Workshop on Xanthomonas citri/ Citrus canker

Transcription

Workshop on Xanthomonas citri/Citrus canker
17-18th of November, 2011 █ Ribeirão Preto, Brazil
Workshop on Xanthomonas citri/
Citrus canker
November 17-18th, 2011 █ Ribeirão Preto, Brazil
C
itrus canker is one of the most important diseases affecting
citrus production worldwide. The objectives of this
Workshop are:
a) to gather researchers working with Xanthomonas citri/
Citrus canker, to stimulate the discussion of scientific
data, and the establishment of cooperation among these
groups in new research projects,
b)to join scientists and citrus producers in an attempt to
renew priorities of research and culture management
intended to fulfill the present and future demands
relative to citrus canker.
Around 120 participants, from at least seven countries, will
meet in November 2011 at the JP Hotel, Ribeirão Preto, Brazil, for
a two-day workshop in which people will have the opportunity
to share scientific information and their necessities concerning
citrus canker and/or the etiological agent of this disease, the
bacterium Xanthomonas citri subsp. citri. The Workshop is an
international meeting organized by the State University of São
Paulo (UNESP) and Fundecitrus, and it is mainly sponsored
by FAPESP (Fundação de Amparo à Pesquisa do Estado de São
Paulo) and PROPe-UNESP. Leading scientists dedicated to the
study of citrus canker and Xanthomonas citri, together with
citrus growers and orange juice industries will start a new era
of research and development related to citrus canker and to
Xanthomonas pathogenic to citrus.
Henrique Ferreira and José Belasque Jr.,
Organizers
Workshop on Xanthomonas citri/Citrus canker █
Organization
Sponsors
(Process No. 2011/11612-1)
Sponsors
Agenda
5
Wednesday, 16th November 2011
15:00 – 18:00 Registration
Thursday, 17th November 2011
7:30 – 8:00 Registration
Welcome Reception/Workshop Introduction Henrique Ferreira, FCFAR,
8:00 – 8:10
UNESP at Araraquara
Session 1: Citrus canker current status and Economical importance, Moderator Tim R. Gottwald, USDA-ARS
Eradication, litigation, and hurricanes: The quandaries of canker Tim R. Gottwald,
8:10 – 8:55
Talk 1
epidemiology
USDA-ARS
Orange production under an endemic citrus canker situation: Ron P. Muraro,
8:55 – 9:15
Talk 2
Increased costs and potential loss yields and reduced returns
University of Florida, USA
Citrus canker control in São Paulo state, Brazil: A new chapter in a José Belasque Jr.,
9:15 – 9:35
Talk 3
50-year book?
Fundecitrus, Brazil
9:35 – 9:45 Panel members to answer the questions from the audience
Session 2: Epidemiology, Moderator Clive H. Bock, USDA-ARS
Survival of Xanthomonas citri subsp. citri to estimate risk of
9:45 – 10:05 Talk 4
transmission by infected fruit
Risk of symptomatic and asymptomatic fruit as a pathway for citrus
10:05 – 10:25 Talk 5
canker establishment in new areas
10:25 – 10:45 Coffee Break provided by Syngenta
Continue Session 2: Epidemiology, Moderator Clive H. Bock, USDA-ARS
A survey of survival and activity of citrus canker lesion populations
10:45 – 11:05 Talk 6 on foliage, fruit and shoots in a Florida grapefruit orchard in 2009
and 2010
Processes involved in the dispersal of Xanthomonas citri subsp. citri
11:05 – 11:25 Talk 7 from canker-infected citrus canopies, and in the infection of citrus
foliage
Maps of zones of risk epidemics and agriculture climatical zoning of
11:25 – 11:40 Talk 8 the citrus canker in the State of São Paulo
James H. Graham,
Tim R. Gottwald,
USDA-ARS
Clive H. Bock,
USDA-ARS
Clive H. Bock,
USDA-ARS
Mariana Vilela Lopes,
UNESP/Oxiquímica,
Brazil
William M.C. Nunes,
Diagrammatic scale to assess citrus canker severity on mature sweet
11:40 – 11:55 Talk 9
Universidade Estadual de
orange fruit
Maringá, Brazil
12:05 – 13:25 Lunch
Session 3: Citrus canker control, Moderator James H. Graham, University of Florida, USA
Comparison of copper formulations for management of citrus canker James H. Graham,
13:25 – 13:45 Talk 10
on ‘Hamlin’ Orange in Florida
Systemic acquired resistance for bacterial canker disease James H. Graham,
13:45 – 14:05 Talk 11
management in citrus
Copper bactericides for control of citrus canker: Is there room for Franklin Behlau,
14:05 – 14:25 Talk 12
improvement?
Fundecitrus, Brazil
Eliane Cristina de Freitas,
Molecular characterization of the copper resistance operon copAB in
14:25 – 14:40 Talk 13
Instituto de QuímicaXanthomonas citri subsp. citri
-UNESP, Brazil
Agenda
Control of citrus canker mediated by neonicotinoids in combination
with acibenzolar-S-methyl
Efficiency of treatments with benzalkonium chlorides of
14:55 – 15:10 Talk 15
asymptomatic citrus fruit in relation to Xanthomonas citri subsp. citri
15:20 – 15:40 Coffee break provided by Oxiquímica
14:40 – 14:55 Talk 14
6
Thales Pereira Barreto,
IAPAR, Brazil
Mayara M. Murata,
IAPAR, Brazil
Session 4: Citrus canker detection and diagnosis, Moderator Luis G. Marcassa, Instituto de Física de São Carlos – USP,
Brazil
Luis G. Marcassa,
15:40 – 16:10 Talk 16 Fluorescence imaging spectroscopy applied to citrus diseases
Instituto de Física de São
Carlos – USP, Brazil
Reza Ehsani,
16:10 – 16:30 Talk 17 Sensors and sensor platforms for disease detection
Tim R. Gottwald,
16:30 – 16:50 Talk 18 Canine detection of Citrus Canker in the plantation and packinghouse
USDA-ARS
Francisco Assis Filho,
16:50 – 17:05 Talk 19 Citrus canker diagnostic by Xac ImmunoStrip®
Agdia, USA
18:30 – 21:30 Cocktail (previous reservation required)
Friday, 18th November 2011
Session 5: Host resistance, Moderator Jeff B. Jones, University of Florida, USA
8:00 – 8:30
Talk 20 Activation of resistance to Xanthomonas citri by native TAL effectors
8:30 – 8:45
Talk 21 Exploiting basal defense mechanisms against citrus canker
8:45 – 9:05
9:05 – 9:20
9:20 – 9:35
9:35 – 9:50
Citrus cybrid response to biotic stress caused by Xanthomonas citri
subsp. citri
Reaction of transgenic sweet orange cv. Pera expressing stx IA gene
Talk 23
to citrus canker caused by Xanthomonas citri subsp. citri
Talk 22
Talk 24 In field reaction of citrus genotypes to Xanthomonas citri subsp. citri
Talk 25
Resistance of ‘Pera’ sweet orange (Citrus sinensis) genotypes to
Xanthomonas citri subsp. citri in field conditions
10:00 – 10:15 Coffee Break
Session 6: Pathogen diversity, Moderator Olivier Pruvost, CIRAD, France
Two new MLVA- and CRISPR-based schemes for global surveillance
10:15 – 10:45 Talk 26
of populations of Xanthomonas citri pv. citri
Molecular epidemiology of Xanthomonas citri pv. citri causing Asiatic
10:45 – 11:05 Talk 27
citrus canker in Senegal
Jeff B. Jones,
Celso E. Benedetti,
Laboratório Nacional
de Biociências (LNBio),
Brazil
James H. Graham,
Rui Pereira Leite Jr.,
IAPAR, Brazil
Sérgio Alves Carvalho,
Centro APTA Citros Sylvio
Moreira/IAC, Brazil
Aline M.O. Gonçalves-Zuliani, Universidade
Estadual de Maringá,
Brazil
Olivier Pruvost,
CIRAD, France
C. Vernière,
CIRAD, France
Helvécio D. Coletta-Filho,
Genetic diversity of in vitro collections of Xanthomonas citri subsp.
11:05 – 11:20 Talk 28
Centro APTA Citros Sylvio
citri analyzed with relationship to origin of strains
Moreira/IAC, Brazil
Agenda
11:20 – 11:35 Talk 29 Xanthomonas citri subsp. citri strains in Iran
7
Masoud Shams-Bakhsh,
Tarbiat Modares
University, Iran
Session 7: Host-pathogen interaction, Moderator Adrian A. Vojnov, Instituto Dr. Cesar Milstein-Fundacion Pablo
Cassará, Argentina
Burkholderia andropogonis isolated from citrus causes canker-like Dean W. Gabriel,
11:45 – 12:05 Talk 30 symptoms and its pathogenicity is enhanced by PthA effectors from University of Florida, USA
Xanthomonas citri
Characterization of the two Type II Secretion Systems in Marcos A. Machado,
12:05 – 12:30 Talk 31 Xanthomonas axonopodis pv. citri and their effect on pathogenicity, Centro APTA Citros Sylvio
enzyme secretion, and biofilm formation
Moreira/IAC, Brazil
12:30 – 13:50 Lunch
Continue Session 7: Host-pathogen interaction, Moderator Nian Wang, University of Florida, USA
What are behind? Genetic determinants of disease development of Nian Wang,
13:50 – 14:15 Talk 32
citrus canker
How does Xanthomonas axonopodis pv. citri coordinate its virulence Nian Wang,
14:15 – 14:40 Talk 33
genes?
Adrian A. Vojnov,
Biofilm and virulence of Xanthomonas axonopodis pv. citri and its Instituto Dr. Cesar
14:40 – 15:10 Talk 34
detection in canker disease
Milstein-Fundacion Pablo
Cassará, Argentina
Celso E. Benedetti,
Laboratório Nacional
15:10 – 15:30 Talk 35 New Insights into the Xanthomonas citri – sweet orange interaction
de Biociências (LNBio),
Brazil
Shaker C. Farah,
15:30 – 15:45 Talk 36 The Xanthomonas citri Type IV Secretion System
Universidade de São
Paulo, Brasil
15:55 – 16:10 Coffee break
Cell-cell communication regulates the motility, exopolyssacharide, Maxuel Andrade,
16:10 – 16:30 Talk 37 and extracellular enzymes production of Xanthomonas axonopodis Universidade de São
Paulo, Brazil
pv. citri
The chromosomal par locus is required for normal cell division in Amanda P. Ucci,
16:30 – 16:45 Talk 38
Xanthomonas citri
UNESP, Brazil
Leandro M. Moreira,
Comparative proteomic analysis allows understanding Xanthomonas
16:45 – 17:05 Talk 39
Universidade Federal de
axonopodis pv. citri adaptation during plant burst oxidative process
Ouro Preto, Brazil
Comparative proteomic analysis of the periplasmic fractions of Carolina M. Carnielli,
17:05– 17:20 Talk 40 Xanthomonas citri (XAC) and Xanthomonas fuscans subsp. aurantifolii Universidade Federal de
type B (XauB) reveals remarkable differences
São Carlos, Brazil
Flávia S. Zandonadi,
Comparative proteomic analysis of the periplasmic fraction reveals
17:20 – 17:35 Talk 41
Universidade Federal de
remarkable differences between Xanthomonas spp. types A and C
São Carlos, Brazil
17:45 – 17:55 Concluding remarks and end of the Workshop José Belasque Jr., Fundecitrus, Brazil
Session 1 – Citrus canker current status and
Economical importance
Session 1 – Citrus canker current status and Economical importance
Eradication, litigation, and
hurricanes: The quandaries
of canker epidemiology
11
Talk 1
Gottwald, TR1
Graham, JH2
Irey, MS3
Schubert, TS4
1 - Agricultural Research Service, US Department of Agriculture, US
Horticultural Research Laboratory, Fort Pierce, Florida, 34945, USA
2 - Citrus Research and Education Center, University of Florida,
Lake Alfred, 33850, USA
3 - Southern Gardens Citrus, US Sugar Corp, 1820 County Road 833,
Clewiston, FL 33440, USA
4 - Florida Department of Agriculture and Consumer Services,
Division of Plant Industry, Gainesville, 32611, USA
Increasing international travel and trade
has resulted in an unprecedented number of plant
pathogen introductions, including Xanthomonas citri
subsp. citri (Xcc), the bacterium that causes Asiatic
citrus canker (ACC). The disease affects commercial
and dooryard citrus, and has far-reaching political
and socioeconomic impact. To date, the only known
eradication method is removal of diseased and
nearby asymptomatic trees suspected to have subclinical infections. This has elicited conflict between
regulatory agencies, commercial citrus growers, and
homeowners resulting in legal proceedings to resolve
the disputes.
Although canker first affected the Florida citrus
industry in 1910, it was eradicated by the 1930s after
massive removals of infected trees. However, ACC
was discovered a second time in Florida in 1986 and
was declared eradicated in 1992, but was discovered
a third time in Florida in residential citrus in Dade
County in 1995 in a 14 square mile area south of the
Miami International Airport. This 1995 discovery
prompted an immediate and intensive eradication
campaign by USDA, APHIS (Animal and Plant Health
Inspection Service) and the Florida Department of
Agriculture and Consumer Services (FDACS), who in
combination, formed the joint State/Federal Citrus
Canker Eradication Program (CCEP). The eradication
program was based on an epidemiological study of
ACC spread that resulted in a 1900-ft (579-m) ACCeradication protocol, that required the removal of all
‘exposed trees’ within a 579-m radius of a known Xccinfected tree.
Eradication policy decisions are at times
influenced by public perception and legal challenges
that are not always in agreement with pathogen
biology. Researchers working on Xcc find themselves
in situations in which scientific information does
not take precedence in decisions on public policy
and regulatory decisions on Xcc epidemics. Even
so, eradication is considered a biologically sound
regulatory response when a pathogen is detected
if incidence is low, distribution is limited, and
scientific studies indicate a possibility of elimination.
However, a pathogen can affect both homeowner
and commercial agricultural interests in the same
region when the same plant species is grown in
residential gardens and commercially. This is often
the case for fruit and nut tree crops such as citrus,
peach and apple. If eradication is pursued, then both
residential tree owners and commercial growers are
affected. Depending upon community composition,
cohesiveness and common interest, the support for
eradication among residential homeowners and
commercial growers can coincide or be in opposition.
Workshop on Xanthomonas citri/Citrus canker █ Session 1
12
Over the next 10 years, the canker eradication
program cost was approximately $1 billion dollars; the
largest plant disease eradication program worldwide
to date. The program was plagued by legal conflicts
between the CCEP and residential homeowners who
felt that the regulatory actions being taken protected
the citrus industry at too high a cost to residential
citrus tree owners. The numerous injunctions
and appeals led to a discontinuous and sporadic
eradication program. As the legalities of eradication
were debated, the disease continued to spread, and
outbreaks in new commercial and residential areas
erupted across Florida.
Hurricanes and tropical storms in Florida have
been associated with long range dissemination and
local increase of Xcc. Many factors have been involved
in the spread of Xcc; however, the 2004 hurricane
season appears to have been one of the major factors
leading to the widespread and numerous citrus
canker infections discovered in late 2004 and 2005.
Geospatially referenced citrus canker infection data
from infections that were discovered after the 2004
hurricanes were examined in relation to wind and
rain conditions experienced during the hurricanes
and used to develop a predictive model to explain
storm-related spread of citrus canker. The model
incorporates a “threshold” concept for wind and
rains that, in-effect, incorporates only biologically
significant weather parameters in the calculations.
When applied to three distinct areas of the state, the
predictive model accounted for approximately 80%
of the hurricane related and subsequent secondary
spread of citrus canker over the next 14 months.
Therefore the use of the predictive model shows great
promise a tool to predict disease spread as a result of
extreme weather events and as a means of targeting
resources for citrus canker survey and detection
activities.
The CCEP immediately adopted the technology
and deployed it throughout the state of Florida;
by marshalling survey teams within 48 hours
and dedicating millions of dollars of resources to
this phase. The survey and models for improved
detection of new outbreaks led to rapid discovery and
eradication of many new infections of this devastating
disease. The survey and model provided the
regulatory agencies, citrus industry representatives,
and research scientists a method to assess the spread
of the disease caused by Hurricanes Charlie, Frances,
Jeanne, and Wilma.
The 2005 hurricane season spawned
Hurricane Wilma. Finally, the impact of Wilma on
the dissemination of Xcc and subsequent disease
development was examined and predictions for
the areas into which Xcc was likely to have spread
from known sources of infection were developed.
In addition, the effect of the current 579-m (1900
ft) eradication protocol, resulting in removal of all
‘exposed trees’ with a 579-m radius of a known
Xcc-infected tree, was calculated via GIS analysis
and expressed as the predicted ‘impacted area’.
The GIS calculations were based on the extension
of the previous published wind-rain index vector
(WRIV) model. The model extension consisted of the
incorporation of an estimate of distance of spread
due to various combinations of wind and rain from
data collected during the 2004 hurricane season. An
inverse power law dissemination function was used to
describe regional dispersal from a point focus of Xccinfection. Alternative eradication protocol (distances)
to the 579-m protocol were evaluated in association
with the GIS analyses and used to examine the effect
of eradication distance on predicted ‘impacted area’.
The models demonstrated that canker had
become endemic in the state and beyond the ability
to eradicate. These findings led regulatory policy
makers to end the 10-year, $1 billion citrus canker
eradication program. The models and the conclusions
also solved a large political dilemma as well by giving
the CCEP a scientifically-documented and justified
compilation of results on which to base the decision
to halt the eradication program. The outcome was a
savings to the FL and US taxpayers of ~$100 million/
year in continued eradication costs. This brought an
end to the Florida citrus canker eradication era, but
the efforts for eradication gave the citrus industry 10
years of freedom from the stringent quarantines and
national/international marketing regulations in place
today.
Orange production under an
endemic citrus canker situation:
Increased costs and potential loss
yields and reduced returns
13
Talk 2
Muraro, RP
University of Florida, USA.
The presence of citrus canker will likely
require a change in cultural management programs
to reduce potential fruit loss and fruit drop caused by
citrus canker infestation. Timely additional spraying
of copper as a bactericide and decontamination of
equipment and trucks, grove workers and harvesting
labor will be essential to reduce the presence of citrus
canker and minimize fruit loss on early and Pera
orange varieties. This new citrus canker management
program will result in higher costs, reduced yields
and lower grower returns. This paper will compare
a citrus canker eradication program with managing
citrus canker under an endemic situation. Examples
for Brazil citrus production will be discussed using
information and experiences from Parana (Brazil),
Entre Rios (Argentina) and Florida (U.S.DA.)
14
Current status of citrus canker
control in São Paulo state, Brazil:
A new chapter in a 50-year book?
Talk 3
Belasque Jr., J
Behlau, F
Fundecitrus - Fundo de Defesa da Citricultura
Av. Adhemar Pereira de Barros 201, 14807-040. Araraquara, SP,
Brazil. Email: belasque@fundecitrus.com.br
Citrus canker (Xanthomonas citri subsp
citri - Xcc) was first reported in Brazil in 1957, in
Presidente Prudente, São Paulo State (SPS) [1]. The
decision of Brazilian government to establish the
Citrus Canker Eradication Program (CCEP) occurred
soon after its discovery, based on the potential
aggressive spread of the disease and on previous
eradication programs undertaken in other countries
such as the USA. The program did not eradicate the
pathogen, but maintained the citrus canker incidence
at very low level until now [3, 4]. In order to localize
contaminated groves in the State and estimate the
disease incidence, Fundecitrus, a private company
maintained by citrus growers and sweet orange juice
producers, conducts annually since 1999 a survey in 5
to 10% of commercial orchards in the State. According
to these surveys, after several years of low incidence,
the number of infected blocks in SPS reached in 2011
the highest level ever registered ~1.0%! (Figure 1).
A change in the legislation in 2009 has contributed
significantly for such an increase [4].
From 1992 to 1996 the annual average numbers
of symptomatic and eradicated trees were 2,705
and 22,077, respectively, in SPS. In the subsequent
years the numbers increased, and achieved 299,856
and 2,037,401 contaminated and eradicated trees
in 1999, respectively. This increase of the number
of new citrus canker foci coincided with the period
after introduction of citrus leafminer (Phyllocnistis
citrella Stainton) in Brazil in 1996. Damage by citrus
leafminer significantly altered the spatial pattern of
citrus canker in SPS and increased the spread and
development of new infections [5, 6]. As a consequence
of this increase in disease spread, in September 1999
the eradication protocol became more stringent
and the number of trees to be eliminated became
depended on the disease incidence in the affected
orchards [5, 6]. When disease incidence was higher
than 0.5%, all trees were removed in the orchard,
whereas when disease incidence was equal to or less
than 0.5%, an eradication radius of 30 meters was
applied. During this time, surveys were conducted
periodically by a team of at least 1,500 field inspectors
in a joined effort between Fundecitrus and the State
government. Alternative eradication methods, such
as drastic pruning or chemical defoliation, were
not allowed. During that period (1999-2009), the
CCEP in SPS not only addressed the disease foci in
commercial citrus groves, but also in non-commercial
citrus groves in rural and residential areas, as well as
in citrus nurseries. However, in June 2009, the CCEP
in SPS suffered a new setback and the 0.5% rule was
ruled out [4]. Thus, since then the CCEP has been
conducted just like until 1999, with the elimination
of the diseased trees and all trees in a radius of 30
meters. Besides, there has been a reduction in the
number of annual inspections in the contaminated
blocks and suspicious of contamination, which is
currently relying exclusively on the grower’s efforts.
The changes promoted by the State government
in June 2009, making the eradication program more
relaxed, would require a drastic increase in the
number of additional field inspectors to detect and
remove the disease foci [4]. Also, as the number of
secondary foci would certainly increase, inspections
would have to be performed at shorter intervals to
contain disease spread. Thus, since January 2010
Fundecitrus did not maintain inspections for the CCEP.
The absence of field inspectors and the application of
a less suppressive protocol for disease eradication led
to the highest citrus canker incidence ever observed
in 2011.
Since 2000, one year after the 0.5% rule
started being applied, to 2009, when the methodology
of eradication was modified, the incidence of
contaminated blocks ranged from 0.08% and 0.27%
(Figure 1). This numbers confirm the efficacy of the
CCEP practiced during that period for maintaining the
disease under control. The CCEP recognizes that the
program was not designed to completely eradicate
the disease in SPS, but to suppress the disease to a
very low, acceptable level. However, changes in the
legislation in 2009 that resulted in a less rigorous
CCEP and the reduction of number of inspections,
contributed to an increase of the disease in SPS. The
number of contaminated blocks in SPS rose from
0.14% in 2009 to 0.44% in 2010 and to ~1.00% in
2011.
Although the citrus canker eradication program
is mandatory by a Federal law, some states in Southern
Brazil have been managing the disease since the 90`s,
using less susceptible citrus genotypes, frequent
cooper sprays, and wind-breaks [2]. This approach
for citrus canker management started being adopted
firstly in the 80`s in Argentina’s citrus-growing
areas. It has also being practiced in Florida, United
States since 2006, after the eradication program
was suspended. In 2006, the Brazilian government
established a Risk Management System (RMS) for
citrus canker, to facilitate the free commerce of citrus
fruit adopted by some South American countries.
The RMS is under implementation by the Federal
government, and will legalize three status of citrus
canker occurrence in Brazil:
a)Xcc-free areas;
b)eradication/suppression areas – as applied
in SPS currently; and
c) management areas, as in Southern states in
Brazil.
The recent increase in the citrus canker
incidence in SPS, the world largest sweet orange juice
producer, implies in new demands, opportunities, and
challenges. At very low incidence, the eradication of
the disease is the best economical strategy for citrus
canker control. Low incidence means that a few
15
diseased trees are present in one or a few orchards
in the farms. This is the situation that most, if not
all, citrus farms are currently facing throughout SPS.
Conversely, eradication means the elimination of
symptomatic plants, and those non symptomatic ones
located around the symptomatic ones. The distance
from foci used for eliminating trees depends mostly
on the efficacy of the disease detection and the
frequency of inspection. Citrus canker suppression
refers to keeping the disease at an extremely low
incidence, and differs from the eradication for
allowing the presence of the pathogen in the area.
Although called eradication, the control strategy
applied in SPS and the incidence of citrus canker
orchards around 1.0% characterize it as a scenario of
disease suppression. Disease suppression demands
continuously efforts of inspections and eliminations
of disease foci. Both eradication and suppression
require financial and human resources. On the other
hand, disease management requires also additional
financial resources for the frequent copper sprays,
windbreaks, crop loss etc. [2]. Financial comparisons,
as will be showed, demonstrate that the eradication
(meaning suppression) is the best economical
strategy for citrus production in SPS. Considering
that the citrus production is a business activity
and the recent significant increase of citrus canker
incidence in the State, the most urgent requirement
for citrus growers is to detect and remove all citrus
canker foci in their areas. This approach, the best
economical one in any place at the State, depends
exclusively on the efforts of citrus growers, and
could be facilitated by governmental support.
Undoubtedly, there is a demand that the scientific
community have to work on: development of novel,
more efficient approaches for disease detection and
control, focused especially on resistant genotypes.
Such demand for citrus growers and the scientific
community is also challenging. Citrus growers are
struggling to maintain a profitable crop under a
new scenario with the pressure of citrus canker.
The scientific community is being dared to generate
strategies for a better citrus canker control. These
demands and challenges generates, by consequence,
opportunities. Citrus growers that can keep the
orchards under a low pressure or ever free of
citrus canker will take an outstanding economical
advantage. Meanwhile, the demand for effective and
profitable approaches for citrus canker control is an
El Dorado to be sought by the scientific community.
16
1.20
Incidence (%)
1.00
0.80
0.60
0.40
0.20
0.00
1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011
Figure 1. Incidence of commercial orchards (Sweet orange)
detected with citrus canker in annual surveys conducted
in Sao Paulo state, Brazil. The incidence for 2011 is an
estimative.
References
1. Amaral, S.F. 1957. Providências para a erradicação
do cancro cítrico. O Biológico, 23:112-123.
2. Behlau, F., Amorim, L., Belasque, J., Bergamin Filho,
A., Leite, R.P., Graham, J.H. and Gottwald, T.R. 2010.
Annual and polyetic progression of citrus canker
on trees protected with copper sprays. Plant
Pathology, 59:1031-1036.
3. Belasque Jr, J., Gimenes-Fernandes, N. and Massari,
C.A. 2009. O sucesso da campanha de erradicação
do cancro cítrico no estado de São Paulo, Brasil.
Summa Phytophthologica, 35:91-92.
4. Belasque Jr., J., Barbosa, J.C., Bergamin Filho, A. and
Massari, C.A. 2010. Prováveis consequências do
abrandamento da metodologia de erradicação do
cancro cítrico no Estado de São Paulo. Tropical
Plant Pathology, 35:314-317.
5. Belasque Jr., J., Parra, A.L.G., Rodrigues Neto, J.,
Yamamoto, P.T., Chagas, M.C.M., Parra, J.R.P.,
Vinyard, B. and Hartung, J.S. 2005. Adult citrus
leafminers (Phyllocnistis citrella) are not efficient
vectors for Xanthomonas axonopodis pv. citri. Plant
Disease, 89:590-594.
6. Gottwald, T.R., Bassanezi, R.B., Amorim, L. and
Bergamin Filho, A. 2007. Spatial pattern analysis
of citrus canker-infected plantings in São Paulo,
Brazil, and augmentation of infection elicited by
the asian leafminer. Phytopathology, 97:674-683.
Session 2 – Epidemiology
Survival of Xanthomonas citri
subsp. citri to estimate risk of
transmission by infected fruit
19
Talk 4
Cubero, J1
Sena, M1
Redondo, C1
Gell, I1
Johnson, E2
Graham, J2
1 - Instituto Nacional de Investigación y Tecnología Agraria y
Alimentaria (INIA), Ctra, De La Coruña, 28040 Madrid, Spain
2 - University of Florida, Citrus Research and Education Center,
Lake Alfred, FL 33850, USA
Studies evaluating Xanthomonas citri subsp.
citri (Xcc) on plant tissues have demonstrated limited
survival outside of lesions on leaf and fruit surfaces.
Bacteria multiply in lesions, and when there is free
water on leaf surfaces, they egress from lesions and
stomata to disperse by windblown rain droplets to other
plants where a new infection is initiated after stomatal
penetration. Little is known about the role of bacterial
colonization of the plant surface as a prelude to infection,
but this needs clarification because of the potential role
of this process in disease transmission. Leaf wetness
duration plays a role in development of CBC; however,
it is unclear whether free moisture is absolutely
necessary for bacterial infection through stomata.
In addition, evidence is limited or absent for survival
of Xcc on fruits and the potential for Xcc on harvested
fruit surfaces to produce new infections (3). Recovery
of the target bacterium by culture plating is often
compromised by the presence of competing microflora
or physiological stress that prolongs or inhibits the
development of bacterial colonies on the culture plate.
For these reasons, culture independent approaches are
required for assessing bacterial viability. Hence, we
developed Xcc strains that express green fluorescent
protein (GFP) in two different forms to monitor
bacterial survival: the native protein, and a protein that
is unstable due to a specific oligopeptide tail targeted
by proteases within the bacterium (1). Evaluation of
protein stability confirms that strains with unstable
GFP only expressed and fluoresced in metabolically
active cells, and not in dead bacteria. Fluorescence of
unstable GFP strains under confocal laser scanning
microscopy (CLSM) was used to track bacterial survival
and biofilm formation on leaf and fruit surfaces. After
spray inoculation, aggregates of fluorescing cells of
unstable GFP strains formed biofilms on leaves and
fruit. Bacterial cells that aggregated on the surfaces only
survived when protected from desiccation. To confirm
the role of biofilm as a survival strategy, viability of
bacteria in aggregates was evaluated in vitro based on
amplification of a specific length fragment from gumD
mRNA (2). The amplification of the 445-bp product
from gumD mRNA was demonstrated to be useful for the
detection of viable Xcc due to the instability of the long
msRNA fragment. By this approach bacterial survival in
biofilm aggregates as compared to planktonic cells was
demonstrated in culture (Fig. 1). This detection method
may become a practical tool for the study of survival of
Xcc.
Aggregation of viable bacteria in biofilms
confirmed their role in survival outside of lesions and
potential for protection from bactericide treatments
in the field or in the packinghouse during the fruit
disinfection process. Persistence of viable bacteria in
biofilms explains the occasional recovery of Xcc from
exposed symptomless fruit after rigorous disinfection
with chlorine and sodium ortho-phenylphenate
(SOPP) (3).
20
Fig. 1. RNA from GumD gene in planktonic (Susp) or
biofilm-forming bacteria (Biof) after 3 and 7 days (d)
post inoculation. The long fragment of GumD is used as a
viability marker and the short fragment of GumD is used for
evaluation of gene expression.
Aggregation and biofilm formation were
confirmed for wide (Xcc A) and limited host range
strains (Xcc A* and Xcc Aw). Higher aggregation and
biofilm formation was demonstrated for Xcc A than
Xcc Aw or Xcc A*. The higher biofilm formation of
Xcc A was associated with greater motility on agar
(swarming) and lower motility in liquid medium
(swimming) than Xcc A* strains. Moreover, differences
in biofilm structures between wide and narrow
host range strains in initial stages of aggregate
formation were observed by scanning electron
microscopy (SEM) and CLSM. Greater flagellation
and presence of swarming cells (with high ability for
movement) in the Xcc A strains compared to Xcc Aw
was observed by transmission electron microscopy
and gene expression analysis. This suggests that
action of flagella-like structures may account for the
difference in biofilm formation between these strains.
Differences in biofilm formation and motility among
wide and limited host range strains may account in
part for their difference in virulence. Based on the
SEM, Xcc A is able to aggregate and form biofilm on
both Mexican lime and grapefruit while Aw produces
biofilm on lime but not grapefruit.
