17 th WORKSHOP ON THE DEVELOPMENTS IN THE

Transcription

Alma Mater Studiorum – University of Bologna
Doctorate School in Agricultural Sciences
Department of Agri-Food Science and Technologies
Department of Food Science
PROCEEDINGS
17th WORKSHOP ON THE DEVELOPMENTS
IN THE ITALIAN PHD RESEARCH
ON FOOD SCIENCE TECHNOLOGY
AND BIOTECHNOLOGY
edited by Massimiliano Petracci and Tullia Gallina Toschi
Cesena, September 19-21, 2012
17th Workshop on the Developments in the Italian PhD Research on Food Science Technology and Biotechnology
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 Honor Committee
Gianni Braghieri (President of “Polo Scientifico Didattico” of Cesena)
Giordano Conti (President of Ser.In.Ar.)
Giovanni Dinelli (Alma Mater Studiorum – University of Bologna)
Maria Elisabetta Guerzoni (Alma Mater Studiorum – University of Bologna)
Giovanni Lercker (Alma Mater Studiorum – University of Bologna)
Paolo Lucchi (Major of Cesena)
Bruno Piraccini (President of “Cassa di Risparmio di Cesena” Foundation)
Giuseppe Placucci (Alma Mater Studiorum – University of Bologna)
Organising Committee
Alma Mater Studiorum – University of Bologna
Alessandra Bendini
Alessandra Bordoni
Maria Fiorenza Caboni
Francesco Capozzi
Marco Dalla Rosa (Chairperson)
Achille Franchini
Tullia Gallina Toschi
Fausto Gardini
Andrea Gianotti
Luigi Grazia
Rosalba Lanciotti
Massimiliano Petracci
Gian Gaetano Pinnavaia
Pietro Rocculi
Maria Teresa Rodriguez Estrada
Santina Romani
Andrea Segrè
Lucia Vannini
Ser.In.Ar. Forlì-Cesena Soc.Cons.p.A.
Fabrizio Abbondanza
Nadia Molinari
Executive Staff
Federica Balestra
Francesca Danesi
Chiara Montanari
Gianfranco Picone
Vito Verardo
II
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 Coordinator Committee of the Italian PhD in
Food Science, Technology and Biotechnology
Gianpaolo Andrich – University of Pisa
Davide Barbanti – University of Parma
Marilena Budroni – University of Sassari
Claudio Cavani – University of Bologna
Silvana Cavella – University of Napoli
Francesca Clementi – Polytechnic University of Marche
Viviana Corich – University of Padua
Matteo Alessandro Del Nobile – University of Foggia
Marco Esti – University of Viterbo
Maria Grazia Fortina – University of Milan
Natale Frega – Polytechnic University of Marche
Vincenzo Gerbi – University of Turin
Marco Gobbetti – University of Bari
Mara Lucisano – University of Milan
Emanuele Marconi – University of Molise
Maria Ambrogina Pagani – University of Milan
Eugenio Parente – University of Basilicata
Marco Poiana – University of Reggio Calabria
Andrea Pulvirenti – University of Modena and Reggio Emilia
Alessandro Sensidoni – University of Udine
Maurizio Servili – University of Perugia
Angela Silva – Catholic University of Piacenza
Giovanni Spagna – University of Catania
Giovanna Suzzi – University of Teramo
Antonella Verzera – University of Messina
Bruno Zanoni – University of Florence
III
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 IV
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 Welcome note
Food innovation represents an ongoing challenge for researches, industries, policy makers, suppliers and
food chain managers. On the other side the consumers demand for good quality and tasty food but with
increasing nutrition and functionality following the more advanced research facts.
In this framework the ongoing researches carried out in the PhD programs, are placed at the highest
scientific level among the Italian academic research activities in food area on characterization, quality
evaluation, functionality of food and ingredients from both traditional and innovation sources. Advanced
and innovative technologies to improve food safety, food quality and its maintenance to prolong the
shelf-life, biotechnologies to increase nutrition and functional properties, highly efficient new analytical
methods, new packaging approaches and a view on food processing sustainability are topics on which the
PhD are involved and their researches are referred to.
The exchange of viewpoints and experiences on those highly qualified competences of the PhD students
results to be a key point to create the synergies needed to boot the development and the innovation in the
food science and consequently of the food industry sector.
Following this principle, around twenty years ago the Coordination of the Italian PhD programmes
promoted the establishment of an event to be organized on annual basis, hosted by different Universities
year by year, in order to put all the PhD students (and their tutors) in the food area at national level able
to present their research plans, activities and results in a national contest to meet scientists, industries and
stakeholders.
After fifteen years the organization of the Workshop on the Developments in the Italian PhD Research
on Food Science, Technology and Biotechnology is back to the University of Bologna and it is going to
be held in Cesena, hosted by the Campus of Food Science of the Scientific and Didactic Pole of Cesena,
where most of the research in Food Science belonging to the University of Bologna are carried out.
Thus, it is with a great pleasure that the undersigned President of the Organization Committee on behalf
of all the colleagues and co-workers involved in the Workshop organization, welcome you at this
essential event for the development of our new scientists and for improving our national researches.
Marco Dalla Rosa
Chairperson of the Organising Committee
V
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 VI
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 INDEX
3rd Year PhD Student Oral Communications ALBERIO Giuseppina Rosaria Antonella.......................................................................................................
Analytical and Enzymatic Investigations for the Assessment of Quality of Locally Caught Fresh Seafood of
Mediterranean
Tutor: Giovanni SPAGNA
3
AL-MOGHAZY Marwa....................................................................................................................................
Development of Antimicrobial Packaging Films
Tutor: Andrea PULVIRENTI; Co-tutor: Patrizia FAVA
8
AMENDOLA Danila ......................................................................................................................................... 13
Recovery of Phenolic Compounds from Winery By-Products and their Food Application
Tutor: Giorgia SPIGNO
BRUNETTI Lorenza ......................................................................................................................................... 18
Biotechnological Production of Vanillin using Microbial Cells
Tutor: Maurizio RUZZI
COSTANZO Angela .......................................................................................................................................... 23
Characterization of a New Donkey b-Lactoblobulin II Genetic Variant by Proteomic Approach
Tutor: Lina CHIANESE
COZZOLINO Carlo Alessio ............................................................................................................................. 28
Modulating the Release Properties of Active Compounds from Packaging Materials by a
Physicochemical/Nanotechnology Approach
Tutor: Antonio PIGA, Luciano PIERGIOVANNI; Co-tutor: Stefano FARRIS
DALL’ERTA Andrea ........................................................................................................................................ 33
Occurrence of Deoxynivalenol and Deoxynivalenol-3-Glucoside in Durum Wheat
Tutor: Gianni GALAVERNA
DE ANGELIS Elisabetta ................................................................................................................................... 37
Fate of Mycotoxins in Cereal Based Products and Assessment of their Bioaccessibility through an in vitro
Digestion Model
Tutor: Linda MONACI
DE BRUNO Alessandra .................................................................................................................................... 42
Variation of Antioxidant Compounds in Table Olives Submitted to Different Thermal Treatments
Tutor: Marco POIANA
DE PAOLA Eleonora Laura............................................................................................................................. 47
Study and Development of Fast Analytical and Instrumental Methods for Food Quality Control in Animal
and Vegetable Complex Matrices
Tutor: Andrea ANTONELLI, Domenico Pietro LO FIEGO; Cotutor: Davide GARBINI
DELLA VELLA Umberto................................................................................................................................. 52
Long-Term Impact of Farm Management and Crops on Soil Microorganisms
Tutor: Giovanna SUZZI; Co-tutor: Rosanna TOFALO
FERRARIO Chiara ........................................................................................................................................... 57
Lactococcus garvieae and Morganella morganii as Models to Study Safety and Quality of Fish Products
Tutor: Maria Grazia FORTINA
FUSELLA Giuseppe Christian ......................................................................................................................... 62
Development of Nanostructured Sensing Systems for Food Analysis
Tutor: Dario COMPAGNONE
GAMBACORTA Lucia ..................................................................................................................................... 65
Development and Validation of Biomarkers to Monitor Human and Animal Exposure to the Principal
Mycotoxins
Tutor: Michele SOLFRIZZO
VII
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 GRECO Donato ................................................................................................................................................. 70
Development of New Alimentary Additives and Evaluation of their Effectiveness to Reduce Human and
Animal Exposure to Mycotoxins
Tutor: Giuseppina AVANTAGGIATO
GUIDONE Angela ............................................................................................................................................. 75
Stress Response and Functionality of Lactobacillus plantarum: Genotypic and Phenotypic Aspects
Tutor: Eugenio PARENTE
HELAL Ahmed.................................................................................................................................................. 80
Interaction of Polyphenols with Milk and Casein: Nutritional Effects and Application Studies
Tutor: Angela CONTE
INTROZZI Laura.............................................................................................................................................. 85
Development of High Performance Biopolymer Coatings for Food Packaging Application
Tutor: Alberto SCHIRALDI
LI Fei................................................................................................................................................................... 90
Development of Nano-Material for Food Packaging
Tutor: Luciano PIERGIOVANNI; Co-tutor: Saverio MANNINO
MELI Federica................................................................................................................................................... 95
Poultry Industry Waste: Proteinaceus Hydrolizates as Growth Stimulator for Microorganisms Potentially
Probiotic
Tutor: Erasmo NEVIANI; Co-tutor: Camilla LAZZI
MOLINARO Stefano......................................................................................................................................... 100
Bio-based Food Packaging: Influence of Formulation and Processing on Functional Properties
Tutor: Alessandro SENSIDONI; Co-tutor: Joe KERRY
MONCALVO Alessandro ................................................................................................................................. 105
Screening of Lactobacillus spp. Related with the Biogenic Amines Production in Wine
Tutor: Angela SILVA; Co-tutor: Maria Daria FUMI
MORETTI Elio .................................................................................................................................................. 110
Development of Guidelines for Microbiological Control in Microbreweries
Tutor: Paolo FANTOZZI
NITRIDE Chiara ............................................................................................................................................... 115
Proteomic and Immunoassay Characterization of a New Food Allergen from Hazelnut (Corylus avellana)
Tutor: Pasquale FERRANTI
PANARESE Valentina ...................................................................................................................................... 120
Study of Traditional and Innovative Technologies for Minimally Processed Fruit and Vegetables Products
Tutor: Pietro ROCCULI
PANNELLA Gianfranco................................................................................................................................... 125
Interactions between Lactobacillus plantarum and Listeria innocua
Tutor: Elena SORRENTINO
PERPETUINI Giorgia....................................................................................................................................... 130
Selection of Lactic Acid Bacteria and Yeasts to be Used as Mixed Starter Cultures for Table Olive
Fermentation
Tutor: Aldo CORSETTI, Rosanna TOFALO, Hélène LICANDRO-SERAUT
PICARIELLO Gianluca ................................................................................................................................... 135
Advanced Applications of MALDI-TOF Mass Spectrometry in Food Lipidomics
Tutor: Francesco ADDEO
REMAGNI Maria Chiara ................................................................................................................................. 140
Biotechnological and Spectroscopical Evaluation of Selected Lactobacillus plantarum Strains with
Probiotic and Nutraceutical Potentialities
Tutor: Diego MORA; Co-tutor: Tiziana M.P. CATTANEO, Domenico CARMINATI
RUGGIERO Antonietta.................................................................................................................................... 145
Effects of SAR (Systemic Acquired Resistance) Inducers on Quality and Safety of the Grape Products
Tutor: Stefania IAMETTI; Co-tutor: Marcello IRITI
SBERVEGLIERI Veronica .............................................................................................................................. 150
Different Applications of the Electronic Nose in Coffee and Other Foodstuff
Tutor: Patrizia FAVA, Andrea PULVIRENTI
VIII
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 TAVERNITI Valentina ..................................................................................................................................... 155
The Role of Food and Probiotic Microorganisms, and Dietary Compounds in the Modulation of the Immune
Response
Tutor: Simone GUGLIELMETTI
TIBOLLO Simone ............................................................................................................................................. 160
Development of Protocols for the Detection of Caliciviruses
Tutor: Giuliano Ezio SANSEBASTIANO
VALENZANO Stefania ..................................................................................................................................... 165
Development and Validation of Rapid Methods for the Determination of Mycotoxins in Food Products
Tutor: Michelangelo PASCALE
VALLI Enrico .................................................................................................................................................... 170
Analytical Methods for Evaluating the Quality and the Genuineness of Olive Oils
Tutor: Alessandra BENDINI
ZAPPIA Angela.................................................................................................................................................. 175
Study of the Qualitative Parameters of Provola Cheese Submitted to Different Storage Systems
Tutor: Marco POIANA
2nd Year PhD Student Poster Communications
BIGNARDI Chiara ............................................................................................................................................ 183
Determination of Thermal Treatment Markers in Flours and Related Products by Capillary Electrophoresis
Coupled to Tandem Mass Spectrometry Tutor: Claudio CORRADINI BOTTESINI Chiara........................................................................................................................................... 185
Non Proteolytic Aminoacyl Derivatives in Parmigiano-Reggiano Cheese: Origin and Properties Tutor: Stefano SFORZA BOU ZEIDAN Marc .......................................................................................................................................... 187
Cell Wall Structure and Phenomic Analysis of a Saccharomyces cerevisiae Flor Strain Tutor: Severino ZARA CAFIERO Caterina ........................................................................................................................................... 189
First Assignement of the HRMAS-NMR Spectra of Golden delicious Apples for the Creation of a new
Analitycal Method to Verify the Maintenance of the Quality of Apples during Storage Tutor: Riccardo MASSANTINI; Co-tutor: Massimiliano VALENTINI CALDERA Lucia ............................................................................................................................................... 191
Detection and Characterization of Specific Spoilage Organisms (SSOs) in Different Food Matrices Tutor: Laura FRANZETTI CHESSA Luigi ................................................................................................................................................... 193
Influence of a Veterinary Antibiotic on the Structure and Function of Microbial Communities in Amended
Soils Tutor: Alba PUSINO CIMINI Alessio .................................................................................................................................................. 195
Cross-flow microfiltration of rough beer using a 0.8-μm tubular ceramic membrane Tutor: Mauro MORESI CIRILLI Marco ................................................................................................................................................. 197
Biochemistry and Molecular Analysis in Two Paradigmatic Mutant Variety of Apple and Olive Producing
High Content of Phenolics for Bio-Fortified Food Tutor: Rosario MULEO COI Annalisa...................................................................................................................................................... 199
Sequencing the Genome of Flor Strains for the Detection of Adaptation to Sherry-like Wines’ Biological
Aging Tutor: Marilena BUDRONI, Sylvie DEQUIN CUTZU Raffaela ................................................................................................................................................ 201
Molecular and Physiological Characterization of a β-Carotene Hyperproducing Mutant of Rhodotorula
glutinis Tutor: Ilaria MANNAZZU; Co-tutor: Marilena BUDRONI
IX
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 D’AGOSTINO Maria Francesca...................................................................................................................... 203 Antioxidant Activity of Wild and Cultivated Blackberry (Rubus ulmifolius Schott) from Calabria (Italy) Tutor: Angelo Maria GIUFFRÈ; Co-tutor: Vincenzo SICARI DAKAL Tikam Chand ...................................................................................................................................... 205
Zygosaccharomyces sapae: from Species Delineation to Mating-Type (MAT) Genes Characterization Tutor: Paolo GIUDICI DALL’ASTA Margherita ................................................................................................................................. 207
Quercetin-3-O-Glucuronide Affects Gene Expression Profile of M1 and M2a Macrophages Exhibiting AntiInflammatory Effects Tutor: Daniele DEL RIO DE FRANCESCO Giovanni ............................................................................................................................. 209
Brewing Processes Optimization for High Quality Alcohol-Free Beer Production Tutor: Giuseppe PERRETTI DE MARCHI Fabiola........................................................................................................................................ 211
Development of a Method for the Study of Grape Metabolomics Tutor: Riccardo FLAMINI DELLA CAMPA Marcello ............................................................................................................................... 213
Study for the Development of a Production Process to Obtain High Quality Bitter Orange Marmalade in a
Short Supply Chain Context Tutor: Stefania IAMETTI; Co-tutor: Tiziana Maria Piera CATTANEO DI CAPUA Marika ............................................................................................................................................ 215
Effect of Chestnut Extract Obtained by “Castagna di Montella” on the Viability of Potential Probiotic
Strains and Application to the Production of a Functional Chestnut Mousse Tutor: Maria APONTE FLORIO Paola................................................................................................................................................... 217
Natural Polyphenols: an “in vitro” Investigation on their Protective Role as Inhibitors of Amyloid
Formation by Human Transthyretin Tutor: Rodolfo BERNI FRIGO Francesca.............................................................................................................................................. 219
Biofilm-forming Ability of Staphylococcus aureus and Pseudomonas spp. of Food Origin Tutor: Michela MAIFRENI; Co-tutor: Marilena MARINO GABRIELLI Mario ........................................................................................................................................... 221 Chemical Markers for the Evaluation of Sensory and Antioxidant Properties of Wines
Tutor: Antonio TIRELLI GAROFALO Carmela ...................................................................................................................................... 223 Management of Microbial Resources for the Production of Typical Apulian Wines
Tutor: Giuseppe SPANO GLICERINA Virginia ....................................................................................................................................... 225 Physico-chemical and Microstructural Properties of Food Dispersions
Tutor: Santina ROMANI; Co-tutor: Federica BALESTRA GRASSI Silvia.................................................................................................................................................... 227 Lactic Acid Fermentation: Innovative Approach using NIR Spectroscopy
Tutor: Ernestina CASIRAGHI; Co-tutor: Roberto FOSCHINO GREPPI Anna.................................................................................................................................................... 229 Beneficial effects of yeasts in increasing the nutritional value of traditional African fermented food
Tutor: Luca COCOLIN, Lene JESPERSEN GUAZZOTTI Valeria ....................................................................................................................................... 231 Evaluation of Transference Capacity of Contaminants from Cellulosic Packaging and Innovative Approach
to Improve Food Contact Material Safety
Tutor: Sara LIMBO; Co-tutor: Luciano PIERGIOVANNI GUERRA Elena ................................................................................................................................................. 233 Improving of Bioactive Compounds in Dairy Commodities Produced in the Parmigiano-Reggiano Cheese
Area
Tutor: Maria Fiorenza CABONI; Co-tutor: Alessandro GORI HAMAN Nabil ................................................................................................................................................... 235 The Microbial Growth and Isothermal Calorimetry
Tutor: Dimitrios FESSAS X
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 LE GROTTAGLIE Laura ................................................................................................................................ 237 Evolution of Southern Red Wine Composition and Kinetics of Acutissimins and Oaklins Formation During
Accelerated Aging with Oak Chips or Oak Barrels
Tutor: Raffaele ROMANO MAZZEO Teresa ............................................................................................................................................... 239 Development of a composition database of gluten free products
Tutor: Nicoletta PELLEGRINI MIGLIORI Carmela Anna ............................................................................................................................... 241 Evolution of Chemical and Nutraceutical profiles of Vegetables Cultivated with Organic System
Tutor: Luigi Francesco DI CESARE MOTTA Silvia.................................................................................................................................................... 243 Study of The Influence of Native Molecules and of Some Additives on White Wines Evolution During
Storage. Individuation of the Conditions that Can Slow Down the Oxidative Aging in Bottled Wines
Tutor: Antonella BOSSO; Co-tutor: Antonio TIRELLI PANI Giovanna .................................................................................................................................................. 245 Search for Natural and Natural-Like Inhibitors of Trichothecene Biosynthesis by Fusarium
Tutor: Quirico MIGHELI; Co-tutor: Giovanna DELOGU PANOZZO Agnese............................................................................................................................................. 247 Effect of Pulsed Light on Selected Food Proteins
Tutor: Lara MANZOCCO PASSAGHE Paolo ............................................................................................................................................. 249 The Colloidal Stability of Craft and Gluten-Free Beers: an Assessment af Aspects Related ao Technology,
Composition and Analysis
Tutor: Stefano BUIATTI PORTARENA Silvia.......................................................................................................................................... 251 Authentication and Traceability of Italian Extravergin Olive Oils by means of Stable Isotopes Techniques
Tutor: Marco ESTI PRANDI Barbara............................................................................................................................................... 253 Simulated Gastrointestinal Digestion of Gluten: Assessment of Different In Vitro Models
Tutors: Stefano SFORZA, Gianni GALAVERNA RIMINI Simone.................................................................................................................................................. 255 Strategies for Improving Qualitative Characteristics of Poultry and Rabbit Meat
Tutor: Massimiliano PETRACCI ROVERSI Tommaso ......................................................................................................................................... 257 Delivery Behaviour in Simulated Model of Small Intestine of Co-Extruded Alginate Microbeads as Carrier
for Vitamin B12
Tutor: Laura PIAZZA SIROLI Lorenzo ................................................................................................................................................ 259 Use of Essential Oils for the Improvement of Shelf-life and Food Safety
Tutor: Rosalba LANCIOTTI; Co-tutor: Fausto GARDINI TANEYO SAA Danielle Laure ........................................................................................................................ 261 Use of Biotechnology to Increase the Content of Bioactive Compounds in Fermented Foods of Plant Origin
Tutor: Andrea GIANOTTI TESTA Bruno .................................................................................................................................................... 263 Isolation and Identification of Lactobacillus plantarum from Wines
Tutor: Massimo IORIZZO UBOLDI Eleonora ............................................................................................................................................. 265 Effects of Anoxic Storage on Beef Patties Quality
Tutor: Maria Ambrogia PAGANI; Co-tutor: Stefania IAMETTI, Sara LIMBO VALLI Veronica ................................................................................................................................................ 267 Healthy and Nutritional Improvement of Confectionery Products
Tutor: Alessandra BORDONI
ZAUPA Maria .................................................................................................................................................... 269 An in vitro Study on Nutritional Characteristics of Different Wheat Bran Fractions
Tutor: Nicoletta PELLEGRINI XI
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 1st Year PhD Student Dissertation Project
AYYAD Ziad...................................................................................................................................................... 273
Analytical and Sensory Characterization of Typical Extra Virgin Olive Oils Tutor: Tullia GALLINA TOSCHI BELLESIA Andrea ........................................................................................................................................... 275
Metabolism and Biological Effect of Food (Poly)phenols and their Metabolites in Human Tutor: Angela CONTE; Co-tutor: Davide TAGLIAZUCCHI BERGAMASCHI Valentina ............................................................................................................................. 277
Liking, Familiarity, and Neophobia in the Prevention of Child Obesity by Applying a new Educational
Program Tutor: Ella PAGLIARINI BONO Veronica................................................................................................................................................. 279
Recovery of Fibrous Fractions from Wine Industry By-Products and their Use in Baked Goods Tutor: Manuela MARIOTTI; Co-tutor: Mara LUCISANO BOSI Matteo ...................................................................................................................................................... 281
Recovery, Purification and Encapsulation Process of Bioactive Compounds from Agro-Food By-Products Tutor: Giorgia SPIGNO BOVO Federica.................................................................................................................................................. 283
Definition of Food Safety Criteria for Bacteria Food-Borne Pathogens in Ready to Eat Products Tutor: Gerardo MANFREDA; Co-tutor: Alessandra DE CESARE CAGGIANIELLO Graziano ............................................................................................................................ 285
Polyphasic Characterization of Exopolysaccharides Produced by Lactobacillus plantarum Tutor: Giuseppe SPANO CAPORASO Nicola ........................................................................................................................................... 287
Virgin Olive Oil and its Interactions During Cooking Tutor: Raffaele SACCHI CARBONE Katya.............................................................................................................................................. 289
Effect of Ozone Postharvest Treatment on the Oxidative Metabolism of Grapes for Wine Production Tutor: Fabio MENCARELLI; Co-tutor: Francesca CECCHINI CASANOVA Francesco Pio.............................................................................................................................. 291
Use of Probiotic Microorganisms for the Production of Cereal-based Functional Food Tutor: Maria Rosaria CORBO COSTANTINI Lara........................................................................................................................................... 293
Formulation of Functional Foods for Hypertensive and/or Affected by Metabolic Syndrome and Oxidative
Stress Subjects, using Chia Sprouts, Rich in Polyphenols and Omega-3 Fatty Acids, as a Main Ingredient Tutor: Nicolò MERENDINO D’ANTUONI Isabella........................................................................................................................................ 295
Optimization of PET Properties for the Packaging of Functional Oils Tutor: Raffaele SACCHI DE CANIO Paola............................................................................................................................................... 297
Yeasts Co-cultures to Enhance Aromatic and Nutraceutical Characteristics of the Wine and for Energetic
Recovery of Winery Wastes Tutor: Angela CAPECE DECIMO Marilù ............................................................................................................................................... 299
Bacterial Enzymatic Activities as Potential Markers for Assessing the Technological Properties of
(Un)Processed Milk Tutor: Ivano DE NONI DI TORO Maria Rosaria .................................................................................................................................. 301
Biodiversity of Dekkera/Brettanomyces in Apulian Wines: Isolation, Characterization of Representative
Biotypes and Assessment of Control Strategies Based on Management Biotechnological Resources Tutor: Giuseppe SPANO FASOLI Giuseppe ............................................................................................................................................. 303
Microbiological and Hygienic Aspects of Pecorino Abruzzese Cheese with Particular Emphasis on Yeasts Tutor: Rosanna TOFALO, Co-tutor: Giovanna SUZZI XII
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 FORMATO Dora ............................................................................................................................................... 305
Influence of pH on Malolactic Fermentation and Volatile Compounds in Some Typical Wines of South Italy Tutor: Luciano CINQUANTA FOSCHIA Martina ............................................................................................................................................ 307
Study and Development of New Functional Foods Containing Cereals Tutor: Donatella PERESSINI FRIONI Eleonora............................................................................................................................................... 309
Environmental Effects on Olive Fruit Phenolic Composition: Genomic, Proteomic and Metabolomic
Approaches Tutor: Rosario MULEO FUENMAYOR Carlos Alberto......................................................................................................................... 311
Electrospun Nanofibrous Membranes for Filtration of Selected Beverages Tutors: Saverio MANNINO, Matteo SCAMPICCHIO, Stella COSIO GIACOSA Simone ............................................................................................................................................. 313
Influence of the Chemical and Physical Characteristics and Microbiota of Fresh and Dried Grapes on the
Composition and Quality of Wines Tutor: Luca ROLLE GOZZI Giorgia .................................................................................................................................................. 315
Response Mechanisms of Food Spoilage and Pathogenic Microorganisms to Gas Plasma Treatments Tutor: Lucia VANNINI GRASSO Gerardo ............................................................................................................................................. 317
Engineered Bioprobes for the Identification of Chemical-Toxicological Hazards in Foods Tutor: Roberto DRAGONE, Chiara FRAZZOLI, Emanuele MARCONI IGNAT Alexandra ............................................................................................................................................. 319
Emerging Technologies for Safe, Healthy and Sustainable Fresh-Cut produce Tutor: Maria Cristina NICOLI; Lara MANZOCCO INCHINGOLO Raffaella .................................................................................................................................. 321
Study of the Effect of Minor Compounds on the Oxidative Stability and Physical Properties of Oil-in-Water
Emulsions and Food Emulsions Tutor: Maria Teresa RODRIGUEZ ESTRADA MANINI Federica .............................................................................................................................................. 323
Biotechnological Approaches to Develop Functional Ingredients Tutor: Maria Cristina CASIRAGHI MARCHIANI Roberta ...................................................................................................................................... 325
Application of Winery and Distillery By-Products for Innovative Functional Foods Production Tutor: Giuseppe ZEPPA MARCOLINI Elena........................................................................................................................................... 327
The FoodOmics Methodologies to Determine the Quality of Food and Nutrition Tutor: Elena BABINI MARSEGLIA Angela........................................................................................................................................ 329
Influence of Beans Origin and Processing on Cocoa Chemical Composition and Optimisation of Conditions
in Order to Increase the Content of Specific Functional Constituents Tutor: Augusta CALIGIANI, Gerardo PALLA MASCIA Ilaria................................................................................................................................................... 331
Development, Characterization and Shelf life of Artisanal Wheat Beer Tutor: Alessandra DEL CARO; Co-tutor: Costantino FADDA MAZZARRINO Giovanni................................................................................................................................. 333
Development of Biopreserving Solutions to Control Microbial Growth in Chilled Packaged Meat and Meat
Products Tutor: Antonello PAPARELLA; Annalisa SERIO MOUANNES Emilio .......................................................................................................................................... 335
Probiotic Features of Autochthonous Mesophilic Lactobacilli Tutor: Nicoletta Pasqualina MANGIA MUDALAL Samer............................................................................................................................................. 337
Farming and Processing Factors for Improving Technological, Sensory and Nutritional Properties of
Poultry Meat Tutor: Massimiliano PETRACCI
XIII
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012 PACIULLI Maria .............................................................................................................................................. 339
Vegetable Preservation Processing: Impact on Physico-Chemical Properties Tutor: Emma CHIAVARO
PEDAPATI S.C. Sri Harsha ............................................................................................................................. 341
Phytochemical-Rich Fractions Recovered from Wine-Making By-Products as Ingredients for New
Sustainable Fruit-Based Foods Tutor: Vera LAVELLI; Co-tutor: Paolo SIMONETTI
PIERINI Francesca ........................................................................................................................................... 343
The Sensory Quality of Food: Characteristics, Methods of Analysis, Typicality Markers, Consumers'
Preferences and Knowledge Tutor: Tullia GALLINA TOSCHI
PIOVESANA Alessia......................................................................................................................................... 345
Antimicrobial Active Packaging Applied on Food Matrices Tutor: Alessandro SENSIDONI; Andrea CERESER
PIZZONI Daniel ................................................................................................................................................ 347
Development of Analytical Methodologies for Process Analytical Technology in Food Industry Tutor: Dario COMPAGNONE
PUNZI Rossana.................................................................................................................................................. 349
Ultrasound-Assisted Extraction of Nutraceutical Substances from Vegetable Products and By-Products Tutor: Giuseppe GAMBACORTA QUARTIERI Andrea ........................................................................................................................................ 351
Bioactivation of Phytochemicals by Human Gut Microbiota Tutor: Maddalena ROSSI RAZZU Salvatorico ........................................................................................................................................... 353
Selection of Saccharomyces cerevisiae and non-Saccharomyces wine strains high producers of
mannoproteins Tutor: Zara SEVERINO SEGAT Annalisa................................................................................................................................................ 355
Application of non Conventional Treatments in Dairy Field Tutor: Nadia INNOCENTE UYSAL Ünalan İlke........................................................................................................................................... 357
Innovative Bionanocomposite Materials for Food Packaging Applications Tutor: Luciano PIERGIOVANNI VASILE SIMONE Giuseppe ............................................................................................................................ 359
Study Strategies for Valorization of Local Grapevine Cultivars of Emilia Romagna region Tutor: Cristina BIGNAMI, Andrea ANTONELLI VENDRAMINI Chiara ..................................................................................................................................... 361
Develop of Molecular Methods Based on Genome Analysis to Evaluate the Distribution of Enological
Characters in Populations of Wine Saccharomyces cerevisiae Strains Isolated in the Vineyard Tutor: Viviana CORICH ZAMBELLI Paolo ............................................................................................................................................. 363
Development of new Biocatalytic Processes for Fructooligosaccharides Production Tutor: Francesco MOLINARI ZAPPINO Matteo .............................................................................................................................................. 365
Graphene/Chitosan Nanocomposites for Food Enzyme Immobilization Tutor: Marco ESTI ZIVOLI Rosanna............................................................................................................................................... 367
Fate of Aflatoxins During Processing and Transformation of Tree Nuts Tutor: Michele SOLFRIZZO ZURLO Nicola ................................................................................................................................................... 369
Animal Nutrition and Milk Production in Dairy Chain Innovations of Marginalised Areas Tutor: Elisabetta M. SALIMEI
XIV
Alma Mater Studiorum - University of Bologna, Cesena, 19-21 September, 2012
rd
3 Year PhD Student
Oral Communications
-1-
-2-
Analytical and Enzymatic Investigations for the Assessment of Quality of
Locally Caught Fresh Seafood of Mediterranean
Giuseppina Rosaria Antonella Alberio (giusialberio@yahoo.it)
Dip. di Scienze delle Produzioni Agrarie e Alimentari (DISPA) Università degli Studi di Catania, Italy
Tutor: Prof. Giovanni Spagna
This work has as object the evaluation of the quality and freshness of a particular fish species widely distributed in
Mediterranean Sea: that of anchovies and sardines. The evaluation was also extended to a type of crustacean very
common in the waters of this sea: the pink shrimp. The analytical parameters studied are intended to identify the
level of impairment suffered by the product, the causes of that damage as well as some possible solutions to the
problem as an alternative to those established by years of research and consecrated by the scientific literature on the
topic.
Indagini analitiche ed enzimatiche per la valutazione della qualità
del pesce locale giornaliero del Mediterraneo
Questo lavoro ha come oggetto la valutazione della qualità e freschezza di una particolare specie di pesci
ampiamente diffusa nel Mediteraneo: quella delle alici e sardine. La valutazione si estende anche a un tipo di
crostaceo molto frequente nelle acque di questo mare: il gambero rosa. I parametri analitici studiati hanno lo scopo
di individuare il livello di alterazione subito dal prodotto , le cause che lo hanno provocato nonché alcune possibili
soluzioni al problema in alternativa a quelli consolidati in alternativa a quelli consolidati da anni di ricerca e
consacrati dalla letteratura scientifica sull’argomento.ù
Key words: Anchovie (E. Engrasilocus), Sardine (S. Pilchardus), Parapenaeus Longirostris, freshness,
frozen/thawed.
1. Introduction
The Mediterranean is one of the richest seas in the world for the presence of millions of species of fish, including bone
and cartilage which fully comply with current nutritional trends. In recent years it has increasingly highlighted the
importance of economic, commercial and nutritional consumption of freshly caught fish available daily in the fish
markets of the area and sold as minimally processed products . In the Gulf of Catania, the main sefood local daily are
represented by species of small blue fish like sardines (S. pilchardus) and anchovy (E. Engrasilocus) and a particular
type of shellfish species represented by the pink shrimp (Parapenaeus longirostris). These products present regarding
the economic, nutritional and commercial property important characteristics. The blue fish (anchovies and sardines) is
characterized by a composition of fats rich in unsaturated compounds (ω3-ω6) that improve blood fluidity and prevent
cardiovascular disease (Daviglus et al., 1997; Alberio et al., 2012a; Allegra et al. 2012). This nutritional composition
is influenced by conditions of the marine ecosystem (38-39% salinity of the sea; average temperatures between 1224°C), period (winter and summer) and method of capture craftsmanship. This is done with encircling nets (purse
seines) through the use of light sources (lampare) which give the meat of these species peculiar qualitative
characteristics . In fact, once captured these species suffer death by decapitation due to the continuous attempt to
escape that results in post-mortem, in high blood levels that give the muscles of the species precious qualitative and
sensory characteristics (Alberio et al. 2012b ). With regard to species of pink shrimp (Parapenaeus Longirostris) it
presents from the nutritional point of view the same characteristics with the exception of the high in cholesterol
content found mostly in the non-edible portion (the pereion). The capture and the period of capture with purse seine
nets permits daily availability both for the consumer, and to the transformation of innovative products minimally
processed( Alberio et al. 2012e). The reference standard of seafood local daily is very complex (Sciacca et al., 2011)
and seeks to protect the fundamental elements that influence consumer choice. These fish products, in fact, being
consumed fresh, undergo various problems such as physical trauma that determine the onset of microbic flora on the
skin, gill and intestine due to micro-organisms (Jiang et al., 1990; Koohmaraie, 1996; Koutsoumanis and Nychas,
1999). These microorganisms, disappeared natural defenses of the fish and solved the rigor mortis, are able to multiply
actively and invade the tissues with the ability to release proteolytic enzymes (calpains) and autocatalytic (Aoki et al.,
1997). These alterations, catalyzed by enzymes, cause a rapid decay of the sensory and nutritional quality OF products
which inevitably results in a reduction of the shelf-life of the same. Another problem to which these fish undergo is the
hydrolysis of structural proteins substances, lipids and phospho-lipids and their subsequent oxidation with enzymes of
the lipoxygenase pathway (LOX) and in some cases by polyphenol oxidase (PPO), whose final result is the alteration
of color, the development of off-flavors, loss of consistency, which make the fish not attractive from the sensory point
of view. Unlike, one of the main problems crustaceans face is melanosis correlated to the different phases in intermuta.
Numerous studies aim to reduce the effects of using a wide range of inhibitor treatments (Buta and Moline, 2001;
(Walker, 1977). (Liao et al., 1988). (Whitaker, 1972; Otwell and Marshall, 1986; Chinivasagam et al., 1998). And it is
-3-
shown the effectiveness of the treatments is influenced by the type of the species of the crustacean and the stages of
intermuta to which they face (Leung et al. 1996; Alberio et al., 2012c; Barbagallo et al 2012 a,b).
2. Materials and Methods
Different sets of samples of seafood local daily were collected, captured and analyzed, in particular:
1) 114 Anchovies (E. Engrasilocus) captured directly from the Italian ships with night fishing with encircling nets
(purse seines);
2) 122 Sardine (S. pilchardus) caught directly from the Italian ships with night fishing by seine;
3) 92 commercial anchovies (E. Engrasilocus);
4) 92 commercial Sardine (S. pilchardus);
5) 101 Pink Shrimp (Parapenaeus longirostris) captured directly from the Italian ships with night fishing by
trawlers.
Immediately after the fishing the samples were placed in tanks with salt water and ice to reach thermal shock. The
determination of total protein was carried out with the method proposed by Bradford (1976); According to the
method developed by Ho et al. (1999) has been carried out the determination of calpain and cathepsin. In order to
verify the freshness of the commercial samples was carried out the determination of alfa-glucosidase, B-GAL, BNA in accordance with the method of Duflos et al. (2002) and Sozzi et al. (1996). Sensory analysis in accordance
with the method of Antrade et al. (1997) and Yoshioka and Kitamikadom (1983). Statistical processing of data was
performed using the program STATISTICA (ver. 6.1).
3. Results and Discussions
3.1 Verification of freshness index
The morphological-biometric reliefs on samples analyzed immediately after capture, allowed to highlight that the
average weight of the types of fish analyzed did not show significant differences. The average weight of anchovy
was around 23 g (22.8 g min - max 30.0 g) of the sardines was around 25 g (23.4 g min - max 30.0 g), average
length of anchovies 6-9 cm, sardines 10-15 cm. It was observed that on 60 anchovies, more than half (35) showed
post-mortem trauma from capture, otherwise only 15 samples of sardines showed stress from capture. This
difference among interspecies could be due to increased tissue fragility of anchovies. Overall, the samples had
injuries charged to external skin, fins and head (eye-operculum area). In particular, such damage in the samples of
anchovies were represented by obvious blood suffusions around the eye, obvious mutilation of the rear fins and in
some samples of the entire head. In sardines there were obvious cuts and bruises in the head and 4 samples had at
the time of the process of gutting, broken vertebra. Such damage would be caused by crowding of fish around the
net and their repeated attempts to escape capture. Through the measure of the parameter of pH it is possible to
estimate the state of stress to which the fish has been subjected to at the moment of capture, and in a muscle just
cut, also provides a useful method for estimating levels of lactic acid released and then the variations pH and
acidity. In the literature, the average values of pH of sardines and anchovies are respectively 6.11 and 6.18 (Sigholt
et al., 1997).
In order to monitor this phenomenon in association with stress from capture was analyzed the activity of proteolytic
enzymes such as calpain. Figure 1 shows the evolution of the activities of calpain on freshly caught product. The
sardines had significantly higher values of activity compared with anchovies, no significant differences in activity
were observed on the product under stress from capture. At the beginning of the experiments both anchovies and
sardines have presented Quality index (QI) very low which was followed by a rapid increase across the Entire
period of storage. This has allowed us to classify both samples belonging to the EXTRAcategory that is as fresh
product (Regulation n.2406/96/CEE). The process of conservation of anchovies instead determines a considerable
increase in the IQ already after 7 days of storage which corresponds to an apparent loss of gloss of the skin,
presence of turbid mucus or eye totally opaque. These visual and sensory evaluations were further expanded by
more detailed analysis of skin color, eye, and the process of bleeding (Alberio et al., 2012b).
The skin of anchovy subjected to color analysis bilocalizzata before and during the preservation process, confirmed
the values obtained for IQ and reduced opacity, after freezing, it is associated with visible changes in skin color
straw yellow around to 21 days. The eye subjected to further analysis according to the method of Yoshioka et al.
(1983), confirmed the data of IQ is that for anchovies, sardines.
3.2 Activities of enzymatic
Furthermore, the fillets of anchovies and sardines have been characterized with respect to lysosomal-enzyme
activities (AG, B-GA, B-NA) in both the fresh product and the frozen product. The AG increases more in sardines
and less in the anchovies, the B-GA, on the contrary, it is not useful to differentiate fresh fish from frozen with
regard to the sardines, while for the anchovies is useful. Instead AG allows to distinguish in both species, the fresh
product from frozen. The B-GA could be used as a marker of freezing occurred only for the anchovies, while you
could use the AG for sardines. So the AG confirms the data in literature, because you appreciate his remarkable
increase regardless of species (Figure 1)
-4-
Figure 1 Evolution of the enzymatic activity lysosomal.
The main conclusions to be drawn are as follows: PPO activity tended to decrease in both processed products
compared to the fresh product, in terms of specific activity, the process of marinating inhibited PPO activity more
intensely than the product simply treated with citric acid (100% reduction in the anchovies, 39.6 and 59.02% for
sardines, respectively, at T2 and T3), the lowest activities were found the 2nd day of cold storage for anchovies and
in respect of sardines, in terms of exclusive treatment with citric acid, minimal activity was found for sardines
marinated in 3rd day of cold storage, the maximum in correspondence of T2. Ultimately, the determination of PPO
can not be used as an "index of freshness" to discriminate between fresh and thawed fish, but it is well suited as an
index of freshness of processed fish products. This enzymatic parameter is studied in different species of fish
compared with anchovies and sardines, especially in crustaceans, which are more sensitive to oxidation.
Phenomenon related to it and alteration of pH is also the so-called "gaping" which consists in breaking of the fish
fillets (Figure 2).
-5-
Figure 2 Evolution of the enzymatic activity of calpain on freshly caught product (s anchovie.: Anchovie stress; sardines s.:
Sardines stress).
4. Conclusions and Perspectives
This study, therefore, allows the following conclusions: Fishing with handicraft systems (purse) to capture the blue
fish in the Mediterranean Sea is quite suitable for the preservation of the status of this type of fresh fish in the long
term. The analyzes made have shown in anchovies and sardines a series of indices that demonstrate that the stress
undergone by the species with this type of capture is normal and does not damage the subsequent operations of
conservation. This on the one hand protect the interests of consumers of the products of the Mediterranean
environment and opens a debate on the need to increase and preserve up to this type of fishing than the industrial
one by providing the most appropriate economic and regulatory instruments.
5. References
Alberio GRA, Giuffrè I, Sciacca AM, Spagna G (2012a) "Supplements blue" omega three in the Mediterranean: a valuable aid for
the "scavengers" of our body. Submitted to the Journal Eurofishmarket.
Alberio GRA, Barbagallo RN, Todaro A, Bono G, Spagna G (2012b) Use of lysosomal enzymatic activity for the differentiation
of fresh small blue fish (anchovies and sardines) from frozen and thawed ones. Submitted to Meat Science.
Alberio GR.A., Spagna G (2012c) The role of tyrosinase in matrices of animal and vegetable origin. Submitted Meat Science.
rewie.
Alberio GRA, Todaro A, Spagna G (2012d ) Correlazione tra indici di freschezza e tecniche di pesca artigianali (a cianciolo) di
specie di pesce azzurro (E encrasicolus, S pilchardus). Submitted to congress AISSA.
Alberio G.R.A, Todaro A., Spagna G., Allegra V, Zarbà S. (2012e) The market for alternative species of shrimp processe to
increase the shelf-life. 5th Shelf Life International Meeting & Workshop on Food Packaging Safety Changwon
Convention Center, Changwon, South Korea.
Allegra V, Zarbà S., Alberio G. R. A., Spagna G., Bono G. (2012) The implications on the "shelf life" of international trade
flows of shrimp in Italy. 5th Shelf Life International Meeting & Workshop on Food Packaging Safety Changwon
Convention Center, Changwon, South Korea.
Antrade A, Nunes ML, Batista I (1997) Freshness quality granding of small pelagic species by sensory analysis In: G
Olafsdottottir and others (eds) Methods to determine the freshness of fish in Research and Industry; Proceedings of the
Final Meeting of the concerted Action Evalutation of fish Freshness" AIR3CT942283 Nantes Conference, Nov 12-14,
International Institute of Refrigeration Paris, France, P333.
Barbagallo R.N, Alberio G. R. A., Spagna G. (2012a) Preservation of pink shrimp (Parapenaeus longirostris Lucas, 1846) from
tyrosinase activity assayed in vitro with some melanosis inhibitors. In Proc.s of the 5th Shelf Life International Meeting &
Workshop on Food Packaging Safety, Changwon Convention Center, Changwon, South Korea.
Barbagallo R.N, Alberio G. R. A., Spagna G. (2012b) Tyrosinase change in ready-to-use marinades anchovies (Engraulis
engrasicolus (Sardina pilchardus ). In Proc.s of the 5th Shelf Life International Meeting & Workshop on Food Packaging
Safety, Changwon Convention Center, Changwon, South Korea
Bradford, M (1976) A Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle
of protein-dye binding. Anal Biochem 72: 248-254.
Buta JG, Moline HE (2001) Prevention of browning of potato slices using polyphenoloxidase inhibitors and organic acids. J
Food Qual 24: 271-282.
Chinivasagam HN, Bremner, HA, Thrower, SJ, Nottingham SM (1998) Spoilage pattern of five species of Australian prawns:
deterioration is influenced by environment of capture and mode of storage. J Aquat Food Prod 5: 25-50.
Daviglus ML, Stamler J, Orencia AJ, Dyer AR, Liu K, Greenland P, Walsh MK, Morris D, Shekelle RB (1997) Fish consumption
and the 30-year risk of fatal myocardial infarction. N Engl J Med 336: 1046-1053.
Duflos G, Le Fur B, Mulak V, Becel P, Malle P (2002) Comparison of methods of differentiating between fresh and frozenthawed fish or fillets. J Sci Food Agric 82: 1341-1245.
Ho ML, Chen GH, Jiang ST (1999) Effects of mackerel cathepsins L and L-like, and calpain on the degradation on mackerel
surimi. Fish Sci 66: 558-568.
Jiang ST, Wang YT, Gau BS, Chen CS (1990) Role of pepstatin-sensitive proteases on the postmortem changes of tilapia
-6-
(Tilapia nilotica X Tilapia aurea) muscle myofibrils. J Agric Food Chem 38: 1464-1468.
Koohmaraie M (1996) Biochemical factors regulating the toughening and tenderization process of meat. Meat Sci 43: 193-201.
Koutsoumanis K, Nychas GJ (1999) Chemical and sensory changes associated with microbial flora of mediterranean boque
(Boops boops) stored aerobically at 0, 3, 7, and 10°C. Appl Environ Microbiol 65: 698-706.
Liao ML, Seib PA (1990) A stable form of vitamin C: L-ascorbate 2-triphosphate synthesis, isolation, and properties. J Agric
Food Chem 38: 355-366.
Leung P, Chow W, Duffey S, Kwan H, Gershwin M, Chu K (1996) IgE reactivity against a cross-reactive allergen in crustacean
and mollusca: evidence for tropomyosin as the common allergen. J Allergy Clin Immunol 94: 882-890
Otwell WS, Marshall MR 1986 Report of the Florida Sea Grant Screenin alternatives to sulphiting agents to control shrimp
melanosis (black spot). Tech Paper 46: 1-10.
Sciacca AM, Alberio GRA, Belfiore M, Arena E, Fallico B (2011) Guida alla normativa nel settore ittico. Submitted to Ind.
Alimentari.
Sigholt T, Erikson U, Rustad T, Johansen S, Nordvedt TS, Seland A (1997) Handling stress and storage temperature affect meat
quality of farmed-raised atlantic salmon (Salmo salar). J Food Sci 62: 898-905.
Sozzi GO, Cascone O, Fraschina AA (1996) Effect of a high-temperature stress on endo-mannase and a and galactosidase
activities during tomato fruit ripening. Postharvest Biol Technol 9, 49-63.
Ueno RT (1997) Involvement of cathepsins B and L in the post-mortem autolysis of mackerel muscle. Food Res Int 30: 585591.
Walker JRL (1977) Enzymatic browning in foods Its chemistry and control. Food Tech NZ 12: 19-25.
Whitaker JR (1972) Polyphenol oxidase. Principle of enzymology for the food sciences, pp. 571-582
Yoshioka K, Kitamikado M (1983) Differentiation of freeze–thawed fish from fresh fish by the examination of medulla of
cristalline lens. Bull Jpn Soc Sci Fish 49:151-154.
-7-
Development of Antimicrobial Packaging Films
Marwa Al-Moghazy (marwa.almoghazy@unimore.it)
Dept. of Agriculture and Food Science, University of Modena and Reggio Emilia, Italy
Tutor: Prof. Andrea Pulvirenti; Co-Tutor: Prof. Patrizia Fava
This PhD thesis is focusing on development of different kinds of possible active edible and non edible packaging
material, and enhancing their antimicrobial properties by incorporation of different antimicrobial agents and
applying them to different food systems. Alginate was used to perform an instant edible coating incorporated with
essential oils. On the other part of this study, poly venyle alcohol (PVOH) polymer used as base to form the non
edible films after crosslinked by using polycarboxylic acid. Producing PVOH antimicrobial films were established
in combination with silver nano paricles and allyl isothiocyanate (AIT).
Sviluppo di films imballaggi antimicrobici
Questa tesi di dottorato è incentrata sullo sviluppo di diversi tipi di imballaggi attivi edibili e non edibili.Atta a
migliorare inoltre le loro proprietà antimicrobiche per incorporazione di diversi agenti antimicrobici e la loro
possibile applicazione ai sistemi alimentari diversi. L’alginato è stato utilizzato per eseguire un rivestimento
commestibile istantaneo incorporato con oli essenziali. Nella seconda parte di questo studio, il polivinalcol (PVOH)
polimero usato come base per formare i film non commestibili dopo verranno reticolati con acido policarbossilico.
Produrre film PVOH antimicrobici sono stati stabiliti in combinazione con l'argento nano paricles e allil
isotiocianato (AIT).
Key words: Antimicrobials, food packaging, edible coating, essential oils, PVOH, silver nanoparticles, AIT.
1. Introduction
In accordance with the PhD thesis project previously described (Al-Moghazy, 2011), this oral communication
reports the main results of the following activities aimed to
(A1) Preparing of antimicrobial edible caoting and studying the effect of adding different gums and using
different crosslinking agents on its antimicrobial activity;
(A2) Applying the antimicrobial coating to fresh refregerated chicken meat into brolong its shelflife;
(B1) Producing of PVOH film crosslinked with polycarboxylic acid as GRAS crosslinking agent;
(B2) Enhancing the antimicrobial activity of PVOH by incorboration of silver nano particle and allyl
isothiocyanate (AIT);
(B3) Applying PVOH-AIT film to past felata cheese to brolong its shelflife.
2.1 Preparing of antimicrobial edible coating and studying the effect of adding different gums and using
different crosslinking on its antimicrobial activity
Preparation of edible coatings: the polysaccharide solutions was prepared by dissolving of 2.4 gm sodium alginate
(Sigma Aldrich) alone or in combination of 0.5 gm of arabic gum or guar gum in 100 ml of distilled water then
sterilized it by autoclave for 15 min at 121°C (Pranoto, 2005). After coaling concentrations of 0.2 and 0.4% (v/v) of
oregano and clove essential oils (according to MIC was studied before by Al-Moghazy, 2011) were add to solution
and mixed for 2 min using magnetic stirrer, then 40 ml of solution were spread on glass surface and then the instant
cross linking performed using different solutions of crosslinking agents including CaCl2 10%, CaCl2 30% and
calcium pantathonate 20% (w/v) were using to perform the instant crosslinking of the edible coating film.
Antimicrobial activity of different edible coating films incorporated with essential oregano and clove essential oils
against broad spectrum of microorganisms including gram negative and gram negative pathogens bacteria , yeast
and mould, by using the over layer method (Cutter, 1999). The thinking of films was measured using a digital
micrometer (model CDJAAB15, Borletti-LTF S.p.A., Antegnate, Bergamo, Italy) five random points along the
surface of each film.
Availability of active compounds in the edible coating films was measured by determination of total polyphenolic
compounds released from the film. According to the method of Oussalah et al. (2006) with limited modifications, 1
gm of each film sample was placed in 12.5 ml of ethanol 96% and kept under shaking at room temperature for 30
min, and the extract was then filtered through filter paper No.1 (Whatman International Ltd., Maidstone, UK). The
total phenolic compounds in each film extract were determined according to the Folin-Ciocalteu procedure.
2.2 Applying the antimicrobial coating to fresh refrigerated chicken meat into prolong its shelf life
Applying of the edible coating in fresh meat chicken (Lu et al., 2010): 40 ml of plain alginate solution or
incorporated with oregano essential oil at concentrations of 0.3 and 0.4% v/v were spreaded on half entire chicken
-8-
breast meat using syringe then 10 ml of CaCl2 10% were sprayed to perform instant reticulating on the meat
surface, then the chicken samples were packed in XPS CX321 trays and sealed with PVC stretch film (Coopbox,
Reggio Emilia), then all samples were stored at 4oC and evaluated for its microbiological quality by counting of
total mesophilic bacteria, Coliform, Pseudomonas spp, and Brochothrix thermosphacta.
2.3 Producing of PVOH film crosslinked with polycarboxylic acid as GRAS crosslinking agent
Preparation of PVOH film: An heterogeneous mixture composed of PVOH (3.90 g) and deionised water (30 mL)
was obtained by mixing the substances inside a glass beaker. Once covered with an aluminium foil to avoid
contaminations, the beaker was placed into an autoclave at 120°C for 30 min (Del Nobile, et al 2003). After cooling
under stirring at room temperature, 7.20 % (wt/wt of PVOH) of PEG was added to the obtained solution. On
complete solubilisation, PVOH and PEG were crosslinked for 2 h by first adding 0.44 g of citric acid and,
immediately after, 1 mL of concentrated hydrochloric acid. A known amount of the final solution was cast onto a
Petri dish and dried in the air for 48 h. Thinking, transparency, and mechanical properties for the PVOH were also
measured.
2.4 Enhancing the antimicrobial activity of PVOH by incorporation of silver nano particle and allyl
isothiocyanate (AIT)
PVOH- silver nanoparicle film was preparing by adding 0.5mM and 1mM of AgNo3 to the PVOH solution after
adding crosslinking agents in presence of 1mM ascorbic acid as a reduction agent and 2mM sodium citrate as
stabilizer, presence of silver nanobarticles in the film were detected using SEM and X-ray spectrum (Djokić, 2008;
Khan 2011).
Antimicrobial activities of the films were tested against bacteria, yeast and moulds by using broth dilution method.
One, 2, and 3 straps (0.5x3cm) of each film in tubes containing 10 ml of nutrient broth the inoculated with different
cultures to achieve 107 cfu/ml for bacteria and 105 for yeast and mould as final concentrations and measure the OD
at 600 nm frequently (Ye et al., 2008)
PVOH-AIT antifungal film was preparing by adding allyl isothiocyanate (AIT) (Sigma-Aldrich) in concentrations
of 1, 1.5 and 2 % to PVOH solution after adding the crosslinking agents. For antifungal activity flasks, square
pieces of each film (5.5x3cm) were add to flasks containing 50 ml of Sabouraud broth and then incubated at 27o C
for 3 days then the dry weight of mycelium was measured.
2.5 Applying PVOH-AIT film to past felata cheese to prolong its shelf life
Similar discs of pesta filata cheese was covered with the different films and then placed in Petri dishes and store at
4o C for 30 days with counting of yeast and moulds on Rose Bengal media, and total mesophilic bacteria. All,
microbiological analysis was continue until visible growth of fungi has appeared.
2.6 Statistical analyses
Statistical analysis was conducted using Microsoft® Office xlstate 2007. One-way analysis of variance (ANOVA)
was used to compare significant differences between treatments (P<0.05).
3. Results and Discussion
3.1 Preparing of antimicrobial edible coating and studying the effect of adding different gums and using
different crosslinking on its antimicrobial activity
Calcium ion is curtail to have reticulation of alginate coating, but high concentrations of calcium ions in
crosslinking solutions causing in bitterness of the coating film and that may affect the sensory properties of the
coated food, so different concentrations and sources of calcium ions were used. Using of CaCl2 10% and calcium
pantathonate 20% reduced the coating film bitterness but also reduced the antimicrobial activity of alginate film
incorporated with essential oils specially in lower concentrations of essential oils (date are not shown), Oregano
essential oil was the most essential oil that able to keep its antimicrobial activity with all alginate films and with
lower concentrations of CaCl2 10%. On the other hand using of calcium pantathonate 20% caused in completely
losing of the antimicrobial activity of all alginate – essential oils films, these results drove us to continue the further
studies with just oregano essential oil. Alginate blended with Arabic gum film and incorporated with oregano
essential oil was tended to lose antimicrobial effect more than alginate alone or alginate blended with guar gum
especially in lower concentration (0.2%) (Table 1). Availability of active compounds measured as total phenolic
compounds (Figure 1) were affected by difference in reticulation solutions, calcium pantathonate 20% cased in high
reduction in total phenolic compounds availability and also the thinking of the different films (Figure 2) and that
may explain the reduction of antimicrobial activity, as no significant difference between thinking in alginate film
and alginate+Arabic gum crosslinked with CaCl2 30% (P>0.05), while the reduction of total phenolic compound in
alginate+ Arabic gum film was significantly higher, and that may due to the presence of Arabic gum which caused
more weakness in crosslinking and loosing the essential oil during casting.
-9-
Kind of film
L.innocoua
S. typhimurium
S. cerevisiae
P .anomala
Alginate
T1
24.5±0.53
T2
24.7±1.16
T1
27.5±1.20
T2
25.7±0.46
T1
58.5±7.91
T2
37.5±26
T1
25.7±0.89
T2
25.5±0.53
Alginate+arabic gum
25.5±0.58
0.0±0.0
25.7±0.50
0.0±0.0
0.0±0.0
0.0±0.0
25.0±0.0
0.0±0.0
Alginate+ guar gum
26.5±0.58 25.5±0.58 26.5±0.58 26.0±0.82 41.2±2.5 25.0±0.0 25.75±0.96 26.5±0.58
Table 1 Effect of different crosslinking solutions and adding of different gums on antimicrobial activity of alginate film
incorporated with 0.02% oregano essential oil where T1; CaCl2 30% and T2; CaCl2 10%, * clear zone around the film squires
in mm)
Figure 1 Availability of total polyphenolic compounds
from different alginate films containing 0.2 % oregano
essential oil crosslinked with different calcium solutions.
Figure 2 Thinking of different alginate films containing 0.2
% oregano essential oil and crosslinked with different
calcium solutions.
3.2 Applying the antimicrobial coating to fresh refrigerated chicken meat into prolong its shelf life
Since calcium chloride solutions 10% has given good cross-linking properties without notable bitterness it was
chosen as cross-linking agent, on the other hand the only antimicrobial substance that kept its efficacy with this
formula was the oregano essential oil at all tested concentrations. Chicken fresh breast meat were treated with
alginate coating containing oregano essential oil at concentrations of 0.3% and stored at 4°C for 10 days and
regularly analyzed for total mesophilic, Enterobacteriaceae, Pseudomonas sp., Psychotropic bacteria, Brochothrix
thermosphacta and lactic acid bacteria. Adding oregano essential oil to alginate coating reduced the counts of all,
no significant (p>0.05) different between both concentrations of oregano essential oil in reduction of total
mesophilic, Enterobacteriaceae, Pseudomonas sp., Psychotropic bacteria, Brochothrix thermosphacta (Figure 3).
Figure 3. Effect of alginate – oregano coating on total mesophilic counts in fresh chicken meat refrigerated at 4oC.
After 5 days of cold storage the mesophilic count reached to the unsatisfactory limits (>107) in chicken samples
without coating or coated with plain Alginate while samples coated with alginate incorporated with oregano
essential oils in both concentrations have been used recorded this count in the 8th day of storage.
3.3 Producing of PVOH film crosslinked with polycarboxylic acid as GRAS crosslinking agent
PVOH film has a thinking of 0.6 ±0.1 mm, almost completely transparent to visible radiation. By comparing the
mechanical properties of the two types of film produced, obtained also for the film devoid of PEG according to the
above-mentioned method, it is possible to note that the presence of PEG corresponds to a remarkable increase of
elastic modulus of the material (and therefore of its rigidity), with a slight increase of tensile strength and a slight
decrease of elongation at break, in confirmation of a more effective crosslinking (Table 2).
- 10 -
Young’s modulus
(MPa)
Tensile strength
(MPa)
Elongation at break (%)
Dry film, with PEG
1077,86 ± 307,60
77,23 ± 8,49
157,94 ± 41,85
Dry film, without PEG
494,58 ± 101,63
70,43 ± 7,31
162,38 ± 17,63
Wet film, with PEG
2,92 ± 0,84
3,96 ± 0,75
169,13 ± 29,27
Wet film, without PEG
2,40 ± 0,44
5,47 ± 0,63
216,13 ± 22,41
Table 2 Mechanical properties of the dry and wet PVOH-based film, containing PEG Data are means ± SD (n = 10).
3.4 Enhancing the antimicrobial activity of PVOH by incorboration of silver nano particles and allyl
isothiocyanate (AIT)
Adding silver ions to the PVOH film enhance the antibacterial activity of the film against both Gram positive
(Listeria innocoua) and Gram negative bacteria (Salmonella typhimurium) (Fig. 4). Otherwise PVOH- silver
nanoparicles film didn’t show a reasonable activity against yeast or moulds.
A
B
Figure 4 Antimicrobial activity of PVOH-silver citrate film (1mM AgNo3) against (A) Listeria innocua and (B)Salmonella
typhimurium in different concentrations of films, where 1, 2 and 3 is the number of film straps in the tubes.
Figure 5 illustrates PVOH-Silver nanoparicls as appeared under scaning electronic microscope (SEM), also silver
ions was detected in the film by X-ray spectrum. Sizes of nanoparicles were ranged between 130-150nm.
On the other hand PVOH-AIT film showed a very strong antifungal activity against Aspergillus niger and
Penicullium roqueforti (Fig. 6).
- 11 -
Figure 5 SEM Image and X-ray
spectrum of PVOH – silver
nanoparicle film.
Figure 6 Antifungal activity of
PVOH incorporated with different
concentrations of AIT against
Aspergillus niger and Penicilium
roqueforti.
3.5 Applying PVOH-AIT film to past felata cheese to prolong its shelf life
The application of AIT in the food industry has been limited because of AIT’s poor water solubility volatility. Both
these obstacles can be overcome by using AIT inside PVOH film
Applying of PVOH-AIT film to pesta filate cheese: PVOH containing AIT at concentrations of 1 and 1.5% can
prolong the shelf life of cheese for 1 week more than the control samples without visible mould growth while PVOH
containing AIT at concentrations of 2% can prolong the shelf life for 2 weeks more than control samples Also there
was a significant reduction in yeast count in cheese samples covered with PVOH-AIT films along the storage period
of 21 days for films with 1 and 1.5% AIT and 30 days for film with 2% AIT, while no significant effect on the total
mesophilic counts (p<0.05)
Figure 7 Effect of PVOH-AIT films on the total yeast count in pasta filata cheese date bars are ± SD.
4. Future Perspectives
This study has paid more attention for the applied sector of active packaging and finds the possibilities to transfer this
technology to the pilot scale which needs to more and further studies. More studied will be done to determine the
migration of silver nanoparticls from PVOH film in order to measuring the possible health hazardous and also to
enhance its antimicrobial activity to achieve wider antimicrobial spectrum against all spoilage microorganisms
including yeast and moulds and also to measure the releasing rates of AIT from PVOH-AIT films.
5. Selected References
Al-Moghazy M (2011) In Proc.s of the 16th Workshop on the Developments in the Italian PhD Research on Food Science and
Technology, Lodi (Italy), 21-23 September, 2011, pp. 209-210.
Cutter CN (1999) The effectiveness of triclosan-incorporated plastic against bacteria on beef surfaces. J Food Prot 62:474-79.
Del Nobile MA, Piergiovanni L, Buonocore GG, Fava P, Puglisi ML, Nicolais L (2003) Naringinase immobilization in polymeric
films intended for food packaging applications. J Food Sci 68: 2046-2049.
Djokić S (2008) Synthesis and antimicrobial activity of silver citrate complexes. Bioinorg Chem Appl ID 436458: pp. 7.
Khan Z, Al-Thabaiti SA, Al-Nowaiser FM, Obaid AY, Al-Youbi AO, Malik MA (2011) Kinetics of silver nanoparticle growth in
aqueous polymer solutions. Arabian Journal of Chemistry DOI: 10.1016/j.arabjc.2010.12.024.
Oussalah M, Caillet S, Ri SS, Saucier L, Lacroix M (2007) Antimicrobial effects of alginate-based films containing essential oils on
listeria monocytogenes and salmonella typhimurium present in bologna and ham. J Food Prot 70: 901-908.
Pranoto Y, Salokhe VM, Rakshit SK (2005) Physical and antibacterial properties of alginate-based edible film incorporated with
garlic oil. Food Res Int 38: 267-272.
- 12 -
Recovery of Phenolic Compounds from Winery By-Products
and their Food Application
Danila Amendola (danila.amendola@unicatt.it)
Institute of Oenology and Food Engineering, Università Cattolica del Sacro Cuore, Piacenza, Italy
Tutor: Prof. Giorgia Spigno
This thesis has focused on the recovery of high added-value compounds, mainly phenolic compounds, from winery
by-products and their use in food. In particular, we studied the lignocellulosic fractionation of grape stalks for the
recovery of hemicelluloses, cellulose, lignin and antioxidants through an autohydrolysis process. We also studied
the influence of variety on the antioxidants extraction from Barbera, Pinot Noir and Nebbiolo grape marc. Finally, a
freeze-dried extract from Barbera grape marc was used to improve the shelf-life of hazelnut paste evaluating the
oxidation kinetics and the influence of different nanodelivery systems on the extract efficiency.
Recupero di composti fenolici da sottoprodotti dell’industria vinicola
e loro applicazione alimentare
Questa tesi di dottorato ha riguardato il recupero di composti fenolici dai sottoprodotti del comparto vitivinicolo e il
loro utilizzo in campo alimentare. In particolare, si è studiato il frazionamento lignocellulosico dei raspi d’uva per
ottenere emicellulosa, cellulosa, lignina e antiossidanti attraverso un processo di auto idrolisi e l’influenza della
varietà sull’estrazione di antiossidanti da vinacce d’uva di Barbera, Pinot Noir e Nebbiolo. Infine, si è utilizzato un
estratto di Barbera liofilizzato per migliorare la shelf-life di pasta di nocciole valutando la cinetica d’ossidazione e
l’influenza di diversi nanosistemi di rilascio sull’efficienza dell’estratto.
Key words: Antioxidants, auto-hydrolysis, hazelnut paste, natural extracts, oxidation kinetics.
1. Introduction
In accordance with the PhD thesis project, this oral communication reports the main results of the following
activities:
A1) auto-hydrolysis process for recovery of hemicelluloses, phenolic compounds and lignin from grape stalks;
A2) antioxidants recovery from three different grape marc varieties;
A3) nanoencapsulation of grape marc extract to improve its solubility and antioxidant activity into hazelnut paste.
Grape marcs and stalks can be considered as rich source of polyphenols, hemicelluloses, lignin and cellulose and
different methods can be used for their extraction. In particular, grape stalks are a lignocellulosic material and in
our study, auto-hydrolysis process was carried out with hot, compressed water leading to a liquid phase (liquor) rich
in hemicellulose-derived sugars or oligomers and sugar decomposition products. Moreover, as the reaction is not
selective, other compounds, including those derived from extractives and acid-soluble lignin, are also present in the
liquor. Liquor from autohydrolysis was evaluated in terms of polyphenols content and their antioxidant activity.
Regarding the valorisation of grape marcs, we produced three extracts from three different varieties of grape marcs
(Barbera, Nebbiolo and Pinot Noir) in order to assess the impact of variety on the polyphenols recovery and the
antioxidant activity of the extracts. Since, it was previously shown that it’s possible to produce a freeze-dried
phenolic extract, which could be stored for long times, maintaining good antioxidant properties (Amendola et al.,
2010), a solution that would bring to the profitable exploitation of the phenolic extract is its use as an innovative
and natural active additive, which can improve preservation of food products, such as hazelnut paste. Hazelnut
paste is a food ingredient used in the processing of different foodstuffs (ice-creams, confectionery and bakery
products). After processing into paste, hazelnuts become more prone to oxidation because of increased surface area
exposed to oxygen and damaged structure that cause deterioration reactions to proceed faster (Cam and Kilic,
2009). If stability of whole hazelnut has been studied to a great extent in the literature, there is a scarcity of
information regarding stability of processed hazelnut. Addition of the marc extract could therefore be exploited to
produce a more stable hazelnut paste but, due to the limited solubility of the extract in lipid medium, suitable
encapsulation solutions need to be developed, such as the nanoemulsion-based delivery systems investigated in this
project.
The auto-hydrolysis of grape stalks (from Barbera and Bonarda Grapes) was carried out in duplicate in a 4 L
pressurized reactor during 30 min at 180 ºC, using a solid/liquid ratio of 1:10/w:v/stalks:water. The auto-hydrolysis
process leads to a liquid fraction (auto-hydrolysis liquor) which contains water, hemicelluloses, sugars, acid soluble
lignin and ashes, and to a solid fraction which contains mainly lignin and cellulose. The two phases were separated
- 13 -
by filtration through a steel strainer. Auto-hydrolysis liquor was characterised in terms of pH, density (by
gravimetric method), dry matter and inorganic matter, monosaccharides (by HPLC), total phenols content (by
Folin-Ciocalteau’s assay) and antioxidant activity (by ABTS test).
Three red-grape marc extracts were obtained by solvent extraction with ethanol:water/60:40, at 60°C for 2 h under
stirring according to the procedure described in Amendola et al. (2010). The extracts were characterised for total
phenols content, anthocyanins and antioxidant activity.
Finally a Barbera extract was freeze-dried (crude extract, CE) and used in a natural hazelnut paste (NP) and a fluid
hazelnut paste (FP) (added with monoglycerides as emulsifiers) obtained from roasted unpeeled kernels kindly
provided by an Italian company. To improve solubility in lipid phase, four different nanometric size delivery
systems were fabricated.
Formulation 1 consisted of an O/W nanoemulsion, where the grape extracts (0.25% wt) were first embedded in a
sunflower oil emulsion (9% wt), stabilized in water by using soy lecithin (1% wt) as emulsifier and subsequently
reduced to nanometric dimensions (200 nm) by high pressure homogenization (5 passes at 150 MPa). Formulation
2 consisted of a powder obtained by spray-drying Formulation 1. The nanoemulsion was dried out and entrapped in
a micrometric vitreous maltodextrin structure. The final grape extract load was 0.7% wt. Upon rehydration, the
emulsion retained a nanometric size (290 nm). Formulation 3 was an ethanol-oil nanoemulsion. The grape extracts
(0.5%) were dissolved in ethanol (10%) and homogenized with a hot melt of stearic acid (4.4%) and peanuts oil
(83.1%), using soy lecithin (2%) as emulsifier. The emulsion was further comminuted by high pressure
homogenization (5 passes at 150 MPa).
Formulation 4 was identical to Formulation 3, using instead of 0.5% grape extracts a lower amount of resveratrol
(0.05%) in consideration of its higher antioxidant activity. Antioxidant activity of final formulation was assessed by
the DPPH radical assay and expressed as mg of ascorbic acid equivalents /ml (mgAAE/ml).
An accelerated shelf-life test was carried out keeping the samples and a blank (paste without extract addition) into
open 10 mL amber glass vials in oven at 60°C. Peroxides value (PV) of the lipid phase and antioxidant activity (as
reducing power by the Folin-Ciocalteau assay) of the hydrophilic fraction were periodically analysed.
2.1 Chemical analysis
Total phenols content was determined by Folin-Ciocalteau method (Ribereau-Gayon et al., 2000). Briefly, 0.5 mL
of sample were mixed with 2.5 mL of Folin-Ciocalteau reagent (Merck); then 5 mL of Na2CO3 20% were added
and the mixture was brought to 50 ml with distilled water. A blank sample was included (with 0.5 ml of the solution
in which the sample was dissolved). The samples were kept in a thermostatic bath at 40 ºC for 30 min, then the
absorbance of the samples at 750 nm were measured against the blank. Results were expressed as Gallic Acid
Equivalents (GAE) by means of a calibration curve obtained with a standard of gallic acid (Scharlab).
The antioxidant capacity was assessed by the ABTS assay (Re et al., 1999). A radical solution (7 mM ABTS by
Fluka and 2.45 mM potassium persulfate) was prepared and kept in the dark at room-temperature for 12-16 h before
using. This solution was then diluted with ethanol 50 % to an absorbance of 0.70 (±0.02) at 734 nm and
equilibrated at 30 °C. For the analysis, 2 ml of the diluted radical solution were mixed with 20 μl of the sample
opportunely diluted and after 6 minutes the absorbance at 734 nm was read against ethanol 50%.
Peroxide value. Samples were defatted twice with 15 ml of hexane mixing for 2 min with a vortex (Velp scientific
srl Milano Italy) and centrifuged at 10000 g for 10 min. Hexane was removed under vacuum (Rotavapor Büchi R114) and the recovered oil was used to evaluate PV. Briefly, 1 g of oil was weighed into a 250 ml flask, 25ml of
mixture of acetic acid/chloroform (3/2 v/v) and 0.5ml of saturated solution of potassium iodide were added. The
sample was left in the dark for 2 min. 25 ml of water were added to dilute the sample and 0.5 % starch solution was
added as indicator. Sample was then titrated with Na2S2O3 0.01 N and PV calculated as:
⎛ meqO 2
PV ⎜⎜
⎝ kgoil
⎞ mlNa 2S 2O 3 ⋅ N Na 2S 2O 3
⎟=
⋅ 1000
⎟
gsample
⎠
3.1 Auto-hydrolysis process
Auto-hydrolysis has been suggested as pre-treatment for dissolution of hemicelluloses for fermentation applications
and for improving the next delignification step necessary to obtain a purer cellulose fraction and/or more accessible
to cellulolytic enzymes. From elaboration of data reported in Table 1, it comes that the 90.36, the 68.51 and the
12.42% of cellulose, lignin and hemicelluloses, respectively, remained in the solid fraction, therefore, the results
suggest that auto-hydrolysis was efficient in removing most of the stalks hemicelluloses which should be recovered
either totally or in a very significant amount, in olygomeric form. Recently, the interest in recovering phenols as
added-value antioxidant compounds has been increasing, that’s why total phenols content and antioxidant capacity
were also evaluated. Total phenols concentration in liquor was 2.54 ± 0.25 g/L GAE) and the antioxidant activity
was 9.85 ± 0.45 AOP%/μgGAE. Complete results of this experimentation are reported in Amendola et al. (2012).
- 14 -
Table 1
Characterization of auto-hydrolysis liquor and solid residue
L iq uo r
So lid
a
A ssay
S ta l k s %
(d .w . b a s i s )
M oi s t u r e
7 .0 9 ± 0 .3 6
D r y m at t er
100
A s h es
H o t w a t er s o l u b il i t y
6 .1 1 ± 0 .4 3
5 5 .9 9 ± 0 .6 8
1 % N a O H s o l u b i li t y
7 5 .9 7 ± 1 .1 8
E t h an o l -t o l u en e
ex t ra ct i v es
2 2 .6 1 ± 2 .1 4
L i g n in
3 2 .3 5 ± 0 .3 1
C e l l u lo s e
1 2 .1 9 ± 0 .5 2
H em i ce l lu l o s e
2 5 .7 ± 0 .4 2
G l u co s e
F r u ct o s e
Y i el d
(% / d .w .
S ta l k s)
g /L
35.02 ± 0.38
4.52 ± 0.28
30.15
3.89
d
4 .9 9 – 1 3 . 3 1
1 3 .3 5 ± 0 .1 3
1 0 .7 4 ± 0 . 5 4
9.25
1 3 .0 8 ± 0 .2 5
n o t d et ec t ed
5 . 7 9 - 1 5. 4 6
X i l os e
5 .7 4 ± 0 . 3 8
4.94
A ra b i n o se
0 .8 5 ± 0 . 0 4
0.72
T o t al p h en o l s (G A E )
2 .5 4 ± 0 . 2 5
b
Y ie l d
(% / d . w .
S ta l k s)
% (w / w )
c
100
1 .5 0 ± 0 . 0 2
3 9 .4 6
0 .5 9
10.81 ± 0.40
4 .2 7
56.16 ± 0.31
2 2 .1 6
27.91 ± 0.48
1 1 .0 1
8 .0 9 ± 0 . 1 0
3 .1 9
3.2 Antioxidants recovery from three different grape marc varieties
The three red grape varieties were selected because of their regional (Barbera and Nebbiolo) and international
(Pinot Noir) diffusion; their representativeness of different wine-making processes (Pinot noir was fermented offskins) and of their different phenolic profiles (Barbera and Nebbiolo are well known for their high anthocyanins
and tannins content, respectively). Significant difference was found, as expected, only for colour and free sugars
content. The average contents (w/w) found were: moisture 3.3%; lipids 6.0%; free sugars 8.2%; protein 9.8% and
fibre 34.7%. The ash content was 8.7% with K the major detected metal cation followed by Ca, Mg and Na. With
regard to phenolic extracts, Pinot extract had the highest total phenolic content (5.54±0.31%) (due to the different
wine-making process), and Barbera extract the highest anthocyanins content( 6.15± 0.43%) (Fig. 1). Interestingly,
the average specific antioxidant activity of phenolic extracts was 13.3 AOP%/µgGAE without significant differences
between the three red varieties.
Barbera
7
6
5
4
3
2
1
0
280 nm index (gGAE/100g dried raw material)
Figure 1
Nebbiolo
Pinot Noir
Folin index (gGAE/100g dried raw material)
Anthocy anins (mgM AE/100g dried raw material)
Composition of red skins phenolic extracts in terms of total yield.
3.3 Nanoencapsulation of grape marc extract to improve solubility and antioxidant activity into hazelnut
paste
3.3.1 Addition of crude extract to different types of hazelnut paste
The effects of extract addition into NP and FP in terms of peroxides formation during storage at 60 °C, are shown
in Fig.2. Addition of CE to the NP brought to inhibition of lipid oxidation. Similarly to NP, also in the FP the
extract showed a certain antioxidant effect. Oxidation was observed only after an induction period of 14 days, after
which it followed a similar trend as observed with the NP, even though FP oxidation was about 50% slower
compared to the NP, both with and without extract (compare PV after 35 days in Fig. 2). In order to possibly
distinguish the effect of added antioxidants from that of endogen compounds, the total phenolics content was
assessed on both the blank and the extract-enriched-sample. The total phenolics content of the blank was 1.25±0.13
mgGAE/g, in agreement with literature, where values ranging from 0.07 to 7 mgGAE/g have been reported (Jakopic et
al., 2011). Addition of the CE obviously increased the total phenolics content of the paste (Fig.3) which remained
apparently constant until after 45 days, while that of the blank increased after 21 days. This increase, followed by a
decrease, might be ascribed to the ability of polyphenols to oxidize and further polymerize to form oligomers with a
higher antioxidant activity (Di Mattia et al., 2009). If the difference between the extract-enriched paste and the
blank is considered, that is the reducing power of only the added polyphenols, there seems to be a strong reduction
after 21 days, which would confirm the active role of the extract in the inhibition of paste oxidation.
- 15 -
1000
2.5
a
a,b a,b
a,b
a
2.0
PV
mgGAE/gpaste
100
10
1
1.5
a
a,b,c
a,b,c a,b
b,c,
c,d
d
1.0
10
Blank-NP
20
30
CE-NP
50 Day 60
40
Blank-FP
0
Blank
CE-FP
Figure 2 Peroxides formation NP and FP without
(Blank) and with (Extract) addition of crude
extract. Error bars indicate ± s.d.
c
b,c,d
a,b,c
0.5
0.0
0
b,c
15
Extract
30
45 Days 60
(Extract-Blank)
Figure 3 Reducing power of FP samples. For each
series same letters indicate means not
statistically different according to Tukey’s
test
3.3.2 Addition of nanoencapsulated extract
In order to improve extract solubility, as well as polyphenols efficiency into the paste, the different nanosized
delivery systems described in materials and methods were tested with the fluid paste at the same dosing of the crude
extract. Because of the different content of extracts in the formulations, the final extract concentrations ranged from
12.5 to 35 ppm (Table 2), while the consequent concentration of extract phenols in the paste was always lower than
10 ppm.
Table 2 Composition of the different nanoemulsion formulations with reference to antioxidant activity, grape extract content
and final grape extract concentration in the hazelnut paste.
Specific antioxidant
activity
Antioxidant
Formulation activity
mgAAE/g
Marc extract in
formulation
% w/w
mgAAE/gmarc extract
Crude extract
F1
F2
F3
F4
Resveratrol
0.13
0.25
0.7
0.5
0.05*
0.05*
91.72a
76.00b
80.80b
38.20c
157.30*
269.38*
0.11
0.19
0.57
0.19
0.079
0.13
Marc extract in
hazelnut paste
ppm (w/w)
12.5
35
25
2.5*
* values referred to resveratrol
(a,b,c)
same letter refers to statistically not significant different values according to Tukey’s post-hoc test
The results of accelerated shelf-life tests showed again that paste oxidation started after an IP, which this time was
of 7 days instead of 14 (Fig. 4).
The results showed that the encapsulated extracts were still capable of reducing lipid oxidation, despite the active
ingredient concentration was significantly lower than in the crude extract trials. The net result is that encapsulation
improved extract lipid solubility and also significantly increased the efficiency of the phenolic compounds. PV
evolution was characterized by three characteristic periods: an induction period, between days 0 and 7, where no
inhibition occurred, a first inhibition period, between days 7 and 35, where the most intense inhibition took place,
and a second inhibition period, between days 35 and 100, where a residual weaker inhibition was observed (Fig. 4).
1000
Figure 3 Peroxides formation in FP without (Blank) and
with encapsulated marc extract (F1 to F3) and resveratrol
(F4).
PV
100
10
1
0
Blank
20
40
F1
60
F2
80
F3
Day
F4
100
3.3.2 Kinetics interpretation
Experimental data of PV over storage time were tentatively elaborated according to different kinetics model in
order to find out the best model to predict hazelnut paste oxidation and evaluate the inhibition efficiency of the
different extract formulations. Oxidation of vegetable oils has been found to follow half-order kinetics according to
- 16 -
Eq. 1 (Erkan et al., 2009).
PV 1/2 − PV01/2 − = (1/2)kM [RH0 ] ⋅ t
(Eq. 1)
where kM is the mixed rate constant which takes into account an initiation, a propagation, a termination rate
constant, corresponding to the three steps of the oxidation of lipids, and [RH0] is the initial concentration of lipid
substrate. It was reported that the addition of prooxidants and antioxidants can change the half-order to first-order,
while in complex food systems the data sometimes fit zero-order kinetics (Colakoglu, 2007; Shim and Lee, 2011).
Furthermore, oxidation rate varies with the partial pressure of oxygen and when this is high, the oxidation rate is
independent of oxygen concentration but directly dependent on substrate concentration and can be studied by a
first-order reaction kinetics (Eq. 2).
ln(PV ) = k ⋅ t + ln(PV0 )
(Eq. 2)
In the NP the oil phase separated at the top resulting in a single phase, which, in the open vials used in the
experiment was in direct contact with atmospheric air, with constant oxygen concentration, therefore explaining the
observed first-order kinetics for oxidation of NP, with and without addition of CE. Similarly to what previously
observed, also in the FP an apparent first-order kinetics for PV formation was observed, with a reaction rate in the
blank a 18 % faster than in the sample with the extract. However, the first-order model accurately fitted all the data
only after the induction period. When considering the PV evolution over the entire storage period, the half-order
kinetics model (Eq. 1) resulted to fit accurately only the experimental data for the extract-enriched paste but not for
the blank. Globally, the effect of extract addition was an inhibition of lipid oxidation with reduced formation of
peroxides, but not a delay in the induction period of oxidation reactions.
In the case of extract nanoformulations added into FP, experimental data after the induction period could be
accurately fitted by both a double step first-order kinetics model (with a reaction rate decreasing after 35 days) and
with a half-order kinetics model. Based on the different set of experimental data, with crude and encapsulated
extract, it appears that the first-order kinetics model is the more appropriate to describe the oxidation behaviour of
hazelnut paste, and is quite accurate after the induction time.
4. Conclusions and Future Perspectives
This study showed the efficiency of a phenolic grape marc extract in improving the shelf-life of hazelnut paste by
inhibiting its oxidation, in spite of the limited solubility of the extract in such a high lipid content matrix.
Nanoemulsion formulation of the extract improved its lipid solubility and also significantly increased the efficiency
of the phenolic compounds as preservative agent. Further research is needed to better understand the stability and
action mechanism of the nanoemulsions and to optimise formulation (since the three tested formulations exhibited
different efficiency and encapsulation process caused a reduction in the antioxidant activity of the extract) and
dosing levels, from different points of view: costs, sensorial quality of the product and possibility of using the
extract not only as preserving additive but also as an healthy-functional ingredient.
5. References
Amendola D, De Faveria DM, Egüesb I, Serranob L, Labidib J, Spigno G (2012) Autohydrolysis and organosolv process for
recovery of hemicelluloses, phenolic compounds and lignin from grape stalks. Biores Technol 107: 267-274.
Amendola, D., De Faveri, D.M., & Spigno G. (2010) Grape marc phenolics: Extraction kinetics, quality and stability of extracts.
J Food Engin 97: 384-392.
Cam S, Kilic M. (2009) Effect of blanching on storage stability of hazelnut meal. J Food Quality 32: 369-380.
Colakoglu AS (2007) Oxidation kinetics of soybean oil in the presence of monolein, stearic acid and iron. Food Chem 101: 724728.
Di Mattia CD, Sacchetti G, Mastrocola D, Pittia P (2009) Effect of phenolic antioxidants on the dispersion state and chimica
stability of olive oil O/W emulsions. Food Res Int 42: 1163-1170.
Erkan N, Ayranci G, Ayranci E (2009) A kinetic study of oxidation development in sunflower oil under microwave heating:
effect of natural antioxidants. Food Res Int 42: 1171-1177.
Jakopic J, Petkovsek MM, Likozar A, Solar A, Stampar F, Veberic R (2011) HPLC-MS identification of phenols in hazelnut
(Corylus avellana L.) kernels. Food Chem 124: 1100-1106.
Shim SD, Lee SJ (2011) Shelf-life prediction of perilla oil by considering the induction period of lipid oxidation. European J
Lipid Sci Technol 113: 904-909.
- 17 -
Biotechnological Production of Vanillin using Microbial Cells
Lorenza Brunetti (brunetti@unitus.it)
Dept. for Innovation in Biological Agro-food and Forest Systems, University of Tuscia, Viterbo, Italy
Tutor: Prof. Maurizio Ruzzi
This PhD thesis is aimed at optimized procedure for the biotechnological production of vanillin using ferulic acid as
a substrate. Combining different experimental approaches it has been demonstrated that production rate and
maximum vanillin yield, using Escherichia coli as a catalyst, was dependent on, pH and composition of the
bioconversion medium, agitation speed and initial concentration of ferulic acid. In particular it has been shown that
adaption of the cells to ferulic acid proved successful in overcoming substrate inhibition. Finally, entrapment of
ferulic acid within a gel matrix was examined as a means to offset substrate toxicity.
Ottimizzazione del processo di produzione di vanillina per via microbica
Questo lavoro di tesi è volto ad ottimizzare la produzione biotecnologica di vanillina utilizzando acido ferulico
come substrato. Combinando diversi approcci sperimentali e usando ceppi di Escherichia coli, è stato dimostrato
che la velocità di produzione, e la resa in vanillina, dipendono dalla composizione e dal pH del tampone di
bioconversione, dalla velocità di agitazione e dalla concentrazione iniziale di acido ferulico. Inoltre è stato
dimostrato che l’adattamento delle cellule all’acido ferulico permette di superare l’inibizione da substrato. In fine, è
stata valutata la possibilità di intrappolare l’acido ferulico all’interno di un gel d’agarosio per limitare la tossicità
del substrato.
Key words: Vanillin, ferulic acid, Escherichia coli, bioconversion, two-phase system.
1. Introduction
In accordance with the PhD thesis project, this oral communication reports the main results of the following
activities directed to:
(A1) evaluate the effect of buffer constituents on the conversion of ferulic acid to vanillin and on the formation of
unwanted by-products, i.e. vanillic acid and vanillyl alcohol;
(A2) optimize the vanillin yield, evaluating the synergic effect of ferulic acid concentration and stirring speed;
(A3) perform the bioconversion process in a solid-liquid two-phase system allowing controlled release of ferulic
acid.
1.1 Optimization of vanillin production using microbial cells
Currently, the total market for flavors and fragrances is estimated at 20 million U.S. dollars, representing the 25%
of the world market for food additives. Flavoring compounds are mainly produced via chemical synthesis or by
extraction from natural sources. Flavors obtained by chemical synthesis cannot be legally labeled as natural and
there is a growing body of literature on potential environmental and human health risks associated with their
manufacture and use. On the other hand, extraction processes from plants is often expensive because of the low
concentrations of these molecules in the raw material. Moreover the cost of natural flavor depends on unpredictable
factors such as plant diseases and adverse weather conditions. In recent years, there has been growing interest in
natural and healthy foods, especially with regards to the ingredients such as flavoring agents and preservatives
(Sinha et al., 2008). Recently, there has been a huge upsurge in the exploration of more “eco-friendly” procedures
for the production of natural flavors, such as the vanillin (Priefert et al. 2001). Quantitatively, vanillin (4-hydroxy3-methoxybenzaldehyde) is major organoleptic component of natural vanilla, obtained from Vanilla pods, and one
of the most important flavoring agent in food and pharmaceutical precursors. Biotechnological production of
vanillin from natural feedstock, such as ferulic acid, is a valid alternative to the production of the aroma by
extractive means or to its chemical synthesis from petrochemical precursors. Interestingly, the biotechnological
flavor may have a lower price compared to vanilla and can be still considered natural, according to EC Regulation
no 1334/2008 (December 16th 2008), if it is obtained from a natural substrate (i.e. ferulic acid). However,
production of vanillin at high concentration by biological means is limited due to toxicity of both substrate (ferulic
acid) and product (vanillin). Moreover, bioconversion of ferulic acid to vanillin by metabolically engineered
Escherichia coli cells is influenced by several factors, such as: physiological state of microbial cells; number of
copies of catabolic genes; composition and the pH of the bioconversion buffer. Our previous results (Barghini et al.,
2007) demonstrated that high amounts of ferulic acid negatively affect the ability of E.coli cells to produce vanillin
by almost 25%. Since working with dilute substrate solution, waste-water treatment and product recovery costs can
be very high, a major goal of this project was to find the best operating conditions that lead to high vanillin
concentration. A viable solution to keep the substrate in a steady stream, limiting the manual intervention of the
operator and by trapping the ferulic acid inside a gel matrix, might be the use of a solid-liquid two phase system
- 18 -
(Rehmann 2007). Agarose gels provide a well-defined, controllable scaffold to entrap ferulic acid and can be
beneficial in elucidating the effects of the modulated release of the entrapped substrate on the bioconversion
process.
2. Experimental Procedure
In this PhD thesis optimization of bioconversion buffer was carried out with phosphate-based buffers with different
pH values and molarities of buffer components. Bioconversions experiments were carried out in shaken flasks, at
30°C, using E. coli resting cells. Consumption of ferulic acid and production of vanillin were monitored by high
performance liquid chromatography (HPLC). The mutual effect of independent variables on the production of
vanillin and unwanted side-products was determined by Response Surface Methodology (RSM). Ferulic acidloaded agarose hydrogels were used as a system for controlled release of ferulic acid into the bioconversion
medium.
3.1 Microorganisms and culture conditions
Bioconversion of ferulic acid to vanillin was carried out using resting cells of E. coli strains carrying ferulic
catabolic genes on low-copy [JM109(pBB1); Barghini et al., 2007], high-copy [JM109 pG-BTG] and integrative
[FR13; Luziatelli et al., 2008] plasmid vector. Cells were grown over night at 30°C [JM109(pBB1) and JM109
(pG-BTG)] or at 44°C (FR13), on LB medium (composition per liter: bacto-tryptone 10g, bacto yeast extract 5g,
NaCl 5g), containing ampicillin (50 μg/mL) or kanamicin (25 μg/mL), as requested. All experiments were
performed with final concentration of biomass of 4.5 g (wet weight)/L in M9 phosphate buffer (composition per
liter: Na2HPO4 6g, KH2PO4 3g, NaCl 0.5g, NH4Cl 1g) amended with yeast extract (2 mg/L) and ferulic acid (7.7 to
23.2 mM). Biotransformation were performed in 100 mL shaken flasks (120 to 180 rpm) containing 15 mL of cell
suspension. Conversion of ferulic acid to vanillin was monitored by HPLC using a 150 x 4.6 mm C-18 column and
UV-VIS detection at 320 nm. The mobile phase was composed of water : methanol (49:49), containing 2% acetic
acid, 0.6 mL/min flow.
3.2 Buffer composition and experimental design
Reaction condition for vanillin production was optimized respect to buffer composition (presence/absence of NaCl
and NH4Cl), potassium-to-sodium ratio, pH of buffer solution (pH 6.8-9.0). In brief, the following buffer were
used: saline phosphate M9 buffer adjusted at pH 6.8, 8.0 and 9.0 (buffer A, B, C); M9 buffer (pH 9.0) without NaCl
and NH4Cl (buffer F); 90 mM sodium-potassium phosphate, potassium phosphate and sodium phosphate buffer at
pH 9.0 (buffer D, E, G); sodium-potassium phosphate buffer (pH 9.0) with different molar concentration of
phosphate, 47 mM (buffer H), 70 mM (buffer J) and 94 mM (buffer K). To evaluate the effect of multiple
parameters [stirring speed (120 to 180 rpm), ferulic acid concentration (7.7 to 23.2 mM)] on the production of
vanillin, the statistical program Modde 5.0, which generated a full-factorial screening design with a total of 24
experiments including three triplicate centre points, was used, with confidence level 0.95. Data were analyzed by
Tukey test at significance level of 0.05.
3.3 Preparation and use of ferulic acid loaded agarose rods
In this work a solid-liquid two-phase system for the modulated release of ferulic acid in the liquid phase was
developed. For this purpose ferulic acid (1.5%) was entrapped into agarose (1.75% w/v) gel rods. All rods were
prepared by dissolving agarose powder at 3.5% in water by boiling 2-3 minutes in a microwave oven. The agarose
solutions were mixed and cooled at 50°C prior adding ferulic acid 3% (1:1). The solutions were cooled at room
temperature for 3 hours in static conditions. Each cylinder had diameter 0.6 cm and height 1 cm, containing about
29.4 mM of ferulic acid. Bioconversions were carried out in saline phosphate M9 buffer at different cylinder-to-unit
of volume ratios (eight to twelve cylinders per 15 ml volume).
4.1 Effect of buffer composition on the production of biovanillin
In order to evaluate the effect of buffer concentration, pH and buffer ions on the ability of E. coli cells to convert
ferulic acid to vanillin, different sodium/potassium phosphate, sodium phosphate and potassium phosphate buffers
were considered (see Section 3.2). Bioconversion experiments were carried out with resting cells at 30°C, and the
decrease in ferulic acid concentration as well as the formation of vanillin and potential unwanted metabolites
(vanillyl alcohol) was measured at serial time points by HPLC analysis. Results obtained with E. coli
JM109(pBB1), a strain containing a low-copy number plasmid, indicated (Table 1) that higher amounts of vanillin,
and lower amounts of vanillyl alcohol, can be obtained incubating cells in sodium/potassium phosphate buffer at
pH 9.0 (Table 1, line C, D and J). Similar results were obtained with E. coli strains containing single (FR13 strain)
or multiple copies (JM109(pG-BGT) strain) of ferulic catabolic genes, in experiments carried out in buffer C
(compared to buffer A), we obtained a 0.9-fold increase in vanillin yield, from 5.52 to 6.12 mM, with FR13 strain
and a 2.4-fold increase, from 0.9 to 2.2 mM, using JM109(pG-BGT) cells as a catalyst.
- 19 -
Table 1 Effect of buffer composition on the production of biovanillin using low-copy plasmid transformant (JM109[pBB1]).
Metabolites (mM)*
Bioconversion
buffer
Vanillin
Vanillyl alcohol
Ferulic acid
consumption rate
(mmol/h)**
A
3.10± 0.04a
3.36 ± 0.14a
0.40 ± 0.01a
B
5.80 ± 0.04b
2.20 ± 0.02b
0.84 ± 0.01b
C
5.92 ± 0.09c
1.89 ± 0.06b
0.94 ± 0.09c
D
5.61 ± 0.09
d
c
0.98 ± 0.06d
E
5.41 ± 0.02b
1.62 ± 0.01e
0.74 ± 0.02b
F
5.50 ± 0.00b
1.65 ± 0.01d
0.91 ± 0.03b
G
4.71 ± 0.00b
2.00 ± 0.01e
0.96 ± 0.02b
H
5.42 ± 0.04
b
c
0.90 ± 0.01e
J
5.72 ± 0.12e
1.44 ± 0.05b
0.86 ± 0.01c
K
5.50 ± 0.01b
1.30 ± 0.01c
1.00 ± 0.05d
1.64 ± 0.12
1.26 ± 0.01
*values calculated after 24 hours of bioconversion. **value calculated from the second to fifth hour.
4.2 Optimization of the bioconversion process by Response Surface Methodology
Response Surface Methodology (RSM) was used to study the effect of initial ferulic acid concentration and
rotational speed on the maximum vanillin concentration. Results reported in Figure 1 indicated that E. coli FR13
was able to produce vanillin under all the tested conditions and that maximum vanillin concentration depends on
both selected variables and their mutual interaction. Increase in the initial ferulic acid concentration from 7.7 to ~15
mM and in the rotational speed from 120 to 150 rpm leads to a clear rise in the vanillin concentration. Excess
substrate inhibition, observed at ferulic acid concentration higher than 15.0 mM, cannot be overcome by increasing
rotational speed. Better results, compared with standard conditions (180 rpm and 7.7 mM ferulic acid) were
obtained using an initial concentration of ferulic acid between 13.0 and 15.0 mM; under these conditions we
observe a 40% increase in the maximum vanillin concentration. The optimal conditions to obtain the maximum
of vanillin identified by the program are: 152 rpm and 14.88 mM ferulic acid, in this way we obtained 11.5 mM of
aldehyde more than double the standard conditions. A slight amount of vanillyl alcohol (up to 1.56 mM) was
detected in the medium at the end of the incubation time, the formation of this vanillin degradation product by
increasing the rotational speed up to 150 rpm (Figure 2, panel A) and increasing the initial ferulic acid
concentration (Figure 2, panel B). These results indicated that the increase in the maximum vanillin concentration
dependent by selected variables cannot be explained by a simple reduction of vanillin degradation and that vanillyl
alcohol formation is not related to maximum vanillin concentration.
Figure 2 Prediction plot
for vanillic alcohol
production relatively to stirring speed (panel A) and
ferulic acid initial concentration (panel B)
Figure 1 RSM Response surface plot showing the effect of
stirring speed, initial ferulic acid concentration and their
mutual effect on vanillin production (R2 0.95).
- 20 -
4.3 Cells adaptation to substrate
As previously reported (Figure 1), an increase in the initial ferulic acid concentration leads to an excess substrate
inhibition, increasing the initial concentration of ferulic acid from 14.0 to 19.5 mM a 25% decrease in the
maximum vanillin concentration was observed (from 8.15 ± 0.03 to 6.24 ± 0.03 mM; Table 2, condition A and B).
Interestingly, we were able to demonstrate that this inhibitory effect can be partially overcome adapting cells to
ferulic acid. Cells adapted to 14.0 mM ferulic acid, can be exposed to substrate concentrations higher than 18 mM
without significant effects on the maximum vanillin concentration, which reached 7.92 ± 0.05 mM (Table 2,
condition C).
Table 2 Effect of substrate adaptation on vanillin molar yield.
A
B
t (h)
ferulic acid
(mM)
vanillin
(mM)
0
13.90 ± 0.00
0.00
24
3.96 ± 0.00
8.15 ± 0.03
a
C*
ferulic acid
(mM)
vanillin
(mM)
19.56 ± 0.00
0.00
9.68 ± 0.03
6.24 ± 0.03
b
ferulic acid
(mM)
vanillin
(mM)
13.90 ± 0.00
0.00
9.27 ± 0.1
7.92 ± 0.05a
*after two hours were added 5 mM of ferulic acid.
4.4 Development of a two-phase system for modulated release of ferulic acid
To facilitate cell adaptation in the presence of ferulic acid and prevent dilution of the bioconversion medium, due to
the sequential addition of fresh substrate, a solid-liquid two-phase system has been developed for modulated release
of ferulic acid. Preliminary tests were carried out with different gel matrices, but the best results in terms of
percentage of release were obtained entrapping ferulic acid into agarose gel cylinders. Subsequently, we carried out
bioconversion experiments at different cylinder-to-unit of volume ratios (eight to twelve cylinder per 15 ml
volume) to investigate potential benefits, in terms of maximum vanillin production, of using the two-phase system.
Data presented in Figure 3 demonstrated that providing ferulic acid in a bounded-form and modulating its release in
the bioconversion medium, allowing adaptation of the cells to increasing concentrations of the substrate, a 35%
increase in the maximum vanillin concentration, compared to a standard single-phase system, can be achieved. In
the best conditions, 10 cylinders per 15 ml volume, vanillin concentration reached 19.13 mM after 24 h. This
amount of vanillin was the highest found in the literature for recombinant strains and the highest achieved so far
applying such strains under resting cells conditions.
Figure 3 Bioconversion of ferulic acid ( ) to vanillin ( X ): effect of addition of different amount of agarose entrapping units
[8 (black), 10 (dark grey), 12 (pearl grey) cylinders]
This study demonstrated that E. coli cells can be efficiently used as a catalyst for the production of vanillin from
ferulic acid. Optimization of bioconversion conditions based on statistical methodologies was very effective and the
maximum vanillin concentration in the shake flask, using ferulic acid-loaded agarose for regulation of substrate
delivery, could reach 19.13 mM, which was 5.3-fold higher compared with that before optimization. This work
confirmed that an increase in the initial concentration of ferulic acid can lead to an excess substrate inhibition, this
inhibitory can be partially overcome by an increase in the rotational speed, while it can be significantly reduced by
adaptation of the cells to increasing concentrations of ferulic acid. The acquired knowledge can be useful for the
- 21 -
scaling-up of the process from shake flask to bench-top fermenter. Considering that few reports focused on
optimization of the production of vanillin and aromatic aldehydes using a solid-liquid two phase system, this study
could also serve as a guide for optimization of aromatic aldehyde synthesis using E. coli resting cells.
5. References
Barghini P, Di Gioia D, Fava F, Ruzzi M (2007) Vanillin production using metabolically engineered Escherichia coli under nongrowing conditions. Microb Cell Fact 6: 2-11.
Berger R G (2009) Biotechnology of flavours - the next generation. Biotechnol Let 31: 1651-1659.
de Carvalho CCCR, Poretti A, da Fonsece MMR (2005) Cell adaptation to solvent, substrate and product: a successful strategy
to overcome product inhibition in a bioconversion system. Biothecnol Products Process Eng 69: 268-275.
De Faveri D, Torre P, Aliakbarian B, Dominguez JM, Perego P, Converti A (2007) Response surface modeling of vanillin
production by Escherichia coli JM109 pBB1. Biochem Eng J 36: 268-275.
Etschmann M M W , Schrader J (2008) An aqueous-organic two-phase bioprocess for efficient production of the natural aroma
chemicals 2-phenylethanol and 2-phenylethylacetate with yeast. Appl Microbiol Biotechnol 71: 440-443.
Gao F, Daugulis AJ (2009) Bioproduction of the aroma compound 2-phenylethanol in a solid-liquid two-phase partitioning
bioreactor system by Kluyveromyces marxianus. Biothecnol Bioeng 104: 332-339;
Guentert M (2007) The Flavour and Fragrance Industry-Past, Present, and Future in Flavour and frangances ed Springer;
Priefert, H, Rabenhorst, J, Steinbüchel, A (2001) Biotechnological production of vanillin. Appl Microbiol Biotechnol 56: 296314.
Rehmann L, Daugulis AJ (2007) Biodegradation of biphenyl in a solid-liquid two-phase partitioning bioreactor. Biochem Eng J
36:195-201.
Ruzzi M, Luziatelli F, Di Matteo P (2008) Genetic engineering of Escherichia coli to enhance biological production of vanillin
from ferulic acid. Anim Sci Biotechnol 65: 4-8.
Sinha AK, Sharma U K, Sharma N (2008) A comprehensive review on vanillin flavor: extraction, isolation and quantification of
vanillin and others constituents. Int J Food Sci Nutr 59: 299-326.
- 22 -
Characterization of a New Donkey β-Lactoblobulin II Genetic Variant
by Proteomic Approach
Angela Costanzo (angela.costanzo@unina.it)
Dept. of Food Science, University of Naples, Federico II, Italy
Tutor: Prof. Lina Chianese
In the last years the interest of many researchers has been increasingly focused on the study of donkey milk
composition for its positive dietetic impact on patients with allergy to cow’s milk proteins (CMPA). However, the
characterization of donkey milk proteins, such as whey proteins, is still limited. To this aim, in this part of PhD
research, the characterization of donkey β-Lactoglobulin II (β-Lg II) was assayed by means of proteomic approach.
The results achieved showed the existence of a qualitative and quantitative polymorphism at donkey β-Lg II locus
for the occurrence of the new E β-Lg II variant and that of a defective allele at the same locus for the lack of the
protein expression into the milk.
Caratterizzazione di una nuova variante genetica di β-lattoglobulina II asinina
mediante approccio proteomico
Negli ultimi anni l’interesse di molti ricercatori è stato lo studio della composizione del latte di asina per il suo
positivo impatto dietetico nei pazienti con dimostrata allergia alle proteine del latte vaccino. Tuttavia la
caratterizzazione molecolare delle proteine del latte asinino, tra cui quella delle sieroproteine è ancora limitata. In
questa parte del lavoro di tesi è stata caratterizzata la β-Lg II asinina mediante approccio proteomico. I risultati
ottenuti hanno evidenziato l’esistenza di un polimorfismo qualitativo e quantitativo al locus della β-Lg II per
l’identificazione di una nuova variante genetica di β-Lg II denominata E ed il ritrovamento di un allele difettivo allo
stesso locus per l’assenza della relativa proteina nel latte.
Key words: Donkey milk whey proteins, proteomics, genetic polymorphism, beta-Lactoglobulin.
1. Introduction
In the last years, the high incidence of allergies and/or intolerances to bovine milk in newborns increased the
production of infant formulae based on either bovine or soy proteins hydrolysates. Moreover these formulae can be
affected by the presence of peptides with a size stimulating an immunological response and/or by an unpleasant
taste for the infant consumers (Businco et al., 2000; Muraro et al., 2002). Today, several clinical studies showed
that donkey’s milk could represent a valid alternative to both IgE and non-IgE mediated CMPA (Monti et al.,
2007). Basically, allergies and/or intolerances to bovine milk are mainly depending on milk proteins otherwise
present at very lower amount (αs1-CN) or not expressed (αs2-CN and β-Lg) in human milk (Docena et al., 1996).
The composition of donkey’s milk is more similar to human milk than cow, because of the higher lactose content (7
vs 5 g/100ml), the lower protein content (1,7 vs 3,2 g/100ml), the lower casein/ whey protein ratio (about 1 vs 4)
and the higher level of the non-protein nitrogen (NPN) fraction (0,29 vs 0,18%) (Guo et al., 2007; Mao et al.,
2009). Other non-bovine milks (mainly goat milk) have been studied (Bevilacqua et al., 2002), as substitute of
human milk owing to the very similar composition. Nevertheless, the availability of these types of milk requires a
genetic screening to select the animals carrying weak or null alleles at αs1-CN locus.
Compared with bovine milk, the characterization of donkey milk proteins (casein and whey proteins) is still at
