Cysteine protease involving in autophagosomal degradation of

Molecular & Biochemical Parasitology 185 (2012) 121–126
Contents lists available at SciVerse ScienceDirect
Molecular & Biochemical Parasitology
Cysteine protease involving in autophagosomal degradation of mitochondria
during encystation of Acanthamoeba
Eun-Kyung Moon, Yeonchul Hong, Dong-Il Chung, Hyun-Hee Kong ∗
Department of Parasitology, Kyungpook National University School of Medicine, Taegu, Republic of Korea
a r t i c l e
i n f o
Article history:
Received 12 June 2012
Received in revised form 24 July 2012
Accepted 30 July 2012
Available online 14 August 2012
Keywords:
Acanthamoeba
Encystation
Cysteine protease
Autophagosome
Mitochondria
a b s t r a c t
Using the microarray to identify encystation mediating factors, significantly higher expression of a cysteine protease gene was observed in cysts, compared with trophozoites. Results of real-time PCR analysis
also showed a magnificent increase of cysteine protease levels during encystation of Acanthamoeba. We
named the gene cyst specific cysteine protease (cscp) of Acanthamoeba. The purified recombinant protein of CSCP showed activities of papain and cathepsin B against the substrates. During encystation, EGFP
fused CSCP showed colocalization with LysoTracker, an autophagosome marker, in transiently transfected
amoeba. Amoeba transfected with siRNA against cscp was unable to form mature cysts. Undigested mitochondria in vacuole like structures were observed in cscp siRNA treated cells by transmission electron
microscopy. These results provide evidence of the important role of CSCP in autophagosomal degradation
of cell constituents, particularly mitochondria, during encystation of Acanthamoeba.
© 2012 Elsevier B.V. All rights reserved.
1. Introduction
Encystation is one of the most important processes to be determined in Acanthamoeba infection, such as granulomatous amoebic
encephalitis (GAE) and amebic keratitis (AK) [19]. Transformation
of Acanthamoeba trophozoites to cysts occurs under unfavorable
conditions, conveying resistance to pH, high temperature, and various biocides [3,18]. Due to the resistant nature of the cyst, there
is hardly an effective treatment against Acanthamoeba infection. In
order to achieve a better understanding of the mechanism of encystation, characterization of various encystation mediating factors,
including the cyst specific protein 21 (CSP21) gene, encystation
mediating serine protease (EMSP), autophagy related protein 8
(AcAtg8), autophagy related protein 3 (AcAtg3), and autophagy
related protein 16 (AcAtg16L) of Acanthamoeba was performed
[2,20,23,24,32].
Results of an analysis of the differential gene expression profile between cysts and trophozoites of Acanthamoeba showed that
the “O” article (posttranslational modification, protein turnover,
and chaperones) was highly populated in cyst specific ESTs [21].
This result suggested that various proteases mediate encystation
of Acanthamoeba.
Acanthamoeba includes four major classes of proteases; aspartic
protease, cysteine protease, serine protease, and metalloprotease.
∗ Corresponding author at: Department of Parasitology, Kyungpook National University School of Medicine, 101 Dongin-dong, Joong-gu, Taegu 700-422, Republic of
Korea. Tel.: +82 53 420 4882; fax: +82 53 422 9330.
E-mail address: hhkong@mail.knu.ac.kr (H.-H. Kong).
0166-6851/$ – see front matter © 2012 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.molbiopara.2012.07.008
In almost genotypes, serine protease is the most abundant and
well reported for degradation of ECM (extracellular matrix) components in Acanthamoeba infection [8,11,13]. Metalloprotease
has been reported to exhibit properties of ECM degradation
[31]. However, data on cysteine protease are limited, and
only the possibility that they may play a role in intracellular protein degradation or phagocytosis has been reported
[9]. The role of cysteine protease during the early phase
of encystment in Acanthamoeba has recently been suggested
[15].
Roles of cysteine protease in cell differentiation of several
other protozoan parasites have been reported. Specific expression of cysteine peptidase was observed during encystation in
Entamoeba invadens [4]. Production of oocysts by Plasmodium
falciparum was inhibited by cysteine protease inhibitor E64d
[5], and the role of cysteine proteases of Trypanosoma brucei
bloodstream form in surface coat exchange during differentiation has been reported [29]. Necessity of lysosomal cysteine
peptidases for autophagy and differentiation in Leishmania mexicana has been reported [35]. Findings from these reports
demonstrated the critical roles of cysteine protease in cell differentiation.
