under cover” of the standard phenotype from natural populations (where they emerged stochastically)
have become homozygous and phenotypically expressed. These mutations have been demonstrated
to have a wide spectrum of pleiotropic effects. In
2014 Adam S. Wilkins with colleagues proposed that
the domestication syndrome results predominantly
from mild neural crest cell deficits during embryonic development. Most of the modified traits, both
morphological and physiological, can be readily explained as direct or indirect consequences of such
deficiencies. Some of these modified traits in domesticated animals are very similar with signs of several
human disorders and consequently might be used in
biomedical research. For example, homozygous white
animals such as Hedlund mink (hh) have symptoms
similar to the Waardenburg syndrome; minks with
the Aleutian coat color gene (a/a) and sapphire foxes
(b/b p/p s/s) have characteristics associated with the
Chédiak-Higashi syndrome.
Moreover, it is possible to use the carnivorous furbearing animals as models in ecological research for
studying applied ecological issues such as pollution,
disease, and global climate change. Some of the characteristics of the mammals make them useful models
for studying these environmental problems are their
trophic importance and environmental sensitivity.
The husbandry and life history of animals reared in
captivity are well understood, and this has permitted
controlled experiments to be conducted.
The study was carried out under state order (projects
№ 0221-2014-0001) and it was partially funded by the
President of the Russian Federation grant for Leading
Scientific School #1410.2014.4 and partially of the grant
for Russian-Polish Interacademic Cooperation.
79
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Transgenic mice in cancer research
Alicja Jozkowicz
Department of Medical Biotechnology, Faculty of Biochemistry, Biophysics and Biotechnology,
Jagiellonian University in Kraków, Poland
email: alicja.jozkowicz@uj.edu.pl
Insights into the molecular and cellular basis of cancer biology are to a large extent derived from small
animal models, especially transgenic mice. The use of
systemic or conditional and tissue-specific knock-out
or knock-in gene targeting strategies, including the inducible and tissue-specific Cas9-dependent mutagenesis, have allowed the generation of loss-of-function
or gain-of-function mutations in tumor suppressors
or proto-oncogenes. Such models become a basic tool
in studies on resistance to drug treatment, oncogene
cooperation, or role of microenvironment in tumor
growth and formation of metastasis. Moreover, lineage tracing has recently been used to explore the
tumor heterogeneity and to analyze neoplastic stem
cells and cancer cell subpopulation dynamics. Finally,
the study of immune response to growing tumor can
be refined by use of patient-derived xenograft in humanized mice, with immune system reconstituted by
human hematopoietic cells, or by conditional cell depletion in mice expressing a diphtheria toxin receptor
under the control of cell-type specific promoter.
Importantly, modification of even minor parameter may significantly influence the model used. In
80
the simplest approach, most frequently applied in
the screening of anticancer drug effectiveness, the
suspension of cancer cells is injected subcutaneously
into mouse. Instead, we have proposed the subcutaneous injection of a single spheroid. Direct comparison of the tumor development from the same number
of cells delivered as a cell-suspension or cell-spheroid
revealed that the latter grew significantly slower, but
were better vascularized and less necrotic. Moreover,
they were more heavily infiltrated by mesenchymal
stromal cells and hematopoietic progenitor cells, and
contained more cells with cancer initiating cell phenotype. Accordingly, spheroid model is the more suitable and sensitive tool for analysis of anticancer drugs
which target tumor angiogenesis or cancer stem cells
or tumor microenvironment.
Thus, mouse models are indispensible for understanding the tumor biology and can be very helpful
in translational studies of anticancer therapies. However, all of them have some limitations, and can be
sensitive to even modest changes in experimental
protocols.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Influence endurance workout on selected
physiological parameters of Arabian horses
Romana Augustyn1, A. Pustuła1, Bogusława Długosz1, Tomasz Próchniak2, Magdalena
Pieszka1, Jarosław Łuszczyński1, Weronika Pisarczyk1, Monika Stefaniuk-Szmukier1,
Zenon Podstawski1
1
Institute of Animal Science, Department of Poultry Breeding, University of Agriculture in Krakow, Poland
2
Department of Biological Basis of Animal Production, University of Life Sciences in Lublin, Poland
e-mail: r.augustyn@ur.krakow.pl
This paper examines the influence of the pressures
exerted on the endurance races horses. The research
was conducted on Arabian horses of different ages
and different training advancement. The aim of this
study was to investigate whether gradually increasing
intensity of effort during the training season affects
the level of selected indicators of blood and physiological parameters of Arabian endurance horses.
3 blood collection were conducted, at each a material of horses at rest, right after exercise and 30 min
after the end of exercise was tested. Moreover, after
each training session the heart rate, movement and
dehydration were examined. The number of haematocrit, leukocytes, erythrocytes and platelets, level of
haemoglobin, value of MCV, MCHC, contains of to-
tal plasma protein (CK) and creatine kinase were determined. The results indicated that horses were good
preparing for the beginning of the season and in the
vast majority their blood parameters were contained
within the reference values. The level of total plasma
protein and haematocrit indicate to the good state of
water and electrolyte management and small variations CK determined for insignificant destructive effects of exercise on the horses muscle tissue. Strong
individual characteristics of obtained results shows
that only year-round research and determination of
individual horse predisposition will allow to precise
determination of progress in training and adequate
reaction from the horse body on the effort.
81
Wpływ treningu rajdowego na wybrane parametry
fizjologiczne koni czystej krwi arabskiej
Romana Augustyn1, A. Pustuła1, Bogusława Długosz1, Tomasz Próchniak2,
Magdalena Pieszka1, Jarosław Łuszczyński1, Weronika Pisarczyk1,
Monika Stefaniuk-Szmukier1, Zenon Podstawski1
Instytut Nauk o Zwierzętach, Zakład Hodowli Koni, Uniwersytet Rolniczy w Krakowie
Katedra Biologicznych Podstaw Produkcji Zwierzęcej, Uniwersytet Przyrodniczy w Lublinie
1
2
e-mail: r.augustyn@ur.krakow.pl
W pracy zbadano wpływ obciążeń, jakim poddane
zostały konie startujące w sportowych rajdach konnych. W doświadczeniu wzięły udział konie czystej
krwi arabskiej w różnym wieku i w różnym zaawansowaniu treningowym. Celem pracy było zbadanie, czy
stopniowo wzrastająca intensywność wysiłku w czasie sezonu treningowego wpływa na poziom wybranych wskaźników krwi oraz parametrów fizjologicznych koni rajdowych. Przeprowadzono 3 pobrania.
Podczas każdego zbadano krew koni w spoczynku,
zaraz po wysiłku i 30 min po zakończeniu wysiłku.
Ponadto, po każdym treningu zbadano tętno, ruch
oraz odwodnienie. Oceniano liczbę hematokrytową,
liczbę leukocytów, erytrocytów i płytek krwi, poziom
hemoglobiny, wartość MCV, MCHC, zawartość białka całkowitego oraz kinazy kreatynowej. Uzyskane
wyniki wskazywały na dobre przygotowanie koni do
sezonu startowego oraz – w zdecydowanej większości – mieściły się w normach referencyjnych. Poziom
82
białka całkowitego i hematokrytu wskazywał na dobry stan gospodarki wodno-elektrolitowej, a małe
wahania powysiłkowego CK stanowiły o mało destrukcyjnym wpływie wysiłku na tkankę mięśniową
koni. Trening rajdowy (wysiłek długotrwały) spowodował wzrost spoczynkowych wartości płytek krwi
oraz krwinek białych. Początek sezonu treningowego charakteryzował się największym wahaniem zawartości białka całkowitego, a wraz z kolejnymi treningami różnice te były znacznie mniejsze. Badane
konie wykazywały się zadowalającym przygotowaniem kondycyjnym do startów w zawodach, czego
dowodzi szybki powrót analizowanych parametrów
krwi do normy po wysiłku. Silnie osobniczy charakter uzyskanych wartości świadczy o tym, że dopiero
całoroczne badania i ustalenie indywidualnych predyspozycji konia pozwoli na precyzyjne określenie
postępów w treningu i adekwatnej reakcji ze strony
organizmu konia na wysiłek.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Experimental gender related obesity effect of diet
Agnieszka Baranowska1, Beata Skowron1, Katarzyna Ciesielczyk1,
Justyna Domagała2, Piotr J. Thor1
1
Department of Pathophysiology, Jagiellonian University Medical College, Krakow, Poland
2
Department of Microbiology, Jagiellonian University Medical College, Krakow, Poland
e-mail: abaranowska@cm-uj.krakow.pl
Introduction: High-calorie diet is responsible for
excessive weight gain. Obesity has recently become
world epidemics, affecting not only adults but also
children, which makes it the biggest health problem
in the world. Yet the underlying mechanism remains
a matter of debate.
Objectives: The aim of this study was to clarify the
role of gender in high fat diet induced obesity in pups
and adult animals.
Materials and methods: Female rats were fed low/
high fat diet during mating, pregnancy and lactation.
The offspring and adult rats fed different diet had
their body weight and temperature measurements
taken twice a week. On the 21st day of the experiment the animals underwent anesthesia in order to
have their blood samples collected for lipid profile.
Results: After 3 weeks on HF diet female pups
body weight was higher than in control group (p <
0.05). Contrary to the female pups, the increase in
body weight was higher (p < 0.05) in male pups and
occurred after 2 and 3 weeks. In adult female rats
body weight increased after 2 weeks on HF, while in
adult male group such weight gain was observed no
sooner than after 3 weeks. After three weeks of the
experiment body weight was correlated positively
(r = 0.941) with lipid profile of adult both gender
groups on HF diet.
Conclusions: In male pups group body weight increased faster and achieved higher values then in female pups. On the contrary, in adult group of females
body weight increased faster than in male rats and
achieved similar values.
83
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Method of positioning the catheter into cisterna
magna and fourth ventricle of the brain in sheep
Aneta Bocheńska1, Agnieszka Pietsch-Fulbiszewska1, Natalia Sowińska1,
Katarzyna Kirsz2
1
Center for Experimental and Innovative Medicine, University Center for Veterinary Medicine UJ-UR,
Krakow, Poland
2
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
e-mail: a.pietsch-fulbiszewska@ur.krakow.pl
Drugs infusion through a catheter into the cisterna
magna (CM) and repeated sampling of the cerebrospinal fluid (CSF) allow to determine the impact of
chemicals on the central nervous system without
passing drugs through the peripheral circulation and
blood-brain barrier. Developing an effective, reproducible and minimally invasive method of collecting
CSF is particularly useful for exploring central nervous system disorders and study the interactions of the
nervous and endocrine systems.
Surgical field included area between the occipital protuberance to the spinous process of the fourth
cervical vertebra, the width of the wings of the first
cervical vertebra. The animal was placed on the right
side. A catheter was introduced into atlanto – occipital space to the cisterna magna. Puncture site was
determined by median line and intracranial-dorsal
edge of the wings of the atlas, caudally to the external
occipital protuberance. The set of disposable Uniever
combined epidural anesthesia minitray (polyurethane catheters, radiopaque, 90 mm, 18G) was used.
Puncture at an angle of approx. 75–80 degrees, nasally, towards to the cisterna magna was performed. The
84
needle was inserted into the mid-length. When the
CSF appeared through the guide – needle the catheter was placed, and then the needle was removed.
The free end of the catheter was sutured to the skin of
the animal and secured by dressing.
The control of the location of the catheter was
carried out by fluoroscopic examination and computed tomography. In the bone window, in the sagittal cross-section of the three-dimensional reconstruction portion of the catheter was visualized in the
cerebrospinal reservoir and the tip was in the lateral
recess of the fourth ventricle of the brain.
The present modified method of injection into
the CM is accurate, replicable, and safe. It might be
applicable for assessing the pharmacological effects
and mechanisms of the central action of drugs on the
nervous system in sheep.
Research supported by DS 3242/KBZ/2015 (Method
of positioning the catheter into cisterna magna and
fourth ventricle of the brain in sheep).
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Intrаbreed variability of the Ukrainian Mountain
Carpathian sheep genetic structure under using
of the different types of molecular genetic markers
Taras Chоkаn1, Anna Radko2, Serhiy Tarasjuk3, Agnieszka Szumiec2, Dominika Rubiś2
Institute of Animal Biology NAAS, Lviv, Ukraine
National Research Institute of Animal Production, Balice near Krakow, Poland
3
Institute of Fisheries NAAS, Kyiv, Ukraine
1
2
e-mail: tchokan@ukr.net
The genetic structure of the population is determined
mainly by the diversity of the gene pool, which includes both the general properties of species and genetic features that have arisen under adaptation of the
population to the specific conditions of its existence.
Thus the analysis of the genetic structure of Mountain Carpathian sheep with different color wool, its
monitoring using different types of molecular genetic
markers is the issue of vital importance.
The research of genetic structures using different
types of molecular genetic markers (DNA markers –
from 11 microsatellite DNA sequences recommended by the FAO for assessing the biodiversity of sheep
and genetic and biochemical systems – 13 loci).
Microsatellite (STR) in most cases, are characterized by species conservatism, but the analysis revealed
a number of markers specific by close groups. In total 106 alleles were detected, the number of which
ranges from 3 (locus MAF65) in sheep with white
wool to 12 (locus INRA63) in sheep with gray wool.
The high polymorphic information content (PIC) it
was averaged 0.740 in groups of sheep with gray wool
and ranged from 0.525 (locus Oar304) to 0.851 (locus
HSC). In our studies, the highest polymorphism was
typical for loci INRA063 in sheep with black wool,
which consisted of 13 alleles while the PIC was 0,865
and the observed heterozygosity (HO) – 0.878.
The results of studies on the genetic structure of
genetic and biochemical systems indicate the presence of intrabreed genetic differentiation. The data
analysis proved that certain genetic and biochemical
systems, particularly Tf and PN, can be used as markers for specific characteristics of the genetic structure
of the studied groups of animals.
For the distribution of allelic variants of genes and
genotypes studied groups differ from one another,
which of course is the result of different factors of natural and artificial selection and different approaches
in the process of breeding them.
85
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The influence of orexin B on spontaneous
and GnRH-stimulated LH secretion from dispersed
pituitary cells of female Prussian carp
Jarosław Chyb, Gabriela Cora, Piotr Lisowski, Magdalena Socha,
Mirosława Sokołowska-Mikołajczyk
Department of Ichthyobiology and Fisheries, University of Agriculture in Krakow, Poland
e-mail: j.chyb@ur.krakow.pl
Orexins are hypotalamic nauropeptides involved in
numerous physiological processes, such as (among
others) the regulation of appetite and sleep. Recent
data show their role as factors influencing the secretory activity of pituitary gland. Therefore, the aim of
this study was to evaluate the influence of orexin B
on LH secretion from the pituitary cells of female
Prussian carp (Carassius gibelio Bloch). For the experiments, the females in two different periods of reproductive cycle (resting stage of gonad development
and periovulatory period) were used. After netting
from pond, fish were transferred to 400 L aquaria
and acclimated for 5 days. After deep anaesthesia followed by decapitation, the pituitaries were removed
and transferred to an incubation medium containing
antibiotic-antimycotic. After rinsing and 7-hour enzymatic dispersion of pituitaries using collagenase A,
the dispersed cells were transferred to sterile 96-well
microplates at amount of 50 000 cells per 250 µl of
medium and subjected to 48 hours of preincubation.
Then, the plates were rinsed and filled with incubation
86
medium containing orexin B at the concentrations of
10–9, 10–8 and 10–7 M or with medium containing
the combination of above mentioned concentrations
of orexin B and synthetic native sGnRH at the concentration of 10–8 M, each group consisted of 6 replicates. After 24-hour incubation the medium from
each well was transferred to 1,5 mL Eppendorf tubes
until LH determination using ELISA. In both periods
of reproductive cycle orexin B stimulated spontaneous LH secretion in a dose dependent manner, being more potent in females during the resting time of
gonad development, while it had no significant influence on GnRH-stimulated LH release. These results
suggest that orexin B may play a positive role on Prussian carp reproduction through a direct stimulatory
influence on LH secretion.
Research was financed by the Ministry of Science and
Higher Education of the Republic of Poland DS 3202/
KIiR.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Prenatal exposure to anti-androgen alters expression
of transcription factor forkhead L2 (Foxl2)
in the fetal porcine ovaries
Iwona Dobosz, Katarzyna Knapczyk-Stwora
Department of Endocrinology, Institute of Zoology, Jagiellonian University in Kraków, Poland
e-mail: katarzyna.knapczyk@uj.edu.pl
In many mammals, including pigs, formation of the
primordial follicles begins during fetal development
and involves the breakdown of egg nests, oocytes separation and subsequent recruitation of somatic cells
(pregranulosa cells). Follicular transition from primordial to primary stage occurs when oocytes are enclosed by a single layer of cuboidal granulosa cells. It
is known that transcription factor Foxl2 is a key regulator of granulosa cells differentiation. Interestingly,
primordial follicle arrest occurs in Foxl2-null mice
due to inhibition of ovarian granulosa cell differentiation. Previously, we have revealed that the prenatal exposure of porcine fetuses to the anti-androgen
flutamide during mid- and late pregnancy resulted
in delayed folliculogenesis. Thus, we hypothesized
that this phenomena may, at least partially, originate
from the disruption in the Foxl2 expression. In order
to study the effect of anti-androgen on Foxl2 expression in the fetal porcine ovaries, pregnant gilts were
injected with flutamide (50 mg/kg bw) between days
43–49, 83–89 or 101–107 of gestation. The fetal ova-
ries (n = 5–12/each group) were obtained on day 50
(GD50), 90 (GD90) or 108 (GD108) of pregnancy. To
assess Foxl2 expression real-time PCR and immunohistochemistry were performed. In the fetal ovaries,
flutamide treatment decreased Foxl2 mRNA level in
all examined groups. Foxl2 was immunolocalized exclusively in the nuclei of somatic cells surrounding
ovarian egg nests in all examined fetuses. Moreover,
this transcription factor was also present in the nuclei of pregranulosa and granulosa cells of primordial
and primary follicles in the GD90 and GD108 groups.
Concluding, diminished androgen action in porcine
fetal ovaries induces downregulation of Foxl2 mRNA
expression, which may affect regulation of gene expression in pregranulosa and granulosa cells and consequently lead to delay in follicle formation and its
transition to the primary stage.
Supported by K/DSC/002997.
87
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Does 2-hydroxyflutamide affect localization
of kinases involved in non-classical testosterone
pathway in prostate cancer cell line LNCaP?
Ewelina Górowska-Wójtowicz1, Laura Pardyak1, Alicja Kamińska1, Anna Hejmej1,
Małgorzata Kotula-Balak1, Joanna Dulińska-Litewka2, Barbara Bilińska1
Department of Endocrinology, Jagiellonian University in Kraków, Poland
Chair of Medical Biochemistry, Medical College, Jagiellonian University in Kraków, Poland
1
2
e-mail: ewelina.gorowska@uj.edu.pl
Testosterone has been shown to act via non-classical
pathway in androgen-dependent prostate cancer cell
line LNCaP. In this way, testosterone activates classical
androgen receptor (AR) which triggers non receptor
tyrosine kinase Src activation and stimulation of the
EGF receptor (EGFR). EGFR undergoes autophosphorylation and leads to binding mitogen-activated
protein kinases (MAPK: Raf, MEK and ERK1/2) to
phosphotyrosines which results in CREB-dependent
gene transcription. Moreover, complex between AR,
Src and regulatory subunit of PI3K – p82α is required
for androgen-stimulated PI3K/Akt pathway activation. The aim of this study was to assess the effect of
an anti-androgen 2-hydroxyflutamide (HF) on the localization of AR and kinases involved in MAPK and
PI3K/Akt pathways in LNCaP cells.
The LNCaP cells were cultured in vitro and treated
for 15 minutes with HF. Changes in AR and kinases
88
localization were visualized by immunocytochemistry using specific rabbit polyclonal antibodies against:
AR, Akt, c-Src, Raf-1 and ERK1/2.
Immunostaining for AR was localized in control
and HF-treated LNCaP cells in the cytoplasm, perinuclear region and frequently as single dots in the
nucleus. The positive signal of Akt was found in the
cytoplasm and along the cell membrane of control
cells whereas HF-treated cells exhibited exclusively
diffused cytoplasmic staining. Immunopositive staining for c-Src, Raf-1 and ERK1/2 was detected in the
cytoplasm of both control and HF-treated LNCaP
cells.
Taken together, HF administration affects localization of Akt which may suggest changes in the activation of PI3K/Akt pathway in androgen-dependent
prostate cancer cell line LNCaP.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The impact of the ration supplemented
with synthetic ß-carotene and silage
with a pumpkin as a source of natural ß-carotene
on the bioactive compounds in colostrum
Gabriela Halik, Andrzej Łozicki, Agata Koziorzębska, Mateusz Makarski,
Magdalena Matusiewicz
Department of Feed Science and Biotechnology, Warsaw University of Life Sciences, Poland
e-mail: gabrysiahalik@wp.pl
Bovine colostrum has various usages, mainly is the
first nutrient-rich food that can get newborn. It is
easily digestible, contains easily digestible nutrients,
provides the first line of defense for the content of immunoglobulin. It works such compounds as immunoglobulins, lysozym, lactoferrin makes colostrum
food exceptional properties preventative and curative
(Szulc 2012). Main of study was the effect of the ration
of cows in the last dry period, enriched with natural
and synthetic b-carotene on the bioactive composition of colostrum.
The study was conducted on 40 simmental cows
breed from the Experimental Institute of Animals
PIB Odrzechowa. The animals were divided into four
groups of 10 individuals each. The colostrum was collected from all cows up to 5 hours after calving, separated it into 50 ml tubes and then frozen at –20°C.
The content of immunoglobulins, PRP, lysozym and
lactoferrin was determineted. The control group(I)
was feeding grass and maize silages and concentrate
additive, in the II group additional 400 mg synthetic
beta-carotene /day/ animal was introduced. Natural
b-carotene, in the III group was introduced to the
pumpkin silage (replacing it partly silage corn, so as
to obtain the above and 400 mg of b-carotene to the
control group), and in the IV group of 50% corn silage replaced pumpkin silage balancing b-carotene.
A higher concentration of immunoglobulin found in
the groups receiving silage with a pumpkin and a synthetic b-carotene. Differences statistically significant
P ≤ 0.05, differences statistically highly significant
P ≤ 0.01. Colostrum from group IV was characterized by the highest concentration of lactoferrin and
lysozyme (P-value) differences in relation to group I.
Were statistically significant differences in groups II,
III, IV compared to group I. Effect of rations on the
affected immunoglobulin levels in colostrum – higher levels of IgG, IgM and IgA were in the group of
synthetic b-carotene, and pumpkin silage compared
group I. Colostrum animals in IV group was characterized by the highest concentration of lactoferrin
and lysozyme-statistically significant differences in
relation to I group.
89
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of phosphodiesterase 8B ablation
on mouse spermatogenesis and steroidogenesis
Alicja Kamińska, Laura Pardyak, Ewelina Górowska-Wójtowicz,
Małgorzata Kotula-Balak, Barbara Bilińska, Katarzyna Szczęśniak, Anna Hejmej
1
Department of Endocrinology, Institute of Zoology, Jagiellonian University in Kraków, Poland
e-mail: ewelina.gorowska@uj.edu.pl
The 3’–5’-cyclic adenosine monophosphate (cAMP)
plays an important role in many biological processes
acting as secondary messenger in intercellular signal
transduction pathways. The cAMP-dependent protein kinase (PKA) signaling pathway regulates gene
expression and the activity of numerous enzymes.
The level of intracellular cAMP is maintained by the
balance between adenylyl cyclase and phosphodiesterases. Phosphodiesterase 8B (PDE8B) is the enzyme
which catalyzes hydrolysis of the cyclic phosphate
bond in cAMP to generate inactive metabolite adenosine 5-monophosphate (5’AMP). The aim of the present study was to examine the role of PDE8B in the
regulation of the proteins crucial for spermatogenesis
(androgen receptor (AR) and N-cadherin) and steroidogenesis (StAR, 3b-hydroxysteroid dehydrogenase
and aromatase) in mouse testis.
The study was performed on testicular tissue isolated from adult Pde8b knock-out mice (KO) and
wild-type C57BL/6 mice. Morphological analysis was
carried out by hematoxylin-eosin staining. Locali-
90
zation and expression of the proteins were analyzed
using immunohistochemistry and Western blot, respectively.
In the testis of KO mice morphological alterations
of the seminiferous epithelium were observed. Immunohistochemical analysis showed delocalization
and decreased staining intensity of N-cadherin and
AR in KO testis when compared to the controls. Decrease of AR, N-cadherin, StAR and aromatase protein, and increase of 3bHSD protein expression were
demonstrated in the testis of KO mice (*P < 0.05)
compared to wild-type mice by WB analysis.
In summary, disturbances in the structure of the
seminiferous tubules, altered localization and expression of studied proteins observed in KO indicate that
PDE8B is an important regulator of cAMP pool involved in the control of both spermatogenesis and
steroidogenesis.
Supported by K/ZDS/005402.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Comparison of antioxidant status in farmed raccoon
dog from Poland and Russia
Tatiana N. Ilyina1, Irina V. Baishnikova1, Viktor A. Ilyukha1, Svetlana N. Sergina1,
Stanisław Łapiński2
1
Institute of Biology, Karelian Research Centre, Russian Academy of Sciences, Petrozavodsk, Russia
2
Department of Swine and Small Animals Breeding, Institute of Animal Sciences,
University of Agriculture in Krakow, Poland
e-mail: ilyina@bio.krc.karelia.ru
Changes in natural photoperiod trigger modifications in many physiological, morphological, and
behavioral processes that are believed to promote
survival in seasonally breeding animals. Seasonality
results in metabolic adjustments that include changes
in the antioxidant defense system that protects organisms against the excess of reactive oxygen species
and this plays an important role in adaptation to environmental factors. The aim of the investigation was
to conduct a comparative study of various indicators
of the antioxidant system activity in farmed raccoon
dog (Nyctereutes procyonoides Gray) from Poland
and Russia in autumn period. Tissue samples (liver,
kidney, heart, lung, spleen, skeletal muscle) were collected in the late autumn when animals show willingness to winter conditions and examined for indicators
of the antioxidant system – vitamin A and E content,
reduced glutathione (GSH) level, activities of super-
oxide dismutase (SOD) and catalase. The data suggest
differences in some indicators between animals from
the two regions. The largest differences between values were observed in the liver and skeletal muscles.
Liver SOD activity, GSH content and vitamin levels
were significantly higher in animals from Russia than
in raccoon dogs from Poland. Also skeletal muscle
of raccoon dog from the colder region had higher
enzyme activities but lower α-tocopherol level than
animals from the warmer region. However, no differences in the values between animals from different localities were detected in heart that demonstrated high
stability of antioxidant defense in this tissue. Results
suggest that raccoon dogs from higher latitudes possess stronger antioxidant capacity than animals from
lower latitudes. These differences appear to be related
to the availability of energy and the relative severity of
climatic conditions in Russian locality.
91
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Agonist and antagonist of 5-HT2B/2C receptor
and ghrelin activate intracellular signal cascades
responsible for melatonin biosynthesis
in the ovine pineal gland
Katarzyna Kirsz, Małgorzata Szczęsna, Dorota A. Zięba
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
e-mail: k.kirsz.ur@gmail.com
Recent research has indicated a participation of ghrelin (GHRL) and serotonin receptors type 2 in the
regulation of melatonin (MEL) biosynthesis and secretion from the ovine pineal gland (PG). Herein, we
examined the role of GHRL, mCPP (a mixed agonist
of the 5-HT2B/2C receptor) and RS 102221 (a highly
selective antagonist of the 5-HT2C receptor) in the
activation of inositol 1,4,5-triphosphate (IP3), diacylglycerol (DAG) and protein kinase C (PKC), leading
to release of MEL from the ovine PG explants. Pineal
glands were collected after sunset from 8 ewes during short days (November). The PG were transected
sagittally into strips (~ 30 mg) with each equilibrated
in 1.0 ml of DMEM for 60 min, followed by a 4-h incubation in medium alone (Control) or in medium
containing: GHRL (100 ng/ml); GHRL (100 ng/ml)
+ m-CPP (10 µM); RS 102221 (10 µM) +m-CPP (10
µM). The PG explants were harvested every 60-min,
frozen in liquid nitrogen and stored at –80°C until
ELISA for IP3, DAG and PKC determinations. Samples of medium were stored at –20°C until RIA for
92
MEL. There was no effect of experimental factors on
IP3 concentrations in the culture of the PG explants.
However, treatment with GHRL decreased (P < 0.05)
DAG concentrations as compared with controls and
GHRL + mCPP group. The RS 102221 + mCPP combination reduced (P < 0.05) DAG and PKC concentrations in comparison to all experimental groups.
Exogenous GHRL and RS 102221 + mCPP inhibited
(P < 0.05) the secretion of MEL as compared to controls, whereas treatment with GHRL + mCPP increased (P < 0.01) the concentration of MEL in relation to all experimental groups. These results indicate
that GHRL and 5-HT2 receptors are involved in the
regulation of MEL biosynthesis and secretion through
activation of DAG/PKC intracellular signal cascade.
This work was supported by grant from the National Science Center (NCN 2012/05/B/NZ4/02408) and the Ministry of Science and Higher Education of Poland (BM4241/KBZ/2015).
