relazione scientifica 2014

Transcription

F o n d a z i o n e C . & D . C a lle r i o O n lu s
I s t i t u t i d i R i c e r c h e B i o lo g i c h e
((hhttttpp::////w
ww
ww
w..ccaalllleerriioo..oorrgg))
R ELA Z I O N E S CI EN T I F I CA
2014
D
Diirreettttoorree S
Scciieennttiiffiiccoo:: PPrrooff.. G
Giiaannnnii S
Saavvaa
FONDAZIONE CALLERIO ONLUS – http://www.callerio.org
IN FO R M A Z IO N I GEN ER A LI
L’attività di ricerca riportata nella presente relazione è stata svolta nei laboratori della Fondazione
Callerio Onlus e nell’ambito delle collaborazioni esistenti con ricercatori di altri Enti e di Atenei italiani
e stranieri nel periodo 1 gennaio 2014 – 31 dicembre 2014.
Oltre ai ricercatori dipendenti, al tecnico di laboratorio ed al personale amministrativo, nel 2014 la
Fondazione Callerio Onlus ha potuto contare su giovani laureati, per i quali ha investito risorse per
sostenere la loro formazione nella ricerca e su giovani laureandi favorendo la loro partecipazione ad
attività sperimentali utili alla preparazione della tesi di laurea. Globalmente sono state investite risorse
per 8,9 anni/uomo (1 anno/uomo= 11 mesi; il Direttore Scientifico è escluso dal computo). Nel
dettaglio, sono intervenuti, in aggiunta al tecnico di laboratorio ed ai 2 ricercatori in servizio
permanente, 1 ricercatore, inserito nelle attività ricerca programmate e svolte attraverso lo strumento
dell’assegno post-dottorato. A questi si sono aggiunti 6 studenti dell’Università di Trieste ed 1
dell’Università di Olomouc (Repubblica Ceka) che hanno contribuito agli studi con il proprio lavoro per
la preparazione della tesi di laurea.
Composizione del gruppo di ricerca
Prof. Gianni Sava
Direttore Scientifico
Dott. Paolo Macor
Vicedirettore Scientifico
Dott. Moreno Cocchietto Biologo, ricercatore
Dott. Alberta Bergamo
Chimico e Tecnologo Farmaceutico, ricercatore
Dr. Chiara Pelillo
Biotecnologa, Assegnista di ricerca
Sig. Domenico Masiello
Studente di Chimica e Tecnologia Farmaceutiche, interno tesista
Mr. Jurai Zajac
Biofisico, dottorando
Ms. Gloria Cancian
Studente di Farmacia, interno tesista
Ms. Manuela Piazza
Ms. Chiara Volpato
Studente di Farmacia, interno tesista
Mr. Cesare Sciarelli
Dott. Hilaria Mollica
Laurea Genomica funzionale, training stage
Sig. M. Zabucchi
Diploma maturità scientifica ad indirizzo sanitario, tecnico di laboratorio
La sottolineatura indica le persone con contratto a tempo indeterminato.
RELAZIONE SCIENTIFICA 2011
Pagina 2 di 75
R ICER CA S CIEN TIFICA
Temi di Ricerca della Fondazione Callerio
Farmacologia oncologica
1. Coordinamento del WG1 del programma COST CM1105
La Fondazione Callerio è coordinatore del Working Group 1 dell’Azione COST CM1105, un progetto
di cooperazione europea nel campo dei farmaci basati sui metalli per la terapia e la diagnosi dei
tumori. Il WG1 si occupa del tema “Protein Targets” ed è coordinato dalla dott.ssa A. Bergamo. Al
WG1 afferiscono altri 11 laboratori, rispettivamente dall’Università di Granada (dr. E. Barea),
dall’Università di Groningen (dr. A. Casini), dall’Università di Muenster (prof. J. Eble), dall’Università di
Strasburgo (dr. C. Gaiddon), dall’Università di Auckland (dr. C. Hartinger), dall’Università di Marburg
(dr. E. Meggers), dall’Università di Firenze (prof. L. Messori), dall’Università di Padova (prof. M.P.
Rigobello), dall’Università di Oeiras (prof. C. Romao), e dall’Ecole National Supérieure de Chimie de
Paris (ENSCP) (prof. A. Vessières-Jaouen).
L’attività principale è quella di promuovere e coordinare ricerche per identificare bersagli di natura
proteica per “costruire” nuovi farmaci basati sui metalli, più potenti e più selettivi, rispetto quelli
tradizionalmente basati sul platino e di corrente uso clinico.
Nel corso del 2014 il WG1 ha organizzato il meeting del proprio Working Group “Potentialities of
Metal-based compounds targeting proteins” che si è svolto a Trieste il 11 – 12 aprile 2014. I
ricercatori della Fondazione Callerio hanno inoltre partecipato al Meeting “Metallodrugs III: From DNA
interactions to chemotherapy of cancer” svoltosi a Olomouc nei giorni 29 – 31 maggio 2014, e al “2nd
International Symposium on Functional Metal Complexes that bind to Biomolecules” che ha riunito
tutti i Working Group della COST Action CM1105 e che si è tenuto a Zurigo il 22 – 23 agosto 2014. In
tutte queste occasioni i ricercatori della Fondazione Callerio hanno contribuito al programma
scientifico presentando i risultati delle ricerche svolte in quest’ambito e i loro aggiornamenti. Inoltre il
coordinatore del WG1 dott.ssa Bergamo è stata invitata a tenere una lezione dal titolo “Targeting
extracellular matrix and metastasis” nell’ambito della COST CM1105 Training School “Organometallic
anticancer comopunds: markers and targets for innovative therapeutic strategies” che si è svolta dal
19 al 23 maggio 2014 a Strasburgo organizzata dal membro del WG1 dott. Gaiddon presso l’unità
INSERM U1113.
2. Identificazione di molecole di adesione coinvolte nella fase di metastatizzazione del
cancro colorettale nel tessuto epatico e possibili target molecolari per lo sviluppo di
nuovi farmaci antitumorali
Il progetto prevede l’identificazione di molecole di adesione cruciali per la metastatizzazione del
cancro al colon nel tessuto epatico con la prospettiva di identificare bersagli verso i quali sviluppare
nuovi trattamenti farmacologici antitumorali.
Durante quest’anno lo studio è proseguito nella validazione del ruolo dell’integrina α5β1 nella fase di
metastatizzazione del tumore e nell’analisi dell’influenza del microambiente epatico, entrambi fattori
che cooperano nella progressione tumorale. Inoltre lo studio è proseguito investigando le pathways
intracellulari correlate ad α5β1 al fine di identificare altri possibili target terapeutici. Alcuni di questi
esperimenti sono stati condotti in collaborazione e presso il laboratorio del prof. J. Eble, Università di
Muenster, membro del WG1 dell’azione COST CM1105 e grande esperto di integrine.
Al fine di ottenere più informazioni utili possibili, sono stati avviati in parallelo esperimenti con il NAMIA per valutare il coinvolgimento dell’integrina α5β1 nell’azione anti-metastatica del NAMI-A.