Of particular interest, results of microarray analysis between
cysts and trophozoites of Acanthamoeba showed 282-fold expression of a type of cysteine protease in cysts [22]. Cyst specific EST
by KOG (eukaryotic orthologous groups) analysis also revealed a
similar result, where 11 copies of the cysteine protease were identified only in cyst ESTs [21]. These results suggest that the cysteine
protease may play an important role during encystation in Acanthamoeba.
122
E.-K. Moon et al. / Molecular & Biochemical Parasitology 185 (2012) 121–126
In this study, we report on characteristics of the cysteine protease expressed only during cyst stage of Acanthamoeba as an
encystation mediating factor and investigate its role in the encystation process.
2. Materials and methods
2.1. Cultivation of Acanthamoeba
Acanthamoeba castellanii Castellani (ATCC 30011) trophozoites
were obtained from the American Type Culture Collection and
were grown axenically in PYG (peptone-yeast-glucose) medium
in a 25 ◦ C incubator (Sanyo, San Diego, CA, USA). The procedure
described by Bowers and Korn was used to induce encystment
[1]. Cysts were counted under a light microscope for calculation
of encystation ratio.
2.2. Real-time PCR analysis
TRIzol Reagent (Gibco BRL, Rockville, MD, USA) was used for
purification of total RNA and cDNA synthesis was performed using a
RevertAidTM First Strand cDNA Synthesis Kit (Fermentas, Hanover,
IN, USA). Twenty-five nanograms were used as a template for real
time PCR analysis. A GenAmp 5700 SDS (Biosystems, Barcelona,
Espana) was used in performance of real time PCR, using sense
and antisense primers (sense 5 -AACAGCACGCTCGTTTCCCTCT
and antisense 5 -GTAGTTGGCCTCCGTCATGAGCTT) and a previously described thermocycler program [23]. SYBR Premix
Ex TaqTM (Takara, Otsu, Shiga, Japan) was used in performance of all reactions. 18s rDNA was used as a reference
gene (sense 5 -TCCAATTTTCTGCCACCGAA and antisense 5 ATCATTACCCTAGTCCTCGCGC) [23,24]. Real time quantitative PCR
was performed for analysis of relative gene expression data using
the 2−CT method [17].
Fig. 1. Expression levels of cscp mRNA measured by real time PCR performed during
encystation. A significant increase of expression level (A) and correlation with encystation ratio (B) were observed during encystation. Experiments were repeated three
times and the average values are presented with error bars representing standard
deviations. **Means differ significantly at P < 0.01 by Student t-test.
2.3. Cysteine protease activity assay
For production of recombinant CSCP protein, the cscp gene
was cloned into the pGEX 4T-2 vector (Amersham Bioscience,
Buckinghamshire, England). Activity of purified recombinant
CSCP protein was determined by incubation with substrates
of papain (N-Acetylphenylalanyl-glycine 4-nitroanilide (Ac-PheGly-pNA)) (Calbiochem, San Diego, CA, USA), human cathepsin L (N-benzyloxycarbonyl-Phe-Ala-7-amino-4-trifluoro-methyl
coumarin (Z-Phe-Arg-AFC-, TFA)) (Enzo life Science, Farmingdale,
NY, USA), or human cathepsin B (benzyloxycarbonyl-l argininel-arginyl 4-nitroanilide (Z-Arg-Arg-pNA)) (Calbiochem, San Diego,
CA, USA). The incubation buffer used in the papain activity assay
contained 2 mM DTT, 8 mM l-cystein, and 4 mM EDTA in 100 mM
Tris–HCl (pH 6.5). One microgram of purified protein was incubated
with 10 ␮M substrate at 37 ◦ C for 1 h, followed by measurement
of optical density at OD405 nm . The incubation buffer used in the
cathepsin L activity assay contained 4 mM EDTA and 8 mM DTT in
400 mM sodium acetate (pH 5.5), and the incubation buffer used
in the cathepsin B activity assay contained 16 mM DTT in 100 mM
sodium acetate (pH 6.8). Also, 1 ␮g of purified protein was incubated with 10 ␮M substrate at 37 ◦ C for 1 h to determine cathepsin
L and cathepsin B activity.
