␤ -Adrenergic Receptor Polymorphisms Affect Response to Treatment in Children With Severe Asthma

Original Research
ASTHMA
␤2-Adrenergic Receptor Polymorphisms
Affect Response to Treatment in
Children With Severe Asthma
Exacerbations*
Christopher L. Carroll, MD, FCCP; Petronella Stoltz, APRN;
Craig M. Schramm, MD; and Aaron R. Zucker, MD
Background: ␤2-adrenergic receptor (AR) agonists are the mainstay of treatment for severe
asthma exacerbations, one of the most common causes of critical illness in children. Genotypic
differences in the ␤2-AR gene, particularly at amino acid positions 16 and 27, have been shown
to affect the response to ␤2-AR agonist therapy. Our hypothesis is that genotypic differences
contribute to patient response to ␤2-AR agonist treatment during severe asthma exacerbations in
children.
Methods: Children admitted to the hospital ICU for a severe asthma exacerbation between 2002
and 2005 were located, and genetic samples were obtained from saliva. Children hospitalized
during this period were treated with a protocol that titrated ␤2-AR therapy (first nebulized, then
IV) according to a validated clinical asthma score.
Results: Thirty-seven children hospitalized during the study period were enrolled into the study. At
amino acid position 16 in the ␤2-AR gene, 13 children were homozygous for the glycine (Gly) allele
(Gly/Gly), 8 were homozygous for the arginine (Arg) allele (Arg/Arg), and 16 were heterozygous
(Arg/Gly). Despite similar clinical asthma scores on hospital admission, the children with the Gly/Gly
genotype had significantly shorter hospital ICU length of stay and duration of continuously nebulized
albuterol therapy and were significantly less likely to require IV ␤2-AR therapy than those with
Arg/Arg or Arg/Gly genotypes. No association existed among polymorphisms at amino acid position 27
and response to ␤2-AR therapy.
Conclusions: In this cohort of children with severe asthma exacerbations, children whose genotypes
were homozygous for Gly at amino acid position 16 of the ␤2-AR gene had a more rapid response to
␤2-AR agonist treatment. The ␤2-AR genotype appears to influence the response to therapy in this
population.
(CHEST 2009; 135:1186 –1192)
Abbreviations: AR ⫽ adrenergic receptor; Arg ⫽ arginine; Gln ⫽ glutamine; Glu ⫽ glutamic acid; Gly ⫽ glycine;
MPIS ⫽ modified pulmonary index score; SNP ⫽ single-nucleotide polymorphism
evere asthma exacerbations are one of the most
S common
causes of critical illness in children,
accounting for approximately 10,000 hospital ICU
admissions per year in the United States.1–5 Inhaled
*From the Department of Pediatrics, Connecticut Children’s
Medical Center, Hartford, CT.
This research was supported by the University of Connecticut
Health Center General Clinical Research Center (grant M01
RR006192).
The authors have reported to the ACCP that no significant
conflicts of interest exist with any companies/organizations whose
products or services may be discussed in this article.
Manuscript received August 21, 2008; revision accepted November
8, 2008.
1186
Downloaded From: http://journal.publications.chestnet.org/ on 10/28/2014
␤2-adrenergic receptor (AR) agonist medications are
the foundation of therapy for acute asthma exacerbation.6 – 8 They may be delivered intermittently or
continuously during more severe episodes.6 – 8 If the
child progresses to having a severe asthma exacerbation that requires a hospital ICU admission, several
Reproduction of this article is prohibited without written permission
from the American College of Chest Physicians (www.chestjournal.
org/site/misc/reprints.xhtml).
Correspondence to: Christopher L. Carroll, MD, FCCP, Division of
Pediatric Critical Care, Connecticut Children’s Medical Center, 282
Washington St, Hartford, CT 06106; e-mail: ccarrol@ccmckids.org
DOI: 10.1378/chest.08-2041
Original Research
different second-line therapies are used, including
systemic ␤2-AR agonists, methylxanthines, and magnesium.6 – 8 Often, these therapies are used in combination or a trial-and-error fashion and chosen
without an evidence-based rationale.6 – 8 Determining the likelihood of response to a specific therapy
would be a major advance in the treatment of severe
asthma exacerbations in children.