relatively early stage of progress. Donkey whey proteins (WPs), consisting of α-La, β-Lg, blood serum albumin
(BSA), lactoferrin (Lf) and Lyz as in ruminants (Martin et al., 2002) and horse milk (Uniacke-Lowe et al., 2010).
The primary structures of donkey WPs, as expected, showed a higher identity with horse than bovine counterparts.
Donkey β-Lg, for instance, was consisting of two components, the major β-Lg I (162 aa) and the minor β-Lg II
(163 aa) for the additional glycine residue between 116th and 117th aa as in mare milk (Halliday et al., 1991). The
genetic polymorphism occurred at donkey β-Lgs loci gave rise to A and B β-Lg I genetic variants (GodovacZimmermann et al., 1988, 1990; Herrowin et al., 2000). As far as β-Lg II, four genetic variant were found: A
(Godovac-Zimmermann et al., 1990), B (Herrouin et al., 2000), C (Herrouin et al., 2000) and D (Cunsolo et al.,
2007). Unlike ruminants β-Lgs and donkey β-Lg II variant A (each having five Cys residues), only four Cys
residues were found in asinine species. They were arranged in two disulphide bridges at the same chain position
(namely Cys106-Cys120 and Cys66-Cys161) (Cunsolo et al., 2007) of the dairying species counterparts. Another
interesting structural characteristic differentiating donkey β-Lgs with respect to ruminants was the maintenance of a
monomeric structure at the pH of milk (Table 1).
So far, donkey α-La resulted monomorphic differently from the three genetic variants A, B and C occurring in
horse counterpart (Giuffrida et al., 1992). Since the knowledge about the genetic profile of donkey whey proteins of
animals reared in Italy is very scarce, the present research was aimed to filling this gap and to relating it to the milk
nutritional quality. In particular, whey proteins extracted from individual milks of donkeys reared in Italy, were
- 23 -
separated in the constitutive components by means of one- and/or two-dimensional immuno-electrophoresis, RPHPLC, coupled to MALDI-TOF-MS and ESI-Q-TOF-MS/MS analysis.
2.1 Sample preparation
Individual whey protein samples (70) have been prepared by acid precipitation at pH 4.6 from skimmed milk of two
breeds reared in Italy (Sicilia and Abruzzo regions) as reported by Aschaffenburg and Drewry (1959).
2.2 Ultra Thin Layer Isoelectric Focusing (UTLIEF) and immunoblotting analysis
UTLIEF on polyacrylamide gels (0.25 mm) was performed in a 4.2–9.0 pH gradient mixing Ampholine buffers
4.2–4.9, 4.5–5.4, 5.0-7.0, 7.0-9.0 (2.3:2.3:1:1 by volume) and all procedure was that early reported by Chianese et
al. (2010). For immunoblotting analysis, the whey proteins separated by UTLIEF analysis were transferred by
capillary diffusion from the gel onto a nitrocellulose membrane (0.45 μm, Trans-Blot, Bio-Rad, Richmond, CA
94804, USA) and immunostained using home-made polyclonal antibodies against bovine α-La, β-Lg as primary
antibodies.
2.3 Reversed-phase high performance liquid chromatography (RP-HPLC)
Whey protein samples were fractionated by RP-HPLC on a 214TP54, 5 μm Vydac C4, 250 × 4.6 mm internal
diameter column (Vydac, Hesperia, CA, USA) at a detection wavelength of 220 nm. Solvent A was 0.1% TFA in
ultra-pure water (v/v) and solvent B 0.1% (v/v) TFA in CH3CN. Fifty microliters of a solution containing 10 mg
(whey protein sample)/mL (solvent A) were loaded onto a C4 column, equilibrated with solvent A. The elution
program involved a linear gradient from 30 to 50% of solvent B in 46 min, at a flow rate of 1 mL/min.
2.4 LC/ESI-MS analysis
A routinary screening on individual whey samples to discriminate A from B β-Lg II variant, otherwise comigrating
in UTLIEF analysis, was carried out using a single quadrupole instrument LC ESI-MS (HP1100-MSD, Agilent
Technologies, Santa Clara, CA, USA) on a 214TP54, 5 μm Vydac C4, 250 × 2.1 mm internal diameter column and
the same chromatographic conditions previously described for RP-HPLC analysis.
2.5 Trypsin enzymatic digestion
The digestion of the whey protein eluted from electrophoretic spots and isolated from chromatographic peak was
carried out following the procedure reported by Mamone et al. (2003).
2.6 Matrix-assisted laser desorption/ionization-time-of-flight-mass spectrometry (MALDI-TOF-MS) analysis
MALDI-TOF-MS experiments were carried out on a Voyager DEPRO mass spectrometer (PerSeptive Biosystems,
Framingham, MA) equipped with delay extraction technology and N2 laser at 337 nm. Mass spectra were acquired
both in positive linear or in reflector mode and 10 mg/mL SA and CHCA both dissolved in 50% ACN/0.1% TFA,
were used as matrices for the analysis of proteins and peptides, respectively. MALDI-TOF analysis of intact
proteins were obtained in linear positive ion mode over the m/z range 10,000–30,000 and were averaged from about
150 laser shots.
The mixtures of tryptic peptides were subjected to a desalting/concentration step with Zip-Tip C18 micro columns
prior to analysis by MALDI-TOF. Spectra were obtained in reflectron positive ion mode over a m/z range 500–4500
and were averaged from about 150 laser shots. External calibration was performed by acquiring separate spectra of
a mixture of standard peptides (Perseptive Biosystems).
Signals detected in the mass spectra were associated with the corresponding peptides on the basis of the expected
molecular weight deduced from the sequence of the whey proteins genetic variants (expasy.org) by using a suitable
computer program (GPMAW 5.1, Lighthouse data, Odense, Denmark).
2.7 Electrospray quadrupole - time of flight - mass spectrometry) ESI-Q-TOF-MS/MS analysis
Tandem MS (MS/MS) data were obtained by using a liquid quadrupole/time-of-flight instrument Q-STAR (Applied
Biosystems, Foster City, CA) equipped with a nanospray interface (Protana, Odense, Denmark). Dried samples
were resuspended in 0.1% TFA, desalted by using ZipTip C18 micro columns, and sprayed from gold-coated
“medium-length” borosilicate capillaries. The capillary voltage used was 800 V. Double-charged ion isotopic
clusters were selected by using the quadrupole mass filter and then induced to fragment by collision. The collision
energy was 20 to 40 eV, depending on the size of the peptide. The collision-induced dissociation was processed by
using Analyst 5 software (Applied Biosystems) as well as the deconvoluted MS/MS spectrum manually interpreted.
3.1 UTLIEF and immunoblotting analysis of donkey whey proteins
By UTLIEF analysis the most representative donkeys whey proteins were identified throughout the pH gradient
according to calculated pI values (Table 1) and to immunoblotting results with α-La and β-Lg specific polyclonal
antibodies (Fig. 1). In addition to the identified whey proteins two unknown components, a and b occurred,
recognised by β-Lg and α-La polyclonal antibodies, respectively (Fig. 1).
From a genetic point of view, these results allowed to conclude that both α-La and β-Lg I were monomorphic. Four
different β-Lg II phenotypes, instead, numbered in decreased order of pI value, occurred in homozygous (lanes 4, 5
and 6) and heterozygous forms (lanes 1, 2, 3 and 8). Finally a defective β-Lg II allele, for the lack of expressed
protein, occurred in lane 7. A similar sample was found in Sicilian (Criscione et al., 2009) and Sardinian donkey
- 24 -
breeds (Conti et al., 1989).
Table 1 Properties of donkey β-Lg. Values were calculated from the amino acid sequences of the
mature proteins provided on http://au.expasy.org/tool
Protein Variant Primary
accession
number
A
P13613
β-Lg I
B
A
P19647
β-Lg II
B
D6QX31
C
D6QX31
D
-
Amino acid
residues
Molecular mass
(Da)
pI
162
162
163
163
163
163
18.528
18.514
18.263
18.227
18.241
18.311
4.79
4.85
4.70
4.70
4.72
4.64
Substitutions
E36→S; S97→T; V150→I
C110→P; M118→T
D →E; C110→P; M118→T
C110→P; D162→G
96
Figure 1 UTLIEF analysis
of representative donkey
whey proteins with double
staining, i) Blue Comassie, ii)
anti α-La and anti β-Lg
specific antibodies.
3.2 Identification of the new β-Lg II E variant by RP-HPLC/ESI/MS analysis
By UTLIEF analysis it could be difficult to discriminate one another A, B and C β-Lg II variants because of their
closer calculated pI values (A = B = 4.70; C = 4.72) than that of D variant (pI = 4.64). At this regard, to correctly
identify the focalised β-Lg II genetic variants, the electrophoretic bands 1, 2, 3 and 4 were excised, in gel digested
with trypsin and the enzymatic mixture of peptides analysed by MS analysis. The MALDI-TOF mass spectrum of
band 1 tryptic digest, obtained by operating in the reflectron positive ion mode, was reported in Fig. 2. All the
identified MH+ signals well fitted with those of calculated tryptic peptides of β-Lg II C. The same analytical
procedure carried out on both electrophoretic bands 2 and 3, gave rise to very similar MALDI-TOF spectra (results
not shown), except for the MH+ values recorded in the m/z 3800 - 4100 range; in this zone two tryptic peptides,
f(92-125) and f(91-125) containing the a.a. substitutions discriminating each other the known A (not found in this
research) B, C and D β-Lg II variants has been identified (insets b, c and d in Fig. 2) (Cunsolo et al., 2007;
Herrouin et al., 2000).
Tacking into account these results and the experimentally measured Mr values of parent proteins (see theoretical
molecular mass in Table 1) determined by LC/MS, C with m/z 18235, B with m/z 18221 and D with m/z 18309, βLg II variants have been ascertained in bands 1, 2 and 3, respectively. This analytical procedure allowed to
discriminate A and B β-Lg II variants otherwise co-migrating in UTLIEF gel on the basis of same calculated pI. At
this regard the results of the present genetic screening indicated the β-Lg II B genetic variant as the most common
at donkey β-Lg II locus, while the β-Lg II A was non been found in this work.
Furthermore, β-Lg II D variant, found either in homozygous (lane 4) or heterozygous form with the known variants
B (lane 1) and C (lane 2) and with the new variant E (band 4, lane 8), was confirmed as the fastest moving variant
towards the cathode (pI = 4.64).
In order to characterize the new β-Lg II E variant, the whey protein sample (lane 8) was chromatographically
separated by RP-HPLC (Fig. 3) and the purified peaks individually characterized by MALDI-TOF MS analysis. In
- 25 -
peak 1, 2 and 4 the Lyz, α-La and β-Lg I B were identified, while only in peak 3 the co-elution of two β-Lg II was
observed. In particular, the measured molecular mass Mr 18314 and Mr 18256 Da allowed us to identify β-Lg II D
and indicated the occurrence of a new genetic variant β-Lg II E (component at Mr 18256 Da).
The MALDI-TOF mass spectrum of the tryptic digest of RP-HPLC peak 3 allowed the assignment of all peptides
with β-Lg II D theoretical peptides, with the exception of two new peptides at Mr 2001.2 Da, f1(E) and 2356.34 Da,
f2(E) (results not shown). The two peptides f1(E) and f2(E) presented a molecular weight lower of 29 and 28 Da
compared to the f1(D) and f2(D) peptides, respectively, in close agreement with the 57 Da molecular mass
difference measured between β-Lg II D and β-Lg II E. The peptides f1(E) and f2(E) were submitted to MS/MS
analysis for sequencing. Peptide f1(E) corresponded to sequence 1-18 with two amino acid substitutions: D2 is
exchanged for N2 and the C-terminal R18 with K18 . Peptide f2(E) corresponded to peptide f2(D) with only one amino
acid substitution V25→A25. Overall, the β-Lg II E amino acid substitutions experimentally observed in this work
were all confined in the N-terminal area of the protein sequence that is known to be conserved among the other βLg II genetic variants.
Figure 3 RP-HPLC profile of
donkey whey protein sample
(lane 8), shown in fig 1.
Figure 2 MALDI TOF-MS spectrum recorded in m/z
500-4500, relative to band 1 excised from the
UTLIEF gel of donkey whey protein sample (lane 5)
shown in Fig. 1. The insets (c, b and d)MALDI TOFMS analysis, recorded in m/z 3800-4100, of β-Lg II
genetic variants contained in 1, 2 and 3, bands
ti l
Three amino acid substitutions characterized β-Lg II E variant in comparison with D variant: D β-Lg II Asp2 Æ E
β-Lg II Asn2, D β-Lg II Arg18Æ E β-Lg II Lys18 and D β-Lg II Val25Æ E β-Lg II Ala25. These results indicated a
very close phylogenic origin of E from D variant. Thus, the proteomic methodology is a powerful tool to underline
the genetic biodiversity inter and/or intra species. In particular, the sensibility of based separative technique as
UTLIEF was very high and able to discriminate between β-Lg II D and E variants and β-Lg II C and B/A variants
differing each other for 0.01 pH unit. From a nutritional point of view the minor content of β-Lg in donkey milk in
addition to quantitative genetic polymorphism occurred at β-Lg II locus (Fig. 1 lane 7) can be related to the
tolerance mechanism of donkey milk in the allergic patients to bovine milk. So, the combined methodologies
applied in this study were able to disclose the complexity and heterogeneity of each donkey protein fraction, as well
as the occurrence of polymorphism at β-Lg II locus. These results may be useful when programming breeding
strategies for preservation and selection of donkey biodiversity, aimed to production of donkey milk for human
consumption. In fact, the variability associated with genetic polymorphism complemented with a major or minor
complexity in the expression of proteins, as β-Lg II, may influence qualitative and quantitative donkey milk
composition and, as a consequence, its allergenic properties.
5. References
Aschaffenburg R, Drewry J (1959) In Proc.s of the 15th International Dairy Congress 3:1631.
Bevilacqua C, Ferranti P, Garro G, Veltri C, Lagonegro R, Leuroux C, Pietrolà E, Addeo F, Pilla F, Chianese L Martin P (2002)
Eur J Biochem 269: 1293-1303.
Businco L, Gianpietro PG, Lucenti P, Lucaroni F, Pini C, Di Felice G (2000) Allergenicity of mare’s milk in children with
cow’s milk allergy. J Allergy Clin Immunol 105: 1031-1034.
Chianese L, Calabrese MG, Ferranti P, Mauriello R, Garro G, De Simone C, Addeo F, Cosenza G, Ramunno L (2010)
Proteomic characterization of donkey milk “caseome”. J Cromatog A 1217: 4834-4840.
- 26 -
Conti A, Napolitano L, Lai P, Pinna W, Godovac-Zimmermann J (1989) Isolation of donkey whey proteins and N-terminal
amino acid sequence of α-lactoalbumins A and B, β-lactoglobulins I and II and lysozyme. Milchwissenchaft 44: 138-141.
Criscione A, Cunsolo V, Bordonaro S, Guastella AM, Saletti R, Zuccaro A, D’Urso G, Marletta D (2009) Donkey’s milk protein
fraction investigated by electrophoretic methods and mass spectrometric analysis. Int Dairy J 19: 190-197.
Cunsolo V, Costa A, Saletti R, Muccili F, Foti S (2007) Detection and sequence determination of a new variant of βlactoglobulins II from donkey. Rapid Commun Mass Spectrom 21: 1438-1446.
Docena GH, Fernandez R, Chirdo FG, Fossati CA (1996) Identification of casein as the major allergenic protein of cow’s milk.
Allergy 51: 412-416.
Giuffrida MC, Cantisani A, Napolitano L, Conti A, Godovac-Zimmermann J (1992) The amino acid sequence of two isoforms
of alpha-lactoalbumin from donkey (Equus asinus) milk is identical. Biol Chem Hoppe-Seyler 373-391.
Godovac-Zimmermann J, Conti A, James L, Napolitano N (1988) Microanalysis of the amino acid sequence of monomeric betalactoglobulin I from donkey (Equus asinus) milk. The primary structure and its omology with a superfamily of
hydrophobic molecule transporters. Biol Chem Hoppe-Seyler 369: 171-179.
Godovac-Zimmermann J, Conti A, Sheil M, Napolitano N (1990) Covalent structure of the minor monomeric β-lactoglobulin
component from donkey milk. Biol Chem Hoppe-Seyler 371: 871-879.
Guo HY, Pang K, Zhang XY, Zhao L, Chen SW, Dong ML, Ren FZ (2007) Composition, Phisiochemical properties, nitrose
fraction distribution and amino acid profile of donkey milk. J Dairy Sci 90: 1635-1643.
Halliday JA, Bell K, Shaw DC (1991) The complete amino acid sequence of feline beta-lactoglobulin II and a partial revision of
the equine beta-lactoglobulin II sequence. Biochim Biophys Acta 1077: 25-30.
Herrouin M, Molle D, Faunquant J, Ballestra F, Maubois JL, Leonil J (2000) New variants identified in donkey milk whey
proteins. J Prot Chem 19: 105-115.
Mamone G, Caira S, Garro G, Nicolai MA, Ferranti P, Picariello G, Malorni A, Chianese L, Addeo F (2003) Casein
phosphoproteome: Identification of phosphoproteins by combined mass spectrometry and two-dimensional gel
electrophoresis. Electrophor 24: 2824-2837.
Mao X, Gu J, Sun Y, Xu S, Zhang X, Yang H, Ren F (2009) Anti-proliferative and anti- tumour effect of active components in
donkey milk on A549 human lung cancer cells. Int Dairy J 19: 703-708.
Martin P, Szymanowska S, Zwierzchowski L, Leroux C (2002) The impact of genetic polymorphismon the protein
composition of ruminant milks. Reprod Nutr Dev 42: 433-459.
Monti G, Bertino E, Muratore MC, Coscia A, Cresi F, Silvestro L, Fabris C, Fortunato D, Giuffrida MG, Conti A (2007)
Efficacy of donkey’s milk in treating highly problematic cow’s milk allergic children: an in vivo and in vitro study.
Pedriatr Allergy Immunol 18: 258-264.
Muraro MA, Giampietro PG, Galli E (2002) Soy formulas and non bovine milk. Ann Allergy Asthama, 89: 97-101.
UniacKe-Lowe T, Huppertz T, Fox PF (2010) Equine milk proteins: Chemistry, structure and nutritional significance. Int Dairy
J 20: 609-629.
- 27 -
Modulating the Release Properties of Active Compounds
from Packaging Materials by a Physicochemical/Nanotechnology Approach
Carlo Alessio Cozzolinoa,b (trichocar@libero.it)
STAA, Dept. of Agriculture - University of Sassari, Sassari, Italy
b
DeFENS, Dept. of Food, Environmental and Nutritional Sciences, Packaging Division - University of Milan,
Milan, Italy
Tutor: Prof. Antonio Pigaa, Prof. Luciano Piergiovannib; Co-tutor: Dr. Stefano Farrisb
a
Over the last decade great effort has been produced in an attempt of obtaining effective controlled release
packaging, in order to extended shelf-life and controlled quality of food products.
The goal of this PhD thesis is firstly the selection of the polymer matrix based on physicochemical criteria
(representing the first step for the production of polymer systems with modulated release properties), and secondly
to study the incorporation and the release of active compounds (lysozyme) from biopolymers (microfibrillated
cellulose - MFC) for food packaging applications (e.g. controlled release system).
Modulazione delle proprietà di rilascio dei composti attivi dai materiali
per il packaging attraverso un approccio fisico-chimico e nanotecnologico
Nell’ultimo decennio è stato profuso un grande impegno nel tentativo di ottenere un imballaggio alimentare a
rilascio controllato di principi attivi, al fine di migliorare le condizioni igienico-sanitarie dei prodotti ed aumentarne
la shelf-life.
Scopo di questa tesi di dottorato è in primo luogo la selezione, basata cu criteri fisico-chimici come primo passo per
la produzione di sistemi polimerici con proprietà di rilascio modulate, della matrice polimerica inglobante i principi
attivi. Il secondo step ha previsto lo studio dei meccanismi di incorporazione e rilascio di antimicrobici (lisozima)
da films biopolimerici (microfibrille di cellulosa) per applicazioni nel settore del packaging alimentare.
Key words: Controlled release system, biopolymers, microfibrillated cellulose, lysozyme.
1. Introduction
Consumer demands and industrial production trends towards minimally processed, fresh, tasty and convenient food
products with extended shelf-life and controlled quality have recently increased. For this reason novel release
systems are expected to grow in the coming years within the food packaging field, also due to the increasing
interest toward the concept of active packaging (Dainelli et al., 2008). The underlying basic idea is to convey an
active molecule (e.g. antimicrobial, antioxidant, etc.) from the polymeric reservoir to the target body (i.e. the food),
maintaining its concentration to a predetermined level over a required time span. This can be accomplished if the
polymer system ‘senses’ and ‘responds’ to specific stimuli, such as temperature (Liu et al., 2011), surrounding
medium (Yeh et al., 2011), pH (Jin and Hsieh, 2005; Klee et al., 2009), light (Costa et al., 2011), ultrasound (Small
et al., 2011), and electric field (Juntanon et al., 2008; Yun et al., 2010), which act as triggers. The main relevant
advantage of this approach is that it allows avoidance of either multiple supplies or direct addition of a large
amount of the active compound directly into the target body. However, to make release systems work efficiently,
controlling the delivery rate over time in a deliberate manner is the crucial point. This is why ‘controlled release
system’ (CRS) appears in most cases a more appropriate definition.
In accordance with the PhD thesis project previously presented (Cozzolino, 2010), this communication reports the
main results concerning:
1) investigation the release kinetics of a model drug-like compound (Coomassie brilliant blue) from polyvinyl
alcohol (PVOH) films into a hydro-alcoholic solution as a function of the physicochemical properties of the
polymer matrix;
2) incorporation and the release of active compounds (lysozyme) from biopolymers (microfibrillated cellulose MFC).
2. Materials and methods
2.1 “Selection of the polymer matrix based on physicochemical criteria” project
Three different types of PVOH were used in this work: 1) PVOH 4-88, 2) PVOH 40- 88, 3) PVOH 10-98.
Coomassie Brilliant Blue G-250 was used as the model active compound. Milli-Q water and ethanol were used for
the preparation of the hydro-alcoholic polymer-dye dispersions.
Film preparation. PVOH pellets were firstly dispersed in hot water. After cooling at room temperature, the filmforming dispersions were loaded with the dye powder. Next, 5 g of the obtained dispersions were poured on glass
- 28 -
Petri plates and dried in an oven at 55°C for 24 h. Dried films were then peeled off the plate and, before analyses,
stored for 2 weeks in a desiccators containing silica gel.
Dye release kinetics. Dye-loaded PVOH films were put into flasks containing a hydro-alcoholic solution at 20°C
under moderate shaking. The dye concentration was measured spectrophotometrically recording the absorption of
the dye at 610 nm at different time intervals over a time span of ~ 33 days. Experimental data were modeled using
the solution of Fick’s second law for a planar sheet with constant boundary conditions (Buonocore et al., 2003):
⎧⎪
8
M t = M ∞ ⎨1 − 2
⎪⎩ π
n =∞
1
∑ (2n + 1)
n =0
2
⎡ Ddye
⎤ ⎫⎪
2
exp ⎢− 2 (2n + 1) π 2 t ⎥ ⎬
⎣ l
⎦ ⎪⎭
where Mt is the amount (mg / kg) of the diffusing compound released at time t (s); M∞ is the corresponding amount
at infinite time; Ddye is the dye apparent diffusion coefficient (cm2 / s) through the polymeric matrix, l is the
thickness (cm) of dry films. X-ray diffraction (XRD), Differential Scanning Calorimetry (DSC) and Field-Emission
Scanning Electron Microscopy (FE-SEM) analyses allowed evaluating the influence of physicochemical aspects on
the release kinetics.
2.2 “Incorporation and release of active compounds from biopolymers” project
Microfibrillar cellulose was produced at the Paper and Fibre Research Institute (PFI, Trondheim, Norway) by two
different types of cellulose: (I) ECF (elemental chlorine free) fully bleached sulphate pulp mainly based on juvenile
Picea abies and (II) ECF (elemental chlorine free) fully bleached sulphate cellulose mainly based on mature Picea
abies with up to 5 wt.% pine (Pinus sylvestris), according to the same manufacturing procedure described by
Turbak et al. and Herrik et al.. Lysozyme from chicken egg white powder (crystalline; ~70000 units/mg) was
purchased from Sigma-Aldrich (Oslo, Norway). Glycerol (redistilled, min 99.5 % w/v) was purchased from VWR
International (Leuven, Belgium). Sodium chloride was purchased from Merck (Darmstadt, Germany). Milli-Q
water with a resistivity higher than 18.2 MΩ cm and ethanol (Fluka Analytical, Oslo, Norway) were used for the
preparation of the hydro-alcoholic solutions (water/ethanol 10 wt.%).
Film preparation. Three different batches of films were prepared for the release tests: 1) MFC films including LYS
(10 wt.% = 1g/10g MFC), coded as M-L10; 2) M-L10, also including glycerol (4 wt.% = 0.4g/10g MFC), coded as
M-L10-G4; M-L10, also including NaCl (10 wt.% = 1g/10g MFC), coded as M-L10-G4-N10. For all the above
formulations, an initial 0.89% water dispersion of MFC was used. Before incorporation in the polymer matrix, the
lysozyme powder was firstly dissolved in cold water at room temperature for 2 hours. When necessary, the third
component (i.e. glycerol or NaCl) was added as the last step of the preparation of the water dispersion, which was
then left to settle for 2 hours. At this point, a known amount of the antimicrobial water dispersion was poured into
Petri dishes (Ø 8.5 cm) to obtain a final film weight of ~20g/m2. Before the release experiments, samples, in the
form of 5¯2 cm2 strips, were stored in a climatic chamber (23° C and 50% RH) for one week. The thickness of
samples was measured at ten different random positions on each sample, using a digital micrometer (Micrometer 51
Lorentzen & Wettre, Stockholm, Sweden).
Lysozyme release kinetics. LYS-loaded MFC films were put into flasks containing two different contact media (50
mL), namely distilled water and water/ethanol 10 wt.% solution, which are two food simulants (simulant A and
simulant B, respectively) within the food contact material legislation. The LYS release experiments were conducted
over a time span of 10 days (after which the release from the MFC films was no longer observed) by keeping the
flasks at 6°C and 20°C under moderate shaking (100 rpm) using a Flask Dancer 270292 orbital shaker from Boekel
Scientific (Feasterville, PA, USA). The release kinetics were built by assessing the LYS concentration in the
simulant at different time intervals, by recording the absorption at 280 nm using a Lambda 650 UV/VIS
spectrophotometer (PerkinElmer, Waltham, MA, USA). The absorbance values were then converted into
concentration values by the calibration curve, which was obtained by means of standard solutions (three replicates)
from 50 ppm to 250 ppm (mg / kg). Each data point of the release curves represents the mean of nine replicates.
Laser profilometry tests were also conducted to check for any potential influence of LYS, glycerol, and NaCl on the
surface roughness of the MFC films.
3.1 “Selection of the polymer matrix based on physicochemical criteria” project
The final amount of dye released from samples 4-88, 40- Figure 1 Back-shifted experimental (symbols) and
88, and 10-98 was, respectively, 60%, 45%, and 10% of calculated (line) release data of the dye at 20 ◦C from the
the initial amount loaded in the films. All the samples PVOH film samples.
showed an initial ‘induction’ or ‘lag’ phase (Fig. 1).
Figure 1 displays the fitting of the mathematical model
expressed by Fick’s second law to the experimental data.
This procedure allowed for estimating the apparent
diffusion coefficient (D) of the released dye molecules for
all the three PVOH films. The D1/l2 values can be easily
inferred from Table 1. Fick’s second law was also fit to
- 29 -
the experimental data underlying the sudden jump observable in the dye release evolution (see arrow in Fig. 1), to
which was associated a second diffusion coefficient (D2). To do this, a new independent procedure taking into
account new and different starting points (t1, t2, and t3 for PVOH samples 40-88, 10-98, and 4-88, respectively, see
Figure 1) was used. As indicated by the D2/l2 value, which was significantly lower for sample 40-88 (1.42 × 10-7 s-1)
compared to samples 10-98 and 4-88 (6.31 × 10-7 s-1 and 6.15 × 10-7 s-1, respectively), this second ‘release step’ was
less pronounced for sample 40-88, presumably due to its higher molecular weight.
Table 1 Dry weight, moisture content, thickness (l), partition coefficient PVOH/solvent (K), and diffusion coefficients (D1 and
D2) of the dye-loaded PVOH films. Different superscripts within a group (i.e. within each parameter) denote a statistically
significant difference (p < 0.05).
PVOH type
a) 4-88
b) 40-88
c) 10-98
Dry weight
(g)
0.27a ± 0.011
0.26b ± 0.004
0.26ab ± 0.002
Moisture content
(%)
1.80cd ± 0.52
1.12c ± 0.41
1.93d ± 0.41
l
(μm)
63.75ef ± 6.28
64.17e ± 0.88
56.33f ± 5.01
K
0.68 ± 0.08g
1.24 ± 0.14h
9.95 ± 0.96i
D1
(cm2/s)
8.33E-11
8.33E-11
1.16E-11
D2
(cm2/s)
2.50E-11
5.83E-12
2.00E-11
XRD (Table 2) and DSC (Table 3) analyses suggested that Table 2 Main parameters obtained from the XRD traces
crystallinity influenced the extended induction phase of the different PVOH films.
observed for the sample 10-98, as the higher amount of
Crystallite
Peak
Peak
crystallite regions could have induced a decrease in the PVOH Diffraction
size (nm)
type
peak (2q)
intensity
area
relaxation rate of the polymer chains. The enhanced
4-88
19.68
1000
4727.61
2.30
tendency to generate crystal domains, probably due to the
40-88
19.20
1000
2802.89
3.53
synergistic effect of both a high hydrolysis degree and a
10-98
19.06
869.24
1656.35
4.04
low molecular weight, also affected the final release
profiles.
PVOH
type
4-88
40-88
10-98
Tg (°C)
Tm (°C)
xc (%)
60.14 (± 0.54)a
66.94 (± 3.38)b
71.77 (± 3.43)b
170.21 (± 1.35)c
168.12 (± 2.51)c
219.55 (± 0.75)d
15.98 (± 1.24)e
13.62 (± 1.71)e
50.96 (± 2.13)f
Table 3 Glass transition temperature (Tg), melting
temperature (Tm), and crystallinity degree (xc) obtained
from the DSC traces of the different PVOH films.
Different superscripts within a group (i.e. within each
parameter) denote a statistically significant difference (p
< 0.05).
Observations arising from the SEM analysis suggested that the release kinetics of the molecule dye from the PVOH
matrices can be somehow influenced by different morphologies (presumably linked to different molecular
arrangements). Sample 4-88 exhibited a spiky “stalactite-like” morphology, sample 40-88 showed an apparently
rougher morphology, with an “orange peel-like” texture and sample 10-98 displayed a more compact and tighter
structure (Cozzolino et al., 2012).
Figure 2 Cross-sectional SEM images (20k×,
left column; 40k×, right column) of the three
PVOH films. Images in the same row are from
the same sample.
Table 4 pH values of matrices and
simulants
Samples
MFC
MFC + Glycerol 4%
MFC + NaCl 10%
Simulant A
Simulant C
pH
6.9
7.3
7.4
5.7
6.2
3.2 “Incorporation and the release of active compounds from biopolymers” project
The main focus of the study was to assess the influence of two different simulants at two different temperature
values on the release of LYS from MFC. Alike all hydrophilic molecules, MFC exhibits faster and more intense
release of the active compound. The overall release kinetics depends, besides intrinsic factors of the polymer
matrix, on external parameters such as pH, ionic force, and temperature of the medium. Within our work, we have
assumed LYS as homogeneously dispersed into the MFC matrix. LYS has four disulfide bonds that hold the threedimensional structure, with the polar groups on the outside and inside the hydrophobic group. At pH values of our
matrices (Table 4) the LYS, which has an isoelectric point of 10.7, has a net positive charge due to NH3+ groups.
Under these conditions the LYS probably binds to MFC only through weak ion-dipole bonds.
3.2.1 Influence of temperature and simulant on the lysozyme release from MFC
As shown in Table 5, the release of LYS from the MFC films was very similar for a given stimulant. Moreover,
- 30 -
there was not statistically significant difference between 6° C and 23° C. For this reason, the temperature cannot be
considered as a trigger for the release of LYS. It can be also noticed that the release in water was approximately
threefold compared with the hydro-alcoholic simulant. This fact can be explained considering the high hydrophilic
nature of MFC, which allows a more intense swelling of the structure and hence a greater release in water.
Table 5 Maximum released of LYS to MFC after ten days. aLetters denote statistically significant differences
within groups (p < 0.05).
Samples
Max release (%)a
6°C Simulant C
23°C Simulant A
5.00 (±0.67)bcd
11.51 (±1.75)abc
MFC + LYS
6°C Simulant A
11.96 (±2.46)ab
23°C Simulant C
4.48 (±0.61)cd
MFC + LYS + Gly
9.33 (±0.15)abcd
3.46 (±1.52)d
10.21 (±0.28)abcd
4.33 (±1.06)d
MFC + LYS + NaCl
12.78 (±3.28)a
9.70 (±3.61)abcd
8.99 (±2.80)abcd
9.36 (±2.51)abcd
3.2.2 Influence of temperature and simulant on the lysozyme release from MFC with glycerol and NaCl
One approach to modulate the release is to use release-modulating agents. Table 5 shows the LYS release from
MFC after the addition of glycerol and NaCl. The plasticizer effect of glycerol (physical effect) is counterbalanced
by the presence of three polar -OH groups (chemical effect) that bind
Table 6 Thickness of different samples.
further the LYS. For this reason, contrary to what was expected, an *
Letters denote statistically significant
increased release of LYS did not occurred, being indeed observed a differences within groups (p < 0.05).
lower release compared to the films of only MFC, in all test conditions.
The addition of NaCl induces a greater aggregation of the fibrils, most
Samples
Thickness (μm)*
likely due to the increased extent of weak interactions between ions and
MFC + LYS
21.67 (±1.15)a
polymer matrix. This is also confirmed by the reduced thickness of the
MFC + LYS + Gly
22.33 (±0.58)a
films treated with NaCl compared with the other formulations (Table 6).
In addition, the same films exhibited a less pronounced release of LYS
MFC + LYS + NaCl
16.67 (±0.58)b
when immersed in water at 23° C. A double release is found with
hydroalcoholic simulant, at both temperatures. This may be due to the higher affinity of LYS with ethanol, while
the NaCl does not have much affinity with ethanol (Simão P. Pinho and Eugénia A. Macedo, 2005), thus favoring
the release of the same LYS.
3.2.3 Laser profilometry analysis
The glycerol-added MFC films showed a statistically significant difference (Table 7) compared with the other
samples, presenting a less rough surface area. The smoother morphology could be attributed to the plasticizer effect
of glycerol.
Table 7 Surface roughness of samples. *Letters denote
statistically significant differences within groups (p <
0.05).
Samples
MFC
MFC + LYS
MFC + LYS + Gly
MFC + LYS + NaCl
Surface roughness (μm)*
0.86391 (±0.02043)a
0.86875 (±0.04004)a
0.81523 (±0.03019)b
0.88462 (±0.02415)a
4. Conclusions and Future Perspective
The results obtained in these works showed that the release from biopolymers is mainly controlled by its chemical
composition (i.e. the degree of substitution of the acetate groups by hydroxyl groups, which in turn dictates the
degree of crystallinity, in the case of the PVOH-dye study). The crystallinity played an important role in controlling
the release properties of the matrices insomuch as the final release system can be reasonably considered as a crystal
dissolution-controlled system. Molecular weight was shown to affect the overall release properties to a less extent.
Apparently, higher level of molecular chain entanglement hindered the mobility of the entrapped molecule through
the molecular polymer chains. The use of ethanol also influenced the ultimate release properties of the PVOH and
MFC samples. Due to its non-solvent feature toward this polymer, ethanol made possible avoiding both abrupt
volumetric expansion and complete dissolution of the matrices over the entire time of analysis. Finally, the affinity
between the polymer matrix and the loaded molecule could have promoted the establishment of new weak
intermolecular forces, e.g. ion-dipole interactions, which would have somehow affected the final amount of the
compounds (dye, lysozyme) released.
These results, together with the mathematical modeling of the release kinetics, can be profitably used for the
development of delivery systems for different applications (e.g. food packaging), where the controlled release over
time of an active molecule is the target. However, further studies are needed to test the microbiological effect of
- 31 -
antimicrobial films on selected food systems, together with further characterization such as the mechanical
properties of the MFC films.
5. Selected References
Buonocore GG, Del Nobile MA, Panizza A, Bove S, Battaglia G, Nicolais L (2003) Modeling the lysozyme release kinetics
from antimicrobial films intended for food packaging applications. J Food Sci 68: 1365-1370.
Costa D, Valente AJM, Miguel MG, Lindman B (2011) Light triggered release of solutes from covalent DNA gels. Colloid
Surface A 391: 80-87.
Cozzolino CA (2010) Development of an active packaging for the controlled release of natural antimicrobials, obtained from
biomacromolecules In Proc.s of the 15th Workshop on the Development in the Italian PhD Researchon Food Science
Technology and Biotechnology, Portici, Napoli, 15-17 Settembre 2010.
Cozzolino CA, Blomfeldt T OJ, Nilsson F, Piga A, Piergiovanni L, Farris S (2012) Dye release behavior from polyvinyl alcohol
films in a hydro-alcoholic medium: influence of physicochemical heterogeneity. Colloid Surface A 403: 45-53.
Dainelli D et al. (2008) Active and intelligent food packaging: legal aspects and safety concerns. Trends Food Sci Tech 19:
S103-S112.
Herrick FW, Casebier RL, Hamilton JK, Sandberg KR (1983) Microfibrillated cellulose: Morphology and accessibility. J Appl
Polym Sci Appl Polym Symp 37: 797-813.
Jin X, Hsieh Y-L (2005) pH-responsive swelling behavior of poly(vinyl alcohol)/ poly(acrylic acid) bi-component fibrous
hydrogel membranes. Polymer 46: 5149-5160.
Juntanon K, Niamlang S, Rujiravanit R, Sirivat A (2008) Electrically controlled release of sulfosalicylic acid from crosslinked
poly(vinyl alcohol) hydrogel. Int J Pharm 356: 1-11
Klee SK, Farwick M, Lersch P (2009) Triggered release of sensitive active ingredients upon response to the skin’s natural pH.
Colloid Surface A 338: 162-166.
Liu H-B, Yan Q, Wang C, Liu X, Wang C, Zhou X-H, Xiao S-J (2011) Saccharideand temperature-responsive polymer brushes
grown on gold nanoshells for controlled release of diols, Colloid Surface A 386: 131-134
Simão P Pinho and Eugénia A Macedo (2005) Solubility of NaCl, NaBr, and KCl in water, methanol, ethanol, and their mixed
solvents. J Chem Eng Data 50: 29-32.
Small EF, Willy MC, Lewin PA, Wrenn SP (2011) Ultrasound-induced transport across lipid bilayers: influence of phase
behavior. Colloid Surface A 390: 40-47.
Turbak AF, Snyder FW, Sandberg KR (1983) Microfibrillated cellulose, a new cellulose product: Properties, uses, and
commercial potential.J Appl Polym Sci: Appl Polym Symp 37: 815-827.
Yeh K-W, Chang CP, Yamamoto T, Dobashi T (2011) Release model of alginate microcapsules containing volatile tea-tree oil,
Colloid Surface A 380: 152-155.
Yun J, Im JS, Lee Y-S, Bae T-S, Lim Y-M, Kim H-I (2010) pH and electro-responsive release behavior of
MWCNT/PVA/PAAc composite microcapsules. Colloid Surface A 368: 23-30.
- 32 -
Occurrence of Deoxynivalenol and Deoxynivalenol-3-Glucoside
in Durum Wheat
Andrea Dall’Erta (andrea.dallerta@nemo.unipr.it)
Dept. of Food Science, University of Parma, Italy
Tutor: Prof. Gianni Galaverna
This study is aimed at the development of new analytical methods for the determination of trichothecenes in durum
wheat samples. A multiresidual UPLC-ESI-MS method has been set up for the simultaneous determination of
mycotoxins and their masked forms, as well as an optimized extraction protocol, based on the QuEChERS
approach. These methods were applied to the analysis of 150 naturally contaminated durum wheat samples.
Presenza di Deossinivalenolo e deossinivalenolo-3-glucoside in grano duro
Il seguente studio ha avuto come scopo lo sviluppo di una nuova metodica analitica per la determinazione di
tricoteceni in campioni di grano duro. A tal fine è stato sviluppato un metodo multi residuale basato sull’utilizzo di
una strumentazione UPLC-ESI-MS per la determinazione delle micotossine e delle loro forme mascherate. È stata
inoltre ottimizzata una nuova metodica di estrazione basata sull’approccio QuEChERS che, in aggiunta al
precedente metodo messo a punto, è stata utilizzata per l’analisi di 150 campioni di grano duro naturalmente
contaminati.
Key words: Fusarium Head Blight, masked mycotoxins, durum wheat.
1. Introduction
In according with the PhD thesis project previously described, this oral presentation displays the results of the
following activities: i) development of a new analytical method for the analysis of deoxynivalenol and its masked
forms; ii) analysis of durum wheat samples; iii) study of statistical correlations between samples characteristics and
mycotoxins content.
2. Deoxynivalenol and Deoxynivalenol-3-glucoside
Deoxynivalenol (DON) is a trichothecene mycotoxin mainly produced by fungus Fusarium graminearum that
inhibits DNA, RNA and protein synthesis. It is responsible for hemorrhagic and anorexic syndromes as well as
neurotoxic and immunotoxic effects in mammals (Petska, 2010). On account of this evidence, the European
Communities (EC Regulation 1881/2006) has fixed the limit for this mycotoxin to 1250 µg/kg for unprocessed
cereals (other than maize, durum wheat and oat) and to 1750 µg/kg for unprocessed durum wheat and oat. In Italy
the whole durum wheat production is used for food, particularly for pasta production, therefore DON contamination
is a major issue for the Italian food chain. In particular, during the growing season 2007-2008, DON has been found
in FHB-infected durum wheat kernels in Emilia-Romagna at levels exciding the legal limits (Rossi, 2008). The
production of DON by Fusarium spp. is believed to play a significant role in pathogenesis: resistant cereal lines
inoculated with pathogens of the genus Fusarium contain lower amounts of DON in the grain in comparison with
susceptible ones. Recently, it was shown that plants can reduce the toxicity of mycotoxins either by chemical
modification and/or by inclusion into the plant matrix components by producing mycotoxin conjugates (“masked
mycotoxins”). In particular, it has been shown that cereal crops exposed to DON infection are capable of
detoxifying this mycotoxin. In this context, one major pathway is the conjugation of DON to a glucose moiety
giving rise to deoxynivalenol-3-glucoside (D3G). D3G has been isolated from Zea Mays suspension cultures that
were treated with DON and from contaminated wheat (Berthiller et al., 2005). Miller (1983) was among the first to
speculate that formation of a less toxic DON conjugate might be responsible for partial Fusarium Head Blight
(FHB) resistance of wheat. Lemmens (2005) demonstrated that the conversion of DON to D3G in bread wheat
(Triticum aestivum L.) is strongly related to the plant resistance towards Fusarium Head Blight. Furthermore, a
UDP-glucosyl transferase from Arabidopsis thaliana has been identified, which catalyzes transfer of glucose from
UDP-glucose to the hydroxyl group at the carbon 3 of DON and 15 acetyl deoxynivalenol and 13 acetyl
deoxynivalenol. So far, D3G has been described to occur in bread wheat (grains, semolina and flour), maize
(grains), oats (flour), barley, malt (grist and extract), and beer (Kostelanska et al., 2009). Analytical methods
applied for DON and D3G determination are commonly based on mass spectrometric techniques (Zachariasova et
al., 2010), although different sample clean up approaches have been reported. In particular, difficulties in D3G
recovery are ascribable to the higher polarity in comparison to its precursor and to the different behavior towards
antibodies. For this reason, since classical clean up methods based on immunoaffinity columns cannot be applied on
account of low recovery rates, the “dilute and shot” approach has been often proposed (Berthiller et al., 2009).
3. QuEChERS Method
- 33 -
The ‘Quick Easy Cheap Effective Rugged and Safe’ (QuEChERS) sample preparation method has been introduced
by Anastassiades (2003).This method has many advantages over traditional techniques: high simple throughput, the
use of smaller amounts of organic solvent and the use of no chlorinated solvents. QuEChERS extraction is a rapid
and economic method for food contaminants extraction. This procedure has been applied with success in several
nonfatty (<2%) and low-fat (2-20%) food matrixes, like milk, eggs and avocado to determine various compounds in
foods such as pesticides, antibiotics and acrylamide. Very recently, the application of a QuEChERS-like
purification followed by UPLC-TOF/MS analysis for trichothecene determination in wheat has been reported by
Zachariasova (2010). This method allowed to obtain satisfactory results in terms of recovery and method
sensitivity.
In this PhD thesis we analyzed Deoxynivalenol (DON) and Deoxynivalenol-3-glucoside (D3G) occurrence in
durum wheat samples (n = 150) collected in 2010 from 3 areas located in Northern-Central Italy. The extraction
procedure was optimized for DON in durum wheat by chemometry-assisted Design of Experiment (DoE) based on
a four factor Box-Behnken design, followed by LC-ESI-MS analysis. The optimized protocol was then applied to
D3G analysis. Validation parameters were given for the main target analytes. Results were statistically compared
and analyzed in order to verify potential correlations with the pathology.
5.1 Sampling strategy and sample collection
A total number of 150 durum wheat samples (25 lines x 2 reps x 3 environments) were analyzed for DON, D3G
toxin content. Samples, belong to 25 inbred lines (F10..11), were collected from three different durum wheat
growing areas located in Northern-Central Italy, namely Argelato (Bologna, 44°39'03.52"N 11°20'34.47"E), Poggio
Renatico (Ferrara, 44°46'22.68"N 11°25'46.58"E), and Falconara (Ancona, 43°38'05.59"N 13°21'23.24"E).
5.2 Trichothecenes extraction method
For toxin content evaluation, an amount of 50 g of whole mill flour of each line was prepared in a Cyclotec™
sample mill (FOSS Analytical A/S, Hillerød, Denmark). After milling, samples were maintained at -20°C in plastic
bags until analysis. A modified QuEChERS method was applied for the extraction of target mycotoxins (Sospedra
et al., 2010). In particular, 2 g of sample, weighted in a 50 ml centrifuge tube, were added with 1.2 g of NaCl and
7.5 ml of methanol:acetonitrile (80:20, v/v). After 1 min of homogenization step with Ultraturrax IKA-T18 basic
(IKA®-Werke GmbH & Co. KG, Staufen, Germany), sample was centrifuged for 5 minutes at 3500 rpm (Universal
320 R Hettich, Tuttlingen Germany). The surnatant (1 ml) was transferred into a 2 ml vial and added by a proper
amount of internal standard solution in order to get a final concentration of 0.5 mg/Kg. After solvent evaporation,
the extract was re-dissolved in 300 µl of water/acetonitrile (80/20 v/v) and analysed by UPLC-ESI/MS. The
extraction procedure was optimok grazieeised through the application of a Design of Experiment (DoE) approach,
based on a Box-Behnken method. In particular, 4 factors (methanol and acetonitrile volume, NaCl and MgSO4
concentration) were included, considering 3 levels for each factor.
5.3 Trichothecenes determination by UPLC-ESI-MS
The UPLC-ESI-MS analyses was carried out with an Acquity UPLC separation system (Waters Co., Milford, MA,
USA) equipped with an Acquity Single Quadrupole MS detector with an electrospray source. Chromatographic
conditions were the following: column, Acquity UPLC BEH C18 (1.7 μm, 2.1 x 50 mm); flow rate, 0.35 mL/min;
column temperature, 30°C; injection volume, 5 μL; gradient elution was performed using 0.1 mM sodium acetate
solution in bidistilled water (eluent A) and methanol (eluent B), both acidified with 0.2% formic acid. Initial
conditions were set at 2% B for 1 minute, then eluent B was increased to 20% in 1 minute. After an isocratic step (6
minutes), eluent B was increased to 90% in 9 minutes. After a 3 minutes isocratic step (90% B), the system was
reequilibrated to initial conditions for 2 min. The total analysis time was 22 minutes. The ESI source was operated
in positive ionization mode. MS parameters were as follows: capillary voltage, 2.50 kV; cone, 30 V; source block
temperature, 120°C; desolvation temperature, 350°C; cone gas, 50 Lh-1; desolvation gas, 850 Lh-1. Detection was
performed using single ion monitoring mode (SIM) using the following ions: DON, 319 m/z; D3G, 481 m/z;
DON13C (internal standard), 334 m/z. Matrix-matched calibration curves (calibration range 0.10-2.50 mg/kg) were
used for target analyte quantification. A good linearity was obtained for all the considered mycotoxins (r2 > 0.99).
For all the target compounds, limit of quantification (LOQ) and limit of detection (LOD) were lower than 30 µg/Kg
and than 10 µg/Kg respectively. Recovery experiments were performed by spiking a blank wheat matrix at two
different concentration levels (1 mg/kg and 2.5 mg/Kg).
5.4 Experimental design - Multivariate optimization.
In order to determine the effect of solvents and salts on the DON recovery in wheat, response surface methodology
was applied with a Box-Behnken experimental design. The effects of four factors in a single block of 24 sets of test
conditions and 3 central points were studied. The order of experiments was fully randomized. Three levels were
attributed to each factor. Statistical analyses were performed with the software package Statistica v.8.0 (StatSoft.
Inc. Tulsa, OK 71104. USA). The Pareto chart was used for data exploration. A second Box-Behnken experimental
design was applied on the two main factors found to affect DON recovery in durum wheat. Also in this case, the
order of experiments was fully randomized and three levels were attributed to each factor.
- 34 -
6.1 Method development and validation
Extraction parameters were optimized using a Box-Behnken experimental design, including 4 factors (volume of
methanol and acetonitrile, NaCl and MgSO4 concentration) with 3 levels for each factor. The experimental design,
considering all parameters and factors, designed 27 testing, in order
Figure 1 Pareto chart obtained for the
to optimize the recovery of DON in wheat samples. Deoxynivalenol
preliminary
Box-Behnken
design
of
was chosen as target compound for the optimization procedure
experiment. Factors: A, methanol; B,
acetonitrile; C, NaCl; D, MgSO4.
instead of D3G since certified reference materials for D3G are not
4 3-level factors, 1 Blocks, 27 Runs; MS Residual=2672.512
commercially available so far. However, the optimized protocol was
A
3.070
then applied to D3G spiked samples in order to evaluate whether the
B
2.714
recovery of this compound was satisfactory under the applied
AB
-.498
conditions. Analyses were performed on blank wheat samples
C
.411
spiked at a known DON level (500 µg/Kg). The standardized effect
AD
-.352
of the independent variables and their interactions on the dependent
AC
.340
variable was investigated by Pareto chart, which quantifies the main
BC
.251
influence of the independent variables and interactions with their
BD
.230
CD
-.110
relative significance on the extraction procedure. A positive value
D
.092
for the estimated effects indicates an increase in the extraction yield
p=.05
if the variable increases to its higher level, while a negative value
Standardized Effect Estimate (Absolute Value)
indicates that a better extraction yield is obtained at low levels of the
variables. The interpretation of the chart indicates that the factors A (methanol) and B (acetonitrile) are significant,
while salts do not significantly influence the recovery of mycotoxin. The positive value obtained for both solvents
indicated that the extraction yield increases with the increase of these factors. Therefore, a Box-Behnken design
was carried out considering only these two factors fit for purpose critical variables. A total of 9 experiments were
needed to estimate the model. The results of this limited set of experiments provided a statistical model used to
optimize the extraction conditions. Duplicate extractions were carried out for each run, obtaining a relative standard
deviation value lower than 0.5%. Results obtained from each analysis were elaborated with surface charts that
enabled us to calculate the optimal condition for the best recovery of mycotoxin during extraction, finding that the
optimized volumes for acetonitrile and methanol were 10.5 ml and 5 ml, respectively. The addition of salts in the
extraction mixture is very important since it ensures the disaggregation of the matrix thanks to the salting out effect.
On the other hand, the lack of significance of these factors indicates that recovery efficiency is not affected by salt
amount. Thus, salt concentrations were fixed in the protocol at low values in order to limit ion
suppression/enhancement effects during the mass spectrometric analysis. The chosen parameters were used for the
validation of the extraction procedure, which has been performed analyzing blank samples fortified with DON and
D3G at two spiking levels: 1 and 2.5 mg/Kg. The method showed high recovery and reproducibility values,
obtained by applying the optimized protocol to blank samples (n = 2), spiked with all the target toxins at 2 different
concentration levels, as shown in Table 2. All the analyses were performed in duplicate. The method accuracy was
also tested by measuring a Certified Reference Material (wheat) naturally contaminated by DON (declared
concentration: 1062±110 µg/Kg), obtaining a recovery of 85±2% and a z-score of 1.45. A good recovery values
have been obtained not only for DON, but also for D3G. The use of a methanol/acetonitrile extraction mixture
instead of a water/acetonitrile mixture allowed for the satisfactory recovery of the more polar glucoside. Indeed, as
a possible explanation of this result, the use of a water/acetonitrile mixture resulted in a phase separation, due to the
high salt concentration, and to the consequent transfer of analytes into the organic layer, transfer which is not
quantitative for the highly polar D3G. On the other hand, the use of a methanol/acetonitrile mixture do not induce
such a separation, thus allowing the quantitative extraction of the analyte. For the analysis, an UPLC-ESI/MS
method was developed starting from a previous method proposed by our group (Dall’Asta et al., 2004), which
exploit the use of sodium acetate added to the eluent as cationization agent: this approach was found to be very
efficient in enhancing the method sensitivity using single quadrupole mass spectrometry. In order to avoid ion
suppression/enhancement phenomena, the flow was diverted to waste during the initial conditioning step of the
chromatographic separation, performed at 98% water. Moreover, isotopically labelled 13C-DON was used as
internal standard in order to correct possible matrix effect affecting the peak intensity.
6.2 DON and D3G determination in durum wheat
Using the developed method, occurrence of Don and D3G was assessed in n = 150 durum wheat samples produced
in three different districts of northern Italy during the 2009-2010 growing season. As far as mycotoxin
contamination, all the samples were found positive for DON contamination, with a concentration varying between
47 and 3715 µg/kg. D3G was detected in 85% of the analyzed samples with a concentration range between 46
µg/kg and 842 µg/kg. In order to verify the possible relationship between mycotoxin contamination and harvesting
areas, the dataset was analysed by OneWay-ANOVA (α = 0.05), showing that samples harvested in Ferrara area
(code: 3) were characterized by a significantly higher amount of DON (p = 0.000) and D3G (p = 0.001) in
comparison to those harvested in the other districts. The mean data as well as the contamination ranges for the
considered area are reported in Figure 2. It is noticeable that the DON mean value for samples harvested in Ferrara
was found to be 2055±220 μg/kg, thus higher than the EU legal limit for raw wheat. This difference in
- 35 -
contamination levels is mainly due to local microclimate and agronomical conditions during the crop growing
season.
6.3 DON and D3G correlation to Fusarium Head Blight resistance in durum wheat
Contamination data were then statistically elaborated by considering the 0-9 fusariosis ranking scores, as an index
of the infection virulence. The ranking score summarizes the percentage of infected plants per plot and the infection
severity in the plants. In particular, a non parametric Spearman’s correlation test was performed (two tails, α =
0.05) even in consideration of the relatively small sample number considered for this study. Besides DON and D3G
concentrations, also the D3G/DON ratio has been considered. As first, a positive correlation was found among
DON and D3G concentrations, showing that high DON levels usually correspond to high D3G levels. In addition, a
significant positive correlation was found among D3G/DON ratio values and FHB ranking scores, in agreement
thus with what already reported by Lemmens (2005) for bread wheat.
District
District
Figure 2 Box plots obtained for DON and D3G occurrence in durum wheat (District’s codes: 1 Argelato, 2 Falconara, 3 Ferrara.
7. Conclusion
In this PhD thesis project a new extraction method has been developed and applied to 150 samples of durum wheat
coming from three different Italian areas and belonging to 25 genotypes; all analyzed samples resulted positive for
Don contamination and in particular samples collected in district 3 (Ferrara) displayed an high value of
deoxynivalenol contamination that exceed the EU legal limit for deoxynivalenol in raw wheat fixed to 1750 µg/kg.
Furthermore positive correlations were observed between Don and D3G concentration and zone, genotypes and
plant deseases.
8. References
Anastassiades M, Lehotay SJ, Stajnbaher D, Schenck FJ (2003) Fast and easy multiresidue method employing acetonitrile
extraction/partitioning and "dispersive solid-phase extraction" for the determination of pesticide residues in produce. J AOAC
International 86: 412-431.
Berthiller F, Dall'Asta C, Corradini R, Marchelli R, Sulyok M, Krska R, Adam G, Schuhmacher R (2009) Occurrence of
deoxynivalenol and its 3--D-glucoside in wheat and maize. Food Addit Contam A 26: 507-511.
Berthiller F, Dall'Asta C, Schuhmacher R, Lemmens M, Adam G, Krska R (2005) Masked mycotoxins: determination of a
deoxynivalenol glucoside in artificially and naturally contaminated wheat by liquid chromatography-tandem mass
spectrometry. J Agric Food Chem 53: 3421-3425.
Dall’Asta C, Sforza S, Galaverna G, Dossena A, Marchelli R (2004) Simultaneous detection of type A and type B trichothecenes
in cereals by liquid chromatography-electrospray ionization mass spectrometry using NaCl as cationization agent. J
Chromatogr A 1054: 389-395.
Kostelanska M, Hajslova J, Zachariasova M, Malachova A, Kalachova K, Poustka J, Fiala J, Scott PM, Berthiller F, Krska R
(2009) Occurrence of deoxynivalenol and its major conjugate, deoxynivalenol-3-glucoside, in beer and some brewing
intermediates. J Agric Food Chem 57: 3187-3194.
Lemmens M, Scholz U, Berthiller F, Dall'Asta C, Koutnik A, Schuhmacher R, Adam G, Buerstmayr H, Mesterházy A, Krska R,
Ruckenbauer P (2005) The ability to detoxify the mycotoxin deoxynivalenol colocalizes with a major quantitative trait locus
for Fusarium head blight resistance in wheat. Mol. Plant Microbe Interact 18: 1318-1324.
Miller JD, Young JC, Trenholm HL (1983) Fusarium toxins in field corn. I. Time course of fungal growth and production of
deoxynivalenol and other mycotoxins. Can J Bot 61: 3080-3087.
Petska JJ (2010) Deoxynivalenol: mechanisms of action, human exposure, and toxicological relevance. Arch Toxicol 84: 663679.
Rossi V (2008) La fusariosi della spiga: una annata favorevole alla malattia che conferma però l’affidabilità dei sistemi di
previsione. Filiera grano duro news 8: 2.
Sasanya JJ, Hall C, Wolf-Hall C (2008) Analysis of deoxynivalenol, masked deoxynivalenol, and Fusarium graminearum
pigment in wheat samples, using liquid chromatography-UV-mass spectrometry. J Food Prot. 71: 1205-1213.
Sospedra I, Blesa J, Soriano JM, Manes J (2010) Use of modified quick easy cheap effective rugged and safe sample preparation
approach for the simultaneous analysis of type A- and type B-trichothecenes in wheat flour. J Chromatogr A 1217: 14371440.
Skrbic B, Malachova A, Zivancev J, Veprikova Z, Hajslova J (2011) Fusarium mycotoxins in wheat samples harvested in
Serbia: A preliminary survey. Food Control 22: 1261-1267.
Zachariasova M, Lacina O, Malachova A, Kostelanka M, Poutska J, Godula M, Hajslova J (2010) Novel approaches in analysis
of Fusarium mycotoxins in cereals employing ultra performance liquid chromatography coupled with high resolution mass
spectrometry. Anal Chim Acta 662: 51-61.
- 36 -
Fate of Mycotoxins in Cereal Based Products and Assessment
of their Bioaccessibility through an in vitro Digestion Model
Elisabetta De Angelis (elisabetta.deangelis@ispa.cnr.it)
Institute of Sciences of Food Production, National Research Council of Italy (ISPA-CNR)
Tutor: Dr. Linda Monaci
The object of this Ph.D project is to investigate the influence of baking on DON, T-2 and HT-2 levels in cereal
based products. Mycotoxin degradation/modification is likely to occur during food processing with the occurrence
of different conjugated forms. The extent of degradation and appearance of modified mycotoxins were thoroughly
investigated both in the starting flour and respective bread by using a new method optimized in this research project
based on HPLC-High Resolution Mass Spectrometry. Ultimately, naturally contaminated breads analysed by LCMS were further subjected to in vitro digestion aiming at assessing the stability of the native mycotoxins and their
conjugated forms in the digestive biofluids.
Distribuzione e trasformazione di micotossine in prodotti alimentari
e valutazione della loro bioaccessibilità mediante modello di digestione in vitro
La presente tesi di dottorato ha come oggetto lo studio dell’influenza del trattamento termico sulla distribuzione
delle micotossine DON, T-2 e HT-2 in prodotti a base di cereali. Durante la lavorazione degli alimenti le
micotossine possono subire degradazione e/o modificazioni chimiche con conseguente produzione di forme
coniugate. In questo lavoro è stata studiata l’entità di degradazione delle micotossine e la formazione di relative
forme coniugate durante la trasformazione dalla farina al panetto utilizzando un nuovo metodo HPLC-MS ad Alta
Risoluzione messo a punto in questo lavoro di tesi. E’ stata successivamente monitorata la stabilità delle
micotossine sia in forma nativa che coniugata in campioni di pane naturalmente contaminato sottoposti a digestione
in vitro.
Key words: Trichothecenes, T-2, HT-2, DON, conjugated mycotoxins, mass spectrometry, glucosides, food
processing, bread.
1. Introduction
According to the Ph.D project, this oral communication reports the main results of the following activities aimed to:
A.
develop a new analytical method for the simultaneous identification of DON, T-2 and HT-2 in bread
samples employing an high resolution mass spectrometric (HR-MS) method
B.
study the fate of DON, T-2 and HT-2 and their conjugated forms during bread-making in naturally
contaminated bread
C.
assessment of bioacessibility of DON, T-2 and HT-2 and of the derived conjugated forms in digestive
biofluids through in vitro digestion experiments
2. Mycotoxin Issue
Mycotoxin contamination of cereals and derived products represents one of the major safety issue due to the toxic
effects exerted by these fungal metabolites on humans and animals. Mycotoxin production is a consequence of
extensive fungal growth, in particular Fusarium genus, which represents a common contaminant of cereals such as
wheat, barley and corn. It is renowned producer of trichothecenes considered a highly toxic class of mycotoxins
generally subdivided in 4 groups (A-D). Among them, trichothecenes A and B are the most common types, the
former comprising T-2 and HT-2 toxin, while the latter including deoxynivalenol (DON). Type A trichothecenes
commonly cause inhibition of protein synthesis and mitochondrial function, thereby triggering toxic effects on skin,
mucous, immune system and cells (Visconti, 2001), whereas type B are more responsible for abdominal pains,
dizziness, headache, throat irritation, nausea, vomiting, diarrhoea and blood in the stool (Rotter, 1996).
To protect consumers the last European Regulation has established several maximum limits in food in relation to
the type of mycotoxin and foodstuff taken into account, whether detected in raw material or processed food.
Currently, maximum permitted levels set for DON are 1250 µg/kg in unprocessed cereals, 1750 µg/kg in
unprocessed durum wheat, oat and maize, 750 µg/kg in flour and pasta, and 500 µg/kg in bread, pastries, biscuits,
cereal snacks and breakfast cereals (European Commission, 2006b). As for T-2 and HT-2 toxins official maximum
levels have not been set yet within the European Union. Provisional maximum tolerable intake (PMTDI) for either
the single mycotoxin or the sum of T-2 and HT-2 has been set at 0.06 µg/kg of body weight/day (JECFA, 2001).
Recently in the European Food Safety Authority (EFSA) a group tolerable daily intake (TDI) of 100 ng/kg b.w. has
been established (EFSA, 2011). In general, the different acceptable levels of mycotoxins set for raw materials and
- 37 -
processed foods reflect the change in mycotoxins content that is likely to occur throughout food processing.
Cleaning, milling, brewing, fermentation and cooking can change the distribution of trichothecenes in the
differently processed foods altering, as a result, their final concentration in the end-products. Contrasting results
have been documented on the influence of thermal processing and fermentation (Kostelanska et al., 2011, Pacin et
al., 2010, Bergamini et al., 2010) on the final DON content, leading to the conclusion that time length and baking
temperature play an important role on the final levels of DON (Bergamini et al., 2010). As for the fate of T-2 and
HT-2 toxins during baking there is a paucity of papers in literature addressing this issue. Whether cleaning and
milling promote a decrease of T-2 and HT-2 final content in kernels (Pascale et al., 2011), other processing such as
boiling, fermentation, baking frying and extrusion did not show to impact T-2 and HT-2 levels (Scudamore, 2008).
In addition to mycotoxin issue in processed food, this last years have seen an increasing interest of the occurrence
of the modified mycotoxins co-occuring with the native form in food. DON and its conjugate DON-3Glu have been
identified for the first time by Berthiller et al. (2005) in infected wheat and maize and subsequently studies focused
on the fate of this masked mycotoxin also in milling and baking by comparing it to the level of free DON
(Kostelanska et al., 2011).
The multitude of information, often contradictory, on the fate of DON during baking and the lack of knowledge on
the levels of T-2 and HT-2 toxins during bread processing have prompted us to investigate on the fate of DON, T-2
and HT-2 toxins upon baking extending the study to masked forms too, such as DON-3Glucoside and T-2 and HT2 glucosides. The recent development of high resolution mass spectrometry employing Orbitrap technology has
made possible to overcome the limits of previous mass spectrometer analyzers thanks to the many advantages
offered by this technology such as the higher resolving power, higher mass accuracy and dynamic range of analysis.
In this Ph. D work a High Resolution MS method based on Orbitrap analyser integrated with a high collision
dissociation chamber for ion fragmentation has been optimized and applied for the simultaneous determination of
DON, T-2 and HT-2 and their conjugated forms both in flour and the processed cereal based food matrix as bread
(Monaci et al., 2011).
All MS and HCD-MS analysis were performed on an Exactive non-hybrid single stage Orbitrap mass spectrometer
(Thermo Fisher Scientific, Bremen, Germany), equipped with an HESI II (heated electrospray interface), whereas
LC separation was accomplished on a Kinetex PFP (pentafluorilphenyl) column based on a core shell technology
for a highest chromatographic efficiency. LC/HR-MS optimized method was successively applied to naturally
contaminated breads prepared in our lab according to a standard recipe optimized within an EU project. Naturally
contaminated breads were prepared from flour contaminated at three different levels labelled as SAMPLE 1 (3,5
µg/g DON, 160ng/g HT-2 and 39 ng/g T-2), SAMPLE 2 (1,85 µg/g DON, 1,3 µg/g HT-2 and 110 ng/g T-2),
SAMPLE 3 (1,5 µg/g DON, 610 ng/g HT-2 and 63 ng/g T-2). As for the simultaneous extraction of DON, T-2 and
HT-2 toxins, two strategies were tested and compared in order to select the best procedure in terms of highest
recovery: purification through SPE columns MYCOSEP 227® and QuEChERS-like procedure (Vaclavik et al.,
2010). In vitro digestion experiments were performed on blank and contaminated bread samples according to a
procedure designed as “statical or biochemical model” which mimics three steps of human digestion: chew, gastric
and duodenal phases. Before LC/HRMS analyses, digests were purified and preconcentrated through a solid phase
extraction column based on C18 stationary phase.
4.1 Development of a HR-MS method for the simultaneous determination of DON, T-2 and HT-2 toxins in
bread
4.1.1 Optimization of ESI-MS conditions
In order to detect mycotoxins at trace levels in a complex matrix as bread, a robust and sensitive MS based method
tailored to the multiple detection of mycotoxins has been developed (Monaci et al., 2011). An high resolution mass
spectrometer (HR-MS) based on the Orbitrap analyzer, exploiting the high accuracy and resolution power offered
by this technology, was employed. First of all MS and HCD-MS experiments for the optimization of ESI-MS
conditions were carried out. To this purpose standard solutions of single mycotoxins in mobile phase were injected
by flow injection into the ion source operating in positive mode by mixing it with a coaxial flow of mobile phase
delivered by an HPLC pump. All the ESI parameters were varied in real-time and duly optimized. Then by
activation of the high collision dissociation chamber the best fragmentation pattern were found for each
mycotoxins. Standard solution of single mycotoxins were directly injected in the MS ion source and submitted to
collision energies within the range 15-40 eV. 25 eV was found to be the best compromise to provide a good
fragmentation pattern for all mycotoxins. It is worth noting that by introducing the mass lock mode against a
phthalate mass constantly present as contaminant in the LC–MS run, mass accuracy resulted improved at values ≤
0.5 ppm. After that, the analytical performances of the method such as linearity of calibration curves, limit of
detection, limit of quantification and recovery of the whole procedure were investigated in standard solutions as
well as in bread in order to assess the feasibility of the proposed HCD-HR-MS method for the quantitative
determination of DON, T-2 and HT-2 in bread extracts. The experiments were carried out activating the HCD cell
- 38 -
so to operate in MS and all ion fragmentation mode monitoring at the same time both the precursor ion and the two
most intense fragment-ions selected for each mycotoxin. As for LC separation, employing a Kinetex PFP
(pentafluorilphenyl) column, the three mycotoxins eluted within 8 min with the following retention times:
3.24±0.01 min (SD, calculated on the average of 5 chromatographic runs) for DON; 6.64±0.01 and 7.73±0.01 min
for HT-2 and T-2, respectively. The explored concentration range of standard solutions ranged from 0.001 to 1.65
µg/ml and calibration-related parameters obtained from data interpolation by linear least squares showed good
linearity and sensitivity for the molecular ions and their fragments with a squared correlation coefficients (R2)
comprised between 0.996 and 0.999. LOD and LOQ values were also calculated, respectively, as 3 and 10 times the
standard deviation of the calibration curve intercept as an estimator of response variability. The minimum amount
detectable for DON was 0.9 ng injected, whereas 1.5 and 1 ng were found respectively for HT-2 and T-2 toxins. As
for LOQ, 2.8, 5.2 and 3.5 ng injected were the values calculated respectively for DON, HT-2 and T-2. Within-day
and between-day precision were also evaluated on bread samples spiked with the three mycotoxins at 50 ng/g each
and injected 4 times each day for a period of five consecutive days. The calculated means were not statistically
different according to the ANOVA test (95% confidence) with CV ranging from 5 to 15% for the within-day
precision and from 15 to 20% for the between-day precision.
4.1.2 Optimization of mycotoxins extraction procedure
In order to investigate the best procedure for the simultaneous extraction and analysis of DON, HT-2 and T-2 toxins
in cereal-derived products, two different approaches, one based on the use of Mycosep columns and the other using
salts for precipitation of interfering compounds (also termed QuEChERS-like procedure) were tested and
compared. Firstly, the potential matrix effect was assessed by preparing two matrix-matched calibration curves for
each mycotoxin by implementing both extraction methods. Both curves were prepared re-dissolving different
aliquots of mycotoxin mixture standard solutions previously evaporated in matrix extract (corresponding to 1 g of
matrix for Mycosep procedure and 0.2 g for QuEChERS) prepared according to the two procedures. A
concentration range comprised between 2.5 and 412.5 ng/g (six calibration points) of bread was investigated using
Mycosep columns, whereas the covered range for QuEChERS method was 10-500 ng/g. Each solution was injected
in the LC/MS apparatus and analysed by MS and HCD-MS scan mode. Signal suppression/enhancement (SSE) %
(slope matrix curve calibration/ slope standard curve calibration *100) effect was assessed for each mycotoxin and
pre-treatment procedure tested. Results showed that while Mycosep-based method produced a negligible matrix
effect on T-2 and HT-2 and a slight suppression effect on DON, the QuEChERS based procedure displayed an
enhancement matrix effect for DON (nearly 120%) even higher in case of analysis of T-2 toxin. Subsequently
spiked calibration curves were prepared for each mycotoxin implementing both procedures in order to calculate
calibration-related parameters and the limits of detection and quantification schematized in table 1. In the light of
the results obtained, Mycosep approach was further employed in this study and recovery test were performed to
assess the feasibility of the developed method on bread. To this purpose spiked calibration curve prepared in bread
samples (range between 5 and 250 ng/g corresponding to 0.002-1 µg/ml of extract) and matrix-matched calibration
curve were compared. The ratio between the two slopes was used to calculate the best estimate of the real recovery
throughout the concentration range investigated. This yielded values respectively of 74% for DON, 62% for HT-2
and 71% for T-2.
Table 1 Comparison of calibration parameters, LOD and LOQ values calculated for DON, T-2and HT-2 in spiked bread
samples using Mycosep and QuEChERS- like procedures.
Sample pre-treatment
DON (C15H20O6)
Mycosep-method
QuEChERS-method
HT-2 (C22H32O8)
Mycosep-method
QuEChERS-method
T-2 (C24H34O9)
Mycosep-method
QuEChERS-method
Curve equation
R2
LOD (ng/g)
LOQ (ng/g)
y=1960.9 x-15698
y=202.83 x-1795.2
0.999
0.999
17
19
58
65
y=1200.5 x+6138.2
y=119.01 x-169.58
0.982
0.999
12
13
41
42
y=44996 x+123563
y=2307.5 x+26631
0.994
0.991
7
15
25
50
4.2 Degradation of DON, T-2 and HT-2 and their conjugated forms during bread-making in naturally
contaminated bread
Once the analytical method has been developed, next objective was to study the impact of bread-making process
(through baking) on the final distribution of three mycotoxins from flour to bread. The content of each mycotoxin
was calculated by interpolation of two calibration curves prepared separately in raw flour and bread. MS analysis
were carried out in positive and negative ion mode, and in particular DON was preferentially detected in negative
mode with the most intense ion appearing in the MS spectrum corresponding to the molecular ion adduct
[M+HCOOH]- (m/z=341.1244). Results are plotted in Figures 1 A, B and C showing the fate of DON, T-2 and HT2 in flour and bread respectively.
- 39 -
Figure 1 Comparison of DON (A) HT-2 (B) and T-2 (C) levels calculated in wheat flour and bread from the respective
calibration curves (referred to dry matter weight).
Bread
2000
HT-2 content (ng/g)
DON content (ng/g)
1200
Flour
A
1500
1000
500
0
140
Flour
B
1000
Bread
T-2 content (ng/g)
2500
800
600
400
200
120
Sample2
Bread
100
80
60
40
20
0
Sample1
Flour
C
0
Sample 1
Sample3
Sample 2
Sample 3
Sample 1
Wheat samples
Wheat samples
Sample 2
Sample 3
Wheat samples
Figure 1A depicting the levels of free DON calculated both in flour and bread shows that DON in bread is
approximately 18% higher. This result might be explained by the release of DON from the masked forms
(conjugated) that have been reported to occur along with the free mycotoxin in naturally contaminated flour. As for
T-2 and HT-2 toxins, a general decrease of the final content after baking phase was observed, as shown in figures
1B and 1C. HT-2 reduction ranges from 18 to 25% of the initial content (Figure 1B), whilst as for T-2, a remarkable
reduction between 63-74% is observed, highlighting a more thermolabile behaviour displayed by this last
mycotoxin (Figure 1C). The drop in T-2 content could probably result from the combination of two phenomena: i)
partial conversion of T-2 into HT-2 during yeast fermentation operated by the carboxylestherase naturally present
in cereal-based products and ii) partial degradation of T-2 due to the thermal treatment. Likewise, also the final
level of HT-2 detected, as pictured in Fig. 1B, might arise from new HT-2 formed as a consequence of the
enzymatic conversion operated by the carboxylestherase on T-2 during fermentation.
In addition to study the influence of bread making on free DON, T-2 and HT-2 toxins, the fate of the glucosylated
forms was also investigated in naturally contaminated breads produced, such as DON-3Glu, T-2Glu and HT-2Glu.
Concerning LC/MS analysis, while DON-3Glu was detected as an adduct with formate in negative ion mode, T-2
and HT-2 glucosides were monitored as adducts with ammonium in positive ion mode. Molecular ion masses were
respectively 503.1774 for DON-3Glu, 646.3083 for T2-Glu and 604.2972 for HT2-Glu. As for DON-3Glu,
quantitative estimation was accomplished on the three flour and bread samples using spiked calibration curve.
Despite to what found for the native DON, Figure 2 A shows that the content of DON-3Glu after baking was nearly
halved. These findings suggest a likely release of free DON mycotoxin from the masked form as a consequence of
the thermal effect, thus confirming the final mass balance. With regard to the fate of HT-2Glu and T-2Glu upon
bread making, due to the absence of a standard available for quantification purposes, analysis were carried out in
the wholemeal flours and the respective breads and the resulting peak areas were compared (see Figures 2B, 2C).
As reported in Figure 2B, HT-2-Glu final levels appeared to be affected by baking with a drop of around 60%
displayed in bread. In stark contrast with this, a different behaviour was found for T-2Glu levels that showed a
remarkable increase upon baking with final values up to 140%, see figure 2C.
Figure 2 A) Histogram reporting the levels of glucosylated DON calculated in wheat flour and bread; B), C) comparison of HT2 and T-2 glucosides (expressed as peak areas) in the extracts of wheat flour and bread.
B
DON‐3Glu
Flour
Bread
500
450
C
HT2‐Glu
7000000
Flour
6000000
Bread
250
200
150
Peak area
300
4000000
3000000
2000000
100
50
1000000
0
0
Sample1
Sample2
Wheat samples
Sample3
Flour
Bread
50000
5000000
350
T2‐Glu
60000
400
Peak area
DON‐3 Glu content (ng/g)
A
40000
30000
20000
10000
Sample 1
Sample 2
Wheat samples
Sample 3
0
Sample 1
Sample 2
Sample 3
Wheat samples
In summary, whether HT-2Glu proved to undergo a significant decrease upon baking, T-2 appeared instead to be
preferentially converted in its respective glucoside whose level increased by approximately 140% in the final
product. This is an important aspect worthy to be deepened as already pointed out in a recent document issued by
EFSA (EFSA, 2011) where it was highlighted the need to undertake further in-depth studies to assess the impact of
processing on the final levels of T-2 and HT-2. Our findings also demonstrate that a massive production of HT2Glu could occur in infected grain crops. Therefore a significant production of mycotoxin glucosides is likely to
occur and does not necessarily exclude the possibility to be detected also in naturally contaminated grain. This
result is of uttermost importance since the toxicity of some conjugated mycotoxins has not been fully studied yet
and, as a result, the hazard arising from the co-occurrence of these modified forms along with the free mycotoxin
- 40 -
within a food product should be checked for to avoid underestimation of the risk.
4.3 Study of bioaccessibilty of DON, T-2 and HT-2 toxin through in vitro digestion experiments
The last aim of this Ph.D work was to monitor the stability of the native mycotoxin and/or their conjugated forms in
the in vitro digests subdivided into chew, gastric and duodenal biofluids. To date this study is still in progress and
in the next future digests of blank and contaminated bread samples will be analysed in order to address this point.
5. Conclusions
The extent of DON, T-2 and HT-2 degradation has been investigated and assessed in naturally contaminated wheat
flours and the respective breads. Our data proved that unlike DON showing a significant increase upon baking, HT2 and T-2 levels decreased in bread with a more remarked drop displayed by T-2. On the other hand, glucosylated
DON, T-2 and HT-2 were also identified and detected as mono-glucosides both in flour and bread. Findings show
that whether the % of DON-3Glu and HT2-Glu appeared to decrease after baking, an opposite trend was pointed
out by T-2Glu that appeared to nearly double its original content upon baking. This is an important result since
there is a paucity of papers in literature on this regard and for the first time it has been described a remarkable
increase of T2-Glu levels after baking with consequent possible implications on human health.
6. References
Bergamini E, Catellani D, Dall’Asta C, Galaverna G, Dossena A, Marchelli R, Suman M (2010) Fate of Fusarium mycotoxins in
the cereal product supply chain: the DON case within industrial bread-making technology. Food Addit Contam 27: 677687.
Berthiller F, Dall’Asta C, Schuhmacher R, Lemmens M, Adam G, Krska R (2005) Masked Mycotoxins: Determination of a
deoxynivalenol glucoside in artificially and naturally contaminated wheat by liquid chromatography-tandem mass
spectrometry. J Agric Food Chem 53: 3421-3425.
EFSA Panel on Contaminants in the Food Chain (2011) Scientific Opinion on the risks for animal and public health related to
the presence of T-2 and HT-2 toxin in food and feed. EFSA Journal 9: 2481, pp. 187. doi:10.2903/j.efsa.2011.2481.
European Commission. Commission Regulation (EC) N° 1881/2006 of 19 December 2006 setting maximum levels for certain
contaminants in foodstuff (2006b). Official Journal of the European Union L 364: 5-24.
Joint FAO/WHO Expert Committee on Foods Additives (JECFA) (2001) Safety evaluation of certain mycotoxins in food.
Rome, Italy: Food and Agriculture Organization.
Kostelanska M, Dzuman Z, Malachova A, Capouchova I, Prokinova E, Skerikova A, Hajslova J (2011) Effects of milling and
baking technologies on levels of deoxynivalenol and its masked Form deoxynivalenol-3-glucoside. J Agr Food Chem 59:
9303-9312.
Monaci L, De Angelis E, Visconti A (2011) Determination of deoxynivalenol, T-2 and HT-2 toxins in a bread model food by
liquid chromatography–high resolution-Orbitrap-mass spectrometry equipped with a high-energy collision dissociation cell.
J Chromatogr A 1218: 8646-8654.
Pascale M, Haidukowski M, Lattanzio VMT, Silvestri M, Ranieri R, Visconti A (2011) Distribution of T-2 and HT-2 toxins in
milling fractions of durum wheat. J Food Protect 74: 1700-1707.
Rotter BA, Prelusky DB, Pestka JJ (1996) Toxicology of deoxynivalenol (vomitoxin). J Toxicol Env Heal A 48: 1-34.
Scudamore K (2008) Fate of Fusarium mycotoxins in the cereal industry: Recent UK studies. World Mycotoxin J 1: 315-323.
Vaclavik L, Zachariasova M, Hrbek V, Hajslova J (2010) Analysis of multiple mycotoxins in cereals under ambient conditions
using direct analysis in real time (DART) ionization coupled to high resolution mass spectrometry. Talanta 82: 1950-7
Visconti A (2001) Problems associated with Fusarium mycotoxins in cereals. Bullettin of the Institute for Comprehensive
Agricultural Science, Kinki University 9: 39-55.
- 41 -
Variation of Antioxidant Compounds in Table Olives
Submitted to Different Thermal Treatments
Alessandra De Bruno (alessandra.debruno@unirc.it)
Dept. of Biotechnologies for Agricultural Food and Environmental Monitoring,
Mediterranean University of Reggio Calabria, Italy
Tutor: Prof. Marco Poiana
The aim of this PhD thesis is to evaluate the effect of thermal processes on the antioxidant activity of Calabrian
table olives, analysing the compounds naturally present in olives and those of new formation (melanoidins). Also, a
comparison among several treatments has been defined on qualitative characteristics of olives.
Variazione dei composti antiossidanti sulle olive da tavola
sottoposte a differenti trattamenti termici
Lo scopo della tesi di dottorato è quello di valutare l’effetto dei processi termici sull’attività antiossidante di olive
da tavola calabresi, analizzando i composti antiossidanti presenti naturalmente nelle olive e quelli di neoformazione (melanoidine). Inoltre, sono stati fatti dei confronti sulle caratteristiche qualitative delle olive
diversamente trattate.
Key words: ABTS, colour, DPPH˙, melanoidins, polyphenols, table olives, tocopherol.
1. Introduction
According to the PhD thesis project this oral communication reports main results of the activities concerning:
(A1) the physicochemical characterization of fresh, fermented, pasteurized and dried table olives;
(A2) antioxidant activity of fresh, fermented, pasteurized and dried table olives;
(A3) antioxidant activity of melanoidin fractions, generated in thermally treated olives.
2. Antioxidants in Table Olives
In the recent years, some researches have increased the interest in natural dietary antioxidants and bioactive
components of foods as phenolics. These compounds possess a free radical scavenging activity and have potential
beneficial effects on human health associated with their assumption (Ben Othman et al., 2009).
Table olives (Olea europea L.) and derivated products represent an important part of the Mediterranean diet and are
recognized as a valuable source of so-called “functional foods” because of their natural antioxidant content,
including tocopherols, flavonoids and phenolic compounds (Bianco and Uccella, 2000). One of the most important
operation in table olive processing is the removal of the bitter taste of the fruit by hydrolysis of oleuropein
(Gambella et al., 2000). For this reason the table olives need transformation processes to become edible. Table
olive fermentation is one of the oldest biotechnological applications in food processing that historically appeared in
the Mediterranean region and subsequently spread over to other countries. There are several ways to process table
olives, but prominent industrial elaborations are: the green Spanish style (the most widespread process), ripe olives
by alkaline oxidation (so-called Californian style), and naturally black olives (also known as Greek style) (Garrido
Fernández et al., 1997).
Today is very important to extend the shelf-life of food and different methodologies are adopted to it. In the
Mediterranean area olives are present as several preparations and dried olives are numbered among these. The
thermal treatment on food is widely used in the food industry. This processing induced a variety of physical and
biochemical changes that could affect the overall acceptability by the consumer, as well the nutritional quality of
the product. The effect of thermal treatment on functional and nutraceutical properties of table olives is still a
controversial issue. According to some authors, the thermal treatments have negative effects on qualitative
properties of food, because they affect on phenolic compounds, on lipids, protein and vitamin compounds, and also
they alter the texture and colour (Calligaris et al., 2004). Other authors instead reported that after the heat treatment
the antioxidant activity increases, due to the formation of new compounds, for example the melanoidins derivated
by the Maillard reaction (Piga et al., 2003, Madrau et al., 2009). Melanoidins are present in widely consumed
dietary components (eg., coffee, bread). In addition, melanoidins possess antioxidant (Delgado-Andrade and
Morales, 2005), antimicrobial and prebiotic activities (Borrelli and Fogliano, 2005). They are also responsible for
the development of colour in heat-processed food products (Rizzi, 1997).
For the measurement of antioxidant activity, various tests are available depending on area of interest. Some of these
are:
- 42 -
1. The DPPH˙ (2,2-diphenyl-1-picrylhydrazyl) radical scavenging assay, based on the disappearance of the
purple colour of the radical solution, through scavenging reaction with antioxidants. This method has been
developed for both the hydrophilic (Valavanidis et al., 2004) and lipidic fractions (Espin et al., 2000).
2. The ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) assay, based on the disappearance of
the blue-green colour of the radical solution, upon consumption by antioxidants. This method has been
used for lipophilic fraction (Pellegrini et al., 2001).
3. The total phenolic content, quantified through the Folin-Ciocalteu assay (Montedoro et al., 1992) and
measured spectrophotometrically in methanolic extract.
The olives (Carolea cv.) were harvested at the end of October 2010 in Rizziconi, Reggio Calabria (Italy).
Just arrived in the laboratory olives were subjected to carpological measurements and physicochemical analyses.
After it, the samples were submitted to different technological treatments that are below reported:
1) Fermentation: the table olives were placed in plastic jars of 15 L, with a 7% NaCl brine for 6 months (10 kg
olives/7 L brine);
2) Pasteurization: after 6 months of the fermentation, the olives were placed in glass jars of two different
dimensions. In particular 190 g of olives and 150 mL of brine were put on jar 1 (6,5 cm of diameter and 370
mL of volume) and 300 g of olives and 220 mL of brine were put on jar 2 (8,5 cm of diameter and 580 mL of
volume). Other samples were packaged in flexible plastic bags (20x15cm) of two different storage materials
(PA/PE: Polyethylene/Polyamide and OPA/PP: Oriented Polyamide/Polypropylene): 190 g of olives and 150
mL of brine in both bags. Successively to the packaging operation, jars and bags were placed in a thermostatic
water bath with at 70°C and the container core was maintained for 18 minutes. For evaluating of temperature
changes a probe was put (thermocouple K) in jars and bags and the curve of penetration of the heat was
obtained using a Data Logger (Escort Junior).
3) Dehydration: fresh and fermented olives were dried at two different temperatures: 50°C and 70°C to achieve a
dry matter of about 70% on all samples. For the drying process a pilot dryer (Scirocco, Italian dryer society,
Milan, Italy) was used which provided with an air flow tangential to the steel shelves where the fruits were
placed (velocity: 1750 m3/h, with a variable load between 2 and 4,5 kg/m2).
Samples were defined as follows: O (fresh olives), O50 (dried olives at 50 °C), O70 (dried olives at 70 °C); F
(Fermented olives), F50 (Fermented and dried olives at 50 °C), F70 (Fermented and dried olives at 70°C), P1
(Pasteurized olives in jar 1); P2 (Pasteurized olives in jar 2); P3 (Pasteurized olives in OPA/PP); P4 (Pasteurized
olives in PA/PE).
The following analyses were performed on the olives: peel colour by a tristimulus colorimeter (Konica Minolta CN700d spectrophotometer) using the CIE- L, a, b System; dry matter percentage in an oven at 105°C to achievement
of constant weight; water activity by the Aqualab LITE (Decagon) hygrometer; the pH and the total acidity
following the AOAC methods (1980); the total polyphenols by the Folin Ciocalteau method (Amiot et al., 1986).
For the total antioxidant activity (TAA) assays, the extraction of Nakatani et al. (2000) and the DPPH˙ assay
(Brand-Williams et al., 1995) were applied on hydrophilic fraction of olives. The extraction of lipophilic fraction
followed the method reported by Othman et al. (2009) and obtained extracts were submitted to the ABTS assay (Re
et al., 1999). The extraction of melanoidin compounds was carried out following that reported by Lindenmeier et
al. (2002) and then DPPH˙ assay was applied on. For spectrometric measurements Agilent-8453 instrument was
employed. The oil extraction by olive occurred by Folch method (1957). The analyses of α-tocopherol in oil was
determinated according to AOAC (1989) method and Linch et al. (2001) respectively for extraction and
quantification, using an α-tocopherol standard (Sigma Aldrich). The HPLC phenols were extracted following the
method reported by McDonald et al. (2001) and quantified by Benavente-Garcia (2000). These analyses were
conducted by a HPLC system (Knauer Smartline Pump 1000) with a DAD detector Knauer Smartline UV detector
2600; a column Knauer Eurosfer 100-5 C18 (150x4,6 mm with pre-column) was used. All analyses were conducted
on three replicates and all data were submitted to the statistical analysis of variance (ANOVA) with Tukey post-hoc
test.
Results of carpological measurements showed the typical size of the olive cultivar, with a good pulpe:stone ratio
(mean of 4.75, data not shown). In tables 1-2 chemical analyses on dried and pasteurized olives were reported. The
initial moisture content in fresh and fermented olives was on the average of 68 and 64 % and this parameter is
correlated with the dehydration time: drying times required were: 58 hrs for O50; 22 hrs for O70; 48 hrs for F50
and 20 hrs for F70. The relative humidity varied between 22 and 30%, obtaining an aw of 0.60-0.75 suitable to a
correct preservation of dried product, as reported in another study (Piga et al., 2003).
- 43 -
Table 1 Physicochemical analyses of fresh, fermented and dried olives. Values are means ± S.D. (n=3). *Significance at
P<0.05;**Significance at P<0.01; n.s. not significant. Data followed by different letters for each treatment are
significantly different by Tukey’s multiple range test.
Samples
Free acidity
(citric acid% d.m.-1)
pH
aw
Moisture (%)
Lipids
(% d.m.-1)
0.57±0.02b
0.90±0.02a
0.33±0.03de
0.51±0.02bc
0.28±0.07e
0.42±0.06cd
**
5,26±0,01cd
5,60±0,01b
5,40±0,01a
5,22±0,06de
5,13±0,01e
5,35±0,04bc
**
0.99±0.01a
0.83±0.01c
0.69±0.02f
0.97±0.01b
0.76±0.01d
0.73±0.02e
**
68.63±0.31a
29.58±1.50b
22.54±0.62c
64.37±1.45a
27.25±2.13bc
23.44±4.43c
**
88.52±1.82a
66.64±1.22c
83.76±1.31a
75.47±2.36b
71.54±1.60b
83.56±2.24a
**
O
O50
O70
F
F50
F70
Sign.
Table 2 Physicochemical analyses of fermented and pasteurized olives. *,**,abcdefg, to see table 1
Free acidity
(citric acid% d.m.-1)
0.51±0.02
0.51±0.11
0.57±0.00
0.59±0.13
0.51±0.14
ns
Samples
F
P1
P2
P3
P4
Sign.
pH
aw
Moisture (%)
5.22±0.11a
5.13±0.00ab
5.11±0.01ab
5.00±0.02c
5.07±0.12bc
**
0.97±0.01ab
0.96±0.01ab
0.95±0.01b
0.96±0.02ab
0.97±0.01a
**
64.37±1.46a
63.15±0.44ab
61.82±0.61b
61.59±0.90b
60.25±0.89b
**
Lipid
(% d.m.-1)
75.47±2.36a
79.11±1.99a
77.67±2.32a
59.42±2.02b
60.76±1.76b
*
Compared to O and F samples, in the olives dried at 50°C, the acidity appeared more abundant but in F50 and in the
samples dried at higher temperatures decreased. Differences between fresh and fermented samples were not instead
observed as well as among pasteurized samples. The pH increased after the drying process, particularly in O50,
while it reduced after the fermentation of sample, with results fairly similar to those reported in the literature
(Gambella et al., 2000; Piga et al., 2001). The total lipids content in the different typologies of olives ranged
between 60 and 88%.
Table 3 Colour analyses of fresh, fermented, dried olives and fermented and pasteurized olives. Values are means ± S.D.
(n=20). *,**,abcdefg, to see table 1
Samples
L*
a*
b*
chroma
Samples
L*
a*
b*
chroma
O
61.70±3.7a
-9.56±4.9c
37.54±3.1a
39.05±2.9a
F
50.86±4.1a
5.44±1.7b
38.81±4.5a
39.24±4.4a
O50
42.83±1.3c
2.89±0.7b
3.91±1.2c
4.87±1.3c
P1
50.42±3.7a
6.36±1.1ab
36.93±3.8a
37.51±3.6a
O70
24.84±1.8d
5.87±1.2a
5.63±1.9bc
8.15±2.2b
P2
50.57±3.8a
6.47±0.9ab
37.30±3.3a
37.89±3.1a
50.86±4.1
b
5.44±1.7
a
a
38.81±4.5
a
P3
46.04±3.6
b
6.86±0.6
a
31.86±5.1
b
32.62±4.9b
27.08±1.4
d
6.41±1.3
a
b
P4
44.84±4.4
b
7.07±1.2
a
29.73±6.1
b
30.64±5.8b
F70
25.41±2.2
d
5.80±1.3
a
Sign.
**
Sign.
**
F
F50
**
7.00±1.7
5.66±1.6
**
bc
39.24±4.
9.51±2.1
b
8.11±2.1
b
**
**
**
**
In table 3 the colour analyses of dried, pasteurized and untreated olives are reported. A higher lightness (L*) was
shown in the fresh sample, while in dried olives L* value reduced considerably especially in samples dried at 70°C.
About the chromatism a* significant changes of colour from green to red after the dehydration were noted and this
indicated a beginning of browning. The b* chromatism (blue-yellow) and the chroma value decreased in dried
samples. In pasteurized samples L*, b* and Chroma parameters decreased slightly in the samples P3-P4 that
oppositely showed higher value of a*.
The analyses relative to antioxidant activity of dried olives were reported in table 4. The DPPH˙ assay showed the
highest radical scavenging effect in O70. This was due probably to the formation of new compounds, derivated by
Maillard reaction after the thermal treatment while in the fermented and fermented and dried samples the TAA
decreased. Different trend was observed by ABTS assay: in fact the sample that showed the greatest antioxidant
power was the fermented one, and after the drying process, particularly in F50 the radical scavenging lowed. The
total polyphenols content decreased in all treated samples respect to the fresh olives (13639 mg gallic acid kg-1
d.m.), only the O70 sample preserved an higher value of polyphenols. A positive correlation between TAA-DPPH˙
and total polyphenols was pointed out by Pearson’s coefficient (r = 0.769; P<0.05). A HPLC analysis of olive
phenols permitted the identification of twelve phenolic compounds with quantitative difference among the different
samples (data non shown). The α-tocopherol, which represent the principal tocopherol of oil, was present in the oil
extracted by olives with a content variable between 56-532 mg kg-1 dm. Among the samples there were revealed
significant differences, particularly the fresh olives showed a expected higher content of this compound, while it
decreased considerably in F50.
Concerning the olives submitted to the pasteurization treatment, the DPPH˙ assay showed lower TAA in the
- 44 -
starting sample (F) than pasteurized ones, while it increased after the stabilization treatment. The ABTS assay was
oppositely higher in F without significant differences among P-samples. Comparing O and F samples, total
polyphenols reduced after fermentation, probably because the treatment induced the release from pulp to the brine
of the polyphenols or for the oxidation process due to the polyphenoloxidase activity (PPO) (Marsilio et al., 2001).
This content changed instead after the pasteurization of samples, in particular more in the glass packaging than in
plastic bags. Among P-samples α-tocopherol content did not change much with light differences among packaging
materials (Table 5).
Table 4 Total Antioxidant activity (TAA) and compounds in dried olives. *,**,abcdefg, to see table 1
Samples
O
O50
O70
F
F50
F70
Sign.
TAA-DPPH˙ Assay
[-OD-3min-1 g-1 d.m.]
130.68±3.29b
57.74±5.62c
239.96±10.63a
65.46±5.11c
11.08±0,53e
27.13±3.45d
**
TAA-ABTS Assay
(µM trolox g-1 d.m.)
10.29±1.71b
6.04±1.18c
9.41±0.35b
15.62±0.25a
2.49±0.56d
5.47±0.73c
**
Total poliphenols
(mg Gallic acid kg-1 d.m.)
13639±644.49a
4555±111.4c
11392±1310.93b
5406±64.57c
678±16.23d
1063±21.11d
**
α-tocopherol
(mg kg-1 d.m.)
532.31±9.25a
261.40±24.26b
238.48±0.39b
231±9.64b
56.66±2.38d
142.47±5.6c
**
Table 5 Total Antioxidant activity (TAA) and compounds in pasteurized olives. *,**,abcdefg, to see table 1
Samples
F
P1
P2
P3
P4
Sign.
TAA-DPPH˙ Assay
[-OD-3min-1 g-1 d.m.]
65.46±5.11c
87.11±3.39b
100.38±1.96a
64.53±1.20c
93.12±3.21ab
**
TAA-ABTS Assay
(µM trolox g-1 d.m.)
15.62±0.25a
9.88±0.93b
8.38±0.53b
8.22±1.34b
8.35±0.89b
**
Total poliphenols
(mg Gallic acid kg-1 d.m.)
5406±64.57a
3707±515.63b
4204±332.09b
1825±28.7c
1439±57.73c
**
α-tocopherol
(mg kg-1 d.m.)
231±9.64b
354.79±36.56a
372.06±22.45a
309.50±5.27ab
287.42±67.10ab
**
In table 6 the antioxidant capacity of melanoidin fractions extracted from treated olive samples is shown. From a
general observation, fractions 1, 2, 3 revealed antioxidant activity depending on samples and in particular Fraction
2 presented the greatest value with the only exception in O50 and O70. Highlighting the influence of single
fractions in all studied samples, significant differences were noted (P < 0.01): the Fraction 1 showed the highest
value in O70; Fraction 2 presented the greatest antioxidant activity in P2; Fraction 3 was the most active in P4.
Finally Fraction 4 manifested the lowest TAA (P < 0.05) because is represented by drupes residues and original
antioxidants were just extracted previously. As above discussed, pasteurization promoted the formation of active
melanoidins, whereas the drying at medium temperature were less efficient.
Table 6 Total Antioxidant activity of “melanoidin compounds” (-OD-3min-1 g-1 d.m.) *,**,abcdefg, to see table 1
SAMPLES
O50
O70
F50
F70
P1
P2
P3
P4
Fraction 1
Fraction 2
Fraction 3
Fraction 4
Sign.
149.91±13.1c
1127.02±27.6a
72.11±16.7b
190.90±7.6b
482.67±29.9b
385.87±9.1b
537.64±23.2b
582.95±27.6b
215.39±7.1b
698.69±13.3b
226.44±7.8a
592.67±5.8a
912.73±27.3a
1490.19±7.7a
1173.93±16.8a
1014.15±13.3a
311.54±17.0a
456.42±18.6c
211.92±25.1a
122.45±29.8c
418.31±23.8b
247.45±10.6b
201.81±26.6c
531.46±18.5b
59.12±4.9d
86.86±7.2d
63.41±10.8b
76.43±9.2c
85.33±6.4c
86.40±6.7c
89.12±6.2d
100.62±7.2c
**
**
**
**
**
**
**
**
Results of this PhD thesis confirm that olives contain a high content of antioxidants and this property is maintained
also after thermal treatments because of the melanoidin presence. On the other hand, the treatment that induced a
reduction of functional compounds is the pasteurization in flexible plastic bags. In the future other methods of
antioxidant activity evaluation and a deepen study on melanoidin compounds will be performed.
- 45 -
7. References
Amiot MJ, Fleuriette A, Macheix JJ (1986) Importance and evolution of phenolic compounds in olive during growth and
maturation. J Agricul Food Chem 3: 823-826.
AOAC (1980) In Official Methods of Analysis, 13th edn. Association of Official Analytical Chemists, Washington, p.266.
AOAC (1989) Determination of tocopherols and tocotrienols in vegetable oil and fats by HPLC. Champaign:American Oil
Chemist’s Society, Method Ce-66.
Benavente-Garcia O, Castillo, J, Lorente J, Ortuno A, Del Rio JA (2000) Antioxidant activity of phenolics extracted from Olea
europaea L. leaves. Food Chem 68: 457-462.
Bianco A, Uccella N (2000) Biophenolic components of olives. Food Res Int 33: 475-485.
Borrelli RC, Fogliano V (2005) Bread crust melanoidins as potential prebiotic ingredients. Mol Nutr Food Res 49: 673-678.
Brand-Williams W, Cuvelier ME, Berset C (1995) Use of a free radical method to evaluate antioxidant activity. Food Sci
Technol 28: 25-30.
Calligaris S, Manzocco L, Anese M, Nicoli MC (2004) Effect of heat-treatment on the antioxidant and pro-oxidant activity of
milk. Int Dairy J 14: 421-427.
Delgado-Andrade C, Morales FJ (2005) Unraveling the contribution of melanoidins to the antioxidant activity of coffee brews. J
Agric Food Chem 53: 1403-1407.
Espin JC, Soler-Rivas C, Wichers HJ (2000) Characterization of the total free radical scavenger capacity of vegetable oils and
oil fractions using 2,2-diphellyl-1-picrylhydrazyl radical. J Agric Food Chem 48: 648-656.
Folch J, Lees M, Sloane-Stanley GH (1957) A simple method for the isolation and purification of total lipides from animal
tissues. J Biol Chem 226:497-509.
Gambella F, Piga A, Agabbio M, Vacca V, D’hallewin G (2000) Effect of different pre-treatments on drying of green table
olives (Ascolana tenera var.). Grasas y Aceites 51: 173-176.
Garrido Fernández A, Fernández Díez MJ, Adams MR (1997) Table Olives: Production and Processing. Chapman & Hall,
London.
Lindenmeier M, Faist V, Hoffmann T (2002) Structural and functional characterization of pronyl-lysine, a novel protein
modification in bread crust melanoidins showing in vitro antioxidative and phase I/II enzyme modulating activity. J. Agric
Food Chem 50: 6997-7006.
Lynch A, Kerry JP, Buckley DJ, Morrissey PA, Lopez-Bote C (2001) Use of high pressure liquid chromatography (HPLC) for
the determination of cda-tocopherol levels in forage (silage/grass) samples collected from different regions in Ireland.
Food Chem 72: 521-524.
Madrau MA, Piscopo A. Sanguinetti AM, Del Caro A, Poiana M, Romeo FV, Piga A (2009) Effect of drying temperature on
polyphenolic content and antioxidant activity of apricots. European Food Res Tecnology 228: 441-448.
Marsilio V, Campestre C, Lanza B (2001) Phenolic compounds change during California-style ripe olive processing. Food
Chem 74: 55-60.
McDonald S, Prenzler PD, Antolovich M, Robards K (2001) Phenolic content and antioxidant activity of olive extracts. Food
Chem 73: 73-84.
Montedoro GF, Servili M, Baldioli M, Miniati E, (1992) Simple and hydrolyzable compounds in virgin olive oil. 1. Their
extraction, separation, and quantitative and semiquantitative evaluation by HPLC. J Agric Food Chem 40: 1571-1576.
Nakatani N, Kajano S, Kikuzaki H, Sumino K, Katagiri K, Mitani T (2000) Identification, quantitative determination and
antioxidative activities of chlorogenic acid isomers in prune (Prunus Domestica L.). J Agric Food Chem 48: 5512-5516.
Othman NB, Roblain D, Chammen N, Thonart P, Hamdi M (2009) Antioxidant phenolic compounds loss during the
fermentation of Chétoui olives. Food Chem 116: 662-669.
Pellegrini N, Visioli F, Buratti S, Brighenti F (2001) Direct analysis of total antioxidant activity of olive oil and studies on the
influence of heating. J Agric Food Chem 49: 2532-2538.
Piga A, Gambella F, Vacca V, Agabbio M (2001) Response of three Sardinian olive cultivars to Greek- Style processing. Ital. J
Food Sci 13: 29-40.
Piga A, Del Caro A, Corda G (2003). From Plums to Prunes: influence of drying parameters on polyphenols and antioxidant
activity. J Agric Food Chem 51: 3675-3681.
Re R, Pellegrini N, Proteggente A, Pannala A, Yang M, & Rice-Evans C (1999) Antioxidant activity applying an improved
ABTS radical cation decolorization assay. Free Radical Biol Medical 26: 1231-1237.
Rizzi GP (1997) Chemical structure of colored Maillard reaction products. Food Reviews Int 13: 1-28.
Valavanidis A, Nisiotou C, Papageorgiou Y, Kremli I, Satravelas N, Zinieris N, Zygalaki H (2004) Comparison of the radical
scavenging potential of polar and lipidic fractions of olive oil and other vegetable oils under normal conditions and after
thermal treatment. J Agric Food Chem 52: 2358-2365.
- 46 -
Study and Development of Fast Analytical and Instrumental Methods
for Food Quality Control in Animal and Vegetable Complex Matrices
Eleonora Laura De Paola (83984@studenti.unimore.it)
Dept. of Agricultural and Food Science, University of Modena and Reggio Emilia, via Amendola, 2, Italy
Tutor: Prof. Andrea Antonelli, Prof. Domenico Pietro Lo Fiego; Co-tutor: Dr. Davide Garbini
This PhD thesis deals with the setting up of analytical and instrumental methods for food quality control. In
particular during the last year, it has been developed an extraction method coupled with a LC-MS/MS instrument
for the determination of acrylamide in dried fruits using a “QuEChERS” approach by dispersive SPE. Linearity,
precision, sensitivity and recovery have been determined to assess the reliability of the method. This study is a
survey on the acrylamide content, a process contaminant, in dried fruits from the Italian market.
Studio e sviluppo di metodi analitici e strumentali veloci per il controllo qualità
in matrici alimentari complesse animali e vegetali
Questa tesi si occupa della messa a punto di metodi analitici e strumentali veloci per il controllo della qualità
alimentare. In particolare nell’ultimo anno è stato sviluppato un metodo estrattivo accoppiato allo strumento LCMS/MS per la determinazione dell’acrilamide nella frutta secca ed essiccata attraverso un approccio QuEChERS e
di SPE dispersiva. La linearità, la precisione, la sensibilità ed il recupero sono stati determinati per testare la validità
del metodo. Questo studio è un'indagine sul contenuto di acrilamide, un contaminante di processo, in frutta secca ed
essiccata presenti sul mercato italiano.
Key words: Acrylamide, process contaminant, LC-MS/MS, Maillard reaction
1. Introduction
The present work is part of a project aimed to set up methods for the determination of compounds involved in food
quality and safety. In the first part of the project a direct transmethylation method for FAME analysis was set up
and coupled with an ultra-fast GC. In fact, the fatty acid profile can be used for frauds identification in several
foods, to determine food adulteration (Ficarra et al., 2010) and it can provide information about the history of the
product. These procedure allowed to complete the analysis of FAME in pork without wasting time and solvent.
Acrylamide (2,3 propenamide) is a process contaminant, absent in the raw material. It is produced during thermal
treatment. This contaminant is present in foods containing a high concentration of reducing sugars and asparagine
though Maillard reaction (Figure 1).
Figure 1 The Maillard reaction
A fast analytical and instrumental method for acrylamide detection and quantification has been set up. The
reliability of the method was tested for linearity, precision, sensitivity, recovery and the extraction yield.
In 2002, the Swedish National Food Administration published alarming data and comments about a disturbingly
high concentration of acrylamide in different foodstuffs normally used by consumers, such as potato chips, French
fries, roast potatoes, breakfast cereal, crisp bread and coffee (Biedermann and Biedermann, in press). This
contaminant is known as carcinogen and neurotoxic.
From 2002 , the acrylamide level has been strictly controlled even if it does not exist a limit for the concentration of
this contaminant in foodstuffs. Nowadays different official documents have been published to monitor acrylamide
levels (Table 1).
- 47 -
Table 1 List of European document about the monitoring of acrylamide levels.
September
2011
Acrylamide toolbox
It provides to national and local authorities, manufacturers and other relevant bodies
brief descriptions of intervention steps which may prevent and reduce formation of
acrylamide in specific manufacturing processes and products
January
2011
Recommendation
EFSA
In this document are listed indicative levels of acrylamide in different foodstuffs
March 2011
Report EFSA
It is the data base of acrylamide levels in several foodstuffs, collected from the
European Member State during 2007-2009
April 2012
Report FSA 02/12
Number 02/12
UK survey about acrylamide and furan in different foodstuffs
1.1 Acrylamide in dried fruits
As acrylamide is present mainly in fried potatoes and in bakery products a lot of data have been collected by the
European Member States (EFSA, 2011) but for dried fruits there is a lack of data.
Although dried fruits are widely used as an ingredient in biscuits, breakfast cereals, bakery product and Italian
typical products, only in the report FSA 02/12 are shown the first data on this topics. For this reason, a survey on 68
samples of dried fruits (Table 2) was carried out.
Table 2 List of samples
Dried fruits
Pistachios
Pine nuts
Peanuts
Walnuts
Almond
Hazelnuts
Dried
prunes
N° samples
7
7
26
4
2
2
13
A HPLC-MS/MS (Agilent-Appied Biosystems) has been used for the analysis of acrylamide. The instrument is
composed by a vacuum pump (HS602), a gas generator (Peak Scientific API Systems), a degaser (Agilent 1200
G1379B), a binary pump (Agilent 1200 G1312A), an autosampler (Agilent 1200 G1329A), a TCC (Agilent 1200
G1316A), a mass spectometer triple quadrupole API 3200 and a column Gemini C18 RP, 250 mm x 2.0 mm, 5
micron (Phenomenex) for the HPLC. The ionization was ESI+ and the transition monitored for acrylamide was
72.1 > 72.1 and 72.1 > 54.9.
Acylamide (99% of purity) was used for the calibration curve and methanol purchased by Sigma-Aldrich,
acetonitrile (AcCN) purchased by Fluka and water (Milli-Q) were used for the extraction of acrylamide together
with a QuEChERS Pouch composed by 4.0 g MgSO4 + 0.5 g NaCl.
The chromatographic conditions have been conducted with an isocratic ramp at ambient temperature and the mobile
phase was composed by 99.5% of water and 0.5% methanol (both with 0.1% formic acid). The flux was 0.25
ml/min.
An innovative approach, relied upon a modified procedure (Mastovska et al., 2007) has been developed for dried
fruits. The method is a fast and ecologically sustainable. The impact of each step of the extraction procedure has
been evaluated, determining the % recovery after the addition of a 250 ppb spike of acrylamide to the samples
(Table 3). As a consequence of these trials the procedure for dried fruits has been adopted as follow: to 2.5 g of
sample and a ceramic homogenizer, 5 ml of water Milli-Q and 10 ml of AcCN have been added and shaken
vigorously for 1 min each one. A prepared mix of QuEChERS Pouch composed by 4,0 g MgSO4 + 0,5 g NaCl has
been added and shaken 1 min by hands and for 3 min with an auto-shaker to permit the anhydrification of the
sample (exothermic reaction) and the migration of acrylamide in the AcCN phase (upper layer after a 3 min
centrifugation at 3000 rpm). An aliquot of the upper layer (2 mL) has been dried under a nitrogen flux (20 min in a
bath at 40°C). The sample has been dissolved in 1 mL of water Milli-Q and filtered with a 0.2 µm filter.
- 48 -
Table 3 Set up of the procedure. Proof 1: effect of the addition of 10 mL of AcCN to 250 ppb of acrylamide; proof 2: proof 1 + 4
.0 g MgSO4 + 0.5 g NaCl; proofs 3 - 4: the same + 2.5 mL, and + 5 mL of water, respectively. A: addition of 4 .0 g MgSO4 +
0.5 g NaCl; W: addition of an alternative salt mixture (8.0 g MgSO4 + 2 g CH3 COONa).
Fitness of the method
Matrix effect
Sample weight effect and of the salt mixture
Samples
% Recovery
Samples
% Recovery
Proof 1
40
Almonds
70
Proof 2
83
Pistachios
62
Proof 3
107
Peanuts
Proof 4
117
g of samples
% Recovery
% Recovery
Almonds
Pistachios
1
70
68
77
2.5
81
73
Pine nuts
63
5
54
38
Hazelnuts
76
1W
54
30
Sultana
61
2.5 W
58
58
Walnuts
82
1A
60
69
Dried prunes
61
2.5 A
70
73
3.1 Linearity and sensitivity
Linearity was tested preparing a calibration curve using increasing concentration of acrylamide, from 1 ppb to 500
ppb basing the choice of the maximum concentration on the EFSA recommendation levels indicated for biscuits,
wafers and crisp bread (dried fruits are not reported). The correlation coefficient (r) was 0.999 that indicates a good
linearity. The limit of detection (LOD) and the limit of quantification (LOQ) calculated for the calibration curve are
1 ppb and 2.5 ppb determined respectively with a signal-to-noise ratio of 3 and 6. LOD and LOQ calculated in the
sample are 2 and 5 ppb.
3.2 Precision
For the determination of the precision 4 levels of contamination have been considered. A sample not contaminated
(pine nuts <LOD), a sample with a not determinable quantity of acrylamide (pistachios <LOQ), a sample with a
medium quantity of acrylamide (peanuts~43 ppb) and a sample with a high (for dried fruits) quantity of acrylamide
(dried prunes~124 ppb). Each sample has been extracted 3 times and injected 3 times. Results show that for
acrylamide concentrations ranged between 5 and 25 ppb, the RSD% associated was 20% and for concentrations
between 26 and 124 ppb the RSD% associated was 10%.
3.3 Recovery % (matrix effect) and extraction yield
For the evaluation of the matrix effect one sample for each matrix has been chosen and spiked with 250 ppb of
acrylamide. The % recovery has been calculated for each sample (Table 3).
For the extraction yield the method was applied to a reference matrix (crisp bread) used in the Food Analysis
Performance Assessment Scheme (FAPAS) as a proficiency test. The concentration of acrylamide determined was
in the range of acceptability applying 61 % of recovery.
4 Result and Discussion
As shown in Table 4, 5, and 6 only two matrices, dried prunes and peanuts, resulted naturally contaminated by
acrylamide. For almonds, pine nuts, hazelnuts, dried sultanas and walnuts value were all < LOD as well for
pistachios except for one sample that was < LOQ (data not shown).
These results were expected because dried fruits are not subjected to high temperature treatments. For dried prunes
the minimum value was 14.74 ppb in sample 9 and the maximum 124.26 ppb in sample 20. For peanuts 2 samples
(41 and 47) were < LOQ and one sample (55) was < LOD. Between the data quantifiable, the lowest value is 6.16
ppb (sample 60) and the highest 42.86 ppb (sample 46). The RSD% range from 10 to 20 that could be considered
good values if compared with 47% found in roasted kernel (Amrein et al., 2005) and 60 % in dried prunes (Amrein
et al. , 2007).
- 49 -
Even if in literature data about the acrylamide level in dried fruits are scarce, Amrein (2007) published data about
the high quantity of acrylamide present in dried prunes. In fact, even if prunes are not exposed to high temperature
(70-80°C), the time of exposure is quite long (24-36 h) to allow acrylamide formation. Moreover, drying (until
about 18% moisture) enhances sugar concentration and along with asparagine (690 ppm) according to Amrein et al.
(2007) can bring to the formation of acrylamide. Ehling and Shibamoto (2005) reported that the ratio between
asparagine and reducing sugars must be 1:3 to allow the acrylamide formation.
For peanuts, the roasting temperatures are the key factors for the formation of acrylamide. Generally temperatures
range between 160 and 180°C with a roasting time of 25-30 min. Moreover, the content of asparagine according to
the journal “Nutspaper” is about 280 ppm, quite enough for acrylamide formation.
RECOVERY %
61
61
61
PPB
44.59
14.75
14.92
±SD
4.46
2..95
RSD %
10
20
61
61
Prunes
Prunes
Prunes
Prunes
Prunes
Prunes
Prunes
Prunes
Prunes
Prunes
Prunes
Prunes
TYPE OF SAMPLE
Prunes
Table 4 Levels of acrilamide naturally present in dried prunes.
61
61
61
61
61
61
61
61
101.31 104.59
34.75
71.15
76.07
71.80
16.75
72.46
45.25
124.26
2.98
10.13
10.46
3.48
7.11
7.61
7.18
3..35
7..25
4.52
12.43
20
10
10
10
10
10
10
20
10
10
10
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
TYPE OF SAMPLE
Peanuts
Table 5 Levels of acrylamide naturally present in peanuts (samples 39-51).
RECOVERY %
77
77
77
77
77
77
77
77
77
77
77
77
77
PPB
11.22
26.49
<LOQ
29.87
18.65
21.71
32.73
42.86
<LOQ
9.71
9.74
14.78
12.88
±SD
2.24
5.30
2..99
3.73
4..34
3..27
4..29
1..94
1..95
2..96
2..58
RSD %
20
20
10
20
20
10
10
20
20
20
20
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
Peanuts
TYPE OF SAMPLE
Peanuts
Table 6 Levels of acrylamide naturally present in peanuts (samples 52-64).
RECOVERY %
77
77
77
77
77
77
77
77
77
77
77
77
77
PPB
21.84
16.13
13.04
<LOD
9.38
12.29
14.83
10.49
6.16
7.45
15.40
1.08
3.30
±SD
4.37
3.23
2.61
1.88
2.46
2.97
2.10
1.23
1.49
3.08
0.22
0.66
RSD %
20
20
20
20
20
20
20
20
20
20
20
20
- 50 -
5 Conclusions and Future Perspective
The data reported in this study show as dried fruits can be considered a low risk food for acrylamide contamination
even if with some exception (dried prunes); moreover monitoring the technological production processes is
fundamental to control acrylamide formation. A QuEChERS HPLC-MS/MS approach could be useful also for fast
and precise determinations of other contaminants or chemical substances for food quality and safety control.
6. References
Amrein TM, Andres L, Escher F, Amadò R (2007) Occurrence of acrylamide in selected foods and mitigation options. Food
Addit and Contam 24: 13-25.
Amrein TM, Lukac H, Andres L, Perren R, Escher F, Amadò R (2005) Acrylamide in roasted almonds and hazelnuts. J Agric
Food Chem 53: 7819-7825.
Barret D M, Somogyi L, Ramaswamy H (2004) Processing fruit science and technology USA: Crc Press.
Biedermann M, Biedermann-Brem S, Noti A, Grob K (to be published) Two GC-MS methods for the analysis of acrylamide in
foodstuffs Mitt Lebensmittelunters Hyg. http://www.laborveritas.ch/php/bdata/files/filesDatei_bdataFileExtPDF/11_acrylamid.pdf
Buccella F, Baldrati C, Petrini N (2010) Arachidi americane Nutspaper anno IV n° I Editore Menabò s.r.l.
CIAA (Confederation of the European Food and Drink Industries) (2009). Rev 12. The CIAA acrylamide toolbox.
Confederation of the European Food and Drink Industries (CIAA), Brussels.
EC (European Commission) (2011) Recommendation of 11 January 2011 on investigations into the levels of acrylamide in food,
C (2010) 9681 final.
Ehling S and Shibamoto T (2005) Correlation of acrylamide generation in thermally processed model systems of asparagine and
glucose with color formation, amounts of pyrazines formed, and antioxidative properties of extracts. J Agric Food Chem
53: 4813-4819.
European Food Safety Autority (2011) Results on acrylamide levels in food from monitoring years 2007-2009 and exposure
assessment EFSA J 9: 2133.
Ficarra A, Lo Fiego DP, Minelli G, Antonelli A (2010) Ultra fast analysis of subcutaneous pork fat. Food Chem 121: 809-814.
Food Standard Agency (2012) A rolling program of surveys on process contaminants in UK retail foods. Acrylamide & furan:
survey 4. Number 02/12 April 2012.
Mastovska K, Lehotay S (2006) Rapid sample preparation methods for LC-MS/MS or GC-MS analysis of acrylamide in various
food matrices J Agric Food Chem 54: 7001-7008.
- 51 -
Long-Term Impact of Farm Management and Crops on Soil Microorganisms
Umberto Della Vella (udellavella@unite.it)
Dept. of Food Science, University of Teramo, Mosciano Sant’Angelo, Italy
Tutor: Prof. Giovanna Suzzi; Co-tutor: Dr. Rosanna Tofalo
In this PhD thesis our objectives are to determine whether different cover crops, separate management practices,
and the management history of the soils lead to differences in microbial community composition, and discern
distinct relationships between soil characteristics, management factors, crops and soil microbial community
composition. Therefore, to study the long-term impact of agronomic management (organic and conventional) and