2.4. Transient transfection
To investigate intracellular localization of CSCP, the gene was
cloned into the pUb vector using enhanced green fluorescent protein (EGFP) as a marker. This plasmid was transfected into live cells
of A. castellanii. Using a previously described method, transient
Fig. 2. Protease activity of the recombinant CSCP. One microgram aliquots of purified CSCP were assayed with synthetic colorimetric substrates. Protease activity
was detected in papain substrate (A) and cathepsin B substrate (B). Graphs show
mean ± SEM from three independent experiments. Asterisks denote statistically significant (*P < 0.05 and **P < 0.01) differences between control (Bf or Bf + Sub) and
recombinant CSCP. Bf; buffer, Sub; substrate.
E.-K. Moon et al. / Molecular & Biochemical Parasitology 185 (2012) 121–126
123
Fig. 3. Intracellular localization of CSCP. EGFP tagged CSCP protein was distributed in cytoplasm of trophozoites (A). Gathering of CSCP in large vesicle like structures was
observed in cysts incubated for a period of 48 h (B). These structures (green signal), which were co-localized with LysoTracker Red DND 99, an autophagosomal marker (red
signal), showed a yellow signal (C).
transfection was performed using Superfect transfection reagent
(Qiagen, Hilden, Germany) [14].
by staining with uranyl acetate and lead citrate. Sections were
observed under a transmission electron microscope (Hitachi H7000, Tokyo, Japan).
2.5. Gene silencing methodology
3. Results
Synthesis of siRNA targeting the cscp gene of A. castellanii was performed by Sigma-Proligo (Boulder, NV, USA),
based on the cDNA sequence. The siRNA duplex with sense
(5 -GAGUUCUCCCGCCUCUACAdTdT) and anti-sense (5 -UGUAGAGGCGGGAGAACUCdTdT) sequences was used. siRNA (4 ␮g) was
added to trophozoites at a density of 4 × 105 cells in 3 ml of encystment media. As a control, siRNA with a scrambled sequence absent
in Acanthamoeba was used (Ambion, Grand Island, NY, USA).
2.6. Confocal microscopy
The LSM 5 EXCITER Scalable confocal system (ZEISS, Hamburg, Germany) was used for selection and observation of amoeba
expressing EGFP. EGFP- or DAPI (4 ,6-diamidino-2-phenylindole)mediated fluorescence was performed using band-pass filters that
provided excitation and emission wavelengths of 500 and 530 nm
or 360 and 460 nm, respectively.
2.7. Transmission electron microscopy
Cells were prefixed with 4% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.2–7.4) for 2 h, followed by post-fixation with 1%
osmium tetraoxide for 3 h. Fixed cells were dehydrated with ethyl
alcohol and treated with propylene oxide–resin (1:1) overnight
with continuous shaking. Samples were embedded in resin. Ultrathin sections were cut on a Reichert-Jung ultramicrotome, followed
3.1. Identification of a cyst specific cysteine protease
Real time PCR was performed in order to confirm the level
of expression of cysteine protease; results of microarray analysis
showed higher expression in cysts than in trophozoites. A magnificent increase in expression of cysteine protease was observed
during encystation, particularly on Day 2 and Day 3 (Fig. 1A). This
result shows good correlation with the encystation ratio. Encystation ratio of amoeba in encystation media showed 0% on control
day (Day 0), 26% on the first day (Day 1), 54% on the second day
(Day 2), and 82% on the third day (Day 3) (Fig. 1B). The full open
reading frame of this gene, which we named cyst specific cysteine
protease (cscp), was identified in A. castellanii (GenBank accession
no. JQ253375). The CSCP of Acanthamoeba showed homology at
the histidine active site and the asparagine active site with peptidase C1A superfamily. The purified GST–CSCP recombinant protein
showed papain and cathepsin B like activity (Fig. 2) but no activity against cathepsin L substrate (data not shown). Based on these
characteristics, CSCP may be a lysosomal cysteine protease.