Genetic variations of the ␤2-AR may have important effects on modulating responses to therapy for
asthma.9 –23 Single-nucleotide polymorphisms (SNPs)
at amino acid positions 16 and 27 of the ␤2-AR gene
are the most common and have been shown to be the
most functionally relevant.9 –23 A change at base 46
from adenine to guanine causes glycine (Gly), rather
than arginine (Arg), to appear at amino acid position
16 in the ␤2-AR gene.9 A change at base 79 from
guanine to cytosine results in the substitution of
glutamic acid (Glu) for glutamine (Gln) at position
27.9 However, conflicting data exist regarding the
effects of these variations in different populations,
and the clinical importance of these polymorphisms
is poorly understood.9 –23 Our hypothesis is that
genotypic differences of the ␤2-AR are associated
with response to short-term ␤2-AR agonist treatment
during severe asthma exacerbations in children.
Materials and Methods
This study was approved by the Institutional Review Board at
Connecticut Children’s Medical Center. Written informed consent was obtained before patient enrollment.
All children between 2 and 18 years of age with physiciandiagnosed asthma and who were admitted with a severe asthma
exacerbation between January 1, 2002, and December 31, 2005,
were included in the study. Severe asthma exacerbations were
defined as those requiring hospital ICU admission. Children with
chronic medical conditions other than asthma, such as bronchopulmonary dysplasia, tracheobronchial malacia, and congenital
heart disease, were excluded.
The modified pulmonary index score (MPIS) was used to
assess illness severity. Asthma scoring systems often are used in
pediatric patients because of the difficulty in obtaining reliable
and reproducible measures of airflow obstruction in children who
are critically ill. This validated scoring system is highly reproducible among groups of medical professionals (respiratory therapists, nurses, and physicians) as well as among individuals within
each group.24 In the MPIS, the following six categories are
evaluated: oxygen saturation in room air, accessory muscle use,
inspiratory-to-expiratory ratio, degree of wheezing, heart rate,
and respiratory rate. For each of these measurements or observations, a score of zero to three is assigned.24
Admission and discharge criteria from both the ICU and the
hospital remained constant during the study period. At the study
institution, pediatric patients may be treated with continuously
nebulized albuterol on the inpatient ward. Children were admitted to the hospital ICU for an asthma exacerbation if after 2 h of
at least 20 mg/h of continuous nebulized albuterol therapy the
child was given an MPIS score of ⬎ 12, required supplemental
oxygen of ⬎ 40% to maintain oxygen saturation ⱖ 94%, or was
intubated and mechanically ventilated. A child was transferred
www.chestjournal.org
Downloaded From: http://journal.publications.chestnet.org/ on 10/28/2014
from the hospital ICU to the ward when he or she required
bronchodilator therapy of ⱕ 20 mg/h of continuous albuterol
aerosol, needed supplemental oxygen ⱕ 40% to maintain oxygen
saturation ⱖ 94%, and was given an MPIS score of ⱕ 10.
Pediatric patients were discharged home if their MPIS score was
⬍ 7 while receiving intermittent albuterol nebulizer treatments
every 4 h or more and required no supplemental oxygen therapy
to maintain oxygen saturation at ⱖ 94%.
During the study period, all children were treated prospectively according to a clinical protocol that adjusted ␤2-AR agonist
therapy based on hourly MPIS assessments of each child’s illness
severity.25,26 The children were treated initially with high-dose
continuous nebulized albuterol therapy (ⱖ 20 mg/h), and those
who showed no improvement on sequential MPIS assessments
were treated with IV terbutaline, which also was adjusted hourly
based on MPIS scores. This previously published protocol25 has
been shown to reduce variability and reduce duration of therapies
for asthma exacerbations. All the children also received 4 mg/kg/d
of IV methylprednisolone during the acute phase of illness.