crop species on soil health and microorganisms a culture-dependent and independent approach was used.
Impatto a lungo termine delle pratiche agronomiche
e delle colture sui microrganismi del terreno
In questa tesi di dottorato i nostri obiettivi sono stati: determinare se differenti colture e pratiche agronomiche e il
pregresso storico di suddette pratiche attuate in campo influenzano la composizione della comunità microbica
presente. Perciò, per studiare l’impatto di pratiche agronomiche a lungo termine (regime organico e/o
convenzionale) e delle specie coltivate sul terreno e i microrganismi è stato utilizzato un approccio colturadipendente ed -indipendente.
Key words: Soil microbial community, PFLA, conventional and organic management.
1. Introduction
The organic farming combine traditional conservation-minded farming methods with modern farming techniques.
Fertility management relies on a long-term integrated approach rather than the more short-term very targeted
solutions common in conventional agriculture (Watson et al., 2002). Organic farmers do not use conventional
inputs such as synthetic pesticides and fertilizers and attempt to close nutrient cycle on their farms, protect
environmental quality, and enhance beneficial biological interactions and processes. Instead of synthetic inputs,
compost and animal and green manures are used to build up soil fertility; pests are controlled naturally, crops are
rotated, and both crops and livestock diversified (Reganold et al., 2001).
1.1 Chemical and microbial properties in organic and conventional soils
Soil biochemical and microbiological indicators can be used to assess soil quality, which has been defined in terms
of sustainability (Bending et al., 2004). Several results with respect to chemical soil parameters were obtained with
studies comparing conventional farms with organic farming systems. Higher levels of total and organic C, total N,
and soluble P were reported for organic soils (Poudel et al., 2002), whereas Mäder et al. (2002) reported small
differences for soil chemical parameters like organic C and P. In the same time, few studies show that organic
farming leads to higher soil quality with higher microbiological activity than conventional farming, due to versatile
crop rotations, reduced application of synthetic nutrients, and the absence of pesticides (Shannon et al., 2002).
Since, the content and the activity of soil microbial biomass are closely related to the C input, the organic
management affects soil microbial properties with a large input of organic matter derived from green manure and
organic fertilizers. Organically managed soils had a higher diversity of bacteria (Mäder et al., 2002), arbuscular
mycorrhizal fungi (Oehl et al., 2003) than conventionally managed soils. However, some authors found no
differences in bacterial biodiversity (Lawlor et al., 2000) or in fungal communities (Franke-Snyder et al., 2001)
between organically or conventionally managed soils.
1.2 Phospholipid fatty acid analysis (PLFA)
Culture-based methodology is inadequate to describe the diversity of bacterial communities in environmental
samples. Alternatively, culture-independent molecular techniques provide relatively new avenues for studying
bacterial communities of soil in general as well as specific functional groups (Hirsch et al., 2010). Phospholipid
ester-linked fatty acid (PLFA) analysis uses the cell membrane lipids within microorganisms as biomarkers for
specific groups of organisms. Phospholipids constitute an important part of all cell membranes, and thus the
phospholipids of a given sample, as reflected in the composition of the associated long-chain fatty acids, are taken
as a fingerprint of the microbial community.
The study was carried out at the experimental field of CRA-ORA Monsampolo del Tronto (AP), Italy, over the
growing season 2010 in a clay loam soil. The surface for the organic rotation is far from the respective conventional
30 m. Treatments consisted of organic versus conventional management and two different crops (Brassica oleracea
- 52 -
L. and Foeniculum vulgare L.). Four-year rotation implemented in experimental fields includes periods of green
manure in organic compared to conventional. The fertilization was performed taking into account the code of good
agricultural practice as well as the actual needs of plants in various stages of development. In the organic system
were distributed slow-release fertilizer such as organic pellets and micro-pellets. The experiment was a split-plot
arranged in a randomized complete block design with three replications. Five replicate samples, each comprising of
three replications, were taken randomly from each different block between the crop rows at one dept (0-10 cm) and
immediately stored in a cooler at 4 °C. In laboratory, stones, large pieces of plant material and soil animals were
removed before use. The samples were named as follows: BIO/FIN (organic management/Foeniculum vulgare),
BIO/CAV (organic management/Brassica oleracea), CON/FIN (conventional management/Foeniculum vulgare),
CON/CAV (conventional management/Brassica oleracea). In the same time, five replicate samples were taken
randomly in four vineyards (two oraganic and two conventional farms) located in three production areas of
Montepulciano d'Abruzzo DOCG "Colline Teramane" with different climatic and topographic characteristics. In
this case, the samples were taken in rhizosphere area at one dept (0-20 cm) and immediately stored in a cooler at 4
°C. The following operations were the same described above. The samples were named Vineyard A and Vineyard
A1 (organic farms); Vineyard B and Vineyard B1 (conventional farms).
3.1 Chemical and microbial analyses
Chemical analyses of BIO and CON samples have been made directly to the CRA-ORA Monsampolo, while those
of the vineyards were carried out at the University of Perugia, Department of Agricultural Chemistry. To evaluate
the principal soil microbial groups, several media were used for growth of culturable microorganisms.
Actinomycetes and nitrogen-fixing bacteria were grown on two selective medium: starch casein agar (Kuster and
Williams, 1964) and brown medium (Thompson, 1989) respectively. The total mesophilic microbiota were grown
on TSA (Tryptone Soy Agar, Oxoid, Milan, Italy) and fungi on YPD (Yeast extract 10 g/L, peptone 20 g/L,
dextrose 20 g/L, agar 18 g/L). For every samples three replicates were performed for each dilution and the
incubation temperature was 26 °C for bacteria and 28 °C for fungi. The plate count was made after 3 days for
nitrogen-fixing bacteria, total mesophilic microorganisms and fungi, and after 7 days for actinomycetes.
3.2 PLFA
Lipid extraction, isolation of phospholipids and methylation of PLFAs was made according to Petersen and Klug
(1994). The gas chromatographic analysis was carried out through Fisons HRGC mega 2 gas chromatograph with
termostated FID detector and an automated sampler. The injection volume was 1 ul, split valve set in split mode
and a split ratio of 5 was employed. Bacterial acid methyl esters mix (BAME; Matreya 1114), methyl 10(Z)heptadecenoate (Matreya 1203) were used to identify peaks, and the internal standard methyl nonadecanoate
(Matreya 1029) was used to quantify data. Fatty acid identified were grouped into satured, Gram-positive and
Gram-negative bacteria, and fungi according to McKinley et al. (2005): saturated (15:0; 17:0), Gram-positive
bacteria (i15:0; a15:0; i16:0; i17:0; a17:0), Gram-negative bacteria (16:1ω9c; cy17:0; cy19:0) and fungi (18:1ω9c;
18:2ω6,9c). Fatty acids are designated by the number of carbon atoms: number of double bonds, location of the first
double bond from the ω (methyl) end of the molecule, cis or trans configuration (c or t letter). Prefixes i, a and cy
indicate iso or anteiso branching and cyclopropyl groups, respectively. The identification of peaks was made by
comparing the retention times (RT). Was also verified any correspondence between the RT peaks on the
chromatogram of the sample and the standard solution. The criterion of acceptability adopted for the identification
of unknown peak corresponds to a range of ± 1.5%. The abundance of individual fatty acid methyl-esters in each
sample was expressed in nmol/g.
4.1 Chemical analyses
In Monsampolo samples (data shown in Table 1) we observed a higher content of organic matter, total and nitric N
in BIO samples compared to CON, due to the use of organic inputs for fertilization (bottom and cover) and crop
residues.
Infact, it has been shown that organic inputs, as a management method, are more important to build up organic soil
fertility. At the same time, in BIO system, we found higher values of organic matter in FIN than CAV theses due,
probably, the culture procession adopted: barley green manure for BIO/FIN and horseradish for BIO/CAV. How
well, it’s very likely that the different nutritional requirements and bio-morphological characteristics of both crops
led to a higher content of nitric N in BIO/FIN and CON/FIN compared to CAV samples. Also the value of
assimilable P is higher in thesis BIO as already reported by other authors. Similar results (data shown in Table 2
and 3) were obtained for vineyards samples. In this case, it’s difficult to compare the samples of the organic
vineyards with conventional ones, since they are located in different areas for which the differences in the values
may not depend only on the type of management. However the values of organic matter, assimilable P and Ntot are
higher in one of two organic vineyards (A) compared to those conventional, and this could be due to the fact that
the vineyard A1 has just begun to implement organic management.
- 53 -
Table 2 Values (Media±S.D.) of chemical analysis of Monsampolo soil samples.
Chemical analyses
pH*
Organic matter*
Ntot**
Assimilable P**
Assimilable Fe**
Assimilable Mn**
Assimilable Cu**
Assimilable Zn**
Exchangeable K **
Exchangeable Mg**
C/N ratio
Mg/K ratio
CEC***
Nitric N**
Humic+Fulvic acids****
Samples
BIO
8.18±0.02
17.31±1.54a
1.23±0.05a
33.01±6.58
11.35±2.91
4.79±0.32a
12.30±0.54a
1.93±0.27a
421.05±19.77a
258.01±16.43a
8.20±0.22b
2.0±0.21
15.26±0.71
15.90±1.62a
0.53±0.03a
CON
8.25±0.04
12.77±0.18b
0.8±0.05b
28.50±3.85
11.07±0.72
3.50±0.12b
9.40±1.86b
1.17±0.05b
352.17±5.33b
216.50±13.94b
9.31±0.12a
1.99±0.23
14.85±0.11
7.70±2.19b
0.45±0.02b
*g/kg; **mg/kg; ***Cation Exchange Capacity (CEC) meq/100g; ****%s.s. Means in rows without common letters (a-b) are
significantly different (p<0.05).
Table 2 Values (Media±S.D.) of chemical analyses of organic vineyards.
Organic
Vineyard A
Vineyard A1
pH*
8.20±0.05
8.10±0.05
Organic matter*
3.28±0.03a
1.22±0.10b
Ntot*
0.19±0.04a
0.07±0.05b
Assimilable P**
65.0±0.57a
22.0±0.59b
Assimilable Fe**
7.0±0.13
7.0±0.04
Exchangeable K **
656.0±1.0a
310.0±1.0b
Exchangeable Mg**
543.0±0.71a
303.0±0.22b
Exchangeable Na
60.0±0.46
60.04±0.24
a
Exchangeable Ca
2571.97±0.80
2538.0±0.22b
a
CEC***
19.33±0.52
16.27±0.11b
*%; **mg/kg; ***Cation Exchange Capacity (CEC) meq/100g. Means in rows without common letters (a-b) are significantly
different (p<0.05).
Chemical analyses
Table 3 Values (Media±S.D.) of chemical analyses of conventional vineyards.
Conventional
Vineyard B
Vineyard B1
pH*
8.30±0.09
8.40±0.08
Organic matter*
1.56±0.43
1.29±0.13
Ntot*
0.09±0.04
0.08±0.03
Assimilable P**
21.0±0.27b
22.0±0.22a
Assimilable Fe**
6.0±0.10a
5.0±0.25b
b
Exchangeable K **
453.03±0.75
596.0±0.39a
b
Exchangeable Mg**
366.0±0.13
534.0±0.78a
b
Exchangeable Na
49.0±0.51
52.0±0.37a
Exchangeable Ca
2908.0±1.0a
1592.0±0.71b
a
CEC***
18.91±0.15
14.12±0.22b
*%; **mg/kg; ***Cation Exchange Capacity (CEC) meq/100g. Means in rows without common letters (a-b) are significantly
different (p<0.05).
Chemical analyses
- 54 -
4.2 Culture-dependent microbial analysis
The ANOVA analysis (Table 4) showed that there is a significant difference of total mesophilic bacteria and
actinomycetes in BIO than CON samples, while we not found differences for nitrogen-fixing bacteria.
Table 4 ANOVA analisys of plate count values performed on Monsampolo soil samples
System
Conventional
Crop
Fennel
Cauliflower
Nitrogen-fixing bacteria
1.1x105
1.1x105
Total mesophilic bacteria
1.4x105
1.2x105
Actinomycetes
2.4x105
1.3x105
Overall average
1.3x105
1.1x105
1.8x105
Fennel
Cauliflower
1.1x106
7.0x105
1.9x105
7.5x104
1.6x106
1.1x106
8.8x105
s.e.d.
294289
System
1
**
Crop
1
n.s.
SxC
1
n.s.
n.s., *, **: not significant or significant at p < 0.05 or p < 0.01
1.3x105
33750
n.s.
*
*
1.3x106
161618.6
**
*
n.s.
Organic
Overall average
We have not found the presence of fungi. The increased presence of actinomycetes in BIO theses is due to larger
amounts of organic matter present in this samples compared with conventional as already shown above. This is in
agreement with some authors who have already demonstrated that the availability of accessible C sources, in
particular organic matter, strongly stimulates the growth of actinomycetes. No significant differences were found
for samples from the vineyards (data not shown). In addition about 600 colonies were isolated and selected
according to colony shape, colour, surface feature and frequency. The isolates belong to Department of Food
Science (University of Teramo) and short will be characterized by molecular analysis.
4.3 PLFA (Culture-independent approach)
To have an overview of microbial communities of the soils subject of this study, we conducted a PLFA analysis.
One of the most important aspects of this analysis is that we have reported the presence of fungi in contrast to that
obtained using culture-dependent approach. In particular, the fatty acid 18:1ω9c was present in all samples, but the
values were much higher in BIO than CON (about twice). The other fatty acid relative to the fungi (18:2ω6,c9) was
found only in the BIO samples while was absent in conventional soil management. Even in the vineyards, we found
a higher presence of these two biomarkers (box-plot of this samples is shown in Figure 1) comparing organic with
conventional samples. The significant differences of fungal biomarkers values in samples are due to stress factors
which these microorganisms are subjected. Infact, generally, the variation of the biomarker 18:2ω6,c9 is associated
with the presence of heavy metals and pesticides, as filamentous fungi are more sensitive. Generally the obtained
data showed that even Gram+ (i15:0, a15:0, i16:0, i17:0 and a17:0) and Gram- (cy17:0, cy19:0) are mainly present
in organic samples. We are also using another culture-independent technique the M-TRFLP (Terminal Restriction
Fragment Length Multiplex-Polymorphism) that surely will give us further information on the microbial
communities present in our samples.
Figure 1 Box-plot chart of organic (a) and conventional (b) vineyards after PLFA analysis.
a
b
Conventional
4,5
4,0
4,0
3,5
3,5
3,0
3,0
2,5
2,5
nmoli/g soil
nmoli/g soil
Organic
4,5
2,0
1,5
2,0
1,5
1,0
1,0
0,5
0,5
0,0
-0,5
i15:0
i16:0
a15:0
i17:0
16:1w9c
cy17:0
a17:0
18:2w6,9c
cy19:0
17
18:1w9c
Mean
25%-75%
Max-Min
Extremes
0,0
-0,5
i15:0
i16:0
a15:0
- 55 -
i17:0
16:1w9c
cy17:0
a17:0
17
18:2w6,9c
cy19:0
18:1w9c
Mean
25%-75%
Max-Min
5. Conclusion and Future Perspectives
Although it’s well known that environmental factors, farming practices and crops influence the development of
microbial communities of croplands yet it is not clear how the interaction of all these factors can influence the type
and amount of microorganisms. Our study shows that the long-term organic management determines an effective
improvement of soil chemical properties and microbial communities. The result takes even more value by the fact
that the experimental field of Monsampolo is unique (the same climatic conditions, exposure, place, etc), but run in
a different way (organic and conventional). The obtained results indicate a significant effect of soil management (in
vineyards too) and crops on soil biota communities (quality and quantity). The PCA analysis will give us more
guidance on the relationship between microorganisms, soil characteristics and crops. We can definitely say that a
proper long-term organic management may be beneficial to the soil and microbial communities and also indirectly
to agricultural crops, but a better knowledge of soil biota will be useful for the development of sustainable
management strategies.
6. References
Bending GD, Turner MK, Rayns F, Marx MC, Wood M (2004) Microbial and biochemical soil quality indicators and their
potential for differentiating areas under contrasting agricultural management regimes. Soil Biol Biochem 36: 1785-1792.
Franke-Snyder M, Douds DD, Galvez L, Phillips JG, Wagoner P, Drinkwater L, Morton JB (2001) Diversity of communities of
arbuscular mycorrhizal (AM) fungi present in conventional versus low-input agricultural sites in eastern Pennsylvania,
USA. Appl Soil Ecol 16: 35-48.
Hirsch PR, Mauchline TH, Clark IM (2010) Culture independent molecular techniques for soil microbial ecology. Soil Biol
Biochem 42: 878-887.
Kuster E, Williams ST (1964) Selection of media for isolation of streptomycetes. Nature 202: 928-929.
Lawlor K, Knight BP, Barbosa-Jefferson VL, Lane PW, Lilley AK, Paton GI, McGrath SP, O’Flaherty SM, Hirsch PR (2000).
Comparison of methods to investigate microbial populations in soils under different agricultural management. FEMS.
Microbiol Ecol 33: 129-137.
Mäder P, Flieβbach A, Dubois D, Gunst L, Fried P, Niggli U (2002) Soil fertility and biodiversity in organic farming. Science
296: 1694-1697.
McKinley VL, Peacock AD, White DC (2005) Microbial community PLFA and PHB responses to ecosystem restoration in
tallgrass prairie soils. Soil Biol Biochem 37: 1946-1958.
Oehl F, Sieverding E, Ineichen K, Mäder P, Boller T, Wiemken A (2003). Impact of land use intensity on the species diversity
of arbuscular mycorrhizal fungi in agroecosystems of central Europe. Appl Environ Microbiol 69: 2816-2824.
Petersen SO, Klug MJ (1994) Effects of sieving, storage, and incubation temperature on the phospholipid fatty acid profile of a
soil microbial community. Appl Environ Microb 60: 2421-2430.
Poudel DD, Horwarth WR, Lanini WT, Temple SR, van Bruggen AHC (2002). Comparison of soil N availability and leaching
potential, crop yields and weeds in organic, low-input and conventional farming systems in northern California. Agric
Ecosyst Environ 90: 125-137.
Reganold JP, Glover JD, Andrews PK, Hinman HR (2001) Sustainability of three apple production systems. Nature 410: 926930.
Shannon D, Sen AM, Johnson DB (2002) A comparative study of the microbiology of soils managed under organic and
conventional regimes. Soil Use Manage 18: 274-283.
Thompson JP (1989) Counting viable Azotobacter chroococcum in vertisols. II. Comparison of media. Plant Soil 117: 17-29.
Watson CA, Atkinson D, Gosling P, Jackson LR, Rayns FW (2002) Managing soil fertility in organic farming systems. Soil Use
Manage 18: 239-247.
- 56 -
Lactococcus garvieae and Morganella morganii as Models
to Study Safety and Quality of Fish Products
Chiara Ferrario (chiara.ferrario@unimi.it)
DeFENS - Dept. of Food, Environmental and Nutritional Sciences, University of Milan, Italy
Tutor: Prof. Maria Grazia Fortina
This PhD thesis reports the study of two bacterial species, Lactococcus garvieae and Morganella morganii, that
represent models of contaminating emerging pathogens in fish products: i) molecular characterization and genetic
polymorphism of L. garvieae strains coming from different food niches; ii) quantification of M. morganii through
the development of a new real-time PCR assay and study of the gene responsible of histamine production during
storage of fish belonging to the Scombridae’s family.
Impiego di Lactococcus garvieae e Morganella morganii
come modelli per lo studio di qualità e sicurezza dei prodotti ittici
Questa tesi di dottorato riporta lo studio di due specie batteriche, Lactococcus garvieae e Morganella morganii,
come modelli batterici di patogeni emergenti nei prodotti ittici: i) caratterizzazione molecolare e polimorfismo
genetico di ceppi di L. garvieae isolati da diverse nicchie alimentari; ii) sviluppo di un nuovo saggio di real-time
PCR per la determinazione di M. morganii e studio del gene responsabile della produzione di istamina durante la
conservazione di pesci appartenenti alla famiglia degli Sgombridi.
Key words: Fish products, Lactococcus garvieae, Morganella morganii, molecular characterization, histidine
decarboxylase.
1. Introduction
In the last two decades, foodborne diseases have been emerging as an important and growing public health concern.
New pathogens or new biovars of known bacterial species are frequently being reported. The impact of most new
pathogens on specific ecosystems and their pathogenicity are not known. Indeed, the traditional food inspection
systems are insufficient, because knowledge of the emerging pathogens is incomplete. To determine the concept of
healthy food, it is crucially important that we expend efforts to comprehensive study of new emerging pathogens
present in food products.
Lactococcus garvieae is a gram positive pathogen bacteria that causes septicemia in fish and serious damage to fish
aquaculture worldwide (Vendrell et al., 2006). However, the host range of L. garvieae is not limited to aquatic
species. This pathogen has also been found in domestic animals, in humans associated with different tissue
infections and in various food matrices, as artisanal cheeses, meat, vegetables and cereals, sometimes as a major
component (Ferrario et al., 2012c). Despite its widespread distribution and emerging clinical significance, little is
known about the genetic content of this microorganism.
Morganella morganii is a gram negative enteric bacteria considered the most prolific histamine former, and the
main responsible for histamine accumulation during storage of fish belonging to the family of Scombridae (tuna,
mackerel). In fact, regarding safety aspects of fishery products, one of the most important parameters to be taken in
consideration is the biogenic amines (BA) content of the product that is also considered as an important index of
product quality. Histamine fish poisoning (HFP) is probably the most common fish-related intoxication (Lehane
and Olley, 2000). This biogenic amine is formed mainly through the decarboxylation of histidine by exogenous
histidine decarboxylases released by the microbial species associated with seafood. Despite the clinical significance
of M. morganii, nearly all data generated for this species are obtained using traditional biochemical tests and
analytical procedures that are time-consuming and often unreliable.
In accordance with the PhD thesis project previously described, this communication reports the main results
obtained for Lactococcus garvieae and Morganella morganii through a polyphasic approach. For L. garvieae we
explored the intra-species variability using a molecular approach comprising PCR-ribotyping, REP and RAPD-PCR
analyses, a multilocus restriction typing (MLRT) carried out on six partial genes (atpA, tuf, dltA, als, gapC and
galP) (Ferrario et al., 2012c), genome sequencing (Ricci et al., 2012) and a Multi Locus Sequence Type (MLST)
study.
For M. morganii we tested the relationship among bacteriological quality, histamine content, and occurrence of
histamine-forming bacteria in fish sample, and developed a reliable PCR-based method targeting the hdc gene,
useful to promptly detect potentially contaminated fish products (Ferrario et al., 2012a). In addition, a new
quantitative real-time assay for the detection and quantification of M.morganii in food matrix was developed
- 57 -
(Ferrario et al., 2012b). We also constructed a DNA library of M. morganii type strain for the evaluation of the
heterologous expression of hdc in E. coli, and carried out typing experiments of M. morganii strains from different
ecological niches.
In accordance with the PhD thesis project previously described, this communication reports the main results
obtained for Lactococcus garvieae and Morganella morganii through a polyphasic approach. For L. garvieae we
explored the intra-species variability using a molecular approach comprising PCR-ribotyping, REP and RAPD-PCR
analyses, a multilocus restriction typing (MLRT) carried out on six partial genes (atpA, tuf, dltA, als, gapC and
galP) (Ferrario et al., 2012c), genome sequencing (Ricci et al., 2012) and a Multi Locus Sequence Type (MLST)
study.
For M. morganii we tested the relationship among bacteriological quality, histamine content, and occurrence of
histamine-forming bacteria in fish sample, and developed a reliable PCR-based method targeting the hdc gene,
useful to promptly detect potentially contaminated fish products (Ferrario et al., 2012a). In addition, a new
quantitative real-time assay for the detection and quantification of M.morganii in food matrix was developed
(Ferrario et al., 2012b). We also constructed a DNA library of M. morganii type strain for the evaluation of the
heterologous expression of hdc in E. coli, and carried out typing experiments of M. morganii strains from different
ecological niches.
Strains and growth conditions. A total of 51 Lactococcus garvieae strains isolated from different food matrices
and 19 Morganella morganii strains from tuna samples and human infections were examined. Escherichia coli
DH5αF’(Promega) was used for DNA manipulations. E.coli BL21(DE3) pLysS (Promega) competent cells, were
used for expression in pURI3 vector. DNA library was built with plasmid pUC19. L.garvieae strains were grown at
37°C in M17 broth, M. morganii and E. coli strains in Luria-Bertani broth. When required, ampicillin was added to
the medium at 100g ml-1. Working cultures were prepared from frozen stocks through two transfers in broth.
Plasmids were conserved at -20°C.
DNA extraction and amplification. For the strains grown in pure culture DNA was extracted as previously
described (Fortina et al., 2009). For the extraction of DNA from food samples, the UltracleanTM Microbial DNA
Isolation Kit was used according to the manufacturer’s instructions. PCR assays were carried out as follow: after
incubation for 2 min at 94 °C, samples were subjected to 35 cycles of 60 s at the annealing temperature followed by
1 min at 72 °C; the reaction was completed by 7 min at 72 °C and kept at 4 °C, using a PCR-Mastercycler 96
(Eppendorf).
Real-time PCR. Quantitative PCR assay was performed by using the SYBR Green chemistry. The identity of the
real-time PCR product was confirmed by performing a melting curve analysis comparing its melting temperature
(Tm) with Tm of the product from the positive control, and with sequence analysis of the obtained amplicons.
Genome analysis. Sequencing analyses were performed employing ABI Prism Big Dye Terminator Kit and the
reaction products were analyzed with the ABI PrismTM310 DNA Sequencer. A whole-genome shotgun strategy
with an Illumina Genome Analyzer Hiseq 1000 was used. Quality-filtered reads were assembled using the Velvet
software (version 1.1.04). Open reading frames (ORFs) were predicted using Glimmer 3.02, functional annotation
was done by merging the results obtained from the RAST (rapid annotation using subsystem technology) Server,
BLAST, tRNAscan-SE 1.21, and RNAmmer 1.2.
Molecular typing. Strains were characterized by combined analysis of REP-PCR using primers (GTG)5 (5’GTGGTGGTGGTGGTG-3’) and BOXA1R (5’- CTACGGCAAGGCGACGCTGACG-3’) and RAPD with primer
M13 (5’- GAGGGTGGCGGTTCT- 3’). Dendrograms were deduced using the unweighted pair group method with
arithmetic average (UPGMA).
Multi Locus Restriction Typing (MLRT). Products from specific amplified loci were tested to select a suitable
discriminating restriction enzyme in order to clearly identify allelic variations. Overnight restriction digestion was
carried out at 37°C in a 20 µL reaction mixture containing 4 µL of the PCR product, 2 µL of 10x incubation buffer
and 10 U of each enzyme (Amersham). Restriction digests were subsequently analyzed by agarose electrophoresis.
Multi Locus Sequence Typing (MLST). Forward and reverse DNA sequences obtained from PCR amplification
of eight selected loci were sequenced, trimmed, aligned and analyzed using MEGA v5 (Takamura et al., 2011).
Allele and isolate dataset creation, arbitrary allele assignation and Sequence Type (ST) were done using mlstdbNet
software. ST clustering into Clonal Complex (CC) were performed using eBURST (Feil et al., 2004). Subgroups
population were detected selecting the consensus network representation on SplitsTree v4.1 (Huson and Bryant,
2006). Phylogenetic analysis were performed using MrBayes (Ronquist et al., 2012) with the GTR evolution
model. The number of segregating or polyphormic site (S), nucleotide diversity (π), Tajima’s D, Fu & Li’s D and F
were calculated using DnaSP v5.10 (Librado and Rozas, 2009). πMAX values were extracted from the squared
similarity matrix calculated with the DNADIST program in the PHYLIP v.3.69 package. To evaluate the intragenic
recombination rate, we used Clonal Frame (Didelot and Falush, 2007) for concatenated sequence loci of all strains
and for separated subgroups.
DNA manipulation and library. 10 µg of DNA and the vector pUC19 were digested with restriction enzymes and
ligated with TL USB ligase. Resulted bands were visualized in agarose gel, cutted and, after purification (Quiakit
gel extraction kit), were sequenced. Sequence similarities searches were carried out using Basic Local alignment
- 58 -
search tool on the EMBL/GenBank databases.
Heterologous expression of hdc in E. coli. The 1.2 kb PCR product of the hdc gene of M.morganii was gelpurified and inserted into pURI3 vector by using the enzyme restriction- and ligation-free cloning strategy
described by Curiel et al.,2011. The corresponding pURI3hdc was firstly amplified in the E.coli DH5α, sequenced
and then transferred, for protein production, to the host E.coli BL21(DE3), grown at 37 °C in LB with ampicillin.
Several conditions were tested to evaluate the best condition for HDC production, comprising the addition of the
inducer isopropyl-β-D-thiogalactopyranoside. After incubation, cells were harvested by centrifugation, washed with
sodium phosphate buffer (pH 6.5) and disrupted by french press. The soluble fraction was quantified using the BioRad protein assay (Biorad) and separed on a sodium dodecyl sulphate (SDS) gel. For protein purification the
soluble fraction was applied to a Talon Superflow metal affinity column (Clontech), equilibrated with sodium
phosphate buffer (pH 6.5). The HDC was eluted by applying a gradient of imidazole (10 mM to 150 mM) and
dialyzed against sodium phosphate buffer (pH 7.0). The HDC activity was assayed in the presence of histidine and
pyridoxal 5’-phosphate. After incubation at 37 °C for 10 min the histamine produced was derivatized and detected
by TLC as described by García-Moruno et al. (2005).
4.1 Lactococcus garvieae
4.1.1 To contribute to the characterization of the natural variability of the species Lactococcus garvieae, we
evaluated the genetic diversity of a collection of strains isolated from different sources. L. garvieae is mainly
known for its presence in aquatic environments and as component of milk and many artisanal cheeses. In this work,
we added new isolates from food matrices not yet or poorly investigated for the presence of L. garvieae,
particularly, meat, vegetables and cereals. Particularly, raw meat and meat products showed the highest prevalence
of contamination. First of all, the strains were explored using a molecular polyphasic approach comprising PCRribotyping, REP and RAPD-PCR analyses. This approach allowed high-resolution cluster analysis in which two
major groups were distinguishable: one group included dairy isolates, the other group meat isolates. Unexpectedly,
of the 12 strains coming from fish, four grouped with dairy isolates, whereas the others with meat isolates.
Likewise, strains isolated from vegetables allocated between the two main groups. When we tested several genes
belonging to the core genome of L. garvieae through a MLRT approach, we observed again that all isolates can be
shared out between two clusters, highly similar to PCR-fingerprinting clusters previously obtained. These data
confirmed the existence of two major division, not coherent with the ecological niche of isolation (Ferrario et al.,
2012c).
4.1.2 For a deeper understanding of the evolutionary history and the global complexity of this bacterial species, we
carried out a MLST analysis of eight selected loci
(atpA, tuf, gyrB, rpoC, dltA, als, gapC, and galP).
The strains investigated included 19 isolates chosen
as representative of the various food sources and 4
fish isolates and 1 human isolate whose genome was
deposited in database. All loci were polymorphic and
the number of polymorphic nucleotide sites varied
between 8 in gapC and 122 in dltA, suggesting a
different evolution rate. By combining the sequence
results of the 8 loci, 17 unique Sequence Types (STs)
were distinguished. The Splitstree analysis in Figure
1, based on concatenated sequence data, revealed the
presence of three subgroups. Two main subgroups
were located in the two major branches of the
phylogenetic tree (subgroups A and B). In addition
one strain (Sa113) present in one individual branch,
formed another subgroup (C). Although subgroups A
and B appeared at approximately the same time (as
evidenced by Clonal Frame analysis in Figure 2),
subgroup B seems to have experienced a recent
expansion of the population size with higher
recombination frequency and effect than those of
Figure 1 Splitstree consensus network constructed from the
subgroup A, and might represent the possible
6553 bp concatenated DNA sequences at eight loci
evolution
direction
toward
adaptation
to
environments.
- 59 -
4.1.3 Finally, we performed the genome sequencing of two strains, representative of the two main genomic lineages
previously obtained, using a whole-genome shotgun strategy. These strains revealed similar genome size
(2,014,328 and 2,087,705 bases) a similar number of predicted genes (about 2,000 CDSs and 42 tRNAs) and
similar G+C content (38.3%) (Ricci et al., 2012). The
newly sequenced genomes and the genomes of five L.
garvieae strains already available in databases, were
used for subsequent analyses. The information derived
from the comparison of the seven genomes suggested
that this species can be described by its “pangenome”, which includes a core genome containing
genes present in all strains and a “dispensable”
genome. The latter is composed of genes absent from
one or more strains and genes that are unique to each
strain, such as genes involved in sucrose and lactose
fermentation. It is interesting to note that gene clusters
involved in exopolysaccharide/capsule biosynthesis,
correlated to pathogenicity in fish, were part of
dispensable genome, and were only present in some
strains, among those isolated from fish. Aside from
the capsule gene clusters, we identified other possible
virulence genes, as candidate genes encoding
haemolysins and cell surface adhesins.
Many shared genes fall into the class of hypothetical
Figure 2 Majority-rule consensus tree based on Clonal
proteins and protein of unknown function, suggesting
Frame output.
that many aspects of basic L. garvieae biology still
need to be explored.
4.2 Morganella morganii
4.2.1 With the aim to study the relationship among bacteriological quality, histamine content and occurrence of
histamine-forming bacteria in fish products, several filleted tuna fish samples sold in wholesale fish market and
different local supermarkets in Milan, Italy, were analyzed. Despite low levels of histamine were detected (<10
ppm), many samples showed high total viable counts that reached dangerous levels after temperature abuse. A PCR
assay targeting the hdc gene revealed that 31% of the 141 enteric bacteria isolated from samples were positive and
potentially able to produce histamine. Among the positive strains, identified by 16S rDNA sequence analysis, 37%
belonged to M. morganii, the most active histamine-producing species (Ferrario et al., 2012a).
Figure 3 Genetic organization of the hdc region in
Morganella morganii DSM 30164T.
4.2.2 To promptly detect potentially contaminated fish
products before histamine accumulates and to monitor risk
factors during processing, storage and marketing, we
developed a SYBR Green quantitative PCR assay (qPCR)
for the specific detection of M. morganii. A primer set,
amplifying a 179-bp fragment of the16S rRNA gene, was
selected for specificity, and 14 M. morganii strains and 32
non-Morganella strains were evaluated. The method was
sensitive because the detection limit was 0.563 pg of pure
DNA, corresponding to DNA extracted from
approximately nine cells.
4.2.3 To improve the knowledge at genome level and to
Figure 4 Molecular fingerprinting of M. morganii
study the expression of the pyridoxal phosphate dependent
strains.
hdc of M. morganii, a DNA library of M. morganii type
strain was constructed and the heterologous expression of
hdc in E. coli was performed. The obtained region of 7681 bp showed the presence of two permease genes (potE)
codifying transporters of the basic aminoacid/polyamine antiporter family, located upstream and downstream from
the hdc gene, codifying the histidine decarboxylase. Oriented in the same direction, partially overlapped, a
- 60 -
histidinyl - tRNA synthetase gene (hisS) was found (Figure 3). The organization of these genes in M. morganii is
unique for the presence of two potE genes. To verify the gene expression and to simultaneously obtain high HDC
protein amount, the hdc gene was cloned into Escherichia coli, grown in different cultural conditions. Recombinant
E. coli strains, grown in a complex medium at 37°C, were shown to over-produce histidine decarboxylase (as
determined by TLC method). The specific protein was purified and conserved for further studies.
4.2.4 Finally, with the aim to prepare a significant collection of different M. morganii strains from different
ecological niches, we selected several clinical biotypes, in addition to strains isolated from fish. In a preliminary
investigation on genetic variability intra-species, by DNA fingerprinting analyses (REP and RAPD-PCR),
interesting results were obtained. As shown in Figure 4, strains could be grouped in relation to their niche of origin;
the low similarity coefficient observed for the two clusters, could indicate a significative influence of the habitat on
the adaptive capability of the strains.
In conclusion, data obtained for the species Lactococcus garvieae and Morganella morganii have contributed to the
advance of knowledge of these emerging pathogens in food, and represent a good standpoint for the development of
more sophisticated approaches, as micro-arrays, metagenomic analyses and post genomic studies. In this way it will
be possible to really understand the role of these species and the risk factors associated to their presence in food.
6. References
Curiel JA, de las Rivas B, Mancheño JM, Muñoz R (2011) The pURI family of expression vectors: A versatile set of ligation
independent cloning plasmids for producing recombinant His-fusion proteins. Protein Expr Purif 76: 44-53.
Didelot X, Falush D (2007) Inference of bacterial microevolution using multilocus sequence data. Genetics 175: 1251-1266.
Feil EJ, Li BC, Aanensen DM, Hanage WP, Spratt BG (2004) eBURST: inferring patterns of evolutionary descent among
clusters of related bacterial genotypes from multilocus sequence typing data. J Bacteriol 186:1518-1530.
Ferrario C, Pegollo C, Ricci G, Borgo F, Fortina MG (2012a) PCR detection and identification of histamine-forming bacteria in
filleted tuna fish samples. J Food Sci 77:115-120.
Ferrario C, Ricci G, Borgo F, Fortina MG (2012b) Species-specific DNA probe and development of a quantitative PCR assay
for the detection of Morganella morganii. Lett Appl Microbiol 54:292-298.
Ferrario C, Ricci G, Borgo F, Rollando A, Fortina MG (2012c) Genetic investigation within Lactococcus garvieae revealed two
genomic lineages. FEMS Microbiol Lett 8: doi: 10.1111/j.1574-6968.2012.02591.
Fortina MG, Ricci G, Borgo F (2009) A study of lactose metabolism in Lactococcus garvieae reveals a genetic marker for
distinguishing between dairy and fish biotypes. J Food Prot 72:1248-1254.
Garcìa-Moruno E, Carrascosa A, Muñoz R (2005) A rapid and inexpensive method for the determination of biogenic amines
from bacterial cultures by thin-layer chromatography. J Food Prot 68:625-629.
Huson DH and Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23:254-267.
Lehane L and Olley J (2000) Histamine fish poisoning revisited. Int J Food Microbiol 58: 1-37.
Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 1:
1451-1452.
Ricci G, Ferrario C, Borgo F, Rollando A, Fortina MG (2012) Genome sequences of Lactococcus garvieae TB2.5, isolated from
Italian cheese, and Lactococcus garvieae LG9, isolated from Italian rainbow trout. J Bacteriol 194: 1249-1250.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012)
MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61: 539542.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using
maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731-2739.
Vendrell D, Balcazar JL, Ruiz-Zarzuela I, de Blas I, Girones O, Muzquiz JL (2006) Lactococcus garvieae in fish: a review,
Comp Immunol Microbiol Infect Dis 29: 177-198.
- 61 -
Development of Nanostructured Sensing Systems for Food Analysis
Giuseppe Christian Fusella (gcfusella@unite.it)
Dept. of Food Science, University of Teramo, Mosciano Sant’Angelo, Italy
Tutor: Prof. Dario Compagnone
Work reports developing of nanostructured gas sensors based on piezoelectric sensors (QCMs). They are modified
with gold nanoparticles (GNP) functionalised with small peptides. Developed sensors were applied in food model
system and real matrices.
Sviluppo di sistemi nanostrutturati per l’analisi di matrici alimentari
Il lavoro mostra lo sviluppo di sensori gas nanostrutturati, sviluppati depositando nanoparticelle d’oro modificate
depositate su sensori piezoelettrici. I sensori così sviluppati sono stati applicati su sistemi modello e matrici reali.
Key words: Gas sensors, aromas, QCM, Gnp.
1. Introduction
In accordance with the PhD thesis project previously described (Fusella, 2010), this abstract reports the main results
on production, characterization and development of sensing systems based on metal nanoparticles;
All chemicals were purchased by Sigma-Aldrich. 20 MHz quartz crystal microbalance were purchased by Elbatech
(Isola d’Elba). GNP were prepared according with Aryal et al. (2006), by reducing of chloroauric acid with NaBH4.
GNPs were functionalized with cysteine (Cys), glutathione (GSH), γ-glutammylcystein (γ-Glu-Cys),
cysteinylglycine (Cys-Gly), thioglycolic acid (TA) and an heptapeptide (N-Cys-Glu-His-Gly-Gly-Pro-Ser-C; HPT).
GNP and GNP modified were characterized using TEM, SEM, UV-Vis spectroscopy. The different GNP colloidal
dispersions were used to modify 20 MHz QCM sensors, by drop casting of 50 µl on each crystal side.
E-nose analysis were performed with a electronic system developed in the Department of Electronic Engineering of
Tor Vergata University (Rome). Working method was previously described by Santonico et al. (2008).
Head-space analysis of samples was carried out as follows: 10 ml sample were introduced in a 100 mL flask, the
flask was then sealed and let to equilibrate for 20 min at 30 °C. The headspace was then fluxed to the sensor array
by a constant flow of nitrogen at 12 l h-1. The Δf has been taken as the average of the last 20 measurements (1/s)
before sending the sample and the average of the last 20 values before the cleaning procedure.
Commercial olive oil samples were equilibrated at 40°C before measurement.
Peptides monolayer formation on gold surfaces can be easily achieved via self-assembling in the presence of a
cysteine containing peptide. However, the formation of such monolayers directly onto the gold electrodes of the
QCMs it is expected to suffer two major drawbacks that could limit the number of binding sites interacting with the
volatiles and, then, the sensitivity of the measurement: a) the “bi-dimensional” nature of the monolayer and b) the
reduced area of the sensor used for the immobilization with respect to the whole area of the QCM sensor. In order
to increase the number of binding sites, it was taken advantage of the large increase of the surface/volume ratio
expected using gold nanoparticles (GNPs). GNPs have been prepared as reported in the experimental section and
modified using aminoacids and dipeptides that constitute the well known cysteine containing tripeptide glutathione;
namely, glutathione (GSH), cysteine (Cys), cysteinil-glycine (Cys-Gly), γ-glutamil-cysteine (γ-Glu-Cys). The aim
was to exploit the sensing ability of such, very simple and structurally closely related compounds in order to
understand the potentialities of using peptides. UV-Vis spectra of all the resulting peptide modified GNPs exhibit
the well known absorption peak of the plasmonic band around 520 nm with broader peaks for all the peptide-GNPs
with respect to GNPs; TEM analysis resulted in an average diameter of 2 ±0.3 nm with a clear tendency of
modified GNPs to form aggregates in the experimental conditions tested.
20 MHz QCMs were modified by casting of GNPs suspensions on both side of the crystals and checking the
variation of the frequency after drying at room temperature under nitrogen overnight. Increasing amounts of GNPs
(up to 300 µL) were tested and resulted in variation of the frequency up to 30 kHz. As a compromise between
simplicity of operation and linearity of the signal, the final amount of suspension used was 100 µL (50 on each
side). Using this volume of GNPs a variation in frequency in the 18-22 KHz range was obtained for all the sensors
realized. The formation of “aggregates” of GNPs was confirmed by the SEM picture after deposition on QCM
(Figure 1).
- 62 -
Figure 1 Show SEM image of GNP depositio on AT-cut quartz.
Typical sensors adsorption kinetics in the realized measurement set-up are reported in Figure 2. The steady state of
the signal was reached in 300 s. Recovery of the signal was achieved in 400 s for all the solvents tested. Thus,
headspace analysis was carried out taking the analytical signal at 600 s and using 600 sec of clean-up cycle.
Figure 2 Kinetics of hexan, ethanol acetone and acetonitrile in experimental condition.
Peptide modified GNPs sensitivity pattern were different indicating different sensing ability despite the similar
structure. In these experimental conditions intraday RSD was in the 1-10% range and interday RSD was in the 316% range for all the QCM sensors.
to test the ability of the GNPs peptide modified QCMs to discriminate simple aromas in different conditions we
challenged the sensors dissolving the aromas in different solvents. The selected aromas were cis-3-hexenol (aroma
of rocket), terpinen-4-ol aroma of green the), ethylacetate (aroma of vinegar) and isopentylacetate (aroma of
banana), that were tested at a concentration of 0.1% (vol/vol). The solvents tested were ethanol acetonitrile, acetone
and hexane; water was not used because in the experimental conditions tested, a drift in the sensor response and
longer recovery times were observed for prolonged use of the sensor array leading to increased values of RSDs. In
order to improve variability of the array the headspace analysis was, in this case, carried out using 7 different
modified QCMs; the 5 sensors already evaluated (GNPs, Cys-GNPs, Cys-Gly-GNPs, γ-glutamil-CYS-GNPs, GSHGNPs) a thioglycholic acid-GNPs (TA-GNPs) and an eptapeptide-GNPs (HEPT) modified QCMs.
The principal component analysis of the data output, reported in Figure 3, confirms that the response of the array is
strongly influenced by the solvent used. In fact, only a partial overlapping of the data from acetonitrile and ethanol
was obtained while the data set in acetone and hexane were clearly separated.
- 63 -
Figure 3 PCA of different aromas prepared in different solvent.
Sensory and gas sensor array analysis of 10 samples of olive oil having the chemical attributes as extravirgin, has
been carried out in parallel. The PCA of the samples analyzed using the sensor array is reported is reported in
Figure 4. From the sensory analysis 5 of the samples were classified as extra virgin (samples 1,2,3,4,10) and 5
having defects. The PCA obtained with peptide sensor array clearly indicates discrimination among the samples
along PC1; the defected samples being not really differentiated between each other. The only sample classified as
extra virgin not separated by defected sample was sample n. 10. These preliminary data appear very promising for
the development of a gas sensor array to classify extra virgin and virgin olive oils. A further optimization of the
method based on the analysis of higher amount of samples as well as appropriate selection of the peptide sensors in
the array and/or use of a more discriminant statistical approach is obviously needed and will be adopted in the
future.
Figure 4 PCA olive oils analysed.
4. Conclusion
The new sensor array is able to descriminate different types of aroma in different conditions. The new material is
useful at room temperature don’t need any activation. Sensitivity is highest for lipophilic matrix.
The new system can be a good promises for quality control in food industry.
5. References
Aryal S., Remant B.K.C., Dharmaray N., Bhattarai N., Kim C.H., Kim H.Y., (2006) Spettroscopic identification of S-Au
interaction in cysteine capped gold nanoparticle. Spect ACTA A 63: 160-163.
Fusella G.C., (2010) Development of nanostructured sensing system for food analysis. In Proc.s of the 15th Workshop on the
Developments in the Italian PhD Research on Food Science Technology and Biotechnology, Portici (NA, Italy), 15-17
September, 2010, pp. 329-330.
Santonico M., Pittia P., Pennazza G., Martinelli E., Bernabei M., Paolesse R., D’Amico A., Compagnone D., Di Natale C.,
(2008). Study of the aroma of artificially flavoured custards by chemical sensor array fingerprinting. Sens Act B 133: 345351.
- 64 -
Development and Validation of Biomarkers to Monitor Human
and Animal Exposure to the Principal Mycotoxins
Lucia Gambacorta (lucia.gambacorta@ispa.cnr.it)
Institute of Sciences of Food Production, ISPA-CNR, Bari, Italy
Tutor: Dr. Michele Solfrizzo
This PhD thesis deals with the development/optimization and validation of a sensitive, accurate, precise and robust
LC-MS/MS analytical method for the simultaneous determination of biomarkers of deoxynivalenol (DON),
aflatoxin B1 (AFB1), fumonisin B1 (FB1), zearalenone (ZEA) and ochratoxin A (OTA) in human and animal urine.
This method was in-house validated and revalidated in a mini-intercomparison study. The applicability of the new
method to real samples was demonstrated in a human pilot study conducted in South Africa and South Italy. The
high percentage of urines found positive for mycotoxin biomarkers permitted to statistically compare the results
from the two countries.
Sviluppo e validazione di biomarcatori per la valutazione dell’esposizione umana
e animale alle principali micotossine
Questa tesi di dottorato riguarda lo sviluppo/ottimizzazione e validazione di un nuovo metodo analitico LC-MS/MS
sensibile, accurato, preciso e robusto per la determinazione simultanea dei biomarcatori di DON, AFB1, FB1, ZEA e
OTA. Il metodo è stato validato con uno studio intralaboratorio e rivalidato con un confronto interlaboratorio.
L’applicabilità del nuovo metodo a campioni reali è stata dimostrata in uno studio pilota sull’uomo condotto in sud
Africa e in sud Italia. L'elevata percentuale di urine positive ai biomarcatori delle micotossine ha permesso di
confrontare statisticamente i risultati ottenuti per i due Paesi.
Key words: Mycotoxins, urine, biomarkers, LC-MS/MS, immunoaffinity cleanup.
1. Introduction
Mycotoxins are toxic metabolites produced by toxigenic fungi that contaminate crops worldwide. The main
mycotoxins occurring in food and feed commodities all over the world are AFB1, OTA, DON, ZEA and FB1
(Miller, 1999). The assessment of human exposure to these mycotoxins is usually performed by means of chemical
analysis of foods and beverages for specific mycotoxins and results are correlated with mean intake of analysed
foods/beverages (WHO/FAO, 2001). However, this approach has several disadvantages that can bring to
overestimation or underestimation of the real intake of humans to mycotoxins. In particular, the high heterogeneity
of mycotoxin distribution in foods requires the use of complex sampling plans that need big efforts in terms of
human and economic resources and are difficult to put in practice. Moreover, due to the diversity in the
composition of different foods/beverages several different analytical methods have to be used to monitor
mycotoxins in different foods/beverages. In addition, individuals may have a quite different intake of each
food/beverage which considerably affect the consequent mycotoxin exposure.
The measurement of specific mycotoxin biomarkers in biological fluids is an alternative approach to measure
human exposure to mycotoxins. This approach can overcome the disadvantages of mycotoxins determination in
foods/beverages and provides information on individual exposure to mycotoxins. Urine can contain parent
mycotoxins and/or relevant metabolites or conjugates that can be used as biomarker of exposure to the principal
mycotoxins. The available data on toxicokinetics of AFB1, OTA, DON, ZEA and FB1 in animals indicate that
suitable urinary biomarkers for these mycotoxins could be aflatoxin M1 (AFM1), OTA, DON/de-epoxydeoxynivalenol (DOM-1), ZEA/alpha-zearalenol (α-ZOL)/beta-zearalenol (β-ZOL) and FB1 respectively (Benford
et al., 2001; Crews et al., 2001; Meky et al., 2003; Danicke et al., 2005; Shephard et al., 1994). The measurement
of urinary AFM1 has been used to assess human exposure to AFB1 in China, South America and Africa (Zhu et al.,
1987; Romero et al., 2009; Calori-Domingues et al., 2005; Polychronaky et al., 2008). The measurement of urinary
DON and DOM-1 has been extensively used to demonstrate the wide exposure of humans to DON in Europe
(Turner et al., 2008a,b; 2010a,b). The measurement of urinary FB1 in humans has been used to demonstrate the
efficacy of an intervention strategy that reduced the levels of fumonisins in maize consumed in South Africa (van
der Westhuinzen et al., 2011). The measurement of OTA in blood and urine has showed the widespread exposure
of humans to this mycotoxin in Europe. Moreover, it was demonstrated that urinary concentrations of OTA, instead
of blood concentration, correlates better to the intake of this toxin (Gilbert et al., 2001). ZEA and α-ZOL have been
detected in blood of Italian girls with precocious puberty (Massart et al., 2008) whereas no study has been
performed on the occurrence of these biomarkers in human urine. On the other hand urinary concentrations of ZEA,
α-ZOL and β-ZOL have been used in several animal studies (Danicke et al., 2005; Zollern et al., 2002). All these
studies were performed by using specific methods for biomarker(s) determination of a single mycotoxin. Since
- 65 -
humans and animals can be exposed contemporaneously to several mycotoxins, the development and validation of
methods for multi-biomarker determination is necessary to assess the frequency and levels of human and animal
exposure to the major mycotoxins.
In this contribute we propose a liquid chromatography tandem mass spectrometry (LC-MS/MS) method for
simultaneous determination of mycotoxin biomarkers in human and animal urine. In particular we demonstrated
that the use of LC-MS/MS coupled to multi-antibody immunoaffinity column permitted to reach the necessary
sensitivity and specificity for the simultaneous determination of biomarkers of AFB1, DON, ZEA, OTA and FB1 in
human and animal urines. This method permits, with a single analysis, to measure the individual exposure to the 5
principal mycotoxins that could contaminate different foods/beverages. Analyses of human and animal urine
samples collected in South Italy and South Africa demonstrated the applicability of this method to real samples. In
particular, measurable concentrations of biomarkers of AFB1, DON, ZEA, OTA and FB1 were measured in the
majority of analysed samples.
LC-MS/MS analyses were performed on a QTrap MS/MS system (Applied Biosystems), equipped with an ESI
interface and an 1100 series micro-LC system comprising a binary pump and a microautosampler from Agilent
Technologies. The separation of biomarkers was performed with a Gemini C18 column (150 mm × 2 mm, 5μm
particles; Phenomenex), preceded by a Gemini C18 guard column (4 mm × 2 mm, 5μm particles). The column oven
was set at 40 °C. The flow rate of the mobile phase was 200 μL min-1 and the injection volume was 20 μL. For LCMS/MS analyses, the ESI interface was used in positive mode for AFM1, FB1 and OTA and in negative mode for
DON, DOM-1, α-ZOL and β-ZOL.
The enzymatic pre-treatment with β-glucuronidase/sulphatase was performed to deconjugate biomarkers from
glucuronic acid or sulphate in naturally contaminated urine samples. After enzymatic pre-treatment urine samples
were purified and concentrated by a double cleanup approach, using a multi-antibody immunoaffinity column
(Myco6in1, Vicam) and a reversed-phase SPE column (Oasis HLB). The final eluate was dried, reconstituted in LC
mobile phase, filtered and analyzed by LC-MS/MS. Recovery experiments were performed by using urine samples
collected from six individuals within the age range 26-87 years and one pig. Spiking levels are reported in Table 1.
The quantitative measurement of each biomarker was performed by using matrix-assisted calibration curve to
compensate for matrix effects. Detailed descriptions of experimental protocol, equipment and conditions, enzymatic
pre-treatment, sample cleanup, spiking procedure and calibration curve are reported elsewhere (Solfrizzo et al.,
2011).
2.1 Mini Intercomparison Study
The method was re-validated in a mini intercomparison study involving 3 laboratories (CNR-ISPA, University of
Leeds and IFA-Tulln) that used their own method for biomarker determination. CNR-ISPA, in addition to
participating in the study, coordinated the study, prepared and shipped the urine samples and calibration solutions
and performed the statistical evaluation of the results. Laboratory 1 and 3 (CNR-ISPA) analyzed urine for 8
biomarkers whereas Laboratory 2 only for DON and FB1 by using a single method for each biomarker.
A mixture of human urine samples was prepared by mixing equal volumes of urine collected from 9 healthy
volunteers (three male and six female, 9-65 years old). Aliquots of this sample were used to prepare blank and
spiked samples containing biomarkers at 2 concentrations. Blank and spiked urine samples were kept frozen at 20°C until dispatch to the participants under dry ice. Each participant received: a) 1 tube containing blank human
urine, b) 4 tubes containing blind duplicate human urine samples spiked at two different concentrations, c) 1
ampoule containing the calibration solution.
Blank urine samples were spiked with the following concentrations 15 and 30 ng/mL for DON; 35 and 70 ng/mL
for DOM-1; 0,5 and 1 ng/mL for AFM1; 4 and 8 ng/mL for FB1, β-ZOL and α-ZOL; 1.5 and 3 ng/mL for ZEA; 0.3
and 0.6 ng/mL for OTA. Sample cleanup was performed by laboratories 2 and 3 (immunoaffinity or solid phase
extraction cleanup) whereas Laboratory 1 used the dilute and shoot approach. For quantification, laboratory 1
prepared the calibration curves in pure solvent mixture. Laboratory 2 prepared the calibration curves in pure solvent
mixture spiked with one concentration of internal standard; this laboratory also spiked each urine sample with one
concentration of internal standard to compensate for recovery and matrix effects. Laboratory 3 prepared matrixassisted calibration curves to compensate for matrix effects.
2.7 Improvement of method sensitivity
To improve the sensitivity of our method the chromatographic separation and MS/MS quantification of the
biomarkers were performed with a more powerful apparatus. The instrumentation was an API 5000 MS/MS system
with ESI interface from Applied Biosystems coupled to an Acquity UPLC system comprising a binary pump and a
microautosampler from Waters. The biomarkers were separated with an Acquity UPLC BEH phenyl column (2.1 x
150 mm, 1.7 µm particles). The improved method using the UPLC-API 5000 MS/MS system was used to analyse
52 human urine samples collected in South Africa and 52 human urine samples collected in South Italy. For
comparison the urines collected in South Africa were also analysed by the University of Leeds for DON and FB1
and by IFA Tulln for all mycotoxin biomarkers.
- 66 -
3.1 Performance of the New Method
In Figure 1 is reported the LC-MS/MS chromatogram of a mixture of standards of DON, DOM-1, AFM1, FB1, αZOL, β-ZOL and OTA (a) and the chromatogram of a spiked human urine sample (b). Due to the big difference in
polarity of the tested analytes a 3 step linear gradient of acidic MeOH in acidic water (from 20 to 80%, 0.5% acetic
acid) was necessary to separate the 7 biomarkers in 38 min.
Figure 1 Total ion chromatogram (TIC of MRM) of: (a) a standard mixute in MeOH+water (20+80) containing 0.5% acetic
acid, 450 ng/mL DON, α-ZOL and β-ZOL, 225 ng/mL DOM-1, 45 ng/mL AFM1, 90 ng/mL FB1 and 4.5 ng/mL OTA;
(b) human urine sample spiked with 9 ng/mL DON, α-ZOL and β-ZOL, 4.5 ng/mL DOM-1, 0.9 ng/mL AFM1, 1.8
ng/mL FB1 and 0.09 ng/mL OTA.
In Table 1 are reported the method performance characteristics obtained from quadruplicate analyses of urine
samples spiked at four levels and quantified by using matrix-matched calibration curves. Acceptable mean recovery
values were obtained for all tested analytes which ranged between 61 and 95%. The repeatability of results was also
acceptable and ranged between 3 and 20%. The limits of detection (LOD, calculated as signal to noise 3) ranged
from 0.01 ng/mL (OTA) to 2.2 ng/mL (β-ZOL). These limits are suitable to measure the concentrations reported in
the literature for DON, FB1 and OTA in human urines. Good performance characteristics were also obtained when
the method was tested on pig urine and urine collected from 6 individuals.
Table 1 In-house validation results from analysis of spiked human urine samples analysed in quadruplicate at each spiking level
Biomarker
Spiking levels
(ng/mL)
DON
3.0, 6.0, 9.0, 12.0
DOM-1
1.5, 3.0, 4.5, 6.0
0.3, 0.6, 0.9, 1.2
AFM1
FB1
0.6, 1.2, 1.8, 2.4
α-ZOL
3.0, 6.0, 9.0, 12.0
β-ZOL
3.0, 6.0, 9.0, 12.0
OTA
0.03, 0.06, 0.09, 0.12
a
RSDr within-laboratory relative standard deviation
% Mean recovery
(n=16)
77
78
95
61
72
83
61
RSDra range
(%)
3–7
4–18
5–7
5–17
6–17
12–20
5–9
3.2 Results of the Mini Intercomparison Study
Individual result performance for each laboratory and for each biomarker result was evaluated in terms of z-score in
accordance with the International Harmonised Protocol (Thompson et al., 2006).
The z-score compares the participant's deviation from the assigned value (spiking concentration) with the target
standard deviation accepted for the proficiency test. The z-score is interpreted as: |z| ≤ 2 (satisfactory result), 2 < |z|
≤ 3 (questionable result) and |z| > 3 (unsatisfactory result).
With the exception of some FB1 and OTA results reported by Laboratory 1 and 2 and one result reported by
Laboratory 3 all other z-score results from the 3 laboratories were satisfactory. The overall percentage of
satisfactory z-scores for all biomarkers was 84% (64 results out of 76). The repeatability of results reported by the 3
laboratories, calculated for each biomarker, were all acceptable (< 15%) with the exception of FB1 results of
Laboratory 1. The results of our laboratory were all acceptable with the exception of one out of 4 determination of
α-ZOL (z = 2.4). Good results were also obtained for ZEA not included in the panel of biomarkers in previous inhouse validation of our method.
- 67 -
Table 2 Individual z-score results for each biomarker in duplicate human urine samples (samples A and C; samples B and D)
spiked at two different biomarker concentrations.
Biomarker
1
Assigned
value
ng/ml1
DON
DON
DOM-1
AFM1
FB1
FB1
β-ZOL
α-ZOL
ZEA
OTA
15
15
35
0.5
4
4
4
4
1.5
0.3
Laboratory 1
Sample
A
1.52
1.33
1.0
-0.4
17.0
-0.9
-0.6
-1.5
24.2
Sample
C
0.62
1.03
0.6
-0.4
6.8
-0.7
-0.7
-1.5
28.8
Laboratory 2
Sample
A
0.23
na
na
3.4
1.04
na
na
na
na
Sample
C
0.63
na
na
3.3
1.04
na
na
na
na
Laboratory 3
Sample
A
0.32
-0.3
0.1
1.8
1.5
1.1
0.9
0.15
Sample
C
0.52
-0.4
0.0
1.6
0.8
2.4
1.5
0.15
Assigned
value
ng/ml1
30
30
70
1
8
8
8
8
3
0.6
Laboratory 1
Sample
B
0.52
0.33
0.2
-0.5
9.1
-1.1
-0.8
-1.2
15.5
Sample
D
-0.22
0.03
-0.7
0.1
1.7
-1.0
-1.0
-1.0
13.2
Laboratory 2
Sample
B
-0.13
na
na
2.7
0.64
na
na
na
na
Sample
D
-0.23
na
na
2.7
0.64
na
na
na
na
Laboratory 3
Sample
B
-1.02
-0.9
-0.2
1.2
0.6
1.0
0.1
-1.7
Sample
D
-0.82
-0.9
-0.3
1.1
0.2
1.4
0.6
-1.7
Spiking level
Result of DON after subtracting free endogenous DON. Samples analyses without enzymatic pre-treatment
3
Result of DON after subtracting free endogenous DON and DON derived from DON-Glu. Samples analyses after enzymatic
pre-treatment
4
Results obtained with own standards
na: not analyzed
-: not applicable
2
3.3 Performance of the UPLC-MS/MS method
The use of UPLC-API 5000 MS/MS system produced a marked increase of sensitivity (up to 114 times) for AFM1,
FB1,α-ZOL, β-ZOL, ZEA and OTA whereas for DON the same sensitivity was observed for this system and LCQTrap MS/MS (Table 3). The use of UPLC-API 5000 MS/MS system produced a marked ion suppression for
DOM-1 that made undetectable this compound.
Table 3 LOQ values for DON, DOM-1, AFM1, FB1, β-ZOL, α-ZOL, ZEA and OTA in human urine samples obtained with LCQTrap MS/MS system and UPLC-API 5000 MS/MS system.
Apparatus 1: LC-QTrap MS/MS
Apparatus 2: UPLC-API 5000 MS/MS
LOQ (ng/mL)
LOQ (ng/mL)
DON
1.5
1.5
DOM-1
1.5
na
AFM1
0.1
0.02
0.1
0.01
FB1
β-ZOL
4.4
0.05
α-ZOL
1.6
0.029
ZEA
0.8
0.007
OTA
0.02
0.006
na: not applicable due to a marked signal suppression effect that made undetectable this compound
Biomarker
The improved method was used in a human pilot study for the analysis of human urine collected in South Africa
and in South Italy. The percentage of positive sample and means of each biomarker concentrations measured in
urine samples are reported in Table 4. In South Africa an high percentage of samples were found positive for OTA
and biomarker of Fusarium toxins (DON, FB1, β-ZOL, α-ZOL and ZEA) whereas all samples were negative for
AFM1 suggesting that exposure to AFB1 is absent. Eight percent of samples collected in South Italy were positive
for AFM1 suggesting that exposure to the high carcinogenic AFB1 occurs in Italy but it is limited to few individuals.
High percentage of positive samples for DON, ZEA and OTA were also observed for Italians urine. Difference
between the two countries was observed for FB1 (56% positive in Italy and 96% positive in South Africa) and
AFM1 (8% positive in Italy and all negative in South Africa). Statistically significant difference between biomarker
concentrations measured in South Africa and Italian urine were observed for DON, FB1, ZEA and OTA (Table 4).
These differences demonstrated that human exposure to FB1 and ZEA is higher in South Africa whereas for DON
and OTA human exposure was higher in South Italy.
Table 4 Comparison of results of 52 urine samples collected in South Africa and 52 urine samples collected in South Italy
Biomarker
DON
AFM1
FB1
β-ZOL
α-ZOL
ZEA
OTA
nd: not detected
% positive
96
8
56
98
100
100
98
South Italy
mean ± SD (ng/ml)
11.9 ± 10.1
0.05 ± 0.06
0.06 ± 0.07
0.09 ± 0.01
0.077 ± 0.027
0.057 ± 0.023
0.144 ± 0.312
South Africa
% positive
mean ± SD (ng/ml)
87
4.9 ± 7.6
0
nd
96
0.84 ± 1.06
75
0.24 ± 0.82
92
0.257 ± 0.590
100
0.204 ± 0.456
98
0.024 ± 0.058
- 68 -
P
< 0.0001
nd
< 0.0001
0.6185
0.0302
0.0098
< 0.0001
4. Conclusions
The new multi-biomarker method based on a double cleanup before LC-MS/MS determination is suitable to
measure biomarkers of DON, AFB1, FB1, ZEA and OTA at concentrations naturally occurring in human and animal
urines. The method was validated in a mini intercomparison study showing satisfactory z-score values (|z| ≤ 2) for
31 out of 32 determinations. The good sensitivity of the UPLC-API 5000 MS/MS method permitted to identify the
multiple mycotoxin exposure of humans resident in South Italy and South Africa. Moreover, a very high percentage
of human urine samples were found positive for DON, ZEA, α-ZOL, β-ZOL and OTA in South Italy and for DON,
ZEA, α-ZOL, β-ZOL, OTA and FB1 in South Africa. Work is in progress to evaluate the correlation between
urinary biomarker concentrations and levels of mycotoxins measured in maize based foods collected in South
Africa.
5. References
Benford D, Boyle C, Dekant W, Fuchs R, Gaylor DW, Hard G, McGregor DB, Pitt J, Plestina R, Shephard G, Solfrizzo M,
Verger JP, Walker R (2001) Safety evaluation of certain mycotoxins in food. International Programme on Chemical Safety
(IPCS). Food and Agriculture Organization of the United Nations (FAO). World Health Organization (WHO), Geneva.
Calori-Domingues MA, Gloria EM, Jolly P, Jiang Y, Ellis W, Awuah R, Nnedu O, Phillips T, Wang JS, Afriyie-Gyawu E,
Tange L, Person S, Williams J, Jolly C (2006) Determinants of aflatoxin levels in Ghanaians: sociodemographic factors,
knowledge of aflatoxin and food handling and consumption practices. Int J Hyg Environ Health 209: 345-358.
Crews H, Alink G, Anderson R, Braesco V, Holst B, Maiani G, Ovesten L, Scotter M, Solfrizzo M, van den Berg R, Verhagen
H, Williamson G (2001) A critical assessment of some biomarker approaches linked with dietary intake. Br J Nutr 86: S5S35.
Dänicke S, Brüssow KP, Valenta H, Ueberschär KH, Tiemann U, Schollenberger M (2005) On the effects of graded levels of
Fusarium toxin contaminated wheat in diets for gilts on feed intake, growth performance and metabolism of deoxynivalenol
and zearalenone. Mol Nutr Food Res 49: 932-943.
Gilbert J, Brereton P, MacDonald S (2001) Assessment of dietary exposure to ochratoxin A in the UK using a duplicate diet
approach and analysis of urine and plasma samples. Food Addit Contam 18: 1088-1093.
Massart F, Meucci V, Saggese G, Soldani G (2008) High growth rate of girls with precocious puberty exposed to estrogenic
mycotoxins. J Pediatr 152: 690-695.
Meky FA, Turner PC, Ashcroft AE, Miller JD, Qiao YL, Roth MJ, Wild CP (2003) Development of a urinary biomarker of
human exposure to deoxynivalenol. Food Chem Toxicol 41: 265-273.
Miller JD (1999) Mycotoxin Francis FJ (ed) In: Encyclopedia of food science and technology, New York: Wiley 1698-1706.
Polychronaki N, Wild CP, Mykkänen H, Amra H, Abdel-Wahhab M, Sylla A, Diallo M, El-Nezami H, Turner PC (2008)
Urinary biomarkers of aflatoxin exposure in young children from Egypt and Guinea Food Chem Toxicol 46: 519-526
Romero AC, Ferreira TRB, Dias CTS, Calori-Domingues MA, Gloria EM (2010) Occurrence of AFM1 in urine samples of a
Brazilian population and association with food consumption. Food Control 21: 554-558
Shephard GS, Thiel PG, Sydenham EW, Alberts JF, Cawood ME (1994) Distribution and excretion of a single dose of the
mycotoxin fumonisin B1 in a non-human primate. Toxicon 32: 735-741.
Solfrizzo M, Gambacorta L, Lattanzio VM, Powers S, Visconti A (2011) Simultaneous LC-MS/MS determination of aflatoxin
M1, ochratoxin A, deoxynivalenol, de-epoxydeoxynivalenol, α and β-zearalenols and fumonisin B1 in urine as a multibiomarker method to assess exposure to mycotoxins. Anal Bioanal Chem 401: 2831-2841.
Turner PC, Burley VJ, Rothwell JA, White KLM, Cade JE, Wild CP (2008a) Deoxynivalenol: rationale for development and
application of a urinary biomarker. Food Addit Contam 25: 864-871.
Turner PC, Burley VJ, Rothwell JA, White KL, Cade JE, Wild CP (2008b) Dietary wheat reduction decreases the level of
urinary deoxynivalenol in UK adults. J Expo Sci Environ Epidemiol 18: 392-399.
Turner PC, White KL, Burley VJ, Hopton RP, Rajendram A, Fisher J, Cade JE, Wild CP (2010a) A comparison of
deoxynivalenol intake and urinary deoxynivalenol in UK adults. Biomarkers 15: 553-562.
Turner PC, Hopton RP, Lecluse Y, White KL, Fisher J, Lebailly P (2010b) Determinants of urinary deoxynivalenol and deepoxy deoxynivalenol in male farmers from Normandy, France. J Agric Food Chem 58: 5206-5212.
van der Westhuizen L, Shephard GS, Burger HM, Rheeder JP, Gelderblom WGA, Wild CP, Gong YY (2011) Fumonisin B1 as a
urinary biomarker of exposure in a maize intervention study among south african subsistence farmers. Cancer Epidem
Biomar 20: 483-489.
WHO/FAO Safety evaluation of certain mycotoxins in food. Prepared by the fifty-sixth meeting of the Joint FAO/WHO Expert
Committee on Food Additives (JECFA). WHO food additives series 47. FAO food and nutrition paper 74. International
Programme on Chemical Safety, World Health Organization, Geneva.
Zhu J, Zhang L, Hu X, Xiao Y, Chen J, Xu Y, Fremy J, Chu FS (1987) Correlation of dietary aflatoxin B1 levels with excretion
of aflatoxin M1 in human urine. Cancer Res 47: 1848-1852
Zollern P, Jodlbauer J, Kleinova M, Kahlbacher H, Kuhn T, Hochsteiner W, Lindner W (2002) Concentrations levels of
zearalenone and its metabolites in urine, muscle tissue, and liver samples of pig feed with mycotoxin-contaminated oats. J
- 69 -
Development of New Alimentary Additives and Evaluation of their
Effectiveness to Reduce Human and Animal Exposure to Mycotoxins
Donato Greco (greco_donato@libero.it)
Istituto di Scienze delle Produzioni alimentari, ISPA-CNR, Bari, Italy
Tutor: Dr. Giuseppina Avantaggiato
Aim of this PhD thesis is the in vitro selection of commercial agents and very fine sized agricultural products
(mainly by-products) for preparing a nutritional composition intended to reduce mycotoxin bioavailability in farm
animals. In particular, the study explores the feasibility of using agriculture residues as potential low-cost products
able to adsorb the mycotoxins that are found more frequently as feed contaminants, such as aflatoxin B1 (AFB1)
ochratoxin A (OTA), zearalenone (ZEA), fumonisin B1 (FB1) and deoxynivalenol (DON).
Sviluppo di nuovi additivi alimentari e valutazione della loro efficacia a ridurre
l’esposizione umana ed animale alle principali micotossine
Scopo della presente tesi di dottorato è valutare l’efficacia di prodotti commerciali e materiali di origine vegetale a
sequestrare/adsorbire le micotossine che ricorrono con maggiore frequenza in alimenti e mangimi (in particolare,
AFB1, OTA, ZEA, FB1 e DON). Lo studio ha come obiettivo principale il recupero di scarti vegetali derivanti dal
settore agricolo e agroalimentare per la produzione di additivi alimentari. L’ambito di applicazione dell’idea
riguarda lo sviluppo di nuovi materiali da proporre in campo mangimistico quali additivi per la riduzione della
contaminazione e la prevenzione degli effetti tossici delle micotossine.
Key words: Mycotoxins, mycotoxin-detoxifying agents, mycotoxin decontamination, agriculture residues.
1. Introduction
This paper summarizes some of the main results obtained within the PhD thesis aimed to:
A.1 assess the efficacy of agricultural products in binding, simultaneously, different classes of mycotoxins;
A.2 select by in vitro tests the most promising additives to be further tested in feeding trials with piglets for their
efficacy in reducing mycotoxin bioavailability;
A.3 study the mycotoxin adsorption mechanism of the selected additives by adsorption isotherms.
2. Mycotoxin-Detoxifying Agents
Mycotoxins have become one of the most recognised feed chain contaminants, with hundreds of mycotoxins
identified to date (Avantaggiato and Visconti, 2010). One of the strategies for reducing the exposure to mycotoxins
is to decrease their bioavailability by including various adsorbing agents into the compound feed, which leads to a
reduction of mycotoxin uptake as well as distribution to the blood and target organs (Avantaggiato et al., 2005).
Recently, the status of commitments on the European market of these feed additives has been regulated by the
Commission Regulation (EC) No. 386/2009, which introduced a new functional group within the category of
technological feed additives entitled “substances for reduction of the contamination of feed by mycotoxins:
substances that can suppress or reduce the absorption, promote the excretion of mycotoxins or modify their mode of
action” (EC, 386/2009). Following a request from the European Commission, in July 2010, the FEEDAP Panel of
the European Food Safety Authority (EFSA) issued a statement detailing the additional information that would be
required to perform an assessment of the safety and efficacy of this new group of additives (EFSA, 2009).
According to this statement the efficacy of additives should be demonstrated by both in vitro and in vivo studies. In
vitro evaluations are considered a key step in the development and quality control of feed additives, and are useful
as screening method for potential mycotoxin-detoxifying agents. Using equilibrium adsorption isotherms, in vitro
evaluations may also provide indications on the mode of action of additives.
3. Isotherm Adsorption Experiments
In general, an adsorption isotherm is a curve describing the phenomenon governing the retention (or release) or
mobility of a substance from the aqueous porous media or aquatic environments to a solid-phase at a constant
temperature and pH. Adsorption equilibrium (the ratio between the adsorbed amount with the remaining in the
solution) is established when an adsorbate containing phase has been contacted with the adsorbent for sufficient
time, with its adsorbate concentration in the bulk solution is in a dynamic balance with the interface concentration.
Typically, the mathematical correlation, which constitutes an important role towards the modeling analysis,
operational design and applicable practice of the adsorption systems, is usually depicted by graphically expressing
the solid-phase against its residual concentration. Its physicochemical parameters together with the underlying
- 70 -
thermodynamic assumptions provide an insight into the adsorption mechanism, surface properties as well as the
degree of affinity of the adsorbents. Over the years, a wide variety of equilibrium isotherm models have been
formulated to describe surface adsorption. Some of these models (Langmuir and Freundlich equations) have been
applied in the present work to study mycotoxin isotherm adsorption to feed additives. Freundlich expression is an
exponential equation and therefore assumes that the concentration of adsorbate on the adsorbent surface increases
with the adsorbate concentration. The equation is widely applied in heterogeneous systems. The Freundlich
equation is given as: Ca = Kf Cs1/n where Kf is a constant related to the capacity, and 1/n is a constant related to the
adsorption intensity.
The Langmuir adsorption isotherm is probably the most widely applied adsorption isotherm. It is based on the
following assumptions: - adsorbates are chemically adsorbed at a fixed number of well-defined sites; - each site can
only hold one adsorbate; - all sites are energetically equivalent; - there is no interaction between the adsorbates. The
Langmuir equation is formulated as: Ca = Qmax [(KL Cs)/(1 + KL Cs)] where Qmax is a Langmuir constant that
expresses the maximum mycotoxin uptake and KL is a constant related to the energy of adsorption and affinity of
the adsorbent.
4.1 Multi-mycotoxin adsorption experiments
The materials assayed as mycotoxin-adsorbents were 37 agricultural products particularly rich in insoluble dietary
fibres. They were obtained from local markets and included vegetables (15), legumes (8), fruit pomaces (5), legume
by-products (3), dry fruit shells (2), pruning by-products (2), tubers (1), and straw (1). Fresh agricultural products
were first dried, then ground and sieved in order to have a micro-powder (<63 µm).
In the preliminary set of trials aimed to select the most promising mycotoxin adsorbents, all products were assayed
at 0.1% (w/v) inclusion level for their ability to bind simultaneously different mycotoxins from a multi-toxin
working solution containing 1 µg/mL of AFB1, ZEA, FB1, OTA, and DON. Subsequently, some agricultural byproducts were selected and tested at inclusion levels higher than 0.1% (i.e., 1 or 2%) towards the same multi-toxin
working solution. All experiments were performed in triplicate. The effect of medium pH (pHs 3 and 7) on
mycotoxin adsorption was also investigated. Briefly, the principle of the adsorption method consists in adding
known volumes of mycotoxin solution to material samples of known dry weight. The mixture is agitated for an
appropriate time (90 min), at constant temperature (37°C). The material suspensions are then separated by
centrifugation and/or filtration and the aqueous phase is analysed. In this study, supernatants were split in 2 aliquots
and made ready for analysis of residual mycotoxin content by High Performance Liquid Chromatography (HPLC)
for FB1 and by Ultra Performance Liquid Chromatography (UPLC) for simultaneous determination of AFB1, ZEA,
OTA and DON. FB1 analysis required pre-column derivatization of toxin by OPA reagent. Supernatant samples
obtained from all materials tested at 0.1% (w/v) inclusion level were not further treated before LC analysis. Those
obtained from promising agricultural products tested at higher inclusion levels (1 and 2%, w/v) required a clean-up
step prior to LC determination of DON and FB1. Purification methods were based on immunoaffinity column cleanup and were properly optimized.
In the present work, for the first time, a very fast and sensitive chromatographic technique (UPLC) was applied to
the simultaneous determination of DON, aflatoxins, ZEA and OTA by FLD/PDA detection. UPLC method was
properly optimized in order to prove its suitability for the routine analysis of mycotoxin adsorbents. UPLC analysis
was performed using a Waters Acquity Ultra Performance LCTM system (Miliford, MA, USA) equipped with a
Waters Acquity BEH C18 column (100 x 2.1 mm i.d., 1.7 µm particle) eluted by a gradient mixture of
water/acetonitrile/methanol containing acetic acid. Residual FB1 in supernatant samples was analyzed by a HPLCFLD method, which was also properly optimized. Under optimized analytical method conditions, chromatographic
separation of toxin was achieved through a Kinetex PFP analytical column, 100 x 4.6 mm i.d., 2.6 µm particle sizes
(Phenomenex, Castel Maggiore, BO, Italy), thermostated at 30°C and eluted by an isocratic mobile phase of
water/acetonitrile/methanol with acetic acid.
4.2 Adsorption equilibrium studies
Isotherm adsorption experiments were carried out for selected agricultural products in order to determine the
adsorption efficacy of mycotoxin binders in the case of highly contaminated feed and to calculate the constants (i.e,
affinity and capacity) related to the adsorption process. Taking into account the outcomes of the preliminary in vitro
screening, adsorption isotherms were carried out for 4 selected products (numbered as 30, 32, 36 and Mix2), those
showing the ability to adsorb simultaneously different mycotoxins (i.e, AFB1, ZEA, OTA and FB1). Mycotoxin
adsorption results obtained by testing agricultural product number 30 are reported herein.
4.3 Data calculations and statistical analysis
The amount of mycotoxin adsorbed on the material sample was calculated as the difference between the amount of
mycotoxin initially present in solution and the amount remaining at the end of the experiment. The amount of
mycotoxin adsorbed per unit of weight of adsorbent was plotted against the concentration of the mycotoxin in
solution at a fixed temperature. The amount of adsorbed mycotoxin per unit mass of test material was calculated by
the following equation: Ca = [(C0 – Cs)* V] / m where: Ca = quantity of mycotoxin adsorbed per gram of test
material (µg/mg); C0 = concentration of mycotoxin in the supernatants of the blank tubes with no test material
(µg/mL); Cs = residual mycotoxin concentration in the supernatant of the experimental tubes with product at
- 71 -
equilibrium (µg/mL); V = volume of solution (mL); m = mass of test material (mg). The amount of adsorbed
mycotoxin per unit mass of test material was plotted as a function of the residual mycotoxin concentration at
equilibrium, Ca = f(Cs), and the relevant adsorption curves were obtained. The experimental adsorption data were
fitted to the Langmuir and Freundlich isotherm models using Sigma Plot (Systat.com, version 12) non-linear
regression. The Marquardt-Levenberg algorithm was applied to find the parameters that give the best fit between a
set of data and a proposed non-linear equation. This algorithm seeks the values of the parameters that minimize the
sum of the squared differences between the values of the observed and predicted values of the dependent variable:
_
2
SS = ∑ wi ( y1 − y 2 )
i
where y1 is the observed and y2 is the predicted value of the dependent variable.
Statistical analysis was done by using a factorial ANOVA with concentrations or adsorbent/mycotoxin ratio (Cs) as
categorical predictor variable and quantity of mycotoxin adsorbed (Ca) as dependent variable. In addition, the
Normality test (Kolmororov-Smirnov test), the Constant Variance test (Spearman rank correlation between the
absolute values of the residuals and the observed value of the dependent variable) and the Durbin-Watson Statistic
test were used to test, respectively, for normally distributed population, constant variance assumption, and
correlation between residuals. The threshold for significance level for Normality and Constant Variance tests was
set at p<0.05. The expected value of the Durbin-Watson Statistic for random, independent, normally distributed
residuals was 2. In addition, the multiple correlation coefficient (r), the predicted residual error sum of squares
(PRESS) and the residual sum of squares (SSres) were calculated to measure how well the regression models
describe the data.
5.1 Screening of multi-mycotoxin adsorbing agents
The present work demonstrates that the inclusion of micronized agricultural by-products into a model liquid
medium makes it possible, through the adsorption of mycotoxins onto the products, to reduce the amount of toxins
available in the medium. For the overall products (n=37) the values of mean of means of mycotoxin adsorption
recorded at pHs 7 and 3 were, respectively, 21% and 17% for AFB1; 23% and 22% for ZEA; 0.9% and 12% for
OTA; 8% and 18% for FB1; 2% and 3% for DON. The relevant values of maximum adsorption were 66% for
AFB1, 74 % for ZEA, 38% for OTA, 58% for FB1, and 18% for DON. Considering mycotoxin binding to
agricultural by-products as single toxin adsorption, these products adsorbed preferably AFB1 and ZEA and at lesser
extent FB1 and OTA. Little DON adsorption was recorded. The effect of pH of the medium on mycotoxin
adsorption was also investigated. Depending on mycotoxin involved into adsorption process, pH of medium had a
different effect on toxin binding. In general, AFB1 and ZEA adsorptions were similar at pHs 3 and 7. FB1 and OTA
are mycotoxins with acid groups in the molecule; therefore, strong pH effect on their adsorption onto binding
agents is expected. In acidic conditions (pH<4) acid groups of these toxins are in the not ionized form, thus they
may be more easily bound by adsorbing agents, likely through hydrophobic interactions. This was confirmed by the
present study, which showed both FB1 and OTA adsorptions occurring mainly at acid pH.
According to the scope of the present work, intending to select broad-spectrum toxin adsorbents, agricultural byproducts were classified for their efficacy in adsorbing simultaneously and quantitatively more than one toxin. A
large percentage of products (57%) met the scope of the work by adsorbing from 2 to 4 toxins. The best multi-toxin
binders were 7 products, which adsorbed different combinations of 4 toxins.
Further to this preliminary study, 4 promising agricultural by-products were selected (numbered as 30, 32, 36 and
Mix2) and tested at higher inclusion levels (1 and 2%, w/v) towards the same pool of mycotoxins and by the same
experimental procedure. As shown in Table 1, at 2% inclusion level mycotoxin adsorptions ranged from 49-97%
for AFB1, 67-92% for ZEA, 11-91% for OTA, and 1-54% for FB1. Two of these products (i.e., products number 30
and 32) were selected as the most promising, adsorbing simultaneously up to 97% AFB1, 92% ZEA, 91% OTA and
54% FB1. All products failed in sequestering in vitro DON.
Table 1 Simultaneous multi-toxin adsorptions recorded for selected agricultural by-products assayed at 2.0% (w/v) inclusion
level. Values are means of triplicate independent experiments.
Mycotoxin adsorption (%)
Code number of
agricultural by-products
AFB1
ZEA
OTA
FB1
pH7
pH3
pH7
pH3
pH7
pH3
pH7
pH3
30
97
97
92
92
91
91
46
54
32
97
95
90
87
83
80
53
33
36
92
94
86
88
40
55
26
0
Mix 2
67
69
91
90
13
30
15
0
5.2 Equilibrium adsorption isotherms: effect of adsorbent dosage on mycotoxin adsorption
The effect of adsorbent dosage of agricultural product number 30 on removal of mycotoxins from buffer solutions
- 72 -
was investigated. Adsorption isotherms were obtained by testing a fixed amount of toxins (1 µg/mL) with respect to
increasing ratios of detoxifying agent/mycotoxins (ranging from 1:500 to 1:30000 w/w). These ratios correspond to
a feed contamination of 1 mg mycotoxin/kg feed and an inclusion of 0.5 up to 30 g detoxifying agent per kg feed.
Thus, they represent 0.05-3% inclusion rates of detoxifying agents. Adsorption isotherms were obtained by plotting
the percentage of mycotoxins removed as a function of adsorbent/mycotoxin ratio, and then fitting by the Langmuir
model. This mathematical model allowed calculating the theoretically estimated maximum adsorption (Adsmax) and
the C50, which is the theoretically estimated inclusion rate of the mycotoxin detoxifying agent into the assumed diet
containing 1 mg toxin/kg to achieve a 50% reduction of the absorbable toxin (Table 2). As shown in Figure 1, the
selected raw material number 30 was quite effective in reducing AFB1, ZEA, OTA and FB1 levels from buffer
solutions. The percentage of mycotoxins removed from neutral or acidic buffer solutions increased with increasing
ratios of tested product up to a certain limit and then it reached a constant value. At both pHs, the agricultural
product adsorbed up to 100% of AFB1, ZEA and OTA. Maximum FB1 adsorptions were lower, accounting to 23%
at acidic pH and 46% at neutral pH. Adsorption efficiency of product number 30 in sequestering different classes of
mycotoxins decreased in the order AFB1>ZEA>OTA>FB1. AFB1, ZEA and OTA adsorptions were not affected by
medium pH, while FB1 was adsorbed mainly at neutral pH.
Percentage of mycotoxins removed from buffer solutions (pHs 3 and 7) by agricultural product number 30 at
increasing ratios of adsorbent/mycotoxin.
100
80
80
80
ratio (adsorbent / AFB1)
ZEA pH 7
ZEA pH 3
60
40
20
OTA pH 7
OTA pH 3
ratio (adsorbent /ZEA)
30000
20000
15000
8000
10000
5000
0
500
1000
2000
0
30000
0
20000
30000
20000
15000
8000
10000
5000
0
1000
2000
0
20
15000
AFB1 pH 7
AFB1 pH 3
8000
20
40
10000
40
60
5000
60
OTA adsorption (%)
100
ZEA adsorption (%)
100
0
500
1000
2000
AFB1 adsorption (%)
Figure 1
ratio (adsorbent / OTA)
100
FB1 pH 7
FB1 pH 3
FB1 adsorption (%)
80
60
40
20
ratio (adsorbent / FB1)
30000
20000
10000
8000
2000
0
500
1000
0
Table 2 Regression analysis results obtained for product number 30. Values
represent the theoretically estimated maximum adsorption (Adsmax) and the
theoretically estimated inclusion rate of mycotoxin detoxifying agent to
achieve a 50% reduction of the absorbable toxin.
pH 3
pH 7
Toxin
C50 (g/kg)
Adsmax (%)
C50 (g/kg)
Adsmax (%)
103.9 ± 0.5
1.4
103.2 ± 0.3
1.2
AFB1
101.9 ± 0.5
2.5
100.7 ± 0.7
2.5
ZEA
100.3 ± 0.9
2.5
100.2 ± 2.2
5.0
OTA
22.8 ± 0.5
n.d.
45.5 ± 0.4
30.0
FB1
5.3 Equilibrium adsorption isotherms: effect of mycotoxin concentration on equilibrium adsorption
A second set of adsorption isotherms was obtained by plotting the percentage of mycotoxins removed as a function
of toxin concentration in solution. Equilibrium adsorption isotherms were determined at 37°C and at pH7
(phosphate buffer). Briefly, a fixed amount of product number 30 was tested towards multi-toxin standard solutions
containing increasing mycotoxin concentrations. Adsorbent dosage was 0.1% w/v (1mg/mL) for AFB1 and ZEA,
and 0.2% w/v (2 mg/mL) for OTA and FB1. Isotherms consisted of 9 or more experimental points covering a large
range of toxin concentrations (0.05-5.0 µg/mL). Figure 2 graphically shows the two sets of experimental and
predicted isotherm data for AFB1, ZEA, OTA and FB1 adsorption. Values for experimental maximum adsorption
capacity were 1.54 µg of AFB1, 1.12 µg of ZEA, 0.64 µg of OTA and 0.54 µg FB1 adsorbed per milligram of
product (Table 3).
AFB1 and ZEA adsorption isotherm plots showed a typical shape of L-1 isotherm, indicating a reduction in the
number of active sites on the adsorbent at high residual toxin concentration in the solution phase. The plots were
fitted by Freundlich and Langmuir models. Both these isotherm equations provided good fit-lines to experimental
data (small variance and correlation coefficient values higher than 0.997). Values of statistical methods used for
quantitating goodness of fits showed that the experimental data were best fit by the Freundlich model. The
correlations obtained by the Freundlich equation were in excellent agreement with the experimental data. Fitting by
Freundlich isotherm model suggests that the toxin adsorption on agricultural product number 30 occurs on
heterogeneous surface as well as by multilayer adsorptions. For the adsorption isotherms of AFB1 and ZEA, the
Freundlich isotherm constant Kf related to the adsorption capacity, and corresponding to the slope of the curves,
was 0.65 and 0.41 (µg/mg)(mL/µg)n, respectively. These values ranged between 0 and 1 and suggest high surface
heterogeneity. In general, a system is as much heterogeneous as its Kf value gets closer to zero. Accordingly, the
Freundlich parameter (1/n), which measures the adsorption intensity, was less than unit indicating that adsorption
isotherms can be characterized by a convex Freundlich isotherm and a significant toxin adsorption may take place
- 73 -
even at high toxin concentrations. For the two sets of isotherm adsorption data, Freundlich parameter (1/n) was 0.71
for AFB1 and 0.79 for ZEA. Since the Freundlich 1/n parameter lies between 0 and 1, it is indicative of favourable
adsorption of AFB1 and ZEA onto product. Similarly to Freundlich equation, Langmuir model fitted the
experimental adsorption data very well. Langmuir equation was used to calculate the maximum adsorption capacity
(Qmax) of the mycotoxin adsorbent agent. The Langmuir constant Qmax was 3.0 µg/mg for AFB1 and 3.2 µg/mg for
ZEA (Table 3).
OTA and FB1 adsorption to agricultural product was not influenced by toxin concentration, since almost same
percentage values for toxin removal were recorded by testing 0.05-5 µg/mL toxin. Such an adsorption of solute to
solid materials is indicative of a partition mechanism and can be explained by penetration of substrate micropores
by solute, with or without solvent, whereby new adsorption sites are opened up. Linear isotherms (Qeq=Kd*Ceq)
were observed for OTA and FB1. The linear regression analysis method was used to assess the goodness of the
linear fits and to calculate the parameter (Kd), corresponding to the adsorption (partition) coefficient (mL/mg).
From a practical point of view, the Kd parameter can be interpreted as “Kd=1/BC50” and corresponds to the binder
dosage necessary to ensure 50% adsorption of toxin. Kd values computed for OTA and FB1 were 0.18 and 0.15
mL/mg, respectively. Taking into account to the meaning of Kd parameter (Kd=1/BC50), 0.6% and 0.7% dosages
(w/v) of product number 30 are required to have 50% removal of OTA and FB1, respectively, from buffer solution
at pH7.
In conclusion, the agricultural product number 30 is a good candidate for being used as “multi-mycotoxin binder”
for AFB1, ZEA, OTA and FB1. Further in vitro studies, such as isotherm studies at different pHs, thermodynamic
and kinetic studies will be performed to characterize the mechanism of adsorption and to calculate the relevant
adsorption constants.
Figure 2 Adsorption isotherms for AFB1, ZEA, OTA and FB1 obtained at pH 7 and 37°C.
2,0
AFB1 Experimental values
Toxin adsorbed (µg/mg)
AFB1 Freundlich
ZEA
ZEA
OTA
OTA
FB1
1,5
Experimental values
Freundlich
Experimental values
Linear
Experimental values
FB1 Linear
1,0
0,5
0,0
0
1
2
3
4
5
Toxin concentration (µg/mL)
Table 3 Regression analysis results obtained for
product 30. Values represent the experimental
maximum adsorption capacity (Adsmax), the
Langmuir constant Qmax and the adsorption
partition coefficient (Kd).
Adsmax
Kd
Qmax
Toxin
(µg/mg)
(mL/mg)
(µg/mg)
1.54
3.0
AFB1
1.12
3.2
ZEA
0.64
0.18
OTA
0.54
0.15
FB1
6. Conclusion and Perspectives
Mycotoxin adsorption results obtained by testing selected agricultural by-products show that these materials have
the potential to be used as novel and promising mycotoxin adsorbents. Like some clay-based products, selected
agricultural by-products are effective towards AFB1, ZEA, OTA and FB1, at both acid and neutral pH, but fail in
sequestering DON. These results suggest that some agricultural by-products or mixtures of them can interact with a
wide range of mycotoxins, thus counteracting the negative effects on animal health due to the ingestion of multitoxin contaminated feeds. This is of practical utility due to the frequent cases of multi-contamination found
naturally in feeds. Further perspectives of our work will be to evaluate the efficacy of some promising agricultural
by-products in reducing animal bioavailability for different mycotoxins. According to EFSA guidelines (EFSA,
2009), short-term animal studies will be carried out on one of the target species for which these additives can be
intended (piglets). Urine biomarkers of mycotoxins will be used as end-points for evaluation of in vivo efficacy.
7. References
Avantaggiato G, Visconti A (2010). Mycotoxin issues in farm animals and strategies to reduce mycotoxins in animal feeds. In
Garnsworthy PC; Wiseman J (Eds) Recent advances in animal nutrition – 2009, Nottingham: Bonington Campus, School
Biosci., pp 149-189
Avantaggiato G, Solfrizzo M, Visconti A (2005) Recent advances on the use of adsorbent materials for detoxification of
Fusarium mycotoxins. Food Addit Contam 22: 379-388.
European Commission (EC) (2009). Commission regulation (EC) No. 386/2009 of 12 May 2009 amending Regulation (EC) No.
1831/2003 of the European Parliament and of the Council as regards the establishment of a new functional group of feed
additives. Off. J. Eur. Union L 118: 66.
European Food Safety Authority (EFSA) (2009) Review of mycotoxin-detoxifying agents used as feed additives: mode of
action, efficacy and feed/food safety. Scientific report CFP/EFSA/FEEDAP/2009/01.
- 74 -
Stress Response and Functionality of Lactobacillus plantarum:
Genotypic and Phenotypic Aspects
Angela Guidone (angela.guidone@unibas.it)
Dip. di Biologia, Difesa e Biotecnologie Agro-Forestali, Università degli Studi della Basilicata, Potenza, Italy
Tutor: Prof. Eugenio Parente
The impact of the aerobic growth on the response to different stresses in L. plantarum was evaluated using a multi
disciplinary approach. Aerobic and respiratory growth significantly improved stress tolerance. The polymorphism
of 5 stress response genes (clpP, hrcA, ctsR, dnaK, fstH) was evaluated using an approach based on multi-locus
restriction typing and sequencing of hrcA and ctsR. A significant relationship was found between restriction
patterns and/or sequences of clpP and hrcA and heat stress tolerance. Moreover, by comparing published sequences
of HrcA for lactic acid bacteria it was found that this protein may have great taxonomic significance.
Risposta allo stress e funzionalità in Lactobacillus plantarum:
aspetti genotipici e fenotipici
Utilizzando un approccio multidisciplinare è stato valutato l’impatto del metabolismo aerobio sulla risposta a
diversi stress in L. plantarum confermando l'impatto positivo della crescita aerobia. E' stato valutato il
polimorfismo di geni importanti per la resistenza allo stress (clpP, hrcA, ctsR, dnaK, fstH) utilizzando un approccio
basato sul Multilocus Restriction Typing e sul sequenziamento dei geni per i regolatori di risposta hrcA e ctsR.
Sono state individuate relazioni significative fra il polimorfismo in clpP e hrcA e la resistenza allo stress termico.
Inoltre è stato dimostrato che le sequenze di HrcA hanno un potenziale valore come marcatore tassonomico.
Key words: Lactobacillus plantarum, aerobic metabolism, stress response genes polymorfism.
1. Introduction
In accordance with the PhD thesis project described in Guidone (2010), this oral communication reports the main
results of the following activities:
A1) optimization of techniques for the measurement of cells viability and metabolic activity;
A2) study the aerobic metabolism in selected strains of L. plantarum, L. paraplantarum and L. pentosus;
A3) study L. plantarum WCFS1 and in its ΔccpA mutant in batch culture and evaluation of the effect of
temperature and respiratory conditions on the growth and stress resistance of L. plantarum C17;
A4) analysis the polymorphism of stress response genes in 32 L. plantarum strains;
A5) evaluation of potential probiotic traits in a collection of L. plantarum strains;
Activity A4 will be treated in greater detail in this paper.
2. State of the Art
L. plantarum is an ubiquitous lactic acid bacterium which is important in several food fermentations and as a
probiotic. In the presence of O2 and low sugar concentration the main fermentation end product is acetate produced
by the patway LDH (lactate dehydrogenase), POX (pyruvate oxydase) and ACK (acetate kinase) with ATP
generation, which temporarily improves cells survival in the stationary phase (Quatravaux et al., 2006). POX
(coded by poxB, poxF), induced by oxygen or H2O2, is controlled by carbon catabolite repression (Goffin et al.,
2006), and H2O2 accumulation in absence of heme, may reduce vitality and activity of stationary phase cells.
Exogenous sources of heme and menaquinone result in the synthesis of an electron transport chain (ETC), including
an electron donor (NADH dehydrogenase), an electron transporter (a menaquinone pool) and a heme-requiring
terminal electron acceptor (bd-type cytochrome) which reduces oxygen to water (Brooijmans et al., 2009). Heme
supplementation also induces heme-dependent catalase activity, which is essential to remove the H2O2 generated
during the aerobic conversion of lactate to acetate. H2O2 can be detoxified also by NADH peroxidase (NPR), and
some strains of L. plantarum can produce a Mn-dependent pseudocatalase. The enzyme thioredoxin disulfide
reductase (TRX) is also involved in response to oxidative stress (Serrano et al., 2007).
As a starter and probiotic organism, L. plantarum is subjected to several abiotic stresses to which it responds by
activating adaptive mechanisms with a large diversity in the stress response (Parente et al., 2010) in different
strains. The expression of several stress response genes is controlled by the repressors CtsR and HrcA which
regulate the expression of the operons of class III and class I (groESL and dnaK ), respectively. Some L. plantarum
stress response genes have a dual regulation by both repressors and is known that CcpA (catabolite control protein
A) regulates the expression of the class I heat shock response operons in L. plantarum (Castaldo et al., 2006).
- 75 -
3. Outline of main Results of the Thesis Work
To evaluate the viability and metabolic activity in L. plantarum strains after the exposure to stress, fluorescent
staining protocols were optimized and a simple procedure for automated cell counts was developed using NIH
ImageJ macros (Zotta et al., 2011a).
In order to study the aerobic metabolism in 12 strains belonging to the species L. plantarum, L. paraplantarum and
L. pentosus were employed 4 growth condition using the same complex buffered substrate without supplement
(AE), with hemine (AEH), with hemine and menaquinone (AEHM) incubated in shaken flasks and in tubes (AN
anaerobiosis) (Guidone et al., 2011). To investigate the effect of ccpA inactivation on aerobic growth and stress
resistance in the model strain L. plantarum WCFS1 and its ΔccpA ery mutant, growth was compared in batch
fermentations in a complex medium at controlled pH (6.5) and temperature (30 °C) with or without aeration (Zotta
et al., 2012). To evaluate the effect of the temperature and aerobic conditions on the growth and stress resistance in
the selected strain L. plantarum C17, kinetics of growth and stress resistance were studied during batch, fed-batch
and continuous fermentations (pH 6.5) under anaerobic (nitrogen) and aerobic (air, with hemine and menaquinone)
conditions at both 25°C and 35°C (Zotta et al., 2011b).
To identify potential probiotic strains, 29 L. plantarum subsp. plantarum and 3 L. plantarum subsp. argentoratensis
strains were tested for probiotic characteristics, for resistance to biological barriers, for antimicrobial activity and
for antibiotic resistance. The presence of genes of the bacteriocin pln locus and of genes encoding for the bile salt
hydrolase and for the mannose-specific adhesion was also evaluated (Guidone et al., 2012). The polymorphism of
some stress response genes and its relationships with heat stress tolerance was evaluated in greater detail. This
activity is described in detail below.
4.1 Strains
29 L. plantarum subsp. plantarum and 3 L. plantarum subsp. argentoratensis strains from the culture collection of
the Dipartimento di Biologia, Difesa e Biotecnologie Agro-Forestali, Università degli Studi della Basilicata, Italy
and from Teagasc, Dairy Products Research Centre, Moorepark, Fermoy, Co. Cork, Ireland, isolated from different
sources were tested in this study (Fig. 1).
4.2 Characterization by Multiplex-PCR and Pulsed field gel electrophoresis (PFGE)
Genomic DNA extraction was performed on stationary phase cells using GenElute™ Bacterial Genomic DNA Kit
(NA2110-Sigma Aldrich). A multiplex PCR assay was performed with the recA gene-based primers (Parente et al.,
2010). PFGE was carried out as described in Birren and Lai (1993) with minor modifications. Gel images were
digitized using Gel Doc XR (Bio-Rad Laboratories) and the DNA fingerprints were analysed and normalized using
FPQuestTM II software (Bio-Rad Laboratories). Similarity was calculated using Dice’s correlation coefficient
clustering was performed with the unweighted pair group method with arithmetic averages (UPGMA). The
discriminatory power of the technique was evaluated by use of the index of diversity (ID) described by Hunter and
Gaston (1988).
4.3 Multilocus restriction typing (MLRT)
Primers designed on the basis of L. plantarum WCFS1 genome (Ricciardi et al., 2012) were used to amplify 5
genes (clpP, ctsR, dnaK, fstH, hrcA), according to the KOD Hot Start DNA Polymerase (Novagen) manufacturer's
recommendations. PCR products were checked for size by agarose gel electrophoresis and used for restriction
analysis with 10U of Sau3A1 and Taqα1 (New England Biolabs). Restriction digests were analyzed by agarose
electrophoresis (1.5%, w/v, agarose gel, containing 0.2 µg/mL ethidium bromide, 0.5XTBE buffer). Gels were run
at 5 V/cm for 2 h and gel images were digitized using Gel Doc XR (Bio-Rad Laboratories). Hyper Ladder I or IV
(Bioline) were used as standard. Gel images were imported in FPQuestTM II software for detection of lanes and
bands. Hierarchical Cluster Analysis (HCA; UPGMA) was performed using Dice’s coefficient for a composite data
set built from all experiments (gels and banding profiles) and the dendrogram was generated using a binary table
showing the presence/absence of bands.
4.4 Sequencing of ctsR and hrcA
PCR samples were purified for sequencing using Exo-SAP PCR cleanup protocol and sent to Beckman Coulter
Genomics (UK). Multiple sequence alignments of nucleotide and aminoacid sequences were using the CLUSTAL
algorithm in MEGA version 5, which was used to perform phylogenetic analysis with the inclusion of sequences
from other taxa. DNA polymorphism analysis was carried out using DnaSP v5.
4.5 Maximum growth temperature (Tmax) and heat tolerance
MRS tubes supplemented with 0.16 g/L bromocresol purple were inoculated (1% v/v) with the 32 strains in study
and incubated 40, 41, 42, 43 and 44°C) for 24 h. Inactivation of exponential phase cells was evaluated in PB7 as
described by Parente et al., 2010 and to find breakpoints between heat resistant, intermediate and sensitive strains,
the results were grouped on the basis of K-means clustering using the Euclidean Distance Metric.
- 76 -
5. Risults and Discussion
5.1 Characterization by PFGE
32 strains were identified by Multiplex-PCR as 29 L. plantarum subsp. plantarum and 3 L. plantarum subsp.
argentoratensis. Cluster analysis of the PFGE patterns gave the dendrogram shown in Fig. 1. PFGE correctly
divided the two subspecies and strains
were classified in 5 different clusters
containing 5, 8, 10, 6 and 3 strains
respectively. The percentage of similarity
between unrelated and closely related
profiles varied from 34 to 96%. The
polymorphism observed with PFGE was
high as indicated by the index of diversity,
ID = 0.796, and it is consistent with the
different origin of the isolates (AN,
animal isolates; CH, cheese; CCH;
cheddar
cheese;
FV,
fermented
vegetables; HU, human isolate; OL,
olives; SD, sourdough; SI, silage; UN,
unknow; VE, vegetables; WI, wine; WM,
water milking). No correlation between
clusters, isolation source or heat resistance
was found.
Figure 1 AscI PFGE patterns and similarity
dendrogram of 32 L. plantarum isolates.
5.2 Multilocus restriction typing (MLRT) and HT
Five genes (clpP, ctsR, dnaK, fstH, hrcA) were amplified and submitted to restriction using one or two restriction
endonucleases. All amplicons had the expected size. Strains were divided in 6 clusters (data not shown). Each
cluster included from 1 to 15 strains. L. plantarum subsp. plantarum and L. plantarum subsp. argentoratensis were
separated and their percentage of similarity varied from 83 to 94%. The index of diversity observed with MLRT
analysis was 0.704. Chaperonin genes have been shown to be useful markers for taxonomic purposes and Blaiotta
et al. (2008) showed that hsp60 (groEL, encoding a 60-kDa heat shock protein) can be considered an excellent
molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus. Multilocus
restriction typing (MLRT) and multilocus sequence typing (MLST) are two tools used to evaluate gene
polymorphisms in populations (Maiden et al., 1998). Although the number of strains in our study was low for
taxonomic purposes the combination of all restriction patterns allowed the discrimination of L. plantarum subsp.
plantarum from L. plantarum subsp. argentoratensis, and the restriction with Taqα1 restriction enzyme better
identified the polymorphic sites in each gene. Correspondence analysis was carried out and showed a strong
association between heat tolerance defined on the basis of K-means clustering using the Euclidean Distance Metric,
Tmax, MLRT clusters and clpP and hrcA restriction patterns. Most of this effect was related to the lower heat
tolerance of argentoratensis strains, but one L. plantarum subsp. plantarum strain (DPC2159) was unusually
sensitive to heat and had a lower maximum growth temperature.
5.3 Sequencing of ctsR and hrcA
HrcA and CtsR are two highly conserved negative regulators of the heat shock response in bacteria (Derré et al.,
1999; Naberhaus et al., 1999; van de Guchte et al., 2002) and their regulons have been characterized in L.
plantarum (Castaldo et al., 2006; Fiocco et al., 2010). The amplicons for ctsR and hrcA were sequenced for all
strains and compared with sequences available from public databases for L. plantarum susbp. plantarum WCFS1,
JDM1 and ST-III. DNA polymorphism was evaluated and the results are shown in Table 1. The diversity of the
sequences varied significantly in the two genes. For hrcA 86 mutations were identified: 5 were non-synonimous
mutations and 2 of these (both in DPC2159 L12-F12 and V39->A39) were located in HTH region which is important
for binding to CIRCE sequences, another mutation (DPC159 E176->D176) mapped in the dimer interface region and
these changes may explain differences in heat tolerance.
Maximum likelihood clustering of aligned sequences of HrcA, showed in fig. 2, identified three clusters (one
containing most plantarum strains, one with argentoratensis strains and one with DPC2159). In addition, clustering
of HrcA sequences for lactic acid bacteria also correctly classified all species and this confirm the importance of
- 77 -
hrcA as a taxonomic marker (data not shown). As extension of Ricciardi et al. (2012) this is the first work in which
the genotypic diversity in stress related genes are compared for several strains of the L. plantarum group. On the
other hand clustering of CtsR sequences had little taxonomic value.
Figure 2 Molecular Phylogenetic anaylsis by Maximum Likelihood method of aligned sequences of HrcA (left) and CtsR.
Table 1 DNA polymorphism analysis on partial sequences of ctsR and hrcA for L. plantarum subsp. plantarum
andargentoratensis. 1 in parenthesis sites excluding gaps or missing data, n number of polymorphic sites, with the
number of informative sites in parenthesis; η number of mutations; S number of synonimous mutations; Nhap number
of haplotypes; πi nucleotide diversity; k average number of nucleotide differences.
gene
Reference
Sequences
Sites1
n
η2
S2
Nhap2
πi2
k2
ctsR
This work
34
499 (450)
15 (4)
15
7
8
0.00321
1.442
Ricciardi et al. 2012
10
528 (526)
4 (1)
4
2
5
0.0023
1.133
This work
34
1017 (904)
82 (70)
86
81
13
0.01753
15.85
Ricciardi et al. (2012)
10
1073 (628)
55 (1)
53
49
5
0.0174
10.93
hrcA
Growth of Lb. plantarum under respiratory conditions can result in higher energy production per glucose molecule
compared with fermentative growth, thereby improving the formation of biomass. Furthermore, the respiratory
growth mode has a positive impact on the robustness and stress resistance by inducing stress response genes.
Potential applications could be the preparation of starter culture and probiotics under respiratory conditions or of
mixed culture with a respiring strain in a non-respiring strain where the first strain could serve as an oxygen ‘mop’,
to reduce overall oxidative stress and as a lactate removal in late stationary phase to reduce acid stress.
The study on polymorphism on stress response regulators confirmed that hrcA may be used as a valuable taxonomic
marker as well as proven in the past (Ahmad et al., 1999).
7. References
Ahmad S, Selvapandiyan A, Bhatnagar RK (1999) A protein-based phylogenetic tree for Gram-positive bacteria derived from
hrcA, a unique heat-shock regulatory gene. Int J Syst Bacteriol 49: 1387-1394.
Birren B, Lai E (1993) Pulsed Weld gel electrophoresis: a practical guide. Academic Press Inc, pp. 25-74.
Blaiotta G, Fusco V, Ercolini D, Aponte M, Pepe O, Villani F (2008) Lactobacillus strain diversity based on partial hsp60 gene
sequences and design of PCR410 Restriction Fragment Length Polymorphism assays for species identification and
differentiation. Appl and Environ Microb 74: 208-215.
Brooijmans R, de Vos WM, Hugenholtz J (2009) Lactobacillus plantarum WCFS1 electron transport chains. Appl Env Mic 75:
3580-3585.
Castaldo C, Siciliano RA, Muscariello L, Marasco R, Sacco M (2006) CcpA affects expression of the groESL and dnaK operons
in Lactobacillus plantarum. Microb Cell Fact 5, 35 doi:10.1186/1475-2859-5-35.
Derré I, Rapoport G, Msadek T (1999) CtsR, a novel regulator of stress and heat shock response, controls clp and molecular
chaperone gene expression in Gram-positive bacteria. Mol Microbiol 31: 117-131.
Fiocco D, Capozzi, V, Collins, M, Gallone, A, Hols, P, Guzzo, J, Weidmann S, Rieu A, Msadek T, Spano G (2010).
Characterization of the CtsR stress response regulon in Lactobacillus plantarum. J Bacteriol 192: 896-900.
- 78 -
Goffin P, Muscariello L, Lorquet F, Stukkens A, Prozzi D, Sacco M, Kleerebezem M, Hols P (2006) Involvement of pyruvate
oxidase activity and acetate production in the survival of Lactobacillus plantarum during the stationary phase of aerobic
growth. Appl Environ Microb 72: 7933-7940.
Guidone A (2010). Aerobic metabolism of Lactobacillus plantarum: physiological and technological aspects. In Proc.s of 15°
Workshop on the developments in the italian PhD Research on food science, technology and biotechnology.
Hunter P R, Gaston M A (1988) Numerical index of the discriminatory ability of typing systems: an application of simpson's
index of diversity. J Clin Microbiol 26: 2465-2466.
Maiden MC, Bygraves J A, Feil E, Morelli G, Russell J E, Urwin R, Zhang Q, Zhou J, Zurth K, Caugant DA, Feavers I M,
Achtman M, Spratt B G (1998) Multilocus sequence typing: a portable approach to the identification of clones within
populations of pathogenic microorganisms. P Natl Acad Sci USA 95 :3140-3145.
Narberhaus F (1999) Negative regulation of bacterial heat shock genes. Mol Microbiol 31:1-8.
Parente E, Ciocia F, Ricciardi A, Zotta T, Felis GE, Torriani S (2010) Diversity of stress tolerance in Lactobacillus plantarum,
Lactobacillus pentosus and Lactobacillus paraplantarum: a multivariate screening study. Int J Food Microbiol 144: 270279.
Quatravaux S, Remize F, Bryckaert E, Colavizza D, Guzzo J (2006) Examination of Lactobacillus plantarum lactate metabolism
side effects in relation to the modulation of aeration parameters. J Appl Mic 101: 903-912.
Ricciardi A, Parente E, Guidone A, Ianniello R, Zotta T, Sayem S M Abu, Varcamonti M (2012) Genotypic diversity of stress
response in Lactobacillus plantarum, Lactobacillus paraplantarum and Lactobacillus pentosus. Int J Food Microbiol
doi:10.1016/j.ijfoodmicro.2012.05.018
Serrano LM, Molenaar D, Wels M, Teusink B, Bron PA, de Vos WM, Smid EJ (2007) Thioredoxin reductase is a key factor in
the oxidative stress response of Lactobacillus plantarum WCFS1. Microb Cell Fact 6: 29.
van de Guchte M, Serror P, Chervaux C, Smokvina T, Ehrlich S D, Maguin E (2002) Stress responses in lactic acid bacteria.
Antonie van Leeuwenhoek 82: 187-216.
Zotta T, Guidone A, Ianniello R G, Ricciardi A, Parente E (2011b) Temperature and aerobic conditions affect the growth and
stress resistance of Lactobacillus plantarum C17.1st International Conference on Microbial Diversity, Milano.
Zotta T, Guidone A, Tremonte P, Parente E, Ricciardi A (2011a) A comparison of fluorescent stains for the assessment of
viability and metabolic activity of lactic acid bacteria. World J Microb Bio doi:10.1007/s11274-011-0889-x.
Zotta T, Ricciardi A, Guidone A, Sacco M, Muscariello L, Mazzeo M F, Cacace G, Parente E (2012) Inactivation of ccpA and
aeration affect growth, metabolite production and stress tolerance Lactobacillus plantarum WCFS1. Int J Food Microbiol
155: 51-59.
- 79 -
Interaction of Polyphenols with Milk and Casein:
Nutritional Effects and Application Studies
Ahmed Helal (ahmed.helal@unimore.it)
Dept. of Agricultural and Food Science, University of Modena and Reggio Emilia, Italy
Tutor: Prof. Angela Conte
This PhD thesis targeted to study the polyphenols interaction with milk and its effects on the bioaccessibility of the
polyphenols in different beverages. Addition of milk had dissimilar effects among the different beverages
depending on milk types, concentration and on the polyphenolic profile in the different beverages. In addition,
application study by integrating polyphenols molecules in caseins and caseinate films was achieved, with
production of antioxidant-rich films as packaging material. Furthermore, manufacturing of polyphenols-rich cheese
by applied different polyphenols compounds in the cheese matrix was successfully done, showing high retention
coefficient of polyphenols with high bioaccessibility and antioxidant activity.
Interazione dei polifenoli con latte e caseine: effetti nutrizionali e studi applicativi
L'obiettivo di questa tesi di dottorato è stato quello di studiare l’interazione tra i polifenoli e il latte e il suo effetto
sulla bioaccessibilità dei polifenoli stessi in diverse bevande. L'aggiunta di latte ha avuto effetti diversi in
dipendenza del tipo di latte, della concentrazione di grassi e caseine e del profilo polifenolico delle bevande. Come
studio di applicazione tecnologica, sono stati prodotti film ricchi in polifenoli da utilizzare come materiale di
imballaggio. Infine sono stati realizzati formaggi ricchi in polifenoli come alimenti funzionali, caratterizzati da un
alto coefficiente di ritenzione dei polifenoli ed una elevata attività antiossidante.
Key words: Coffee, polyphenols, milk, cheese, casein, antioxidant activity, bioaccessibility.
1. Introduction
In according with the PhD thesis project, the target of the work was to cover the following activities,
(A1)
Milk type and concentration modulate the in vitro digestive recovery of coffee chlorogenic acids.
(A2)
Common formulations of black and green tea modulate in vitro digestive antioxidant activity and catechins
recovery
(A3)
Bioaccessibility of polyphenols and cinnamaldehyde in cinnamon beverages.
(B1)
Integrating of polyphenols molecules in caseins and caseinate matrix with the intention to produce
antioxidant-rich films as packaging material.
(B2)
Polyphenols-rich cheese. Antioxidant activity and bioaccessible polyphenols recovery during in vitro
digestion
In according with the PhD thesis project results, part of the data has been previously reported (Helal, 2011; Helal,
2012; Helal et al., 2012). Therefore, the aim of this oral communication is to focus on other parts of the study, (A1)
as an example of beverage and (B2) as one of the application studies.
2. Milk Type and Concentration Modulate the in Vitro Digestive Recovery of Coffee
Chlorogenic Acids
2.1. Materials and methods
Coffee was prepared by dissolving two grams of soluble coffee in 100 mL of boiling water. To test the effect of
milk type on the in vitro bioaccessibility of coffee chlorogenic acids, the following beverages have been prepared.
CM beverage was made by mixing 50% of coffee with 50% of whole milk, CSSM by mixing 50% of coffee with
50% of semi skimmed milk, CSM by mixing 50% of coffee with 50% of skimmed milk and C beverage by mixing
50% of coffee with 50% of water to maintain constant chlorogenic acids levels between formulations. To test the
effect of milk concentration, beverages with 10% (CM/5) and 25% (CM/2) whole milk and with 10% semiskimmed milk (CSM/5) were prepared. To maintain constant chlorogenic acids levels between beverages, water
was added to CM/5, CM/2 and CSM/5 formulations until the 50% was reached. In vitro gastro-pancreatic digestion
of beverages was performed as previously described in Tagliazucchi et al., 2010. Later, all the beverages were
subjected to ultrafiltration with Amicon Ultra-4 nominal cutoff 3 KDa, at 7500g for 120 min at 4°C., to separate
chlorogenic acids that are bound to high molecular weight material. The chlorogenic acids were separated and