3.2. Intracellular localization of CSCP during encystation
To investigate intracellular localization of CSCP, the CSCP-EGFP
recombinant plasmid was transfected into live Acanthamoeba. In
trophozoites, evenly distributed fluorescence was observed in the
124
E.-K. Moon et al. / Molecular & Biochemical Parasitology 185 (2012) 121–126
cytoplasm of transfected amoeba (Fig. 3A). Following transfer of
transfected amoebae to encystment media, gathering of dispersed
fluorescent CSCP into vesicle like structures was observed after a
48-hr period of incubation (Fig. 3B). These vesicle like structures
containing CSCP were stained with LysoTracker Red DND-99, an
autophagosome marker (Fig. 3C).
3.3. Effect of CSCP on encystation
Gene silencing with siRNA was performed in order to confirm
the function of CSCP in Acanthamoeba encystation. FACS analysis confirmed 77% siRNA transfection efficiency (data not shown).
siRNA transfected cells showed similar levels of expression of cscp
to that of trophozoites. By the gene silencing effect of siRNA, the
expression level of cscp in transfected cell was similar to that of
trophozoite (Fig. 4A). Significantly inhibited formation of mature
cysts was observed in cscp-siRNA transfected cells (Fig. 4B).
3.4. The role of CSCP during encystation
To determine the role of CSCP in encystation, we monitored
the mitochondria as a primary target for autolysis during encystation of Acanthamoeba. In control cells, a few mitochondria were
clearly separated from each other and their localization did not
overlap with autophagosome like structures (Fig. 5A). However,
in cscp-siRNA transfected cells, DAPI-stained, irregularly shaped
masses in vesicular structures, colocalized with autophagosomes,
were observed (Fig. 5B). This result suggested a relationship
between function of CSCP and digestion of mitochondria during encystation. In addition, even after incubation in encystment
media for more than three days, formation of mature cysts in
cscp-siRNA transfected cells was not observed. Control cells and
cscp-siRNA transfected cells were observed under transmission
electron microscopy in order to confirm the presence of an undegraded mitochondrial mass. Control cells, which contained a few
mitochondria, converted to mature cysts (Fig. 6A). However, the
undigested mitochondrial mass was observed in cscp-siRNA transfected cells, which were still trophozoites or immature cysts
(Fig. 6B). This result clearly demonstrated an important role
for cyst specific cysteine protease (CSCP) in autophagosomes,
particularly in mitochondrial autolysis during encystation of
Acanthamoeba.
4. Discussion
Remarkable morphological changes and rearrangement of intracellular components occur during encystation of Acanthamoeba,
resulting in elimination of unnecessary organelles and recycling of
macromolecules for reuse. Cytoplasmic changes that show correlation with encystment are most evident in mitochondria, the Golgi
complex, and the digestive vacuole system [1]. The importance
of autophagy in turnover of cellular components is well known.
Acanthamoeba trophozoites contain large numbers of mitochondria for generation of the energy required for active movement,
proliferation, and other cellular activities. However, compared with
trophozoites, the dormant cyst requires significantly fewer mitochondria [30]. This was supported by our FACS analysis data, which
showed a much lower level of fluorescence in cysts than in trophozoites stained with MitoTracker red (Supplementary data).
Supplementary material related to this article found, in
the online version, at http://dx.doi.org/10.1016/j.molbiopara.
2012.07.008.
In addition, degradation of a large number of mitochondria may
provide a large number of macromolecules for building up the thick
cyst walls for maturation of cysts. Cyst walls of CSCP inhibited cells
Fig. 4. Inhibition of encystation by cscp-siRNA. Following transfection of cscp-siRNA,
no increase in expression levels of cscp was observed during encystation (A). Means
did not differ significantly at P < 0.05 by Student t-test. Following incubation of
transfected cells in encystment media for three days, the number of mature cysts
was counted. A reduced percentage of mature cysts was observed in cscp-siRNA
transfected cells (B). Experiments were repeated three times; asterisks (**) denote
significant differences at P < 0.01 by Student t-test.
were immature or remained with the plasma membrane. Inhibition of CSCP might block recycling of cellular macromolecules from
degradation of mitochondria. And, finally, transformation of cells
to mature cysts could not occur. Control of mitochondrial quantity
may be one of the most important processes for achievement of
successful encystation in Acanthamoeba.
In this study, we identified cscp in A. castellanii. Significant
expression of CSCP was observed during encystation [22] (Fig. 1),
and resulted in mediation of mitochondrial autolysis (Figs. 5 and 6).