3. METAPLATE: messa a punto di un prototipo per lo studio simulato del processo della
crescita e disseminazione tumorale per l’impiego nella selezione di farmaci antitumorali
innovativi.
Pagina 3 di 75
La ricerca condotta sul Plastic Mouse quest’anno ha avuto come scopo lo studio del comportamento
di cellule epiteliali sane di colon e di cellule tumorali di carcinoma colorettale in un sistema di cocolture per valutare parametri di base e la risposta al composto anti-metastatico NAMI-A e ad altri
farmaci di abituale impiego nei pazienti affetti da carcinoma colorettale.
4. Studio di coniugati metallo-porfirine per la Terapia Fotodinamica.
La terapia fotodinamica (PDT) è una procedura terapeutica clinicamente approvata e minimamente
invasiva che può esercitare una selettiva citotossicità verso le cellule maligne. La procedura prevede
la somministrazione di un agente fotosensibilizzante (PS), seguita dall’irradiazione a una lunghezza
d’onda appropriata. In questo campo le porfirine sono molecole particolarmente attraenti perché sono
altamente fluorescenti e possono fungere da “carrier” per il trasporto di complessi metallici nelle
cellule tumorali, dove si accumulano di preferenza. Le ricerche iniziate nel 2012 sono proseguite con
l’indagine di derivati porfirinici simmetrici e asimmetrici di nuova sintesi e con la valutazione delle loro
proprietà fototossiche su linee cellulari tumorali e non tumorali. La progettazione e sintesi dei nuovi
coniugati è il frutto della collaborazione con il Dipartimento di Scienze Chimiche e Farmaceutiche
dell’Università di Trieste e con Dept. of Chemistry dell’Università di Zurigo. La valutazione delle
proprietà fototossiche è stata condotta presso i laboratori della Fondazione Callerio Onlus con un
nuovo dispositivo di illuminazione, una LedBoard appositamente progettata e realizzata, frutto di una
collaborazione con il Dipartimento di Scienze Chimiche e Farmaceutiche e il laboratorio A.P.L. del
Dipartimento di Ingegneria e Architettura dell’Università degli Studi di Trieste. I risultati delle ricerche
sono stati poi riportati in due tesi di laurea, e in un lavoro scientifico in corso di valutazione per la
pubblicazione.
5. Studio del meccanismo d’azione del composto anti-metastatico di rutenio NAMI-A
mediante RNA-sequencing
Ad oggi non è noto il meccanismo d’azione di NAMI-A, sebbene test funzionali in vivo e in vitro
impiegati finora abbiano messo in luce molteplici proprietà farmacologiche riconducibili al suo effetto
finale di inibitore delle metastasi. Questo progetto mira ad investigare il meccanismo d’azione di
NAMI-A, servendosi per la prima volta di un’analisi dell’intero trascrittoma mediante RNA-sequencing
allo scopo di analizzare le alterazioni di espressione genica indotte da questo composto. Lo studio del
trascrittoma è determinante per interpretare gli elementi funzionali del genoma e i costituenti
molecolari di cellule e tessuti, così come per comprendere la dinamica di processi altamente
complessi quali lo sviluppo e l’insorgere di malattie. L’RNA-seq è una tecnica basata sui metodi di
sequenziamento di nuova generazione. Essa permette di quantificare i trascritti nei campioni biologici
mediante sequenziamento high-throughput di RNA, e il successivo mappaggio dei dati ottenuti su un
genoma di riferimento. L’analisi dell’espressione differenziale, cioè l’identificazione di geni che
presentano differenze significative del loro livello di espressione fra due o + condizioni sperimentali,
rappresenta una delle applicazioni più interessanti di questa tecnologia, di cui abbiamo usufruito per
investigare la modulazione dell’espressione genica indotta da NAMI-A. Lo studio è proseguito nel
corso del 2014 attraverso analisi di espressione di geni selezionati mediante real time RT-PCR per
approfondire alcuni aspetti dell’attività di NAMI-A contro le metastasi dei tumori solidi. I risultati dello
studio di RNA-sequencing e di real time RT-PCR sono stati riassunti in un lavoro scientifico in corso
di valutazione per la pubblicazione.
Tecnologia farmaceutica
1. Ingegnerizzazione di sistemi chimerici per la veicolazione di principi biologicamente
attivi
1.1. Sviluppo di sistemi per la veicolazione orale di ormoni cHH
Nel corso del 2014 La Fondazione Callerio ha instaurato un rapporto di collaborazione con il Gruppo
di Ricerca coordinato dal prof. Piero Giulianini del Dipartimento di Scienze della Vita per sviluppare un
sistema di veicolazione orale capace di proteggere ormoni iperglicemizzanti dei crostacei (crustacean
Hyperglycaemic Hormones, cHHs) mantenendone intatta l’attività biologica.
Pagina 4 di 75
I CHH sono una superfamiglia di neuro-ormoni multifunzionali, presenti nei crostacei, principalmente
coinvolti nella regolazione della glicemia e del metabolismo glicogeno.
Obiettivo ultimo della Ricerca è lo sviluppo di nuovi metodi ecosostenibili autocidi per contrastare la
diffusione di specie non-indigene di gambero nei corsi d’acqua europei.
1.2. Sviluppo di sistemi per la veicolazione orale dell’anticorpo chimerico Rituximab®
Nel corso del 2014 La Fondazione Callerio ha instaurato un rapporto di collaborazione con il Gruppo
di Ricerca coordinato dal dott. Paolo Macor del Dipartimento di Scienze della Vita per sviluppare un
sistema di orale capace di veicolare l’anticorpo chimerico Rituximab®.
Il Rituximab® è un anticorpo monoclonale chimerico con una grande affinità per l’antigene CD20
superficiale. CD20 è una proteina transmembrana espressa sia nei linfociti pre-B sia nei linfociti B
normali differenziati.
L’utilizzo di questa biomolecola comprende svariati usi terapeutici.
Nota:
Le collaborazioni 1.1. e 1.2. sono complementari e, in parte, la naturale implementazione del lavoro
svolto in precedenza nel contesto del Progetto PRIN avente come titolo generale: “Identificazione di
sistemi di rilascio ottimali per i Nucleic Acid Based Drugs e studio dei meccanismi di azione in alcuni
modelli di patologie umane infiammatorie e tumorali”.
Collaborazioni in atto
Le attività di ricerca svolte nel corso del 2014 sono state condotte anche attraverso collaborazioni
attivate e/o mantenute con ricercatori di vari Enti italiani e stranieri.
- Ricercatori di Atenei Italiani:
Dall’Università di Trieste (Dipartimento di Scienze Chimiche e Farmaceutiche, prof. Enzo Alessio;
prof. D. Voinovich, dr. F. Serdoz, dr. B. Perissutti, dr. T. Gianferrara, dr T. Da Ros, prof. M. Prato;
Dipartimento di Scienze della Vita, dr. S. Pacor, prof. S. Zorzet, dr. A. Pallavicini, dr. M. Gerdol, dr.