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
T FOXO3 genetic variability
in selected Polish sheep breeds
Urszula Kaczor1, Magdalena Luber1, Mirosław Kucharski1, Andrzej Kaczor2
1
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
2
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: rzkaczor@cyf-kr.edu.pl
FOXO proteins are a subgroup of the Forkhead family of transcription factors. This family is characterized by a conserved DNA-binding domain (the ‘Forkhead box’, or FOX) and comprises more than 100
members in humans, classified from FOXA to FOXR
on the basis of sequence similarity. In invertebrates,
there is only one FOXO gene, termed daf-16 in the
worm and dFOXO in the fly. Intriguingly, FoxO transcription factors extend longevity in invertebrates. In
mammals, there are four FOXO genes, FOXO1, 3, 4,
and 6. FOXO transcription factors are at the interface
of crucial cellular processes, orchestrating programs
of gene expression that regulate apoptosis, cell-cycle
progression, oxidative stress resistance, and may also
extend mammalian lifespan. They also regulate energy metabolism and development of a number of
tissues. Recent studies also provide some evidence for
an association between ageing, human longevity, and
variation in the FOXO3 gene. The genetic variability
in FOXO3 may potentially affect sheep lifespan either
directly or indirectly by impacting on factors that
lead to reduced productivity and increased likelihood
of culling. The aim of the study was to identify polymorphisms in exon 2 of the FOXO3 gene in 90 domestic sheep of three breeds: Polish Mountains sheep,
Suffolk meat sheep, and prolific Olkuska sheep. The
test gene consists of 4 exons wherein exon 2 encodes
coding sequence domains of FH (well folded Forkhead DNA-binding domain) and conserved regions
CR2 or CR3, including DNA binding sites of other
genes. This region is highly conservative in many species. The method of PCR-MSSCP was used and the
presence of two patterns of MSCP emerging from
different turnouts was revealed. The sequencing of
the PCR product patterns varying in MSSCP showed
the presence of SNPs which change the amino acid
sequence of synthesized proteins of p. 285 T > I
(g. 845A > C) and p. 288 E > D (g. 825 C > G) (NCBI:
NM_001267889.1).
93
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Identification of SNP c.*1116A > G and c.2218G > A
in the SCD gene of sheep breeds raised in Poland
Mirosław Kucharski1, Urszula Kaczor1, Katarzyna Piórkowska2, Karolina Pastuszak1
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
Department of Genomics and Molecular Biology, National Research Institute of Animal Production,
Balice near Krakow, Poland
1
2
e-mail: mirkuch@op.pl
Stearoyl-CoA desaturase encoded by the SCD gene
is an oxidoreductase class enzyme that catalyzes the
introduction of the first double bond in fatty acids.
Due to its role, stearoyl-CoA desaturase influences
the fatty acid profile of adipose tissue and determines
the quality of animal derived products, i.e. meat and
milk. SCD protein mainly determines the ratio of saturated (SFA) to unsaturated fatty acids (UFA).
The aim of the study was to analyse genetic variation in the stearoyl-CoA desaturase gene.
Biological material was collected from 150 sheep
aged 2–3 years, which belonged to five breeds: Ile de
France, Kołudzka, Olkuska, Polish Mountain Sheep,
and Suffolk. Genomic DNA was isolated from peripheral blood collected at one time from each animal. High resolution melting analysis (HRMA) as
a method of screening for polymorphic sites was used
94
to study genetic variation in 11 fragments containing
regulatory, coding sequences and splicing sites of the
SCD gene. Sequencing of selected samples showed
the presence of two mutations, c.*1116A > G and
c.2218G > A, in the 3’-UTR region. RFLP-PCR reactions using RsaI and BccI enzymes, respectively, were
also designed.
For the c.*1116A > G mutation, alleles A (0.42)
and G (0.58) and genotypes GG (0.33), GA (0.49) and
AA (0.18) were identified. Analysis of the occurrence
of c.2218G > A substitution revealed that only one
animal (of the Suffolk breed) has the GA genotype,
and no homozygote with the AA mutation was found
in any of the breeds. The results obtained will serve to
show the possible effect of the c.*1116A > G mutation
in the region of the stearoyl-CoA desaturase gene on
sheep meat quality.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Identification of SNP c.391 – 66C > T
and c.529 + 27G > C in the PPARγ
gene of sheep breeds raised in Poland
Mirosław Kucharski1, Urszula Kaczor1, Katarzyna Piórkowska2, Katarzyna Zemsta1
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
Department of Genomics and Molecular Biology, National Research Institute of Animal Production,
Balice near Krakow, Poland
1
2
e-mail: mirkuch@op.pl
Peroxisome proliferator-activated receptors (PPAR)
are ligand-activated transcription factors that play
a significant role in several biological pathways associated with lipid, protein and carbohydrate metabolism. PPARγ-activated receptors play a key role
in adipogenesis and lipogenesis. In addition, they
contribute to oxidation of long-chain fatty acids and
are responsible for enhancing gluconeogenesis and
increasing insulin sensitivity. The PPARγ protein
coding gene is responsible for lipid metabolism, thus
affecting the content of individual fatty acids in depot
fat and in the intramuscular fat of muscle tissue.
Biological material was collected from 150 sheep
aged 2–3 years, which belonged to five breeds: Ile de
France, Kołudzka, Olkuska, Polish Mountain Sheep,
and Suffolk. Genomic DNA was isolated from peripheral blood. High resolution melting (HRM)
analysis was used to investigate genetic variation in
8 fragments containing regulatory, coding sequences
and splicing sites of the PPARγ gene. Sequencing of
selected samples showed the presence of c.391 – 66C
> T and c.529 + 27G > C mutations in the region of
introns 4 and 5. RFLP-PCR reactions using the BccI
and HpyCH4III. enzymes, respectively, were designed to identify mutations in the entire population.
In the analysed population, diversified in terms
of breeds, identical allele and genotype distributions
were obtained for the c.391 – 66C > T and c.529 +
27G > C mutations: alleles C/G = 0.10 and T/C = 0.90
and genotypes CC/GG = 0.01, CT/GC = 0.18 and TT/
CC = 0.81. In the case of both SNPs, the high frequencies of the alleles with the mutation may be indicative
of significant differences in the genetic structure of
the analysed breeds compared to the Iranian breeds
of sheep in which these mutations were identified for
the first time.
95
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Analysis of the structure of sperm chromatinin
breeding foxes
Marta Kuchta-Gładysz1, Katarzyna Andraszek2, Piotr Niedbała2,
Agnieszka Otwinowska-Mindur3, Anna Grzesiakowska1, Olga Szeleszczuk1
Department of Animal Anatomy, University of Agriculture in Krakow, Poland
Department of Swine and Small Animal Husbandry, University of Agriculture in Krakow, Poland
3
Department of Genetics and Animal Breeding, University of Agriculture in Krakow, Poland
1
2
e-mail: m.kuchta-gladysz@ur.krakow.pl
While testing semen of breeding animals, steps are
taken towards possibly most accurate evaluation of
sperms’ ability to fertilization. The most recent reports
indicate the fact that the structure of sperms’ chromatin and DNA integrity significantly influence sperms’
functions. The aim of the research was to determine
condensation level in the structure of chromatin of
fresh semen as well as the damage degree in DNA
chain of the chilled semen of tested breeding foxes.
The semen for analysis was collected by means of
a manual method while insemination procedure used
on the farm. 38 foxes including 15 Alopex lagopus
and 23 Vulpes vulpes were used in the experiment.
Sperms of one-year breeding foxes were the subject of
survey. Directly after collecting, macroscopic and microscopic evaluation of the semen with concentration
of 15 × 106 sperms/L mL of semen was performed.
Estimation of chromatin’s structure was conducted
by means of three techniques of staining: aniline blue
(AB, Franken et al. 1999), chromomycin (CMA3, Lolis et al. 1996) and acridine orange (AO, Tejda et al.
1984). To evaluate differences in DNA integrity of the
fresh sperms (0h) and the chilled ones (4º C for 24h
/ 48h / 72h), the semen was diluted to the concen-
96
tration of 10 × 106/5µl and the comet test was used
(SCGE, Singh et al. 1988). The sperms were evaluated
by means of the fluorescent microscope Olympus BX
50, using the lens Olympus UplanApo 100x/1.35/Oil
Iris/∞/0.17. 500 sperms stained with each method
were evaluated for each animal.
The difference between species were investigated by
the one-way analysis of variance with repeated measurements, using SAS. The Tukey Kramer test was used
for multiple comparison. The average percentage of
head DNA was changing during chilled: in the case
of blue foxes from 99.12% (SE = 0.038%) to 97.83%
(0.062%) and in Vulpes vulpes decreased from 99.37%
(SE = 0.028%) to 98.05% (SE = 0.045%). When the
head DNA was analyzed, the highly significant difference (P < 0.01) between species was observed. Similarly, the head DNA differed highly significantly (P <
0.01) in chilled semen (0h / 24h / 48h / 72h), within
species. Sperms with proper histones retention were
mostly observed in the result of staining by AB, CMA3
and AO. The average share of sperms with increased,
improper content of histones was on the similar levels
regardless the staining method, both in Vulpes vulpes
(0–4%) and Alopex lagopus (0–3%).
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of butylated hydroxytoluene on bioavailability
of dietary nutritional compounds
Magdalena Mika, Agnieszka Wikiera, Anna Antończyk, Anna Starzyńska-Janiszewska
Department of Food Biotechnology, University of Agriculture in Krakow, Poland
e-mail: m.mika@ur.krakow.pl
The addition of butylated hydroxytoluene (BHT)
to the diet in animal studies may influence the bioavailability of nutritional compounds. A diet applied
in nutritional studies is usually prepared once at the
beginning of an experiment and thus it is stabilized
with preservatives. Antioxidants are added at small
amounts of 0.001–0.01%. The results of the in-vitro
study showed that the addition of BHT at a dose of
0.01% to the diet containing butter and wheat roll
(1:4) resulted in the increase of fat, carbohydrates and
protein bioavailability. In order to estimate the bioavailability of dietary compounds, the model product
was subjected to the in-vitro digestion and next the
hydrolysate was analysed for the intestinal absorption
(using Caco-2 cell monolayers). The sample with BHT
addition was characterised by the higher bioavailability of protein, glucose, cholesterol and triacylglycerols
as compared to the control one. BHT was proven to
inhibit the activity of digestive enzymes when applied
at 10 times higher concentration than the one used
in our study. It is also established that the peroxidative attack, initiated by Fe2+-ascorbate, resulted in the
reduction of sodium-dependent glucose transport
and lowered the bioavailability of lipids. However, in
the case of our study no differences in the concentration of lipid peroxidation products were observed
between the sample containing BHT and the control.
Thus, further studies concerning the mechanism of
BHT effect on the absorption of nutrients from the
digestive tract are needed.
97
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The role of light and exogenous melatonin
in the regulation of prolactin secretion in sheep
Edyta Molik1, Michał Błasiak1, Tomasz Misztal2, Katarzyna Romanowicz2,
Dorota A. Zięba1
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
Department of Endocrinology, The Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy
of Sciences, Jablonna near Warsaw, Poland
1
2
e-mail: rzmolik@cyf-kr.edu.pl
In seasonal breeding animals, the basic environmental stimulus regulating sexual activity of the body is
changing the length of day light. The aim of the study
was to determine the effect of exogenous melatonin
on prolactin secretion in sheep during pregnancy. The
material of experiment was 60 ewes (Polish Longwool
Sheep). Animals were divided into 3 groups (Group
1 : n = 20, Group 2 : n = 20, Group 3 : n = 20). Fertilization for the first group was carried out on September 15, lambing were held on 15 February. For
Group 2 and 3 were performed on 15th January. The
measurement of concentration of melatonin (MLT)
and prolactin (PRL) carried out by RIA method. The
first blood sampling was performed 6 weeks before
lambing in all groups of sheep, then mothers Group 3
implanted subcutaneous implants of melatonin (Ceva
Animal – Melovine 18 mg). The second blood sampling carried out in 57 day of lactation. Blood samples
were collected each time, every 10 minutes, from the
98
time of the sunset through a catheter inserted into the
jugular vein. 6 weeks before lambing highest concentration of MLT occurred in animals Group 1 (January) (148.15 ± 12.4 pg/ml), while the lowest in sheep
Group 2 (May) (68.0 ± 7.6 pg/ml). The lowest concentration of prolactin has been found in animals in
Group 1 (12.11 ± 2.6 ng/ml), and the highest in sheep
Group 3 (322.0 ± 18.1 ng/ml). The studies from 57
day of lactation have shown that the highest concentration of MLT occurred in sheep Group 3 (106.4 ±
10.7 pg/ml), and the lowest in Group 2 (22.44 ± 8.75
pg/ml). By analyzing changes in the levels of prolactin in the test group of sheep in a 57 day lactation, it
was shown that the highest concentration of PRL occurred in animals from Group 1 (110.55 ± 5.5 ng/ml),
while the lowest in sheep Group 3 (17.17 ± 2.07 ng/
ml). The study showed that the presence of exogenous
melatonin during pregnancy reduced the secretion of
prolactin in 57 day of lactation.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Cryopreservation of bull semen produces
an oxidative damage of sperm proteins
Agnieszka Mostek, Mariola A. Dietrich, Błażej Westfalewicz,
G. Hołownia, Andrzej Ciereszko
Institute of Animal Reproduction and Food Research of Polish Academy of Science, Olsztyn, Poland
e-mail: a.mostek@pan.olsztyn.pl
Artificial insemination is biotechnological advancement that has made a significant contribution to the
genetic improvement, particularly in bulls breeding.
The technique of artificial insemination could not
be conducted on a large scale without cryopreservation of sperm. However, cryopreservation reduces
the functional and structural integrity of bull spermatozoa, and is associated with reactive oxygen species (ROS) production. Oxidative stress during freezing–thawing process of mammalian semen can cause
functional and structural damage to spermatozoa
that impair sperm motility, membrane integrity, and
fertilizing potential.
The aim of this study was to investigate the oxidative modifications of bull spermatozoa proteins
triggered by cryopreservation process. Western blotting, in conjunction with 2D PAGE (2D-Oxyblot)
and MALDI TOF spectrometry, was employed to
identify and quantify the specifically-carbonylated
spermatozoa proteins. We identified 13 protein spots
representing 8 proteins showing significant (p < 0.05)
differences in protein oxidation in response to cryopreservation. These proteins include ropporin, glutathione-S-transferase, phosphatidylethanolamine
binding protein, actin binding protein, actin related
protein, calicin, triosephosphate isomerase and uncharacterized protein C15orf26. Many among the
identified proteins are associated with actin what suggests oxidative damage of cytoskeleton during cryopreservation process. In conclusion, we have demonstrated for the first time that cryopreservation of
bull semen produces an oxidative damage of specific
sperm proteins. Further research is needed to explore
the mechanisms of the particular protein oxidation
changes and to establish the relationship between
those changes and sperm quality.
99
Kriokonserwacja nasienia buhaja powoduje
oksydacyjne uszkodzenia białek plemnikowych
Agnieszka Mostek, Mariola A. Dietrich, Błażej Westfalewicz, G. Hołownia,
Andrzej Ciereszko
Instytut Rozrodu Zwierząt i Badań Żywności Polskiej Akademii Nauk w Olsztynie
e-mail: a.mostek@pan.olsztyn.pl
Sztuczne zapłodnienie jest powszechnie stosowaną
biotechniką w rozrodzie zwierząt gospodarskich, która przyczyniła się do genetycznego udoskonalenia populacji zwierząt gospodarskich, w szczególności bydła. Technika sztucznego zapłodnienia nie mogłaby
być prowadzona na szeroką skalę bez kriokonserwacji
nasienia. Jednakże kriokonserwacja zmniejsza funkcjonalną i strukturalną integralność plemników byka,
co wiąże się z wytwarzaniem reaktywnych form tlenu
(ROS). Stres oksydacyjny podczas procesu zamrażania i rozmrażania nasienia ssaków może powodować
uszkodzenia funkcjonalne i strukturalne plemników,
które upośledzają ich ruchliwość, integralność błony
komórkowej oraz zdolność do zapłodnienia.
Celem niniejszej pracy było zbadanie zmian poziomu utlenienia białek plemnikowych, wywołanych
przez proces kriokonserwacji. Do identyfikacji i określenia specyficznych zmian karbonylacji białek plemników zastosowano metodę western blotting, w po-
100
łączeniu z elektroforezą żelową 2D PAGE (Oxyblot)
oraz spektrometrią mas MALDI TOF. Zidentyfikowano 13 plam białkowych reprezentujących 8 białek
wykazujących istotne (p < 0,05) różnice w poziomie
utlenienia białek w odpowiedzi na kriokonserwację
nasienia. Do białek tych należą: roporyna, transferaza
glutationowa, białko wiążące fosfatydyloetanoloaminę, białko wiążące aktynę, białko związane z aktyną,
calicyna, izomeraza triozofosforanowa, niescharakteryzowane białko C15orf26. Wiele spośród zidentyfikowanych białek jest powiązanych z aktyną, co
sugeruje występowanie oksydacyjnych uszkodzeń
cytoszkieletu w procesie kriokonserwacji. Podsumowując, po raz pierwszy wykazano, że kriokonserwacja
plemników byka powoduje oksydacyjne uszkodzenia
poszczególnych białek plemników. Konieczne są dalsze badania ukierunkowane na zbadanie mechanizmów poszczególnych zmian utleniania białek oraz
relacji pomiędzy tymi zmianami a jakością nasienia.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The pre-established reserve of porcine
preantral follicles – advanced method
of enzymatic isolation and identification
Maria Motal, Kamil Wartalski, Małgorzata Duda
Department of Endocrinology, Institute of Zoology, Jagiellonian University in Kraków, Poland
e-mail: kamil.wartalski@doctoral.uj.edu.pl
Proper follicular development is necessary for the
emergence of functional oocytes. Growth and development of the follicle from the primary to the mature
Graafian follicle stage requires the presence of multiple regulatory factors. Knowledge of the mechanisms
allowing for the proper development of preantral
follicles under physiological conditions is important
because on its basis in vitro follicular maturation can
be performed. So far, the greatest difficulty in the
studies on in vitro preantral follicular development
was low isolation efficiency and low survival rate of
cultured structures. Atresia of follicles was caused by
their improper isolation from ovarian cortex, resulting in their damage and incapability of development
and survival.
The purpose of this study was to develop an efficient and effective method of preantral follicles isolation from the ovarian tissue of sexually immature
pigs.
After isolation of the cortical part of the ovary obtained from slaughterhouses tissue was cut into small
pieces. Slices were placed in a variety of enzymes, to
determine both safe and effective mixture. After that,
histochemical and immunohistochemical staining
was performed to determine the morphology and ultrastructure of isolated follicles.
Results of this study confirmed the effectiveness of
the enzymatic isolation of preantral follicles of large
mammals. The most effective isolation of the preantal follicles was achieved with liberase. Microscopic
observations has proven that this enzyme allowed for
obtaining high amounts of integral follicles. Because
of the preservation of the correct morphology and ultrastructure enzymatically isolated follicles are likely
to be successfully used for further in vitro development. Receiving follicles under extracorporeal conditions requires further research on the factors involved
in the process of follicular development.
Supported by DEC-2013/09/B/NZ9/00226 from National Science Center Poland.
101
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Usefullness of disected sheep heads in paranasal
sinuses endoscopy for physicians
Klaudia Nalik1, Kinga Fic1, Patryk Hartwich2, Paweł Stręk2, Michał Nowakowski1, 3
1
Center for Experimental and Innovative Medicine, University Center for Veterinary Medicine UJ-UR,
Krakow, Poland
2
Chair and Department of Otolaryngology, UJ CM, Krakow, Poland
3
Department of Medical Didactics, UJ CM, Krakow, Poland
e-mail: k.nalik@ur.krakow.pl
Endoscopy is one of the least invasive methods of diagnosing and treatment of nose and sinus diseases.
Proper personnel training continues to be the biggest
obstacle for its widespread use.
Performing surgeries within a narrow visual field,
propriosensoric dissociation and lack of 3D vision,
seem to be the biggest obstacles in this area. Training during actual surgeries is a controversial topic, so
searching for an adequate animal model has a high
priority.
Purpose: Evaluation of using sheep heads as
a training method for: (1) increasing the ability to use
equipment, (2) increasing manual dexterity, (3) planning procedures.
A group of 48 laryngologists participated in training of the use of medical equipment using prepared
sheep heads as a model. Groups of 12 people were
divided into pairs and trained simultaneously, supervised by two laryngologists and two technicians.
Effects of training were then evaluated by the supervisors. Sheep heads were prepared using R. Mla-
102
dina protocol. Karl Storz equipment was used for
training.
All of the personnel finished the training. 56% of
participants rated the animal model as adequate and
21% as good or very good representation of working with humans. 52% of participants stated that the
sheep material allows to adequately train planning
and performing procedures on humans, 43% rated it
as good or very good. Training of endoscopy equipment usage (82% participants rated it as good or very
good) and increasing manual dexterity (82% participants rated it as good or very good, 18% rated it as
adequate) showed best results. According to supervisors, everyone from the study group increased their
abilities significantly. Before training, manual dexterity of the participants was rated as poor for 52% of the
group and 48% as good or adequate. After training
28% were rated as poor and 72% as good or adequate.
Prepared sheep heads are adequate training model
for physicians. Training methodology seems to have
room for optimization.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Preliminary research of chosen biochemical
compounds’ level in the semen of breeding
chinchillas (Chinchilla lanigera)
Piotr Niedbała1, Gabriela Lipień1, Olga Szeleszczuk2, Marta Kuchta-Gładysz2,
Stanisław Łapiński1, Iwona Guja1
1
Department of Swine and Small Animal Husbandry, University of Agriculture in Krakow, Poland
2
Department of Animal Anatomy, University of Agriculture in Krakow, Poland
e-mail: p.niedbala@ur.krakow.pl
The aim of the surveys was to determine fructose and
citric acid levels in breeding chinchilla males semen
plasma. The tests were performed in 40 ejaculates collected by means of electroejaculation method from
young chinchilla males 9–10-month-old (n = 20) and
animals at the age from 2 to 8 years (n = 20). The semen was collected in two periods: summer–autumn
(n = 20) and winter–spring (n = 20). The level of
fructose was determined using Mann’s method and
the level of citric acid by Speck’s method with Mann’s
modification. Preliminary surveys showed that the
content of fructose in semen plasma stood at the average level of 241 in the range from 68 to 538 mg/100
ml. Its slightly higher content was stated in the ejaculates of 9–10-month-old males soon after obtaining
sexual maturity. At the time, it accounted for the average level of 270 mg/100 ml. In the semen plasma
of multiannual males, its amount was 211 mg/100
ml. Small differences between seasons were also observed. Slightly higher rate of mean fructose amounting to 248 mg/100 ml was stated in the winter–spring
period than in the summer–autumn one (233 mg/100
ml). The average level of citric acid which testi-
fies to androgenic activity of testicles amounted to
0.5 mg/100 ml of plasma in the range from 0.081 to
1.16 mg/100 ml. The level of this compound in both
groups was approximate and respectively amounted
to 0.493 mg/100 ml in younger animals and 0.507
mg/100 ml in multiannual ones. However, bigger differences were observed between seasons. In the summer–autumn one, the level of citric acid amounted to
0.471 mg/100 ml and in the winter–spring one it was
0.533 mg/100 ml. Preliminary surveys showed that
the age of animals as well as the season do not influence significantly the change of fructose and citric
acid levels in plasma of breeding chinchillas’ semen.
Only the significant correlation (r = 0.731) between
fructose and citric acid levels in the semen plasma of
9–10-month-old males in the winter–spring period
was observed.
Supported by the Polish Ministry of Science and Higher
Education/National Science Centre under project No
NN311297235 and University of Agriculture Research
Funding No DS 3266/DSSAB/2015.
103
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Analysis of KM1 allele frequency in intron 13
of the KIT gene in solid-coloured Hucul horses
with white markings
Marta Pasternak
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: marta.pasternak@izoo.krakow.pl
Mutations in the KIT gene, which affect hair and coat
pigmentation have been observed in many studies
with humans and different species of animals such as
mice, pigs or horses. One such change is substitution
in intron 13 of the KIT gene in horses with tobiano
pattern. The mutation creates a cutting site for the
restriction enzyme MspI. Earlier research showed,
however, that the presence of KM1 allele (with an additional cutting site) cannot be considered the direct
cause of piebaldism because it is also found in some
horses of solid colour. The aim of this study was to
analyse KM1 allele frequency in solid-coloured Hucul horses with white markings, for the purpose of determining the relationship between this mutation and
the occurrence of undesirable markings on legs and
head. Blood samples collected from the horses were
analysed by PCR-RFLP. Genotype frequency in the
104
experimental group (52 solid-coloured horses with
white markings) was 0.39 for KM0 homozygotes, 0.48
for KM0/KM1 heterozygotes and 0.13 for KM1 homozygotes. In the control group (61 solid-coloured
horses without white markings), the frequency was
0.53 for KM0 homozygotes, 0.39 for KM0/KM1 heterozygotes and 0.08 for KM1 homozygotes. Allele
frequencies were 0.63 for KM0 and 0.37 for KM1 in
the experimental group and 0.74 for KM0 and 0.26
for KM1 in the control group. Based on the results
obtained, no clear relationship was found between
KM1 allele and the occurrence of white markings in
the studied horse group. Comparison of the results
with phenotypic evaluation also revealed no correlation between genotype variant and the size and extent
of markings.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
In vitro LH secretion by female common carp
(Cyprinus carpio L.) pituitary cells incubated
with popular herbicide Roundup
Magdalena Socha, Jarosław Chyb, Mirosława Sokołowska-Mikołajczyk,
Ewa Drąg-Kozak, Włodzimierz Popek
Department of Ichthyobiology and Fisheries, University of Agriculture in Krakow, Poland
e-mail: m.socha@ur.krakow.pl
The aim of the study was to determine the direct effect of Roundup on LH secretion by pituitary cells
collected from common carp (Cyprinus carpio L.). In
Poland, Roundup was sold with the information connected with its biodegradation, but it was shown that
it did not degrade in natural environment. Roundup
was detected in the tissue of animals and humans,
moreover it was also shown that this herbicide has
hormonal activity. Roundup might be used to control aquatic vegetation in ponds, lakes so it was interesting to investigate its effect on fish reproduction.
Gonadotrophs were obtained from 3 sexually mature
female of Common carp (mean body weigh about
4.24 kg) at the time of natural spawning (June). Gonad maturity was specified as a percentage of body
weight (gonadosomatic index GSI) and was about
12.87%. Collected pituitary glands were chopped into
small pieces and exposed to medium containing collagenase A. The dispersed pituitary cells were incubated with different concentrations of Roundup (10,
100 and 1000 ng mL-1 medium) or/and salmon gonadotropin-releasing hormone analogue (sGnRHa)
at the concentration of 10-7 M. The luteinizing hormone (LH) levels in the cultured medium were measured after 24 hours of incubation by ELISA method.
After 24 hours of incubation in the control culture the
LH level was 24,303 ng mL-1 medium. Statistically
important stimulation (33.99 ng mL-1 medium) was
observed in group incubated with sGnRHa as compared to the control. Roundup given at the highest
concentration caused statistically significant increase
in LH secretion (44.88 ng mL-1 medium) after 24 h
of incubation in comparison to control group as well
as to the lowest tested concentration of Roundup. Obtained results show the possible impact of Roundup
on (female) common carp reproduction at the level
of pituitary, by direct stimulating action on LH secretion, what might suggest more careful using of this
popular herbicide specially in the area close to fish
farm.
105
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Application of time-lapse monitoring of embryo
development (TLMED) in different mouse strains
Grzegorz Sokołowski1, Ricardo Faundez2, Zuzanna Sandowska-Markiewicz1,
Marta Gajewska1, Anna Niwińska2, Anita Tyl-Bielicka1, Marek Woszczyński1,
Katarzyna Kermen-Germaniuk1, Sebastian Dąbrowski2,
Monika Petrajtis-Golobow2, Jerzy Ostrowski1
1
The Department of Genetics, Maria Skłodowska-Curie Memorial Cancer Center and Institute of Oncology,
Warsaw, Poland
2
The Department of Large Animal Diseases with Clinic, Faculty of Veterinary Medicine,
Warsaw University of Life Sciences, Center for Biomedical Research (CBB-SGGW), Warsaw, Poland
e-mail: gsokolowski@coi.waw.pl
Time Lapse Monitoring of Embryo Development –
TLMED – is the imaging system to observation the
exact sequence of consecutive events in real-time.
Monitoring of embryo development is the new method which permit an appropriate embryo selection by
the identification of the embryo showing the highest
developmental potential. The purpose of this study was
to check the developmental potential of embryos from
different mouse strains, using TLMED technique.
Animals were 3 (8–10 weeks aged) female mice
from every A.CA/W, BALB/cW, C57BL/6W, C3H/W,
C3Hwad/W, CBAmut/W, superovulated (eCG-5 IU,
hCG-5 IU with 42–48-hour interval), mated with the
male mice form the same strain. After 24 hours, animals were euthanized, necropsy was performed and
embryos were flushed out from the oviducts as routine breeding procedures. Only 1-, 2-, 3- cell cleavages
with normal morphology were obtained (abnormal or
unfertilized were discarded). Embryos were cultured
in the CSC medium containing 10% SSS (Irvine sci,
USA) for 96–120 hours in three gas atmosphere (6%
106
CO2, 5% O2, 89% N2) incubator. The morphometrical
imaging and assessment were provided using Primo
Vision Time-Lapse Embryo Monitoring System (Vitrolife, Sweden).