In a previous study, we reported on characterization of the encystation mediating serine protease in A. castellanii [23]. Following
treatment of amoebae with siRNA against the serine protease,
undigested cytoplasmic materials and organelles were observed
within the autophagosomes. From the beginning, because high
expression of cysteine protease in Acanthamoeba is very particular,
we hypothesized that CSCP might play a specific role in encystation. cscp-siRNA, which abolished digestion of mitochondria in
autophagosomes of cells, was observed as an undigested mitochondrial mass (Figs. 5 and 6). These results suggest different roles
of both encystation mediating serine protease and CSCP in autolysis for encystation, and that CSCP works specifically to degrade
mitochondria in Acanthamoeba.
Autophagy is involved in degradation of mitochondria
(mitophagy), endoplasmic reticulum (reticulophagy), peroxisomes (pexophagy), and ribosomes (ribophagy). Mitophagy is the
selective autophagy for degradation of mitochondria [16]. Findings
from recent studies have suggested that mitochondrial autophagy
may occur through a selective process [27,34]. Three main genes
have been reported in association with mitophagy: Uth1p (a specific outer membrane protein of Saccharomyces cerevisiae), Aup1p
(a yeast mitochondrial protein phosphatase homolog), and Atg32
(autophagy related gene) [10,12,33]. Atg32, a mitophagy specific
E.-K. Moon et al. / Molecular & Biochemical Parasitology 185 (2012) 121–126
125
Fig. 5. The role of CSCP-confocal microscopy. Mature cysts of Acanthamoeba contain a small number of mitochondria (stained with DAPI) (A). In cscp-siRNA transfected cells,
DAPI-stained, irregularly shaped masses in vesicular structures with autophagosomes (stained with LysoTracker red) were observed (B). Compared to control cysts, the cells
did not have cyst wall structure (B).
Fig. 6. The role of CSCP-transmission electron microscopy (TEM). The effect of cscp-siRNA was examined under TEM. Following induction of encystation for a period of days,
formation of mature cysts was observed in control cells (A). However, an undigested mitochondrial mass (arrow) in immature cysts was observed in cscp-siRNA transfected
cells (B). Several free mitochondria (arrow heads) were also observed (B).
126
E.-K. Moon et al. / Molecular & Biochemical Parasitology 185 (2012) 121–126
receptor in yeast, is important for recruitment of mitochondria
by macroautophagy. PINK1 (a mitochondrial serine/threonine
protein kinase) is associated with specific recruitment of Parkin (a
multiprotein E3 ubiquitin ligase complex), which promotes mitochondrial autophagy [25,26]. However, an enzyme for selective
degradation of substrate in mitophagy has yet to be discovered.
The mechanism of selective degradation of mitochondria is not
known in Acanthamoeba; however, data on siRNA against cscp in
association with mitochondrial degradation provide important
evidence of mitophagy in Acanthamoeba. Findings from our previous report on the Atg16L system also provide strong evidence of
mitophagy in encysting Acanthamoeba [32].
Intracellular trafficking of autophagosomal enzymes remains
unknown. In general, mediation of transport of lysosomal proteins
by mannose 6-phosphate receptors has been reported [7]. Regulated transport of cysteine protease to lysosomes in E. histolytica
by Rab7 isotype has been reported [28]. Mediated transport of
lysozymes and ␤-hexosaminidase of E. histolytica by a novel transmembrane receptor in phagosome transport, cysteine protease
binding protein family 8 (CPBF8), has been reported [6]. The mechanism of intracellular trafficking to autophagosomes of amoebic
cysteine protease, involving CSCP, should be demonstrated.
The prominent role of proteolytic activity during encystation
is in accordance with autophagic processes in encysting Acanthamoeba [1]. Results of cyst specific ESTs analysis also showed that
the ‘O’ article (posttranslational modification, protein turnover, and
chaperones) possessed the highest percentage of cyst specific ESTs
[21]. These results suggested the necessity of various proteases of
Acanthamoeba in regulation of autophagic mechanisms in formation of a mature cyst. Although the majority of research on the
protease in Acanthamoeba has focused on pathogenesis, interest in
the role of protease in association with encystation or excystation
has increased in recent years. We supposed that various proteases
play important roles in regulation of autophagic processes. Knowledge of the role of CSCP could lead to an expanded understanding
of autophagic mechanisms in cyst forming protozoa, including
Acanthamoeba, during encystation. In order to understand the complete mechanism of Acanthamoeba encystation, investigation of
mitophagy related genes and genes controlling CSCP activity will
be needed.