M. Lucafò, prof. R. Gennaro, dr M. Scocchi, prof. Piero Giulianini, dr. Federica Piazza, dr. Paolo
Macor, dr. Sara Capolla; Dipartimento di Ingegneria e Architettura, prof. O. Sbaizero, dr. F. Armani,
prof M. Grassi, prof. R. Lapasin, dr. M. Abrami; Dipartimento Clinico di Scienze Mediche,
Chirurgiche e della Salute, prof G. Grassi, dr. Rossella Farra).
Dall’Università di Udine (Dipartimento di Scienze Animali, prof. Galeotti, dr. D. Volpatti, dr. B.
Contessi, dr. D. Bassignana).
Dall’Università di Perugia (Dipartimento di Chimica e Tecnologia del Farmaco, dr. P. Blasi,dr. Aurélie
Shobben).
- Ricercatori di altri Enti
Laboratorio SISSI, Sincrotone, Trieste (dr. L. Vaccari).
ICGEB, Area Science Park, Trieste (dr. M. Bestagno).
- Ricercatori di Atenei stranieri
Institute of Inorganic Chemistry, University of Zürich (prof. R. Alberto, prof. G. Gasser)
Institute for Physiological Chemistry and Pathobiochemistry, Westfälische Wilhelms – Universität
Münster (prof. J.A. Eble).
INSERM U692 – Université de Strasbourg (dr. C. Gaiddon).
Institute of Biophysics, Academy of Sciences of the Czech Republic (prof. V. Brabec).
Pagina 5 di 75
Sintesi dei risultati
I risultati di seguito sintetizzati si riferiscono alle ricerche svolte nei laboratori della Fondazione
Callerio Onlus e/o nei laboratori di ricercatori di altri Enti con i quali esistono collaborazioni e che
riguardano i temi di ricerca prioritari che la Fondazione Callerio Onlus ha attivato per l’anno 2014.
Farmacologia oncologica
L’attività di ricerca scientifica in questo settore è svolta nell’ambito del laboratorio LINFA
(http://www.callerio.org/Linfa_i.htm).
Re(I)-porfirine di tipo simmetrico e asimmetrico come potenziali agenti per Terapia
Fotodinamica.
L’attività citotossica e fotocitotossica delle due porfirine (1 e 3) e dei relativi coniugati di Re(I) (2 e 4) (Figura
1) è stata valutata in due linee cellulari tumorali, il carcinoma della cervice uterina HeLa e il carcinoma
polmonare non a piccole cellule H460M2, e per confronto nella linea cellulare non tumorigenica HBL-100.
Figura 1. Struttura delle porfirine 1 e 3, e dei coniugati con Re(I) 2 e 4.
Le cellule sono state esposte a diverse concentrazioni di composti e dosi di luce. I risultati di questa serie di
esperimenti sono riportati nella Tabella 1. In generale i composti sono privi di citotossicità al buio,
caratteristica positiva per potenziali fotosensibilizzatori in PDT, e a basse dosi di luce. Il coniugato 2
rappresenta un’eccezione in quanto dimostra una spiccata azione citotossica già a basse dosi di luce sulla
linea cellulare H460M2. Un diverso comportamento emerge confrontando le coppie di composti 1 e 2 verso
3 e 4. Nel primo caso la coniugazione del complesso metallico potenzia l’attività della porfirina, mentre nel
secondo caso l’aggiunta del Re(I) non sembra conferire alcun vantaggio.
Pagina 6 di 75
Tabella 1. Valori di IC50 [µM] nelle cellule HeLa, H460M2 e HBL-100 trattate per 24 ore con i composti 1 – 4
(0,1 – 100 µM) e poi esposte a dosi crescenti di luce rossa (650 nm).
Buio
1 J/cm2
5 J/cm2
10 J/cm2
1
2
3
4
>100
>100
>100
>100
>100
32.6 ± 4.4
>100
>100
>100
2.6 ± 1.6
>100
12.9 ± 3.0
1.4 ± 1.3
≥100
100 ± 41
73 ± 19
H460M2
1
2
3
4
>100
7.4 ± 2.0
>100
>100
35.5 ± 7.7
2.8 ± 1.4
>100
>100
4.3 ± 1.3
0.5 ± 0.2
≥100
58 ± 9
1.3 ± 0.6
0.5 ± 0.2
13 ± 1
12 ± 5
HBL-100
1
2
3
4
>100
33.7 ± 14.5
>100
>100
82.0 ± 7.4
9.4 ± 3.4
>100
>100
4.8 ± 2.9
1.0 ± 0.3
76.6 ± 1.6
75.4 ± 0.1
1.4 ± 0.9
0.5 ± 0.1
23.4 ± 12.0
42.8 ± 5.3
HeLa
Studio di meccanismo d’azione del composto anti-metastatico di rutenio NAMI-A
mediante RNA-sequencing.
Sono stati condotti studi di real time RT-PCR (q-RT-PCR) su un numero selezionato di geni (Tabella
2) trovati essere differenzialmente espressi nelle cellule metastatiche dopo trattamento con il
complesso di rutenio NAMI-A.
Tabella 2. Geni differenzialmente espressi in cellule MDA-MB-231 e coinvolti nei meccanismi di
invasione, metastasi, rimodellamento del citoscheletro e ciclo cellulare, e i relativi cambi di
espressione osservati nell’analisi RNA-seq, dopo trattamento con NAMI-A.
Gene
Expression level Ctrl
Fold change
(RPKM)
vs Ctrl
0h
20 h
-5
10 M
-4
10 M
-5
10 M
10-4 M
ABL2
15.74
-
2.25
-
-
ATF3
23.20
2.35
2.95
-2.54
-2.08
C13orf15
2.00
2.01
5.10
-
-
CSRNP1
26.40
2.06
2.57
-
-
KLF9
4.90
-
2.59
-
-
NFATc2
2.50
-
2.30
-
-
NR4A1
13.40
2.07
2.50
-2.03
-2.21
PER1
5.90
-
2.86
-
-
PTGS2
74.60
2.05
2.53
-
-
RCAN1
43.40
-
2.25
-
-
RND1
6.54
-
2.38
-
-
SIK1
9.32
-
2.68
-
-
La Figura 2 mostra i livelli di espressione analizzati con la tecnica di real time RT-PCR.
Pagina 7 di 75
all genes dropped quickly and significantly, as detected at 2 h p.t., progressively returning to
expression levels comparable to those of control cells at 20 h p.t., in line with RNA-Seq results.