An additional objective was to evaluate the
effect of different bactericides on biofilm formation
or removal of pre-existing aggregates. Adhesion of Xcc
to borosilicate slides was measured by colorimetric
assay after exposure to sublethal concentrations of
NaCl, SOPP, NaClO and CuSO4. Bactericides did not
inhibit biofilm formation but sometimes increased
adhesion to the surface even when bacterial growth
was not directly affected by the bactericide treatment
(Fig. 2).
Fig. 2. Growth and adhesion to surface of the bacteria in
culture treated with sublethal concentration of bactericides.
Increase in aggregation of Xcc treated with
sublethal concentration of bactericides was also
confirmed by CLSM with the GFP strains and viability
of Xcc was demonstrated with the labile GFP strain
(Fig. 3).
Fig. 3. Aggregation of Xcc expressing labile GFP on
borosilicate plates treated with different concentrations of
bactericides.
21
Similar results were obtained on plant surfaces
as observed using CLSM and SEM (Fig. 4). None of the
bactericides significantly decreased biofilm formation
by Xcc, however NaCl promoted more rapid formation
of larger and thicker biofilms. Furthermore, the
bactericides did not prevent bacterial ingress through
the stomata. In the case of SOPP that reduced Xcc on
leaf surface, colonization inside the leaf appeared
to be higher. In summary, sublethal concentrations
of bactericides increased adhesion and promoted
biofilm formation.
Fig. 5. Adhesion to surface by bacteria in culture treated
with sublethal concentration of bactericides to remove
biofilms.
Fig. 4. Biofilm formation by Xcc on Swingle citrumelo leaves
treated with sublethal concentrations of CuSO4, NaCl and
SOPP at 1, 3 and 9 days post inoculation (dpi) .
Finally the effect of the bactericides on
preformed biofilms was evaluated after treatments
with H2O2, CuSO4, SOPP, NaCl and NaClO at different
concentrations (Fig. 5). None of the bactericides were
able to completely remove bacterial cells from the leaf
nor were bacteria completely killed as verified with
the labile GFP strain.
Literature Cited
1. Cubero, J., I. Gell, E.G. Johnson, A. Redondo, and J.H.
Graham. 2011. Unstable green fluorescent protein
for study of Xanthomonas citri subsp. citri survival
on citrus. Plant Pathology 60, 5:977-985.
2. Golmohammadi, M., P. Llop, G. Scuderi, Gell.I., J.
H. Graham, and J. Cubero. 2011. mRNA and rRNA
for evaluation of viability for Xanthomonas citri
subsp. citri by monitoring stability of selected
transcripts. Plant Pathology, Doi:10-1111/j-13653059.2011.02526.x.
3. Gottwald T, Graham JH, Bock C et al., 2009. The
epidemiological significance of post-packinghouse
survival of Xanthomonas citri subsp. citri for
dissemination of Asiatic citrus canker via infected
fruit. Crop Protection 28, 508–24.
22
Risk of symptomatic and
asymptomatic fruit as a pathway
for citrus canker establishment
in new areas
Gottwald, T
Talk 5
1
Graham, J
Bock, C3
Bonn, G4
Civerolo, E5
Irey, M6
Leite, R7
McCollum, G1
Parker, P8
Ramallo, J9
Riley, T10
Schubert, T3
Stein, B8
Taylor, E1
2
1 - Agricultural Research Service, US Department of Agriculture, US
Horticultural Research Laboratory, Fort Pierce, Florida, 34945, USA
2 - Citrus Research and Education Center, University of Florida, Lake
Alfred, 33850, USA
3 - Agricultural Research Service, US Department of Agriculture,
Southeastern Fruit and Tree Nut Research Laboratory, 21 Dunbar
Rd., Byron, GA 31008, USA
4 - Florida Department of Agriculture and Consumer Services,
Division of Plant Industry, Gainesville, 32611, USA
5 - Agricultural Research Service, US Department of Agriculture,
San Joaquin Valley Agricultural Sciences Center, Parlier, California,
93648, USA
6 - Southern Gardens Citrus, US Sugar Corp, 1820 County Road 833,
Clewiston, FL 33440, USA
7 - Área de Proteção de Plantas, IAPAR, CP 481, 86047-902, Londrina,
Brazil
8 - US Department of Agriculture, Animal and Plant Health Inspection
Service, Plant Protection and Quarantine, Center for Plant Health
Science and Technology, Edinburg, Texas 78541, USA
9 - Estación Experimental Agroindustrial-Obispo Colombres,Las
Talitas, Tucumán, Argentina
10 - US Department of Agriculture, Animal and Plant Health
Inspection Service, Plant Protection and Quarantine, Citrus Health
Response Program, Orlando, Florida, 32824, USA
The risk of introduction of Xanthomonas citri
subsp. citri (Xcc) to new, unaffected citrus producing
areas is a major concern for those citrus industries
attempting to remain free of citrus canker. Citrus
fruit, as a potential pathway for Xcc to enter and
become established in these areas, is assumed to be
a risk. However, prior to this study, there was little
information relative to the potential of harvested
fruit to act as an inoculum source. A multi-national
research team was established to investigate the
potential of bacterial survival in infected citrus fruit
lesions and as surface contaminants on symptom-free
fruit, and to examine the potential of infected fruit as
a viable inoculum source.
Experiments were conducted in various
locations in Florida and Argentina. Bacterial recovery
and culture plating were problematic due to the
presence of nonpathogenic bacteria with cultural
characteristics that were difficult to distinguish from
Xcc. Therefore, in all experiments, although culturing
on semi-selective agar media was used as an indication
of overall bacterial populations, bioassays were
conducted via needleless injection and infiltration
of suspect bacterial suspensions into susceptible
cv. Duncan grapefruit leaves. Inoculation sites were
subsequently assessed for symptoms of citrus canker
and lesions were individually enumerated to confirm
the presence of Xcc. In commercial packing lines
in Florida and northwest Argentina, prewashing
the fruit to remove dirt and debris reduced surface
bacterial populations.
As anticipated, recovery of Xcc from fruit
surfaces increased when active citrus canker lesions
were present but total bacterial recovery decreased
after processing, and bioassays demonstrated that
the quantity of viable Xcc declined as fruit remained
in cold storage, or as they aged on the trees. Bioassays
demonstrated that the highest incidence of Xcc from
fruit after the packing line antimicrobial treatment
occurred with symptomatic fruit (2.5-50.6 lesions
per leaf), and zero to very low levels with fruit from
apparently healthy trees (0-1.74 lesions per leaf).
Furthermore, the proportion of injection-infiltration
bioassay sites that developed lesions consistently
decreased with time after processing in each of the
three packinghouse studies, also showing that as fruit
senesce and lesions age the ability of fruit to generate
or sustain Xcc bacteria was increasingly compromised.
The packing line process reduced canker lesion
23
activity by as much as 50% compared to unprocessed
fruit. Xcc survived in wounds on mature fruit attached
to the tree, but Xcc populations declined in wounds of
processed or non-processed harvested fruit.
Discarded canker-infected fruit in cull piles
was ineffective as a source of inoculum for dispersal.
Transmission from cull piles of packing lineprocessed fruit to surrounding trap plants, even less
than 1 m away, did not occur under natural conditions.
However, with severely infected piles of culled fruit
subject to extreme simulated wind (25 m sec-1) and
rain conditions, only a single lesion, associated with
leaf injury, developed on a trap plant immediately
downwind of the cull pile, suggesting an exceedingly
low risk of spread.
Taken as a group, this series of experiments
demonstrated that canker bacteria decreased rapidly
on post-harvest fruit surfaces and within bacterial
lesions that are passed through the packinghouse.
Thus, packinghouse-disinfested citrus fruit were
extremely unlikely to act as a pathway for canker to be
transported to, and become established in, canker-free
areas. The resulting research publication served as the
justification for USDA’s APHIS to promulgate a new
regulation (7 CFR Part 301, FR Doc E9-15508 “Citrus
Canker; Movement of Fruit from Quarantined Areas).
This rule eliminates the requirement that fruit lots be
inspected at the packinghouse and found to be free of
canker symptoms and reduces industry costs by nearly
$15 million annually. It also removes the prohibition
on the movement of fruit from a quarantined area to
commercial citrus producing states. While relieving
restrictions on interstate movement of fresh citrus
fruit, the rule continues, to prevent the spread of
citrus canker and protect canker-free areas. The rule
potentially saves the $400 million/year Florida fresh
citrus fruit industry that would have continued to
decline and potentially become nonviable as citrus
canker continues to increase in the State of Florida.
24
A survey of survival and activity Talk 6
of citrus canker lesion populations
on foliage, fruit and shoots in a Florida
grapefruit orchard in 2009 and 2010
Bock, CHa
Gottwald, TRb
Graham, JHc
a - USDA-ARS-SEFTNRL, 21 Dunbar Rd., Byron, GA 31008
b - USDA-ARS-USHRL, 2001 S. Rock Rd., Ft. Pierce, FL 34945
c - University of Florida, CREC, 700 Experiment Station Rd., Lake
Alfred, FL 33850
Citrus canker is caused by the plant pathogenic
bacterium, Xanthomonas citri subsp. citri (Xcc), which
can infect several species of citrus. The disease
can develop on the leaves, shoots and fruit, causing
erumpent lesions, that on fruit precludes sale to the
fresh market. Export markets that do not have citrus
canker impose barriers to the import of fruit from
canker-endemic areas, such as Florida (Gottwald
et al., 2009; Shiotani et al., 2009). Assessing lesion
activity in orchard-grown grapefruit provides
information on the population dynamics of fruit
lesions in a commercial situation that can help gauge
risk associated with infected fruit entering fresh
markets. The objective of this study was to survey the
activity of canker lesions on grapefruit in a typical
orchard in Florida.
Every month from June 2009 to January 2010,
and from June 2010 to January 2011, a grapefruit
orchard in east-central Florida was sampled for 50
leaves, 20 shoots and 54 fruit. Lesions counts were
made on each sample unit, and a random selection of
80 lesions from fruit, 50 lesions from leaves and 20
lesions from shoots taken using a cork-borer. Lesion
diameter was measured. Lesions were incubated in a
vial of sterile distilled water for 10 min and the vial
vortexed twice at the start and end of the incubation
period. Aliquots of the water were dilution plated on
antibiotic-amended nutrient agar and the number
of colonies of Xcc counted and the data normalized
by calculating the bacteria flux density (BFD) for
each lesion (bacteria/mm2/min). Bioassays were
also made on leaves of ‘Duncan’ grapefruit using the
syringe injection method. Monthly rainfall and mean
daily temperatures at 2 m were obtained from the
Florida Automated Weather Network (http://fawn.
ifas.ufl.edu/) for the Fort Pierce site. The orchard
received bactericide sprays applied according to
standard farm practice (Table 1). Data were analyzed
with linear regression analysis using SAS (SAS
systems, Cary, NC). Standard deviations for the mean
BFDs were calculated.
Between June 2009 and January 2010 the
analysis indicated a slight decline in the proportion of
active lesions (R2 = 0.44) from 88% in June to 69% in
January, at the time of harvest (Figure 1A). On leaves
there was no apparent reduction in the proportion
of active lesions (R2 =0.06) with 94% active in July,
and 88% active by January. On stems there was a
decline (R2 = 0.44), with 95% active in June and 20%
active in January. From June 2010 to January 2011,
linear regression analysis indicated a decline in the
proportion of active lesions for fruit from 98% to
6% (Figure 1B), R2 = 0.80), for leaves from 100%
to 66% (R2 = 0.44) and for stems from 45% to 10%
(R2 = 0.41). In 2009 the mean BFD (bacterial flux
density) from lesions on fruit, leaves and stems was
variable and erratic. On fruit, mean BFD was greatest
in November (3.9x104 Xcc/mm2/min, Figure 2A),
and least in August (2.8x103 Xcc/mm2/min). On
leaves, mean BFD ranged from 2.1x103Xcc/mm2/min
Lesions remained active on fruit, foliage and
shoots throughout the sampling period from June to
the following January. There was a detectable decline
in the proportion of lesions active during the season
on fruit and shoots, but less this was less consistent
on leaves. Fruit lesions results from infections from
fruit set through fruit maturity (Graham et al., 1992;
Verniere et al., 2002), while leaf and shoot lesions can
occur on new growth at any time during the growing
season, thus fruit lesions might become moribund
towards the end of the season. Nonetheless, the
activity of surviving lesions on fruit (measured by
BFD) was highly variable throughout the season, and
even at the end of the season some lesions produced
prolific quantities of bacteria. Stem lesions appeared
to consistently have the least BFD among these three
tissues. The data demonstrate that lesions on the
surface of grapefruit in Florida can remain active for
at least seven months, and are thus comparable to
lesions on the foliage (Graham et al., 1992; Verniere et
(A)
Percent active lesions
Table 1. Bactericides applied following standard
farm practice in 2009-10 and 2010-11.
Season Date
Bactericide
18-Jun-10 CuOH, Champ DP (2.0 kg/ha)
17-Jul-10 CuOH, Kocide 3000 (2.8 kg/ha)
2009-10 8-Aug-10 CuOH, Kocide 3000
23-Aug-10 CuOH, Kocide 3000
20-Sep-10 CuOH, Kocide 3000
31-Mar-09 Nu Cop 50WP (3.5 kg/ha)
30-Apr-09 Nu Cop 50WP
2010-11 8-Jun-09
Nu Cop 50WP
11-Jul-09 Nu Cop 50WP
3-Sep-09 Kocide 2000 (2.8 kg/ha)
al., 2002). Despite the decline in proportion of active
lesions, the fact the lesions on grapefruit can maintain
such output of bacteria even in the presence of copper
sprays reinforces the need to focus on post harvest
approaches for deactivating lesions of citrus canker
on fruit being sold for the fresh market. Postharvest
disinfection treatments might mitigate the risk of
viable Xcc on fresh fruit (Gottwald et al., 2009), and if
possible approaches to deactivate fruit lesions should
be developed.
(B)
Time (day)
Percent active lesions
in November to 7.9x03Xcc/mm2/min in December.
Lesion activity was most erratic for stems. From June
2010 to January 2011 the mean BFD on fruit was
variable and ranged 2.7x104 in June to 0.8 bacteria/
mm2/ min in December (Figure 2B). From June 2010
to January 2011, the mean BFD was variable and
erratic on leaves (3.5x102 to 2.4 x 105 bacteria/mm2/
min) and stems (4.0 to 1.4x104 bacteria/mm2/min).
Although the 2009-10 season was warmer (Figure
3A) and wetter (Figure 3B) on average (particularly
later in the season), there was no discernable effect
of these conditions on lesion activity using regression
analysis.
25
Time (day)
Figure 1. The proportion of active citrus canker lesions
on fruit of grapefruit in an orchard in east-central Florida
from A. June 2009 to January 2010, and B. from June 2010
to January 2011.
26
(A)
(B)
Total monthly rainfall (mm)
Time (day)
BFD (bacteria cm-2 min-1)
(B)
Mean daily temp (C)
BFD (bacteria cm-2 min-1)
(A)
Time (day)
Figure 2. The mean bacteria flux density (BFD, bacteria/
mm2/min) of Xanthomonas citri subsp. citri calculated for
80 canker lesions on fruit of grapefruit in an orchard in
east-central Florida from A. June 2009 to January 2010, and
B. from June 2010 to January 2011. Standard deviations of
the mean are indicated.
References
Gottwald, T, Graham, J., Bock, C.H., Bonn, G., Civerolo,
E., Irey, M., Leite, R., Lopez, M., McCollum, G., Parker,
P., Ramallo, J., Riley, T., Schubert, T., Stein, B. and
Taylor, E. 2009. The epidemiological significance
of post-packinghouse survival of Xanthomonas
citri ssp. citri for dissemination of Asiatic citrus
canker via infected fruit. Crop Protection 28:508524.
Time (day)
Time (month)
Figure 3. The mean daily temperature (A) and mean
monthly rainfall (B) in Fort Pierce, east-central Florida from
June 2009 to January 2010, and from June 2010 to January
2011.
Graham, J.H., Gottwald, T.R., Riley, T.D. and Bruce, M.A.
1992. Susceptibility of citrus fruit to bacterial spot
and citrus canker. Phytopathology 82:452-457.
Shiotani, H., Uematsu, H., Tsukamoto, T., Shimizu, Y.,
Ueda, K., Mizuno, A and Sato, S. 2009. Survival
and dispersal of Xanthomonas citri pv. citri from
infected Satsuma mandarin fruit. Crop Protection
28:19-23.
Verniere, C.J., Gottwald, T.R. and Pruvost, O. 2002.
Disease development and symptom expression of
Xanthomonas campestris pv. citri in various citrus
plant tissues. Phytopathology 93:832-843.
27
Processes involved in the dispersal Talk 7
of Xanthomonas citri subsp. citri from
canker-infected citrus canopies, and in
the infection of citrus foliage
Bock, CHa
Gottwald, TRb
a - USDA-ARS-SEFTNRL, 21 Dunbar Rd., Byron, GA 31008
b - USDA-ARS-USHRL, 2001 S. Rock Rd., Ft. Pierce, FL 34945
Introduction
Citrus canker (Xanthomonas citri subsp. citri,
Xcc) is now widespread in Florida, and epidemics
result in yield loss and market penalties both in Florida
(Gottwald et al., 2009), and elsewhere where the
pathogen occurs and susceptible citrus is cultivated
(Schubert et al., 2001). The bacterium is dispersed
in rain splash (Bock et al., 2005, 2010a), and strong
winds cause more severe disease (Serizawa and
Inoue, 1974; Bock et al., 2010b). Storms with strong
winds and heavy rain are common in Florida (Irey
et al., 2007). Understanding the interaction of the
physical (wind and splash) and biological (bacteria
production, dispersal and infection) factors involved
can help guide development of effective management
strategies, including cultural solution, such as the
use of wind breaks. The objective of this study was
to characterize dispersal and infection processes in
turbulent wind.
A series of experiments simulating wind and
rain was used to study the dynamics of dispersal of
Xcc, and infection of susceptible hosts. The wind was
generated using a fan system, and the rain-splash
was generated from a series of four overhead garden
sprayers (Bock et al., 2005, 2010). The position of
the fan was adjusted in relation to the plants to set
wind speed at the canopy face. For the dispersal
studies, a group of 2-3 1.5 m trees (cv. Ruby Red) in
38 L containers were used as the source of inoculum.
Splash was collected downwind of the plants using
vertical panel samplers (5 or 10 min sampling
periods, depending on the experiment) positioned
up to 12 m downwind, depending on the experiment.
Volume of splash (ml) collected was measured. Panels
were rinsed. Aliquots of the water were dilution
plated on antibiotic-amended nutrient agar and the
number of colonies of Xcc counted. The data was
normalized by calculating the bacteria flux density
(BFD, bacteria cm-2 min-1) for each sample of splash
collected (bacteria/mm2/min). For the infection
studies, replicate seedlings of ‘Swingle’ citrumelo
were situated in front of a sprayer with three nozzles
which fed from a tank which acted as the source of
inoculum (Bock et al., 2010b). Spray pressure was held
constant. The concentration was set at (0 [control] to
106 bacteria ml). With the sprayer operating, wind was
generated for 2 min. periods and the plant exposed
to the inoculum. Immediately on completion of the
experiment, plants were transferred to a greenhouse
(27 °C) and incubated for 28 days. Each leaf was
assessed for disease, counting total number of lesions
and number of lesions associated with injury. Injury
was scored on a 0-5 scale where 0 = no injury, and 5
= superficial scratches, with punctures and scratches
penetrating the leaf, the leaf severely torn with pieces
missing. Data were analyzed with linear and nonlinear regression using SAS (SAS Systems, Cary, NC).
Bacteria were produced and dispersed in
splash continuously for up to 52 h (Figure 1A, the
maximum time tested), although the BFD declined
rapidly during the first 10 minutes of a dispersal
event (Figure 1B). In the simulated system, wind
speed inevitably declined with distance downwind
(Figure 2A), yet bacteria of Xcc were collected several
28
Figure 1. Effect of duration of a wind and rain event on the
quantity of Xanthomonas citri subsp. citri dispersed from
diseased canopies of ‘Ruby red” grapefruit in three different
experiments over 52 h (A), and three experiments over 240
min (B).
Figure 2. The effect of distance from the source of wind
on wind speed (A) and on the bacteria flux density (BFD)
of Xanthomonas citri subsp. citri collected at different
distances downwind (B) of diseased canopies of ‘Ruby red”
grapefruit in three different experiments.
meters downwind when canopies were exposed to
a wind speed of 19-25 m sec-1. With wind, Xcc was
collected up to 12 m downwind of an infected canopy,
the maximum distance tested, where the canopy was
subject to a wind speed of 16-20 ms-1. The relationship
was described by an inverse power function (R2 =
0.83-0.93). Wind speed at the canopy face varied
depending on the fan distance, as illustrated for one
of the experiments (Figure 3A), but higher wind
speeds resulted in greater BFD escaping the canopy
downwind in wind driven splash. The log BFD had
a linear relationship with increasing wind speed
(Figure 3B, R2 =0.62-0.86) in four of five experiments.
In the presence of inoculum, greater wind speed (>10
m sec-1) consistently resulted in higher incidence and
severity of citrus canker developing (Figure 4A),
with a dramatic increase in disease between 10 and
15 ms-1. Injury to leaves due to wind was evident
at 10-15 m sec-1, and the number of canker lesions
associated with injury increased over this range of
wind speed (Figure 4B). Disease not associated with
visible injury also increased with wind speed. The
Figure 3. The relationship between wind speed and distance
of the fan from the canopy face for one experiment on 10
Feb (A, standard deviations of the wind speed indicated),
and log bacteria flux density (log BFD, bacteria cm2 min-1) of
Xanthomonas citri subsp. citri by panel samplers downwind
of the diseased canopy subject to simulated wind-rain
events in five repeats of the experiment (B).
relationship between wind speed and disease, and
disease associated with injury was described by a
logistic model (R2 = 0.81 and 0.97, respectively).
On exposure of lesions to moisture, there is a
dramatic release of bacteria of Xcc in wind dispersed
splash, and the rate of dispersal declines over a
period of 2 h and gradually stabilizes for at least
52 h. Xcc is dispersed from diseased plants in large
quantities, particularly when wind blows splash
29
Figure 4. Severity of symptoms of citrus canker subsequent
to exposing young plants of ‘Swingle’ citrumelo to spray
inoculum of Xanthomonas citri subsp. citri at different
wind speeds in five experiments. (A) The number of canker
lesions per infected leaf, and (B) the relationship between
visible injury severity and number of lesions of citrus
canker associated with injury per injured leaf.
from the canopy. Although the dispersal of bacteria
over distance was described by an inverse power
function, which is common for both wind and splash
dispersed pathogens (Fitt 1987), the wind produced
by a fan slows fast and thus the distance noted here
for dispersal of Xcc is likely conservative. Wind
will ordinarily move as an air mass and although
turbulence will be common in canopies, wind speed
would be more constant with distance. Wind speed
30
affected disease severity at a particular concentration
of inoculum. The greater the wind speed, the greater
the disease severity. Wind also caused leaf injury,
and more disease was associated with injured parts
of the leaf. Wind and rain-splash combine to result in
increased dispersal of Xcc, and wind can dramatically
increase the severity of disease both directly, and due
to leaf injury in susceptible citrus. Reducing wind
speed in citrus groves with the aid of wind breaks
should contribute to a reduction in the severity of a
canker epidemic by reducing dispersal and infection
events.
References
Bock, C.H., Parker, P.E. and Gottwald, T.R. 2005. The
effect of simulated wind-driven rain on duration
and distance of dispersal of Xanthomonas
axonopodis pv citri from canker infected citrus
trees. Plant Disease 89:71-80.
Bock, C.H., Graham, J., Gottwald, T.R., Cook, A.Z.
and Parker, P.E. 2010a. Wind speed effects on
the quantity of Xanthomonas citri sub sp. citri
dispersed downwind from canopies of grapefruit
trees infected with citrus canker. Plant Disease 94:
725-736.
Bock, C.H., Graham, J.H., Gottwald, T.R., Cook, A.Z.
and Parker, P.E. 2010b. Wind speed and wind
associated injury affect severity of citrus canker
on Swingle citrumelo. European Journal of Plant
Pathology 128:21-38.
Fitt, B.D.L., Gregory, P.H., Todd, A., McCartney, H.A. and
MacDonald, O.C. 1987. Spore dispersal and plant
disease gradients, a comparison between two
empirical models. Journal of Phytopathology 118:
227-242.
Gottwald, T., Graham, J., Bock, C.H., Bonn, G., Civerolo,
E., Irey, M., Leite, R., Lopez, M., McCollum, G., Parker,
P., Ramallo, J., Riley, T., Schubert, T., Stein, B. and
Taylor, E. 2009. The epidemiological significance
of post-packinghouse survival of Xanthomonas
citri ssp. citri for dissemination of Asiatic citrus
canker via infected fruit. Crop Protection: 28:508524.
Irey, M., Gottwald, T.R., Graham, J.H., Riley, T.D. and
Carlton, G. 2006. Post-hurricane analysis of
citrus canker spread and progress towards the
development of a predictive model to estimate
disease spread due to catastrophic weather
events. Online. Plant Health Progress doi:10.1094/
PHP-2006-0822-01-RS.
Schubert, T., Shabbir, J., Rizvi, A., Sun, X., Gottwald, T.R.,
Graham, J.H. and Dixon, W.N. 2001. Meeting the
challenge of eradicating citrus canker in Florida again. Plant Disease, 85:340-356.
Serizawa, S. and Inoue, K. 1974. Studies on citrus
canker, Xanthomonas citri. III. The influence of
wind on the infection of citrus canker. Bulletin of
Schizuoka Prefecture Citrus Experiment Station
11:54-67.
31
Talk 8
Maps of zones of risk epidemics
and agriculture climatical zoning of the
citrus canker in the State of São Paulo
Lopes, ML1
Barreto, M1
Scaloppi, EAGS2
Barbosa, JC1
Brunini, O3
Faculdade de Ciências Agrárias e Veterinárias. Universidade Estadual Paulista. V.A. Prof. Paulo D. Castellane, s/n. 14.884-900. Jaboticabal, SP, Brasil
2
APTA/PRDTA Centro Leste. Av. Bandeirantes. 14030-670. Ribeirão
Preto/SP, Brasil
3
Instituto Agronômico de Campinas - IAC/APTA/SAA. Caixa Postal 28.
13001-970. Campinas, SP, Brasil.
1
The citrus canker, caused by the bacterium
Xanthomonas axonopodis pv. citri Valterin et alii
1995, is a known disease world-wide known and it is
always a serious threat for the brazilian citriculture.
The objective of the present study was to analyze the
climatic conditions of the State of São Paulo in order
to develop zone maps of great risk for citrus canker
epidemics. They had been used given meteorological
referring from the years 2002 to 2005, which had
been used in the model of forecast of citrus canker
developed by Campbell and Madden in 1990 (1) and
Hau and Kranz in 1990 (2). The data frequency was
in hourly. After the accounting of the indexes had
been calculated the percentages of days favorable
to the occurrence of the disease in the period of one
year. From this information, the thematic maps of the
state of São Paulo had been generated, with the space
distribution of the percentage of days favorable to the
occurrence of citrus canker. The region the northwest
region of the state was the one that presented
the greatest percentage of days favorable to the
occurrence of the disease (Fig. 1).
Fig. 1 - Percentage of days favorable to the occurrence of
citrus canker in São Paulo State. Years 2002 to 2005.
References
1. Campbell, C.L.; Madden, L.V. 1990. Introduction
to plant disease epidemiology. NY: John Willey,
p.329-52.
2. Hau, B.; Kranz, J. 1990. Mathematics and statistics
for analysis in epidemiology. In: Kranz J., (Ed.).
Epidemics of plant diseases. Mathematical analysis
and modeling. Berlin: Springer, p.12-52.
32
Diagrammatic scale to assess
citrus canker severity on mature
sweet orange fruit
Talk 9
Braido, R1
Gonçalves-Zuliani, AMO1
Belasque Jr, J2
Janeiro, V3
Carvalho, SA4
Zanutto, CA1
Nunes, WMC1
1 – Núcleo de Pesquisa em Biotecnologia Aplicada – NBA. Universidade Estadual de Maringá.
2 – Fundecitrus.
3 – Departamento de Estatistica – UEM.
4 – CCSM/IAC. e-mail: ricardo-braido@ig.com.br
Summary
The citrus canker is a major disease of citrus
cultivation in the world. The assessment of disease
in fruit is necessary to compare the resistance of
genotypes or the efficiency of control methods. Due to
the lack of easy and standardized method to quantify
the severity of citrus canker on fruit we developed
and tested a diagrammatic scale with five levels of
disease severity (0.7, 2.0, 7.0, 21.0, and 39.0%). The
scale was validated by fifteen evaluators based on 40
digitized images of mature fruit, which had different
levels of severity. The accuracy and precision of the
estimations of each rater were determined by linear
regression between the predicted and real severity,
with and without the aid of the diagrammatic scale.
The evaluators were more accurate and precise with
the help of the diagrammatic scale.
Keywords: citrus canker, Xanthomonas citri subsp.
citri.
Introduction
Citrus canker caused by Xanthomonas citri
subsp. citri [7] is one of the most important diseases
of citrus cultivation. This disease induces symptoms
such as erumpent lesions on branches, leaves, and fruit
[2]. Disease control can be run through eradication
and exclusion, as in the São Paulo State [4], or through
the cultivation of resistant varieties of sweet orange
(Citrus sinensis L. Osbeck) and mandarin [1, 3, 4, 5,
8], in a disease management with windbreaks and
frequent copper sprays, as in Southern Brazil [5].
Severity estimation is one of the most
important practices on comparisons of control
measures and also genetic resistance for citrus canker.
Easy and standardized methods for the estimation of
citrus canker severity on citrus fruit are not available.
In the present work we developed and tested a
diagrammatic scale to evaluate citrus canker severity
on mature Sweet orange fruit.
Material and Methods
We developed a diagrammatic scale with
five levels of disease severity: 0.7, 2.0, 7.0, 21.0, and
39.0%, based on the minimum and maximum values
found in field surveys. The logarithmic increments
of the severity levels of the scale were based on the
Weber-Fechner Law.
Fifteen evaluators estimated the severity of
citrus canker of 40 images of sweet orange fruit without
and with, respectively, the help of the diagrammatic
scale. A linear regression where applied considering
the real severity as the independent variable and
estimated severity the dependent variable using the
33
Figure 1. Diagrammatic scale for estimation of citrus canker severity on mature citrus fruit.
statistical software 2.12.2 R (R Foundation, 2011).
The precision of the estimations was determined by
the t test (5%) applied to the angular (β) and linear
(α) coefficients. The accuracy was determined by the
coefficient of determination (R2) and the distribution
of the residuals (estimated severity minus real
severity).
Results and Discussion
Without the use of diagrammatic scale, the
values of β for evaluators 1, 8, 9, 10, 13, 14, and
15 were significantly different from the value 1,
indicating the presence of systematic biases and
imprecise estimations. Evaluators 3, 5, and 12 had α
significantly different from zero (Table 1). With the
use of diagrammatic scale only the evaluators 4, 7,
and 8 showed the β significantly different from value
1 (Fig. 2). Without the help of scale the evaluators
showed a relatively good accuracy as indicated by
the R² coefficient (from 0.59 to 0.86, mean 0.76).
However, the accuracy of the evaluators improved
when they used the diagrammatic scale (R² values
from 0.88 to 0.97, mean 0.94) and better residues
distribution (Fig. 3).
References
Croce Filho, J., 2005. Avaliação do cancro cítrico em
variedades de citrus em condições de campo no
noroeste do Paraná. [Dissertação de Mestrado]
Univ. Est. de Maringá.