identified in ultrafiltrates with HPLC-ESI-MS/MS analysis based on method described by Verzelloni et al. (2011).
- 80 -
2.2. Results and discussion
The total content of chlorogenic acids (CGAs) in ultrafiltrate was 80.2 ± 4.4 μmol in 200 mL of beverage while in
beverage before ultrafiltration was 87.3 ± 2.8 μmol/200ml with a decrease in ultrafiltrate of about 8.1%. This
decrease may be due to the binding of chlorogenic acids to ultrafiltration apparatus or to high molecular weight
material removed by ultrafiltration. In Figure 1, the amount of total chlorogenic acids in ultrafiltrate before, after
simulated gastric and pancreatic digestion is reported. In ultrafiltrates, the total amount of CGAs decreases from
80.2 ± 4.4 to 53.0 ± 3.1 μmol/200mL of beverage with a recovery of 66% which represented the bioaccessibility of
total CGAs after gastric and pancreatic digestion. CGAs decrease occurred primarily during pancreatic digestion, as
we found that no significant decrease achieved during the gastric phase.
Figure 1 Total chlorogenic acids (CGAs) after the
addition of different type of milk to coffee. ■ C; ■ CM;
□CSSM; ■ CSM.
Data are means ± SD (n = 3).
a
Denotes P value < 0.05 with respect to the previous
time. bDenotes P value < 0.05 with respect to the C
sample at the same time.
The addition of various types of milk to coffee caused an immediate decrease in total chlorogenic acids in
ultrafiltrate (Figure 1, after mixing), as a consequence of the binding between milk proteins and chlorogenic acids.
The decrease in total CGAs was 20%, 22% and 17% after whole, semi-skimmed, and skimmed milk addition,
respectively. The decreases were not statistically different between the three types of milk that had the same amount
of proteins (3.1%). The different fat concentration seems to be not relevant on this respect. Considering the
different classes of CGAs in coffee, the highest affinity for milk protein was found for di-caffeoylquinic acid (43%
of diCQAs bound to milk proteins) followed by caffeoylquinic acid (18% of CQAs bound to milk proteins) and
feruloylquinic acids (14% of FQAs bound to milk proteins). Passing to the end of the gastric digestion we observed
a small and not significant decrease in total CGAs in ultrafiltrates respect to values after mixing.
Table 1 Final bioaccessibility of individual chlorogenic acids in beverages. Results are expressed as μmol in 200 mL of
beverage. Data in brackets indicate the percentage of bioaccessibility respect to the initial coffee content.
Total CQAs
Total FQAs
Total diCQAs
Total CGAs
a
C
39.3 ± 2.4 (65.4%)
9.1 ± 0.3 (65.9%)
3.3 ± 0.3 (67.3%)
53.0 ± 3.1 (66.1%)
CM
51.9 ± 1.9 a (86.4%)
11.2 ± 0.3 a (81.2%)
5.0 ± 0.3 a (102.0%)
69.5 ± 2.6 a (86.7%)
CSSM
46.3 ± 1.8 a (77.0%)
9.1 ± 0.8 (65.9%)
3.5 ± 0.3 (71.4%)
60.0 ± 3.0 a (74.8%)
CSM
41.2 ± 2.0 (68.6%)
7.4 ± 0.9 (53.6%)
2.8 ± 0.3 (57.1%)
51.5 ± 3.4 (64.2%)
indicates significantly different (P< 0.05) respect to coffee (C) beverage. Data are means ± SD; n=3
As can be seen in Table 1, in the presence of whole and semi-skimmed milk (CM and CSSM beverages) the
quantities of total CGAs in ultrafiltrates after pancreatic digestion were significantly higher respect to the values
obtained in the presence of coffee alone (C beverage). The addition of skimmed milk (CSM beverage) had no
impact on the CGAs bioaccessibility respect to C beverage. The bioaccessibility of the individual chlorogenic acids
at the end of the digestion is shown in Table 1. In the presence of milk, the only significant increase of
bioaccessibility for the three main class of chlorogenic acids (CQAs, FQAs, diCQAs) respect to C beverage was
observed in whole milk beverage (CM).
Green et al. (2007) found that the addition of 50% bovine milk to green tea resulted in a significant improvement in
total catechins recovery after gastro-pancreatic digestion, suggesting that the protective effect is a consequence of
the binding between green tea catechins and milk proteins. The mechanism for the stabilization of polyphenols by
milk is believed to involve protein-polyphenol interactions which provide a physical trapping of the reactive
polyphenolic species. On the contrary, our results show that the protein binding is irrelevant to the protection and
the recovery of chlorogenic acids. The CM, CSSM and CSM beverages contained the same amount of proteins
(1.55 g/100mL) but had different protective effect.
Whole milk beverage (CM) showed the highest protection while no protection was observed with skimmed milk
beverage (CSM). The CM/2 beverage which contains 0.78 g/100mL protein, showed protective effect towards
CGAs degradation similar to that of semi-skimmed milk beverage (CSSM) although its protein content was halved.
Finally, digestion carried out in the presence of commercial casein did not increase the bioaccessibility of CGAs
respect to the coffee beverage (C). All these experimental results demonstrate that there is not a relationship
- 81 -
between the protein content of added milk and the protective effect observed at the end of the digestion, suggesting
that milk proteins are not responsible for the increased bioaccessibility of CGAs even if a part of chlorogenic acids
is bound to proteins.
Figure 2 Relationship between the fat content of milk
and the concentration of total CGAs at the end of the
digestion. (▲) C , (○) CM, (●) CSSM, (◊) CSM, (■)
CM/2, (□) CM/5, (▬) CSSM/5.
Milk fat had not any influence on the amount of CGAs bound to high molecular weight material in milk containing
beverages since the decrease of CGAs after mixing with milk was not statistically different with the different types
of milk having diverse fat content.
The addition of 50% whole or semi-skimmed milk or 25% whole milk to coffee, as in CM, CSSM or CM/2
beverages, increased however the recovery of CGAs at the end of the simulated digestion process. From our results,
a clear relationship arises between the fat content of added milk and the increasing of CGAs bioaccessibility
(Figure 2). Milk fat, or antioxidant compounds in the milk fat fraction, may provide protection against CGAs
degradation with different mechanisms. Hydrophobic interactions between milk fat and CGAs that favor their
stability are possible. The presence of fat increased the antioxidant activity of milk (Zulueta et al., 2009).
In conclusion, our results clearly show that there is a good relationship between the amount of fat in added milk and
the increase of coffee chlorogenic acids bioaccessibility. To have a significant increase of chlorogenic acid
bioaccessibility the fat content in beverage should be higher than 0.4 g/100mL. Milk proteins even if bind
chlorogenic acids, they do not protect them. A high affinity binding site for 5-caffeoylquinic acid (KD 37.5 μmol/L)
has been demonstrated in casein. The binding to this site does not protect chlorogenic acids as shown by in vitro
digestion of coffee-casein beverage.
A role of high molecular weight material present in coffee beverage in increasing the loss of chlorogenic acids
during digestion has been demonstrated. The pH value, food matrix, presence of prooxidant and antioxidant are
shown to be very important to determine chlorogenic acid loss during in vitro gastro-pancreatic digestion. Our
study is a starting point for further investigation directed to increase the bioaccessibility and bioavailability of
chlorogenic acids and other food compounds.
3. Polyphenols-rich Cheese. Antioxidant Activity and Bioaccessible Polyphenols Recovery
during in Vitro Digestion
3.1. Materials and methods
Polyphenols-rich cheese was manufactured as described by Han et al., (2011) with alternative modifications;
different phenolic compounds belonging to different classes of polyphenols were added to the milk at the final
concentration of 0.5mg/mL, followed by stirring to have a homogenized solution. Rennet was then added and the
samples were incubated in water bath at 35°C within 2h to have complete coagulation. To separate the cheese whey
(milk serum) from the curd, centrifugation at 1300g at 21°C for 15 min was occurred. The same procedures were
followed without adding polyphenols to milk for the control sample. All the curds were weighted and the whey was
volumetric measured for all samples. Measurement of polyphenols retention coefficient was carried out by
measuring the phenolic content of the whey, by using HPLC and calculated as mg.
The retention coefficient of each curd sample was calculated using the follow equation:
The value is expressed as (%); high value reflects high retention of phenolic compounds in curd. To understand the
binding between milk caseins and phenolic compounds, fluorescence spectroscopy analysis was carried out as
reported in Dufour & Dangles (2005). According to the target of the study which is increasing the nutritional value
of the cheese, it was important to measure the bioaccessibility of the cheese during in vitro digestion experiment
adapted from Tagliazucchi et al (2010). Phenolic content was later measured to all the samples before, after gastric
and after pancreatic digestion to follow the bioaccessibility of the phenolic compounds. Radical scavenging activity
was measured according to (Re et al., 1999); the results were expressed as Trolox equivalent antioxidant capacity
(TEAC).
- 82 -
3.2. Results and discussion
Measurements of the retention coefficient is an important parameter in expecting the residual amount of additives
such as polyphenols and became a pressing indication for evaluation of the benefits and the recovery of functional
ingredients. A higher retention coefficient obtained in curd means that a lower losing of functional ingredients in
whey occurred during cheese manufacturing. However, the curd consider as the first step of cheese making, but the
high retention coefficient of the curd predict a high retention during the cheese processing. Table 2 shows the
different retention coefficient values of polyphenols in cheese curd, varied values were noticed between the
different polyphenols. Generally, the values were varied between 63.65and 84.84%, showing a significant
differences among the different treatments.
Table 2 Retention coefficient of polyphenols, binding affinity with casein, polyphenols recovery after digestion and antioxidant
activity of cheese curd
Treatment
Retention
coefficient
Actual residual
in curd (mg)
Binding affinity with
casein
(KD μmol/l)
Polyphenol recovery
after
gastro-Intestinal
digestion (%)
Antioxidant
activity
(TEAC)
Catechin
84.84±0.63a
6.62±0.30a
21.9 ± 1.6
90.46
46.38b
Tannic acid
Chlorogenic acid
p-Coumaric acid
Ferulic acid
3,4-dihydroxyphenylacetic acid
Vanillic acid
86.84±0.19a
72.98±1.43b
70.33±2.6bc
69.28±0.29cd
5.99±0.02b
6.03±0.32b
4.9±0.13c
4.86±0.02c
1.8 ± 0.10
37.9 ± 2.3
75.2 ± 4.4
73.2 ± 5.1
97.21
109.5
79.74
89.61
38.10a
38.78a
49.72bc
49.18bc
63.65±2.33e
4.89±0.04c
92.2 ± 5.5
90.93
51.88c
66.52±1.11de
5.92±0.18b
90.1 ± 8.3
105.73
40.31a
Data are means ± SD (n = 3).
In the same column, means with the same lower case letter are not significantly different (p > 0.05).
To explain the differences obtained between different treatments, it is important to understand the environment
around these polyphenols; the curd is a matrix of proteins and fat, protein is composed principally of insoluble
caseins (Robitaille et al., 2004). Water solubility and interaction with proteins is the main factors of polyphenols
recovery in cheese curd. The binding affinity of the different polyphenols with casein can partly explain the
differences in the retention coefficient in curd. High binding with casein led to decrease in the release of the
polyphenol during the whey separation, which implies high recovery and high retention in curd.
The quantification of the binding between the single phenolic compounds and casein is showed in Table 2 as KD
values. This value is indicative of the affinity between the protein and the polyphenols; the smaller is KD, the
stronger is the binding. Correlation analysis showed an inverse correlation between KD value and the retention
coefficient (Pearson r = -0.9590; P = 0.0006).
Following simulated gastric digestion phase there were no significant changes on curd polyphenols content. Passing
to pancreatic digestion (Table 2), the majority of samples showed stability during the digestion. Although, many
previous studies reported negative effect of pancreatic enzymes on phenolic compounds, Bermúdez et al. (2007)
found a significant decrease in phenolic compounds of chokeberry during the pancreatic digestion. Also in study by
Tagliazucchi et al. (2010), they found 43.3% decrease of pure gallic acid after pancreatic digestion. We achieved a
high recovery of different polyphenols which reflect the low degradation during the digestion and the release from
cheese matrix. This protective behavior is believed to be the effect of high percentage of fat presented in the curd as
we mentioned before, and as we already found in the first part of the study. Furthermore, the binding between
casein and polyphenols play a partly role, as it noticed in some cases the recovery was more than 100% and it
means the releasing of some polyphenols from the casein-polyphenol complex, resulted in increasing the recovery
after the digestion. Antioxidant activity of the cheese curd was measured at the end of the gastric-intestinal
digestion (Table 2). The control curd possessed antioxidant activity (31.63 TEAC), displaying the role of peptides
to trigger off the increase in the radical scavenging activity at the end of the digestion. Research on casein
hydrolysates with trypsin or chymotrypsin has shown that they possess radical scavenging activities. All the curd
containing polyphenols showed high antioxidant activity after the pancreatic digestion. It was also clear the
differences among the different curds. These differences is a function of different factors affect the antioxidant
activity of the curd, such as the antioxidant capacity of the compound itself, the environment in which the
antioxidant has to execute its function and the casein binding affinity.
4. Future Perspectives
Future work should be focused on bioavailability of polyphenols of the beverages during in vivo study. Also, further
studies are needed to be made on combination the new packaging films to study the protective effect on reducing the
oxidation, improving flavor stability and shelf life of some products such as dairy products. Furthermore, in
manufacturing of polyphenols-rich cheese, it is needed to study the actual consequences of additional cheese
- 83 -
proceeding steps on the polyphenols bioaccessibility and release, and the possibilities to apply this technology to other
dairy products.
5. References
Bermúdez-Soto M J , Tomás-Barberán FA, García-Conesa MT (2007) Stability of polyphenols in chokeberry (Aronia
melanocarpa) subjected to in vitro gastric and pancreatic digestion. Food Chem 102 :865-874.
Dufour C, Dangles O (2005) Flavnoid-serum albumin complexation: Determination of binding constants and binding sites by
fluorescence spectroscopy. Biochim Biophys Acta 1721: 164-173.
Green R J, Murphy A S, Schulz B, Watkins BA, Ferruzzi M G (2007) Common tea formulations modulate in vitro digestive
recovery of green tea catechins. Mol Nutr Food Res 51: 1152-1162.
Han J ,Britten M , St-Gelais D , Champagn C P, Fustier P, Salmieri S, Lacroix M (2011) Polyphenolic compounds as functional
ingredients in cheese. Food Chem 124: 1589-1594.
Helal A (2011) Observation of antioxidant activity of some polyphenols during storage with incorporation in Na-caseinate edible
films. In Proc.s of the 16th Workshop on the Developments in the Italian PhD Research on Food Science and Technology,
Lodi (Italy), 21-23 September, 2011, pp. 239-240.
Helal A , Tagliazucchi D , Conte A , Desobry S (2012) Antioxidant properties of polyphenols incorporated in casein/Na-caseinate
films. Int Dairy J 25 : 10-15.
Helal, A (2012) Casein-polyphenols interaction: from test tube to applied technology. In Proc.s of TWAS/BioVisionAlexandria.Nxt.,
Alexandria, (Egypt), 21-22 April 2012 pp. 74-75.
Re R, Pellegrini N, Proteggente A, Pannala A, Yang M, Rice-Evans C (1999) Antioxidant activity applying an improved ABTS
radical cation decolorization assay. Free Radical Biol Med 26: 1231-1237.
Robitaille G , Giroux H , Britten M (2004) Turbidity method to monitor the kinetics of rennet-induced coagulation of milk using a
microplate reader. Milchwissenschaft 59 : 479-482.
Tagliazucchi D, Verzelloni E, Bertolini D, Conte A (2010) In vitro bioaccessibility and antioxidant activity of grape berries
polyphenols. Food Chem 120: 599-606.
Verzelloni E, Tagliazucchi D, Del Rio D, Calani L, Conte A (2011) Antiglycative and antioxidative properties of coffee fractions.
Food Chem 124: 1430-1435.
Zulueta A, Maurizi A, Frigola A, Esteve M J, Coli R, Burini G (2009) Antioxidant capacity of cow milk, whey and deproteinized
milk. Int Dairy J 19: 380-385.
The application part of the PhD project was carried out in LIBio, Universite de Lorraine, France, under the
supervision of Prof. Stéphane Desobry.
- 84 -
Development of High Performance Biopolymer Coatings
for Food Packaging Application
Laura Introzzi (laura.introzzi@unimi.it)
DeFENSE, Dept. of Food, Environmental and Nutritional Sciences, University of Milan, Italy
Tutor: Prof. Alberto Schiraldi
This PhD project focused on the optimization of the food packaging plastic materials through the development of
biopolymer-based coatings. The main aim was the development of a coating with high oxygen barrier properties,
especially at high relative humidity values. At the same time, a suitable optical appearance was constantly targeted
and some surface properties fine-tuned, insomuch as an anti-fog coating was developed. Excellent results have been
obtained in terms of oxygen barrier property combining biopolymers and inorganic components by exploiting the
nanotechnology approaches (top-down and bottom-up approaches).
Sviluppo di coating biopolimerici per applicazioni nel settore dell’imballaggio alimentare
Scopo di questa tesi di dottorato è stato quello di ottimizzare le soluzioni di packaging esistenti, sviluppando dei
coatings biopolimerici. Lo scopo principale è stato quello di conferire al packaging finale un’alta barriera
all’ossigeno, in particolare per alti valori di umidità relativa. Contemporaneamente sono state monitorate le
proprietà ottiche e di superficie dei films, e ciò ha permesso lo sviluppo di un coating anti-fog. Eccellenti risultati in
termini di barriera all’ossigeno sono stati raggiunti combinando biopolimeri con componenti inorganici sfruttando
gli approcci nanotecnologici ad oggi conosciuti (top-down e bottom-up).
Key words: Food packaging, bio-macromolecules, oxygen barrier, nanotechnology.
1. Introduction and Aim
Over the last decade the interest in using natural resources in order to replace, totally or partially, synthetic
packaging has increased. A promising way to see biopolymers promptly used as packaging materials is represented
by their deposition as thin layers on plastics or bio-derived materials, replacing the existing multi-layered structures
with lighter and cheaper solutions maintaining at the same time the requested performances. In accordance with the
PhD project previously described (Introzzi, 2010) the research has been divided in activities, the first two already
discussed (Introzzi, 2011) and focused on one-component coating performances (Farris et al., 2011). In particular,
that research brought, during this third year of PhD, to a special application of one of the developed coating as an
anti-fog layer (Introzzi et al., 2012a). Moreover, a biopolymer from microbial origin, pullulan, emerged as the most
promising as an alternative to the synthetic ones. Pullulan disclosed excellent features not only in terms of surface
characteristics, but also from both optical and especially oxygen barrier performances. Its physical and chemical
characteristics made it the selected biopolymer for an oxygen barrier property improvement at high relative
humidity, which has been accomplished by nanotechnology approaches. More specifically, both a bottom-up and a
top-down approaches have been considered. The former envisaged the use of an inorganic precursor as the
counterpart to the biopolymer within a sol-gel route that eventually led to the formation of a nano-structure;
conversely the latter approach involved the use of inorganic clays that, coupled with the biopolymer phase, allowed
obtaining a bionanocomposite. The final goal was to obtain a bio-based coating with the highest oxygen barrier
performances.
2. Rationale
Nano-sized inorganic components adequately dispersed in a polymer matrix can affect its permeability in two
specific ways (Duncan, 2011):
- the oxygen diffusion is reduced due to the presence of a more tortuous path;
- the interface phenomena at the polymer/filler interface make the polymer matrix partially immobilized.
Pullulan (PF-20 grade, Mn ~ 200 kDa) (Hayashibara Biochemical Laboratories Inc., Okayama, Japan) was used for
coating deposition on polyethylene terephthalate (PET) 12.0 ± 0.5 µm thick (Radici Film, San Giorgio di Nogaro,
Italy). To lay the coating water solutions on the plastic substrate, an automatic applicator (ref 1137, Sheen
Instruments, Kingston, UK) was used.
The following analyses were carried out for each film:
- oxygen transmission rate (OTR, mL m-2 day-1) using a permeability tester (MultiPerm, ExtraSolution Srl,
Navacchio, PI, Italy), based on the method described by ASTM F 2622-08;
- 85 -
- haze (%) analysis (ASTM D 1003-00) using a UV-Vis high-performance spectrophotometer (Lambda 650,
PerkinElmer, Waltham, MA, USA) coupled with a 150 mm integrating sphere;
- transmission electron microscopy (TEM) and field-emission scanning electron microscopy (FE-SEM).
3.1 The bottom-up approach
High-purity tetraethoxysilane (TEOS, Sigma−Aldrich, Milan, Italy) was used as the metal alkoxide precursor of the
inorganic phase. In the first step, an acidic (pH = 2.0 ± 0.8) hydroalcoholic (30 wt % ethanol) solution of TEOS was
prepared by using 1 M HCl (0.78 wt %) as a catalyst. Reacted TEOS (i.e. after hydrolysis) and the already prepared
pullulan water solution were mixed together, to allow the formation of the hybrid network. With the goal of
investigating the influence of the organic/inorganic ratio [O/I, defined as the pullulan/(SiOH)4 weight ratio for a
complete hydrolysis process] on the final oxygen barrier properties of the hybrid coatings, six solutions were
prepared by varying the O/I ratio of the coating from 100/0 to 50/100, as reported in Table 1. FTIR−ATR analyses
were performed to check for the coatings’ structural characteristics and chemical bonding.
Exp.
n°
Coded
name
Pullulan
(wt-%)
Si(OH)4
(wt-%)
(O/I*)
ratio
**Coating
thickness (µm)
1
2
3
4
5
6
H0
H3
H2
H1
H0.75
H0.5
10
7.5
6.66
5
4.3
3.33
0
2.5
3.33
5
5.7
6.66
/
3
2
1
0.75
0.5
1.27 ± 0.12 a
1.37 ± 0.18 ab
1.31 ± 0.07 ab
1.26 ± 0.14 ab
1.19 ± 0.08 ab
1.15 ± 0.09 b
Table 1 Formulation and thickness of
coatings tested.
*“I” refers to the silanol form, Si(OH)4,
calculated by the initial TEOS content and
assuming the completion of the hydrolysis
reaction.
**Letters denote statistically significant
differences within groups (p < 0.05).
3.2 The top-down approach
A natural montmorillonite, Closite® Na+ (Southern Clay Products Inc., Rockwood Additives, Gonzales, TX) was
used for the preparation of the bionanocomposite coatings. Different amounts of clays, in accordance with the
experimental range 0.2%-3.0% (Table 2), were dispersed in water and then ultrasonicated by means of an UP400S
(frequency: 24 kHz) ultrasonic device (Hielscher, Teltow, Germany). The duration of the ultrasonic treatment
varied in accordance with the experimental design (Table 2). A Central Composite Face (CCF) design, supported
by the quadratic polynomial equation of the general formula (1) here reported:
m=2
m=2
m=2
k =1
k =1
k≠ j
(1)
Y z = b z 0 + ∑ b zk X k + ∑ b zkk X k2 + ∑ b zkj X k X j + ε
allowed the development of a semi-empirical model able to pinpoint the best factors combination according to the
optimization criteria set up for the selected responses (minimum OTR with a haze 3% maximum).
The OTR results were fitted with Nielsen’s and Cussler’s permeation theoretical models (Takahashi et al., 2006).
Table 2. Worksheet of the CCF factorial design with responses’ results.
a
Clay concentration (wt%). b Ultrasonication time (min). c Oxygen transmission rate (mL m-2 day-1). d Haze (%).
Exp. n°
Variable
levels
Responses
X1 (x1)
1
2
3
4
a
0.2 (-1)
3 (+1)
0.2 (-1)
3 (+1)
b
X2 (x2)
5
6
7
0.2 (-1) 3 (+1) 1.6 (0)
8
1.6 (0)
9
10
11
1.6 (0) 1.6 (0) 1.6 (0)
15 (-1)
15 (-1) 45 (+1) 45 (+1)
30 (0)
30 (0) 15 (-1) 45 (+1)
30 (0)
30 (0)
30 (0)
c
68.26
15.08
70.27
19.22
73.12
13.97
18.23
18.41
22.89
23.63
23.83
d
1.89
4.25
1.8
4.16
1.87
4.48
3.15
2.8
3.12
2.72
2.88
Y1
Y2
4.1 The bottom-up approach
The FT-IR analyses revealed the occurrence of the expected reaction of hydrolysis and condensation of TEOS and
the formation of the interactions between the organic/inorganic phases (pullulan and TEOS, Fig. 1). Fig. 2a and 2b
show the characteristic peaks of pure pullulan and reacted TEOS. The spectra collected from hybrid coatings (Fig.
2c and 2d) showed some important changes compared to the pure phases. In the 980−880 cm−1 region, a band
including the two overlapping peaks corresponding to the silanol groups of TEOS and the α-(1,6) linkages of
pullulan gradually shifted toward higher wavenumbers as the inorganic phase increased. In addition, the peak
centered at around 945 cm−1 became increasingly sharper compared to that of reacted TEOS. Correspondingly, the
band of the hybrid coatings at around 3300 cm−1 associated with hydroxyl group stretching, became broader
compared to that of pullulan, while the peak slightly shifted toward lower wavenumbers. It has been pointed out
that the simultaneous broadening and shifting of peak absorption area is possibly due to extensive hydrogen
bonding between the silanol and hydroxyl groups of the organic phase (Uragami et al., 2002).
- 86 -
Figure 1 Schematic representation of the expected sol−gel hybrid
network formation.
Figure 2 (a, b) FTIR-ATR spectra of
(a) pullulan and (b) reacted TEOS. (c,
d) FTIR-ATR spectra of pullulan (),
reacted TEOS ({), and hybrid coatings
H0.5 (───), H0.75 (xxxxxxx), H1 (- - - -),
H2 (───), H3 (───) within 1300 cm-1
– 850 cm-1 (c) and 3800 cm-1 – 3000
cm-1 (d) spectral ranges.
TEM image 3a displays the SiO2 network after hydrolysis and condensation of the metal alkoxide precursor (i.e.,
TEOS): the inorganic network was formed by silica particles approximately 30−50 nm in diameter. Conversely,
pullulan molecules (Fig. 3b) appeared as thin chains with an estimated diameter of approximately 5−7 nm, with
more disordered organization and entanglements, linked to the flexibility of high molecular weight chains. The
association of the two phases (i.e., organic and inorganic) led to a new scenario (Fig. 3c): the larger-size silica
clusters appear to be twisted by pullulan chains. The final silica−pullulan structure can thus be conceived as a selfassembled three-dimensional hybrid network, where the organic and inorganic phases interact spontaneously
through intermolecular hydrogen bonding, as also shown by FTIR-ATR.
Figure 3 TEM images of (a) reacted TEOS, (b)
pullulan, and (c) hybrid coating H1. All images
are from 0.5 wt % hybrid dispersions 1 h after
preparation.
Figure 4 shows the oxygen barrier results. At first glance, it can be seen that all hybrid coatings provided an OTR
reduction compared to the neat substrate (PET), at least up to 60% relative humidity, but the best performances are
shown by formulation H3. However, the general trend indicates that increasing the inorganic concentration had a
detrimental effect on the barrier properties of the final structure. This is in contrast to what was expected, as it is
well established that decreasing the O/I ratio should improve the barrier properties. The cause can be linked to some
physical changes, induced by the decrease in the O/I ratio, on the overall organization of the final coatings:
increasing the inorganic component yielded a concomitant increase in the inherent rigidity of the silica network,
which prevailed on the innate flexibility of pullulan, thereby causing ruptures and cracks that dramatically affected
the film’s permeability.
- 87 -
Figure 4 OTR evolution for PET, pullulan, and
the five hybrid coatings over the 0%–80% relative
humidity gradient range at 23°C.
4.2 The top-down approach
The quadratic models obtained for the responses (OTR and haze) revealed coefficients R2 (fitting capability) and Q2
(prediction capability) very close to unity (for OTR: R2 = 0.999 and Q2 = 0.994; for haze: R2 = 0.984 and Q2 =
0.955). The effects of factors on the responses can be seen in Fig. 5.
Figure 5 Response surface plots showing
the influence of clay concentration and
sonication time on haze (a) and oxygen
transmission rate (b).
In particular, fig. 5b reveals that OTR decreases with clays concentration up to ~2.0%, indicating that the inorganic
component plays the expected role in decreasing the permeability. However, a further increase had a detrimental
effect. It can be also observed that long ultrasound treatment time tends to worsen the OTR and 15 minutes of
treatment are sufficient and energy-effective. Probably, both phenomena are caused by clays re-aggregation that
leads to micro- instead of nano-composites.
The DoE approach made possible to pintpoint the formulation providing the minimum OTR value with a haze of
maximum 3%: clay concentration of 1.57% and sonication time of 15 min. Accordingly, the OTR and haze values
predicted by the model were, respectively, 18.44 mL m-2 day-1 and 2.99%, which were then verified experimentally.
It is a valuable result considering that the OTR analysis was performed at 70% of relative humidity, so the
performances are better than that of polymers such as PVOH and EVOH, whose OTR values start decreasing from
RH > 50%.
To understand the possible aspect ratio of the clays inside the coating layer, the OTR of the bionanocomposite
coatings was computed with the well-known series resistance formula intended for multilayer systems. The values
were then used in the Nielsen’s and Cusslers’ models, as can be seen from Figure 6.
Nielsen
*100
Cussler 2
Cussler 1
*100
*100
Figure 6 Oxygen Transmission Rate of the bionanocomposite coatings. Experimental OTR values (□) and values
predicted by Nielsen’s (a) and Cussler’s (b and c) models for different aspect ratios (α).
P0 = permeability parameter of the pure biopolymer coating
P = permeability parameter of the nanobiocomposite coatings
a = aspect ratio of the platelets, i.e. the width divided by the thickness
Φ = volume fraction of the platelets dispersed in the biopolymer matrix.
- 88 -
The best prediction is provided by Nielsen’s model, with α = 20. It is far below the expected aspect ratio of
approximately 100-150 for montmorillonite clays, but it is plausible that even well-dispersed and exfoliated clays
after ultrasonic treatment rearrange in a more compact organization when forced into a confined space (i.e. the
coating thickness) upon the drying of the coating. The optimized formulation was finally analyzed through some
microscopy techniques. TEM image (figure 7a) indicates that the exfoliation of the clays was achieved after
ultrasonic treatment. SEM image (figure 7b) confirmed the apparently random organization of the clays within the
pullulan matrix.
a
b
Figure 7 TEM (a) and SEM (b) images of the optimized
pullulan nanocomposite coating.
The studies have demonstrated that a biopolymer, pullulan, in combination with inorganic components can be
profitably used to generate new oxygen barrier coatings. The bottom-up approach can be further exploited to
improve the obtained results (Farris et al., 2012), whereas the top-down approach gave promising final films for
future food packaging applications (Introzzi et al., 2012b).
6. References
Duncan TV (2011) Applications of nanotechnology in food packaging and food safety: barrier materials, antimicrobials and
sensors. J Colloid Interface Sci 363: 1-24.
Farris S, Introzzi L, Biagioni P, Holz T, Schiraldi A, Piergiovanni L (2011) Wetting of biopolymer coatings: contact angle
kinetics and image analysis investigation. Langmuir 27: 7563-7574.
Farris S, Introzzi L, Fuentes-Alventosa JM, Santo N, Rocca R, Piergiovanni L (2012) Self-Assembled pullulan−silica oxygen
barrier hybrid coatings for food packaging applications. J Agric Food Chem 60: 782-790.
Introzzi L (2010) Development of high performance bio-based hybrid coatings for food packaging applications In Proc.s of the
15th Workshop on the Developments in the Italian PhD Research on Food Science and Technology, Portici (NA, Italy), 1517 September, pp. 333-334.
Introzzi L (2011) Development of high performance bio-based hybrid coatings for food packaging applications In Proc.s of the
16th Workshop on the Developments in the Italian PhD Research on Food Science and Technology, Lodi (Italy), 21-23
September, pp. 241-242.
Introzzi L, Fuentes-Alventosa JM, Cozzolino CA, Trabattoni S, Tavazzi S, Schiraldi A, Piergiovanni L, Farris S (2012a)
‘Wetting enhancer’ pullulan coating for anti-fog packaging applications. Submitted to Appl Mater Interfaces.
Introzzi L, Blomfeldt TOJ, Trabattoni S, Tavazzi S, Santo N, Schiraldi A, Piergiovanni L, Farris S (2012b) Ultrasound-assisted
pullulan/montmorillonite bionanocomposite coating with high oxygen barrier properties. Submitted to Langmuir.
Takahashi S, Goldberg HA, Feeney CA, Karim DP, Farrell M, O’Leary K, Paul DR (2006) Gas barrier properties of butyl
rubber/vermiculite nanocomposite coatings. Polymer 47: 3083-3093.
Uragami T, Okazaki K, Matsugi H, Miyata T (2002) Structure and permeation characteristics of an aqueous ethanol solution of
organic inorganic hybrid membranes composed of poly(vinyl alcohol) and tetraethoxysilane. Macromolecules 35: 91569163.
- 89 -
Development of Nano-Material for Food Packaging
Fei Li (fei.li@unimi.it)
Tutor: Prof. Luciano Piergiovanni; Co-tutor: Prof. Saverio Mannino
The aim of PhD project research is to improve the properties of food packaging materials and develop new food
packaging materials. To the purpose, we use nano-materials to improve the characteristics of materials, as well as to
produce nanocomposite. Particularly, biopolymer, cellulose nanocrystals (CNs), is considered as the main coating
material for improving the gas barrier properties of conventional packaging materials. In order to better understand
the relationships between nano-coating and its properties, we investigated the oxygen barrier and mechanical
properties, morphology and thickness of nanocomposite through advanced instruments.
Studio e sviluppo di nano materiali per migliorare
le prestazioni degli imballaggi alimentari
L’obiettivo fondamentale della tesi di dottorato è quello di migliorare le proprietà funzionali di materiali flessibili
per il confezionamento alimentare, attraverso lo sviluppo di soluzioni innovative e sostenibili che impieghino nano
strutture di materiali di origine naturale. In particolare sono stati studiati i cristalli di nano cellulosa (CNs) con il
fine di ottenere componenti a bassa permeabilità ai gas, da impiegare come lacche a base acquosa da applicare su
convenzionali, anche in combinazione con Chitosano (CS). Per comprendere le relazioni tra nano strutture biopolimeriche e caratteristiche funzionali, è stata indagata la morfologia dei rivestimenti e le proprietà meccaniche e
di barriera.
Key words: Cellulose nanocrystals (CNs), layer-by-layer (LbL) coating, oxygen barrier.
1. Introduction
In accordance with the PhD thesis project previously described (LI, 2011), this communication reports the main
results of the following four activities directed to:
A1) Determination of the physical and chemical properties of selected biopolymers: Cellulose nanocrystals
(CNs) obtained from cotton linter by acid hydrolysis under optimized condition (A1.1) and morphology by
TEM and FE-SEM (A1.2).
A2) Analysis of films coated with functional nanofibers: Two kinds of coating methods presented, including
casting and layer-by-layer (LbL) coating.
A3) Analysis of nanocomposite: Using the CNs from cotton linter as coating material on plastic substrate in order
to improve the properties, the analyses were those described in (A2.1) and (A2.2).
A4) Improvement of the coating materials and nanocomposite: Improving by following steps, coating solution
optimization and typical analysis in order to understand the relationships between structure and performance.
2. Cellulose Nanocrystals Applications
Cellulose is the most ubiquitous and abundant renewable organic material produced in the biosphere (de Mesquita,
et al., 2010), which annual production is estimated to be over 75 billion tons. Besides the common paper-based for
packaging, the nano-cellulose extracted from plant or microbial cellulose was studied for different practical and
potential applications, due to its renewability, wide variety, nonfood, low energy consumption, low cost and low
density.
Nano-cellulose is a general nomenclature for cellulose related to at least one dimension in the nanoscale, while
indeed the nano-cellulose was classified into three aspects, including cellulose nanocrystals (CNs)/cellulose
nanowhiskers (CNW), microfibrillated cellulose (MFC) and others (bacterial cellulose (BC), TEMPO-oxidized
nanofibers etc.).
The methods of producing nano-cellulose are mainly classified into three types, including acid/alkali treatment,
homogenization and others. The ‘others’ treatments consist of microbiological (Kalashnikova et al., 2012),
enzymatic (Filson et al., 2009) and TEMPO-oxidized (Isogai et al., 2011) methods. The nano-scale cellulose is
obtained and has different properties, which will be reviewed in the following of this part. Generally, it is presented
from four aspects, including, mechanical, thermal, barrier and other general properties.
Firstly, the mechanical properties of CNs from different given sources are summarized in Table 1. To our best
knowledge, no mechanical tests on individual MFC, NFC or AC have been done. Most work has focused on elastic
traits.
- 90 -
Table 1 Mechancial properties of nano-cellulose (Moon et al., 2011).
Material
WF
PF
MCC
MFC & NFC
CNs
Plant
wood
t-CNs
Acid a
TEMPO
BC
EA (GPa)
14-27
5-45
25 ± 4
N/A
ET (GPa)
—
—
—
—
σf (GPa)
0.3-1.4
0.3-8
—
—
εf (%)
4-23
1.3-8
—
—
Techinque
Tensile
Tensile, Raman
Raman
57, 105
—
18-50
—
—
—
9±3
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
—
Raman
143
151 ± 29
145 ± 31
78 ± 17
114
Raman
AFM-3pt bend
AFM-3pt bend
AFM indentation
AFM-3pt bend
Raman
EA = elastic modulus in axial direction, ET = elastic modulus in transverse direction. σf = tensile strength (tensile testing), εf = strain to failure
(tensile testing).a Treated t-CNCs.
Wood fiber (WF), plant fiber (PF), microcrystalline cellulose (MCC), microfibrillated/nanofibrilated cellulose (MFC/NFC), cellulose
nanocrystals (CNs), tunicate cellulose nanocrystals (t-CNs), algae cellulose (AC), bacterial cellulose (BC).
Secondly, the thermal properties of CNs are briefly described here in terms of thermal chemical degradation and
coefficient of thermal expansion (CTE). Some researchers reported that the thermal chemical degradation of MCC
and CNC was around 300°C and 260°C, respectively, measured by thermal gravity analysis (TGA) (Petersson et
al., 2007). The CTE of crystalline cellulose in the axial direction has been estimated at around 0.1 ppm K-1 (Yano,
et al., 2005), which is comparable to other high-modulus, anisotropic fibers, such as carbon fibers.
Thirdly, CNs-based materials, both neat and modified/composites, have been considered as barrier films with
potential uses in filtration and packaging applications (Hubbe et al., 2008). Barrier property investigations have
primarily focused on water vapor transmission (Dufresne et al., 2000) and oxygen permeability (Fukuzumi, et al.,
2008). Isogai group reported that through 0.4µm TEMPO-NFC film deposited on 25µm PLA film, the oxygen
permeability significantly reduced from 746 to 1 cm3 m-2 day-1 bar-1. However, some researchers demonstrated that
neat MFC films (20-30 mm thick) had low oxygen permeability of 17 cm3 m-2 day-1 bar-1 (Fukuzumi et al., 2008).
Besides above, liquid crystallinity, rheological and optical properties are also interesting and important. Further
investigating LC can better understand the behaviour of cellulose in nano scale, while rheological properties are
crucial factors for blending the nano-cellulose with other polymer matrices, and optical properties, such as
refractive index, are closely related with practical application on food packaging.
The nano-cellulose has many unique properties and also well-connected with different fields, we thus should
continuously investigate it more systematically and specifically. In this paper, the work refers to a bionanocomposite coating, developed by means of chitosan (CS, polycationic) and cellulose nanocrystals (CNs,
polyanionic), through a LbL assembly technique. This biopolymer combination, here proposed as a green oxygen
barrier for food packaging, shows an easy tunability of its own performance according to the manufacturing
process. By a combination of complementary analytical and imaging techniques, we were able to systematically
address the morphology and oxygen barrier property of the CS/CNs multilayer nanocomposite.
Preparation of CNs (Li, 2011).
Layer-by-Layer assembly. Glass slides and silicon wafer were used as the substrates for AFM and ellipsometry
thickness evaluation, respectively. Firstly, the glass slides or silicon wafer were rinsed and pre-treated to remove
the contaminations and generate the negative-charge on the surface of glass slides. The coating procedure is as
follows: (1) The glass slide was dipped into the chitosan dispersion for 5 min (for the first bilayer) or 3 min (for
other bilayers); (2) The slide was rinsed in distilled water for 3 min for removing the excess chitosan; (3) The slide
was dried by filtered compressed air and dipped into the CNs dispersion for certain time (5 min for the first bilayer
or 3 min for other bilayers); (4) The rinsing and drying steps were the same as the one for chitosan. Finally, the
different numbers of bilayers were achieved by the recycle of (1)-(4) steps. All of the samples were stored into
desiccators with 0% RH ready for following measurements. The pH of CS or CNs dispersions is presented next to
their name in the figures and text. For example, one bilayer of CS (pH= 4)/CNs (pH = 2) is abbreviated as
(CSpH4/CNspH2)1.
Atomic Force Microscopy. An atomic force microscope (AFM, AlphaSNOM, WITec GmbH, Germany) was
employed both to systematically study the thickness of the deposited multilayers and to analyze their morphology.
Standard AFM Si probes have been used.
Ellipsometery. The thickness of each layer from 0 to 8 bilayers was determined by a variable angle
spectroscopic ellipsometer (VASE® J.A. Woollam Co. Inc., USA). CS/CNs multilayers were here deposited on a
Si wafer. Data were collected at different angles of incidence (60°, 65° and 70°), between 400 and 800 nm.
Field-Emission Scanning Electron Microscopy. SEM observation of the film cross-sections was carried out with
a Zeiss Σigma field emission microscope at 5 kV. The samples subjected to the SEM observation were pre-coated
- 91 -
with gold using a Polaron E5100 Coater at 18 mA for 20s.
Surface charge density measurement. The surface charge density of CNs was measured by PCD-04 particle
charge detector (Müteck, Germany).
Oxygen barrier property. Oxygen permeability measurements of coated films were performed by OX-TRAN®
Model 702 (MOCON, USA), complying with ASTM-3985, under the condition of 23°C and 0% relative humidity.
4.1 The process and morphology of LbL nanocomposite coating
Figure 1 (a) Illustrations of the LbL self-assembly process and (b) the nanostructure constructed by the alternate adsorption of
CS (orange) and CNs (gray) onto a substrate. (c) Scanning electron microscopy image of the multilayer cross section, after
cutting it with blade and coating it with a few nm Au layer.
In Figure 2(a) and 2(b) we show the thickness, obtained by atomic force microscopy (AFM) and ellipsometry,
respectively, for films constituted of an increasing number of bilayers and deposited under two different pH
conditions (CSpH2/CNspH6 and CSpH4/CNspH2). The two independent thickness measurements give consistent results
on each investigated sample. Note that the thickness increase is proportional to the nominal number of deposited
bilayers, clearly indicating a stable and replicable growth process. Under the (CSpH2/CNspH6) deposition conditions,
we obtain an average thickness of ~6 nm per bilayer, as shown in Figure 2(a) and 2(b) (empty circles), consistent
with previous values reported in the literature for a similar pH combination (de Mesquita et al., 2010). Noticeably,
the pH conditions of the employed solutions can be suitably controlled as a means to tune the thickness of the
individual layers. Indeed, under the (CSpH4/CNspH2) conditions, we observe a huge change in the thickness of the
individual bilayers, which increases from ~6 up to ~26 nm (solid squares). Since the oxygen barrier also increases
according to the thickness, pH conditions seem, therefore, an easy way to achieve lower permeability while keeping
the number of deposition steps reasonably low.
4.2 The thickness of the LbL nanocomposite coating and growth mechanism
Figure 2 (a) Thickness, obtained from AFM, as a function of the number of CS/CNs bilayers (n) deposited on a glass substrate
at two different combinations of pH values: (CSpH4/CNspH2)n (■) (dashed line: linear fitting with adjusted R squared R2=0.996)
and (CSpH2/CNspH6)n (○) (R2=0.999). (b) Thickness, obtained by ellipsometry, as a function of number of bilayers (n) deposited
on silicon wafer for the same conditions as in panel (a). Non integer values of n represent deposition of CS layers, while integer
values are related to CNs deposition.
In order to better understand the role of charges on the growth process, we performed surface charge density
measurements by means of conductometric titration (see Supplementary Material). From such measurements, the
amounts of cationic and anionic groups are found to be about 4600 and 220 mmol kg-1 for CS and CNs,
respectively. In other words, the ratio of -NH3+ (from CS) to -O-SO3- (from CNs hydrolyzed by H2SO4) is about 21
at neutrality. A highly different surface charge density leads to large differences in the CS and CNs-layer thickness,
as confirmed by Figure 2(b). Indeed the average thicknesses of the CNs and the CS layer were ~25 nm and ~0.65
- 92 -
nm, respectively, under the (CSpH4/CNspH2) conditions, and they are estimated to be ~3.92 nm and ~0.92 nm,
respectively, under the (CSpH2/CNspH6) conditions. Combining the evidence of surface charge density with the
thickness values obtained for each individual layer by ellipsometry, we conclude that electrostatic interactions are
probably the main driving force in the LbL assembling of CS and CNs and in establishing their thickness. On the
other hand, one also has to take the interactive charge overcompensation into account as a crucial factor in
determining the thickness (Yang, et al., 2011), especially under the CSpH4/CNspH2 conditions. In this case, surface
charges on the CNs layer are particularly sensitive to local pH, thus the pH of the CS solution makes cellulose
segments more charged. A similar process occurs for the complementary situation as well, where the CS layer is
dipped into the CNs solution. Eventually, a larger number of charged groups induces overcompensation, thereby
significantly changing the thickness of deposition. Hence, adjusting the pH of two polyelectrolytes solutions or
dispersions can tune both the individual thicknesses and the relative proportion of the two biopolymers, thereby
influencing the oxygen permeability of LbL coating (Lee et al., 2008, Svagan, et al., 2012, Yang et al., 2011).
4.3 Gas barrier properties of LbL nanocomposite coating
Figure 3 Oxygen permeability (PO2, cm3 m-2 24h-1 bar-1) for a 180 µm A-PET substrate coated with increasing numbers of
(CSpH4/CNspH2)n bilayers (n = 0, 5, 10, 15, 20, 25, and 30). Inset, reciprocal value of the oxygen permeability coefficient (KPO2)
(cm-3 µm-1 m2 24h bar) of the bio-nanocomposite coating only. All of the measurements were performed under ‘dry condition’
(namely, 23 °C and 0% RH). For each number of bilayers, two independent samples were prepared and tested, with typical
standard deviation between the two measurements around 20%.
The oxygen barrier properties of the CS/CNs coating only and those of the coated A-PET are presented in Figure 3
for the (CSpH4/CNspH2) condition, according to the number of bilayers (n) which vary from 0 to 30. Following the
thickness increase of LbL coating, the oxygen permeability (PO2) value of coated A-PET is decreasing
dramatically. At 30 bilayers, the PO2 value of coated A-PET reduces by 94%, compared to uncoated A-PET, from
about 20 down to about 1.3 cm3 m-2 24h-1 bar-1, as a result of the strong electrostatic interaction and hydrogen
bondings between CS and CNs. The most significant decrease of PO2 value is observed from 5 to 10 bilayers,
denoting a likely inhomogeneous structure of LbL coating of the first 5 bilayers: some pores or extremely thin parts
might exist, resulting in easier oxygen penetration. In order to test this hypothesis, we studied the sample
topography over 100×100 µm2 areas by AFM. Figure 4 shows the topography for the bare A-PET substrate (a) and
for the coated substrate with 5 (b) or 10 (c) bilayers. Scratches on the bare A-PET surface are likely caused by the
friction between films during the handling, but most parts of the PET are smooth. Noticeably, the roughness of the
5 bilayer film is comparable with its average thickness, denoting a non-uniform coverage of the substrate by the
coating, as can also be clearly seen by simple eye inspection of Figure 4(b). For the 10 bilayer coating, on the
contrary, a fully covered surface, with many small CS/CNs aggregates, is apparent from the AFM image, in
qualitative agreement with the results from the oxygen permeability measurements.
In the inset of Figure 3, the reciprocal value of KPO2 is also reported to highlight the oxygen resistance of the bare
LbL coating only. It is a remarkable evidence that from 10 to 30 bilayers, i.e. from 260 to 780 nm, this index
remains quite stable, hence KPO2 is approximately constant. We can thus assume that at the testing temperature
neither the oxygen diffusion coefficient, nor the oxygen solubility changes in the CS/CNs nanocomposite, which
therefore acts as a homogeneous single material, independently of the thickness and the number of bilayers (Lee, et
al., 2008). This is a necessary assumption in order to design a specific oxygen permeability, in other words to finely
tune the oxygen barrier properties at the nanoscale through LbL self-assembly.
- 93 -
Figure 4 AFM topography images of a bare A-PET substrate (a), the same substrate coated with 5 CS/CNs bilayers (b) and with
10 CS/CNs bilayers (c).
In conclusion, we demonstrated the use of CS/CNs nanocomposite realized by LbL self-assembly as oxygen
barrier, which has not been systematically reported so far to the best of our knowledge. The oxygen permeability
coefficient of CS/CNs nanocomposites is as low as 4.3 cm3 µm m-2 24h-1 bar-1, close to EVOH co-polymers, under
dry conditions.(Lee et al., 2008). Although the oxygen barrier property of the CS/CNs bio-nanocomposite is still
not as outstanding as that of some LbL coatings including inorganic nanoclays,(Svagan et al., 2012, Yang et al.,
2011) we consider the absence of any potential risks for human beings and the renewable origin of the polymers as
a significant added value that justifies a deeper investigation and exploitation of the LbL process applied to
CS/CNs.(Kovacs, et al., 2010, Lordan et al., 2011) Moreover, the production processes for chitosan and cellulose
nanocrystals are both low-energy consuming, especially compared to microfibrillated cellulose (MFC) produced by
mechanical processes (Isogai et al., 2011) Finally, the inexpensive use of cotton linters might lead to further
promising practical applications. Therefore, based on the advantages outlined above, the LbL CS/CNs
nanocomposite represents a promising oxygen barrier component in flexible and transparent packaging materials
for food applications.
5. References
de Mesquita JoP, Donnici CL, Pereira FV (2010) Biobased nanocomposites from layer-by-layer assembly of cellulose
nanowhiskers with chitosan. Biomacromolecules 11: 473-480.
Dufresne A, Dupeyre D, Vignon MR (2000) Cellulose microfibrils from potato tuber cells: Processing and characterization of
starch-cellulose microfibril composites. J Appl Polymer Sci 76: 2080-2092.
Filson PB, Dawson-Andoh BE, Schwegler-Berry D (2009) Enzymatic-mediated production of cellulose nanocrystals from
recycled pulp. Green Chem 11: 1808-1814.
Fukuzumi H, Saito T, Iwata T, Kumamoto Y, Isogai A (2008) Transparent and high gas barrier films of cellulose nanofibers
prepared by TEMPO-mediated oxidation. Biomacromolecules 10: 162-165.
Hubbe MA, Rojas OJ, Lucia LA, Sain M (2008) Cellulosic nanocomposites: a review. BioResources. 3: 929-980.
Isogai A, Saito T, Fukuzumi H (2011) TEMPO-oxidized cellulose nanofibers. Nanoscale 3: 71-85.
Kalashnikova I, Bizot H, Cathala B, Capron I (2012) Modulation of cellulose nanocrystals amphiphilic properties to stabilize
oil/water interface. Biomacromolecules 13: 267-275.
Kovacs T, Naish V, O'Connor B, Blaise C, Gagné F, Hall L, Trudeau V, Martel P (2010) An ecotoxicological characterization of
nanocrystalline cellulose (NCC). Nanotoxicology 4: 255-270.
Lee DS, Yam KL, Piergiovanni L (2008) In (Eds) Food Packaging Science and Technology, ed, CRC Press, p 86-93.
LI F (2011) Development of nano-material for food packaging. In Proc. s of the 16th Workshop on the Developments in the
Italian PhD Research on Food Science Technology and Biotechnology, Lodi (Italy), 21-23 September, 2011, pp 245-246.
Lordan S, Kennedy JE, Higginbotham CL (2011) Cytotoxic effects induced by unmodified and organically modified nanoclays
in the human hepatic HepG2 cell line. J Appl Toxic 31: 27-35.
Moon RJ, Martini A, Nairn J, Simonsen J, Youngblood J (2011) Cellulose nanomaterials review: structure, properties and
nanocomposites. Chem Soc Rev 40: 3941-3994.
Petersson L, Kvien I, Oksman K (2007) Structure and thermal properties of poly(lactic acid)/cellulose whiskers nanocomposite
materials. Compos Sci Technol 67: 2535-2544.
Svagan AJ, Åkesson A, Cárdenas M, Bulut S, Knudsen JC, Risbo J, Plackett D (2012) Transparent films based on PLA and
montmorillonite with tunable oxygen barrier properties. Biomacromolecules 13: 397-405.
Yang Y-H, Haile M, Park YT, Malek FA, Grunlan JC (2011) Super gas barrier of all-polymer multilayer thin films.
Macromolecules 44: 1450-1459.
Yano H, Sugiyama J, Nakagaito AN, Nogi M, Matsuura T, Hikita M, Handa K (2005) Optically transparent composites
reinforced with networks of bacterial nanofibers. Adv Mater 17: 153-155.
- 94 -
Poultry Industry Waste: Proteinaceus Hydrolizates as Growth Stimulator
for Microorganisms Potentially Probiotic
Federica Meli (federica.meli@nemo.unipr.it)
Dept. of Genetics, Biology of Microorganisms, Anthropology, Evolution, University of Parma, Italy
Tutor: Prof. Erasmo Neviani; Co-tutor: Dr. Camilla Lazzi
This PhD thesis research project is aimed to investigate the microbiological properties of protein hydrolizates (FAP,
Functional Animal Protein, and FFP, Functional Feathers Protein) obtained from poultry bones&meat trimmings
and from feathers. This project belongs to the European research project PROSPARE -PROgress in Saving Proteins
and Recovery of Energy-, whose aim is the recovery of poultry industry leftovers into valuable end-products.
Evaluation of growth promoting activity of FAPs/FFPs on Bifidobacterium and Lactobacillus probiotic spp. and
their effect on expression of aminopeptidase activities were described.
Scarti dell’industria avicola: idrolizzati proteici come stimolatori
dello sviluppo di microrganismi potenzialmente probiotici
La presente tesi di dottorato si propone di indagare sulle proprietà microbiologiche di idrolizzati proteici (FAP,
Functional Animal Protein, and FFP, Functional Feathers Protein) ottenuti dalle carni, ossa e piume avicole. Questo
lavoro si inserisce nell’ambito del progetto di ricerca europeo PROSPARE- PROgress in Saving Proteins and
Recovery of Energy-, il cui scopo è la trasformazione degli scarti dell'industria avicola in nuove materie prime ad
alto valore aggiunto. In questo contesto è stata effettuata la valutazione degli effetti sulla crescita e sulla vitalità
cellulare di microrganismi di interesse alimentare appartenenti al genere Lactobacillus e Bifidobacterium in
presenza di FAP/FFP. Inoltre è stato valutato il loro effetto sull’attività aminopeptidasica dei microrganismi per
indagare i meccanismi alla base della stimolazione.
Key words: Protein hydrolizate, Lactobacillus, Bifidobacterium, cell viability, growth promotion, aminopeptidase.
1. Introduction
One of the main topics of food industry is the waste management. The traditional waste chain usually ends with
disposal but nowadays this solution is no more sustainable both economically and from the environmental point of
view (Sancho et al., 2004). Protein hydrolyzates are widely used in the manufacture of probiotics, starter cultures
and fermented products due to their exploitation in microbiological media by fermentation and biotechnology
industries (Pasupuleti and Demain, 2010). Many studies are focused on using of different wastes of food industry
such as whey (Mahalakshmi and Murthy, 2000), fishery leftovers (Martone et al., 2005) fibrous proteins sources
(Kurbanoglu and Algur, 2002) (horns, nails, etc), for production of ingredients intended for formulation of
microbiological media. In fact growth substrate costs often comprise the major part of the production cost of
microbial cells and bioproducts from the fermentation industry (De la Broise et al., 1998). In this context the
formulation of the fermentation medium is undoubtly the most important step in the production of starter and
probiotic cultures. This research is aimed at investigate the possibility to use proteinaceus hydrolizates obtained
from poultry industry waste as nitrogen source in microbiological media for cultures involved in food production
such as Lactobacillus and Bifidobacterium genus: the former as starter and probiotic and the latter as probiotic.
These two genus have complex nutritional requirements and they need a complete medium that can support their
growth and enhance it indeed. In this way it could be possible give these wastes a new commercial value because
growth media represent a very high cost in microbiological propagation for this reason it is economically interesting
to find less expensive supplements to replace the common ones..
2.1 Growth Promotion of Bifidobacterium Species by Poultry Bone and Meat Trimming Hydrolyzate
Bacterial strains Eighteen strains belonging to 15 Bifidobacterium species were used in this work. Peptide
hydrolyzate FAP0 was provided by the State Institution All-Russian Research Inst. for Poultry Processing Industry
of Russian Academy of Agricultural Science within the European project PROSPARE. FAP was obtained starting
from leftovers of the avian industry after grinding, enzymatic hydrolysis, separation of the fat layer, filtration, and
drying. Growth assays After incubation for 48 h under anaerobic conditions at 37 ◦ C in MRS broth supplemented
with cysteine hydrochloride (Sigma-Aldrich, Milano, Italy) (Cys) at 0.05%, each culture was centrifuged at 8000×
g for 10 min at 4 ◦C. The harvested cells were washed twice, suspended in Ringer solution (Oxoid Italia), and used
to inoculate (2%, v/v) B12 (Difco Laboratories, Detroit, Mich., U.S.A.) broth (B12), B12 supplemented with Nacetylglucosamine (Sigma) (Nag) (B12-Nag)(22.00 g/L), and B12 supplemented with FAP0 (B12-FAP0)(22.00
- 95 -
g/L). Prior to inoculation, media were filtered through Millex -GV 0.22 μm filters (Millipore). Microbial growth
after incubation at 37◦C under anaerobic conditions was evaluated by both turbidimetric measurement (Golod et al.,
2009) and microscopic count. The extent of growth was monitored at various time points (0, 22, 44, 66, and 88 h)
by determining OD650 using a spectrophotometer. Fluorescence microscopy counts were performed using the
LIVE/DEAD BacLightTM Bacterial Viability Kit for microscopy (Invitrogen Ltd, Paisley, U.K.) (Bottari et al.,
2010).
The growth experiments were performed in duplicate, and resulting values were averaged in each experiment.
2.2 Growth promotion of Bifidobacterium and Lactobacillus species by proteinaceous hydrolysates derived
from poultry processing leftovers
Bacterial Strains: Eighteen strains belonging to fifteen Bifidobacterium species and twentyeight strains belonging
to fourteen Lactobacillus species were used in this work. Species of both genus have different origins. Protein
Hydrolyzates: Eight FAP samples (58T, 78T, 81T, 82T, 83T, 100T, 100AT, 101T) and one FFP (6L). Growth
Assays: The growth of Bifidobacterium strains was evaluated in B12 as basal medium as suggested by Etoh et al.
(1999), in B12-Nag at 22,00g/L as control medium and in B12 supplemented with each FAPs and one FFP at
22,00g/L (B12-FAP/FFP). The growth of Lactobacillus strains was evaluated in a homemade MRS broth without
the major nitrogen sources as basal medium (MRSN), in MRSN supplemented with Yeast Extract at 22,00g/L as
control medium (MRSN-YE) and in MRSN broth supplemented with each FAPs and one FFP at 22,00g/L (MRSNFAP/FFP). Evaluation of microbial growth after incubation in conditions according to the species and the genus
was made by turbidimetric measurement by determining OD650nm using a spectrophotometer. Viability Assay: The
viability of the cells were evaluated by direct count, as described in Lazzi et al. (2011), for all the strains.
Bifidobacterium strains were grown in B12 broth, B12-Nag and B12-6L. While Lactobacillus strains in were grown
in MRSN, MRSN-YE, MRSN-78T. The growth experiments and viability assays were carried out in duplicate and
resulting values were averaged in each experiment. Statistical analysis was conducted with STATPLUS:Mac
LE.2009. Chemical Analyses were performed by the Department of Organic and Industrial Chemistry of Parma
University.
2.3 Evaluation of peptidase activities of Lactobacillus and Bifidobacterium after the growth in new and
traditional proteinaceus hydrolizates
Bacterial strains Ten strains belonging to Lactobacillus genus and ten belonging to Bifidobacterium one were used
in this work. Proteinaceus Hydrolizates Four different proteinaceus hydrolizates: FAP 78T (78T), FFP 6L (6L)
Tryptone (TRI) (Oxoid) and Peptone (PEP) (Oxoid). Growth Media Five different growth media were used in this
study: MRS (Oxoid), a homemade MRS broth without the major nitrogen sources as basal medium (MRSN)
supplemented with 22g/L of 6L, 78T, TRY and PEP. MRS and MRSN used for bifidobacteria growth contained
cysteine hydrocloride at 0.05%. Cell extract (CE) CEs were obtained from MRS, MRSN-6L, MRSN-78T, MRSNPEP, MRSN-TRY strains culture pellets after a period of adaptation to the growth media. The strains growth was
stopped at the end of log growth phase. The cells cultures were collected by centrifugation at 8000 g for 10 min at
4°C. The pellets were disrupted mechanically. Protein concentrations were determined as described by Bradford
using a commercial reagent (Bio-Rad Laboratories, Hercules, Calif.) with bovine serum albumin (Sigma) as a
standard. Aminopeptidase activity (AA) AA was measured using five different chromogenic substrates (βnaphthyl amide derivates of L-anomers of leucine (Leu), lysine (Lys), proline (Pro), glycine-proline (Gly-Pro) and
phenilalanine-proline (Phe-Pro). The AA was evaluated by reading spectrophotometrically at 589 nm. Statistical
analyses were conducted with SPSS ver. 19.
3.1 Growth promotion of Bifidobacterium species by poultry bone and meat trimming hydrolyzate
The growth experiments were carried out on 18 Bifidobacterium strains in B12 as the basal medium, B12-Nag and
B12-FAP0 for their assessment as growth-promoting factors. The experiments were carried out with 22.00 g/L
corresponds to the total content of nitrogen sources in MRS. The growth of each Bifidobacterium spp was
monitored every 22 h to 88 h via turbidimetric measurement. Every strain displayed a characteristic growth curve,
but the highest OD650nm value was obtained after 66 h (data not shown). Therefore, this time of incubation was used
for the following experiments. FAP0 provided the best growth support to all the studied strains, although this
stimulation appeared to be variable among the species. The level of viability, after 66 h of incubation under
anaerobic condition at 37 ◦C, varied depending on the media and the strains. The percentage of dead cells was, on
average, lower in B12-FAP0 (18%) than in B12 (25%) or in B12-Nag (38%). The percentage of dead cells in B12FAP0 was always less than 45%. Considering the number of viable cells, the positive effect of FAP0 addition was
confirmed, and this stimulation appeared to have low variability among the species, ranging from 8.07 to 9.16 log
cell/mL. The average number of viable cells cultured in the presence of FAP0 was 8.57 log cell/mL; in B12-Nag
and in B12, the averages were 5.57 log cell/mL and 6.42 log cell/mL, respectively. Despite the fact that Nag has
been identified as a bifidogenic compound, growth in B12-FAP0 yielded the highest maximum OD and number of
viable cells. The mechanism by which FAP0 increases the growth of bifidobacteria has not been studied yet;
nevertheless, we propose the following 3 hypotheses. (1) FAP0 acts as a simple essential amino acid supplier.
- 96 -
Actually, FAP0 was mainly constituted by the low molecular weight fraction (<3 kDa) that contained both short
peptides and free amino acids. In this regard, Etoh et al. (1999) stated that the promoting effect on the growth of
bifidobacteria is due to a low molecular weight nitrogen fraction (<1 kDa); (2) FAP0 probably contains specific
peptides that bifidobacteria, after uptake in the cell by oligopeptide transport systems, can degrade due to the
presence of a specific peptidase that is able to hydrolyze peptide bonds within an oligopeptide. In this regard, very
little is known about the proteolytic enzyme systems of Bifidobacterium (Sela et al., 2010). The analysis of the B.
longum NCC2705 genome predicted more than 20 peptidases, including general aminopeptidases, peptidases
specific for proline residues, dipeptidases, and endopeptidases (Schell et al., 2002). (3) FAP0 may contain, among
peptides, a specific growth-promoting factor. Different research has shown the importance of peptide structure in
growth-promotion activity. Indeed, the addition of single amino acids that are contained in the active peptide do not
stimulate the growth of bifidobacteria strains (Zhao et al., 1996; Etho et al., 2000; Liepke et al., 2002).
3.2 Growth promotion of Bifidobacterium and Lactobacillus species by proteinaceous hydrolysates derived
from poultry processing leftovers
Bifidobacteria showed a growth behaviours strain-dependent. Although this, the best performances are generally
obtained with FAP 100T, 100AT, 101T and with FFP 6L. FFP 6L seems to well sustain the growth of
Bifidobacterium spp. also with strains that did not usually show a high growth. Concerning about the effects of
FAPs on Lactobacillus spp it is possible to notice that most of the species showed a higher growth than in MRS-N
supplemented with YE. The FAP that most positively affected the growth of Lactobacilli was 78T, the richest in
free aminoacids (data not shown). The Figures 1a and 1b show the average value of the extent of microbial growth
of two genus Bifidobacterium (1a) and Lactobacillus (1b) strains in control media and FAP/FFP media, compared
to the basal media, as determined by turbidimetric measurements. The coefficient of variation (CV) expresses the
variability of strains responses, among the genus, to the FAP/FFP media. Bifidobacterium strains showed a CV that
ranged from 38% to 453 %. The highest variability was observed for B12-83T and B12-Nag, while comparable
growth behaviour (low CV) was observed in presence of FAP 81T and FFP 6L. The FAP effect on Bifidobacterium
growth was different: 58T, 78T, 81T, 82T and 83T enhanced less the growth of all the species as compared to
100T, 100AT and 101T. In the presence of FFP 6L, the highest Bifidobacterium growth was observed. Moreover
the lesser CV (38%), indicating similar growth behaviour among the genus, was also observed (Figure 1a). For
Lactobacillus strains the CV ranged from 55% to 73%. Regardless of the variability of responses among the
species, the MRSN-FAPs and FFP positively affected the growth of the strains in comparison to basal medium.
Moreover, OD mean values in the FAPs media were comparable with the control medium (MRSN-YE). On the
other hand FFP 6L enhanced less than YE the Lactobacillus microbial growth.
Figure 1 Average Optical Density at 650 nm (OD650nm) value of the extent of microbial growth in FAP/FFP and control medium
respect to the basal culture medium; a) Bifidobacterium genus; b) Lactobacillus genus. Coefficient of variation is reported on
top of the bars.
Cells viability for Bifidobacterium strains B12-6L varied from 6.46 log cell/ml (±0.03 dev. st.) for B.
pseudocatenalatum to 9.86 log cell/ml (±0.01 dev. st.) for B. asteroides, and was always higher than the values
observed in basal and control medium. B. bifidum, B. longum, B. minimum, B. pseudocatenalatum and B. scardovii
kept their viability in basal control medium and in proteinaceus hydrolyzate presence. B. longum, B. magnum and
B. catenolatum strains kept their viability only with proteinaceus hydrolysate presence. All of them lost viability, or
even they underwent to autolysis, in the other growth condition. In MRSN only seven strains were not able to grow
and did not keep their viability. When complex nitrogen sources, FAP or YE, were added, values of viable cells
resulted high in all the strains. The strain L. pentosus grew in the same way in MRSN, MRSN-YE, MRSN-78T and
seemed to be not affected by the absence of complex nitrogen source. Among the strains different growth capacity
and level of viability were observed. The strain that presented the lowest number of viable cells (7.10 log cell/ml ±
0.02) was L. delbrueckii subsp. bulgaricus, while L. casei evidenced a higher degree of vitality (10.41 log cell/ml ±
0.02) in MRSN-78T.
- 97 -
The reasons why growth and the viability of Bifidobacterium and Lactobacillus strains are so well enhanced by
these kinds of hydrolizates could be found analysing the chemical composition of them. 6L resulted to the poorest
in free aminoacids, ten times less than other hydrolizates (Figure 2). Although bifidobacteria are usually considered
weakly proteolitic, they found in small peptides a better source of aminoacid than the same free aminoacids (Proulx
et al., 1994). The analysis of peptides fraction of 6L could support this affirmation in fact 6L had the most abundant
fraction of peptides smaller than 3kDa (Table 1). The case of lactobacilli their growth is well sustained by 78T that
is the richest in free amino acids (Figure 2) that could well support the several auxotrophies of Lactobacillus spp so
they have not to purchase essential amino acid from oligopeptides.
Table 1 Molecular weight distribution of FAP and FFP.
0,5
0,45
0,4
>10 kDa,% 16.1 25.0
83T
20.1
81T
19.2
82T 100T 100AT 101T 6L
27.2
11.0
6.7
Aminoacid content (g/g)
58T 78T
11.3 1.8
0,35
0,3
0,25
0,2
0,15
3-10 kDa,% 31.8 17.2
21.1
21.2
20.6
45.7
53.9
44.0 24.4
0,1
0,05
<3 kDa,%
52.1 57.8
58.7
59.7
52.2
43.3
39.4
44.7 73.8
0
58T
78T
83T
81T
82T
100T
100AT
101T
6L
Figure 2 Free amino acid content in FAP and FFP samples.
3.3 Evaluation of peptidase activities of Lactobacillus and Bifidobacterium after the growth in new and
traditional proteinaceus hydrolizates
After a period of adaptation to the growth media the CE of each lactobacilli and bifidobacteria strains was
extracted. The AA on five different chromogenic substrates (Leu, Lys, Pro, Gly-Pro, Phe-Pro) was determined.
Lactobacillus strains whole AAs, i.e. the sum of AA of each, chromogenic substrates were strain dependent and
significantly different (p<0.05) and they were not affected by the different media: oneway ANOVA showed a p>
0.05. Also the AAs expressed in presence of each chromogenic substrates were strain dependent.
Table 2 Frequency of higher peptidase activity. For each medium a score number indicates how many times a substrate reached
the higher activity to each other. A) Lactobacillus spp; B) Bifidobacterium spp.
Lactobacillus strains
MRS
MRSN-6L
MRSN-78T
MRSN-PEP
MRSN-TRY
Gly-Pro
2
2
1
3
2
Leu
5
4
4
5
5
Phe-Pro
2
4
3
2
0
Bifidobacterium strains
Lys
0
0
2
0
0
Pro
0
0
0
0
0
Gly-Pro
2
2
1
0
0
Leu
2
0
1
0
0
Phe-Pro
5
4
3
4
4
Lys
0
0
1
1
0
Pro
3
2
7
1
4
Table 2 resumes how many times a chromogenic substrate scored the highest value of AA among the others for
each strains grown in each medium. As shown in table 2A, β-naphthylamide-Leu was the best substrate for
Lactobacillus spp because its AAs were more frequently higher than other. This chromogenic substrate detects the
presence of generic aminopeptidases PepC and PepN, often found in lactic acid bacteria (LAB) (Savijoki et al.,
2006) but they can act also on β-naphthylamide-Lys. The AAs for Lys was about 2/3 less than Leu when the latter
showed higher AA. Therefore AA for Leu could be due also to the presence of PepL (Klein et al., 1995). Also the
activity of PepX, dipetdidil prolidase, detected by Gly-Pro and Phe-Pro substrates, was often the higher. This
aminopeptidase is often found in species belonging to LAB (Savijoki et al., 2006), and this activity depends on the
sequence of peptides in the growth media. Bifidobacterium strains whole AAs were strain dependent and
significantly different (p<0,05) and they were not affected by the different media: oneway ANOVA showed a p>
0,05. Also the AAs expressed in presence of each chromogenic substrates were strain dependent. As shown in table
2B, β-naphthylamide-Phe-Pro AAs were more frequently higher than other chromogenic substrates followed by
AAs for β-naphthylamide-Pro. This means that Bifidobacterium spp of this study had high levels of X prolyl
dipeptidyl peptidase that acts on Phe-Pro and they had high level of an iminopeptidase that acts on Pro residues (ElSoda et al., 1992). Bifidobacteria strains had lower relative activity on Leu and Lys substrates.
- 98 -
4. Conclusions
Bacterial growth depends on the biosynthesis and/or uptake of medium components required for the formation of
biomass. Growth media represent a very high cost in industrial application and for this reason it is economically
interesting to find less expensive supplements to replace the common ones. Currently, a great deal of attention is
being paid on the biotechnological potential of food industrial residues. This study suggested that by-products from
poultry industries provide a good alternative to substitute expensive nutrient supplements with cheaper renewable
low-cost products for growing Lactobacillus and Bifidobacterium. In food application, the viability of probiotic
strains, coupled with the amount of biomass, is used as the measure for probiotic suitability. FAPs for Lactobacillus
and FFP for Bifidobacterium are promising ingredients of industrial media not only because they support growth
very well but also because they allow to maintain an high level of viability (Lazzi et al., 2011).
5. References
Bottari B, Santarelli M, Neviani E, Gatti M (2010) Natural whey starter for Parmigiano Reggiano: culture-independent
approach. J App Microbiol 108:1676-84.
De la Broise D, Dauer G, Gildberg A, Guerard F (1998) Evidence of positive effect of peptone hydrolysis rate on Escherichia
coli culture kinetics. J Mar Biotechnol. 6: 111-115.
El-Soda M, Macedo A, Oison NF (1992) The peptide hydrolase system of Bifidobacterium species. Milchwissenschaft 47: 8790.
Etoh S, Asamura K, Obu A, Sonomoto K, Ishizaki A (2000) Purification and identification of a growth-stimulating peptide for
Bifidobacterium bifidum from natural rubber serum powder. Biosci Biotechnol Biochem. 64: 2083-2088.
Etoh S, Sonomoto K, Ishizaki A (1999) Complementary effects of bifidogenic growth stimulators and ammonium sulphate in
natural rubber serum powder on Bifidobacterium bifidum. Biosci Biotechnol Biochem. 63: 627-631.
Golod N, Loiko N, Mulyukin A, Neiymatov A, Vorobjeva L, Suzina N, Shanenko E, Gal’chenko V, El-Registan G (2009)
Adaptation of lactic acid bacteria to unfavorable growth conditions. Microbiol 73: 280-289.
Klein JR, Dick A, Schick J, Matern HT, Henrich B, Plapp R (1995) Molecular cloning and DNA sequence analysis of pepL, a
leucyl aminopeptidase gene from Lactobacillus delbrueckii subsp. lactis DSM7290. Eur J Biochem 15: 570-578.
Kurbanoglu EB, Algur OF (2002) Use of Ram Horn Hydrolysate as Peptone for Bacterial Growth. Turk J Biol 26: 115-123.
Lazzi C, Meli F, Dossena A, Gatti M, Neviani E (2011) Growth Promotion of Bifidobacterium Species by Poultry Bone and
Meat Trimming Hydrolyzate. J Food Sci In Press.
Liepke C, Adermann K, Raida M, Magert HJ, Forssmann WG, Zucht HD (2002) Human milk provides peptides highly
stimulating the growth of bifidobacteria. Eu J Biochem 269: 712-718.
Mahalakshmi R, Murthy VVPS (2000) Growth of Bifidobacteria bifidum in whey-based media. J Ind Microbiol Biotechnol 25:
177-179.
Martone CB, Perez Borla O, Sanchez JJ (2005) Fishery by-product as a nutrient source for bacteria and archaea growth media.
Bioresource Technol 96: 383-387.
Microbiol Biotechnol 71: 394-406.
Pasupuleti VK, Demain AL (2010) Applications of protein Hydrolysates in Biotechnology. In: Protein Hydrolizates in
biotechnology (Edited by: Springer). Pp. 1-9. London.
Proulx M, Ward P, Gauthier SF, Roy D (1994) Comparison of bifidobacterial growth-promoting activity of ultrafiltered casein
hydrolyzate fractions. Lait 74: 139-152.
Sancho P, Pinacho A, Ramos P, Tejedor C (2004) Microbiological characterization of food residues for animal feeding. Waste
Management. 24: 919-926.
Savijoki K, Ingmer H, Varmanen P (2006) Proteolytic systems of lactic acid bacteria. Appl Microbiol Biotechnol 71: 394-406
Schell MA, Karmirantzou M, Snel B, Villanova D, Berger B, Pessi G, Zwahlen MC, Desiere F, Bork P, Delley M, Pridmore
RD, Arigoni F (2002) The genome sequence of Bifidobacterium longum reflects its adaptation to the human
gastrointestinal tract. Proc Natl Acad Sci U S A 99: 14422-14427.
Sela DA, Price NPJ, Mills DA (2010) Metabolism of bifidobacteria. In: Mayo B, van Sinderen D, editors. Bifidobacteria:
genomics and molecular aspects. Norfolk, U.K.: Caister Academic Press. pp. 45-70.
Zhao QY, Piot JM, Gautier V, Cottenceau G (1996) Isolation and characterization of a bacterial growth stimulating peptide from
a peptic bovine haemoglobin hydrolizate. Appl Microbiol Biotechnol 45: 778-784.
- 99 -
Bio-based Food Packaging: Influence of Formulation
and Processing on Functional Properties
Stefano Molinaro1 (stefano.molinaro@uniud.it)
Dept. Food Science and Technology, University of Udine, Udine, Italy
Tutor: Prof. Alessandro Sensidoni1; Co-tutor: Dr. Joe Kerry2
2
School of Food & Nutritional Sciences, University College Cork (UCC), Cork, Ireland
1
The objectives of this research were to study the effects of four types of organically modified montmorillonite
(OMMT) in two poly(lactic)acid (PLA) matrices consisting of distinct contents of L-isomer on the structural,
thermal and mechanical properties of the resulting composite materials. The nanoclays were added at a fixed
concentration of 4% (w/w) and films were obtained using an extrusion process. Results showed that the influence of
the organic modifier was particularly significant in improving the barrier properties to water vapour and oxygen.
Influenza della formulazione e delle condizioni di processo
sulle proprietà funzionali di un imballaggio alimentare ottenuto da fonti rinnovabili
Gli obiettivi di questa ricerca sono stati quelli di studiare gli effetti di quattro tipologie di montmorillonite
modificata organicamente (OMMT) su due matrici di acido polilattico (PLA), a diverso contenuto di L-isomero,
sulle proprietà strutturali, termiche e di barriera dei materiali compositi ottenuti. Le nanoargille sono state aggiunte
ad una concentazione fissa pari al 4% (w/w) ed i film sono stati ottenuti attraverso un processo di estrusione. I
risultati hanno evidenziato che l’influenza del modificante organico è stata particolarmente significativa nel
migliorare le proprietà barriera al vapor d’acqua ed all’ossigeno.
Key words: Poly(lactid acid), organoclay, barrier properties, structural properties, nanocomposite.
1. Introduction
In accordance with the PhD thesis project previously described (Molinaro, 2010), this oral communication
describes the results obtained during the activity of bio-based packaging development and investigation of the
physico-chemical properties of the films designed and manufactured.
2. Nanoscience in Biopolymers
The interest in biopolymers in the world has significantly grown recently and the consumption of bioplastics has
increased from 15,000 to 225,000 tons during the years 1996 - 2008 (Gross and Kalra, 2002; Pilla, 2011), with an
estimated growth between 20 and 30% each year (Nampoothiri et al., 2010). According to Van Bailen and Poirier
(2007), three factors are important for the diffusion of bio-plastics over petroleum-derived plastics: economics,
public acceptance and regulation. For instance, the recent strong increase in oil price and the several issues
regarding the petrochemical plastics due to their persistence in the environment have been key factors in the
development of alternative sustainable packaging.
2.1 PLA
Poly(lactic acid) (PLA) is a compostable polymer derived from renewable sources, in particular from starch and
sugar. During the last decade, it has been used primarily for medical applications such as implant devices, tissue
scaffolds and internal sutures, due to its high cost, low availability and limited molecular weight (Datta and Henry,
2006). Recently, since production cost has been lowered by new technologies, such as the ring-opening
polymerization (ROP) process and large-scale production, the use of PLA has been extended to other areas as
packaging, textiles and composite materials (Drumright et al., 2000; Garlotta, 2001; Groot et al., 2010).
PLA is characterised by good processability and can be manufactured in machines used for conventional plastic.
Unfortunately, it is a brittle material with poor barrier and mechanical properties These drawbacks limit its use in
films, thermoformed and blow molded containers, food service ware and short shelf-life bottles (Gross and Kalrs,
2002).
2.2 Organoclays
The progress occurred recently in the field of nanoscience and nanotechnology has given an unique opportunity to
develop interesting materials which allow to overcome the typical performance compromises of the conventional
materials by benefiting of the sinergism occuring between components below certain dimensions (Sinha Ray,
2010). Thus, a way to improve the performance of materials could be through the structuration with nanofillers.
Among nanofillers, montmorillonite (MMT) has an interesting structure. It is a layered silicate (2:1 phyllosilicate)
characterized by a crystalline structure constituted of stacks of clay platelets. An important characteristic of MMT
- 100 -
is the ability to exchange inorganic with organic cations to form organically modified montmorillonite (OMMT),
which is more compatible with hydrophobic food packaging polymers. Many studies have focused on PLA
nanocomposites with OMMT (Fukushima et al., 2009; Jiang et al., 2007; Pluta, 2006; Thellen et al., 2005), but
only a relatively small number of them have considered a simultaneous effect of combining nanoclays and PLA of
different degrees of purity. The objectives of this study were to investigate the combined effects of the addition of
four types of OMMT possessing different chemical structures in two PLA matrices consisting of distinct contents
of L-isomer on structural, thermal and mechanical properties of nanocomposites manufactured using extrusion
process.
3.1 Materials
PLA 4032D and PLA 4042D possessing a 98.5 and 96% L-isomer lactide content respectively, were used as the
polyester matrix (NatureWorks® LLC, USA). Four types of nanosized organically modified montmorillonite,
Cloisite® 10A (C10A), 20A (C20A), 30B (C30B) and 93A (C93A) (Southern Clay Products Inc., Gonzales, TX,
USA) were purchased and used as fillers. These organoclays are obtained by modification of natural
montmorillonite with different ammonium salts. In particular, C10A, C20A, C30B are modified with a quaternary
ammonium salt, while C93A with a tertiary ammonium salt.
3.2 Film preparation
Films were produced in the facilities of the Department of Chemical and Food Engineering, University of Salerno
(Fisciano, SA, Italy). PLA and PLA-based nanocomposite films were prepared in two steps. First, PLA was
blended with organomodified clay (nominal content 5% w/w) using a co-rotating intermeshing twin-screw extruder
(ZK25, Dr Collin, Ebersberg, Germany). Before processing, PLA and layered silicates were dried at 80°C for at
least 12 hours under vacuum due to their high hygroscopic nature and to prevent excessive hydrolysis. The
processing temperature ranged from 200°C in the feed section to 185°C in the metering section and the screw speed
was set at 150 rpm. Successively, resin pellets were casted into uniaxially oriented films by a single-screw
extrusion cast film machine (Gimac, Varese, Italy).
3.3 Analytical determination
Investigation on the structure of nanoclays and nanocomposite films were carried out in a X-ray Diffraction (XRD)
instrument (X’Pert Pro, PANalytical, Almelo, The Netherlands) using a Cu Kα radiation at a wavelength of 0.1541
nm and operating at 40 kV and 35 mA. Scans were performed with a step size of 0.0084˚ from 2θ = 1.0 to 10.0°.
Differential scanning calorimetry (DSC) was carried out on a DSC 200 F3 (Netzsch Group, Selb, Germany). Each
sample (5 mg) was run in a nitrogen atmosphere and heated from 0 to 200°C at 10°C/min, held at 200°C for 2 min,
cooled to 0°C at a rate of 10°C/min, held at 0°C for 2 min and reheated to 200°C at 10°C/min. The reported glass
transition (Tg), crystallization (Tc) and melting (Tm) temperatures were obtained from the second heating scan.
Water vapour transmission rate (WVTR) of the films was determined according to Wang et al. (2009) from the
slope obtained from the regression analysis of weight loss data as a function of time, once the steady state was
reached. The increase in O2 concentration in function of time in a known volume chamber filled with nitrogen was
monitored using an optical measuring system (Optech-O2 Platinum, Luxcel Biosciences Ltd, Cork, Ireland) based
on fluorescent quenching principle. Oxygen transmission rate (OTR) was calculated considering the volume of the
receiving chamber and the area of the film available for gas permeation. Puncture strength (PS) and tensile
properties such as tensile strength (TS), elongation at break (E) and Young’s modulus (YM) of each film were
evaluated using an ImperialTM 2500 Test System (Mecmesin, Slinfold, UK) according to the ASTM Method D 88202. Film samples were preconditioned for at least 48 hours at 23°C and 50% relative humidity.
3.4 Statistical analysis
SPSS Statistical software version 15 for windows (SPSS Statistical software Inc., Chicago, IL, USA) was used for
data processing. The difference between means of pairs was resolved by means of confidence intervals using
Duncan’s test.
4.1 Structural properties
The addition of OMMTs to PLA matrices produced XRD peaks in composites where the diffraction maximum was
shifted to a lower 2θ angle in comparison with OMMT powder (Fig. 1). This suggests an interaction between
polymer chains and nanoclays with a formation of nanocomposites characterized by intercalated structures and a
partial preservation of OMMTs layered configuration (Rhim et al., 2009). PLA chains were inserted in the galleries
of OMMTs, thereby increasing the basal spacing between layers (d001) as shown in Table 1. C30B seems to have
the best compatibility with PLA. This can be deduced by the greatest shift to lower 2θ angles of the diffraction
maximum and the lowest intensity of peaks in the nanocomposites which suggest a partial exfoliation of the clay
(Zaidi et al., 2010).
- 101 -
Table 1 Effect of the addition of OMMTs on the basal spacing in nanocomposite films.
OMMT type
C10A
C20A
C30B
C93A
OMMT powder
2θ (°)
d001 (nm)
4.83
3.61
4.94
3.49
1.83
2.45
1.79
2.53
PLA 4032D composites
2θ (°)
d001 (nm)
2.83
2.78
2.73
3.24
a)
3.13
3.17
3.24
2.73
b)
PLA 4042D composites
2θ (°)
d001 (nm)
2.71
2.70
2.77
3.06
3.26
3.27
3.19
2.89
c)
C93A
C30B
U/C10A
Z/C93A
U/C93A
Z/C30B
U/C20A
Z/C20A
U/C30B
U
Z/C10A
Z
C20A
C10A
Figure 1 XRD patterns of (a) nanoclays, (b) PLA 4032D and (c) PLA 4042D series nanocomposites (U=PLA 4032D; Z=PLA
4042D).
3.2 Thermal and barrier properties
The water vapour and oxygen barrier properties of films increased significantly (P < 0.05) through the addition of
OMMTs (Table 2). The enhancement of barrier properties observed for PLA-nanocomposites can be explained by
the ability of the nanoclays to act as barrier elements in their own right, forcing the molecules to diffuse in the
polymer-clay nanocomposite through a “tortuous path”, thus increasing the diffusion length (Sinha Ray et al.,
2003). While OTR was significantly affected (P < 0.05) by both OMMT and L-isomer content, WVTR was
significantly influenced (P < 0.05) by the purity of PLA.
The different chemical structures associated with OMMT affected only the PLA 4042D series nanocomposites,
where the WVTR values were significantly different (P < 0.05). The OMMT C20A and C30B fillers in PLA 4032D
were the most effective in improving respectively water vapour and oxygen barrier properties.
Table 2 Effects of OMMT type and PLA purity on barrier and thermal properties*.
WVTR
Tg
OTR
(g d-1 m-2)
(°C)
(mL d-1 m-2)
PLA 4032D
55.3±1.3a
86.8±1.1a
60.1±0.1a
c
c
46.0±3.3
79.5±2.4
59.9±0.1acf
PLA 4032D/C10A
PLA 4032D/C20A
26.0±1.4d
53.1±2.9d
60.0±0.2ac
30.1±0.8d
43.4±3.6e
59.9±0.4acf
PLA 4032D/C30B
29.8±1.5d
71.1±3.9fg
60.7±0.4d
PLA 4032D/C93A
b
b
63.1±4.4
95.0±5.1
59.2±0.3be
PLA 4042D
c
f
PLA 4042D/C10A
46.7±4.5
70.0±1.9
58.7±0.4be
38.7±2.8f
78.1±3.8cg
59.5±0.2cef
PLA 4042D/C20A
e
d
PLA 4042D/C30B
31.7±1.5
57.8±4.9
58.4±0.5e
47.8±4.3c
77.2±3.0cg
59.4±0.2ef
PLA 4042D/C93A
* Values are mean ± standard deviation of data of 3 replicates. Different superscripts in
difference (P <0.05) between treatments.
Films
Tm
Tc
(°C)
(°C)
169.9±0.2a
112.0±0.6a
d
168.7±0.7
110.3±0.6c
168.7±0.5d
108.5±1.4d
168.2±0.5d
116.3±0.9e
168.7±0.5d
107.6±0.3d
155.1±0.5bc
128.4±0.7b
bc
155.3±0.1
129.7±1.0f
155.7±0.4c
130.7±0.3f
154.7±0.4be
130.5±0.2f
154.2±0.5e
128.3±0.4b
the same column indicate significant
The thermograms of the PLA 4032D and 4042D nanocomposites are reported in Fig. 2. Tg, Tc and Tm temperatures
are reported in Table 1. The results showed that the L-isomer content of the PLA samples significantly (P < 0.05)
affected the Tg, Tm and Tc. The decrease of Tm and increase of Tc in PLA 4042D and its nanocomposites may be
explained by the higher D-isomer content that makes the polymer more amorphous. As a consequence, the chain
reorganization due to the greater mobility shifts the cold crystallisation to higher temperatures (Thellen et al.,
2005). A nucleating effect of nanoclays can also be reported. The soft shoulder observed in the endothermic peak
may be related to a different PLA crystalline structural conformation.
- 102 -
U/C93A
U/C30B
U/C20A
U/C10A
U
Figure 2 DSC Thermograms of (a) PLA 4032D and (b) PLA 4042D series nanocomposites U=PLA 4032D; Z=PLA 4042D.
3.3 Mechanical properties
The effects of OMMT type dispersed in PLA and the different polymer purity affected the mechanical properties of
manufactured films (Table 3). A significant effect on TS and E was observed (P < 0.05). In general, the addition of
layered silicates decreased TS and resulted in a greater E. Most notably, an excellent increase in elongation was
obtained when C93A was incorporated into the PLA 4032D matrix. Thellen et al. (2005) reported greater
elongation values for nanocomposite films compared to control films. It was also observed in this study that a great
variation in TS and E values of films occurred in accordance with differing L-isomer content. However, a
significant decrease in the PS of the films occurred with the lowest PS recorded when C30B was incorporated into
PLA 4042D (P < 0.05).
Table 3 Effect of OMMT type and PLA purity on the mechanical properties of films*
Films
TS
E
YM
PS
(MPa)
(%)
(MPa)
(N/mm)
7.1±0.7ac
1765±135a
408.1±40.5a
PLA 4032D
39.9±3.6a
b
a
bc
PLA 4032D/C10A
27.7±2.7
6.4±0.6
1562±159
287.6±18.4c
PLA 4032D/C20A
31.1±3.3ce
7.4±0.8bc
1654±150ab
389.5±34.1a
d
bcf
a
7.9±0.8
1731±125
289.1±18.8c
PLA 4032D/C30B
34.7±3.4
PLA 4032D/C93A
33.2±1.8de
18.3±2.1d
1381±124d
284.6±25.2c
a
bfg
ab
8.2±0.8
1655±151
360.2±35.2b
PLA 4042D
39.2±3.9
PLA 4042D/C10A
27.7±2.0b
9.9±1.0e
1462±137cd
283.4±16.4c
d
fg
e
8.7±1.0
1895±104
437.3±18.8d
PLA 4042D/C20A
34.6±3.3
bc
fg
d
PLA 4042D/C30B
28.8±2.8
8.7±0.8
1373±164
193.5±18.1e
9.1±1.0eg
1688±180ab
364.9±21.3b
PLA 4042D/C93A
37.6±4.0a
* Values are mean ± standard deviation of data of 10 replicates. Different superscripts in the same column indicate significant
difference (P <0.05) between treatments. Tensile tests were carried out with specimens cut in direction machine.
The blending of PLA with a small amount of OMMTs resulted in a formation of nanocomposites, with C30B
demonstrating the greatest compatibility with PLA. The positive interaction between the nanoclays and the PLA
matrix also improved the mechanical properties of films with a general reduction in stiffness being determined
through data generated from tensile strength and elongation testing. The incorporation of small amounts of OMMTs
within PLA had also a significant effect on the improvement of water vapour and oxygen barrier properties. Further
studies on the mechanisms of permeation, diffusion and migration of gases in the nanocomposites packaging
materials will be necessary in order to have a deeper understanding of the interactions occurring between polymer
and nanoclays which affect the improvement of the barrier properties, depending on the organoclay type used.
5. References
Datta R, Henry M (2006) Lactic acid: recent advances in products, processes and technologies-a review. J Chem Technol Biot
81: 1119-1129.
Drumright RE, Gruber PR, Henton DE (2000) Polylactic acid technology. Adv Mater 12: 1841-1846.
Fukushima K, Tabuani D, Camino G (2009) Nanocomposites of PLA and PCL based on montmorillonite and sepiolite. Mat Sci
Eng C 29: 1433-1441.
- 103 -
Garlotta D (2001) A literature review of poly(lactic acid). J Polym Environ 9: 63-84.
Groot W, van Krieken J, Sliekersl O, de Vos S (2010) Production and purification of lactic acid and lactide. In Auras R, Lim LT, Selke SEM, Tsuji H (Eds) Poly(lactic acid): synthesis, structures, properties, processing and applications, John Wiley
& Sons Inc, Hoboken, New Jersey, USA, pp 3-18.
Gross R A, Kalra B (2002) Biodegradable polymers for the environment. Science 297: 803-807.
Jiang L, Zhang J, Wolcott MP (2007) Comparison of polylactide/nano-sized calcium carbonate and polylactide/montmorillonite
composites: reinforcing effects and toughening mechanisms. Polymer 48: 7632-7644.
Molinaro S (2010) Bio-based food packaging: influence of formulation and processing on functional properties. In Proc.s of the
15th Workshop on the Developments in the Italian PhD research on Food Science Tecnology and Biotechnology, Portici
(Italy), 15-17 September, 2010, pp 339-340.
Nampoothiri KM, Nair NR, John RP (2010) An overview of the recent developments in polylactide (PLA) research. Bioresource
Technol 101: 8493-8501.
Pilla S. (2011) Handbook of bioplastics and biocomposites engineering applications, John Wiley & Sons, Inc, Hoboken, New
Jersey, USA, pp 1-15.
Pluta M. (2006) Melt compounding of polylactide/organoclay: structure and properties of nanocomposites. J Polym Sci Part B:
Polym Phys 44: 3392-3405.
Rhim J-W, Hong S-I, Ha C-S (2009) Tensile, water vapor barrier and antimicrobial properties of PLA/nanoclay. LWT-Food Sci
Technol 42: 612-617.
Sinha Ray S, Kazunobu Y, Okamoto M, Ueda K (2003) New polylactide-layered silicate nanocomposites. 2.Concurrent
improvements of material properties, biodegradability and melt rheology. Polymer 44: 857-866.
Sinha Ray S (2010) Nanocomposites. In Auras R, Lim L-T, Selke SEM, Tsuji H (Eds) Poly(lactic acid): synthesis, structures,
properties, processing and applications, John Wiley & Sons Inc, Hoboken, New Jersey, USA, pp 311-322.
Thellen C, Orroth C, Froio D, Ziegler D, Lucciarini J, Farrel R, D’Souza NA, Ratto JA (2005) Influence of montmorillonite
layered silicate on plasticized poly(L-lactide) blown films. Polymer 46: 11716-11727.
Van Beilen JB, Poirier Y (2007) Prospects for biopolymer production in plants. Adv Biochem Eng/Biotechnol 107: 133-151.
Wang L, Auty MAE, Rau A, Kerry JF & Kerry JP (2009) Effect of pH and addition of corn oil on the properties of gelatin-based
biopolymer films. J Food Eng 90: 11-19.
Zaidi L, Bruzaud S, Bourmaud A, Médéric P, Kaci M, Grohens Y (2010) Relationship between structure and rheological,
mechanical and thermal properties of poolylactide/cloisite 30B nanocomposites. J Appl Polym Sci 116: 1357-1365.
- 104 -
Screening of Lactobacillus spp. related
with the Biogenic Amines Production in Wine
Alessandro Moncalvo (alessandro.moncalvo@unicatt.it)
Institute of Oenology and Food Technology, Università Cattolica del Sacro Cuore, Piacenza, Italy
Tutor: Prof Angela Silva; Co-tutor: Dr. Maria Daria Fumi
This PhD thesis concern the relationship between Lactobacillus spp. and biogenic amines production in wine, and
the selection of strains able to develop the malo-lactic fermentation not producing the biogenic amines.
Screening di Lactobacillus spp. in relazione alla produzione di ammine biogene in vino
Questa tesi di PhD tratta della relazione tra Lactobacillus spp. e produzione di ammine biogene nel vino, nonché
della selezione di ceppi non produttori di ammine biogene ed in grado di svolgere la fermentazione malo-lattica.
Key words: Lactobacillus; biogenic amines; amino acid decarboxylases.
1. Introduction
The wine is usually a safe product, nevertheless in some cases can content biological contaminants such as
ochratoxin A (OTA) and biogenic amines (BA).
Ochratoxin A is a mycotoxin produced by several species belong Aspergillus and Penicillium genera. OTA is a
well-known nephrotoxin and it is classified by IARC as possible human carcinogen (EFSA, 2006). Since the
vintage of 2005, with the adoption of Regulation CE 123/05, the level of ochratoxin A in commercial wines cannot
exceed 2 μg/L.
Biogenic amines occur in different kind of food, such as cheese, fish products, beer and wine. They are undesirable
in all foods and beverages because, if present in high concentration, they may induce headache, respiratory distress,
hyper/hypotension and several allergenic disorders (Silla, 1996).
They are low molecular weight organic bases, aliphatic (putrescine, cadaverine, spermine and spermidine),
heterocyclic (histamine and tryptamine) or aromatic (tyramine and phenylethylamine) (Lounvaud-Funel, A., 2001).
Some amines are normal constituents of grapes, varying according to variety, soil type and composition,
fertilization and climatic conditions, level of grape ripening and oenological parameters (Marques, 2008; MorenoArribas and Polo, 2008; Marcobal et al., 2006; Del Prete et al., 2009). Recent study show that the grape storage
time before crushing affects the amines content in must (Cecchini and Morassut, 2010).
BA are formed by decaboxylation of the precursor amino acids by microorganisms through the substrate-specific
enzymes. This property is not linked to a microbial species, usually it is strain dependent (Leitão et al., 2000).
Enzymes on which most research has been focused are: histidine decarboxylase (HDC), which catalyzes the
formation of histamine; tyrosine decarboxylase (TDC), which is specific for tyramine formation; and ornithine
decarboxylase (ODC), which catalyzes the formation of putrescine (Costantini et al., 2006)
Some studies report no remarkable increase of the concentration of BA during alcoholic fermentation (AF) and
show that yeasts do not seem to be responsible for the production of amines present in wine (Herbert, 2005). In
wine malolactic fermentation (MLF) is considered a critical step for biogenic amines production. The wild bacteria
are the major responsible of the formation of biogenic amine (Lonvaud-Funel, 2001). The use of selected strains of
lactic acid bacteria (LAB) amino acid decarboxylase-negative is certainly a good practice in winemaking.
In this work we investigated the relationship between Lactobacillus spp., oenological practices and production
biogenic amines. In particular the different co-inoculation time of selected bacteria strains with selected yeast was
considered.
This oral communication reports the main results of the following activities directed to:
1) determine the level of biogenic amines in must and their evolution during winemaking in different trials of coinoculation;
2) investigate the presence of the amino acid decarboxylases in wild strains of Lactobacillus spp..
2. Materials and methods
2.1. Grape cultivar and strains of yeast and bacteria
The trials were made using Cornalin, an autochthonous Vitis vinifera cultivar of the “Valle d’Aosta”. The must was
subdivided in 12 part of 20 L and added of SO2 (40 mg L-1).
The Saccharomyces cerevisiae strain QD145 (Lallemand Inc.) was used to ferment the must. The LAB
Lactobacillus plantarum V22 (Lallemand Inc.) was selected because of its good capacity to induce MLF.
- 105 -
2.2 Biogenic amines samples preparation and analysis
The standards were prepared and must and wine were analyzed in according to resolution OIV/OENO 346/2009.
2.3 PCR conditions
The PCR screening was carried out, during the study period at the laboratories of AWRI (Australian Wine Research
Institute), to investigate the presence of specific amino acid decarboxylases in wild lactic acid bacteria; 35 strains of
Lactobacillus spp. collected from different winery of Barossa Valley, Adelaide Hills and McLaren Vale (Adelaide,
South Australia, Australia) were screened. The hdc, tdc and odc gene were evaluated according to the protocol of
Costantini et al. (2006).
2.4 Winemaking protocol
Six different theses were carried out in two replicates. Alcoholic fermentation and maceration were conducted in
demijohns, with three punching the cap to day. The must was inoculated by S. cerevisiae (20 g hL-1) pre-rehydrated
in presence of yeast nutrient GO-FERM (30 g hL-1) (Lallemand Inc.). During alcoholic fermentation FERMAID
(30 g hL-1) (Lallemand Inc.) was added; in all thesis Opti’Malo plus (20 g hL-1) (Lallemand Inc.), lactic acid
bacteria nutrient, was added at the end of the alcoholic fermentation. Lactobacillus plantarum V22 (L. V22) was
inoculated after hydration in water for 15 min. In thesis 1 the L. V22 was inoculated in the must and the yeast 24 h
later, in thesis 2 the bacteria were inoculated 24 h after yeast, in thesis 3 at 30% of AF, in thesis 4 at 60% of AF, in
thesis 5 at end of AF. The thesis 6 was the control not inoculated with L. V22. The analysis were carried out in 6
different steps: must, 50% of alcoholic fermentation, end of alcoholic fermentation, end of malo-lactic
fermentation, after one week on the lees and after one year in bottle. Before bottling the theses inoculated at the end
of AF were divided in two parts: filtered (filter 0,45 μm) and not filtered.
2.5 Statistical analysis
The analysis of variance (ANOVA test) of BA content determined during winemaking process was carried out by
IBM SPSS Statistics Version 19 software.
3. Results and discussion
3.1 Biogenic amines evolution
The results show that the ethanolamine was the major amine present in must, ethylamine, phenylethylamine,
histamine and cadaverine were detected in very low concentration (Table 1).
The presence of amines in must can be caused by grapes storage time before to be crushed, necessary because the
grapes temperature was very low. The grapes were stored in cellar overnight to range 16°C before crushing and
yeast/bacteria inoculum.
Table 1
Level of the biogenic amines (mg L-1) in the must. n.d. = no detected.
Ethanolamine
Histamine
Ethylamine
Tyramine
Phenylethylamine
Cadaverine
10.60 ± 0.1
0.10 ± 0.01
0.50 ± 0.02
n.d.
0.90 ± 0.04
0.10 ± 0.01
Ethanolamine was the relevant BA in each step of winemaking process. The concentration of this amine decreases
during alcoholic fermentation (data not shown). The change during FA is related to the role that this amine plays in
different pathways as precursor of the phosphatidylethanolamine and then of the phosphatidylcholine, a
phospholipid present in the membrane of the yeast (Schuiki et al., 2010); in the yeast cells the ethanolamine is
present in citosol, therefore lysis of the cells may promote its transfer to the medium.
Cadaverine was detected in trace or not detected in each thesis during winemaking, this work confirms that this
amine is not a problem for the wine.
The ethylamine and phenylethylamine slightly increase during AF and in MLF are constant (data not shown).
Related to ethylamine, literature data are not in agreement, in some studies ethylamine decreases during AF and in
other instead increases. However, in all works this amine is always present in grape and in must. The data of
phenylethylamine indicate that this compound can be present in the grapes but can be formed by yeast during AF
too, according to literature data.
Tyramine was absent in must and not detected in all theses during AF and MLF, histamine was detected always at
level vey low, these results confirm the inability of L. plantarum V22 to produce these amine.
At the end of MLF, we observed no significant differences in amine content among the six theses, although we
detect a slight increase of ethylamine and a decrease of ethanolamine. Histamine, tyramine and cadaverine were
present in trace or not detected (Table 2).
- 106 -
Table 2 Level of the biogenic amines at the end of malo-lactic fermentation in the different theses. Means followed by the
same letter are not significantly different (p<0.05). n.d. = no detected
Amines
Thesis 1
Thesis 2
Thesis 3
Thesis 4
Thesis 5
Thesis 6
Ethanolamine mg L-1
7.70 ± 1.84a
8.15 ± 0.35a
7.65 ± 0.78a
7.35 ± 0.07a
8.35 ± 2.76a
7.95 ± 0.35a
Histamine mg L-1
0.20 ± 0.14a
0.35 ± 0.07a
0.35 ± 0.07a
0.30 ± 0.01a
0.20 ± 0.14a
0.40 ± 0.01a
Ethylamine mg L-1
1.65 ± 0.64a
2.25 ± 0.64a
1.95 ± 0.78a
2.05 ± 0.78a
1.70 ± 0.42a
1.65 ± 0.35a
n.d.
n.d.
n.d.
n.d.
n.d.
n.d.
1.35 ± 0.21a
1.35 ± 0.07a
1.25 ± 0.07a
1.25 ± 0.07a
1.30 ± 0.28a
1.35 ± 0.21a
n.d.
n.d.
n.d.
n.d.
n.d.
0.05 ± 0.07
Tyramine mg L-1
Phenylethylamine mg L-1
Cadaverine mg L-1
Amines content in the not inoculated thesis (thesis 6) is similar to the other theses and this suggests that LAB amino
acids decaboxylases-positive were not present in grapes and/or that must conditions were not favorable to produce
the BA. In this study, excluding histamine and tyramine, we observed that the different time of co-inoculation not
significantly influences the behavior of the biogenic amines during wine-making. As reported in literature (Herbert
et al. 2005) it’s clear that grape variety, region of production and vintage can affect BA contents in must and wine,
although alcoholic and malo-lactic fermentation can overcome these factors.
After one year in bottle the theses are different in ethanolamine content. In particular the thesis 1 and thesis 6 have a
higher ethanolamine level than the other (Figure 1). No differences are observed in the theses concerning the other
amine contents.
Figure 1 Level of biogenic amines of the five different co-inoculation time and the test in wine after1 year in bottle.(wine filtered
before bottling). Means followed by the same letter are not significantly different ( p<0.05)..
3.2 Biogenic amines after one year in bottle in filtered and not filtered wine
After one year the wines from the theses inoculated at the end of alcoholic fermentation, both filtered and non
filtered before bottling, show a high concentration of each amine especially histamine and tyramine in not filtered
samples (Figure 2).
- 107 -
Figure 2 Level of amines in thesis 5 wine, filtered and non filtered before bottling after 1 year in bottle. Means followed by the
same letter are not significantly different ( p<0.05).
The ethanolamine level is not affected by filtration. The analysis of the two theses after one year in bottle confirm
that the filtration process is very important to preserve the microbiological safety of the product, avoiding the
production of biogenic amines probably due to the microorganisms naturally present in wine that can release the
BA during bottle storage in not filtered wine.
In general the oenological good practices allow to have a product more safe, avoiding the presence of compounds
capable to give health problems or to alter the aromatic characteristic of the product.
3.3 PCR screening
Figure 3 shows the results of PCR amplification performed on the odc gene. The PCR screening, to detect
Lactobacillus spp. strains hdc-tdc-odc positive, shows that L. casei only was tdc-positive among the 35 tested
strains.
Figure 3 Example of Electrophoresis gels of PCR amplification performed on the odc gene. The strain with odc gene was L.
casei B749 (lane 7). Positive control was L. brevis CECT 5354 (lane 19), the amplified fragment of tyrosine decarboxylase gene
gave an amplicon of 560 bp. The molecular size of the marker (Marker 1Kb, Sigma, lane 1) is indicate on the left. The negative
control that had no template DNA is in lane 20.
The study shows, according to literature (Costantini, 2006), that is not very frequent in Lactobacillus spp. the
presence of specific enzymes involved in biogenic amines production.
Based on the results of this study we can conclude that in MLF the use of selected strains of bacteria, unable to
produce biogenic amines, reduce the possibility to have a product with a high level of BA. The different time of
inoculation no influences the behavior of the BA and the final concentration.
Very important is the filtration before bottling to avoid that microorganism present in the wine can increase the
- 108 -
level of these compounds and can modify the safety and quality of wine.
PCR data show that the genes of the hdc-tdc-odc are not frequently in the wild strains of Lactobacillus spp.;
nevertheless has been observed that the MLF is a critical point during winemaking for the production of BA and
there is the possibility that in the must few strains, able to produce BA, predominate during MLF.
Other studies will be necessary to isolate strains of autochthonous Lactobacillus spp. able to make the MLF,
maintaining also the typical characteristic of the grapes, and not producing biogenic amines.
Other important aspect will be the study of the origin of different BA in must and in wine, analyzing the level of
these contaminants in relationship with the vintage, territory and cultivar.
5. References
Cecchini F, Morassut M (2010) Effect of grape storage time on biogenic amines content in must. Food Chem 123: 263-268.
Choi J-Y, Martin WE, Murphy RC, Voelker DR (2004) Phosphatidylcholine and N-Methylated Phospholipids Are Nonessential
in Saccharomyces cerevisiae. J Biolog Chem 279: 42321-42330.
Costantini A, Cersosimo M, Del Prete V, Garcia-Moruno E (2006) Production of biogenic amines by lactic acid bacteria:
screening by PCR, thin-layer chromatography, and high-performance liquid chromatography of strains isolated from wine
and must. J Food Protect 69: 391-396.
Costantini A, Vaudano E, Del Prete V, Danei M, Garcia-Moruno E (2009) Biogenic Amine Production by Contaminating
Bacteria Found in Starter Preparations Used in Winemaking. J Agric Food Chem 57: 10664-10669.
Del Prete V, Costantini A, Cecchini F, Morassut M, Garcia-Moruno E (2009) Occurrence of biogenic amines in wine: The role
of grapes. Food Chem 112: 474-481.
EFSA (European Food Safety Authority) (2006). Opinion of The Scientific Panel on contaminants in the Food Chain of the
EFSA on a request from the Commission related to ochratoxin A in food. EFSA J. 365: 1-56.
Herbert P, Cabrita MJ, Ratola N, Laureano O, Alves A (2005) Free amino acids and biogenic amines in wines and musts from
the Alentejo region. Evolution of amines during alcoholic fermentation and relationship with variety, sub-region and
vintage. J Food Engin 66: 315-322.
Landete JM, Ferrer S, Pardo I (2007) Biogenic amine production by lactic acid bacteria, acetic bacteria and yeast isolated from
wine. Food Control 18: 1569-1574.
Leitão MC, Teixeira HC, Barreto Crespo MT, San Romão MV (2000) Biogenic amines occurrence in wine. Amino acid
decarboxylase and proteolytic activities expression by Oenococcus oeni. J Agric Food Chem 48: 2780-2784.
Lonvaud-Funel A (2001) Biogenic amines in wines: role of lactic acid bacteria. FEMS Microbiol Letters 199: 9-13.
Marcobal Á, Martín- Álvarez PJ, Polo MC, Muñoz R, Moreno-Arribas MV (2006) Formation of biogenic amines throughout the
industrial manufacture of red wine. J Food Protect 69: 397-404.
Marques AP, Leitão MC, San Romão MV (2008) Biogenic amines in wines: Influence of oenological factors. Food Chemistry,
107, 853-860.
Moreno-Arribas MV, Polo MC (2008) Occurrence of lactic acid bacteria and biogenic amines in biologically aged wines. Food
Microbiology, 25, 875-881.
Schuiki I, Schnabl M, Czabany T, Hrastnik C, Daum G (2010) Phosphatidylethanolamine synthesized by four different
pathways is supplied to the plasma membrane of the yeast Saccharomyces cerevisiae. Biochim Biophys Acta 1801: 480486.
Silla Santos MH (1996) Biogenic amines: their importance in foods. Int J Food Microbiol 29: 213-231.
- 109 -
Development of Guidelines for Microbiological Control in Microbreweries
Elio Moretti (elio.moretti@hotmail.it)
Dept. of Economic and Food Science, University of Perugia, Italy
Tutor: Prof. Paolo Fantozzi
Process hygiene plays a major role in the production of high quality beer. Today, in Italy there are around 400
craft breweries, in most cases that do not perform routine microbiological controls of process and product.
Knowledge of spoilage microorganisms found in the brewery environment is essential for the prevention of the
microbial spoilage of beer. The aim of this study is to identify the weak points of the process and the development
of guidelines for the microbiological control in craft breweries.
Sviluppo di linee guida per il controllo microbiologico nelle microbirrerie
L’igiene di processo ha un ruolo chiave nella produzione di birra di alta qualità. Oggi in Italia ci sono circa 400
birrifici artigianali, in molti casi non svolgono i controlli microbiologici routinari di processo e prodotto. La
conoscenza dei microrganismi dannosi che possono essere presenti in birrificio è essenziale per evitare il lo
sviluppo microbico nel prodotto. Lo scopo di questo studio è quello di individuare, attraverso monitoraggio, i
punti critici per lo sviluppo dei microrganismi dannosi nelle microbirrerie ed implementare delle linee guida per
effettuare il controllo di questi.
Key words: Weak point, process, beer bacteria spoilage, Italian craft breweries, guidelines.
1. Introduction
In accordance with the PhD thesis project previously described (Moretti, 2011), this oral communication reports the
main results of the following four activities:
A1) Bibliographic research and implementation of the main analytical methods used for the official identification
and recognition of the microorganism associated with the production of beer.
A2) Review of the microbiological and technological methods currently used in microbreweries for microorganism
control.
A3) Sample collection and analytical determinations.
A4) Analysis of case studies.
2. State of the art
For brewing industry beer spoilage bacteria and yeasts have been risky for centuries (Sakamoto et al., 2003). Beer
has been recognized as a microbiologically safe beverage. This is due to the presence of ethanol (0.5-10 % v/v), hop
bitter compounds whit antibacterial activity (ca. 17-55 ppm of iso-α-acids), high carbon dioxide content
(approximately 0.5% w/v), low pH (3.8 - 4.7) and reduced concentration of oxygen (generally less than 0.3 ppm)
(Suzuki, 2011). Microbreweries have a much longer history in Europe. In Germany, there are still 400 breweries
that produce less than 4000 hL per year and consequently very few new microbreweries have been established. In
other countries like Britain, United States, and Canada, very few traditional microbreweries existed during the
1970s. Therefore, numerous new microbreweries have been developed in the last 30 years. The 2002 Company
Directory of the Institute of Brewing & Distilling lists 239 smaller microbreweries in the United Kingdom and Eire,
and in Germany 833 breweries with an output of less than 10,000 hL/year were registered in 2000. This represents
65.6% of the breweries registered in Germany (Priest and Stewart, 2006).
Micro-brewed beer is typically more susceptible to microbial spoilage, as it is typically not pasteurised or sterile
filtered (Menz et al., 2010). The microbiological instability of beer is often caused by bacteria consisting of four
genera, Lactobacillus, Pediococcus, Pectinatus and Megasphaera (Suzuki, 2011). Spoilage by Lactic Acid Bacteria
(LAB) leads to the production of off-flavours and aromas, mainly lactic acid. In addition, the appearance of the beer
is degraded due to turbidity (Sakamoto and Konings, 2003).
A variety of yeasts and bacteria are able to flourish in beer causing product deterioration. There is also a range of a
new products containing lower levels of alcohol (or none at all), and/or fruit juices, that are more susceptible to
spoilage than the traditional ale and lager beers. In addition, production of non-pasteurized beer is continuing to
increase (Hill, 2008). Run losses, product retrieval, and prohibitive cost effect on brand integrity excite the need for
premium quality control mechanisms. Control of microbial contaminants is also important in ensuring consistently
uniform and high quality beer (Hill, 2008).
The association of germs proliferating in brewery plant environment is quite important and exhibits a striking
capability to form what can be considered as a symbiotic effect. Indeed, they mutually assist one another, efficiently
utilizing the nutrients and growth-promoting substances they produce with their metabolic activities (Back, 2005).
- 110 -
In these germ niches are not eliminated thoroughly and in a timely fashion, dangerous species may spread into any
area of the plan by the action of machine (e.g. conveyors, rotating parts, forklifts) personnel, air flow and water
rinses (Back, 2005). If the biologically endangered, weak areas are not eliminated, less sensitive beverage may also
be impaired or completely spoiled at later stage (Back, 2005). The development of such contamination is shown
schematically in Figure 1 (Back, 2005).
All brewing equipment such as fermenters, lager tanks, dispensing tanks, hoses, pipelines, and kegging equipment
should be checked visually and microbiologically by swabbing and cultivating in NBB broth. These simple quality
checks can be easily carried out by a trained brewer with little equipment but are very important to ensure a
constant beer quality that is one of the main factors of a successful pub brewery (Priest & Stewart, 2006). Weak
spots in the production and filling area are checked with a sterile swab (Back, 2009).
Swabbing method with NBB - B - AM has proved of value in the filling area of the beverage industry (and also in
the mineral well and soft drink industry) worldwide, since it is easy to handle and the analysis has a high
significance (Figure 1). Swabs are particularly taken on direct and indirect contact points with the beer (e.g. stars,
valves, lifting elements, bolted connections, stay bolts, hollow spaces). On statistical grounds, it is reasonable to
cover about 20 - 30 of such weak spots (Back, 2009). Swabs should be taken weekly during ordinary fillings to
capture the actual biological circumstances (Back, 2009).
Figure 1 LAB contamination level in the samples (Back, 2005).
For microbreweries that produce both kegged
and bottled beer for wholesale, providing an
extended shelf life becomes much more
laborious and expensive because of the
requirements of the quality control system.
Microbiological analysis of the beer at
different points along the production path,
must be carried out in order to spot
contamination at an early stage. Therefore,
careful consideration should be given to
whether the quality control system should be
outsourced or carried out in-house (Priest &
Stewart, 2006).
Today, in Italy there are around 400 craft
breweries, and in most cases they do not
perform routine microbiological controls of
the process and product.
This PhD work aims to study the following objectives:
- Collection of the information on the management of the process in microbreweries;
- collection and identification of the LAB mainly involved in the contamination of the finished product;
- identification of weaknesses of the production process.
Management of the process in Italian Microbrewery. 356 questionnaires were sent to the microbrewers in order
to collect information on the process management.
Identification of lactic acid bacteria mainly involved in the contamination of the finished product. 152 craft
beer samples were collected and analyzed for the LAB presence. The samples were collected from 37 craft
breweries. The majority of these samples (n = 150) were non-pasteurized products. The analytical methods of
Analytica - Microbiologica - EBC were used for the detection of spoilage bacteria in beers. 100 mL of beer were
filtered (0.45 µm, cellulose nitrate) with vacuum assistance. Some beers required multiple filters to achieve a
sample volume of 100 ml due to yeast and other particle. Each membrane was placed onto NBB-A (Döhler Germany) and the plates were incubate in anaerobic condition at 27 ± 1°C for 7 days. The isolated bacteria were
collected on MRS agar (0.2 % phenyl ethanol) and several subculture are done to obtain pure culture. LAB were
identified using API 50 CHL kits (BioMérieux - France).
Case studies. Wort, mature beer, centrifugated beer, beer with priming, bottle conditioning beer, swab test and
atmospheric air were collected from two breweries. One of the breweries participating in the project (“A” brewery)
produces less than 10,000 hL/year, the other (“B” brewery) has a production under 1,000 hL of beer per year. The
beers are produced with a secondary fermentation in bottle. To achieve this “bottle conditioning”, fermentable