All families of children meeting the study criteria were contacted. The children’s genomic DNA was obtained from a saliva
sample (ORAgene DNA Self-Collection Kit; DNA Genotek Inc;
Ottawa, ON, Canada), and analysis was performed at the University of Connecticut Health Center’s General Clinical Research
Center. Genotyping of the adjacent Arg16Gly and Gln27Glu was
determined by restriction fragment length polymorphism analysis
of a 100-base pair (bp) polymerase chain reaction product
encompassing both SNPs, using primers AGCGCCTTCTTGCTGGCACCCCAT and ACATGACGATGCCCATGC. Digestion of
the polymerase chain reaction product with NcoI was used to
determine frequency of the Arg16 and Gly16 variant alleles (100
bp vs 20 ⫹ 80 bp) as well as with NcoI and Fnu4HI to generate
size-specific products (italicized) for each of the following four
possible haplotypes: Gly16/Glu27 (20 bp, 35 bp, 45 bp), Gly16/
Gln27 (20 bp, 35 bp, 45 bp), Arg16/Gln27 (55 bp, 45 bp), and
Arg16/Glu27 (100 bp). These four haplotypes define ⬎ 90% of
the known haplotypes across a 1,500-bp region encompassing 13
SNP variants, including eight 5⬘-upstream SNPs with potential
regulatory effects as well as the common Arg16Gly and Gln27Glu
amino acid variants.12
A trained research assistant extracted clinical data retrospectively from the medical record, using a uniform data extraction
tool. Investigators were blinded to ␤2-AR genotype at the time of
data collection. Actual lengths of stay and duration of therapy
were calculated from the medical record. Although data regarding National Heart Lung and Blood Institute classifications27
were collected retrospectively, they were determined prospectively at the time of admission to the hospital ICU by an attending
pulmonologist or intensivist, using the guidelines in effect at the
time of hospitalization. Because of missing height data, the
children were classified as overweight if their age-for-weight
percentile was ⬎ 95% based on gender-specific reference data
collected by the National Center for Health Statistics.28
Statistical Analysis
The relationships between ␤2-AR genotypes and outcomes
were assessed with appropriate parametric tests and statistics,
including ␹2 and t tests. Nonparametric tests, such as Wilcoxon
rank sum test and Kruskal-Wallis test, were used when indicated
by the distribution of the data. The Shapiro Wilk test was used to
assess normality. Multiple regression was used to determine the
influence of genotype, controlling for other potential risk factors
found to be significantly associated with length of stay in the
hospital ICU and duration of continuous albuterol therapy. All p
values represent two-sided hypothesis testing, and a p value of
⬍ 0.05 was considered statistically significant. Data were anaCHEST / 135 / 5 / MAY, 2009
1187
Table 1—Demographics and Measures of Baseline Illness Severity According to ␤2-AR Genotype at Amino Acid
Position 16*
Gly/Gly
(n ⫽ 13)
Arg/Gly or Arg/Arg
(n ⫽ 24)
p Value†
Arg/Arg
(n ⫽ 8)
p Value‡
Arg/Gly
(n ⫽ 16)
p Value§
6.3 ⫾ 3.9
46
8
7.7 ⫾ 3.9
54
33
0.23
0.74
0.12
7.3 ⫾ 4.1
38
38
0.54
1.00
0.25
7.9 ⫾ 4.0
63
31
0.45
0.46
0.21
8
23
61
69
46
15
0
21
21
50
58
58
33
8
0.22
1.00
0.73
0.72
0.52
0.44
0.53
25
25
50
63
63
25
0
0.53
1.00
0.67
1.00
0.66
0.62
1.00
31
19
50
56
56
38
13
0.30
0.93
0.80
0.77
0.75
0.41
0.25
54
23
15
7
54
17
38
21
25
54
0.03
0.48
1.00
0.38
1.00
25
25
38
13
50
0.37
1.00
0.33
1.00
1.00
13
44
13
31
56
0.05
0.44
0.31
0.24
0.96
Variables
Age, yr
Male gender
Obese (⬎ 95% weight for age)
Race/ethnicity
Hispanic
African American
White
Public insurance
Previous hospitalization
Previous hospital ICU admission
Previous intubation
NHLBI asthma classification
Intermittent
Mild persistent
Moderate persistent
Severe persistent
Baseline inhaled corticosteriod use
*Values are given as the mean ⫾ SD or %. NHLBI ⫽ National Heart, Lung and Blood Institute.
†Comparison of Gly/Gly genotype to grouped sample of Arg/Arg and Arg/Gly genotype populations.
‡Comparison of Gly/Gly genotype to Arg/Arg genotype populations.