Cubero, J. et al. 2011. Unstable green fluorescent
protein for study of Xanthomonas citri subsp. citri
survival on citrus. Plant Pathology. v. 60, p. 977985.
Gonçalves, A.M.O. et al. 2010. Avaliações de variedades
de laranja doce Citrus sinensis quanto à resistência
ao cancro cítrico. Tropical Plant Pathology, v.35, p.
154, (Suplemento).
Table 1. Coefficients of linear regression obtained
between real and estimated severity from 15
evaluators.
Without scale
With scale
Evalu
ators
β
α
R²
β
α
R²
1
0,80* -0.35 0.59
1.06 -0.27 0.96
2
0.89 -1.77 0.81
1.01 0.07 0.97
3
0.86 3.46* 0.83
1.00 0.57 0.93
4
0.89 -1.84 0.86 0.93* 0.35 0.95
5
0.83 -2.43* 0.84
0.94 0.26 0.93
6
0.93 -0.47 0.84
1.03 0.31 0.97
7
0.84 0.06 0.65 1.12* -0.06 0.92
8
1.25* 0.50 0.73 1.18* 0.17 0.95
9
0.77* -1.49 0.73
1.11 -0.17 0.90
10
1.27* 0.03 0.77
0.99 -0.80 0.88
11
0.86 -0.78 0.80
1.04 -0.41 0.93
12
0.89 -2.20* 0.79
1.06 -0.20 0.95
13
0.81* -0.16 0.68
0.98 -0.50 0.94
14
0.74* 0.24 0.77
1.00 0.05 0.95
15
0.79* -0.20 0.75
1.06 0.22 0.92
Mean
0.87 -0.41 0.76
1.02 -0.33 0.94
Values with (*) indicates that the angular and linear
coefficients of the line (α and β) were significantly different
from 1 and 0 respectively by T test (5% probability).
Gonçalves-Zuliani, A.M.O. et al. 2011. Resistência
de diferentes clones de pêra (Citrus sinensis) à
Xanthomonas citri subsp. citri em condições de
campo na região noroeste do Paraná. v.36, p. 1062,
(Suplemento).
Leite Jr, R.P. et al. 1987. Controle integrado de cancro
cítrico – efeito da resistência genética e da
aplicação de bactericidas. Fitopatologia Brasileira
vol. 12, p. 257-263.
Massari, C.A., Belasque Jr. J. 2006. A campanha de
erradicação do cancro cítrico no Estado de São
34
Figure 2. Linear regressions representing the estimates of
severity in mature fruit by 15 evaluators with the aid of the
diagrammatic scale.
Figure 3. Distribution of residuals without the scale and
with diagrammatic scale.
Paulo - Situação atual e contaminação em viveiros.
Laranja vol. 27, p. 41-55.
Schaad, N.W. et al. 2006. Emended classification of
xanthomonad pathogens on citrus. Systematic and
Applied Microbiology, v. 29, n. 8, p. 690-695.
Vargas, R.G. 2008. Resistência de variedades de
Citrus sp. à Xanthomonas axonopodis pv. Citri em
condições de campo na região noroeste do estado
do Paraná. [Dissertação de Mestrado] Univ. Est. de
Maringá.
Session 3 – Citrus canker control
37
Comparison of copper formulations Talk 10
for management of citrus canker on
‘Hamlin’ Orange in Florida
Graham, J1
Dewdney, M1
Yonce, H2
1 - University of Florida, IFAS, Department of Plant Pathology,
Citrus Research and Education Center, Lake Alfred, FL 33850
2 - KAC Agricultural Research, Inc., Deland, FL 32720 USA
Among sweet orange cultivars grown in Florida,
canker is most severe on early season varieties
including ‘Hamlin’, ‘Pineapple’, and Navels. Trees are
most susceptible in the young fruiting stages as they
have the highest proportion of susceptible vegetative
flush per volume of tree canopy and are vulnerable to
windblown rain due to the wide spaces between trees
and opportunity for wind penetration of the grove
area. At this stage, trees require multiple insecticide
applications to control citrus leafminer (Phyllocnistis
citrella) and prevent damage of emerging leaf flush
that predisposes them to canker infection (4) and
copper bactericide sprays to protect the fruit (1).
Copper applications are made to sweet oranges from
the time fruit are 0.5 to 1.0 cm diameter as stomates
open until fruit reach a diameter at which they become
more resistant to infection. Copper should be applied at
least every 21 days due to the effect of fruit growth on
coverage of the surface with copper residues (1,3). The
average number of copper sprays needed depends on
many factors including the susceptibility of the citrus
cultivar and environmental conditions such as wind
exposure of the grove site, and may range from 2 to 7
sprays per season. Several studies have compared the
efficacy of different copper formulations for control of
citrus canker and found only minor differences related
to rate of metallic copper (4). Fixed forms of copper
such as copper hydroxide, copper oxychloride, basic
copper sulfate, and copper oxide are the formulations
most widely used (4). Frequent copper applications for
fungal and bacterial disease management in citriculture
may have adverse effects on the environment as a result
of accumulation in the soil and potential effects on tree
health. The objective of this study was to compare the
efficacy of copper formulations, rates and number of
21-day interval sprays for control of canker on ‘Hamlin’
orange, the most important early season orange cultivar
in Florida.
Methods
A grove of 6-8 year-old bearing ‘Hamlin’ orange
(C. sinensis) trees located in Hardee Co., Florida was
selected for the trial. The tree spacing was typical for
‘Hamlin’ orange trees on Carrizo citrange (Poncirus
trifoliata × C. sinensis) rootstock, 3.65 m x 7.62 m (358
trees/ha). The experiment was set up as a randomized
complete block design with four blocks of five trees
(20 trees/treatment). Sprays were applied at ~1500
liters/ha using an airblast sprayer at a 21-day interval
from April to September depending on the experiment.
In experiment 1, different formulations and rates of
copper (Table 1) were compared with an untreated
check (UTC) with five sprays/treatment. In experiment
2, either 4, 5, 6, or 7 sprays of Kocide 3000 at 2.24 kg/
ha were applied compared to an UTC. All fruit on the
ground under the middle three trees in each block
was collected periodically and evaluated for cause of
fruit drop. Prior to harvest, the incidence of fruit with
canker lesions was evaluated each season. The lesion
age was assessed for 100 fruit collected from both
sides of the middle three trees (50 fruit/side). Lesions
were classified as “old” if they were larger than 0.6 cm
in diameter, coalescing with surrounding lesions, or
having a prominent yellow halo; and “young” if lesions
are smaller than 0.6 cm in diameter, brown, and not
coalescing with surrounding lesions.
38
Results
2008 trials. In experiment 1, all copper
formulations, except Cuprofix at the 1.68 and 1.26
kg/ha rates and Magna-Bon, significantly reduced the
incidence of fruit with total and old lesions compared
to the UTC (Table 1). Reduction of new lesions was
much more variable. Treatment blocks with highest
fruit infection were those exposed to early season
wind-blown rains from the southeast direction. Early
season rainfall produced infection of very small fruit
(0.6 to 1.0 cm diam.) that resulted in heavy premature
fruit drop in May. Most of the copper treatments except
Cuprofix at the 1.26 and 1.68 kg/ha rates significantly
reduced cumulative fruit drop due to canker. There
was a significant correlation between total canker fruit
incidence and cumulative fruit drop (r = 0.83, t = 4.62,
P < 0.05). The estimated fruit loss in the UTC trees
was one 40 kg box/tree and on average the copper
treatments reduced fruit drop to 0.5 of a box/tree (Fig.
1). In experiment 2, four sprays of Kocide 3000 at 2.24
kg/ha rate significantly reduced the incidence of total
infected fruit and fruit with new lesions whereas, five to
seven sprays did not. The majority of the fruit infection
was early and no treatment reduced incidence of fruit
with old lesions or cumulative fruit drop compared to
the UTC.
2009 trial. In experiment 1, applications of
copper formulations significantly reduced incidence
of total fruit infection compared to UTC-1, but not
UTC-2 (Table 2). No copper formulation or rate
treatment differed from the others except the three
Magna-Bon treatments which were not significantly
different (P < 0.05) from either UTC. Cumulative fruit
drop was significantly reduced by copper treatments
compared to UTC-2 but not UTC-1. As in 2008, there
was a significant correlation between total canker fruit
incidence and cumulative fruit drop (r = 0.57, t = 2.56,
P < 0.05). The estimated fruit loss due to canker in the
two UTC was 0.3 box/tree, and on average, the copper
treatments reduced fruit drop to ~ 0.15 box/tree (Fig.
1). In experiment 2, four to seven applications of Kocide
3000 at the 2.24 kg rate did not reduce fruit lesion
incidence or fruit drop due to canker compared to the
UTC.
2010 trial. Several of the copper formulations
treatments significantly reduced the incidence of
total, new and old lesions on fruit compared to UTC2 whereas none were different from UTC-1. The least
effective treatments were Kocide 3000 applied twice at
1.12 kg/ha, Cuprofix at 1.26 kg/ha and the two MagnaBon treatments (Table 3). Cumulative fruit drop due
to canker was not significantly different from the two
Table 1 – Effect of sprays of copper formulation on the total number of canker lesions on fruit, number of
old and new lesions, and on cumulative number of fruit dropped due to canker from June to September for
6-yr-old ‘Hamlin’ orange trees in Hardee Co., FL in 2008. Means followed by different letters are significantly
different at P ≤ 0.05 as determined by a t-test for pair-wise comparisons.
Treatment
Untreated check
Kocide 3000 (2.0 lb)
Cuprofix Ultra 40 (1.75lb)
Champ DP (1.6lb)
Kentan DF (1.5lb)
Badge SC (2.1pt)
Badge X2 (2.14lb)
Magna-Bon
Copper formulation
(% Metallic Cu)
--Copper hydroxide (0.30)
Copper hydroxide (0.30)
Copper sulfate (0.40)
Copper hydroxide /Copper
oxychloride (0.20)
Copper hydroxide /Copper
oxychloride (0.28)
Copper sulfate pentahydrate
-2.24
1.68
1.12
1.96
1.68
1.26
1.8
1.68
2.46L
-0.67
0.50
0.34
0.78
0.67
0.50
067
0.67
0.67
71.8e
54.0abcd
40.8a
52.5abcd
44.3ab
64.3de
61.5cde
50.1abcd
42.8ab
49.0abcd
Fruitw/
old
lesions
(%)
18,5c
11.5b
4.3a
7.3ab
6.5ab
11.0b
10.8ab
9.0ab
6.3ab
6.0ab
2.5L
0.16
58.3bcde
9.8ab
Rate
(kg/
ha)
Metallic Fruit w/
Cu
lesions
(Kg/ha)
(%)
2.4
0.67
48.0abc
9.5ab
Fruit
w/new
lesions
(5)
53.3c
42.5abc
36.5a
45.2abc
37.8a
53.3c
50.8bc
41.1abc
36.5a
43.0abc
830d
503abc
210a
432ab
357ab
768cd
529bcd
437ab
483abc
402ab
48.5abc
456ab
38.5ab
Curn
fruit
drop
429ab
39
Table 2 – Effect of sprays of copper formulation on the total canker lesions incidence on the total number of canker lesions
on fruit, number of old and new lesions, and on cumulative number of fruit dropped due to canker from June to September
for 7-yr-old ‘Hamlin’ orange trees in Hardee Co., FL in 2009. Means followed by different letters are significantly different
at P ≤ 0.05 as determined by a t-test for pair-wise comparisons.
Rate Metallic Fruit w/ Fruit w/
Fruitw/
Cum
Copper formulation
Treatment (lbs/acre)
(kg/
Cu
lesions old lesions
new
fruit
(% Metallic Cu)
ha) (Kg/ha)
(%)
(%)
lesions (5) drop
Untreated check 1
------45.2d
11.0d
34.2c
130bcd
Untreated check 2
------33.0bcd
7.4abcd
25.6abc
183d
Kocide 3000 (2.5)
2.80
0.84
224ab
5.4abc
17.0a
98ab
Kocide 3000 (2.0)
2.24
0.67
23.6ab
5.6abcd
18.0a
82ab
Kocide 3000 (1.5)
1.68
0.50
214ab
5.6abcd
15.8a
115abc
Kocide 2000 (3.0)
5.04
1.76
214ab
4.0ab
17.4a
95ab
Kocide 2000 (2.5)
4.20
1.47
21.8ab
4.4ab
17.4a
75a
Cuprofix Ultra 40 (1.875) Copper sulfate (0.40)
2.10
0.84
19.2a
5.6abcd
13.6a
69a
Cuprofix Ultra 40 (1.5)
1.68
0.67
27.4abc
8.0abcd
19.4ab
85ab
1.26
0.50
20.0ab
24a
17.6a
90ab
Champ DP (2.0)
2.24
0.84
28.0abc
6.4abcd
21.6ab
89ab
Kentan DF (1.5)
1.68
0.67
21.6ab
3.8ab
17.8a
89ab
Badge X2 (2.68)
Copper hydroxide/Copper
3.0
0.84
22.6ab
6.8abcd
15.8a
120abc
oxychloride (0.28)
Copper sulfate pentahydrate 6.27L
0.40
40.8cd
9.8cd
31bc
91ab
Magna-Bonx
0.40
40.6cd
10.4d
30.2bc
164cd
Magna-Bony
0.16
33.2bcd
9.2bcd
24abc
120abc
Magna-Bonz
x - 250 ppm for all applications, y - 250 ppm on 4/8, applications alternated with Magna-Bon 47 nutritional, z - 250 ppm
on 4/8, 200 ppm on 4/29, 100 ppm for rest of application.
Table 3 – Effect of sprays of cooper formulations on total number of canker lesions on fruit, number of old and new lesions,
and on cumulative number of fruit dropped due to canker from June to September for 8-yr-old ‘Hamlin’ orange trees in
Hardee Co., FL in 2010. Means followed by different letters are significantly different at P ≤ 05 as determined by a t-test
for pair-wise comparisons.
Fruit
Rate Metallic Fruit w/
Fruit w/
Cum
Copper formulation
w/new
Treatment (lbs/acre)
(kg/
Cu
lesions old lesions
fruit
(% Metallic Cu)
lesions
ha) (Kg/ha)
(%)
(%)
drop
(5)
Untreated check 1
------48.8
17.2
31.6c
105a
Untreated check 2
------40.9abc
20.4c
20.4abc
108a
Kocide 3000 (2.5)
2.80
0.84
25.8ab
8.8a
17.0abc
78a
Kocide 3000 (2.0)
2.24
0.67
23.2a
9.8a
13.4a
76a
Kocide 3000 (1.5)
1.68
0.50
28.4ab
10.8ab
17.6abc
113a
Kocide 3000 (1.0) 2 apps Copper hydroxide (0.30)
1.12
0.34
42.2bc
12.2ab
30.0bc
97a
Kocide 2000 (3.0)
4.20
1.47
30.6abc
10.0ab
20.8abc
94a
2.10
0.84
24.2ab
11.6ab
12.6a
80a
Cuprofix Ultra 40 (1.5)
1.68
0.67
27.4ab
10.8ab
16.6ab
109a
1.26
0.50
40.6bc
11.8ab
28.8bc
99a
Champ 30 DP (2.5)
2.80
0.84
29.0ab
9.2a
20.0abc
83a
Champ 30 DP (2.0)
2.24
0.67
29.8ab
8.8a
21.0abc
75a
Kentan DF (2.625)
2.94
1.18
32.8abc
8.4a
24.4abc
78a
Badge X2 (2.68)
Copper hydroxide/Copper
3.0
0.84
29.ab
9.0a
20.0abc
77a
oxychloride (0.28)
y
0.40
35.8abc
11.6ab
24.2abc
108a
Magna-Bon
0.16
41.8abc
14.4abc
27.4abc
108a
Magna-Bonz
40
UTCs. The estimated fruit loss due to canker in the UTC
trees was approximately 0.25 box/tree. On average the
standard copper treatments reduced fruit drop to ~ 0.1
box/tree (Fig. 1).
1.2
without copper
with copper
1.0
Boxes/tree
0.8
0.6
0.4
0.2
0.0
2008
2009
2010
Year
Fig. 1. Crop loss in 40 kg boxes for 6- to 8-year-old ‘Hamlin’
orange trees sprayed with various copper formulations and
rates (with copper) or left untreated (without copper).
Discussion
In the evaluation of 6 to 8 year-old ‘Hamlin’
trees, fruit drop was related to early season infection
that occurred as fruit reached 0.5 cm to 4.0 cm
diameter. Copper sprays applied during this fruit
development period and before early rain events in
the spring were effective for reducing early season
infection and fruit drop. In contrast, copper sprays
applied after March through April rains in 2008 were
ineffective for preventing early season drop confirming
that copper films on the surface of the fruit have no
curative activity once bacteria penetrate the fruit rind.
No more than four sprays were necessary to achieve
control and prevent crop loss because later season fruit
infections, although higher in incidence, did not cause
fruit drop compared to infections that occurred before
July. In early August 2008, Tropical Storm Fay produced
several hours of windblown rain and as predicted,
high levels of fruit infection (1). The resulting high
incidence of late season fruit infection did not cause
appreciable premature drop when fruit on the ground
were inspected according to age (size) of the lesions.
Copper formulations varied little in their effectiveness
when used at the proper rate and timing. Rates of 0.5
to 1.0 kg/ ha metallic copper were efficacious, whereas,
Magna-Bon at ~30% the metallic copper of the other
materials was less effective. When applied in 11 sprays
per season on grapefruit, Magna-Bon was as effective
for canker control as the standard copper formulations
(3). Therefore, Magna-Bon at a lower metallic rate per
application may require more frequent sprays than
every 21 days to obtain effective disease control on
early season oranges. As trees developed hedgerows
from age 6- to 8-years-old, they become more resistant
to canker probably due to reduction in flush per volume
of tree and penetration of the grove by windblown rain.
Fewer copper sprays are needed after tree canopy
closure creates an ‘internal windbreak’ effect. Hence,
optimal spacing of trees according to rootstock vigor
and site conditions for tree development is important
to promote canopy closure as rapidly as possible.
Literature cited
1. Behlau F., Belasque Jr., J., Graham, J.H., and Leite Jr.,
R.P. 2010. Effect of frequency of copper applications
on control of citrus canker and the yield of young
bearing sweet orange trees. Crop Prot. 29:300-305.
2. Bock, C.H., Graham, J.H., Gottwald, T.R., Cook, A.Z.,
and Parker, P.E. 2010. Wind speed and windassociated leaf injury affect severity of citrus canker
on Swingle citrumelo. Eur. J. Plant Pathol. 128:2138.
3. Graham, J.H., Dewdney, M.M., and Myers, M.E. 2010.
Streptomycin and copper formulations for control
of citrus canker on grapefruit. Proc. Fla. State Hort.
Soc. 123:92-99.
4. Stein, B., Ramallo, J., Foguet, L., and Graham, J.H.
2007. Citrus leaf miner control and copper fungicide
sprays for management of citrus canker on lemon
in Tucumán, Argentina. Proc. Fla. State Hort. Soc.
120:127-131.
41
Systemic acquired resistance for Talk 11
bacterial canker disease managment
in citrus
Graham, J1
Myers, M1
Mou, Z2
1 - University of Florida, Citrus Research and Education Center,
Lake Alfred, 33850
2 - University of Florida, Dept. Microbiology and Cell Science,
Gainesville, FL 32611, USA
There are no highly effective canker disease
suppression tactics for susceptible cultivars of citrus
when the crop is grown in wet subtropical areas like
Florida. Copper reduces bacterial populations on
leaf surfaces, but multiple applications are needed
to achieve adequate control on susceptible citrus
hosts. Disadvantages for long-term use of copper
bactericides include the selection for copper resistance
in xanthomonad populations and accumulation of
copper in citrus soils with potential phytotoxic and
adverse environmental effects. However, other contact
bactericides are not as effective as copper because
they lack sufficient residual activity to protect leaf
and fruit surfaces for extended periods.
Systemic acquired resistance (SAR) is an innate
plant defense that may confer long-lasting protection
against a broad spectrum of microorganisms. Plants
acquire an enhanced defensive capacity against
subsequent pathogen attack as a result of induction
by primary, limited pathogen infection. SAR requires
the signal molecule salicylic acid (SA) and is
associated with the accumulation of pathogenesisrelated (PR) proteins, which are thought to contribute
to resistance. SAR may be activated in the absence
of pathogens by treatment of plants with chemical
inducers. Acibenzolar-S-methyl (ASM, Actigard®
or Bion®, Syngenta Crop Protection), a functional
homolog of salicylic acid, is the most widely known
commercially-produced inducer of SAR.
Chemical induction of SAR in citrus
ASM and other commercial inducers of
resistance have been extensively evaluated as a
component for plant disease control in the field,
however their effectiveness for practical application
in disease management has been questioned due
to variability of control. Field studies showing
promise for control of bacterial diseases have been
conducted with foliar sprays of ASM either alone or in
combination with copper on tomato and pepper. For
citrus, foliar application of ASM was effective against
citrus canker under greenhouse conditions, but foliar
sprays of ASM combined or alternated with copper
did not contribute to control of canker on sweet
orange trees in field trials (3).
In citrus, soil application of the neonicotinoid,
imidacloprid (IMID), involves the use of this
insecticide for citrus bacterial disease management
through the control of the interaction of citrus
leafminer (Phyllocnistis citrella) with Xcc or X. alfalfae
pv. citrumelonis, the cause of citrus bacterial spot in
Florida citrus nurseries. Reduction in the incidence of
foliar lesions for weeks was not due to the prevention
of exacerbation of citrus bacterial spot by leafminer
as foliar insecticides were applied to control
leafminer damage (3). Likewise, incidence of canker
lesions on foliage of young sweet orange trees in
the field was suppressed for months in Brazil where
foliar insecticides were applied to control leafminer.
IMID breaks down in planta into 6-chloronicotinic
acid, an analog of INA which induces SAR response.
In a greenhouse pot trial, soil drenches of IMID as
well as INA and ASM induced a high and persistent
up-regulation of PR-2 gene expression that was
42
correlated with reduction of canker lesions for up to
24 weeks compared to 4 weeks for inoculated plants
sprayed with ASM (1). Canker lesions on leaves of SARtreated citrus seedlings were small, necrotic, and flat
compared to pustular lesions on untreated inoculated
plants. Population of Xcc per leaf was reduced 1 to 3
log units in plants treated with soil applications of
ASM compared to untreated plants.
Soil applications of SAR inducers at various
rates and application frequencies were evaluated
for control of canker in a field trial of 3- and 4-yr old
‘Ray Ruby’ grapefruit trees in southeastern Florida.
Reduction of foliar incidence of canker produced by
one, two or four soil applications of the neonicotinoids,
IMID and thiamethoxam (THIA), or ASM was
compared with 11 foliar sprays of copper hydroxide
and streptomycin applied at 21-day intervals. In
2008 and 2009 crop seasons, canker incidence on
each set of vegetative flushes was assessed as the
percentage of the total leaves with lesions (4). By
the end of the 2008 season, despite above average
rainfall and a tropical storm event, all treatments
significantly reduced foliar incidence of canker on
the combined Spring-Summer-Fall flushes. Sprays of
copper hydroxide and streptomycin were effective
for reducing canker incidence on shoot flushes
produced throughout the season compared to the
untreated control, whereas soil applied SAR inducers
reduced foliar disease depending on rate, frequency
and timing of application. Except for the treatment
of four applications of ASM at 0.2 g a.i. per tree or
two applications of imidacloprid, SAR inducers were
ineffective for reducing foliar disease on the flushes
that were present during the tropical storm. In 2009,
all treatments significantly reduced the incidence of
foliar canker on the combined Spring-Summer-Fall
flushes but not all treatments of Spring-Summer
flushes with SAR inducers were effective compared
to the untreated control. Hence, depending on rate,
frequency and timing of application, soil-applied SAR
inducers reduced incidence of canker on foliar flushes
of young grapefruit trees under epidemic conditions
(4).
While soil application of systemic neonicotinoid insecticides has been demonstrated
in our field trials to induce SAR and provide long
lasting canker control for non-bearing trees, use of
these systemic insecticides at higher rates for young
fruiting trees is restricted due to perceived risks for
soil leaching and insecticide residues in flowers. An
objective of current field research is to develop more
effective suppression of Xcc and fruit infection using
trunk applications of non-insecticidal SAR inducers.
A preliminary trial with young fruiting trees showed
the efficacy of trunk application as an alternative to
soil application on young fruiting trees. Applications
of imidacloprid at 2X the label rate per season to
compensate for the larger tree volume produced
canker control on foliage and fruit that matched
that of 6 sprays of copper. Trunk application was as
effective for canker control as soil application (Table
1).
Transgenic enhancement of SAR in citrus
Arabidopsis NPR1 gene (AtNPR1) has been
well established as a key positive regulator of SAR,
Table 1. Trunk and soil applications of imidacloprid (Admire Pro) at 28 oz/acre compared to six sprays of copper
for control of citrus canker on foliage and fruit of 4-yr old Hamlin orange trees at Arcadia, FLt
Canker fruit drop Phytotoxicity symptom
Fruit disease
Treatments
Canker foliar
rating (1-4) x
rating (1-3)y
incidence (%)z
rating (1-5)w
Copper sprayu
2.3 a
1.4 b
1.0 a
65.8 a
2.7 a
1.8 ab
1.2 a
75.2 a
Admire soilv
2.3 a
2.0 a
1.1 a
68.1 a
Admire trunkv
t - Values are the means of 4 replicate plots of 28 trees. Different letters indicate significant differences at P< 0.05% according
to Waller-Duncan multiple range test.
u - Copper applied with an air-blast sprayer on 4/23,5/14,6/5,6/30,7/21,9/1.
v - Admire applied to the soil or trunk at 14oz/acre with a surfactant (Kinetic) on 5/5 and with a penetrant (Pentrabark) on
7/29
w - Rating of incidence of canker-affected foliage: 1= 1-20%, 2= 21-40%, 3= 41-60%, 4= 61-80%, 5= 81-100%x - Estimation
of fruit dropped under the canopy: 1= low, 2= medium, 3= high, 4= very high.
y - Rating of interveinal chlorosis: 1= none, 2= mild, 3= severe.
z - Percentage fruit with lesions (50 fruit per 5 trees per plot).
which acts downstream of the signal molecule SA.
Mutations in NPR1 not only block SA-induced PR gene
expression and SAR, but also increase susceptibility
to pathogens. In contrast, overexpression of AtNPR1
in transgenic Arabidopsis enhances resistance to
bacterial and oomycete pathogens. The enhanced
resistance is associated with a faster or stronger
response of thetransgenic plants to pathogen infection
and the SAR signal molecule SA. Overexpression of the
AtNPR1 gene or its orthologs also enhances disease
resistance in many crop plants including rice, wheat,
rapeseed, tomato, and apple. Interestingly, overexpression of AtNPR1 in most plant species does not
cause obvious detrimental effects on plant growth and
development, which makes AtNPR1 a workable target
for genetic engineering of nonspecific resistance in
plants.
Using a transgenic approach to generating
‘Duncan’ grapefruit and ‘Hamlin’ sweet orange plants
expressing AtNPR1 (5). Over-expression of AtNPR1
in citrus increased resistance to citrus canker and
that the resistance was related with the expression
levels of AtNPR1 in the transgenic plants. The lines
with the highest expression level of AtNPR1 was also
the most resistant,which developed significant fewer
lesions accompanied by a ten-fold reduction in Xcc
population. The lesions developed were smaller and
darker than those on the control and lacked callus
formation. These lesion phenotypes resemble those
on canker resistant kumquats and canker susceptible
citrus trees treated with SAR-inducing compounds.
Therefore, over-expression of AtNPR1 in citrus is
43
a promising approach for development of more
resistant cultivars to citrus canker.
Literture cited
1. Francis, M.I., Peña, A. and Graham, J.H. 2010.
Detached leaf inoculation of germplasm for rapid
screening of resistance to citrus canker and citrus
bacterial spot. Eur. J.Plant Path. 124:283-292.
2. Graham, J.H., and Leite Jr., R.P. 2007. Soil-applied
neonicotinoids for control of bacterial diseases on
young citrus trees. Proc. Intl. Wkshp. PR-Proteins
and Induced Resistance Against Pathogens and
Insects. Doorn, The Netherlands. p. 107.
3. Graham, J.H. and Leite, R.P. 2004. Lack of control
of citrus canker by induced systemic resistance
compounds. Plant Dis. 88:745-750.
4. Graham, J.H. and Myers, M.E. 2010. Soil application
of imidacloprid, thiamethoxam and acibenzolar-Smethyl for induction of SAR to control citrus canker
in young grapefruit trees. Plant Dis. 95:725-728.
5. Zhang, X., Francis, M.I., Dawson, W.O., Graham,
J.H., Orbovic V., Triplett, E.W., Mou, Z. 2010.
Overexpression of Arabidopsis NPR1 gene in
citrus increases resistance to citrus canker. Eur. J.
Plant Path. 128:91-100.
44
Copper bactericides for control
of citrus canker: Is there room for
improvement?
Talk 12
Behlau, F
Silva, TG da
Belasque Jr, J
Fundecitrus - Fundo de Defesa da Citricultura. Av. Adhemar Pereira
de Barros 201, 14807-040. Araraquara, SP, Brazil. Email: franklin@
fundecitrus.com.br
Efficiency
The use of copper-based bactericides for
management of citrus canker (Xanthomonas citri
subsp. citri [Xcc]) under endemic conditions has been
one of the main measure adopted by citrus growers
for control of the disease in these areas. The lack of
alternative products and the relative, satisfactory
efficiency of copper bactericides are the reasons for
the unchanged, persistent use of these bactericides in
the last decades. Several studies have been conducted
in order to evaluate the most efficient rate, timing of
spray, active ingredient (i.e. copper hydroxide [CH],
copper oxychloride [CO]) for control of citrus canker
on leaves and fruits (2, 3, 5, 8, 9, 10, 11, 14). In all
these studies, irrespective of the number of sprays in
a season, copper-treated trees presented consistently
lower incidence of citrus canker (Fig. 1). Linear
regression analysis using a series of 85 data pair from
the aforementioned publications demonstrated that
the reduction of the disease due to copper sprays in
comparison to untreated control is proportionally
constant regardless the disease incidence (Fig. 1a,
c, d, e, f), the organ affected (i.e. leaf, fruit) (Fig. 1c,
d), and the active ingredient used (i.e. CH, CO) (Fig.
1e, f). Coefficients of determination (R2) between
disease incidence on copper treated trees and
untreated control trees were statistically significant
(P < 0.0001) for all the comparisons involving copper
treated and non-treated trees studied and ranged
from 0.61 to 0.82. The data also reveals that copper
sprays are more efficient for reducing the disease
on leaves as compared to fruits. At high incidences
of citrus canker on untreated trees (> 60%), the
incidence of the disease on treated leaves was never
higher than 37% of affected leaves, resulting in a
calculated slope in the regression analysis of 0.30. In
contrast, the incidence of copper treated fruits with
citrus canker was as high as 64% with a slope of 0.67
(Fig. 1c,d). When comparing the active ingredient
used, the level of disease control on trees sprayed
with CH was slightly higher than on CO-treated trees,
with the slope of 0.47 and 0.65, respectively. There
was no significant relationship (P>0.05, R2 = 0.003)
between the concentration of metallic copper (Cumet)
sprayed on the trees and the perceptual reduction
of the incidence of citrus canker on leaves and
fruits as compared to the untreated control trees
(Fig. 1b). This comparison also reveals that of the
85 data pairs analyzed, 78% presented reduction
of the incidence of citrus canker greater than 50%
in comparison with the untreated control. Of the
remaining pairs, 14% showed reduction of 30
to 50% and, for only 8% of the comparisons, the
reduction in disease control on copper-treated trees
was lower than 30%. These observations illustrate
that copper sprays have a substantial effect in
reducing the incidence of citrus canker, but clearly,
there is room for improvement, that can be achieved
either by using novel, distinguishable copper basedcompounds or by using other active ingredients, that
are yet to become a reality in the field. Moreover, there
is no information available about the effect of copper
sprays to prevent the establishment and spread of
citrus canker in canker-free groves. This subject is
important for São Paulo state and other areas where
Xcc has been recently introduced.