- 111 -
extract is added to mature beer. The brewery “B” does not centrifugate mature beer before bottle conditioning.
The analytical methods of Analytica - Microbiologica - EBC were used for the detection of spoilage bacteria in
wort, mature beer, uncentrifuged and centrifugated beer, beer with priming and bottle-conditioned beers. 100 mL of
samples were filtered (0.45 µm, cellulose nitrate) with vacuum assistance. Some samples required multiple filters to
achieve a sample volume of 100 mL due to the presence yeast and other particles. Each membrane was placed onto
NBB-A (Döhler - Germany) and the plates were incubate in anaerobic condition at 27 ± 1°C for 7 days.
Swab test is used for monitoring the hygienic condition of the plant. Every week swab samples were taken from
different parts of the filling plant and other relevant sites. Incubation of swab-samples was carried out at 27 ± 1 °C
for 3 days in selective media NBB-B-AM (Döhler, Darmstadt, Germany).
Process air was sampled with analytical methods of Analytica - Microbiologica - EBC 2.2.4.1 and 4.6.3. A sample
of process gas was collected using the bubble bottle device. The 200 mL physiological saline sample was analyzed
by membrane filtration (0.45 µm). The filter was placed on an agar plate with NBB-A medium and was incubated
aerobically for 3 days.
Atmospheric air in bottle filling plant was sampling with analytical methods of Analytica - Microbiologica - EBC
2.2.4.2. Petri dishes with surface area of 6358 mm2 and NBB-A medium (Döhler, Darmstadt, Germany) were
positioned around the bottling machine and in the filling area. After removing the lids and exposing the medium to
atmosphere air for 15 minutes, the plates were incubate in anaerobic condition at 27 ± 1°C for 7 days.
5.1 Management of the process in Italian Microbreweries
Twenty questionnaires were collected from microbreweries. The 60 % of the breweries taking part in the project
have an annual beer production between 100 and 1.000 hL; the 25 % has a beer production between 10 - 100 hL,
and 15 % between 1.000 and 10.000 hL.
The 70 % of microbreweries does not use cropped yeast. The 55% of that breweries uses freeze-dried yeasts for
pitching the wort, the 15% uses liquid yeasts, while the 20 % uses both freeze-dried and liquids yeasts. The 45%
of the microbreweries does not have an integrated CIP system (Cleaning In Place); the 10 % of the breweries has a
mobile CIP system. Plant typologies are shown in the (Figure 2).
The 75 % of beers are conditioned in bottle, the 10 % are filtered and centrifuged to remove the yeast and then
subjected to a secondary fermentation in bottle. The 15 % of beers are filtered and packaged by means of isobaric
filling. The 25 % of respondents state that it was necessary to waste the beers because of the deterioration caused
by spoilage of microorganisms.
5.2 LAB identification mainly involved in the contamination of the finished product
Thirteen of the 37 analyzed breweries (35 %) show at least one positive sample to the presence of LAB (Figure 2).
26 of the 152 samples of craft beer (17 %) show the presence of LAB.
Figure 2 LAB contamination level in the samples.
Furthermore, 92 % of samples with LAB contain concentrations above 100 CFU/100 mL. Only two cases show a
concentration less than 101 CFU/100 mL.
Figure 3 reports the analytical results of the identification of LAB: 94 % of these belongs to the genus
Lactobacillus, 6 % to the Pediococcus spp.
- 112 -
Figure 3 LAB identification.
The most found species is Lactobacillus brevis, which represents 82 % of LAB, while Lactobacillus curvatus ssp
curvatus was found in 9 % of the cases and Lactobacillus paracasei ssp. paracasei in 3 % of the cases. Notably
Pediococcus damnosus was found in 6 % of cases.
The high presence of beer spoilage bacteria is an economic problem for the brewing industry because it can
damage the brand and cause high costs of product retrieval. An uncorrected process management in Italian craft
breweries is probably the origin of the detected spoilage bacteria.
This situation highlights the necessity to develop a better microbiological control and process management in
order to reduce the incidence of LAB contaminations.
5.3 Case study: process control of two Italian Microbreweries
The analysis of the production plants and operations carried out in the breweries “A” and “B” aims to identify the
weak points where microbiological control is essential.
Four brews were performed at the breweries “A” and “B” and samples were collected along the production
process (wort, mature beer, centrifuged beer, beer with priming, bottled beer, bottle conditioned beer). No
microorganism were found in all samples from brewery “B”.
Two of the four samples of the brewery “A” resulted positive for the presence of spoilage bacteria grown on NBB
- A media (Figure 4.). In the other two cases there were no spoilage bacteria in 100 mL of sample.
The
growth
of
spoilage bacteria in the
two positive samples
has followed the same
trend.
Data show that the
weak point in “A”
case is the bottling
process, in fact after
bottling there is an
increase
of
the
spoilage
bacteria
concentration.
The
increment of spoilage
bacteria
may
be
related to the presence
of fermentable extract
readily usable.
Figure 4 Spoilage bacteria grown on NBB-A media at different points of the process.
The demonstration that the bottling is a weak point is confirmed by the results of swabs and atmospheric air
sampling from bottling machine (Figure 5; Figure 6). The weekly sampling show an increase of positivity. After
the 3rd week in the brewery “A” was made a specific cleaning to decrease the positive samples. The effectiveness
of cleaning is shown in the (Figure 5). Despite of the clean up, after the sixth week was recorded a new increase of
positive samples. As shown in Figure 6 the high incidence of positive swabs at the third week is related to the
presence of spoilage bacteria in the air of the filling machine. In the brewery “B” samples (swabs and atmospheric
air) were collected only for three weeks during the bottle filling operation. All samples taken in the brewery “B”
- 113 -
during the filling operations were negative. This could be due to the different type and size of the bottling plant,
especially the cleaning that are made after the bottling session.
Figure 5 Weekly swab results in the bottling area of brewery A e B.
Figure 6 Spoilage bacteria in the atmospheric air in bottle filling plant Brewery “A”.
Sampling and data analysis were useful to highlight the weaknesses of the process in order to obtain a product
with no spoilage bacteria. The hygiene of brewery plant, machinery and surfaces crucially affects the quality of
the final product. Is even more important to have effective sanitation practices especially during the production of
unpasteurised beers.The identification of weakness points of the craft brewing process will lead to a better
awareness of microbrewery management, in order to develop guidelines for microbiological control in
microbreweries.
7. References
Analytica - Microbiologica - EBC, 2005. Fachverlag hans carl, Nürnberg.
Back W (2005) Colour Atlas and Handbook of Beverage Biology. Fachverlag Hans Carl.
Back W (2009) Microbiology, In Eßlinger H.M. Handbook of brewing: Process, Technology, markets. WILEY-VCH Verlag
GmbH & Co. KGaA, Weinheim.
Hill AE (2008) Microbiological stability of beer. In Bamforth C.W. Handbook of Alcoholic Beverages. Academic Press Inc.
Elsevier science and technology.
Menz G, Andrighetto C, Lombardi A, Corich V, Aldred P, Vriesekoop F (2010) Isolation, identification, and characterisation of
beer-spoilage lactic acid bacteria from microbrewed beer from Victoria, Australia. J.I.B, Vol.116, No.1.
Moretti E (2011) Sviluppo di linee guida per il controllo microbiologico nelle microbirrerie. In Proc.s of the XVI Workshop on
the Developments in the Italian PhD Research on Food Science, Technology and Biotechnology. PTP, Lodi.
Priest F.G., Stewart G.G., 2006. Handbook of brewing. CRC Taylor & Francis Group, LLC.
Sakamoto K, Konings WN (2003) Beer spoilage bacteria and hop resistance. Int J Food Microbiol 89:105-115.
Suzuki K (2011) 125th Anniversary review: microbiological instability of beer caused by spoilage bacteria. J Inst Brew117: 131155.
- 114 -
Proteomic and Immunoassay Characterization of a New Food Allergen
from Hazelnut (Corylus avellana)
Chiara Nitride (chiara.nitride@unina.it)
Dept. of Food Science, University of Naples “Federico II”, Naples, Italy
Tutor: Prof. Pasquale Ferranti
Hazelnut are among the common tree nuts that lead to lifetime lasting IgE-mediated food allergy, with an incidence
of about 0.4-1% of the world population. The predominance of the specific allergens appears to be associated to the
geographical origin of allergic subjects. Advanced integrated proteomic strategies coupled with immunochemical
assays were exploited to investigate the pattern of the immunological response of n=4 hazelnut allergic children
from Campania region. A new hazelnut food allergen, that shows a high homology degree with 11S globulin like
protein expressed in several other seeds, has been detected and preliminarily characterized.
Caratterizzazione proteomica ed immunochimica di un nuovo allergene alimentare
della nocciola (Corylus avellana)
L’allergia alimentare alla nocciola ha un’incidenza sulla popolazione mondiale di circa lo 0.4-1% ed una forte
tendenza a persistere nell’età adulta. La prevalenza di specifici allergeni è strettamente correlata alla provenienza
geografica dei soggetti allergici. Il profilo della risposta immunitaria di n=4 bambini con allergia alla nocciola nati
e cresciuti in Campania è stato determinato con tecniche di spettrometria di massa avanzate accoppiate a saggi
immunochimici. E’ stato identificato e parzialmente caratterizzato un nuovo allergene alimentare della nocciola che
mostra un elevato grado di omologia con le globuline 11S espresse come proteine di riserva in semi di diverse altre
specie.
Key words: Hazelnut, food allergy, tree nut, seed storage protein,
1. Introduction
According to the Food and Agriculture Organization (FAO) of United Nations the 70% percent of hazelnut world
production is concentrated in Turkey, followed by Italy, Spain and United States. Only 10% of the hazelnuts are
eaten as raw nuts; the majority of the crop is cracked, and the kernels are roasted and transformed by bakers, candy
makers, and other processors.
Hazelnuts are among the tree nuts the main cause of severe food-induced allergic reactions. Symptoms include Oral
Allergic Syndromes (OAS), urticaria, angioedema, asthma, vomiting, pharyngeal edema, diarrhea, and/or even
anaphylaxis.
Hazelnut allergy is more frequent in infancy than in adulthood and its prevalence varies among countries. In the
years different studies aimed to identify the hazelnut allergic determinant(s) were carried out. Several important
hazelnut seeds storage proteins have been identified and characterized as allergens such as (1) Cor a 1.04, major
allergen in the Northern Europe related to 65 patients sensitized to birch (Bet v 1, Betula verrucosa) (Lüttkopf et
al., 2002); (2) 11S globulin (Cor a 9, with 30–40 kDa acidic and 20–25 kDa basic chain bounds together via
disulfide bridge), described by Beyer et al. (2002) as the major non-pollen related allergen in United States; (3) 48
kDa-glycoprotein (Cor a 11) (Lauer et al., 2004); (4) ns-LTP (Cor a 8), supposed to be the major allergen in
Southern Europe (Schocker et al., 2004), and (5) 2S albumin (Cor a 14) (Garino et al., 2010). These proteins share
high homology degree with allergens from other nuts and peanut. The complexity of the hazelnut allergen pattern
challenges a clear definition of both the allergens and the allergenic determinants (epitopes). The identification of
the major hazelnut allergens, upon characterization of the IgE reactivity patterns with sera from a large number of
patients, may allow to design innovative and more accurate diagnostic and therapeutic approaches.
The aim of our investigation is the identification of the allergenic determinants in paediatric subjects from
Campania region (Italy) diagnosed with hazelnut allergy.
2.1 Materials
Three hazelnut Campania autochthonous cultivar (Mortarella, San Giovanni, Tonda), and one hazelnut cultivar
from Oregon were utilized in this study. Sera of hazelnut allergic children (n = 4, 50% male; mean age 39 months)
from Campania region (Italy) have been provided by the Department of Pediatrics, University of Naples “Federico
II”.
2.2 Preparation of protein extract
Shelled raw hazelnut were ground using an electric coffee grinder and defatted by stirring in five volumes (w/v) of
- 115 -
diethyl ether. After centrifugation at 4000g, the powder was overnight lyophilized. Proteins were extracted in PBS
0.1M, pH 7.5 (1/10, w/v) containing protease inhibitor (PMSF 1 mM) by agitating overnight at 4 C. After
centrifugation (30 min, 10 000g, 4 C) the supernatant was collected and filtered through 0.2 mm cellulose acetate
filter (Millipore). The protein concentration was determined by the Bradford assay.
2.3 Mass spectrometry for proteomics analysis
2.3.1 MALDI-TOF MS
Spectra were acquired by a Voyager STR-DE Pro mass spectrometer (PerSeptive BioSystems, Framingham, MA,
USA) equipped with a N2 laser (λ= 337 nm). The instrument operated at an accelerating voltage of 20 kV. Mass
spectra were acquired both in positive linear or reflector mode and 10 mg/mL sinapinic acid or α-cyano-4hydroxycinnamic acid (CHCA) dissolved in 50% acetonitrile (ACN)/ 0.1% trifluoroacetic acid (TFA) were used as
matrices for the analysis of proteins and peptides, respectively. Typically, 250 laser shots were accumulated for
each spectrum. External mass calibration was performed with a commercial low mass standard peptide mixture
(Sigma).
2.3.2 µHPLC-ESI-Q-TOF MS/MS
Microflow (µ) HPLC-Electrospray (ESI)-Q-TOF MS/MS analysis was carried out using an Integral modular HPLC
(Applied BioSystems) coupled to a Q-TOF mass spectrometer (Q-Star pulsar, Applied BioSystems) equipped with
an ESI source. For LC separation flow rate was split from 200 µl/min to 5 µl/min using a flow splitter. Eluents were
(A) 5% ACN in 0.08% FA and 0.01% TFA and (B) 95% ACN in 0.08% FA and 0.01% TFA. Peptides were
separated on a capillary column, C18 PepMap, 15 cm length, 300 mm ID, 300 Å (LC Packings), using the linear
gradient 5-40% B over 60 min. LC-MS/MS raw spectra files were used to generate text files in mascot generic file
format (.mgf) which were submitted to the Mascot ver. 2.3 (http://www.matrixscience.com) and Batch tag (Protein
Prospector) search engines.
2.4 2D IEF/SDS-PAGE
Crude hazelnut protein extracts were suspended in IPG strip Rehydration Buffer and applied to 7 cm immobilized
pH 3-11 NL gradient strips (Biorad). The second dimension was run on NuPAGE 4%-12% Bis-Tris ZOOM Gels
(Invitrogen, Carlsbad, Calif). The resolved proteins were detected with Coomassie Blue staining.
2.5 SDS/PAGE and detection of allergens by Western blotting
The hazelnut extract and the markers were separated in a discontinuous buffer system in SDS-12% polyacrylamide
gel. Proteins (12.5 μg of proteins), after precipitation with 20% trichloroacetic acid (TCA) (w/v) and washing with
acetone (-20 C), were resuspended in the sample buffer. After separation, one line of the gel was stained with
Coomassie Brilliant Blue R-250 for the image analysis. The remaining lines were electroblotted onto nitrocellulose
paper using a Trans-Blot Cell from BIO-RAD (Richmond, Calif), by dipping in the transfer buffer (Glycine 39
mM, TRIS base 48 mM, SDS 0.0375%, Methanol 20%, Water 80%) at 4 C at 120 Volt for 2 hours. The
nitrocellulose blot was blocked for 1h at room temperature with bovine serum albumin (BSA) dissolved in TBST
(5% w/v), and incubated overnight at 4 C, after three washing steps, with 75 μL of sera diluted in TBST (1:200).
IgE binding was detected by incubation with HRP conjugate mouse anti-human IgE diluted 1:10000 for 1h at room
temperature. Immunoreactive bands were detected by enhanced chemiluminescence (ECL plus, Amersham)
exposure of Kodak ML film. Optimal exposure times were around 10 minutes.
2.6 Purification of the targ et allergen by means of HPLC
Purification was achieved by using a 2-step procedure. The first step was carried out using an HP 1100 Agilent
Technology modular system (Palo Alto, CA, USA) equipped with a Superdex 75 column, previously calibrated
with proteins with known MW, equilibrated and eluted with a 50 mmol/L sodium phosphate buffer (pH 7.5) and
150 mmol/L NaCl. The allergen purification was followed by immunoblotting with allergic subject’s sera.
Immunoreactive fractions were pooled and concentrated. The second step of purification was a Reverse Phase (RP)
– HPLC using a Vydac (Hesperia, CA, USA) C8, 2.1 mm i.d., column. After 10 min of isocratic elution at 25%
solvent B (0.1% TFA in ACN, v/v) a fractionated step was applied: 25- 30% B in 5 min; 30-35 % B in 30 min; 3550% B in 60 min 50-55% B in 15 min at a flow rate of 0.200 mL/min. Solvent A was 0.1% TFA in water (v/v).
Column effluents were monitored by UV detection at 220 and 280 nm.
2.7 Gastric-pancreatic digestion
Proteins were dissolved in 5% formic acid and incubated at 37 C with pepsin (1:100 enzyme/protein ratio, w/w) for
120 min. Before pancreatic digestion, samples were evaporated and washed twice with deionised water. Trypsin
(1:100, w/w), chymotrypsin (1:100, w/w), elastase (1:500, w/w) and carboxypeptidase (1:100, w/w) were added in
0.1M sodium phosphate buffer (pH 7.0) and the mixtures incubated 1 h at 37 C.
3. Results
3.1 2D-PAGE and Peptide Mass Fingerprinting
A preliminary study aimed to the characterization of total hazelnut proteins was carried out combining the 2D
electrophoresis separation with the MS analysis of selected trypsin-digested protein spots (Figure 1).
- 116 -
Figure 1 2D IEF/SDS-PAGE analysis of the total hazelnut protein extracted
from Mortarella Cv. (Comassie stained). Spots identification, related to the
major hazelnut allergens, are marked by arrow.
The extremely high similarity among the 2D map of the hazelnut varieties analyzed suggests that there is no
cultivar-dependent proteins expression. The map shows the intrinsically high complexity of the pattern of hazelnut
storage proteins, also exhibiting several spots with very close molecular weight and pIs, which are most likely due
to related gene products of several protein isoforms. The occurrence of seed storage proteins as multi- isoforms
families is very frequent because of their exclusive function to provide nitrogen during seed germination.
This approach allowed to individuate the major hazelnut allergens on the 2D map, as for instance the 11S acid and
basic chains (Cor a 9; UNIPROT entry: Q8W1C2); the 7S glycoprotein (Cor a 11; UNIPROT entry: Q8S4P9) with
the typical glycoprotein pattern; the Cor a 1.0402 variant, homologues to Bet v 1, the major white birch pollen
antigen (UNIPROT entry: Q9FPK4); the ns-Lipid Transfer Protein (ns-LTP) (Cor a 8; UNIPROT entry: Q9ATH2);
the 2S albumin (Cor a 14; UNIPROT entry: D0PWG2). Due to its intrinsic pitfalls, the 2D-based proteomic
approach was unsuccessful to identify many of the minor spots and other protein components that probably have
not been annotated in genomic and protein databases so far.
Differently, the gel free shotgun proteomic approach allowed the identification of not yet described hazelnut
proteins by homology with gene products arising from other seeds, though with a relatively low sequence coverage.
In Table 1 the unexpected gene products identified in hazelnut by homology are listed.
Table 1 Summary of Mascot Search results related to the shotgun of total hazelnut extracted proteins. In the table are reported
all the proteins identified by homology. Major storage proteins already identified by the 2D-MS approach were omitted.
DB
NCBInr
NCBInr
SwissProt
NCBInr
NCBInr
NCBInr
NCBInr
SwissProt
accession
gi|22135427
gi|118340979
HSP7B_ARATH
gi|388514675
gi|7484767
gi|1181673
gi|224126933
11S2_SESIN
score
158
70
48
44
44
43
27
27
mass
62814
56865
71741
36480
57185
22537
52898
52083
Matches (unique)
3(3)
3 (3)
1(1)
3(2)
2(2)
1(1)
1(1)
4(2)
description
castanin Castanea crenata
7S globulin Ficus pumila
heat shock 70 kDa Arabidopsis thaliana
unknown Lotus japonicus
protein body membrane MP27 cucurbit
heat shock 70 kDa Sorgum bicolor
predicted protein Populus trichocarpa
11S globulin 2OS= Sesamum indicum
3.2 Immunochemical assays
Total protein extracts, separated by SDS-PAGE under reducing condition, were tested for the IgE binding capacity
by Western-blot immunostaining using sera of four hazelnut allergic children (Fig. 2a).
a
b
Figure 2 Panel a) IgE Western blot of hazelnut proteins with 4 allergic children’s sera. Proteins were extracted from three
hazelnut autochthonous cultivars from Campania region (A. Tonda, B. San Giovanni, C. Mortarella) and one from Oregon (D).
Panel b) Western blot of hazelnut proteins separated without (-BME) and with β-mercaptoethanol (+BME).
- 117 -
Four out four sera were IgE reactive to a band of about 21 kDa. In a single case it was detected an additional faint
IgE reactivity to the ~48 kDa band that was identified by peptide mass fingerprinting as the 7S glycoprotein (Cor a
9). The identification of the most IgE-affine 21 kDa band was unsuccessful as it is missing in the genomic and
proteomic data bank.
The Western blotting of total extracted proteins, separated under non reducing condition (Fig. 2b), showed the
presence of three IgE immunoreactive bands of about 60, 40 and 35 kDa, indicating that the target protein of 21
kDa is actually a polypeptide linked by disulfide bridges to one or more other chains, constituting an higher
molecular weight protein. This can be explained by a post-translation proteolytic event, frequent in seeds storage
proteins such as in 11S globulin and 2S albumin, that splits the protein into two or more chains that remain
disulfide linked.
3.3 Purification and partial amino acid sequence analysis
Two sequential chromatographic steps were applied to purify the protein allergen in order to perform “de novo”
peptide sequencing. The first step was a size exclusion chromatography on a Superdex S75 column. Fractions
containing the allergen were identified by SDS-PAGE and immunostaining and pooled together. According to
calibration the target protein have an apparent MW of ~55 kDa.
The subsequent RP-HPLC (Fig. 3a) fractionation further separated the targ et allergen from the 11S albumin and
the 7S glycoprotein that are the most abundant high MW hazelnut proteins. The MALDI-TOF MS spectrum of the
intact IgE-binding chain (Fig. 3b), after cystein reduction and carbamidomethylation, shows a cluster of signals of
about 20.7 kDa.
a
b
Figure 3 Panel a) C8/RP-HPLC chromatogram of the SEC high MW fraction of hazelnut proteins. All the labeled collected
peaks were analyzed by immunostaining. Corresponding SDS-PAGE was Coomassie Brilliant Blue R-250 stained. Panel b)
MALDI-TOF spectrum of the 21 kDa intact protein and of its in gel tryptic digests.
The 21 kDa protein was isolated also after reduction/alkylation of the high MW precursor. The Mascot search using
the HPLC MS/MS data from the analysis of the tryptic digests did not retrieve any hazelnut protein with high
confidence. However, the manual inspection of the spectra allowed the “de novo” sequencing of several peptides
(Table 2). The data bank interrogation identified by homology the 11S globulin isoforms expressed in other seed
(11S globulin isoform 1B Ficus pumila (Uniprot entry A1E0V5), v 2.0101 allergen 11S globulin precursor Pistacia
vera (Uniprot entry: B7P073), 11S globulin isoform 4 Sesamum indicum (Uniprot entry Q2XSW6), predicted
protein Cupin superfamily Populus trichocarpa (NCBInr entry: gi|224126783). The post-translational cleavage of
the asparaginyl site that split the 11S globulin proteins into the acidic and basic subunits was also confirmed,
through the identification of the N-terminal domain of the basic chain. The sequences of these isoforms exhibit a
high homology degree among each other but a low sequence similarity with the canonical Cor a 9.
Table 2 “De novo” tryptic peptide sequencing of the purified 21 kDa allergen.
Mr (expect)
1210.6
1386.7
1389.2
1400.6
1452.8
2187.1
Mr (calc)
1211.5
1386.6
1389.8
1400.2
1452.8
2187.2
sequence
GVEETFCTLR
TNDNAQISQLAGR
ALPDVLLNSYR
HDGQNLFDWLR
LTTVNSLNLPILR
GLLLPAYSNAPKLVYVEQGR
- 118 -
Simulation of the gastrointestinal digestion has been carried out on the purified targ et allergen and digests were
tested by dot blot with allergic children’s sera. The actual IgE immunoreactivity of the digests suggests the presence
in the protein of linear epitope. Further investigations are required to confirm this assumption and will allow the
precise characterization of the IgE-binding epitopes.
The present results show that sera of 4/4 hazelnut allergic children from Campania region were immunoreactive to
an allergen expressed in all the cultivars investigated, which has not been annotated in database so far. The SDSPAGE under reducing and non reducing condition demonstrates that the targ et allergen shares structural traits with
the hazelnut 11S globulin-like proteins (Cor a 9) (Beyer et al., 2002), being composed by two or more subunits
linked via a disulfide bond. Only the subunit of about 21 kDa exhibited antigenic properties. The mass
spectrometry-based characterization, also including the de novo sequencing of tryptic peptides, provided evidence
of the high homology degree between the unknown IgE-binding polypeptide with 11S globulin-like isoforms that
are expressed in several other seeds. The allergen has been isolated and immunochemical and clinical tests are in
progress to validate the allergenic potential of the 21 kDa protein.
5. References
Beyer K, Grishina G, Bardina L, Grishin A, Sampson HA (2002) Identification of an 11S globulin as a major hazelnut food
allergen in hazelnut-induced systemic reactions. J Allergy Clin Immunol 110: 517-523
Garino C, Zuidmeer L, Marsh J, Lovegrove A, Morati M, Versteeg S, Schilte P, Shewry P, Arlorio M, van Ree R (2010)
Isolation, cloning, and characterization of the 2S albumin: a new allergen from hazelnut. Mol Nutr Food Res 54: 12571265.
Lauer I, Foetisch K, Kolarich D, Ballmer-Weber BK, Conti A, Altmann F, Vieths S, Scheurer S (2004) Hazelnut (Corylus
avellana) vicilin Cor a 11: molecular characterization of a glycoprotein and its allergenic activity. Biochem J 383: 327334, Oct, 15.
Lüttkopf D, Müller U, Skov PS, Ballmer-Weber BK, Wüthrich B, Skamstrup Hansen K, Poulsen LK, Kästner M, Haustein D,
Vieths S (2002) Comparison of four variants of a major allergen in hazelnut (Corylus avellana) Cor a 1.04 with the major
hazel pollen allergen Cor a 1.01. Mol Immunol 38: 515-525.
Schocker F, Lüttkopf D, Scheurer S, Petersen A, Cisteró-Bahima A, Enrique E, San Miguel-Moncín M, Akkerdaas J, van Ree R,
Vieths S, Becker WM (2004) Recombinant lipid transfer protein Cor a 8 from hazelnut: a new tool for in vitro diagnosis of
potentially severe hazelnut allergy. J Allergy Clin Immunol 113: 141-147.
- 119 -
Study of Traditional and Innovative Technologies
for Minimally Processed Fruit and Vegetables Products
Valentina Panarese (valentina.panarese2@unibo.it)
Dept. of Food Science, Alma Mater Studiorum - University of Bologna, Cesena, Italy
Tutor: Dr. Pietro Rocculi
The first aim of this PhD project was to evaluate the response of different fruit and vegetable products to different
mild technologies, such as osmotic dehydration and vacuum impregnation. The second project objective was to
shift the technologies on a pilot scale, obtaining performance standardization by the process automation. Evaluation
of treatment efficiency and impact on final product was performed through a multi-analytical approach, which
enabled to describe structural, chemical-physical and metabolic modifications occurred on the product.
Studio di processi di trasformazione tradizionali ed innovativi
per la realizzazione di prodotti vegetali lavorati al minimo
Il presente progetto di ricerca si è proposto innanzitutto di valutare differenti tecnologie mild, quali disidratazione
osmotica ed impregnazione sottovuoto, applicabili a prodotti vegetali minimamente processati. Il secondo obiettivo
del progetto ha riguardato il trasferimento di tali processi su scala pilota, integrandovi sistemi di supervisione e
automazione per la standardizzazione delle performance. La valutazione dell’efficacia del trattamento e
dell’impatto avuto sul prodotto vegetale ha previsto l’utilizzo combinato di tecniche analitiche, che hanno permesso
di indagare modificazioni strutturali e chimico-fisiche verificatesi sul prodotto.
Key words: Osmotic dehydration, vacuum impregnation, fresh-cut products, multi-analytical approach.
1. Introduction
In accordance with the PhD thesis project previously described (Panarese, 2010 and 2011), this oral communication
reports the main results concerning the study of vegetable products changes promoted by mild processing.
First macro, micro and ultrastructural measurements were performed to evaluate the cellular compartment
modifications of the kiwifruit outer pericarp tissue during osmotic dehydration treatment (OD).
Secondly Vacuum Impregnation (VI) process has been investigated. On tissues with different porosities (e.g. apple and
spinach), the values of the pressure acting on the liquid leading to (i) the expansion of the gas occluded in the pores
during vacuum formation and (ii) the impregnation of the pores during atmospheric pressure restoration have been
evaluated.
Osmotic dehydration (OD) was carried out on Actinidia deliciosa var. Hayward kiwifruit. The fruits were bought on
the local market and stored at 4 ± 1°C until processing. OD was applied on fruit hand peeled and cut into 10-mm thick
slices. The fruit had homogeneous size and refractometric index of 12.0 ± 0.4 °Brix. DSC analysis was carried out on a
Pyris 6 DSC (Perkin-Elmer Corporation, Wellesley, USA) enabling the evaluation of the kiwifruit thermo-physical
properties (Tylewicz et al., 2011) and pectic composition of the cell wall. Six cylinders were sampled using a core
borer from the outer pericarp tissue of each kiwifruit slice and placed in sealed 20 ml glass ampoule. Four replicates
for each treatment condition were performed. The rate of heat production was continuously measured in a TAM air
isothermal calorimeter (Thermometric AB, Järfälla, Sweden), with a sensitivity (precision) of ±10 μW (Wadsö &
Gόmez Galindo, 2009). LR-NMR analysis was performed by using a Bruker Minispec PC/20 spectrometer operating
at 20 MHz allowing the determination of water distribution and self-diffusion coefficient in three different cell
compartments (Tylewicz et al., 2011). Ultra-thin sections of raw and treated kiwifruit pericarp tissue were double
stained with uranyl acetate and lead citrate and examined under a Philips CM10 TEM, at an accelerating voltage of 60
kV (Panarese et al., 2012). Texture analysis was performed on the kiwifruit slices external pericarp by means of
Texture Analyzer TA.HDi500 (Stable Micro System, Surrey, U.K.) by using 6 mm diameter stainless steal probe.
Vacuum impregnation was carried out on Spinacia oleracea baby leaves and on Malus domestica cv. Granny Smith
samples. The treatment chamber was composed by a plastic block (40x40x7 mm) wherein a main opening has been
created. The sample and 4 ml of isotonic sucrose solution were placed inside the main opening. The plastic block was
sealed tighten between two glasses (40x40x3 mm) with o-rings and screws. A plastic fastener was held between the
glass and the frame adherent to the sample, and fastened the sample to the bottom glass.
VI treatments were performed by means of Automatic Vacuum Controller System (AVCS, S.I.A., Bologna, Italy), a
programmable device constructed to control the pressure acting on the impregnating solution along the treatment. VI
treatment with final reduced pressure of 150 mbar was tested on apple and spinach samples. The treatment implied 20
- 120 -
succeeding steps and each step was distinguished by two parameters: duration (s) and absolute pressure value (mbar).
The treatment chamber containing both the sample and the solution was placed on the specimen stage of the
microscope. The specimen held in the treatment chamber was observed during the process using an upright
microscope (Nikon Eclipse Ti Inverted Microscope, Melville, U.S.A.). The microscope is coupled to a computer and a
camera (Nikon DS Qi1Mc, Melville, U.S.A.). The microscope software (Nikon NIS-Elements Advanced Research,
Ver. 3.00) controls both the microscope and the camera enabling to capture images of the specimen placed in the
treatment chamber along the VI. Each 0.1 s-1 PLC records pressure value in the treatment chamber. 0.1 s-1 was also
chosen as images capturing frequency. Synchronization between image capturing with the microscope and pressure
data recording by AVCS was operated manually. The synchronization enabled the correspondence between pressure
values recorded and captured images. A series of pictures and the corresponding pressure values were recorded for
each VI treatment performed. VI treatment was replicated at least six times for both spinach and apple samples. As the
tissue was immersed in a solution, the air outflow during vacuum formation and the liquid impregnation during
atmospheric pressure restoration were detected respectively through bubbles formation and tissue translucency change.
Pictures processing by means of ImageJ software (Image processing and analysis in Java, Ver. 1.45r, National
Institutes of Health, Bethesda, MD, USA) allowed defining pressure threshold values provoking gas outflow and tissue
impregnation.
3.1 Osmosis and changes on thermo-physical properties
DSC and texture measurements resulted complementary to better understand structural changes of the tissues caused
by osmotic treatment. DSC measurements showed decrease of peak temperature and entalphy value related to cell wall
pectin decomposition by increasing OD time.
Heat production measured by isothermal calorimetry (Figure 1) decreased with the increase of the OD time. A
reduction of viable cells in OD-treated kiwifruit tissue and its lower metabolic activity showed a progressive damaging
of the tissue due to the osmotic stress.
Figure 1 Specific thermal power profiles of pericarp
tissue cylinders of raw, cooked and selected osmodehydrated kiwifruits during 24 h of analysis at 20 °C.
(Panarese et al., 2012).
3.2 Osmosis and reorder of cell compartments
Low-Resolution Nuclear Magnetic Resonance (LR-NMR) measurements on kiwifruit tissue during the OD (Figure 2)
have been associated and validated by both light (LM) and electron scanning microscopy (TEM) micrographs. The
results obtained showed irreversible changes on cellular compartmentation and cell wall structure (Figure 2).
Moreover the OD enabled tissue textural properties modification, as revealed by the changes in the consistency and
adhesiveness parameters detected by Texture Analyzer measurements.
As far as cell wall changes promoted by OD are concerned, these findings are in agreement with previous studies
regarding the modifications promoted by fruit ripening. These involve cell wall swelling, dissolution of the middle
lamella and reduction of overall staining, as shown for apple and pear, avocado, tomato, nectarine and kiwifruit
(Hallett et al., 1992). The correspondence of fruit ripening and modifications promoted by OD was confirmed also by
the retention of intense staining in the plasmodemata of the treated fruits and by cell wall loss of staining intensity,
reflecting a change in its structure and composition (Figure 3).
- 121 -
Figure 2 Example of T2 spectrum obtained on kiwifruit treated 30 min
at 25°C.
Figure 3 Transmission electron micrographs of cell wall, plasmodesmata
intercellular spaces of outer pericarp cells of raw and treated fruits. Bar = 1 μm
(a) Section of the raw fruit tissue. The cells are well attached along the con
areas showing a well-preserved structure.
(b). Detail of cell wall from treated fruit. Wall swollen and lack of staining
apparent. Electron- dense deposits accumulated in intercellular space region
wall margins.
(c). Detail of cell wall from raw fruit. Wall shows intense staining of ma
longitudinal fibers. No swelling detected.
(d). Detail of cell wall from treated fruit. Wall is swollen, failed to show
significant staining and little details are visible within the wall.
(e). Plasmodesmata in cell wall from treated fruit. Plasmodesmata appear
distinct constriction of the wall, staining is restricted to this area and there
sharp difference between the lightly stained cell wall and the plasmodesmatal s
(f). Detail of plasmodesmata in cell wall from raw fruit. Wall shows a constric
in the plasmodesmata region. Staining density is similar in wall
plasmodesmatal regions.
3.3 Pressure thresholds leading to the outflow of the gas occluded in the pores during vacuum formation:
spinach vs apple
As the sample was immersed in a solution, the expansion of the gas occluded in the pores leaded to outflow of bubbles
from the tissue. For each apple sample tested, bubbles were already detectable from the second picture of the series, as
shown in Fig. 4b, correspondent to pressure values of 860 ± 15 mbar. Thus, as the first picture of each series was
always captured at atmospheric pressure (Fig. 4a), gas outflow from apple tissue appeared concurrently with the
vacuum application and the range 860 ± 15 mbar can be considered for apple as the pressure threshold leading gas
outflow during vacuum formation.
Figure 4 Examples of pictures captured on apple (a, b) and spinach (c,
d) samples during vacuum formation. (a) and (c) were captured at
atmospheric pressure; (b) and (d) were captured respectively at pressure
values of 870 mbar and 270 mbar.
Contrary to apple, gas outflow from spinach tissue did not occur concurrently with vacuum application. Thus image
analysis was needed to detect gas outflow from the tissue. In spinach samples a gradual increase of values of gas
bubble area occurred during vacuum formation, as shown in Figure 5 where area values are plotted vs recorded
pressure values. Gas bubble formation could be detected as the external pressure value lowered the range 571 ± 51
mbar, which can thus be considered as the pressure threshold leading to outflow of the gas occluded in spinach pores
- 122 -
during vacuum formation.
Figure 5 Area values of gas bubble from spinach tissues
during vacuum formation. Area was evaluated by means of
image analysis. Results of three replicates out of six are
reported.
3.4 Pressure thresholds leading to pores impregnation during atmospheric pressure restoration: spinach vs
apple
Figure 6 displays selected pictures of apple and spinach tissues recorded during the vacuum releasing phase of VI
treatment. Both in apple and spinach bright regions in the sample are appearing with the increase of the external
pressure.
Figure 6 Examples of pictures captured on apple (a, b) and spinach
(c, d) samples during atmospheric pressure restoration. (a) and (c)
were captured at the final reduced pressure (150 mbar); (b) and (d)
were captured respectively at pressure values of 330 mbar and 450
mbar.
Image analysis revealed gradual impregnation of both apple and spinach tissues during atmospheric pressure
restoration, as shown in the example reported in Figure 7. Grey colour kept almost a constant value after the air inlet
valve opening. The pressure range at which the grey colour value resulted higher than 3 was defined as the
translucency change pressure threshold. Image analysis showed pressure thresholds in range of 220 ± 27 and 173 ± 2
respectively for spinach and apple samples.
Figure 7 Pixel grey colour mean
values of images of apple (z) and
spinach ({) samples captured during
atmospheric pressure restoration.
Example of gas bubble area changes
during vacuum formation in spinach
sample. The bubble area was evaluated
by means of image analysis.
Osmotic Dehydration promoted critical changes in the kiwifruit, as pointed out with good agreement by both texture
profiles and thermal degradation thermograms. DSC revealed hemicellulose degradation and pectin network rupture of
kiwifruit cell wall. Isothermal calorimetry confirmed its high potentiality for calorespirometric measurement on fresh
vegetable tissues. Metabolic heat production of kiwifruit samples showed a linear decrease with the proceeding of OD,
confirming the damage progression on tissue induced by osmotic stress, accompanied by the reduction of the number
of viable cells. LF-NMR observations revealed that OD promoted a redistribution of water among the cell
- 123 -
compartments, followed by substantial shrinkage. TEM analysis showed that OD treatment induced intracellular space
formations; this observation was confirmed by means of LF-NMR. Cell wall changes promoted by OD, i.e. wall
swelling, dissolution of the middle lamella and reduction of overall staining, were similar to those promoted by fruit
ripening.
Vacuum Impregnation treatments have been performed through a programmable device constructed to control the
pressure acting on the impregnating solution along the treatment. The synchronization between microscopic
observation of the tissue and pressure values recording during VI suggested the gas expansion and the flow of the
impregnated liquid are strongly affected by the topology and geometry of the network formed by the highly
interconnected intercellular air spaces. The method here studied enables to evaluate the pressure thresholds leading to
gas expansion and pores impregnation, which resulted characteristic for the raw material. Pressure thresholds are
fundamental parameters for the optimization of VI at industrial scale.
The multi-analytical approach purposed in this research study can lead to a better understanding of the structural and
physiological features of fruit and vegetables, promoted by minimal processing. These are fundamental aspects to
consider for processing modulation/optimization as strictly connected with the overall quality and stability of the final
product.
5. References
Hallett I, Macrae E, Wegrzyn TF (1992) Changes in kiwi fruit cell wall ultrastructure and cell packing during postharvest ripening.
Int J Plant Sci 153: 49-60.
Panarese V (2010) Study of traditional and innovative technologies for minimally processed fruit and vegetables products. In Proc.s
of the 15th Workshop on the Developments in the Italian PhD Research on Food Science and Technology, Napoli (Italy), 1517 September, 2010.
Panarese V (2011) Study of traditional and innovative technologies for minimally processed fruit and vegetables products. In Proc.s
of the 16th Workshop on th.e Developments in the Italian PhD Research on Food Science and Technology, Lodi (Italy), 21-23
September, 2011.
Panarese V, Laghi L, Pisi A, Tylewicz U, Dalla Rosa M, Rocculi P (2012) Effect of osmotic dehydration on Actinidia deliciosa
kiwifruit: a combined NMR and ultrastructural study. Food Chem 132: 1706-1712.
Panarese V., Tylewicz U., Santagapita P., Rocculi P., Dalla Rosa M. (2012) Isothermal and differential scanning calorimetries to
evaluate structural and metabolic alterations of osmo-dehydrated kiwifruit as a function of ripening stage. Inn Food Sci Emer
Techn 15: 66-71.
Tylewicz U, Panarese V, Laghi L, Rocculi P, Nowacka M, Placucci G, Dalla Rosa M (2011) NMR and DSC water study during
osmotic dehydration of Actinidia deliciosa and Actinidia chinensis. Food Bioph 6: 327-333.
Wadsö, L., Gόmez Galindo, F. (2009). Isothermal calorimetry for biological application in food science and technology. Food
Control 20: 956-961.
- 124 -
Interactions between Lactobacillus plantarum and Listeria innocua
Gianfranco Pannella (gianfranco.pannella@unimol.it)
Dip. di Agricoltura, Ambiente e Alimenti, University of Molise, Campobasso, Italy
Tutor: Prof. Elena Sorrentino
The study was aimed to individuate Lactobacillus plantarum strains able to inhibit many undesirable food-related
microorganisms. The antimicrobial effect of Lb. plantarum against Listeria innocua was investigated. The stress
response of L. innocua ATCC33090 to Lb. plantarum RTB was studied using a proteomic and bioinformatic
approaches. Both cell and cell free supernatant of Lb. plantarum represent a stress factor for L. innocua. The
inhibition was not attributable to organic acids, since in the presence of only lactic acid were detected new proteins
able to survive at acidity conditions. Lb. plantarum also influenced the activity and expression of other proteins.
Interazioni tra Lactobacillus plantarum e Listeria innocua
Il presente studio, rientrante nel progetto volto a individuare ceppi di Lb. plantarum ad attività antagonistica verso
microrganismi indesiderati di interesse alimentare, ha inteso descrivere, attraverso un approccio proteomico e
bioinformatico, la risposta di L. innocua ATCC33090 al ceppo Lb. plantarum RTB. Quest’ultimo, sia come cellule
sia come surnatante, ha rappresentato una condizione di stress per L. innocua. Inibizione che non può essere
attribuita alla mera presenza di acido lattico. Infatti, il ceppo indicatore reagiva efficacemente alla condizione acida
con l’espressione di proteine stress regolatrici. Al contrario, Lb. plantarum influendo l’espressione di altre proteine
pregiudicava la vitalità del ceppo indicatore.
Key words: Lb. plantarum, L. innocua, stress response, proteomic, bioinformatic.
1. Introduction
Lb. plantarum is characterized by a high metabolic plasticity and by a large set of genes involved in sugar uptake
and utilization. These findings agree with the observation that Lb. plantarum is a versatile bacterium that can
sustain its growth in a variety of environmental niches. It is widespread found in different environments ranging
from fermented vegetable, dairy and meat products, to the human gastrointestinal tract. Some strains of Lb.
plantarum are known for their ability to produce several substances with antimicrobial effects against foodborne
pathogenic bacteria (Diep et al., 2009, Diaz-Ruiz et al., 2012). In the last years, great attention was focused on the
inhibitory action against Listeria monocytogenes exerted by Lb. plantarum strains (Salvucci et al., 2012; Sip et al.,
2012). The interest towards this topic is due to diseases caused by Listeria monocytogenes and which are known as
“listeriosis” (causative agent of abortions, gastrointestinal diseases or septicaemia, and often leads to the death of
infected individuals). This pathogen bacterium, growing at low pH, at refrigeration temperature, and at very high
salt concentrations, is isolable from several food products, albeit in low numbers. Several studies reported the
characterization of antimicrobial substances produced by certain Lb. plantarum strains (Svetoslav et al., 2011; Reis
et al., 2012). However it is well known that the knowledge of the undesirable strains response to these antimicrobial
substances (stress conditions) represents a crucial step for the definition of an effective bio-control tool. Some
Authors reported that several mechanisms, can be developed by Listeria spp. in order to resist the injury processes
caused by stress conditions such as temperature, acidity and NaCl (Bergholz et al., 2012; Bowen et al., 2012;
Milillo et al., 2012). In detail, the stress seems to induce variations in the synthesis of certain cell components,
especially proteins. Nevertheless the literature is very pour in studies focusing on the mechanisms of response, in
terms of susceptibility or resistance, expressed by L. monocytogenes against antimicrobial substances produced by
Lb. plantarum. Therefore, part of the present PhD activity focused the attention on the stress response of Listeria to
the presence of Lb. plantarum. In detail, a commercial L. innocua strain was used as a pathogen surrogate
throughout this study, since L. innocua has been deemed a suitable biological indicator for L. monocytogenes
(Kamat and Nair, 1996) and it revealed a similar sensitivity to different bacteriocins as eight L. monocytogenes
strains tested.
2.1 Strains used and antimicrobial activity detection
Sixty-one Lb. plantarum strains, isolated from foods and identified by PCR-DGGE, were tested for antimicrobial
activity against 31 undesirable food-related bacteria (Table 1). Spot-on-the-lawn test was carried out to evaluate the
antimicrobial activity (Moraes et al., 2010). Thirty-four Lb. plantarum strains with antimicrobial activity were
successively assayed by the agar well diffusion test to detect the presence of acids or proteins with inhibitory effects
(Rojo-Bezares et al., 2007). Statistical analyses were performed by Statistica version 8 (Statsoft®).
- 125 -
Table 1 Bacteria used as indicators
2.2 Quantification of inhibition against L. innocua
Lb. plantarum RTB and L. innocua ATCC 33090 were used as producer and indicator strains respectively. In
details, four batches of MRS (450 mL) were inoculated with L. innocua ATCC at concentration of 107 CFU/ml and
then added respectively with 50 mL of MRS (as Control) and with 50 mL of MRS containing the three stresses as
show below:
i) stressRTB: culture of Lb. plantarum RTB (108 CFU/ml);
ii) stressCFSRTB: cell free supernatant of culture containing Lb. plantarum RTB at 108 CFU/ml;
iii) stressLA: MRS acidified with lactic acid up to pH 4.0 (the same of stress RTB and stress CFSRTB pH);
Batches were incubated for 96h at 28°C and a vital count of L. innocua was performed in ALOA (Biolife) in three
different times (time 0 and after 24 e 96 hour of incubation).The antimicrobial activity of different stress conditions
against L. innocua was calculated according to Charernjiratragul et al. (2010):
(1)
where: “CFU/ml control” is L. innocua concentration at 24 and 96h in MRS broth, “CFU/ml in stress condition” is
L. innocua concentration at 24 and 96h of incubation in stress conditions
2.3 SDS-PAGE and 2D-PAGE analyses of L. innocua ATCC 33090 proteome
2.3.1 Total protein extraction
Cells of L. innocua, grown in MRS, MRS+stressCFSRTB and MRS+stressLA until the second half of the
exponential phase, were harvest by centrifugation and washed three times with Tris-HCl 50 mM pH 7.5. Pellets
were resuspended in a lysis buffer (Tris-HCl 100 mM, pH 9.5; SDS 1% p/v) and sonicated (LABSONIC M) for 12
minutes with the following settings: 100% Amplitude, 0.8 Cycle, pulse 5 s. The suspensions were centrifugated for
15 minutes at 13200 rpm and the supernatants containing protein extract were recovered.
2.3.2 SDS-PAGE
About 40 µg of proteins in a Laemmli buffer were charged in poliacrilammide gel, 1.5 mm thickness and 4% T,
2.6% C (stacking gel) and separated in a gradient gel 8-18% T, 2.6% C (running gel). Two wells per gel were
charged with molecular standards (Prestained SDS-PAGE Standards, Bio-Rad). Electrophoresis was performed for
180 min at 220V in a Hoefer SE600 apparatus (Amersham, Bio-sciences). Proteins were stained with Coomassie
blue G-250 and the images were acquired by Densitometer Calibrate GS – 800 (Bio-Rad) at 42 microns resolution.
Background subtraction, lines and bands number were carried out by Quantity – One software (Bio-Rad).
2.3.3 2D-PAGE
Proteins were collected by lysis buffer through Metanol/Chloroform protocol (Wessel and Fugge, 1984). About 200
µg of protein were suspended into 250 µL of rehydration buffer (Urea 8M, CHAPS 2%, DTT 50 mM, Anfoline
3/10 2%, blu di bromofenolo 0.002%) and Immobiline DryStrip pH 4-7 (GE Healthcare) of 13 cm were rehydrated
for 15h. Isoelectrofocusing (IEF) was performed at 33,500Vh with Ettan IPGphor Amersham apparatus (GE
Healthcare Bio). Strips were equilibrated and then 2D-PAGE was performed on a gradient gel 1.5 mm thickness (818% T, 2.6% C) at 220V for 180 min in a Hoefer SE600 (Amersham, Bio-sciences) apparatus. Proteins were
stained with Coomassie blue G-250 and the images were acquired by Densitometer Calibrate GS – 800 (Bio-Rad) at
42 microns resolution. Image analyses were performed with PD – Quest software (Bio-Rad).
2.3.4 Bioinformatics studies
Bioinformatics studies are in progress, in detail the first step is focalized to study the sequences and multialignment
of hypothetical proteins involved in stress response. For proteins with unknown 3D structures in Listeria spp. will
- 126 -
be adopted a homology modeling technique.
3. Results
3.1 Antimicrobial activity expressed by Lb. plantarum strains
Thirty-four Lb. plantarum strains showed an antimicrobial activity. In detail, Gram negative bacteria, except for A.
pasteurianus, were strongly inhibited (P <0.05). A different sensibility was evidenced in Gram positive bacteria. Lb.
plantarum RTB and Lb. plantarum BB showed the highest inhibition (data not shown). Moreover, statistical
analyses (TCA) showed a behaviour of these last strains
different from all other producer strains (data not shown).
In particular, they were selected for the ability to inhibit L.
innocua.
Results of Agar Well Diffusion Test showed that many
indicator strains and in particular L. innocua were inhibited
by cell free supernatant (CFS) of L. plantarum RTB.
Moreover the inhibition against L. innocua was also found
in presence of neutralized CFS (data not shown).
3.2 Quanification of inhibition against L. innocua
L. innocua ATCC 33090 in absence or in presence of
stresses (stressRTB, stressCFSRTB stressLA) showed a
different behaviour. In details, with-out stresses (control) L.
innocua, from initial concentration of 7 log CFU/ml,
reached after 96h levels of about 9.6 CFU/ml. Inhibitory
effect was appreciated when the strains was cultivated in Figure 1 Inhibition of L. innocua ATCC 33090
cultivated whit several stressors and
presence of stresses. However, the intensity and the
expressed as percentage.
behaviour of inhibition effect was different in several
stress conditions (Figure 1). Results evidenced that L.
innocua was inhibited of 100% after 24 and 96h when
cultivated in stressRTB. In presence of stressCFSRTB the
indicator strain was inhibited of 97.7% at 24h and of
99.8% at 96h. The strain cultivated in stressLA, was
inhibited of 96.7% at 24h and only of 92.7% after 96h.
These last data showed the ability of the indicator strain to
adapt to the acid stress. Therefore it’s possible to assert
that the presence of the acid induces a stress condition
reversible against the indicator strain, which, after an
adaptation period, was still able to grow. This could be due
to a complex molecular mechanism known as the Acid
Tolerance Response (ATR). It is known that ATR leads the
activation of several defense mechanisms, as changes in
the composition of the membrane, increase of proton flux
and amino acids catabolism and expression of enzymes
involved in DNA repair (Beales, 2004).
3.3 Analysis of cell protein by SDS-PAGE and 2D-E
Changes in protein patterns cells of L. innocua ATCC
33090 cultivated in presence or in absence of CFS of Lb.
plantarum RTB were analyzed by SDS-PAGE. Moreover,
the effects of lactic acid and other metabolites produced by
Lb. plantarum were quantified by the adopted
experimental design. Figure 2 showed the cell protein
patterns of L. innocua at beginning of the exponential
phase (lane 2), at second half of the exponential phase
(lane 3), at second half of the exponential phase in Figure 2 Cell protein patterns of L. innocua ATCC at
presence of lactic acid (lane 4), and in presence of cell free
beginning of the exponential phase (L2), at
supernatant of Lb. plantarum (lane 5). In all patterns the
second half of the exponential phase (L3), at
second half of the exponential phase in
presence of 36 bands, with molecular weight between 100
presence of stressLA (L4), and stressCFSRTB
kDa and 8 kDa, was detected (software Quantity-One, Bio(L5)
Rad). The intensity of each detected band was first
expressed as percentage of the total intensity in lane. Moreover, band intensities of each lane were standardized
dividing them by the intensity of the band at 16.5 kDa, which was present in all patterns with the same intensity.
This parameter (PSInt) is useful to compare the bands with the same molecular weight of different patterns. To
know the effects produced exclusively by presence of no-acid metabolites (stressCFSRTB) on the protein expression,
was firstly calculated the effects due to the growth phase (E Gphase) and to acidi condition (stressLA).
- 127 -
The effects due to the evolution of the exponential growth phase was calculated as follows:
(2)
The results showed that the evolution of the exponential growth phase does not cause significant changes in protein
expression.
The effect of acid condition (E StressLA) on the protein expression of L. innocua ATCC 33090 was calculated as
follows:
(3)
The acid stress determined the over-expression of seven protein bands. In detail, a strong expression has been
appreciated for the protein band 11 with molecular weight of 58.2 kDa, for the band 14 with molecular weight of
48.2 kDa and for the bands 28 and 30 with molecular weight of 26.5 and 23.6 kDa respectively. Furthermore, an
over-expression was also appreciated for the three protein bands (16, 17 and 19) ranging between 37.2 and 42.2
kDa.
The effect on protein changes due to no acid metabolites present in the CFS of Lb. plantarum RTB was estimated as
follows:
(4)
This stress caused a significant change in the expression of nine protein bands. In detail, it is possible to appreciate
the over-expression of three protein bands, one with molecular weight of 83.4 kDa and another two with a
molecular weight of 26.5 and 23.6 kDa respectively. These two bands are also over-expressed in the protein pattern
of L. innocua in StressLA. However stress CFSRTB also caused the significant repression of 6 protein bands. In
detail it was appreciated the repression of two bands with molecular weight of 78 kDa, 18.5 kDa. In addition,
repression was also observed for 4 protein bands (11, 16, 17 and 19) between 58.2 and 37.2 kDa, which were overexpressed in StressLA.
The cell protein 2D-E map (data not shown) of L. innocua cultivated without stresses and in presence of StressLA
or StressCFSRTB evidenced significant differences. In detail, the map relative to the proteins of the strain cultivated
in StressLA showed the neoformation of a protein spot (N1) and the over-expression of other four spots (S1, S2, S3,
S4). These phenomena were not observed in cell protein 2D-E map of strain cultured without stress conditions. The
spot of neo-formation, arbitrarily labeled "N1", is characterized by a
molecular weight of about 26.5 and an isoelectric point equal to
5.04. This spots is also present in the 2D-E map of L. innocua
cultivated in stressCFSRTB. The molecular weight and the isoelectric
point of the spot N1 could be compatible with a protein already
identified and involved in stress responses. In fact the spot N1 could
be represented by the protein "Response regulator ArlR" that
participates, in response to stress conditions, to the regulation of
virulence, growth and autolysis (Nielsen et al., 2012). The spot S1
(IP: 4.50, MW: 48.27 KDa) could be represented by beta-glucosidespecific, a protein of phosphoenol-transferase system. The spot S2
(IP: 4.72, Mw: 47.49) was compatible with the enzyme acetolactate
synthase-ALS, which catalyzes steps for the essential amino acids
synthesis. Spots S4 and S5 (Mw: 41.5 kDa IP: 5.1 and 5.2
respectively) are not detectable by means of available databases
(http://web.expasy.org/). Five spots (S1-S5) are absent or poorly
expressed in 2D-E map of L. innocua cultivated in stressCFSRTB
(Figure 3). Moreover the 2D-E map of L. innocua under
stressCFSRTB was characterized by the absence of a spot labeled R1,
which was present in 2D-E map both of L. innocua without stress
condition and of L. innocua cultivated in stressLA (Figure 3). The
protein relative to R1 spot (IP 4.6, Mw37.2 kDa) could coincide
with the protein AIRS (phosphoribosyl aminoimidazole synthetase),
Figure 3 2D-E
spots
analysed
by
the enzyme which, under different stress conditions, is involved in
PDQuestTM® software (BIO.RAD).
purine synthesis. The proteomic results showed that L. innocua
strain reacts to the presence of stress acid through the expression of proteins of neo-synthesis or through the overexpression of other proteins. In the presence of stressCFSRTB this stress response was not observed. L. innocua in
stressCFS showed not only the new-expression of spot N1 (2D-E map), but also the repression of a series of
- 128 -
proteins. These reactions do not allow the overcoming of adverse and/or lethal conditions produced by
stressCFSRTB. Therefore, the producer strain determines one or more stress conditions, different from acid stress,
able to exert a lethal effect against the indicator strain.
3.4 Bioinformatics studies
3D structures of some proteins involved in stresses response were defined. Particular attention was focused on the
ArlR protein Furthermore there are not ArlR proteins structure for Listeria spp. in protein data bank (PDB) but
there are ArlR structures with high similarity sequence from other microorganisms. Several biocomputational
experiments are in progress to individuate the best template for homology modeling.
4. Conclusion and Future Perspectives
The results obtained in this study improved the knowledge in stress response of L. innocua and allowed to develop
biotechnology tools to assure the food bio-preservation. In fact, the study evidenced that L. plantarum strains, if
opportunely selected for their antagonistic activity, could be successfully used in the formulation of anti-listerial
adjunct starter or protective cultures.
Future prespective. Sequencing and identification of all protein differentially expressed by L. innocua in the
different stresses may be useful to elucidate the mechanism of stress response. A transcriptomic approach may
allow to detect gene differentially expressed.
Acknowledgment. The Author is very grateful to Prof. Franca Fraternali for the supervision of the PhD activities
carried out at Department of Randall Division of Cell and Molecular Biophysics of King’s College of London.
5. References
Beales N (2004) Adaptation of microorganisms to cold temperatures, weak acid preservatives, low pH, and osmotic stress: A
Review. Compr Rev Food Sci F 3: 1-20.
Bergholz TM, Bowen B, Wiedmann M, Boor KJ (2012) Listeria monocytogenes shows temperature dependent and independent
responses to salt stress, including responses that induce cross-protection to other stresses. Appl Environ Microb 78: 26022612.
Charernjiratragul W, Bhoopong P, Kantachote D, Jomduang S, Kong-Ngoen R, Nair GB, Vuddhakul V (2010) Inhibitory
activity of lactic acid bacteria isolated from Thai fermented food against pandemic strains of Vibrio parahaemolyticus. J
Food Safety 30: 67-82.
Díaz-Ruiz G, Omar NB, Abriouel H, Cañamero MM, Gálvez A (2012) Inhibition of Listeria monocytogenes and Escherichia
coli by bacteriocin-producing Lactobacillus plantarum EC52 in a meat sausage model system. Afr J Microbiol Res 6:
1103-1108.
Diep DB, Straume D, Kjos M, Torres C, Nes IF (2009) An overview of the mosaic bacteriocin pln loci from Lactobacillus
plantarum. Peptides 30: 1562-1574.
Kamat AS, Nair PM (1996) Identification of Listeria innocua as a biological indicator for inactivation of L. monocytogenes by
some meat processing treatments. Lebensm-Wiss Technol 29: 714-720.
Milillo SR, Friedlya EC, Saldivara JC, Muthaiyana A, O'bryana C, Crandalla PG, Johnsona MG, Rickea SC (2012) A review of
the ecology, genomics, and stress response of Listeria innocua and Listeria monocytogenes. Crit Rev Food Sci 52: 712725.
Nielsen PK, Andersen AZ, Mols M, Van der Veen S, Abee T, Kallipolitis BH (2012) Genome-wide transcriptional profiling of
the cell envelope stress response and the role of LisRK and CesRK in Listeria monocytogenes. Microbiol 158: 963-974.
Reis JA, Paula AT, Casarotti SN, Penna ALB (2012) Lactic Acid Bacteria Antimicrobial Compounds: Characteristics and
Applications. Food Eng Rev 4: 124–140.
Rojo-Bezares B, Saenz Y, Navarro L, Zarazaga M, Ruiz-Larrea F, Torres C (2007) Coculture-inducible bacteriocin activity of
Lactobacillus plantarum strain J23 isolated from grape must. Food Microbiol 24: 482-491.
Salvucci E, Saavedra L, Hebert EM, Haro C, Sesma F (2012) Enterocin CRL35 inhibits Listeria monocytogenes in a murine
model. Foodborne Pathog Dis 9: 68-74.
Sip A, Więckowicz M, Olejnik-Schmidt A, Grajek W (2012) Anti-Listeria activity of lactic acid bacteria isolated from golka, a
regional cheese produced in Poland. Food Control 26: 117-124.
Svetoslav DT, Hervé P, Martine L, Xavier D, LeBlanc JG, Franco Bernadette DGM (2011) Bacteriocinogenic Lactobacillus
plantarum ST16Pa isolated from papaya (Carica papaya)-From isolation to application: Characterization of a bacteriocin.
J Food Res 44: 1351–1363.
Wessel D, Flügge UI (1984) A method for the quantitative recovery of protein in dilute solution in the presence of detergents
and lipids. Anal Biochem 138: 141-143.
- 129 -
Selection of Lactic Acid Bacteria and Yeasts to be Used
as Mixed Starter Cultures for Table Olive Fermentation
Giorgia Perpetuini (gperpetuini@unite.it)
Dept. of Food Science, University of Teramo, Mosciano Sant’Angelo (TE), Italy
Tutor: Prof. Aldo Corsetti, Prof. Rosanna Tofalo, Dr. Hélène Licandro-Seraut
This PhD thesis dealt with the physico-chemical and microbiological characterization of six different cultivar of
fermented Italian table olives. In order to obtain a complete picture of olive microbiota a PCR-DGGE analysis was
optimized. Moreover, a quantitative PCR (qPCR) to detect the main yeast species present in table olives was
developed. The last part of the project was addressed to the optimization of a random mutagenesis strategy to detect
genes involved in Lactobacillus pentosus adaptation in a stressful environment such as brine.
Selezione di batteri lattici e lieviti per la messa a punto di miscele
di colture starter per la fermentazione di olive da tavola
Il lavoro di dottorato ha previsto l’analisi chimico-fisica e microbiologica di sei cultivar Italiane di olive da tavola.
Al fine di ottenere un quadro completo della popolazione microbica è stato ottimizzato un protocollo di PCRDGGE. Inoltre, è stata messa a punto una PCR quantitativa (qPCR) al fine di determinare le principali specie di
lievito presenti in questo ecosistema. L’ultima parte del progetto ha riguardato lo sviluppo di una strategia di
mutagenesi per determinare i geni coinvolti nell’adattamento di Lactobacillus pentosus in salamoia.
Key words: Table olives, microbiota, qPCR, random mutagenesis
1. Introduction
Olive fermentation is a natural process in which the spontaneous fermentation results from the combined activities
of the indigenous microbiota (lactic acid bacteria -LAB- and yeasts). So, it is a spontaneous non standardized
process influenced by the microbiota and technological factors such as fermentation temperature and salt
concentration of brines. In order to improve olive fermentation some authors proposed the use of starter cultures
(Ruiz-Barba et al., 1994; Leal Sanchez et al., 2003; Hurtado et al., 2010; Segovia-Bravo et al., 2007; Servili et al.,
2006). This PhD project was aimed at the selection of LAB and yeasts to be used for table olives debittering. For
this reason six different cultivars of Italian table olives (Itrana Bianca, Itana Nera, Peranzana, Nocellara del
Belice, Cellina di Nardò and Bella di Cerignola) were previously analyzed from a physico-chemical and
microbiological point of view (Tofalo et al., 2012). In order to assess olive microbiota, LAB and yeasts were
detected by a polyphasic approach including both culture-dependent and independent (PCR-DGGE, RT-qPCR)
techniques. Moreover, all strains were tested for some technological properties. In particular, β-glucosidase,
peroxidase, proteolytic, pectinolytic and lipase activity were determined for yeasts and NaCl tolerance, ability to
grow in brine and β-glucosidase activity were investigated for LAB. Lactobacillus pentosus RT1 showed the best
technological properties,as also verified in laboratory scale fermentations, so in order to establish the molecular
mechanisms that allow this strain to survive in a stressful environment such as brine, a transposon mutagenesis was
developed. A set of 6000 random transposon-mutants was generated using the Pjunc-TpaseIS1223-based system
(Licandro-Seraut et al., 2012) and screened for their ability to grow in olive brine supplemented medium.
In accordance with the PhD thesis project previously described (Perpetuini, 2011), this oral communication reports
the main results of the following activities directed to:
1) Table olive microbiota: identification, technological properties and applications;
2) development of a RT-qPCR assay;
3) random mutagenesis of Lactobacillus pentosus
2 Materials and Methods
2.1 Table olive microbiota: identification, technological properties and applications
For yeast and LAB identification purposes, sequence analysis of the D1/D2 region of the 26S rRNA (Kurtzman and
Robnett 1998) and 16S rRNA and recA gene (Altschult et al., 1997), respectively was carried out. Molecular typing
was carried out by RAPD-PCR analyses using the oligonucleotide M13 (5’ GAG GGT GGC GGT TCT 3’) for
yeasts (Stendid et al., 1994) and (GTG)5 primer for LAB (Parente et al., 2010). Moreover, technological properties
for yeasts (β-glucosidase, peroxidase, proteolytic, pectinolytic and lipase activity) and LAB (NaCl tolerance, ability
to grow in brine and β-glucosidase activity) were investigated. Viable but not cultivable cells (VBNC) were
detected by PCR-DGGE. DGGE analysis were performed according to Mello et al. (2010) for yeasts and to
Abrouiel et al. (2011) for LAB.
- 130 -
Lab scale fermentation were performed: L. pentosus RT1 was inoculated at an initial cell concentration of about
107CFU/ml. Fermentations were performed at 20°C in a modified brine made up of yeast extract 0.5 g/l, glucose 3
g/l and NaCl 6% (w/v). Fermentations ended in 42 days for all tested cultivars and the main phenolic compounds
were detected by HPLC as reported by Montedoro et al. (1993).
2.2 Development of a RT-qPCR assay
A RT-qPCR protocol was developed to directly detect and quantify the total number of yeasts and three species
(Wickerhamomyces anomalus, Pichia guillermondii and Pichia kluyveri) associated to table olives.
Wickerhamomyces anomalus, P. guillermondii and P. kluyveri specific-primers were designed from the region of
the internal transcribed spacers ITS (rDNA), while yeast universal primers were designed from conserved
sequences of the variable D1/D2 domains of the 26S rRNA gene. Nucleic acids were obtained using a kit generally
used for soil, grape and must. Several conditions were preliminary tested to optimize the simultaneous extraction of
DNA and RNA from table olives and brines (Tofalo et al., 2012).
2.3 Random mutagenesis of Lactobacillus pentosus
All DNA manipulations were performed according to standard procedures (Sambrook et al., 1989). Plasmids were
isolated using Quiagen Spin Miniprep Kit (QIAGEN, Valencia, CA, USA). Ligation and restriction analysis were
carried out according to the manufacturer’s instructions. PCR were performed using 0.1 unit of Platinium®Taq
DNA polymerase high fidelity (Invitrogen), according to the manufacturer’s recommendations, in an automatic
thermocycler (Bio-Rad). For Southern blot analysis chromosomal DNA was digested with Hind III. The obtained
fragments were separated on 1% (w/v) agarose gel and transferred to a nylon membrane (GE Healthcare UK Ltd,
Buckinghamshire, UK) using the Pharmacia vacuum system. Hybridization was performed using a DIG High Prime
DNA labeling and detection starter kit (Roche, Indianapolis, IN). Lactobacillus pentosus RT1 and Escherichia coli
were transformed by electroporation as described by Aukrust and Blom (1992) and Dower et al. (1988). Plasmids
were prepared from E. coli using Nucleospin plasmid Miniprep Kit (Euromedex). Mutagenesis was proceeded
using Pjunc-TpaseIS1223system as reported by Licandro-Seraut et al. (2012). Mutants were screened for their
ability to grow up in brine using a new medium made up of brine enriched with glucose and yeast extract 1% (w/v).
Plates were incubated at 37°C for 72 h. Transposon insertion site was identified by ligation and transformation in E.
coli TG1 strain. Plasmids were isolated from selected transformants and subjected to sequencing reactions (GATC
Biotech) using the primers IRRseqext (5’ TCACCGTCATCACCGAAACG 3’) and IRL6 (5’
GCCGCACTAGTGATTAAAATAC 3’) which target the transposon sequence extremities. Identification of
transposon target sequences was performed with the BLAST software from the National Center for Biotechnology
Information (www.ncbi.nlm.gov./BLAST/).
3.1 Yeast and LAB identification and characterization
Traditional plating, isolation of LAB and identification by recA analysis showed that L. pentosus was the dominant
species in all cultivars.The other species detected were Lactobacillus plantarum, Lactobacillus fermentum,
Lactobacillus helveticus. Rep-PCR analysis allowed to identify different biotypes, where some strains grouped in
function of their origin. PCR-DGGE applied to DNA directly extracted from olive brine samples confirmed the
complex microbiological pattern of LAB in fermented table olives as well as the prevalence of L. pentosus.
Yeast biota was identified by a polyphasic approach including 26S rDNA gene sequencing and RAPD
fingerprinting. The obtained results showed that Saccharomyces cerevisiae was the dominant species followed by
Pichia galeiformis, Candida boidinii, Candida ishiwadae and W. anomalus. The predominance of S. cerevisiae in
all cultivars was confirmed by PCR-DGGE. RAPD PCR analysis revealed that the majority of the isolated strains
correlate to their cultivar. In general, the applied approach resulted useful to analyze the structure of a complex
microbial ecosystem such as table olives and to monitor microbial dynamics in relation to environmental factors.
The main species identified by culture-dependent and independent approaches are indicated in table 1.
In order to select a strain to be used as starter culture all LAB strains were subjected to technological
characterization. Results showed that almost all strains had β-glucosidase activity, 90% was able to grow in brine
and 100% grew in the presence of NaCl 6%. Regarding yeasts all the strains were able to grow at NaCl 5%.
Pectinolytic activity was absent in all the yeast species considered. On the contrary, all the strains showed moderate
or strong catalase activity. β-glucosidase activity was detected only in 3 strains: P. galeiformis, W. anomalus and C.
ishiwadae. Only 12% of the tested strains hydrolyzed urea. The obtained results showed that L. pentosus RT1 had
the best technological properties. So, it was used in lab scale fermentation. The obtained results showed that L.
pentosus RT1 modifies the phenolic composition of olives. Concentrations of oleuropein and the aglycon
derivatives of oleuropein (the dialdehydic form of decarboxymethylelenolic acid linked to hydroxytyrosol)
significantly decreased (table 2).
- 131 -
Table 1 LAB and yeast species detected by culture dependent and independent techniques.
Species
L. plantarum
L. pentosus
L. fermentum
L. helveticus
α-proteobacteium
S. cerevisiae
W. anomalus
C. boidinii
P. galeiformis
P. membranifaciens
C. ethanolica
C. stellimalicola
Uncultured bacterium 1
Uncultured bacterium 2
Uncultured prokaryote
Cultivar
Peranzana Nocellara
del Belice
Itrana Bianca
ItranaNera
x/○
x/○
x/○
x/○
x/○
x/○
x
○
x/○
○
x/○
○
x/○
Cellina
di Nardò
Bella di
Cerignola
x/○
x/○
x/○
x/○
x/○
x/○
x
○
x/○
x
○
x/○
x
x
x
○
○
○
○
○
○
○
○
○
x
○
○
○
○
○
○
○
○
○
○
○
○
x/○
○
○
○
X plate detection
○ PCR DGGE
Table 2 Phenol compounds present in olive pulp before (T0) and after (T45) debittering using L. pentosus RT1 as starter culture.
Phenols
Itrana Bianca
Nocellara del Belice
Peranzana
Cellina di Nardò
T0
T45
T0
T45
T0
T45
T0
T45
3,4-DHPE
p-HPEA
429.30±24.9
38.26±1.8
1037.3±60.2
119.0±5.7
341.8±19.8
28.9±1.4
652.0±37.8
147.6±7.1
978.5±56.8
172.9±8.3
2388.0±60.1
256.2±9.1
304.0±17.6
26.1±1.3
526.4±30.5
82.6±4.0
Verbascoside
2177.9±148
984.0±57.1
983.6±47.2
345.3±16.6
28992.0±13
13999.0±952
1283.2±87.3
612.3±41.6
3,4-DHPEEDA
Oleuropein
742.7±44.6
n.d.
1725.8±86.3
n.d.
8705.2±43.5
n.d.
1659.2±99.6
n.d.
7973.4±398
n.d.
770.7±38.5
n.d.
1943.0±97.2
n.d.
7387.9±369.4
n.d.
Total
11361.5±428
2140.3±83.1
3850±107.5
1144.9±41.9
40792.0±146
16643±962
10660.4±392.8
1221.3±51.8
3.2 Development of a RT-qPCR assay
In order to obtain reliable results applying culture-independent methods good protocols for DNA/RNA extraction
are needed. So, firstly total nucleic acids isolation method was optimized. RT-qPCR allow to directly detect and
quantify the total number of yeasts besides three species (W. anomalus, P. guillermondii and P. kluyveri) associated
to table olives. This assay allowed to unequivocally distinguish the three species from other yeasts and lactic acid
bacteria generally associated to table olives fermentation. To evaluate the effectiveness of the technique, the qPCR
results were compared with those obtained by a plate count approach in synthetic medium. P. guillermondi and P.
kluyveri were detected starting from 102 cell/ml and the lowest cell quantification for total yeast was 103 cell/ml.
Only W. anomalus was detected starting from 10 cell/ml (figure 1).
- 132 -
Figure 1 Standard curves obtained from qPCR ( ) and RT-qPCR (
).
3.3 Random mutagenesis of Lactobacillus pentosus RT1
Lactobacillus pentosus was mutagenized using the efficient Pjunc-TpaseIS1223 transposition system. The
transposition efficiency was 4000 mutants obtained for 109 viable cells (carrying pVI129) transformed with 1 µg of
pVI110. These results demonstrate that random mutagenesis was efficient and that pVI110 integrations can be
considered as stable. Eighteen pVI110 insertion mutants were randomly selected and analyzed by Southern blot that
demonstrated unequivocally that transposon was inserted at different position in a random manner in the genome.
To confirm the diversity of mutants and to identify the nature of the target sequences of pVI110, the ten first
randomly selected mutants were identified by DNA sequencing. A library of 6000 mutants was obtained and all
mutants were tested for their ability to survive in brine and 6 of them failed to grow. In particular, in three of them,
transposon was inserted in intergenic region, on the contrary the three other mutants were mutated in ORF (Table
3). This strategy allowed the identification of three genes essential for the adaptation and growth of L. pentosus
RT1 in olive brine: LPENT_00392, encoding the hypothetical integral membrane protein, LPENT_01085, encoding
the enolase 1 and LPENT_01085, encoding a mucus binding protein.
Table 3 Identification of pVI110 integrants in L. pentosus RT1.
Mutant
Location in
ORF interrupted
WCFS1 genome
(WCFS1 homologous)
1061700
lp_1162
ATP-dependent RNA helicase
cd00046
B5
664050
lp_1163
lp_0725
nucleotide-binding protein, universal stress protein UspA family
redox-sensitive transcriptionregulator
cd00293
cl06152
D12
980016
lp_0726
lp_1078
lp_1079
membrane-bound protease, CAAX family
30S ribosomalprotein S9
DegVfamilyprotein
cl00558
cl00334
cl00577
B11
B10
G1
2223818
1449282 / 227383
729018 / 1083530
lp_2486
lp_1590 / LPENT_00392
lp_0792 / LPENT_01085
mucus-binding protein, LPXTG-motif cell wall anchor
hypotheticalprotein / integral membrane protein
enolase 1
cl16280
cd06259
cd0313
B1
Potential function*
Protein
family code
The obtained results showed the complexity of table olives ecosystem. The combination of culture-dependent and
independent techniques proved to be specific and useful in studying the diversity of table olives microbiota.
Moreover, lab scale fermentation showed that L. pentosus RT1 is able to dominate the fermentation process in all
analyzed cultivars by its rapid implantation, growing under unfavorable conditions (e.g. low amount of nutrients)
and by a rapid acidification of the fermentation brines. The results presented here clearly show the performance and
the efficiency of this strain to control olive fermentations, so it should be used at industrial level. Moreover, random
mutagenesis allowed to identify three genes essential for the adaptation and growth of L. pentosus RT1 in olive
brine: LPENT_00392, encoding the hypothetical integral membrane protein, LPENT_01085, encoding the enolase
1 and LPENT_01085, encoding a mucus binding protein.
- 133 -
5. References
Abriouel H, Ben Omar N, Lucas R. Gálvez A (2011) Culture-independent study of the diversity of microbial populations in
brines during fermentation of naturally-fermented Aloreña green table olives. Int J Food Microbiol 144: 487-496.
Altschult SF, Maddelen TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a
new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402.
Aukrust T, Blom H. (1992) Transformation of Lactobacillus strains used in meat and vegetable fermentations. Food Res Int 25:
253-261.
Dower WJ, Miller JF, Ragsdale CW (1988) High efficiency transformation of E. coli by high voltage electroporation. Nucleic
Acids Res 16: 6127-6145.
Hurtado A, Reguant C, Bordons A, Rozès, N (2010) Evaluation of a single and combined inoculation of a Lactobacillus
pentosus starter for processing cv. Arbequina natural green olives. Food Microbiol 27: 731-740.
Kurtzman CP, Robnett CJ (1998) Identification and phylogeny of ascomycetous yeast from analysis of nuclear large subunit
(26S) ribosomal DNA partial sequences. Antonie Leeuwenhoek 73: 331-371.
Leal-Sánchez MV, Ruiz-Barba JL, Sánchez AH, Rejano L, Jiménez-Díaz R, Garrido A (2003) Fermentation profile and
optimization of green olive fermentation using Lactobacillus plantarumLPCO10 as a starter culture. Food Microbiol 20:
421-430.
Licandro-Seraut H, Brinster S, van de Guchte M, Scornec H, Maguin E, Sansonetti P, Cavin JF, Serror P (2012) Development of
an efficient in vivo Pjunc-TpaseIS1223 system for random transposon mutagenesis of Lactobacillus casei. Appl Environ
Microbiol doi:10.1128/AEM.00531-12.
Mello A, Miozzi L, Vizzini A, Napoli C, Kovalchuk G, Bonfante P (2010) Bactereial and fungal communities associated with
Tuber magnatum- productive niches, Plant Biosystems 144: 323-332.
Montedoro GF, Servili M, Baldioli M, Selvaggini R, Miniati E, Macchioni A (1993) Simple and hydrolyzable compounds in
virgin olive oil. Spectroscopic characterization of thesecoiridoid derivates. J Agric Food Chem 41: 2228-2234.
Parente E, Ciocia F, Ricciardi A, Zotta T, Felis G, Torriani S. (2010) Diversity of stress tolerance in Lactobacillus plantarum,
Lactobacillus pentosus and Lactobacillus paraplantarum: a multivariate screening study. Int J Food Microbiol 144: 270279.
Perpetuini G. (2011) Selection of lactic acid bacteria and yeasts to be used as mixed starter cultures for table olive fermentation.
In Proc.s of the XVI Workshop on the Developments in the Italian PhD Research on Food Science and Technology, Lodi
(Italy), 21-23 September, 2011.
Ruiz-Barba JL, Jimenez-Diaz R (1994) Vitamin and amino acid requirements of Lactobacillus plantarum strains isolated from
green olive fermentations. J Appl Bacteriol 76: 350-355.
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd ed, vol. Cold Spring Harbor
Laboratory. Cold Spring Harbor, N.Y.
Segovia Bravo KA, Arroyo-López FN, GarcíaGarcía P, Durán Quintana MC, Garrido Fernández A (2007) Treatment of green
table olive solutions with ozone. Effect on their polyphenol content and on Lactobacillus pentosus and Saccharomyces
cerevisiae growth. Int J Food Microbiol 114: 60-68.
Servili M, Settanni L, Veneziani G, Esposto S, Massitti O, Taticchi A, Urbani S, Montedoro GF, Corsetti, A (2006) The use of
Lactobacillus pentosus 1MO to shorten the debittering process time of black table olives (Cv. Itrana and Leccino): a pilotscale application. J Agric Food Chem 54: 3869-3875.
Stendid J, Karlsson JO, Hogberg N (1994) Intraspecific genetic variation in Heterobasidiumannosum revealed by amplification
of minisatellite DNA. Mycol Res 98: 55-63.
Tofalo R, Schirone M, Perpetuini G, Angelozzi G, Suzzi G, Corsetti A (2012) Microbiological and chemical profiles of naturally
fermented table olives and brines from different Italian cultivars. Antonie Leeuwenhoek 102: 121-131.
Tofalo R, Schirone M, Perpetuini G, Suzzi G, Corsetti A (2012) Development and application of a real-time PCR-based assay to
enumerate total yeasts and Pichia anomala, Pichia guillermondii and Pichia kluyveri in fermented table olives. Food
Control 23: 356-362.
- 134 -
Advanced Applications of MALDI-TOF Mass Spectrometry
in Food Lipidomics
Gianluca Picariello (picariello@isa.cnr.it)
Dep. Food Science, University of Naples “Federico II”, Naples, Italy
Istituto di Scienze dell’Alimentazione CNR, Avellino, Italy
Tutor: Prof. Francesco Addeo
MALDI-TOF mass spectrometry (MS)-based techniques are emerging as powerful analytical tools to profile oils
and fats. Several quick strategies of sample pre-treatment have been developed to significantly enhance the
potential and the analytical applicability of MALDI-MS in food lipidomics. These methodologies enable: (1) the
analysis of saturated triacylglycerols (TAG) separately from the unsaturated counterpart; (2) the assessment of food
authenticity through lipid “profiling”; (3) to monitor low-abundance TAG that contain very short-/long-chain fatty
acids or odd-numbered carbon TAG; (4) the characterization of the apolar and polar fraction of thermo-oxidized
oils; (5) to infer semi-quantitative determinations.
Applicazioni innovative della spettrometria di massa MALDI-TOF
all’analisi lipidomica degli alimenti
Le tecniche di spettrometria di massa (MS) MALDI-TOF sono potenti strumenti analitici per il “profiling” dei
lipidi. Sono state sviluppate strategie di pre-trattamento di oli e grassi di interesse alimentare che aumentano
ulteriormente le potenzialità della MALDI-MS in analisi lipidomica. Queste metodologie permettono di: (1)
analizzare triacilgliceroli (TAG) saturi separatamente dagli insaturi; (2) stabilire l’autenticità di matrici alimentari
attraverso l’analisi della frazione lipidica; (3) monitorare TAG minoritari contenenti acidi grassi a catena molto
corta, molto lunga o a numero dispari di atomi di C; (4) caratterizzare le frazioni polari e apolari di oli termoossidati; (5) ottenere determinazioni semiquantitative.
Key words: Food lipidomics; MALDI-TOF mass spectrometry; triacylglycerols; oil thermo-oxidation.
1. Introduction
Potential of MALDI-TOF (matrix assisted laser desorption ionization-time of flight) mass spectrometry (MS) in the
analysis of neutral and polar lipids have been long underestimated, due to a series of intrinsic limitations including
the background in the low molecular weight (MW) range, the laser-induced prompt fragmentation of lipids, the
relative insolubility in organic media of the MALDI matrices. The introduction of matrices such as 2,5dihydroxybenzoic acid (DHB) and 2’,4’,6’-trihydroxyacetophenone (THAP) has significantly contributed to the
steadily increasing use of MALDI-MS for analyzing complex lipid mixtures. “Soft” MS techniques, especially
MALDI, deliver several analytical advantages if compared to the classical methods of lipid analysis (e.g. gas
chromatography) including: (1) minimal sample handling; (2) no need of hydrolysis or derivatization; (3) costeffectiveness, time of analysis being in the order of 1-2 minutes; (4) applicability to very complex mixtures; (5)
high sensitivity and improved specificity; (6) large dynamic range; (7) relative tolerance to interfering compounds.
More importantly, soft MS techniques maintain the integrity of lipids, such as triacylglycerols (TAG), thus
preserving relevant information, as for instance the content of partial acylglycerols (di- and mono-acylglycerols).
MALDI-TOF MS spectra of TAG are relatively easy to assign, considering that upon opportune cationization with
an alkali metal ion, generally Na+, each signal corresponds to a single molecular component. For this reason,
MALDI-TOF MS is the methods of choice for very complex lipid mixtures and, complementarily to electrosprayMS, offers an array of procedures that are the basis of modern lipidomics. The current contribution offers an
overview of a series of innovative applications of MALDI-TOF MS applied to mixtures of food-derived oils and
fats. Quick strategies of sample pre-treatments or pre-analytical set-up further expand the potential and the
applicability of the technique, and enable: (1) the analysis of saturated TAG separately from the unsaturated
counterpart (Picariello et al., 2007); (2) the assessment of food authenticity through the lipid “profiling”; (3) the
identification and the detection of minority TAG that contain very short-/long-chain or odd-numbered carbon fatty
acids (Picariello et al., 2007); (4) the characterization of the apolar and polar fraction of thermo-oxidized oils
(Picariello et al., 2009); (5) to minimize lipid fragmentation, thereby permitting to obtain reliable semi-quantitative
determinations (Picariello et al., 2010).
BCR® Certified Reference Material (CRM-519) was used as the reference anhydrous milk fat. Bovine (tallow) and
swine (lard) depot fats and extra-virgin olive oil (EVO) were obtained from local agro-technical farms (region of
- 135 -
Avellino, Italy). Tuna and fish oils have been furnished by Pharma Marine (Norway). Chemicals have been
purchased from Sigma-Aldrich (Milan, Italy). All the solvents were HPLC-grade or better.
2.1 TAG bromination
Bromination was carried out by dropwise addition of bromine to fat (10 mg) dissolved in CHCl3 (0.5 mL) until the
solution turned reddish. After reduction of the excess bromine with 10% aqueous sodium thiosulfate, the aqueous
phase was discarded and the organic phase used for mass spectrometric analysis.
2.2 TAG catalytic hydrogenation
Hydrogenation of TAG from food lipid mixtures was carried out in 1 mL absolute CH2Cl2 in the presence of a
catalytic amount of platinum under 1 bar H2 pressure (2 h at room temperature). Sample were paper-filtered before
analysis.
2.3 Separation of polar and apolar fractions of thermo-oxidized oils
EVO and sunflower oil were thermo-oxidized 360 min at 180°C. Polar and apolar fractions were separated by
chromatography on silica gel according to the official IUPAC procedure (IUPAC, 1992). Briefly, 500 mg of oil
dissolved in 2 mL of hexane/diethyl ether 90:10 (v/v) was loaded onto a hand-packed silica gel column containing
15 g of stationary phase. The apolar fraction containing the not-oxidized TAG was eluted with hexane/diethyl ether
90:10 (v/v), and the solvent was evaporated. The polar compounds were then eluted by diethyl ether and finally
dried. Purification was monitored by thin layer chromatography.
2.4 Nitrocellulose MALDI-TOF MS analysis of TAG
For the nitrocellulose (NC) MALDI-TOF MS, 1 µL of the following solutions has been sequentially loaded on the
sample target: a. 7 mg/mL NC in acetonitrile/methanol 7/3 (v/v); b. DHB 10 mg/mL in 35% (v/v) acetonitrile; c.
lipid mixture, 5 µg/mL in CHCl3.
2.5 MALDI-TOF analysis
MALDI-TOF e NC MALDI-TOF MS have been acquired with a MALDI Voyager DE-PRO (Perseptive
BioSystems, Framingham, MA, USA) spectrometer in positive reflector ion mode. Cationization of TAG has been
induced by vigorous shaking of the organic TAG solutions with equal volumes of 0.5 M CH3COONa. The aqueous
layer has been discarded before analysis. Matrix was DHB (10 mg/mL in 50% acetonitrile) containing 5 mM
CH3COONa.
3.1 Bromination of tallow
Addition of Br2 to unsaturated fatty acids or TAG increases their molecular mass by 160 Da/double bound.
Bromination reduces TAG detectability, due to signal dispersion that is caused by the natural isotopic distribution
of Br, i. e. 79Br and 81Br that have natural relative abundance ~50%. In contrast, saturated TAG are not affected by
Br2 and preserve their native molecular weight. Therefore, the contribution of saturated TAG, isolated from that of
the unsaturated species is easily recognized. The mass spectra of tallow before and after bromination are compared
in Figure 1. Tallow contains long-chain TAG, with different unsaturation degrees. After bromination, the
unsaturated TAG shift at higher m/z and are barely detectable, while saturated TAG can be easily assigned.
Interestingly, minor odd-carbon numbered (CN) TAG, which are specific of ruminants, were detected between
adjacent signals of even-CN TAG.
Figure 1 MALDI-TOF MS of native and brominated
tallow. Bromine addition to double bonds provokes
unsaturated TAG to shift at higher m/z. Saturated TAG
are unaffected buy bromination.
- 136 -
3.2 Hydrogenated fish oil
Fish oils are very complex TAG mixtures, containing long- and very-long chain TAG with an averagely high
unsaturation degree. Identification of TAG components is hampered by the overlapping of signals belonging to
clusters of different CN. Hydrogenation of fish oil provokes coalescence with convergence of the signals for the m/z
of the corresponding saturated species. Several fish oil with nutritional value, including oil from seal, squid,
salmon, tuna and cod liver, were characterized. The MALDI-TOF MS spectra of native tuna oil with the
hydrogenated counterpart are compared in Figure 2. Hydrogenation provide a simplified spectrum in which TAG
with CN ranging from C48 to C62 are clearly distinguishable. Odd-CN TAG, most likely arising from plankton,
were detected as well. Though causing the loss of information about the occurrence of unsaturated species, the
coalescence prevents the signal dispersion effect, enabling the detection of very low-abundance components. With
the same technique, it has been possible to identify very low- and very high-CN TAG that had not described before
in milk fat (Picariello et al., 2007).
C54
C56
C52
Native tuna
oil
C60
C58
Figure 2 MALDI-TOF MS spectra of native and hydrogenated tuna
oil. After hydrogenation unsaturated TAG converge to the signal of
saturated TAG, enabling the detection of low-abundance TAG clusters.
C52
C54
C50
C48
C55
C51
C58
C53
C46
C48
Hydrogenated
tuna oil
C56
C60
C62
3.3 MALDI-TOF MS analysis of polar and apolar fractions of thermo-oxidized oils
Thermal treatments such as deep frying cause drastic modifications in the molecular compositions of edible oils.
These modifications are primarily triggered by radical auto-oxidation processes involving double bonds, generating
unstable hydroperoxides. The secondary spontaneous decomposition of hydroperoxides yields several classes of
oxidation products, including mono- and di-acylglycerols, β- scission products, TAG fragments (“core
aldeheydes”), oxidated TAG, oligomerized TAG, volatile aldehydes and hydrocarbons. The relative amount of
polar compounds (alcohol and aldehyde derivatives of TAG) increases with the severity of the thermal stress.
Classical methodologies based primarily on the gas chromatography are often inadequate to challenge such a
molecular complexity also considering the prevalence of unmodified TAG in the mixtures. Due to a high
unsaturation degree, edible oils undergo heavy heat-induced modifications. A preliminary normal phase (silica gel)
chromatographic step prior to MALDI-MS analysis permit to separately analyze polar and apolar fraction of
thermo-oxidized oils. By this way the components belonging to all the classes of neo-formed compounds were
singled out in sunflower and EVO (Picariello et al., 2009).
Figure 3 shows the MALDI-TOF MS spectra of the polar and apolar fraction of EVO. The pre-fractionation
minimizes the suppression effects due to the predominance of unmodified apolar species. Spectra have been
acquired with NC MALDI-TOF MS that prevent both in source fragmentation and matrix ionization, thus allowing
to clearly detect mono- (MAG) and di-acilglycerols (DAG) at low m/z, which arise from the hydrolytic scission of
TAG.
- 137 -
Figure 3 NC MALDI-TOF MS analysis of polar and apolar
fraction of thermally stressed EVO. All the neo-formed class
of compounds are clearly detected and components singled
out.
3.4 NC MALDI-TOF MS
It has been developed a sample deposition procedure that minimizes the in source TAG fragmentation and prevents
matrix ionization, thereby overcoming two of the main drawbacks that limit the informative potential of MALDITOF in lipidomics. The procedure consists in the sequential deposition of matrix and TAG over the stainless steel
target pre-coated with a thin layer of NC. NC MALDI-TOF spectra of TAG are free from interfering fragment and
matrix ions at low m/z. As an example, it is shown in Figure 4 the NC MALDI-TOF spectrum of bovine milk fat
(CRM-519), which is the most complex natural fat mixture. A complete “profiling”, including the characterization
of variously unsaturated, low-, medium-, and high-CN and odd-CN TAG, were one-step obtained. The negligible
fragmentation and the even sample-matrix crystallization enhance the shot-by-shot and sample-by-sample
reproducibility, enlarging the potential of MALDI-TOF MS to semi-quantitative and quantitative determinations
(Picariello et al., 2010).
C36
C38
C34
Figure 4 NC MALDI-TOF MS of bovine milk
fat. The spectrum is free of interfering
fragment and matrix ions at the low m/z. Very
low- or very high-CN, due to improved
sensitivity, can be detected.
C40
C32
C30
C50
C48
C46
C44
C42
C28
C26
C24
C52
C54
The novel strategies of sample pre-treatment or deposition enlarge the potentiality of MALDI-TOF MS techniques
in lipidomics. The application of these methodologies are particularly useful for the analysis of food oils and fats
which are very heterogeneous lipid mixtures. The improvement of sensitivity, specificity and repeatability proposes
MALDI-TOF MS-based methods as good alternatives to GC-based techniques for the evaluation of TAG, even
quantitative, in fats and oils. Studies are in progress to develop simple methods to isolate phospholipids and polar
lipids from foodstuff and to validate procedure that can offer analytical support to the assessment of the events
occurring in technological food processes, such meat ripening or cheese lipolysis.
- 138 -
5. References
IUPAC (1992) Determination of polar compounds in frying fats 2.507. In Standard Methods for the Analysis of Oils, Fats and
Derivatives, 1st Supplement, 7th ed.; International Union of Pure and Applied Chemistry, Pergamon Press: Oxford, U.K.,
1992.
Picariello G, Paduano A, Sacchi R, Addeo F (2009) Maldi-tof mass spectrometry profiling of polar and nonpolar fractions in
heated vegetable oils. J Agric Food Chem 57: 5391-5400.
Picariello G, Romano R, Addeo F (2010) Nitrocellulose film substrate minimizes fragmentation in matrix-assisted laser
desorption ionization time-of-flight mass spectrometry analysis of triacylglycerols. Anal Chem 82: 5783-5791.
Picariello G, Sacchi R, Addeo F (2007) One-step characterization of triacylglycerols from animal fat by MALDI-TOF MS. Eur
J Lipid Sci Technol 109: 511-524.
- 139 -
Biotechnological and Spectroscopical Evaluation of Selected Lactobacillus
plantarum Strains with Probiotic and Nutraceutical Potentialities
Maria Chiara Remagni (maria.remagni@unimi.it)
DeFENS - Dept. of Food, Environmental and Nutritional Science, University of Milan, Italy - CRA - FLC Lodi
Tutor: Prof. Diego Mora; Co- tutors: Dr. Tiziana M.P. Cattaneo, Dr. Domenico Carminati.
This PhD thesis dealt with the development of a Near Infrared Spectroscopy system to monitor biofermentation in
milk whey using selected strains of Lactobacillus plantarum with potential probiotic and nutraceutical
characteristics, in order to produce high amounts of biomass which could be added to other foods for exploitation as
carrier of functional supplements.
Valutazione biotecnologica e spettroscopica di ceppi selezionati
di Lactobacillus plantarum con potenzialità probiotiche e nutraceutiche
Questo lavoro di dottorato ha riguardato la messa a punto di un metodo spettroscopico per il monitoraggio delle
fermentazioni in siero di latte ad opera di ceppi di Lactobacillus plantarum selezionati per potenzialità probiotiche e
nutraceutiche, al fine di produrre elevate quantità di biomassa da aggiungere ad altri alimenti per utilizzarli come
carrier di integratori funzionali.
Key words: Lactobacillus plantarum, NIR spectroscopy, probiotic and nutraceuticals.
1. Introduction
In accordance with the PhD project previously described (Remagni, 2011), this oral communication reports the
main results of the following activities directed to:
A1) Selection of strains isolated from different matrixes;
A2) Molecular typing of isolates to select strains with different genotypic profile and to detect presence of msa
and bsh genes;
A3) In vitro phenotypic tests to detect BSH activity;
A4) PCR and RT-qPCR to detect the expression level of rib operon, which encode the production of vitamin B6
(riboflavin);
A5) In vitro phenotypic tests to determine the ability of the strains to produce riboflavin;
A6) Fermentation tests in laboratory conditions using milk whey, to monitor lactose degradation, lactic acid
production using potentiometric and spectrometric techniques (NIR optic probe) in order to select strains with
good capability to produce high amount of biomass.
2.1 Strain selection and molecular typing
A total of 80 strains were used in this study. Seventy-nine strains of Lactobacillus plantarum, belonging to the
collection of the CRA-FLC (Fodder and Dairy Productions Research Centre, Lodi), were isolated from different
matrixes (23 strains from dairy products, 38 strains from olive brines and 18 strains from grape marcs); the type
strain ATCC 14917T used as reference strain. Strains were kept as frozen stocks at -80 °C in MRS broth (Merck,
Darmstadt, Germany) added with 20% (v v-1) glycerol. Frozen stock cultures were thawed and subcultured twice
(2% inoculum) in MRS at 30 °C overnight before use.
Bacterial DNA was extracted using a Chelex® 100 method (Walsh et al. 1991) and used as a template for PCR
reactions. RAPD-PCR was performed using M13 primer (GAGGGTGGCGGTTCT) as described by Rossetti and
Giraffa (2005) and the fingerprinting profiles were processed using Bionumerics software (5.1 Applied Maths,
Belgium). Similarity among different profiles was evaluated by applying the Pearson’s correlation coefficient.
Strains representative of different genotypic profiles were selected and their taxonomic affiliation was confirmed by
PCR according to Torriani et al. (2001).
2.2 Detection of the bsh and msa genes and phenotypic assay
Total DNAs were also used to detect the presence of bsh (bile salt hydrolase) and msa (mannose specific adhesing)
genes, according to Zago et al. (2011).
BSH activity was detected by a plate screening procedure using both sodium salts of taurodeoxycholic acid
(TDCA) and sodium salt glicodeoxycholic acid (GDCA), according with Zago et al. (2011). BSH activity was
shown by the presence of halos around the colonies or by colonies appearance (white opaque).
- 140 -
2.3 Detection of the rib operon
Strains were tested by PCR to search for the presence of genes of the rib operon encoding for the production of
riboflavin (vitamin B6). PCR primers were designed on the basis of the alignment of operon sequences of L.
plantarum WCFS1 (GenBank Accession number: AL 935263.1) and JDM1 (GenBank Accession number:
CP001617.1). The primers had the following sequences: 5’ - GGGTGGCGAGCTACCAAAAT - 3’ (rib for) and 3’
- CGTGGTTAAAACGCCGAACATTA - 5’ (rib rev). The primers were designed to obtain a PCR product length
of 3190 bp. L. plantarum WCFS1, lacking the complete rib operon, was used as control strain.
2.4 Evaluation of rib operon expression by real time PCR
The expression level of rib operon was performed as follows: (i) reverse PCR. Total RNA was isolated from 1,5 ml
of an overnight culture, by using TRIzol (Invitrogen, New Zeland) and RNA concentration were measured using a
spectrophotometer (Jasco, Japan). 0.01μg/ml were transcribed into cDNA using High Capacity cDNA reverse
Trascription Kit (Life Technologies, Italy). (ii) Real - time PCR. PCR primers to detect the ribG gene, the
endogenous reference (glyceraldehydes - 3- phosphate gene) and the internal Taqman Mionor Groove Binder
(MGB) probe were designed with Primer Express version 3.0 (Life Technologies, Italy). The probe was labelled at
the 5’ end with a the reporter dye FAM. Forward and reverse primers for the rib gene detection had the following
sequences respectively: primer for: 5’ - GGAATTCGGCAAGTCGTGATTG - 3’, rev: 5’ CAAAAGATACTGACGTCCCTTACCA - 3’.The probe sequence was 5’ - (FAM) TCCCCATCCAATCGTG - 3’.
RT-PCR amplified an internal fragment of the ribG gene with size of 75 bp.
Forward and reverse primers for the endogenous gene detection had the following sequence, respectively: for: 5’ CCCTGTACGTGGTGGTAACTT - 3’, rev: 5’ - CACCAGTTGAATGAGGAATA - 3’ The probe sequence was 5’
- (FAM) CTGCCGGTGTAAACAC - 3’. RT-PCR amplified an internal fragment of the endogenous gene with the
size of 71 bp.
Real time PCR was carried out in a 25 μL volume and contained TaqMan universal PCR master mix, No AmpErase
UNG (Life Technologies, Italy), Gene Expression Assay Mix (final concentration 1X) and 2.5 μL of template
cDNA. Thermal cycling conditions were the following: 95 °C for 10 min, 45 cycles of 95 °C for 15 s and 60 °C for
1 min. Thermal cycling, data collection and data analysis were carried out with the ABI 7300 Real time PCR
System (Life Technologies, Italy). The amplification were normalized to the constantly expressed housekeeping
gene and relative transcript levels were calculated applying the equation 2-∆∆Ct.
2.5 Detection of riboflavin production
The evaluation of riboflavin production was carried out with strains which expressed the entire rib operon by a
microbiological assay using the Lactobacillus rhamnosus ATCC 7469 as test strain because it needs riboflavin to
grow. Riboflavin Assay Medium (RAM; Difco, USA) free from riboflavin but containing all other nutrients and
vitamins essential for the growth of L. rhamnosus ATCC 7469 was used. The inoculum for assay was prepared in
MRS for 16-24 h at 35-37 °C.
The cells were recovered by centrifugation at 9000 g for 10 min, washed three times and resuspended in 10 mL of
sterile 0.85% saline solution. The cell suspension was diluted to a turbidity of 35-40% of transmittance,
corresponding to 0.45±0.05 of absorbance, when read at 660 nm. Fifty μL of this suspension were used to inoculate
tubes containing RAM. A standard curve was constructed before performing the assay according to a reference
procedure (Horwitz, 2007). The standard curve was obtained by using different concentration of riboflavin (Sigma,
Italy), ranging from 0 to 30 ng/mL. Tubes were incubated at 37 °C overnight, and after growth the absorbance was
measured to evaluate the linearity of the curve. To detect the riboflavin production, the L. plantarum strains were
cultivated in RAM at 37 °C overnight, cells eliminated by centrifugation, and spent broths filter sterilized. Different
concentrations (2%, 5%, 10%) of spent broths were added to RAM inoculated with the test strain to detect the
presence of riboflavin and to determine the amount by interpolation from the standard curve.
2.6 Evaluation of biomass production by Near Infrared Spectroscopy
Tests were performed using pasteurized whey and a strain of L. plantarum selected for its potential probiotic
characteristics (Zago et al. 2011). Inoculum of 1% was standardized by diluting or concentrating bacterial cells to
9.0±0.2 log CFU/mL (cells number determined by direct microscopic count using Thoma counting chamber). Whey
culture was incubated in thermostatically-controlled water bath at 30±1°C for 48 hours. At fixed intervals from 0 to
48 hours samples were taken to determine microbial cells count (MRS agar, 30°±1°C, 48 h), and lactose and lactic
acid contents (by HPLC with a ion exchanger column in isocratic conditions) according to the method of Buozas et.
al (1991).
FT-NIR spectra were acquired in transflectance mode using a FT-NIR® - NIRFlex N-500 (BUCHI, Italy)
spectrometer. Analysis were performed using an optic fiber with an optical path of 0.08 mm, submerged directly in
the whey samples at the established intervals. Three measurements were made on each sample, and spectra were
collected in the whole NIR range, from 4000 to 10 000 cm-1 using NIRWare software 1.2 Operator (BUCHI, Italy).
NIR data processing was made using the Unscrambler software v. 9.2 (Camo Inc., Norway). Calibration curves for
the determination of lactose and lactic acid contents, and biomass (microbial count, expressed as log CFU/mL),
were calculated by applying the Partial Least Squares Regression (PLSR) on the averaged and mean centered data
(smoothing Savitzky-Golay: 15 points, polynomial order 2).
- 141 -
Eighty L. plantarum strains, identified on the basis of species-specific PCR for L. plantarum group, with different
M13 PCR fingerprinting profiles and coming from different matrixes, were screened for the presence of msa and
bsh genes, that are considered to be associated with probiotic features. Thirty-four (Table 1) out of the 80 strains
showed the expected amplicons for both genes. These 33 strains and the L. plantarum type strain ATCC14917 were
selected for further characterization.
Table 1 Lactobacillus plantarum strains used for characterisation.
Strains
Origin
Strains
Origin
Lp751
Pecorino Pisano Cheese
50339
Olive Brine
Strains
50357
Origin
Olive Brine
Lp752
50341
Olive Brine
50358
Olive Brine
Lp755
50343
Olive Brine
50360
Olive Brine
Lp793
Canestrato Pugliese Cheese
50346
Olive Brine
50361
Olive Brine
Lp794
Monte Veronese Cheese
50347
Olive Brine
50362
Olive Brine
Lp797
Morlacco Cheese
50348
Olive Brine
50363
Olive Brine
Lp799
50350
Olive Brine
50366
Olive Brine
Lp804
50351
Olive Brine
50368
Olive Brine
Lp813
Spressa Cheese
50352
Olive Brine
50369
Olive Brine
Lp994
Argentinian Cheese
50353
Olive Brine
50371
Olive Brine
50337
Olive Brine
50356
Olive Brine
50372
Olive Brine
ATCC 14917
Type Strain
All 34 strains demonstrated the ability to hydrolyze both sodium glycodeoxycholate and sodium taurodeoxycholate,
as shown by halos around colonies after growth in MRS-GDCA and by the appearance of white opaque colonies
after growth in MRS-TDCA, respectively. A relevant property of candidate probiotics is BSH activity, which
involves deconjugation of bile salts to primary bile salts, protects bacteria from the toxicity of conjugated bile salts,
being considered a detoxification mechanism of vital importance to bacterial communities (such as lactobacilli),
which are typically associated to the human gastro intestinal tract. All 34 L. plantarum strains possessed the bsh
gene and expressed BSH activity. Schmidt et al. (2001) also showed that, at least in lactobacilli, bile salt resistance
could not be related to the presence of BSH. BSH activity, however, is a widespread trait in L. plantarum (Zago et
al., 2011).
rib operon
2,0
1,8
1,6
1,4
1,2
1,0
0,8
0,6
0,4
0,2
0,0
Lp994
Lp804
Lp799
ATCC14917
Strains
Lp797
Lp794
Lp793
Lp755
Lp752
Lp751
Figure 1 Expression level of tested strains.
Lp813
Log 10 2^‐ddCt
3.1 Detection and transcription analysis of rib operon
In order to investigate the potentiality of the 34 L. plantarum strains to produce riboflavin, a PCR based method
was applied. Among all the strains analysed, only 10, from dairy matrix, and type strain ATCC 14917 highlighted
the presence of complete rib operon and these strains were subject of further studies of gene expression.
Transcription analysis of rib operon revealed that the strain ATCC14917 showed the high level of expression
followed by Lp794. Lp 813 was used as calibrator to normalize the expression level (Figure 1).
- 142 -
These strains were first tested to verify their ability to grow in RAM medium which not contain riboflavin. All
strains grew, and the amount of the riboflavin produced and released into RAM were detected by a microbiological
assay using a strain auxotroph for riboflavin. The standard curve carried out with L rhamnosus ATCC 7469 on the
basis of OD660 values obtained with increasing amounts of riboflavin in RAM medium gave a linear response (R2=
0.9719). The interpolation of OD660 values, obtained by adding 2%, 5% or 10% of L. plantarum spent broths, to
RAM on the standard curve allowed to determine the amount of riboflavin produced by each strains.
Table 2 shows that L. plantarum ATCC 14917 is the highest producer of free riboflavin, whereas Lp 813 was the
lowest. The amount of riboflavin produced is in accordance with the relative level of gene expression determined
by RT-qPCR.
Table 2 Absorbance values at different concentration of each supernatant produced by tested strains.
Abs 660 nm
Strains
2%
5%
10%
Lp751
0,9220
1,1311
1,1612
Lp752
1,0930
1,0798
1,2458
Lp755
0,7877
0,9653
1,1022
Lp793
1,2045
1,4043
1,3314
Lp794
1,2496
1,4632
1,4146
Lp797
0,9551
1,2796
1,3391
Lp799
0,9331
1,0395
1,1697
Lp804
1,1928
1,4628
1,5454
Lp813
0,0592
0,2484
0,6087
Lp994
0,8594
0,8767
1,3059
ATCC14917
1,3425
1,4749
1,3379
These results indicated that all the examined strains were able to grow in the absence of the vitamin, thus indicating
that these strains encoded a complete and functional riboflavin biosynthetic pathway and they were able to release
this compound in the medium.
3.2 Evaluation of biomass production by Near Infrared Spectroscopy
Adaptability of Lactobacillus plantarum strains tested on the pasteurised whey was demonstrated by the
fermentation trend, supported by the microbial growth values resulting from the performed samplings. Within 48
hours, the maximum fermentation period, strains reached growth values of order 9 log CFU/mL, demonstrating
how this species was able to multiply, even in non-optimal growth conditions, and justifying its presence in many
environmental niches, as reported in literature (De Vries, 2006).
PLS regression applied to NIR results proved to be very satisfactory for all parameters, as shown in Table 3. In all
cases high correlation coefficients and good RMSEP values in validation, using models with a low number of
principal components (PCs) were obtained. Based on these statistical indexes, the NIR prediction was in agreement
with data resulting from the use of the reference methods.
Table 3 NIRS Calibration and Validation curves: Lactose, Lactic Acid and Biomass determination.
Sample set
Parameter
Range
R
Lactose
Lactic Acid
Biomass
0.24-3.56 (g/100g)
1.093-3.49 (g/100g)
7-9 (log CFU/mL)
0.9885
0.9893
0.8902
Calibration
RMSEC
(g/100g)
0.0451
0.0579
0.2531
SEC
(g/100g)
0.0459
0.0590
0.2586
R
0.9224
0.9585
0.9222
Validation
RMSEP
(g/100g)
0.1802
0.1245
0.2070
SEP (g/100g)
0.1713
0.1270
0.2130
The NIR proposed regression models were very satisfactory for all of the three considered analytes. Usually SEP is
higher than SEC, but in the case of biomass produced with Lactobacillus plantarum it turned out to actually be
lower. This study demonstrated that the developed model gave an adequate representation of the fermentation
process (Tamburini, 2003). To identify the specific absorption bands, related to the determination of lactic acid and
lactose, and the evaluation of biomass content, the second derivative of NIR spectra was computed and a
relationship between bands intensity and concentration was noticed: the NIR bands that increased with the
incubation time were located in the same spectral region for all the three calibrated parameters (Williams 2001).
The use of an optic probe proved to be a viable alternative to existing methods of fermentation monitoring,
particularly with respect to biomass determination. A complex analytical matrix, such as a culture medium with
suspended cells, at varying concentration wasn’t an impediment for a rapid, reliable, and accurate determination of
the studied components.
- 143 -
4. Conclusions
This study revealed important among the phenotypic traits in Lactobacillus plantarum strains and highlighted the
possibility to designed multiple coltures to cooperatively link strains showing the widest range of industrial and
probiotic features.
More specifically, the obtained results showed that the strains display probiotics and nutraceutical potentialities and
they can, therefore, considered candidates for inclusion as added cultures for the manufacture of functional foods
Although the most important characteristics of probiotic bacteria are their beneficial effects in host health, the
evaluation of technological traits such as growth and survival in food, e.g. milk-based media, and during product
manufacturing and shelf life, is important for the selection of strains for food applications. Further studies are in
progress to enhance the ability of strains to produce high amount of biomass, through respiration.
5. References
Bouzas J, Kantt CA, Bodyfelt F, Torres JA (1991) Simultaneous determination of sugars and organic acids in cheddar cheese by
high-performance liquid chromatography. J Food Sci 56: 276-278.
De Vries M.C., Vaughan E.E., Kleerebezem M., de Vos W.M. (2006) Lactobacillus plantarum - survival, functional and
potential probiotic properties in the human gastrointestinal tract. Int. Dairy J 16: 1018-1028.
Horwitz (2007) Official methods of analysis of AOAC International, 18th ed., online. AOAC International, Gaithersburg, Md.
Remagni MC (2011) Application of spectroscopic techniques for monitoring biotransformation processes using Lactobacillus
plantarum in optimising milk whey destination. In Proc.s of the 16th Workshop on the Developments in the Italian PhD
Research on Food Science Technology and Biotechnology, Lodi, 21-23 September, 2011.
Rossetti L, Giraffa G (2005) Rapid identification of dairy lactic acid bacteria by M13-generated, RAPD-PCR fingerprint
databases. J Microbiol Meth 63: 135-144.
Schmidt EJ, Boswell JS, Walsh JP, Schellenberg MM, Winter TW, Li C, Allman CW, Savage PV (2001) Activities of cholic
and acid-derived antimicrobial agents against multidrug-resistant bacteria. J Antimicrob Chemoth 47: 671-674.
Tamburini E, Vaccari G, Tosi S, Trilli A (2003) Near-Infrared Spectroscopy: A tool for monitoring submerged fermentation
processes using an immersion optical-fiber probe. Appl Spectrosc 57: 132-138.
Torriani S, Felis GE, Dellaglio F (2001) Differentiation of Lactobacillus plantarum, L. pentosus, and L. paraplantarum by recA
gene sequence analysis and multiplex PCR assay with recA gene-derived primers. Appl Environ Microbiol 67: 3450-3454.
Walsh PS, Metsger DA, Higuchi R (1991) Chelex® 100 as a medium for simple extraction of DNA for PCR- based typing from
forensic material. Biotechniques 10: 506-513.
Williams PC, Norris K (2001) Near infrared technology in the agricultural and food industries. Ed by P. Williams and K. Norris
American Association of Cereal Chemists, St. Paul, MN, USA.
Zago M, Fornasari ME, Carminati D, Burns P, Suarez V, Vinderola G, Reinheimer J, Giraffa G (2011) Characterization and
probiotic potential of Lactobacillus plantarum strains isolated from cheeses. Food Microbiol 28: 1033-1040.
Acknowledgment: Special thanks to Sacco srl having made possible the conclusion of this PhD work.
- 144 -
Effects of SAR (Systemic Acquired Resistance) Inducers
on Quality and Safety of the Grape Products
Antonietta Ruggiero (antonietta.ruggiero@unimi.it)
Tutor: Prof. Stefania Iametti; Co-tutor: Dr. Marcello Iriti
The effects of two SAR inducers (benzothiadiazole and chitosan) were investigated on volatile isoprenoid (monoand sesquiterpene) and phytosterol (β-sitosterol, stigmasterol and campesterol) content in a grapevine cultivar
(Groppello, autochthonous of Lombardy) and in its respective experimental wines. The efficacy of plant activators
has been also assayed on the control of the potentially toxigenic grape mycoflora, by measuring the mycotoxin
levels in wines.
Effetti degli induttori di SAR (Systemic Acquired Resistance)
sulla qualità e sulla sicurezza alimentare della filiera viti-vinicola
Gli effetti di induttori di resistenza, quali benzotiodiazolo e chitosano, sono stati indagati relativamente al contenuto
di isoprenoidi volatili (mono- e sesquiterpeni) e fitosteroli (β-sitosterolo, stigmasterolo e campesterolo) in una
cultivar di vite (Groppello, autoctona della Lombardia) e nei rispettivi vini sperimentali. E’ stata inoltre valutata
l’efficacia dei trattamenti nel controllo della micoflora, potenzialmente micotossinogena, dell’uva, misurando i
livelli di un’eventuale contaminazione da micotossine nei vini.
Key words: Grape, SAR inducers, bioactive phytochemicals, phytosterols, volatile compounds, mycotoxins.
1. Introduction
In accordance with the PhD project previous described (Ruggiero, 2010), this oral communication reports the main
results of the following activities direct to:
A1) evaluate the phytosterol content in different grape berry and seed tissues, at different phenological stages, and
in experimental wines treated with SAR inducers.
A2) verify the effects of plant activators on volatile compounds content in wine.
A3) assess the levels of mycotoxins in wines.
The improvement of the qualitative aspects of crops should be considered an integral and remarkable part of any
control program of plant diseases. In this view, some typologies of phytoiatric treatments, besides protecting from
pathogens, can increase, at the same time, the content of plant bioactive secondary metabolites. Resistance inducers
are products employed in crop protection able to trigger the plant immune system, unlike the most common
agrochemicals, such as fungicides, directly toxic to the pathogens. The induced resistance to diseases is durable and
unspecific. It is directed towards a broad spectrum of pathogens of different nature (fungi, bacteria, viruses,
nematodes, insects, parasitic plants), and effective also in distal organs from where the treatment occurred. This
phenomenon, defined as systemic acquired resistance (SAR), stimulates a series of plant defense reactions,
including the synthesis of phytoalexins (Gozzo, 2003). These latter, also known as nutraceuticals, are synthesized
by the plant secondary metabolic pathways of phenylpropanoids, isoprenoids and alkaloids in response to
infections, because of their antibiotic activity. In this research project, two plant defence inducers, benzothiadiazole
(BTH, Bion ®, Syngenta) and chitosan (CHT), deserving particular attention because of their efficacy and low
toxicity, have been used. CHT is a natural and low-cost polymer produced by deacetylation of chitin obtained from
the waste products of the crustacean carapace. BTH [benzo-(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester] is
a synthetic compound and a functional analogue of salicylic acid, a plant hormone-like compound deeply involved
in resistance against pathogens. The efficacy of SAR inducers in increasing the synthesis of bioactive metabolites in
different food plants is well documented. In particular, BTH has proven to increase the content of different
phytochemicals (flavonoids, anthocyanins, stilbenes, proanthocyanidins, lycopene and melatonin) in different crops
(grape, tomato, strawberry) (Iriti et al., 2007; Hukkanen et al., 2007). Recent epidemiological studies have
attributed to some plant secondary metabolites antioxidant and antitumor activities, as well as cardio- and
neuroprotective properties, possibly responsible, at least in part, of the health benefits associated with adequate and
regular consumption of fruit and vegetables (Heber, 2004). At this regard, certain phytoiatric practices could