RCAN1
30
20
10
0
-4
0
4
8
12
16
20
30
20
10
24
0
-4
Time after the end of NAMI-A treatment (h)
0
4
8
50
10
5
0
8
12
16
20
24
12
-4
0
4
8
10
5
0
-5
-4
0
4
8
12
16
20
24
16
20
24
5
0
-4
0
4
8
12
16
20
24
10
5
0
-5
-4
0
4
8
12
16
20
24
CTNNB1
10
-5
12
Normalized Fold Expression
0
8
-5
5
4
0
MTA1
10
0
5
STK11
15
COL4A2
15
-4
24
20
-5
20
150
4
16
10
KLF9
250
0
12
15
NR4A1
350
-4
SIK1
40
40
ATF3
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
16
20
24
10
5
0
-5
-4
0
4
8
12
16
20
24
Figura 2. Validazione dei dati RNA-seq mediante q-RT-PCR. Cellule MDA-MB-231 trattate con NAMIA 10-4 M per 1 ora a 37°C sono state analizzate al termine dell’ora di esposizione (t = 0) o 2, 4, 8, 12,
20 ore dopo la fine del trattamento.
L’espressione di questi geni segue un andamento consistente con i dati di RNA-seq. Inoltre, l’analisi
q-RT-PCR ha permesso di studiare come questi geni siano modulati nel tempo dal trattamento con
NAMI-A. Sono state quindi ottenute queste importanti informazioni aggiuntive: i) la sovraregolazione
indotta da NAMI-A è estremamente rilevante e rapidamente attivata; ii) dopo la fine del trattamento
farmacologico i livelli di espressione genica ritornano velocemente a valori normali. Infatti,
15 per
l’espressione dei geni scende velocemente e significativamente già 2 ore dopo il trattamento,
tornare poi ai valori dei controlli 20 ore dopo il trattamento, in linea con i risultati di RNA-seq.
Identificazione di nuovi target tra le molecole di adesione nella fase di
metastatizzazione del cancro al colon nel tessuto epatico: valutazione del ruolo delle
integrine.
La validazione del ruolo dell’integrina α5β1 nella progressione del carcinoma colorettale (CRC) è
stata condotta inizialmente con cellule di CRC HCT-116 trattate con un anticorpo bloccante tale
integrina, o con echistatina, una “disintegrina” estratta da veleno di serpente che inibisce anche
l’integrina α5β1, mediante un saggio di adesione alla fibronectina in tempo reale (Figura 3).
Il fondamentale ruolo svolto dall’integrina α5β1 nella fase di adesione delle cellule HCT-116 è
evidenziato bene dal completo annullamento di questo processo causato dal trattamento con
l’anticorpo bloccante. Anche l’echistatina riduce drasticamente l’adesione, sebbene in tale caso sia
richiesto un tempo maggiore per ottenere un effetto completo.
Pagina 8 di 75
Time%(hrs)
CTR
Ab%2,5%uM
Echistatin%12.5%nM
Figura 3. Adesione alla fibronectina in tempo reale di cellule HCT-116 trattate con un anticorpo
bloccante l’integrina α5β1, o con echistatina. I valori riportati sull’asse y rappresentano unità
arbitrarie.
Absorbance Units
(570 nm)
1.5
NAMI-A 0
NAMI-A 1 µM
NAMI-A 10 µM
NAMI-A 100 µM
1.0
**
**
*** ***
0.5
0.0
Fibronectin
Collagen I
Figura 4. Adesione di cellule di CRC HCT-116 a diversi substrati della matrice extracellulare dopo
trattamento con NAMI-A.
La validazione dell’integrina α5β1 come bersaglio rilevante per il controllo della malattia disseminata
nel CRC è stata condotta utilizzando NAMI-A come controllo positivo di composto anti-metastatico.
Il processo di adesione delle cellule HCT-116 a vari substrati della matrice extracellulare è stato
studiato dopo trattamento con NAMI-A. Come riportato in Figura 4, il complesso di rutenio riduce
significativamente l’adesione delle cellule alla fibronectina (substrato preferito dall’integrina α5β1) e al
collagene I, indicando una sua possibile interazione e interferenza con tale integrina. Al contrario,
NAMI-A non interferisce in maniera significativa con l’adesione delle stesse cellule ad altri substrati
della matrice extracellulare (dati non mostrati).
La conferma di questa interferenza viene dell’esperimento mostrato in figura 5, nel quale l’attività antiadesiva del NAMI-A è stata valutata in presenza dell’anticorpo bloccante l’integrina α5β1. In tali
condizioni il NAMI-A perde completamente la sua capacità di ridurre l’adesione delle cellule alla
fibronectina, a indicare che la sua interazione con questo bersaglio o con la sua attività, è necessaria
affinché si abbia l’effetto anti-adesivo.
Pagina 9 di 75
Absorbance Units
(570 nm)
0.8
- anti-α5β1
+ anti-α5β1
0.6
**
0.4
***
4. Risultati
***
0.2
lavaggio ha evidenziato valori di fluorescenza simili a quelli del solo PBS, indicando la
0.0
sostanziale
assenza
non mostrato).
0 di cellule
1 nel surnatante
10 (dato
100.0
Dopo aver messo NAMI-A
a punto ilconcentration
protocollo, le cellule
[µM] in mono- ed in co-coltura sono state
trattate di
percellule
72 oreHCT-116
con 3, 10,
30,fibronectina
100 e 300 μM
5-fluorouracile
irinotecano.
Figure 5. Adesione
alla
dopoNAMI-A,
trattamento
con NAMI-Aed
e in
presenza di
anticorpo bloccante anti-α5β1.
I valori di fluorescenza ottenuti dalle letture effettuate a 72 ore e dopo un lavaggio con
“The plastic
mouse”
PBS,
sono stati rielaborati sia per evidenziare il relativo effetto sulla crescita della co-
Nell’ambito del progetto “Plastic Mouse” sono stati condotti esperimenti di co-coltura facendo
presenza
delle HCT-116
due linee sopra
cellulari
assenza di ditrattamento
(Figura
4. 4),
perHCEC,
ottenereper
crescere le cellule
di CRC
unin
monostrato
cellule epiteliali
sane
di sia
colon
ricreare il microambiente
del tumore
le curve dose-risposta
ai primario.
farmaci illustrate in Figura 4. 5.
**
10000
Fluorescenza (590 nm)
9000
8000
7000
6000
5000
4000
3000
2000
1000
0
HCT-116*
HCT-116*/HCEC°
Figura 5. Effetto delle cellule HCEC sulla crescita delle cellule tumorali HCT-116 nel modello delle coFigura 4. 4: Effetto delle cellule HCEC sulla vitalità cellulare delle HCT-116 nel modello delle co-colture. Le
colture.
cellule HCEC marcate con calceina sono state seminate (10000 cellule/pozzetto) in piastra da 96 pozzetti 24 ore
prima della semina delle cellule HCT-116 marcate con Fast DiI (5000 cellule/pozzetto). Le cellule in mono-e in coDai risultati mostrati
Figura
emerge
sane
ditermine
colondelle
HCEC
coltura sonoinstate
lasciate5crescere
per che
72 orelein cellule
terreno diepiteliali
coltura delle
IHH al
quali favoriscono
sono stati letti i in
maniera significativa
la crescita
delle
cellule
tumorali
HCT-116
rispetto
alla semplice
mono-coltura.
valori di fluorescenza
a λ di
590 nm.