§Comparison of all three genotype populations.
lyzed using a statistical software package (JMP, version 6.0.2; SAS
Institute; Cary, NC) in collaboration with consultants from the
University of Connecticut Health Center’s General Clinical
Research Center. Results are reported as mean ⫾ SD or as
frequency (%).
Results
Patient Characteristics
During the study period, 149 children were admitted to the hospital ICU for a severe asthma exacerbation. The parents of 90 of these children could be
contacted by mail and telephone, and 37 of them
consented to enroll their child in this study. At amino
acid position 16 of the ␤2-AR gene, 13 (35%)
children were homozygous for Gly (Gly/Gly), 8
(22%) were homozygous for arginine (Arg/Arg), and
16 (43%) were heterozygous (Arg/Gly). At amino
acid position 27 of the ␤2-AR gene, 16 children
(43%) were homozygous for Gln (Gln/Gln), 5 children (14%) were homozygous for Glu (Glu/Glu), and
16 children (43%) were heterozygous (Glu/Gln).
Six haplotypes were present in this cohort. The
most common haplotype was Arg/Gly-Glu/Gln
(n ⫽ 10, 27%), followed by Arg/Arg-Gln/Gln (n ⫽ 9,
24%), Gly/Gly-Glu/Gln (n ⫽ 6, 16%), Gly/Gly-Glu/
Glu (n ⫽ 5, 14%), Arg/Gly-Gln/Gln (n ⫽ 5, 14%),
and Gly/Gly-Gln/Gln (n ⫽ 2, 5%).
Outcomes
Children with the Gly/Gly genotype at amino acid
position 16 of the ␤2-AR were more likely to have
1188
Downloaded From: http://journal.publications.chestnet.org/ on 10/28/2014
intermittent asthma exacerbations than those with
either the Arg/Arg or Arg/Gly genotypes. Otherwise,
no statistically significant differences were found in
the demographics, baseline characteristics, or medical
history between these two patient groups (Table 1).
No differences were found in admission MPIS
among the study groups; however, despite similar
illness severity on hospital admission, children with
the Gly/Gly genotype had significantly shorter hospital ICU length of stay, duration of continuously
nebulized albuterol therapy, and duration of supplemental oxygen therapy and were significantly less
likely to require IV ␤2-AR therapy than those with
Arg/Arg or Arg/Gly genotypes (Table 2 and Fig 1).
In addition to these grouped comparisons, we also
compared the clinical characteristics and outcome
variables by individual genotypes at amino acid position
16 (Tables 1 and 2). When comparing the clinical
outcomes of the children with the Gly/Gly genotype
to those with the Arg/Arg genotype, the Gly/Gly
group had significantly shorter duration of continuous albuterol therapy (Table 2). When comparing
clinical outcomes of the children with the Gly/Gly,
Arg/Arg, and Arg/Gly genotypes, significant differences were found in the duration of continuous
albuterol therapy and hospital ICU length of stays
among these groups (Table 2). No other statistically
significant differences were found in clinical characteristics or outcomes among the groups (Tables 1 and 2).
Genetic polymorphisms at amino acid position 27
were not associated with response to ␤2-AR agonist
therapy or with the other clinical outcomes measured.
Original Research
Table 2—Hospital and Outcome Data According to ␤2-AR Genotype at Amino Acid Position 16*
Variables
Admission MPIS
ICU length of stay, h
Types of therapy received, %
IV ␤2-AR
Intubation
Duration of therapies
Continuous albuterol, d
Oxygen, d
IV corticosteroids, d
IV ␤2-AR, h
Gly/Gly
(n ⫽ 13)
Arg/Gly or Arg/Arg
(n ⫽ 24)
p Value†
Arg/Arg
(n ⫽ 8)
p Value‡
Arg/Gly
(n ⫽ 16)
p Value§
14 ⫾ 2
43 ⫾ 25
14 ⫾ 2
74 ⫾ 34
0.58
0.009
15 ⫾ 2
70 ⫾ 31
0.06
0.08
14 ⫾ 1
75 ⫾ 36
0.11
0.03
31
0
71
8
0.036
0.53
75
13
0.08
0.38
69
6
0.06
0.46
3.0 ⫾ 0.9
3.5 ⫾ 1.6
3.2 ⫾ 1.4
38 ⫾ 22
4.8 ⫾ 1.9
4.8 ⫾ 1.8
4.5 ⫾ 1.7
64 ⫾ 34
0.002
0.04
0.02
0.22
5.1 ⫾ 2.5
4.8 ⫾ 2.3
4.5 ⫾ 1.9
63 ⫾ 22
0.03
0.13
0.06
0.22
4.7 ⫾ 1.7
4.8 ⫾ 1.7
4.5 ⫾ 1.7
64 ⫾ 39
0.009
0.11
0.07
0.44
*Values are given as the mean ⫾ SD, unless otherwise indicated.