From C3H/W and C3Hwad/W it was obtained respectively 9/16 and 11/16 blastocysts. C57BL/6W and
CBAmut/W are characterised by lower fraction of embryos with high developmental potential – 3/8 and
6/16 blastocysts obtained. After 96-hour culture, most
of BALB/cW and A.CA/W embryos were dead or
stopped the development at early stages. Re-analysis
with strong pre-selection of embryos (only 2-, 3-cell
embryos were cultured with Primo Vision monitoring) allowed to obtain later stages – 3/60 blastocysts
form A.CA and 2/40 form BALB/cW).
Embryos form different mouse strains show variable developmental potential and timing. Time-lapse
analyze of embryo development may be crucial method for selection of embryos with high developmental
and implantation potential to increase the efficiency
of cryo-banking and embryo transfer.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The role of cumulus cells in in vitro maturation
and in vitro fertilization of oocytes of domestic cat
Natalia Sowińska, Anna Filipczyk, Katarzyna Frankowska, Klaudia Nalik, Kinga Fic
Center of Experimental and Innovative Medicine, University Center of Veterinary Medicine UJ-UR,
Krakow, Poland
e-mail: kinga.fic07@gmail.com
Cumulus cells (CC) are important for oocytes growth,
maturation and fertilization. They supply the oocytes
with nutrients, but during cryopreservation they decrease the permeation of the cryoprotectant into the
oocytes, affecting the results. Studies performed on
cat oocytes showed positive influence of some co-culture systems on resumption of meiosis and fertilization. The aim of the present study was to evaluate the
effect of the co-culture of denuded oocytes with CC
or COC on the results of in vitro maturation (IVM)
(experiment 1) and in vitro fertilization (IVF) (experiment 2). Immature oocytes were collected from ovaries of domestic cat. In experiment 1, oocytes were in
vitro matured for 24 h in four groups: (i) DO, (ii) DO
co-cultures with CC, (iii) DO co-cultured with COC,
(iv) COC as a control group and then denuded mechanically after incubation in 0.2% hyaluronidase. In
experiment 2, COC were IVM for 24 h, then oocytes
were divided into four groups analogous to that in
exp. 1 and IVF. Presumptive zygotes were cultured up
to 7 days. In the end of each experiment oocytes/embryos were stained in Hoechst 33342 (2 µg/ml solution) and observed under the epifluorescence microscope. In experiment 1 of maturation rate of oocytes
decreased significantly in all experimental groups,
when compared to the control group. Maturation
rate amounted 21% (5/24), 14% (4/28), 33% (8/24)
and 50% (18/36) (p < 0.05), in a group (i), (ii), (iii)
and (iv), respectively. In experiment 2, embryos up to
morula stage developed in all experimental groups.
DO and oocytes cultured with COC during fertilization showed lower cleavage rate – 36% (9/25) and
25% (3/12) than those co-cultured with loose CC and
from the control group 43% (12/28) and 42% (16/38),
respectively. Results of this study show that cumulus
cells connected with oocyte into an cumulus oocyte
complex are irreplaceable in the process of maturation of domestic cat oocyte, but addition of loose CC
might be useful in the process of IVF.
107
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Genetic variability in equine GDF9
in Arab and Thoroughbred mares
Monika Stefaniuk-Szmukier1, Katarzyna Ropka-Molik2, Katarzyna Piórkowska2,
Jarosław Łuszczyński1, Magdalena Pieszka1, Tomasz Szmotała2, Bogusława Długosz1,
Romana Augustyn1, Weronika Pisarczyk1, Zenon Podstawski1
Department of Horse Breeding, University of Agriculture in Krakow, Poland
Department of Animal Genomics and Molecular Biology, National Research Institute of Animal Production,
Balice near Krakow, Poland
1
2
e-mail: zpodstawski@ar.krakow.pl
In horses, multiple ovulation resulting implantation of
multiple embryos are adverse. It has been postulated
that multiple ovulation (MO) may have genetic background. Despite the low heritability rate there is few
evidence that this trait is incorporated with sire lines.
Numerous mutations has been found across species
associated with premature ovarian insufficiency, twinning’s, infertility or ovarian hiperstymulation syndrome. Two major: genes: bone morphogenetic protein 15 (BMP15) and growth and differentiation factor
9 (GDF9) are recognized as playing a crucial role in
folliculogenesis and controlling the ovulation rate.
Thus the aim of presented study is structural analysis of GDF9 in horses. Besides we perform variation
screening of investigated gene in population of TB vs.
Arab horse breeds as Thoroughbred which are recognized as having high rate of multiple pregnancy (20
%) whilst Arabs are recognized with low estimation
of this trait.
DNA samples from five mares with confirmed
spontaneous, repetitive multiple ovulation (at least 5
108
seasons of repetitive multiple ovulation in cycles under control of ultrasound scan) and five with no history of MO were Sanger sequenced for entire GDF9
regions (Chr14:42748507-42752672) Sequencing of
GDF9 shown high level of conservativity however
intronic region covers STS (submitted to NCBI, accession numbers: KX139147; KX139148; KX139149):
g.42750467GT[7]GA[9], g.42750467GT[8]GA[11],
g.42750467GT[8]GA[12].
None of them were claimed as functional according to ovulation rate. Thus we genotyped this STS
on sequencer CEQ8000 Genetic Analysis System by
Fragment Analysis application (Beckman Coulter) in
mares grouped by breed Arabians (n = 73) and Thoroughbreds (n = 53). Genotype frequencies were estimated for two breeds and were compare using a Chi
2 test. The analysis indicate that none of the haplotype frequencies were significant in any breeds so we
could suppose that variation in BMP15 GDF9 are not
linked with multiple ovulation in horses.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Pregnancy-induced changes of leptin
concentration in Polish Longwool ewes
Małgorzata Szczęsna, Katarzyna Kirsz, Dorota A. Zięba
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
e-mail: m.szczesna@ur.krakow.pl
Leptin is an adipose-derived hormone characterized
by wide spectrum of actions, particularly in the regulation of food intake, energy homeostasis and reproduction. Pregnancy is a state of physiological hyperphagia, which is an adaptive response that facilitates
energy storage in preparation for the high metabolic
demands of gestation and subsequent lactation. The
aim of this study was to investigate the leptin secretion depending on the stage of pregnancy in Polish
Longwool sheep. The experiments were performed
on 4 pregnant ewes. Females were 3 to 4 years old,
weighed 60 ± 5 kg, and were fed ad libitum. Ewes
were housed under natural photoperiodic and thermoperiodic conditions (19°57’E, 50°04’N) and were
mated in October. Blood samples (5 ml) were collected at 15-min intervals beginning at dusk and were
continued for 4 hrs under the red light. Experimental
treatments were repeated at 2-weeks intervals starting before mating (–15 d.g.; day of gestation) and
continuing between 30 and 135 day of pregnancy.
Leptin concentration in the plasma were determined
using RIA. Results of experiments provided that leptin concentration increased during the first half of
pregnancy and after peaking at day 60 (4.01 ± 0.30
ng/ml), it began to decline. Concentration of leptin
observed in periparturient ewes at 135 d.g. (1.44 ±
0.13 ng/ml) was comparable to concentration noticed
before mating (1.42 ± 0.09 ng/ml) and during the first
month of pregnancy (1.21 ± 0.09 ng/ml).
These findings confirm that, in seasonally breeding ewes, pregnancy-induced hyperphagia occurs
despite of the high concentration of leptin in midgestation and support the hypothesis that pregnant
females become resistant to the anorectic actions of
leptin.
Research supported by NCN 2013/09/B/NZ4/01532.
109
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Analysis of changes in the frequency of FST genotypes
depending on inbreeding of native Puławska sows
Magdalena Szyndler-Nędza1, Katarzyna Ropka-Molik2, Katarzyna Piórkowska2,
Aurelia Mucha1, Marek Babicz3, Tadeusz Blicharski4
Department of Animal Genetics and Breeding, National Research Institute of Animal Production,
Balice near Krakow, Poland
2
Department of Genomics and Animal Molecular Biology, The National Research Institute
of Animal Production, Balice near Krakow, Poland
3
Department of Swine Breeding and Production Technology, University of Life Sciences in Lublin, Poland
4
Institute of Genetics and Animal Breeding of the Polish Academy of Sciences, Jastrzębiec, Poland
1
e-mail: aurelia.mucha@izoo.krakow.pl
Increased inbreeding in a population has a negative effect mainly on reproductive and health traits.
In small populations, it is recommended to monitor the inbreeding and genetic variation based on
the polymorphism of marker loci alleles. Follistatin,
a cytokine isolated from the ovarian follicular fluid
of pigs, has multiple activities. Blowe et al. [2006],
who underlined the physiological role of follistatin,
proposed the FST gene as a marker of reproductive
traits in sows. The aim of the study was to analyse
the effect of the inbreeding coefficient on changes in
the frequency of FST genotypes (follistatin; 16q14)
in a small number native Puławska breed. Based on
pedigree analysis, it was classified into five groups according to the coefficient of inbreeding F: (F < 0.008
(1); 0.008 ≤ F < 0.0313 (2); 0.0313 ≤ F < 0.0625 (3);
0.0625 ≤ F < 0.098 (4); F ≥ 0.098 (5)). A total of 131
sows were chosen from the groups for further study
and samples of biological material (hair bulbs) were
collected from the animals. Most of the analysed animals had the homozygous genotype FST BB (59.38%),
followed by heterozygous FST AB (30.47%) and FST
110
AA genotypes (10.16%). The chi-square test based on
Hardy-Weinberg equilibrium demonstrated that the
studied group of sows is not in genetic equilibrium
(P = 0.0496). Detailed analysis of the changes in FST
genotype frequency in different inbreeding groups
showed the lack of genetic equilibrium in group
two (0.008 ≤ F < 0.0313, P = 0.0155) and above all
in group five which had the highest inbreeding coefficient (F ≥ 0.098, P = 0.0000). A relationship was
also observed between the inbreeding coefficient and
the frequency of FST genotypes (Spearman correlation). As the inbreeding coefficient increased to F <
9.8%, the number of animals with FST BB genotype
increased significantly (r = 0.199; P ≤ 0.05). However, when the inbreeding value of sows exceeded F ≥
9.8%, the number of animals with FST BB and FST
AB genotypes decreased. In summing up the results,
it is concluded that the increase in the inbreeding coefficient of Puławska sows beyond F ≥ 9.8% was related to a reduced number of sows with the FST B allele
(FST BB and FST AB) in their genotype.
Analiza zmian frekwencji genotypów
genu FST w zależności od zinbredowania loch
rodzimej rasy puławskiej
Magdalena Szyndler-Nędza1, Katarzyna Ropka-Molik2, Katarzyna Piórkowska2,
Aurelia Mucha1, Marek Babicz3, Tadeusz Blicharski4
Dział Genetyki i Hodowli Zwierząt, Instytut Zootechniki – PIB w Balicach k. Krakowa
Dział Genomiki i Biologii Molekularnej Zwierząt, Instytut Zootechniki – PIB w Balicach k. Krakowa
3
Katedra Hodowli i Technologii Produkcji Trzody Chlewnej, Uniwersytet Przyrodniczy w Lublinie
4
Instytut Genetyki i Hodowli Zwierząt PAN w Jastrzębcu
1
2
e-mail: magdalena.szyndler@izoo.krakow.pl
Wzrost wartości inbredu w populacji wpływa negatywnie przede wszystkim na cechy związane z rozrodem i zdrowotnością. W małych populacjach zalecane jest monitorowanie inbredu oraz zmienności
genetycznej na podstawie wskaźników polimorfizmu
alleli loci markerowych. Folistatyna należy do cytokin, wydzielonych z płynu pęcherzykowego jajników
świni, o wielokierunkowym oddziaływaniu. Blowe
i inni [2006], podkreślając fizjologiczną rolę folistatyny, zaproponowali gen FST jako marker cech rozpłodowych loch. Celem pracy była analiza wpływu wartości współczynnika inbredu na zmianę frekwencji
genotypów genu FST (follistatin; 16q14) u mało licznej rodzimej rasy puławskiej świń. W oparciu o analizę rodowodową podzielono ją na pięć grup o określonej wartości współczynnika inbredu F (F < 0,008 (1);
0,008 ≤ F < 0,0313 (2); 0,0313 ≤ F < 0,0625 (3); 0,0625
≤ F < 0,098 (4); F ≥ 0,098 (5)). Z wyznaczonych grup
wytypowano do dalszych badań 131 loch, od których pobrano materiał biologiczny – cebulki włosowe. U analizowanych osobników najwięcej miało
genotyp homozygotyczny FST BB (59,38%), następ-
nie heterozygotyczny FST AB (30,47%) i FST AA
(10,16%). Analiza Ch2 zgodnie z prawem Hardy’ego-Weinberga wykazała, że objęta badaniami grupa
loch nie jest w równowadze genetycznej (P = 0,0496).
Analizując szczegółowo zmiany frekwencji genotypów FST w poszczególnych grupach inbredu, stwierdzono brak równowagi genetycznej w grupie drugiej
(0,008 ≤ F < 0,0313, P = 0,0155) i przede wszystkim
w grupie piątej o najwyższej wartości współczynnika
inbredu (F ≥ 0,098, P = 0,0000). Wykazano również
zależność między wartością współczynnika inbredu
a frekwencją genotypów genu FST (korelacja Spearmana). Wraz ze wzrostem współczynnika inbredu (do
wartości F < 9,8%) istotnie wzrastała liczba osobników o genotypie FST BB (r = 0,199; P ≤ 0,05). Jednak
przekroczenie wartości inbredu loch F ≥ 9,8% skutkowało zmniejszeniem liczby osobników o genotypie
FST BB i FST AB. Podsumowując uzyskane wyniki,
można stwierdzić, że wzrost wartości współczynnika
inbredu loch rasy puławskiej powyżej F ≥ 9,8% związany był ze zmniejszeniem liczby loch posiadających
w genotypie allel FST B (FST BB i FST AB).
111
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Extract from pine needle enriched with L-arginine
prevents the protein malnutrition of American mink
(Neovison vison) kits
Aleksey R. Unzhakov1, Nikolay N. Tyutyunnik1, Svetlana N. Sergina1,
Nadezhda P. Chernobrovkina2, Ekaterina P. Antonova1, Lyudmila B. Uzenbaeva1,
Irina V. Baishnikova1, Viktor A. Ilyukha1, Stanisław Łapiński3, Piotr Niedbała3
Institute of Biology, Karelian Research Centre, Russian Academy of Science, Petrozavodsk, Russia
Forestry Research Institute, Karelian Research Centre, Russian Academy of Science, Petrozavodsk, Russia
3
Institute of Animal Sciences, University of Agriculture in Krakow, Poland
1
2
e-mail: uar@bio.krc.karelia.ru
Protein malnutrition leads to metabolic changes
which are accompanied by a reduced growth rate in
kits and a restriction of the biotic potential of an organism. This might be of particular importance for
strict carnivores, for example, cat and mink (Neovison
vison) because of their higher protein requirements
than in other domestic mammals. Prevention or
treatment of mammals’ protein malnutrition during
the early postnatal period of life might be achieved
by the supplementation of the diet with L-arginine.
A search for the new sources of this essential amino
acid led to use the extract from pine needle enriched
with L-arginine in mink diet. Moreover, pine needles
are the source of numerous vitamins, microelements
and also 18 free amino acids.
This study aimed to investigate the effect of extract
from pine needle enriched with L-arginine on weight
gain and protein metabolism in hypotrophic mink
kits during the early post-weaning period of rapid
growth. A total of 20 two-months-old mink kits of the
standard dark-brown genotype with signs of hypotro-
112
phy were used. They were divided into two groups:
control and experimental. The control animals were
fed the basal diet and the experimental animals were
fed the basal diet supplemented with 5 ml extract
from pine needle containing 7.5 mg L-arginine / kg
body weight for 14 days.
Weight gain was higher and serum transaminases’
activities were lower (AST – by the 23.3%, ALT – by
the 26.0%) in mink kits of experimental group compared with those of control one. Decrease in enzymes’
activities indicates an improvement in the hepatic
function and protein metabolism. In conclusion,
feeding mink kits with the extract from pine needle
enriched with L-arginine, increased their viability by
50–60%.
The study was carried out under state order (projects
№ 0221-2014-0001 and № 01201257867) and partially
of the grant for Russian-Polish Interacademic Cooperation.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Glutathione peroxidase activity, respiration intensity
and spermatozoa survival in bull ejaculates
Vasyl Vlizlo, Natalia Kuzmina, Dmytro Ostapiv, Mykola Sharan,
Iryna Yaremchuk, Julia Bodnar
Institute of Animal Biology NAAS, Lviv, Ukraine
e-mail: m_sharan@ukr.net
The aim was to study correlation between activity of
glutathione peroxidase, oxygen consumption intensity and spermatozoa survival in bull ejaculates. For
experiments, freshly obtained bull ejaculates (n = 48),
with volume 2–5 ml, concentration 0.8–1.2 × 109
cells, and quantity of moving spermatozoa – 75–80%
were used. In ejaculates were studied: respiration intensity – polarographycally in phosphate-saline buffer Dulbecco, activity of glutathione peroxidase (GPx)
– with Elman reagent and spermatozoa survival at
temperature 2–4°С (hours). Statistical analysis of the
experimental results was conducted by the Student-t
test using the correlation ratio (η).
Bull ejaculates characterize by GPx activity 0.79
± 0.092 µmol GSH/min × mg of protein, respiration
intensity 8.1 ± 0.6 ng-atom О/min × 0.1 ml of semen
and spermatozoa survival at temperature 2–4°С 114
± 31.8 hours. It was determined, that when activity of
GPx was more than 0.80 µmol GSH/min × mg of protein, semen respiration intensity was highest – 9.4 ±
0.30 ng-atom О/min × 0.1 ml of semen. It decreased
on 28.7% (p < 0,01), when GPx activity was 0.60 µmol
GSH/min × mg of protein. The correlation between
enzyme activity and oxygen consumption was – η =
0.298. Addition of inhibitors of mitochondrial respiratory chain did not alter the correlation between respiratory intensity and GPx activity: high oxygen consumption after addition of sodium fluoride (η = 0.432),
amital (η = 0.332), sodium azide (η = 0.215) and Na2EDTA (η = 0.289) was manifested when enzyme activity
was over 0.80 µmol GSH/min × mg of protein and had
lower value when GPx activity was less than 0.80 µmol
GSH/min × mg of protein. The highest spermatozoa
survival (123 ± 8.1 hours) was registered when GPx activity was more than 0,80 µmol GSH/min × mg of protein, whereas when enzyme activity was less than 0,60
µmol GSH/min × mg of protein, spermatozoa survival
was lowest (93 ± 8.6 hours; p < 0.001). The correlation
between enzyme activity and survival of spermatozoa
equalled – η = 0.416.
113
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The evaluation of the ability to differentiate
of putative stem cells from mature pig ovaries
Kamil Wartalski, Gabriela Gorczyca, Marta Hereta, Małgorzata Duda
Department of Endocrinology, Institute of Zoology, Jagiellonian University in Kraków, Poland
e-mail: kamil.wartalski@doctoral.uj.edu.pl
The ovaries are organs in which the presence of stem
cells has not yet been indisputably proven. Mature
ovaries may contain adult stem cells (ASCs). ASC is
a pool of cells that has an unknown ability to differentiate. According to one hypothesis, ASCs may be the
source of cancer stem cells (CSCs) by the accumulation of genetic mutations. There is a great similarity
of morphological and functional stem cells to cancer
cells, which requires explanation. This will allow to
understand the etiology of ovarian cancers and processes such tumor initiation and its growth. This is
important because ovarian tumors are the second
most common in women after breast cancer.
In order to obtain a pool of putative stem cells
(PSCs) the magnetic beads insulated with epitope
SSEA-4 were used. The obtained cells were cultured
in vitro for 7 and 14 days in medium DMEM/F12
with the addition of SCF (stem cells factor) and special supplement B-27.
114
During the culture, the observed characteristic
clusters containing ASCs were observed. Cells in
clusters showed immunolocalization of proliferation
markers such as Ki-67 and PCNA. We also showed
the presence of protein markers for stem cells such
as Oct-3/4, c-Kit, Sox2 and GDF-9 protein associated
with the development of primary follicles. These results were obtained both on paraffin sections of the
ovary and cells from culture. Similar results were obtained in control tissue – neonatal porcine ovaries. At
the protein level we were able to demonstrate the expression of Ki-67; PCNA; c-Kit and GDF-9. Loading
control constituted b-actin. The transcript level also
revealed the presence of GDF-9. It also indicated expression of c-Kit receptor, and Ki-67.
This work was supported by a grant K/DSC/002993.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Characterization and possible involvement
of mesenchymal stem cells in endometrium
of porcine uterus model
Jerzy Wiater, Janusz Karasiński
1
Department of Cell Biology and Imaging, Jagiellonian University in Kraków, Poland
e-mail: jerzy.wiater@doctoral.uj.edu.pl
Stem cells are characteristic for various organs, which
have high potential for remodelling and regeneration.
The uterus is an organ with outstanding ability to regenerate its complex tissue structures. It is composed
of two main compartments: the endometrium and
myometrium. The endometrium undergoes about
400 cycles of shedding, proliferation and differentiation during female reproductive period.
Mesenchymal stem cells (MSCs) are self-renewing
and multipotent cells, which may differentiate into
more than one cell type. We have shown the presence
of stem or progenitor cells in the porcine endometrium by demonstrating their in vitro differentiation
into adipogenic and osteogenic lineages and expression of some mesenchymal stem cell markers by RTPCR. Hence, we aim to further characterize these
cells and study their potential to differentiate into
various lineages.
Experiments were performed on cryostat sections
and in vitro cultured cells from porcine uteri. For
characterization and localization of MSCs markers we
used Western blot and immunohistochemistry meth-
ods, and antibodies against MSCs markers CD29,
CD44, CD90, CD105, CD140b, against vimentin, as
well as markers for proliferating cells PCNA and Ki67, and pluripotency marker Oct-3/4.
Cells cultured in vitro expressed MSCs markers
such as: CD29, CD44, CD105, CD140b and vimentin, as well as marker for proliferating cells PCNA.
In tissue sections immunofluorescent signals from
MSCs were localized in the endometrium close to the
endometrial glands and blood vessels which may suggest their potential involvement in gland formation
and angiogenesis. Western blot analysis showed the
presence of CD44, CD105, CD140b, vimentin, PCNA
and Oct-3/4 signals. Our results indicate that MSCs
or progenitor cells may be responsible for regeneration of endometrial tissue structures such as luminal,
glandular and vascular epithelium.
This work was supported by grant from the National Science Centre: NN 303 804 240.
115
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Pig with reduced expression of the Galα(1,3)Gal
epitope as a potential donor
of skin grafts – preliminary study
Jerzy Wiater1, Janusz Karasiński1, Jacek Jura2, Zdzisław Smorąg2, Ryszard Słomski3, 4,
Marek Romek1
1
2
Department of Cell Biology and Imaging, Institute of Zoology, Jagiellonian University in Kraków, Poland
Department of Animal Reproduction Biotechnology, National Research Institute of Animal Production,
Balice near Krakow, Poland
3
Institute of Human Genetics of the Polish Academy of Sciences, Poznan, Poland
4
Department of Biochemistry and Biotechnology, Poznań University of Life Sciences, Poznan, Poland
e-mail: jerzy.wiater@doctoral.uj.edu.p
Xenotransplantation of the living organs as well
as individual tissues or cells from pig to human is
a promising method which will increase the number
of available grafts and shorten the waiting time for
a transplant. The organ size and physiology of the pig
is almost identical to human. Some animal materials are already used in humans, such as biotechnology dressing of skin from transgenic pigs, but these
are treated so that they contain no living cells. The
major difficulty in xenotransplantation is high risk of
hyperacute rejection of xenograft so reducing the expression of the Galα(1,3)Gal by the transgenesis may
solve this problem. Therefore, the aim of this study
was to determine the level of expression of Galα(1,3)
Gal epitope in skin from transgenic pig.
In our experiments we used skin obtained from
pigs designed to express human: α-galactosidase
(αGal), α1,2-fucosyltransferase (α1,2FT) and αGal
× α1,2FT. Experiments were performed on cryostat
sections and in vitro cultured keratinocytes and fibroblasts. For localization and determination of ex-
116
pression level of Galα(1,3)Gal we used lectin BS-IB4
conjugated with AlexaFluor 647 flourochrome, while
for αGal and α1,2FT specific antibodies against this
proteins. The fluorescence intensity was analysed
with confocal microscope LSM 510 META Axiovert
200 M (Carl-Zeiss, Germany).
Our results show that the level of Galα(1,3)Gal
expression in the skin of transgenic pigs is lower
compared to control non-transgenic porcine skin.
The lowest expression of Galα(1,3)Gal was recorded
in skin from double transgenic pig (αGal × α1,2FT).
Moreover, there were no differences between keratinocytes and fibroblasts cultured in vitro. In conclusion skin of transgenic pig with living cells may be
a promising material for xenotransplantation.
This work was supported by grant from National Center
for Research and Development No. INNOMED/I/17/
NCBR/2014 and grant No. K/DSC/002994 from Jagiellonian University in Kraków.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The changes of CRP and IL-10 secretion
from piglet lymphocytes in response to adiponectin
Joanna Zubel-Łojek, Anna Latacz, Ewa Ocłoń
Department of Animal Physiology and Endocrinology, University of Agriculture in Krakow, Poland
e-mail: e.oclon@ur.krakow.pl
It is now known that adipose tissue is a dynamic endocrine organ, secreting a number of biologically active
proteins, also known as adipokines. These peptides
could participate in the development of obesity-related complications through regulation of inflammatory
responses. Most adipokines are proinflammatory. In
contrast, adiponectin exerts an anti-inflammatory effect and the actions of this protein involve a variety of
mechanisms that are poorly defined.
The present study was carried out to examine the
in vitro influence of adiponectin addition on the cytokines (CRP and IL-10) lymphocytic secretion in
piglets during inflammation. Studies were performed
on 10 – week old piglets (Polish Landrace, n = 24),
which were divided into control group (I) and three
experimental groups; II (with obesity), III (with acute
inflammation) and IV (with obesity and acute inflammation). Peripheral blood lymphocytes (PBL) were
isolated from fresh heparinized piglet blood using
standard gradient sedimentation technique. Isolated
lymphocytes were placed in medium (RPMI 1640,
10% fetal calf serum, L-glutamine, penicillin, streptomycin) and cultured for 72 h with or without 1nM of
adiponectin. The enzyme-linked immunosorbent assay method was used for estimation of CRP and IL-10
in culture supernatant. The results obtained indicated
that CRP lymphocytic secretion depends on physiological condition and significantly increased during
inflammation and obesity, whereas secretion of IL-10
decreased only in obese animals (p < 0.05). In addition, adiponectin in vitro supplementation inhibits
CRP (from 36% to 70%) and stimulates (23‒492%)
IL-10 secretion (p < 0.05). To summarize, obtained
result show that adiponectin has a direct anti-inflammatory impact on the piglet lymphocytes.
Supported by: grants from NCN (NN 311 227 138) and
DS (3243/KFiEZ).
117
Session 3
”7th Poultry Days” – current problems
of poultry and ornamental bird breeding
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The effect of the humic acid and herbal additive
supplement on production and carcass parameters
of broiler chicken
Veronika Pistová, Henrieta Arpášová, Cyril Hrnčár
Department of Poultry and Small Animal Husbandry, Faculty of Agrobiology and Food Resources,
Slovak University of Agriculture, Slovakia
e-mail: xpistova@uniag.sk
In this study the effect of humic acids and dietary
herbal additive: clove (Syzygium aromaticum), lavender (Lavendula angustifolia) and black pepper (Piper
nigrum L.) on production and carcass parameters of
Ross 308 broiler chicken (n = 60) were studied. The
chicken of the control group were fed with complete
feed mixtures without any additives. Chicken in
treatment T1 were fed a diet containing 1% of humic
acid and drank a water containing 150 mg/l of herbal
additive. Chicken in treatment T2 were fed with complete feed mixture without any additives and drank
a water containing 150 mg/l of herbal additive. From
production parameters the body weight, feed intake
and feed conversion were observed. From carcass
parameters the carcass weight, weight of heart, liver,
gizzard and carcass yield were evaluated. The results
shout that the body weight was significantly higher
(P ≤ 0.05) in treatments groups compared to the control group (the order of the groups: 1796.6 ± 188.2;
2053.1 ± 197.8 and 2140.2 ± 300.5 g ± SD). The feed
intake was in the control group 3.10 kg, in the treatment T1 3.00 kg and in the treatment T2 3.13 kg. The
carcass weight was in the treatment T2 significantly
higher (P ≤ 0.05) in compare with control group (values in the order of the groups: 1293.8 ± 179.5; 1428.9
± 156.5 and 1532.6 ± 283.1 g ± SD). In the treatment
T1 was weight of gizzard (44.7 ± 7.6 g ± SD) significantly higher (P ≤ 0.05) compared to control group
(35.5 ± 5.8 g ± SD). In the treatment T2 was weight
of liver (74.1 ± 12.5 g ± SD) significantly higher
(P ≤ 0.05) compared to control group (50.1 ± 11.5 g
± SD). In conclusion, supplement by humic acid and
herbal additive can improve production parameters
of broiler chicken.