In figura
è rappresentata
la media
± deviazione
standard della
fluorescenza in un
rappresentativo
di quattro
esperimentirendere
indipendenti.
Analisi statistica
one-tail
P value unpaired
t-test:
Al contrario,esperimento
la presenza
di HCEC
non sembra
le cellule
tumorali
maggiormente
sensibili
**p<0,01
vs monocoltura
di cellule HCT-116.
all’azione del
complesso
di rutenio
NAMI-A, né di 5-fluorouracile e irinotecano, due farmaci
comunemente impiegati per il trattamento di pazienti affetti da CRC (Tabella 3).
Tabella 3. Valori di IC50 in cellule HCT-116 nel modello delle co-colture dopo 72 ore di trattamento
Dalla Figura 4. 4 emerge come le cellule HCEC favoriscano la crescita delle cellule
con NAMI-A, 5-fluorouracile e irinotecano.
Co-coltura
tumorali rispetto alla sempliceMono-coltura
mono-coltura, in maniera statisticamente
significativa.
NAMI-A
> 300 µM
> 300 µM
Per quanto riguarda l’effetto del trattamento, il NAMI-A non mostra una tossicità diretta
5-fluorouracile
> 300 µM
> 300 µM
irinotecano sulle cellule HCT-116 né in mono-coltura
> 300 µM (Figura 4. 5 [1] [a]), né in
> 300
µM
co-coltura
con le
(Figura
[b]).
R E L A Z I O NHCEC
E SCIE
N T I F I 4.
C A5 2[1]
011
L’IC50 per questo composto non è calcolabilePagina
in quanto
10 di 75
superiore alla massima concentrazione utilizzata (>300 μM). Nemmeno con il 5-FU e
l’irinotecano si è evidenziata una rilevante citotossicità sulle cellule (Figura 4. 5 [2] e
Tecnologia Farmaceutica
Ingegnerizzazione di sistemi chimerici per la veicolazione di principi biologicamente
attivi.
Introduzione
Nel corso degli ultimi anni sono stati sviluppati presso la Fondazione Callerio degli innovativi sistemi
chimerici per la veicolazione di principi biologicamente attivi. Tali sistemi e le tecniche produttive
utilizzate sono state descritte nel dettaglio nella Relazione Scientifica 2013.
Il meccanismo d’azione dei micro/milli-sistemi chimerici sviluppati presso la Fondazione Callerio è
rappresentato, schematicamente, in figura a.
Figura a - Visualizzazione concettuale del meccanismo d’azione dei micro/milli-sistemi chimerici dopo
veicolazione orale in un organismo vivente superiore. Descrizione: partendo dalla freccia in alto a
destra e proseguendo verso sinistra, vengono rappresentati graficamente gli ipotetici vari passaggi a
cui il microsistema chimerico va incontro lungo il tratto gastrointestinale. Il principio biologicamente
attivo microincapsulato nell’esempio specifico è il Rituximab®. Nota: Il disegno non è in scala.
1.1. Sviluppo di sistemi per la veicolazione orale di ormoni CHH
Descrizione del sistema di veicolazione
Il sistema di veicolazione orale del cHH è stato sviluppato incorporando una microemulsione
acqua/olio/acqua (A/O/A) composta da globuli su nano-scala (circa 50 nm di diametro) contenenti al
Pagina 11 di 75
loro interno l’ormone, all’interno di beads su milli-scala (circa 3-4 mm di diametro) composte da
matrice di alginato/HPMC. Le beads sono state rivestite di chitosano per rendere muco-adesivo il
sistema. Per rendere appetibile il sistema, vi è stato incorporato, inoltre, un omogenato di mangime
specifico per gamberi. Lo schema del processo produttivo messo a punto è illustrato in figura b.
Descrizione del processo produttivo (vedi figura b)
La microemulsione A/O/A, contenente nella parte acquosa centrale il cHH, è stata prodotta mediante
tecnica ad ultrasuoni. Parallelamente è stata preparata una soluzione alimentante di base composta
da alginato ed HPMV. Tali tecniche sono state descritta in dettaglio nella Relazione Scientifica 2013.
Un’aliquota di mangime per gambero in pellet è stata fatta imbibire in soluzione fisiologica ed è stata
poi omogeneizzata fino a creare una sospensione. Tale sospensione di mangime è stata mescolata
alla soluzione alimentante di base. Alla soluzione alimentante di base contenente mangime è stata di
seguito aggiunta, goccia a goccia, la microemulsione A/O/A per ottenere una soluzione alimentante
complessa. Quest’ultima soluzione è stata fatta gocciolare (mediante siringa a cui è stato tolto l’ago)
dentro ad una soluzione gelificante/di rivestimento composta da CaCl2 e chitosano, tenuta sotto
agitazione mediante un’ancoretta magnetica. Le beads, aventi dimensioni pari a 3-4 mm sono state
lasciate in soluzione a gelificare per 15 minuti. L’eccesso di CaCl2 e chitosano è stato rimosso
mediante lavaggio in soluzione fisiologica (agitando una provetta da 50 ml manualmente).
Le beads sono state utilizzate per le prove sui gamberi in giornata.
“Razionale” alla base dei milli-sistemi chimerici per la veicolazione orale del cHH nei gamberi
La struttura esterna composta da alginato/HPMC, contenente le nano-gocce (o nano-globuli)
dell’emulsione acqua/olio (A/O) ed il cibo e rivestita di chitosano ha una tripla funzione:
1) strutturale: incorpora cibo e nano-gocce
2) protettiva: protegge dai bassi valori di pH tipici dell’ambiente gastrico (fatto già comprovato
in prove pregresse)
3) il chitosano esterno, inoltre, garantisce la muco-adesività
Le sub-strutture interne, composte da nano-gocce di un’emulsione A/O contenenti al loro interno
l’ormone, hanno una doppia funzione:
1) incorporare l’ormone in un “santuario” acquoso (rivestito d’olio) che gli impedisca di venire
a contatto con qualunque tipo di molecola che non sia acqua.
2) permettere ai villi intestinali di assumere la struttura stessa “come tale”, viste le sue
dimensioni su nano-scala.
Le beads sono state testate sia su gamberi da laboratorio (peduncolati) che su gamberi selvatici
pescati 1 settimana prima del prova sperimentale. In entrambi i casi l’ormone veicolato dal sistema da
noi sviluppato ha indotto un aumento dei livelli glicemici estremamente significativo.
In figura c, sono riportati i risultati ottenuti sui gamberi di fiume selvatici. I livelli glicemici degli animali
trattati con i milli-sistemi chimerici orali contenenti il cHH, con i milli-sistemi chimerici orali senza il
cHH e con l’ormone cHH iniettato per via parenterale sono indicati, rispettivamente, nel pannello in
alto a sinistra, in alto a destra ed in basso a sinistra. Il picco di glicemia, riscontrato a 6 ore dalla
somministrazione orale, nel caso dei due pannelli in alto è correlato ai tempi fisiologici di digestione.