Perspective for improvement
As previously stated, engineering of novel
formulations of copper based bactericides may be a
way to improve the reasonable control of citrus canker
currently achieved in endemic areas with copper
bactericides. Certainly, use of wind-breaks, control of
the citrus leafminner, and use of less susceptible citrus
varieties should never be set aside. Recently, several
copper-based formulations have become available
in Brazil with the promise of being innovative and
more efficient for control of diseases affecting citrus,
including citrus canker. Among them, mention should
be given to Difere (concentrated suspension, CO,
35% Cumet), Supera (concentrated suspension, CH,
35% Cumet) and Redshield (wettable powder, cuprous
oxide, 75% Cumet). Not to mention the organic copper
formulations which have not been deeply exploited.
Based on the results of in vitro assays, we found that
the products mentioned above have some substantial
differences as far the bactericide capability against
Xcc, which suggests some potential for improving
disease control in the field. Spray mixtures of Difere,
Supera, Redshield and the wide used formulations of
Kocide WDG (water dispersible granules, CH, 35%
Cumet) and Cuprogarb 350 (wettable powder, CO, 35%
Cumet) were prepared in sterile distilled (DI) water
amended with 0.01 M of magnesium sulfate (MgSO4)
at 0, 17.5, 52.5, 82.5 and 122.5 g of Cumet 100 L-1 and
inoculated separately with a copper sensitive (CuS)
and a copper resistant (CuR) strain of Xcc at 105 cfu mL1
. At 0, ½, 1, 2, 4, and 8 h of incubation at 25 °C under
agitation, 100 µL aliquots of each mixture were plated
on Nutrient Agar (NA) medium for assessing survival
of Xcc over time. Plates were incubated at 28 °C for
96 h before assessing growth of Xcc. When challenged
with the CuS strain of Xcc, no Xcc could be recovered
after ½ h of exposure to Difere, Supera, or Redshield
for any of the concentrations of copper tested (Fig. 2a,
b). In contrast, for Kocide and Cuprogarb, CuS Xcc was
recovered after 1 and 4 h of incubation, respectively
(Fig. 2c, d, e). When CuR strain of Xcc was used, all
products had the efficiency diminished. For the
bactericides used as controls, Kocide and Cuprogarb,
none of the rates of copper tested affected the survival
of Xcc up to 8 h of exposure (Fig. 2f, g). Conversely,
Redshield was the most efficient in reducing CuR Xcc
population over time and no Xcc could be recovered
45
on NA after 2 h of exposure for any of the rates
tested (Fig. 2h). Difere and Supera presentenced
intermediary efficiency, and although some reduction
of Xcc could be observed, these bactericides did not
completely eliminate the inoculated CuR Xcc after
8 h of incubation (Fig. 2i, j). These results clearly
illustrate that the efficiency of the bactericides tested
is variable and that the novel formulations are more
efficient as bactericides against Xcc in vitro. Further,
ongoing steps of this study include testing these
bactericides in green house and in the field for control
of citrus canker.
Copper resistance
One of the consequences of the copious use
of copper bactericides for control of citrus canker is
that it may lead to the development of CuR strains of
Xcc and impair disease control, as observed for other
bacteria affecting crops (1, 6, 12, 13) CuR strains of
Xcc were first and solely isolated in Argentina from
groves located in the province of Corrientes, which
showed no response to the numerous copper sprays
used for control of recurrent outbreaks of citrus
canker (7). Molecular characterization of the genes
involved in copper resistance in one of these strains
from Argentina demonstrated that the resistance
determinants are shared with other plant pathogenic
bacteria, including X. alfalfae subsp. citrumelonis,
a bacterium closely-related to Xcc that also affects
citrus (4). Aiming at assessing whether CuR strains of
Xcc have developed in Brazil, a survey is underway in
the citrus-growing area of Paraná State, Brazil, where
copper has been sprayed for almost three decades for
control of citrus canker. Approximately 20 leaves with
symptoms of citrus canker are being sampled from
each of the 40 selected blocks. Sample processing and
plating are being conducted as described previously
(5). After assessing 24 blocks we could not isolate
any Xcc strains as resistant as the strains from
Argentina mentioned above (400 mg L-1 of copper
sulfate pentahydrate [CSP] on MGY agar) and used
as control. However, from two blocks we isolated
Xcc strains that were able to grow up to 150 ppm of
CSP. This concentration is higher than the maximum
concentration of 75 ppm usually tolerated by sensitive
strains of Xcc on MGY agar (4). PCR analysis of these
strains using primers specifically designed for the
copper resistance genes copL, copA, and copB from
Xcc (4) did not revealed the presence of these genes
in the featured strains. For instance, we presume that
46
Figure 1. Efficiency of copper bactericides for control of
citrus canker. Relationship between: the incidence of leaves
and fruits (pooled data) with citrus canker on copper treated and non-treated trees (a); the incidence of leaves (c) or
fruits (d) with citrus canker on copper treated and non-treated trees; the incidence of leaves and fruits (pooled data)
with citrus canker on trees treated with copper hydroxide
(e) or copper oxychloride-based (f) bactericides and non-treated trees; the amount of metallic copper sprayed and
the reduction of the number of leaves and fruits with citrus
canker (b). y= ax+y0, for (a), (c), (d), (e), (f) y = incidence
of citrus canker on copper treated trees as the percentage
of the number of leaves and/or fruits with citrus canker, y0
= intercept at y, a = linear coefficient, and x = incidence of
citrus canker on non-treated trees as the percentage of the
number of leaves and/or fruits with citrus canker; for (b)
y = reduction of the incidence of the number of leaves and
fruits with citrus canker on copper treated trees in comparison with the untreated control y0 = intercept at y, a =
linear coefficient, and x = amount of metallic copper (Cumet)
sprayed in g L-1.
Figure 2. Percentage of the log10 population of Xanthomonas
citri subsp. citri (Xcc) recovered on Nutrient Agar medium
as compared to the initial bacterial titer (time 0, no copper
amended), after 0, 0.5, 1, 2, 4, and 8 hours of exposure to
0, 17.5, 52.5, 82.5 and 122.5 g of metallic copper per 100
L of different copper-based bactericides. Kocide WDG
(a, f), Cuprogarb 350 (b, g), Redshield (c, h), Difere (d,
i), and Supera (e, j). Copper sensitive (a to e) and copper
resistant (f to j) strains of Xcc, 306 and A45, respectively.
Error bars indicate the standard error of the mean based on
three replicates of the experiment (a to e). Data from one
replicate, no error bar is indicated (f to j).
the higher resistance of these strains may be due
to the greater capacity of the chromosomal copper
homeostasis genes cohLAB to bind copper ions (4).
Nevertheless, the reasons for such an enhanced
resistance as compared to previously characterized
sensitive strains of Xcc are yet to be unveiled.
References
1. Al-Daoude, A., Arabi, M.I.E. and Ammouneh, H.
2009. Studying Erwinia amylovora isolates from
Syria for copper resistance and streptomycin
sensitivity. J. Plant Pathol. 91:203-205.
2. Behlau, F., Belasque Jr, J., Graham, J.H. and Leite,
Jr, R.P. 2010. Effect of frequency of copper
applications on control of citrus canker and the
yield of young bearing sweet orange trees. Crop
Protect. 29:300-305.
3. Behlau, F., Belasque, Jr., J., Bergamin Filho, A.,
Graham, J.H., Leite Jr, R.P., Gottwald, T.R. 2008.
Copper sprays and windbreaks for control of
citrus canker on young orange trees in southern
Brazil. Crop Prot. 27:807-813.
4. Behlau, F., Canteros, B.I., Minsavage, G.V., Jones, J.B.
and Graham, J.H. 2011a Molecular characterization
of copper resistance genes from Xanthomonas
citri subsp. citri and Xanthomonas alfalfae subsp.
citrumelonis. Appl. Environ. Microbiol., 77:40894096.
5. Behlau, F., Jones, J.B., Myers, M.E. and Graham,
J.H. 2011b. Monitoring for resistant populations
of Xanthomonas citri subsp. citri and epiphytic
bacteria on citrus trees treated with copper or
streptomycin using a new semi-selective medium.
Eur. J. Plant Path. doi:10.1007/s10658-011-98707 (in press).
6. Bender, C.L. and D.A. Cooksey. 1986. Indigenous
plasmids in Pseudomonas syringae pv. tomato:
conjugative transfer and role in copper resistance.
J. Bacteriol. 165:534-541.
7. Canteros, B.I. 1999. Copper resistance in
Xanthomonas campestris pv. citri, p. 455–459. In
A. Mahadevan (ed.), Plant pathogenic bacteria.
Proceedings of the International Society of
Bacteriology. Centre for Advanced Study in Botany,
University of Madras, Chennai, India.
8. Graham, J.H., and Myers, M.E. 2011. Soil application
of SAR inducers imidacloprid, thiamethoxam, and
acibenzolar-S-methyl for citrus canker control in
47
young grapefruit trees. Plant Dis. 95:725-728.
9. Graham, J.H., Leite Jr., R.P., Yonce, H.D., & Myers,
M. 2008. Streptomycin controls citrus canker on
sweet orange in Brazil and reduces risk of copper
burn on grapefruit in Florida. Proc. Fla. State Hort.
Soc., 121:118-123.
10.Graham, J.H., Dewdney, M.M. and Myers, M.E. 2010.
Streptomycin and copper formulations for control
of citrus canker on grapefruit. Proc. Fla. State Hort.
Soc. 123:92–99.
11.Graham, J.H., and Leite, R.P. 2004. Lack of control
of citrus canker by induced systemic resistance
compounds. Plant Dis. 88:745-750.
12.Marco, G.M. and Stall, R.E. 1983. Control of bacterial
spot of pepper initiated by strains of Xanthomonas
campestris pv. vesicatoria that differ in sensitivity
to copper. Plant Dis. 67:779-781.
13.Nischwitz, C., Gitaitis, R., Sanders, H., Langston,
D., Mullinix, B., Torrance, R., Boyhan, G. and
Zolobowska, L. 2007. Use of fatty acid methyl
ester profiles to compare copper-tolerant and
copper-sensitive strains of Pantoea ananatis.
Phytopathology 97:1298-304.
14.Stein, B., Ramallo, J., Foguet, L., Morandini, M. and
Graha, J.H. 2007. Citrus leafminer control and
copper sprays for management of citrus canker
on lemon in Tucumán, Argentina. Proc. Fla. State
Hort. Soc. 120:127-131.
48
Molecular characterization of the Talk 13
copper resistance operon copAB in
Xanthomonas citri subsp. citri
Freitas, EC de
Ucci, AP
Texeira, EC
Pedroso, GA
Bertolini, MC
Instituto de Química, Departamento de Bioquímica e Tecnologia
Química, UNESP, 14.800-900, Araraquara, SP
Xanthomonas citri subsp. citri (Xac), the bacteria
responsible for citrus canker in Brazil and worldwide
has been the subject of increasing interest due to its
phytopathogenic action in economically important
crops. Considering the economic losses caused by Xacin
citrus, the completion of its genome [1] has enabled
the knowledge advance of the microorganism and in
the molecular interactions with the host. During the
annotation of the Xac genome, orthologues of genes
described as involved in the mechanism of copper
resistance in phytopathogens were identified; the
genes copA and copB. Copper compounds have been
used to control bacterial diseases in plants and the
effectiveness of this process has been reduced by the
emergence of resistant strains to copper.
Studies in our laboratory [2] showed that the
genes in Xac are organized in an operon (copAB) whose
transcription was induced by copper and specific to
this metal. In these studies, the gene encoding CopA
was inactivated by the insertion of a transposon, which
led a bacterial strain unable to synthesize the proteins
CopA and CopB. The mutant strain showed a complete
inability to grow in vitro in the presence of copper
even at low concentrations (0.25 mM) and a greater
sensitivity to copper during growth in plant, with a delay
in the induction of the specific symptoms of disease.
We are interested to understand the molecular
mechanisms that participate in the operon regulation in
the presence of copper. Analysis in silico of the operon
5’-flanking region identified a short ORF (XAC3629),
orthologous to the gene copL described by Voloudakis
et al. [3] as involved in the copper operon expression
regulation in Xanthomonas axonopodis pv. vesicatoria
(Xav). The Xac gene encodes a 152 amino acid residues
protein rich in cysteine and histidine. The ORF XAC3629
was inactivated by the insertion of a transposon and
the mutant strain showed sensitivity to copper when
analyzed in relation to growth in the presence of
different concentrations of copper, while the wild strain
306 was able to grow up to 1.0 mM CuSO4. These results
suggested that the XAC3629 protein may have a role in
the copAB operon regulation in the presence of copper
[4].
The expression of the operon copAB and the ORF
XAC3629 in the mutant strains has been investigated by
Northern blot. Preliminary results showed the presence
of the ORF XAC3629 transcript only in the wild-type
strain, while the copAB transcript was detected in both
wild-type and mutant strains. To better understand
the molecular mechanisms, DNA fragments from the
5’-flanking region containing the ORF XAC3629, either
as a whole or its fragments, were amplified by PCR and
are being analyzed by DNA shift assay using Xac crude
extracts prepared from cells grown in the presence of
copper.
We are also interested in the evaluation of the
copper resistance in isolates of Xac from different
regions of Brazil. A collection of Xac strains isolated from
different States were donated by the FUNDECITRUS
(Araraquara, SP, Brazil), and the strains were evaluated
for growth in the presence of 1.0 mM CuSO4. We
observed a relative increase in copper resistance in the
49
Xac population from Brazil Southern, mainly in Parana,
Rio Grande do Sul and Santa Catarina States, in relation
to the control strain Xac 306. The genomic organization
of the operon copAB in some of these Xac strains was
analyzed by Southern blot using the genes copA and
the ORF XAC3629 as probes. All selected strains have
identical profile when compared to the wild-type strain
indicating that no other genes are present in the copAB
operon.
References
1. da Silva, A.C. et al. (2002) Comparison of the genomes
of two Xanthomonas pathogens with differing host
specifities. Nature 417:459-463.
2. Teixeira, E.C., de Oliveira, J.C.F., Novo, M.T.M., Bertolini,
M.C. (2008) The copper resistance genes copAB
from Xanthomonas axonopodis pathovar citri
gene inactivation results in copper sensitivity.
Microbiology 154:402-412.
3. Voloudakis, A.E., Reignier, T.M., Cooksey, D.A. (2005)
Regulation of resistance to copper in Xanthomonas
axonopodis pv. vesicatoria. Appl. Environ. Microbiol.
71:782-789.
4. Ucci, A.P. (2010) Participação da ORF XAC3629 na
regulação do operon de resistência a cobre copAB
em Xanthomonas citri subsp. citri. Dissertação de
Mestrado apresentada ao Instituto de Química,
UNESP, Araraquara.
Financial support: FAPESP, CNPq and CAPES
50
Control of citrus canker mediated
by neonicotinoids in combination
with acibenzolar-S-methyl
Talk 14
Miller, AM
Barreto, TP
Silva, MRL
Leite Jr, RP
Instituto Agronômico do Paraná, Área de Proteção de Plantas. C.P.
481, CEP 86.001-970, Londrina, PR, Brazil. e-mail: thales@iapar.br
Introduction
Asiatic citrus canker, caused by Xanthomonas
citri subsp. citri (Xcc), is a serious disease on
commercial citrus cultivars and some citrus relatives
(7). The pathogen causes distinctive necrotic and
raised lesions on leaves, stems and fruits. Severe
infections can also cause tree defoliation, blemished
fruits, premature fruit drop, and twig dieback, as well
as a general tree decline (8).
Copper-based bactericides are the standard
chemical control measure for citrus canker worldwide
(10). Copper reduces bacterial populations on leaf
surfaces, but multiple applications are needed to
achieve adequate control. Long-term use of copper
bactericides may lead to selection of copper resistance
in Xcc populations (2,13) and accumulation of copper
in the soil.
Systemic acquired resistance (SAR) is an innate
plant defense mechanism that may confer long-lasting
protection against a broad spectrum of microorganisms
(3,16). Plants may acquire an enhanced defensive
capacity against subsequent pathogen attack as a result
of induction by primary, limited pathogen infection. SAR
can also be induced by the signal molecule salicylic acid
(SA). Further, SAR is associated with the accumulation
of pathogenesis-related proteins, which are thought to
contribute to resistance. Thus, SAR may be activated in
the absence of pathogens by treatment of plants with
chemical inducers (5). Acibenzolar-S-methyl (ASM),
a functional homolog of SA, is the most widely known
commercially inducer of SAR (15).
Soil application of the neonicotinoid
imidaclopride (IMI) is used for citrus bacterial disease
management through the control of the citrus leafminer
(Phyllocnistis citrella). Furthermore, IMI breaks down
in planta into 6-chloronicotinic acid, an analog of the
isonicotinic acid which also induces SAR response
(1,4,14). Different SAR inducers have been tested
for control of citrus canker. Graham et al. (8) tested
ASM and neonicotinoids separately and obtained
satisfactory results in the control of the disease.
The purpose of this research was to evaluate the
efficacy of soil-applied neonicotinoids in combination
with acibenzolar-S-methyl to control citrus canker
through SAR induction.
Materials and Methods
Seedlings of sweet orange Valencia (Citrus
sinensis L. Osbeck) of uniform vigor and stem caliper
were pruned four weeks in advance to allow a single
dominant shoot to develop. The plants were soil treated
with 100 ml per plant of solutions containing 64 mg
of acibenzolar-S-methyl (ASM) and 1.0 g or 0.7 g of
imidacloprid (IMI) or thiamethoxam (TMX), respectively.
Five days after application, ten leaves per plant
were injection infiltrated with a suspension of 104
CFU/ml of Xcc strain 306 on the abaxial leaf surface.
Inoculations were performed from 9 to 12 h when
stomata were fully open.
Greenhouse experiments were arranged in a
completely randomized design with five plants per
treatment and five repetitions.
The disease incidence was evaluated by
counting the citrus canker lesions per cm2 of the
inoculated leaf area 36 days after inoculation (dai).
The bacterial population was determined by
macerating 0.64 cm2 of inoculated leaf area in the
intervals of 0, 2, 4, 8, 16, 24, 32 and 36 dai, by plating
onto Nutrient agar. The Petri plates were evaluated
after 72 hours of incubation at 28°C. The bacterial
population was expressed on log CFU/0.64 cm2 of leaf
tissue.
Untreated check plants developed lesions
characteristic of citrus canker, which were larger
and more eruptive than on plants treated with SAR
inducers (Figure 1). The treatment of the citrus
plants with different neonicotinoids and ASM for
SAR induction significantly decreased the number
of canker lesions on the leaves (Figures 1 and 2).
A single application of the combination of IMI +
ASM reduced the number of citrus canker lesions in
91% as compared to the untreated check treatment
(Figure 2). Furthermore, reduction in the number of
canker lesions in citrus plants treated with ASM was
83% as compared to the untreated check treatment
(Figure 2). Decrease in disease incidence of 46% and
57% was also observed in the plants treated with only
neonicotinoids, IMI or TMX, respectively (Figure 2).
Figure 1. Development of citrus canker lesions on leaves of
sweet orange Valencia treated with the neonicotinoids TMX
and IMI, ASM, IMI + ASM and untreated check (abaxial side
of the leaf).
The population of Xcc recovered from leaf
areas infiltrated with the bacteria was lower in plants
treated with neonicotinoids, IMI + ASM and ASM alone,
as compared to the untreated check plants (Figure
3). Differences in bacterial populations between the
untreated check plants and the ones treated with the
neonicotinoids alone or with the combination of IMI
51
+ ASM were larger than three log units during the
exponential growth (Figure 3).
Figure 2. Number of lesions of citrus canker caused by
Xanthomonas citri subsp. citri per cm2 of leaf area. TMX =
thiamethoxam, ASM = acibenzolar-S-methyl, Imidacloprid
= IMI. For statistical analysis, values were transformed into
√x +1. Means followed by same letter do not differ by Tukey
test at 5% significance level.
Figure 3. Colony-forming unit of Xanthomonas citri subsp.
citri on leaves of sweet orange Valencia plants treated with
the neonicotinoids TMX and IMI, ASM, and IMI + ASM. *, No
significant difference between treatments. Different letters
indicate significant differences between treatments by the
Tukey test at 5% significance level.
As previously demonstrated, applications
of copper alone to control citrus canker have been
moderately to highly effective for reducing foliar
disease, fruit infection, and premature fruit drop
on susceptible sweet orange varieties (6,9,10,12).
Furthermore, copper-resistant strains of Xcc have
52
been indentified in citrus groves in Argentina (2). ASM
has been particularly useful for disease management
of bacterial speck and bacterial spot where copperresistant strains predominated (11). Therefore,
soil-applied SAR inducers could be employed for
copper-resistance management of citrus canker by
reducing the rate and frequency of copper bactericide
applications on highly susceptible young trees (8).
Conclusion
Preventive treatment of neonicotinoids, IMI +
ASM or ASM makes citrus plants competent to reduce
the multiplication of Xcc on leaves.
Sweet orange plants treated with the
combination of IMI + ASM or ASM alone show lower
incidence of canker on leaves than the untreated
check plants.
Literature Cited
1. Beckers, G.J., and Conrath, U. 2007. Priming for
stress resistance: from the lab to field. Curr. Opin.
Plant Biol., 10:425-431.
2. Canteros, B.I., Rybak, M., Gochez, A., Velazquez,
P., Rivadeneira, M., Mitidieri, M., Garran, S., and
Zequeira, L. 2008. Occurrence of copper resistence
in Xanthomonas citri subsp. citri in Argentina.
Phytopathology, 98:S30.
3. Durrant, W.E., and Dong, X. 2004. Systemic acquired
resistance. Annu. Rev. Phytopathol., 42:185-209.
4. Ford, K.A., Casida, J.E., Chandran, D., Gulevicha, A.G.,
Okrent, R.A., Durkinc, K.A., Sarpong, R., Bunnellec,
E.M., and Wildermuth, M.C. 2010. Neonicotinod
insecticides induce salicylate associated plant
defense responses. Proc. Nat. Acad. Sci. USA, 107:
17527-17532.
5. Gorlach, J., Volrath, S., Knauf-Beiter, G., Hengy,
G., Beckhove, U., Kogel, K.H., Oostendorp, M.,
Staub, T., Ward, E., Kessemann, H., and Ryals, J.
1996. Benzathiadiazole, a novel class of inducers
of systemic acquired resistance, activates gene
expression and disease resistance in whet. Plant
Cell, 8:629-643.
6. Graham, J.H. 1998. Citrus canker: Control efforts in
Brazil, prognosis for Florida. Citrus Ind., 79:54-57.
7. Graham, J.H. Gottwald, T.R., Cubero, J., and Achor,
D.S. 2004. Xanthomonas axonopodis pv. citri:
factors affecting successful eradication of citrus
canker. Mol. Plant Pathol., 5:1-15.
8. Graham, J. H., and Mayers, M. F. 2011. Soil application
of SAR inducers imidacloprid, thiamethoxam, and
acibenzolar-S-methyl for citrus canker control in
young grapefruit. Plant Disease, 95:725-728.
9. Leite, R.P., Jr. 1990. Cancro cítrico – prevenção e
controle no Paraná. IAPAR, Londrina, PR, Brazil.
Circ. no. 61.
10.Leite, R.P., Jr., and Mohan, S.K. 1990. Integrated
management of the citrus bacterial canker disease
caused by Xanthomonas campestris pv. citri in the
State of Paraná, Brazil. Crop Prot., 9:3-7.
11.Louws, F.J., Wilson, M., Campbell, H.L., Cuppels,
D.A., Jones, J.B., Shoemaker, P.B., Sahim, F., and
Miller, S.A. 2001. Field control of bacterial spot and
bactereial speck of tomato using a plant activator.
Plant Dis., 58:481-488.
12.Muraro, R.P., Roka, F.M., and Spreen, T.H. 2002.
Grower costs of having citrus canker in Florida
with an overview of Argentina’s citrus canker
control program. Staff Pap. SP02-3. Dept. Food and
Resource Economics, University of Florida, IFAS,
Gainesville.
13.Rinaldi, D.A.M.F., and Leite Jr., R.P. 2000. Adaptation
of Xanthomonas axonopodis pv. citri population to
the presence of copper compound in nature. Proc.
Int. Soc. Citric., 2:1064.
14.Sur, R., and Stork, A. 2003. Uptake, translocation
and metabolism of imidacloprid in plants. Bull.
Insectol., 56:35-40.
15.Tally, A., Oostendorp, M., Lawtion, K., Staub, T.,
and Bassi, B. 1999. Commercial development
of elicitors of induced resistance to pathogens.
Pages 357-370 in: Induced Plant Defenses Against
Pathogens and Herbivores. Biochemistry, Ecology,
and Agriculture. A. A. Agrawal, S. Tuzun, and E.
Bent, eds. American Phytopathological Society, St.
Paul, MN.
16.van Loon, L.C., Rep, M., and Pieterse, C.M.J. 2006.
Significance of inducible defense-related proteins
in infected plants. Annu. Rev. Phytopathol., 44:
135-162.
53
Talk 15
Efficiency of treatments with
benzalkonium chlorides of
asymptomatic citrus fruit in relation
to Xanthomonas citri subsp. citri
Costa, DF1
Cordeiro, AB1
Murata, MM1
Silva, EG2
Pimenta, AA2
Leite Jr, RP1
1 - Instituto Agronômico do Paraná. Laboratório de Bacteriologia.
Londrina, PR, Brazil
2 - BR3- Agrobiotecnologia. São Paulo, SP, Brazil. e-mail: ruileite@
iapar.br
Introduction
Citrus canker, caused by Xanthomonas citri
subsp. citri (Xcc), is one of the most important diseases
for the citrus industry in several regions around the
world. The disease is present in citrus orchards in
different parts of the world, and is endemic in several
regions along the Indian Ocean, East Asia, Middle
East, Africa, South America and North America. This
includes the major citrus producing countries such
as Brazil and the United States [1;2;3]. Thus, the
disease is subject to strict laws enforcing quarantine
and eradication measures in Brazil, as well as other
countries. The development of effective methods
for surface disinfestations of asymptomatic citrus
fruits in respect to Xcc is of great importance for the
Brazilian citrus industry. Benzalkonium chlorides
belong to chemical group of quaternary ammonium
and have fungistatic and bacteriostatic properties.
They have been widely used as pharmaceuticals
and agricultural disinfestants. The objective of this
study was to evaluate the effect of treatment of
asymptomatic citrus fruits for surface disinfestation
with benzalkonium chloride + ethilbenzalkonium
chlorides (Fegatex®) in regard to the citrus canker
bacterium Xanthomonas citri subsp. citri.
Field collected orange fruits (cv. Valencia),
free of citrus canker symptoms, harvested in
commercial orchards in the Northwest region of
Parana State, Brazil, were used in this study. For
surface disinfestation, the citrus fruits were subjected
to immersion for 2 minutes in one of the 6 different
treatments: (1) benzalkonium chlorides (Fegatex®)
at a concentration of 25 ppm, (2) benzalkonium
chlorides (Fegatex®) at a concentration of 50 ppm, (3)
benzalkonium chlorides (Fegatex®) at a concentration
of 100 ppm, (4) benzalkonium chlorides (Fegatex®) at
a concentration of 200 ppm, (5) sodium hypochlorite
at a concentration of 200 ppm, and (6) distilled
water as control check. After treatment, fruit were
placed each in a separate plastic bag with 50 mL of
phosphate buffer containing 0.1% Tween 20 and
shaken at 150 rpm at 25°C for 2 hours to loosen and
release surface bacteria. The wash solution of the bag
was centrifuged at 5000 rpm at 20°C for 10 minutes.
The supernatant was discarded and the resulting
pellet was resuspended in 5 ml of autoclaved distilled
water (Figures 1 and 2). The liquid resulting from
the resuspended pellet was diluted to 10-1, 10-2 and
10-3 and 100µl was plated onto semi-selective KCB
medium. The petri plates were kept in B.O.D. at 28°C
for 4 days. The evaluation was performed in the fourth
54
day by counting the colony forming units (CFU) of
the total number of bacteria and the total Xcc colony
(Figure 2). The averages were compared statistically
by Tukey test at 5%.
Treatments
1-6
Packaging of
fruits
Agitarion
Surface disinfection
Recovery of bacteria
Detection of bacteria
Centrifugation
Plating
Figure 1. Schematic illustration of the process of surface
disinfection, recovery and detection of X. citri subsp. citri
from orange fruits.
Results
Fruit treatment with sodium hypochlorite at
200 ppm, used as standard packinghouse treatment,
showed no complete efficiency for disinfestation of
the surface of citrus fruit for both, total bacteria and
Xcc (Table 1; Figure 3). In contrast, benzalkonium
chlorides (Fegatex®) at the concentrations of 25 and
50 ppm already reduced significantly the growth of
total bacteria on the fruit surface (Table 1; Figure 3).
Furthermore, these concentrations of benzalkonium
chlorides (Fegatex®) were effective for complete
elimination of Xcc from the surface of citrus fruit (Table
1; Figure 3). Benzalkonium chlorides (Fegatex®) at
concentrations of 100 and 200 ppm were effective
for the complete disinfestation of total bacteria and
Xcc (Table 1; Figure 3). Therefore, benzalkonium
chloride (Fegatex®) at the concentrations of 100 and
200 ppm can be recommended for decontamination
of citrus fruits in relation to total bacteria and Xcc
(Table 1 and Figure 3).
Table 1. Average number of CFU/mL of total bacteria
(Total) and X. citri subsp. citri (Xcc) four days after
plating.
Log CFU Log CFU
Treatment
Total/ml1 Xcc/ml1
1. benzalkonium chlorides at
1,19 ab
0,00 a
25 ppm
0,40 a
0,00 a
50 ppm
0,00 a
0,00 a
100 ppm
0,00 a
0,00 a
200 ppm
5. sodium hypochlorite at
2,21 b
0,80 b
200 ppm
6. Control check
2,40b
2,00 b
CV%
73,11% 85,50%
(1) Averages followed by same letter in columns do
not differ statistically.
Conclusions
Benzalkonium chlorides (Fegatex®) are
effective for disinfection of the surface of orange fruits.
For better efficiency of bacteria desinfestion, the
concentration of benzalkonium chlorides (Fegatex®)
are 100 ppm for total bacteria and 25 ppm for Xcc.
Figure 2. Orange fruits in plastic bag containing 50 ml of phosphate buffer (A), agitation (B), centrifugation (C) and petri
dishes of semi-selective KCB medium with bacterial growth (D).
55
Figure 3. Average of Log of CFU/mL of the total number of
bacteria and the total Xcc colony.
Literature cited
1. Koizumi, M. Citrus canker: The word situation. In:
Timmer. L. W. (ed.). Citrus canker: An international
perspective. University of Florida/Institute of
Food and Agricultural Science, p. 340-344. 1985.
2. Leite Jr., R.P.; Mohan, S.K. Integrated management
of the citrus bacterial canker disease caused by
Xanthomonas campestris pv. citri in the state of
Paraná, Brazil. Crop Protection, 9:3-7. 1990.