increase the content of some bioactive compounds in numerous plant foods, avoiding much more laborious and
expensive techniques of genetic engineering, not yet accepted in Italy, in order to obtain similar results. In addition
to these qualitative aspects, the use of plant activators may also be beneficial in terms of food security.
- 145 -
2.1 Plant material
Open field treatments with plant activators (Table 1), performed in 2009 and 2010, were carried out with a spray
lance. The trial was set up as a complete randomized block design in 4 replications, with 10 vines (a parcel) per
treatment in each block. Plants were nebulized every 10 days, approximately, according to the meteorological
conditions, from the beginning of grape susceptibility to fungal diseases until the complete véraison (i.e.
approximately from the half of April to the end of July). Sampling was scheduled at two phenological phases:
prevéraison (‘pea-size’ stage, before the end of the berry’s growth cycle) and 100% véraison (stage when berry
begin to turn color and soften). Bunches were randomly collected from plants during the morning and stored at 20°C.
Table 1 Open field treatments applied every 10 days on Groppello parcels
Treatment
CHT (0.01% chitosan)
CHT-Cu (0.01% chitosan + 150 g hL-1 copper hydroxide)
BTH (0.3 mM benzothiadiazole)
Fungicides (penconazole + methyldinocap, positive control)
No treatment (negative control)
2.2 Wine samples
Groppello experimental wines (microvinificates), one for each treatment, were produced by standard
microvinification techniques, in the Centro Vitivinicolo Provinciale of Brescia (Italy), and stored at 4°C until
analyses.
2.3 Phytosterol extraction
The extraction of plant sterols was performed following Ruggiero (2011) both for berry tissues and experimental
wines.
2.4 Phytosterols gas chromatographic analysis
The obtained dry samples were analyzed by GC to determine the content of sterols and their structure in accord
with Ruggiero (2011).
2.5 Volatile compounds
The headspace sampling and the instrumental analysis were performed following Rosillo et al. (1999).
2.6 Wine mycotoxin analyses
An aliquot (1 mL) of each wine was mixed with a double volume of ethyl acetate, vortexed for 1 min and allowed
to stand till the partition of the two layers. The organic portion (200 μL) was dried under nitrogen gas and then
resuspended in 250 μL of ethyl acetate. The mixture was dried under nitrogen and, after the addition of methanol
(50 μL), centrifuged at 12,000g for 1 min. The supernatant was subjected to analysis by UPLC-MS/MS according
to Monbaliu et al. (2009).
3.1 Phytosterols
Phytosterols (plant sterols) are triterpenes that have both a metabolic role and a structural function. Therefore they
play major roles in several areas, namely in pharmaceuticals (production of therapeutic steroids) and nutrition (anticholesterol additives in functional foods, anti-cancer properties) (Fernandes, 2007). In all plant tissues, phytosterols
exist in the form of free sterols, steryl esters, steryl glycosides and acylated steryl glycosides. More than 100 types
of phytosterols have been reported in plant species, but the more abundant are β-sitosterol, stigmasterol and
campesterol. The plant sterol content may vary depending on many factors, such as genetic background, growing
conditions, tissue maturity and postharvest changes (Piironen et al., 2003). A detailed analysis of the sterol content
in grape products (berries and wine) was reported, for the first time, in this work. The table 2a,b shows the
phytosterol amounts in all berry (flesh and skin) and seed tissues from Groppello cultivar, at two different
phenological stages, pre-véraison and véraison, and in two years. In general, β-sitosterol is the main component in
the berry tissues, with the highest levels in the flesh, followed by skin and seeds respectively. According to a
previous work (Bauman, 1977), the sterol content decreased during ripening, with values less than half. Our results
also show the same trend in fleshes (Tab. 2a,b). About seeds it is true for β-sitosterol and campesterol (Tab. 2a,b).
Stigmasterol and campesterol were present in very low quantities in both grow stages (Tab. 2a,b). With regard to
the effects of inducers on β-sitosterol content, the most effective treatments in seeds were CHT and BTH in prevéraison and in véraison, respectively, in 2009, only CHT in the two phenological stages in 2010. In fleshes and
skins, the most effective treatment was CHT/Cu at véraison, in 2009, and at pre-véraison, in the 2010. In fleshes, at
véraison 2010, the highest levels of β-sitosterol were recorded in BTH treated sample.
In general, the data on experimental wines indicated that the treatments with SAR inducers increased the plant
sterols. In fact, β-sitosterol, stigmasterol and campesterol were more abundant in microvinificates obtained from
grapes treated with CHT, CHT/Cu and BTH compared to those from conventional fungicide-treated grapes. In
- 146 -
particular, the β-sitosterol was the most plentiful in all wines, while stigmasterol was the lowest (Fig. 1a,b).
Table 2a,b
Phytosterols contents in grape seeds, fleshes and skins of Groppello vintage 2009 (a) and 2010 (b) (mg/100 g dry
weights). Number in parenthes represents the standard error (n = 3).
Table 2 a
Sample
β -Sitosterol
Stigmasterol
Campesterol
CTRL
CHT
CHT/Cu
BTH
Fungicides
pre-vèraison
100.30 (±3.03)
112.25 (±3.07)
92.96 (±1.97)
86.36 (±0.67)
86.03 (±0.94)
vèraison
72.43 (±0.39)
70.58 (±2.01)
64.62 (±1.43)
72.43 (±0.38)
62.53 (±0.20)
S eeds
pre-vèraison
7.48 (±0.80)
9.52 (±0.42)
8.21 (±0.16)
8.12 (±0.38)
8.29 (±0.14)
CTRL
CHT
CHT/Cu
BTH
Fungicides
289.00 (±8.20)
262.97 (±4.45)
262.24 (±8.55)
282.59 (±6.30)
282.63 (±2.99)
53.30(±2.15)
52.91 (±0.28)
60.25 (±3.74)
59.38 (±2.02)
46.79 (±1.12)
Fleshes
10.14 (±0.76)
8.19 (±0.14)
8.37 (±0.27)
8.70 (±0.44)
8.87 (±0.42)
2.65 (±0.56)
2.68 (±0.06)
2.50 (±0.22)
2.31 (±0.42)
1.89 (±0.38)
16.05 (±0.79)
15.04 (±0.21)
14.9 (±0.27)
14.84 (±0.28)
15.23 (±0.41)
2.79 (±0.75)
3.80 (±0.64)
2.69 (±0.20)
2.87 (±0.19)
2.29 (±0.56)
CTRL
CHT
CHT/Cu
BTH
Fungicides
170.61 (±2.38)
179.32 (±3.74)
172.59 (±2.62)
169.99 (±2.91)
183.34 (±4.90)
73.67 (±2.23)
75.45 (±1.18)
79.76 (±3.98)
77.38 (±1.48)
71.55 (±1.37)
S kins
10.95 (±0.44)
10.86 (±0.64)
10.72 (±0.41)
11.52 (±0.37)
10.55 (±0.21)
2.77 (±0.18)
3.18 (±0.19)
3.04 (±0.20)
3.19 (±0.19)
2.14 (±0.13)
11.05 (±0.46)
10.81 (±0.11)
10.81 (±1.30)
10.45 (±0.07)
10.1 (±0.49)
4.05 (±0.27)
3.91 (±0.09)
3.85 (±0.14)
3.74 (±0.11)
3.80 (±0.33)
vèraison
8.25 (±0.11)
8.88 (±0.38)
8.89 (±0.32)
9.27 (±0.38)
7.06 (±0.17)
pre-vèraison
10.80 (±0.37)
12.20 (±0.42)
10.67 (±0.23)
10.37 (±0.24)
10.19 (±0.24)
vèraison
6.37 (±0.05)
6.62 (±0.14)
5.72 (±0.17)
6.20 (±0.11)
4.62 (±0.14)
Table 2 b
β− Sitosterol
Sample
Stigmasterol
Campesterol
CTRL
CHT
CHT/Cu
BTH
Fungicides
pre-vèraison
120.91 (±1.18)
140.91 (±3.21)
107.53 (±4.12)
108.07 (±2.88)
116.23 (±2.16)
vèraison
77.47 (±2.06)
81.72 (±1.40)
79.25 (±2.21)
70.20 (±2.63)
66.88 (±0.28)
Seeds
pre-vèraison
10.55 (±0.29)
12.40 (±0.31)
9.94 (±0.74)
9.20 (±0.33)
9.59 (±0.29)
CTRL
CHT
CHT/Cu
BTH
Fungicides
285.65 (±4.32)
283.96 (±6.86)
311.65 (±3.60)
251.28 (±0.80)
264.35 (±0.20)
64.53 (±0.28)
67.75 (±1.31)
69.12 (±0.76)
69.47 (±0.32)
56.65 (±1.94)
Fleshes
10.06 (±0.31)
10.11 (±0.37)
12.19 (±0.52)
9.68 (±0.49)
10.03 (±0.46)
2.34 (±0.22)
2.05 (±0.04)
2.35 (±0.15)
2.21 (±0.09)
1.67 (±0.10)
15.41 (±0.33)
15.22 (±0.55)
17.94 (±0.32)
14.07 (±0.33)
13.39 (±0.44)
3.28 (±0.06)
3.38 (±0.07)
2.73 (±0.10)
3.54 (±0.14)
2.69 (±0.08)
CTRL
CHT
CHT/Cu
BTH
Fungicides
244.63 (±6.80)
212.84 (±3.08)
252.76 (±1.33)
214.06 (±6.06)
231.53(±10.25)
97.99 (±2.94)
106.18 (±2.26)
92.97 (±2.65)
95.14 (±4.48)
96.16 (±0.72)
Skins
16.33 (±0.30)
14.27 (±0.70)
16.21 (±0.22)
14.60 (±0.59)
16.30 (±0.59)
4.63 (±0.23)
5.89 (±0.43)
3.81 (±0.06)
4.78 (±0.50)
3.58 (±0.04)
12.11 (±0.28)
12.05 (±0.29)
13.93 (±0.28)
11.76 (±0.92)
12.54 (±0.41)
5.49 (±0.43)
5.53 (±0.40)
4.70 (±0.13)
4.86 (±0.25)
5.15 (±0.24)
vèraison
9.93 (±0.23)
11.58 (±0.17)
10.49 (±0.11)
9.41 (±0.30)
8.50 (±0.03)
pre-vèraison
13.77 (±0.23)
15.82 (±0.25)
12.04 (±0.34)
11.27 (±0.37)
13.09 (±0.15)
vèraison
7.52 (±0.08)
7.50 (±0.10)
9.13 (±1.03)
6.42 (±0.15)
5.49 (±0.04)
Figure 1a,b Phytosterols content in experimental wines of Groppello vintage 2009 (a) and 2010 (b) (μ mol/L).
Figure 1 b
2.5
2,5
2
2
1.5
1,5
μ mol / L
μ mol / L
Figure 1 a
1
0.5
1
0,5
0
0
CTRL
CHT
CHT/Cu
BTH
β-Sitosterol
CTRL
Fungicides
Stigmasterol
- 147 -
CHT
Campesterol
CHT/Cu
BTH
Fungicides
Table 3 Volatile compounds (ng/L) detected in microvinificates, vintage 2009, produced with elicitor-treated grapes.
Volatile compounds
Acetals
1-methoxy-ethoxy-ethane
1,1-diethoxy-ethane
1-ethoxy-1-pentoxyethane
1,1-di(1-methyl-butoxy) ethane
Σ Acetals
Alcohols
2-methyl-1-propanol (isobutanol)
n-butanol
3-methyl-1-butanol (isopentanol)
n-octanol
Σ Alcohols
Aldehydes
3-methyl butanal
2-methyl butanal
benzaldehyde
4-methyl benzaldehyde
Σ Aldehydes
Esters Acetates
ethyl acetate
S-methyl thioacetate
propyl acetate
3-methyl butyl acetate
2-methylbutylacetate
hexyl acetate
Σ Esters Acetates
Esters Butanoates
ethyl butanoate
ethyl 2-methyl butanoate
ethyl-3-methyl butanoate
diethyl butanoate
Σ Esters Butyrate
Esters Propionates
ethyl propionate
ethyl lactate
Σ Esters Propionate
Esters Aliphatic
ethyl hexanoate
ethyl 3-hexenoate
ethyl heptanoate
methyl octanoate
methyl salicylate
ethyl octanoate
ethyl nonanoate
ethyl decanoate
Σ Esters Aliphatic
Σ Esters
Ketones
2-pentanone
2,3-pentanedione
4-methyl 2-heptanone
beta-damascenone
Σ Ketones
Terpenes
Linalool
Other
1,3-di-tert-butyl benzene
Σ Volatile compouds
CTRL
Groppello
CHT
CHT/C
u
BTH
0
2228
471
240
2939
11
9009
2033
935
11987
0
11643
3561
1787
16991
45
8120
1718
659
10542
6359
4918
4190
122
43479
62
48904
38
39243
95
0
49960
0
53883
0
43471
0
51294
91
30
0
232
353
158
17
0
0
175
149
29
0
0
179
168
33
0
0
201
39201
149
634
6980
1486
50
48500
24932
86
182
7767
2051
66
35085
28547
0
259
5534
2678
36
37054
48951
220
711
8827
1818
82
60609
1127
457
465
119
2169
761
195
274
299
1529
709
216
192
154
1271
1257
264
306
374
2201
4597
46602
3.2 Volatile compounds
Aroma is an important factor in quality control
and quality assurance of foods, but in wine,
this factor is possibly the most important. It is
produced by a complex balance of more than
800 volatile compouds in different ranges of
concentrations, and with different volatilities
and polarities. These compounds have
differentiated origins, from grapes (varietal
aroma), from alcoholic fermentation under
anaerobic conditions (fermentative aroma) and
the bouquet, which results from the
transformation of the aroma during ageing.
The highest concentrations of acetals and
alcohols were detected in CHT/Cu and CHT
microvinificates, respectively (Tab. 3). BTH
treatment rised the levels of all esters in wines:
acetates, butanoates, propionates and aliphatic
esters (Tab. 3). Elicitors had no effects on
aldehydes and ketones, whereas CHT/Cu was
the most effective treatment in increasing the
terpene linalool (Tab. 3). The analyses on
experimental wine from vintage 2010 are in
progress. To the best of our knowledge, no
study has been published on the effects on
plant activators on red wine volatile aromatic
compounds.
3.3 Mycotoxins
Mycotoxins are fungal secondary metabolites
widely distributed in nature, which can be
detected in soil and many food plants. They
are synthesized in particular growth conditions
by some genera of toxigenic fungi
(Aspergillus, Penicillum, Fusarium), as a
2638
1382
1194
2516
result of field or post-harvest infections, and
1455
4987
2293
7467
many important plant and animal foods are
4094
6369
3487
9983
susceptible of contamination. The most
important groups of mycotoxins include
1672
1957
1347
2761
aflatoxins, ochratoxins, and Fusarium toxins.
29
43
23
48
20
37
27
28
The main mycotoxin of concern in grape is
5
5
4
8
ochratoxin A (OTA), produced by the black
0
0
0
0
Aspergillus spp. (Aspergillus section Nigri).
847
829
737
1230
Because the proper use of agrochemicals is
1
0
0
0
part of a careful vineyard management, in
19
27
15
188
addition to other viticultural practices, we
2593
2897
2152
4262
evaluated the level of OTA, aflatoxin B2
57356
45881
43965
77054
(AFB2), G1 (AFG1) and G2 (AFG2) in
experimental wines produced with grapes
160
161
153
149
treated with both elicitors and conventional
496
0
0
0
fungicides.
53
56
44
90
8
24
8
13
In all the samples (2009 and 2010), all
716
241
205
251
mycotoxins were detected at a concentration
lower than 6 pg/mL (limit of detection, LOD,
8
8
11
9
0.15 ng/mL). Figure 2 shows the
chromatographic profile of the standard
30
19
16
36
samples whereas the wine extract (sample
111362 112193 104837 139386
Groppello CHT 2010) are reported in figure 3.
Therefore, all microvinificates contained levels of OTA below the 2 ng/mL (limit established in wine, must and
grape juice by the European Community - (EC) No 1881/2006). In general, it seems that, all treatments in open
field prevent the infection of grapes with toxigenic fungi, or reduce their synthesis of mycotoxins.
- 148 -
To the best of our knowledge, the efficacy of plant activators in reducing the mycotoxin contamination of
foodstuffs has been previously investigated only in wheat and barley. In both cereals, CHT treatment significantly
reduced the Fusarium head blight disease caused by Fusarium culmorum, as well as the contamination of grains
with the trichothecene mycotoxin deoxynivalenol, under both glasshouse and field conditions (Khan and Doohan,
2009).
Figure 3 Typical UPLC-MS/MS chromatogram of a
wine extract (sample Groppello CHT 2010). The
+
fragmentation transitions were: (m/z) 404.3→257.5 for
OTA, 315.3→287.6 for AFB2, 329.3→243.6 for AFG1,
331.3→189.6 for AFG2.
Figure 2 UPLC-MS/MS chromatogram of the mycotoxin
+
standards. The fragmentation transitions were: (m/z)
404.3→257.5 for OTA, 315.3→287.6 for AFB2,
329.3→243.6 for AFG1, 331.3→189.6 for AFG2.
Vino_Ext_10a
6.83
99
7.33
2: MRM of 1 Channel ES+
404.3 > 257.5 (Ochr_A)
684
Mix_1
2: MRM of 1 Channel ES+
404.3 > 257.5 (Ochr_A)
1.04e4
%
%
7.30
99
OTA
-1
4.20
Vino_Ext_10a
4.40
99 4.13 4.26
4.60
4.50
4.80
4.69
5.00
4.94
5.20
5.40
5.60
5.80
6.00
6.20
6.40
6.60
6.80
7.00
7.20
5.13
AFB2
7.40
7.60
7.80
1: MRM of 3 Channels ES+
315.3 > 287.6 (B2)
1.25e3
-1
4.00
4.20
4.40
4.60
5.00
5.20
5.40
5.60
5.80
6.00
6.20
6.40
6.60
6.80
7.00
7.20
7.40
7.60
7.80
315.3 > 287.6 (B2)
1.43e4
4.80
5.00
5.20
5.40
5.60
5.80
6.00
6.20
6.40
6.60
6.80
7.00
7.20
7.40
7.60
7.80
329.3 > 243.6 (G1)
1.69e4
4.60
4.80
5.00
5.20
5.40
5.60
5.80
6.00
6.20
6.40
6.60
6.80
7.00
7.20
7.40
7.60
7.80
331.3 > 189.6 (G2)
8.23e3
4.60
4.80
5.00
5.20
5.40
5.60
5.80
6.00
6.20
6.40
6.60
6.80
7.00
7.20
7.40
Mix_1
4.80
4.77
%
%
99
-1
4.20
Vino_Ext_10a
99
4.40
4.60
4.80
5.00
5.20
5.40
5.60
5.80
6.00
6.20
6.40
6.60
6.80
7.00
7.20
4.82 4.94
5.24
4.25
7.40
7.60
7.80
331.3 > 189.6 (G2)
1.51e3
-1
AFG1
4.20
4.40
4.60
4.70
99
%
%
4.00
Mix_1
-1
4.20
Vino_Ext_10a
4.40
4.60
4.80
5.00
5.20
5.40
5.60
5.80
6.00
6.20
6.40
6.60
6.80
7.00
7.20
4.15
4.26 4.36
4.66 4.77
4.97
5.17
7.40
7.60
7.80
329.3 > 243.6 (G1)
1.01e3
-1
4.00
4.20
Mix_1
AFG2
4.40
4.35
99
%
%
99
-1
4.20
4.40
4.60
4.80
5.00
5.20
5.40
5.60
5.80
6.00
6.20
6.40
6.60
6.80
7.00
7.20
7.40
7.60
Time
7.80
-1
4.00
4.20
4.40
7.60
Time
7.80
4. References
Bauman JA (1977) Effects of maturation on the lipid content of Concord grape. Amer J Enol Vitic 28: 241-244.
Cocito C, Delfini C (1994) Simultaneous determination by GC of free and combined fatty acids and sterols in grape musts and
yeasts as silanized compounds. Food Chem 50: 297-305.
Fernandes P, Cabral JMS (2007) Phytosterols: Applications and recovery methods. Bio Tech 98: 2335-2350.
Gozzo F (2003). Systemic acquired resistance in crop protection: from nature to a chemical approach. JAFC 51: 4487-4503.
Heber D (2004). Phytochemicals beyond antioxidation. J Nutr 134: 3175S-3176S.
Hukkanen AT et al (2007). Benzothiadiazole induces the accumulation of phenolics and improves resistance to powdery mildew
in strawberries. JAFC 55: 1862-1870.
Iriti M et al (2007). Chemical-induced resistance against post-harvest infection enhances tomato nutritional traits. Food Chem
105: 1040-1046.
Khan M.R., Doohan F.M. (2009) Comparison of the efficacy of chitosan with that of fluorescent pseudomonad for the control of
Fusarium head disease of cereals and associated mycotoxin contamination of grain. Biological Control 48: 48-54.
Monbaliu S, Van Poucke C, Van Peteghem C, Van Poucke K, Heungens, De Saeger S (2009) Development of a multimycotoxin liquid chromatography/tandem mass spectrometry method for sweet pepper analysis Rapid Commun Mass
Spectrom 23: 3-11.
Piironen V, Toivo J, Lampi A (2003) Plant sterols in vegetables, fruits and berries, J Sci Food Agric 83: 330-337
Rossillo L, Salinas R, Garijo J, Alonso GL (1999) Study of volatiles in grapes by dynamic headspace analysis application to the
differentiation of some Vitis vinifera varieties J Chrom A 847: 155-159
Ruggiero A (2010) Effects of SAR (Systemic Acquired Resistance) inducers on quality and safety of the grape products. In
Proc.s of the 15th Workshop on the Developments in the Italian PhD Research on Food Science and Biotechnology, Napoli
Portici (Italy), September 15-17, 2010, pp. 361-362.
Ruggiero A (2011) Effects of SAR (Systemic Acquired Resistance) inducers on phytosterol content of the grapevine products. In
Proc.s of the 16th Workshop on the Developments in the Italian PhD Research on Food Science and Biotechnology, Parco
Tecnologico Padano Lodi (Italy), September 21-23, 2011, pp. 269-270.
Salinas MR, Alonso GL, Esteban-Infantes FJ (1994) Adsorption-thermal desorption-gas chromatography applied to the
determination of wine aromas. J Agric Food Chem 42: 1328-1331.
- 149 -
Different Applications of the Electronic Nose in Coffee and Other Foodstuff
Veronica Sberveglieri (veronica.sberveglieri@unimore.it)
Dept. of Agricultural and Food Sciences, University of Modena and Reggio Emilia, Italy
Tutor: Prof. Patrizia Fava, Prof. Andrea Pulvirenti
This PhD thesis concerned the development of a model of analysis fast and economic applicable to different types
of food. In particular the study was focused on two projects related to coffee. The first has concerned the
identification of the geographical origin before and after the roasting process with the joint use of various
techniques including the electronic nose (EN EOS 835) and the gas chromatograph coupled with mass
spectrometer. In this way the composition of the volatile fraction (consisting of hundreds of volatile substances)
was determined by different conditions. The second project was aimed to test the ability of electronic nose (EN
EOS 835) in the early detection of fungal contamination in the early stages of the food chain of green coffee.
Diverse applicazioni del naso elettronico nel caffè e in altri alimenti
Questa tesi di dottorato ha riguardato lo sviluppo di un modello di analisi rapida ed economica applicabile a diversi
tipi di alimenti. In particolar modo lo studio si è focalizzato su due progetti riguardanti il caffè. Il primo ha
riguardato l’individuazione della provenienza geografica del caffè prima e dopo la tostatura con l’utilizzo congiunto
di diverse tecniche tra cui il naso elettronico e il gascromatografo con spettrometro di massa. In questo modo la
composizione della frazione volatile (costituita da centinaia di sostanze volatili) è stata determinata in diverse
condizioni. Il secondo progetto è stato quello di verificare la capacità del naso elettronico (EN EOS 835) per la
diagnosi precoce della contaminazione fungina nelle prime fasi della catena alimentare di caffè verde.
Key words: Electronic nose, coffee, mold, headspace, geographical origin, chromatography-mass spectrometry.
1. Introduction
In accordance with the PhD thesis project previously described, this oral communication reports the main results in
food application of an array of semiconductor chemical sensors. Conductometric semiconductors sensors are the
most promising devices among solid-state chemical sensors, due their small dimension, low cost, low power
consumption, on-line operation and high compatibility with microelectronic processing (Sberveglieri et al., 2012).
The progress made on Si technology for micromaching and micro fabrication foreshadows the development of low
cost, small size and low power consumption devices, suitable to be introduced in portable instruments and possibly
in biomedical systems.
The materials for chemical sensing that were investigated covered a wide spectrum of metal oxides (MOX) like:
SnO2, In2O3, WO3, MoO3, TiO2, Ga2O3, and several mixed oxides like SnO2-In2O3, TiO2-Fe2O3 and TiO2-WO3. It’s
shown in Fig 1 a picture of the devices applied in this thesis.
The sensing layers were prepared by physical vapor deposition (PVD) techniques, in particular RF magnetron
sputtering, which are easily scalable on the industrial scale, and deposited both on alumina and silicon
micromachined substrates. Novel activities point towards nanostructured systems with reduced dimensionality like
metal-oxide nanowires and nanostructures, and to their implementation in functional devices. The fundamental
sensing mechanism of semiconductor gas sensors relies on a change in electrical conductivity due to the interaction
process between the surface complexes and the gas molecules to be detected. Unfortunately, sensors still suffer
from lack of selectivity and long-term stability: they are not able to recognize single chemical compounds, their
analytical approach being based on unspecific chemical interactions (redox processes on semiconductor surface).
However, the mentioned limits have not restricted the interest and the use of these tools. ENs have indeed found
applications in many fields, from environmental monitoring to medical diagnostic and food analysis.
Figure 1 Picture of a MOX sensor, showing its very small size.
- 150 -
2. Electronic Nose
Figure 2 Picture of electronic nose system.
Electronic Noses (EN), as shown in figure 2 are useful in applications domain like environmental monitoring and
food processing control. Analyze gaseous mixtures for discriminating between different (but similar) mixtures and,
in the case of simple mixtures, quantifying the constituents’ concentration.
There is in fact a strong and growing request from the market for artificial olfactory systems dedicated to
environmental monitoring and food processing control, Electronic Noses (ENs) are instruments simulating the
mammalian olfaction by means of a semi-selective chemical gas sensor array that can identify differences in
volatile patterns for different samples (Persaud and Dodd, 1982).
ENs do not separate a complex mixture in its single constituents: the interaction of the global sample head-space on
the surface of the sensor sensitive layer induces a variation on a electrical characteristic of the sensor.
Over the last years, SENSOR Lab. (http://sensor.ing.unibs.it) has been especially working on food quality and
safety evaluation and on security application (Pearce et al., 2006). The ability in food analysis relies on recognition
of the differences in the volatile headspace of a sample induced by an adulteration with respect to the native
composition. Since most food adulterations are reflected on volatile chemical profile, ENs appear as excellent
candidates for process monitoring, freshness evaluation, shelf-life investigation, sensory and authenticity
assessment, microbial contamination diagnosis, providing for rapid and objective analysis (Peris and EscuderGilabert, 2009).
Among the advantages in using artificial olfactory systems it is worth to remind their flexibility, easiness of use,
low-cost, no or minimal sample pre-treatment demanding and the possibility to work completely stand-alone once
trained.
ENs consist of four main building blocks as shown in Figure 2:
- The sample headspace generation.
- The array of sensors . The generated sample headspace is carried through the sensor chamber, whose
temperature and relative humidity are constantly monitored by means of dedicated sensors.
- The electronic circuit either for controlling the sensors or the analogic - digital conversion
- A computer manages the overall system operation. On it the data analysis is carried out by means of
statistical techniques that reconstruct the olfactory fingerprint of the analyzed samples.
The use of ENs envisages two main steps, being the first the instrument training, during which EN is taught to
recognize the characteristics under study.
The training consists in randomly submitting to EN’s analysis a certain number of samples belonging to different
classes and verifying the skill in separating that classes by means of supervised analysis. The second step is the
validation of the analytical protocol: unknown samples are smelt by the EN and classified by means of
unsupervised statistical analysis.
In accordance with the PhD thesis project previously described, we have applied the study of a model of analysis
fast and economic applicable to different types of food. In particular the study has been focused on two projects for
the coffee.
- 151 -
3.1 Different food matrix
During my PhD thesis project we have applied this new method at different food matrix:
- The fraudulent adulteration of high quality extra virgin olive oil (EVOO) with low quality hazelnut oil is
heavily damaging the European olive oil market and posing a threat on customers’ health. Due to the very
similar composition as respect to fatty acids content, this fraud is extremely difficult to identify (Arlorio et
al.). EN revealed a noteworthy capability in discriminating between pure and hazelnut-diluted EVOO
samples, even at very low dilution levels. This result suggests that ENs can be used as monitoring tool for
a fast evaluation of EVOO.
- The impressive ability shown by Alicyclobacillus spp. (ACB) in contaminating drinks, without at present
any effective early diagnostic tool, has qualified these as major quality control target microorganisms. EN
demonstrated a surprising skill in identifying beverages contaminated by ACB, with correct classification
rates up to 100%, both for peach-and pear-based soft drinks and fruit juices (Walker and Phillips), even
before the production of secondary taint metabolites, usually exploited as contamination markers by
traditional analytical techniques.
3.2 Coffee applications
Discrimination between different kinds of coffee according to their country of origin: geographical origin
traceability of food is a relevant issue for both producers’ business protection and customers’ right safeguard.
Between the most widely consumed beverage, coffee in a valuable one, with an aroma constituted by hundreds of
volatiles. Differentiation of coffee on the basis of geographical origin still a challenging issue, tough possible by
means of chemical techniques. Since the final global volatile composition is also determined by the cultivation
climatic conditions, it is in principle possible to distinguish geographical proveniences by exploiting the differences
in chemical volatile profile (Sberveglieri et al., 2012).
The analyses have been carried out in parallel with chemical classical techniques like HS-SPME coupled with GCMS and the Electronic Nose. Again, have not changed the operation of sample preparation in order to make the
results comparable with these two different techniques.
Early detection of fungal contamination on green coffee: The main toxigenic fungal genera (Aspergillus and
Penicillium) are natural coffee contaminants and are present from the field to the warehouse. One species of the
genus Aspergillus was selected (A.niger type strain A733). The green coffee beans were first contaminated and
incubated in a moist chamber at 27°C for 21 days (analyzed at 0, 4, 6, 8, 11, 16 and 21 days after inoculations) in
order to promote the growth of fungi inoculated and to standardized at 0.6 the activity water (Aw). Coffee beans
were preliminarily sterilized under UV light in order to remove any undesired contamination and to be sure of
having sterile control samples.
The strain was tested in parallel with classical microbiological isolation techniques to quantify the actual
contamination in the days after inoculation and with analytical chemical techniques, like gas chromatography
coupled with mass spectroscopy (GC-MS) with solid-phase microextraction (SPME) for the detection of formation
of any secondary metabolites (Falasconi et al., 2011).
Discrimination between different kinds of coffee according to their country of origin: Green coffee samples grow in
different locations resulted well separated on principal component (PC) plane as shown in Fig. 3. The slight drift
along the PC1 axis shown in Fig. 4 is attributable to natural rearrangements occurring in the samples over the time,
such as oxidative process. This effect on PC1 has been already observed in literature for food matrices. GC-MS
analyses were in good agreement with EN’s results: chemical volatile profile, both for green and roasted samples,
evidenced indeed both qualitative (presence of different compounds) and quantitative (relative percentages)
differences.
Figure 3 e 4 PCA score plot of different kind of coffee from different country of origin (roasted and green).
- 152 -
Early detection of fungal contamination on green coffee: GC-MS analyses evidenced quite different chemical
volatile profiles for uncontaminated and contaminated coffee beans shown in Fig. 6. In particular, a relevant
presence of carbon dioxide, ethanol and ethyl acetate, which are considered to be typical microbial metabolites,
emerged in the headspace of contaminated samples. Sample contamination was also confirmed by the appearance
of anisole, recognized as one of the major volatile contaminants in fungal contaminated coffee. The EN was able to
successfully discriminate contaminated samples of green coffee from non-contaminated ones shown in Fig. 7.
Five/six days of growth were necessary to identify the coffee contamination; this was attained by means of the
monitoring of mold growth on Petri dishes as shown in Fig. 5.
EN could be very valuable tools to evaluate microbiological food quality and safety. Strengths of the EN include
good sensitivity and correlation with data from microbiological tests. It might have other advantages regarding
portability, price and ease of use. Therefore, it has the potential to move from well-equipped chemical laboratories
to industrial routine at-line controls.
Figure 5 Petri dish with the inoculated and non-inoculated coffee.
Figure 6 Comparison between the GC-MS spectra (most abundant compounds) of contaminated and uncontaminated samples.
Figure 7 PCA score plot results of contaminated and uncontaminated samples.
- 153 -
5. References
Arlorio M, Coisson J.D, Boriga M, Travaglia F, Garino C, Zuidmeer I (2010) Olive oil adulterated with hazelnut oils: simulation
to identify possible risks to allergenic consumers. Food Addit Contam 27: 11-18.
Falasconi M, Concina I, Gobbi E, Sberveglieri V, Pulvirenti A, Sberveglieri G (2011) Electronic nose for microbiological
quality control of food products. Int J Electrochem 2012: 12 pages.
Pearce T.C, Schiffman S.S, Nagle T, Gardner J.W (2006) Handbook of Machine Olfaction. Wiley-VcH.
Peris M, Escuder-Gilabert I (2009) A 21st century technique for food control: electronic noses. Anal Chim Acta 638: 1-15.
Persaud K, Dodd (1982) Analysis of discrimination mechanisms in the mammalian olfactory system using a model nose. Nat
299: 352-355.
Sberveglieri G, Baratto C, Comini E, Concina I, Faglia G, Falasconi M, Ferroni M, Gobbi E, Ponzoni A, Sberveglieri V,
Vomiero A, Zappa D (2012) Nanostructured metal oxide gas sensors and Electronic nose at SENSOR. Nanotec IT 13: 2426.
Sberveglieri V, Concina I, Falasconi M, Pulvirenti A, Fava P (2012) Discrimination between different types of coffee according
to their country of origin. (Eds) Sensors and microsystems, Lecture notes in electrical engineering, Springer NY 109: 145149.
Walkers M, Phillips A (2008) Alyciclobacillus acidoterrestris: an increasing threat to the fruit juice industry?. J Food Sci
Technol 43: 250-260.
- 154 -
The Role of Food and Probiotic Microorganisms, and Dietary
Compounds in the Modulation of the Immune Response
Valentina Taverniti (valentina.taverniti@unimi.it)
Tutor: Dr. Simone Guglielmetti
The aim of this PhD research project was to investigate the interaction between the immune system and (i) bacterial
cells and (ii) their components, and (iii) food molecules. Specifically, our experiments were designed to study by
means of in vitro and ex vivo analyses the possible signalling pathways involved in the cross-talk between epithelial
and immune cells, and a dairy bacterium, its purified Surface (S)-layer protein and an anthocyanin fraction
extracted from wild blueberry (Vaccinium Angustifolium).
Il ruolo di microrganismi probiotici e di origine alimentare e di componenti della dieta
nella modulazione della risposta immunitaria
Lo scopo del presente lavoro di dottorato è stato quello di valutare l’interazione tra il sistema immunitario e (i)
batteri e (ii) loro componenti molecolari e (iii) molecole di origine alimentare. Nello specifico, i nostri esperimenti
sono stati condotti al fine di individuare, attraverso analisi in vitro ed ex vivo, le possibili vie di trasduzione del
segnale coinvolte nell’interazione tra cellule epiteliali e immunitarie e un ceppo batterico caseario, la sua proteina
di superficie S-layer e una frazione di antociani estratta da mirtillo selvatico (Vaccinium Angustifolium).
Key words: S-layer protein, Lactobacillus helveticus, Caco-2, U937, anthocyanins.
1. Introduction
In accordance with the original project, in this oral communication we present the results of the following activities:
(A1) selection of bacterial strains with immunomodulatory properties based on the ability to reduce nuclear factor
kappa-light-chain-enhancer of activated B cells (NF-κB) activation in Caco-2 cells;
(A2) individuation of a dairy bacterial strain with immunostimulating properties, and extraction and purification of
its S-layer protein;
(A3) characterization of the effects of whole bacterial cells and the purified protein on both human and murine
immune cells and identification of the host’s receptors involved in their recognition;
(A4) extraction of polyphenols from wild blueberries (WB) and evaluation of the immunomodulatory potential of
the anthocyanin fraction on Caco-2 cells and murine bone marrow-derived dendritic cells (DCs).
2. State of the Art
The expanding body of scientific evidence linking the importance of dietary factors and the occurrence of chronicdegenerative diseases has led to an increased interest in the potential health effects of food-derived components.
Altered mucosal immune function, and in particular immune system activation or other mechanisms associated with
the interaction between the human (host) and colonic content, have been recently demonstrated to be involved in
degenerative diseases at intestinal levels, such as irritable bowel syndrome and Crohn’s disease (Aerssens et al.,
2008). Probiotics and compounds such as polyphenols have been suggested to have anti-inflammatory and
immunomodulatory effects, at mucosal surfaces and systemically (O'Mahony et al., 2001; McCarthy et al., 2003;
Karlsen et al., 2007), leading to an arising interest in the characterization of their beneficial properties. Thus,
several studies are now required to elucidate, at molecular level, the mechanisms of action of such components in
the modulation of the immune responses.
3. Aims of the Project and Experimental Procedures
According to the aim of the PhD project, the research activity was first targeted to a preliminary immunological
screening among several commercial probiotics, food-derived and human-isolated bacteria, based on the ability to
reduce the activation of NF-κB. We found two bacterial strains, which displayed promising properties for their
potential use as probiotic for the oro-pharyngeal mucosa when tested on epithelial pharyngeal FaDu cell line, and
U937 human macrophages (Guglielmetti et al., 2010a; Taverniti et al., 2012): Streptococcus salivarius ST3,
isolated from the oral cavity of an healthy donor, and the dairy strain Lactobacillus helveticus MIMLh5. Since
MIMLh5 confirmed to possess immunomodulatory abilities also at intestinal level, along with other interesting
metabolic properties (Guglielmetti et al., 2008; Gardana et al., 2012), in the second part of the project we focused
our attention on this microbial species. With the aim to identify the role that specific molecules on the bacterial
- 155 -
surface can play in immunomodulation, we studied the S-layer protein, which is the most abundant molecule
present on the outer surface of all L. helveticus strains. According to their aminoacidic sequence, the S-layer protein
of several L. helveticus strains have been clustered in two groups. We extracted and purified S-layer protein from
strains SLh02 and MIMLh5, taken as representatives of the two groups. Afterwards, since we did not find
significant difference between the ability of strains SLh02 and MIMLh5, and their S-layer, to reduce NF-κB
activation in Caco-2 cells, in the following experiments we studied exclusively the strain MIMLh5. We
characterized from an immunological point of view this bacterium and its purified protein through the
quantification of pro- and anti-inflammatory cytokines, both on epithelial and immune cells of human and murine
origin. We also performed experiments aimed to understand which Toll-like receptors (TLRs) are involved in the
recognition of the bacterium and its S-layer protein in U937 human macrophages. Finally, we used the same
experimental procedures to study the immunomodulatory potential of a chemically characterized anthocyanin
fraction extracted from WB.
The selection of bacterial strains according to their immunomodulatory properties has been performed by
transfecting FaDu cells and Caco-2 cells with a vector in which the reporter gene luciferase is under the control of a
native promoter recognized by the transcriptional regulator factor NF-κB.
The nucleotidic sequence of the S-layer gene was determined for different L. helveticus strains and used to deduce
the aminoacidic sequences of the protein. Aminoacidic sequences were then analysed in silico to build a Neighborjoining dendrogram, which was used to select two bacterial strains. The isolation of S-layer protein from the
selected strains was obtained by an extraction protocol based on LiCl solutions (Smit et al, 2001); the purity of Slayer protein was assessed through SDS-PAGE, high performance liquid chromatography (HPLC) and mass
spectrometry (MS) analyses.
Stimulation of macrophages and dendritic cells was performed with in vitro experiment on the U937 human cell
line, and through ex vivo experiments by isolating cells from mouse bone-marrow, subsequently analyzed in flow
cytometry to check the purity of the population, and then cultured for differentiation.
Cytokines quantification by real time quantitative PCR was performed on the cDNA obtained through
retrotranscription reaction on the RNA isolated from cells after 4 h stimulation. SYBR Green probes were used for
in vitro and ex vivo experiments on macrophages, while TaqMan probes were used for experiments on DCs.
The role of TLRs in the recognition of the bacteria and S-layer protein was assessed by using neutralizing
antibodies (Abs) against TLR-2 and TLR-4 prior to the additions of bacterial stimuli on U937 cells, followed by the
analysis of cytokine gene expression profiles.
Anthocyanin fraction was extracted from the supernatant of WB powder, obtained through resuspension in water
and sonication. Fractions separation from the supernatant was done through solid-phase extraction (SPE)-cartridge,
and elution of the anthocyanin fraction was carried with methanol acidified with HCl 0,1 %. The identification and
quantification of anthocyanins (ACNs) were performed by means of HPLC coupled with tandem MS (HPLCMS/MS).
5.1 Selection of strain Lactobacillus helveticus MIMLh5 and purification of its S-layer protein
Seven strains of L. helveticus were compared for their ability to decrease the activation of NF-κB, a transcriptional
activator involved in the expression of different inflammatory cytokines. All tested L. helveticus strains did not
show significant differences in their ability to reduce NF-κB activation, both at baseline and in presence of
interleukin (IL)-1β (a pro-inflammatory citokine used to mimic an inflammatory status). In order to individuate the
components that could be responsible for this activity, attention has been given to S- layer protein, which represents
up to 14% of total protein content of L. helveticus, and 45% of cell wall dry weigh. According to their aminoacidic
sequence, the S-layer proteins of the L. helveticus strains under investigation have been clustered in two groups,
displaying a sequence similarity (identity) of about 60 %. When we tested the purified S-layer proteins of the
strains SLh02 and MIMLh5, taken as representative of the two clusters, we did not find any significant difference
between them when using the above-mentioned Caco-2-based cell model. These data show that, as first, S-layer
protein plays an important role in the immunomodulatory properties of L. helveticus. Furthermore, differences in
the aminoacidic sequence did not determine a diverse behavior of the protein ability to reduce NF-κB activation.
Thus, the subsequent experiments were carried out only on strain MIMLh5, which was selected even due to its
interesting probiotic and biotechnological properties (Guglielmetti et al., 2008; Guglielmetti et al., 2010b; Gardana
et al., 2012).
- 156 -
Figure 1
Unrooted neighbourjoining dendrogram
obtained from the
alignment of S-layer
protein
sequences
from L. helveticus
strains.
Figure 3
CLUSTAL W
alignment of
S-layer
aminoacidic
sequences of
strains
MIMLh5
and SLh02.
Figure 2
SDS-PAGE profiles of
L. helveticus S-layer
proteins. M: proteic
mamarker; 1-2: Slayer
proteins of strains
MIMLh5 and SLh02
respectively; kDa: kilo
Dalton.
Figure 4
Reverse
phase
high performance
liquid
chromatography
(HPLC) profile of
the purified
S-layer protein of
L.
helveticus
MIMLh5.
5.2 Immunological characterization of MIMLh5 and S-layer protein on human and murine macrophages
To better characterize MIMLh5 and S-layer protein we moved our investigation from epithelial cells, that represent
the first line of defense of the immune system, to more specialized cells, involved in the innate immunity. We
quantified the mRNA levels of pro- and anti-inflammatory cytokines first in vitro on the human macrophages U937
cell line (Data not shown), and afterwards ex vivo on macrophages isolated from mouse bone marrow (BMDMs).
400
COX2
TNF-a
IL10
300
100
µg
/m
l
10
M
O
I1
Sl
ay
er
M
IM
Lh
5
O
I1
00
0
M
M
IM
Lh
5
LP
S
00
25
20
15
10
5
0
1µ
g/
m
l
FOI
200
Figure 5
Cytokine expression levels determined by
Reverse Transcription quantitative PCR
analysis (RT-qPCR) on BMDMs after 4 h
incubation with bacterial cells at a multiplicity
of infections (MOIs)1000 and 100 respect to
immune cells.
Lipopolysaccharide (LPS) was used as the
positive control at a concentration of 1 mg ml-1.
Results are the representatives out of three
independent experiments, expressed as fold of
induction (FOI) relative to the result for the
control (unstimulated macrophages), which was
set at a value of 1.
MIMLh5 induced more pro-inflammatory than anti-inflammatory cytokines, in a dose-dependent manner.
Moreover, also the purified S-layer protein resembled the pro-inflammatory attitude exerted by the whole
bacterium. As a confirmation, when we used MIMLh5 cells depleted of the S-layer through LiCl treatment, we
observed a reduction trend for the cytokines TNF-α and COX-2, while the levels of the anti inflammatory IL-10 did
not change, meaning that the protein probably plays an important role in the pro-inflammatory response elicited by
the bacterium; these data were also observed in murine macrophages isolated from peritoneal cavity (Data not
shown). However, the activations of COX-2 and TNF-α were always lower after stimulation with the bacterium or
S-layer than LPS, which has been used as a positive control.
5.3 Involvement of TLRs in the recognition of MIMLh5 S-layer protein in human U937 cells
To gain information on the possible signaling pathways involved in the immune responses induced by L. helveticus
MIMLh5 and its protein, we investigated which TLRs are involved in their recognition. TLRs work as pattern
recognition receptors (PRRs) and participate in detecting various conserved microbial molecules. We used
neutralizing Abs on U937 cells to partially block the ability of TLR2 and TLR4 to bind ligands, prior to the
- 157 -
addition of the bacterium and the S-layer protein. We found that TLR-2 and, to a lesser extent TLR4, are involved
in mediating the pro-inflammatory response elicited by both the whole bacterium (Data not shown) and S-layer,
since the treatments with Abs significantly reduced the S-layer-induced activation of TNF-α and COX-2, but not
IL-10. From these data, we can hypothesize that S-layer, which is the most external part of bacterial cell wall, might
reasonably come in contact first with host cells, mediate bacterial recognition and, therefore, play a key role in
triggering the immune response.
Figure 6
Cytokine expression levels determined by RT-qPCR analysis
on U937 cells in the presence of antibodies against TLR2 (aTLR2) and TLR4 (a-TLR4). Anti-TLRs were added to U937
cells 1 h before stimulation with Slayer protein, followed by
4 h incubation. a-TLR2/4: a-TLR2+a-TLR4.
Immunoglobulin-A2 isotype (IgA2) was used as the control
for nonspecific blocking activity. TLRs antibodies (tested
alone or in association) and IgA2 were used at a final
concentration of 5μg/ml. Results are the representatives out
of three independent experiments, expressed as fold of
induction (FOI) relative to the result for the control (U937
cells + IgA2 ), which was set at a value of 1. Asterisks
indicate statistically significant differences compared to
results for the corresponding control, namely Slayer+IgA2
(*, P<0.05; **, P<0.005).
5.4 Assessment of the immunomodulatory properties of WB anthocyanin fraction in Caco-2 cells
When we tested the three different fractions obtained from WB (anthocyanin, phenolic and soluble fractions), we
found that only the ACNs had a significant effect in reducing, in a dose-dependent manner, the activation of NF-κB
in transfected Caco-2 cells, in the presence of the pro-inflammatory stimulus IL-1β. However when the same ACNs
fraction was tested on bone marrow-derived DCs (Data not shown) we found no effect in inducing Th1-related nor
Treg cytokines. Our results suggest that food molecules, like ACNs extracted from WB, may not have an effect on
immune system by themselves, but rather they might enhance the responses triggered by bacteria and/or their
components in a synergistic way. Starting from this hypothesis, further experiments will be carried out in order to
test the anthocyanin fraction together with selected bacteria on DCs.
Figure 7
Modulation of light emission expressed by Caco-2 cells stably
transfected with a NF-κB/luciferase reporter vector and incubated in
presence of Interleukin-1β with different fractions extracted from
wild blueberry powder. Data are reported as percent variation of
light emission, referred to the control. Control: Caco-2 cell layers
incubated only with media supplemented with MetOH + 0.05 mM
HCl at a concentration correspondent to the one present in highest
concentration of fractions tested. ACN: anthocyanin fraction; PHE:
phenolic fraction; S.F.: soluble fraction. Fraction concentrations
reported (5-25-50-100) are referred to μg/ml. The values are the
means (± standard deviations) for eight independent experiments
conducted in duplicate. Asterisks indicate statistically significant
differences compared to results for the control (*, P<0.05).
From the results obtained during this research activity, we can first conclude that an immunological characterization
is of primary importance in assessing the potential health benefits of both probiotics/food microorganisms and
dietary compounds. Moreover, the individuation of specific bioactive food molecules and food-grade bacterial
components, can support their use in novel functional foods or nutraceutics products. Furthermore, our results
support the idea that the use of non-viable material of microbial origin, known as paraprobiotic strategy (Taverniti
and Guglielmetti, 2011), can positively affect human/animal health, displaying noticeable advantages over the use
of conventional “live” probiotics. The administration of viable bacterial cells to individuals with weaker immune
systems, enhanced inflammatory responses and/or compromised mucosal barrier functions, in fact, could turn
‘generally recognised as safe’ harmless probiotic bacteria into detrimental microorganisms (Besselink et al. 2008).
On the contrary, the paraprobotic strategy, consisting of the use of killed/inactivated bacteria or their components,
would allow the generation of safer (potentially harmless) health-promoting products. In this way, it would be
- 158 -
possible take advantage even from bacteria and molecules with a pro-inflammatory profile, which can thus exert a
transient and positive stimulation of the immune system, targeted to help reacting against infections and/or
inflammation, but avoiding the risk of detrimental outcomes.
7. References
Aerssens J, Camilleri M, Talloen W, Thielemans L, Göhlmann HW, Van Den Wyngaert I, Thielemans T, De Hoogt R, Andrews
CN, Bharucha AE, Carlson PJ, Busciglio I, Burton DD, Smyrk T, Urrutia R, Coulie B (2008) Alterations in mucosal
immunity identified in the colon of patients with irritable bowel syndrome. Clin Gastroenterol Hepatol 6: 194-205.
Besselink MG, van Santvoort HC, Buskens E et al (2008) Probioticprophylaxis in predicted severe acute pancreatitis: a
randomised, double-blind, placebo-controlled trial. Lancet 371:651-659.
Gardana C, Barbieri A, Simonetti P, Guglielmetti S (2012) A biotransformation strategy to reduce allergens in propolis. Appl
Environ Microbiol 78: 4654-4658.
Guglielmetti S, De Noni I, Caracciolo F, Molinari F, Parini C, Mora D (2008) Bacterial cinnamoyl esterase activity screening for
the production of a novel functional food product. Appl Environ Microbiol 74: 1284-1288.
Guglielmetti S, Taverniti V, Minuzzo M, Arioli S, Stuknyte M, Karp M, Mora D (2010a) Oral bacteria as potential probiotics
for the pharyngeal mucosa. Appl Environ Microbiol 76: 3948-3958.
Guglielmetti S, Taverniti V, Minuzzo M, Arioli S, Zanoni I, Stuknyte M, Granucci F, Karp M, Mora D (2010b) A dairy
bacterium displays in vitro probiotic properties for the pharyngeal mucosa by antagonizing group A streptococci and
modulating the immune response. Infect Immun 78: 4734-4743.
Karlsen A, Retterstøl L, Laake P, Paur I, Kjølsrud-Bøhn S, Sandvik L, Blomhoff R (2007) Anthocyanins inhibit nuclear factorkappaB activation in monocytes and reduce plasma concentrations of pro-inflammatory mediators in healthy adults. J Nutr
137: 1951-1954.
McCarthy J, O'Mahony L, O'Callaghan L, Sheil B, Vaughan EE, Fitzsimons N, Fitzgibbon J, O'Sullivan GC, Kiely B, Collins
JK, Shanahan F (2003) Double blind, placebo controlled trial of two probiotic strains in interleukin 10 knockout mice and
mechanistic link with cytokine balance. Gut 52: 975-980.
O'Mahony L, McCarthy J, Kelly P, Hurley G, Luo F, Chen K, O'Sullivan GC, Kiely B, Collins JK, Shanahan F, Quigley EM
(2005) Lactobacillus and Bifidobacterium in irritable bowel syndrome: symptom responses and relationship to cytokine
profiles. Gastroenterology 128: 541-551.
Smit E, Oling F, Demel R, Martinez B, Pouwels PH (2001) The S-layer protein of Lactobacillus acidophilus ATCC 4356:
identification and characterisation of domains responsible for S-protein assembly and cell wall binding. J Mol Biol 305:
245-257.
Taverniti V, Guglielmetti S (2011) The immunomodulatory properties of probiotic microorganisms beyond their viability (ghost
probiotics: proposal of paraprobiotic concept). Genes Nutr 6: 261-74.
Taverniti V, Minuzzo M, Arioli S, Junttila I, Hämäläinen S, Turpeinen H, Mora D, Karp M, Pesu M, Guglielmetti S (2012) In
Vitro Functional and Immunomodulatory Properties of the Lactobacillus helveticus MIMLh5-Streptococcus salivarius
ST3 Association That Are Relevant to the Development of a Pharyngeal Probiotic Product. Appl Environ Microbiol 78:
4209-16.
- 159 -
Development of Protocols for the Detection of Caliciviruses
Simone Tibollo (simonetibollo@alice.it)
Dept. of Public Health Sec. Hygiene, University of Parma, Italy
Tutor: Prof. Giuliano Ezio Sansebastiano
During these PhD years I was concerned in the detection of Caliciviruses (particularly Human Norovirus and Feline
Calicivirus) on food samples and in the inactivation of these viruses using oxidizing disinfectants and High
Pressure Processing (HPP) treatment. I developed a protocol for the viral detection starting from existing methods
present in literature; this protocol was compared with another to evaluate the recovery rate.
Sviluppo di protocolli per il rilevamento di alcuni Calicivirus
Durante questi anni di dottorato mi sono occupato di rilevamento di Calicivirus (in particolare Norovirus umano e
Calicivirus felino) in campioni alimentari e di inattivazione di questi virus mediante l’utilizzo di disinfettanti
ossidanti e di trattamenti con alte pressioni idrostatiche. Nel primo caso è stato sviluppato un protocollo per il
rilevamento messo a punto partendo da metodiche già presenti in letteratura, che è stato confrontato con un
precedente protocollo per valutarne l’efficienza di recupero.
Key words: Norovirus, gastroenteritis, proteinase K, Real-time PCR, hydrogen peroxide, Feline Calicivirus, HPP.
1. Introduction
Noroviruses (NoVs) are the leading cause of acute nonbacterial gastroenteritis resulting in 23.000.000 infections,
50.000 hospitalizations and 300 deaths per year only in the U.S.A. NoVs, transmitted mainly through the fecal-oral
route, are particularly infectious and few viruses carried by contaminated water or food are sufficient to cause the
disease. Although the course of the illness is mild and self-limiting, infants, elderly and immunocompromised patients
may develop serious complications caused by vomiting and protracted diarrhoea. The main sources of infection are
contaminated water as reported by Pedalino et al. (2003) in addition to the preparation of food with bare hands by
infected personnel. Foods normally involved in this disease are edible bivalve molluscs (mussels, oysters and clams)
that are often eaten raw or under-cooked, Alfano-Sobsey et al. (2011), and frozen wild berries imported from areas
with low hygienic controls, Sarvikivi et al. (2011). Another important source of infection originates from the crosscontamination between contaminated foodstuffs and the surfaces that come in contact with these foods. As it is often
reported in literature NoVs do not replicate in vitro (or is very difficult to do so), for this reason it is necessary to use
substitutes such as Feline Calicivirus (FCV) to perform experimental tests, Cannon et al. (2006). For these reasons my
PhD thesis is divided in two different activities:
A1) the development of a rapid, reliable and sensitive method that allows the detection of NoVs in foodstuffs using
proteinase K, a serine protease, often used in molecular biology to digest proteins and remove contamination
from nucleic acids preparations, Costantini et al. (2006). I used a mix of frozen wild berries for these tests. I
evaluated the recovery rates of this protocol and I compared these data with the ones obtained with another
protocol;
A2) the inactivation of these viruses using hydrogen peroxide and HPP treatment. For the first I used solutions with
a known concentration of hydrogen peroxide to which I added a viral suspension. For HPP treatment I infected
clams which were then subjected to the pressure treatment.
For all these tests I evaluated the viral titre remained after the treatments using cell cultures or Real-time PCR
respectively for Feline Calicivirus and Human Norovirus.
A1) The protocol developed was described previously (Tibollo, 2011) but tests with Human Norovirus were
performed with 30, 20 and 10 grams of wild berries while tests with FCV only with an amount of 30 grams.
Moreover this protocol involved a 30 minutes contact between the foodstuffs and 10 ml of a viral solution instead
of spraying the solution over the berries. The solution is then recovered before the homogenization to assess the
amount of virus attached to the surface of the foodstuffs. For tests with Proteinase K I added the inhibitor,
Anilkumar et al. (2009), to avoid a cytopathic effect noted in cell cultures and due to the residual activity of the
enzyme. The samples were subjected to the two methods as described below.
PROTEINASE K PROTOCOL
After the homogenization of the samples 2 grams of the homogenate are placed in a tube with 2 ml of a 0.1 mg/l
proteinase K solution (Novagen, Madison, USA). Tubes are left continuously shaking for 60 min at 37°C and then the
samples are centrifuged at 3000g for 10 min at 4°C and the supernatant is recovered. I added the proteinase K inhibitor
- 160 -
(0,05mM) to the samples and I left it to act for at least 15 min at room temperature; then I centrifuged for 10 min at
3000g at 4°C and at this point the samples are ready for the successive phases of analysis and titration.
PEG8000 PROTOCOL
I added glycine buffer to the homogenate at a ratio of 1:1 and I shook the beaker (that were kept at 4°C) every 5
min for half an hour to facilitate the buffer activity. I centrifuged the sample at 10000g for 20 min at 4°C and then I
added to the supernatant the PEG8000 at a ratio of 1:4. The solution was left at 4° overnight. The second day I
centrifuged the sample at 10000g for 45 min at 4°C, I eliminated the supernatant and I added 10 ml of sterile water
to suspend the pellet. After that I performed a centrifugation at 10000g for 20 min at 4°C and I added PEG8000 at the
same ratio of the previous day. The sample remained overnight at 4°C and the next day I applied the same steps of
the second day but instead of adding 10 ml of sterile water I used only 2 ml. At the end of the last centrifugation I
recovered the surnatant that was subjected to the analysis to determine the viral titre.
A2) Starting from a 35% commercial solution I prepared several concentration of H2O2 (30000 mg/l; 25000 mg/l;
20000 mg/l; 17000 mg/l; 15000 mg/l; 10000 mg/l; 7000 mg/l; 5000 mg/l) using the Sorensen’s phosphate buffer to
maintain the neutral pH value. Tests were conducted at 37°C. Once the disinfectant solution was ready we added
1ml of viral suspension (NoV or FCV) with a known titre and then we took 1ml solution samples at pre-set times
(0, 5, 10, 15, 30, 45, 60 minutes). I immediately added 1ml of bovine liver catalase to these samples to neutralize
the disinfectant activity. Assessment of the efficacy of the disinfectant was performed by analysing the trend of the
inactivation kinetics and calculating the average times (using the statistical software SPSS) for an inactivation of
99%, 99.9%, 99.99%. The objective is to determine suitable contact time-concentration combinations which could
be applied on the field in various sectors of the food processing industry.
For tests with HPP I left 1Kg of clams for at least 24h in an aquarium in which for each test I prepared 10lts of 3%
saline water maintained at 14-17°C. I infected the water with a solution containing FCV with an unknown titre. Then
I packaged clams in plastic envelopes with 120ml of 2.5 % saline water and I sealed them under vacuum. The
packages were then subjected to high pressure treatment (HPP) with pressure values of 300, 400, 500 and 600 MPa
for times of 1, 3, 5 and 7 minutes each. Therefore I treated clams with proteinase K as described previously and I
calculated the viral titre. I made these tests only with FCV because I performed the treatments at SSICA (Stazione
Sperimentale Industria Conserve Alimentari) in Parma and to ensure the health safety of the operator I can not use
human viruses.
For tests involving the NoV I had to analyse the sample with real-time PCR since this virus isn’t capable of
growing in cell culture. RNA was extracted using Nucleo Spin RNAII kit (Macherey-Nagel, Düren, Germany)
sticking to the enclosed protocol and then the nucleic acids were retrotranscripted into cDNA.
The cDNA was then used as a template for the Real-time PCR which implies primers COG2R and QNIF2d
(Kageyama et al., 2003). The thermal profile involves an initial step of denaturation at 95°C for 5 min; then 45
cycles constituted of denaturation at 95°C for 15s, annealing at 60°C for 60s and elongation at 72°C for 60s.
The amplification, detection and data analysis was carried out with Rotor Gene 6000 (Corbett Life Science, San
Francisco, California). All data were further confirmed by gel electrophoresis.
FCV replicate in cell culture so I recovered the supernatant for every test and from these samples we set up scalar 10fold dilutions. I also prepared 96-wells plates with 25 μl per well of Minimum Essential Medium (MEM) with Earle’s
salt and L-Glutamine (PAA Laboratories GmbH, Pasching, Austria) then I inoculated the dilutions (25μl per well and
16 wells per dilution). Finally I added 50 μl of cell suspension (Crandell Reese Feline Kidney cells) for each well. The
plates were incubated at 37°C with 5% of CO2 and after 6 days I detected the presence of the cytopathic effect induced
by the virus. The cytopathic effect is visible on the cell layer and we have calculated for every dilution the number of
positive wells (the ones with an evident cytopathic effect). The viral titre was calculated according to the ReedMüench method which is a 50 percent endpoint assay. This method involves the determination of the dilution of
inoculum producing 50 percent infection of the wells. I have to calculate an index with the formula provided by ReedMüench showed in Eq. (1)
Index =
A − 50
A− B
(1)
where A is the percentage of infected wells at the dilution immediately above 50% and B is the percentage of
infected wells at the dilution immediately below 50%.
This index is added to the value of the dilution that produced the infection rate immediately above 50 percent and
the result of 10 to the power of this number is the value of TCID50 in 25 μl. Then I multiply this value by four to
have the TCID50 per 100 μl which is the total volume of the solution contained in one well. Finally I express our
results as the logarithm of TCID50 to normalize the data collected.
- 161 -
3. Results
A1) First of all I set a calibration curve for the real-time machine to allow the quantification of the samples. Then I
carried out real-time PCRs on wild berries samples contaminated with Human Norovirus. In the tables below the
results for 30, 20 and 10 g are shown; the titres are expressed as viral particles per μl.
Table 1 Viral titre for tests with 30 grams of berries.
Starting solution
sample 1
sample 2
sample 3
PEG8000
n.d.
n.d.
4.893
8.7
Proteinasi K
14.78
n.d.
6.554
59.28
sample 1
sample 2
sample 3
Starting solution
PEG8000
n.d.
n.d.
n.d.
n.d.
Proteinasi K
n.d.
n.d.
n.d.
7.831
sample 1
sample 2
sample 3
Starting solution
PEG8000
n.d.
n.d.
n.d.
213.3
Proteinasi K
n.d.
n.d.
17.56
1452
As we can see from the tables there were some problems in detecting the viral titre for tests with 20 and 10 grams
of wild berries and this is probably due to a low starting titre or a lower attaching surface compared to that I had
with 30 grams of foodstuff. Nevertheless the data show that the protocol involving Proteinase K provides more
positive results and a better recovery.
I also carried out 15 tests with FCV and I used cell culture to assess the viral titre as described previously. The
data collected, expressed as the Log TCID50, are shown below in table.
Table 4 Titres of the samples recovered before and after the application of the protocols
Mean
s.d.
Initial viral titre
4.668
0.523
Recovery solution
1.725
0.4
PEG protocol
0.706
0.08
PK protocol
2.01
0.292
I have analysed the titre for the starting solution and also for the solution recovered after the initial 30 minutes
contact (called recovery solution). Then we can see the resulting titre after the treatment with each one of the two
protocols and it shows that the PK protocol has a better recovery. I calculated the difference between the first two
data so I can evaluate the recovery percentages that are 23.989% and 68.298% respectively for the protocol with
PEG and the PK protocol. Moreover I also made a test t with my data which results in a 0,000 significance value.
A2) Hydrogen Peroxide is a very reactive and efficient disinfectant against pathogens and its activity is yielded at
37°C. For tests with FCV the results are shown in table 5. Assessment of the efficacy of the disinfectant was
performed by analyzing the trend of the inactivation kinetics and calculating the times needed for an inactivation
of 99%, 99.9% and 99.99% (table 6). The titres decrease as the disinfectant concentration increase and this is
exactly what I expected. The only data diverging from this trend are the ones of tests at 20,000 and 30,000 mg/l.
The same trend is visible in table 6 for the average inactivation times.
- 162 -
Table 5 Titres for H2O2 tests with FCV. The viral titre is shown corresponding to every contact time.
Times
(min)
0
5
10
15
30
45
60
5000 mg/l
7000 mg/l
10000 mg/l
15000 mg/l
20000 mg/l
25000 mg/l
30000 mg/l
5,541
5,102
4,575
4,254
2,719
1,876
1,032
5,662
5,406
5,022
4,329
2,402
1,135
0,602
5,812
5,318
4,302
3,68
2,062
1,442
1,102
5,34
4,387
3,141
2,322
0,852
0,601
0,087
5,177
4,365
3,82
3,013
1,504
0,438
0
5,144
3,065
1,982
1,173
1,102
0
0
4,566
3,595
2,53
1,998
0,861
0
0
25000 mg/l
9,513
19,826
30,139
30000 mg/l
16,122
27,914
39,706
Table 6 Average times to obtain a 2-log, 3-log and 4-log reduction of the viral titre.
99%
99,9%
99,99%
5000 mg/l
24,143
37,03
49,917
7000 mg/l
21,963
32,429
42,895
10000 mg/l
18,767
30,104
41,441
15000 mg/l
13,791
24,084
34,377
20000 mg/l
17,471
28,353
39,235
Human Noroviruses can’t replicate in vitro and the only way to detect them is to use biomolecular techniques.
Again I used the real-time PCR to detect the presence of the viruses. The results are expressed as viral particles
per μl and are shown in table 7.
Table 7 Results for tests with Human Norovirus subjected to the disinfectant treatment.
Times
(min)
0
5
10
15
30
45
60
10000 mg/l
15000 mg/l
17000 mg/l
20000 mg/l
20000 mg/l
25000 mg/l
450,3
422,7
50,46
149,0
2,734
222,6
n.d.
n.d.
9,563
21,16
31
7,332
98,05
12,28
22,18
29,14
n.d.
9,686
41,37
36,77
22,39
334,8
109,7
177,1
182,9
235,2
193,7
24,44
2506
6822
546,3
795,8
410,8
1014
162,8
9,76
n.d.
15,81
n.d.
23,36
12,61
n.d.
I have not obtained the total inactivation of the NoVs even at the highest H2O2 concentrations. I can nevertheless
draw out a trend similar to that obtained with FCV especially for tests at 20000 mg/l. Looking at these data we can
also understand that there are some difficulties in the detection of NoVs with real-time PCR and that all the process
must be improved to obtain better results.
High pressure processing is a technique of food conservation that eliminates bacteria potentially hazardous for
human health and stops the alterative microflora proliferation. It also affects relatively little the nutritive and
sensorial characteristics of foodstuffs. I made 12 tests on clams (3 per pressure value) and I recorded a total viral
inactivation even at low contact times as we can see in table 8.
Table 8 Average viral titres for tests with clams treated by HPP.
Pressure (MPa)
300
400
500
600
Initial viral titre
3,48 (± 0,28)
3,47 (± 0,31)
3,29 (± 0,1)
3,75 (± 0,43)
1 min
1,13 (± 0,23)
0,55 (± 0,151)
0
0
5 min
0
0
0
0
7 min
0
0
0
0
10 min
0
0
0
0
4. Conclusions and Future Perspective
A1) Mixed wild berries constitute a great problem for the detection of viruses because they have an indented peel to
which the viral particles could bind and there remain hidden out of reach for most of the eluting solutions. For this
reason is important to develop protocols which are more efficient in dividing the viral particles from food samples
which ultimately is the critical point of every detecting protocol. Proteinase K is yet present in literature and has the
requirements to become the substance that could remedy to the problem. I used this enzyme to remove viral particles
from the samples and I compared the results obtained with other results obtained applying a protocol in parallel on
the same food sample. The viral recovery is definitely better with Proteinase K than with the other that involves
PEG8000 purification. This outcome is visible not only for FCV but also for NoV. The recovery percentage for FCV
speaks for itself as I detected three times more viral particles with Proteinase K than with PEG8000. Altogether these
data provide a great result and confirm the efficacy of this new protocol in detecting viral particles bound to food
samples. I carried out also an experiment with these two protocol on FCV viral solution without wild berries and
- 163 -
surprisingly I found that in this case the protocol with PEG8000 has a better recovery (59,31% versus 21,025%
obtained with Proteinase K). This outcome could be explained with the fact that without the wild berries the
Proteinase K is free to act directly on viral particles thus damaging the capsid. These damaged viruses aren’t able to
infect the cell cultures so I obtain a lower viral titre unlike that with PEG8000. Tests with Nov produced similar results
even if it wasn’t always possible to detect the viral titre because it was probably below the apparatus detection limit. I
can also say that actually the PK protocol associated with real-time PCR makes analysis faster and more sensitive
than with cell cultures. This protocol is a good candidate to become a repeatable and official method for viral
detection in foodstuffs since we still haven’t one. The validity of this method is also reported in literature in studies
published by the Journal of Virological Methods (Uhrbrand et al., 2010) and Istituto Superiore di Sanità. To confirm
beyond any doubt that this protocol could provide good results in detecting viruses linked to food I will test it with
other food samples. Good targets for this research could be clams because they are often associated with NoV
gastroenteritis outbreak and they provide different problems for the detection other than that posed by wild berries.
A2) H2O2 treatments proved to be a good way to inactivate viruses that could contaminate surfaces. From data with
FCV we can understand how increasing the H2O2 concentration we can reduce the viral titre until the complete
inactivation. The average inactivation times show us that only 9.5 minutes are needed to have a 99% inactivation of
FCV at 25000 mg/l. In literature is stated that NoV is more resistant than FCV and this is clearly showed by mine
results because I have not obtained the complete inactivation of NoV even at higher contact times. It will be
necessary to do other tests to complete the data and make a better regression line to define the average times of
inactivation. Regarding the NoV data I need to specify that the results might be overpriced because H2O2 is able to
produce an oxidative damage to the viral particles. This damage takes place first of all on the capsid thus releasing
the RNA from the inside. Then if I don’t stop hydrogen peroxide activity it can also damage RNA. This explanation
is necessary to understand why I haven’t obtained a complete inactivation at higher concentration of disinfectant
and that is because probably some fragments of RNA remained intact after the treatment even if the viral capsid
were broken and this is sufficient to have a detection. To eliminate this results that are indeed false positive I found
in literature that is used an enzyme called RNAse A that cuts RNA strands which are exposed as reported by
Nuanualsuwan and Cliver (2002). To complete my data for NoV and also to confirm or not what I already obtained
I will probably need to purchase this enzyme and add a further step with this RNAse A in my inactivation tests to
avoid the detection of false positive.
From experiments on clams emerged a good efficiency in viral inactivation yet for low pressure values and times.
With a 3-log contamination only 3 minutes at 300 and 400 MPa are needed to eliminate completely the viruses
while with 1 minute contact I obtained a reduction of the viral titre respectively of 68% and 80%. For higher
pressures 1 minute is enough to have a complete inactivation. These results confirm that HPP is a good method for
the viral inactivation and it will be interesting to apply this technique also on Human Norovirus to verify the
inactivation rate with this more resistant virus.
5. References
Alfano-Sobsey E, Sweat D, Hall A, Breedlove F, Rodriguez R, Greene S, Pierce A, Sobsey M, Davies M, Ledford SL (2011)
Norovirus outbreak associated with undercooked oysters and secondary household transmission. Epidemiol Infect 1-7.
Anilkumar RK, Shanmugasundaram M, Hoang Q, Kuo M, Chapman LM, Chen HH (2009) Synthesis and application of
MeOSuc-Ala-Ala-Pro-Phe-CH2Cl as potent proteinase K inhibitor. Bioorg Med Chem Let 19: 1296-1300.
Cannon JL, Papafragkou E, Park GW, Osborne J, Jaykus LA, Vinjé J (2006) Surrogates for the study of norovirus stability and
inactivation in the environment: A comparison of murine norovirus and feline calicivirus. J Food Prot 69: 2761-5.
Costantini V, Loisy F, Joens L, Le Guyader FS, Saif LJ (2006) Human and animal enteric caliciviruses in oysters from
different coastal regions of the United States. Appl Environ Microbiol 72: 1800-9.
http://www.iss.it/binary/spve/cont/determinazione NoV e HAV mediante Real-Time PCR. Istituto Superiore di Sanità.
Kageyama T, Kojima S, Shinohara M, Uchida K, Fukhusi S, Hoshino FB, Takeda N, Katayama K (2003) Broadly reactive and
highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J Clin Microbiol
41: 1548-1557.
Nuanualsuwan S, Cliver DO (2002) Pretreatment to avoid positive RT-PCR results with inactivated viruses. J Virol Met 104:
217-225.
Pedalino B, Feely E, McKeown P, Foley B, Smyth B, Moren A (2003) An outbreak of Norwalk-like viral gastroenteritis in
holidaymakers travelling to Andorra, January-February 2002. Eurosurv 8.
Sarvikivi E, Roivainen M, Maunula L, Niskanen T, Korhonen T, Lappalainen M, Kuusi M (2011) Multiple norovirus outbreaks
linked to imported frozen raspberries. Epidemiol Infect 1-8.
Tibollo S (2011) Study on the Application of a New Method for the Viral Detection in Foodstuffs. Experimental Tests on
Caliciviruses. In Proc.s of the XVI Workshop on the Developments in the Italian PhD Research on Food Science,
Technology and Biotechnology, Lodi (Italy), 21-23 September, 2011, pp. 275-276.
Uhrbrand K, Myrmel M, Maunula L, Vainio K, Trebbien R, Nørrung B, Schultz AC (2010) Evaluation of a rapid method for
recovery of Norovirus and hepatitis A virus from oysters and blue mussel. J Virol Methods 169:70-78.
- 164 -
Development and Validation of Rapid Methods
for the Determination of Mycotoxins in Food Products
Stefania Valenzano (stefania.valenzano@ispa.cnr.it)
Institute of Sciences of Food Production, National Research Council of Italy (ISPA-CNR)
Tutor: Dr. Michelangelo Pascale
The object of this PhD thesis is the development and validation of rapid and accurate analytical methods for the
determination of mycotoxins in food products. Research activities on the development and validation of
Fluorescence Polarization (FP) immunoassays for the simultaneous determination of T-2 and HT-2 toxins in wheat
and oats will be described herein.
Sviluppo e validazione di metodi rapidi per la determinazione
di micotossine in prodotti agroalimentari
La presente tesi di dottorato ha come oggetto lo sviluppo e la validazione di metodi analitici rapidi ed affidabili per
la determinazione delle micotossine in prodotti agro-alimentari. Verranno descritte le attività di ricerca relative alla
messa a punto e validazione di immunosaggi basati sulla Polarizzazione di Fluorescenza (FP) per la determinazione
simultanea delle tossine T-2 e HT-2 in frumento e avena.
Key words: Mycotoxins, T-2 toxin, HT-2 toxin, fluorescence polarization immunoassay, wheat, oats.
1. Introduction
T-2 toxin (T2) and HT-2 toxin (HT2) are type-A trichothecene mycotoxins produced by several Fusarium species,
mainly Fusarium sporotrichioides, Fusarium poae and Fusarium langsethiae, that may grow in the field or after
harvesting on a variety of cereal grains including maize, oats, barley, wheat, rice, beans and soybean (WHO/FAO,
2001; SCOOP, 2003; EFSA, 2010).
These mycotoxins cause acute toxic effects on mammals and T2 has been shown to be a potent inhibitor of DNA,
RNA and protein synthesis and shows hematotoxic, immunosuppressive and dermotoxic effects both in vivo and in
vitro. T2, in vivo, is rapidly metabolized to HT2 that also induces adverse effects similar to T2. (WHO/FAO, 2001).
Currently there are no regulatory limits for T2 and HT2 due to the limited data concerning the exposure of
consumer to these toxins, however within the European Union there have been suggestions that regulatory limits of
100, 500, 200 and 50 μg kg−1, intended as the sum of T2 and HT2, will be agreed for unprocessed cereals,
unprocessed oats, oat products and infant food, respectively (Edwards et al., 2009).
Analytical methods for the detection of T2 and HT2, alone or in combination with other trichothecenes, are mainly
based on chromatographic techniques (GC, HPLC) and they have been extensively reviewed (Krska et al., 2001;
Lattanzio et al., 2009a; Meneely et al., 2011). Although these analytical methods permit sensitive and accurate
determination of T2 and HT2, they require a preliminary clean-up of the extracts and are time-consuming,
expensive, and unsuitable for screening purposes. Simpler, rapid, reliable and more effective screening methods are
needed for T2 and HT2.
Fluorescence polarization (FP) immunoassay is a homogeneous technique that measures the rate of rotation of a
toxin-fluorophore conjugate (tracer) in solution by monitoring the interaction between the tracer and a specific
antibody. The technique is based on the measurement of the polarization value (P), commonly expressed as
millipolarization units (mP) and defined by the equation P = (IV − IH)/(IV + IH) where IV and IH are the intensities of
fluorescence of the tracer along the vertical axis and the horizontal axis, respectively. The polarization value is
inversely proportional to free unlabelled antigen content in solution that competes with the tracer, and it increases
when the binding of specific antibody to the tracer increases (Smith and Eremin, 2008). FP immunoassays have
been reported for the determination of major mycotoxins, including aflatoxins, zearalenone, fumonisins,
deoxynivalenol and ochratoxin A in different matrices (Nasir and Jolley, 2002; Maragos et al., 2001; Maragos and
Plattner, 2002; Maragos and Kim, 2004; Lippolis et al., 2006; Zezza et al., 2009).
The aim of this study was the development and the validation of two rapid, sensitive and quantitative FP
immunoassays for the simultaneous determination of T2 and HT2 in wheat and oats, respectively.
Fluorescein-toxin tracers were obtained from the reaction of T2 or HT2 with 4’-(aminomethyl)fluorescein after
activation with 1,1’-carbonyldiimidazole according to the procedure reported by Maragos and Plattner (2002) for
the preparation of DON-fluorescein conjugate.
- 165 -
A monoclonal antibody specific for T2 (clone G10-E11) and three monoclonal antibodies specific for HT2 (clones
H10-A10, C12-G8, D7-C11) were obtained from the University of Natural Resources and Life Science, Vienna,
Department for Agrobiotechnology IFA-Tulln, (Tulln, Austria). Commercial monoclonal antibodies specific for T2
(AK-T2) and HT2 (AK-HT2) respectively were purchased from Aokin AG (Berlin, Germany) and a monoclonal
antibody specific for T2 (clone 8H2) was purchased from Softflow Biotechnology (Pécs, Hungary).
Sample preparation was performed according to the methods described by Visconti et al.(2005) and Trebstein et al.
(2008), for the determination of T2 and HT2 in wheat and oats, respectively. The wheat and oats extracts were
analysed by FP immunoassay without further treatment or by HPLC previous immunoaffinity column clean-up and
derivatization procedure.
FP analyses were performed by a Sentry® 100 portable system (Diachemix Corporation, Milwaukee, WI, USA), a
manual single-well instrument using glass culture tubes and excitation (λex) and emission (λem) wavelengths of 485
and 535 nm, respectively. For each tracer, the optimum tracer concentration in the test solution was determined as
the dilution of the stock solution producing a total fluorescence intensity equal to about 2- to 3-fold the blank signal
measured against PBS-A. Optimized MAb concentrations in the test solution, corresponding to the lowest MAb
concentration providing the maximum polarization shift (ΔPmax = mPMab – mPtracer), were determined per each
antibody-tracer combination.
Competitive FP immunoassays were carried out with single T2 and HT2 standard solutions by using the selected
tracers (T2-FL and HT2-FL1a) and antibodies (clones H10-A10, C12-G8, AK-HT2 and 8H2) at the optimized
concentrations. To evaluate the kinetics of the competition, measurements were made after holding at room
temperature for time ranging from 15 s to 10 min.
Optimized FP immunoassays were performed by adding a volume of filtered extract equivalent to 20 mg and 3 mg
of wheat and oats, respectively. Clean-up purification, derivatization procedure and HPLC analyses were performed
according to the method described by Visconti et al.(2005).
3.1 Synthesis of the fluorescein-toxin tracers
The derivatization reaction of T2 led to a T2-fluorescein derivative, T2-FL. Whereas the derivatization reaction of
HT2 produced two isomeric mono-substituted products (HT2-FL1a and HT2-FL1b) and a bi-substituted product
(HT2-FL2), due to the presence of two hydroxyl groups at -C3 and -C4 positions, respectively (Fig. 1).
Figure 1 Structures of fluorescein-labelled T2 toxin tracer (T2-FL) and of mono-substituted (HT2-FL1a and HT2-FL1b,
arbitrarily ascribed to each isomeric product) and bi-substituted (HT2-FL2) fluorescein-labelled HT2 toxin tracers.
H
H3C
O
H3C
H
O
H
O
O
O
O
NH
H
CH3
O
H3C
O
O
O
OH
O
CH3
O
O
H3C
HO
T2-FL
H
H 3C
O
H3C
H3C
H
O
H
O
O
CH3
O
O
H
OH
O
H3C
OH
O
NH
H
H3C
O
O
H3C
O
O
HO
H3C
H
H
H
O
H3C
OH
O
H
O
CH3
O
+H3C
O
O
H3C
NH
O
H3C
O
O
H
O
H
O
O
O
CH3
H
O
HT2-FL1b
O
HO
NH
O
O O
O
NH
O
H3C
HO
O
O
HT2-FL1a
OH
O
O
O
OH
HT2-FL2
O
OH
HO
The identity of the tracers was confirmed by HPLC-HRMS analysis (positive chemical ionization mode) of the
reaction mixtures. The tracers were isolated and purified by semi-preparative HPLC.
3.2 Study of the antibody-tracer interactions
The assessment of the antibody-tracer binding was performed by FP immunoassay for the four synthesized tracers
and seven monoclonal antibodies (MAbs). Table 1 shows the maximum values of polarization shift (ΔPmax,
maximum tracer-antibody binding) and optimized MAbs concentrations obtained for each antibody-tracer
combination. The combinations showing the highest binding with ∆Pmax of 230 mP (8H2/T2-FL, H10-A10/HT2FL1a and AK-HT2/HT2-FL1a) were used in the optimization of competitive FP immunoassays.
- 166 -
Table 1 Maximum values of polarization shift (ΔPmax) and relevant optimized antibody concentrations obtained for each
antibody-tracer combination.
Mab
G10-E11
AK-T2
8H2
H10-A11
C12-G8
D7-C11
AK-HT2
Anti-T2
Anti-HT2
a
[Mab]
(µg mL-1)
27.9
24.4
3.3
11.8
24.8
21.4
5.4
Clone
T2-FL
80
230
200
100
25
200
HT2-FL1a
45
20
230
130
25
230
ΔPmaxa
HT2-FL1b
110
110
110
HT2-FL2
50
15
15
ΔPmax = mPMAb - mPtracer
3.3 Optimization of the FP immunoassay
Calibration curves obtained with T2 and HT2 standard solutions for the selected antibody-tracer combinations
8H2/T2-FL, H10-A10/HT2-FL1a and AK-HT2/HT2-FL1a are shown in Figure 2. The FP immunoassay based on the
use of 8H2/T2-FL combination (Figure 2a) exhibited a lower cross-reactivity for HT2 (2.8%, IC50= 35 ng mL-1) as
compared to T2 (IC50= 0.98 ng mL-1) leading to under-estimation of the sum of the toxins content. Whereas
competitive FP immunoassays using the antibody-tracer combination AK-HT2/HT2-FL1a (Figure 2b) and H10A10/HT2-FL1a (Figure 2c) showed 100% cross-reactivity for both T2 and HT2 that allow the determination of the
sum of the toxins. The antibody-tracer combination H10-A10/HT2-FL1a was used in all subsequent experiments
due to its better sensitivity (IC50 = 0.54 ± 0.04 ng mL-1 vs IC50 = 1.61 ± 0.22 ng mL-1).
Figura 2 Normalized calibration curves obtained with standard solution of T2 (filled circle) and HT2 (triangle) for FP
immunoassay using antibody-tracer combination of: (a) 8H2/T2-FL, (b) AK-HT2/HT2-FL1a and (c) H10-A10/HT2-FL1a.
Normalized Polarization
T2
HT2
0.8
0.6
0.4
0.2
0.0
0.01
0.1
1
10
(b)
(b)
1.0
100
0.6
0.4
0.2
0.0
0.01
1000
T2
HT2
0.8
0.1
-1
1
10
100
T2
HT2
0.8
0.6
0.4
0.2
0.0
0.01
1000
-1
[tox] ng mL
(a)
(c)
1.0
(a)
(c)
1.0
0.1
1
10
100
1000
-1
[tox] ng mL
[tox] ng mL
Figure 3 shows the calibration curve obtained for the FP immunoassay with H10-A10/HT2-FL1a combination in the
concentration range 0.02-24.4 ng mL-1 (expressed as sum of T2 and HT2). A good correlation (coefficient of
correlation, r = 0.9973) between polarization values and logarithm of T2/HT2 concentrations was observed in the
concentration range 0.37-2.20 ng mL-1 with good repeatability of the FP responses (relative standard deviation,
RSD < 10%; n = 3).
Figura 3 Normalized calibration curve of the FP immunoassay, using antibody-tracer combination of H10-A10/HT2-FL1a,
obtained with mixed standard solutions of T2 and HT2 (expressed as sum) in PBS-A solution. The FP linearity range vs log
[T2+HT2] is reported in the insert.
0.9
N orm a liz e d P o lariz atio n
1.0
0.8
0.8
2
0.6
0.5
0.4
0.3
0.2
0.1
0.0
2.50
0.6
+ 3.3235
ry == -0.9847x
0.9973
R = 0.9946
0.7
2.70
2.90
3.10
3.30
Log[T2 + HT2] pg mL-1
0.4
0.2
0.0
0.01
0.1
1
[T2 + HT2] ng mL
10
100
-1
3.4 Cross-reactivity of the FP immunoassay
The cross-reactivity of the optimized FP immunoassay was tested against structurally related mycotoxins
(diacetoxyscirpenol, neosolaniol, nivalenol, deoxynivalenol, 3-acetyldeoxynivalenol and 15-acetildeoxynivalenol)
- 167 -
and other mycotoxins commonly occurring in wheat and oats (ochratoxin A and zearalenone).The antibody
demonstrated high specificity for T2 and HT2, a very low cross-reactivity for neosolaniol (CR% = 0.12%; IC50 =
461.6 ng mL-1) and no cross-reactivity was observed for all tested mycotoxins.
3.5 Matrix effect and recovery experiments
In order to evaluate the possible matrix interferences in the FP measurements, the regression line obtained with
T2/HT2 standard solutions was compared with the regression lines obtained by adding spiked extract of wheat and
oats uncontaminated samples and corresponding to different amounts of matrix.
No significant differences were observed between slopes (tcalc < 2.306; p < 0.05) and positions (tcalc < 2.262; p <
0.05) of the regression lines up to an amount of matrix corresponding to 20 mg of wheat and 3mg of oats. In those
conditions, a limit of detection (LOD) of 8 µg kg-1 and 70 µg kg-1 (as sum of the toxins) was calculated in wheat
and oats, respectively.
Recoveries of T2 and HT2 were carried out in triplicate measurements by spiking wheat samples in the range 50200 µg kg-1 and oats samples in the range 250-1,000 µg kg-1. Average recoveries from wheat and oats determined
by FP immunoassay were 96 and 104%, respectively, with relative standard deviations lower than 8%, whereas
average recoveries determined by HPLC method were 80 and 99%, respectively, with relative standard deviations
lower than 12% (Table 2).
Table 2 Average recoveries of T2 and HT2, expressed as the sum of the toxins, from spiked wheat and oats obtained by FP
immunoassay and HPLC method.
% recovery ± SDa
Wheat
Spiking level
(µg kg-1)
Oats
50
96 ± 8
78 ± 10
Spiking level
(µg kg-1)
250
100
89 ± 4
80 ± 6
500
200
103 ± 5
82 ± 6
1000
109 ± 2
100 ± 6
Overall average
96 ± 8
80 ± 7
Overall average
104 ± 5
99 ± 4
FPIA
HPLC
FPIA
HPLC
101 ± 6
99 ± 3
102 ± 6
97 ± 3
a
SD, standard deviation (n = 3)
3.6 Comparison of FP immunoassay and HPLC/FLD for contaminated samples
For comparison, naturally contaminated or spiked wheat (n=55) and oats (n=51) samples were tested by both FP
immunoassay and HPLC/FLD with immunoaffinity clean-up method. No false positive result was observed by FP
immunoassay for uncontaminated samples. A good correlation (r = 0.964 in wheat and r = 0.9796 in oats) between
T2/HT2 concentrations obtained by FP immunoassay and HPLC method was found for spiked and naturally
contaminated samples (Figure 4).
Figura 4 Comparison of T2/HT2 contents in naturally contaminated (filled circle) and spiked (filled triangle) samples of (a)
wheat and (b) oats analyzed by HPLC and FP immunoassay.
400
(a)
350
(b)
2000
[T2 + HT2] µg kg-1 (FP)
[T-2 + HT-2] µg kg-1 (FP)
300
250
y = 1.120x + 22.95
r = 0.9640
r = 0.964
y = 1.120× + 22.95
200
150
100
1500
y = 1,2661x + 87,552
r = 0.9796 R² = 0,9596
y = 1.266× + 87.552
1000
500
50
0
0
0
50
100
150
200
250
300
350
400
0
500
1000
1500
2000
[T2 + HT2] µg kg-1 (HPLC)
[T-2 + HT-2] µg kg-1 (HPLC)
The trueness of the method was also determined by analysing a FAPAS® oats test material (T2261) containing 164
μg kg−1 T-2 (satisfactory range: 95–233 μg kg−1) and 257 μg kg−1 HT-2 (satisfactory range: 156–358 μg kg−1).
Results obtained with the optimized FP immunoassay of 387 ± 41 μg kg−1 (n=3 replicates) were very close to the
assigned value 421 μg kg−1 (expressed as sum) and within the FAPAS® satisfactory range 251 – 591 μg kg−1
(expressed as sum). A similar analysis could not be performed with wheat samples due to the lack of wheat certified
materials.
- 168 -
Two rapid, easy-to-perform and sensitive FP immunoassays have been developed for the determination of the total
content of T2 and HT2 in wheat and oats. The interactions between four fluorescein-labelled T2/HT2 tracers, ad
hoc synthesized, and seven monoclonal antibodies have been studied and the H10-A10/HT2-FL1a combination was
selected for the method developed because of its better sensitivity (LOD, 8 μg kg−1 in wheat and 70 μg kg−1 in oats,
expressed as the sum of the two toxins).
In addition, the absence of long incubation times and washing steps reduces the time of analysis as compared to
other antibody-based methods. In fact, the overall time consumed in T2/HT2 analysis with the optimized
immunoassay procedure was less than 10 min, thus allowing the performance of the analysis with a very high
sample throughput. Due to the absence of significant matrix effect (in the tested conditions) and cross-reactivity
against the mycotoxins most frequently occurring in wheat and oats, the developed FP immunoassay avoids
overestimation of the toxins content.
Analytical performance in terms of accuracy and precision values of FP immunoassay was better than that HPLC
method and fulfil the criteria established by the European Union for acceptance of an analytical method for the
determination of T2 and HT2 (European Commission, 2006). The accuracy of the assay was confirmed by the good
correlation (r= 0.964 for wheat; r= 0.9796 for oats) of the results obtained by FP immunoassay and HPLC/FLD
method for naturally contaminated or spiked wheat and oats samples. In addition, no false positive result was
observed for uncontaminated samples. The validation of the FP immunoassay for the determination of T2/HT2 in
oats was also performed by analyzing a FAPAS® oats test material showing results within the satisfactory range and
very close to the assigned value.
Furthermore the proposed assays are inexpensive, easy-toperform, suitable for automation and they use a portable
instrument. These findings indicate that these methods are suitable for high throughput screening as well as for
quantitative determination of T2 and HT2 in wheat and oats and can be used as a valid alternative method to
HPLC/FLD. Moreover, the concept of determining the total content of T2 and HT2 in cereal samples, for both
official control purposes and risk assessment studies, is definitely in line with incoming EU legislation
requirements (Lattanzio et al., 2009b).
5. References
Edwards SG, Barrier-Guillot B, Clasen PE, Hietaniemi V, Pettersson H (2009) Emerging issues of HT-2 and T-2 toxins in
European cereal production. World Mycotox J 2: 173-179.
EFSA (2010) Occurrence data of trichothecene mycotoxins T-2 toxin and HT-2 toxin in food and feed.
http://www.efsa.europa.eu/en/supporting/pub/66e.htm. Accessed 31 May 2011.
European Commission (2006) Off J Eur Comm L 364/5.
Krska R, Baumgartner S, Josephs R (2001) The state-of-the-art in the analysis of type-A and -B trichothecene mycotoxins in
cereals. Fresenius J Anal Chem 371: 285-299.
Lattanzio VMT, Pascale M, Visconti A (2009a) Current analytical methods for trichothecenes mycotoxins in cereals. Trends
Anal Chem 28: 758-768.
Lattanzio VMT, Solfrizzo M, Visconti A (2009b) Enzymatic hydrolysis of T-2 toxin for the quantitative determination of total
T-2 and HT-2 toxins in cereals. Anal Bioanal Chem 395: 1325-1334.
Lippolis V, Pascale M, Visconti A (2006) Optimization of a fluorescence polarization immunoassay for rapid quantification of
deoxynivalenol in durum wheat-based products. J Food Prot 69: 2712-2719.
Maragos CM, Jolley ME, Plattner RD, Nasir MS (2001) Fluorescence polarization as a means for determination of fumonisins in
maize. J Agric Food Chem 49: 596-602.
Maragos CM, Plattner RD (2002) Rapid fluorescence polarization immunoassay for the mycotoxin deoxynivalenol in wheat. J
Maragos CM, Kim E (2004) Detection of zearalenone and related metabolites by fluorescence polarization immunoassay. J
Food Prot 67: 1039-1043.
Meneely JP, Ricci F, van Egmond HP, Elliott CT (2011) Current methods of analysis for the determination of trichothecene
mycotoxins in food. Trends Anal Chem 30: 192-203.
Nasir MS, Jolley ME (2002) Development of a fluorescence polarization assay for the determination of aflatoxins in grains. J
SCOOP (2003) TASK 3.2.10: Collection of occurrence data of Fusarium toxins in food and assessment of dietary intake by the
population of EU member states. http://www.ec.europa.eu/food/fs/scoop/task3210.pdf. Accessed 31 May 2011.
Smith DS, Eremin SA (2008) Fluorescence polarization immunoassays and related methods for simple, high-throughput
screening of small molecules. Anal Bioanal Chem 391: 1499-1507.
Trebstein A, Seefelder W, Lauber U, Humpf HU (2008) Determination of T-2 and HT-2 toxins in cereals including oats after
immunoaffinity cleanup by liquid chromatography and fluorescence detection. J Agric Food Chem 56: 4968-4975.
Visconti A, Lattanzio VMT, Pascale M, Haidukowski M (2005) Analysis of T-2 and HT-2 toxins in cereal grains by
immunoaffinity clean-up and liquid chromatography with fluorescence detection. J Chromatogr A 1075: 151-158.
WHO/FAO (2001) Safety evaluation of certain mycotoxins in food. Prepared by the fifty-sixth meeting of the Joint FAO/WHO
Expert Committee on Food Additives (JEFCA). WHO food additives series 47. FAO food and nutrition paper 74.
International Programme on Chemical Safety, World Health Organization, Geneva.
Zezza F, Longobardi F, Pascale M, Eremin SA, Visconti A (2009) Fluorescence polarization immunoassay for rapid screening
of ochratoxin A in red wine. Anal Bioanal Chem 395: 1317-1323.
- 169 -
Analytical Methods for Evaluating
the Quality and the Genuineness of Olive Oils
Enrico Valli (enrico.valli4@unibo.it)
Tutor: Dr. Alessandra Bendini
This PhD thesis deals with the evaluation of quality and genuineness of different categories of oils obtained by
olives: extra virgin olive oils, both directly collected from Italian mills and sold in the large scale retailed trade,
lampante, “repaso” and refined olive oils. The analytical parameters include, on the one hand, strengthened and
recently introduced official markers, and on the other hand not official parameters, but very important for the
evaluation of the quality and the freshness of the product, such as the determination of diacylglycerols or phenolic
compounds.
Indagini analitiche per la valutazione di qualità e purezza di oli di oliva
Questa attività di tesi di dottorato riguarda la valutazione di qualità e purezza di diverse tipologie di prodotti: oli
extravergini di oliva, sia campionati presso frantoi italiani che reperiti direttamente dal commercio, oli di oliva
lampanti, “repaso” e raffinati. I parametri analitici studiati comprendono, da un lato, indicatori ufficiali consolidati
da anni e di recentissima introduzione, dall’altro indici che non sono stati ancora recepiti a livello legislativo, ma
che assumono un ruolo importante, ad esempio, come marcatori della qualità e freschezza del prodotto, come la
determinazione dei digliceridi e dei composti fenolici.
Key words: Extra virgin olive oil, quality and genuineness indexes, alkyl esters of fatty acids, diacylglycerols.
1. Introduction
Among vegetable oils, extra virgin olive oil (EVOO) has nutritional and sensory characteristics that make it unique
and a basic component of the Mediterranean diet (Caramia et al., 2012). Because of its prestige, unfortunately a
great number of olive oils fraudulently sold as EVOOs has always been illegally mixed with cheaper and lowquality olive oils, with poorer characteristics (Pérez -Camino et al., 2008). Among these latter, the so-called
“lampantini” olive oils cannot be used for direct human consumption, since they have a too high acidity level and
their volatile profile is characterized by “soft” off-flavours, derived from low-quality olives or from inappropriate
procedures during extraction or storage of the oil. Illegal deodorization applying a “mild” technology, developed
under vacuum and at low temperature, is able to remove unacceptable defects, avoiding the formation of chemical
traces in the oils exploited as forensic proof of fraud (Bendini et al., 2009). At now, the determination of fatty acid
methyl (FAME) and ethyl esters (FAEE), known as fatty acid alkyl esters (FAAEs), seems the most promising
method to detect such low-quality oils, as suggested by data recently published in different scientific works (Pérez Camino et al., 2008; Biedermann et al., 2008; Bendini et al., 2009). Actually, in good quality EVOOs, FAMEs and
FAEEs are present in very small amounts, since they are formed as a consequence of degradation and fermentation
processes of low quality olives, which can be overripe, damaged, or simply poorly preserved before being
processed. These alterations lead to a production of short chain alcohols by the degradation of the pectines by
endogenous pectin-methyl-esterases (methanol) and by the aerobic metabolism of microorganisms (ethanol)
(Biedermann et al., 2008). At the same time, lipolysis of triacylglycerols with liberation of free fatty acids may
occur. Then the formation of FAMEs and FAEEs by esterification can take place, while it does not seem to occur
during the storage of high-quality EVOOs (Mariani and Bellan, 2011). These molecules have two different but
complementary meanings: first they are related to the olive (and consequently the olive oil) quality, and FAAEs can
be considered as “virtual” markers of possible “mild-deodorization”, since they resist and are not removed by this
illegal treatment. In fact, the contemporary presence of a high level of FAAEs, without a clearly perceivable
sensory defect, can be reasonably explained by the application of “mild-deodorization”. Moreover, the presence of
high amount of FAAEs is also related to fermentative defects, detected by the sensory analyses. From April 2011,
the determination of FAAEs became an official method adopted by the European Community law (EU Reg.
61/2011 and corrigendum), with the aim to evaluate the belonging of olive oils to the commercial category of
EVOO. Considering the possible frauds of the EVOOs with other vegetable oils, it’s important to evaluate the
composition of macro constituents (triacylglycerol, fatty acids) and micro components (sterols) of the oils, since
they are typical for each botanical specie. To evaluate the degree of freshness of the examined oils, it’s important to
consider the ratio between 1,2- and 1,3-diacylglicerols (1,2-DGs and 1,3-DGs) (Frega et al., 1993), even if it’s not
an official method. In general, the 1,3-DGs are not linked to positive characteristic of the EVOOs, since they are
formed only as a consequence of lipolytic process and they increase during the storage of the oils, mainly after an
- 170 -
isomerization reaction that involves 1,2-DGs (Serani et al., 2001). Differently from the free acidity content, that can
be decrease with fraudulent practices, the presence of DGs can’t be illegally modified.
The study and the evaluation of the complete analytical pattern of the EVOOs, both from a sensorial and a chemical
point of view, can be a useful tool to discriminate products also within the same commercial categories, according
to their different levels of quality.
Different sets of samples of olive oils were collected and analyzed, in particular:
1) 28 samples of EVOO (F1-F28), directly collected from Italian mills;
2) 34 samples of EVOO (C1-C34), all sold at a medium-low price (2-5 €/kg) in the large scale retail trade
(supermarkets and discounts);
3) 6 lampante and “repaso” olive oils (LR1-LR6) and 6 refined olive oils (R1-R6);
4) 35 samples of EVOO (S1-S35) with different prices, all from the retail trade, of which: 12 certified from organic
farming, 15 with a labeled declaration of Italian origin “100% italiano”, 5 Protected Denomination of Origin
(P.D.O.) and 1 Protected Geographical Indication (P.G.I.) EVOOs, 6 samples obtained from olives from E.U.;
5) 140 samples of “premium quality” EVOO coming from 6 different countries and 4 different years, all
participating at the I.O.O.A. (International Olive Oil Award, Zurich).
For the sets of samples 1-4, the determination of FAAEs was performed, using analytical procedures that followed
the historical evolution of the method, first reported in the literatures (Pérez -Camino et al., 2008; Bendini et al.,
2009; Cerretani et al., 2011) and then adopted by the European Community law (EU Reg. 61/2011): all these
approaches are based on solid-liquid chromatography for isolating the fraction containing the alkyl esters and the
waxes, and a subsequent gas chromatographic analyses. Some selected samples of the sets 1, 2 and 4 were
submitted to a more complete plan of analysis, involving different basic quality indexes (free acidity FA, peroxide
value PV, spectrophotometric indexes K232 and K270, sensory analyses with Panel test and consumer tests) and other
specific analytical determinations (composition in triacylglicerols TGs, diacylglycerols DGs, sterols and
methylsterols, fatty acids, phenolic and volatile compounds, bitterness index K225, acquisition of the FT-IR spectra).
Moreover, the samples of the set 5 were sensorially evaluated both by the Swiss Olive Oil Panel and in a consumer
test during an important annual food exhibition in Zurich, in order to evaluate the perception of the consumers. A
statistical elaboration of all the results (ANOVA, PCA, Preference mapping) was performed by using XLSTAT
(Addinsoft, USA).
Determination of alkyl esters of fatty acids (FAAEs)
Many samples (12 out of 34) sold as EVOOs at medium-low price (C1-C34) showed total amounts of FAAEs
higher than the legal limit established by the European community for EVOOs (EU Reg. 61/2011). This can be due
to a low quality degree of the olives and/or to an illegally mixture between EVOO and low-quality oils (such as
“mild” deodorized) (Pérez -Camino et al., 2008). It’s important to underline that the C1-C34 samples were
collected before that the EU Reg. 61/2011 came into effect. Furthermore, the FAAEs were almost not present in the
oils sampled directly from Italian mills (F1-F28), suggesting a high quality of the processed olives (Fig.1).
Figure 1 Box-plot diagram showing the total amount of FAAEs in all the samples (see“Materials and Methods”for the codes of
the samples).
1600
FAAEs
[mg kg -1 ]
1400
1200
1000
800
600
400
200
C1-C34
R1-R6
0
F1-F28
S1-S35
LR1-LR6
The effectiveness of such a quality parameter is confirmed by the results evidenced for the samples “repaso” (LR1LR6), that were characterized by very high amount of FAAEs (Cerretani et al., 2011). The FAAEs are removed by
refining process, as seen for samples R1-R6. For the samples collected in the second phase of the project (S1-S35),
the amounts of FAAEs were lower than the EVOOs previously sampled (Fig 1). In particular, the EVOOs having a
denomination of origin (P.D.O. and P.G.I.) showed a very low content in FAAEs (from 13.42 mg kg-1 to 46.57 mg
kg -1): only two samples of the S1-S35 group were above the legal limit of the E.U. for EVOOs: they were both
labeled as “not filtered EVOOs” and sold at low price (Table 1). Actually, two other samples (S2, S24) were close
- 171 -
to the legal limit of FAAEs and they were also sold at low price. Since the official analytical method for the
evaluation of FAAEs is time and solvent-consuming and expensive, we decided to acquire the FT-IR spectra of the
samples, in order to build a statistical model able to discriminate the EVOOs according to their content in FAAEs.
Moreover, the analytical separation of the FAAEs was improved by using a Fast-GC method, in order to decrease
the time of analysis respect to the traditional gas chromatography.
Evaluation of the purity
For evaluating the purity of the EVOOs directly sampled from the Italian mills (F1-F28), the compositions in TGs,
fatty acids and sterols were evaluated. All the samples showed a typical composition for olive oils, since they were
within the legal limit established by EEC Reg. 2568/1991, with some not significant exceptions. In particular the
determination of TGs, carried out also to calculate the ECN42 value (EEC Reg. 2568/1991), was performed,
proposing an alternative gas chromatographic separative approach, instead of the official liquid chromatographic
one. This new method has to be still validated.
Evaluation of the freshness
The ratios between 1,2- and 1,3-DGs were also calculated, as marker of quality and freshness of the samples
(Serani et al., 2001). For all the oils sampled from Italian mills (F1-F28), except for one sample, this ratio was
always more than one, suggesting a good quality and freshness of the oil. For 15 out of 35 samples collected at the
supermarket (S1-S35), the ratio was less than 1, indicating both an advanced degree of preservation and a low
freshness of such products (Table 1).
Analytical determination on the samples collected from the retail trade
For the EVOOs sampled from the retail trade (S1-S35), the sensory analysis was carried out (EC Reg. 640/2008) by
the official Panel group of tasters of the Department of Food Science of the University of Bologna: 34 samples
were classified as “extra virgin”, while one of them was a lampante oil (rancid). Considering the chemical results,
the FA values were below the legal limit for all the samples, while for 9 samples the PV were above the legal limit
fixed for EVOO (Table 1). For some samples, also the spectrophotometric extinction coefficients were not within
the legal limit established for EVOOs (EEC Reg. 2568/1991). Only 5 samples out of 35 showed a total phenol
amount (TP) higher than 250 mg of gallic acid/ kg oil, so they can be considered as medium-high rich in phenolic
compounds. The same results were confirmed considering the contents in o-diphenols (o-DPH) and the K225 values
(Table 1). In particular, the sample S33 (from olives of the Italian cultivar Coratina) was the richer in TP and in oDPH and with the highest K225 value. The fatty acid composition of all the samples was typical for EVOOs (EEC
Reg. 2568/1991), except for arachic acid percentage (for 4 samples).
Table 1 FA, free acidity in % of oleic acid; PV, peroxide values in meq. O2 kg-1 oil ; K232, K270, extinction coefficients; K225,
bitter index as specific coefficient at 225 nm; TP, total phenols, in mg gallic acid kg-1 oil; o-DPH, orto-diphenols, in mg gallic
acid kg-1 oil; FAAE, total amount of FAAEs, in mg methyl heptadecanoate kg-1 oil; OA/LA, ratio between oleic acid and linoleic
acid; 1,2-/1,3 DG: ratio between 1,2- and 1,3-DG. Values in bold are not within the legal limits for EVOO (UE Reg. 61/2011).
Means in the same column shown with different letters are significantly different (p<0.05).
FA
PV
K232
K270
K225
TP
o -DPH
FAAE
OA/LA
S1
0.3 j,k
11 r
1.75 k-o
0,14 h-i
0.33 d-f
236.0 e
68.1 e-g
92.23 a-c
12.0 c-e
1.09 j-l
S2
0.4 h,i
15 l,m
2.08 d-k
0,47 a
0.22 l-p
175.7 h,i
58.7 i-l
102.81 a,b
10.7 f,g
1.02 j-n
S3
0.5 c,d
12 r
2.01 e-l
0,23 c-g
0.31 d-h
226.0 e,f
68.3 d-g
49.20 e-i
10.3 g
1.23 i,j
S4
0.3 j,k
15 m,n
1.74 k-o
0,14h-j
0.28 e-i
197.7 g
57.1 j-l
43.42 f-k
8.4 i-k
0.70 o-q
80.0 c
1,2-/1,3-DG
S5
0.5 f,g
17 h-j
2.01 e-l
0,18 c-j
0.34 d
254.0 d
35.48 h-m
10.6 f,g
2.04 g
S6
0.3 l-n
17 h,i
2.34 b-f
0,17 e-j
0.35 d
231.3 e,f
90.2 b
66.47 d-f
8.6 h,i
11.23 i,j
S7
0.5 e-g
24 c
2.65 b
0,15 f-j
0.21 m-p
127.4 k,l
50.3 m-o
70.47 c-e
8.0 j,k
0.72 o-q
1.22 i,j
S8
0.4 g,h
25 b
2.49 b,c
0,15 f-j
0.21 m-p
118.8 k-m
45.6 o-q
34.66 h-m
7.8 j,k
S9
0.2 n,o
28 a
2.29 b-g
0,19 c-j
0.43 b,c
327.9 b,c
46.6 n-p
37.56 g-m
11.3 d-f
2.57 f
S10
0.3 l,m
20 f
2.26 b-h
0,14 h-j
0.35 d
185.5 g,h
35.3 r,s
56.31 d-h
8.4 i,j
1.74 h
S11
0.4 h,i
21 e,f
2.18 c-i
0,20 c-i
0.25 i-n
127.7 k
40.1 q,r
39.58 g-k
10.0 g,h
0.88 m-o
S12
0.5 d-f
24 c
2.16 c-j
0,23 c-f
0.18 p
111.9 k-n
25.4 u,v
78.80 b-d
13.0 a,b
S13
0.5 c,d
15 k-m
2.10 d-k
0,18 c-j
0.24 i-o
177.0 h,i
69.1 d-f
33.84 h-m
7.5 k
S14
0.5 b,c
2.14 c-j
0,15 f-j
95.9 n,o
28.6 t,u
43.40 f-k
9.3 g,h
S15
0.6 a,b
27 a
3.11 a
0,22 c-h
0.20 n-p
148.4 j
39.7 q,r
41.45 g-k
5.3 m
0.49 r
S16
0.6 a
21 d,e
2.46 b-d
0,52 a
0.21 m-p
106.0 m-o
19.9 v
55.59 d-h
9.8 g,h
0.59 p-r
S17
0.4 g,h
16 j-l
2.46 b-d
0,25 b-e
0.25 i-m
190.4 g,h
52.6 l-n
46.32 e-j
8.3 j,k
0.73 o-q
S18
0.4 g,h
17 h
2.40 b-d
0,21 c-h
0.23 j-o
159.5 j
43.4 p,q
61.71 d-g
8.3 j,k
0.73 o-q
S19
0.4 i,j
17 h-j
1.73 k-o
0,25 b-d
0.41 c
226.5 e,f
64.1 f-i
48.88 e-i
11.8 c-e
0.75 o,p
S20
0.3 k,l
7s
1.77 j-n
0,32 b
0.46 a-c
334.5 b
70.8 d,e
29.21 i-m
12.0 c-e
0.94 l-o
S21
0.5 e,f
12 r
2.32 b-g
0,26 b,c
0.24 i-o
107.4 m-o
24.3 u,v
34.64 h-m
10.0 g,h
0.63 p-r
S22
0.3 k,l
16 i-k
0.19 o,p
0.56 q,r
0.57 p-r
0.50 r
14 n,o
2.32 b-g
0,18 c-j
0.26 h-l
111.4 l-n
32.4 s,t
52.09 e-i
12.9 a,b
S23
0.2 o
13 q
1.62 m-o
0,17 d-j
0.32 d-g
187.2 g,h
74.4 c,d
47.54 e-i
12.0 c-e
3.46 e
S24
0.4 i,j
14 n,o
1.38 o
0,19 c-j
0.33 d,e
218.3 f
68.9 d-f
116.39 a
13.6 a
0.88 n,o
1.15 j,k
S25
0.5 c-e
17 h-j
1.99 e-m
0,19 c-j
0.28 g,k
197.7 g
65.2 e-h
29.87 i-m
7.7 j,k
1.39 i
S26
0.3 j,k
13 q
1.81 i-n
0,14 h-j
0.20 n-p
94.7 o
47.2 n-p
30.56 i-m
6.5 l
2.50 f
0.64 p-r
S27
0.4 i,j
19 g
1.97 e-m
0,18 c-j
0.24 i-o
153.3 j
64.4 f-i
38.13 g-l
8.5 i,j
S28
0.3 m,n
16 h-j
1.95 g-m
0,15 g-j
0.28 f-j
161.7 i,j
39.7 q,r
19.04 k-m
10.1 g,h
2.10 g
S29
0.3 k,l
11 r
1.46 n,o
0,11 j
0.32 d-g
159.6 j
61.0 h-j
13.42 m
12.2 b-d
5.63 b
S30
0.2 o
13 p,q
1.69 l-o
0,23 c-g
98 n,o
53.8 k-m
14.13 l,m
8.5 i,j
5.34 c
S31
0.3 l-n
18 g
2.35 b-e
0,12 i,j
0.21 l-p
191.3 g,h
35.2 r,s
46.57 e-j
11.2 e,f
1.07 j-m
S32
0.3 j,k
22 d
1.66 l-o
0,13 i,j
0.23 k-o
105.3 m-o
58.9 i-k
41.75 g-k
8.4 i,j
2.15 g
S33
0.3 m,n
13 o-q
1.89 h-m
0,15 g-j
0.48 a
428.1 a
114.0 a
19.30 k-l
9.8 g,h
6.56 a
S34
0.3 j,k
17 h-i
1.96 f-m
0,17 d-j
0.47 a,b
311.9 c
62.4 g-j
41.32 g-k
12.2 b,c
4.57 d
S35
0.3 k,l
22 d
2.01 e-l
0,17 e-j
0.32 d,g
187.1 g,h
32.8 s,t
22.05 j-m
10.6 f,g
2.16 g
0.2 n-p
The chemical results, the sensory attributes evaluated by the Panel and the class of price (low, < 5 €/kg; medium, 58 €/kg; high, > 8 €/kg) were statistically elaborated, performing a Principal Component Analysis (PCA): some
interesting correlations among the variables were observed (Fig. 2). This PCA explains more than 69% of variance
- 172 -
among samples and in particular the first component F1 more than 50%. As examples, the content in FAAEs was
negatively correlated with the price, while bitterness was high positively correlated with pungency. Moreover, the
samples were arranged in the plane, according to different levels of their quality (Fig. 1). Actually, all the EVOOs
with a P.D.O formed a cluster located in the bottom right quadrant and were characterized by freshness, high
intensity of fruitiness, green and other positive sensory attributes, good appreciation by the panelists. In the top-left
quadrant there were only samples sold at low-price, with high amount of FAAEs. All the six EVOOs obtained by
olives picked up in the E.U. (except in Italy) were in the bottom left quadrant, in the direction of high intensity of
sweet, high values of free acidity and K270 (primary oxidation products).
Figure 2 PCA built with chemical and sensory parameters evaluated for the samples collected from the retail trade (S1-S35).
Biplot (F1 and F2: 69.04 %)
OA/LA
K225
14
9
FAAE
o‐DPH
F2 (19.00 %)
1
4
12
‐1
21
17
bitter
pungent
24
20
19
34
3
2
22
33
5
9
35
23
6
4
18 27 10
11 25
7
31
13
32
16 14
29
28
DG‐1,2/DG‐1,3
30
8
FA
overall‐liking
‐6
15
sweet
green
fruity
other positive attributes
26
K232
‐11
price
‐16
‐20
‐15
‐10
‐5
0
5
10
15
20
25
F1 (50.03 %)
Correlations between sensory and chemical properties
On the group of 35 EVOOs (S1-S35), 8 of them were selected, according to different chemical and sensorial
properties and a deep study was performed on their phenolic and volatile fractions. Moreover, a consumer test was
realized, in order to evaluate the overall liking of the products and to study the acceptance, the knowledge and the
preferences of the consumers. A preference map was realized, showing that the consumers appreciate the fruitiness
and partially the pungency of the oils, but not the bitterness. Moreover, good correlations were found between the
sensory attributes of bitterness and pungency and the content in phenolic compounds evaluated by
spectrophotometric indexes (TP, o-DPH, K225) and by liquid chromatography (HPLC-MS). Considering the volatile
profile, it was possible to confirm the presence of both the C5 and C6 compounds, originated by the lipoxygenase
pathway (LOX), mainly responsible for sensory green attributes. (E)-2-hexenal (C6-LOX) and 3-pentanone, 1penten-3-one, (Z)-2-penten-1-ol, 1-penten-3-ol (C5-LOX) were positively correlated with the overall liking of
tasters and consumers. A poor influence of the information related to the farming systems (conventional or organic)
was observed on the degree of overall liking expressed by consumers. The consumers preferred the EVOOs labeled
as P.D.O., confirming a good sensory perception of the quality of such oils. It’s nevertheless true that a not
complete knowledge of the EVOOs by consumers has been evidenced. On the one hand, the consumers were able
to link the fruitiness (and, in part, the pungency) of the EVOOs to the quality, but on the other hand the bitterness
was considered a negative attribute and it was not positively related to the overall liking.
Sensory evaluation and consumer perceptions of 140 “Premium quality” EVOOs
For evaluating the consumers’ acceptance of the EVOOs, a more detailed study was carried out. In particular, 140
samples of “premium quality” EVOOs from 6 different countries and 4 different years, all participating at the
IOOA (International Olive Oil Award, Zurich) were sensorially evaluated both by the official Swiss Olive Oil Panel
(EC Reg. 640/2008; Bongartz and Oberg, 2011) and by consumers. All the samples were characterized by high
level of harmony (above 5.15) and persistency (above 5.75), reflecting the strong degree of balance of all the
positive characteristics of these EVOOs, from an olfactory, tactile and kinaesthetic point of view and their long
length in the “aftertaste” phase of the degustation (Bongartz and Oberg, 2011). The results were statistically
elaborated in order to build a preference map, that permits to evaluate the correlations among the objective sensory
attributes (evaluated by the Swiss Olive Oil Panel) and the overall liking of the consumers. The main results of such
an approach confirm that the consumers’ overall liking was negatively related to the bitterness and pungency, and
positively related to the sweet and the ripe fruitiness. Moreover, a discrimination of the samples according to the
cultivar of the olives and the geographical area of cultivation was carried out, according to some of the most
- 173 -
significant sensory attributes: as example, a good discrimination was found for oils of the cultivar Tonda Iblea and
Picudo, and oils coming from Catalonia and Kreta, confirming that they share common sensory attributes within
each cluster. We also tried to check if the samples were grouped according to the presence of a denomination of
origin (P.D.O.), or the difference in farming system (organic or conventional), or the employment of only one
cultivar of olives or more cultivars for obtaining the EVOOs, but no discriminations were found.
According to this plan of analysis, all the EVOOs didn’t show lacks in terms of purity, so there were no evident
problems about illegally mixtures with other vegetable oils. Only some anomalies were detected in the profiles of
fatty acids and sterols, respect to the fixed values by the EEC Reg. 2568/1991 and following amendments.
Furthermore, it is desirable that an improving of the quality of the oils has to be reach in the future, especially
regarding the quality and storage of the olives, as confirmed by the results of the determination of FAAEs. Since
the low-quality “repaso” and “mild deodorized” oils showed very high values of FAAEs, we can’t exclude that the
EVOOs sold at low price and characterized by high amount of alkyl esters can be actually the results of illegal
mixture with the latter ones. On the other hand, the EVOOs directly sampled from Italian mills and the P.D.O
samples showed very low amounts of FAAEs, confirming the effectiveness of such a quality parameter. The
freshness of the EVOOs sold at the supermarkets was not also so good, as evidenced by the peroxide numbers and
the ratio 1,2-/1,3-DGs evaluated for the samples S1-S35. Even if the ratio 1,2-/1,3-DGs is not an official method
established by E.U. law, it is very useful to verify the freshness of an EVOO. All the chemical and sensory results
can be a useful tool to evaluate the quality of the oils and to discriminate different products. We can state that the
sensory positive attributes of EVOOs are not completely understood or appreciated by consumers. In other words,
consumers do not appear to practice a well-informed consumption of EVOOs. For this reason, a wide dissemination
of the importance of both pungency and bitterness in EVOOs should be done, in order to teach people about the
precious value of these sensory attributes, their linkage to the phenolic compounds and their beneficial effects on
the human health.
5. References
Bendini A, Valli E, Cerretani L, Chiavaro E, Lercker G (2009) Study on the effects of heating of virgin olive oil blended with
mildly deodorized olive oil: focus on the hydrolytic and oxidative state. J Agric Food Chem 57: 10055-10062.
Biedermann M, Bongartz A, Mariani C, Grob K (2008) Fatty acids methyl and ethyl esters as well as wax esters for evaluating
the quality of olive oils. Eur Food Res Technol 228: 65-74.
Bongartz A, Oberg DG (2011). Sensory evaluation of extra virgin olive oil (EVOO) extended to include the quality factor
“harmony”. J Agric Sci Technol A1, 422-435.
Caramia G, Gori A, Valli E, Cerretani L (2012) Virgin olive oil in preventive medicine: from legend to epigenetics. Eur J Lipid
Sc Technol 114: 375-388.
Cerretani L, Bendini A, Valli E, Morchio G, Chiavaro E, Lercker G (2011) Chemical characterization of refined olive oils and
second extraction olive oils (“repaso” oils) available on the national and international markets. Riv Ital Sostanze Grasse 88:
82-88.
Corrigendum to Commission Regulation (EEC) No. 61/2011 of 24 January 2011 amending Regulation No. 2568/91 on the
characteristics of olive oil and olive pomace oil and on the relevant methods of analysis. Off J Eur Commun 2011, L78:69.
EC Commission Regulation (1991) No 2568/91/EEC, July 11 Off J Eur Commun, L248: 1-83.
EU Commission Regulation No. 61/2011 of 24 January 2011 amending Regulation No. 2568/91 on the characteristics of olive
oil and olive pomace oil and on the relevant methods of analysis. Off. J. Eur. Commun 2011, L23: 1-14.
Frega N, Bocci F, Lercker G (1993) Acidi grassi liberi e diacilgliceroli quali parametri di qualità di oli extravergini di oliva. Riv
Ital Sostanze Grasse 70: 153-155.
Mariani C, Bellan G (2011) On the possible increase of the alkyl esters in extra virgin olive oil. Riv Ital Sostanze Grasse 88: 310.
Pérez-Camino MC, Cert A, Romero-Segura A, Cert-Trujillo R, Moreda W (2008) Alkyl esters of fatty acids a useful tool to
detect soft deodorized olive oils. J Agric Food Chem 56: 6740-44.
Serani A, Piacenti D, Staiano G (2001) Analytical system for the identification of deodorized oils in virgin olive oils. Note 2:
kinetics of diacylglycerol isomerization in virgin olive oil. Riv Ital Sostanze Grasse 78: 525-528.
- 174 -
Study of the Qualitative Parameters of Provola Cheese
Submitted to Different Storage Systems
Angela Zappia (angela.zappia@unirc.it)
Dept. of Biotechnologies for Agricultural Food and Environmental Monitoring,
Tutor: Prof. Marco Poiana
In this PhD thesis various storage methods of Provola cheese produced in Calabria have been developed and
validated: vacuum packaging, modified atmosphere packaging, and unwrapping at two thermal conditions. Also the
study involved the effect of different polymeric films on qualitative characteristics of stored cheeses. It will assess
the best option to preserve the quality during the shelf-life.
Studio della variazione dei parametri qualitativi della Provola
sottoposta a diversi sistemi di conservazione
In questa tesi di dottorato sono state messe a punto e validate diverse metodologie di conservazione della Provola
prodotta nel territorio calabrese: confezionamento sottovuoto, in atmosfera modificata e senza confezione a due
differenti condizioni termiche. Inoltre lo studio ha riguardato l’effetto di diversi film polimerici da imballaggio sulle
caratteristiche qualitative dei formaggi conservati. Ciò permetterà di valutare la migliore soluzione perché la qualità
del prodotto possa essere mantenuta durante tutto il tempo di conservazione.
Key words: Modified atmosphere, polymeric films, provola, shelf-life, storage conditions, vacuum.
1. Introduction
Following the PhD thesis project this paper reports the main results on the following activities direct to:
A1) Assess the effect of several packaging materials and conditions upon the physicochemical and microbiological
characteristics of the Provola cheese;
A2) Evaluate the trend of oxidation, lipolysis and proteolysis during the storage;
A3) Define the best storage condition for the maintenance of the product.
2. Storage of Cheese