L’ormone cHH veicolato dai milli-sistemi chimerici induce un aumento dei livelli glicemici in modo
altamente significativo.
Commento ai risultati
Il milli-sistema chimerico da noi sviluppato si è rivelato essere efficace per la veicolazione orale
dell’ormone cHH. Tale sistema è, inoltre, costituito nella sua interezza da prodotti naturali ed è
relativamente semplice da produrre. I costi di produzione sono contenuti.
I risultati ottenuti pongono le basi per lo sviluppo di un efficace sistema autocida per contrastare la
diffusione di specie non-indigene di gambero nei corsi d’acqua europei.
Sarà interessante, in una fase seguente, eseguire un test di dose-risposta.
Nota:
E’ in fase di completamento la stesura del lavoro scientifico intitolato:
Pagina 12 di 75
“New autocidal methods to contrast the spreading of invasive non-indigenous crayfish species: the
oral delivery of eyestalk neuropeptide”.
Figura b – Schema riassuntivo del processo produttivo messo a punto per produrre milli-sistemi
chimerici per la veicolazione orale dell’ormone cHH nel gambero di fiume.
Nota:
E’ in fase di completamento la stesura del lavoro scientifico intitolato:
“New autocidal methods to contrast the spreading of invasive non-indigenous crayfish species: the
oral delivery of eyestalk neuropeptide”.
Pagina 13 di 75
Figura c – time-course dei livelli glicemici nel gambero di fiume dopo trattamento con: milli-sistemi
chimerici orali contenenti cHH (in alto a sinistra), gli stessi sistemi non contenenti i cHH (in alto a
destra) e d il cHH somministrato per via parenterale (in basso a sinistra).
1.2. Sviluppo di sistemi per la veicolazione orale dell’anticorpo chimerico Rituximab®
Descrizione del sistema di veicolazione
Sono stati sviluppati due sistemi di veicolazione distinti allo scopo di verificare in via preliminare quale
fosse più adatto ad essere saggiato nelle prove di attività in vitro. A tal fine il Rituximab® è stato
microincapsulato in microsistemi “classici”, conformi per quanto riguarda la formulazione alle
specifiche riportate nel brevetto WO2005/013941 3982PT e in microsistemi chimerici, conformi per
formulazione a quanto riportato nel capitolo “Ingegnerizzazione di sistemi chimerici per la
veicolazione di principi biologicamente attivi” della Relazione Scientifica della Fondazione
Callerio Onlus del 2013. Lo schema del processo produttivo messo a punto è illustrato in figura d.
Descrizione del processo produttivo
I processi produttivi dei microsistemi classici e chimerici si sovrappongono parzialmente e, pertanto,
sono stati rappresentati in un unico schema (vedi figura c). Nel caso dei microsistemi “classici”, il
Rituximab® è stato aggiunto direttamente alla soluzione alimentante. Nel caso dei microsistemi
“chimerici”, il Rituximab® è stato prima incorporato all’interno di una microemulsione A/O/A composta
da globuli su nano-scala (circa 50 nm di diametro).
Pagina 14 di 75
Rituximab
®
Figura d – Schema riassuntivo delle tecniche produttive utilizzate per la produzione delle due tipologie
di microsistemi (“classici” e “chimerici”) contenenti Rituximab®.
Ottenimento degli eluati per il saggio in vitro
Il “prodotto semilavorato” è dato dalle microparticelle gelificate in soluzione acquosa mentre il
“prodotto finito” è dato dalle particelle sottoposte al processo di disidratazione mediante alcol assoluto
ed asciugate mediante flusso d’aria e, di seguito, in termostato a 37°C.
Per verificare in vitro il mantenimento dell’attività biologica del Rituximab®, il prodotto semilavorato ed
il prodotto finito di entrambe le tipologie di microsistemi (classici e chimerici) sono stati disgregati
mediante sodio citrato 0,44 M (disgregazione “moderata”) oppure mediante sonda ad ultrasuoni
(processo “forte”). I campioni così ottenuti sono stati sottoposti a filtrazione seriale mediante filtri con
cut-off di 30 µm e di 10 µm. Sono stati, alla fine ottenuti 8 eluati distinti (vedi tabella a) che sono stati
saggiati mediante lo specifico test in vitro.
Pagina 15 di 75
Tabella a – Tabella riassuntiva delle tipologie di come sono stati ottenuti gli eluati saggiati in vitro per
verificare il mantenimento dell’attività biologica del Rituximab®.
Test in vitro
Il saggio di attività del Rituximab® contenuto negli eluati, recuperati dalla disgregazione dei
microsistemi,è stato eseguito presso il laboratorio di Immunologia del Dipartimento di Scienza della
Vita, Università di Trieste.
Il test in vitro è descritto in dettaglio nella Tesi di Laurea “Microsistemi innovativi per la
veicolazione orale”, AA 2013-2014 del Laureando Domenico Masiello.
In sintesi, cellule BJAB sono state incubate per 1 h con gli eluati da noi ottenuti (contenenti
Rituximab®), dopodiché si è proceduti con l’incubazione con un anticorpo monoclonale secondario
anti-human IgG-FITC per 1 h. I campioni così incubati sono stati mediante citometro a flusso.
Come si evince da quanto riportato in tabella a, l’attività biologica del Rituximab®, contenuto negli
eluati, è stata mantenuta nel caso dei microsistemi “classici” sottoposti a disgregazione “moderata”. Il
livello di attività Rituximab® è superiore al 94% (vedi figura e).
Figura e - Risultati ottenuti dai campioni “semilavorato”dei microsistemi classici disgregati.
Descrizione: (a) grafico della capacità di legame del campione disgregato con metodica “moderata”
diluito 1 a 2 (10 µg/mL); (b) grafico della capacità di legame del campione disgregato con metodica
“moderata” diluito 1 a 4 (5 µg/mL); (c) grafico della capacità di legame del campione disgregato con
metodica strong diluito 1 a 2 (10 µg/mL); (d) grafico della capacità di legame del campione disgregato
con metodica “forte” diluito 1 a 4 (5 µg/mL).
Pagina 16 di 75
Commento ai risultati
La produzione di lotti di microparticelle contenenti Rituximab® mediante tecnologie diverse e l’analisi
degli eluati ottenuti disgregando i microsistemi con diverse metodiche, ha consentito d’individuare le
criticità peculiari concernenti la microincapsulazione dell’anticorpo e lo specifico test di quantificazione
in vitro.
Si ipotizza che i fattori che compromettano l’attività biologica dell’anticorpo microincapsulato mediante
il sistema “classico” siano l’alcool assoluto, utilizzato per disidratare il “semi-lavorato” per ottenere il
“prodotto finito” e gli ultrasuoni ove utilizzati nella preparazione degli eluati. La matrice di alginato,
infatti (contrariamente a quanto avviene in soluzione acquosa), propagherebbe l’energia meccanica
degli ultrasuoni agli anticorpi intrappolati al suo interno, agendo in modo distruttivo (vedi figura f).