Session 4 – Citrus canker detection and
diagnosis
58
Session 4 – Citrus canker detection and diagnosis
Fluorescence imaging spectroscopy
applied to citrus diseases
Talk 16
Wetterich, C1
Belasque Jr, J2
Marcassa, LG1
Instituto de Física de São Carlos. Universidade de São Paulo
Cx.Postal 369, São Carlos. 13.560970, SP, Brazil
2
Departamento Científico. Fundecitrus. Av. Dr. Adhemar P. de Barros, Araraquara, 201. 14.807-040, SP, Brazil
1
Diseases are one of the most serious threats for
citrus production worldwide. Sao Paulo, Brazil, and
Florida, USA, are the most important citrus producers
and, both, are making efforts for citrus diseases
control. Citrus canker is one of the serious diseases,
caused by the Xanthomonas citri subsp. citri bacteria,
which infects citrus trees and relatives, causing a
large economic loss in the citrus juice production.
Another important disease affecting the citrus
production worldwide is the Huanglongbing (HLB,
Greening), present too in Sao Paulo and Florida. Both
bacterial pathogens are, mainly, under suppression
control, applied by eradication of symptomatic and
no-symptomatic plants. In this way, the detection and
diagnostic of the related symptoms and, consequently,
the eradication of the citrus trees are essential for
higher economical losses prevention. However this
task is very hard because it requires a field inspection
and laboratory diagnostic. Our goal is to develop a
new optical technique, applied in field conditions, to
detect citrus diseases using a portable fluorescence
imaging unit.
In this work, we describe the construction
of our fluorescence spectroscopy imaging system
and the first tests with Citrus canker, Citrus scab,
citrus variegates chlorosis and Huanglongbing (HLB,
Greening). We will also present a comparison between
the results involving HLB in São Paulo and Florida.
Sensors and sensor platforms
for disease detection
59
Talk 17
Ehsani, R
Assistant Professor. Citrus Research and Education Center.
University of Florida
Dr. Ehsani’s research group at the Citrus
Research and Education Center (CREC) of the
University of Florida is currently working on multiple
sensing techniques for detection of citrus diseases. Dr.
Ehsani’s talk will cover an overview of various sensing
techniques and data analysis methods for detection
of citrus greening disease. Different approaches
such as visible-near infrared spectroscopy, midinfrared spectroscopy, fluorescence spectroscopy,
and volatile profiling-based HLB detection will be
discussed. Among the methods, visible-near infrared
spectroscopy offers non-destructive detection of
symptomatic HLB-infected citrus leaves; while
mid-infrared spectroscopy offers the advantage
of identification of HLB-infected leaves at presymptomatic stages. In addition to the sensors, there
will be a discussion on various ground- and aerialbased sensor platforms. Low-cost multi-rotor remote
sensing platforms and autonomous tractors are
examples of two approaches that were used and will
be discussed in this talk.
60
Canine detection of Citrus Canker Talk 18
in the plantation and packinghouse
Gottwald, TR1
Peruyero, P2
1 - USDA, Agricultural Research Service, US Horticultural Research
Laboratory, Fort Pierce, Florida, USA.
2 - J&K Canine Academy Inc., High Springs, Florida, USA.
Since prehistoric times, man has recognized
the olfactory abilities and sensitivity of canines. Man
began to take advantage of the olfactory abilities of
dogs immediately upon domestication, for tracking
and hunting. Canines have shown their prowess
at forensic detection (cadaver dogs), detection of
cancer (melanoma, breast, and lung), firearms, illegal
narcotics, blood, explosives, etc. In addition, they
have been trained to detect agricultural products in
airline baggage and commercial shipments, bed bugs,
termites, wild water foul eggs, mealy bugs, Quagga
muscles and many other scents. Recent studies have
shown that the threshold sensitivity of the canine
olfactory ability for some chemical volatiles ranges
from one part per billion (ppb) to 500,000 parts per
trillion (ppt), whereas, the human threshold for odors
ranges from 100 parts per million (ppm) to 500,000
ppb. Therefore, canine sensitivity threshold to odors
appear to range from 1,000 to 100 million times more
sensitive than humans. We have been conducting
studies on canine detection of citrus canker, caused by
Xanthomonas campestris pv. citri (Xcc), for more than
10 years, which was complicated by the September
11, 2000 bombing of the World Trade Center in New
York and the Pentagon in Arlington, Virginia, which
immediately diverted the attention of many canine
trainers and scent dogs for detection of explosives and
terrorist activities. Recently, we have demonstrated
canine detection of citrus canker, both in field and
packinghouse environments. The canines were cross
trained by positive reinforcement to discriminate
between target (Xcc-infected) and non target (noninfected) odor signatures of citrus foliage and fruits.
The canine had no trouble distinguishing multiple
odor signatures, i.e., foliage versus fruit. The dog will
alert within a few seconds and confirm detection by
sitting next to the target. Replicated field trials with
spatially randomized plots with various disease
incidences demonstrated detection accuracy is ca.
98%, with nearly an equal number of false-positive
detections and false-negative non-detections.
Citrus canker diagnostic by Xac
ImmunoStrip®
61
Talk 19
Andrade, JC de1
Assis Filho, FM2
Belasque Jr, J1
1 - Fundecitrus, Sao Paulo, Brazil
2 - Agdia, Inc., Elkhart, IN, USA
Brazil is the world leader in orange production
and export of orange juice concentrate, which
annually generate over 5 and 2 billion dollars,
respectively. Eighty percent of that production
comes from the state of Sao Paulo. Citrus canker is
one of the top two pests threatening the Brazilian
citriculture. This serious disease is caused by the
bacterium Xanthomonas citri subsp. citri (Xac), which
is responsible for economic losses mainly by inducing
premature fruit drop, dieback, and defoliation. The
disease control in the state of São Paulo focuses on
an eradication program, while other Brazilian states
have adopted an integrated management system
that allows limited presence of the pathogen (1).
Generally disease diagnosis is based on PCR assay or
bacterial isolation, both of which are relatively timeconsuming and expensive and are not the most cost
effective for testing thousands of samples. This report
presents the results from a series of experiments
carried out to validate the Xac ImmunoStrip® test for
the detection of Xac under the Brazilian conditions.
Eight experiments were conducted to determine
the detection level, specificity, and sensitivity of Xac
ImmunoStrip® test. All experiments used strips and
sample bags containing SEB1 buffer according to the
manufacturer instructions. All results were obtained
from the strips in less than 10 minutes after the
samples were macerated and mixed in the sample bags.
Experiment 1 evaluated the Xac ImmunoStrip®ability
to detect Xac on symptomatic, fresh samples of Citrus
spp. Forty-six samples of leaves, stems, and fruits
from eight citrus genotypes were collected from
symptomatic plants in urban and rural areas of Sao
Paulo State. The samples were tested first on the field
by Xac ImmunoStrip®shortly after collection and two
days later under laboratory conditions. A total of 31
samples tested positive by Xac ImmunoStrip® and
were confirmed by bacterial isolation on culture media
under laboratory conditions (Table 1). Experiment 2
evaluated the Xac ImmunoStrip® ability to detect Xac
on one-month old dried leaf samples collected from
symptomatic C. sinensis in a commercial orchard.
The samples were taken to the laboratory where
bacterial cultures were obtained on Nutrient Agar.
The remaining leaves, presenting typical symptoms
of citrus canker, were dried between paper sheets for
one month. A total of 15 symptomatic dried leaves
were tested and the pathogen was detected in14 of
them using the ImmunoStrip®. In experiment 3, eightmonth old dried leaf samples obtained as described
above in experiment 2 were used to evaluate the Xac
ImmunoStrip® ability to detect Xac. The pathogen
was detected in12 out of 13 symptomatic dried
leaves tested (Table 2). Experiment 4 evaluated
the ability of Xac ImmunoStrip® to detect Xac using
partially decomposed leaf samples of C. sinensis,
most of which exhibiting typical citrus canker
symptoms. After bacterial isolation on Nutrient Agar,
the leaves were allowed to decompose while being
kept for eight months in a humid chamber formed
by a plastic bag maintained at 4oC under laboratory
conditions. Of 13 symptomatic leaves tested, 10 were
positive using the Xac ImmunoStrip®. Experiment 5
evaluated the ability of Xac ImmunoStrip®® to detect
Xac using leaf and fruit samples exhibiting typical
symptoms of citrus canker (Figure 1). Twenty-four
leaf samples and 24 fruit samples were collected
from C. cinensis, kept at 4oC and tested a few days
later. All 48 samples tested positive for the presence
of Xac using ImmunoStrip®, and were confirmed by
bacterial isolation on culture media, indicating 100%
accuracy. Experiment 6 evaluated the possibility of
62
Table 1. Detection of Xanthomonas citri subsp. citri (Xac) on symptomatic Citrus spp. samples collected and
processed in the field.
Positive samples/total tested1
Plant host
Specie host
Tissue
Xac ImmunoStrip®
Xac Isolation
Sicilian lemon
C. limon
Leaves
1/2
1/2
Mexican lime
C. aurantifolia
Leaves
3/3
3/3
Rangpur lime
C. limonia
Leaves and stems
6/13
7/13
Mexerica do Rio C. deliciosa
Leaves
2/2
2/2
Murcott
C. sinensis x C. reticulata Leaves
1/1
1/1
Sweet orange
C. sinensis
Leaves and fruit
13/15
14/15
Tahiti lime
C. latifolia
Leaves
1/3
1/3
Mandarin
C. reticulata
Leaves
4/7
4/7
Total
31/46
33/46
1 - For each citrus genotype is indicated the number of positive samples and the total number of samples tested. Each
sample corresponded to a symptomatic leaf, stem or fruit used for Xac detection. Positive samples were determined by Xac
ImmunoStrip® test and confirmed by Xac isolation under laboratory conditions.
Table 2 - Detection of Xanthomonas citri subsp. citri (Xac) on Citrus spp. dried leaf tissue
Positive samples/total tested1
Plant host
Specie host
Xac ImmunoStrip®
Xac Isolation
Sicilian lemon
C. limon
2/2
2/2
Mexican lime
C. aurantifolia
1/1
1/1
Rangpur lime
C. limonia
2/2
2/2
Mexerica do Rio
C. deliciosa
1/1
1/1
Sweet orange
C. sinensis
3/4
4/4
Mandarin
C. reticulata
3/3
3/3
Unknown genotype
Unknown specie
0/1
0/1
Total
12/14
13/14
1 - For each citrus genotype is indicated the number of positive samples and the total number of samples tested. Positive
samples indicated in “Xac Isolation” column correspond to leaves presenting typical citrus canker symptoms, similar to
those from positive samples of the same plants, determined previously by Xac isolation on Nutrient Agar plates.
false results induced by double infection of C. limonia
by Xac and the agent of citrus scab (Elsinoe fawcetti).
Leaf samples exhibiting typical symptoms of citrus
canker and citrus scab were collected and maintained
at 4 °C. One month later the samples were tested
using the Xac ImmunoStrip®. Lesions similar to those
induced by Xac were cut off. Half of the lesions were
tested for Xac detection by the ImmunoStrip® and the
remainder were used for bacterial isolation. A total of
19 out of 20 samples tested positive and the bacterium
was successfully isolated from them. In experiment 7
the specificity of the Xac ImmunoStrip® was evaluated
using 25 Xanthomonas spp. strains pathogenic to
citrus. The strains were artificially inoculated on
citrus plants. Among them four were the causal agent
of citrus canker, one of cancrosis B, 18 of cancrosis
C, and two of citrus bacterial spot. Samples were
collected several weeks after inoculation, when the
corresponding disease symptoms were present. Only
samples inoculated with Xac and exhibiting typical
symptoms of the disease tested positive (Table 3),
showing that the Xac ImmunoStrip® was specific to
Xac, exhibiting no cross-reactivity with other citrus
pathogenic bacteria. Experiment 8 evaluated the Xac
ImmunoStrip® sensitivity to detect Xac. Seventeen
suspensions of cultured Xac (strain 306) were
tested. Stronger signals were observed for bacterium
suspensions >2 x 103 cells/ml. Recovery of the
Figure 1. Lesions from leaf and fruit of ‘Valencia’ Sweet
orange excised and tested with Xac ImmunoStrip®.
63
bacterium by plating on Nutrient Agar from the sample
extract was not successful, confirming that the sample
extraction buffer eliminates the pathogen without
affecting the detection level of the ImmunoStrip test.
This comprehensive series of experiments proved
that the Xac ImmunoStrip® test represents a practical,
economical and reliable tool to detect Xanthomonas
citri subsp. citri, the causal agent of citrus canker
disease on citrus fruit and foliar tissue in both field
and laboratory conditions. Agreement over 98% with
the bacterial isolation on culture media was observed
for different experimental conditions and sample
types. The test proved to be very robust, successfully
detecting Xac even on samples not generally suitable
for diagnosis by other methods, such as dried
or partially decomposed foliar tissue. Under the
experimental conditions described in this report,
the Xac ImmunoStrip® test proved to be specific for
Xac, not cross-reacting with the most common citrus
pathogens, among them other Xanthomonas species
pathogenic to citrus, particularly X. fuscans subsp.
aurantifolii and X. alfalfa subsp. citrumelonis. The
test is also very sensitive, with a limit of detection of
7 x 102 cells/ml. In conclusion, the test is a practical,
economical and reliable assay for Xac detection, which
Table 3 - Specificity of Xac ImmunoStrip® test when challenged by other Xanthomonads pathogenic to citrus
Plant host
Specie host
Bacterium specie
Xac ImmunoStrip®1
X. citri subsp. citri
3/3
Swingle citrumelo
C. paradisi x C. trifoliata
X. fuscans subsp. aurantifolii C
0/17
4/4
Cleopatra mandarin
C. reshni
0/1
Grapefruit
C. paradisi
4/4
4/4
‘Hamlin’ Sweet orange C. sinensis
0/2
Rangpur lime
C. limonia
7/7
1/1
Mexican lime
C. aurantifolia
X. fuscans subsp. aurantifolii B
0/1
0/3
3/3
Sicilian lemon
C. limon
0/1
X. alfalfae subsp. citrumelonis
0/2
2/2
Tahiti lime
C. latifolia
0/2
4/4
Mandarin
C. reticulate
0/2
1 - Indicated the number of positive samples and the total number of samples tested. Each sample corresponded one
lesion excised from foliar tissue.
64
agrees with similar conclusion from researchers that
validated this test for use in the USDA packinghouse
inspection program in Florida (2). It has also been
used for disease identification in field (3). Among the
advantages over other diagnostic methods, one of the
most important would be the standardization of the
diagnostic among the several laboratories accredited
to process samples. Additionally, it can be completed
either in the field or in the laboratory; it does not
require any equipment, it is simple to perform and
requires minimum training; and it can be completed
within 10 minutes. Also, DNA can be extracted from
the ImmunoStrip for PCR confirmation once the test
has been completed (2).
References
1. Leite Jr., R.P. and Mohan, S.K. 1990. Integrated
State of Paraná, Brazil. Crop Protection, 9:3-7.
2. Rascoe, J.E., Schoedel, B.A. and T. Riley. 2007. Direct
real-time confirmation of citrus canker from
ImmunoStrips. Phytopathology, 97:S97.
3. Balestra, G.M., Sechler, A., Schuenzel, E. and Schaad,
N.W. 2008. First Report of Citrus Canker Caused
by Xanthomonas citri in Somalia. Plant Disease,
92:981.
Session 5 – Host resistance
Activation of resistance to
Xanthomonas citri by native
TAL effectors
67
Talk 20
Figueiredo, JL
Römer, P
Horvath, D
Stall, RE
Lahaye, T
Jones, JB
We have designed a strategy for control of citrus
bacterial canker based on recent findings predicting
activation of the UPT boxes by TAL effectors and the
fact that most citrus canker strains contain at least
two TAL effector. A major target is the TAL effector,
commonly referred to as PthA, that is present in X. citri
and critical in virulence. We have hypothesized that
by engineering a promoter which contains several
putative UPA boxes fused to a hypersensitive reaction
(HR)-inducing gene, we could target PthA and other
prevalent AvrBs3 homolog proteins in X. citri that
when injected by the bacterium into the plant cell
would activate transcription of the engineered gene,
resulting in expression of a HR. We will discuss
preliminary findings based on transient assays and
stable transformants.
68
Talk 21
Exploiting basal defense
mechanisms against citrus canker
Benedetti, CE
Laboratório Nacional de Biociências, CP6192, CEP 13083-970,
Campinas – SP, Brazil
While Xanthomonas citri causes canker in all
commercial citrus varieties, Xanthomonas aurantifolii
pathotype C is a pathogen of the Mexican lime only, and
in sweet oranges plants it triggers a hypersensitive
reaction. We used large scale transcription analysis
of sweet orange leaves challenged with X. citri or X.
aurantifolii C to identify possible genes associated
with canker development and disease resistance,
respectively. We have identified a number of sweet
oranges genes implicated in basal resistance which
were preferentially induced by X. aurantifolii very
early on during infection. One of these genes encodes
a MAP Kinase (MAPK) that is highly induced by X.
aurantifolii relative to X. citri infection. The MAPK
gene was expressed in citrange Troyer plants in
response to bacterial infection. When challenged
with X. citri, such plants expressing higher levels of
the MAPK protein showed unusual canker lesions,
which were smaller and with no signs of rupture of
the epidermis. The results indicate that basal defense
mechanisms can be exploited to provide resistance
against the canker bacteria.
69
Citrus cybrid response to biotic Talk 22
stress caused by Xanthomonas citri
subsp. citri
Francis, M
Peña, A
Grosser, J
Graham, J
University of Florida, Citrus Research and Education Center,
Lake Alfred, FL 33850
While genetic resistance is the most desirable
strategy for control of citrus canker, conventional
sexual hybridization with citrus relatives for disease
resistance is considered difficult; therefore, alternative
strategies utilize in vitro protoplast fusion for somatic
hybridization. A cybrid is an asymmetric hybrid that
contains the nucleus of one parent in combination
with the mitochondrion (mt) and/or chloroplast of
the cytoplasm donor parent. Mitochondria play an
important role in plants and are also associated with
programmed cell death (PCD) and development of
hypersensitive reaction to plant pathogens (3). Cybrids
(Cy) of highly susceptible Red grapefruit (RG) and the
more tolerant Valencia orange (VO) as the cytoplasm
donor, were screened for their susceptibility to Xcc. The
objective of this work was to characterize the effect of
organelle substitution differentially expressed from
resistant and susceptible hosts on susceptibility of
cybrids to citrus canker.
Methods
Plant material and inoculation. Canker
susceptibility of 20 RG+VO cybrids was compared
with each parent (RG, VO) using detached leaves for
inoculation with Xcc at 105cfu/ml in vitro as previously
described (2). Attached leaves of the most resistant
cybrids (1-yr old plants) were inoculated with Xcc
at 105 cfu/ml in the greenhouse under controlled
environmental conditions.
Symptom
expression
and
bacterial
populations. Reactions were evaluated by phenotype
of the canker lesions and number of lesions per
inoculation site in the detached and attached leaf
assay. The population of Xcc per leaf area (cfu/cm2)
was estimated. Symptoms in detached leaf of attached
leaves assays were compared to verify reproducibility
of the lesion phenotype.
Gene expression. Putative genes with mt-related
function were identified with EST sequences from the
citrus data base in NCBI. Genes involved in mitochondria
retrograde signals (MRR), were previously described
(1). Genes involved in plant-pathogen interaction
were selected from previous work, describing the
hypersensitive reaction caused by Xcc in the highly
resistant Kumquats (2). The expressions of selected
genes were quantified by real-time RT-PCR using Power
SYBR® Green and normalized to the reference gene
18SrRNA. Change in gene expression was calculated
by the ∆∆Ct method, relative to non-inoculated control
and expressed as fold change.
Results
Host reactions. Highly susceptible RG
produced abundant lesions at 15 dpi with cellular
hypertrophy and hyperplasia typical of callused canker
in compatible hosts. Similar lesion phenotype was
observed in detached leaf and attached leaves (Fig 1).
Valencia orange had less callus-like lesions, and more
necrotic lesions (Fig 1, VO). Numbers of lesions was
greatest for RG (93) and least for VO (47). The different
cybrids showed a variable number and phenotype of
the lesions (Table 1), 4 cybrids developed a higher
number of lesions than VO (>50), 11 cybrids produced
an intermediate number (25-50), and 5 cybrids formed
a lower number of lesions than VO (<25). In contrast
to the callus-like lesions for RG, less susceptible cybrid
70
Fig. 1- Symptoms developed 15 days post-inoculation with Xcc in Red grapefruit (RG), Valencia orange (VO) and cybrids
3 and 10. Top row, detached leaf assay in vitro, bottom row attached leaves in the greenhouse. RG formed primarily callus
lesions (c) and VO, Cy 3 and Cy10 formed mostly necrotic lesions (n). bar = 1 mm.
Table 1. Lesion number and phenotype for citrus cybrids and parents after inoculation with Xcc in the detached
leaf assay
Treatment
Lesions per inoculation site
Lesion phenotype
Parents
Red grapefruit
93
Mostly callus
Valencia orange
47
Mixture of callus and necrotic
Cybrids
5,6,8,9
>50
Mostly callus
1,2,4,7,11,12,12R,17,22,24,18
25-50
Mixture of callus and necrotic
3,10,13,26,27
<25
Few callus, mostly necrotic
Gene expression. Responses of genes related to
host pathogen interaction in VO and Cy, differed from
RG. The pathogenicity related proteins PR4, chitinase
(CHI) and beta-glucanase (BG) were up regulated at 4
and 24 hpi in both cybrids. Higher expression of heat
shock proteins (Hsp20) in the cybrids suggested a
differential interaction of genes from the nucleus with
10
2
Xcc population (Log cfu/cm )
lesions were more necrotic as observed for VO. Thus,
canker resistance appeared to be quantitatively
inherited from VO based on an intermediate lesion
phenotype in the selected cybrids, (Fig. 1). This was
confirmed by Xcc population growth in Cy 3 (7.8 log
cfu) and Cy 10 (8.1 log cfu), that was similar to VO (8.0
log cfu) and nearlyly one log unit lower than RG (8.7 log
cfu) at 15 days post inoculation (Fig. 2).
8
6
4
RG
VO
Cy10
Cy3
2
0
0
2
4
6
8
10
12
14
16
Day
Fig. 2. - Xcc population over 15 dpi in Red grapefruit (RG),
Valencia orange (VO) and two cybrids (Cy3 and Cy10).
mitochondria and chloroplast genes from the cytoplasm
donor (Fig. 3a). Expression of genes related to MRR
(Fig. 3b), like alternative oxidase (AOX), aconitase-iron
regulated protein (IRP1) and ascorbate peroxidase
(APX2) were up regulated at 4 hpi in the cybrids, as
evidence for enhanced antioxidant activity.
A. Host pathogen related genes
6
VO
RG
Cy3
Cy10
Gene expression
5
4
3
2
1
0
-1
4
24
PR4
4
24
ACO
4
CHI
24
4
24
HSP20
4
24
BG
B. Genes involved in mitochondrial retrograde regulation
4
VO
RG
Cy3
Cy10
Gene expression
3
2
1
0
-1
71
Discussion
Mitochondria and chloroplasts have a central
role in stress and programmed cell death signaling.
The response of cybrids to Xcc may be expressed at
different levels depending on whether mitochondrial
and/or chloroplast genomes are transferred in the
cybridization process. Cybrids 3 and 10 produced a
quantitative resistance reaction to Xcc resembling that
in VO. Xcc population development in the cybrids was
similar to VO and almost one log unit lower than in
RG. More necrotic lesions in these cybrids and VO and
lower Xcc populations in lesions suggested cell death
occurred which reduced Xcc proliferation. Responses
of genes related to host pathogen interaction and
MRR, in VO and cybrids constrasted with those in RG.
At the present time, several citrus cybrids are under
evaluation in field trials in areas of endemic citrus
canker in South Florida.
Literature cited
1. Bassene J.B., Froelicher Y., Navarro L., Ollitrault P.,
Ancillo G. 2011. Influence of mitochondria on gene
expression in a citrus cybrid. Plant Cell Rep. 30:
1077-1085.
2. Francis, M.I., Peña, A., Graham, J.H. 2010. Detached
leaf inoculation of germplasm for rapid screening of
resistance to citrus canker and citrus bacterial spot.
Eur. J. of Plant Path. 127:571-578.
3. Sweetlove, L.J., Fait, A., Nunes-Nesi, A., Williams, T.,
Fernie, A.R. 2007. The mitochondrion: an integration
point in cellular metabolism and signalling. Crit.
Rev. Plant Sci. 26:17-43.
-2
-3
4
24
AOS
4
24
GST
4
24
FERT
4
24
IRP1
4
24
APX2
Fig. 3. - Relative expression of genes associated with host
pathogen interaction (A) and mitochondrial retrograde
regulation (B). Leaves were assayed at 4 and 24 h post
inoculation with Xcc at 108 cfu/ml. Red grapefruit (RG),
Valencia Orange (VO) and cybrids (Cy3 and Cy10) . Fold
changes expressed as (log2).
72
Reaction of transgenic sweet
orange cv. Pera expressing stx IA
gene to citrus canker caused by
Talk 23
Marques, VV1,4
Bagio, TZ1,2
Souza, GV1,4
Grange, L1,5
Meneguim, L1,2
Kobayashi, AK3
Bespalhok, JC5
Pereira, LFP3
Vieira, LGE1
Leite Jr, RP1
1 - Instituto Agronômico do Paraná. Londrina, PR, Brazil
2 - Universidade Estadual de Londrina. Londrina, PR, Brazil
3 - Empresa Brasileira de Pesquisa Agropecuária. Brasília, DF, Brazil
4 - Fundação de Apoio à Pesquisa e ao Desenvolvimento
do Agronegócio. Londrina, PR, Brasil
5 - Universidade Federal do Paraná. Curitiba, PR, Brazil.
e.mail: ruileite@iapar.br.
Introduction
Citrus production has been constantly
threatened by bacterial diseases, such as citrus
canker caused by Xanthomonas citri subsp. citri (Xcc).
Citrus canker is a leaf-spotting and rind-blemishing
disease. Under favorable environmental conditions,
the disease may cause severe tree defoliation, shoot
dieback and intense fruit drop on highly susceptible
citrus cultivars. Most of the highly valuable commercial
citrus cultivars are moderately to highly susceptible to
citrus canker. Furthermore, disease control measures
available are usually only modestly effective and
relatively costly (5). The development of transgenic
plants for disease resistance in economically
important citrus cultivars may represent a unique and
efficient strategy for control of citrus canker (1,3).
Different genes related to disease resistance
have been examined for the development of disease
resistant transgenic plants (8). Emphasis on
enhancing overall disease resistance in transgenic
plants has explored the potential of large proteins
and also small peptide cysteine-rich proteins (4,6).
Antimicrobial peptides (AMPs) are an integral part of
the innate immune system that protects a host from
invading pathogenic bacteria (7,8). Many eukaryotic
peptides act on bacterial membranes or other general
targets. In contrast, most antibiotics are usually
target specific proteins (10). Sarcotoxin IA (stx IA) is
an antibacterial peptide that is secreted by the meatfly Sarcophaga peregrine (9). This AMP belongs to the
peptide group that interacts with bacterial cellular
membrane and causes an electrochemical potential
loss (9).
In recent years, our group has investigated
the action of AMPs to control citrus diseases caused
by different bacteria, such as Xylella fastidiosa,
Candidatus Liberibacter asiaticus and Xanthomonas
citri subsp. citri. Plant transformation has been
examined to enhance pathogen resistance in different
citrus cultivars. In this work we report the reaction
of stx IA transformed sweet orange cv. Pera lines to
citrus canker.
Five independent events of sweet orange
(Citrus sinensis Osbeck) cv. Pera (STX-3, STX-5, STX11, STX12, and STX-13), transformed with the vector
pST10 containing the stx IA gene under control of
CaMV 35S promoter and the signal peptide from
tobacco PR1a were included in this study (2). For each
transformation event, five plants with similar age and
size were inoculated with the strain 306 of the Xcc
bacterium. For inoculation by injection-infiltration,
young expanded citrus leaves were infiltrated with a
bacterial suspension of approximately 104 cfu/ml. For
spray inoculation, young expanded citrus leaves were
sprayed with a bacterial suspension of approximately
106 cfu/ml. The bacterial population in the leaf tissue
of injection-infiltrated plants was determined up to 32
days days after inoculation. The disease incidence and
severity were evaluated 32 days after inoculation to
determine the resistance of the sarcotoxin producing
transgenic plants to citrus canker.
The plants of sweet orange cv. Pera
expressing the stx IA gene showed normal growth
and development, indicating that the antibacterial
peptide was not deleterious for the plant. A reduction
in disease incidence was observed for some of the
transgenic events as compared to the non-transformed
control plants of sweet orange cv. Pera (Figure 1). The
lowest levels of disease incidence were observed for
the events STX-3 and STX-5, which were significantly
different from the level observed for the nontransformed control plants (Figure 1). Furthermore,
significant differences were also observed in disease
severity between the stx IA gene transgenic plants and
the non-transformed control plants of sweet orange
cv. Pera. While the non-transformed control plants
showed more than 11 lesions/cm2, all the transgenic
events showed less than 5.0 lesions/cm2 (Figure 2).
The events STX-3 and STX-5 also showed the lowest
level of disease severity with less than 3.0 lesions/
cm2 (Figure 2).
In regard to bacterial growth, differences in
bacterial population were also observed between
the stx IA transgenic plants and the non-transformed
control plants of sweet orange cv. Pera (Figure 3).
From the eighth day after inoculation, a slower growth
73
of Xcc was observed in the stx IA gene transgenic
plants, with differences of up to 2 log units in bacterial
population from the non-transformed control plants
of sweet orange cv. Pera (Figure 3). The events STX-3
and STX-12 showed the lowest populations of Xcc in
the leaf tissue (Figure 3).
Figure 1. Incidence of citrus canker on leaves of stx IA gene
transgenic plants and non-transformed control plants of
sweet orange cv. Pera, 32 days after spray inoculation. Bars
labeled with different letters indicate significant differences
among treatments at P<0.5 level according to Duncan test.
Figure 2. Severity of citrus canker (number of lesions/cm2)
on leaves of stx IA transgenic plants and non-transformed
control plants of sweet orange cv. Pera, 32 days after
inoculation by injection-infiltration. Bars labeled with
different letters indicate significant differences among
treatments at <0.5 level according to Tukey´s HSD test.
Conclusions
The results show an improvement in resistance
to citrus canker in the citrus plants of sweet orange
cv. Pera transformed with the stx IA gene. This
improvement is observed in disease incidence and
severity, as well as in the growth of the Xcc population
74
in the leaf tissue. Field experiments are needed
to better evaluate the performance of stx IA gene
transgenic events under natural conditions of citrus
canker occurrence.
Figure 3. Growth curve of Xanthomonas citri subsp. citri
in leaves of stx IA transgenic plants and non-transformed
control plants of sweet orange cv. Pera inoculated by
injection-infiltration. Each value is the mean of three
replicates.
References
1. Barbosa-Mendes, J.M., Mourão Filho, F.A.A.,
Bergamin Filho, A., Harakava, R., Beer, S.V. and
Mendes, B.M.J. 2009. Genetic transformation
of Citrus sinensis cv. ‘Hamlin’ with hrpN gene
from Erwinia amylovora and evaluation of the
transgenic lines for resistance to citrus canker.
Scientia Horticulturae, 122:109-115.
2. Bespalhok Filho, J.C., Kobayashi, A.K., Pereira,
L.F.P. and Vieira, L.G.E. 2001. Laranja transgênica.
Biotecnologia, Ciência e Desenvolvimento, 23:6266.