121
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
In ovo technology – efficient method
of chicken microbiome stimulation
Maria Siwek1, Anna Sławińska1, 2, Katarzyna Stadnicka1, Aleksandra Dunisławska1,
Arkadiusz Płowiec1, Giuseppe Maiorano2, Marek Bednarczyk1
1
University of Science and Technologies, Bydgoszcz, Poland
2
University of Molise, Campobasso, Italy
e-mail: siwek@utp.edu.pl
Digestive tract of animals harbors living and metabolizing microorganisms. They influence on physiological functions of the host and are considered fundamental drivers of some physiological traits, including
metabolism and immune system. In EU ban on antibiotics in 2006 directed interests of the poultry producers to use natural growth promoters (NGPs), such
as prebiotics, probiotics and synbiotics. These NGPs
stimulate colonization of the chicken intestines with
beneficial microflora. In poultry farming, chicks are
given NGPs at first day after hatching (in-feed or inwater). The early timing of guts colonization with
commensal bacteria is crucial, otherwise they tend to
get colonized by pathogens. For this purpose, we have
optimized an in ovo technology for delivery of NGPs
to the chicken embryo at 12th day of egg incubation.
We have tested several prebiotics (e.g. inulin, GOS –
galactooligosaccharides and RFO – raffinose family
oligosaccharides), probiotics (e.g. Lactococcus spp.,
Lactobacillus spp.) and synbiotics (e.g. RFO + Lacto-
122
coccus lactis subsp. cremoris) in combination with in
ovo technology. All of them proved to have beneficial
effects on egg hatchability, chicken mortality rate, on
broiler chicken growth and meat quality traits. There
are clear differences between effects of different NGPs
delivered in ovo on the host. These differences were
determined based on gene expression level, bacteriology, histology of the gastrointestinal track, physiological, immunological and biochemical parameters.
In conclusion, NGPs injected in ovo are beneficial for
the host but their effect strictly depends on the bioactive compound used; they might act towards improvement of metabolic or immune traits. Detailed
results will be discussed during presentation.
Research projects partially funded by National Science Centre in Cracow, Poland (UMO-2013/11/B/
NZ9/00783) and Ministry of Education, Universities
and Research in Rome, Italy (RBSI14WZCL)
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of lavender essential oil
(Lavandula angustifolia) on production indicators
of broiler chicken
Michalina Adaszyńska-Skwirzyńska1, 2, Danuta Szczerbińska2
Poultry Farm Michalina Adaszyńska-Skwirzyńska, Żabówko, Poland
Department of Poultry and Ornamental Bird Breeding, West Pomeranian University of Technology,
Szczecin, Poland
1
2
e-mail: madaszynska@zut.edu.pl
Currently the use of natural biologically active substances is promoted in many branches of industry
and in agriculture, e.g. those with the action similar
to withdrawn antibiotic growth stimulants. For instance, the properties of lavender oil can be used in
animal production. The aim of this study was to estimate the effect of an addition of the lavender essential
oil (Lavandula angustifolia) to drinking water on the
production indicators.
The study was carried out on a commercial poultry farm and experimental animals were broiler Ross
308 chickens. A total of 300 of one-day chicks were
divided into three experimental groups: I group (control) – 100 specimens (water without addition of essential oil); II group – 100 specimens (addition of oil
to water at a concentration of 0.2 cm3 L-1; III group
– 100 specimens (addition of oil to water at concentration of 0.4 cm3 L-1).
Commercial lavender oil with antimicrobial properties was administered throughout the rearing cy-
cle. Water with oil was available for chicken for 6 h/
day. Chickens were fed ad libitum with mixed feeds
delivered from the Feed-Processing Plant in Wałcz
(PZZ Wałcz). Birds were provided with standard
conditions of lighting and temperature according
to the guidelines of the chick supplier. The chicken
body weight and feed consumption were controlled
during the experiment. To control the body weight,
the chickens were weighed six times: on 1, 7, 14, 28,
35 and 42 day of fattening. Based on the carried out
study it was stated that an addition of oil is characterized by a positive effect on body weight gains in
broilers. The highest mean weight was recorded in the
group of chickens that were given water with an addition of lavender oil (group III – oil concentration of
0.4 cm3 L-1). In this case the weight gain in relation
to the control group at the end of rearing amounted
to 3.7%, and the feed conversion rate (FCR) was 1.26.
In the same group also the lowest mortality rate was
recorded (1.0%).
123
Wpływ olejku lawendowego (Lavandula angustifolia)
na wskaźniki produkcyjne kurcząt broilerów
Michalina Adaszyńska-Skwirzyńska1, 2, Danuta Szczerbińska2
Ferma Drobiu Michalina Adaszyńska-Skwirzyńska, Żabówko
Zakład Hodowli Ptaków Użytkowych i Ozdobnych, Zachodniopomorski Uniwersytet Technologiczny
w Szczecinie
1
2
e-mail: madaszynska@zut.edu.pl
Obecnie w wielu gałęziach przemysłu i w rolnictwie
promuje się stosowanie naturalnych substancji biologicznie czynnych, np. o działaniu zbliżonym do
wycofanych antybiotykowych stymulatorów wzrostu.
Właściwości olejku lawendowego mogą zostać wykorzystane w produkcji zwierzęcej.
Celem badań było określenie wpływu dodatku do
wody pitnej olejku eterycznego z lawendy lekarskiej
(Lavandula angustifolia) na wskaźniki produkcyjne.
Badania przeprowadzono na fermie komercyjnej (Żabówko), a zwierzętami doświadczalnymi były kurczęta brojlery Ross 308. Jednodniowe pisklęta, w liczbie
300 osobników, przydzielone zostały do trzech grup
doświadczalnych: I grupa kontrolna – 100 osobników
(woda bez dodatku olejku eterycznego), II grupa –
100 osobników (dodatek do wody olejku w stężeniu
0,2 cm3 L-1, III grupa – 100 osobników (dodatek do
wody olejku w stężeniu 0,4 cm3 L-1).
Komercyjny olejek lawendowy o właściwościach
przeciwdrobnoustrojowych był podawany przez
124
cały okres odchowu. Woda z olejkiem była dostępna dla kurcząt przez 6 h/dobę. Kurczęta żywiono bez
ograniczeń mieszankami paszowymi dostarczanymi
z Wytwórni Pasz w Wałczu (PZZ Wałcz). Ptaki miały
zapewnione standardowe warunki oświetlenia oraz
temperatury zgodne z wytycznymi dostawcy piskląt.
W czasie trwania doświadczenia kontrolowana była
masa ciała kurcząt oraz spożycie paszy. W celu kontroli masy ciała kurczęta ważono sześciokrotnie: w 1.,
7., 14., 28., 35. oraz 42. dniu tuczu.
Na podstawie przeprowadzonych badań stwierdzono, że dodatek olejku ma pozytywny wpływ na
przyrosty masy ciała brojlerów. Najwyższą średnią
wagę odnotowano w grupie kurcząt, którym podawano wodę z dodatkiem olejku lawendowego (grupa
III – stężenie olejku 0,4 cm3 L-1). W tym przypadku
wzrost masy w stosunku do grupy kontrolnej na koniec chowu wyniósł 3,7%, a współczynnik konwersji
paszy (FCR) 1,26. W tej samej grupie odnotowano
także najniższy wskaźnik śmiertelności (1,0%).
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effects of fumonisin contaminated diet
on glutathione redox system and lipid peroxidation
processes in broiler chickens
Krisztián Balogh, Nikolett Tokodi, Erika Zándoki, Judit Szabó-Fodor, Csilla Pelyhe,
Andrea Bócsai, Miklós Mézes
Department of Nutrition, Faculty of Agricultural and Environmental Sciences, Szent István University, Hungary
e-mail: balogh.krisztian@mkk.szie.hu
Fumonisins are secondary metabolites of the corn
pathogen fungus Fusarium verticillioides. Based on
their structural similarities the different fumonisins
are clustered into four groups. In feedstuffs and feeds
the fumonisin B1 and B2 (FB1 and FB2) are the most
frequent. They alter the sphingolipid metabolism in
animals and they also have carcinogenic effects. The
purpose of our study was to investigate the effect of
feed-borne fumonisin (FUM) exposure on the amount
and activity of glutathione redox system and on the lipid peroxidation processes of broiler chickens.
A total of 68 3-week old broiler cockerels were divided into two groups: a control and a FUM treated
one. The control group was fed broiler commercial
grower diet, while the treated group received the
same diet artificially contaminated with fumonisins
(30 mg FB1 + FB2/kg feed) for 14 days. Samplings
(n = 6/group) were done at day 1, 2, 3, 7 and 14 of
mycotoxin exposure. At every sampling blood and
post mortem liver, spleen and kidney samples were
taken, in which the parameters of glutathione redox
system (reduced glutathione (GSH) concentration
and gluathione-peroxidase (GPx) activity) and also
the meta-stable end product of the lipid peroxidation
processes, the malondialdehyde (MDA) concentration were measured.
GSH concentration in the spleen of the treated
group was significantly higher at day 1, 2 and 7 of
sampling. The increased amount of co-substrate resulted in elevated GPx activity at day 2, 3 at 7 of FUM
exposure as compared to the control. In kidney samples FUM treatment increased the GSH concentration and GPx activity in kidney at day 3 of the experiment. Lower GSH concentrations were measured
at days 2, 3 and 7 in blood plasma, which led to an
increase in lipid peroxidation processes as measured
by the MDA concentrations.
The study was supported by the János Bolyai Research
Scholarship (BO/261/13) of the Hungarian Academy of
Sciences and by the OTKA (PD-104823).
125
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Seasonal changes in the behavior of emu
(Dromaius novaehollandiae) under farm conditions
Mateusz Bucław
Department of Poultry and Ornamental Bird Breeding, West Pomeranian University of Technology,
Szczecin, Poland
e-mail: mateusz.buclaw@zut.edu.pl
The year season strongly affects the behaviour of
emus, which is a source of unique problems in their
adaptation to the farm environment. While creating
the farming environment for any livestock animals,
the specificity of their behaviour should be taken into
account, since this has an impact on the animal welfare and the productivity of the herd.
The aim of this study was to present selected elements of the emu behavior during the off breeding season, the breeding preparation period and the
breeding season. The study focuses on feed, water and
sand intake, plumage care, resting, agonistic behavior, and other activities, mostly standing still, aimless
walking or observing the surrounding.
The troop consisted of 11 emus (5 females and 6
males) aged 12 years, housed in a free-ranging system. Observations were carried out in three, 3-weeklong stages, during which 60-minute watching sessions took place on 3 randomly chosen days.
126
A significant effect was found of each season on
the behavior patterns of emu related to feeding, pecking, sand intake, plumage care, resting, and agonistic
behavior. Plumage care and agonistic behavior took
most time during the off breeding season. The longest periods of resting, feeding and sand intake were
observed during the breeding preparation period,
which suggests that birds prepared for the breeding
season by saving energy and gathering reserve material in the body. Feeding and water drinking behavioural patterns were similar in all the seasons. Most of
the time, regardless of the period of observation, the
emu spent on such activities as standing still, walking
aimlessly, watching the sourrounding area, which are
affected by their housing system.
The emu belongs to birds whose behavior is considerably affected by the season. Seasonality and the resulting changes in behavior are associated with reproduction, which is superior to the remaining activities.
Sezonowe zmiany w zachowaniu się emu
(Dromaius novaehollandiae) utrzymywanych
w warunkach fermowych
Mateusz Bucław
Zakład Hodowli Ptaków Użytkowych i Ozdobnych,
Zachodniopomorski Uniwersytet Technologiczny w Szczecinie
e-mail: mateusz.buclaw@zut.edu.pl
Sezon ma znaczący wpływ na zachowanie się emu,
co powoduje unikatowe problemy ich adaptacji jako
zwierząt hodowlanych. Specyficzne zachowania
zwierząt muszą zostać uwzględnione przy tworzeniu
warunków środowiskowych utrzymania, gdyż determinuje to ich dobrostan i produktywność.
Celem niniejszej pracy było przedstawienie wybranych elementów zachowania się emu w okresie
spoczynku, wchodzenia w sezon rozrodczy oraz sezonu rozrodczego. W pracy analizowano zagadnienia
dotyczące: pobierania pokarmu, wody i piasku oraz
porządkowania upierzenia, odpoczynku, zachowań
agonistycznych i pozostałych, związanych głównie ze
staniem w bezruchu, chodzeniem bez celu czy obserwowaniem otoczenia.
Badane stado liczyło 11 ptaków (5 samic i 6 samców) w wieku 12 lat, utrzymywanych systemem
otwartym. Obserwacje prowadzono w trzech trzytygodniowych etapach, w których przez losowo wybrane 3 dni prowadzono 60-minutowe obserwacje, dwa
razy dziennie.
Stwierdzono istotny wpływ poszczególnych sezonów na behawior związany z pobieraniem pokarmu,
dziobaniem i pobieraniem piasku, porządkowaniem
upierzenia, odpoczynkiem, a także na zachowania
agonistyczne. Najwięcej czasu na porządkowanie
upierzenia i zachowania agonistyczne emu poświęcały w okresie spoczynku. Najdłuższy czas odpoczynku oraz pobierania pokarmu i piasku stwierdzono
w okresie wchodzenia w sezon rozrodczy, co sugeruje
przygotowywanie się ptaków do sezonu rozrodczego
poprzez oszczędzanie energii i magazynowanie w organizmie materiału zapasowego. Zachowania związane z żerowaniem i pobieraniem wody w przypadku
poszczególnych sezonów były zbliżone. Najwięcej
czasu, bez względu na okres obserwacji, emu poświęcały na czynności związane głównie ze staniem
w bezruchu, chodzeniem bez celu czy obserwowaniem otoczenia, na które wpływa ich fermowe utrzymywanie.
Emu należą do ptaków, u których sezon w znaczący sposób oddziałuje na ich zachowanie. Sezonowość
i zmiany w zachowaniu są związane z rozrodem, który podporządkowuje sobie pozostałe zachowania.
127
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The content of selected chemical components
in hen eggs depending on egg production cycle
Jolanta Calik
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: jolanta.calik@izoo.krakow.pl
The experiment used eggs from four layer breeds
covered by the genetic resources conservation programme: Greenleg Partridge (Z-11), Yellowleg Partridge (Ż-33), Sussex (S-66), Leghorn (G-99) as well
as from Hy-Line Brown commercial layers, kept on
a farm at the Experimental Station of the National
Research Institute of Animal Production in Chorzelów near Mielec.
The aim of the study was to evaluate the content
of some chemical components in hen eggs depending
on egg production cycle.
Chemical analyses of eggs were performed at 33
and 83 weeks of age at the Institute’s Central Laboratory. The highest crude protein and ash content of
albumen at 33 weeks of age were found in eggs from
Hy-line Brown layers, and at 83 weeks of age in S-66,
G-99 and Hy-Line Brown hens, the eggs of which also
had the highest dry matter and ash content. The highest crude protein content, especially in the second year
128
of production, was noted in yolks from Z-11 and Ż-33
hens of conservation breeds. Significantly lower protein content, at both 33 and 83 weeks, was observed
in yolks of eggs from G-99 and Hy-Line Brown hens.
The yolks of eggs from S-66 layers had the highest
concentration of fat, which tended to increase with
the age of the hens. Cholesterol content ranged from
13.90 to 14.78 at 33 weeks and from 14.29 to 15.48
mg/g yolk at 83 weeks of age, with Z-11 hens producing eggs with the lowest cholesterol percentage of
all breeds. The high nutrient content observed in the
second production cycle suggests the appropriateness
of using hens for the period of two years.
This study was supported from the Multiannual Program
no. 17-1.10.9 financed by the Ministry of Agriculture and
Rural Development.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of caponizing Yellowleg Partridge (Ż-33)
cockerels on meat quality
Jolanta Calik1, Katarzyna Połtowicz2, Robert Gąsior3
1
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
2
Department of Animal Genetic and Breeding, National Research Institute of Animal Production,
Balice near Krakow, Poland
3
Central Laboratory, National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: jolanta.calik@izoo.krakow.pl
Capon production has recently attracted increasing
interest in Poland and across the world. According to
the EU Commission Regulation No 543/2008 of 16
June 2008, “a capon is a male fowl castrated surgically before reaching sexual maturity and slaughtered
at a minimum age of 140 days; after castration the
capons must be fattened for at least 77 days”.
The aim of the study was to determine the effect
of caponization on the body weight and selected meat
quality parameters of Yellowleg Partridge (Ż-33)
cockerels. Ż-33 cockerels were randomly assigned to
two groups with 40 birds. Group I (control) consisted
of uncastrated cockerels and birds from group II were
castrated at 9 wk of age. The castration was performed
under local anesthesia by a veterinary surgeon. Birds
were kept until 24 wk of age and fed the same diet
ad libitum. Dressing percentage, proportion of breast
and leg muscles, giblets and abdominal fat were de-
termined postmortem. Physical characteristics of
meat: pH, CIE L*a*b* colour, drip loss, cooking loss,
and shear force were determined and sensory evaluation was performed.
It is concluded from the results obtained that the
castration of Ż-33 cockerels had a positive effect on
increasing of body weight, dressing percentage and
carcass muscling. Capon muscles, especially leg muscles, were characterized by better water holding capacity and tenderness, lower drip loss, lower cooking
loss and better sensory scores. Therefore, capon production may provide poultry meat as a niche product
for consumers who look for meat of special quality.
This study was supported from the Multiannual Program
no. 17-1.10.9 financed by the Ministry of Agriculture and
Rural Development.
129
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Evaluation of productivity and egg quality
in Sussex (S-66) laying hens during
the first two years of production
Jolanta Calik, Michał Puchała, Joanna Obrzut
Department of Animal Genetic Resources Conservation, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: jolanta.calik@izoo.krakow.pl
Due to the increasing costs of rearing resulting from
increasing prices of chicks, feeds and energy carriers,
keeping layers for one season may be unprofitable
and it might be appropriate to prolong their use for
the next two or more production periods.
The aim of the study was to analyse the productivity and egg quality of Sussex (S-66) laying hens during the first two years of production. The study was
performed on 200 hens. The health of the birds during the first two years of production was very good.
Laying rate averaged 53.76% during the first year of
production (21 to 56 weeks of age) and 48.58% in the
second (63 to 99 weeks of age). The quality of eggs was
assessed (30 eggs per test) at 21, 33, 43, 56, 73, 83 and
93 weeks of age. Average egg weight increased from
44.05 (week 21) to 62.89 g (week 93). The increase in
egg weight was paralleled by a significant increase in
130
yolk and shell weight. Eggs showed good parameters
of albumen (albumen height and Haugh units) and
shell quality, but these traits deteriorated significantly
towards the end of the second egg production period
(83 to 93 weeks).
It was established from the results obtained that
keeping Sussex (S-66) hens for the second production
cycle has no adverse effect on their health. The good
productivity and egg quality, which persisted into the
second year of production, shows that it is appropriate to use Sussex (S-66) hens for the period of two
years.
This study was supported from the Multiannual Program
no. 17-1.10.9 financed by the Ministry of Agriculture and
Rural Development.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The welfare of hens in various systems
of extensive farming
Magdalena Dykiel1, Zofia Sokołowicz2
Faculty of Agriculture and Rural Development, State Higher Vocational School in Krosno, Poland
Department of Animal Production, Faculty of Biology and Agriculture, University of Rzeszów, Poland
1
2
e-mail: dykiel@op.pl
The study presents the examined welfare of commercial hens (group I) and Greenleg Partridge hens
(group II) housed in various systems of extensive
farming, i.e. in the floor raising system without exercise area, free range and organic system.
In 20th, 36th and 54th weeks of age, observations
concerning the behavior of hens were conducted in
each of the studied methods of housing system. The
number of physically active hens, sitting hens, hens
showing signs of aggression and “playing” hens was
registered.
In all periods of evaluations, both in free range
and organic system, regardless of weather conditions,
Greenleg Partridge hens willingly benefited from the
exercise area. In the free range, 73.06% of hens stayed
on the run, and about 40% of commercial hens took
advantage of the run. In the organic breeding, the
part of hens using the run from group I amounted to
52.22%, and from group II – 76.67%.
The carried out researches showed that the participation of comfort behavior in particular farming
system was as follows: 15.74% in the floor raising
system, 25.05% in free range and 21.57% in organic
housing system.
In the free range and organic farming, symptoms
of aggression were not found neither in a group of
Greenleg Partridge hens nor in a group of commercial hens. In a group of hens kept without an access
to run, the frequency of aggressive behaviors reached
the level of 2.78% in group I and 3.61% in group II.
Symptoms of aggression occurring in the floor raising
system were mostly mild, but there were also cases
of pecking, fighting and chasing away defeated individuals, preening and even pulling out feathers. Attacked hens responded to these actions through the
cry, escape or revenge.
131
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
In ovo study on calcium protective effect
against cadmium embryotoxicity
Małgorzata Dżugan1, Monika Wesołowska1, Marcin Lis2, Teodora Król3,
Jakub Nowak4, Jerzy W. Niedziółka2
Department of Chemistry and Food Toxicology, University of Rzeszow, Poland
Department of Veterinary and Animal Reproduction and Welfare, University of Agriculture in Krakow, Poland
3
Department of Cell Biology and Electronic Microscopy, The Jan Kochanowski University in Kielce, Poland
4
Technological Incubator, Stalowa Wola, Poland
1
2
e-mail: mdzugan@ur.edu.pl
The aim of this study was to determine if simultaneous calcium (Ca) supplementation of hen’s egg could
reduce cadmium (Cd) embryotoxicity during in ovo
experiment. On day 4th of incubation egg albumen
(60 eggs/group) was injected with cadmium alone
(50 nmol/egg) or in combination with calcium (5 or
25 µmol/egg). Moreover, saline and saline with 5 or
25 µmol Ca injection were used in control groups.
Hatching results and embryopathological evaluation
were performed. For both studied metals their distribution in tissues of 1-day old chicks was examined
by LA-ICP-OES method. The tissues structure was
evaluated by transmission electron microscope. The
activity of N-acetyl-β-D-glucosaminidase in chicks
blood, kidney and liver was tested. Administration of
cadmium decreased the hatchability of eggs (35.7%)
compared to the control group (52.7%). A simultaneous administration of calcium, at a dose of 5 and 25
µmol/egg, gradually improved hatching results (43.9
and 47.3%, respectively). Similarly, the accumulation
132
of cadmium in liver, kidneys and blood was limited
by calcium (P < 0.05). During the combined administration of Cd and Ca (at a higher dose) the level
of N-acetyl-β-D-glucosaminidase activity in chicks
blood and kidney was similar to the level of the control group (P > 0.05). Ultrastructural analysis of liver
and kidney cells indicated that the most sensitive to
the cadmium were mitochondria, endoplasmic reticulum and lysosomal system. Moreover, when tissues
of chicks exposed to the combined effect of Cd and
Ca during embryogenesis were examined, stabilizing
effect of Ca ions on the cell structure, in particular on
mitochondria, was observed. Conclusion: the supply
of Ca seems to protect against Cd-induced disorders
during the development of chick embryo.
Funded by: NCN project NN 304 291 140 and DS
ZWRiDZ/2016.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Preliminary study on some parameters
of meat quality and antioxidant defence
of grey partridge (Perdix perdix)
Csaba Fernye, Márta Erdélyi, Krisztián Balogh, Zsolt Ancsin, Andrea Bócsai,
Miklós Mézes
Department of Nutrition, Faculty of Agricultural and Enviromental Sciences, Szent István University, Hungary
e-mail: fernye.csaba@gmail.com
Grey partridge was one of the most significant small
game in Hungary in the 1960s and 70s. Their population dropped dramatically due to the rapid changes
in the agricultural management. In spite of the small
amount of partridge available for the consumers these
birds provide palatable red meat. However, there is
no data available about the physical and chemical
characteristics of partridge meat. Purpose of present
study was to study some physical meat quality and
antioxidant parameters in partridge meat.
Grey partridge birds at 20 weeks of age were exterminated and post mortem heart, liver, spleen and
kidney tissue samples were taken. For meat quality
measurements the pectoral muscle of the birds was
sampled. To characterize antioxidant status, malondialdehyde (MDA) content was measured in the liver,
spleen, kidney and heart homogenate and in blood
plasma. Reduced glutathione (GSH) content and glutathione-peroxidase (GPx) activity were measured
in blood plasma and 10,000 g supernatant fraction
of tissue homogenates. For meat quality analysis pH,
colour and water holding capacity were determined.
MDA content of the liver, heart, kidney and spleen
were 10.74 ± 0.55 µmol/g, 9.83 ± 1.14 µmol/g, 11.65
± 3.98 µmol/g and 14.54 ± 5.46 µmol/g, respectively.
GSH contents of the liver, heart, kidney and spleen
samples were 2.72 ± 0.16 µmol/g protein, 2.61 ± 0.25
µmol/g protein, 2.50 ± 0.21 µmol/g protein, and 2.71
± 0.24 µmol/g protein, respectively. GPx activity of
the liver, heart, kidney and spleen samples were 2.83
± 0.45 U/g protein, 3.41 ± 0.26 U/g protein, 2.28 ±
0.16 U/g protein and 3.06 ± 0.17 U/g protein, respectively. The mean pH value of the meat samples was
5.90 ± 0.20. Considering colour, lightness was found
to be 32.88 ± 2.00, while intensity of red colour was
10.49 ± 1.88, whereas yellow colour was 3.32 ± 1.01,
respectively.
Our results revealed, that the measured parameters are comparable to that of other poultry species,
such as chicken or turkey.
133
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The infuence of rapeseed on growth
performance in broiler diets
Marian Foltyn1, Vojtěch Rada1, 2, Martina Lichovníková2
Výkrm Třebíč s.r.o., Czech Republic
Department of Animal Breeding, Mendel University in Brno, Czech Republic
1
2
e-mail: marian.foltyn@centrum.cz
The aim of this study was to determine the effect of
feeding full-fat rapeseed on growth performance
and feed conversion ratio in broiler diets. Single sex
(male) ROSS 308 broiler chickens were used in the
experiment. A total of 800 9-day-old chickens were
randomly distributed among 4 dietary treatments using 2 replicate pens per treatment and 100 birds per
pen. The dietary treatments consisted of the control
diet (0% of rapeseed) and diets with the 8%, 12%
134
and 15% of rapeseed. The best growth performance
(2708.9 ± 16.28 g) in 36 day was in group containing
12% rapeseed in the diet. The significanty (P < 0.05)
worst growth performance (2590.3 ± 16.62 g) was in
group feeding diet containing 15% of rapeseed. Feed
conversion ratio was similar in all groups (1.61 kg/kg
in groups containing 0% and 8% rapeseed and 1.59
kg/kg in groups contaning 12% and 15% rapeseed).
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The microscopic study of the conjunctiva-associated
lymphoid tissue (CALT) in Indian peafowl
(Pavo cristatus)
Karolina Goździewska-Harłajczuk1, Joanna Klećkowska-Nawrot1, Karolina Barszcz2
Division of Animal Anatomy, Department of Animal Physiology and Biostructure,
Wrocław University of Environmental and Life Sciences, Poland
2
Department of Morphological Sciences, Warsaw University of Life Sciences, Poland
1
e-mail: k.gozdziewska.wroc@gmail.com
The conjunctiva-associated lymphoid tissue (CALT)
is a component of mucosa-associated lymphoid tissue
(MALT), thus CALT represents a part of immune system of the body that is located in eyelids. The eyelids
structure is support by lymphocyte recirculation and
it forms the common conjunctival immune system,
which provide immune protection of the eyeball area.
The study was conducted on the 10 females of peafowl (3–4 weeks old, 1.5, 2–3 and 4 years old birds).
Tissue sections were stained with haematoxylin and
eosin, Masson-Goldner trichrome, azan-trichrome
and methyl green-pyronin Y. The light microscopy investigation were performed with using of Zeiss Axio
Scope A1 light microscope (Carl Zeiss, Jena, Germany). The obtained results showed the presence of
well-developed CALT: diffuse lymphoid tissue within
the connective tissue of the eyelids and the numerous
lymphatic follicles mostly under the conjunctival epithelium, in all of the examined birds. The numerous
lymphocytes were observed within the loose connective tissue as well as the numerous goblet cells were
present within the conjunctival epithelium. The shape
of goblet cells was similar as in other avian species.
The examination of the CALT in Indian peafowl can
be contribute to enlarge of our knowledge about the
physiology and functioning of the eye and the nasopharynx in this bird species, what is very important
in prevention of the respiratory system diseases in
domestic, ornamental and wild birds.
135
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Monitoring of the genetic diversity of the Zatorska
goose based on the pedigree information
Magdalena Graczyk1, Krzysztof Andres2, Ewa Kapkowska2, Tomasz Szwaczkowski1
Department of Genetics and Animal Breeding, Poznan University of Life Sciences, Poland
Department of Swine and Small Animal Breeding, University of Agriculture in Krakow, Poland
1
2
e-mail: maggra@up.poznan.pl
Populations covered by the genetic resources conservation program require special monitoring of their
genetic variability. It may be estimated based on the
polymorphism of genetic markers , or recorded traits
or pedigree information. From the economic point of
view the third approach is the most desirable. It requires reliable and complete pedigree data. The aim
of the study was to estimate the genetic conservation
index and other parameters supporting the management of the Zatorska goose population.