†Comparison of Gly/Gly genotype to grouped sample of Arg/Arg and Arg/Gly genotype populations.
‡Comparison of Gly/Gly genotype to Arg/Arg genotype populations.
§Comparison of all three genotype populations.
Haplotypes of the ␤2-AR also were not associated with
clinical characteristics or outcomes measured.
To identify significant predictors of duration of continuous albuterol therapy and hospital ICU length of
stay, stepwise multiple regressions were performed
using key variables, including ␤2-AR genotype, age,
gender, obesity, intermittent asthma classification,
and admission MPIS. In these models, Gly/Gly
genotype and female gender were associated with
decreased duration of continuous albuterol therapy
and hospital ICU length of stay; however, the Gly/
Gly genotype had a stronger relationship to these
outcomes than did gender (Table 3).
Discussion
In this cohort of children with severe asthma
exacerbations, the children whose genotypes were
homozygous for the ␤2-AR genotype were associated
with a response to short-term high-dose ␤2-AR
agonist therapy. Specifically, children homozygous
Figure 1. Kaplan-Meier curve of time to discharge from the
hospital ICU for children with Arg/Gly or Arg/Arg genotypes and
children with Gly/Gly genotypes (p ⫽ 0.006 by log-rank test).
www.chestjournal.org
Downloaded From: http://journal.publications.chestnet.org/ on 10/28/2014
for the Gly allele at amino acid position 16 had
significantly shorter durations of continuously nebulized ␤2-AR agonist therapy and shorter hospital
ICU length of stays when compared to the rest of
the cohort and treated according to a goal-directed
protocol. Knowledge of this genotype could significantly affect treatment selection for severe asthma
exacerbations in children.
The relationship between ␤2-AR genotypes and
response to ␤2-AR agonist therapy is controversial.
Some studies10 –17 have found that the Arg/Arg genotype is associated with reduced response to ␤2-AR
agonists, whereas others17–20 have found that the
Gly/Gly genotype is associated with reduced response.
This difference may be partly due to the use of
different types of ␤2-AR agonist therapy. The influence of ␤2-AR genotype appears to vary, depending
on whether the child receives short-term, singledose therapy or long-term, recurrent therapy. Children with severe asthma exacerbations, however,
routinely receive very high doses of ␤2-AR agonist
therapy for relatively long durations. Examining the
pharmacogenetics in this population may provide
potentially different results than found in the populations previously studied.
When examining the influence of ␤2-AR genotype
on response to short-term, single-dose ␤2-AR agonist
therapy, the Gly/Gly genotype has been more strongly
associated with reduced response.17–20 Martinez18 examined the bronchodilating effect of single-dose
albuterol administration in children. Children with
the Gly/Gly genotype had significantly diminished
bronchodilator response than children with the Arg/
Arg genotype at amino acid position 16 of the ␤2-AR
gene. Kotani19 and Lima20 reported similar results.