3. Boscariol, R.L., Monteiro, M., Takahashi, G.K.,
Chabregas, S.M., Vieira, M.L.C., Vieira, L.G.E.,
Pereira, L.F.P., Mourão Filho, F.A.A., Cardoso, S.C.,
Cristiano, R.S.C., Bergamin Filho, A., Barbosa, J.M.,
Azevedo, F.A. and Mendes, B.M.J. 2006. Attacin A
gene from Tricloplusia ni reduces susceptibility
to Xanthomonas axonopodis pv. citri in transgenic
Citrus sinensis cv. Hamlin. Journal of the American
Society for Horticultural Science, 131:530-536.
4. Gutiérrez M.A., Luth, D.E. and Moore, G.A. 1997.
Factors
affecting
Agrobacterium-mediated
transformation in Citrus and production of sour
orange (Citrus aurantium L.) plants expressing the
coat protein gene of citrus tristeza virus. Plant Cell
Reports, 16:745-753.
5. Graham, J.H., Gottwald, T.R., Cubero, J. and Achor,
D.S. 2004. Xanthomonas axonopodis pv. citri:
factors affecting successful eradication of citrus
canker. Molecular Plant Pathology, 5:1-15.
6. Li, X., Gasic, K., Cammue, B., Broekaert, W. and
Korban, S.S. 2003. Transgenic rose lines harboring
an antimicrobial protein gene, Ace-AMP1,
demonstrate enhanced resistance to powdery
mildew (Sphaerotheca pannosa). Planta, 218: 226232.
7. Mourão Filho, F.A.A, Stipp, L.C.L. and BarbosaMendes, B.M.J. 2010. Perspectivas da produção
e utilização de transgênicos para o controle do
huanglongbing. Citrus Research & Technology,
Cordeirópolis, 31:91-100.
8. Nguyen, L.T., Haney, E.F. and Vogel, H.J. 2011.
The expanding scope of antimicrobial peptide
structures and their modes of action. Trends in
Biotechnology, 29:
9. Okada, M; Natori, S. 1983. Purification and
characterization of an antibacterial protein from
hemolinph of Sarcophaga peregrine (flesh-fly)
larvae. Biochemical Journal, 211: 727-734.
10. Peschel, A. and Sahl, H.G. 2006. The co-evolution of
host cationic antimicrobial peptides and microbial
resistance. Nat. Rev. Microbiology, 4:529-536.
In field reaction of citrus genotypes
to Xanthomonas citri subsp. citri1
75
Talk 24
Carvalho, SA2
Nunes, WMC3
Croce Filho, J3
Belasque Jr, J4
Machado, MA2
1 - Financial Support: Fapesp e CNPq
2 - Centro APTA de Citros “Sylvio Moreira” – IAC CP 04, 13490-970.
Cordeirópolis, SP. E-mail: sergio@centrodecitricultura.br
3 - Universidade Estadual de Maringá. Avenida Colombo, 5790,
87020-900. Maringá, PR
4 - Fundecitrus
Introduction
Citrus canker, a bacterial disease of citrus
that causes premature leaf, fruit drop and reduction
in yield and fruit quality. The disease is highly
contagious and can be spread rapidly by windborne
rain, lawnmowers and other landscaping equipment,
animals and birds, people carrying the infection
on their hands, clothing, or equipment and moving
infected or exposed plants or plant parts (3).
In Brazil, Xanthomonas citri subsp. citri the
Asian strain of the bacteria, was first time registered
in 1957 (2), but the disease have been maintained on
control in the São Paulo State citrus industry for several
decades, through program of eradication of focus,
interdiction of contaminated areas, control of nursery
trees and budwood production and quarantine. Citrus
leafminer, Phyllocnistis citrella Stainton a Lepidoptera
insect improves de dissemination of the disease
and, after its first occurrence in 1996, have been
considerate as an important cause of resurgence of
citrus canker in São Paulo State.
X. axonopodis appears to be pathogenic to all
cultivated species of Rutaceae. Besides greenhouse
studies (1) field screening has been conducted wordwide to evaluate the reaction of varieties to citrus
canker under local environmental conditions (5,
8). In Brazil, variations in the susceptibility among
species, varieties and even clones to X. axonopodis are
pointed (6, 7). The last research evaluating materials
introduced up to 1982 in the IAC citrus germplasm
collection, verified the existence of larger tolerance
in 41 clones of sweet orange and 36 of tangerine
and hybrid of potential horticultural characteristics
for the cultivation in the State. Besides the need of
a new evaluation of some of these materials, now in
the presence of the leaf miner, a research project is in
development the study the behavior in field, of new
varieties of sweet orange, tangerines and hybrid of
potential interests for the State, recent introduced in
that collection.
These expanded abstract describes the
results obtained in field evaluation of incidence
and severity canker symptoms in the plants, due to
natural inoculation in 183 varieties of sweet oranges,
mandarins an hybrids, introduced after 1982 in the
IAC citrus germplasm collection.
Two hundred thirteen genotypes of sweet
oranges, tangerines and hybrids of these two species,
belonging to the Citrus BAG - IAC, were planted in
April 2003 in the experimental area of the State
University of Maringá, in the city of Maringá, Paraná
state. Each genotype was considered a treatment
and the experiment was conducted in randomized
blocks with two replications and four plants per
plot. All plants (genotypes) were grafted on Rangpur
lime (Citrus limonia Osbeck). Plants of ‘Bahia Cabula’
(Washington Navel) were planted between the plots
of all varieties, and in November 2004 were artificially
76
inoculated to serve as a source of inoculum of Xcc.
The evaluations were performed monthly until
Dec/2005 and from this time every two months from
October to May. Grade of 0-5 were given to each plant,
being 0 = absence of leaves with lesions in the plant
and 5 approximately 100% of leaves with canker
symptoms. Of the 213 genotypes, 183 were evaluated
and are part of this expanded abstract. Average data
of each treatment were grouped by the Scott-Knott
test at 5% probability.
Date
nov/05
set/05
jul/05
mai/05
mar/05
jan/05
nov/04
set/04
jul/04
mai/04
mar/04
100
90
80
70
60
50
40
30
20
10
0
jan/04
Canker infection (%)
Six months after inoculation of Washington
Navel plants (May 2005), 80% of the plants of
treatments showed symptoms of citrus canker.
Seven months later (December 2005), when 98% of
the plants were infected (Figure 1), was initiated to
evaluation of incidence of leaves with lesions of the
disease in each plant.
Figure 1 – Canker infestation in the experimental area, in
54 evaluations of occurrence of plants with symptoms in
the period of January 2004 to December 2005.
The average values of the 18 assessments
of disease severity, held from October 2005 to
March 2010, involving the distribution of scores
for symptoms around the plant (0-5) are shown in
Figure 2. It is observed that there were variations
between assessments, which are due to changes in
the availability of inoculum inside and outside the
experimental area, but mainly due to variations
in weather conditions, with greater occurrence of
disease in periods of high humidity and temperature
and the occurrence of new sprout, conditions
conducive to the development of the pathogen.
Adapting the methodology used in other
researches (1,4), the groups provided by Scott-Knott
test were re-grouped setting only four classes of
resistance (Table 1). Thus, 43% of the accessions
were classified as resistant, with about 12% with high
potential for resistance to disease. However, more
than half appeared as susceptible, 30% with values
equal to or higher than those observed in control
susceptible Washington Navel.
Figure 2 – Average data of 18 evaluations of citrus canker
in citrus germplasm conducted from October 2005 to March
2010. Grades for symptoms around the plant (0-5).
Among the accessions with the greatest
potential for resistance, eleven are sweet orange,
representing 6% of all genotypes. Twelve are other
species, mainly mandarin or hybrids of this species,
which represented 6.5% of total accessions evaluated,
and. On the other hand, six mandarins or hybrids
were grouped as highly susceptible, showing that
Table 1 - Reaction of genotypes of citrus to citrus canker, according to grades of distribution of leaves with
symptoms around the canopy. Average scores from 0 to 5 of 18 reviews.
Genotypes
Tolerance/Resistance
Grades*
Sweet Oranges (%) Others** (%)
Classification
Number
%
Resistant
0,45 - 1,01
23
12,57
6,56
6,01
Moderadately Resistant
1,14 - 2,03
56
30,60
25,69
4,91
Susceptible
2,06 - 2,49
48
26,78
20,77
6,01
High Susceptible
2,94 - 4,35
55
30,60
27,33
3,28
*Re-groupping genotypes grouped by Scott-Knott test; **mandarins/hybrids (20), sour orange (1), lime (1),
Citrus spp (1) . Susceptible control Washington Navel = grade = 2.95 (average from 425 plants in 18 evaluations)
77
the phenotype “resistance” to the citrus canker is not
exclusively dependent on the botanical species.
References
1. Amaral, A.M. et al. 2010. Citrus reaction against
Xanthomonas citri subsp. citri. Journal of Plant
Pathology, 92 (2):519-524.
2. Bitancourt, A.A. O cancro cítrico. Biológico,
26(6):101-111.
3. Graham, J.H. et al. 2004. Xanthomonas axonopodis
pv citri: factors affecting successful eradication of
citrus canker. Molecular Plant Pathology, 5(1):115.
4. Hammerschlag, F.A.V. 1994. Stability of bacterial
leaf spot resistance in peach regenerants under in
vitro, greenhouse and field conditions. Euphytica,
76: 101-106.
5. Kishum, R. & Chand, R. 1987. Studies on germplasm
resistance and chemical control of citrus canker.
Indian-Journal-of-Horticulture, 44:126-132.
6. Mohan, S.K. et al. 1985. Comportamento de
cultivares de tangerinas ao cancro cítrico causado
por Xanthomonas campestris pv. citri. Fitopatologia
Brasileira, 10:549-558.
7. Namekata, T. et al. Comportamento de uma
coleção de citros submetida à contaminação do
cancro cítrico, causado pela bactéria Xanthomonas
campestris pv. citri. Laranja, 13:757-772.
8. Zubrzycki, H.M. & Zubrzycki, A.D., 1988. Evaluación
de resistencia a concrose en citros com diferentes
niveles de inoculo en infecciones naturales a
campo. Boletin Genetico, Instituto de Fitotecnia,
Castelar, 15:21-29.
78
Resistance of ‘pera’ sweet orange
(Citrus sinensis) genotypes to
in field conditions
Talk 25
Gonçalves-Zuliani, AMO1
Belasque Jr, J2
Zanutto, CA1
Remolli, JA1
Nunes, WMC1
1 - Núcleo de Pesquisa em Biotecnologia Aplicada – NBA. Universidade Estadual de Maringá.
2 - Fundecitrus. e-mail: alineorb@hotmail.com
Summary
The use of resistant genotypes is critical to
control the citrus canker and their obtainment can
be accomplished by selecting genotypes resented
germplasm banks. The objective of this study was to
evaluate clones of the Pera variety and their resistance
to citrus canker. The establishment of the experiment
was carried out in commercial orchards in the
municipalities of Congonhinhas, Cornelio Procopio,
and Paranavai, Parana State, Brazil. To determine
the incidence and severity were assessed ten plants
per clone, within four branches per plant sampled
in the middle portion of it. The first evaluations
allowed to infer the incidence of diseased plants in
Congonhinhas was lower than in Cornelio Procopio
and Paranavai, and that some clones have a lower
incidence and severity of the disease on the leaves.
These assessments will be conducted for a two years
period.
Keywords: citrus canker, Xanthomonas citri subsp.
citri, resistance.
Introduction
The citrus canker caused by Xanthomonas
citri subsp. citri [14] is an important disease in
citrus producing regions [10]. This disease affects
commercial sweet orange genotypes, resulting in
significant economical losses. The symptoms of
citrus canker can be seen throughout the plant
canopy. Lesions on leaves are generally prominent
on both sides, usually surrounded by a yellow halo.
Lesions on fruit are similar to those of the leaves,
and symptomatic fruit generally fall before reaching
maturity. On branches lesions generally occurs only
on very susceptible varieties [12]. The infection of
the bacteria on shoots of the plant may be associated
with the growth phases of the host and does not
occur uniformly throughout the year, being more
severe in early summer, where wind, heavy rain and
high temperatures are observed at the same time in
Brazilian conditions [12]. Citrus genotypes that have
prolonged vegetative growth, with shoots of young
tissues, are particularly susceptible to the bacteria [1,
2, 9].
The management of citrus canker should
consider that many commercial genotypes of citrus
are susceptible, which makes conventional control
measures almost inefficient and expensive [11].
Resistance is the most economical and efficient
management practice for this disease [4]. Several
citrus genotypes of economic importance have been
cited by adequate levels of resistance to citrus canker.
In the Parana State some variability for resistance
was found in citrus genotypes, especially among
cultivars of sweet orange (Citrus sinensis L. Osbeck)
and mandarin [6, 7, 8, 13, 15]. The obtaining of citrus
cultivars showing resistance to disease, even in
intermediate grade, can be accomplished by selection
of genotypes presented in germplasm banks or by
genetic transformation [5]. Thus, the present study
aims to assess the resistance to citrus canker of 25
clones of Pera genotypes, selected from germplasm
banks and farmers.
Trials of 25 clones of Pera Sweet orange
variety was installed in commercial citrus orchards
in three regions of Parana State, Brazil: Congonhinhas
(23° 29’S, 50° 29’W and 757 m altitude), Cornelio
Procopio (23° 05’S, 50° 38’W and 360 m altitude),
and Paranavai (23° 1’S, 50° 41’W and 467 m altitude).
Clones of Pera Sweet orange that were used in the
experiment came from the ‘Centro de Citricultura
Silvio Moreira’ (CCSM), the Nursery ‘Viveiro de Mudas
79
Pratinha’ (VMP) and the ‘Instituto Agronomico do
Paraná’ (IAPAR). All clones were planted in 2008 (6.0
x 2.5 meters) on Rangpur lime rootstock and plants
were naturally infected with the bacterium X. citri
from inoculum presented in neighbor commercials
orchards.
Incidence and severity of citrus canker were
assessed on 10 plants per clone in each evaluation.
There was counted the total number of leaves with
and without symptoms of citrus canker on four
branches per plant. Grades of estimated severity were
assigned to all leaves that showed symptoms using
diagrammatic scales [3]. Pera Sweet orange clones
were compared by mean values of incidence and
severity in each trial and between trials from all three
municipalities.
Figure 1. Citrus canker severity on leaves of clones of Pera Sweet orange in trials conducted in Congonhinhas, Cornelio
Procopio, and Paranavai municipalities, Parana State, Brazil.
Figure 2. Disease incidence on leaves of clones of Pera Sweet orange in trials conducted in Congonhinhas, Cornelio Procopio,
and Paranavai municipalities, Parana State, Brazil.
80
The trial at Congonhinhas presented the lowest
incidence and severity of diseased plants, probably
by the higher altitude and lower temperatures. Base
on three evaluations, clones named EEL, IAC, Ipigua,
Ovale Siracusa, and Coroada showed the lowest
severity and incidence of disease at the three trials.
References
1. Agostini, J.P. et al. 1985. Relationship between
development of citrus canker and rootstock
cultivar for young ´Valencia`orange trees in
Misiones, Aregentina. Proc.Fla. State Hortic. Soc.,
98:19-22.
2. Amaral A.M. 2004. O que torna o cancro cítrico
uma doença? Laranja, 25:375-387.
3. Belasque Júnior, J. et al. 2005. Escalas diagramáticas
para avaliação da severidade do cancro cítrico.
Fitopatologia Brasileira, 30:387-393.
4. Brunings A.M., Gabriel D.W. 2003. Xanthomonas
citri: breaking the surface. Molecular Plant
Pathology 4:141-157.
5. Cervera, M. et al. 2005. Genetic transformation
of mature citrus plants. Methods in Molecular
Biology, 286:177-188.
6. Croce Filho, J. 2005. Avaliação do cancro cítrico
em variedades de citrus em condições de campo
no noroeste do Paraná. [Dissertação de Mestrado]
Univers. Est. de Maringá.
7. Gonçalves, A.M.O. et al. 2010. Avaliações de
variedades de laranja doce Citrus sinensis quanto
à resistência ao cancro cítrico. Tropical Plant
Pathology, v.35, p. 154, (Suplemento).
8. Gonçalves-Zuliani, A.M.O. et al. 2011. Resistência
de diferentes clones de pêra (Citrus sinensis) à
Xanthomonas citri subsp. citri em condições de
campo na região noroeste do Paraná. v.36, p. 1062,
(Suplemento).
9. Gottwald, T.R. 1993. Differential Host Range of
Citrus and Citrus Relatives to Citrus Canker and
Citrus Bacterial Spot Determined by Leaf Mesophyl
Susceptibility. Plant Disease, 77:1004-1009.
10.Gottwald, T.R. et al. 2002. Geo-referenced
spatiotemporal analysis of the urban citrus canker
epidemic in Florida. Phytopathology, 92: 361-377.
11.Graham, J. H. et al. 2004. Xanthomonas axonopodis
pv. citri: factors affecting successful eradication of
citrus canker. Molecular Plant Pathology, 5:1-15.
12.Laranjeira, F.F. et al. 2005. Fungos, procariotos e
doenças abióticas. In: Mattos Junior, D. et al. Citros.
Campinas: Instituto Agronômico e Fundag. Centro
APTA Citros Sylvio Moreira. p. 509-566.
13.Leite Junior, R.P. and Mohan, S.K. 1990. Integrated
State of Paraná, Brazil. Crop Protection, v. 29.
14.Schaad, N.W. et al. 2006. Emended classification of
xanthomonad pathogens on citrus. Systematic and
Applied Microbiology, 29:690-695.
15.Vargas, R.G. 2008. Resistência de variedades de
Citrus sp. à Xanthomonas axonopodis pv. Citri em
condições de campo na região noroeste do estado
do Paraná. [Dissertação de Mestrado] Univers. Est.
de Maringá.
Session 6: Pathogen diversity
Two new MLVA- and CRISPR-based
schemes for global surveillance of
populations of Xanthomonas citri
pv. citri
83
Talk 26
Pruvost, O1
Koebnik, R3
Vernière, C1
Jeong, K3
Vital, K1
Forero, N3
Magne, M1
Rodriguez-R, LM3
Prugnon, C1
Guérin, F2
Gagnevin, L1
1 - CIRAD
2 - Université de la Réunion, UMR Peuplements Végétaux et Bioagresseurs en Milieu Tropical, Pôle de Protection des Plantes, 7,
chemin de l’Irat, 97410 Saint Pierre, Réunion, France
3 - IRD, UMR186 Résistance des Plantes aux Bioagresseurs, BP
64501, 34394 Montpellier cedex 5, France
Xanthomonas citri pv. citri , the causal agent
of Asiatic citrus canker has long been recognized as
a monomorphic pathogen. This can be explained by
(i) the rather low discriminatory power of phenotypic
and genotypic methods used until the end of the
1990s and (ii) the poor knowledge of the diversity of
the pathogen in the countries where Citrus and X. citri
pv. citri likely originated.
Since then, several research groups highlighted
some pathological diversity among strains (pathotypes
A*, Aw). Likewise, the development of typing schemes
targeting mobile elements or micro- and minisatellites
have allowed a more detailed description of the genetic
diversity among strains. The very low intra-pathovar
diversity at housekeeping genes precludes the use for
X. citri pv. citri of MLST (MultiLocus Sequence Typing),
which has become the standard for global surveillance
of bacterial pathogens.
Here, we report two new typing schemes, based
on minisatellites (MLVA) and CRISPR loci, the molecular
basis of the well-known spoligotyping scheme. The
MLVA scheme targeted 29 loci with tandem repeat size
ranging from 18 to 301 bp, thus allowing the use of
standard agarose gel electrophoresis in laboratories
that are not equipped with a genotyper. Among these
loci, 12 were found to be polymorphic within a strain
collection composed of 90 strains from all continents
where X. citri pv. citri has been recorded, including
from recent outbreaks in Africa. Monomorphic loci
were useful for distinguishing pv. citri strains from
any phylogenetically related xanthomonad or any
xanthomonad pathogenic to rutaceous species.
CRISPR loci from several representative X .citri strains
were sequenced and compared to results from VNTR
and AFLP typing approaches.
84
Talk 27
Molecular epidemiology of
Xanthomonas citri pv. citri causing
Asiatic citrus canker in Senegal
Vernière, C1
Leduc, A1
Boyer, C1
Vital, K1
Niang, Y2
Rey, JY3
Pruvost, O1
1 - CIRAD-Université de la Réunion, UMR/PVBMT, Saint Pierre,
La Réunion, F-97410 France
2 - ISRA-CDH, Dakar, Senegal
3 - CIRAD-ISRA, UPR Hortsys, Thies, Senegal
In February 2010, grapefruit (Citrus paradisi)
and Mexican lime (C. aurantifolia) leaves with erumpent
callus-like lesions were collected in Senegal. These
symptoms similar to those of citrus canker have been
observed by local farmers since 2008. PCR using the
primer pair 4/7 revealed that all the Senegalese strains
were assigned to X. citri pv. citri. Using a detached leaf
assay, 15 strains inoculated on Duncan grapefruit,
Pineapple sweet orange and Mexican lime leaves
induced typical erumpent, callus-like tissue two weeks
after the inoculations. A high disease prevalence was
observed in Senegal with incidence exceeding 90% in
the orchards where lime and grapefruit were infected for
three years, indicating the suitability of environmental
conditions in this region for the development of Asiatic
citrus canker. This represents the fourth outbreak of
citrus canker reported from Africa within the last five
years, the other documented reports being in Ethiopia
(2007), Mali and Somalia (2008).
Insertion sequence ligation-mediated-PCR
(IS-LM-PCR), AFLP and MLSA analyses of twentythree X. citri pv. citri strains from Senegal, additional
African strains and reference strains of X. citri pv. citri
pathotypes A and A* confirmed that the strains from
Senegal were related to X. citri pv. citri but not to pv.
aurantifolii. They were closely related to X. citri pv. citri
pathotype A strains, with a broad host range, present
in the Indian subcontinent and Mali but differentiated
from the East-Asian strains.
A survey was conducted from late 2010 to
early 2011 and 526 individuals were collected from
different orchards. The analysis of the Senegalese
collection using 14 polymorphic VNTR markers
revealed a low genetic diversity (HT = 0.37, allelic
richness = 6.24). The STRUCTURE program applied
on the whole collection defined two populations
with distinct allele frequencies. These Senegalese
populations S1 (n1=397) and S2 (n2=129) showed
similar genetic diversity levels and were genetically
differentiated but not geographically separated.. A
significant linkage disequilibrium was found at the
population level and at the orchard level most of the
time. Two major clonal complexes were identified by
eBURST. The physical distances between individuals
within a clonal complex suggest a local dissemination
(wind, rain) combined with transport by human
activities. The low genetic diversity and the presence
of major clonal complexes support the hypothesis of a
recent emergence of X. citri pv. citri in Senegal.
Our results provide additional information
on the epidemiology of X. citri pv. citri and its reemergence in Africa and point out the importance of
molecular tools in the epidemiological analysis and
global epidemiological surveillance.
85
Talk 28
Genetic diversity of in vitro
collections of Xanthomonas citri subsp.
citri analyzed with relationship
to origin of strains
Coletta-Filho, HD
Dorta, SO
Alves, KCS
Machado, MA
Centro de Citricultura/IAC. Cordeiropolis, SP, Brazil.
helvecio@centrodecitricultura.br
Introduction
The Asian Citrus Canker - ACC caused by
Xanthomonas citri subsp. citri (Xcc) is the most
worldwide spread citrus canker type, infecting
some genera in the Rutaceae family, but with
known susceptibility degrees within and between
citrus species [1]. The disease is endemic in China,
Japan, southern Asia, Oceania, and North and South
America. In Brazil the exclusion and eradication of
symptomatic and the neighboring citrus plants are
the strategies adopted by Sao Paulo State for ACC
control since the 50’s, while in others States like
Parana, an integrated management approach of this
disease has been conduced in the last three decades,
which contributed for the disease to became endemic
with re- or new infection events occurring naturally.
The same occurred in another South America
countries (Uruguay Paraguay, and Argentine), and
recently in North America (Florida, USA). Factors like
agricultural practices, species or host varieties, and
host geographic origins could be a driver for genetic
diversity of plant pathogens [10, 7, 4]. Bacterial
simple sequence DNA repeats (SSRs) are heritable
loci of contiguous short sequences of repeating
nucleotides. These are hypermutable loci in bacterial
species with height-throught potential being useful
for studies addressing the ecology of pathogens at
fine scale as observed by Ngoc et al. [9], that conclude
that SSR markers best described the variation found
among Xcc individual strains from the same countries
or groups of neighboring countries. In this work we
are interested in addressing questions concerning the
genetic diversity of Xcc, analyzed by microsatellites
based markers, and if factors like agricultural
management of ACC, hosts, and geographic origin
could have some effect on genetic diversity of this
pathogen.
Biological material. The genomic DNA
sequence of Xcc strain 306 was screened for repetitive
DNA with the Tandem Repeat Finder software [2]. This
software scores all DNA motif categories, although in
our study only perfect repeats were selected, resulting
in ten SSRs. Primers flanking the repetitive regions of
Xcc 306 genome were designed and those that were
able to amplify a single DNA fragment were selected
for analysis (Table 1). These SSR primers were used
to amplify SSR loci in DNAs from 65 strains of Xcc
collected worldwide and present in International
Collections like IBSBF (Phytobacteria Culture
Collection of Instituto Biologico, Campinas, Brazil,
and Plant Pathology Quarantine Facility, Division of
Plant Industry, USDA). Xcc isolated by our group from
infected plants from Parana State were also included
in the analysis.
Statistical Analysis. This collection of isolates
was structured in subgroups like; 1. Management
86
Table 1. Information of SSR primers used on this study.
Primer ID
Sequence (5’ - 3’)
SSR02
GTGAGTGCCCTTTGCTTGGTCCTGGCTCACCCGAAATG
SSR02
CATCATGCGCCTGTGC CGCACAAGCCGGTA
SSR04
CCATCGACACCACTCAGAAAGGGAATTGCGTTCAAACC
SSR07
GGCCAGCGCCACTGGCCTTGCGTCAGCAAAAGCGATAG
SSR08
CGCATCATCGCACCGCGGT GCACACCGTTGTGATGGA
1 - Genetic diversity estimates for each loci according to Nei, (1973).
strategy: endemic – from Parana (n = 7) vs. nonepidemic – from Sao Paulo (n = 15); 2. Host species:
from C. sinensis (n = 32) vs. from other citrus species
(n = 22); and 3. Geographic regions: from Asia (n =
26) vs. America (n = 39) continents (Table 2).
The Slatkin’s RST index analysis for
differentiation between pairs of comparison (1, 2,
and 3) was obtained using the Stepwise Mutation
Model of SSR in Xcc, as proposed by Ngoc et al [9].
Gene diversity (H) index, as know as frequency allelic
within each sub-collection, was also estimated. Both
index were estimated by the GenoDive software [6] as
measures of genetic diversity between or within the
sub-collection. Randomization steps (n = 1,000) were
conduced for the statistical significance.
Amplicon
H Nei1
size (pb)
(GAATCGG)7
110
0.507
(ACCGCC)5
120
0.000
(ATTCCCG)4
114
0.134
(ATTGCC)6
100
0.244
(ATCGGC)7
90
0.222
Motif
citrus species tested like C. aurantifolia, C. grandis,
C. paradise, or C. reticulata. Also, Xcc strains from
endemic and copper-managed area (Parana) and
from non-spread area (Sao Paulo) were genetically
similar. As already hypothesized probably Sao Paulo
and Parana populations of Xcc were originated
from the same genotypic strains [5]. Also, our data
suggested that the endemic behavior of Xcc in Parana
in the last 30 years was not enough to change the
clonally of these bacteria. An unexpected absence of
differentiation between Xcc from Citrus sinensis was
obtained compared to others citrus species, even
analyzing high variable SSR target regions. Analysis
using other molecular markers under pressure
selection like the based on type III effectors genes
could be informative for those comparison [5]. Values
of gene diversity (H) estimated for strains within
each previous defined sub-collection supported the
found RST values. Xcc from Asia showed the highest
value (H = 0.328) that was statistically different from
strains from America (H = 0.116). Cubero & Graham
[3] also observed higher values of genetic diversity
The level of genetic differentiation among
pairwise sub-collections by AMOVA based on
Slatkin’s RST test was significant only for geographic
stratification (RST = 0.076, p =0.008) with no difference
for host species (RST = 0.006, ns) or management
strategy (RST = 0.008, ns). For all
the analyzed stratification most Table 2. Hierarchical AMOVA1 of X. citri pv. citri populations (three
of genetic diversity observed was stratus) by using SSR markers
consequence of variation among
Stratum / Source of variation % of variation RST values P value
strains within each stratum
(Table 2). The negative values 1. Management strategy /
-3.860
-0.389
0.995
obtained for comparison 1 (Sao Among strains
Between
population
0
0.008
0.23
Paulo x Parana) was consequence
2.
Host
species
/
of lowest or absence of genetic
variation among strains within Among strains
0.994
1.0
0.000
Sao Paulo and Parana strata, Between population
0.006
0.006
0.306
respectively (Table 2). These 3. Geographic regions /
non-statistically different values
Among strains
0.924
1.0
0.000
indicated an absent of genetic
Between population
0.076
0.076
0.008
differentiation between pairs of
comparison of Xcc from sweet 1 - Amova: Analysis of Molecular Variance. Significance e was tested using
orange (C. sinensis) and the others 10000 permutations.
for Xcc from Asia, the origin center of Xcc, which was
confirmed by our results. But no statistical difference
was found for gene diversity from Xcc strains of
sweet orange (H = 0.200) compared to others hosts
(H = 0.220) neither for the epidemic areas in Parana
(H = 0.000) or under eradication program adopted
by Sao Paulo (H = 0.090). The interpretation of data
from Sao Paulo and Parana (strata 1) needs be done
with caution since a limited number of strains, most
of them randomly sampled from in vitro collections
and a few number of SSR markers were used in the
analysis.
References
1. Amaral A.M., Carvalho S.A., Silva L.F.C and Machado
M.A. 2010. Reaction of genotypes of citrus species
and varieties to Xanthomonas citri subsp. citri
under greenhouse conditions. Journal of Plant
Pathology, 92: 519-524
2. Benson, G. 1999. Tandem repeats finder: a program
to analyzed DNA sequences. Nucleic Acids Res.
27:573-580.
3. Cubero, J. & Graham, J.H. 2002. Genetic relationship
among wordwide strains of Xanthomonas causing
cancker in citrus species and design of new
primers. Appl. Env. Microbiol. 68:1257-1264.
4. Fraser, C., Alm E.J., Polz M.F., Spratt B.G., and
Hanage W.P. 2009. The bacterial species challenge:
making sense of genetic and ecological diversity.
Science 323:741-746.
5. Jaciani F.J., Ferro J.A., Ferro, M.I.T., Vernière C.,
Pruvost O., Belasque Jr., J. 2011. Genetic Diversity
of a Brazilian Strain Collection of Xanthomonas
citri subsp. citri Based on the Type III Effector
Protein Genes. DOI: 10.1094/PDIS-04-11-0357.
6. Meirmans, P., and P. Van Tienderen. 2004.
GENOTYPE and GENODIVE: two programs for the
analysis of genetic diversity of asexual organisms.
Molecular Ecology Notes 4:792-794.
7. Mundt, C.C. 2002. Use of multiline cultivars and
cultivar mixtures for disease management. Annual
Reviews of Phytopathology 40:381-410.
8. Nei, M. 1973. Analysis of gene diversity in
subdivided populations. Proc. Natl. Acad. Sci. USA
70:3321-3323.
9. Ngoc L.B.T., Vernie`re C., Jarne P., Brisse S.,
Gue´rin F., Boutry S., Gagnevin L., Pruvost O.
2009. From local surveys to global surveillance:
87
three high-throughput genotyping methods for
epidemiological monitoring of Xanthomonas citri
pv. citri pathotypes. Applied and Environmental
Microbiology, 75:1173-1184.