The analysis covered 437 of the currently living
individuals of the Zatorska goose population hatched
between 2012–2015. The following parameters were
estimated: genetic conservation index (GCI), completeness of the pedigree (CP), inbreeding coefficient
(F), coancestry coefficient (CC), genetic diversity
(GD) and effective population size (Ne). A similar
analysis was conducted for 5704 individuals hatched
between 1990–2015. These calculations were carried
out using ENDOG v4.8 program.
136
Completeness of the pedigree of the present population was high and reached 97.43% (for males:
97.92%, for females: 96.95%). Inbreeding level is low
and reached 5.30% (for males: 5.56%, for females:
5.21%). The average CC was 7.13%, which means that
this percentage of alleles is common for all animals.
GCI is balanced for males and females and reached
3.61 and 3.59, respectively. Despite the varied number of individuals between 1990–2015, GCI has been
stable (3.0–3.5) for the last 20 years with a very high
concurrent genetic diversity (92.76%). Effective population size estimated on the basis of individual increase in inbreeding is 82 individuals.
Comparative analysis of the estimated parameters
for the whole and present population indicates stabilisation, which is beneficial from the perspective of
the genetic resources conservation of the Zatorska
goose.
Monitorowanie zmienności genetycznej gęsi
zatorskiej na podstawie informacji rodowodowych
Magdalena Graczyk1, Krzysztof Andres2, Ewa Kapkowska2, Tomasz Szwaczkowski1
Katedra Genetyki i Hodowli Zwierząt, Uniwersytet Przyrodniczy w Poznaniu
Katedra Hodowli Trzody Chlewnej i Drobnego Inwentarza, Uniwersytet Rolniczy w Krakowie
1
2
e-mail: maggra@up.poznan.pl
Populacje objęte programem ochrony zasobów genetycznych wymagają szczególnego monitorowania
zmienności genetycznej. Może być ona szacowana
na podstawie polimorfizmu markerów genetycznych,
rejestrowanych cech i informacji rodowodowych.
Z ekonomicznego punktu widzenia trzecie podejście
jest najbardziej pożądane. Wymaga ono jednak wiarygodnych i kompletnych danych rodowodowych.
Celem badań było oszacowanie indeksu zachowania
zmienności genetycznej i innych parametrów wspomagających zarządzanie populacją gęsi zatorskiej.
Analizą objęto 437 obecnie żyjących gęsi zatorskich, wyklutych w latach 2012–2015. Oszacowano
następujące parametry: indeks zachowania zmienności genetycznej (GCI), kompletność rodowodu (PC),
współczynnik inbredu (F), współczynnik wspólnego
pochodzenia (CC), zróżnicowanie genetyczne populacji (GD) oraz efektywną wielkość populacji (Ne).
Analogiczną analizę przeprowadzono dla 5704 osobników wyklutych w latach 1990–2015. Obliczenia
wykonano za pomocą programu ENDOG v4.8.
Kompletność rodowodowa obecnie żyjącej populacji była wysoka i wynosiła 97,43% (u samców:
97,92%, u samic: 96,95%). Poziom inbredu jest niski
i wynosi 5,30% (u samców: 5,56%, u samic: 5,21%).
Średni współczynnik wspólnego pochodzenia wynosił 7,13%, co oznacza, że taki procent alleli jest identyczny dla wszystkich osobników. GCI był wyrównany dla samców oraz samic i wynosił odpowiednio:
3,61 i 3,59. Pomimo znacznych zmian w liczebności
populacji w latach 1990–2015 indeks GCI od 20 lat
utrzymuje się na stałym poziomie (3,0–3,5), przy jednocześnie bardzo wysokim współczynniku zróżnicowania genetycznego (92,76%). Efektywna wielkość
populacji szacowana na podstawie przyrostu inbredu
wynosi 82 osobniki.
Analiza porównawcza oszacowań parametrów dla
całej populacji i obecnie żyjącej wskazuje na stabilizację, co jest korzystne z perspektywy ochrony zasobów
genetycznych gęsi zatorskiej.
137
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of biologically active substances
on laying traits of Japanese quails
Emília Hanusová, Anton Hanus, Cyril Hrnčár, Marta Oravcová
National Agriculture and Food Centre – Research Institute for Animal Production, Nitra, Lužianky, Slovakia
e-mail: hanusova@vuzv.sk
The objective of this study was to compare the effect
of additions of humic acids and probiotic in the diet
on laying traits in Japanese quails (Coturnix japonica). The birds involved in experiment were farmed in
the National Agriculture and Food Centre – Research
Institute for Animal Production Nitra (NAFC – RIAP
Nitra). Birds were housed in four-stage cage technology. Feed mixture contained 11.7 MJ ME and 200.0 g
crude protein throughout the experiment. Feed and
water were given ad libitum. The design consisted of
one control group and two experimental groups. In
the first experimental group, birds were added Humac Natur (min. 62% humic acids in dry matter) at
a dose of 3 g per 1 kg of feed mixtures. In the second experimental group, birds were added probiotic
based on Bacillus subtilis (min. 1 × 107 CFU) and
Lactobacillus paracasei (min. 1 × 107 CFU) at a dose
of 1 g per kg of feed mixtures. Daily laying traits were
138
observed during 215 days (7 months) in each group.
The best laying traits were observed from 12 to 20
weeks of age in each group. In the first part of the experiment duration (July to October), birds of the first
experimental group with the Humac Natur addition
had the best laying traits; in the second part of the
experiment duration (November to January), birds
of the control group had the best laying traits. Laying traits evaluated throughout the whole experiment
were better in birds of the first experimental group
added Humac Natur addition in comparison to birds
of the second experimental group added probiotic.
Laying traits in birds of the control group were also
better than these in bird of the second experimental group (added probiotic). Research indicates that
birds added Humac Natur are better laying traits than
birds added probiotic.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Single nucleotide polymorphism of PMCA genes
in ISA Brown laying hens
Eliska Horecka, Cenek Horecky, Lenka Kovarikova, Ales Knoll, Ales Pavlík
Mendel University in Brno, Czech Republic
e-mail: pavlik@mendelu.cz
The experiments were performed in 110 ISA BROWN
egg production hens, kept from 15 to 26 week of age
in enriched (furnished) housing technology. Therefore, the present objective was to investigate the presence of SNPs of ATP2B1 gene. Plasma membrane
calcium-transporting ATPase 1 gene (ATP2B1) in
hens is located on chromosome 1, region 43 273 706
– 43 305 815 bp. ATP2B1 gene has 21 exons. In this
study three exons were genotyped. In the investigated
group of animals only allele without deletion in exon
10 and only allele A in exon 12 were found. In exon
8 only genotypes CC/CC, TT/CC and TT/TT were
found.
139
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The effect of supplementation of enzyme preparation
on base of pepsin on performance and carcass
characteristics of Japanese quail
Cyril Hrnčár, Denis Porubský, Ján Weis, Henrieta Arpášová,
Veronika Pistová, Jozef Bujko
Department of Poultry Science and Small Animal Husbandry, Slovak University of Agriculture in Nitra, Slovakia
e-mail: cyril.hrncar@uniag.sk
The objective of this study was to investigate the effects of three levels of supplement prepared on the
base of pepsin (0.8 ml, 1.0 and 1.2 ml) in 1l of drinking water on performance and carcass characteristics
of Japanese quails. Growth performance traits including weight gain, feed consumption and mortality were
recorded. At the end of the experiment, five birds per
treatment were slaughtered and carcass characteristics were measured. The results of this study indicated that supplementation of enzyme beneficial af-
140
fected body weight, feed consumption and mortality
in quails. All carcass traits, except for abdominal fat
weight, were not influenced by enzyme supplementation. The abdominal fat was higher in control birds.
We found that the addition of enzyme in 1.2 ml per
1 liter of water affected growth potential of the Japanese quail the most. It is concluded that enzyme can
be successfully incorporated in nutrition of Japanese
quail as a growth promoter.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The adsorbents of mycotoxins in poultry
Inessa B. Izmailovich1, Marcin W. Lis2
Department of Animal Nutrition, Belarusian State Agricultural University in Horky, Belarus
Department of Veterinary, Animal Reproduction and Welfare, University of Agriculture in Krakow, Poland
1
2
e-mail: insera@tut.by
Mycotoxins are an invisible group of feed components of varying toxicity and the waste products of
mold fungi. The first mycotoxin adsorbents are natural minerals. The basis for the second generation of
the adsorbents have become organic substances. The
third generation of adsorbents consists of two parts:
mineral and organic. Representative of such adsorbents is phytomineral “Fungisorb”.
We studied the effect of the adsorbent of mycotoxins on the efficiency of growing broilers.
Studies have shown that the use of “Fungisorb” facilitated the intensification of growth of broiler chickens while reducing cost of feed per unit of live weight
gain. By the end of the experiment the difference in
body weight between the control and experimental groups was 88.2 g, which is 4.0% higher than the
control. At the same time the overall cost of feed to
weight gain in the experimental group were higher by
3.8 kg than in the control, and the cost of feed to live
weight gain per 1 kg were below by 3.6% increase in
the experimental group, indicating that a higher ratio
of nutrients feed the chickens of experimental group.
In the blood of chickens of experimental group
compared to the control was observed a statistically
significant difference in the content of red blood cells
(2.57 ± 0.08) 1012/L against (2.28 ± 0.07) in the control, which provided more substantial opportunities
for the effective implementation physiological functions and more rapid growth of experienced livestock. In addition the content of leukocytes was (28.3
± 0.43) 109/L in experience against (26.9 ± 0.31) in
the control; hemoglobin (89.4 ± 1.32) g/L in experiment against (87.5 ± 1.22) in the control.
Cellular and humoral factors to protect the body
from the chickens of experimental group had advantages.
Thus, the use in rations of broiler chickens adsorbent “Fungisorb” stimulates metabolism, strengthens
the resistance of the body, increases the growth rate
of young growth, while reducing the cost of feed to
weight gain, which is economically efficient.
Studies supported by DS 3263.
141
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Trends in current research on avian influenza viruses
Michał Jóźwiak, Krzysztof Wyrostek, Edyta Świętoń, Monika Olszewska-Tomczyk,
Krzysztof Śmietanka, Zenon Minta
Department of Poultry Diseases, National Veterinary Research Institute, Puławy, Poland
e-mail: michal.jozwiak@piwet.pulawy.pl
Avian influenza virus (AIV) causes the highest economic losses in poultry amongst all infective agents.
Due to their high variability, both highly and low
pathogenic AIV are capable of adaptation to new
hosts species, including humans.
Research on avian influenza viruses are currently
carried out in several main directions. The role of
wild birds as a reservoir of LPAIV in the pathogenesis of infections in poultry is underlined. Numerous studies focus on determination of adaptability
of these viruses, including molecular characterization of the direction of their genetic variability. Next
generation sequencing, which enables sequencing of
whole viral genomes, plays a key role. Methods of
genetic engineering facilitate studies on the significance of mutations and the role of individual genes.
The analysis of nucleotide sequences allows to determine pathogenicity, zoonotic potential and virus resistance to antiviral agents. The participation of some
compounds of host immune system in inducing virus
142
variability has not been yet excluded. Much attention
has been paid to the role of environmental stressors in
virus adaptation. The role of coinfections (especially
with immunosuppresive viruses) in AIV adaptation
is particularly underlined. The mammalian model
(eg. mouse BALB/c) has become a promising object
in research on viral variability and zoonotic potential of AIV. A further step in this study may be the
use of strains of mice with innate immune defect. The
trials of evaluation of protective properties of newly
constructed vaccines, mostly vector vaccines, are undertaken. The use of viral, bacterial and yeast vectors
is described. Great emphasis is placed on the studies of innate immune response in birds, based on the
level of expression of proinflammatory cytokines and
pattern recognition receptors and on identification
of the potential factors inducing this response. Many
studies are devoted to the role of TLR receptors in the
signaling pathway of immune response.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Selection of the best reference gene
in real-time qPCR studies in ovarian tissue
of hens treated with silver nanoparticles
Dorota Katarzyńska, Małgorzata Grzesiak, Andrzej Sechman
Department of Animal Physiology and Endocrinology, University of Agriculture in Krakow, Poland
e-mail: katdorota@op.pl
To achieve accurate and reproducible expression profiles of selected genes by real-time qPCR it is crucial
to use reliable housekeeping genes. It should be validated for each target cell or tissue type to confirm that
it remains unaltered at all points of the experiment.
The aim of this research was to evaluate the stability of 4 reference genes and to select the best one for
normalization of the gene expression analysis in the
ovarian tissues of hens treated with colloidal silver
nanoparticles (AgNPs).
Four genes were selected for the validation: HPRT
(hypoxanthine phosphoribosyltransferase), HMBS
(hydroxymethylbilane synthase), VIM (vimentin),
which were reported to be the most stable in the
chicken ovary according to Olias et al. (2014), and 18S
rRNA gene as one of the most commonly used reference gene. The expression levels of these four genes
were measured in 51 samples collected from ovarian
follicles of control hens (n = 17) and hens receiving
the 13 nm AgNPs (n = 17) or 50 nm AgNPs (n = 17)
for 14 consecutive days. The stability of the reference
genes was determined by three different descriptive
statistics, i.e. geNorm, NormFinder and BestKeeper,
which produced highly comparable results.
The HPRT gene was characterized by the lowest
Cq variation and was recommended as the most suitable gene by the BestKeeper algorithm. Similar results
were obtained using the geNorm and NormFinder.
Outputs from these programs demonstrated that
HPRT and VIM genes were the most stable.
In conclusion, to achieve accurate comparison of
gene expression levels, two or more reference genes
should be used for data normalization. The combination of HPRT/VIM genes are suggested to be the
most suitable for gene expression evaluation in the all
chicken ovarian samples.
References
Olias P., Adam I., Meyer A., Scharff C., Gruber A.D.
2014. Reference genes for quantitive gene expression studies in multiple avian species. PLoS One, 9(6),
e99678.
Supported by NCN grant no 2014/15/N/NZ9/01435.
143
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Microstructural features of the Harderian gland in
Common pheasant (Phasianus colchicus talischensis)
and hybrid of Italian Amber and Common pheasant
Joanna Klećkowska-Nawrot1, Karolina Goździewska-Harłajczuk1,
Karolina Barszcz2, Artur Kowalczyk3, Ewa Łukaszewicz3
1
Department of Animal Physiology and Biostructure, Faculty of Veterinary Medicine,
University of Environmental and Life Sciences in Wroclaw, Poland
2
Department of Morphological Sciences, Faculty of Veterinary Medicine,
Warsaw University of Life Sciences, Poland
3
Division of Poultry Breeding, Institute of Animal Breeding,
University of Environmental and Life Sciences in Wroclaw, Poland
e-mail: lestat_v@poczta.onet.pl
The goal of this study was a characterisation of the
histological and histochemical morphology of the
Harderian gland in the wild and a hybrid of the wild
and domestic birds. The staining with haematoxylineosin, methyl green-pyronin Y, periodic acid-Schiff,
alcian blue pH 2.5, aldehyde fuchsin and Hale’s dialyzed iron were performed. In both species the Haredrian glands had multilobar tubuloacinar structure
type I. The Harderian glands in birds were located in
the orbit near the inter-orbital septum, between medial rectus muscle, pyramidal muscle of the third eyelid and ventral oblique muscle. In a common pheasant the gland was wider in the proximal and distal
part. The common pheasant had more elongated
lobes of the Harderian gland than in the hybrid one.
In the common pheasant, the glandular cells were
144
darkly stained – serous secretion and lightly stained
– mucous secretion. In the hybrid the glandular cells
had seromucous secretion. Central lobular space, interacinar space, and apical parts of the acini of the
Harderian glands were filled with many lymphocytes
and plasma cells especially in the common pheasant,
where all centers of big lobes were abundantly filled
with plasma cells. The plasma cells dominated in the
common pheasant`s Harderian gland, while in the
hybrid a similar quantity of lymphocytes and plasma
cells were present. The periodic acid-Schiff positive
cells were dominant in the hybrid. The stainings with
periodic acid-Schiff, Hale’s dialyzed iron, alcian blue
pH 2.5 and aldehyde fuchsin demonstrate an acid,
carboxylated mucopolysaccharides, in glandular cells
cytoplasm in the examined birds.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Symbiotic regulates incretin (GIP and GLP-1)
expression and secretion in chicken duodenum
Paweł A. Kołodziejski, Ewa Pruszyńska-Oszmałek, Maciej Sassek, Daniela Chałupka,
Tomasz Szwaczkowski, Paweł Maćkowiak, Leszek Nogowski
Department of Animal Physiology and Biochemistry, University of Life Sciences in Poznan, Poland
e-mail: pawelbigi@o2.pl
There is an evidence that synbiotics have positive impact on the gastrointestinal track. Since 2006, when
the European Union banned use of antibiotic growth
promoters in poultry nutrition, researchers have tried
to find alternatives to these compounds. Problems
with finding the alternatives to replace antibiotics
in poultry nutrition and potential strategies for supporting animal husbandry are some of the most intensively studied and the most widely discussed areas
within the husbandry sciences. Natural alternatives to
antibiotics for poultry production are prebiotics and
probiotics, alone or in combination (synbiotics). In
addition, an interesting aspect of the research is the
method of administration. In ovo technique there is
a new method of supplementation which allows for
application synbiotics in early developmental stage.
Simultaneously, enabling the modulation of microbiota in gastrointestinal tract immediately after hatching.
Incretins are a group of metabolic hormones which
include: GIP (gastric inhibitory peptide) and GLP-1
(glucagon-like peptide-1). Incretins slow down the
rate of absorption of nutrients into the blood stream
by reducing gastric emptying and may directly reduce
food intake.
We decided to investigate effect of in ovo symbiotic (SYN1 – Lb. salivarius 3154 + Bi2tos, SYN2 Lb.
plantarum 3036 + RFO) administration on incretin
expression and secretion in chicken broilers.
We found a decrease of GLP-1 and GIP expression
in chicken duodenum, and the effect of SYN1 was
stronger than SYN2. Moreover, we investigated incretin level in blood serum, and we found statistically
significant changes in GIP and GLP-1 concentrations
between experimental groups.
Results of the experiment indicate that synbiotics
regulate incretins signaling and secretion in broiler
chickens.
This project has received funding from European Union’s
Seventh Framework Programme for research, technological development demonstration under grant agreement
No. 311794 the Ministry of Science and Higher Education No. W171/7.PR/2014.
145
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Optimising behavioural tests for studying
cognitive bias in poultry
Ľubor Košťál1, Mária Horváth1, Katarína Pichová1, 2
1
Slovak Academy of Sciences, Institute of Animal Biochemistry and Genetics, Ivanka pri Dunaji, Slovakia
2
Faculty of Natural Sciences, Comenius University in Bratislava, Slovakia
e-mail: lubor.kostal@savba.sk
Although the connection between emotions and cognition is broadly accepted in humans, the potential of
this interaction as a source of information about the
animal emotions has been discovered only recently.
Since the seminal study of Harding et al. (2004) there
have been published many studies exploring the cognitive bias in numerous species, including birds and
poultry. In our laboratory we are studying this phenomenon for several years. We have used two model
animals – Japanese quail and laying hen and several
methodological approaches. The most of our studies
are based on the operant conditioning techniques.
For this purpose we have developed custom operant conditioning chambers for quail and domestic
chicken with touch-screen monitor. These devices
are driven by the Biopsychology Toolbox, a free, open
source Matlab Toolbox for the control of behavioural
experiments. There are many factors affecting operant discrimination learning as well as the ambiguous
stimuli tests. One of them is the value of the reward.
146
We have used pelleted food (requires food deprivation to keep birds motivated) as well as highly palatable mealworms (does not require food deprivation).
To enable testing without food deprivation we have
developed automatic mealworm dispenser. We have
tested also the other approaches. We attempted to
train quail on a go/no-go procedure to discriminate
between two visual stimuli (cardboard lids of white
and dark grey) associated with outcomes of a different value (palatable and unpalatable mealworms hidden underneath). Nevertheless, this technique that
worked in starlings (Bateson and Matheson 2007) did
not prove to work in quail. We have also adopted the
spatial judgment task of Burman et al. (2008) for the
use in quail. Using suitable reward (mealworms) and
punishment (white noise) it proved to be applicable
in quail (e.g. for studying the effect of mothering). In
the presentation we will discuss perspectives of the
cognitive bias testing in poultry.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Quality of native breed hen eggs stored under
different conditions
Józefa Krawczyk
Department of Animal Genetic Resources Conservation,
The National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: jozefa.krawczyk@izoo.krakow.pl
The aim of the study was to determine the quality of
eggs from 6 breeds/lines of hens included in the conservation programme after 28 days of storage in different temperature and relative humidity conditions.
Tests were conducted with class M eggs (53–63 g)
from 36-week-old hens: Greenleg Partridge (Z-11),
Yellowleg Partridge (Ż-33), Sussex (S-66), Leghorn
(H-22), Rhode Island Red (R-11) and Rhode Island
White (A-33). After laying, eggs were divided into
three groups with 20 eggs per group. Group I were
fresh eggs, group II were refrigerated eggs (average
temperature 4–5°C, 29–36% humidity), and group III
were cool-stored eggs (average temperature 14–16°C,
40–45% humidity). Interior egg quality and shell
quality for eggs from groups II and III were evaluated after 28 days of storage. Eggs from native and
local breeds hens were found to show considerable
variation in many quality traits. Cool-stored eggs
for 28 days were characterized by a significant deterioration in thick albumen quality compared to eggs
stored in a refrigerator. Poorest results in this respect
were obtained by eggs from Greenleg Partridge hens.
These results suggest that eggs from native hen breeds
should be refrigerated because when stored at 14–
16°C they lose too much of their weight, while thick
albumen quality parameters may downgrade them
from marketable class A.
147
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Carcass muscling and colour in poulards
from Sussex (S-66) hens
Józefa Krawczyk, Joanna Obrzut
Department of Animal Genetic Resources Conservation,
National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: joanna.obrzut@izoo.krakow.pl
The aim of the study was to determine the effect of
poulardization of Sussex (S-66) hens on body weight
and selected meat quality parameters. The experiment used 100 Sussex (S-66) pullets, half of which
were poulardized at 10 weeks of age. The control
group were unsterilized pullets. Throughout rearing,
all birds were fed ad libitum the same diets and kept
on litter with outdoor access, under optimal environmental conditions. At 23 weeks of age, the pullets and
poulards reached a body weight of 1617 g and 1726 g,
respectively. The poulard group was characterized by
148
higher dressing percentage and weight of breast and
leg muscles (P ≤ 0.05). Compared to hens, poulards
had a greater content of abdominal fat (by 22.8 g), but
with large variation in this trait the differences were
not statistically confirmed. The groups also differed
in carcass colour, which was lighter (L*) and yellower (b*) in poulards compared to hens. The results
obtained show that the poulardization of Sussex (S66) pullets had a beneficial effect on increasing body
weight and improving carcass meatiness.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The effect of breed and free-range production system
on quality of meat from hens of two native breeds
Józefa Krawczyk, Michał Puchała
Department of Animal Genetic Resources Conservation,
National Research Institute of Animal Production, Balice near Krakow
e-mail: michal.puchala@izoo.krakow.pl
The objective of the study was to determine the effect
of breed and free-range production system on quality of meat from hens of two native breeds, Greenleg
Partridge (Z-11) and Rhode Island Red (R-11).
The experimental material consisted of 120 hens
of each breed, which were assigned to two treatment
groups differing in the housing system: 60 layers were
kept on litter without outdoor access (C) and 60 layers were raised on litter with access to free range (FR).
At 56 weeks of age 8 hens were randomly chosen from
each group, slaughtered and subjected to slaughter
analysis.
It was found from the study that carcasses from
56-week-old general-purpose hens were characterized by poor muscle development, considerable fat
content, low tenderness, and high water holding capacity. In the meat of hens that completed their first
year of egg production, the profile of fatty acids was
beneficial from the standpoint of human nutrition.
The free-range production system reduced carcass
fatness, enhanced carcass and meat yellowness, and
increased the proportion of polyunsaturated fatty acids (both n-6 and n-3) in breast and leg muscles while
causing no significant changes in the content of saturated fatty acids. The free-range system improved the
meat quality traits in Greenleg Partridge hens (Z-11)
to a greater extent than in Rhode Island Red hens (R11). The meat of the Z-11 breed was found to contain
less saturated and more unsaturated fatty acids compared to the meat of R-11 hens.
149
Wpływ wybiegowego systemu chowu
na jakość mięsa kur dwóch rodzimych ras
Józefa Krawczyk, Michał Puchała
Dział Ochrony Zasobów Genetycznych Zwierząt, Instytut Zootechniki – Państwowy Instytut Badawczy,
Balice k. Krakowa
e-mail: michal.puchala@izoo.krakow.pl
Celem badań było określenie wpływu rasy i wybiegowego systemu chowu na jakość mięsa dwóch wybranych rodzimych ras kur, tj. zielononóżki kuropatwianej (Z-11) i karmazyna (R-11).
Badaniami objęto po 120 kur każdej rasy, które
przydzielono do dwóch grup różniących się systemem utrzymania: 60 niosek utrzymywano na ściółce
bez dostępu do wybiegu, a 60 na ściółce z dostępem
do zielonych wybiegów. W wieku 56 tygodni wybrano losowo po 8 kur z każdej grupy, które poddano
ubojowi, a następnie ocenie wartości rzeźnej.
Stwierdzono, że tuszki badanych 56-tygodniowych kur ogólnoużytkowych charakteryzują się słabym umięśnieniem, znacznym otłuszczeniem, małą
kruchością i dużą wodochłonnością. Mięso badanych kur po pierwszym roku użytkowania nieśnego
150
charakteryzowało się korzystną z punktu widzenia
dietetyki człowieka strukturą kwasów tłuszczowych.
Wybiegowy system chowu kur wpłynął na zmniejszenie otłuszczenia tuszek, zwiększenie wysycenia barwy tuszek i mięsa w kierunku żółci oraz zwiększenie
udziału wielonienasyconych kwasów tłuszczowych
PUFA zarówno szeregu n-6, jak i n-3 w mięśniach
piersiowych i mięśniach nóg, nie powodując istotnych zmian w zawartości nasyconych kwasów tłuszczowych. Stwierdzono większy wpływ wybiegowego
systemu chowu na poprawę cech jakości mięsa u kur
zielononóżka kuropatwiana (Z-11) niż u karmazynów (R-11). Wykazano, że mięso kur Z-11 zawiera
mniej nasyconych, a więcej nienasyconych kwasów
tłuszczowych w porównaniu z mięsem kur (R-11).
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Carcass quality of fattening laying-type cockerels
Lucie Kupčíková, Martina Lichovníková, Alena Przywarová, Vojtěch Anderle
Department of Animal Breeding, Mendel University in Brno, Czech Republik
e-mail: kupcikovalucie@seznam.cz
Laying-type cockerels in most countries with developed poultry industry are euthanized immediately
after hatching and they are regarded as waste, which
is very unethical. Fattening of the cockerels could be
an alternative to their killing after hatch. Therefore an
experiment was conducted. Males of four laying-type
DOMINANT hybrids from the company Hatchery
Studenec, s.r.o., two hundred of each, were used in
the experiment. Cockerels were fattened on litter until 18 weeks of age. At the age 12 and 18 weeks the
carcass yield and the carcass quality of 10 cockerels
of each hybrid were evaluated. At 12 weeks of age
there was no significant difference (P > 0.05) among
the hybrids in live body weight, carcass weight, and
thigh and breast muscle proportion. The highest carcass yield was found in D 853 hybrid. At 18 weeks
of age the highest live body weight and carcass yield
was in hybrid D 853. Anyway there was no significant
difference in breast yield among the hybrids. The significantly lowest thighs proportion was found in the
hybrids D 109 (P < 0.05).
151
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The effect of day length on broiler breeders’
performance at suboptimal females’ weight
Martina Lichovnikova, Sarka Volna
Faculty of Agri Sciences, Mendel University in Brno, Czech Republic
e-mail: lichovmartina@gmail.com
The aim of the study was to compare 13 h and 14 h
day lengths on broiler breeders’ performance, while
the females had suboptimal body weight at the time
of mixing males and females (19 weeks). Two houses
on the same farm with the same hybrid combination,
technologies and with the same age of the flock were
used in this experiment. Approximately 5,400 females
were housed in each flock. At 19th week of age the
average female weight in both flocks was 234 g lower
than the recommendation for this hybrid is in this
age. Daily feed intake was increased in both flocks
to rich the final body weight, however the live body
weight was lower till 21st week of age. At the age of
155 days the day length was firstly prolonged from
8 h to 11 h and consequently the day length was pro-
152
longed till day 186. From this age 13 h day length was
used in one flock and 14h in the second one. Hatching eggs weight from 28th to 35th weeks of age was
significantly lower (P < 0.05) in flock with 14 h day
length in comparison with the flock with 13 h day
length (61.9 g vs 60.8 g). Between eggs weight from
28th to 57th weeks of age there was no significant difference (P > 0.05). There was no significant (P > 0.05)
difference between the flocks in laying intensity, flock
uniformity, proportion of double yolk eggs or hatching eggs. The day length 13 h is sufficient for broiler
breeders. Longer lay length can have negative effect
on hatching eggs weight at the beginning of laying period in flock with suboptimal body weight at time of
mixing males and females.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Asymmetry of roosters’ primary
and secondary sexual traits
Ewa Łukaszewicz, Martyna Lasoń
Department of Poultry Breeding, Wrocław University of Environmental and Life Sciences, Poland
e-mail: martyna.lason@up.wroc.pl
Asymmetry of roosters’ bilateral traits refers to the
random deviations from symmetry of their development. It may reflect the males ability to cope with either environmental or social stress. Males with more
symmetrical sexual traits tend to benefit from greater
reproductive success than males exhibiting high degree of asymmetry. Moreover, females prefer to mate
with more symmetric males.