Shelf life extension of food products is an important purpose for the industry. Researches conducted about this
subject have shown that enzymatic, chemical and physical reactions have a considerable influence on the
conservation and management of the product. The major approach to keep the quality of the food is based on the
study and application of new innovative processes and use of appropriate conservation techniques (Brody et al.,
2001).
The pasta filata cheeses owe their name to the Italian phrase which literally means ‘spun paste’ or ‘stretched curd’
referring to a unique plasticization and stretching process that is shared by all pasta filata cheeses and which gives
this diverse group their common identity (Kindstedt et al., 2004). This product had typical shape and natural fibre
string. The acceptability of Calabrian Provola cheese by consumers mainly depends on its sensory qualities and, in
this context, flavor and consistence are determinant.
The limited shelf life of this cheese derives from its chemical composition, which constitutes an excellent medium
for microorganisms, and also from the type of packaging material used, which does not always protect effectively
from disadvantageous physicochemical transformations, microbiological contamination and physical damage
(Dmytròw et al., 2007). Most of studies about cheeses were principally concentrated on the effects of various
packaging parameters on the oxidation, proteolysis and lipolysis and changes in texture. The degree of oxidation
depends by temperature, storage time and process (Robertson, 2009).
The deterioration of this food can be reduced and its shelf-life can be increased modifying the atmosphere
surrounding the product by reduction of oxygen concentration inside (Piergiovanni and Limbo, 2010). The
techniques used to reduce oxygen around the food are Modified Atmosphere Packaging (MAP) and include vacuum
packaging and “true” modified atmosphere packaging with the use of a specific gas mixture. The combination of
chill temperature and MAP generally results in a more effective and safer storage regime and longer shelf-life
(Phillips, 1996). Atmosphere in the head space is not only influenced by the initial used gas mixture but also by the
characteristics of packaging material. Moreover, that last can influence the food shelf life by means of barrier
properties because the most common food quality losses are associated with water vapor and oxygen transfer.
Selecting proper packing that will protect both the product and the consumer is so a very important stage in
definition of the quality of the packed product (Steinka et al., 2006). Knowledge of product characteristics, as well
- 175 -
as storage and distribution conditions, dictates the required barrier properties of the packaging materials used for
specific application. Fermented food of animal origin is packed using materials such as Polyamide⁄Polyethylene
(PA⁄PE), Polystyrene and others. For a long time polymers have supplied most of common packaging materials
because they present several desired features like softness, lightness and transparency (Siracusa et al., 2008). On the
other hand they are not readily biodegradable and so considered a detriment to the environment respect to the other
materials that are environmentally friendly.
Some studies were carried out about packaging of dairy products and specially of Provola cheese, but concerning
production in other regions of South Italy: particularly, a valuation of different gas mixture for MAP for portioned
Provolone cheese was done by Favati et al. (2007) and a characterization of a typical Sicilian Provola cheese was
studied by Ziino et al. (2005). This study aims to deepen the knowledges on Calabrian Provola cheese.
Research samples are represented by Calabrian Provola, a regional cheese manufactured in local cheese making
factory situated in Crotone (KR) from cow milk. Provola cheese currently is sold unwrapped and so in this research
the study involved different storage techniques and packaging films. For experiments after 24 hours by production
cheeses were packed (product weight 0.5-0.6 kg, major diameter 6.5 cm and minor diameter 4.5 cm, length 15 cm)
using the vacuum and the modified atmosphere as possible alternative. Samples are constituted as follows:
Unwrapped (UW); in a Vacuum Packaging (VP) pouch of PA/PE (Polyammide/Polyethylene); in
PE/EVOH/PVC+PVA (Polyethylene/Ethylene Vinyl Alcohol/Polyvinyl Chloride+Polyvinyl Alcohol)
thermoformed tray topped with a PE/PET film (Polyethylene/Polyethylene Terephthalate) (MAP A) and in a pouch
of PE/EVOH/PA/PE (MAP B). The used mixture gas is represented by 30:70 of CO2:N2 and samples were stored
for 65 days (declared expiry date of about 45 days) in two refrigerated incubators Foc 225 I (Velp Scientifica) at
4°C and 7°C.
The analyses of packaging materials were investigated in collaboration with DiSTAM department of University of
Milan and performed by use of IR spectroscopy (FT-IR Spectrometer Perkin Elmer Mod. Spectrum 100) and Nikon
mod. Eclipse ME600 Microscope to identify the nature and the number of layers and of a Micrometer (Bowers
mod. Dialmatic - 1μm of precision) for the thickness. Prior to opening the packages, head space gas composition,
expressed as oxygen and carbon dioxide percentages, was determined using a CheckPoint handheld Gas Analyser
(PBI Dansensor). The gas sample was taken with a needle inserted through the septum placed on the packages.
The physicochemical and microbiological characterization of samples, cut into 0.5 thick circles approximately, was
performed on two different layers of Provola cheeses (outer and internal). The following physicochemical
parameters were evaluated: dry matter (% d.m.) by loss weight in a oven at 105 °C to constant weight, content of
free water (aw) by means of AqualabLITE (Decagon) instrument; colour of the outer and inner layers with a Konica
Minolta CM-700d tristimulus colorimeter with reference to the CIE L a b colour space; hardness measurement (N)
by a TA-XT2i (Stable Microsystems, Surrey, UK) texturometer. The total acidity, expressed as g % of Lactic acid,
and pH were measured on extracts of each layer, according to the AOAC method (1980a, 1980b); chlorides were
expressed as % NaCl by the Mohr method; total nitrogen % and total protein % as reported by Lynch et al. (2002);
proteolysis index as water soluble nitrogen/total nitrogen (%). For the lipid fraction, % fat was determined
according to the method of Folch et al. (1957) using the mix of chloroform and methanol (2:1, v/v). The lipids were
then esterified according to modified method of Lin et al. (1995) to analyze Fatty Acids Methyl Esters (FAME) in a
GC 8130 Fison instrument equipped with a MEGA 10 column, length 50 m, inner diameter 0,32 mm, film
thickness 0,25 µm. The peroxide value was quantified by the method reported in Commission Regulation (EC)
2568/91 and it was expressed as mEq O2/kg. Finally for the microbial charge, the total bacterial count was
evaluated on PCA-Plant Count Agar- growth land (Oxoid) at 25 °C.
Two cheeses for each packaging material and temperature conditions were selected at each time of measurement:
production day (day 0) and at 10th, 21st, 35th and 65th day of storage. For each sample were sampled two repetitions
in each layer (for a total of eight measurement repetitions in each packaging study). Obtained data were submitted
to the statistical analysis of the variance (one-way, two and three-ways ANOVA) and post-hoc test (Tukey test) was
applied.
The principal physicochemical and microbiological components of Provola cheeses at production time are shown in
Table 1. During the storage changes in the physicochemical composition of different samples were studied and
some data of the last monitoring time are presented in Table 2.
- 176 -
Table1 Physicochemical and microbiological characterization of Provola cheese (after 24 hours from production time). Values
are means ± Standard Deviation, n=8.
Dry matter
(% d.m.)
51.48±1.75
Total acidity
(g % Lactic acid d.m.-1)
0.30 ± 0.01
pH
5.86±0.02
Peroxide value
(mEq O2 kg-1)
1.90±0.03
Fat
(% d.m.-1)
22,07 ±0.05
Chlorides
(% NaCl d.m.-1)
2.89±0.58
SFA
(%)
75.34±0.84
aw
0.97±0.00
PUFA
(%)
1.28±0.09
Proteins
(% d.m.-1)
48.85±0.04
MUFA
(%)
23.39±0.83
Table 2 Characteristics of the different layers of Provola cheeses stored for 65 days. Values are Means (M) and Standard
Deviation (SD), n=8. *Significance at P<0.05;**Significance at P<0.01; n.s. not significant. Data followed by different
letters are significantly different by Tukey’s multiple range test.
Lactic acid % d.m.-1
Dry matter
Samples
4°C
Internal
Outer
Internal
Outer
Internal
UW
M
77.49a
SD
0.87
M
64.27a
SD
3.95
M
0.39b
SD
0.02
M
0.61a
SD
0.09
M
2.77c
SD
0.02
M
4.76a
SD
0.51
VP
53.89b
0.19
52.14b
0.45
0.52a
0.00
0.59a
0.02
4.90a
0.57
4.26a
0.26
0.05
52.44
b
0.80
b
0.02
a
0.02
b
0.28
a
0.34
52.21
b
MAP A
MAP B
Sign.
UW
VP
7°C
Outer
NaCl % d.m.-1
MAP A
MAP B
Sign.
54.26
b
53.34
b
1.72
**
77.74a
b
54.58
53.91
b
52.23
c
**
0.86
0.39
0.48
a
**
1.23
64.27a
0.04
53.06
b
52.50
b
52.96
b
0.05
0.93
**
0.03
0.58
0.46
b
**
3.95
0.39c
0.41
a
0.49
0.99
0.61
0.55
b
0.51
b
3.00
c
**
0.02
0.03
0.02
0.01
**
0.03
4.05
0.61
0.52
0.55
0.09
2.76c
0.03
a
0.02
n.s.
2.55
b
**
0.03
0.51
0.33
4.40
5.88
4.08
b
3.03
0.03
4.76a
0.51
0.39
4.57
a
0.44
4.38
a
0.12
0.21
c
0.31
**
0.37
**
1.77
b
0.24
**
Dry matter percentage increased during storage time in all samples (in outer layers particularly) without significant
differences between samples and temperature for three-ways ANOVA (data not shown). At the same temperature of
conservation a high statistical difference was observed among samples and, particularly, the greatest amounts were
noted in both layers of UW. The time (and not the temperature) influenced significantly the acidity on samples.
Here as the first a highly significant statistical difference was observed among samples at same temperature: only
the internal layers at 7 °C appeared the same. The NaCl content differed in the samples at two temperatures: among
samples packaged in film, the lowest values were found in MAP B. From a three-ways ANOVA (data not shown)
significant differences were observed among samples, time, temperature in outer (P<0.05) and internal layers (P
<0.01). In particular a correlation for Pearson’s correlation coefficients (r= -0.790 P<0.05) was observed between %
d.m. and % NaCl as confirmed by Lauverjat et al. (2009).
The trends of bacterial growth and aw content of the stored Provola cheeses were illustrated in Fig. 1 (data are
means of layers). The time influenced more than temperature the first parameter on samples with statistical
differences; from results during the storage it followed that MAP B had the lowest bacterial count (5.79
log10CFU/g) compared to VP, MAP A and UW (6.79, 6.48, 6.48 log10 CFU/g respectively). About water activity,
statistical analysis carried out among the layers has shown higher results in internal layers than in outer ones: they
decreased during the storage in all samples. The relationship among some chemical and textural parameters at the
ending time were established by Pearson’s correlation coefficients: hardness had positive correlation with NaCl in
VP stored at 7°C (r = +0.973 P <0.01), with dry matter in VP stored at 4°C and 7°C (r = +0.918 and r = +0.957 P
<0.01 respectively) and in UW stored at 4°C (r = +0.922 P >0.05). Moreover a negative significant correlation was
revealed between hardness and proteolysis index in VP stored at 7°C (r = -0.984 P <0.01). The found increase in
hardness (Fig. 2) was related to the rise in dry matter only in VP samples as just reported by Delgado et al. (2011)
in other cheeses. From the analysis in GC, the principal FAME in fat were the following: Myristic (14.39%),
Palmitic (33%), Stearic (8.6%) Oleic (22%) acids; the other minor FAME were: Butyric (2.9%), Caproic (2,50%),
Caprylic (1,70%), Capric (4%), Lauric (4.8%), Myristoleic (1.1%), Pentadecanoic (1.26%), Palmitoleic (1.90%),
Margaric (0.44), Linoleic (1.34%) acids. There weren’t statistical differences among samples stored in the different
times (data not shown).
Head space gas composition, both MAP A and MAP B, has shown a CO2 decrease from 10th to 21st storage day and
then an increase. The O2 content had a constant trend during the storage and it was about 0,9 % at the ending time
(data not shown).
- 177 -
Figure 1 Trend of the total mesophilic aerobic bacterial count and aw content, respectively, of the different stored Provola
cheeses. (Values are means ± SD, n= 4).
Figure 2 Development of proteolysis index and degree of hardness at principal storage time. (Values are means ± SD, n= 4).
Differences statistically relevant were not observed among packaging and temperatures conditions for the fat and
peroxide value (Figure 3). Only in the storage time was evidenced a highly significant difference for the peroxide
content as increasing in all samples; the lowest values were found in UW Provola cheese probably because if the
oxygen supply was unlimited, the rate of lipid oxidation was independent of oxygen concentration (Park, 2001).
Finally, Figure 3 showed the b* chromatic parameter values at time 0 and after 10, 21, 35 and 65 days of storage in
the outer layer: it decreased because the Provola cheese lost the yellow shade. According to three-ways ANOVA,
temperature did not affect the outer layers, oppositely to internal ones where there were high significant statistical
differences.
Figure 3 Peroxide value in the different samples (Values are means ± S.D., n= 4) and b* chromatic parameter (Values are
means ± S.D., n= 10) during the storage.
As results of this study, the packaging maintains the Provola cheese characteristics with a shelf life of 65 days if it
is preserved at proper temperature. It could favor the development of local markets to sell this typical product in
more distant places. Instead of unwrapping, the use of vacuum and modified atmosphere packaging is suitable in
relation to some organoleptic characteristics, as the acidity and salt content. The use of different films and the
storage conditions can contribute to maintain the Provola cheese quality: sample in MAP B had a different
- 178 -
qualitative trend respect to in MAP A with regard to total bacterial growth and peroxide content (lower values in
first than in second ones) and to proteolysis index (lower trend in MAP A). Nevertheless, further investigations are
required to support such hypothesis. Future study could be pertain the use of biodegradable materials as a
replacement for the conventional plastic films to evaluate the bio-packaging influence on the Provola cheese
quality and the differences with the previously studied materials.
7. References
AOAC (1980a) Acidity. 16.247 method. In Official methods of Analysis, 13th edn. (W. Horwitz, Ed.). Association of Official
Analytical Chemists, p.266.
AOAC (1980b) Hydrogen-ion activity (pH). 14.022 potentiometric method. In Official methods of Analysis, 13th edn. (W.
Horwitz, Ed.). Association of Official Analytical Chemists, p.213.
Brody A, Strupinsky E, Kline L (2001) Oxygen scavengers. Active packaging for food applications. CRC press, pp. 11-12.
Commission Regulation (EC) n.2568/91 (1991) Determination of peroxide value of oils and fats. In: Official Journal of the
European Union L 248, 5 September 1991.
Delgado FJ, Gonzàles-Crespo J, Cava R, Ramìrez R (2011) Proteolysis, texture and colour of a raw goat milk cheese throughout
the maturation. European Food Res Technol 233: 483-488.
Dmytròw I, Kryża K, Dmytròw K (2007) The effect of starter inoculation type on selected qualitative attributes of acid curd
cheeses (tvarogs) stored under cooling conditions. Electronic Journal of Polish Agricultural Universities 10.
Favati F, Galgano F, Pace AM (2007) Shelf-life evaluation of portioned provolone cheese packaged in protective atmosphere.
Food Sci Technol 40: 480-488.
Folch J, Lees M, Sloane-Stanley GH (1957) Simple method for the isolation and purification of total lipids from animal tissues.
J Biol Chem 226: 497-509.
Kindstedt P, Caric M, Milanovic S (2004) Pasta-filata cheeses. Cheese: Chemistry, Physics and Microbiology, pp.251-277.
Lauverjat C, Déléris I, Tréléa IC, Salles C, Souchon I (2009) Salt and aroma compound release in model cheeses in relation to
their mobility. J Agric Food Chem 57: 9878-9887.
Lin H, Boylstone TD, Chang MJ, Luedecke LO, Shulze TD (1995) Survey of the conjugated linoleic acid contents of dairy
products. J Dairy Sci 78: 2358-2365.
Lynch JM, Barbano DM (2002) Determination of the total nitrogen content of hard, semihard, and processed cheese by the
Kjeldahl Method: Collaborative Study. Journal of AOAC International 85: 445-455.
Park YW (2001) Proteolysis and lipolysis of goat milk cheese. J Dairy Sci 84: E84-E82.
Phillips CA (1996) Review: Modified atmosphere packaging and its effects on the microbiological quality and safety of produce.
Int J Food Sci Technol 3: 463-479.
Piergiovanni L, Limbo S, (2010) Tecnologie di packaging per la qualità degli alimenti. Food Packaging: Materiali, Tecnologie e
Qualità degli alimenti. Sprinter, pp.335-343.
Robertson GL (2010) Imballaggio e confezionamento dei prodotti alimentari. Ed agricole, pp.416-425.
Siracusa V, Rocculi P, Romani S, Dalla Rosa M (2008) Biodegradable polymers for food packaging: a review. Trends Food Sci
Technol 19: 634-643.
Steinka I, Morawska M, Rutkowska M, Kukułowicz A (2006) The influence of biological factors on properties of some
traditional and new polymers used for fermented food packing. J Food Eng 77: 771.
Ziino M, Condurso C, Romeo V, Giuffrida D, Verzera A (2005) Characterization of ‘‘Provola dei Nebrodi’’, a typical Sicilian
cheese, by volatiles analysis using SPME-GC/MS. Int Dairy J 15: 589-593.
- 179 -
- 180 -
nd
2 Year PhD Student
Poster Communications
- 181 -
- 182 -
Determination of Thermal Treatment Markers in Flours
and Related Products by Capillary Electrophoresis
Coupled to Tandem Mass Spectrometry
Chiara Bignardi (bignardichiara@alice.it)
Dip. di Chimica Generale ed Inorganica, Chimica Analitica, Chimica Fisica, University of Parma, Italy
Tutor: Prof. Claudio Corradini
A new method for qualitative and quantitative analysis of furosine in food products by capillary electrophoresistandem mass spectrometry (CE-MS2) has been optimized and validated. Despite all previous CE methods proposed
in literature no SPE treatment has been required. The method has been applied to the analysis of different food
products such as milk, pasta and flours (where furosine is in low amount). Reversed phase-HPLC-UV analysis
shown good agreement with CE-MS2 data. Furosine, and another marker proposed in literature for the assessment
of thermal treatment entity of food products, maltose:maltulose ratio, have also been compared by using flour-based
product subjected to different thermal treatments.
Quantificazione di markers di processo in farine e prodotti correlati
mediante elettroforesi capillare-spettrometria di massa tandem
Un metodo innovativo per l’analisi qualitativa e quantitativa di furosina mediante elettroforesi capillarespettrometria di mass tandem (CE-MS2) è stato sviluppato e validato. Rispetto ai precedenti metodi in CE, non è
stato previsto alcun pretrattamento del campione mediante SPE. Il metodo è stato applicato per la quantificazione di
furosina in diversi tipi di alimenti tra cui latte, pasta e farine, nelle quali è contenuta a bassa concentrazione. I dati
ottenuti sono stati confrontati con quelli in HPLC-UV e non sono risultati essere statisticamente diversi.
Analizzando un prodotto a base di farina (tigelle) sottoposto a diversi trattamenti termici, è stato confrontato
l’andamento della furosina rispetto ad un altro marker di processo: il rapporto maltosio:maltulosio.
Key words: Markers of food process, capillary electrophoresis-tandem mass spectrometry.
1. Introduction
Furosine is a marker of food process related to the initial steps of the Maillard reaction, and has been considered to
be the most evident effect induced by heat treatment. It was quantified in a lot of food products such as yogurt
(Tokusoglu et al., 2006), pasta (Resmini et al., 1991), infant formulas (Penndorf et al., 2007), dehydrated fruits
(Sanz et al., 2001). It can also be recognized as a quality indicator especially for milk and dairy products (Corzo et
al., 2000). The common analytical technique employed for furosine determination is reversed phase HPLC-UV.
Mass spectrometry has been rarely employed. Few CE methods have been developed in the past years employing
UV (Corradini et al., 1996). Despite the strategies proposed, only samples containing discrete amounts of furosine,
such as breakfast cereals, milk, dairy products have been analyzed by CE. No application of CE coupled to MS
detection have been reported. This presentation reports the main results of the following two steps concerning:
(A1) Optimization and validation of a new rapid and low-cost analytical method by using capillary electrophoresistandem mass spectrometry, and its application for the quantification of furosine in different food products such as
milk and pasta, where it is contained in large amount, and flours where it occurs in low amount.
(A2) Comparison of furosine and maltulose kinetic productions, another marker of food process introduced by
Garcia-Banos et al., (2000) that is formed simultaneously to Maillard reaction, on flour-based products (tigelle)
subjected to different thermal treatments by cooking in a low-emissivity oven and in a conventional oven.
Solid samples were ground in order to obtain a fine powder and kept under dry atmosphere for 24 hours to
eliminate possible moisture; then weighted and processed as described below. All samples (pasta, flours, milk and
tigelle) were treated following the method proposed by Resmini (1990) slightly modified as follows: 100 mg of
samples were hydrolysed with 5 mL of HCl 8 N, under inert conditions at 110 °C for 23 h in a screw-capped Pyrex
vial with PTFE-faced septa. After hydrolysis, the sample were filtered with a 0.45 μm PTFE membrane filter and
evaporated under nitrogen. The hydrolyzate was resuspended in 2.5 mL of running buffer (formic acid 50 mM, pH
2.7) and re-filtrated on 0.20 μm PTFE membrane filter.
3.1 CE-MS2 method optimization and validation
In the first step, the optimization of the separation conditions and acquisition parameters in terms of pH and ionic
strength of the running buffer, temperature and voltage was performed. In the optimized conditions (ammonium
- 183 -
formiate 50 mM pH 2.7, Temp 30°C, V 25 kV), the separation of furosine was obtained in 4 min. The acquisition
was performed by ion trap (Agilent Technologies) in product ion scan by monitoring the transition m/z 255/130 and
m/z 325/307 for furosine and quinine (internal standard), respectively. Method performance was assessed in matrix
(white flour not containing furosine) under CE-MS2, according to Eurachem guidelines. The results were
satisfactory for all the investigated quality parameters: limit of detection (LOD) and quantification (LOQ), linearity,
accuracy and recovery. The applicability of the method was tested by analyzing different samples containing
furosine values in a large range by using the same matrix calibration curve. Then, some of the samples have been
analyzed by RP-HPLC-UV and the results were not statistically different (p>0.05). All data are reported in an
article in press (Bignardi et al., 2012, Electrophoresis).
3.2 Comparison between furosine and maltose:maltulose ratio, correlation with cook value index and
colorimetric parameters (CIElab)
In the second part of the project, a flour-based product (tigelle) subjected to different thermal treatments was used
to investigate different markers proposed in literature for the assessment of thermal treatment entity of food
products: furosine (Maillard reaction progression), maltose:maltulose ratio (an index of epimerization of maltose to
maltulose), and colour indexes (L, a, b, ∆E). For this purpose, an experimental design of cooking (160-180-200°C,
20-30-40 min) was translated in terms of cook value index, which expresses the degree of cooking of the sample
measured in real time from the heat penetration curve. This plan of cooking was built for two ovens, a standard
oven (emissivity =0.9) and a low emissivity prototype (emissivity <0.1). Furosine amount has been found to
progressively decrease with the increase of the thermal treatment (Figure 1): a negative correlation was recorded (r
= -0.954 for conventional oven and r = -0.937 for low-emissivity oven). This behavior is determined by the fact that
Maillard reaction at these strong values of cooking proceed at late stages, where furosine is degraded to form new
products characteristic of the advanced steps. In figure 2, the Ma:Mu ratio decreases as the epimerization reaction
of maltose to maltulose proceeds (r = -0.960 for conventional oven and r = -0.768 for low-emissivity oven). Unlike
furosine, the production of maltulose continues despite high thermal treatments (high values of cook value)
obtaining low values of Ma:Mu ratio. Among the colorimetric parameters of CIElab system, ∆E, expressing the
degree of browning, is the most representative one. A positive correlation was obtained between ∆E and the cook
value (r = 0.782 for conventional oven and r = 0.921 for low-emissivity oven). Pairwise correlations (Spearman,
SPSS v.18.0) computed between all the variables investigated (furosine, Ma:Mu ratio, ∆E, weight loss and surface
temperature) have shown good values (r > 0.6, p < 0.01 two-tailed).
Figure 1 Trend of amount of furosine versus cook value
in both ovens (conventional-dashed line, low emissivitycontinuos line).
Figure 2 Trend of Maltose:Maltulose ratio versus cook
value in both ovens (conventional-dashed line, low
emissivity-continuos line).
4. References
Bignardi C, Cavazza A, Corradini C (2012) Determination of furosine in food products by capillary zone electrophoresis-tandem
mass spectrometry. Electrophoresis DOI: 10.1002/elps.201100582.
Delgado-Andrade C,·Rufían-Henares JA, Morales FJ (2005) Fast method to determine furosine in breakfast cereals by capillary
zone electrophoresis. Eur Food Res Technol 221: 707-711.
Erbersdobler HF, Somoza V (2007) Forty years of furosine – Forty years of using Maillard reaction products as indicators of the
nutritional quality of foods. Mol Nutr Food Res 51: 423-430.
Garcia-Banos JL, Olano A, Corzo N (2000) Determination of mono- and disaccharide content of enteral formulations by gas
chromatography. Chromatographia 52: 221-224.
Resmini P, Pellegrino L, Battelli G (1990) Accurate quantification of furosine in milk and dairy products by a direct HPLC
method. Ital J Food Sci 3: 173-183.
- 184 -
Non Proteolytic Aminoacyl Derivatives in Parmigiano-Reggiano Cheese:
Origin and Properties
Chiara Bottesini (chiara.bottesini@unipr.it)
Tutor: Prof. Stefano Sforza
The first activity of the Ph.D. thesis is focused on the characterization of unusual aminoacidic derivatives in
Parmigiano Reggiano cheese, in particular their structural characterization, origin and biological-functional
properties.
Amino acidi e loro derivati di origine non proteolitica presenti nel Parmigiano Reggiano:
origine e proprietà
La prima attività del dottorato di ricerca è focalizzato sullo studio e la caratterizzazione di composti inusuali di
derivazione amminoacidica presenti nel Parmigiano-Reggiano, con particolare riguardo alla loro caratterizzazione
strutturale, alle vie di formazione ed alle loro proprietà biologiche e funzionali.
Key words: Parmigiano Reggiano cheese, non proteolytic aminoacyl derivatives.
1. Introduction
The occurrence and the accumulation of non proteolytic peptide like molecules (γ-glutamyl-, pyroglutamyl- and
lactoyl amino acids) in Parmigiano Reggiano cheeses has been previously demonstrated (Sforza et al., 2009).
In order to investigate the origin and properties of this particular class of molecules, several experiments were
performed, in particular a) the chemical synthesis of heavy labelled-γ−Glutamyl-Phenylalanine (D-γ-Glu-Phe), to
be used as standard and the evaluation of the influence of the enzymatic activities present in Parmigiano-Reggiano
cheeses on non proteolytic derivatives production and degradation.
In order to carry out experiments for discriminating the already present from the newly added γ-glutamylphenylalanine, as representative of non proteolytic aminoacyl derivatives (NPADs) in cheeses, the heavy labelled γglutamyl-phenylalanine standard was chemically synthesized by using solution methodologies. The compound was
purified by RP-HPLC and characterized by ESI-MS.
The Parmigiano Reggiano extract was obtained by dilution and homogenization of 20 g of grated cheese in
phosphate buffer (50 mM at 7 pH). After centrifugation at 3500 rpm at 4°C, the extract was filtered on paper filter
and on membrane with 0.45 cut off, then incubated with deuterated precursors for 24 h at 37 °C. The presence of γglutamyl-phenylalanine was determined by LC/ESI-MS. Isotopically labelled γ-glutamyl-phenylalanine was also
incubated in the same conditions in order to have indications on the presence of enzymatic activities eventually able
to degrade NPADs. In order to evaluate the kinetic of NPAD formation, the soluble fraction of Parmigiano
Reggiano cheese was placed in contact with deuterated pheylalanine and the sample was analyzed in LC/ESI-MS
every 72 minutes for 13 hours in order to evaluate the kinetics of γ-Glu-Phe formation. In addition the extract was
incubated 5 hours with different amounts of deuterated phenylalanine and the enzymatic reaction was stopped with
20 % of acetonitrile. The samples were analyzed by LC/ESI-MS and the ratio between deuterated γ-Glu-Phe
/undeuterated γ-Glu-Phe was evaluated. In order to evaluate the optimal pH for enzymatic activity, the samples
were extracted with a phosphate buffer (50 mM) at different pH (4-6-7-8) and then incubated with a heavy labeled
phenylalanine (3.2 mg) for 24 hours at 37°C, and the relative amount of γ-Glu-Phe and Lac-Phe (in this latter case
lactic acid was also added at a 2:1 ration with Phe) was evaluated by LC/MS. A similar experiment was set up in
order evaluate the hydrolysis rate of γ-Glu-Phe at different pH: 7 ml of Parmgiano Reggiano extracts, obtained with
the same procedure (extract in phosphate buffer 50 mM), was adjusted at 4–6-7-8 value and the volume was
equilibrate to 10 ml for all sample, at 900 μl of extrats at different pH were added of deuterated γ-Glu-Phe and
incubated for 24 hours at 37°C, evaluating the appearance of deuterated Phe by LC/MS. Again, the ratio between
deuterated γ-Glu-Phe /undeuterated γ-Glu-Phe was evaluated. In order to evaluate if proteolytic enzymes might be
responsible for NPAD production, first pepsin, chymotrypsin, trypsin were reacted individually and pooled together
with the precursors (solution 2 mg/ml of phenylalanine + glutamic acid) The samples were analyzed by LC/ESIMS.
On the other way round, in order to evaluate the resistance of γ-Glu-Phe to simulated gastrointestinal digestion, the
standard pure molecule was also subjected to a complete simulated digestion. The digestion experiment was
performed at 37 °C and it was subdivided in 3 steps: reaction with saliva, gastric juice, duodenal juice. Finally, also
- 185 -
other proteolytic enzymes, carboxypeptidase Y (CPY) and γ-glutamyl-transpeptidase (GGT), were utilized in order
to test their ability to form and/or or to cleave the deutered γ-Glu-Phe. The reaction solvent was a phosphate buffer
at pH=6 for CPY and at pH 8 for GGT, the reaction was kept overnight at 37°C with a ratio enzyme:substrate
of1:50. The substrates for the enzymatic reaction were prepared as follows: glutamine + deuterated phenylalanine,
glutamic acid + deuterated phenylalanine, lactic acid + deuterated phenylalanine (all in equimolar amounts) and
deuterated γ-Glu-Phe. SEC-HPLC was used to separate the cheese extracts in different fractions characterized by
different molecular masses. The soluble extracts was separated by SEC-HPLC and the subractions reacted with the
precursors of NPADs.
The syntheses of standard and deuterated γ-Glu-Phe yielded the desired molecule in good yield. The deuterated γGlu-Phe was purified by semipreparative-HPLC and characterized by UPLC-ESI/MS, yielding the desired
compound with an optimal purity, as indicated by the chromatogram after purification and by the MS spectrum.
By using isotopically labelled aminoacidic precursors (in order to discriminate the newly produced from the already
present γ-glutamyl-phenylalanine), it was then demonstrated the presence in the aqueous extracts of an enzymatic
activity able to produce γ-glutamyl-phenylalanine from glutamic acid and phenylalanine, after incubation at 37°C
for 24h. The extract denatured at 95°C for 30 minutes before incubation did not yield the compound after
incubation, demonstrating its enzymatic origin. The addition of deuterated γ-glutamyl-phenylalanine to the extract
followed by incubation in the same conditions showed that the γ-glutamyl-phenylalanine decreased, as compared to
the amount γ-Glu-Phe naturally present in the samples, indicating that in cheese extract is present an enzymatic
activity not only producing γ-Glu-Phe, but also one responsible for its degradation. In order to evaluate the kinetic
of formation, the ratio deuterated γ-Glu-Phe / undeuterated γ-Glu-Phe was followed along 13 hours. As shown in
Figure 6, the amount increased during the time until a plateau, clearly indicating a kinetic typical for an enzymatic
reaction.
In a second experiment, the correlation between the amount of γ-Glu-Phe formed and the amount of deuterated Phe
added was studied stopping the reaction after a predefined time (5 hours) with addition of acetonitrile up to 20%, by
using different amounts of deuterated Phe. Again, the amount of deuterated γ-Glu-Phe increased according to the
increased amount of the precursor. Subsequently it was demonstrated that, by increasing the pH of phosphate buffer
used for the extraction, an increased amount of deuterated γ-Glu-Phe was obtained when adding deuterated Phe to
the extract and incubating it in the same conditions as above. It was also observed that a more basic pH favour both
γ-Glu-Phe formation and degradation at the same time, suggesting that the same enzyme might be responsible for it.
Quite interestingly, when adding deuterated Phe and monitoring Lac-Phe formation, a different behavior was
observed: no formation at acidic pH, and then a decreasing trend going from pH=6 to pH=8, differently as seen for
γ-Glu-Phe, suggesting that the responsible enzyme might be different. Also the efficiency seemed to be lower, as
indicated by the lower ratios to the undeuterated compounds measured. In order to assess the ability of pure
enzymes to produce and degrade NPADs, different enzymes were considered. First, common endoproteolytic
enzymes (trypsin, chymotrypsin and pepsin) were tested, both singularly and in combination. γ-Glu-Phe was
demonstrated to be resistant to their action, but also they were not capable of yielding this compound in presence of
the suitable precursors, so they seemed to be uneffective both for production and for degradation of NPADs. Even a
simulated complete gastrointestinal digestion resulted to be totally ineffective in degrading the compounds.
On the other hand, carboxypeptidase Y was able to produce only Lac-Phe, but not γ-Glu-Phe, and was not able to
degrade them. γ-glutamyl-transpeptidase (GGT) was able, on the other side, to yield γ-glu-phe both from glutamine
and from glutamic acid, albeit with a much higher efficiency in the former case. GGT was also found to be able to
cleave the bond of γ−glu-phe, degrading it. SEC-HPLC was used to separate the cheese extracts in different
fractions characterized by different molecular masses.
The subfractions were reacted with glutamic acid and heavy labeled phenylalanine in order to identify those
containing the active enzymes able to generate γ-Glu-Phe. Moreover, experiments done with deuterated γ-Glu-Phe
indicated that the subfractions responsible of the formation of the compound were the same responsible for its
degradation, again suggesting a common enzyme responsible for both processes.
The same experiment with lactic acid and deuterated Phe as substrate showed that only one was able to produce
Lac-Phe, but with a low efficiency than γ-Glu-Phe, confirming previous results and indicating again that the
responsible enzyme(s) are different.
4. Reference
Sforza S, Cavatorta V, Galaverna G, Dossena A, Marchelli R (2009) Accumulation of non-proteolytic aminoacyl derivatives in
Parmigiano-Reggiano cheese during ripening. Int Dairy J 19: 582-587.
- 186 -
Cell Wall Structure and Phenomic Analysis of a
Saccharomyces cerevisiae Flor Strain
Marc Bou Zeidan (mbouzeidan@uniss.it)
Dipartimento di Agraria, Università degli Studi di Sassari, Italy
Tutor: Prof. Severino Zara
Flor yeasts belong to S. cerevisiae species and are the main actors in the aging of sherry-like wines. Particularly,
they form a biofilm, called flor, at the air-liquid interface at the end of alcoholic fermentation, when sugar and
amino acids are depleted and further growth becomes dependent on access to oxygen (Zara et al., 2005). In this
preliminary work the ability to form biofilm by different flor yeasts was first studied through the interaction
between cell wall proteins and specific peptides with antimicrobial activity and then through the ability of flor
yeasts to capture and metabolize amino acids at different cell wall electric charge (zeta potential) in medium
buffered at different pHs.
Struttura della parete cellulare ed analisi fenomica di un ceppo
di Saccharomyces cerevisiae flor
Lieviti Flor appartengono alla specie S. cerevisiae e sono i principali attori nell'invecchiamento dei vini tipo sherry.
In particolare, i ceppi flor di S. cerevisiae formano alla fine della fermentazione alcolica un biofilm all'interfaccia
aria-liquido, quando gli zuccheri e gli aminoacidi sono esauriti e lo sviluppo diventa dipendente dalla presenza di
ossigeno (Zara et al., 2005). In questo lavoro la capacità di formare biofilm da parte di diversi ceppi flor è stata
studiata inizialmente attraverso l’interazione fra le proteine di parete dei lieviti ed alcuni peptidi con attività
antimicrobica e successivamente attraverso la capacità dei lieviti flor di adsorbire e metabolizzare aminoacidi al
variare della carica elettrica della parete cellulare (potenziale zeta) per l’utilizzo di un mezzo di coltura tamponato a
diversi pH.
1. Introduction
In accordance with the PhD thesis project previously described (Bou Zeidan, 2011), this poster reports the main
results of the first two activities concerning: (A1) determination of the role of FLO11 gene in stress medium in the
presence of antimicrobial peptides “AMPs” (Munoz et al., 2006) using biofilm formation test, fluorescent
microscopy and Flow cytometry techniques; (A2) the growth ability of a flor yeast strain and its FLO11 mutant,
using the aminoacid histidine as a sole nitrogen source, and the role of Flo11p as a highly hydrophobic and
negatively charged cell wall mannoprotein in its capture and metabolism, respect to net electric charge of the cells
and different pHs of medium used. Among the different aminoacids tested, histidine was chosen as more promising,
being previously analyzed by Phenotype Microarray technology.
Concerning the first objective, dose response test were conducted to detect the MIC and IC50 of differnt AMPs. 104
cells/mL of strains A9 (wild type flor yeast), 3238-32 (derivate haploid from A9) and 3238-32∆FLO11, were
inoculated for 48 hour at 30°C, in YPD 20% with a 2-fold serial dilution concentration of diverse AMPs, PAF 26,
Histatin 5 and Melittin, characterized by different mode of action, from 64 µM to 0 µM (Fig. 1). Growth was
measured using SPECTROstarNano at OD600. For biofilm formation test, 107 cells/mL were inoculated statically in a
flor medium (0.67% YNB and 4% EtOH) with 32µM and 16µM of AMPs, for 48 hours at 30°C; Biofilm weight
was calculated using the formula:
Biofilm (mg dry weight) = [A600/2] [dilution factor][ml of washed cells].
After biofilm formation test, the gene expression of FLO genes family was analyzed using miRNeasy Mini Kit
(Qiagen) for RNA extraction, miScript Reverse Transcription Kit (Qiagen) for retro-transcription process and
LightCycler480 (Roche) for gene expression quantification. Fluorescent microscopy and flow cytometer techniques
were used for the characterization of physical interaction. Strains were inoculated in flor medium, for 2 hour at
30°C, with the presence of 32µM and 16µM of the labeled AMP, FITC-PAF26, in order to observe the role of the
cell wall in the interaction with PAF26.
Concerning the second activity, 2.105 cells/mL of 3238-32 and 3238-32∆FLO11 were inoculated for 5 days in YNB
(0.67% YNB w/o amino acids and w/o ammonium sulfate, 1%glucose), buffered at pH3, 4, 5, 6 and 7. 5mM of
Histidine was added as a sole nitrogen source. Growth was measured on SPECTROstarNano at OD600, and cell
- 187 -
surface charge was measured using “Malvern Zetasizer”
3.1 Determination of the interaction between Flo11p and PAF26 antimicrobial peptide
The dose response test gave an estimation of the concentration of AMPs subsequently used in the biofilm formation
experiments (IC50=16µM and MIC=32µM). The biofilm formation test showed a clear enhancement in biofilm
weight in the presence of PAF26, almost double respect to the control and to other AMPs.
Considering that, a positive correlation between biofilm formation and PAF26 was observed, qRT-PCR of FLO and
PMT genes isolated from PAF26 treated cells was performed in order to observe differences in transcription levels
of these genes, knowing that they are important for biofilm formation and glycosylation respectively. No significant
differences in genes expression were found between PAF26 and control cells.
Observation of the physical interaction between flor yeast strains and the PAF26 using a FITC-PAF26 labeled
peptide by fluorescent microscopy showed a clear internalization of FITC-PAF26 into A9 and 3238-32 strains
(staining from inside the cells), while in 3238-32∆FLO11 the staining was almost absent. Flow cytometer essays
confirmed these data, showing differences in the cell surface fluorescence related to the linkage of the peptide to
Flo11p (Fig.1).
Figure 1 Staining captured at 525nm from 10.000 cell surfaces treated with16 and 32µM FITC-PAF26 for 2 hours.
All these results led to the conclusion that, in flor medium, the highly hydrophobic and positive charged PAF26
acts as a linkage among flor yeasts with highly hydrophobic and negatively charged Flo11p, which lead to an
enhancement in biofilm formation without any change in gene transcription.
3.2 The growth ability of 3238-32 and 3238-32∆FLO11 in different amino acids as a sole nitrogen source
In this research has been showed that, using histidine as a sole nitrogen source, cell growth of 3238-32 and its
mutant changed depending on the pH. On pH 3, the FLO11 mutant showed a greater growth respect to its derivate
3238-32. This result correlates with the surface net charge measured at different pHs. Indeed, at pH 6, there was no
difference in growth between both strains and the net charge of 3238-32 and its mutant was comparable. (Fig.2).
This study leads to a new approach respect to the interaction between medium used and cell wall mannoproteins,
especially related to Flo11p. Finally, this work accomplished with the phenotype microarray analyses using
different amino acids and other nitrogen sources as a sole nutrient, trying to correlate Flo11p , cell wall composition
and environmental conditions.
Figure 2 Cell surface charge of 3238-32 and its mutant at different pH.
4. References
Bou Zeidan M (2011) Cell wall structure and phenomic analysis of a Saccharomyces cerevisiae flor strain. In Proc.s of the 16 th
Workshop on the Developments in the Italian PhD research on Food Science Technology and Biotechnology. Lodi (Italy).
21-23 September. 2011, pp. 293-294.
Munoz et al. (2006) Studies on the mode of action of the antifungal hexapeptide PAF26 antimicrobial agents and chemotherapy.
Antimicrob Agents Chemother 50: 3847-3855
Zara et al. (2005) FLO11-based model for air-liquid interfacial biofilm formation by Saccharomyces cerevisiae, applied and
environmental microbiology. Appl Environ Microbiol 71: 2934-2939.
- 188 -
First Assignement of the HRMAS-NMR Spectra of Golden delicious Apples
for the Creation of a new Analitycal Method to Verify the Maintenance of the
Quality of Apples during Storage
Caterina Cafiero (c.cafiero@unitus.it)
Dept. for Innovation in Biological, Agro-food and Forest systems (DIBAF), University of Tuscia, Viterbo, Italy
Tutor: Prof. Riccardo Massantini
Agricultural Research Council, Research for Plant and Soil System (CRA-RPS), Monterotondo (RM), Italy
Co-tutor: Dr. Massimiliano Valentini
The aim of this PhD project is to develop an innovative analytical method, fast and consistent, based on High
Resolution Magic Angle Spinning NMR combined with multivariate statistical techniques, to verify the
maintenance of the quality of apples during storage. In this phase of the project, the analysis of NMR spectra was
carried out to determine the metabolic profile of Golden delicious apples. Furthermore, these data were analysed by
the PCA multivariate technique to have an overall idea of the potentiality of the method.
Prima assegnazione dello spettro HRMAS-NMR di mele Golden delicious per la creazione
di un nuovo metodo analitico per il controllo del mantenimento della qualità delle mele
durante la conservazione
L’obiettivo del presente progetto di dottorato è di sviluppare un metodo analitico innovativo, veloce e ripetibile,
basato sulla High Resolution Magic Angle Spinning NMR abbinata a tecniche statistiche multivariate, per la verifica
del mantenimento della qualità delle mele durante la conservazione. In questa fase del progetto è stata realizzata
l’analisi degli spettri NMR per la determinazione del profilo metabolico delle mele Golden delicious. Inoltre, i dati
ottenuti sono stati elaborati mediante la tecnica di analisi multivariata PCA, per avere un primo riscontro delle
potenzialità del metodo.
Key words: Apple, storage, quality control, HRMAS-NMR, statistical analysis, Golden delicious.
1. Introduction
The Nuclear Magnetic Resonance (NMR) is one of the most successful and versatile analytical techniques of our
time, thanks to its direct applicability to heterogeneous systems (Sumner, 2003; Weckwerth, 2003). The NMR
techniques allow to investigate the chemical composition of a food, through the acquisition of proton spectra (oneand two-dimensional) and their interpretation, providing the "metabolic profile" of the food itself (Brosio and
Barbieri,1996). An important aspect of the High Resolution Magic Angle Spinning NMR technique is the
possibility to carry out the analysis directly on the sample, without having to perform pre-treatment, reducing the
time and costs of the analysis and allowing to obtain spectra whose sensitivity and resolution are comparable to
those of spectra obtained on samples pre-treated. The use of HRMAS NMR allows to obtain a snapshot of the
metabolic profile of a food, with the identification of marker compounds of the foodstuff. Such compounds are
important for the characterization of the botanical origin and for the study of the evolution of the metabolic profile
in time, eg during storage. The large number of information which are obtained through the HRMAS-NMR spectra,
however, are not easily interpretable, especially when undertaking studies on the metabolic profile, since the
number of variables is very large. For this reason it is necessary to use multivariate statistical methods for the
interpretation of spectroscopic data. The statistical method most widely used to perform a first exploration of NMR
data is the PCA, Principal Component Analysis.
In this first phase of the PhD project the HRMAS-NMR method has been developed, both as regards the
preparation of the sample and the acquisition parameters of the mono and bi-dimensional NMR experiments. With
regard to the sample preparation, it was carried out as follows: 20 mg of frozen pulp have been carefully weighed
and placed in a rotor for HRMAS-NMR of 4 mm in diameter. In the rotor were added a few drops of a phosphate
buffer solution (0.01M, pH 7) in deuterated water, containing TSP (sodium salt of 2,2,3,3-d4trimethylsilylpropionic acid) 0.01%, used as an internal reference.
- 189 -
3.1 The NMR Analysis
The 1H-HRMAS-NMR spectrum presents a remarkable complexity coming from the large number of signals and
from spectral overlaping of many of them. However, due to the use of previous works on similar matrices present in
the bibliography (Belton et al, 1997; 1998) and the use of TOCSY experiments, it was possible to assign the award
of several spectral signals. Several classes of compounds have been identified, including amino acids, sugars,
organic acids and polyphenols. In the spectral range between 0.80 and 3.15 ppm were identified signals related to
fatty acids (0.87, 1.30, 1.50 ppm), ethanol (1.17 ppm), lactic acid (1.33 ppm ) whose signal are superimposed to that
of threonine, acetic acid (1.92 ppm), succinic acid (2.39 ppm), malic acid (2.50, 2.74 ppm), quinic acid (1.86, 1.92,
2.03 ppm), alanine (1.47 ppm), GABA (1.88 ppm), glutamine (2.05 , 2.33 ppm), asparagine (2.85, 2.96 ppm) and
chlorogenic acid (2.03 and 2.17 ppm). Very intense and almost always well-resolved signals are related to malic
acid, always present in large amounts in the samples analyzed. Also signals related to asparagina are very intense
and well resolved in all samples analyzed. The spectral range between 3.15 and 5.50 ppm is instead characterized
by the predominant presence of signals from carbohydrates and organic acids. The assignment of signals in this area
is very complex because of the high intensity of the signals of carbohydrates, which hide weaker signals and
overlap creating complex structures. However, it was possible to recognize the signals of the main sugars: sucrose
(4.06, 4.20 and 5.40 ppm), α-glucose (5.22, 3.54, 3.42, 3.88, 3.78 ppm), β-glucose (4.64, 3.24, 3.46, 3.39, 3:46 and
3.88 ppm), α-fructose (3.65, 3.89, 3.99, 4.02 and 4.11 ppm), β-fructose (3.57, 3.65, 3.78, 3.82, 4.10 and 4.11 ppm).
Organic acids identified in this area are malic acid (4.33 ppm) and ascorbic acid (4.51 ppm). Finally in the spectral
range between 5:55 to 8:50 ppm, signals of some polyphenols were detected, in particular, were identified:
chlorogenic acid (6.40, 6.96, 7.14, 7.21 and 7.66 ppm) and the epicatechin (6.12 and 6.7 ppm). The signal of formic
acid is always present (8.44 ppm). Within individual experiments there are minimal differences in composition, but
these are attributable to the intrinsic variability of the composition of the apples themselves.
acetic acid
alanine
Lactic acid
and threonine
ethanol
Enlargement of the spectral area
between 0.80 and 2.20 ppm of the
HRMAS 1H-NMR spectrum of a
sample of pulp of Golden
Delicious apple.
3.2 The Multivariate Analysis
The 1H-HRMAS NMR spectra were processed for a first explorative statistical analysis by PCA to obtain an initial
evaluation of changes into the metabolic profile during the storage of apples. The first results are very encouraging
as they show the ability to distinguish quite markedly the different storage times considered.
4. Conclusions
The use of the technique 1H-NMR HRMAS allowed to perform the characterization of the variety Golden delicious
apple, identifying the main components of the metabolic profile directly on samples of pulp as such, without having
to perform pre-treatments of the sample. Data obtained are currently being further processing, and they are going to
be compared with the data obtained through the conventional analysis for the control of the quality of apples, for
the creation of a new analytical method for the control of the quality maintenance of apples during storage .
5. References
Brosio E, Barbieri R (1996) Nuclear Magnetic Resonance in analysis of dairy products. Rev Anal Chem 15: 273-291.
Belton PS, Delgadillo I, Gil AM, Roma P, Casuscelli F, Colquhoun IJ, Dennis MJ, Spraul M. (1997) High-field proton NMR
studies of apple juices. Magn Reson Chem 35: S52 - S60
Belton PS, Colquhoun IJ, Kemsley EK, Delgadillo I, Roma P, Dennis MJ, Sharman M, Holmes E, Nicholson JK, Spraul M
(1998) Application of chemometrics to the 1H NMR spectra of apple juices: discrimination between apple varieties. Food
Chem 61: 207-213.
Sumner LW, Mendes P, Dixon RA (2003) Plant metabolomics: large-scale phytochemistry in the functional genomics era.
Phytochemistry 62: 817-836.
Weckwerth W (2003) Metabolomics in systems biology. Ann Rev Plant Biol 54: 669-689.
- 190 -
Detection and Characterization of Specific Spoilage Organisms (SSOs)
in Different Food Matrices
Lucia Caldera (lucia.caldera@unimi.it)
DeFENS - Dept. of Food, Environmental and Nutritional Science, University of Milan, Italy
Tutor: Prof. Laura Franzetti
The aim of this PhD thesis is to study the microorganisms responsible of foods spoilage. The work was carried out
following the points indicated last year (Caldera, 2011). Here are presented the first three points of the research.
Firstly, the microbiological quality of different food matrices was investigated and the SSOs of each product were
isolated, characterized and identified until specie level. Then the total DNA and RNA of some foods were extracted
and the SSOs were quantified with molecular techniques. After that, the gene coding for a spoilage enzyme was
detected directly in foods.
Riconoscimento e caratterizzazione di Specific Spoilage Organisms (SSOs)
in differenti matrici alimentari
Lo scopo di questa tesi di dottorato è studiare i microrganismi responsabili dell’alterazione di alimenti. Il lavoro è
stato condotto seguendo i punti indicati in precedenza (Caldera, 2011). Qui sono presentati i primi tre punti della
ricerca. All’inizio è stata indagata la qualità microbiologica di differenti matrici alimentari, sono stati isolati,
classificati e identificati fino a livello di specie gli SSOs di ogni alimento. Quindi il DNA e l’RNA totali di alcuni
prodotti sono stati estratti per quantificare gli SSOs con metodi molecolari. Successivamente è stato ricercato
direttamente nell’alimento il gene codificante per un enzima alterante.
Key words: SSOs, foods spoilage, gene quantification, AprX.
1. Introduction
In accordance with the PhD thesis project previously described (Caldera, 2011), this paper reports the main results
of the first three activities concerning:
(A1) microbial quality of different foods, SSOs detection and phenotypic, biochemical, enzymatic and molecular
characterization;
(A2) total DNA and/or RNA extraction and SSOs quantification using quantitative Real-Time Polymerase Chain
Reaction (qRT-PCR) and Reverse Transcription PCR (RT-PCR);
(A3) research and amplification of a gene, specific for an enzyme responsible of spoilage.
In this study, five types of ready-to-use green salads differently packaged, ready-to-use stick carrots, milks,
mozzarella cheeses and hamburgers were used. All these products were analyzed during their shelf-life with
traditional plate count method, using generic and differential / selective media. The isolates were initially classified
phenotypically and enzymatically (morphology; motility; metabolic activity; growing temperatures; fluorescence,
pigments and levans production; catalase, lipolytic, pectinolytic, lecithinasic, amilolytic and proteolytic activities).
After that, all the isolates were classified until specie level by molecular techniques. DNAs were amplified with
universal and specific primers and digested with restriction enzymes to identify the differences among strains
(Scarpellini et al., 2004). Totals DNA and RNA of foods were extracted using commercial kits and they were
amplified (Calisti, 2008; Pennacchia et al., 2009) in qRT-PCR and RT-PCR to quantify the identified SSOs, using
calibration lines appositely created. Then, a gene (aprX) specific for an enzyme (an extracellular alkaline metalloprotease of Pseudomonas spp.) responsible of milk spoilage (Marchand et al., 2009), was studied.
The microbiological quality of the analyzed products was good, in fact pathogens were never found. Integrating the
plate counts with the identifications of strains was possible to recognize the SSOs. In carrots they were
Pseudomonas spp. and Leuconostoc spp. The salads’ SSOs were related to the internal atmosphere of the packages,
in fact even if Pseudomonas spp. was always dominant, in packaged under modified atmosphere products were not
negligible Lactic Acid Bacteria and Enterobacteriaceae. In mozzarella Pseudomonas spp. was the most important
spoilage organism: absent at the beginning, it reached the 107cfu/g at the expiration date. In hamburgers, according
to literature, we found as SSOs Pseudomonas spp. and Brochothrix thermosphacta. Therefore Pseudomonas spp.
appeared the most important spoilage microorganism in fresh foods. This microorganism also causes alteration in
milk, mostly for its heat-resistant extracellular enzymes which can endure the heat treatment and consequently
- 191 -
spoilage milks despite cells death. For this reason we initially focused our attention on Pseudomonas genus.
All Gram negative strains isolated from the analyzed food were subjected to characterization. The most important
activities that characterized the carrots isolates were the lecithinase, pectinase, and protease, and the fluorescence
production. The strains isolated form salads showed the same activities, but they could also produce pigments of
different colors: brown, orange, and yellow. The milk isolates could not hydrolyze starch, some hydrolyzed lecithin,
and the most part of them produced pale pigments. The strains isolated from mozzarella appeared very actives: in
fact they showed lecithinasic, pectinolytic, proteolytic activity and produced pale and dark pigments and
fluorescence. The isolates from hamburger instead hydrolyzed pectin and proteins and produced orange or brown
pigments.
Seeing its importance, proteolytic activity was studied at different temperatures and in culture cell-free to verify if
the produced protease was an extracellular enzyme, in add these results were compared with molecular
amplification of aprX, the gene specific for the most common extracellular metallo-protease of Pseudomonas spp.
About the 70% of the strains were positives both to the traditional and molecular methods, the 20% were always
negatives, but four strains had activity on plates and were negative to the amplification; fortunately these isolates
showed negative results in cell-free plates so they maybe produce an endo-protease. Other five strains appeared
negatives in plates and positives to the aprX amplification, so it was hypothesized that these strains had the gene,
but in that particular conditions could not express it. At this point, SSOs were researched directly in foods by total
DNA and RNA extraction. At the moment only milk, mozzarella and hamburger were analyzed. In milk and
mozzarella the genus Pseudomonas spp. were detected, whereas in hamburger Brochothrix thermosphacta was
researched. For Pseudomonas spp. research, the first steps were the choice of the primers and the optimization of
the operative protocol (thermal cycle, reaction mixture) to eliminate the nonspecific amplifications (e.g.:
Acinetobacter spp.), then a calibration line was create.
After that, edible and deteriorated, UHT, pasteurized and raw milks, at different age of shelf-life (just produced or
expired for some months or more than a year) were investigated for the presence of Pseudomonas spp. We could
not find a strict correlation between genus presence and alteration of milk and we decided to quantify aprX gene.
Using a new calibration line, create with crescent concentration of a protease producer Pseudomonas strain, aprX
was quantified.
For mozzarella the hope was to find a rapid method to understand if the product will get a blue color during its
shelf-life. So at the beginning some mozzarellas were analyzed at different times of their shelf-life.
Total DNA extraction and amplification gave contradictory results so we decided to investigate RNA. Comparing
DNA and RNA results it was possible to notice that the DNA background noise (death cells) ranged among 104105cfu/g, depending on the raw milk quality and the production season. However, alive and stressed cells
quantification couldn’t associate to color production, in fact only a low percentage of strains of Pseudomonas spp.
is able to produce pigments. To better understand this activity, mozzarellas contaminated and not with a blue
pigment producer strain, stored at different temperatures (4°C, 12°C and 25°C), were analyzed during their shelflife (Figure 1). The pigmentation appeared only in the contaminated mozzarellas and its appearance was inversely
proportional to the temperature, in add we noticed that blue was visible only when strains concentration reached
108cfu/g.
Figure 1 Growing trends of Pseudomonas spp. at different temperatures in
contaminated and not mozzarella cheeses during their shelf-life. The dashed lines refer
to the contaminated samples, the continuous ones to the non-contaminated products and
the circles indicate the appearance of the blue pigmentations.
Recently we are beginning the study Brochothrix thermosphacta following the same operative protocol: choice of
primers, optimization of reaction mixture and thermal cycle, construction of calibration line and hamburgers DNA
extraction and amplification.
4. References
Caldera L (2011) Research and isolation of Specific Spoilage Organisms (SSOs) from different food matrices. In Proc.s of the
16th Workshop on the Developments in the Italian PhD Research on Food Science Technology and Biotechnology, Lodi
(Italy), 21-23 September, pp. 297-298.
Calisti C (2008) Sviluppo di metodiche molecolari per il rilevamento rapido di Pseudomonas in matrici alimentari e ambientali.
PhD thesis in Foods Biotechnology, Università degli studi della Tuscia, Viterbo.
Marchand S, Vandriesche G, Coorevits A, Coudijer K, De Jonghe V, Dewettinck K, De Vos P, Devreese B, Heyndrickx M, De
Block J (2009) Heterogeneity of heat-resistant proteases from milk Pseudomonas specie. Int J Food Microb 133: 68-77.
Pennacchia C, Ercolini D, Villani F (2009) Development of a Real-Time PCR assay for the specific detection of Brochothrix
thermosphacta in fresh and spoiled raw meat. Int J Food Microb 134: 230-236.
Scarpellini M, Franzetti L, Galli A (2004) Development of PCR assay to identify Pseudomonas fluorescens and its biotype.
FEMS 236: 257-260.
- 192 -
Influence of a Veterinary Antibiotic on the Structure
and Function of Microbial Communities in Amended Soils
Luigi Chessa (luigi.chessa@uniss.it)
Dip. di Agraria, Sezione Scienze e Tecnologie Ambientali e Alimentari (STAA),
Università degli Studi di Sassari, Italy
Tutor: Prof. Alba Pusino
Here are reported the results about the first activities of this PhD project and in particular we present the results
related to the adsorption-desorption behaviour of tetracycline (TC) in two different soils, amended or not with
manure, the TC effects on total fast-growing heterotrophic fungi, bacteria and actinomycetes in soil, the extraction
and analysis of Phospholipid Fatty-Acids (PLFA) recovered from treated and untreated soils and the esterase
activity of soil microbial communities (Fluorescein Diacetate-hydrolysis, FDA).
Influenza di un antibiotico di uso veterinario sulla struttura
e funzione delle comunità microbiche in suoli ammendati
Sono qui descritte le prime attività svolte nell’ambito di questo progetto di dottorato e in particolare vengono
mostrati i risultati relativi all’adsorbimento e al desorbimento della tetracliclina (TC) in diversi suoli ammendati e
non ammendati con letame. Si riportano inoltre i primi risultati relativi all’effetto della TC sui microrganismi
coltivabili a crescita rapida quali batteri totali, funghi e attinomiceti presenti nei suoli trattati e all’estrazione ed
analisi dei fosfolipidi (PLFA) dai suoli in esame. Infine viene presentato l’andamento dell’attività esterasica (FDA)
delle comunità microbiche del suolo.
Key words: Tetracycline, soil microbial community, adsorption, desorption, FDA, PLFA.
1. Introduction
In accordance with the PhD project previously described (Chessa, 2011), this poster reports the main results so far
acquired:
(A1.1) characterization of soils and manure: physical properties, pH, Organic Matter (OM), Organic Carbon (OC);
(A1.2 and A1.3) batch experiments performed to evaluate the TC adsorption-desorption on two soils with and
without manure addition;
(A3.1 and A5) microcosm experiments performed to evaluate the influence of TC on: total fast-growing
heterotrophic bacteria, fungi, actinomycetes, Gram-positive and Gram-negative soil bacteria and FDA activity;
(A4.3) soil PLFA extraction, identification and quantification (instead of the fluorescent microscopy analysis which
was foreseen by the first draft of the project).
Two Sardinian soils (PU and SA soil) were used in this study. Soil samples were air-dried and sieved to <2 mm
before chemical analyses. The particle size distribution was measured by Purdue University Soil Testing
Laboratory using the pipette method (Day, 1965). The organic carbon content was determined according to the
modified Walkley-Black method (Jackson, 1958). Soil pH was determined on slurries with a soil/water ratio of
1:2.5. The cow manure used in the experiment was collected from a Sardinian cattle farm near Tula and stored in
the dark for 1 year at room temperature. The manure was free from any antibiotics, since no antibiotics were
administered to the animals. Adsorption-desorption trials were carried out using a batch equilibration technique at
25 ± 2°C. The concentration of TC was determined by HPLC Waters 1515 pump equipped with a Waters 2487
UV/VIS (Waters. Mildford, MA, USA). Soil fast-growing heterotropic fungi, bacteria, actinomicetes, Grampositive and Gram-negative bacteria were counted (using the serial dilution and spread-plate method) on GYEP
agar medium pH 4.5, 1:10 Triptic Soy Agar (OXOID, Milan, Italy), Actinomycetes Isolation Agar (DiFCO, Milan,
Italy) and the selective media for Gram-positive and Gram-negative bacteria described by Elliott and Des Jardin
(1999) respectively. FDA activity was determined as described by Adam and Duncan (2001). PLFA extraction
from soil, identification and quantification was essentially done according to Gutierrez et al. (2010).
3.1 Adsorption-desorption of TC
For our study two soils, with different physico-chemical properties, and caw manure, free from any antibiotics,
were chosen and characterized (Table 1).
The TC adsorption in soils amended or not with manure is very fast and not reversible. Kd value give information
- 193 -
about the affinity of TC for each soil. In PU soil, a clay soil, Kd (979) is higher than SA soil (254), a sandy soil. Not
all of TC administered to soils is adsorbed, a small portion remains bioavailable in solution. The TC concentration
that remains in aqueous solution in soils without manure ranged from 0.157 to 4.602 mg/kg, in presence of manure
ranged from 0.155 to 4.468 mg/kg. TC soil untied may be bioavailable and could have effect to microbial soil
community. The concentrations found in our experiment are in accordance with Thiele-Bruhn et al. (2005). They
have demonstrated that TC not adsorbed by soil causes, on microbial soil community, inhibition, of at least 10%, in
enzymatic activities when TC bioavailable ranged from 0.003 to 7.35 mg/kg.
Table 1 Selected physical and chemical properties of the soils and manure investigated.
PU soil
SA soil
Manure
pH
OM (%)
OC (%)
Sand (%)
Clay (%)
Silt (%)
5.77
7.60
7.81
6.90
4.87
52.72
4.00
2.83
30.58
39.40
72.71
-
41.37
16.63
-
19.21
10.61
-
3.2 Microbial counts, FDA activity, PLFA analysis
The results presented refer to the PU soil sampled at two different time-points, i.e. 2 and 7 days after antibiotic
and/or manure addition. After 2 days since TC addition, the fungi/bacteria ratio substantially increased being 306%
higher, with respect to control, at TC concentration of 500 mg/kg (Table 2). On the contrary, manure addition
significantly reduced this ratio but had a short-time effect disappearing after 7 days (Table 2). Moreover, manure
amendment apparently alleviated the TC effect particularly at 2 days time-point. After 7 days the TC effect on the
fungi/bacteria ratio was disappeared. Manure and TC had a synergistic effect on actinomycetes at both time-points
(Table 3). Data about Gram-positive and Gram-negative bacteria are not reported here but will be shown in the
poster presentation. The FDA analysis used to estimate soil microbial activity (esterase activity) showed a mostly
short-term detrimental effect of TC and an opposing trend for manure. Preliminary results seem to indicate that the
procedure employed to extract, quantify and identify PLFA from soil is successful and most likely suitable to detect
TC-induced changes of soil microbial community structure.
Table 2 Fungi/bacteria ratio in % with respect to control soil (S)*.
Time
S
S+M
S+TC100
S+TC500
2 days
Control
68.1%
105.1%
306.6%
Control
107.1%
92.8%
89.0%
7 days
* S, soil; M, manure; TC100, TC 100 mg/kg; TC500, TC 500 mg/kg.
S+M+TC100
S+M+TC500
69.7%
132.0%
89.6%
88.0%
Table 3 Actinomycetes counts population (CFU/g soil dry weight)*.
Time
S
S+M
S+TC100
S+TC500
2 days
5.53E+06
1.22E+07
7.06E+06
9.58E+06
7.47E+06 9.14E+06 1.04E+07 1.22E+07
7 days
* S, soil; M, manure; TC100, TC 100 mg/kg; TC500, TC 500 mg/kg.
S+M+TC100 S+M+TC500
1.69E+07
2.10E+07
1.14E+07
1.27E+07
4. References
Adam G, Duncan H (2001) Development of a sensitive and rapid method for the measurement of total microbial activity using
fuorescein diacetate (FDA) in a range of soils. Soil Biol Biochem 33: 943-951.
Chessa L (2011) Influence of Agricultural Xenobiotics on the Structure and the Function of Microbial Communities in Amended
Soils. In Proc.s of the 16th Workshop on the Developments in the Italian PhD Research on Food Science Technology and
Biotechnology. University of Milano and Piacenza, Lodi, 21-23 September, 2011, pp. 299-300.
Day PR (1965) Particle fractionation and particle-size analysis. In: Black, C. A., (Ed.), Methods of Soil Analysis: Part 1.
American Society of Agronomy, Madison, WI, pp. 545-566.
Elliott ML, Des Jardin EA (1999) Comparison of media and diluents for enumeration of aerobic bacteria from bermuda grass
golf course putting greens. J Microbiol Meth 34 :193-202.
Gutiérrez IR, Watanabe N, Harter T, Glaser B, Radke M (2010) Effect of sulfonamide antibiotics on microbial diversity and
activity in a Californian Mollic Haploxeralf. J Soils Sediments 10: 537-544.
Jackson ML (1958) Soil Chemical Analysis. Prentice-Hall, Englewood Cliffs, NJ.
Thiele-Bruhn S, Beck I-C (2005) Effects of sulfonamide and tetracycline antibiotics on soil microbial activity and microbial
biomass. Chemosphere 59: 457-465.
- 194 -
Cross-Flow Microfiltration of Rough Beer
using a 0.8-μm Tubular Ceramic Membrane
Alessio Cimini (alessio.cimini@hotmail.com)
Dept. for Innovation in the Biological, Agrofood and Forestry Systems, University of Tuscia, Viterbo, Italy
Tutor: Prof. Mauro Moresi
In this work, laboratory-made green beers were produced by using a commercial hopped-malt extract, and
characterised accordingly to the European Brewery Convention (EBC) standards. Their crossflow microfiltration
performance was studied in a bench-top plant, appropriately designed and equipped with a 0.8-μm ceramic tubular
membrane module, by varying the feed superficial velocity (vS) and trans-membrane pressure difference (TMP)
under a constant temperature of ∼10°C. A quasi steady-state permeation flux of 72±7 L m-2 h-1 was achieved when
operating at TMP=4 bar and vS=6 m/s.
Chiarificazione della birra tramite membrane ceramiche tubolari da 0,8 μm
In questo lavoro sono state prodotte e caratterizzate alcune birre crude a partire da un estratto commerciale di malto
luppolato, studiandone il processo di microfiltrazione tangenziale in un impianto da banco, appositamente
progettato ed equipaggiato con un modulo monotubolare ceramico con porosità 0.8 μm, al variare della velocità
superficiale (vS) e della differenza di pressione transmembrana (TMP) a ∼10°C. Si è conseguito un flusso di
permeazione quasi stazionario di 72±7 L m-2 h-1 operando a TMP=4 bar e vS=6 m/s.
Key words: Backflush; green beer clarification; microfiltration; permeation flux; optimal operating conditions.
1. Introduction
Beer clarification is conventionally performed on filter presses, pre-coated with filter-aids in the form of porous
particles, mainly of diatomaceous earth (DE or Kieselguhr). According to the World Health Organization, the
crystalline silica present in DE causes lung disease. Thus, DE use and recovery for either recycling or sludge
disposal are problematic, especially in Europe, where DE consumption is ∼1.7 g/L of clarified beer and DE sludge
disposal cost is ∼ €170/Mg (Fillaudeau et al, 2006).
The main advantages of beer crossflow microfiltration (CFMF) entail no filter-aids handling and disposal problems,
minimum beer losses, high suspended solid handling capacity, and substitution of heat pasteurization.
Unfortunately, membrane fouling severely reduces the beer permeation flux (Jv) by far below the critical steadystate value of 100 L m-2 h-1.
Within the scope of this PhD thesis (Cimini, 2011), this poster reports the main results of the first two activities:
A1) the production and characterization of a laboratory-made green beer; A2) the study of the CFMF process in a
bench-top plant to assess the effect of the feed superficial velocity (vS) and trans-membrane pressure difference
(TMP) on Jv, as well as to optimise the cleaning procedure to restore the membrane permeability and selectivity.
Twenty-five litres of beer wort were obtained by diluting a hopped-malt extract (Pils, Brewferm, Beverlo, B) with
hot (80°C) tap water to a density of 1.045 kg/L, and fermented by adding 11.5 g of dry ale yeast (Safale S-04,
Fermentis, Marcq-en-Barœul, F). The fermentation temperature was kept constant at ∼20 °C for about 4 days, then
gradually lowered to 15 °C over the following 4 days. After racking, the rough beer was stored in a clean stainlesssteel maturation vessel and kept at 4 °C. A typical temperature- and pressure-controlled bench-top CFMF plant was
assembled and used. It was equipped with a 0.8-μm ceramic tubular membrane module, made of Zr and Ti oxides
bound to an Al-Ti oxide support (US Filter, Warrendale, PA, USA), with 6-mm inside diameter, 500-mm length,
and 94.2-cm2 effective membrane surface area. As suggested by Gan et al (1999) membrane cleaning included a
combined synergic caustic and oxidation cleaning, followed by acidic cleaning. During its use the membrane
module exhibited a water permeability of 773±17 L m-2 h-1 bar-1 (r2=0.99) at 20.0±0.1 °C. A stainless steel Lowara
centrifugal pump (Montecchio Maggiore, I) was piloted using a 0.75 kW electric motor via a frequency inverter
Commander SK (Control Techniques, Powys, UK). Feed and retentate pressure and flow rates were monitored
using digital and analogical pressure and flow rate sensors, respectively. The permeate flow rate was assessed via
an electronic balance connected to a PC. Several total recycle runs were carried out at ∼10 °C by varying TMP and
vS in the ranges of 1-5 bar, and 2-6 m/s, respectively. Membrane cleaning with CO2 backflushing was carried out at
a backflush pressure difference of +3 bar for 2 min. The green beer and permeate samples were assayed for pH;
density; viscosity; turbidity or haze; colour; β-glucans, real original and extract, and ethanol contents in accordance
with Analityca EBC (2010).
- 195 -
Table 1
Main characteristics of the rough (RB) and corresponding micro-filtered (P) beer samples used in this work.
Sample pH
Density
[kg/L]
Viscosity
[mPa s]
Turbidity
[EBC]
Colour
[EBC]
β-glucans Real Extract Original Extract Alcohol
[mg/L]
[°Plato]
[°Plato]
[% v/v]
RB1
P1
RB2
P2
RB3
P3
1.016
1.013
1.013
1.008
1.006
1.006
1.46±0.02
1.35±0.07
1.44±0.01
1.45±0.06
1.41±0.02
1.38±0.01
1.14±0.02
0.4±0.05
12.2±0.7
0.5±0.04
69.2±0.1
0.70±0.01
18.1±0.5
14.7±0.5
18±2
12.2±0.04
6.9±0.1
6.3±0.1
197±4
170±7
160±3
n.d
140±2
135±12
4.2
4.2
4.3
4.3
4.4
4.4
4.4±0.1
3.0±0.4
3.8±0.1
2.7±0.1
3.5±0.2
2.9±0.1
10.2±0.1
8.5±0.3
11.7±0.1
10.3±0.1
14.5±0.1
12.6±0.2
3.00±0.02
3.00±0.02
4.00±0.02
4.00±0.07
4.9±0.1
4.9±0.2
3. Result and Discussion
Table 1 summarizes the average characteristics of the rough beers produced here (i.e., RB1 and RB2), as well as
their corresponding permeates (i.e., P1 and P2). Owing to the natural sedimentation of suspended matter in the
storage tank at 4 °C, some variability from batch to batch and within the same beer batch was noticeable. Both beer
permeates fulfilled the European Brewery Convention standards in terms of turbidity (<0.6 EBC unit), while the
original and real extracts, colour, and alcohol degree of samples RB2 and P2 were typical of the classic American
Pilsner (http://www.bjcp.org/stylecenter.php).
In CFMF under constant TMP (1.96 bar), vS (2 m/s) and T (10 °C) for up to 3 h, the quasi steady-state flux of 20±2
L m-2 h-1 was reached after 25-30 min independently of the rough beers tested (RB1 and RB2; data not shown). By
increasing progressively TMP from ∼1 to 4 bar at vS=2 m/s and T=10 °C, the quasi steady-state Jv value increased
from 23 ±2 to 76±22 L m-2 h-1, respectively (Fig. 1A). A further increase in vS from 2 to 6 m/s allowed the
achievement of stable Jv values of 100-150 or 99-203 L m-2 h-1 provided that TMP was 3.9 or 3.7 bar and vS of 4 or
6 m/s, respectively. In this way, the higher capacity of vS=6 m/s to remove the cake at the membrane surface and
minimise the contribution of the reversible external fouling was assessed.
Further replicated CFMF tests were carried out under the optimal conditions so identified (TMP≈4 bar, vS=6 m/s
and T=10 °C), thus leading to a quasi steady-state Jv value of 72±7 L m-2 h-1, this being easily restored by periodic
CO2 back-flushing (Fig. 1B).
Further work will be directed to assess the optimal pore size of the tubular ceramic membranes, as well as the
average permeation flux achievable when using real beers with different initial turbidity and β-glucan contents.
750
150
0.96
-2
2.96
100
-1
TMP=3.96 bar
Jv [L m h ]
A)
-2
-1
Jv [L m h ]
200
1.96
450
300
50
150
0
0
0
Figure 1
60
120
Time [min]
B)
600
0
180
60
120
[min]
Time
180
Time course of the permeation flux (Jv) of a few rough beer samples at 10 °C and different TMP and vS values: A)
TPM increasing from 0.96 to 3.96 bar at vS= 2 m/s when using two samples of RB1 ({, z); B) TMP=4 bar and
vS=6 m/s when using two samples of RB3 (U, {) and periodic CO2 backflashing.
4. References
Analytica EBC (2010) European Brewery Convention, Fachverlag Hans Carl, Nürnberg, Germany.
Cimini A (2011) Beer clarification by tubular ceramic microfiltration membranes and assessment of the main environmental
impact categories. In Proc.s of the 16th Workshop on the Developments on the Italian PhD Research on Food Science
Technology and Biotechnology, University of Milan, Lodi, Sept. 21-23, p. 301-302.
Fillaudeau L, Blanpain-Avet P, Daufin G (2006) Water, wastewater and waste management in brewing industries. J Cleaner
Prod 14: 463-471.
Gan Q, Howell JA, Field RW, England R, Bird MR, McKechinie MT (1999) Synergetic cleaning procedure for a ceramic
membrane fouled by beer microfiltration. J Membr Sci 155: 277-289.
- 196 -
Biochemistry and Molecular Analysis in Two Paradigmatic Mutant Variety of
Apple and Olive Producing High Content of Phenolics for Bio-Fortified Food
Marco Cirilli (marco_cirilli@yahoo.it)
Dept. for Innovation in the Biological, Agrofood and Forestry Systems, University of Tuscia, Viterbo, Italy
Tutor: Prof. Rosario Muleo
According to the GANTT diagram of PhD project, are described the A1 to A3 activity. The A1 part of project was
focused on the isolation and characterization of structural gene and transcription factors involved in secondary
metabolite biosynthesis and catabolism in olive and apple flower and fruit. The A2 activity, instead, was focused on
transcriptional regulation analysis by qPCR and RNAseq of target gene. Finally, the partial A3 activity was focused
on HPLC metabolite analysis of olive fruit secondary metabolite with particular attention on secoiridoids class.
Analisi biochimiche e molecolari in due paradigmatiche varietà mutanti di melo
e olivo caratterizzate da un elevato contenuto di composti fenolici
per la produzioni di cibi bio-fortificati
In accordo con il diagramma di GANTT del progetto di tesi di dottorato, sono descritte le attività da A1 a A3.
L’attivita A1 si è focalizzata sull’isolamento e la caratterizzazione a livello genomico di geni strutturali e fattori di
trascrizione coinvolti nella biosintesi e nel catabolismo dei metaboliti secondari nell’oliva e nella mela. L’attività
A2 si è occupata dello studio della regolazione trascrizionale di geni target durante lo sviluppo del fiore in olivo e
della mela, mediante qPCR e RNAseq, Infine, l’attività A3 si è focalizzata sull’analisi dei metaboliti appartenenti
alla classe dei secoiridoidi durante lo sviluppo dell’oliva.
Key words: Phenolics compounds, fruit, bio-fortified food, transcriptional regulation.
1. Introduction
In accordance with the PhD thesis project, this poster reports the main results:
A1) Isolation and characterization of structural gene and transcription factors involved in biosynthesis and
catabolism of secondary metabolite in olive with particular attention to R2R3-MYB transcription factors using
454 cDNA library from flowers and fruit tissue; isolation and characterization of R2R3MYB and MADS box
transcription factors in promising apple unknown genotype characterized by a striking phenotype with red
foliage and red fruit flesh.
A2) Assess the effects of common agronomic practices on transcriptional regulation of target gene involved
in secondary metabolite biosynthesis gene using qPCR and RNAseq approach.
2. Material and Methods
A PCR cloning strategy on target genes, individuate through bioinformatics analysis on 454 cDNA library of olive
flower tissue and on apple genome available at www.rosaceae.org website, was applied to isolate nucleotide
sequences corresponding to structural genes of secondary metabolism and transcription factors belonging to R2R3MYB, MYC and WDR families. The sequences obtained were used to design specific primers using Primer3
software available at www.Primer3.com website. DNA was extracted from tissues following Doyle and Doyle
modified protocol (Doyle and Doyle, 1998). Total RNA was extracted from olive and apple tissues following the
protocol described by Reid et al. (2006). Reverse transcriptions (RT) were carried out using Ready-To-Go RT-PCR
beads (Amersham Biosciences, Italy) following the manufacturer’s instructions. The expression patterns of target
gene were analyzed by qPCR, performed on a LC480II instrument (Roche) using SYBRGreen chemistry. Olive
flowers cDNA libraries for 454 RNAseq were prepared following SMART library protocol. Library were compared
using MapMan software, armed with an array of 22,000 Arabidopsis gene transcript. The relative quantifications
were obtained with the ΔΔCP method (Kubista et al., 2006), which normalizes the CP values of the target gene
using the correlated reference gene CP value, and using the PCR efficiency value (E) obtained from the respective
standard calibration curve. For HPLC analysis, frozen olive fruit were powdered in liquid nitrogen, lyophilized and
quantitatively extracted with an 8:2 (v/v) methanol-ethanol mixture at room temperature for 2 h in a round-bottom
flask. The extraction was repeated twice, and the collected supernatants were concentrated in a rotary evaporator
with the heated water bath set at 35 °C. The residue was quantitatively recovered in 1 mL of 8:2 (v/v) methanolwater and used for HPLC-PDA-ESI-MS identification and quantification. The experiments were performed with a
Shimadzu LCMS-2010 unit.
- 197 -
3.1 RNAseq and qPCR analysis of olive flower transcriptome
MapMan software comparison of expressed transcripts during flower development of olive cv ‘Leccino’ outlined
the complexity of transcriptional regulation of structural genes of secondary metabolism. In particular, genes
involved in flavonoids, lignans and phenylpropanoid biosynthesis were predominantly expressed during initial
stage of olive flower development and subsequently declined, while transcripts abundance of genes involved in
simple phenolics acid biosynthesis increased in final stage. Expression of genes involved in terpenoids biosynthesis
showed a complex pattern of regulation, with up and down-regulated transcripts. Transcriptional regulation of
MYB family genes, assessed by qPCR approach, outlined the increasing transcription during flower development,
of OeMYB4-like gene, having a repression role of flavonoids biosynthesis while the expression pattern of other
MYB genes, like OeMYBF1, OeMYBPA1 and OeMYBA1 involved, respectively, in flavonols, flavanols and
anthocyanidin biosynthesis, resulted to be difficult to understand, and a molecular analysis of structural flavonoids
gene regulation are needed.
3.2 qPCR analysis of apple fruit secondary metabolism
Twenty three structural genes of entire flavonoids pathways, seventeen transcription factors belonging to MADS,
MYB, MYC and WDR gene families were studied during apple fruit development, in pulp and skin tissue, within
seven genotypic line of ‘Italian Red Passion’ (IRP) and compared with cv ‘Annurca’, characterized by elevated
level of phenolics compounds accumulation. As expected from previous phenotypic analysis, ‘IRP’ line apple fruit,
respect to cv ‘Annurca’, overexpressed MdMYB10 gene in skin and pulp tissue. Other important R2R3-MYB
transcription factor, such as MdMYB1, 9 and 22 were up-regulated in IRP line, suggested possible molecular
interaction at protein or DNA level between MYB10 and the other MYB genes. Not surprisingly, all MYB genes
analyzed showed marked transcriptional oscillation during fruit development, particularly in skin tissue, depending
on environmental condition.
3.3 HPLC analysis of mature olive fruit monoterpenoids-indol-alkaloids compounds
Preliminary data on HPLC analysis of monoterpenoids compounds accumulation, in particular oleuropeina-aglicone
and ligstroside-aglicone, in olive cv ‘Leccino’ and cv ‘Leucocarpa’ showed no significative difference between the
two cultivars, thus excluding mutation in this branch of secondary pathway for the colorless cv ‘Leucocarpa’. In
progress HPLC analysis of flavonoids compounds accumulation will give more accurate information on metabolic
difference between the two analyzed cultivar.
4. References
Espley RV, Hellens RP, Putterill J, Stevenson DE, Kutty-Amma S, Allan AC (2007). Red colouration in apple fruit is due to the
activity of the MYB transcription factor, MdMYB10. Plant J 49: 414-27.
Matus JT, Aquea F, Arce-Johnson P (2008) Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related
clades and conserved gene structure organization across Vitis and Arabidopsis genomes. BMC Plant Biol 8: 83.
Matus JT, Loyola R, Vega A, Peña-Neira A, Bordeu E, Arce-Johnson P, Alcalde JA (2009) Post-veraison sunlight exposure
induces MYB-mediated transcriptional regulation of anthocyanin and flavonol synthesis in berry skins of Vitis vinifera. J
Exp Bot 60: 853-867.
Middleton E., Chitan JR. The Effects of Plant Flavonoids on Mammalian Cells: Implications for Inflammation, Heart Disease,
and Cancer. Pharmacol Rev 52: 673-751.
Mori K, Goto-Yamamoto N, Kitayama M, Hashizume K (2007) Loss of anthocyanins in red-wine grape under high temperatura.
J Exp Bot 58: 1935-1945.
Mori Kentaro, Sumiko Sugaya, Hiroshi Gemma (2005). Decreased anthocyanin biosynthesis in grape berries grown under
elevated night temperature condition. Sci Hortic 105: 319-330.
Takos AM, Jaffé FW, Jacob SR, Bogs J, Robinson SP, Walker AR (2006). Light-induced expression of a MYB gene regulates
anthocyanin biosynthesis in red apples. Plant Physiol 142: 1216-1232.
Ubi BW, Honda C, Bessho H, Kondo S, Wada M, Kobayashi S, Moriguchi T. (2006). Expression analysis of anthocyanin
biosynthetic genes in apple skin: effect of UV-B and temperature. Plant Science.
Vermerris W, Nicholson R. (2006) Phenolic compound biochemistry. Springer.
Yusuke Ban, Chikako Honda, Yoshimichi Hatsuyama (2007). Isolation and Functional Analysis of a MYB Transcription Factor
Gene that is a Key Regulator for the Development of Red Coloration in Apple Skin. Plant Cell Physiol 48 (7): 958-970.
- 198 -
Sequencing the Genome of Flor Strains for the Detection of Adaptation
to Sherry-like Wines’ Biological Aging
Annalisa Coi (acoi@uniss.it)
Dept. Agraria, University of Sassari, Italy
Montpellier Supagro, Montpellier, France
Tutor: Prof. Marilena Budroni, Dr. Sylvie Dequin
The main aim of this PhD thesis is to study the functional impact of mutations specific to flor yeasts’ genes. The
sequencing of 7 flor strains has been completed and when compared to S288c reference genome, several regions
have been detected as containing a high density of SNPs not encountered among wine strains. A set of haploid flor
strains has been created for the functional evaluation of specific genes and the allelic replacement of ZRT1 flor
allele is being made in a wine haploid strain.
Sequenziamento del genoma di ceppi flor per individuare l’adattamento
all’affinamento aromatico dei vini tipo Sherry
Lo scopo principale di questa tesi di dottorato è di studiare l’impatto funzionale di specifiche mutazioni presenti nei
geni dei lieviti flor. Il sequenziamento di 7 ceppi flor è stato completato e, in seguito al confronto col genoma di
riferimento S288c, sono state rilevate parecchie regioni come contenenti un’elevata densità di SNPs non incontrata
tra i ceppi vinari. E’ stato creato un set di ceppi aploidi per l’analisi funzionale ed è in corso l’allelic replacement
dell’allele flor ZRT1 in un ceppo vinario aploide.
Key words: Allelic replacement, adaptive evolution, sequencing, flor strains, biological aging, SNPs
1. Introduction
The research unit UMR1083 Sciences pour l’Oenologie (F-34060 Montpellier, France) has recently completed the
sequencing of the genome of 7 flor strains (Table 1) as well as 8 wine yeast of Saccharomyces cerevisiae. When
comparing the genome of flor strains to the reference strain S288c several regions were detected that present a high
number of SNPs that are not found for classical wine strains.
This poster reports the main results concerning:
¾ the creation of a set of haploid flor strains to test the functional impact of the different allelic forms
encountered in wine and flor strain for potentially relevant functions on film forming ability;
¾ the creation of a wine strain with flor allele of ZRT1, the gene with the highest number of mutations in flor
strains in comparison to wine strains.
Table 1 List of sequenced yeasts
Strain
GUF54-A1
P3-D5
TA12-2
TS12-A7
2D
7-7
F25
Origin
Jura, France
Jura, France
Tokaji, Hungary
Tokaji, Hungary
Sardinia, Italy
Jerez, Spain
Jerez, Spain
To evaluate the functional impact of the specific mutations found in flor strains a set of haploid heterothallic flor
strains was created deleting the HO gene with a loxP-KanMX-loxP disruption cassette, using the protocol of
transformation described by Güldener et al. (1996). Spores carrying the HO gene deleted were then isolated with a
micromanipulator (MSM300 Singer Instrument) and KanMX cassette was removed using the Cre-lox P
recombination system (Güldener et al., 1996) in order to be able to use another KanMX cassette in further
experiments. The allelic replacement was performed in two steps: deleting the allele with a Kanamycin cassette and
replacing this with the desired functional allele, employing the transformation protocol reported by Güldener and
colleagues (1996). The selection of allelic replaced mutants for the ZRT1 allele is being carried out in a low zinc
medium (YNB + EDTA 1mM pH 4.2, Zhao and Eide, 1997).
- 199 -
3.1 Construction of haploid flor strains
The first part of the work was dedicated to obtain haploid heterothallic flor strains, a necessary step for testing the
impact of allelic variation on the phenotypes. Haploids were obtained in both the forms MATa and MATα from the
strains P3-D5 and GUF54-A1 in order to obtain homozygotes diploids ∆ho/∆ho strains for the deletion of essential
genes. The two wine haploid strains K1 (MATa;YDL227c::kanMX4) and D47 (MATα;YDL227c::kanMX4), yet
obtained by the UMR1083SPO, were also transformed with the Cre-loxP system in order to remove the kanamycin
cassette. This set of haploid strains will be used to compare the functional impact of allelic variations between flor
and wine strains using an allelic replacement approach: wine allele will be replaced in flor strains to compare it to
the flor allele, and symmetrically flor allele in wine strains.
3.2 Evaluation of specific target genes
ZRT1, coding for a high affinity zinc transporter, is the gene that present the highest number of differences with
S288c that are not encountered in wine strains. Interestingly this gene presents a similar number of other mutations
among wine strains. Zinc is an essential nutrient of all organisms. It plays a structural role in many proteins and it’s
also a catalytic component of over 300 enzymes, such as superoxide dismutase (Vallee and Auld, 1990). S.
cerevisiae presents high levels of ROS during growth in zinc-limiting conditions and in this depleted-state SOD1
plays an essential role since it’s necessary to metabolize the superoxide anion that accumulates in large quantities in
these cells (Wu et al., 2007; Wu et al., 2009). Even Zn-metallothioneins seem to have an antioxidant activity due to
the oxidation of the metal-bound cysteine ligands in the protein (Maret, 2003). Zinc concentration in wines range
from 0.14 to 4 mg/l (Ribéreau-Gayon et al., 2004), a limiting condition (Zhao and Eide, 1996). Because flor yeasts
during biological aging manifest an aerobic metabolism and because the mitochondrial respiratory chain is the main
source of ROS (Cadenas, 1989) we wonder if the high number of mutations in ZRT1 allele of flor strains results in a
different ability to pump zinc from the media and participates to the adaptation to the oxidative environment of
wine aging. The role of these mutations in the phenotype is being validated through the allelic replacement of the
ZRT1 flor allele in wine strains and of the wine allele in flor strains. The first allelic replacement is in progress: the
allele of the wine strain K1MATa is being replaced by one of a flor strain. Because ZRT1 deleting mutant show
inhibited growth on zinc-limiting media (Zhao and Eide, 1996) allelic replaced mutants will be selected in a low
zinc medium. Their resistance to oxidative stress as well as SOD1 activity will be investigated. Other target genes
that present high variability in flor strains compared to wine strains have been detected and will be studied later. A
transcriptomic analysis should provide information of how these polymorphisms result in different coordinated
metabolic network that could be essential for the adaptation of flor yeasts.
4. References
Barnett JA (1976) The utilization of sugars by yeasts. Adv Carbohydr Chem Biochem 32: 125-234.
Cadenas E (1989) Biochemistry of oxygen toxicity. Annu Rev Biochem 58: 79-110.
Güldener U, Heck S, Fiedler T, Beinhauer J and Hegemann JH (1996) A new efficient gene disruption cassette for repeated use
in budding yeast. Nucleic Acids Res 24: 2519-2524.
Maret W (2003) Cellular zinc and redox states converge in the metallothionein/thionein pair. J. Nutr. 133: 1460S–1462S.
Ribéreau-Gayon P, Glories Y, Maujean A, Dubourdieu D (2004) Traité d’œnologie, Tome 2, Dunod ed. (Paris) p. 136.
Valle BL and Auld DS (1990) Zinc coordination, function, and structure of zinc enzymes and other proteins. Biochem. 9: 56475659.
Wu CY, Bird AJ, Winge DR, Eide DJ (2007) Regulation of the yeast TSA1 peroxiredoxin by ZAP1 is an adaptive response to
the oxidative stress of zinc deficiency. J Bio. Chem 282: 2184-95.
Wu CY, Steffen J, Eide DJ (2009) Cytosolic superoxide dismutase (SOD1) is critical for tolerating the oxidative stress of zinc
deficiency in yeast. PLoS One 4:e7061.
Zhao H, Eide D (1996) The yeast ZRT1 gene encodes the zinc transporter protein of a high-affinity uptake system induced by
zinc limitation. Proc Natl Acad Sci USA 93: 2454-2458.
Zhao H, Eide D (1997) Zap1p, a Metalloregulatory Protein involved in zinc-responsive transcriptional regulation in
Saccharomyces cerevisiae. Mol Cell Biol 17:5044-5052.
- 200 -
Molecular and Physiological Characterization of a β-Carotene
Hyperproducing Mutant of Rhodotorula glutinis
Raffaela Cutzu (rcutzu@uniss.it)
Dept. Agraria, University of Sassari, Italy
Tutor: Prof. Ilaria Mannazzu; Co-tutor: Prof. Marilena Budroni
With the aim of contributing to the elucidation of the mechanisms involved in the production of carotenoids, the
development of molecular tools for the isolation of genes of the carotenogenic pathway of Rhodotorula glutinis,
and the comparative proteomic analyses of strain C2.5t1 and its mutants defective in carotenoids production, were
carried out. Moreover, to develop a rapid and reliable method for the evaluation of carotenoids cell content, the
amount of β-carotene produced by mutant 400A15 was measured by HPLC during growth, and possible
correlations between β-carotene cellular content and yeast cells fluorescence analyzed by flow cytometry, were
evaluated.
Caratterizzazione fisiologica e molecolare di un mutante
di Rhodotorula glutinis iperproduttore di β-carotene
Allo scopo di contribuire alla delucidazione dei meccanismi coinvolti nella produzione di carotenoidi si è proceduto
con lo sviluppo di strumenti molecolari utilizzabili per l’identificazione dei geni del pathway carotenogenico di
Rhodotorula glutinis ed è stata condotta l’analisi proteomica comparativa del ceppo C2.5t1 e di suoi mutanti
difettivi nella produzione di pigmenti. Inoltre, per sviluppare un metodo rapido e affidabile per la quantificazione
dei carotenoidi, la quantità di β-carotene prodotto dal mutante 400A15 durante la crescita è stata misurata mediante
HPLC e sono state valutate le correlazioni possibili tra la concentrazione cellulare di β-carotene e la fluorescenza
emessa dalle cellule, misurata in citofluorimetria.
Key words: Carotenoids, HPLC, TLC, 2D- DIGE, flow cytometry.
1. Introduction
In accordance with the PhD thesis project previously described (Cutzu, 2011) here are reported the main results of
the following research activities: 1) development of molecular tools for the isolation of genes; 2) quali-quantitative
analyses of carotenoids; 3) individuation of proteins involved in R. glutinis carotenogenic pathway; 4) study of the
possible correlations between intracellular β-carotene content and yeast cells fluorescence.
Strains and culture conditions. Strains utilized: Rhodotorula glutinis C2.5t1 (wild type strain) and its mutants
400A15 and 200A6; Xantophyllomyces dendrorhous DBVPG 7009. Yeast strains were maintained in YEPD (2%
glucose, 1% Yeast Extract, 2% peptone, 2% agar) at 4°C for short term storage, and YPDGLY (YEPD + 20%
glycerol) at -80°C for long term storage. Cells were grown aerobically in YEPGLY (2% glycerol, 1% Yeast
Extract, 2% peptone) at 30°C in an orbital shaker (150 rpm). DNA extraction and PCR conditions. Total DNA
was extracted as described by Philippsen et al, 1991. PCR primers crtI400 and crtYB400, designed by using primer
3 software were based on the X. dendrorhous sequences deposited at GenBank. Amplification reactions were
carried out on an Applied Biosystem Gene Amp PCR System 9700. 2-D Differential in Gel Electrophoresis (2-D
DIGE). Crude cell extracts, obtained as described by Mannazzu et al. (2000) were resolved on two-dimensional
gels as described by Hu et al., (2003). Carotenoids extraction and analyses. Carotenoids were extracted as
described by Dominguez-Bocanegra and Torres Muñoz (2004). For Thin Layer Chromatography total carotenoids
extract in petrol ether were evaporated on N2 flow, re-suspended in 20μL of acetone and spotted on Silica Gel
MERCK. Petrol ether:acetone (90:10 vol:vol) was used as mobile phase. HPLC analysis was carried out as
described by Nobre et al., (2006). Flow cytometry. Yeast cells were harvested, washed, resuspended in phosphate
saline buffer to the final concentration of 1×106 cell/ml, stained with two different fluorochromes (Da Silva, 2010;
Cooper, 2010) and analyzed with a FACSCalibur flow citometer (Becton Dickinson Instruments, Erembodgem,
Belgium). The data were visualized using BD CellQuest Pro software.
A wild strain of R. glutinis with a good carotenogenic aptitude on raw glycerol (C2.5t1) and a two mutants, namely,
400A15 (hyperproducing β–carotene) and 200A6 (unable to produce carotenoids), selected as a part of this PhD
program, were subject to the following experiments.
- 201 -
3.1 Development of molecular tools for the isolation of genes involved in R. glutinis carotenogenic pathway.
Primer pairs designed on the sequence of CrtYB and CrtI genes of X. dendrorhous coding for phytoene synthase
and and phytoene desaturase, respectively, were utilised on X. dendrorhous total DNA to PCR amplify portions of
the two genes. The two amplicons obtained, that measure about 400 bp, will be utilized as molecular probes in
southern blotting experiments on total DNA of R. glutinis C2.5t1 to evaluate the presence of homologous sequences
in this species. If this is the case, degenerate primers will be designed and utilized for the amplification of the R.
glutinis genes of interest. These will be sequenced and the isolation of the entire genes will be carried out by means
of Inverse PCR as indicated by Ochman et al. (1988).
3.2 Quali-quantitative analyses of carotenoids.
To further characterize the parental strain C2.5t1 and the mutant strains 400A15 and 200A6, total carotenoids
produced on YEPGLY by the three strains under study were extracted and subject to Thin Layer Chromatography
and HPLC analyses. It resulted that the wild strain C2.5t1 produces 4.13 mg/l total carotenoids consisting of βcarotene (28,9%), torulene (34,6%) and torularhodin (36,5%). For what concerns the two mutants 200A6 is unable
to produce carotenoids while 400A15 produces 7.18 mg/l total carotenoids consisting of β-carotene (64,3%) and
torulene (35,7%).
3.3. Individuation of proteins involved in R. glutinis carotenogenic pathway.
Crude extracts of the parental strain and of the two mutants grown on YEPGLY for 72 h were subject to 2-D DIGE
(2-D Differential in Gel Electrophoresis). Ten proteins over-expressed in the parental strain in respect to the two
mutants were individuated and identified by means of Tandem Mass Spectrometry (LC-MS/MS). BLASTp analysis
of the data obtained is currently in progress.
3.4. Study of the possible correlations between intracellular β-carotene content and yeast cells fluorescence.
Mutant 400A15 was grown on YEPGLY for up to 164 h and sampled every 24 hours to evaluate both β-carotene
cellular concentration by means of HPLC, and fluorescence emitted by the cells stained with two fluorochromes by
flow cytometry. The results obtained indicate that β-carotene content can be correlated with fluorescence emitted by
the cells treated with the two fluorochromes.
4. References
Cooper MS, Hardin WR, Petersen TW, Cattolico RA (2010) Visualizing "green oil" in live algal cells. J Biosci Bioeng 109:198201.
Cutzu R (2011) Study of the molecular mechanisms involved in the production of carotenoids in Rhodotorula glutinis and
optimization of β-carotene production on raw glycerol. In Proc.s of the 16th Workshop on the Developments in the Italian
PhD Research on Food Science and Technology, Lodi (Italy), 21-23 September, 2011, pp 311-312.
da Silva TL, Feijão D, Roseiro JC, Reis A (2011) Monitoring Rhodotorula glutinis CCMI 145 physiological response and oil
production growing on xylose and glucose using multi-parameter flow cytometry. Bioresour Technol 102: 2998-3006.
Domínguez-Bocanegra AR, Torres-Muñoz JA (2004) Astaxanthin hyperproduction by Phaffia rhodozyma (now
Xanthophyllomyces dendrorhous) with raw coconut milk as sole source of energy. Appl Microbiol Biotechnol 66:249-52
Hu Y, Wang G, Chen GYJ, Fu X, Yao SQ (2003) Proteome analysis of Saccharomyces cerevisiae under metal stress by twodimensional differential gel electrophoresis. Electrophoresis 24: 1458-1470.
Mannazzu I, Guerra E, Ferretti R, Pediconi D, Fatichenti F (2000) Vanadate and copper induce overlapping oxidative stress
response in the vanadate-tolerant yeast Hansenula polymorpha. Biochim Biophys Acta 1475: 151-156.
Nobre B, Marcelo F, Passos R, Beirao L, Palavra A, Gouveia L, Mendes R (2006) Supercritical carbon dioxide extraction of
astaxanthin and other carotenoids from the microalga Haematococcus pluvialis. Eur Food Res Technol 223: 787-790.
Ochman H, Gerber AS, Hartl DL (1988) Genetic applications of an Inverse Polymerase Chain Reaction. Genetics 120: 621-633.
Philippsen P, Stolz A, Scherf C (1991) DNA of Saccharomyces cerevisiae. Methods Ezymol 194: 169-182.
- 202 -
Antioxidant Activity of Wild and Cultivated Blackberry
(Rubus ulmifolius Schott) from Calabria (Italy)
Maria Francesca D’Agostino (mariafrancesca.dagostino@unirc.it)
Dept. of Biotechnology for Food and Environmental Monitoring (BioMAA),
Tutor: Dr. Angelo Maria Giuffrè; Co-tutor: Dr. Vincenzo Sicari
The aim of this study was to compare the antioxidant activity as Scavenge Efficacy to quench 50 µmol of initial
free radical DPPH· (SE50) in wild and cultivated blackberries (Rubus ulmifolius Schott) from Southern Calabria
(Italy). Results obtained proved the highest antioxidant activity of wild fruits (SE50 in the range 1.65–3.36) as
compared to the cultivated sample (7.84 SE50). Furthermore, these results seem to be correlated with the content of
antioxidant compounds (total anthocyanin and total phenolic compounds) in the different samples compared. The
lower the SE50 value, the higher the amount of antioxidant compounds.
Attività antiossidante di more spontanee e coltivate
(Rubus ulmifolius Schott) della Calabria (Italia)
Lo scopo del seguente studio è stato comparare l’attività antiossidante, intesa come Efficacia di Spegnimento di 50
µmoli della concentrazione iniziale del radicale libero DPPH (SE50), di more (Rubus ulmifolius Schott) spontanee e
coltivate originarie del Sud Calabria (Italia). I risultati ottenuti provano la maggiore attività antiossidante di frutti
spontanei (SE50 nel range 1,65–3,36) rispetto a quelli coltivati (7,84 SE50). Inoltre, questi risultati sembrano essere
correlati con il contenuto in composti antiossidanti (antociani totali e polifenoli totali) nei diversi campioni
comparati. Minore è il valore di SE50 maggiore è quello in composti antiossidanti.
Key words: Antioxidant activity, Calabria, cultivated blackberry, Rubus ulmifolius Schott, wild blackberry.
1. Introduction
The remarkably high scavenging activity of blackberries (Rubus ulmifolius Schott) towards chemically generated
superoxide radicals has promoted their consumption as a source of natural bioactives. Koka and Karadeniz (2009)
reported the higher antioxidant activity of wild blackberries as compared to cultivated ones. This is the first study
about the comparison of antioxidant activity related to their total anthocyanin and total phenolic content in
Calabrian wild and cultivated backberries.
One cultivated blackberry (Rubus ulmifolius Schott (Loch Ness cultivar)) sample (C1) was obtained from Locri in
South East Calabria (Italy) in June 2011. Six wild blackberries (Rubus Ulmifolius Schott) (samples W1-W6) were
collected at six different places of South West Calabria (Italy) in August 2011: Cosoleto (W1, 429 m a.s.l.);
Filadelfia (W2, 505 m a.s.l.); Rosarno (W3, 66 m a.s.l.); Cicerna (W4, 27 m a.s.l.); Granatara (W5, 12 m a.s.l.);
Nicotera (W6, 7 m a.s.l.). Physicochemical properties were analyzed on the fresh fruit: color (Konica Minolta CM700d/600d spectrophotometer) was expressed as L* (lightness/darkness), a* (redness/greennes), b*
(yellowness/blueness); total titratable acidity (Crison basic 20 pHmeter) was expressed as % citric acid; total
soluble solids (TSS or °Brix) were measured on a digital refractometer PR-101 α, Atago, and results expressed as %
TSS; dry matter content (% DMC) was gravimetically determined. All analyses were made in triplicate. Evalutation
of antioxidant capacity was made on the blackberry extract prepared using a mixture methanol/water/chloridric acid
(80%:19.9%:0.1%) as solvent: total anthocyanin content (TACN) was determined by the pH differential method
like in Wrolstad (1976) and results were expressed as mg g-1 of Cyanidin-3-Glucoside (Cyn-3-Glu) equivalents of
dry weight (DW); total phenolic compounds (TPC) was determined by the Folin-Ciocalteau colorimetric method
modified as in Tomaino et al. (2010) and results were expressed as mg g-1 of gallic acid equivalent (GAE) of DW;
free radical scavenging activity was determined using the radical 2,2-diphenyl-1-picrylhydrazyl (DPPH·) according
to Tomaino et al. (2010) and results were expresses as mg of DW required to scavenge 50 µmol of initial DPPH·
(SE50). All measurements were carried out in triplicate.
3.1 Physicochemical properties
Color parameters did not show significant differences among wild and cultivated samples. °Brix assay showed a
medium value for C1, in the range obtained for all the wild samples analysed (19.60–11.43 % TSS). pH and total
acidity showed very significant differences. pH of C1 sample (3.30 ± 0.04) was lower than that of the wild samples
- 203 -
(3.91−5.12). However, total acidity was higher in the cultivated blackberry (1.00 ± 0.19 % citric acid) than in the
W1−W6 samples (0.23−0.74%). Dry matter assay showed very significant differences between wild
(20.24−21.85%) and cultivated samples (15.31 ± 0.72%). Only one type of wild sample, W5, showed no
statistically significant differences with the dry matter content of the cultivated blackberry.
3.2 Evaluation of antioxidant capacity
The highest total anthocyanin content (Table 1) was found for samples W4 and W1 (12.47–12.04 mg g-1 Cyn-3-Glu
DW). The other wild samples showed a lower amount (10.76–6.08 mg g-1 Cyn-3-Glu DW), in agreement with data
reported by Koka and Karadeniz (2009) for wild samples. C1 contained only 4.64 mg g-1 Cyn-3-Glu DW; this
content being lower than that determined by Koka and Karadeniz (2009) for cultivated samples. Total phenolic
compounds (Table 1) were within the range determined for W1 and C1 samples (41.46–17.90 mg g-1 GAE DW,
respectively). All data were higher than those obtained by Koka and Karadeniz (2009) for the wild and cultivated
blackberries. For the antioxidant activity, W1 and W4 needed the lowest amount of mg DW to scavenge 50 µmol of
initial DPPH· (1.65−1.67 SE50) as shown in Table 1. This is in agreement with the highest amount of total
anthocyanin and total phenolic compounds determined for these samples. No statistically differences were found
for SE50 of sample W3, W5 and W6, despite their significantly different TPC. This could be explained assuming
that TACN is more correlated with antioxidant activity than TPC. As compared to wild samples cultivated sample
showed the lowest antioxidant (7.84 SE50). In conclusion, this study shows that the antioxidant activity of R.
ulmifolius Schott seems to be correlated with the anthocyanin and phenolic content. Data also proved that wild
Calabrian samples had a higher antioxidant activity than the cultivated one. Among wild samples, those from
Cosoleto (W1) and Cicerna (W4) showed the best antioxidant activity.
4. Working Plan for next Year
It is scheduled for next year to complete the characterization of wild and cultivated blackberries from Calabria.
Determinations will include the analysis by GC-MS of volatiles fractionated by SPME, and of sugars. The
development of PSE and/or MWAE methodologies for extracting antioxidants and characterization by LC-UV/MS
of extracts obtained will also be considered along next year.
Table 1 Total anthocyanin, total phenolic content and total antioxidant activity in wild (W1-W6) and cultivated (C1) samples.
Data were expressed as the mean ± standard deviation (SD) and they were subjected to one-way analysis of variance (ANOVA)
using the SPSS 15.0 program. Statistical differences (P < 0.01) were determined by the Duncan test.
Samples
W1 Cosoleto
W2 Filadelfia
W3 Rosarno
W4 Cicerna
W5 Granatara
W6 Nicotera
C1 Cultivated
TACN
(mg g-1 Cyn-3-Glu DW)
12.04 ± 0.08a
6.08 ± 0.36d
8.68 ± 0.02b
12.47 ± 0.06a
10.76 ± 0.03bc
7.33 ± 0.06c
4.64 ± 0.01e
TPC
(mg g-1 GAE DW)
41.46 ± 0.11a
26.33 ± 0.23e
28.00 ± 0.14d
34.24 ± 0.01b
44.61 ± 0.39a
31.74 ± 0.50c
17.90 ± 0.07f
Total antioxidant activity
(SE50)
1.65 ± 0.04a
3.36 ± 0.04c
2.19 ± 0.01b
1.67 ± 0.01a
2.88 ± 0.03b
2.21 ± 0.01b
7.84 ± 0.02d
5. References
Koka I, Karadeniz B (2009) Antioxidant properties of blackberry and blueberry fruits grown in the Black Sea Region of Turkey.
Sci Hort 121: 447-450.
Tomaino A, Martorana M, Arcoraci T, Monteleone D, Giovinazzo C, Saija A (2010) Antioxidant activity and phenolic profile of
pistachio (Pistacia vera L. variety Bronte) seeds and skins. Bioch 92: 1115-1122.
Wrolstad RE (1976) Colour and pigment analyses in fruit products. Station Bullettin 624. Agricultural Experiment Station
Oregon State, Corvallis, OR, pp 1-17.
- 204 -
Zygosaccharomyces sapae: from Species Delineation
to Mating-Type (MAT) Genes Characterization
Tikam Chand Dakal (tikamchand.dakal@unimore.it)
Dept. of Agriculture and Food Sciences, University of Modena and Reggio Emilia, Reggio Emilia, Italy
Tutor: Prof. Paolo Giudici
Fourteen yeast strains retrieved from sugary/low-acid cooked musts samples were de-replicated by microsatelliteprimed-PCR (MSP-PCR) into two representative strains, ABT301T and ABT601. Phylogenetic analysis of the
D1/D2 domain of 26S rDNA gene indicated that the strains belong to a novel species related to Zygosaccharomyces
rouxii and Zygosaccharomyces mellis. Physiological tests supported classification of a new halotolerant,
osmotolerant, non-psychrotrophic and maltose-fermenting negative species. Morphological observation showed
multi-lateral budding, pseudohyphae, and ascospore formation. The name Zygosaccharomyces sapae sp. nov. is
proposed for the novel species; the type strain is ABT301T (= CBS12607T = MUCL54092T = Mycobank number
MB564957). Cloning of mating-type (MAT) and HO loci from ABT301T revealed a high level of polymorphism,
mainly on alpha-specific cassette and HO loci, suggesting that Z. sapae might be a mosaic lineage arisen from
outcrossing.
Zygosaccharomyces sapae: dalla delineazione di una nuova specie
al clonaggio dei geni del mating-type (MAT)
Quattordici ceppi di lievito isolati da campioni acido/zuccherini sono stati de replicati mediante microsatelliteprimed PCR (MSP-PCR) in due cluster, da cui due ceppi rappresentativi, ABT301T e ABT601 sono stati
selezionati. L’analisi filogenetica del dominio D1/D2 del gene 26S rDNA indicata l’appartenenza a una nuova
specie strettamente correlata a Zygosaccharomyces rouxii e Zygosaccharomyces mellis. Test fisiologici definiscono
i nuovi ceppi come alotolleranti, osmotolleranti, non psicrofili e incapaci di fermentare il maltosio. L'osservazione
morfologica evidenzia gemmazione multipolare, con formazione di pseudoife e di ascospore. Il nome
Zygosaccharomyces sapae sp. nov. viene proposto per definire la nuova specie, il cui ceppo tipo è ABT301T (=
CBS12607T = MUCL54092T = Mycobank numero MB564957). Per il ceppo ABT301T il clonaggio dei loci matingtype (MAT) e HO ha evidenziato un elevato grado di polimorfismo principalmente nella locus a cassetta alphaspecifico e nel locus HO, suggerendo che Z. sapae potrebbe essere una linea filogenetica a mosaico.
Key words: Sugary/low-acid niche, Zygosaccharomyces sapae, D1/D2 26S domain, halotolerant, osmotolerant,
mating-type.
1. Introduction
Zygosaccharoymces rouxii, yeast that participates both in the elaboration and spoilage of foodstuff, displays
important genetic properties. Zygosaccharomyces clade separated from Saccharomyces and Nakaseomyces clades
before the whole-genome duplication (WGD). Therefore, it is the most closely related to the putative ancestral
genome of S. cerevisiae. Several evidences suggest that Z. rouxii could represent a complex of closely related
species. Here we collected molecular and phenotypic evidences for allocating two novel strains, ABT301T and
ABT601 into a novel diploid species, namely Zygosaccharomyces sapae sp. nov, closely related to Z. rouxii. Since
life cycle and sexual reproduction are key elements in determining genetic diversity and speciation, genes of MAT
and HO genes of the type strain were sequenced.
Genomic DNA was extracted by standard phenol:choloroform extraction procedure. For typing, primers (GTG)5
and M13 were respectively used for MSP-PCR and RAPD-PCR, according to Solieri et al. (2012). Sporulation test
was performed both on different solid (YPDA, 5% MEA, and Gorodkowa agar) and liquid media (YPD and 5%
ME), at 28°C. Morphological observations were carried out using phase-contrast microscope (Axioskop 40; Carl
Zeiss) connected to an Optech digital camera. The D1/D2 domain of the LSU rRNA gene (D1/D2 26S domain)
from ABT301T and ABT601 was amplified sequences and analyzed. Cloning of ABT301T MAT and HO genes was
performed using Z. rouxii CBS732T-specific degenerate primers. Chromosome walking was carried out by inverse
PCR. Copy number of each genes was determined by Southern blotting on gDNA digested with selected restriction
enzymes, using the DIG labeling kit (Roche, USA). For chromosomal localization, chromosomal DNA was
prepared in plugs and separated using CHEF Mapper apparatus (Biorad) as described by Solieri et al. (2008).
- 205 -
3.1 Species delineation
MSP-PCR fingerprinting of all fourteen isolates showed few differences in DNA banding patterns, suggesting their
conspecific nature. Using a similarity cut-off of 94% MSP-PCR fingerprints analysis de-replicated the isolates into
two groups, from which two representative strains, ABT301T and ABT601, were selected for further studies (data
not shown). Sequencing of D1/D2 26S domain produced a unique sequence for both the strains. The phylogenetic
dendrogram based on D1/D2 26S domain sequences showed that strains ABT301T and ABT601 belong to a distinct
phyletic (78% bootstrap) line, with Z. mellis, Z. rouxii and three recently proposed species, such as Z. siamensis, Z.
machadoi, and Z. gambellarensis, as the closest relatives. The novel strains differ from Z. rouxii by 2.5% (14
mismatches and 1 indels in 567 nucleotides) and from Z. mellis by 4.4% (19 mismatches and 6 indels in 572
nucleotides). It is clear from phylogenetic analysis based on nearly complete D1/D2 domain of 26S rDNA gene
sequences that the new isolates belong to the genus Zygosaccharomyces and represent a novel species.
Figure 1 Neighbour-joining tree based on the LSU rDNA D1/D2
domain sequences of Zygosaccharomyces sapae sp. nov. and
relatives. Percentage bootstrap values were obtained from 1000
iterations (values less than 50% not shown). The tree was rooted by
inclusion of the sequences for Wickerhamomyces anomalus as
outgroup.
Sequences
were
retrieved
from
the
DDBJ/GenBank/EMBL databases under the indicated accession
numbers. Bar, 0.01 substitutions per nucleotide.
Based on the BLAST search matching, D1/D2 26S
sequences of strains ABT301T and ABT601 were closely
related to strains of uncertain taxonomical affiliation. In
particular, NCYC 3042 was isolated from sugar and
described as hybrid (James et al., 2005), whilst ATCC 42981
(p-subgenome) is a miso strain described as an allodiploid
yeast (Gordon & Wolfe, 2008). Genotypic relatedness based
on M13-RAPD showed that the novel strains are clearly separated from type strain Z. rouxii CBS732T (r≤74%) and
the miso strain ATCC 42981 (r≤69%) (data not shown). Further supports for the delineation of Z. sapae sp. nov.
arose from phenotypic analyses. Strains ABT301T and ABT601 exhibited similar morphological and physiological
characteristics (Fig. 2). They reproduced asexually by multilateral budding with mother and daughter cells remain
attached resulting in chain or star-shaped dispositions. Pseudomycelia may be formed after 20 days on YPD and
Gorodkowa media at 27°C. Single colonies of Z. sapae sp. nov. were able to produce persistent conjugated asci
with one to four spheroidal to ovoidal ascospores on YPD medium after 15-20 days at 27°C.
Figure 2 Diagnostic trees to discriminate the novel species Z. sapae from other
Zyogosaccharomyces species on the basis of physiological tests.
3.2 Mating type (MAT) genes characterization
Cloning of mating-type and HO loci from ABT301T revealed: 1) three polymorphic
alpha-specific cassettes (MATalpha2 and MAT1alpha1), including one Z. rouxiilike and two divergent copies (nt similarity ranging from 99% and 81%,
respectively); 2) homozygous Z. rouxii-like MATa1 locus; heterozygous HO locus,
with a Z. rouxii variant and a divergent variant (similarity 85%). No MATa2 gene
was detected. Genomic DNA Southern blotting confirmed copy number for each
locus. PFGE-southern localized the gene copies for each locus on chromosome L.
The results suggested that Z. sapae may be a mosaic phylogenetic lineage.
4. References
Gordon JL, Wolfe KH (2008) Recent allopolyploid origin of Zygosaccharomyces rouxii strain ATCC 42981. Yeast 25: 449-456.
James SA, Bond CJ, Stratford M, Roberts IN (2005) Molecular evidence of natural hybrids in the genus Zygosaccharomyces.
FEMS Yeast Res 5: 747-755.
Solieri L, Cassanelli S, Croce MA, Giudici P (2008) Genome size and ploidy level: New insights for elucidating relationships in
Zygosaccharomyces species. Fungal Genet Biol 45: 1582-1590.
Solieri L, Dakal TC, Giudici P (2012) Zygosaccharomyces sapae sp. nov., a novel yeast species isolated from Italian traditional
balsamic vinegar. Int J Syst Evol Micorbiol (submitted for publication).
- 206 -
Quercetin-3-O-Glucuronide Affects Gene Expression Profile
of M1 and M2a Macrophages Exhibiting Anti-Inflammatory Effects
Margherita Dall’Asta (margherita.dallasta@unipr.it)
Tutor: Prof. Daniele Del Rio
The role of polyphenols in inflammation and prevention cardiovascular disease has been investigated and is
described. A specific phase II polyphenol metabolite, quercetin-3-O-glucuronide, was tested at physiological
concentration in vitro in a model of M1 and M2a macrophage cell cultures and a trascriptome analysis was
performed in order to evaluate the influence of this compound on the whole macrophage genome.
Influenza della quercetina-3-O-glucuronide
sul profilo genetico infiammatorio di macrofagi M1 e M2a
L’attività descritta riguarda lo studio del ruolo dei polifenoli nell’infiammazione e prevenzione di malattie
cardiovascolari. La quercetina-3-O-glucuronide, il principale metabolita di fase II della quercetina, è stato testato, a
concentrazioni fisiologiche, in un modello in vitro di colture di macrofagi M1 e M2a ed è stata effettuata un’analisi
trascrittomica per valutare l’influenza di questo composto sul genoma.
Key words: Macrophage, microarray, quercetin-3-O-glucuronide.