Acknowledgments
This work was supported by a Korea Research Foundation Grant
funded by the Korean Government (MOEHRD, Basic Research Promotion Fund) (2010-0003606) and the Brain Korea 21 Project in
2011.
References
[1] Bowers B, Korn ED. The fine structure of Acanthamoeba castellanii (Neff strain).
II. Encystment. Journal of Cell Biology 1969;41:786–805.
[2] Chen L, Orfeo T, Gilmartin G, Bateman E. Mechanism of cyst specific protein 21
mRNA induction during Acanthamoeba differentiation. Biochimica et Biophysica Acta 2004;1691:23–31.
[3] Coulon C, Collignon A, McDonnell G, Thomas V. Resistance of Acanthamoeba
cysts to disinfection treatments used in health care settings. Journal of Clinical
Microbiology 2010;48:2689–97.
[4] Ebert F, Bachmann A, Nakada-Tsukui K, Hennings I, Drescher B, Nozaki T, et al.
An Entamoeba cysteine peptidase specifically expressed during encystation.
Parasitology International 2008;57:521–4.
[5] Eksi S, Czesny B, van Gemert GJ, Sauerwein RW, Eling W, Williamson KC. Inhibition of Plasmodium falciparum oocyst production by membrane-permeant
cysteine protease inhibitor E64d. Antimicrobial Agents and Chemotherapy
2007;51:1064–70.
[6] Furukawa A, Nakada-Tsukui K, Nozaki T. Novel transmembrane receptor
involved in phagosome transport of lysozymes and ␤-hexosaminidase in the
enteric protozoan Entamoeba histolytica. PLoS Pathogens 2012;8:e1002539.
[7] Ghosh P, Dahms NM, Kornfeld S. Mannose 6-phosphate receptors: new twists
in the tale. Nature Reviews Molecular Cell Biology 2003;4:202–12 [review].
[8] Hong YC, Kong HH, Ock MS, Kim IS, Chung DI. Isolation and characterization of a
cDNA encoding a subtilisin-like serine proteinase (ahSUB) from Acanthamoeba
healyi. Molecular and Biochemical Parasitology 2000;111:441–6.
[9] Hong YC, Hwang MY, Yun HC, Yu HS, Kong HH, Yong TS, et al. Isolation
and characterization of a cDNA encoding a mammalian cathepsin L-like cysteine proteinase from Acanthamoeba healyi. Korean Journal of Parasitology
2002;40:17–24.
[10] Kanki T, Wang K, Cao Y, Baba M, Klionsky DJ. Atg32 is a mitochondrial protein that confers selectivity during mitophagy. Developmental Cell
2009;17:98–109.
[11] Khan NA. Acanthamoeba: biology and increasing importance in human health.
FEMS Microbiology Review 2006;30:564–95 [review].
[12] Kissová I, Deffieu M, Manon S, Camougrand N. Uth1p is involved in the
autophagic degradation of mitochondria. Journal of Biological Chemistry
2004;279:39068–74.
[13] Kong HH, Kim TH, Chung DI. Purification and characterization of a secretory
serine proteinase of Acanthamoeba healyi isolated from GAE. Journal of Parasitology 2000;86:12–7.
[14] Kong HH, Pollard TD. Intracellular localization and dynamics of myosin-II and
myosin-IC in live Acanthamoeba by transient transfection of EGFP fusion proteins. Journal of Cell Science 2002;115:4993–5002.
[15] Leitsch D, Köhsler M, Marchetti-Deschmann M, Deutsch A, Allmaier G, Duchêne
M, et al. Major role for cysteine proteases during the early phase of Acanthamoeba castellanii encystment. Eukaryot Cell 2010;9:611–8.
[16] Lemasters JJ. Selective mitochondrial autophagy, or mitophagy, as a targeted
defense against oxidative stress, mitochondrial dysfunction, and aging. Rejuvenation Research 2005;8:3–5.