The main goal of the study was to determine the
degree of fluctuating asymmetry (FA) of primary
(testes) and secondary (wattles) sexual traits of four
different lines of roosters. Testes and wattles were collected from roosters in semen production at 40 weeks
of age from two laying (ISA Brown and Lohmann
Brown) and two broiler breeders (Hubbard Flex and
Hubbard F15) lines (15 males per line) immediately
after decapitation. Testes and wattles length, width
and testes thickness were measured to the nearest 0.1
cm using digital callipers. Testes were also weighed on
digital scale to the nearest 0.1 g. The degree of relative
FA between the left (L) and right (R) trait was calculated according to the following formula: |L – R|/(L +
R). These measures did not deviate from normal distributions with a mean value of zero (Shapiro-Wilks
test, P > 0.005 in all cases), which indicates that the
traits demonstrate FA.
The results of the study show that degree of asymmetry of measured bilateral traits varies between 0.02
to 0.09. The only difference in FA measurements between the lines was found in wattle length, it was significantly (P ≤ 0.05) greater for Hubbard Flex than
for Hubbard F15 and Lohmann Brown. The other FA
measurements did not differ between the lines. Data
obtained show that bilateral traits of all four rooster
lines was symmetrical, which means that the males
did not suffer from any elevated level of stress. Moreover, there was no evident differences in the degree
of FA between meat-type and laying lines of roosters.
153
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Comparison of embryo development
at the oviposition of three goose breeds
Ewa Łukaszewicz1, Martyna Lasoń1, Murray Bakst1, Krzysztof Andres2,
Joanna Rosenberger1, Artur Kowalczyk1
1
Department of Poultry Breeding, Wrocław University of Environmental and Life Sciences, Poland
2
Department of Swine and Small Animal Breeding, University of Agriculture in Krakow, Poland
e-mail: martyna.lason@up.wroc.pl
Geese are characterized by low reproductive traits
and show many characteristics of wild birds, i.e.
short, seasonal reproductive period, low number
of laid eggs, fertility and hatchability rarely exceeding 80%, as well as high embryo mortality. All these
factors result in low number of goslings (about 30)
obtained from one goose per year. Taking the above
and a large variety of goose breeds into consideration, the optimisation of egg handling and incubation
conditions, adapted even to breed specific requirements, become extremely important. These might be
achieved by getting deep knowledge about early embryo development.
The main goal of project was to determine whether goose genotype affects embryo development i.e., if
embryos from different breeds are in the same stage
of development at the oviposition.
Freshly laid eggs from three breeds: White Koluda,
Bilgoraj, Zatorska, were storage at 14–16°C before examination. After distinguish the egg status (fertilized
154
or not), blastoderm was isolated and cleaned off the
egg-white and yolk, and then analysed under the stereo microscope and staged according to Eyal-Giladi
and Kochav (EGK, Roman numerals) and Hamburger and Hamilton (HH, Arabic numerals) procedures.
From each breed at least twenty blastoderms were
staged. There was a wide range in embryo stages despite the breed. Blastoderms between Stage X EGK
to 2 HH appeared in all breeds. White Koluda embryos were the least developed, majority of them did
not exceed Stage X EGK. Most of Bilgoraj and Zatorska goose embryos were at Stage X EGK or XIII
EGK, which is characterized by complete hypoblast
formation. The results showed no evident differences
in embryo development of examined goose breeds
however, since the other studies indicate that stage
of embryo development at the oviposition determine
it further survival during egg storage, they provide
information allowing to improve the effectiveness of
goose breeding.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The use of the quail chorioallantoic membrane
as an experimental in vivo model
Mariana Máčajová1, Monika Buríková1, 2, Ivan Čavarga1, 3, Pavel Výboh1, Boris Bilčík1
1
Institute of Animal Biochemistry and Genetics, Slovak Academy of Sciences, Bratislava, Slovakia
2
Cancer Research Institute BMC, Slovak Academy of Sciences, Bratislava, Slovakia
3
St Elizabeth Oncological Institute, Bratislava, Slovakia
e-mail: mariana.macajova@savba.sk
An excellent alternative to the use of experimental animals for in vivo testing (e.g. toxicity, potential drugs
and biomaterials testing, cancer diagnosis and treatment) is avian chorioallantoic membrane (CAM).
CAM is an extraembryonic membrane which forms
a primary respiratory and excretion organ of the embryo. It is thin and transparent, with dense capillary
network. CAM is structurally similar to the retina,
buccal mucosa, lungs, placenta and blood brain barrier tissues and offers multiple advantages over other
in vivo models. In addition to the low cost, simplicity,
and possibility to continuously visualize the test site,
CAM model fulfils the 3Rs concept.
Most frequently used is chicken CAM, however,
Japanese quail CAM can be used with similar results.
In our experimental work we used ex ovo technique
with quail embryo. Tested substances can be applied
systematically or topically on CAM surface. We examined angiogenic effect of several compounds (e.g.
endogenous peptide leptin, ghrelin, heparin) admin-
istered in ovo or on ex ovo culture. Changes in blood
vessel density were quantified by the fractal analysis.
Results clearly showed stimulating effect of leptin on
blood vessel development. In another series of experiments we explored possible use of quail CAM for
photodynamic diagnosis and therapy of cancer. Photodynamically active drug Hypericin (HYP) applied
on tumour implanted on CAM surface in fluorescent
light better visualized location of tumour, compared
to white light. Addition of low density lipoproteins as
a delivery molecule improved even more detectability
of tumour position.
Our results indicate that Japanese quail CAM
model is useful tool for the study of antivascular
therapy and tumor angiogenesis, development of new
biophotonic techniques as well as novel drug testing.
This research was supported by VEGA grant
No. 2/0102/15.
155
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Activity of antioxidant enzymes and degree
of lipid peroxidation in eggs from Greenleg Partridge
hens depending on the housing system
Renata Muchacka1, Ewa Sosnówka-Czajka2, Iwona Skomorucha2
Department of Animal Physiology and Toxicology, Institute of Biology,
Pedagogical University of Cracow, Poland
2
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
1
e-mail: rmuchacka@up.krakow.pl
The aim of the study was to determine the activity
of antioxidant enzymes and the level of reduced glutathione (GSH) and malondialdehyde (MDA) in eggs
of hens kept in three housing systems. The experiment used hens of the Greenleg Partridge conserved
breed. Birds were fed ad libitum standard diets based
on layer concentrates. Throughout the experiment,
birds had free access to water. At 18 weeks of age,
hens were assigned to experimental groups differing
in the housing system: group I – furnished cages (750
cm2/bird), group II – litter (9 birds/m2), group III –
litter (9 birds/m2) with outdoor access (2.5 m2/bird).
At 44 weeks of age, 36 eggs (6 eggs from each
group) were collected to determine the yolk and albumen concentrations of MDA and GSH, and the ac-
156
tivity of antioxidant enzymes: superoxide dismutase
(SOD), glutathione peroxidase (GPx) and catalase
(CAT). The results were statistically analysed by oneway analysis of variance and significant differences
were estimated with Duncan’s multiple range test.
The activity of SOD and GPx in yolk and albumen was significantly higher for hens kept on litter
(groups II and III) compared to caged birds (group I).
The highest GSH concentration was observed in yolk
and albumen of eggs from hens in group III, and the
lowest MDA concentration was found in eggs of hens
from groups II and III.
These results suggest that housing system can influence the antioxidant status, and thus the quality of
eggs from Greenleg Partridge hens.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effects of herbal mixture and short-term aflatoxin
exposure on performance, some blood lipid peroxide
and glutathione redox parameters of laying hens
Mangesh Nakade, Krisztián Balogh, Erika Zándoki, Zsolt Ancsin,
Andrea Bócsai, Márta Erdélyi, Miklós Mézes
Department of Nutrition, Faculty of Agricultural and Environmental Sciences, Szent István University, Hungary
e-mail: drmangesh23@gmail.com
Cereals, the most commonly used feedstuffs are often
contaminated with mycotoxins, secondary metabolites of moulds. Aflatoxin (AF) is a hepatotoxic mycotoxin, and, as others, it is thought to provoke oxygen
free radical formation and induce oxidative damage
in livestock. A body has some protection against reactive oxygen metabolites in form of antioxidant defense system. Many of herbs are capable of scavenging
free radicals, thus phytobiotics might be useful antioxidant additives in poultry nutrition.
The purpose of the present study was to investigate the short-term effect of AF (0.17 mg/kg) on
lipid peroxidation and some glutathione redox parameters in layers, and to evaluate the efficacy of an
herbal mixture (Herbamix® Basic Premix 600 mg/kg)
for counteracting short-term (36-hours) aflatoxicosis. Thus 60 Bovans Goldline hens were divided in
four groups (Control, Aflatoxin, Herbamix, Aflatoxin + Herbamix) and 5 birds of each group were
slaughtered and sampled at 12th, 24th, 36th hours of
the experiment. Parameters of the lipid peroxidation
(malondialdehyde, MDA) and the glutathione redox
system (reduced glutathione (GSH) content and glutathione peroxidase (GPx) activity) were measured in
blood plasma and red blood cell (RBC) haemolysate.
The results revealed that AF did not have an effect on feed intake, body and liver weight, but MDA
content was increased, in blood plasma and RBC
haemolysate, as the effect of the combined treatment at 36 hours of the trial. GSH content was significantly reduced due to the Herbamix treatment in
RBC haemolysate, but no other changes were found.
The activity of GPx was lower in all treated groups in
blood plasma, and the difference was significant at 36
hours as compared with the control, while no change
was found in RBC haemolysate. The results are contradictory with previous findings, probably due to the
short-term exposure, and a moderate modifying effect of Herbamix on AF toxicity.
157
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of age of broiler chickens on the expression
level of genes coding for calpain (CAPN1, CAPN2,
CAPN3) and calpastatin (CAST) in breast muscles
Joanna Nowak1, Katarzyna Połtowicz1, Katarzyna Piórkowska2
Department of Animal Genetics and Breeding, National Research Institute of Animal Production,
Balice near Krakow, Poland
2
Department of Animal Genomics and Molecular Biology, National Research Institute of Animal Production,
Balice near Krakow, Poland
1
e-mail: joanna.nowak@izoo.krakow.pl
The objective of the study was to determine the effect
of broiler chicken age on the expression level of genes
coding for calpain 1 (CAPN1), calpain 2 (CAPN2),
calpain 3 (CAPN3) and calpastatin (CAST) in breast
muscles.
Ross 308 cockerels were studied. At 35 (group I)
and 42 days of age (group II), 20 chickens whose body
weight was similar to average weight at a given age,
were selected from each group for slaughter. Within
15 min postmortem, samples of pectoralis superficialis muscles were collected from chickens to isolate
RNA and to determine the expression level of selected genes. After 24-hour chilling of carcasses at 4°C,
chickens were subjected to slaughter analysis. On this
basis, the percentage of breast muscles in relation to
carcass weight with giblets was calculated. The expression data were analysed using Sequence Detection System Software v. 2.0 (Applied Biosystems).
The results were statistically analysed with Statistica
10 PL.
158
The final body weight of 42-day-old chickens
(2657 g) was higher by 864 g on average (P ≤ 0.01).
The dissection results show that significantly better
breast muscling was characteristic of birds subjected
to a 7 days longer rearing period (P ≤ 0.01). A higher transcript level of the examined genes was characteristic of breast muscles from younger chickens.
However, no statistically significant differences in
the expression of CAST, CAPN1 and CAPN2 genes
in breast muscles from birds of different age groups
were found. Significantly stronger expression of the
CAPN3 gene was observed in breast muscles from
younger birds (group I; P ≤ 0.05). Analysis of the correlations showed that expression of the CAPN3 gene
was significantly negatively related to body weight
(–0.383; p = 0.018) and percentage of breast muscles
(–0.468; p = 0.003).
Our study demonstrated that the age of chickens
has an effect on expression of the CAPN3 gene in
breast muscles.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Expression of aromatase in the testis, epididymis and
ductus deferens of the turkey (Meleagris gallopavo)
with yellow semen syndrome
Laura Pardyak1, Alicja Kamińska1, Ewelina Górowska-Wójtowicz1, Anna Hejmej1,
Mariola Słowińska2, Małgorzata Kotula-Balak1, Andrzej Ciereszko2, Barbara Bilińska1
1
Department of Endocrinology, Institute of Zoology, Jagiellonian University in Kraków, Poland
Department of Molecular Andrology, Institute of Animal Reproduction and Food Research,
Polish Academy of Sciences, Olsztyn, Poland
2
e-mail: ewelina.gorowska@uj.edu.pl
Yellow semen syndrome (YSS) is endemic within the
population of domestic turkeys. No prior information
concerning the YSS is available. Most of the existing
evidence points to a viral origin, although other causes of the YSS appearance are not excluded. Yellow semen, when used for insemination, is characterized by
lower quality and reduced fertility. Since an essential
role of estrogens in male fertility has been reported
in mammals and several lower vertebrate species, we
aimed to examine the expression of aromatase in the
testis, epididymis and ductus deferens of YSS turkeys
compared with the turkeys producing white semen
(WS). The study was performed on tissue samples
collected from six adult YSS turkeys and six WS.
Morphological analysis of testicular, epididymal
and ductal deferens cells was performed by staining
with hematoxylin-eosin, whereas localization of aromatase and its expression were analyzed by immunohistochemistry and Western blot, respectively. In
testes of both YSS and WS turkeys, fully differentiated
germ cells, reflecting normal spermatogenesis were
observed. No obvious alterations were found in the
epididymis and ductus deferens morphology of YSS
turkey compared to WS individuals. Immunohistochemical analysis revealed aromatase as localized to
Leydig cells and germ cells residing in the basal compartment of the seminiferous tubules. Immunopositivity was detected in the cell cytoplasm, whereas nuclei
were negative. Intensity of the staining for aromatase
increased along the reproductive tissues being weak to
moderate in testicular cells, strong in epididymal cells,
and very strong in epithelial cells and smooth muscle
cells of the ductus deferens. Moreover, statistically significant increase in aromatase expression at protein
level (P < 0.001) was detected in all the YSS tissues
compared to those of WS turkeys.
Altogether, the results indicate the potential relationship between estrogens and appearance of the
YSS.
Supported by K/ZDS/005402.
159
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The influence of electromagnetic field emitted
by mobile telephony on chick hematology parameters
Krzysztof Pawlak, Bartosz Bojarski, Marcin Lis, Weronika Kanik,
Jerzy Niedziółka, Barbara Tombarkiewicz
Department of Veterinary Science, Animal Reproduction and Animal Welfare, Institute of Veterinary Sciences,
University of Agriculture in Krakow, Poland
e-mail: rzpawlak@cyfronet.pl
Artificial electromagnetic fields (EMF), which are
a consequence of human progress, begin to play
a considerable role in shaping the Earth’s electromagnetic environment. Among these, the fields generated
by mobile telephony deserve special attention due to
their prevalence. There are no data in the literature
concerning the impact of EMF on the hematological picture of animal organisms in the embryo stage.
Therefore, this study attempted to determine the effects of a 1800 MHz electromagnetic field on chick
hematology parameters. There were three hundred
sixty eggs used in the experiment. They were kept in
incubators. The eggs incubated using standard procedures were divided into 2 equinumerous groups:
group I (control) and group II (experimental). The
experiment was conducted in three sequential test
series. In each series, embryos from experimental incubators were exposed daily to electromagnetic field
from the first to the last day of incubation. EMF exposure time was as follows: Series I – 26 min per day
(13 times per 2 minutes), Series II – 40 min per day
160
(10 times per 4 minutes), and Series III – one
40-minute emission. Blood samples were collected
from newly hatched chicks. The samples were obtained from 10 exposed and 10 control individuals.
The total number of erythrocytes (RBC), the total
number of white blood cells (WBC), hematocrit (Hct)
value, and the total hemoglobin concentration (Hb)
were determined. The obtained results showed the influence of the EMF on the image of the chicks blood.
The significant increase of the WBC was observed as
well as the value of Hct and Hb concentration were
increased in the animals exposed to the EMF for
26 minutes a day. Whereas in animals that were exposed to the EMF for 40 minutes per day not only the
mentioned parameters were increased, but also the
RBC and MCHC. No significant changes were noted
in MCV and MCH values.
This research was financially supported by the statutory
activity: DS 3263.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Combined effect of T-2 toxin and deoxynivalenol
on regulation of the glutathione redox system
in broiler chicken
Csilla Pelyhe1, Benjámin Kövesi1, Erika Zándoki2, Miklós Mézes1,
Krisztián Balogh1, Balázs Kovács1
Faculty of Agricultural and Environmental Sciences, Szent István University, Hungary
Mycotoxins in the Food Chain Research Group, Hungarian Academy of Sciences – Kaposvár University,
Hungary
1
2
e-mail: pelyhe.csilla@gmail.com
The aim of this study was to evaluate the combined
effect of T-2 toxin and deoxynivalenol (DON) in
3-week-old broiler chickens, at the doses of A: 0.25
mg T-2 toxin and 5.0 mg DON/kg feed, B: 1.25 mg
T-2 toxin and 12.5 mg DON/kg feed and C: 2.5 mg
T-2 toxin and 25 mg DON/kg feed for 14-days. The
changes in gene expression of the GPx4 (phospholipid hydroperoxide glutathione peroxidase), GSS (glutathione synthetase) and GR (glutathione reductase)
were measured. Liver samples were taken on days 1,
2, 3, 7 and 14 after the beginning of a feeding trial.
Changes of the gene expression of target genes and
endogenous control gene, GAPDH (glyceraldehyde
3-phosphate dehydrogenase) were determined in the
liver, using qPCR with TaqMan probes.
GPx4 is described in avian and fish species to
be far more important in the antioxidant defense
system as compared to mammals; elevated on day
1, but showed only minor changes later. GSH plays
important role in the antioxidant system, protecting
cells from oxidative stress. GSS, which is the final enzyme in the glutathione (GSH) biosynthesis pathway,
showed an inhibition and a slow, but continuous, elevation in gene expression, which exceeded the control
levels after 14-days. During the observed period GR,
which catalyzes the reduction of glutathione disulfide
(GSSG) to GSH, repairing its antioxidant abilities,
showed decreased levels which later elevated and exceeded control levels, but decreased on day 14 again.
The members of glutathione-redox system responded to the mycotoxin exposure in gene expression levels, which can be in association with emerging formation of reactive oxygen species (ROS). The
transcription of antioxidant enzymes are regulated by
Nrf2-ARE pathway, which reacts sensitively to oxidative stress and modulates the transcript of the antioxidant defense system.
This study was supported by the János Bolyai Research
Scholarship (BO/261/13) of the Hungarian Academy of
Sciences and Hungarian National Research fund (OTKA
PD-104823).
161
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Thermographic evaluation of feather cover damage
in laying hens as a tool for welfare assessment
Katarína Pichová1, 2, Boris Bilčik1, Ľubor Košťál1
1
Institute of Animal Biochemistry and Genetics, Slovak Academy of Sciences, Ivanka pri Dunaji, Slovakia
2
Faculty of Natural Sciences, Comenius University in Bratislava, Slovakia
e-mail: katarina.pichova@savba.sk
The quality of the feather cover represents established
poultry welfare indicator because it can reflect the
health as well as outcome of animal-housing and animal-animal interactions. The infrared thermography
for its noninvasiveness and repeatability is considered
as a potential alternative to commonly used visual
feather scoring. The aim of this study was to measure
feather cover damage of laying hens kept in two housing systems and to compare the outcome of the infrared thermography evaluation with the standardized
feather scoring system based on the Welfare Quality® poultry protocol. Thirty beak trimmed Dekalb
White laying hens were starting from 16 weeks of age
housed in litter pens (n = 15) or enriched cages (n =
15). During the next four months the feather damage was assessed in two week intervals and then once
again at week 38 of the experiment. The assessment
was carried out on four body regions: head and neck,
back and rump, belly, and underneck and breast using feather scoring and two parameters derived from
162
the infrared thermographic measurement (the difference between the body surface temperature and the
ambient temperature and the proportion of featherless areas, represented as areas with the temperature
higher than 33.5°C). Data were analysed using the
generalized linear mixed model with housing, body
region and time as the fixed effects. The effects of
housing, time, region and housing x time interactions
on feather damage assessed by the feather scoring
and by both infrared thermography measures were
all significant (P < 0.001). Feather scoring as well as
the thermography parameters revealed higher damage in enriched cages compared to deep litter pens
with belly and back and rump being the most affected
body regions. There was significant positive correlation between the thermographic parameters and the
feather scoring (P < 0.001). These findings support
the feasibility of infrared thermography for the assessment of the feather cover quality in laying hens.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Applications of the CHD locus
in sex identification in birds
Angelika Podbielska, Anna Radko, Agnieszka Szumiec
Department of Animal Genomics and Molecular Biology, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: angelika.podbielska@izoo.krakow
To identify the sex of birds, techniques of molecular
biology are used increasingly, because nearly 50 percent of birds are sexually monomorphic. The CHD
gene has been widely used to determine the sex of
birds, due to the high degree of conservatism and
the presence of polymorphic variants of the Z and
W chromosomes. PCR products are usually visualized on agarose gel, where PCR amplification of the
CHD gene produces a double (ZW) and single (ZZ)
bands in females and males, respectively. In our laboratory, we have implemented a technology for identifications the bands using capillary electrophoresis. 69
individuals were tested from genera Columba and 45
individuals from genera Aprosmictus, Cacatua, Myiopsitta, Platycercus, Polytelis and Psittacula. Genomic DNAs were extracted from feathers and buccal
swabs. DNA isolates were amplified by PCR for the
CHD marker with primers, which was labelled with
fluorescent dye: 6-FAM. Sex-specific amplification of
CHD gene was amplified using the QIAGEN Multiplex PCR Kit, the amplified products were separated
on 3100xl Genetic Analyzer and genotyped using
GeneMapper software (Applied Biosystems). PCR
products were obtained for all samples. Variation in
the intronic sizes of CHD-W and CHD-Z gene was
detected by capillary electrophoresis. Two different
picks of PCR products was produced from CHDW and CHD-Z genes in females and one pick of PCR
products from CHD-Z gene in males. The tested
material had a high genetic diversity, were identified
an evident difference in products size. Additionally
5 gene variants in the range of 268–320 bp were observed.
163
Wykorzystanie konserwatyzmu genetycznego
sekwencji mikrosatelitarnej genu CHD
do identyfikacji płci u ptaków
Angelika Podbielska, Anna Radko, Agnieszka Szumiec
Dział Genomiki i Biologii Molekularnej Zwierząt, Instytut Zootechniki – Państwowy Instytut Badawczy,
Balice k. Krakowa
e-mail: angelika.podbielska@izoo.krakow.pl
W związku z faktem, że blisko 50% ptaków należy do gatunków monomorficznych, do identyfikacji
płci coraz częściej wykorzystuje się techniki biologii
molekularnej. Z uwagi na wysoki stopień konserwatyzmu i występowanie polimorficznych wariantów
na chromosomach Z i W, gen CHD znalazł szerokie
zastosowanie do oznaczania płci u ptaków. Do jego
analizy stosuje się techniki elektroforetyczne oparte na
wizualizacji produktu PCR na żelu agarozowym. Po
uzyskaniu obrazu w postaci dwóch lub jednego prążka ustala się odpowiednio żeńską lub męską płeć badanego osobnika. Obecnie w Laboratorium Genetyki
Molekularnej IZ PIB wdraża się metodę identyfikacji
płci z zastosowaniem techniki elektroforezy kapilarnej.
Dotychczas przebadano 78 osobników z rodzaju
Columba i 45 osobników z rodzajów Aprosmictus,
Cacatua, Myiopsitta, Platycercus, Polytelis i Psittacula. Materiał stanowił genomowy DNA uzyskany z piór
164
i wymazów. Reakcję PCR przeprowadzono z zastosowaniem wyznakowanej fluorescencyjnie barwnikiem
5-FAM sekwencji mikrosatelitarnej genu CHD. Produkty PCR poddano analizie fragmentów długości
w sekwenatorze 3100xl Genetic Analyzer, a wyniki
w postaci pików określonych liczbą par zasad odczytano w programie GeneMapper® Software 4.0.
Dla wszystkich osobników otrzymano produkty
PCR. Dla badanych samic uzyskano 2 produkty PCR
różnej długości z chromosomów CHD-W i CHD-Z,
natomiast dla samców dwa produkty tej samej długości z chromosomów CHD-Z. Pozwoliło to na obserwację w obrazie elektroforetycznym jednego lub
dwóch pików, co umożliwiło ustalenie płci. Uzyskano duże zróżnicowanie długości fragmentów DNA
świadczące o dużym zróżnicowaniu genetycznym
badanego materiału. Otrzymano 5 wariantów genu
w zakresie 268–320pz.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of early feed restriction on liveability, rearing
performance and meat quality of broiler chickens
Katarzyna Połtowicz, Joanna Nowak
Department of Animal Genetics and Breeding, National Research Institute of Animal Production,
Balice near Krakow, Poland
e-mail: katarzyna.poltowicz@izoo.krakow.pl
The aim of the study was to determine the effect of
feed restriction during the early period of rearing
broiler chickens on production results and meat quality.
In total, 540 sexed Ross 308 chicks (cockerels)
were randomly assigned to two groups with 270 birds
per group and reared on litter until day 42 of age under optimal environmental conditions. All birds were
fed the same complete starter, grower and finisher
diets containing 22, 20.5 and 20.5% CP and 2990,
3130 and 3130 ME/kg, respectively, and had free access to drinking water. Throughout rearing, chickens
from group I (control) were fed ad libitum, whereas
birds from group II (experimental) received about
66% of the control feed intake at 2 and 3 weeks of age.
Throughout the study, individual body weight, feed
consumption, and number of dead birds were determined every week. At the end of the rearing period,
30 chickens with average body weight were selected
from each group to estimate dressing percentage and
to determine carcass and meat quality. The results
were statistically analysed with analysis of variance
and Duncan’s test.
The body weight of chickens from groups I and II
averaged 2806 g and 2527 g, respectively (P ≤ 0.01).
The birds from both groups that differed in body
weight also showed differences in carcass fatness, but
a greater proportion of abdominal fat was observed
in group II. There were no differences in dressing
percentage and carcass percentage of breast and leg
muscles. Restricting body weight gain through feed
restriction did not improve the physicochemical
characteristics of broiler meat and did not change
the incidence of muscles characterized by higher drip
loss. This course of action, however, reduced mortality and improved feed conversion (kg feed/kg gain).
165
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effectiveness and safety
of the use of antibiotics in fowl
Andrzej Posyniak, Krzysztof Niemczuk
Department of Pharmacology and Toxicology, The National Veterinary Research Institute, Puławy, Poland
e-mail: aposyn@piwet.pulawy.pl
Intensification of farming, changing living conditions
and effective technologies to gain body weight can
lead to new, previously unknown health problems.
Changing the structure of the herd, crowding a limited space can promote the rapid spread of bacterial
infections. Therefore, before veterinary doctors it is
a unique challenge, because bred varieties can vary
quite significantly physiology and biochemical course.
Therefore, at the stage of accession to the treatment it
plays an important role knowledge, which allows you
to select the drug and to determine the dosage. For
use allowed a significant number of antibiotics, which
have a different mechanism of action and scope. The
doctor is able to find an appropriate antibiotic for the
treatment of bacterial infection, and the use of antibiotics accordance with the instructions may lead to
growing antibiotic resistance and the lack of therapeutic success in treating successive flocks of birds.
166
Furthermore, in the wrong, too high a dosage may
lead to a direct threat to animal health, the negative
impact on the body of the dispensing doctor or operating personnel. Another no less serious threat may
be residues of antibiotics, which can negatively affect the bacterial flora of the human gastrointestinal
tract. With prolonged exposure, they can modify the
composition of the bacterial flora and increase drug
resistance. In addition to the above mentioned side
effects of massive use of antibiotics on farms is environmental pollution are eliminated active substances
and/or products of their metabolism, which after getting into the soil, go into the water and become a secondary source of danger to humans and other living
organisms. This problem is all the more important as
drugs, depending on the chemical, physical and environmental conditions may be stable and its biological
activity for several months or even several years.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
In ovo synbiotic administration affects on metabolic
and hormonal profile in broiler chickens
Ewa Pruszyńska-Oszmałek, Paweł A. Kołodziejski, Maciej Sassek, Daniela Chałupka,
Tomasz Szwaczkowski, Paweł Maćkowiak, Leszek Nogowski
Department of Animal Physiology and Biochemistry, University of Life Sciences in Poznan, Poland
e-mail: ewaprusz@up.poznan.pl
There is evidence that synbiotics have positive impact
on the gastrointestinal microflora and they have antibacterial, immunostimulatory, and anti-inflammatory properties. However, the effect of bioactives on
hormonal profile and lipid-carbohydrate metabolism
is not entirely clear.