Figura f – Individuazione delle criticità che compromettono la funzionalità dell’anticorpo
microincapsulato (Rituximab®) durante il processo produttivo e la preparazione degli eluati che
precedono i test di attività in vitro.
Anche in base ai risultati ottenuti microincapsulando l’ormone cHH, è lecito ritenere che il Rituximab®
microincapsulato nel sistema chimerico mantenga la sua attività biologica.
E’ lecito supporre che il test in vitro non abbia evidenziato alcun grado di attività negli eluati ottenuti
partendo da microsistemi chimerici per il semplice motivo che nessuna delle tecniche di preparazione
è sufficientemente energica per distruggere i nano-globuli contenenti l’anticorpo (vedi figura g).
Ciò enfatizza le qualità protettive del microsistema chimerico nei confronti di principi attivi
particolarmente labili come ormoni o anticorpi.
Anche in base ai risultati ottenuti microincapsulando l’ormone cHH, è lecito ritenere che il Rituximab®
microincapsulato nel sistema chimerico mantenga la sua attività biologica e sia adatto alle
somministrazioni orali in vivo.
Pagina 17 di 75
Figura g – Rappresentazione grafica dei passaggi eseguiti durante la verifica dell’attività del
Rituximab® incorporato nei microsistemi chimerici. Descrizione: Nella figura in alto a sinistra viene
rappresentato il sistema chimera nel suo complesso, prima della disgregazione. Nella figura in alto a
destra si illustra il sistema chimera disgregato composto da frammenti di matrice polimerica e globuli
A/O integri, con al loro interno il principio attivo. Nella figura in basso si può notare l’impossibilità, da
parte di Rituximab®, di legare i recettori presenti a livello della superficie delle cellule utilizzate nelle
prove in vitro. Lo strato oleoso che circonda la fase acquosa dei globuli impedisce la formazione del
legame recettore-anticorpo L’assenza del legame comporta un risultato negativo per il test.
Pagina 18 di 75
Pubblicazioni Scientifiche (copia in appendice)
I risultati riportati brevemente nel paragrafo precedente, sono stati organizzati in lavori scientifici
pubblicati su riviste specialistiche a carattere internazionale, con sistema di peer reviewing. I lavori
sono il risultato dello svolgimento dei progetti di ricerca della Fondazione Callerio che, come si può
dedurre dagli autori degli stessi, sono state condotte nell’ambito di strette collaborazioni con
ricercatori di altre istituzioni. Copia dei lavori è riportata in appendice.
1. Gallo D, Cocchietto M, Masat E, Agostinis C, Harei E, Veronesi P, Sava G. Human recombinant
lysozyme downregulates advanced glycation endproduct-induced interleukin-6 production and
release in an in-vitro model of human proximal epithelial cells. Experiment. Biol. and Med.
239:337-46, 2014.
2.
Lucafò M, Pelillo C, Carini M, Da Ros T, Prato M, Sava G. A Cationic [60] Fullerene Derivative
Reduces Invasion and Migration of HT-29 CRC Cells in Vitro at Dose Free of Significant Effects
on Cell Survival. Micro-Nano Letters 2014, 6: 163-168.
3.
Kumar SR, Lucafò M, Sava G, Nathanael AJ, Hong SI, Oh TH, Mangalaraj D, Viswanathan C,
Popandian N. Hydrophilic polymer coated monodispersed Fe3O4 nanostructures and their
cytotoxicity. Mat. Res. Express, 2014, 1:1-13
4.
Gianferrara T, Spagnul C, Alberto R, Gasser G, Ferrari S, Pierroz V, Bergamo A, Alessio E. Towards
matched pairs of porphyrin-ReI/99mTc(I) conjugates that combine photodynamic activity with
fluorescence and radio imaging. ChemMedChem, 2014, 9: 1231-7.
5.
Hudej R, Miklavcic D, Cemazar M, Todorovic V, Sersa G, Bergamo A, Sava G, Martincic A, Scancar J,
Keppler BK, Turel I. Modulation of activity of known cytotoxic Ruthenium(III) compound (KP418) with
hampered transmembrane transport in electrochemotherapy in vitro and in vivo. J Membr Biol, 2014,
247: 1239-51.
Presentazioni orali e/o posters a convegni e congressi
1.
COST Action CM1105 WG1 Meeting “Potentialities of Metal-based compounds targeting
th
th
proteins”, April 11 – 12 2014, Trieste, Italy. What can we still learn from NAMI-A? A. Bergamo, M.
Lucafò, M. Gerdol, A. Pallavicini, C. Pelillo, G. Sava.
2.
“Metallodrugs III: From DNA interactions to chemotherapy of cancer”, Olomouc, 29 – 31 May,
2014. Can we still gain something from the NAMI-A experience? A. Bergamo, M. Lucafò, M. Gerdol, C.
Pelillo, A. Pallavicini, G. Sava.
3.
Ibidem. The Plastic Mouse: a new promising tool to screen metal-based compounds for their potential
anti-metastatic activity. C. Pelillo, A. Bargamo, G. Sava.
4.
COST Action CM1105 2 International Symposium on Functional Metal Complexes that Bind to
rd
Biomolecules and 3 Whole Action Meeting of the COST Action CM1105, Zurich, Switzerland,
August 22 – 23, 2014. Next Generation Sequencing Analysis sheds new light in the search of NAMI-A
mechanism of action. A. Bergamo, M. Lucafò, M. Gerdol, C. Pelillo, A. Pallavicini, G. Sava.
5.
Ibidem. α5β1 Integrin involvement in the antimetastatic action of the ruthenium-based drug NAMI-A. C.
Pelillo, H. Mollica, A. Bergamo, J. Eble, G. Sava.
6.
Ibidem. Combination therapy of solid tumours with NAMI-A and Doxorubicin in vitro and in vivo. G.
Sava, A. Bergamo, T. Riedel, PJ. Dyson.
nd
Pagina 19 di 75
7. Ibidem. New water soluble porphyrins and their metal-conjugates for PDT applications. T. Gianferrara, G.
Mion, A. Bergamo, G. Gasser, V. Pierroz, E. Alessio.
Brevetti
Nulla.
Pagina 20 di 75
A TTIVITA ’ FO RM A TIVA
Sostegno per la frequenza a Dottorati di Ricerca
Il bilancio economico della Fondazione Callerio Onlus non ha consentito di sostenere attività di
dottorato nel corso del 2014.
Organizzazione di convegni-congressi-seminari
La Fondazione Callerio Onlus ha organizzato il WG1 Meeting “Potentialities of Metal-based
compounds targeting proteins” nell’ambito e con il sostegno della COST Action CM1105. La riunione
si è svolta a Trieste nei giorni 11 e 12 aprile 2014.