[17] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods
2001;25:402–8.
[18] Lloyd D, Turner NA, Khunkitti W, Hann AC, Furr JR, Russell AD. Encystation in
Acanthamoeba castellanii: development of biocide resistance. Journal of Eukaryotic Microbiology 2001;48:11–6 [review].
[19] Marciano-Cabral F, Cabral G. Acanthamoeba spp. as agents of disease in humans.
Clinical Microbiology Reviews 2003;16:273–307 [review].
[20] Moon EK, Chung DI, Hong Y, Kong HH. Atg3-mediated lipidation of Atg8
is involved in encystation of Acanthamoeba. Korean Journal of Parasitology
2011;49:103–8.
[21] Moon EK, Chung DI, Hong Y, Kong HH. Expression levels of encystation mediating factors in fresh strain of Acanthamoeba castellanii cyst ESTs. Experimental
Parasitology 2011;127:811–6.
[22] Moon EK, Xuan YH, Chung DI, Hong Y, Kong HH. Microarray analysis of differentially expressed genes between cysts and trophozoites of Acanthamoeba
castellanii. Korean Journal of Parasitology 2011;49:341–7.
[23] Moon EK, Chung DI, Hong YC, Kong HH. Characterization of a serine proteinase
mediating encystation of Acanthamoeba. Eukaryotic Cell 2008;7:1513–7.
[24] Moon EK, Chung DI, Hong YC, Kong HH. Autophagy protein 8 mediating
autophagosome in encysting Acanthamoeba. Molecular and Biochemical Parasitology 2009;168:43–8.
[25] Narendra D, Tanaka A, Suen DF, Youle RJ. Parkin is recruited selectively to
impaired mitochondria and promotes their autophagy. Journal of Cell Biology
2008;183:795–803.
[26] Narendra DP, Jin SM, Tanaka A, Suen DF, Gautier CA, Shen J, et al. PINK1 is
selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biology
2010;8:e1000298.
[27] Nowikovsky K, Reipert S, Devenish RJ, Schweyen RJ. Mdm38 protein depletion
causes loss of mitochondrial K+ /H+ exchange activity, osmotic swelling and
mitophagy. Cell Death and Differentiation 2007;14:1647–56.
[28] Saito-Nakano Y, Mitra BN, Nakada-Tsukui K, Sato D, Nozaki T. Two Rab7 isotypes, EhRab7A and EhRab7B, play distinct roles in biogenesis of lysosomes and
phagosomes in the enteric protozoan parasite Entamoeba histolytica. Cellular
Microbiology 2007;9:1796–808.
[29] Santos CC, Coombs GH, Lima AP, Mottram JC. Role of the Trypanosoma brucei natural cysteine peptidase inhibitor ICP in differentiation and virulence.
Molecular Microbiology 2007;66:991–1002.
[30] Siddiqui R, Khan NA. Acanthamoeba is an evolutionary ancestor of
macrophages: a myth or reality? Experimental Parasitology 2012;130:95–7
[review].
[31] Sissons J, Kim KS, Stins M, Jayasekera S, Alsam S, Khan NA. Acanthamoeba castellanii induces host cell death via a phosphatidylinositol 3-kinase-dependent
mchanism. Infection and Immunity 2005;73:2704–8.
[32] Song SM, Han BI, Moon EK, Lee YR, Yu HS, Jha BK, et al. Autophagy protein 16mediated autophagy is required for the encystation of Acanthamoeba castellanii.
Molecular and Biochemical Parasitology 2012;183:158–65.
[33] Tal R, Winter G, Ecker N, Klionsky DJ, Abeliovich H. Aup1p, a yeast
mitochondrial protein phosphatase homolog, is required for efficient stationary phase mitophagy and cell survival. Journal of Biological Chemistry
2007;282:5617–24.
[34] Twig G, Elorza A, Molina AJ, Mohamed H, Wikstrom JD, Walzer G, et al. Fission and selective fusion govern mitochondrial segregation and elimination by
autophagy. EMBO Journal 2008;27:433–46.
[35] Williams RA, Tetley L, Mottram JC, Coombs GH. Cysteine peptidases CPA and
CPB are vital for autophagy and differentiation in Leishmania mexicana. Molecular Microbiology 2006;61:655–74.