In the present study, synbiotics were given using
technology in ovo. This is a new, very promising technology, consisting in the administration of the bioacitve compounds, directly inside the eggs during their
incubation.
The aim of the present experiment was to evaluate
the effects of in ovo synbiotics administration on hormonal profile and lipids and glucose levels in serum
blood of broiler chickens.
On d 12 of incubation, the eggs were divided into
control group and two experimental groups (SYN1
and SYN2) treated with different synbiotics, administered in ovo. The SYN1 group was injected with a solution containing Lb. salivarius 3154 + Bi2tos, and
SYN2 group received Lb. plantarum 3036 + RFO. On
days 1, 3, 7, 14, 21, and 42, cockerels were slaughtered
and blood was collected. The concentration of insulin,
glucagon, leptin and corticosteron was determined in
serum blood. Furthermore, we measured blood lipids
and glucose levels.
We found a rise of glucagon and leptin levels in
SYN1 group compared to control broiler chicken, respectively, at 21 and 7 days of age the birds. The effect of synbiotics on corticosteron concentration was
noticed only at the beginning of the experiment (on
day 4). The cholesterol, triglycerides and glucose concentrations determined in this study were found to
be similar among control and experimental groups,
whereas free fatty acids level significantly differ between the groups, however, only in the oldest birds.
This project has received funding from European Union’s
Seventh Framework Programme for research, technological development demonstration under grant agreement
No. 311794 the Ministry of Science and Higher Education No. W171/7.PR/2014.
167
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Application of 10 microsatellites DNA markers
for parentage control in pigeons
Anna Radko1, Agnieszka Szumiec1, Angelika Podbielska1, Tomasz Borkowski2
1
Department of Animal Genomics and Molecular Biology, National Research Institute of Animal Production,
Balice near Krakow, Poland
2
Veterinary Laboratory, Coba Diagnostic, Sośnicowice, Poland
e-mail: anna.radko@izoo.krakow.pl
Microsatellite DNA became an international standard for individual identification and parentage verification of animals. We tested the polymorphism of 10
microsatellite markers and their usefulness for parentage verification in pigeons.
Samples were collected from 69 individuals of Polish, German and Belgian breeds from different locations in Poland. The assay involved the following 10
loci: CliµD01, CliµD16, CliµD32, CliµT13, CliµT17,
PG2, PG3, PG5, PG6, PG7 and the bird sex marker
CHD. We used genomic DNA extracted from feathers and buccal swab samples. DNA extracts were
amplified by PCR for the all microsatellite and CHD
marker, together in one multiplex reaction. Each of
the forward primers was labeled with fluorescent dye:
6-Fam, Vic, Ned and Pet. Markers were amplified using the QIAGEN Multiplex PCR Kit. The amplified
products were separated on 3100xl Genetic Analyzer
and genotyped using GeneMapper software (Applied
Biosystems).
168
In the study we detected 60 alleles, which number per locus ranged from 2 (PG5) to 8 (CliµD01 and
CliµT17). Based on the frequency of identified alleles,
expected heterozygosity (He) and observed (Ho) were
determined as Ho = 0.88 and He = 0.78, respectively.
The average negative inbreeding coefficients was Fis =
–0.03. The lowest polymorphism in the present study
was noted at the PG5 (PIC = 0.34 and H = 0.47),
where two alleles identified, and PG6 (PIC = 0.43 and
H = 0.59) for which two of three alleles occurred with
higher frequency in excess of 94%. The average power
of discrimination (PD) was 0.83. The combined power of discrimination values for all 10 loci reached the
high value as 0.9999999. The cumulative probabilities
of parentage exclusion, when one parent is known,
and when two parents are known (PEc1 and PEc2)
were 0.9726 and 0.9982, respectively.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Nesting behavior of Western capercaillie
(Tetrao urogallus) females in the breeding aviary
Joanna Rosenberger, Artur Kowalczyk, Ewa Łukaszewicz, Zenon Rzońca
Department of Poultry, Wrocław University of Environmental and Life Sciences, Poland
e-mail: joanna.rosenberger@up.wroc.pl
Capercaillie (Tetrao urogallus) is forest grouse that
need active protection, including releasing captive
birds from breeding centers into wild populations.
Despite years of research, biology of this species is
still poorly understood. Eggs incubation conditions is
an aspect which require revision, because the results
of artificial breeding (in incubators) are not satisfactory. Understanding the natural breeding process can
help to increase hatchability.
Out of the ten females selected for observation,
eight started the incubation. The studies have focused
mainly on length and frequency of the recesses (corresponding to egg cooling) and the egg turning frequency.
It has been observed that birds left the nest more
frequently between 15:00 and 19:00, however there
were not significant differences (p = 0.106). Individual factor did not affect on the preferred hours of recesses (p = 0.207). The total length of the recesses did
not depend on the individual preferences (p = 0.326),
but was dependent on incubation day (p < 0.001). On
the first day females spent outside the nest more time,
what suggest that the instinct of incubation, did not
fully activate. Nest leaving frequency was depended
on individual (p < 0.001). Bird 6 and 4, left the nests
significantly more often than the others. This behavior could be caused by weaker condition of females or
individual differences. On the other hand, the number of recesses did not affect the total length of stay
out of the nest. Egg turning rate frequency was affected by day of incubation (p < 0.001). Females turned
eggs more often during first four and last three days
of incubation. An hour affect the frequency of turning (p < 0.001). During the day, the females turned
eggs on average 1.0–1.3 times/hour, and less at night,
between 20:00 and 2:00. Individual factor had an impact on the turning frequency (p < 0.001). Female
number 3 turned eggs most frequently (1.4 turns/
hour.), the lower frequency of turnings was found in
female number 7 (0.8 turns/hour).
169
Zachowania lęgowe samic głuszca (Tetrao urogallus)
w hodowli wolierowej
Joanna Rosenberger, Artur Kowalczyk, Ewa Łukaszewicz, Zenon Rzońca
Zakład Hodowli Drobiu, Uniwersytet Przyrodniczy we Wrocławiu
e-mail: joanna.rosenberger@up.wroc.pl
Głuszec (Tetrao urogallus) jest kurakiem leśnym wymagającym czynnej ochrony, w tym zasilania dziko
żyjących populacji osobnikami pochodzącymi z hodowli zamkniętych. Mimo lat badań, biologia tego
gatunku wciąż jest niedostatecznie poznana. Jednym
z aspektów wymagających rewizji są warunki inkubacji jaj, gdyż wyniki sztucznych lęgów (w inkubatorach) są niezadowalające. Poznanie procesu lęgów
naturalnych może przyczynić się do zwiększenia wylęgowości piskląt. Spośród dziesięciu samic wytypowanych do obserwacji osiem przystąpiło do inkubacji
zakończonej wylęgiem. W badaniach skupiono się
głównie na długości i częstotliwości przerw (odpowiadających chłodzeniu jaj) oraz częstotliwości obracania jaj. Zaobserwowano, że ptaki nieco częściej
opuszczały gniazdo pomiędzy godziną 15:00 a 19:00,
nie były to jednak istotne różnice (p = 0,106). Czynnik osobniczy nie wpływał na preferowane godziny przerw (p = 0,207). Łączna długość przerw nie
zależała od indywidualnych preferencji osobnika
170
(p = 0,326), ale była uzależniona od dnia inkubacji
(p < 0,001). Pierwszego dnia samice przebywały poza
gniazdem dłużej, co sugeruje, że instynkt wysiadywania dopiero się uaktywniał. Częstotliwość opuszczania gniazda była uzależniona osobniczo (p < 0,001).
Samice 6 i 4 istotnie częściej opuszczały gniazdo niż
pozostałe. Zachowanie takie mogło wynikać ze słabszej kondycji dwóch głuszek lub różnic osobniczych.
Z drugiej strony liczba przerw nie wpłynęła na łączną
długość przebywania poza gniazdem. Na częstotliwość obrotów jaj wpływał dzień inkubacji (p < 0,001).
Samice częściej obracały jaja podczas pierwszych
czterech oraz ostatnich trzech dni inkubacji. Godzina miała wpływ na częstotliwość obracania jaj (p <
0,001). W ciągu dnia samice obracały jaja średnio
1,0–1,3 razy/godz., natomiast w godzinach nocnych,
pomiędzy 20:00 a 02:00, rzadziej. Czynnik osobniczy miał wpływ na częstotliwość obracania jaj (p <
0,001). Najczęściej jaja obracała samica 3 (1,4 obrotów/godz.), najrzadziej samica 7 (0,8 obrotów/godz.).
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
In ovo synbiotic administration modulates trypsin,
lipase and amylase activity in broiler chicken
Maciej Sassek, Ewa Pruszyńska-Oszmałek, Paweł A. Kołodziejski, Daniela Chałupka,
Tomasz Szwaczkowski, Leszek Nogowski, Paweł Maćkowiak
Department of Animal Physiology and Biochemistry, University of Life Sciences in Poznan, Poland
e-mail: macsass@up.poznan.pl
Probiotics, prebiotics and their combination – synbiotics are a relatively new alternative to antibiotics
which are banned in European Unions in poultry
nutrition. Synbiotics affect the host’s welfare by improving its survival, growth and health by activating
the metabolism and modulating microflora of the
gastrointestinal tract. Synbiotic selection and administration are some of the most intensively studied in
medical and also husbandry sciences. In ovo technique symbiotic injection is a solution which allows
for application of synbiotics in the early developmental stage and modulation of gastrointestinal tract microbiota immediately after the hatching.
In this study we decided to investigate effect of
symbiotic on enzyme (amylase, lipase and trypsin)
activity in pancreas and duodenum content. On the
12th day of incubation, the eggs were randomly divided into three experimental groups and treated in
ovo with different solutions. Control group (n = 10)
was injected with physiological saline. SYN1 experimental groups (n = 10) were injected with a solution
containing Lb. salivarius 3154 + Bi2tos and SYN2
experimental group (n = 10) received Lb. plantarum
3036 + RFO (raffinose family oligosaccharides). On
the days 1, 3, 7, 14, 21, and 42, 10 cockerels were sacrificed by cervical dislocation. The activity of pancreatic enzymes was determined based on the collected material. For investigation of amylase, lipase
and trypsin activities the colorimetric assay kits were
used.
We detected some changes in enzyme activity,
even on pancreatic level (enzyme activity were measured in pancreas homogenates). However, more visible changes were observed in chicken duodenum
content. Such results suggest that in ovo administration of synbiotics can have a long lasting effect in
chicken physiology and husbandry.
This project has received funding from European Union’s
Seventh Framework Programme for research, technological development demonstration under grant agreement
No. 311794 the Ministry of Science and Higher Education No. W171/7.PR/2014.
171
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of adding herb extracts to drinking water
on broiler chicken productivity, corticosterone level
and heterophil: lymphocyte ratio during heat stress
Iwona Skomorucha, Ewa Sosnówka-Czajka
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: iwona.skomorucha@izoo.krakow.pl
Ross 308 broiler chickens were assigned to 4 experimental groups. During the study, birds were exposed
for 6 days to high daily air temperatures (30°C). In
addition, from 21 days of rearing, water drinkers of
birds from groups 2, 3 and 4 were supplemented with
extracts of herbs: lemon balm (Melissa officinalis L.),
sage (Salvia officinalis L.) and common nettle (Urtica
dioica L.) at 2 ml/l water, respectively. Broilers were
kept in compartments on litter at a stocking density
of less than 33 kg/m2 and fed ad libitum standard diet.
Body weight, feed conversion and mortality were recorded throughout the study. During days of high air
temperature (days 31, 33 and 36), blood was collected
from 10 chickens per group to determine corticosterone levels, and blood smears were made to calculate
the heterophil to lymphocyte (H:L) ratio. These tests
were also performed 3 days after the reduction in air
172
temperature (20.7°C), i.e. on day 39 of rearing. The
results were statistically analysed with analysis of variance and significant differences were estimated using
Duncan’s test. In the first period of rearing, a statistically significant difference in feed conversion (kg/
kg gain) was noted between groups I, II and III and
group IV. Group IV was characterized by the lowest
bird mortality. Broiler chickens showed reduced corticosterone levels on days 36 and 39 compared to day
31 of the study. On day 33, birds from group III had
a lower H:L ratio compared to groups I (p ≤ 0.01) and
II (p ≤ 0.05). In conclusion, supplementing the drinking water with herbs failed to improve body weight
and feed conversion in broilers exposed to high air
temperatures. Birds receiving the nettle extract in water were characterized by better health compared to
the other experimental groups.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of housing systems on some blood
parameters of broiler chickens during a period
of high temperatures
Iwona Skomorucha, Ewa Sosnówka-Czajka
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: iwona.skomorucha@izoo.krakow.pl
The experiment was conducted during the summer
production cycle. Ross 308 broiler chickens assigned
to two experimental groups: I – birds kept on litter
without access to pasture, II – birds raised on litter
with access to pasture from the first day of rearing.
During the second rearing period, when outdoor
temperatures were high in the 4th and 6th week of the
experiment, blood was collected in 10 birds per group
to determine the levels of thyroid hormones, glucose,
corticosterone, and hematocrit. These tests were performed between 13:00 and 15:00 on days 24, 27, 36
and 41 of rearing. Similar tests were done on the 3rd
day after the decrease in external temperature, i.e. on
day 31 of growth. The results were statistically analysed with one-way analysis of variance and the differences were estimated using Duncan’s test. In broilers from group II, T3 decreased and T4 increased
with an increase in air temperature (p ≤ 0.01). In our
study, broiler chickens reared indoors had higher
glucose concentrations on days 27 and 31 as well as
higher corticosterone concentration on day 27 of the
experiment. Broiler chickens raised with outdoor access were characterized by stable blood glucose levels,
while the level of corticosterone decreased significantly during the second period of high external temperatures. In birds confined indoors, blood glucose
and corticosterone levels increased during the 4th
week of growth, i.e. during the first heat wave, and
decreased in the 6th week, i.e. during the second period of increased temperature. In both group I and II,
blood hematocrit was highly significantly the highest
on day 31 compared to the other test days. In summary, even a small increase in ambient temperature beyond the recommendation did influence the broiler’s
body homeostasis regardless of the housing system.
Broiler chickens with outdoor access during high external temperatures had a normal thermoregulatory
system, as indicated by the decrease in the level of T3
thyroid hormone.
173
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of growth hormone on estrogen receptor
and egg shell-specific protein gene expression
in the chicken shell gland during pause
in laying induced by fasting
Joanna Socha, Andrzej Sechman, Maria Mika, Anna Hrabia
Department of Animal Physiology and Endocrinology, University of Agriculture in Krakow, Poland
e-mail: rzhrabia@cyf-kr.edu.pl
The avian oviduct is a side of growth hormone (GH)
synthesis and endocrine/paracrine/autocrine actions.
Recent studies revealed that GH, beside orchestration
of ovarian steroid synthesis, regulates gene expression
of some egg specific-proteins in the chicken oviduct
during maturation. Since concentration of plasma
GH decreases during a pause in egg laying in hens,
in the present investigation the effect of GH administrations during the pause in laying on concentration of estradiol (E2) and its receptors and egg shellspecific protein gene expression in the chicken shell
gland were investigated. The pause in egg laying was
induced by food deprivation for 5 days, followed by
feeding every second day and from day 10 hens were
fed ad libitum. On day 6, 13 and 17–20 of experiment
the shell gland was isolated from hens: (1) control, (2)
fasted and (3) fasted and injected with chicken GH. In
tissues, concentration of steroid (RIA) and mRNA of
E2 receptors (ERalpha, ERbeta), ovocleidin-116, ovocalyxin-32 and -36 (real-time PCR) were examined.
174
The pause in egg laying occurred between the days
6 and 13. Fasting caused: (1) decrease in the tissue
concentration of E2 on the day 6 and 13, (2) increase
in gene expression of both ERs, and ovocalyxin-36 on
the day 6 of the experiment. Administrations of GH
(1) slightly abolished the fasting-induced decrease in
tissue E2 concentration, (2) elevated the expression of
ERalpha and ERbeta on the days 6 and 13 of experiment, (3) decreased the expression of ovocalyxin-36
and ovocleidin-116 on the day 6 of experiment. The
results obtained indicate that GH, by regulation of E2
concentration and ERs gene expression as well as expression of the egg shell-specific proteins produced in
the shell gland, may determine the rate of regression,
rejuvenation and functioning of this organ in chickens during molting.
Supported by: NCN grant no. 2011/01/B/NZ4/03665
and DS-3243/KFiEZ.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of adding herb extract to water on rectal
and radiated temperature of laying hens during
the summer heat
Ewa Sosnówka-Czajka, Iwona Skomorucha
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: ewa.sosnowka@izoo.krakow.pl
The aim of the study was to determine the effect of
supplementing drinking water with an antioxidant
herb extract of sage and common nettle during the
summer heat on rectal and radiated temperature of
laying hens kept in furnished cages.
The experiment was conducted from May to the
end of September on 435 Hy-Line laying hens, which
were kept in furnished cages (750 cm2/bird) from
16 weeks of age and assigned to three experimental
groups. Group 1 (control) received no supplements
in drinking water. In groups 2 and 3, water drinkers
were supplemented from 20 to 44 weeks of age with
extracts of sage (Salvia officinalis L.) and common
nettle (Urtica dioica L.) at 2 ml/l water, respectively. Birds were exposed to elevated air temperatures
throughout rearing. Chickens received ad libitum
standard diets based on layer concentrates. Birds had
free access to feed and water throughout the study.
During days of high air temperature (week 28 of
rearing), 10 hens per group were measured for radi-
ated temperature of feathered and unfeathered body
parts and for rectal temperature. The same measurements were made 3 days after the temperature
dropped to 20.1°C (week 29 of rearing). The results
were statistically analysed by one-way analysis of variance and significant differences were estimated with
Duncan’s multiple range test.
Birds from experimental groups 2 and 3, which received herb extracts in water, exhibited a decrease in
rectal temperature at 29 weeks of rearing (when temperature inside the house was around 20°C) compared
to the measurements made at higher air temperatures
(p ≤ 0.01). On the first day of high temperature, radiated temperature of both feathered and unfeathered
parts was higher in control birds and in birds receiving the sage extract in water. In all the groups, radiated temperature was observed to decrease during the
29th week of rearing.
175
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of breed of laying hens on production
results under organic conditions
Ewa Sosnówka-Czajka, Iwona Skomorucha
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: ewa.sosnowka@izoo.krakow.pl
The act on organic agriculture recommends that preference should be given to native breeds characterized
by relatively good health and adaptation to local climatic conditions. However, choosing the breed of
hens for producing organic table eggs may largely determine the profitability of production, because bird
productivity will be the main factor affecting the efficiency of organic farming. Therefore, the aim of the
experiment was to evaluate the productivity of hens
of different native breeds kept according to organic
farming principles on a certified poultry farm.
Subjects were 16-week-old pullets of conserved
breeds originating from organically raised Greenleg
Partridge and Rhode Island Red (RIR) laying hens.
Layers were fed semi-intensively according to organic
farming principles. Feed mixtures consisted of organic components. Throughout the experiment, birds
had free access to feed and water. Pullets were kept on
litter at a density of 6 birds/m2 of floor space and had
access to green paddocks (4 m2/bird). The paddocks
were equipped with shelters and drinkers.
176
Production results were monitored during the
study. The results were statistically analysed by oneway analysis of variance and significant differences
were estimated with Duncan’s range test.
Until 28 weeks of rearing, Rhode Island Red hens
were characterized by highly significantly higher egg
production compared to Greenleg Partridge hens.
Later in the egg production period, differences between the studied breeds were statistically significant.
RIR hens were also characterized by lower feed intake per egg. Breed of laying hens had no effect on the
health and mortality of organically raised layers.
The results show that RIR hens kept in accordance
with the rules of organic farming achieve better performance compared to Greenleg Partridge layers. As
a consequence, Rhode Island Red laying hens should
be the breed of choice for producing organic table
eggs.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of housing system on some parameters of egg
quality and egg-laying behaviour in laying hens
Ewa Sosnówka-Czajka, Iwona Skomorucha, Eugeniusz Herbut
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
e-mail: ewa.sosnowka@izoo.krakow.pl
There is evidence in the literature that laying hens in
the free-range system relatively often lay eggs outside the nest, preferring secluded free-range sites.
This leads to a higher incidence of dirty eggs. Other
data suggests that the highest egg production and
the smallest number of dirty eggs are obtained in
the cage system. Therefore, the aim of the study was
to evaluate the effect of housing laying hens in furnished cages and on litter with free-range access on
some parameters of egg quality and on the choice of
egg-laying site by hens. The experiment used Hy-Line
commercial layers from 16 to 44 weeks of age. Hens
were fed ad libitum standard diets based on layer concentrates. Throughout the experiment, birds had free
access to water. Pullets were assigned to two experimental groups differing in the housing system: group
1 – furnished cages (750 cm2/bird), group 2 – litter
(9 birds/m2) with access to grass paddocks (2.5 m2/
bird). Paddocks were equipped with drinkers and
shelters providing protection from adverse weather.
During the study, production results and the
number of dirty, misshapen and cracked eggs were
monitored. The number of eggs laid outside the nest
was also recorded. The results were statistically analysed by one-way analysis of variance and significant
differences were estimated with Duncan’s range test.
Layers kept in the barn system with outdoor access were characterized by higher egg production
throughout rearing compared to hens from the cage
system. The number of eggs laid outside the nest was
significantly higher for the furnished cage system
compared to the free-range system. The number of
cracked eggs was higher in the cage system compared
to group 2. The housing system of Hy-Line commercial layers had no effect on the number of dirty and
misshapen eggs.
The results obtained show that rearing system influences the laying behaviour of hens and the number
of cracked eggs, but does not necessarily determine
the number of dirty eggs.
177
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The comparison of microbial transmission within
intensive (commercial farm) and extensive housing
systems on an annual basis
Kinga Stuper-Szablewska1, Tomasz Szablewski2, Sebastian Nowaczewski3,
Renata Cegielska-Radziejewska2
Department of Chemistry, Poznań University of Life Sciences, Poznan, Poland
Department of Food Quality Management, Poznań University of Life Sciences, Poznan, Poland
3
Department of Animals Breeding and Product Quality Assessment, Poznań University of Life Sciences,
Suchy Las, Poland
1
2
e-mail: sebnow@up.poznan.pl
Respirable dust, which then as a result of agglomeration of the particles with the participation of water becomes part of the settled particulate matter is
a large source of microbiological contamination. It
includes next elements with irritation, inflammation and allergenic (eg. spores and fragments from
mold). Removal of volatile impurities microclimate
of the house is extremely important for both animal
welfare and their health. This threat, however, has not
yet been examined in relation to extensive housing
systems in which hens are kept in a smaller cast with
access to the runway and the control of the rearing
conditions is greatly reduced.
A comprehensive assessment of the microclimate
of the house and the transmission of contaminants
outside the building on an annual basis in terms of
microbial contamination. They were compared two
types of laying hens on litter: extensive and commercial housing systems. Dust inside the commercial
178
house contain more microorganisms than extensive
system. Nevertheless, the size of microbiological
contaminants contained in the dust collected inside
the extensive henhouse not significantly different
from the results obtained in intensive. The content of
microflora in the dust settled on the outside of the
house system intensive covered to a large extent (approx. 80%) with individual groups of microorganisms
identified in the dust inside the house, which indicates a high transmission of microorganisms.
Based on the results of microbiology dust taken
from inside and outside the house intensive found
that a large number of microorganisms is removed
from the microclimate of the house thanks to the
forced ventilation fans. In the case of the house extensive where the dust is not removed from its interior
to a large extent, residual indoor livestock may be the
cause of diseases of birds.
Porównanie transmisji wyziewów mikrobiologicznych
z kurników wielkotowarowych i przyzagrodowych
w cyklu rocznym
Kinga Stuper-Szablewska1, Tomasz Szablewski2, Sebastian Nowaczewski3,
Renata Cegielska-Radziejewska2
Katedra Chemii, Uniwersytet Przyrodniczy w Poznaniu
Katedra Zarządzania Jakością Żywności, Wydział Nauk o Żywności i Żywieniu,
Uniwersytet Przyrodniczy w Poznaniu
3
Katedra Hodowli Zwierząt i Oceny Surowców, Wydział Medycyny Weterynaryjnej i Nauk o Zwierzętach,
Uniwersytet Przyrodniczy w Poznaniu, Suchy Las
1
2
e-mail: sebnow@up.poznan.pl
Pył respirabilny jest źródłem dużego zanieczyszczenia
mikrobiologicznego. W jego skład wchodzą elementy
mające działanie drażniące, zapalne oraz alergizujące
(m.in. zarodniki i fragmenty grzybni pleśni). Usuwanie zanieczyszczeń lotnych mikroklimatu kurnika
jest niezwykle ważne ze względu zarówno na dobrostan zwierząt, jak i ich zdrowotność. Zagrożenie to
nie zostało jeszcze zbadane w odniesieniu do chowu
przyzagrodowego, w którym utrzymywane są nioski
w mniejszej obsadzie z dostępem do wybiegu, a kontrola warunków chowu jest znacznie ograniczona.
Przeprowadzono kompleksową ocenę mikroklimatu kurnika oraz transmisji zanieczyszczeń na zewnątrz budynku w cyklu rocznym pod względem
skażenia mikrobiologicznego. Porównane zostały
dwa rodzaje chowu kur niosek na ściółce: przyzagrodowy i wielkotowarowy. Pył wewnątrz kurnika wielkotowarowego zawierał większą liczbę mikroorganizmów niż w systemie przyzagrodowym. Niemniej
wielkości zanieczyszczeń mikrobiologicznych zawartych w pyle pobranym wewnątrz kurnika w chowie przyzagrodowym nie różniły się znacznie od
wyników uzyskanych w chowie wielkotowarowym.
Zawartość mikroflory w pyle osiadłym na zewnątrz
kurnika w systemie wielkotowarowym pokrywała
się w dużej mierze (ok. 80%) z wartościami poszczególnych grup mikroorganizmów zidentyfikowanych
w pyle wewnątrz kurnika, co wskazuje na dużą transmisje mikroorganizmów.
Na podstawie uzyskanych wyników mikrobiologii
pyłu pobranego z wnętrza oraz z zewnątrz kurnika
wielkotowarowego stwierdzono, że duża ilość mikroorganizmów jest usuwana z mikroklimatu kurnika dzięki wymuszonej wentylatorami wentylacji.
W przypadku kurnika przyzagrodowego pył nie jest
usuwany z jego wnętrza w istotnym stopniu, zalega
wewnątrz pomieszczenia inwentarskiego i może być
przyczyną chorób ptaków.
179
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The evaluation of the effect of seasons on the
microbiological contamination of selected elements
of the environment in terms of health safety
of laying hens kept in extensive housing system
Kinga Stuper-Szablewska1, Tomasz Szablewski2, Sebastian Nowaczewski3,
Anna Ostrowska-Kołodziejczak1, Anna Matysiak1, Renata Cegielska-Radziejewska2
Department of Chemistry, Poznań University of Life Sciences, Poznan, Poland
Department of Food Quality Management, Poznań University of Life Sciences, Poznan, Poland
3
Department of Animals Breeding and Origin Materials, Poznań University of Life Sciences, Suchy Las, Poland
1
2
e-mail: sebnow@up.poznan.pl
The aim of an experiment was the evaluation of the effect of seasons on the microbiological contamination
of selected elements of the environment in terms of
health safety of laying hens kept in extensive housing
system. The study was conducted to analyse of microbial contamination of all environmental elements
(feed, litter, dust and microclimate of the henhouse).
Research was carried out on an annual basis. The samples were taken from 5 henhouses with a small stocking density of birds (less than 1 per m2) and with avail-
180
able gritty run. The total number of aerobic bacteria
(OLB), Pseudomonas and Enterobacteriaceae genus, as
well as microscopic fungi (qualitatively and quantitatively) were determined. The season had a significant impact on microbiological contamination of the
environment and the microclimate of the henhouse.
The results showed that spring and autumn are the
seasons conducive to development of mold. On the
other hand, autumn and winter are characterized by
a significantly higher bacterial contamination.
Ocena wpływu pory roku na zanieczyszczenie
mikrobiologiczne wybranych elementów środowiska
kurnika w aspekcie bezpieczeństwa zdrowotnego kur
niosek utrzymywanych w systemie przyzagrodowym
Kinga Stuper-Szablewska1, Tomasz Szablewski2, Sebastian Nowaczewski3,
Anna Ostrowska-Kołodziejczak1, Anna Matysiak1, Renata Cegielska-Radziejewska2
Katedra Chemii, Uniwersytet Przyrodniczy w Poznaniu
Katedra Zarządzania Jakością Żywności, Wydział Nauk o Żywności i Żywieniu, Uniwersytet Przyrodniczy
w Poznaniu
3
Katedra Hodowli Zwierząt i Oceny Surowców, Wydział Medycyny Weterynaryjnej i Nauk o Zwierzętach,
Uniwersytet Przyrodniczy w Poznaniu, Suchy Las
1
2
e-mail: sebnow@up.poznan.pl
W Polsce od wielu lat utrzymuje się liczna grupa konsumentów zainteresowana nabywaniem jaj z chowu
przyzagrodowego, ocenianych jako żywność wysokiej jakości i jednocześnie bezpieczna dla zdrowia,
ale tańsza niż żywność ekologiczna, potwierdzona
certyfikatem. Zapewnienie dobrostanu kur niosek
utrzymywanych w systemie przyzagrodowym jest tematem często pomijanym w odniesieniu do innych,
wielkotowarowych systemów chowu. Jednym z istotnych czynników związanym z dobrostanem niosek
jest ich zdrowotność, na którą niewątpliwie wpływ
ma poziom zanieczyszczenia mikrobiologicznego
środowiska kurnika. Źródłem patogennej mikroflory
oraz mykobiota mogą być: pasza, ściółka, gleba, pył,
woda oraz elementy budynków inwentarskich.