10.Restrepo, S., Vélez, C. M., and Verdier, V. 2000.
Measuring the genetic diversity in Xanthomonas
axonopodis pv. manihotis within different fields in
Colombia. Phytopathology, 90:683-690.
88
strains in Iran
Talk 29
Rezaei, MK1
Shams-Bakhsh, M1
Alizadeh, A2
Tarbiat Modares University, Iran. E-mail: shamsbakhsh@modares.ac.ir
Citrus bacterial canker (CBC) is one of the
most important disease of citrus which caused by
Xanthomonas citri subsp. citri (Xcc). CBC in Iran was
first reported on Mexican lime trees from Kahnouj
region in Kerman province (1). In the present study,
a collection of twenty five strains were isolated
from Fars, Hormozgan, Kerman and Sistan-vaBaluchestan provinces of Iran and assessed. Based
on the phenotypic characteristics all strains were
identified as putative Xanthomonas citri subsp. citri.
All strains had the same biochemical properties and
it is concluded these tests are not so capable to show
differences among Iranian strains of Xcc. (2). Based
on host range determination strains were divided
into two groups; the first group was pathogenic
on Mexican lime (Citrus aurantifolia), citrumelo
(Poncirus trifoliata × C. paradisi), citrange (C. sinensis ×
P. trifoliata) and sour orange (C. aurantium) varieties
whereas the second group was pathogenic on Mexican
lime merely (Table 1). Profile of cellular soluble
proteins analyzed by sodium dodecyl sulphatepolyacryamid gel electrophoresis (SDS-PAGE) did not
reveal any considerable differences among strains.
Genetic diversity analyses were performed using two
marker systems; repetitive polymerase chain reaction
(rep-PCR) (3) and random amplified polymorphic
DNA (RAPD). The results of this research showed that
two primers, ERIC 1R (Fig. 1) and 232 (Fig. 2), with
the highest marker index, resulted in the most genetic
variability among strains. The cluster analysis by the
band patterns allowed the discrimination of strains
from Sistan-va-Baluchestan province as different
group so it was concluded that geographical origin
of these strains is differed from strains isolated from
other provinces (Fig. 3). It seems that geographical
origin of strains from Sistan-va-Baluchestan province
is differed from other strains, because these strains
were separated as a different group by the most
fingerprints that performed by primers of repPCR and RAPD markers. The difference between
percentage polymorphism, PIC and MI values of two
marker primers was not so considerable and it was
concluded that well-chosen primers could result
in quick estimate genetic diversity, epidemiology
and geographical distribution studies of Xcc strains.
However it should be considered that rep-PCR
compare to RAPD is more specific and the results of
this marker are more reliable.
Table 1. Host range determination of Iranian strains
of Xanthomonas citri subsp. citri.
Group Group
Host plant
1
2
Mexican lime (Citrus aurantifolia)
+
+
Sour orange (C. aurantium)
+
Citrumelo
+
(Poncirus trifoliata × C. paradise)
Citrange (C. sinensis × P. trifoliata)
+
Citrumelo
(Poncirus trifoliata × C. paradise)
Grapefruit (C. paradisi)
Orange (C. sinensis)
Pamello (C. grandis)
Sweet lime (C. limettioides)
-
Fig. 1. PCR fingerprinting pattern of genomic DNA of Iranian
strains of Xanthomonas citri subsp. citrifrom different
geographical regions of Iran generated by ERIC-1R primer.
Lane M, molecular marker GeneRulerTM 100 bp DNA ladder
(Fermentas); lane NC (negative control) without DNA template;
lane OG (out group) Xanthomonas citri subsp. malvacearum;
lanes K1 to K9, strains from Kerman provice; lanes S1 to S3,
strains from Sistan-va-Baluchestan province; lane DH, strain
from Philippine; lanes F1 to F7, strains from Fars province;
lane H1 to H5, strains from Hormozgan province.
Fig. 2. PCR fingerprinting pattern of genomic DNA of Iranian
strains of Xanthomonas citri subsp. citri from different
geographical regions of Iran generated by primer 232.
Lane M, molecular marker GeneRulerTM 1 kb DNA ladder
(Fermentas); lane NC (negative control) without DNA
template; lane OG (out group) Xanthomonas citri subsp.
malvacearum; lanes K1 to K9, strains from Kerman provice;
lanes S1 to S3, strains Sistan-va-Baluchestan province; lane
DH, strain from Philippine; lanes F1 to F7, strains from Fars
province; lane H1 to H5, strains from Hormozgan provinc.
89
Fig. 3. Dendrogram showing the relationship between 25
Xanthomonas citri subsp. citri strains by UPGMA clustering
based on rep-PCR (A) and RAPD (B) analysis. Bootstraps
values (based on 100 replicates) are indicated at the
node. K, F, H, and S stands for strains from Kerman, Fars,
Hormozgan, Sistan-va-Baluchestan provinces, respectively.
DH stands for strain from Philippine.
References
1. Alizadeh, A., and Rahimian, H. 1990. Citrus canker
in Kerman province, Iranian Journal of Plant
Pathology 26:118.
2. Schaad, N.W., Jones, J.B. and Chun, W. 2001.
Laboratory guide for identification of plant
pathogenic bacteria. American Phytopathological
Society. St. Paul Minnesota. USA, APS. 373 pp.
3. Versalovic, J., Schneider, M., de Bruijn, F.J., and
Lupski, J.R. 1994. Genomic fingerprinting of
bacteria using repetitive sequence based PCR
(rep-PCR). Methods in Cell and Molecular Biology
5: 25-40.
Session 7 – Host-pathogen interaction
92
Talk 30
Burkholderia andropogonis
isolated from citrus causes cankerlike symptoms and its pathogenicity
is enhanced by PthA effectors from
Xanthomonas citri
Gabriel, DW
Department of Plant Pathology, University of Florida
Gainesville, Florida 32611 USA
Burkholderia andropogonis (Ba) strain Ba6758
was isolated from citrus in Florida in 2007 as a
suspected citrus canker infection, but the lesions were
brown in color, circular and only slightly raised, with
water-soaked margins (Duan et al. 2009). Ba is known
to cause similar symptoms on a very wide range of
hosts including bougainvilleas; on citrus the disease
is called bacterial brown leaf spot. Xanthomonas citri
pv. aurantifolii (Xca) from S. America causes citrus
canker disease (cancrosis B), characterized by raised,
hyperplastic lesions. Xca strain B69 carries a selfmobilizing plasmid, pXcB, that encodes pthB, a pthA
homolog, which can, in planta, transfer ability to
cause citrus canker disease to Xanthomonas strains
that cannot cause cankers (El Yacoubi et al., 2007).
Since the citrus canker eradication program ended
several years ago, citrus canker disease is much more
widespread in the State, allowing opportunity for
bacterial pathogens that colonize citrus to interact
with X. citri and dramatically increasing the possibility
for horizontal gene transfer. Both pthA and pthB
cloned on separate plasmids were independently
mobilized into Ba6758, resulting in greatly increased
pathogenicity of the Ba6758 transconjugants on
citrus and a higher growth rate on citrus as compared
to wild type Ba6758. The enhanced phenotype
was hrcV-dependent, indicating Type III secretion
system injection of PthA and PthB into host cells
and suppression of citrus host defenses. However,
hyperplastic canker lesions did not result, indicating
modulation by additional Ba factors. Transgenic
approaches to controlling multiple bacterial diseases
of citrus, including huanglongbing (HLB or “greening”)
and citrus canker is currently under evaluation.
93
Characterization of the two type Talk 31
II secretion systems in Xanthomonas
axonopodis pv. citri and their effect
on pathogenicity, enzyme secretion,
and biofilm formation
Homem, RA1,2
Machado, MA1
Malamud, F3
Baptista, JC1,2
Vojnov, AA3
Amaral, AM do1,4
1 - Centro de Citricultura “Sylvio Moreira”, CP 04, Cordeirópolis, SP,
13490-000, Brazil
2 – Universidade Estadual de Campinas, Campinas, SP, Brazil
3 – Fundación Pablo Cassará, Centro de Ciencia y Tecnología “Dr.
Cesar Milstein”, Ciudad de Buenos Aires, Argentina
4 – Embrapa Recursos Genéticos e Biotecnologia, Brasília, DF, Brazil
Xanthomonas axonopodis pv. citri (Xac) causes
the citrus canker, a major threat to the citrus industry
worldwide. Throughout its genome, two clustter (xps
and xcs) that encompass for the type two secretion
systems (T2SS) were identified. However, the role of
those genes and the implication of their products in
pathogenicity are poorly understood. In this study, the
function of those two clusters and their activity during
the interaction with the plant host were analyzed.
Xps- T2SS is directly involved with pathogenesis of
Xac, mediates the translocation of enzymes which
degrade starch, carboxymethylcellulose, and proteins,
and plays a role in bacterial attachment and biofilm
formation. In the other hand, Xcs-T2SS did not show
to be a classical T2SS, since, no activity in degradation
enzymes secretion was found and pathogenesis was
slightly affected by knocking out the system. However,
Xcs- T2SS also seems be involved in the attachment
process in vitro and in planta, as well as biofilm
formation.
94
What are behind?
Genetic determinants of disease
development of citrus canker
Talk 32
Wang, N
Guo, Y
Yan, Q
YG and QY contribute equally to this work
The genus Xanthomonas is an important group
of Gram-negative plant pathogenic bacteria, which
infects approximately 124 monocotyledonous and
268 dicotyledonous plants. The genus, Xanthomonas,
has become an important model organism for
studying plant-microbe interaction and for
understanding bacterial pathogenicity and virulence
mechanisms. Among the diseases caused by members
of the genus Xanthomonas, citrus canker is one of the
most serious diseases of most commercial citrus
cultivars resulting in significant losses worldwide.
This devastating disease is caused by Xanthomonas
axonopodis pv. citri (Xac). To investigate the virulence
mechanism of this pathogen, a Xac mutant library
was constructed by randomly mutagenesis using
EZ::Tn5. Around 22,000 independent mutants
were inoculated and screened in host plant citrus
individually. And 217 mutants were identified which
showed significantly virulence change in planta. 103
genes/loci including known virulence genes and
hypothetical genes were identified. The roles of those
novel virulence genes were characterized. To further
understand the virulence mechanisms of XAC, we
designed and conducted genome-wide microarray
analyses to characterize the HrpG and HrpX regulons,
which are critical for the pathogenicity of XAC. Our
results indicate that HrpG, together with HrpX, play
global roles in coordinating different virulence traits
including the novel virulence genes indentified in
the mutagenesis analysis. Interestingly, some of the
virulence genes were also subjected to regulation of
the diffusible signal molecules (DSF) as identified
in the microarray analysis of the rpfF, rpfC and rpfG
mutants compared to wild type.
95
Talk 33
How does Xanthomonas citri
subsp. citri coordinate its virulence
genes?
Wang, N
Universitu of Florida, USA
Xanthomonas axonopodis pv. citri is the
causal agent of citrus canker, which is one of the
most serious diseases of citrus. To understand the
virulence mechanisms of X. axonopodis pv. citri, we
designed and conducted genomewide microarray
analyses to characterize the HrpG and HrpX regulons
and the DSF family signal-mediated quorum sensing
(QS) regulon, which are critical for the pathogenicity
of X. axonopodis pv. citri. Our analyses revealed that
232 and 181 genes belonged to the HrpG and HrpX
regulons, respectively. In total, 123 genes were
overlapped in the two regulons at any of the three
selected timepoints representing three growth stages
of Xanthomonas axonopodis pv. citri in XVM2 medium.
Our results showed that HrpG and HrpX regulated all
24 type III secretion system genes, 23 type III secretion
system effector genes, and 29 type II secretion system
substrate genes. Our data revealed that Xanthomonas
axonopodis pv. citri regulates multiple cellular
activities responding to the host environment, such as
amino acid biosynthesis; oxidative phosphorylation;
pentose-phosphate pathway; transport of sugar,
iron, and potassium; and phenolic catabolism,
through HrpX and HrpG. We found that 124 and 90
unknown genes were controlled by HrpG and HrpX,
respectively. Our results suggest that HrpG and HrpX
interplay with a global signaling network and coordinate the expression of multiple virulence factors
for modification and adaption of host environment
during Xanthomonas axonopodis pv. citriinfection.
Comparison of the transcriptomes of the QS mutants
(rpfF, rpfC, and rpfG) with that of the wild-type strain
revealed a core group of genes controlled by all the
three QS components, suggesting that the RpfC-RpfG
two-component system is a major and conserved
signal perception and transduction system for DSF
family signal-mediated QS in XCC. The unique genes
controlled by RpfF alone indicate the complexity of
the QS pathway and the involvement of additional
sensory mechanisms in XCC. The unique genes
controlled by RpfC and RpfG, respectively, support
the possibility that RpfC and RpfG play broader roles
in gene regulation other than transduction of DSF
signals.
96
Talk 34
Biofilm and virulence of
Xanthomonas citri subsp. citri and its
detection in canker disease
Malamud, F1
Conforte, VP
Rigano, LA1
Torres, PS1
Roeschlin, R2
Amaral, AM do3
Castagnaro, AP4
Marano, MR2
Vojnov, AA1
1 - Instituto de Ciencia y Tecnología Dr. Cesar Milstein, Fundación
Pablo Cassará, CONICET. Ciudad de Buenos Aires, Argentina.
2 - IBR- Depto. Microbiología. Facultad de Ciencias. Bioquímicas y
Farmacéuticas. U.N.R. Rosario, Argentina.
3 - Rothamsted Research and EMBRAPA, UK
4 - Estación Experimental Agroindustrial Obispo Colombres. Las Talitas, Tucumán, Argentina.
Xanthomonas citri pv. citri (Xcc) is the causative
agent of citrus canker, an important threat to the
citrus industry worldwide. Crystal violet staining
and confocal laser scanning microscopy analysis of
Xcc strains expressing the green fluorescent protein
were used to evaluate attachment and biofilm
formation on abiotic and biotic (leaf) surfaces. The
extracellular polysaccharide xanthan (EPS) played
a key role in the biofilm maturation, survival on leaf
surfaces and virulence. Biofilm formation in other
bacteria is a flagellar-dependent process. Xac has
a unique polar flagellum and the evaluation of its
participation in biofilm development was performed
by the generation of two mutants: Xcc fliC (flagelin
gene) and Xcc flgE (hook gene), both involved in
the flagellar structure. Confocal laser scanning
microscopy of biofilms produced in static culture
demonstrated that the flagellum is also involved in
the formation of mushroom-shaped structures and
water channels, and in the dispersion of biofilms. The
presence of the flagellum was required for mature
biofilm development on lemon leaf surfaces. The
absence of flagellin produced a slight reduction in
Xcc pathogenicity and this reduction was more severe
when the complete flagellum structure was absent. A
sensitive, specific and fast diagnostic assay for Citrus
Bacterial Canker detection is also presented.
New insights into the Xanthomonas
citri – sweet orange interaction
97
Talk 35
Benedetti, CE
Laboratório Nacional de Biociências, CP6192, 3083-970. Campinas,
SP, Brazil
Xanthomonas pathogens have the ability to
transfer effectors proteins into plant cells to cause
disease. The Xanthomonas citri protein PthA, a
transcriptional activator-like (TAL) effector, is targeted
to the nucleus of host cells to modulate transcription
associated with citrus canker development. Although
much is known about target genes and DNA specificity
of numerous Xanthomonas TAL effectors, very little
is still known about citrus genes that are directly
modulated by the PthA proteins. In addition, the
molecular mechanism through which TAL effectors
control host transcription is poorly understood.
In this talk, we will present evidence of how PthA
proteins might increase the rates of transcription
in the host, based on protein-protein interactions
identified between PthA variants and sweet orange
proteins involved in transcription regulation.
Additionally, we will present evidence suggesting that
TAL effectors from X. citri positively modulate the
auxin and gibberellin response, required for canker
development. By contrast, TAL effectors from a
Xanthomonas aurantifolii pathotype C strain appears
to down-regulate the auxin and gibberellin response
and to induce gene silencing.
98
The Xanthomonas citri type IV
secretion system
Talk 36
Souza, DP
Andrade, MO
Alvarez-Martinez, CE
Arantes, GE
Salinas, RK
Farah, CS
Department of Biochemistry, Instituto de Química. Universidade de
São Paulo, Brazil.
Type IV secretion systems (T4SS) are used by
bacteria to translocate protein and DNA substrates
across the cell envelope and into target cells. The
Xanthomonas citri subsp. citri (Xac) genome codes
for two type IV secretion systems, one encoded
by the Xac chromosome of unknown function and
another coded by the Xac plasmid pXAC64 probably
involved in plasmid mobility. Translocation across
the outer membrane is achieved via a ringed
tetradecameric complex made up of VirB7-VirB9VirB10 heterotrimers. Here we show that the complex
chromosomally encoded Xac VirB7-VirB9-VirB10
complex is expressed in vivo. We have determined the
NMR and 1.0 Å X-ray structures of the VirB7 subunit
from Xac (VirB7XAC2622) and studied its interaction
with VirB9. NMR solution studies show that residues
27-41 of the disordered flexible N-terminal region
of VirB7XAC2622 interacts specifically with the
Supported by: FAPESP, CNPq and CAPES
VirB9 C-terminal domain, resulting in a significant
reduction in the conformational freedom of both
regions. VirB7XAC2622 has a unique C-terminal domain
whose topology is strikingly similar to that of N0
domains found in proteins from different systems
involved in transport across the bacterial outer
membrane. We show that VirB7XAC2622 oligomerizes
through interactions involving conserved residues
in the N0 domain and residues 42-49 within the
flexible N-terminal region and that these homotropic
interactions can persist in the presence of heterotropic
interactions with VirB9. Finally, we propose that
VirB7XAC2622 oligomerization is compatible with the
outer membrane complex structure in a manner
such that the N0 domains form an extra layer on the
perimeter of the tetradecameric ring.
Keywords: Structural Biology; NMR; Xanthomonas.
99
Cell-cell communication regulates Talk 37
the motility, exopolyssacharide and
extracellular enzymes production of
Andrade, M1
Chuch Farah2
1 - Departamet of Botany-IB
2 - Departament of Biochemistry-IQ, University of São Paulo, Brazil.
Email: aomax@ib.usp.br
The citrus canker is a those principal diseases
affecting citrus species that is cause by the bacterium
Xanthomonas citri subsp. citri. The infection origins
lesions on the leaves, stem, and fruit of citrus trees,
including lime, oranges, and grapefruit, causing leaves
and fruit to drop prematurely. In Xanthomonas the cellcell signaling mediated by diffusible molecules is known
to play an important role in regulating physiological
process, including the formation and dispersal of
biofilm and virulence. It has been shown that the ability
of Xanthomonas species to incite disease depends
on several factors, including adhesins, synthesis of
extracellular enzymes, type III secretion system (T3SS)
effectors and the exopolysaccharide (EPS) xanthan.
The rpf genes act to positively regulate the synthesis
of extracellular enzymes, EPS and pathogenicity. The
rpfF, rpfC and rpfG genes are implicated in a regulatory
system involving a diffusible signal factor (DSF) whose
synthesis of DSF depends on RpfF. DSF perception and
signal transduction are involved the two-component
system comprising RpfC and RpfG. High cell densities
are thought to lead to the phosphorylation of RpfG
by RpfC which in turn activates the RpfG HD-GYP
phosphodiestarase domain whose substrate has been
shown to be the important second messenger cyclic
diGMP (c-diGMP) (Ryan et al., 2006; 2010). This work
was prompted to by the observation that the HD-GYP
domain of RpfG interacts with a subset of diguanylate
cyclase (GGDEF) proteins (Andrade et al., 2006),
responsible for c-diGMP synthesis in Xanthomonas citri
pv citri (XAC). In order to study rpf signaling in XAC,
we produced non-polar knockouts of rpfF, rpfC, rpfG,
all genes coding the GGDEF domains shown to interact
with RpfG, CAP-like protein (clp), fliC, pilT, gumD and
polar insertions in the operons of both type 2 secretion
systems coded by the XAC genome. HPLC-MS/MS
analysis showed that the deletion of rpfG, but not clp,
promoted an approximate 4-fold increase in cellular
c-diGMP levels. Also we demonstrated by EMSA that
c-diGMP inhibits the binding of Clp to the promoter
of the XAC0694 gene, the first gene in the operon
coding the type 2 secretion system. The rpf genes and
clp knockouts have impaired motility, reduction in
exopolissacarides and extracellar enzyme production.
Furthermore, we observe a significant decrease in the
growth of rpfG and clp mutants in host tissues. Our
results demonstrate that RpfF-RpfC-RpfG–Clp signaling
in XAC is associated with cellular c-diGMP levels and
is important for XAC virulence, motility, and EPS
production.
Keywords: Cell-cell communication, diffusible signal
factor, Xanthomonads
100
Talk 38
The chromosomal par locus is
required for normal cell division in
Xanthomonas citri
Ucci, AP1
Martins, PMM2
Belasque Jr, J3
Ferreira, H1
1 - Bacterial Genetics Laboratory. Depto. de Ciências Biológicas.
Faculdade de Ciências Farmacêuticas. Universidade Estadual
Paulista. Rod. Araraquara-Jaú km 1, Araraquara, SP, 14.801-902
2 - Depto. de Bioquímica e Microbiologia. Universidade Estadual
Paulista. Av. 24A, 1515, Rio Claro, SP, 13.506-900
3 - Fundecitrus. Depto. Científico. Av. Dr. Adhemar Pereira de Barros, 201, Araraquara, SP, 14.807-040, Brazil
# - These authors contributed equally to this work
Chromosome segregation is an essential
process to all living cells. It guarantees the
adequate separation of the genetic material to the
daughter cells prior to cytokinesis. In eukaryotes,
the mechanisms and factors that govern such an
important event have long been characterized
in details, and among the techniques employed,
fluorescence microscopy has surely contributed
in a particular manner for the advancement in the
comprehension of eukaryotic mitosis. Unfortunately,
the same degree of understanding has not yet been
achieved for prokaryotic cells. Bacteria are too small,
consequently the inside of the cells are not so easily
observable, and protein structures are in overall
of difficult characterization in vivo. Despite the
difficulties, successful efforts have been published
in the past 10 years where the process of bacterial
chromosome partitioning is becoming clearer. First
of all, bacteria segregate their chromosomes actively;
secondly, some bacteria have protein factors that
constitute and operate like the mitotic apparatus
found in eukaryotic cells. Observations that led to
these conclusions form a composite of several articles
from groups working with E. coli, Bacillus subtilis,
Caulobacter crescentus, among others (here we cite
the tip of the iceberg from where one can dig further
[1-5]). Key protein factors involved in bacterial
chromosome segregation can be simplistically
divided in two groups: one composed of ATPases
(ParA-like proteins) that have been implicated in the
pulling/orientation of newly replicated chromosomes
towards the cell poles, and another represented by
factors unique to prokaryotes (ParB-like), and that are
responsible for the organization of structures similar
to the eukaryotic centromeres. In Caulobacter for
instance, it was recently shown that the ParA protein
forms a spindle-like apparatus, a functional analog
of the eukaryotic spindle, which apparently pulls the
ParB-DNA complex, built around the chromosomal
replication origin, to the edges of the cell. Here, we
show our preliminary data on the characterization of
ParB encoded by Xanthomonas citri (Xac). Disruption
of the parB locus in Xac produced filaments, which
indicates that cells are unable to divide properly
(Figure 1). Note, however, that these filaments
exhibit septal constrictions at their tips as if the cells
had tried to divide in the early stages of growth, but
without success. Constrictions were also detected
sometimes in regions away from the tips. The ability
to initiate septation indicates that probably the defect
on cell division is not directly linked to a perturbation
of factors involved with septum formation. One
feasible explanation to the observed phenotype is
that the disruption of parB could have perturbed the
process of chromosome segregation; hence, a possible
entanglement of duplicated chromosomes may retard
division by means of a non-characterized yet nucleoid
occlusion mechanism in this bacterium. In order
to investigate if the filamentation phenotype could
alter the virulence of the mutant cells, we inoculated
them in Rangpur Lime leaves (Figure 2). The mutant
cells failed to induce the typical symptoms of citrus
canker. Lesions started later than usual and became
dry with a brownish aspect after a week from the day
of the inoculation. Concluding, the perturbation of an
essential process of Xac (chromosome segregation)
was reflected in the ability of the bacterium to cause
the disease.
101
Literature cited
1. Bartosik, A.A. et al. ParB deficiency in Pseudomonas
aeruginosa destabilizes the partner protein ParA
and affects a variety of physiological parameters.
Microbiology, 2009. 155(Pt 4):1080-92.
2. Donovan, C. et al. Subcellular localization and
characterization of the ParAB system from
Corynebacterium glutamicum. J Bacteriol, 2010.
192(13):3441-51.
3. Gruber, S. and J. Errington, Recruitment of
condensin to replication origin regions by ParB/
SpoOJ promotes chromosome segregation in B.
subtilis. Cell, 2009. 137(4):685-96.
4. Lau, I.F. et al. Spatial and temporal organization
of replicating Escherichia coli chromosomes. Mol
Microbiol., 2003. 49(3):731-43.
5. Ptacin, J.L. et al. A spindle-like apparatus guides
bacterial chromosome segregation. Nat Cell Biol,
2010. 12(8):791-8.
Financial support: FAPESP Grant 2010/05099-7, APU
PhD scholarship 2010/02041-8, and PMMM MSc
scholarship 2006/59494-9.
Figure 1. Disruption of parB causes a division defect in
Xac. Cells were visualized under phase contrast microscopy
using a magnification of 100X.
Figure 2. Perturbation of ParB alters the virulence of Xac.
Leaf of Rangpur Lime inoculated with suspensions of wild
type and Xac disrupted for parB.
102
Comparative proteomic analysis Talk 39
allows understanding Xanthomonas
citri subsp. citri adaptation during
plant burst oxidative process
Moreira, LM1,2
Facincani, AP3
Soares, MR4,5
Oliveira, JCF de6
Ferro, JA3
1 - Departamento de Ciências Biológicas. Instituto de Ciências
Exatas e Biológicas. Universidade Federal de Ouro Preto, Ouro
Preto, MG, Brazil.
2 - Núcleo de Pesquisas em Ciências Biológicas (NUPEB).
Universidade Federal de Ouro Preto, Ouro Preto, MG, Brazil.
3 - Departamento de Tecnologia. Faculdade de Ciências Agrárias
e Veterinárias de Jaboticabal. Universidade Estadual Paulista
(UNESP), SP, Brazil.
4 - Departamento de Bioquímica, Instituto de Química. Universidade
Federal do Rio de Janeiro (UFRJ), Rio de Janeiro, RJ, Brazil.
5 - Laboratório Nacional de Luz Sincrotron (LNLS), Campinas, SP,
Brazil.
6 - Departamento de Ciências Biológicas. Universidade Federal de
São Paulo (UNIFESP), Diadema, SP, Brazil.
Motivation
With the prospect that the citrus canker,
caused by XAC (Xanthomonas citri subsp. citri [1,2]
is a major disease affecting citrus species, and that
knowledge about their adaptive capacity in infectious
conditions is crucial for understanding virulence
induction dynamics, understand the importance and
interactions network among Plant Oxidative Burst
induced proteins becomes critical. One approach
that allows getting understanding on the molecular
mechanisms involved in this process is the global
analysis of protein expression, the functional tool
used in this work.
Background
The plant innate immunity is the first line
of defense against invasive microorganisms. The
plant pathogen recognition is mediated by elicitors,
different molecules derived from microbes (avirulence
proteins, LPS and/or peptidoglycan) or released from
plant cell wall degradation (oligogalacturonides)
[3,4].
When pathogen presence is detected,
production of Reactive Oxygen Species (ROS) is the
earliest plant cell responses. The oxidative stress
generated under this condition is fundamental
process, called Plant Oxidative Burst (POB). During
the POB response, species such as superoxide anion
radical (O2), hydrogen peroxide (H2O2), and hydroxyl
radical (OH) are produced. These compounds can
be react with various biological molecules, including
DNA, RNA and their precursors, which cause mutation
and bacterial replication block [5]. If the organism is
susceptible, inside plant adaptation is unfeasible,
blocking the organism replication or causing its
death. However, some microorganisms are capable
to metabolize and inactivation the ROS function,
resulting in plant tissue colonization and disease
induction.
Results
XAC’s comparative proteome analysis from
infection (one, three and five days after inoculation
‘DAI’ in orange leaves) and non infection conditions (NB
medium) [6], we could be observed that XAC express
a complete and functional adaptation machinery
to overcome POB. Catalase peroxidase, Superoxide
dismutase, glutathione synthase and peroxidase and
general stress protein, besides distinctive iron receptors,
outer membrane proteins and bacterioferritin were
induced under infection conditions (Figure 1). It was
also found that proteins encoded by the rml genes
showed differential expression profile. These Rml
proteins are related to cell wall structure and LPS
showed induction in the early stage of infection (1DAI)
with repression in the later stages (3 and 5 DAI). This
allows inferring that these proteins could be related to
induction of POB response.
103
Although many studies have focused on
possible protein expression alterations, this is the first
use of a large scale approach to access the alteration
level according to the infection time course.
Outlook
All information in this work as well as
biological information from other functional genome
analysis will have the prospect of being included in a
specialized database about XAC, XanthomonOMICS
(Figure 2).
The project is at an early stage of development
with funds approved by FAPEMIG in agreement
with the NUBIO (Bioinformatics Center), a branch
of CEBio (Center of Excellence in Bioinformatics of
Minas Gerais). The major objective is to support the
specialized scientific community, which in turn is
invited to be part of the development of this tool.
Figure 1 - Possible inter-relationships between the proteins differentially detected in infectious conditions. Color was
used to indicate if the protein was induced (green circles) or repressed (red circles) during the infective process. All relationships
were drawn from previously discussed data in other pathosystems.
104
The proposal is that all researchers can upload their
results to this data base wich in intended to become
the most representative database of functional
genomics of XAC, allowing better understanding of
the biology of XAC and its relationship with the host.
Development and Analysis
This work reports our analysis of the global
protein expression profile of XAC according to a
time course of infection, detaching the function of
proteins related to POB adaptation. The XAC proteome
was evaluated by two complementary approaches
(2D-gel electrophoresis and 2-dimensional liquid
chromatography-tandem mass spectrometry). Total
proteins were phenol extracted from XAC grew in
non-inducing medium Nutrient Broth (NB) or XAC
grew in inducing medium XAM1 (1 DAI). We also used
XAC after inoculation in host plant leaves for 3 (when
the watersoaking symptom is well established) and
5 days after infection (when hyperplasia symptom
is pronounced). All extracts were analyzed by 2D-gel
electrophoresis and differential protein spots were
identified using mass spectrometry. On average 600
spots were detected on each gel. The differential spots
(with >1.5-fold expression variation according to the
reference non-infecting extract) have been excised
from the gel, trypsin treated and analyzed in a MALDI
Tof/Tof mass spectrometer. Ninety three differentially
expressed proteins were identified according to the
hydrolyzed peptides mass and their fragments (MS/
MS) using the MASCOT software and a local database of
total XAC annotated proteins (Table 1). The reference
2D gel maps of four protein extracts from XAC separated
by 2D SDS-PAGE are shown in Figure 3.
Figure 2 - Comparative 2D profile.
Figure 3 - Overall proposal for the integration of functional genomics data from XAC.
Table 1 - List of differentially expressed proteins in infectious condition.