However, when examining the influence of ␤2-AR
genotype on the response to long-term and repeated
CHEST / 135 / 5 / MAY, 2009
1189
Table 3—Multiple Regression Analysis of Univariate Factors Influencing ICU Length of Stay
Factor
Unstandardized Regression
Coefficient
95% Confidence Interval for
Regression Coefficient
Standardized Regression
Coefficient
p Value
Gly/Gly genotype
Age
Obesity
Gender
Intermittent asthma
MPIS
⫺30.6
⫺0.1
6.2
⫺26.6
2.9
⫺0.7
⫺54.2 to ⫺6.9
⫺2.5 to 2.7
⫺18.2 to 30.5
⫺47.0 to ⫺6.3
⫺20.9 to 26.7
⫺5.8 to 7.3
⫺0.438
⫺0.013
0.079
⫺0.398
0.039
⫺0.035
0.015
0.933
0.616
0.014
0.810
0.826
dosages of ␤2-AR agonist therapy, the Arg/Arg genotype has been more closely associated with reduced
response.10 –17 In a study by Israel et al,13 190 adult
patients with mild asthma were given regular inhaled
␤2-AR agonist treatments. The patients with the
Arg/Arg genotype experienced a decline in morning
peak flow rates relative to those with the Gly/Gly
genotype. In a follow-up study by Taylor et al,14
patients with the Arg/Arg genotype were found to
have an increased number of asthma exacerbations
while receiving regular, short-acting inhaled ␤2-AR
agonist therapy. Israel et al15 then conducted a
prospective, randomized, double-blinded, placebocontrolled, genotype-stratified trial of a short-acting
inhaled ␤2-agonist vs placebo for the regular treatment of adult patients with asthma. The patients
with the Gly/Gly genotype had improved morning
peak flow rates with regularly scheduled albuterol,
whereas the patients with the Arg/Arg genotype had
worsened morning peak flow rates. Palmer et al16
duplicated these findings in a cohort of 546 children.
Our findings are similar to those of other studies10 –17 of long-term, repeated ␤2-AR agonist therapy. In both populations (patients receiving longterm ␤2-AR agonist therapy and children receiving
short-term high-dose therapy), the Gly/Gly genotype
was associated with improved response to ␤2-AR
agonist therapy. It is possible that tachyphylaxis to
␤2-AR agonist therapy may have contributed to
decreased response to therapy in children and adults
with other genotypic subtypes. In studies by Telleria
et al21 and Lee et al,22 adults with the Arg allele of
the ␤2-AR gene had increased tachyphylaxis to
␤2-AR agonist therapy. If children with the Gly/Gly
genotype had less tachyphylaxis to high-dose ␤2-AR
agonist therapy while in the hospital ICU, this may
have led to the improved response seen in our study.
Martin et al23 conducted the only previous study to
have examined the effect of genotype during acute
asthma exacerbations in children. They evaluated
␤2-AR genotypes of 148 children who presented to
the emergency department with acute asthma. They
found that the Glu/Glu genotype at amino acid
position 27 was associated with rapidity of clinical
1190
Downloaded From: http://journal.publications.chestnet.org/ on 10/28/2014
improvement; however, genotype at amino acid position 16 was not in their study. Several possible
explanations exist for the differing results between
our studies. First, Martin et al included all children
presenting with acute asthma exacerbations, whereas
our population included only children who were
severely ill, had been admitted to the hospital ICU,
and were treated with continuous and high doses of
␤2-AR agonist therapy. In addition, the children in
the Martin et al study were treated based on subjective physician preferences; thus, treatment variations
may have influenced rates of clinical improvement.
Racial and ethnic differences also may have played
a role in the relationship of ␤2-AR polymorphisms
and asthma; however, studies29 –32 have found conflicting results in different populations. Additionally,
the use of a variety of outcome measures makes
comparisons between studies difficult. In AfricanAmerican children with asthma, Elbahlawan et al29
found that polymorphisms at amino acid position 27
were linked more closely to clinical outcomes than
polymorphisms at amino acid position 16. Additionally, in the larger adult and pediatric Study of African
Americans, Asthma, Genes Environments, Tsai et
al30 reported that polymorphisms at amino acid
position 19 and not at position 16 were associated
with baseline pulmonary function.
Within Hispanic patient populations, the Tucson
Children’s Respiratory Study31 found that the frequency of ␤2-AR genotypes differed significantly by
ethnicity, with the Glu allele at amino acid position
27 being significantly less common in Hispanic
children than white children with asthma. Finally,
within a cohort of Hispanic children and adults with
asthma, Choudhry et al32 reported that in Puerto
Rican patients, the Arg allele at amino acid position
16 was associated with greater bronchodilator response compared to Mexican patients. These findings support the importance of examining genetic
factors in different racial and ethnic populations.
Several limitations exist in our retrospective study.