Prowadzone badania stanowiły kompleksową analizę zanieczyszczenia mikrobiologicznego wszystkich
elementów tworzących środowisko kurnika (pasza,
ściółka, pyły oraz elementy mikroklimatu kurnika),
w którym utrzymywano nioski w systemie przyzagrodowym. Badania prowadzone były w cyklu rocznym.
Próby pobierano z 5 kurników z niewielką obsadą
ptaków (mniej niż 1 szt./m2) mających do dyspozycji
piaszczysty wybieg. Nioski, mieszańce ROSA, w mo-
mencie rozpoczęcia pobierania prób miały 20 tygodni
życia. W kurniku materiał ściołowy stanowiła słoma.
Próby pyłu osiadłego (w kurniku i na zewnątrz),
paszy oraz ściółki zostały poddane badaniom mikrobiologicznym. Oznaczano ogólną liczbę bakterii
tlenowych (OLB), bakterie z rodzaju Pseudomonas
oraz Enterobacteriaceae, a także ilościowo i jakościowo grzyby mikroskopowe. Na podstawie przeprowadzonych badań stwierdzono, że pory roku miały
istotny wpływ na zanieczyszczenie mikrobiologiczne
elementów środowiska oraz mikroklimatu kurnika. Uzyskane wyniki wykazały, iż wiosna i jesień są
porami roku sprzyjającymi rozwojowi grzybów pleśniowych, natomiast jesień i zima cechują się istotnie wyższym wzrostem zanieczyszczenia bakteriami
szczególnie z grupy Enterobacteriaceae. Wśród badanych elementów środowiska kurnika ściółka i pył
były najbardziej zanieczyszczone. Analiza dyskryminacyjna całościowego zanieczyszczenia 5 badanych
kurników wykazała istotne różnice w zanieczyszczeniu mikrobiologicznym badanych obiektów i wskazała, że to pył (zarówno respirabilny, jak i osiadły) ma
największy wpływ na stan mikrobiologiczny kurnika.
181
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The effect of methionine in ovo administration
on chick (Gallus gallus domesticus)
embryo development
Barbara Tombarkiewicz, Karolina Trzeciak, Marcin Lis, Bartosz Bojarski, Krzysztof
Pawlak, Weronika Kanik, Zbigniew Podgórni, Jerzy Niedziółka
Department of Veterinary Science, Animal Reproduction and Welfare, Institute of Veterinary Sciences,
University of Agriculture in Krakow, Poland
e-mail: rztombar@cyf-kr.edu.pl
The aim of this study was to determine the impact
of various doses of methionine administered at early
stage of embryogenesis on the course of and postnatal development, as well as selected hematological
and biochemical blood parameters of the domestic
chicken embryo (Gallus gallus domesticus).
The experimental material constituted 125 eggs
from the broiler breeder flock of Ross 308 line divided on five groups: control group (O), shame group
(K) – injected in ovo by physiological saline and three
experimental groups, which were injected by 5 mg, 25
mg and 50 mg of methionine. Biochemical (the concentration of uric acid and homocysteine in the blood
plasma and the glucose in whole blood) and hematological (blood hemoglobin content, hematocrit
value, RBC, WBC with leukogramem, MCV, MCH,
MCHC) analyzes of blood were performed as well as
the histological analyzes of selected organs.
182
It was proved that excess of methionine may interupt the embryogenesis process and cause malformations and also affect the histological image of
pancreas, kidney and liver. The administration of
methionine at 4th day of embryogenesis increases
mortality immediately after manipulation. The chick
kidney microstructure in the first day after hatching
(D1) contain both regular renal corpuscules, as well
as impaired-structure ones.
In the pancreases of chicks injected by the highest
dose of methionine a lot of large vacuoles were observed in pancreases cells, which may indicate on fatty
degeneration of this organ. Any hematological nor biochemical changes of blood parameters were noted.
This research was financially supported by the statutory
activity: DS 3263.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Effect of probiotic application as a spray
to egg shell on hatchability of broiler ducks
Ján Weis, Cyril Hrnčár, Matej Rindoš, Slavomír Mindek
Department of Poultry Science and Small Animal Husbandry, Slovak University of Agriculture in Nitra, Slovakia
e-mail: jan.weis@uniag.sk
The aim of this study was to evaluate the effect of application of Lactobacillus fermentum as a spray on
hatchability of broiler ducks. Totally 160 hatching
eggs were divided to two groups. In experimental
group (n = 80) we applied probiotic strain Lactobacillus fermentum CCM 7158 with concentration of
1x109 colony forming units (CFU) as a spray to egg
shell on 24th day of incubation. The control group
(n = 80) was without any application. A total egg
hatchability, hatchability of fertile eggs set, dead in
shells and saleable ducks were measured. Application
of probiotic strain Lactobacillus fermentum caused
statistically significant increase(P < 0.01) total hatchability, hatchability of fertilised eggs, saleable ducks
and statistically significant (P < 0.01) decreased dead
in shells.
183
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Changes in thyroid hormone concentrations
in chick blood during hatching after in ovo
α tocopherol administration
Gabriela Wójcik1, Magdalena Trela1, Andrzej Sechman2, Marcin W. Lis1
1
Department of Veterinary, Animal Reproduction and Welfare, University of Agriculture in Krakow, Poland
2
Department of Animal Physiology and Endocrinology, University of Agriculture in Krakow, Poland
e-mail: rzlis@cyf-kr.edu.pl
Plasma thyroid hormone concentration in the chick
embryo sharply increases toward the end of the incubation. It results from mobilization of the organism
to hatching, associated with the yolk sac retraction,
the onset of pulmonary respiration and initiation of
endothermic responses. The hatching is also very
stressful and tiring for the chick, therefore there are
attempts to improve of chick health by an in ovo supplementation of the chick embryo with antioxidative
vitamins such as ascorbic acid (vitamin C) or tocopherols (vitamin E). Since the E hypervitaminosis can
inhibit the thyroid gland activity in mammals and
birds, it is interesting to investigate the effect of in ovo
administration of α-tocopherol (α-Toc) on thyroid
hormone concentrations in the blood plasma of the
chick embryo during hatching.
At the 17th day of incubation the embryonic
chicken eggs (broiler line Ross 308, n = 40 eggs/
group) were injected with 0 (control), 0.5 or 5.0 mg
α-Toc/egg dissolved in 0.1 ml arachid oil. Blood samples were collected on embryonic on the day 18 (E18),
during internal (IP) and external pipping (EP), and
from hatched chicks (H) and at 6–12 hours after the
hatching (D1). The concentrations of thyroxine (T4)
and triiodothyronine (T3) in plasma samples were
184
determined by RIA method. Results were statistically
evaluated by a two-way ANOVA followed by Tukey
test at p < 0.05.
In the control group, the highest levels of T4 and
T3 were found during IP (7.7 and 10.4 nmol/L, respectively). Following the IP, a rapid decrease in these
hormones was observed. In comparison to the control group, the administration of 0.5 and 5.0 mg α-Toc
reduced T4 and T3 plasma concentrations at the IP
by 58% and 70% (P ≤ 0.05), and 54% and 50% (P ≤
0.05), respectively. Simultaneously, T4 and T3 levels
in blood of the H were more than 25% higher in comparison to control group (P ≤ 0.05). Moreover, the
calculated T3/T4 ratio was similar in the control and
in the 0.5 mg α-Toc treated chicks during the whole
hatching period (1.2–1.4); in the experimental group
treated with the higher dose of α-Toc an increase in
T3/T4 rate was observed (2.1–3.1; P ≤ 0.05).
In summary, the increased availability of
α-tocopherol at the end of the embryogenesis may
affect the synthesis of thyroid hormones in hatching
chicks.
Studies supported by DS ZWRiDZ/2016.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Comparison of parasite infection in laying
hens kept in different housing systems
Anna Wyrobisz1, Ewa Sosnówka-Czajka2, Jerzy Kowal1, Paweł Nosal1
Department of Environmental Zoology, Institute of Animal Sciences,
University of Agriculture in Krakow, Poland
2
Department of Technology, Ecology and Economics of Animal Production,
National Research Institute of Animal Production, Balice near Krakow, Poland
1
e-mail: a.wyrobisz@gmail.com
Welfare of laying hens depends on many overlapping factors. In particular, poultry farming should
provide appropriate housing system that may have
influence on health condition. Many diseases pose
a serious threat to the poultry welfare, however, ailments caused by parasites should be regarded as very
essential. Furthermore, the range of their occurrence
can be related to the housing system. The aim of the
presented study was to compare the parasite infection
level in commercial line of laying hens from different
housing systems.
The research focused on Hy-Line hens housed in
barn, barn with paddock or enriched cage system.
Parasitic fauna composition, as well as the level of infection was determined by ante-mortem (coproscopical) and post-mortem (dissection) analyses. Faeces
samples were examined twice – before (November)
and after (March) winter time.
The coproscopical analysis revealed the presence
of coccidian oocysts (Eimeria sp.) and nematode eggs
(Ascaridia sp., Heterakis sp.), whereas in dissected
material only nematode (Ascaridia sp.) specimens
were found. The hens kept in a barn were slightly
more infected with Eimeria sp. than these with access to a paddock. In contrast, the majority of analyzed animals from barn with paddock system were
infected with Ascaridia sp. Both the prevalence and
intensity of the infection reached high values. Despite
stated differences in nematode infection between
each housing system in coproscopical analysis, postmortem results were not consistent with them. Only
hens kept in enriched cages were parasites-free.
The obtained results indicate that the level of infection with parasites from different groups (coccidia
or nematodes) is highly related to the used housing
system. Although, the enriched cage housing system
is considered to be the least animal-friendly, parasitological approach has contradicted it. Hens kept in
barn, as well as barn with paddock system should be
routinely controlled, as a part of animal welfare.
185
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
The method of identifying species
of poultry on the basis of sequence differences
in the s-rRNA
Małgorzata Natonek-Wiśniewska, Piotr Krzyścin
Department of Genomics and Molecular Biology of Animals,
National Research Institute of Animal Production, Balice near Krakow
e-mail malgorzata.natonek@izoo.krakow.pl
The EU regulations require manufacturers of food
and animal feed accurate information about the qualitative composition of the product. Therefore, to develop and implement methods to verify the declared
composition of the real has become an important
challenge in recent years.
The aim of this study was to develop a method to
quickly determine the presence of poultry: chicken
(Gallus gallus), ducks (Anas platyrhynchos), geese
(Anser anser), turkeys (Meleagris gallopavo) and
guinea fowl (Numida meleagris) based on the analysis
of the region s-rRNA mitochondrial DNA.
The research material was a sample of meat five
species of poultry from which the DNA was isolated
using a set of Axfood (A & A Biotechnology).
186
Using the Primer3 program primers were designed: 5’CCCACCTAGAGGAGCCTGTT and
5’GGCGGTATGTAGGCTGTGTT giving a PCR
product with a size of 81 bp. Designated starters are
characterized by high species specificity ‒ they are
homologous to the species for which they were designed, while other species of farm animals show no
similarities. The proposed method allows the identification of the poultry in one PCR reaction which
significantly reduces the time and cost of a separate
determination of each species.
Introduction of the practice of laboratory developed methods contribute to the implementation of
the EU requirements regarding the qualitative analysis of food products and animal feed.
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Fatty acid profile of intramuscular fat
in supraspinatus, longissimus lumborum
and semimembranosus muscles of farmed fallow deer
Urszula Kaczor1, Marek Stanisz2, Marta Bykowska2, J. Składanowska2,
Dorota Wojtysiak3, Andrzej Kaczor4
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
Department of Animal Breeding and Product Quality Assessment, Poznań University of Life Sciences, Poland
3
Department of Animal Anatomy, University of Agriculture in Krakow, Poland
4
Department of Technology, Ecology and Economics of Animal Production,
The National Research Institute of Animal Production, Balice near Krakow, Poland
1
2
e-mail: rzkaczor@cyf-kr.edu.pl
The world population of farmed Cervidae continues
to grow and now exceeds 5 million. Meat production
is the most popular purpose of Cervidae farming in
Poland and around the world. The high nutritive value
of their meat, which is high in protein and minerals
and low in fat and cholesterol, is greatly appreciated.
The aim of the study was to analyse the intramuscular fat content and fatty acid profile of supraspinatus
(SS), longissimus lumborum (LL) and semimembranosus (MS) muscles in ten 18-month-old male fallow
deer (Dama dama) raised in an organic farm located
in north-western Poland. The analysed muscles had
a low content of intramuscular fat: 0.73% (LL) and
0.77 (MS) vs 1.21% (SS) (P < 0.01). In the analysed
muscles, stearic acid C18:0 and palmitic acid C16:0
dominated among saturated fatty acids (SFA), while
linolenic acid C18:2 among polyunsaturated fatty acids (PUFA). The fatty acid profile of LL and MS dif-
fered significantly from that found for SS. SFA content
of the above muscles was 33.3% and 33.8% vs 43.6%,
respectively (P < 0.01) (% of total acids determined).
PUFA content was high at 46.6% and 48.1% vs 34.1%,
respectively (P < 0.01). n-3 PUFA values for LL and
MS vs. SS were 12.8% and 13.9% vs 11.% (P < 0.01),
and the atherogenic index (IA) was 0.23 and 0.24 vs
0.39 (P < 0.01). The content of hypocholesterolemic
acids (DFA) and hypercholesterolemic acids (OFA)
in SS differed significantly from that in LL and MS.
At the same time, the lowest DFA/OFA values were
found for SS muscle. The results obtained show the
high nutritive value of fallow deer meat, but the location of adipose tissue causes significant differences in
the fatty acid profile. Meat sampled from the shoulder
(supraspinatus muscle) has a higher content of intramuscular fat but shows a less favourable profile of the
analysed fatty acids.
187
International Conference on Biotechnology and Welfare in Animal Science
with a session on “7th Poultry Days” • Krakow • 23–24 June 2016
Histochemical muscle fibre characteristics
of fallow deer meat
Dorota Wojtysiak1, Marek Stanisz2, Agnieszka Ludwiczak2, Urszula Kaczor3
Department of Animal Anatomy, University of Agriculture in Krakow, Poland
Department of Animal Breeding and Product Quality Assessment, Poznań University of Life Sciences, Poland
3
Department of Animal Biotechnology, University of Agriculture in Krakow, Poland
1
2
e-mail: wojtysiakd@wp.pl
In recent years fallow deer farming has become extremely popular. Fallow deer meat is characterized
by a specific taste of meat. The unique properties of
fallow deer meat are caused by a low content of intramuscular connective tissue and a different histochemical muscle fibre composition compared to farm
animals. It is well known that muscle fibre type composition of different skeletal muscles may be associated with post-mortem changes in the conversion of
muscle to meat and subsequently meat quality. Therefore, the aim of this study was to compare fibre type
composition in semimembranosus, supraspinatus, and
longisimus lumborum muscles of fallow deer.
A total of 10 carcasses from male of fallow deer
(Dama dama) shot at 18 months during winter in the
farm of the Złotowski district were evaluated. Shortly
after being shot muscle samples were taken from the
mid-part of semimembranosus, supraspinatus, and
longisimus lumborum muscles and frozen in liquid nitrogen. To determine the muscle fibre types, we used
a modified combined method of NADH-tetrazolium
188
reductase activity and immunohistochemical determination of the slow myosin heavy chain izoforms.
The results obtain indicated that semimembranosus, supraspinatus, and longisimus lumborum muscles
have a heterogenic structure and consists of mixture
of fibre types having different contractile and metabolic properties namely, type I (slow-twitch oxidative), IIA (fast-twitch oxidative) and IIB (fast-twitch
glycolytic) fibres. Moreover, analysis of the muscle
fibre composition showed that muscle type has a significant effect on both muscle fibre percentage and
size. Thus, the supraspinatus muscles of fallow deer
are the most oxidative, as evidenced by the highest
percentage of type I fibres compared to the longissimus lumborum and semimembranosus muscles. Regarding muscle fibre size, the longissimus lumborum
muscle has significantly the smallest muscle fibre
types I and IIA than other muscles.
Funded by DS-3253.
Index of authors
A
Adaszyńska-Skwirzyńska Michalina 123, 124
Ancsin Zsolt 133, 157
Anderle Vojtěch 151
Andraszek Katarzyna 96
Andres Krzysztof 136, 137, 154
Antonova Ekaterina P. 79, 112
Antończyk Anna 97
Antos Piotr A. 21
Anusz Krzysztof 73
Arpášová Henrieta 121, 140
Augustyn Romana 31, 32, 45, 46, 54, 55, 56, 57, 81, 82,
108
B
Babicz Marek 110, 111
Baishnikova Irina V. 79, 91, 112
Bakst Murray 154
Balogh Krisztián 125, 133, 157, 161
Baranowska Agnieszka 83
Barszcz Karolina 135, 144
Bauer Edyta 75, 76
Bednarczyk Marek 122
Bilčík Boris 155, 162
Bilińska Barbara 88, 90, 159
Blicharski Tadeusz 110, 111
Błasiak Michał 98
Bocheńska Aneta 84
Bodnar Julia 113
Bojarski Bartosz 160, 182
Borkowski Tomasz 168
Borodulina Victoria I. 28
Bócsai Andrea 125, 133, 157
Bucław Mateusz 126, 127
Bujko Jozef 140
Buríková Monika 155
Bykowska Marta 187
C
Calik Jolanta 128, 129, 130, 155
Cebulska Aleksandra 34
Cegielska-Radziejewska Renata 178, 179, 180, 181
Chałupka Daniela 145, 167, 171
Chernobrovkina Nadezhda P. 112
Chоkаn Taras 85
Chyb Jarosław 86, 105
Ciereszko Andrzej 99, 100, 159
Ciesielczyk Katarzyna 83
Cora Gabriela 86
Čavarga Ivan 155
Čoudková Veronika 30
D
Dąbrowski Sebastian 106
Demey Vanessa 58, 60
Dietrich Mariola A. 99, 100
Długosz Bogusława 31, 32, 45, 46, 54, 55, 56, 57, 81, 82,
108
Dobosz Iwona 87
Dobrzańska Kinga 45, 46
Domagała Justyna 83
Drąg-Kozak Ewa 33, 49, 50, 105
Duda Małgorzata 101, 114
Dulińska-Litewka Joanna 88
Dunisławska Aleksandra 122
Dybała Jan 34
Dykiel Magdalena 131
Dżugan Małgorzata 132
E
Erdélyi Márta
133, 157
F
Faundez Ricardo 106
Fernye Csaba 133
Fic Kinga 35, 102, 107
Filipczyk Anna 107
Flaga Jadwiga 58, 60
Foltyn Marian 134
Frankowska Katarzyna 107
G
Gajewska Marta 106
Gąsior Robert 129
Gertler Arieh 15
Gorczyca Gabriela 114
189
Gosiewski Grzegorz 33
Goździewska-Harłajczuk Karolina 135, 144
Górowska-Wójtowicz Ewelina 88, 90, 159
Górska Magdalena 74, 136, 137
Graczyk Magdalena 136, 137
Grzesiak Małgorzata 143
Grzesiakowska Anna 96
Guja Iwona 36, 44, 103
H
Halek Anna 54, 55
Halik Gabriela 89
Hanus Anton 138
Hanusová Emília 138
Hartwich Patryk 102
Hejmej Anna 88, 90, 159
Herbut Eugeniusz 177
Hereta Marta 114
Hołownia G. 99, 100
Horecka Eliska 139
Horecky Cenek 139
Horváth Mária 146
Hrabia Anna 21, 174
Hrnčár Cyril 121, 138, 140, 183
I
Ilyina Tatiana N. 79, 91
Ilyukha Viktor A. 44, 79, 91, 112
Izmailovich Inessa B. 141
J
Jackowska-Tracz Agnieszka
Jagusiak Wojciech 65
Jaklińska Barbara 31, 32
Jozkowicz Alicja 80
Jóźwiak Michał 142
Jura Jacek 116
73
K
Kaczor Andrzej 37, 38, 93, 187
Kaczor Urszula 37, 38, 93, 94, 95, 187, 188
Kamińska Alicja 88, 90, 159
Kanik Weronika 160, 182
Kapelański Wojciech 34
Kapkowska Ewa 136, 137
Karasiński Janusz 115, 116
Katarzyńska Dorota 21, 143
Kawęcka Aldona 39, 40, 41
Kądzior Justyna 56, 57
Kermen-Germaniuk Katarzyna 106
Khizhkin Evgeny A. 79
Kirsz Katarzyna 84, 92, 109
Kizhina Aleksandra G. 79
Klećkowska-Nawrot Joanna 135, 144
Knapczyk-Stwora Katarzyna 87
Knoll Ales 139
Kokocińska Agata 42, 43
Kołacz Roman 16
Kołodziejski Paweł A. 145, 167, 171
190
Korytkowski Łukasz 58, 60
Košťál Ľubor 146, 162
Kotula-Balak Małgorzata 88, 90, 159
Kovács Balázs 161
Kovarikova Lenka 139
Kövesi Benjámin 161
Kowal Jerzy 185
Kowalczyk Artur 144, 154, 169, 170
Kowalski Zygmunt M. 58, 60
Koziorzębska Agata 89
Krawczyk Józefa 147, 148, 149, 150
Król Teodora 132
Krzystanek Agnieszka 35
Krzyścin Piotr 48, 186
Kucharski Mirosław 93, 94, 95
Kuchta-Gładysz Marta 96, 103
Kupčíková Lucie 151
Kuzmina Natalia 113
L
Lasoń Martyna 153, 154
Latacz Anna 117
Lichovníková Martina 134, 151, 152
Lipień Gabriela 103
Lis Marcin W. 79, 132, 141, 160, 182, 184
Lisowski Piotr 86
Luber Magdalena 93
Ludwiczak Agnieszka 188
Ł
Łapiński Stanisław 36, 44, 79, 91, 103, 112
Łozicki Andrzej 89
Łukaszewicz Ewa 144, 153, 154, 169, 170
Łuszczek-Trojnar Ewa 33, 49, 50
Łuszczyński Jarosław 31, 32, 45, 46, 54, 55, 56, 57, 81,
82, 108
M
Maćkowiak Paweł 145, 167, 171
Máčajová Mariana 155
Maiorano Giuseppe 122
Makarski Mateusz 89
Malkiewicz Marta 58, 60
Maršálek Miroslav 30
Matusiewicz Magdalena 89
Matysiak Anna 180, 181
Mézes Miklós 125, 133, 157, 161
Mika Magdalena 97
Mika Maria 174
Miksza-Cybulska Anna 39
Mikulich Elena L. 47
Milewska Aleksandra 34
Mindek Slavomír 183
Minta Zenon 142
Misztal Tomasz 98
Molik Edyta 98
Mostek Agnieszka 99, 100
Motal Maria 101
Mrozicka Katarzyna 44
Mucha Aurelia 110, 111
Muchacka Renata 156
N
Nakade Mangesh 157
Nalik Klaudia 102, 107
Natonek-Wiśniewska Małgorzata 48, 186
Niedbała Piotr 36, 44, 79, 96, 103, 112
Niedziółka Jerzy 132, 160, 182
Niemczuk Krzysztof 166
Niwińska Anna 106
Nogowski Leszek 145, 167, 171
Nosal Paweł 185
Nowacki Patryk 49, 50
Nowaczewski Sebastian 178, 179, 180, 181
Nowak Jakub 132
Nowak Joanna 158, 165
Nowakowski Michał 102
O
Obrzut Joanna 130, 148
Ochrem Andrzej 75, 76
Ocłoń Ewa 117
Olszewska-Tomczyk Monika 142
Oravcová Marta 138
Ostapiv Dmytro 113
Ostrowska-Kołodziejczak Anna 180, 181
Ostrowski Jerzy 106
Otwinowska-Mindur Agnieszka 51, 96
P
Paraponiak Paweł 27, 52, 53
Pardyak Laura 88, 90, 159
Pasternak Marta 104
Pastuszak Karolina 94
Pavlík Ales 139
Pawlak Krzysztof 160, 182
Pelyhe Csilla 125, 161
Petrajtis-Golobow Monika 106
Pichová Katarína 146, 162
Pieszka Magdalena 31, 32, 45, 46, 54, 55, 56, 57, 81, 82,
108
Pietsch-Fulbiszewska Agnieszka 84
Piórkowska Katarzyna 94, 95, 108, 110, 158
Pisarczyk Weronika 31, 32, 46, 54, 55, 56, 57, 81, 82, 108
Pistová Veronika 121, 140
Płowiec Arkadiusz 122
Podbielska Angelika 163, 164, 168
Podgórni Zbigniew 182
Podstawski Zenon 31, 32, 45, 46, 54, 55, 56, 57, 81, 82,
108
Połtowicz Katarzyna 129, 158, 165
Popek Włodzimierz 33, 49, 50, 105
Porubský Denis 140
Posyniak Andrzej 166
Próchniak Tomasz 31, 32, 81, 82
Pruszyńska-Oszmałek Ewa 145, 167, 171
Przywarová Alena 151
Ptak Ewa 51, 65
Puchała Michał 39, 66, 67, 130, 149, 150
Pustuła A. 81, 82
Pyś Jan B. 58, 60
R
Rada Vojtěch 134
Radko Anna 85, 163, 164, 168
Radkowska Iwona 61, 62, 63, 64
Radkowski Adam 62, 63, 64
Rindoš Matej 183
Romanowicz Katarzyna 98
Romek Marek 116
Ropka-Molik Katarzyna 108, 110, 111
Rosenberger Joanna 154, 169, 170
Rubiś Dominika 85
Rzońca Zenon 169, 170
S
Sadomov N.A. 28
Sandowska-Markiewicz Zuzanna 106
Sassek Maciej 145, 167, 171
Satoła Alicja 65
Sechman Andrzej 21, 143, 174, 184
Sergina Svetlana N. 79, 91, 112
Sharan Mykola 113
Sikora Jacek 40
Siwek Maria 122
Składanowska J. 187
Skomorucha Iwona 156, 173, 175, 176, 177
Skowron Beata 83
Skrzyński Grzegorz 75, 76
Sławińska Anna 122
Słomski Ryszard 116
Słowińska Mariola 159
Smorąg Zdzisław 116
Šoch Miloslav 68
Socha Joanna 174
Socha Magdalena 33, 49, 50, 86, 105
Sokołowicz Zofia 131
Sokołowska-Mikołajczyk Mirosława 86, 105
Sokołowski Grzegorz 106
Sosin-Bzducha Ewa 41, 66, 67
Sosnówka-Czajka Ewa 156, 172, 173, 175, 176, 177,
185
Sowinski Piotr SJ 25, 26
Sowińska Natalia 35, 84, 107
Sowula-Skrzyńska Elżbieta 75, 76
Stadnicka Katarzyna 122
Stanisz Marek 187, 188
Starý J. 30
Starzyńska-Janiszewska Anna 97
Stefaniuk-Szmukier Monika 31, 32, 45, 46, 54, 55, 56,
57, 81, 82, 108
Stręk Paweł 102
Stuper-Szablewska Kinga 178, 179, 180, 181
Szablewski Tomasz 178, 179, 180, 181
Szabó-Fodor Judit 125
Szczerbińska Danuta 123, 124
191
Szczęsna Małgorzata 92, 109
Szczęśniak Katarzyna 90
Szeleszczuk Olga 96, 103
Szmotała Tomasz 108
Szumiec Agnieszka 85,163, 164, 168
Szwaczkowski Tomasz 136, 137, 145, 167, 171
Szyndler-Nędza Magdalena 110, 111
Ś
Śmietanka Krzysztof 142
Świderska Karina 31, 32
Świętoń Edyta 142
T
Tarasjuk Serhiy 85
Tejml Petr 68
Thor Piotr J. 83
Tokodi Nikolett 125
Tombarkiewicz Barbara 160, 182
Tomczyk-Wrona Iwona 69, 71
Tracz Michał 73
Trapezov Oleg V. 79
Trela Magdalena 184
Trzeciak Karolina 182
Tyl-Bielicka Anita 106
Tyutyunnik Nikolay N. 112
U
Unzhakov Aleksey R. 112
Uzenbaeva Lyudmila B. 79, 112
V
Vlizlo Vasyl 113
Volna Sarka 152
Výboh Pavel 155
W
Wartalski Kamil 101, 114
Weis Ján 140, 183
Wesołowska Monika 132
Westfalewicz Błażej 99, 100
Wiater Jerzy 115, 116
Wikiera Agnieszka 97
Wiśniewska Joanna 34
Wojciechowska Joanna 74
Wojtysiak Dorota 74, 187, 188
Woszczenko Aleksandra 35
Woszczyński Marek 106
Wójcik Gabriela 184
Wyrobisz Anna 185
Wyrostek Krzysztof 142
X
Xu Yongping
79
Y
Yaremchuk Іryna
113
Z
Zándoki Erika 125, 157
Zemsta Katarzyna 95
Zięba Dorota A. 92, 98, 109
Zubel-Łojek Joanna 117
Ż
Żychlińska-Buczek Justyna
75, 76