1. Introduction
In accordance with the PhD thesis project previously described (Dall’Asta, 2011), this poster reports the first results
of the activity concerning the evaluation of biological activity of polyphenol metabolites. In particular, the
behaviour of primary human monocyte during differentiation in differently polarised (M1 and M2a) macrophages
through different biochemical stimuli and exposition to a specific polyphenol metabolite.
Human monocytes were isolated from a pool of healthy blood donor buffy coats. Peripheral blood mononuclear
cells (PBMCs) were separated by means of Ficoll density gradient centrifugation (Lymphoprep, Sentinel
Diagnostic, Milan, Italy) as previously described (Scotton et al., 2005) and subsequently, monocytes were isolated
using Dynabeads® negative isolation kit (Invitrogen, Carlsbad, CA, USA). Classical macrophage activation (M1)
was generated by LPS (100ng/ml) and INFγ (20ng/ml) addition, while alternative macrophage activation (M2a)
was induced by the addition of IL-4 (20ng/ml) to the culture medium. Q3GA (Extrasynthese, Genay, France) was
added at 500 nmols/l concentration together with the stimuli for macrophage activation. Resting macrophages (RM)
were treated without stimuli under the same culture conditions. Macrophages were lysed following 6, 12 and 24
hours of incubation with the stimuli and harvested using QIAzol (Qiagen, Valencia, CA, USA). Total RNA was
extracted using an RNeasy Micro Kit (Qiagen). Reference and sample RNA were hybridized together on 4X44
Whole Human Genome Agilent Microarray slides (Agilent Technologies, ref. G4112F) for 17 h and slides were
scanned with an Agilent G2565AA Microarray Scanner System. The transcriptome analysis, using whole genome
dual color microarray technology (Agilent technologies), was applied for each condition. Gene ontology (GO) was
performed using Gorilla (http://cbl-gorilla.cs.technion.ac.il/) (Eden et al., 2009). In our analysis we looked
principally at p-value score, which well represented results from a biological point of view.
3. Results
The presence of Q3GA on M1 macrophages reduced the expression of inflammatory GO terms (cellular response to
type I interferon, p-value=8.20E-19), maintaining however their inflammatory properties (Table 1). M2a
macrophages exposed to Q3GA also reduced significantly the expression of inflammatory GO terms (cellular
response to cytokine stimulus, p-value: 3.45E-11), compared to M2a without stimuli (Table 2). In both
cases, the addition of Q3GA was associated to a down-regulation of cell cycle related GO terms (M phase, p-value:
5.48E-10 in M1) after 12h of incubation (Table 3).
Q3GA appeared to exert anti-inflammatory effects synergistically with IL-4. Moreover, the small reduction in
inflammatory GO observed in M1 showed that the anti-inflammatory properties of Q3GA do not affect the role of
these cells in the immune response. The significant down regulation of cell cycle GO terms suggested a role of
Q3GA in regulation of macrophage differentiation that deserves further investigation.
- 207 -
Table 1 Major GO categories down-regulated of classical activated macrophages (M1) exposed to Q3GA vs. control (not
exposed) after 6h incubation.
GO Term
GO:0071357
GO:0060337
GO:0034340
GO:0009615
GO:0071345
GO:0019221
Description
cellular response to type I interferon
type I interferon-mediated signaling pathway
response to type I interferon
response to virus
cellular response to cytokine stimulus
cytokine-mediated signaling pathway
P-value M1
8.20E-19
8.20E-19
1.24E-18
5.61E-18
1.01E-17
1.02E-16
Table 2 Major GO categories down-regulated of alternative activated macrophages (M2a) exposed to Q3GA vs. control (not
GO Term
GO:0071345
GO:0009607
GO:0034340
GO:0009611
GO:0071357
GO:0060337
Description
cellular response to cytokine stimulus
response to biotic stimulus
response to type I interferon
response to wounding
cellular response to type I interferon
type I interferon-mediated signaling pathway
P-value M2a
3.45E-11
3.49E-11
3.90E-11
1.41E-10
1.72E-10
1.72E-10
Table 3 Major GO terms related to cell cycle process down-regulated in M1, M2a and RM exposed to Q3GA vs. control (not
GO Term
GO:0051301
GO:0000087
GO:0000279
GO:0045840
GO:0051301
GO:0007049
Description
cell division
M phase of mitotic cell cycle
M phase
positive regulation of mitosis
cell division
cell cycle
P-value M2a
3.45E-11
3.49E-11
3.90E-11
1.41E-10
1.72E-10
2.86E-06
P-value M1
1.16E-09
1.60E-09
5.48E-10
7.58E-04
1.16E-09
1.34E-10
P-value RM+Q3GA
1.83E-12
3.27E-13
6.94E-13
6.28E-4
1.83E-12
1.63E-13
4. References
Dall’Asta M (2011) Identification of human and microbial polyphenol metabolites and evaluation of their bioactivity in in vitro
experimental models. In Proc.s of the 17th Workshop on the Developments in the Italian PhD Research on Food Science,
Technology & Biotechnology, Lodi (Italy), 21-23 September, 2011
Eden E, Navon R, Steinfeld I, Lipson D, Yakhini Z (2009) GOrilla: a tool for discovery and visualization of enriched GO terms
in ranked gene lists. BMC Bioinformatics 3: 10-48
Scotton CJ, Martinez FO, Smelt MJ, Sironi M, Locati M, Mantovani A, Sozzani S (2005) Transcriptional profiling reveals
complex regulation of the monocyte IL-1 beta system by IL-13. J Immunol 174: 834-845
- 208 -
Brewing Processes Optimization
for High Quality Alcohol-Free Beer Production
Giovanni De Francesco (gio.defrancesco@hotmail.it)
Dept. of Economic and Food Science, University of Perugia, Italy
Tutor: Dr. Giuseppe Perretti
The purpose of this work is to produce of a high quality alcohol-free beer. This paper show some preliminary
results of the activities planned and developed during the PhD thesis project. The first activity involved the use of
a contactor membrane which removes the alcohol from the beer by evaporation and subsequent ethanol
condensation in the feed water. The second activity was the screening and the selection of the new strains of of
yeasts Saccharomycodes ludwigii and Zygosaccharomyces rouxii for a high quality alcohol-free beer production.
The quality of the final product was evaluated by monitoring the beer main qualitative parameters.
Ottimizzazione di processo per la produzione di una birra analcolica di elevata qualità
Lo scopo della presente tesi di dottorato è la produzione di una birra analcolica di elevata qualità. Le prime due
attività del progetto vengono descritte. La prima attività ha riguardato l’utilizzo di una membrana contattore per
eliminare l’alcol dalla birra per evaporazione e successiva condensazione dell’etanolo nell’acqua di processo. La
qualità del prodotto finito è stata valutata attraverso il monitoraggio dei principali parametri qualitativi della birra.
La seconda attività del progetto comprende lo screening e la successiva selezione di nuovi ceppi di lievito
(Saccharomycodes ludwigii e Zygosaccharomyces rouxii). La qualità del prodotto finito è stata valutata
monitorando i principali parametri qualitativi studiati per la birra.
Key words: Alcohol-free, brewing, membrane contactor, osmotic distillation, special yeasts, high quality beer.
1. Introduction
Although the alcohol-free beer is still a minor product of the brewing industry, the increasing production of
alcohol-free beer worldwide reflects the global trend for healthier lifestyle (Lehnert et al. 2009). According to
Italian regulations a non-alcoholic beer, is a beer which presents a Plato degree (g of extract/ 100 of g wort) in the
range of 3-8 Plato with an alcoholic residue equal to or less than 1.2 ABV (alcohol by volume). In Europe it is
typical that a non-alcoholic beer or alcohol-free beer have a restricted final alcohol by volume content lower than
0.5 ABV whereas a low alcohol beer is between 0.5 and 1.2 ABV (Porretta et al.; 2008). There are two main
strategies for production an reduced alcohol beer: removal of alcohol from regular beer with dialysis (Bandel et al.
1986), reverse osmosis (Catarino et al.; 2006), vacuum rectification and evaporation (Narziss et al. 1993) and
controlled (suppressed) alcohol formation (Lehnert et al. 2009; Tomescu et al. 2009). All the above methods have
the disadvantage to affect the taste of the low-alcohol or alcohol-free beer obtained. In particular, 3methylthiopropionaldehyde emerged as the key compound responsible for the worty off-flavour in alcohol-free
beers, the most common defect of alcohol-free beers. In this PhD thesis two technologies for producing a high
quality alcohol-free beer (Perpete et al. 1999) were taken in account: an osmotic distillation membrane technology
and a biological process. The membrane contactor has already been studied in the field of the wine with excellent
results (Diban et al. 2008, Gambuti et al. 2011).
In this work the membrane behaviour during dealcoholisation beer was investigated. In particular for the evaluation
of the beer the main quality parameters, such as Plato, alcohol, colour, pH, turbidity, viscosity, total nitrogen,
carbon dioxide where checked. Furthermore, the beers sensory profile before and after the removal of alcohol was
also analysed by gas chromatography. To complete sensory evaluation, the beers will be tested and evaluated by a
trained panel test.
The same analyses will be used for the evaluation of the non-alcoholic beers obtained using special yeast. In this
work, twenty S. ludwigii strains and twenty Z. rouxii will be studied to assess the attitude for the production of a
beer with low alcohol content.
Pilot plant beer production: All the beers were produced at the 110 L pilot plant of CERB (Italian Brewing
Research Centre, Perugia, Italy).
Membrane: The dealcoholization tests were carried out an industrial system Alcoless Primo© (Enolife s.r.l.
Montemesola, Taranto, Italy) equipped with a polypropylene hollow fibre membrane contactor (Liqui-Cel, ExtraFlow 4x28, Celgard x50, Charlotte, USA) and two centrifugal pumps in stainless steel (Lowara CEA 70/3/A, Q 30–
80 L/min, PZ 0.37 kW, Vicenza, Italy).
Yeasts starter cultures: The strains of special yeasts were provided by the industrial yeast collection (DBVPG
- 209 -
Collection, Faculty of Agriculture, Department of Applied Biology, Perugia, Italy) of the Department of
Agriculture (Perugia, Italy).
Culture media: Cultures were grown in specific wort prepared by pilot plant of CERB (Italian Brewing Research
Centre, Perugia, Italy). Cultures were propagated and inoculated for fermentation in the laboratory of Microbiology
at the Department of Applied Biology of the University of Perugia.
Membrane Contactor: the project involves the dealcoholization of different types of beers, in order to assess beer
that is best suited to treatment with membrane contactor. The two tests were performed on an English ale type beer
with 4.3 ABV. Preliminary results show that the alcohol content is decreased from 4.3 to 0.6 ABV in 10 hours
(Figure 1, a) and from 4.1 to 0.9 in the second test (Figure 1, b).The sensory profile with gas chromatography and
the panel test of these beers are being processed.
Special Yeasts: the section will be developed in the second part of the second year of PhD.
Figure 1 (a) Ethanol reduction during beer dealcoholization and standard deviation (sample 1) (b) (sample 2).
Table 1 Normal beer and de-alcoholized beer analysis report
BEER SAMPLES
OB
Original Gravity (wt%)
Real Extract (wt%)
Apparent Extract (wt%)
Alcohol (ABV)
pH
Colour (EBC)
Total Nitrogen (mg/l)
Turbidity (EBC)
Viscosity (mPas)
CO2 (mg/l)
a
10.5
3.8 a
2.28 a
4.3 a
4.14 a
29.1 a
551.0 a
21.8 a
1.53 a
3.2 a
DB
ds
0.01
0.01
0.01
0
0.01
0.11
2
0.1
0
0.1
b
4.16
3.22 b
2.9 b
0.59 b
4.2 b
24.6 b
473.0 b
15.5 b
1.31b
2.9 b
OB
ds
0.01
0.01
0.01
0
0.01
0.11
5
0.17
0.01
0.02
a
10.2
4.0 a
2.58 a
4.0 a
4.01 a
24.9 a
485.0 a
5.5 a
1.5 a
3.2 a
DB
ds
0.01
0
0
0.01
0.1
0.05
2
0.07
0
0.02
4.94 b
3.31 b
2.93 b
1.02 b
4.11 b
22.2 b
434.0 b
7.1 b
1.31 b
3.0 b
ds
0.01
0.01
0.01
0.01
0.01
0.1
5
0.08
0.01
0.04
ds:standard deviation (n=2) OB:original beer DB:de-alcoholized beer. Values with different superscript letters are statistically different (P<0.05)
The parameters are statistically different, but this difference is not relevant for the final product quality assessment
such as the colour, total nitrogen and CO2 content (Table 1).
4. References
Lehnert R, Novák P, Macieira F, Kuřec M, Teixeira JA, Brányik T (2009) Optimisation of lab-scale continuous alcohol-free
beer production. Institute of Agricultural and Food Information 27: 267-275.
Porretta S, Donadini G (2008) A preference study for no alcohol beer in italy using quantitative concept analysis. J Inst Brew
114: 315-321.
Bandel W, Schmitz FJ, Ostertag K, Garske F, Breidohr HG (1986) Process and apparatus for reduction of alcohol by dialysis in
fermented beverages, US Patent 4581236.
Catarino M, Mendes A, Madeira L, Ferreira A (2006) Beer dealcoholization by reverse osmosis. Desalination 200: 397-399.
Narziss L, Back W, Stich S (1993) Alcohol removal from beer by countercurrent distillation in combination with rectification.
Brauwelt Int 133: 1806-1820.
Tomescu MG (2009), Methods of obtaining low alcohol or alcohol-free beer by means of dialysis and reverse osmosis. Journal
of EcoAgriTourism Sanogenous Food 5: 39-45.
Perpete P, Collin S (1999) Contribution of 3-methylthiopropionaldehyde to the worty flavor of alcohol-free beers. J Agric Food
Chem 47: 2374-2378.
Diban N, Athes V, Bes M, Souchon I (2008) Ethanol and aroma compounds transfer study for partial dealcoholization of wine
using membrane contactor. J Memb Sci 311: 136-146.
Gambuti A, Rinaldi A, Lisanti MT, Pessina R, Moio L (2011) Partial dealcoholization of red wines by membrane contactor
technique: influence on colour, phenolic compounds and saliva precipitation index. Eur food Res Technol 233: 647-655.
- 210 -
Development of a Method for the Study of Grape Metabolomics
Fabiola De Marchi (fabiola.demarchi@studenti.unipd.it)
Dept. of Land, Environment, Agriculture and Forestry (L.E.A.F.), University of Padova, Italy
Tutor: Prof. Riccardo Flamini
‘Metabolomics’, in parallel to other ‘omics’ sciences, such as genomics, transcriptomics and proteomics, aims at
the study of the whole set of metabolites synthesized by a biological system. The present paper describes the
development of this relatively new approach to detect the main metabolites in grape berries by identifying the
characteristic chemical compounds and to assemble a grape metabolome database. Mass spectrometry coupled to
separation techniques, such as liquid and gas chromatography, and to advanced mass analyzers represents a
powerful tool for a reliable identification of chemical compounds.
Sviluppo di un metodo per lo studio della metabolomica dell’uva
La metabolomica, in parallelo ad altre scienze quali genomica, transcrittomica e proteomica, ha l’obiettivo di
determinare l’intero insieme di metaboliti chimici prodotti in un sistema biologico. Questo lavoro descrive
l’applicazione di questo approccio, relativamente nuovo, nella caratterizzazione dei metaboliti presenti nell’acino
d’uva attraverso la costruzione di un database che descriva il metaboloma dell’uva. La spettrometria di massa
accoppiata a tecniche separative quali la cromatografia liquida e gassosa, rappresenta un valido strumento per
l’identificazione delle migliaia di composti chimici prodotti dal metabolismo cellulare.
Key words: Metabolomics, grape, LC-MS/QTOF, mass accuracy.
1. Introduction
Metabolites which have to be identified are often several hundreds of small molecules having different
physicochemical properties (pKa, polarity, size) and that are present in a wide range of concentrations in complex
matrices. Mass spectrometry, due to its high sensitivity and selectivity, has emerged as an effective instrumental
method for the identification of compounds on the basis of their mass. In particular High Resolution Mass
Spectrometry (HRMS) coupled to hybrid mass analyzers such as quadrupole time-of-flight QTOF and LTQ
Orbitrap has shown excellent detection and identification capabilities for low molecular weight compounds in
various matrices based on high resolution mass measurement of molecular ions (Krauss et al., 2010). Resolution or
resolving power, R, is defined as the full width at half maximum (FWHM) and for QTOF mass analyzers can reach
40.000 FWHM. Mass accuracy is measured in parts per million (ppm) and it represents the error of a mass
measurement; according to equation (1):
mass accuracy = [(accurate mass-exact mass)/exact mass] · 106
(1)
where accurate mass is the experimentally determined mass and the exact mass is the theoretical mass calculated by
using one isotope of each atom involved, usually the lightest one (Brenton and Godfrey, 2010). Given sufficiently
high mass accuracy and resolution, it is possible to determine the elemental composition and the identity of a
compound. Coupling mass spectrometers to separation techniques like gas chromatography (GC), used for volatile
compounds, and liquid chromatography (LC) for the analysis of polar compounds, it is possible to add each
molecule another information that is the retention time and also to separate isomers and isobaric species, which
have the same mass but different properties and retention times.
In this work 50 different grape varieties are currently being analysed. Sample preparation prior to metabolomics
was minimal in order to avoid editing of the samples. Twenty frozen berries of each variety were weighed,
homogenized with liquid nitrogen and simply added to extraction solvent (methanol). After adding 0.2 μl of 4’,5,7trihydroxy flavanone as internal standard, samples were centrifuged for 20 minutes at 10 °C and the liquid upper
phase was filtered and collected in a vial, ready for LC/QTOF MS analysis. The instrument used was an Agilent
UHPLC 1290 Infinity coupled to an Agilent 6540 accurate-mass Q-TOF MS with electrospray ionization source.
Analyses were performed by operating in both positive and negative ionization mode.
- 211 -
3.1 Data analysis
Metabolomics analyses can be conducted in two ways, by using a targeted approach, which makes use of internal or
external standards and is quantitative, and an untargeted semi-quantitative profiling approach (Scalbert et al., 2009).
In the first case a number of metabolites are identified by a preliminary knowledge of their masses, retention times
and fragment spectrum confirmed then by calibration standards. The untargeted profiling consists instead on an
automated mass assignment to peak signals without any a priori information on the compounds, and the next
searching of possible chemical formulas in open accessible databases. The identification of a compound in both
cases is done by the assignment of a molecular formula to a signal on the basis of: 1) the exact mass, often
determined to 4 decimal places, 2) the ratio and the intensities of the isotopic pattern, 3) the retention times, 4) the
MS/MS fragmentation spectrum. For an automated compound detection several software packages using different
peak detection algorithms are available and usually offered by the MS manufacturer (Krauss et al., 2010).
MassHunter Workstation software provided by Agilent was used to process the large grape metabolites datasets. In
order to identify as many suspect metabolites as possible, the ‘Find by Formula’ algorithm was used, which finds
known metabolite peaks in LC–quadrupole time-of-flight (Q-TOF) data using the empirical formula in a grape
metabolites database expressly constructed (GrapeMetabolomics, which contains about 1.000 hits) to direct the
extraction. For masses that did not match a compound in the database, an empirical formula calculator, called
Molecular Formula Generator (MFG), was used to calculate the formula with the "best" match. Datasets were then
imported to Mass Profiler Pro which calculated the error mass (in ppm) for each formula, compared the theoretical
isotopic pattern with the experimental one and assigned each putative compound a percentage score. The additional
information of retention times was also given to each chemical compound by previously assembling a proper
retention times library (RTL).
3.2 First results
After this process of data filtering a list of several hundreds of proposed compounds was given for each grape
variety. Every compound had an identification score which represents a goodness of fit between observed ions to
against the expected ions in the database. The large number of metabolites detected, e.g. in Raboso Piave grape
variety, included different classes of chemical compounds, such as polyphenols, anthocyanins, organic acids, lipids,
glycosilated terpenes, carbohydrates, phytoalexins and others. Table 1 reports the number of metabolites in
different score intervals for Raboso Piave grape sample.
Confirming identification of putative compounds by performing MS/MS experiment will be the next step in
metabolomics analysis.
Table 1
Number of metabolites determined in different score intervals for Raboso Piave grape variety.
Score interval (%)
99.9 - 99.0
99.0 - 95.5
95.5 - 90.0
90.0 - 60.0
Number of metabolites
61
77
50
192
4. References
Brenton AG, Godfrey AR (2010) Accurate Mass Measurement: Terminology and Treatment of Data. J Am Soc Mass Spectrom
21: 1821-1835.
Krauss M, Singer H, Hollender J (2010) LC-high resolution MS in environmental analysis: from target screening to the
identification of unknowns. Anal Bioanal Chem 397: 943-951.
Scalbert A, Brennan L, Fiehn O, Hankemeier T, Kristal BS, van Ommen B, Pujos-Guillot E, Verheji E, Wishart D, Wopereis S
(2009) Mass-spectrometry-based metabolomics: limitations and recommendations for future progress with particular focus
on nutrition research. Metabolomics 5: 435-458.
- 212 -
Study for the Development of a Production Process to Obtain High Quality
Bitter Orange Marmalade in a Short Supply Chain Context
Marcello Della Campa (marcello.dellacampa@unimi.it)
Tutor: Prof. Stefania Iametti; Co-tutor: Dr. Tiziana Maria Piera Cattaneo
This poster shows one some results obtained as a part of the PhD project titled: “Process innovations and costs
evaluation using conventional or alternative energy supply for food production in a short supply chain context”.
The aim of this PhD thesis is developing, studying and energy testing of different food products tightly pointing the
short supply chain context. These products were “tailored” on the prototype plants developed and built in a previous
part of the national research project funded by the Italian Ministry of Agriculture, named “MIERI project”
(acronym meaning: “Realization of small scale equipment for food processing, also working with renewable
energy”). The study also takes in account quality, safety and raw materials typicity linked to the territory, in order
to obtain high quality, also containing high nutraceutical content, rentable food products in a handicraft producing
context. In particular the production process of bitter orange marmalade is described here.
Studio preliminare per la messa a punto di un processo produttivo per l’ottenimento
di marmellata di arancia amara di alta qualità in un contesto di filiera corta
Questo poster presenta alcuni risultati della tesi di Dottorato intitolata: “Innovazioni di processo per la realizzazione
di prodotti alimentari in filiera corta e valutazione dei vantaggi derivanti dall’uso combinato di energie alternative e
convenzionali”. I principali scopi della tesi sono: sviluppo, studio e valutazione energetica di diversi prodotti
alimentari specificamente pensati per la filiera corta. Questi prodotti sono stati sviluppati “su misura” sui prototipi
progettati e realizzati in una precedente fase del progetto nazionale finanziato dal Ministero delle Politiche Agricole
e Forestali, progetto “MIERI” (l’acronimo significa: “Miniaturizzazione e semplificazione di linee di
trasformazione per le piccole produzioni agroalimentari e impiego di energie rinnovabili”). Lo studio terrà in conto
della qualità, sicurezza, tipicità e legame col territorio delle materie prime, col fine di ottenere prodotti alimentari di
alta qualità, possibilmente ad alto contenuto in nutraceutici, redditizi, ed ottenuti in un contesto artigianale di filiera
corta. Viene qui presentato in dettaglio il lavoro svolto per l’ottenimento di marmellata di arancia amara.
1. Introduction
Although Citrus aurantium, L is the most common rootstock used in citriculture, its fruit is rare in the market
because of its low and local production, in addition to its almost total consumption by pharmaceutical and food
industry. This fruit, known as bitter orange, or Seville orange, sour orange, ecc. is used to produce “bitter orange
marmalade”, or simply “marmalade”, a wide world spread preserve. Moreover no commercial cv were ever
developed (early, late, seedless, etc), hence it is present on the market only during January, in a very narrow
ripening stage.
Citrus aurantium, L shows a natural high content in bioactive compounds (vitamin C, polyphenols, carotenoids,
etc.) thus it can be potentially used in order to obtain a nutraceutical product.
It is possible to find handicraft bitter orange marmalade, but its quality is, in most cases, very low due to the lack of
technology that commonly characterize small and craft producers.
One hundred kg of Organic Citrus aurantium, L fruits were collected by a Sicilian producer during January 2012.
The fruits, after the random splitting into four groups (corresponding to the four different processing), were
immediately processed according to the production diagram, using a prototype miniaturized plant (della Campa,
2011), obtaining 5 different products:
- not blanched, ambient pressure concentration (samples called NTPA)
- not blanched, vacuum concentration (samples called NTSV)
- blanched, ambient pressure concentration (samples called SCPA)
- blanched, vacuum concentration (samples called SCSV)
- not blanched, ambient pressure concentration, skins and pips cooked in the orange pulp (samples called
CASA)
Blanching pretreatment inactivates plyphenoloxidase and other enzymes responsible of many bioactive compounds
loss, while vacuum concentration let the temperature never rise under 45°C during the process. The products NTSV
and SCSV samples were exposed to high temperature during the thermal stabilization treatment and the blanching
- 213 -
pre-treatment (samples SCSV).
In this work handicraft-similar samples (CASA) and samples obtained by the same raw material and composition
(varying the technology) were compared.
Ascorbic acid content was measured in according to Picchi 2012 as a first heat treatment marker. The following
modifications were introduced in the sample preparation step: 2g of marmalade were extracted with 4 ml of 6%
metaphosphoric acid (at 4°C) and 4 ml of water (at 4°C), homogenized and centrifuged at 9,000rpm for 15 min at
4°C, and immediately analyzed.
An explicative video of the process (sample NTSV) is visible on the world wide web at the address:
http://www.youtube.com/watch?v=IY16MoKAjyI
As expected, according to the different processes applied to the same formulation different products were obtained.
They showed noticeably differences in colour, consistence (viscosity), taste and smell.
Ascorbic acid content showed that the blanched sample had a lower retention than the untreated samples, while the
vacuum concentration has always had a positive effect on ascorbic acid retention (Fig. 1). Probably a first loss of
ascorbic acid (Fig. 2) was caused by the primary operations (debittering, separation solids/liquids).
A second experimental step is now on the run: physical, chemical and sensory parameters will also be measured in
order to verify the effective content of natural bioactive compounds in the final products in comparison with the
starting material. Furthermore this work is aiming to verify if the MIERI miniaturized plant can represent a valid
tool to obtain high quality bitter orange marmalade.
Figure 1 Acid ascorbic content in the final products.
Figure 2 Acid ascorbic content in the initial material.
4. References
Della Campa M (2011) Performance and energy balance evaluation of a miniaturized plant for food production. In Proc.s of the
16th Workshop on the Developments in the Italian PhD Research on Food Science Technology and Biotechnology, Lodi
(Italy), 21-23 September, pp. 321-323.
Picchi V, Migliori C, Lo Scalzo R, Campanelli G, Ferrari V, Di Cesare LF (2012) Phytochemical content in organic and
conventionally grown Italian cauliflower. Food Chem 130: 501-509.
- 214 -
Effect of Chestnut Extract Obtained by “Castagna di Montella”
on the Viability of Potential Probiotic Strains and Application
to the Production of a Functional Chestnut Mousse
Marika Di Capua (marika82dm@libero.it)
Dept. of Food Science, University of Naples, Federico II, Portici, Italy
Tutor: Prof. Maria Aponte
The aim of the present PhD project is the development of a new concept food able to join the functional properties
of the chestnut fruits with the benefits provided by the ingestion of probiotic strains on human health.
Effetto dell' estratto da “Castagna di Montella” sulla sopravvivenza
di batteri lattici potenzialmente probiotici e applicazione per la produzione
di una Mousse funzionale di castagna
L’obiettivo del presente lavoro di ricerca è quello di sviluppare un nuovo concetto di alimento in grado di unire le
proprietà funzionali della castagna con i benefici legati all’ingestione di ceppi probiotici sulla salute umana.
Key words: Chestnut extract; Probiotic; Lactobacillus rhamnosus.
1. Introduction
According to the FAO (2010), chestnut (Castanea sativa) worldwide production is estimated in 1.9 million tons.
Europe is responsible for about 5% of global production, with relevance for Italy and Portugal. Campania region
provides the 50% of the Italian chestnut crops; the Irpinia district, in detail, with about 17.000 tons contribute for
about the 40% to the crop of the region and, in 1992, one Protected Geographical Indication (PGI) called “Castagna
di Montella”, was created for chestnuts produced in this area. The chemical composition of chestnut fruits have
been recently reviewed (De Vasconcelos et al., 2010) revealing the presence of various nutrients that are important
for human health. Actually, chestnut appears as a functional fruit and, moreover, due to the presence of nondigestible components of the matrix, chestnut might also serve as prebiotics. However, due to the complexity of
chestnut composition, a systematic approach is needed in order to identify the factors which may enhance the
growth and survival of probiotic strains, both in vitro and in vivo. The overall aim of the present study was to
evaluate a chestnut-based substrate as probiotic carrier, by examining the effect of indigestible chestnut fiber and of
chestnut extracts on the viability of selected LAB strains, and application to the production of a functional chestnut
mousse.
2.1 Microorganism and culture conditions
LAB strains used in this study were: three Lactobacillus (Lb.) rhamnosus isolated from Parmigiano reggiano
cheese, two Lb. casei, 33 Streptococcus (St.) thermophilus, 26 St. macedonicus isolated from Provolone del
Monaco cheese (Aponte et al., 2008) and Lb. rhamnosus GG from ATCC (ATCC 53103).
2.2 Effect of chestnut fiber and chestnut extract on the strains’ tolerance to simulate gastric and bile juice
The tolerance of LAB to simulated gastric and bile juices was determined according to the following procedure.
Free-cell suspensions from MRS or M17 medium and, alternatively, cells immobilized within chestnut fiber (CF),
were mixed with sterile saline or chestnut extract (CE) and finally added to simulated gastric (pH 2.00) or bile juice
(pH 8.00). Aliquots were taken, during incubation at 37°C, after 0, 15, 30, 60, 90, and 180 min and after 0 and 240
min for gastric and bile tolerance measurements, respectively. The same set of experiments was repeated by using
chestnut flours obtained by different cultivar. Reducing sugars content of CE was evaluated by HPLC analysis.
2.3 Spray drying of selected strains
The thermal tolerance (60, 65 and 70°C) of strains was evaluated by heat challenge experiments, according to
Corcoran et al. (2004) in MRS broth, CE, and chestnut medium (CM). Thermal tolerance in 20% (wt wt-1)
trehalose solutions was used as reference. At intervals, survivors were enumerated by plating on MRS agar. A
laboratory scale spray dryer (model B191 Buchi mini spray dryer) was used to process samples at a constant air
outlet temperature of 170°C. Bacterial viability was assessed by using the Live/Dead BacLight Kit and by plating
onto MRS agar and MRS agar supplemented with NaCl (8%). Moreover, a direct count at microscope was carried
on.
- 215 -
2.4. Mousse preparation
Selected strains were spray dried in CE. Powders were separately added (1% wt wt-1) to an anhydrous basis for
chestnut mousse. Inoculated and uninoculated mousses were submitted to a panel test as well as to preliminary
consumers’ test.
3.1 Effect of chestnut extracts and of cells immobilization in chestnut fiber on gastric and bile tolerance
Survival of free cells cultured in MRS medium and cells immobilized within chestnut fiber was evaluated during
transit in simulated gastric juice. CE proved to be able to exert a significant effect on the simulated gastric tolerance
of free cells as well as of cells immobilized within chestnut fiber. All Lactobacillus spp. species, with the unique
exception of Lb. rhamnosus VT1, showed an identical behaviour: population levels remained unchanged up to 180
min. in presence of CE, independently from immobilization in chestnut fiber. Actually, population levels reached
by strains in MRS were about one log higher than levels in CM. This effect of CE did not appear in strains
belonging to the genus Streptococcus spp. On the other hand, immobilization in CF did not seem to exert any
beneficial effect on strain surviving. In all cases, except Lb. casei 4E and Lb. rhamnosus LbGG, population levels
decline under the detection level after 15 min of treatment. The obtained results appear significantly different from
those reported by Michida et al. (2006). The authors evaluated the effect of cereal extracts obtained from barley and
malt on a probiotic Lb. plantarum strain in a similar set of experiments. According to evidences, they reported a
complete tolerance of strain to gastric acidity only when cells were immobilized in cereal fiber. Strains tolerance to
bile salts exhibited a completely differ trend. All tested strains, included streptococci, were able to survive up to
240 min One exception could be reported for strains Lb. rhamnosus RBM526 and RBT739, and for Lb. casei
Lbc496: free cells in saline solution did not survive to the treatment. As general consideration, chestnut-fiberentrapped cells showed higher stability in the presence of simulated bile juice than free cells cultured in MRS
medium
3.2.Influence of flour in the preparation of chestnut extract
With the aim to understand if obtained results could be reported to the kind of chestnut flour employed for the
preparation of CE and CF, the same set of experiment was repeated by using flour coming from a different chestnut
cultivars. All analyzed strains exhibited a different behaviour and even lactobacilli were unable to exert the same
performances. Cell immobilized in CF and in presence of CE of Lb GG did not survive to an exposition 30 min
long . A quali-quantitative characterization of reducing sugars was performed by HPLC for CE obtained by
“Castagna di Montella” flour and from CEs obtained by a different cv. CEs compositions appeared quite different.
Glucose, fructose and maltose were the only sugars retrieved but their content was different. CE from “Castagna di
Montella” resulted richer in sugars and above all in maltose whose content was almost three times higher (1.79 g L1
). Experiments carried out by substituting CE with three different sugars solutions, allowed to exclude the
contribute of reducing sugars in the improving of gastric tolerance of lactobacilli.
3.3. Spray drying and chestnut mousse preparation
Based to previous results, two strains, namely Lb. rhamnosus GG and RBM526, were selected and spray dried in
CE. Evidences emerged by heat challenge tests allowed to point out the optimal conditions for spray drying (outlet
and inlet temperatures 140 and 65°C, respectively). Results obtained by counts on MRS agar and Live/Dead
BacLight Kit allowed to conclude that each gram of dried powder still hosted about 10 Log CFU mL-1 of living and
undamaged bacterial cells. Surprisingly, mousse inoculated with probiotic strain Lb. rhamnosus GG proved to be
the more appreciated among panellists as well as at the consumers’test.
4. References
Aponte M, Fusco V, Andolfi R, Coppola S (2008) Lactic acid bacteria occurring during manufacture and ripening of Provolone
del Monaco cheese: Detection by different analytical approaches. Int Dairy J 18: 403-413.
Corcoran BM, Rossi RP, Fitzgerald GF, Stanton C (2004). Comparative survival of probiotic lactobacilli spray-dried in the
presence of prebiotic substances. J Appl Microbiol 96: 1024–1039.
De Vasconcelos MCBM, Bennett RN, Rosa EAS., Ferreira-Cardoso JV (2010) Composition of European chestnut (Castanea
sativa Mill.) and association with health effects: fresh and processed products. J Sci Food Agric 90: 1578–1589.
FAOSTAT (2010) Food and Agriculture Organization of the United States. [Online]. Available:
http://faostat.fao.org/site/339/default.aspx
Michida H, Tamalampudi S, Pandiella SS, Webb C, Fukuda H, Kondo A (2006) Effect of cereal extracts and cereal fiber on
viability of Lactobacillus plantarum under gastrointestinal tract conditions. Biochem Eng J 28: 73-78.
- 216 -
Natural Polyphenols: an “in vitro” Investigation on their Protective Role
as Inhibitors of Amyloid Formation by Human Transthyretin
Paola Florio (paola.florio@nemo.unipr.it)
Dept. of Biochemistry and Molecular Biology, University of Parma, Italy
Tutor: Prof. Rodolfo Berni
The dissociation of tetrameric human transthyretin (TTR) into monomers and monomer misfolding and
misassembly are believed to represent crucial steps leading to pathologic formation and extracellular deposition of
amyloid fibrils. Small organic molecules are capable of stabilizing the tetrameric native structure of TTR,
representing quite promising drugs for the therapy of TTR amyloidoses. We show here that some natural
polyphenols are able to bind with high affinity to TTR, to stabilize its native structure and to inhibit its “in vitro”
fibrillogenesis.
Polifenoli naturali: indagine “in vitro” sul loro ruolo protettivo
come inibitori della amiloidogenesi da transtiretina umana
Evidenze sperimentali suggeriscono che la dissociazione della proteina tetramerica umana transtiretina (TTR) in
monomeri e l’aggregazione patologica di monomeri strutturalmente alterati rappresentino passaggi cruciali della
formazione e deposizione extracellulare di fibrille nelle amiloidosi da TTR. L’inibizione del processo di
fibrillogenesi da parte di composti organici che stabilizzano la struttura tetramerica nativa della TTR è considerata
una efficace strategia terapeutica. In questo studio abbiamo verificato che polifenoli naturali sono in grado di
legarsi alla TTR, stabilizzandone la struttura tetramerica nativa ed inibendo “in vitro” il processo di fibrillogenesi.
Key words: Transthyretin, natural polyphenols, amyloidogenic proteins, human amyloidoses.
1. Introduction
Misfolding and pathological aggregation of normally soluble proteins are implicated in the pathogenesis of
amyloidoses, important human diseases associated with the extracellular deposition of fibrillar aggregates. While
wild type transthyretin (TTR) is responsible of Senile Systemic Amyloidosis (SSA) in the old age, a number of
genetic variants of human TTR are associated with hereditary amyloidoses (FAP, Familial Amyloid
Polyneuropathy, and FAC, Familial Amyloid Cardiomiopathy). TTR is a 55 kD homo-tetramer, involved in the
transport of the thyroxine hormone (T4). The dissociation of the tetramer into monomers and their misfolding and
misassembly represent crucial steps of the fibrillogenesis process. Small organic molecules that can bind to the T4
binding pockets and stabilize the TTR tetramer represent effective fibrillogenesis inhibitors (Johnson et al., 2005).
The aim of this investigation was to evaluate the ability of natural polyphenols (Genistein, Apigenin, Quercetin,
Curcumin, Resveratrol and Pterostilbene) to interact with and to stabilize human TTR, both wild type and genetic
variants, and to inhibit the fibrillogenesis process.
2.1 Expression and purification of wild type (wt) and I84S human TTR
I84S TTR plasmid was prepared utilizing the Quick-Change site directed mutagenesis procedure using wt TTR
DNA as the template. Expression and purification of wt and I84S TTR were performed as previously described
(Pasquato et al., 2007).
2.2 Fluorometric investigation
Direct binding assays were performed for Resveratrol, Pterostilbene and Curcumin by adding each fluorescent
ligand to wt TTR. Competition binding assays were carried in the case of Quercetin, Genistein and Apigenin, by
monitoring the displacement of TTR-bound Resveratrol used as fluorescent probe. The ability of T4 to displace
Resveratrol or Curcumin bound to TTR was also evaluated, to compare the relative affinities of polyphenols with
that of the physiological ligand.
2.3 Stabilization of TTR in the presence of urea.
Wt human TTR was incubated with 2 equivalents of polyphenols (Genistein, Apigenin, Quercetin, Curcumin,
Resveratrol and Pterostilbene) and with the control Diflunisal (a synthetic fibrillogenesis inhibitor) at 4°C for 24
hours in the presence of different concentrations of urea. TTR present in the samples was then cross-linked with
glutaraldehyde, and the cross-linking reactions were quenched by adding sodium borohydride. The protein samples
were finally subjected to SDS-PAGE (Raghu Pullakhandam et al., 2009).
- 217 -
2.4 Fibrillogenesis at moderately acidic pH (4.2)
The fibrillogenesis kinetics for I84S TTR at acidic pH were monitored by spectrophotometric measurements at 400
nm and 37 °C as described in (Miller et al. 2004). TTR was incubated in the absence and in the presence of natural
compounds or the control Diflunisal before turbidity measurements.
2.5 Binding of ligands to TTR by immunoaffinity technique
To evaluate the binding selectivity of natural polyphenols for TTR present in plasma we used magnetic beads
(Dynabeads Protein G, Invitrogen) functionalized with anti-human TTR antibodies. Resveratrol, Curcumin and
Diflunisal were added to plasma and after 30 minute incubation at room temperature, TTR was isolated from
plasma by the immunobeads and finally TTR-bound ligands were extracted by means of ethanol and analyzed by
HPLC-LTQ Orbitrap XL. At the same time, TTR bound to the beads was quantified by SDS-PAGE for each
sample.
3.1 Fluorometric investigations
Fluorometric investigations have shown the ability of all the natural compounds we have assayed to bind to TTR.
Moreover, Resveratrol displaced, at equal concentration, T4 from its binding sites in TTR; on the contrary,
Curcumin was not able to displace TTR-bound T4, suggesting a binding affinity of this compound lower than that
of Resveratrol. The addition of Genistein, Apigenin and Quercetin to the TTR-Resveratrol complex induced the
displacementtt of bound Resveratrol, indicating for all these compounds a quite high affinity. A lower binding
affinity as compared to Resveratrol was established for Pterostilbene.
3.2 Stabilization of wt TTR in the presence of urea
All of the natural compounds we have assayed proved to be capable of stabilizing wt TTR in the presence of urea.
Resveratrol showed a greater stabilizing effect as compared to Diflunisal. Curcumin, Apigenin, and Genistein.
3.3 Binding of ligands to TTR by immunoaffinity technique
The binding stoichiometry of Resveratrol and Curcumin for TTR was estimated to be 2.7 and 3.7 respectively,
while that of Diflunisal was 0.7. The high binding stoichiometry found for Curcumin might be due to its
nonspecific binding to TTR. We are currently performing the same experiment with the other polyphenols.
3.4 Fibrillogenesis inhibition
The comparison of the ability of the assayed compounds to interfere with TTR fibrillogenesis, monitored at 400
nm, revealed a higher inhibitory effect for the compounds Diflunisal, Resveratrol and Apigenin.
4. References
Johnson SM, Wiseman RL, Sekijima Y, Green NS, Adamski-Werner SL, Kelly JW (2005) Native state kinetic stabilization as a
strategy to ameliorate protein misfolding diseases: a focus on the transthyretin amyloidoses. Acc Chem Res 38: 911-921.
Miller SR, Sekijima Y, Kelly JW (2004) Native state stabilization by NSAIDs inhibits transthyretin amyloidogenesis from the
most common familial disease variants. Laboratory investigation 84: 545-552
Pasquato N, Berni R, Folli C, Alfieri B, Cendron L, Zanotti G (2007). Acidic pH-induced conformational changes in
amyloidogenic mutant transthyretin. J Mol Biol 366: 711-719
Raghu Pullakhandam, Srinivas PNBS, Nair MK, Bhanuprakash Reddy G (2009) Binding and stabilization of transthyretin by
curcumin. Arch Biochem Biophys 485: 115-119.
- 218 -
Biofilm-forming Ability of Staphylococcus aureus
and Pseudomonas spp. of Food Origin
Francesca Frigo (francesca.frigo@uniud.it)
Dept. of Food Science, University of Udine, Udine, Italy
Tutor: Dr. Michela Maifreni; Co-tutor: Dr. Marilena Marino
This part of the PhD thesis project focused on the biofilm-forming ability of Staphylococcus aureus and
Pseudomonas spp. In particular, the objective of this work was to investigate and compare biofilm formation by
strains of Staphylococcus aureus and Pseudomonas spp. of dairy origin under a variety of environmental
conditions, including temperature, pH, glucose % and NaCl %. In order to investigate the combined effects of these
parameters, a factorial Central Composite Design was used.
Capacità di formazione di biofilm da parte di ceppi di Pseudomonas spp.
e Staphylococcus aureus di origine alimentare
Questa parte del progetto di tesi di dottorato è stata dedicata allo studio di batteri appartenenti alla specie
Staphylococcus aureus e al genere Pseudomonas. In particolare, gli obiettivi di questo lavoro sono stati quelli di
approfondire l’attività biofilmogena di ceppi di Staphylococcus aureus e Pseudomonas spp. isolati dal settore
lattiero-caseario in diverse condizioni ambientali (T °C, pH, glucosio % e NaCl %). Per poter investigare gli effetti
combinati di questi parametri, è stato utilizzato un modello Central Composite Design.
Key words: Adhesion, biofilm, Staphylococcus aureus, Pseudomonas spp., dairy products.
1. Introduction
In accordance with the PhD thesis project previously described (Frigo, 2011) this paper reports the main results of
the first two activities concerning (A1) the selection of the strains of Staphylococcus aureus and Pseudomonas spp.
according to their biofilm production and (A2) the study of the combined effects of environmental factors
(temperature, pH, glucose % and NaCl %) on biofilm formation by the selected strains.
The strains of Staphylococcus aureus (Sta2, Sta3, Sta4) and Pseudomonas spp. (P. putida Pp1, P. fluorescens Pfl1 and
P. fragi Pfr1) were isolated from raw milk, dairy products and food handlers and identified by 16S rRNA gene
sequencing. The combined effects of temperature (17-37°C for S. aureus and 8-20°C for Pseudomonas spp.), pH (5.07.0 for S. aureus and 4.5-6.5 for Pseudomonas spp.), glucose % (0.25-4.25% for S. aureus and 0-4% for Pseudomonas
spp.) and NaCl % (0.5-4.5% for S. aureus and 0-4% for Pseudomonas spp.) on biofilm formation were studied
through a 5-level-4-variable central composite design (CCD). The assay for biofilm formation was carried out in
triplicate using a 96-well flat-bottomed polystyrene microtiter plate containing 200 µL of TSB (Oxoid, Italy) for S.
aureus strains and LB broth for Pseudomonas spp. strains, inoculated at a concentration of approximately 106-107
CFU/mL, adjusted for pH, % of glucose and % of NaCl and incubated at different temperatures, for 7 days. After
incubation, the procedures of staining with crystal violet and reading of the Optical Density (OD570) described by
Christensen et al. (1985) were followed.
Staphylococcus aureus is recognized as a serious problem in the food industry due to its property to produce many
kinds of enterotoxins including those most frequently implicated in food poisoning outbreaks (Baird-Parker, 2000). S.
aureus is known to form biofilms on various materials and surfaces and the attachment and biofilm formation may be
important for persistence of S. aureus. According to this, it is interesting to study the combined effect of the
environmental factors on biofilm formation by S. aureus. Among the Pseudomonas genus, P. aeruginosa is known for
its ability to form biofilms on abiotic surfaces (Giltner et al., 2006), but little is known about biofilm-forming capacity
of Pseudomonas spp. isolated from food environments. Moreover, there are few reports about the effect of the
environmental factors on biofilm formation by Pseudomonas spp. and in particular about the interaction between the
environmental stresses on biofilm production. Results evidenced a strain-dependent biofilm-forming ability. Indeed
both S. aureus and Pseudomonas strains were differently affected by the environmental parameters. For strains S.
aureus Sta2 and Sta3 the temperature and pH were statistically significant (p<0.05). In particular, biofilm formation by
Sta2 was enhanced with incremented temperature and at pH 6-7 (Figure 1a) while Sta3 produced high amount of
biofilm at pH near 5 at all temperature values and at pH near 7 only at temperature above 20°C (Figure 1b). For S.
- 219 -
aureus Sta4 the temperature was statistically significant (p<0.05) (Figure 1c). The results obtained for Sta2, Sta3 and
Sta4 regarding the effect of temperature on biofilm formation are in agreement with Rode et al. (2007), according to
which biofilm formation was generally enhanced with increasing temperature. For P. fragi Pfr1 the temperature,
glucose % and the concentration of salt significantly (p<0.05) affected the biofilm formation. This strain showed a
high biofilm-forming ability at temperatures below 18 °C regardless of the pH value (Figure 2a). For P. putida Pp1,
the influence of NaCl % and temperature were statistically significant (p<0.05). This strain produced the highest
amount of biofilm at pH 5.5 at temperatures 4-6°C and 18 -20 °C and NaCl 0-3 % (Figure 2b). The results obtained for
P. fragi Pfr1 and P. putida Pp1 are in agreement with previous studies, which evidenced the influence of temperature
changes on biofilm formation (Di Bonaventura et al., 2008). P. fluorescens Pfl1 produced high amounts of biofilm in
the entire range of T, pH and NaCl% tested, and the biofilm formation was significantly (p<0.05) affected by glucose
%. In particular, biofilm formation was enhanced with decreased glucose % (Figure 2c). This can be due to a bacterial
survival strategy in nutritionally limited environments, as reported by Jefferson (2004). Strain Pfl1 formed high
amounts of biofilm both at low (4°C) and high temperatures (20°C): this behaviour might contribute to its persistence
in dairy-processing environments, where temperatures can be 10°C or less (e.g. brining and ripening areas), or more
than 15°C (cheesemaking area). The pH had no effect on P. fluorescens Pfl1biofilm formation. In fact, this strain
showed a high production of biofilm at any pH values tested in this study.
In conclusion, the results obtained showed that the environmental stresses differently influenced the biofilm formation
by dairy S. aureus and Pseudomonas strains. Moreover, the finding that biofilm formation may be promoted by
environmental conditions present in the food industry, and in particular in dairy processing plants, indicates that food
producers should be aware of the importance of controlling biofilm formation by Pseudomonas spp. and S. aureus,
which are important bacteria causing respectively spoilage of milk and dairy products and food poisoning after their
consumption.
Figure 1 Three dimensional plot of the effect of the interaction of environmental parameters on biofilm formation by S. aureus
Sta2(1a), S. aureus Sta3 (1b) and S. aureus Sta4 (1c).
Figure 2 Three dimensional plot of the effect of the interaction of environmental parameters on biofilm formation by P. fragi
Pfr1(2a), P. putida Pp1 (2b) and P. fluorescens Pfl1 (2c).
4. References
Baird-Parker, TC (2000) Staphylococcus aureus. In: Lund, BM, Baird-Parker, TC, Gould, GW (Eds.) The Microbiological
Safety and Quality of Food. Aspen Publishers, Inc., Gaithersburg, Maryland.
Christensen, GD, Simpson, WA, Younger, JJ, Baddour, LM, Barrett, FF, Melton, DM, Beachey, EH (1985) Adherence of
coagulase-negative staphylococci to plastic tissue culture plates: a quantitative model for the adherence of staphylococci to
medical devices. J Clin Microbiol 22: 996-1006.
Di Bonaventura, G, Piccolomini, R, Paludi, D, D’Orio, V, Vergara, A, Conter, M, Ianieri, A (2008) Influence of temperature on
biofilm formation by Listeria monocytogenes on various food-contact surfaces: relationship with motility and cell surfaces
hydrophobicity. J Appl Microbiol 104: 1552-1561.
Giltner, CL, van Schaik, EJ, Audette, GF, Kao, D, Hofges, RS, Hassett, DG, Irvin, RT (2006) The Pseudomonas aeruginosa
type IV pilin receptor binding domain functions as an adhesin for both biotic and abiotic surfaces. Molec Microbiol 59:
1083-1096.
Jefferson, KK (2004) What drives bacteria to produce a biofilm? FEMS Microbiol Lett 236: 163-173.
Rode, TM, Langsrud, S, Holck, A, Moretro, T (2007) Different patterns of biofilm formation in Staphylococcus aureus under
food-related stress conditions. Int J Food Microbiol 116: 372-383.
- 220 -
Chemical Markers for the Evaluation of Sensory
and Antioxidant Properties of Wines
Mario Gabrielli (mario.gabrielli@unimi.it)
DeFENS - Dept. of Food, Enviromental and Nutritional Sciences ,University of Milan, Italy
Tutor: Prof. Antonio Tirelli
The PhD work will be aimed to the evaluation of chemical markers in wine, useful to characterize the oxidized offflavour, their formation pathways as well as the factors affecting their occurrence.
Marker chimici per valutare le proprietà antiaromatiche ossidative del vino
Verranno studiati i marker chimici che caratterizzano il difetti olfattivi e gustativi di ossidato nel vino, le loro
possibili vie di formazione e i fattori che influenzano la loro presenza.
Key words: Sotolon, oxidative off-flavor, sotolon pathway, untypical aging, solvent extraction, UPLC analysis.
1. Introduction
4-5 dimetil-3-idrossi-2(5H)-furanone (sotolon) is a powerfull flavor compound, characterized by burnt note of aged
sake, roasted caffee, greek hay, sugar cane, spicy and curry (Pons et al., 2008) and high amounts are contained in
oxidative aging wines. Sotolon concentration increases during ossidative aging of Sherry wines and Porto wines. It
is the most important responsible compound of the untypical aging and oxidative off-flavor of wine. Sotolon
perception threshold in wine is very low (10 μg/l) (Guichard et al., 1993) and its chiral molecule (Lavigne et al.,
2008) is chemically stable and soluble in hydroalcoholic solutions (14% etanolo vol/vol). The main parent
compounds are α-ketobutyric acid and ethanal (Cutzach et al., 1999), which can result from ethanol and ascorbic
acid (Konig et al., 1999) as well as from amino acid by means of the Maillard reaction (Guerra et al., 2011). Other
factors may affecting its accumulation in wine are SO2 concentration, presence of oxygen, storage temperature and
duration of storage (Cutzach et al., 1999; Lavigne et al., 2008). Since many common chemical and physical factors
are involved in sotolon formation in wine suche compound could be a useful index for estimating the potential shelf
life of the wine. For the assessment of sotolon a number of different analytical approaches have been proposed, all
of them requiring a concentration step of the sample by organic solvents or SPE due to the low perception threshold
(Ferreira et al., 2000) as well as a chromatographic separation . (Konig et al., 1999; Guichard et al., 1993). All of
these methods require long extraction time (up to 48 h), high sample volume (up to 500 ml) and solvent volume (up
to 250 ml). Therefore, the research work has been spent to develop an easy-to-apply, reliable and sensitive
analytical method. with separation in ultra high performance liquid chromatography (HUPLC) suitable to monitor
the sotolon accumulation in winemaking and storage.
2.1 Samples
The sotolone quantification was performed in water solutions, hydroalcoholic solutions (14% v/v EtOH), model
wine solution (13% v/v EtOH; 5 g/l H2T; pH 3.2 with NaOH 1N) and in white wines 2011-12 ( Trebbiano and
Chardonnay).
2.2 Sample extraction
White wine sample (30 ml) was added with 100 g/l NaCl andsubmitted to three extractions with CH2Cl2 (3*40 ml).
The organic phase was dried over Na2SO4 anhydrous and vacuum dried. The sample was redissolved with 2 ml of
5% MeOH water solutionand purified by SPE cartridge with 50 mg PVPP . The unretained sample was filtered
through 0.22 μm membrane and injected.
2.3 Chromatographic apparatus (UPLC)
The UPLC separation was performed with a Waters Acquity h-class chromatographer (Milford, MA) equipped with
a diode array detector (Waters 2996 Milford, MA). Raw data were acquired and reprocessed by an Empower 2
software system.
- 221 -
UPLC of sotolon in hydroalcoholic solution (A), white wine+25 μg/l (B) and white wine
(C)
30
Chromatography conditions:
0,02
Column:
Eluent:
UV:
temp. column (°C):
temp sample (C°):
flow:
V. inj:
RP18 150*3 nm 3 μm;
A (H2O); B (MeOH);
235 nm;
30°C;
15°C;
0,6 ml/min.
20 μl
Stolon
20
A
% eluente B
Assorbance (AU)
0,03
10
0,01
Gradient (% B)
B
C
0
0,00
1,8
std 1 mg/l
wine tq
2
2,2
wine + 25 μg/l
Gradient (%B)
2,4
2,6
2,8
3
Time (min.)
Sotolon is separated as interferencefree peak eluting at 2.6 min with a 5%
MeOH and it was detected and
quantified by the peak are obtained at
λmax 235 nm.
The limit of detection in white wine is
1.3 μg/l and the limit o quantification
is 4.2 μg/l. The calibration curve was
obtained with white wine samples
spiked with increasing amounts of
sotolon (0 --10 μg/l) . Triplicate
determinations were performed for
each sample. A linear calibration curve
(y = 792 x + 237) with an high R2
(0.9976) was obtained
Table 1 Repeatability parameters for sotolon determination in white wines (n=3).
μg/l
0,0
2,6
6,6
13,2
T.R.
(min)
2,60
2,60
2,60
2,60
media
(μV*sec)
0
2565
5568
10605
Rf
SD
972
844
803
14
100
123
In conclusion, the analytical method described allows the assessment of sotolon levels lower than the perception
threshold in wine. It will be applied to the evaluation of sotolon formation in model solutions. The effect of
glutathione, phenols, aminoacids and sugars will be evaluated in order to assess winemaking and storage conditions
suitable to prevent the oxidative off-flavour in white wine.
4. References
Cutzach I, Chatonnet P, Dubourdieu D (1999) Study of the formation mechanisms of some volatile compounds during the aging
of sweet fortified wines. J Agric Food Chem 47: 2837-2846.
Ferreira V, Ortega L, Escudero A, Cacho JFA (2000) Comparative study of the ability of different solvents and adsorbents to
extract aroma compounds from alcoholic beverages. J Chromatogr Sci 38: 469-476.
Guerra PV, Yaylayan VA (2011) Thermal generation of 3-amino-4,5-dimethylfuran-2(5H)-one, the postulated precursor of
sotolone, from amino acid model systems containing glyoxylic and pyruvic acids. J Agric Food Chem 59: 4699-4704.
Guichard E, Pham TT, Etievant P (1993) Quantitative determination of Sotolon in wines by high-performance liquid
chromatography. Chromatographia 37: 539-542.
Konig T, Gutsche B, Hartl M, Hubscher R, Schreier P, Schwab W (1999) 3-Hydroxy-4,5-dimethyl-2(5H)-furanone (Sotolon)
causing an off-flavor: elucidation of its formation pathways during storage of citrus soft drinks. J Agric Food Chem 47:
3288-3291.
Lavigne V, Pons A, Darriet P, Dubourdieu D (2008) Changes in the sotolon content of dry white wines during barrel and bottle
aging. J Agric Food Chem 56: 2688-2693.
Pons A, Lavigne V, Landais Y, Darriet P, Dubourdieu D (2008) Distribution and organoleptic impact of Sotolon enantiomers in
dry white wines. J Agric Food Chem 56: 1606-1610.
- 222 -
Management of Microbial Resources for the Production
of Typical Apulian Wines
Carmela Garofalo (c.garofalo@unifg.it)
Dept. of Agriculture, Food and Environment, University of Foggia, Italy
Tutor: Prof. Giuseppe Spano
The research topic of this thesis concerns the study of the management of microbial resources for the production of
typical wines of Apulia. The research activities I have performed are: microvinifications assays in order to test the
effects of different inoculation regime of MLF with alcoholic fermentation (sequential inoculation and coinoculation) and the isolation and characterization of autochthonous strains of yeasts and bacteria of oenological
interest from spontaneous fermentation of wine grape varieties of Apulia.
Management delle risorse microbiche per la produzione di vini tipici Pugliesi
L’argomento di ricerca di questa tesi di dottorato riguarda lo studio del management delle risorse microbiche per la
produzione di vini tipici pugliesi. Di seguito sono descritte le attività svolte durante il primo anno di dottorato.
Inizialmente sono stati allestiti delle prove di vinificazione in piccola e media scala, successivamente si è passati ad
isolare e caratterizzare ceppi autoctoni di lieviti e batteri di interesse enologico da fermentazioni spontanee di
vitigni autoctoni della regione Puglia.
Key words: Management, microbial resources, autochthonous, winemaking, spontaneous fermentation.
1. Introduction
Wine has been produced for millennia by natural fermentation of grape juice performed by indigenous yeasts
without inoculation to start the process. Spontaneous alcoholic fermentation (AF) of grape must is a complex
process characterized by the presence of different yeast genera and species contributing to the flavour of wine.
During the early phase of AF, yeast species with low fermentation activity, such as apiculate yeast (Hanseniaspora,
Torulaspora, Candida, Kloeckera, Pichia, Issatchenkia and Kluyveromyces).At mid fermentation, strains of
Saccharomyces cerevisiae, more tolerant to ethanol, become dominant and complete the process. At the end of AF
lactic acid bacteria (LAB) performed a secondary fermentation called malolactic fermentation (MLF). The
introduction of O. oeni starter cultures for direct inoculation in wine has greatly simplified the management of this
fermentation. Various studies have been carried out to determine the best time for bacterial inoculation and suggest
different types of inoculation: simultaneous or sequential inoculation.
In the recent years, there has been a growing demand for new and improved wine-yeast strains that are adapted to
different types of wines. To improve the chemical composition and sensory properties of wine, the inclusion of
non-Saccharomyces wine yeasts, together with Saccharomyces strains as part of multi-starter fermentations has
been proposed as a tool to take advantage of spontaneous fermentation. The aim of this work is to highlight the
features of uniqueness of typical Apulian wines by an improved use of local resource yeasts and bacteria.
Different microvinifications were conducted with must obtained from ‘Uva di Troia’ grapes. For each test the yeast
strain used was Saccharomyces cerevisiae EP2 Maurivin, while LAB were the oenological strains VP41 Lallemand
and O. oeni ATCC 23279. To induce simultaneous AF/MLF, bacteria were co-inoculated with yeast, to sequential
AF/MLF bacteria were inoculated at the end of AF. In order to isolate autochthonous strains, samples of grape
must/wine were taken during the spontaneous fermentation of different Apulian grape varieties . Samples were
taken at the beginning and at the end of the AF and plated on Lysine medium and WL nutrient agar, supplemented
with 10 mg L-1 chloramphenicol to inhibit bacterial growth. After incubation at 25°C for 3 days, 20 colonies from
every fermentation stage were selected, inoculated and stored at –80°C in YPD supplemented with glycerol. Yeast
isolates were identified by PCR amplification of the region spanning ITS1-ITS2 and the 5.8S rRNA gene and
subsequent restriction analysis according to the work by Esteve-Zarzoso et al. (1999).
3.1 Microvinification: simultaneous and sequential inoculation
At the end of the fermentations we observed a slight increase of pH in all tests. As shown by the data reported in
Table 1, pH arose from 3.8 in the must at pH values greater than 4 in all the tests carried out. The AF led to an
average concentration of ethanol of about 10-12% v/v.
The simultaneous inoculation of the two strains used in the tests gave different results, both for the degradation rate
- 223 -
of malic acid and lactic acid production. The strain VP41, in co-inoculation, led to the MLF conclusion in 15 days,
while the strain ATCC took more than 40 days to complete the fermentation.
Table 1 Oenological parameters of must/wine at the beginning and at the end of AF and MLF; C VP41 simultaneous
inoculation VP41, S VP41 Sequential inoculation VP41, C ATCC simultaneous inoculation ATCC, S ATCC Sequential
inoculation ATCC.
Must
Wine
sample
C VP41
S VP41
C ATCC
S ATCC
pH
3,80
4.15
4.06
4.17
4.15
EtOH
Malic acid (g/L)
Lactic acid (g/L)
Ac. Vol.
0.04
4.00
0
0.05
11.26
0.36
2.32
0.87
12.36
0.4
1.86
0.44
10.07
0.31
1.81
0.44
10.75
0.32
1.71
0.44
Figure 1 Monitoring malolactic fermentation by simultaneous inoculation VP41-EP2(figure 1a), ATCC-EP2 (figure 1b) and by
sequential inoculation VP41-EP2 (figure1c), ATCC-EP2 (figure 1d). Continuous line Lactic acid, dashed line Malic acid.
The strain ATCC when simultaneous inoculated resulted to be negatively affected, especially in the early stages, in
presence of yeast strain. In fact MLF started after about 20 days from the end of AF. The strain VP41 instead
showed a rapid decrease of malic acid in simultaneous inoculation, reaching values of 0.36 g/L of malic acid and
2.32 g/L of lactic acid after 15 days. Both strains when used in sequential inoculation need more than 40 days to
complete MLF, reaching values of 0.4 and 0,32 g/L of malic acid, 1.86 and 1.71 g/L of lactic acid, respectively for
strain VP41 and ATCC.
3.2 Isolation and identification of Saccharomyces and non-Saccharomyces
The ITS region of 180 different wine yeast isolate was successfully amplified with ITS1–ITS4 primers. When
opportunely digested, the PCR amplification products showed differences in size depending on the yeast species. At
least one species specific restriction pattern was obtained for each species. The data obtained were generally in
agreement with rITS amplicon and fragment sizes calculated from the ITS region sequences available on GenBank
and confirmed results previously reported in literature.
Table 2 Yeast strains isolated from wine
Specie
Saccharomyces cerevisiae
Candida diversa
Candida apicola
Candida sake
Kluyveromyces thermotolerans
Issatchenkia terricola
Pichia membranifaciensis
Dekkera anomala
Origin
Nero di Troia, San Giovese, Montepulciano, Malbec
San Giovese , Malbec
N° isolated
130
11
18
5
1
14
1
3
4. References
Esteve-Zarzoso B, Belloch C, Uruburu F, Querol A (1999) Identification of yeast by RFLP analysis of the 5.8S rRNA gene and
two ribosomal internal transcribed spacers. Int J Syst Bacteriol 49: 329-337.
Jussier D, Marneau AD, Mira de Ordữna R (2006) Effect of simultaneous inoculation with yeast and bacteria on fermentation
kinetics and key wine parameters of cool-climate chardonnay. Appl Enviromen Microbiol 72: 221-227.
- 224 -
Physico-chemical and Microstructural Properties of Food Dispersions
Virginia Glicerina (virginia.glicerina2@unibo.it)
Tutor: Dr. Santina Romani; Co-tutor: Dr. Federica Balestra
The principal aim of this PhD research project is the study of rheological and physico-chemical properties of
food dispersions. The research will be carried out at microstructural level using also advanced methodologies.
In particular, the influence of process parameters and different composition on the structural characteristics (in
terms of micro-and macro-structure) of food dispersions were studied.
Studio delle caratteristiche chimico-fisiche e strutturali di dispersioni alimentari
Il presente progetto di ricerca riguarderà lo studio, a livello microstrutturale, delle proprietà reologiche e chimicofisiche di dispersioni alimentari, attraverso approfondimenti metodologici. In particolare è stata studiata l’influenza
di parametri di processo e compositivi sulle caratteristiche strutturali (a livello di micro e macrostruttura) delle
dispersioni alimentari.
Key words: Dark chocolate, production process, microstructure, rheology, texture.
1. Introduction
In accordance with the PhD thesis project previously described (Glicerina, 2011), this poster reports the main
results of the two activities concerning:
A3) Study of relations among microstructure, physico-chemical and reological properties of the chosen food
materials.
A4) Influence and effects of process parameters and composition on the microstructural and rheological
characteristics of food dispersions.
Dark chocolate samples were obtained from an Italian confectionery factory. The formulation of dark chocolate
samples was: sugar (39.52%), cocoa liquor (53%), cocoa butter (7% further added during the conching step), soy
lecithin (0.3%), sodium carbonate (0.15%) and vanilla flavour (0.03%). The samples were produced using an
industrial plant (Buhler, Malmo, Sweden) equipped with mixer, pre-refiner, refiner, conche and tempering machine.
Experimental samples were obtained taking them after the steps of mixing (A), pre-refining (B), refining (C),
conching (D) and tempering (E). To perform each analysis was necessary to melt samples in a microwave at 150
watt for 25 minutes. Microstructures were observed using an environmental scanning electron microscope (Evo 50
EP, Zeiss, Germany). The detector used was a backscatter electron detector (QBSE) at 20 kV and in low vacuum
mode (Dahlenborg et al., 2011). The images were elaborated using the software Image Pro-plus 6.0 (Media
Cybernetics Inc Bethesda, USA). Rheological measurements were carried out at 40 °C using a controlled-stress
rheometer (MCR 300, Physica/ Anton Paar, Ostfildern, Germany) by using a bob and cup geometry. Viscosity was
measured in steady state conditions, increasing shear rate from 2 to 50 s-1 in order to evaluate yield stress and
apparent viscosity (ICA, 2000). Frequency sweep tests (in order to evaluate G’ and G” modulus) were carried out in
dynamic conditions in the viscoelastic linear region at the constant deformation amplitudes of 0.007% previously
evaluated with the stress sweep test, in the range from 628 to 0.06 rad/s. Empirical properties were evaluated with
a TA.HDi 500 Texture Analyzer (Stable Micro System Vienna Court, England) by applying a back extrusion test.
3.1 Microstructural properties of dark chocolate
Micrographs obtained from the microstructural analysis of samples are reported in figure 1 (a,b,c,d,e).
Results showed a clear reduction of samples particle size that decreased from 140 μm of the mixing step to 100 μm
of the pre-refining one (B) up to 30 μm of the refining phase (C). The decrease of the particle diameter caused an
increase of the particles number, and of points of contact between particle-particle and of chemical and mechanical
interactions between them, according to Afoakwa et al. 2009. The increase of particle interaction and its specific
surface area, from A to C sample (Fig.1 a,b,c) causes a reduction of the particles mobility due to their high
aggregation. The result is a fully packed suspension in which the smallest particles filled spaces between the largest
ones. Samples D and E, even if made of particles with the smallest size diameter, were constituted by a less dense
sugar crystalline network, and more void spaces between them. This could be related to both the further addition of
cocoa butter and lecithin during the conching step, that, in agreement with Afoakwa et al. (2009), wets the
- 225 -
suspension filling the gaps within the crystal network and opens the structure. Lecithin in particular migrates to
sugar⁄ fat interfaces and coats sugar crystals, reducing particle-particle interactions and dispersed crystals in the fat
phase (Dhonsi & Stapley, 2006).
Fig. 1a SEM
micrograph of
sample (A)
Fig. 1b SEM
micrograph of
sample (B)
Fig. 1c SEM
micrograph of
sample (C)
Fig. 1d SEM
micrograph of
sample (D)
Fig. 1e SEM
micrograph of
sample (E)
3.2 Rheological and empirical properties
The results of rheological and empirical measurements are reported in table 1. Results showed a drastic and
significantly increase (P<0.005) of yield stress, apparent viscosity, G’ and G” parameters, from sample A to sample
C. The highest values of these rheological parameters, as for the sample C (made up from the smallest particles),
could be attributed to the increase of the contact point between particles, that forms very aggregated structures, and,
according to Afoakwa et al. (2009), need of a major amount of stress to break them and initiate to flow. Samples D
and E, obtained from the conching and tempering steps respectively, were characterized by the lowest significantly
values of all rheological parameters. This could be related to the change in the structure aggregation, as showed by
the results of microstructural analysis. In these two last steps (conching and tempering), the addition of lecithin and
further cocoa butter, because of the lubricating action, reduced the particle–particle interactions, increased their
mobility that involved a reduction of viscosity and structure aggregation, that becomes more weak and sensitive to
the breakage (Vernier, 1998). Empirical properties (firmness, consistency, cohesiveness and viscosity index) of
experimental samples, strictly related with sensory properties, exhibited the same trends of the fundamental ones, as
evidenced by results in table 1. C and B dark chocolate samples showed the significantly highest values for all the
textural considered parameters, compared to the others. These results, in agreement with those obtained from
microstructural and rheological analysis, support the presence of an extremely hard and packed structure, which
causes a strong resistance to its compression (during the back extrusion test) and to the breakage during
consumption. Sample A is characterized by intermediate values of consistency and viscosity index, between those
of C-B and D-E group samples. D and E experimental samples were similar for all considered rheological
characteristics, and were characterized by the lowest values of all textural parameters, highlighting the presence of a
weak and less network structure, that involved a low resistance to its breakage, representing a positive sensory
attribute for the consumer.
Table 1 Rheological and empirical characteristics of dark chocolate samples A, B, C, D and E (a-d = P<0,05).
Campioni
Yield
stress
(Pa)
Viscosity
(Pa*s)
Firmness
(N)
Consistency
(N* s)
Cohesiveness
(N)
Viscosity
Index
(N* s)
G’
G”
A
84.50 b
586.67 b
54.90 b
498.26 b
- 36.47 b
- 414.40 b
16346 b
2046 b
B
182.33 c
1406.7
c
146.57 c
739.80 c
- 84.83 c
- 718.90 c
18593 c
3161 c
C
358.67 d
1880
d
378.82 d
1624.4
d
- 199.90 d
-1106.0 d
167086 d
21473 d
D
38.767 a
161.67
a
29.30 a
147.76 a
- 22.33 a
- 147.0 a
5966 a
1406
a
E
33.067 a
147.33
a
20.10 a
110.14 a
- 16.07 a
- 105.7 a
4133 a
1396
a
4. References
Afoakwa E, Paterson A, Fowler M, Vieira J (2009) Microstructure and mechanical properties related to particle size distribution
and composition in dark chocolate. Int J Food Sci Tech 44: 111-119.
Dahlenborg H, Millqvist-Fureby A, Bergenstahl B, Kalnin DJE (2011) Investigation of Chocolate Surfaces Using a Low
Vacuum Scanning Electron Microscopy. J Am Oil Chem Soc 88: 773-783.
Dhonsi D, Stapley AGF (2006) The effect of shear rate, temperature, sugar and emulsifier on the tempering of cocoa butter. J
Food Eng 77: 936-942.
Glicerina V (2011) Physico-chemical and microstructural properties of food dispersion. In Proc.s of the 16 th Workshop on the
Developments in the Italian PhD research on Food Science Technology and Biotechnology. Lodi (Italy). 21-23 September.
2011, pp. 329-330.
ICA (2000) Viscosity of cocoa and chocolate products (Analytical Method 46). Bruxelles (Belgium): CAOBISCO.
Vernier F (1998) Influence of emulsifier on the rheology of chocolate and suspension of cocoa and sugar particles in oil.
Doctoral Thesis- Department of Chemistry. University of Reading-United Kingdom.
- 226 -
Lactic Acid Fermentation: Innovative Approach using NIR Spectroscopy
Silvia Grassi (silvia.grassi@unimi.it)
Dept. of Food, Environmental and Nutritional Sciences, University of Milan, Italy
Tutor: Prof. Ernestina Casiraghi; Co-Tutor: Prof. Roberto Foschino
The activity of the second year of the PhD project is described herein. The experiment aims to develop a control
system for monitoring lactic acid fermentation using NIR techniques. Nine different trials were set varying the
incubation temperatures (37°C, 41°C and 45°C) and the bacterial inoculum (Streptococcus thermophilus and
Lactobacillus delbrueckii subsp. bulgaricus, as single strains or in association). Fermentations were monitored for
7.5 h through the acquisition of NIR spectra (12,500-4,000 cm-1). Principal Component Analysis (PCA) was
performed on spectral data. The PC1 scores were modelled as a function of time to reveal the kinetic and the key
points of the process.
Fermentazioni lattiche: un approccio innovativo attraverso la spettroscopia NIR
L’attività del secondo anno del progetto di tesi di dottorato è di seguito descritta. Sono stati messi a punto nove
diversi esperimenti per monitorare l’andamento di fermentazioni lattiche attraverso l’utilizzo della spettroscopia
NIR. Sono state allestite prove a 37°C, 41°C e 45°C, condotte con Streptoccus thermophilus e Lactobacillus
delbrueckii subsp. bulgaricus sia in associazione (1:1) che singolarmente. Le fermentazioni sono state monitorate in
continuo per 7.5 h mediante acquisizione di spettri NIR (12,500-4,000 cm-1). Gli spettri sono stati elaborati
mediante PCA. Successivamente, i valori della PC1 sono stati modellati in funzione del tempo per descrivere la
cinetica e i punti chiave del processo.
Key words: Lactic acid fermentation, FT-NIR spectroscopy, process modelling.
1. Introduction
In accordance with the PhD thesis project previously described (Grassi, 2011), this poster reports the main results
of the activity concerning the study of lactic acid fermentation by NIR spectroscopy, and including:
(A2) Selection of S. thermophilus and L. bulgaricus strains, on-line monitoring of fermentation for 7.5 hours using
a FT-NIR, equipped with an optic probe, application of PCA to spectral data and kinetic modelling.
Skim milk powder (Merck, Darmstadt, Germany) was reconstituted to 10% (w/v), heat treated and inoculated with
approximately 106 cfu/mL of single cultures strain or a mixed culture strains of S. thermophilus and L. bulgaricus
(1:1), previously isolated from the commercial culture YO-MIX™ 305 (Danisco A/S, Copenhagen, Denmark). NIR
spectra during milk fermentations carried out at different temperatures (37°C, 41°C and 45°C) were collected in
continuous, in transflectance mode, with a FT-NIR spectrometer (MPA, Bruker Optics, Milano, Italy) equipped
with an optic probe. The data were collected in the range 12,500–3,600 cm−1. Two replicates were performed for
each condition. Instrument control were performed using OPUS software (v. 6.0 Bruker Optics, Milano, Italy).
PCA was applied to the transformed (Savitzky–Golay, 11 points, first derivative, polynomial order 2) and meancentered spectral data. The PC1 scores were modelled as a function of time, using a sigmoidal function
implemented in Table Curve software (v.4.0, Jandel Scientific, San Rafael, CA, USA). To identify the main
changes during fermentation, first and second derivatives of the models were calculated.
3. Results
3.1 NIR spectroscopy
NIR spectra are characterised by two dominant peaks at 6,900 (combination band involving the symmetric and
asymmetric stretching modes of water molecule) and 5,183 cm-1(Figure 1a). The second one was excluded cause it
reached a saturation level. Although it can be seen that absorption is clearly increasing with fermentation time, it is
difficult to isolate structural information due to the complexity of milk spectra, which is the sum of each milk
component and their interaction. However, after first derivative transformation (Figure 1b), the peculiar absorption
features are more clearly separated, denoting changes occurring during fermentation. These changes are related to
the second overtone vibration of C-H stretching (8,850 and 8,600 cm-1) (Sivakesava et al., 2001) and to the C–H
stretching and combination band of C-H and O-H (5,850 and 5,700 cm-1) associated as ROHCH3 (Workman and
Mayer, 2007).
- 227 -
Figure 1 NIR spectra of the trial conducted at 41°C with the mixed culture: raw NIR spectra (a), first derivative of NIR spectra
(b).
PCA was performed and the scores calculated on PC1 were plotted as function of time. Examining an example of
PC1 scores obtained for the trial at 41°C with the mixed culture (Figure 2a) a sigmoidal distribution according to
the fermentation times was obtained. The loading plot associated permits to define the main wavenumbers (7,166,
6,900 and 6,700 cm-1) responsible of the distribution of the samples (Figure 2b), which could be associated with the
C–H bonds and O-H bond (Workman and Mayer, 2007).
Figure 2 Principal Component Analysis of the trial conducted at 41°C with the mixed culture: PC1 scores vs. time (min) (a)
and Loading plot (b) of PC1.
3.2 Kinetic modelling
To better describe the spectral changes occurred during fermentation at each condition, a sigmoidal function was
fitted to PC1scores vs. time. This function, usually used to describe biological and enzymatic reactions, showed a
good interpolation ( r > 0.993). First and second derivatives of the models gave the time related to the maximum
acceleration, rate and deceleration of the phenomena (Table 1).
Table 1
Time (min) corresponding to maximum acceleration (max d2x/dt2), maximum rate (max dx/dt) and maximum
deceleration (min d2x/dt2) of the lactic fermentation process by kinetic approach.
Trial
S. thermophilus
T °C
L. bulgaricus
S.thermophilus + L. bulgaricus
37°C
41°C
45°C
37°C
41°C
45°C
37°C
41°C
45°C
2
Max d x/dt
306
283
233
184
135
108
184
130
103
Max d1x/dt1
337
306
265
202
148
117
198
144
112
364
328
297
225
157
126
207
153
121
2
2
2
Min d x/dt
The time of maximum deceleration of each process, corresponding to the minimum value of the second derivative,
could be associated with the formation of the curd and gives information about the end of the fermentation. In order
to draw more interesting information from the results obtained with FT-NIR spectroscopy, in future prospective,
they will be compared with other microbiological and chemical data recorded during the trials (e.g. pH, titratable
acidity, rheological analysis, etc.).
4. References
Grassi S (2011) Microbial food fermentations: innovative approach using NIR and MIR spectroscopy. In Proc.s of 16th
Workshop on the Developments in the Italian PhD Research on Food Science Technology and Biotechnology, Lodi (Italy),
21-23 September, 2011.
Sivakesava S, Irudayaraj J, Ali D (2001) Simultaneous determination of multiple components in lactic acid fermentation using
FT-MIR, NIR, and FT-Raman spectroscopic techniques. Process Biochemistry 37: 371–378.
Workman J, Weyer L (2007) Practical Guide to Interpretive Near-Infrared Spectroscopy, Edited by: Workman, J. and Weyer, L.
107–111. Boca Raton, FL: CRC Press.
- 228 -
Beneficial Effects of Yeasts in Increasing the Nutritional Value
of Traditional African Fermented Food
Anna Greppi (anna.greppi@unito.it)
Dept. DiVaPRA, University of Turin, Faculty of Agriculture, Italy
Tutor: Prof. Luca Cocolin, Prof. Lene Jespersen
The present project focuses on the functional characterization of the yeasts involved in the fermentation of several
traditional products consumed in Benin (West Africa). The main objective is to improve the nutritional value of
those products through the selection of some potential strains to be used as starter cultures. First, the yeast strains
were isolated, identified and molecularly characterized. Second, they were screened for their ability to produce
phosphatases. A complete overview of the yeast ecology of the products, in terms of microbial diversity and activity
were the main results achieved. Moreover, some phosphatase producing strains were identified.
Ruolo dei lieviti nell'incremento nutrizionale di alimenti tradizionali africani
Il presente lavoro si concentra sulla caratterizzazione funzionale di lieviti coinvolti nella fermentazione di diversi
prodotti consumati in Benin (Africa occidentale). L'obiettivo principale è quello di migliorare il valore nutrizionale
di questi prodotti attraverso la selezione di alcuni potenziali ceppi da usare come colture starter. I ceppi di lievito
sono stati isolati, identificati e caratterizzati con metodiche molecolari per poi essere testati per la produzione di
fosfatasi. I principali risultati ottenuti rigurdano una panoramica dell'ecologia dei lieviti coinvolti in queste
fermentazioni e della loro attività. Son stati inoltre identificati alcuni ceppi positivi nella produzione di fosfatasi.
Key words: Yeasts, fermented foods, direct and indirect analysis, DGGE, rep-PCR, phosphatases.
1. Introduction
This poster reports the main results obtained during the first two years of the PhD program:
(A1) yeast diversity in the final products: Ogi, Mawè, Gowè and Thoukoutou are cereal-based traditional
fermented foods from Benin. All the yeasts isolated at the end of their fermentation were identified. The
predominant species identified were also characterized. Total DNA extracted directly from samples was
analyzed in order to get a complete overview of the ecology of the products (included both culturable and
not culturable microbiota).
(A2) yeast dynamics during the fermentation process: the yeast population involved in the whole fermentation
process of Mawè and Thoukoutou were identified both by culture dependent and independent method (at
DNA and RNA level). The predominant yeast species identified were also characterized.
(A3) phosphatase activity of the isolates: all the yeast isolates were screened for phosphatase secretion on a
solid plate assay.
2.1 Identification of yeasts isolates: enumeration, isolation and purification of the colonies were performed on
MYGP agar added of 50 mg chloramphenicol and 25 mg of chlortetracycline. The plates were incubated at 25°C
for 3 to 5 days. Yeast DNA from pure cultures was extracted from 1 ml of an overnight culture according to
Rantsiou et al. (2008). The D1 region of the 26S rRNA gene was amplified using the primers NL1GC (5'‐ GCA
TAT CAA TAA GCG GAG GAA AAG -3') (a GC clamp was added) and LS2 (5'-ATT CCC AAA CAA CTC
GAC TC– 3') (Cocolin et al., 2000). The PCR products were analysed by DGGE. They were electrophoresed in a
0.8 mm polyacrilamide gel (8% [w/v]) acrilamide-bisacrilamide (37.5:1), as described by Cocolin et al. (2001),
using a denaturing gradient from 30% to 60%. Gels were subjected to a voltage of 130 V for 4 h at 60°C, stained in
1x TAE containing 1x SYBR Green I (Sigma) and then analysed under UV. DGGE profiles of isolates were
grouped and representatives of each group were amplified with primers NL1/NL4 (Kurtzman and Robnett 1997) to
amplify partial 26S rRNA gene. The PCR products were sent to MWG Biotech (Edersberg, Germany) for
sequencing and the resultant sequences were aligned with those in Gene Bank using the Blast program (Altschul et
al., 1997), to determine the known relatives. The predominant yeast species identified were characterized by repPCR using the primer GTG5.
2.2 Direct identification from food samples: both RNA and DNA were extracted directly from food matrix using
a MasterPureTM Complete DNA and RNA Purification kit (EPICENTRE) following the manual's instructions. The
reverse transcription (RT) reactions were carried out at 42°C for 1 h. One microlitre of the DNA extract and of the
RT reaction was used for the PCR assays (as described above). The PCR products were analysed by DGGE (3060% denaturant gradient). Selected DGGE bands were extracted from the gels using sterile pipette tips, One μl of
- 229 -
the eluted DNA was re-amplified and checked by DGGE. PCR products that gave a single band comigrating with
the DNA/RNA control were amplified with primers without GC clamp and sent for sequencing. Results were
aligned in GenBank.
2.3 Screening for phosphatase secretion: the phosphatase screening was performed on YNBYE plates (6.5 g/L
Yeast Nitrogen Base w/o phosphate, 20 g/L glucose, 20 g/L yeast extract and 2% agar) supplemented with 40 mg/L
5-Bromo-4-chloro-indolyl phosphate (BCIP). The strains were grown for 3 days before evaluation of the
Phosphatase activity identified by the blue color formed. Yeast strain S. cerevisiae BY80 (Euroscarf Acc. No.
Y01692) was used as a positive control as it is a constitutive high phytase producing strain.
3.1 Yeast diversity in the end products. Samples of Ogi, Mawè,
Gowè and Thochkoutou were collected in triplicates. 20 colonies
were isolated every time, resulting in a total of 240 isolates. The
yeast population in the final products varied from 3.75 log CFU/g
for Ogi, to 5.60 log CFU/g for Tchoukoutou. Issatchenkia
orientalis was the yeast most frequently isolated in all the products
analysed. Candida tropicalis and Kluyveromyces marxianus were
also largely present in Gowè samples. Isolates of Clavispora
lusitaniae, Saccharomyces cerevisiae and Candida rugosa were
also detected at lower incidence. The DGGE analysis on the DNA
extracted directly from the food matrix (Fig. 1) underlined the
presence of Dekkera bruxellensis and Debaryomyces hansenii, not
detected by the culture-based approaches.
When I. orientalis, as the main species
isolated at the end of the fermentation in the
final product, was subjected to rep-PCR, the
cluster analysis underlined a very low
biodiversity of the isolates (data not
shown). The results underlined how few
species largely dominate the last stages of
these fermentations.
Figure 1 DGGE profiles of the yeasts present
in final products. M marker, K Kloekera, C
Candida. Lines 1-2-3, Ogi samples;lines 4-56, Mawè samples; lines 7-8-9,Gowè
samples;lines 10-11-12, Thoukoutou samples.
3.2 Yeast dynamics during the fermentation processes. The fermentation dynamics of Mawè and Thouchkoutou
were studied in two different local processors. Samples were collected at several fermentation times and from each
sampling point 10 isolates were collected for a total of 180 isolates. Candida glabrata and I. orientalis were the
yeast species mostly involved in the Mawè production. Rhodotorula mucilaginosa, Pichia farionsa,
Wickerhamomyces anomalus, C. tropicalis, K. marxianus, C. lusitaniae and S. cerevisiae were also present during
the fermentation process. The yeasts that dominated the fermentation of Thoukoutou were found to consist of S.
cerevisiae, almost exclusively. Isolates identified as C. glabrata, C. lusitaniae, Hanseniaspora guilliermondi,
Debaryomyces nepalensis and I. orientalis were also detected just in the early stages of fermentation. The rep-PCR
fingerprinting did not underline differences at strain level. The direct analysis at DNA level largely confirmed the
results obtained by the isolation except for Hanseniaspora uvarum, detected in the first step of Thoutkoutou
fermentation. Results at RNA level almost completely matched with those of DNA.
3.3 Phosphatase activity of the isolates. BCIP itself is colorless but a phophatase reaction yields a product that
forms a dimer with a strong blue color. Among the 420 isolates tested on plates, 31 colonies stained a strong blue
indicating intense phosphatase activity, 224 stained soft blue indicating activity while 165 colonies resulted
negative. Phosphatases degrading BCIP are however not necessarily phytases. The positive isolates for this test will
be screened again with a more specific phytase assay.
4. References
Altschul SF, Madden TL, Shaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids Res 25: 3389-3402
Cocolin L, Bisson LF, Mills DA (2000) Direct profiling of the yeast dynamics in wine fermentations. FEMS Microbiol Lett 189:
81-87.
Cocolin L, Manzano M, Cantoni C, Comi G (2001) Denaturing gradient gel electrophoresis analysis of the 16 S rRNA gene V1
region to monitor dynamic changes in the bacterial population during fermentation of Italian sausages. Appl Environ
Microbiol 67: 5113-5121
Kurtzman CP, Robnett CJ (1997) Identification of clinically important ascomycetous yeasts based on nucleotide divergence in
the 50 end of the large-subunit (26 S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223.
Rantsiou K, Urso R, Dolci P, Comi G, Cocolin L (2008) Microflora of Feta cheese from four Greek manufacturers. Int J Food
Microbiol 126: 36-42.
- 230 -
Evaluation of Transference Capacity of Contaminants
from Cellulosic Packaging and Innovative Approach
to Improve Food Contact Material Safety
Valeria Guazzotti (valeria.guazzotti@unimi.it)
Tutor: Dr. Sara Limbo; Co-tutor: Prof. Luciano Piergiovanni
The aim of this PhD thesis is to study migration from cellulosic packaging to foods, developing bio-based coatings
onto paper with barrier properties against chemical contaminants. Firstly, a gas chromatographic screening on paper
and paperboard packaging intended for food use was performed to identify typical contaminants. Secondly,
coatings of different biopolymers onto paper substrates were developed and characterized. At the same time,
partition and diffusion studies of selected substances were carried out between paper/coated paper and air or food
simulants.
Valutazione del potenziale di trasferimento di contaminanti da imballaggi cellulosici
e soluzioni innovative per garantire la sicurezza dei materiali a contatto con gli alimenti
Obiettivo della presente tesi di dottorato è lo studio del fenomeno di migrazione dagli imballaggi cellulosici agli
alimenti e lo sviluppo di un coating bio-based in grado di offrire una adeguata barriera verso contaminanti chimici.
È stato condotto uno screening analitico su imballaggi di carta e cartone destinati al contatto con alimenti. In
seguito sono stati sviluppati e caratterizzati differenti coatings biopolimerici su substrati cellulosici. Sono stati
inoltre allestiti esperimenti di ripartizione e diffusione di sostanze target tra carta o carta con coating, in aria o
simulanti alimentari.
1. Introduction
In accordance with the PhD thesis project previously described (Guazzotti, 2011), this poster reports some results of
the first three activities concerning:
(A1) Semi-quantitative evaluation of volatile and non volatile organic chemicals in paper packaging intended for
food use by SPME and solvent extraction GC/MS technique;
(A2) Development and characterization of bio-based renewable coatings onto paper substrates;
(A3) Partition and diffusion experiments of selected substances between paper and air or food simulants.
Comparison of paper, bio-coated paper and plastic materials.
2.1 Sampling of packaging - SPME and Solvent Extraction GC/MS analysis
Twenty representative samples, such as primary and secondary packaging or article for take away foods were
obtained from distributors. All of them have different food capacity, surface treatment, grammage and thickness.
SPME was performed with a 50/30 µm DVB/CAR/PDMS fibre immersed in the headspace of manual-HS vials,
heated at 130°C for 30 min. Solvent extraction was achieved with ethanol/hexane solution, by sonication for 30
min. Analysis were carried out using a Perkin Elmer Autosystem XL GC equipped with a Turbomass MS. The
column was DB-5MS (30 m, 0.25 mm i.d., film thickness 0.25 µm). The MS was used in the total ion current (TIC)
mode and identification of compounds was obtained through mass spectrum comparison with the NIST library.
Semi-quantitative determinations were obtained applying the response factors of internal standards.
2.2 Paper coating with biopolymers - Partition and diffusion experiments
Paper substrates for coating were unprinted and of food-grade quality. Pigskin gelatin and wheat gluten coating
dispersions were obtained by adapting published methods (Farris, 2001; Mascheroni, 2010); cationic starch and
cationic waxy starch were dispersed in distilled water, heated and kept at 95°C for 30 min. All dispersions were
poured on paper with an automatic applicator equipped with a steel horizontal rod. Before experiments, bio-coated
paper was stored in a dessicator at 25°C for one week.
Partition experiments were obtained applying an “on glass injection technique” (Franz, 2002) with benzophenone
(BP), diisopropyl naphthalene (DiPN) and diisobutyl phthalate (DiBP) as selected substances. Briefly, strips of each
material were placed into sealable glass vials, followed by the addiction of 1 µL of spiking solutions at different
concentrations in diethyl ether. Diffusion experiments were carried out with glass migration cells in which each test
materials were sandwiched between a spiked donor (filter paper) and a receptor (Tenax® or filter paper). After
conditioning at 40°C, adsorption of BP, DiPN and DiBP into the different materials was determined by ethanol
extraction and GC/MS analysis using selected ion monitoring (SIM) detection.
- 231 -
3.1 Semi-quantitative evaluation of volatile and non volatile organic chemicals in paper packaging
A large number of both volatile and non volatile substances were identified. All the compounds were grouped in
seven chemical families (Fig. 1A, 1B). It is worth emphasizing the presence of residual solvents, probably coming
from printing inks, as well as hydrocarbons and aromatic compounds, mainly plasticizers such as DiBP or DiPNs,
that could be linked to the recycled pulp content.
Figure 1 Solvent extraction (A)
and SPME (B) profiles of
substances identified in the
analyzed samples.
Applying the Risk Assessment approach, a literature search for safety data or legislative restrictions of the
identified substances was performed (hazard identification). Additionally, the semi-quantification of the compounds
in the packaging allowed a worst case estimation of food contamination by means of the infinite total migration
model; occasionally, migration estimations overcame the specific migration limits (Tasca, 2010).
3.2 Partitioning of selected substances between paper or coated paper and air
From the obtained results, considerable differences in partitioning of the selected contaminants between the coated
and no coated paper and air can be highlighted. Both for BP and DiBP, lower values of the maximum saturation
were achieved when paper was coated and related partitioning coefficients decreased significantly compared with
no coated paper, making evident that biopolymer dispersions coated on paper acted as net repulsive layers. In
particular, the strongly adsorption reduction of the polar contaminant (BP) onto bio-coated paper can be explained
with the characteristics of the tested biopolymers: the hydrophobic amino acid side chains exposed at the solid/air
interface of gelatin; the hydrophobic interactions, along with hydrogen bonds and covalent disulfide bonds, that
define the aggregation properties of gluten proteins; the retrogradation phenomenon of starch gel that causes the
recovery of hydrogen bonds between the polysaccharide chains. DiBP adsorption also decreased when biopolymers
are coated on paper; this finding suggests the importance of other factors in partition behaviour that need to be fully
evaluated.
Figure 2 Partition coefficients of benzophenone and
diisobutyl phthalate between paper or bio-coated
paper and air.
4. References
Farris S, Introzzi L, Biagioni P, Holz T, Schiraldi A, Piergiovanni L (2011) Wetting of biopolymer coatings: contact angle
kinetics and image analysis investigation. Langmuir 27: 7563-7574.
Franz R (2002) Programme on the recyclability of food-packaging materials with respect to food safety consideration:
polyethylene terephthalate (PET), paper and board and plastics covered by functional barriers. Food Addit Contam 19: 93110.
Guazzotti V (2011) Evaluation of transference capacity of contaminants from cellulosic packaging and innovative approach to
improve food contact material safety. In Proc.s of the 16th Workshop on the Developments in the Italian PhD Research on
Food Science Technology and Biotechnology, Lodi (Italy), 21-23 September, pp. 333-334.
Mascheroni E, Chalier P, Gontard N, Gastaldi E (2010) Designing of a wheat gluten/montmorillonite based system as carvacrol
carrier: rheological and structural properties. Food Hydrocoll 24: 406-413.
Tasca E, Guazzotti V, Piergiovanni L, Limbo S (2011) Identificazione e valutazione semiquantitativa di composti organici
volatili e non volatili in imballaggi cellulosici primari e secondari destinati al food packaging. Studio preliminare delle
proprietà diffusionali. In Atti del 10° Congresso Italiano di Scienza e Tecnologia degli Alimenti (CISETA), Milan (Italy),
9-10 May.
- 232 -
Improving of Bioactive Compounds in Dairy Commodities Produced
in the Parmigiano-Reggiano Cheese Area
Elena Guerra (elena.guerra5@unibo.it)
Dept. of Food Science, Alma Mater Studiorum - Università di Bologna, Cesena, Italy
Tutor: Prof. Maria Fiorenza Caboni; Co-tutor: Dr. Alessandro Gori
The first aim of this PhD project is to define and investigate the technological proprieties, chemical - physical and
organoleptic characteristics of dairy products collected in the Parmigiano-Reggiano cheese area and obtained from
milk enriched with bioactive compounds. The second project objective is to determine the effects of this enrichment
on by-products of the primary production, such as whey and buttermilk, that may be used to manufacture products
with interesting functional properties for human consumption. Evaluation of quality of milk fat, with particular
attention to trans fatty acids and conjugated fatty acids (CLA), is carried out by chromatographic and spectroscopic
techniques.
Miglioramento del contenuto di componenti bioattivi in commodities lattiero-casearie
della zona di produzione del formaggio Parmigiano-Reggiano
Il presente progetto di ricerca si propone innanzitutto di definire e indagare le proprietà tecnologiche, le
caratteristiche chimico-fisiche e organolettiche dei prodotti lattiero caseari della zona di produzione del formaggio
Parmigiano-Reggiano e ottenuti da latte arricchito in componenti bioattivi. Il secondo obiettivo del progetto è la
determinazione dell’effetto di tale arricchimento sui sottoprodotti (come siero e latticello) che possono essere
utilizzati come coadiuvanti tecnologici e/o alimenti innovativi con interessanti proprietà funzionali per la salute del
consumatore. La valutazione della qualità del latte, con particolare attenzione al contenuto di acidi grassi trans e
isomeri coniugati dell’acido linoleico (CLA), è realizzata mediante tecniche cromatografiche e spettroscopiche.
Key words: Dairy products, bioactive compounds, by-products, milk fat, CLA.
1. Introduction
In accordance with the PhD thesis project, this poster reports the main results concerning the study of the milk
creams enriched with bioactive compounds, obtained by supplementing the diet of dairy cows with extruded
linseed. The fatty acids (FA) and triglyceride (TG) composition was obtained by Capillary Gas-Chromatography
(GC-FID) analysis. The instrumental limits were determined to verify the reproducibility of the analytical method
used.
A total of 34 milk creams, obtained from outcrop cow milk, were kindly donate by Parmigiano-Reggiano Cheese
Consortium (CFPR) personnel. The experimental period lasted 15 weeks from January to May, 2012. Milk cows
were divided in two groups and each group was provided the type of feeding regiments (from January 13 to March
31: “dry feeding period” and from April 15 to May 29: “fresh forage feeding period”) permitted by the CFPR. One
group was fed a traditional diet without linseed (control group) and the other was fed a traditional diet with
extruded linseed (treated group). Fat from milk cream samples was extracted in duplicate according to Hara – Radin
(Hara and Radin, 1978). FA were derivatized to the corresponding methyl esters (FAME) following the method of
Christie (Christie, 1982). FAME were analyzed by GC-FID in duplicate according to Gori (Gori et al., 2011). The
FA composition was expressed as weight percentage of total FAME (g/100g FAME). To verify the performance of
the analytical method was calculated the coefficient of variation (CV%) for all FA quantified. The instrumental
limits were determined using the limit of detection (LOD) and the limit of quantification (LOQ) as the signal to
noise ratio of 3:1 and 10:1, respectively. For analysis of TG, 1.0 µl dilutions of milk creams fat 10 mg/mL in
hexane, were inject into to the GC-FID (GC-2010, Shimadzu; equipped with an automatic split injector AOC-20i
and programme temperature). A capillary column Rtx-65 TG (Restek Chromatography Products, Superchrom
Milano) was used.
Data of FA and TG composition were analyzed with one-way ANOVA model using the STATISTICA 6 software
package (StatSoft Inc., Tulsa, OK, USA). Comparisons among sample means were performed with LSD-test and
considered to be significant whit p < 0.05.
- 233 -
3.1 Fatty Acid composition of milk creams
Forty-one fatty acids were identified and quantified in the 34 milk cream samples analyzed: 15 were saturated
(SFA), 15 mono-unsaturated (MUFA), and 11 polyunsaturated (PUFA). The coefficient of variation for each FA,
calculated over five analytical milk cream replicates, ranged from 0.01 to 2.24. The coefficient of variation of the
internal standard peak migration times was 3 x 10-4 , while the LOD and LOQ were 0.15 and 0.2 mg/100mg of
FAME, respectively. The inclusion of linseed in the dry diet of dairy cows resulted in an increased in milk cream
fat of PUFA, essential fatty acids (omega3 and omega6 fatty acids), trans fatty acids, total CLA and cis-9,trans-11
CLA content (Figure 1). Conversely, milk creams obtained by supplementation the diet with extruded linseed
(treated group) showed the lowest levels of SFA with significant statistical differences (p < 0.05) during the overall
experimental period. Thus, milk creams collected in dry feeding period of treated group had the lowest SFA/UFA
ratio (1.52 g/100g FAME) compared to that control group (1.84 g/100g FAME). This milk FA profile was
maintained during the fresh forage feeding period because diet was rich in biologically active fatty acids, such as αlinolenic acid. Furthermore, the Δ9-desaturase index was significantly higher in treated group for each type of feed
delivered. These results confirmed what was reported in the literature about the effect of plant lipid
supplementation in the diet of dairy cows (Secchiari et al., 2003; Mele et al., 2011). The feeding strategy used in
this study, therefore, could be conveniently adopted when fresh forage is not available for dairy cows, to achieve a
constant level of bioactive compound enrichment in milk fat.
Figure 1 Partial gas chromatograms of milk cream fat
of the CLA region. FAME were analyzed in duplicate
using a Clarus 500 chromatograph from Perkin Elmer
(Shelton, CT, USA) equipped with FID, employing a
BPX70 fused silica capillary column coated whit 70%
cyanopropyl polysilphenylenesiloxane (50 m, 0.22 mm
i.d., and 0.25 µm f.t.) from SGE (VWR International,
Fontenay–sous–Bois, France). The injector and
detector temperatures were set at 240°C. The air and
hydrogen flow rate were of 400 and 40 mL/min,
respectively. Helium was used as a carrier gas at a flow
rate of 0.75 mL/mi. The oven temperatures was
increased from 100 to 115°C at 1.5°C/min, then to
180°C at 5°C/min for 10 min, and finally to 240°C at
3°C/min for 10 min.
3.2 Triglyceride composition of milk creams
The differences observed in the FA composition between control and treated groups were noticed also in TG
composition. The method applied for the analysis is based on the separation of TG according to their total number
of carbon atoms (Povolo et al., 2008). Sixteen peak were distinguished, corresponding to TG with 24-54 carbon
atoms. The TG profile of fat milk creams from treated group showed a higher content of short-chain TG (C26-C34)
and long-chain TG (C46-C54), as a likely consequence of the higher content of short-chain FA and long-chain FA
from C4 to C10 and from C17 to C22, respectively. Most of the increase was observed in the TG with C54 carbon
atoms, accounting for 27%. Detailed studies on the composition of these molecules showed that the most of monoand di-unsaturated C18 FA are esterified in C50-C54 TG in cow milk fat (Mele et al., 2011). Conversely, the
content of TG from C36-C44 was lower in milk creams of treated group. Therefore, TG composition was modified
by the linseed supplementation.
4. References
Christie WW (1982) A simple procedure of rapid transmethylation of glycerolipids and cholesteryl esters. J Lipid Res 23: 10721075.
Gori A, Cevoli C, Melia S, Nocetti M, Fabbri A, Caboni MF, Losi G (2011) Prediction of butter seasonal production by
computing the fatty acids composition with artificial neural networks. Eur J Lipid Sci Technol 113: 1412-1419.
Hara H, Radin NS (1978) Lipid extraction of tissue with a low-toxicity solvent. Anal Biochem 90: 420-426.
Mele M, Contarini G, Cercaci L, Serra A, Buccioni A, Povolo M, Conte G, Funaro A, Banni S, Lercker G, Secchiari P (2011)
Enrichment of Pecorino cheese with conjugated linoleic acid by feeding dairy ewes with estrude linseed: effect on fatty
acid and triglycerides composition and on oxidative stability. Int Dairy J 21: 365-372.
Povolo M, Pelizzola V, Contarini G (2008) Directly resistively heated – column gas chromatography for the evaluation of cow
milk fat purify. Eur J Lipid Sci Technol 110: 1050-1057.
Secchiari P, Antongiovanni M, Mele M, Serra A, Buccioni A, Ferruzzi G, Paolettia F, Petacchi F (2003) Effect of kind of dietary
fat on the quality of milk fat from Italian Friesian cows. Livest Prod Sci 83: 43-52.
- 234 -
The Microbial Growth and Isothermal Calorimetry
Nabil Haman (nabil.haman@unimi.it)
DeFENS - Dept. of Food, Environmental and Nutritional Science, University of Milan, Italy
Tutor: Prof. Dimitrios Fessas
Isothermal Calorimetry (IC) can be used to assess microbial growth and metabolic activity (Barros et al., 2007). In
the present study calorimetric measurements are proven to be suitable to evaluate the toxic effect of arsenic on the
growth of different microbial strains isolated from soil and groundwater. Other parallel measurements focused
mainly on the toxic effect of arsenic were performed with other conventional such as turbidity for the CFU count
and standard chemical analysis to determine the arsenic concentration.
IC was also used to monitor the microbial spoilage of fresh food vegetables products and assess their shelf life
(Riva et al., 2001).
La crescita microbica e la calorimetria isotermica
La calorimetria isotermica è stata utilizzata in questo progetto di tesi di dottorato per valutare i parametri della
crescita microbica e l’attività metabolica. Attraverso le misure calorimetriche effettuate è stato possibile stimare
l’effetto tossico dell’arsenico sulla crescita microbica di particolari ceppi microbici; parallelamente sono state
effettuate delle analisi convenzionali quali la torbidità, la conta UFC (Unità Formanti Colonie) e l’analisi chimica
dell’arsenico residuo nel terreno.
Le stesse tecniche sono state utilizzate anche per un altro punto della ricerca atta a valutare la vita di scaffale (shelf
life) di alcuni prodotti vegetali di quarta gamma (Riva et al., 2001).
Key words: Isothermal calorimetry, soil microbiology, microbial activity, toxic effect of arsenic, shelf life of fresh
food products.
1. Introduction
In accordance with the PhD thesis project previously described (Haman, 2011), the main subjects of our research
are:
A1) kinetics of the microbial metabolism: use of Isothermal Calorimetry and conventional methods.
A2) toxic effects of Arsenic on the microbial growth.
A3) shelf life on fresh food products, using as reference material either sliced carrots or carrot juice.
In the first step, Achromobacter sp. As5-13 cells were grown in tris-mineral medium supplemented with sodium
gluconate (0.6 %, w/v) (TMMG) as carbon source with the addition of yeast extract (0.3%). Measurements where
performed at 30 °C. 5 mL of initial suspensions of about 2·104 cells/mL were loaded in the measurement
calorimetric cell. The Heat Flux v.s. time raw signal was recorded for 120 hours. Three replicas were performed for
each experiment.
In parallel, experiments performed in 50 mL-vials closed with rubber stoppers were set up to determine the
bacterial growth. The vials were incubated in static at 30 °C. Cell density was measured at successive incubation
times by determining the OD 600nm (Beckman DU 640). Calibration curve was performed with the dilution
method. The lower reliable calorimetric detection limit was 105 cells/mL. Arsenic (As(V), As(III)) concentration
was determined colorimetrically by adapting the method of (Dahr et al., 2004).
In the second step, we performed our experiments with Bacillus sp. 3.2 cells were grown in
two different media, TMMG with the addition of yeast extract (0.3%) and Tryptone Soya Broth
(TSB). 5 mL of initial suspensions of about 5·104 cells/mL were loaded in the measurement
calorimetric cell. The heat flux v.s. time raw signal was recorded for 40 hours. Three replicas
were performed for each experiment. In parallel, experiments performed in 7 mL-vials closed
with rubber stoppers were set up to determine the bacterial growth. The instrument used for IC
investigations was the “Calorimètre E. Calvet pour Micro-calormétrie, DAM” (Setaram, Lyon,
France) previously describe (Haman et al., 2011), was used.At the end of each experiment one
calorimetric calibration was performed. The lower reliable calorimetric detection limit was 105
cells/mL.
Figure 1 Isothermal calorimeter.
- 235 -
exo
HF / mW
3.1 The metabolic activity of Achromobacter sp. As5-13
The microorganism is rather resistant to high concentrations of As(III) that nevertheless hinders the microbial
growth to some extent, arsenic is toxic to plants and soil biota (Sadiq et al., 1997).
IC measurements allow monitoring both the growth
0.1
(peaks) and the basal metabolic activity of the strain.
0.0
As(III) negatively affects both the rate and the extent of
the growth (as confirmed by the microbial counts
-0.1
performed at the end of the experiments).
-0.2
The limited aerobic conditions within the calorimetric
cells (chosen to stress the microbes) permit to single out
-0.3
As5-13 (REF)
differences between the traces obtained at different
As5-13 + 0.3 mM As(III)
-0.4
As(III) concentrations. It was measured that most (about
As5-13 + 1.5 mM As(III)
80%) of the starting As(III) was oxidized to As(V)
-0.5
0
20
40
60
80
100
120
during each run (Cavalca et al, 2010).
time / h
Figure 2 ITC: Achromobacter sp. As5-13 growth and metabolism.
3.2 The metabolic activity of Bacillus sp. 3.2
IC measurements allow quantitatively monitoring the growth (peaks) and the basal metabolic activity of the strain
in different growth media. The total heat released because of the growth process was calculated through the
integration of each curve. The results showed a higher growth in TSB (figure 3). The growth of Bacillus sp. 3.2
decreased due to the effect of increasing concentration of As (V). The presence of As(III) is less prominent,
whereas the presence of As(V) consistently slows the growth of Bacillus sp. 3.2 The increase of generation time tG
(The rate of exponential growth of a bacterial culture is expressed as generation time) at high As(V) concentration
is attributed to the increasing toxicity.
As for the TMMG medium, the results showed that the increase of As(V) concentration causes a decrease of the
metabolic response. On the other hand, the presence of As(III) shifts the response peak, suggesting a deceleration of
the growth (figure 4). According to the results, the growth in TSB increases the resistance of the microorganism
towards the toxicity of As(V).
Figure 3 ITC: Bacillus sp.3.2 growth in absence and presence
presence of various concentrations of As(V) and As(III) in TSB.
Figure 4 ITC: Bacillus sp.3.2 growth in absence and
of various concentrations of As(V) and As(III) in TMMG.
4. References
Cavalca L, Zanchi R, Corsini A, Colombo M, Romagnoli C, Canzi E, Andreoni V (2010) Arsenic-resistant bacteria associated
with roots of the wild Cirsium arvense (L.) plant from an arsenic polluted soil, and screening of potential plant growthpromoting characteristics. Syst Appl Microbiol 33: 154-164.
Dhar R K, Zhenga Y, Rubenstonec J, Van Geenc A (2004) Rapid colorimetric method for measuring arsenic concentrations in
groundwater. Anal Chim Acta 526: 203-209.
Haman N (2011) Use of isothermal calorimetry to monitor microbial growth in food systems and soils. In Proc.s of the 16th
Workshop on the Developments in the Italian PhD Research on Food Science, Technology and Biotechnology, Lodi (Italy),
21-23 September, 2011, pp. 335-336.
Haman N, Corsini A, Signorelli M, Andreoni V, Schiraldi A, Fessas D (2011) Isothermal calorimetry investigations of microbial
growth in as contaminated media. In Proc.s of the 10th Mediterranean conference in Calorimetry and thermal analysis,
Porto (Portugal), 24-27 July, 2011, pp. 100.
Riva M, Fessas D, Schiraldi A (2001) Isothermal calorimetry approach to evaluate the shelf-life of foods. Thermochim Acta 370:
73-81.
Sadiq M (1997) Arsenic chemistry in soils: An overview of thermodynamic predictions and field observations. Water Air Soil
Poll 93: 117-136.
- 236 -
Evolution of Southern Red Wine Composition and Kinetics
of Acutissimins and Oaklins Formation During Accelerated Aging
with Oak Chips or Oak Barrels
Laura Le Grottaglie (laura.legrottaglie@unina.it)
Dept. Food Science, University on Naples “Federico II”, Naples, Italy
Tutor: Prof. Raffaele Romano
Accelerated aging of wine with oak chips is one of the most common practices and an economical alternative to the
use of oak barrels. The aim of the study was to evaluate acutissimins formation to discriminate wines aged in oak
barrels and with oak chips. Acutissimins resulting from a nuclephilic substitution between (-)-vescalagin and (+)catechin. The first step of the experiment consisted in the preparation and analysis of solutions by adding 100 and
500 ppm of catechin and 5 and 10% of oak chips in a hydroalcoholic solution that reproduce extraction condition
similar to those in wine.
Evoluzione della composizione del vino rosso meridionale e cinetica di formazione
delle Acutissimine e delle Ocaline durante l'invecchiamento rapido
con trucioli di legno e in barrique
L’invecchiamento con trucioli di legno è una pratica molto utilizzata nonché un’alternativa economica all’utilizzo
delle barriques. Lo scopo del progetto è quello di valutare se le acutissimine consentono di discriminare vini affinati
tradizionalmente da quelli invecchiati “rapidamente”, con trucioli di legno. Le acutissimine derivano dalla
sostituzione nucleofilica tra la vescalagina e la catechina e le ocaline da reazioni dirette tra catechine e la
sinapaldeide. La prima parte della sperimentazione ha previsto la preparazione e l’analisi di soluzioni modello
ottenute aggiungendo 100 e 500 ppm di catechina e 5 e 10% di chips in miscele al 12% di etanolo.
Key words: Wine model solutions, catechin, acutissimins, oaklins.
1. Introduction
In according to the PhD thesis project, this poster reports the main results of the activities concerning:
(A1) literature study and review;
(A2) planning of the experiment, in order to evaluate Acutissimin and Oaklin kinetics of formation in wine model
solutions and in Southern wines refined with traditional and “alternative” aging systems;
(A3) analysis methods by mean of HPLC/DAD, HPLC/MS, GC/MS analytical techniques;
(A4) wine model solutions preparation and analysis.
2.1 Oak chips collection
Oak chips of Quercuspetraea were kindly provided by A&B Group (Brescia, Italy). The oak chips were at medium
intensity toasted level, according to the process used at the cooperage.
2.2 Experimental plan
In order to reproduce extraction condition similar to those in wine, oak wood chips were placed in 1000 mL of wine
model alcohol solution (WMS: pH 3,3, 12% alcohol content, 3,8g/L tartaric acid, 0,6 g/L potassium chloride)
containing 100 ppm of catechin and 5% of oak chips (100/5), 100 ppm of catechin and 10% of oak chips (100/10),
500 ppm of catechin and 5% of oak chips (500/5) and 500 ppm of catechin and 10% of oak (500/10). Maceration
was prolonged for 6 weeks at 20 ± 2°C in the dark.
2.3 Phenols HPLC/DAD Analysis
Detection and quantification of catechin and new-formation molecules were performed by an HPLC/DAD
apparatus (Agilent technologies, Palo Alto, CA) equipped with a C18 Zorbax Eclipse ODS (5μm) column (15 cm x
4 mm i.d.) (Agilent technologies, Palo Alto, CA). 230, 280 and 380 nm wavelengths were chosen. Compounds
were identified by comparing UV spectra recorded with the diode array detector and those reported in literature or
with retention time of pure standards.
2.4 Phenols HPLC/MS Analysis
HPLC-MS analysis were conducted to confirm each peak identity. Presence of vescalagin, castalagin, catechin,
coniferaldehyde, sinapaldehyde, acutissimins and oaklins were validated by mass spectrometry and comparison of
their mass fragmentation patterns with those indicated by Quideau et al. (2003) and Sousa et al. (2005).
Quantitative analysis has been executed using catechin as esternal standard.
- 237 -
2.5 Volatile organic compounds (VOCs) GC/MS analysis.
Ten milliliter of wine model solutions were extracted three times with 2mL of dichloromethane. The mixture was
stirred during 15 min at 700 rpm. The organic phase was separated, dried over sodium sulfate and then concentrated
through a Kuderna-Danish column at 47°C to 200μL. 2 µL of the extract was analyzed by GC/MS. The mass
spectral identifications of the volatiles were carried out comparing to the NIST 98 (National Institute of Standards
and technology, Gaithersburg, MD, USA). Quantitative analysis has been executed using decanol as external
standard.
All determinations and experiments were performed in triplicate, and the results presented are the average values of
3 determinations. The coefficient of determination (R2) of linearity for the data was statistically analyzed using the
Microsoft Excel 2000 program (Microsof

17 th WORKSHOP ON THE DEVELOPMENTS IN THE

Transcription

Similar documents

Bites, Camera, Action Presents: “The Disaronno Series” At Union

OL396 Gunwharf Quay

Board of directors

- CrossWorks

Spring 2014 - University at Buffalo

Loma Linda University School of Nursing

WALKING TOURS OF PHILADELPHIA SOUTH PHILLY

Marcello Malpighi (1628-1694) - Journal of the Association of

March - SCALab

alma spring 2016

Since When Is Fran Drescher Jewish? Dubbing Stereotypes in The