The sample size was small, and enrollment of eligible
patients was relatively low; both factors potentially
limit the generalizability of our findings. In addition,
Original Research
lack of statistical significance for some outcomes may
have been due to insufficient power. However, a
strength of our study was the treatment protocol
used for all patients. The ␤2-AR agonist therapy and
responses were assessed hourly, and treatment was
adjusted based on a validated measure of illness
severity. Previously,25 we have shown that this protocol significantly decreases variation in therapy. Use
of treatment guidelines at our institution may have
reduced the “noise” of the treatment variation, allowing the treatment effects of ␤2-AR polymorphisms to be observed.
This study builds on our previous work26 to establish phenotypes of severe asthma exacerbations in
children. Establishing appropriate phenotypes is a
crucial first step before attempting to link genotypes
to phenotypes in a particular population of patients.
In this previous population of children,26 we identified a group of children who were slow responders to
IV ␤2-AR agonist therapy. In this population of
children admitted to the hospital ICU with a severe
asthma exacerbation, we noted that a significant
proportion had a slow response to ␤2-AR agonist
therapy. The etiology of this slow response likely
was multifactorial; however, we suspected the
importance of genetic influences in this population. The current study links genetic polymorphisms to that previously identified phenotype.
Conclusions
We found that the Gly/Gly genotype of ␤2-AR
was associated with improved response to highdose ␤2-AR agonist therapy in children with severe
asthma exacerbations. This finding suggests that
pharmacogenetics may allow for evidence-based
therapy in this population.
References
1 McFadden ER Jr. Acute severe asthma. Am J Respir Crit
Care Med 2003; 168:740 –759
2 Romagnoli M, Caramori G, Braccioni F, et al. Near-fatal
asthma phenotype in the ENFUMOSA cohort. Clin Exp
Allergy 2007; 37:552–557
3 Pendergraft TB, Stanford RH, Beasley R, et al. Rates and
characteristics of intensive care unit admissions and intubations among asthma-related hospitalizations. Ann Allergy
Asthma Immunol 2004; 93:29 –35
4 McCormick MC, Kass B, Elixhauser A, et al. Annual report on
access to and utilization of health care for children and youth in
the United States: 1999. Pediatrics 2000; 105:219 –230
5 DeFrances CJ, Podgornik MN. 2004 National Hospital Discharge Survey. Adv Data 2006; 371:1–19
6 Werner HA. Status asthmaticus in children. Chest 2001;
119:1913–1929
7 Baren JM, Zorc JJ. Contemporary approach to the emergency
department management of pediatric asthma. Emerg Med
Clin North Am 2002; 20:115–138
www.chestjournal.org
Downloaded From: http://journal.publications.chestnet.org/ on 10/28/2014
8 Smith SR, Strunk RC. Acute asthma in the pediatric emergency department. Emerg Med 1999; 46:1145–1165
9 Reihsaus E, Innis M, MacIntyre N, et al. Mutations in the
gene encoding for the ␤2-adrenergic receptor in normal and
asthmatic subjects. Am J Respir Cell Mol Biol 1993; 8:334 –
339
10 Taylor DR, Epton MJ, Kennedy MA, et al. Bronchodilator
response in relation to ␤2-adrenoceptor haplotype in patients
with asthma. Am J Respir Crit Care Med 2005; 172:700 –703
11 Lipworth BJ, Hall IP, Tan S, et al. Effects of genetic
polymorphism on ex vivo and in vivo function of the
␤2-adrenoceptors in asthmatic patients. Chest 1999; 115:324 –
328
12 Drysdale CM, McGraw DW, Stack CB, et al. Complex
promoter and coding region ␤2-adrenergic receptor haplotypes alter receptor expression and predict in vivo
responsiveness. Proc Natl Acad Sci U S A 2000; 97:10483–
10488
13 Israel E, Drazen JM, Liggett SB, et al. The effect of