Protein
MW
pI
MW/pI 2D
Product
PEP
XAC0007 43415 6.79 37.530/5.8 conserved hypothetical protein
6
XAC0108 14433 5.06 18.041/5.18 AtsE
6
XAC0190 28328 9.87 21.870/5.27 Xanthomonas conserved hypothetical
5
protein
3
XAC0282 14588 5.63 17.375/5.63 organic hydroperoxide resistance
3
protein
XAC0288 34737 5.07 33229/5.25 oxidoreductase
4
XAC0311 39037 5.81 41563/5.85 vanillate O-demethylase oxygenase
2
subunit
7
XAC0381 15720 4.95
17.469/5 conserved hypothetical protein
2
XAC0470 34625 5.21 33.252/5.29 phosphoribosylaminoimidazole7
succinocarboxamide synthase
XAC0554 21395 5.83 21.753/5.97 nitroreductase
8
5
XAC0656 37601 5.64 38.915/5.69 rod shape-determining protein
4
XAC0785 34442 5.47 34.862/5.47 UDP-3-O-[3-hydroxymyristoyl]
4
N-acetylglucosamine deacetylase
XAC0834 28176 6.03 25267/5.67 two-component system, regulatory
8
protein
XAC1017 37842 6.73 34.607/6.23 ABC transporter sulfate binding
7
protein
XAC1028 23680 5.98 25363/6.1 phosphoglycerate mutase
3
XAC1046 35739 5.4 34862/5.47 isocitrate dehydrogenase
3
XAC1078 22839 5.39 22.774/5.3 ATP-dependent Clp protease
6
proteolytic subunit
5
XAC1149 21174 4.71 21.785/4.82 bacterioferritin
5
XAC1154 14304 5.16 17518/5.29 regulatory protein pilH family
2
4
XAC1301 82833 5.55 81.968/5.65 catalase/peroxidase
8
3
3
5
protein
XAC1432 40558 5.53 38474/5.55 succinyl-diaminopimelate
8
desuccinylase
5
XAC1579 45329 5.25 45.222/5.19 polyphosphate-selective porin O
2
XAC1650 45714 5.68 45.222/5.81 3-phosphoshikimate
3
1-carboxyvinyltransferase
XAC1654 20547 4.82 23.609/4.98 acyl carrier protein phosphodiesterase 4
XAC1776 48508 5.31 45006/5.42 xylose isomerase
7
XAC1838 25832 5.12 23.746/5.27 enolase-phosphatase
5
XAC1858 46126 6.16 41563/5.85 valine-pyruvate aminotransferase
4
XAC1882 99296 5.43 88.533/5.55 aconitase
3
XAC1968 14132 5.03 17.518/5.08 response regulator
3
XAC2005 34530 5.71 29.652/5.81 thioredoxin reductase
2
XAC2246 23230 5.97 24.046/5.98 hypothetical protein
3
XAC2292 32253 5.45 29036/5.55 UTP--glucose-1-phosphate
8
uridylyltransferase
2
105
Cat
VIII
VII
VIII
XAM1
1,87
9,99
2,21
I
I
42,40
1,21
IX
VIII
IV
IV
22,22
6,83
-1,05
1,33
V
45,65
13,96
VIII
V
I
I
VII
VIII
VIII
VIII
2,85
23,71
2,85
11,52
2,89
24,13
2,93
1,56
6,47
>100
1,56
6,47
-3,22
2,58
19,27 >100
5,49
9,66
20,13 100,00
3,48
5,45
VIII
IV
II
13,37
-5,28
24,03
54,21
3,91
-
13,10
7,29
3,49
2,48
1,92
VIII
VII
I
VIII
II
I
I
I
III
II
II
I
II
II
VII
IX
II
VIII
I
VIII
14,45
5,30
3DAI
2,18
22,76
1,30
5DAI
2,21
27,21
4,24
10,25
19,40
2,40
24,36
4,23
1,69
3,06
17,89
3,55
1,62
10,42
10,00
2,16
1,58
2,01
2,50
3,46
1,33
2,71
-1,09
>100
1,68
2,89
1,21
5,71
2,95
100,00
5,18
1,49
8,79
27,05
2,93
-1,78
10,00
3,08
-3,75
10,87
>100
8,57
2,48
1,78
6,88
-3,75
1,00
-1,30
2,48
3,01
1,68
8,40
-2,90
100,00 >100
5,49
9,66
2,93
>100
100,00 7,59
10,00
9,97
1,70
4,42
10,00
1,80
1,57
106
Table 1 - List of differentially expressed proteins in infectious condition. (cont.)
Protein
MW
pI
MW/pI 2D
Product
XAC2369 20069 6.08 19.321/5.23 general stress protein
XAC2386 22703 5.47 23.236/2.47 superoxidase dismutase
XAC2504 41342 5.98 40.438/5.73 regulator of pathogenicity factors
XAC2698 79970 6.24 80003/6.15 NADH-ubiquinone oxidoreductase,
NQO3 subunit
XAC2736 23904 5.31 23190/5.43 carboxymethylenebutenolidase
XAC2736 23904 5.31 22987/5.37 carboxymethylenebutenolidase
XAC2783 31423 4.61 29.856/4.81 thioredoxin
XAC2829 74236 4.89 76.003/5.03 outer membrane hemin receptor
XAC2830 86282 4.97 78.152/5.01 TonB-dependent receptor
XAC2915 15400 5.59 17.556/5.6 osmotically inducible protein
XAC2932 19457 4.73 22.108/4.89 protease
XAC2936 27673 5.64 25.598/5.71 ABC transporter ATP-binding protein
XAC3103 34528 5.76 33950/5.68 glutathione synthetase
XAC3123 20391 5.71 21.588/5.77 DNA-binding related protein
XAC3239 62707 5.56 65.574/5.6 pilus biogenesis protein
XAC3300 62268 4.94 57442/5.4 lipase/esterase
XAC3307 25269 5.61 26787/5.71 fumarylacetoacetate hydrolase
XAC3344 36538 4.98 33667/5.16 fructose-bisphosphate aldolase
XAC3437 19943 5.33 21870/5.27 adenylate kinase
XAC3437 19943 5.33 21588/5.37 adenylate kinase
XAC3456 38289 5.27 38.194/5.33 3-isopropylmalate dehydrogenase
XAC3457 24408 5.23 24.082/5.3 3-isopropylmalate dehydratase small
subunit
XAC3462 24273 4.87 23.609/4.98 L-isoaspartate protein
carboxylmethyltransferase
XAC3491 24295 4.48 25.895/4.98 NonF-related protein
XAC3546 204594 4.2 22.987/5.37 outer membrane protein
XAC3579 49337 5.19 45.222/5.19 phosphoglucomutase/
phosphomannomutase
XAC3584 34151 5.83 27.727/5.57 glucose-1-phosphate
thymidylyltransferase
XAC3602 42683 5.68 41.090/5.76 cystathionine gamma-lyase-like
protein
XAC3652 18207 5.31 20005/5.35 ATP synthase, delta chain
XAC3680
9536 4.85
17.469/5 Xanthomonas conserved hypothetical
protein
XAC3709 20070 6.4 20891/6.32 tryptophan repressor binding protein
protein
XAC3903 22914 5.21 22.910/5.28 orotate phosphoribosyl transferase
protein
XAC4009 33388 5.12 33574/5.23 arginase
PEP
6
3
6
1
4
Cat
VII
VII
VII
VIII
I
XAM1
6,00
100,00
354,75
3,51
10,00
4
III
>100
7
2
6
8
3
4
6
5
7
3
3
2
2
4
4
5
2
7
5
5
I
I
II
IV
V
V
III
V
II
III
VIII
V
IV
I
I
I
II
II
II
II
1
5
5
3
VII
VII
VII
VII
4
II
6
1
3
5
3
3
3
6
4
5
8
4
6
3,67
25,54
2,93
1,48
62,06
-1,06
6,09
1,04
1,09
2,07
3,51
2,57
1,48
1,93
3,52
100,00
2,21
1,21
43,75
-
10,00
10,00
1,89
>100
>100
2,89
100,00
4,60
-1,64
2,70
10,00
10,00
4,33
21,98
1,52
2,48
1,30
1,66
7,62
2,12
2,60
10,00
10,00
>100
>100
2,89
100,00
4,37
2,75
3,04
19,77
9,39
96,64
18,46
2,97
4,24
1,82
18,57
8,27
11,62
25,54
25,54
-5,28
>100
10,00
10,00
3,91
>100
10,00
10,00
7,29
2,67
12,91
10,00
21,26
10,29
5,33
10,00
>100
9,89
54,29
10,00
>100
46,78
76,17
21,26
1,34
>100
8,41
IV
100,00
I
IV
VIII
VIII
2,89
2,28
8,74
1,69
I
VIII
VIII
VIII
II
VIII
VIII
I
3DAI 5DAI
88,95 117,14
1,84
1,75
6,19
13,17
10,00 19,77
13,89
1,78
10,00
10,00
2,48
-2,90
100,00
--
2,33
10,59
2,06
4,08 100,00
84,52 -5,33
3,55
10,00
1,73
>100
13,30
>100
>100
11,58
Table 1 - List of differentially expressed proteins in infectious condition.
Protein
MW
pI
MW/pI 2D
Product
XAC4109 34589 5.81 29.652/5.81 coproporphyrinogen III oxidase,
aerobic
XAC4187 30809 5.41 27727/5.57 2-hydroxyhepta-2,4-diene-1,7dioateisomerase/5-carboxymethyl-2oxo-hex-3-ene-1,7-dioatedecarboxyla
XAC4346 19910 5.16 22.910/5.28 glutathione peroxidase
XAC4349 35994 5.95 35.745/5.97 bifunctional oxireductase/alginate
lyase
XACa0018 22398 5.17 22.887/5.28 partition protein A
XACb0007 46215 5.89 44.072/5.44 lytic murein transglycosylase
Acknowledgements
We acknowledge the Laboratório Nacional
de Luz Síncroton (LNLS) for the use of its Mass
Spectrometry facility. M.R. Soares received a postdoctoral scholarship from FAPESP (Fundação de
amparo à pesquisa do estado de São Paulo). A.P.
Facincani received a PhD scholarship from CAPES. Part
of this work was financed by FAPESP Grant (04/020067). The biological experiments were conducted in Dr.
J.A. Ferro’s Lab. The development of the database is
being funded by FAPEMIG – Fundação de Amparo à
Pesquisa de Minas Gerais (APQ-04425-10).
References
1. Schaad, N.W., Postnikova, E., Lacy, G.H., Sechler,
A., Agarkova, I., Stromberg, P.E., Stromberg, V.K.,
Vidaver, A.K. Reclassification of Xanthomonas
campestris pv. citri (ex Hasse 1915) Dye 1978 forms
A, B/C/D, and E as X. smithii subsp. citri (ex Hasse)
sp. nov. nom. rev. comb. nov., X. fuscans subsp.
aurantifolii (ex Gabriel 1989) sp. nov. nom. rev.
comb. nov., and X. alfalfae subsp. citrumelo (ex Riker
and Jones) Gabriel et al., 1989 sp. nov. nom. rev.
comb. nov.; X. campestris pv malvacearum (ex smith
1901) Dye 1978 as X. smithii subsp. smithii nov.
comb. nov. nom. nov.; X. campestris pv. alfalfae (ex
Riker and Jones, 1935) dye 1978 as X. alfalfae subsp.
alfalfae (ex Riker et al., 1935) sp. nov. nom. rev.; and
“var. fuscans” of X. campestris pv. phaseoli (ex Smith,
1987) Dye 1978 as X. fuscans subsp. fuscans sp. nov.
Syst Appl Microbiol 2005, 28:494-518.
2. Schaad, N.W., Postnikova, E., Lacy, G., Sechler, A.,
Agarkova, I., Stromberg, P.E., Stromberg, V.K., Vidaver,
A.K.: Emended classification of xanthomonas
PEP
3
Cat
II
I
6
2
3
VIII
VII
IX
6
4
6
7
V
VI
IV
XAM1
100,00
107
100,00
3DAI
-
100,00
5DAI
1,70
30,72
10,00
2,79
20,18
1,73
-
8,09
13,30
3,43
2,69
8,11
100,00
-9,39
71,06
2,33
3,16
2,62
>100
pathogens on citrus. Syst Appl Microbiol 2006,
29:690-695.
3. Silipo, A., Molinaro, A., Sturiale, L., Dow, J.M., Erbs, G.,
Lanzetta, R., Newman, M.A., Parrilli, M. The elicitation
of plant innate immunity by lipooligosaccharide
of Xanthomonas campestris. J Biol Chem. 2005 Sep
30;280(39):33660-8.
4. Erbs, G., Silipo, A., Aslam, S., De Castro, C., Liparoti,
V., Flagiello, A., Pucci, P., Lanzetta, R., Parrilli.
M., Molinaro, A., Newman, M.A., Cooper, R.M.
Peptidoglycan and muropeptides from pathogens
Agrobacterium and Xanthomonas elicit plant innate
immunity: structure and activity. Chem Biol. 2008
May;15(5):438-48.
5. Nanda, A.K., Andrio, E., Marino, D., Pauly, N.,
Dunand, C. Reactive oxygen species during plantmicroorganism early interactions. J Integr Plant
Biol. 2010 Feb; 52(2):195-204. Review.
6. Soares, M.R., Facincani, A.P., Ferreira, R.M.,
Moreira, L.M., de Oliveira, J.D.F., Ferro, J.A., Ferro,
M.I.T., Meneghini, R., Gozzo, F.C. Proteome of the
phytopathogen Xanthomonas citri subsp. citri: a
global expression profile. Proteome Science 2010,
8:55.
108
Talk 40
Comparative proteomic analysis
of the periplasmic fractions of
Xanthomonas citri (XAC) and Xanthomonas
fuscans subsp. aurantifolii type B (XauB)
reveals remarkable differences
Carnielli, CM
Zandonadi, FS
Artier, J
Novo, MTM
Postgraduate Program in Genetics and Evolution. Department of
Genetics and Evolution, UFSCar, SP, Brazil
Abstract
The causative agents of citrus canker are
bacteria from the genus Xanthomonas, of which two
new species (X. citri and X. fuscans) have recently
been classified. Xanthomonas citri subsp. citri (XAC) is
more virulent and attacks a greater number of hosts
than Xanthomonas fuscans subsp. aurantifolii type
B (XauB). The genomes of both bacteria have been
totally (XAC) or partially (XauB) sequenced. This
work involved a differential proteomic analysis of the
periplasmic fraction of XAC and XauB. The bacteria
were grown in a control medium (Nutrient Broth,
which does not induce pathogenicity) and in XAM1 medium, which is known to induce pathogenicity
in XAC. Periplasmic protein extractions were
performed in triplicate, and proteins were separated
by bidimensional electrophoresis (2D-PAGE). The
gels were compared after staining with Coomassie
Brilliant Blue R-250. Statistical treatment (ANOVA)
using ImageMaster Platinum 7.0 software (GE
Healthcare) revealed that approximately 200 spots
showed significant (p<0.05) differential expression in
each comparative analysis. Several differential spots
were digested using trypsin and analyzed by mass
spectrometry (ESI-QUAD-TOF). The MASCOT tool
was employed to compare the results with proteins
of the respective NCBI genome databases. XauB and
XAC showed remarkable in vitro differential protein
expression under both pathogenicity-inducing and
non-inducing conditions.
Keywords: citrus canker, Xanthomonas sp.,
pathogenicity, differential proteomic analysis,
2D-PAGE.
Introduction
Many phytopathogenic bacteria use their
secretion systems to inject virulence factors (usually
proteins) into host plant cells. For example, type
III system secretion (T3SS) enables gram-negative
bacteria to secrete pathogenicity proteins that pass
through the periplasm, and are injected into the
cytosol of host cells [1].
Genomic studies have shown that mutations
in genes related to the type III secretion system can
reduce the ability of pathogenic bacteria to cause
citrus canker symptoms [2]. Xanthomonas citri subsp.
citri (XAC) is both more virulent and has a greater
number of citrus hosts than Xanthomonas fuscans
subsp. aurantifolii type B (XauB). The sequencing
(partial or total) of the genomes of both strains
has enabled proteomic analyses to be undertaken.
One of the most common techniques employed is
bidimensional electrophoresis (2D-PAGE), which has
been used in association with mass spectrometry.
Fractionation techniques have been used to reduce
sample complexity and provide better resolution in 2D
profiles, in order to be able to observe less abundant
proteins. In Xanthomonas sp., the periplasmic fraction
is of particular interest, due its involvement in known
phytopathogenicity mechanisms.
Objectives
The aim of this work was to perform differential
proteomic analysis of the periplasmic protein profiles
of XAC and XauB, after growth in either pathogenicityinducing or control media.
The Xanthomonas citri subsp. citri 306 and
Xanthomonas fuscans subsp. aurantifolii (type B)
11122 strains used in the experiments were provided
by FUNDECITRUS (Fundo de Defesa da Citricultura,
Araraquara, SP, Brazil). Nutrient Broth (NB) and XAM1 [3] were used as the control (non-inducing) and
pathogenicity-inducing media, respectively.
Periplasmic proteins were extracted using
the methodology described by Artier (2010) [4],
with some modifications. Proteomic analysis was
performed as illustrated in Figure 1.
109
Bidimensional profiles of periplasmic proteins
from XAC and XauB after growth in inducing or noninducing media are shown in Figure 2. There were
remarkable differences between the profiles of these
bacteria, for both conditions, as well as between the
different conditions of growth for XauB. Spots that
presented significant (p<0.05) differential expression
were identified using Image Master 2D Platinum
software (GE Healthcare), isolated from the gels, and
analyzed by mass spectrometry with strain-specific
NCBI database searching. Some of these spots are
highlighted in Figure 2. Zoom images of gel triplicates
for each condition are shown in Figure 3, together
with comparisons of the intensities (% volume) of the
selected spots.
Several of the XauB spots were analyzed using
mass spectrometry (Table 1). Preliminary results
indicated the presence of XauB-specific proteins (for
example, 101 and 180) for both conditions tested,
while other proteins (for example, 245) seemed to
be specifically induced in XauB by the pathogenicityinducing medium. Additional studies will be
necessary in order to identify the majority of the
differential proteins and their biological roles in the
more virulent XAC strain.
Figure 1. Experimental steps of the differential proteomic analysis performed with XAC and XauB periplasmic proteins.
110
XAC
XAC
XauB
(I)
XauB
(II)
Figure 2. Details of the bidimensional gels of XAC and XauB periplasmic proteins (260 µg) after bacterial growth in noninducing NB medium (I) and in pathogenicity-inducing XAM-1 medium (II). Circles indicate examples of spots that showed
significant (p<0.05) differential expression between XAC and XauB in non-inducing medium (I) and in pathogenicityinducing medium (II). Squares indicate examples of XauB spots with significant differential expression (p<0.05) between
the two growth media. The gels were stained with Coomassie Blue R-250.
Table 1. Identification of proteins in spots differentially expressed between XAC and XauB.
NCBI accession
Peptide
Spot ID Match ID
Protein description
number
matched
Two-component system sensor
10493
101
gi|292599261
2
protein
Type III secretion system hopAJ-like
13657
434
gi|292600368
6
protein
Two-component system regulatory
5171
180
gi|292598956
2
protein
7807
233
gi|292598471
Anthranilate synthase component I
20
Conclusions
XAC and XauB showed substantial differential
in vitro protein expression in the periplasm-enriched
fraction after growth under both pathogenicityinducing and non-inducing conditions. XauB showed
differential protein expression for the two conditions
employed.
Acknowledgements
We are grateful to FAPESP (Fundação de
Amparo à Pesquisa do Estado de São Paulo) and CNPq
(Conselho Nacional de Desenvolvimento Científico e
Tecnológico) for financial support and provision of
fellowships to C. M. Carnielli. We also thank LNBioLNLS (Laboratório Nacional de Luz Síncrotron,
Campinas, São Paulo) for the mass spectrometry
analyses coordinated by Dr. Adriana Franco Paes
Leme. Acknowledgements are also due to Dr. José
Belasque Júnior (Fundo de Defesa da Citricultura,
Condition
Non-inducing
Inducing
Araraquara, São Paulo) for supplying the strains and
for valuable experimental discussions.
References
1. Hueck, C.J. 1998. Type III protein secretion systems
in bacterial pathogens of animals and plants.
Microbiology and Molecular Biology Reviews, 62:
379-433.
2. Laia, M.L. et al. 2009. New genes of Xanthomonas
citri subsp. citri involved in pathogenesis and
adaptation revealed by a transposon-based
mutant library. BMC Microbiology, 9:12.
3. Carvalho, F.M.S. 2006. Gene expression in
Xanthomonas axonopodis pv. citri controlled
by promoters induced by the host plant (in
Portuguese: Expressão gênica em Xanthomonas
axonopodis pv. citri controlada por promotores
induzidos pela planta hospedeira). PhD thesis,
111
(I)
(II)
(III)
Figure 3. Zoom images of spots that presented significant (p<0.05) differential expression between (I) XAC and XauB after
growth in non-inducing NB medium, (II) XAC and XauB after growth in pathogenicity-inducing XAM-1 medium, and (III)
between XauB grown in NB and XAM-1. The bar graphs show the relative intensities (% volume). In (I) and (II), triplicate
XAC and XauB gels are shown on the left and right, respectively. In (III), triplicates for XauB grown in NB and XAM-1 are
shown on the left and right, respectively.
Faculty of Medicine, University of São Paulo,
Ribeirão Preto, SP, Brazil, 173 pp.
4. Artier, J. 2010. Differential proteomic analysis
of the periplasmic fraction of Xanthomonas citri
subsp. citri: proteins related with the induction
of in vitro pathogenicity (in Portuguese: Análise
proteômica diferencial da fração periplasmática
de Xanthomonas citri subsp. citri: proteínas
relacionadas com a indução da patogenicidade in
vitro). Master’s dissertation, Federal University of
São Carlos, SP, Brazil, 75 pp.
112
Comparative proteomic analysis Talk 41
of the periplasmic fraction reveals
remarkable differences between
Xanthomonas sp. types A and C
Zandonadi, FS
Artier, J
Novo, MTM
Department of Genetics and Evolution, Federal University of São
Carlos (UFSCar), São Carlos, SP, Brazil. fa.zandonadi@gmail.com
Abstract
Xanthomonas fuscans subsp. aurantifolii type
C (XauC) is a phytopathogenic bacterium that causes
citrus canker C. This bacterium is restricted to the
Citrus aurantifolia host and is less virulent than
Xanthomonas citri subsp. citri (XAC), although it may
induce a hypersensitivity response (HR) in citrus
other than its specific host. Genome sequencing (total
or partial) of both types has been accomplished.
of Xanthomonas sp. types A and C, grown either in nonpathogenicity-inducing medium (nutrient broth, NB)
or in XAM-1, which is known to be a pathogenicityinducing medium for XAC. Proteins from both types
(grown in triplicate using both media), were separated
by bidimensional electrophoresis (2D-PAGE) and the
gels were stained using Coomassie Brilliant Blue
R-250. A comparative analysis of the protein profiles
of XAC and XauC, grown in the same culture medium,
was performed using ImageMaster Platinum software
(GE Healthcare). Statistical analysis (ANOVA) revealed
a large number of periplasmic proteins that presented
type-specific or differential expression between the
two bacteria. Some of these differential proteins were
identified by mass spectrometry (ESI-QUAD-TOF),
employing XAC and XauC databases.
Introduction
Genome research has provided a vast number
of DNA sequences for many organisms. The genomic
sequence (total or partial) of the three types of
Xanthomonas sp. are available at NCBI. However,
genome sequencing reveals very little about how
the proteins of an organism operate, individually
or together, in order to perform their functions.
Similarly, study of the genome alone is unable to
identify which proteins are actually expressed in a
given cell at any given time. For this reason, proteomic
approaches are required in order to understand how
genetic differences are involved in determining the
phenotypes of X. citri subsp. citri and X. fuscans subsp.
aurantifolii [1].
The success of the infection often depends
on secretion systems whose function is to transport
proteins to the extracellular medium and/or
introduce DNA to the cytosol of the host [2]. Effectors
from different secretion systems are important
determinants of the virulence and the host range
of many plant pathogenic bacteria, especially
Xanthomonas sp. and Pseudomonas syringae [3].
Moreover, it is known that there is a close relationship
between certain proteins that pass through the
periplasm of gram negative cells and the process of
interaction-infection of XAC with the host [4].
The identification of virulence factors that
contribute to, or even determine, the plant-pathogen
interaction is a major challenge for molecular studies
of these mechanisms [2]. The proteomic approach,
especially applied to the study of cellular fractions,
is a strategy that is widely used to study proteins of
interest, because it allows a greater number of low
abundance proteins to be detected and identified,
compared to the total extract. This approach is a
powerful tool that can complement comparative
genomic analysis of X. citri and X. fuscans types A and
C [1].
Objective
of XAC and XauC, under either pathogenicity-inducing
or non-inducing conditions.
Bacteria were provided by Fundecitrus (Fundo
de Defesa da Citricultura, Araraquara, São Paulo,
Brazil). Types A (strain 306) and C (strain ICPB 10535)
of Xanthomonas sp. were used for the experiments.
NB (nutrient broth) and XAM-1 [5] were used as nonpathogenicity-inducing and pathogenicity-inducing
media, respectively.
Periplasmic proteins were extracted by
113
the methodology described previously [3,6], with
modifications [7]. PMSF was added to the protein
extracts in order to inhibit proteolysis. The proteomic
procedure was performed as shown in Figure 1.
Figure 2 shows the periplasmic protein
profiles of XAC and XauC, under the two conditions
tested (either pathogenicity-inducing or noninducing). Remarkable differences between the
profiles of the two strains were observed for both
conditions. Figure 2 highlights those spots that
presented significant differential expression (p<0.05),
as determined by Image Master 2D Platinum software
(GE Healthcare). Some of these were isolated from
the gels and identified by mass spectrometry and
specific database searching (NCBI). Magnified images
of gel triplicates are shown in Figure 3, together with
bar graphs comparing the intensities of the spots. All
intensity values were normalized in relation to the
total intensity of the spots in the gel (% volume).
Figure 1. Experimental steps of the differential proteomic analysis of X. citri and X. fuscans.
114
Figure 2. Mapping of spots differentially expressed for
XAC and XauC, detected by 2D-PAGE, in non-inducing NB
medium (I) and in inducing XAM-1 medium (II). The analysis
was performed using ImageMaster Platinum software (GE
Healthcare). The differential spots are indicated by labels.
Some differential spots were apparently typespecific for either XAC (for example, spots 429, 354,
388 and 391, shown in Figure 3) or XauC (spots 115,
70 and 66), while others (spots 4, 39 and 22) were
present in both types, and only differed in expression
level. Several of the differential spots were identified
by mass spectrometry (ESI-QUAD-TOF), using the
XAC and XauC databases (Table 1).
Conclusions
•XAC and XauC presented remarkable
differential expression in the periplasm-enriched
protein fraction, both at the same and between
different growth conditions.
•At least fifty proteins were differentially
expressed in XAC and XauC, which could be associated
with pathogenicity and/or the type of citrus host.
•When Xanthomonas citri subsp. citri was
exposed to XAM-1, the periplasm was strongly
involved in the response.
•The identification of a larger number of
Figure 3. Amplified images of some spots that were
differentially expressed for XAC and XauC grown in nonpathogenicity-inducing medium (I) and in pathogenicityinducing medium (II). The bar graphs represent the
average intensity (% volume) and standard deviation of
the triplicate for each differential spot. The letters a, b and
c refer to the XAC triplicate, and the letters d, e and f refer
to the XauC triplicate. The blue lines indicate the means,
and the red lines the minimum and maximum standard
deviations from the mean.
differential proteins is needed in order to understand
the metabolic changes that occur, and to establish
relationships between specific periplasmic proteins,
virulence, and host range in Xanthomonas sp.
115
Table 1. Proteins that were differentially expressed for XAC and XauC, in non-inducing and inducing media.
The symbols (+) indicate up-expression in XAC relative to XauC.
Expression
Spot
Theoretical Peptide in XAC in
NCBI accession nº
Protein description
Condition
ID
MW and pI matched relation to
XauC
115 gi|52782957|Q8PMB1.1 Heat shock protein GrpE 90003/4.43
4
+
Non-inducing
39 gi|23814066|Q8PLS0.1 Enolase
45992/ 4.96
24
+
354 gi|25452850|Q8PPZ1.1 60 kDa chaperonin
57131/5.05
42
+
Inducing
388 gi|32469807|Q8PPT1.1 Periplasmic trehalase
63450/ 5.73
17
+
Acknowledgements
We are grateful to FAPESP (Fundação de Amparo
à Pesquisa do Estado de São Paulo) for financial
support of this work. We also thank LNBio-LNLS
(Laboratório Nacional de Luz Sincrotron, Campinas,
SP), coordinated by Dr. Adriana Franco Paes Leme, for
the mass spectrometry analyses. Acknowledgements
are also due to Dr. José Belasque Júnior, of Fundecitrus
(Fundo de Defesa da Citricultura, Araraquara, SP),
who provided the bacterium strains and assisted in
the research.
References
1. Moreira, L.M., Almeida Jr., N.F., Potnis, N.,
Digiampietri, L.A., Adi, S.S., Bortolossi, J.C., Da Silva,
A.C., De Moraes, F. E., Oliveira, J.C., De Souza, R.F.,
Facincani, A.P., Ferraz, A.L., Ferro, M.I., Furlan, L.R.,
Gimenez, D.F., Jones, J.B., Kitajima, E.W., Laia, M.L.,
Leite Jr., R.P., Nishiyama, M.Y., Neto, J.R., Nociti,
L.A., Norman, D.J., Ostroski, E.H., Pereira Jr., H.A.,
Staskawicz, B.J., Tezza, R.I., Ferro, J.A., Vinatzer,
B.A., Setubal, J.C. Novel insights into the genomic
basis of citrus canker based on the genome
sequences of two strains of Xanthomonas fuscans
subsp. aurantifolii. BMC Genomics 11:238, 2010.
2. Büttner, D., Bonas, U. Regulation and secretion of
Xanthomonas virulence factors. FEMS Microbiol.
Rev. 34:07-133, 2010.
3. Lee, V.T., Schneewind, O. Protein secretion and the
pathogenesis of bacterial infections. Gene Dev.
15:1725-1752, 2001.
4. Baptista, J.C. Functional analysis of the
Xanthomonas axonopodis pv. citri genes for
degradation of cellulose (in Portuguese: Analise
funcional dos genes de degradação de celulose
de Xanthomonas axonopodis pv. citri). Master’s
dissertation in Genetics and Molecular Biology,
University of Campinas, Campinas, SP, Brazil. 93
pp., 2006.
5. Carvalho, F.M.S. Gene expression in Xanthomonas
axonopodis pv. citri controlled by promoters
induced by the host plant (in Portuguese:
Expressão gênica em Xanthomonas axonopodis
pv. citri controlada por promotores induzidos
pela planta hospedeira). PhD thesis, Faculty of
Medicine, University of São Paulo, Ribeirão Preto,
SP, Brazil. 177 pp., 2006.
6. Coligan, J.E. et al. (Eds.). Current Protocols in
Protein Science (Volumes 1 and 2). John Wiley &
Sons, Inc., 2000.
7. Artier, J. Detection of proteins potentially involved
in the pathogenicity of Xanthomonas axonopodis
pv. citri: Preliminary studies using different
cellular fractions (in Portuguese: Detecção
de proteínas potencialmente envolvidas na
patogenicidade de Xanthomonas axonopodis pv.
citri: estudos preliminares em diferentes frações
celulares). Monograph in Biological Sciences,
Federal University of São Carlos, SP, Brazil. 41 pp.,
2008.

Workshop on Xanthomonas citri/ Citrus canker

Transcription

Similar documents

Citrus Economic Summit

Tupperware

sunray plaza

to see the Cosmetology PowerPoint

The Horror Found In Some Plants

Effect of crude oil pollution on orange (Citrus) leaves

September, 2013 - Citrus Heights Messenger

International Organization of Citrus Virologists Newsletter, May 20

BOARD MEETING Central Florida Community College 3800 S