polymorphisms of the ␤2-adrenergic receptor on the response
to regular use of albuterol in asthma. Am J Respir Crit Care
Med 2000; 162:75– 80
14 Taylor DR, Drazen JM, Herbison GP, et al. Asthma exacerbations during long term ␤-agonist use: influence of
␤2-adrenoceptor polymorphism. Thorax 2000; 55:762–767
15 Israel E, Chinchilli VM, Ford JG, et al. Use of regularly
scheduled albuterol treatment in asthma: genotype-stratified,
randomised, placebo-controlled cross-over trial. Lancet 2004;
364:1505–1512
16 Palmer CAN, Lipworth BJ, Lee S, et al. Arginine-16 ␤2
adrenoceptor genotype predisposes to exacerbations in young
asthmatics taking regular salmeterol. Thorax 2006; 61:940 –
944
17 Contopoulos-Ioannidis DG, Manoli EN, Ioannidis JP. Metaanalysis of the association of ␤2-adrenergic receptor polymorphisms with asthma phenotypes. J Allergy Clin Immunol
2005; 115:963–972
18 Martinez FD, Graves PE, Baldini M, et al. Association
between genetic polymorphisms of the ␤2-adrenoceptor and
response to albuterol in children with and without a history of
wheezing. J Clin Invest 1997; 100:3184 –3188
19 Kotani Y, Nishimura Y, Maeda H, et al. ␤2-adrenergic
receptor polymorphisms affect airway responsiveness to salbutamol in asthmatics. J Asthma 1999; 36:583–590
20 Lima JJ, Thomason DB, Mohamed MH, et al. Impact of
genetic polymorphisms of the ␤2-adrenergic receptor on
albuterol bronchodilator pharmacodynamics. Clin Pharmacol
Ther 1999; 65:519 –525
21 Telleria JJ, Blanco-Quiros A, Muntion S, et al. Tachyphylaxis
to ␤2-agonists in Spanish asthmatic patients could be modulated by ␤2-adrenoceptor gene polymorphisms. Respir Med
2006; 100:1072–1078
22 Lee DK, Currie GP, Hall IP, et al. The arginine-16
␤2-adrenoceptor polymorphism predisposes to bronchoprotective subsensitivity in patients treated with formoterol and
salmeterol. Br J Clin Pharmacol 2004; 57:68 –75
23 Martin AC, Zhang G, Rueter K, et al. ␤2-adrenoceptor
polymorphisms predict response to ␤2-agonists in children
with acute asthma. J Asthma 2008; 45:383–388
24 Carroll CL, Sekaran AK, Lerer TJ, et al. A modified pulmonary
index score with predictive value for pediatric asthma exacerbations. Ann Allergy Asthma Immunol 2005; 94:355–359
25 Carroll CL, Schramm CM. Protocol-based titration of intravenous terbutaline decreases length of stay in pediatric status
asthmaticus. Pediatr Pulmonol 2006; 41:350 –356
26 Carroll CL, Schramm CM, Zucker AR. Slow-responders to IV
CHEST / 135 / 5 / MAY, 2009
1191
␤2-adrenergic receptor agonist therapy: defining a novel
phenotype in pediatric status asthmaticus. Pediatr Pulmonol
2008; 43:627– 633
27 National Asthma Education and Prevention Program. Expert
panel report 3: guidelines for the diagnosis and management
of asthma. Bethesda, MD: National Heart, Lung and Blood
Institute, 2007; NIH publication No. 07– 4051
28 Kuczmarski RJ, Ogden CL, Grummer-Strawn LM, et al.
CDC growth charts: United States. Adv Data 2000; 1–27
29 Elbahlawan L, Binaei S, Christensen ML, et al. ␤2-adrenergic
receptor polymorphisms in African-American children with
status asthmaticus. Pediatr Crit Care 2006; 7:15–18
1192
Downloaded From: http://journal.publications.chestnet.org/ on 10/28/2014
30 Tsai HJ, Shaikh N, Kho JY, et al. ␤2-adrenergic receptor
polymorphisms: pharmacogenetic response to bronchodilator
among African American asthmatics. Hum Genet 2006; 119:
547–557
31 Guerra S, Graves PE, Morgan WJ, et al. Relation of
␤2-adrenoceptor polymorphisms at codon 16 and 27 to
persistence of asthma symptoms after the onset of puberty.
Chest 2005; 128:609 – 617
32 Choudhry S, Ung N, Avilia PC, et al. Pharmacogenetic
differences in response to albuterol between Puerto Ricans
and Mexicans with asthma. Am J Respir Crit Care Med 2005;
171:563–570
Original Research