AGENDA
th
April 11 2014
14:00 – Starting registration
14:30 – 14:40
Welcome (prof. Graziani, president of the Callerio Foundation Onlus, prof. Fermeglia, chancellor of the
University of Trieste)
14:40 – 15:00
Report on WG1 status by WG leader (participants, current collaboration, STSMs…)
15:00 – 15:30
Introductory Lecture - G. Sava, “Cancer metastasis targets and chemotherapy”
st
I Oral session “Up-to-date on the application of metal-based compounds”
Chair:
Johannes Eble
15:30 – 15:50
O.P. # 1 – A. Vessieres, “Rhenium tricarbonyl complexes as multimodal probes for subcellular imaging”
15:50 – 16:10
16:10 – 16:30
O.P. # 2 – T. Gianferrara, “New water soluble porphyrins and their metal-conjugates for PDT applications”
O.P. # 3 – E. Alessio, “ New approaches to water-soluble metal-porphyrin conjugates for imaging and
photodynamic therapy”
O.P. # 4 – I. Turel, “Applicability of Ruthenium compounds in the electrochemotherapy of tumours”
16:30 – 16:50
II
nd
Oral session “Focus on Early Stage Researches”
Chair:
Gianni Sava
17:10 – 17:30
17:30 – 17:50
17:50 – 18:10
O.P. # 5 – J. Zajac, “Mitaplatin, a dual-targeting cancer therapeutic”
O.P. # 6 – S. Spreckelmeyer, “Possible transport mechanisms for anticancer metallodrugs: new insights”
O.P. # 7 – L. Herzog, “Integrins and RAPTA-T, a strange liaison?”
18:10 – 18:30
O.P. # 8 – C. Pelillo, “Studying α5β1 integrin as target of the ruthenium-based compound NAMI-A against
tumour progression”
18:30 – 19:00
General discussion
th
April 12 2014
rd
III Oral session “Focus on mechanistic insights”
Chair:
Iztok Turel
09:00 – 09:20
09:20 – 09:50
09:50 – 10:10
10:10 – 10:30
O.P. # 9 – C. Gaiddon, “ Characterization of the anticancer activity of organometallic osmium compounds”
O.P. # 10 – J. Eble, “Redox biology of cell adhesion”
O.P. # 11 – E. Meggers, “Design of metal-based enzyme inhibitors: a progress report”
O.P. # 12 – F. Tisato, “Speciation and cellular internalization of an antitumor Cu(I) complex: an ESI-MS
study”
10:50 – 11:10
O.L. # 12 – L. Messori “New mechanistic insights on NAMI-A”
11:10 – 11:30
O.L. # 13 – A. Bergamo, “What can we still learn from NAMI-A?”
th
IV session “Open discussion”
11:30 – 13:00
General discussion
Concluding remarks and future perspectives of the WG
Pagina 21 di 75
Aggiornamento e perfezionamento per ricercatori e borsisti
Dott. Alberta Bergamo
WG1 Meeting “Potentialities of Metal-based compounds targeting proteins”. Trieste, 11 – 12 aprile 2014.
“Metallodrugs III: From DNA interactions to chemotherapy of cancer”. Olomouc, 29 – 31 maggio 2014.
2nd International Symposium on Functional Metal Complexes that bind to Biomolecules. 3rd Whole Action
Meeting of the COST Action CM1105. Zurich, 22 – 23 agosto 2014.
Dott. Moreno Cocchietto
7 marzo 2014 - “Il modello zebrafish (Danio rerio): applicazioni nella ricerca biomedica e
mantenimento”. Università degli Studi di Trieste.
14 aprile 2014 – Progetto I.R.IDEA. “Innovazione della filiera della trota iridea regionale per il
miglioramento della qualità e dell’interazione con l’ambiente”. Organizzato dall’Università degli Studi di
Udine a Villa Manin di Passariano, Codroipo.
9 ottobre 2014 – “La sicurezza in laboratorio”, seminario formativo organizzato da VWR International
PBI s.r.l., Università degli Studi di Trieste.
Chiara Pelillo
WG1 Meeting “Potentialities of Metal-based compounds targeting proteins”. Trieste, 11 – 12 aprile 2014.
“Metallodrugs III: From DNA interactions to chemotherapy of cancer”. Olomouc, 29 – 31 maggio 2014.
2nd International Symposium on Functional Metal Complexes that bind to Biomolecules. 3rd Whole
Action Meeting of the COST Action CM1105. Zurich, 22 – 23 agosto 2014.
Tesi di Laurea e di dottorato in Fondazione Callerio
I laboratori della Fondazione, in particolare LINFA (colture cellulari, preparazioni istologiche, e citometria a
flusso) sono stati oggetto di frequenza da studenti della Facoltà di Farmacia dell'Università degli Studi di
Trieste, sotto la guida di docenti di quelle Facoltà ed autorizzati alla frequenza nella Fondazione, per la
messa a punto della tesi di laurea sperimentale. I ricercatori della Fondazione Callerio onlus sono stati
direttamente responsabili dell’assistenza tutoriale al lavoro svolto da parte degli studenti, come risulta dalla
firma apposta sulla tesi in qualità di correlatori.
Tesi di laurea interamente svolte nei laboratori della Fondazione Callerio Onlus
Laureando: Domenico Masiello
Corso di studi in Chimica e Tecnologia Farmaceutiche
Microsistemi Innovativi per la violazione orale
Relatore: Dario Voinovich; Correlatore: Moreno Cocchietto
Laureando: Gloria Cancian
Corso di Laurea Specialistica a ciclo unico in Farmacia
Sintesi di due derivati porfirinici di tipo simmetrico e valutazione delle loro proprietà
fototossiche per un potenziale impiego in terapia fotodinamica.
Relatore: Teresa Gianferrara; Correlatore: Alberta Bergamo, Giuliana Mion
Pagina 22 di 75
APPENDICE
Pagina 23 di 75
Original Research
Human recombinant lysozyme downregulates advanced glycation
endproduct-induced interleukin-6 production and release in an
in-vitro model of human proximal tubular epithelial cells
Davide Gallo1,5, Moreno Cocchietto1, Elisa Masat2, Chiara Agostinis3, Elisa Harei1,
Paolo Veronesi4 and Gianni Sava2
1
Callerio Foundation Onlus, Institutes of Biological Researches, 34127 Trieste, Italy; 2Department of Life Sciences, University of Trieste,
34127 Trieste, Italy; 3Institute for Maternal and Child Health, IRCCS ‘‘Burlo Garofolo’’, 34137 Trieste, Italy; 4Therapicon srl, 20146 Milano,
Italy; 5Department of Pharmacological Science, University of Padova 35 A 22, Padova, Italy
Corresponding author: Davide Gallo. Email: davide.gallo.3@studenti.unipd.it
Abstract
Diabetic nephropathy is the leading cause of chronic renal disease and one of the major causes of cardiovascular mortality.
Evidence suggests that its progression is due to the chronic hyperglycemia consequent to the production and accumulation of
advanced glycation endproducts (AGEs). Lysozyme was shown to posses AGE-sequestering properties and the capacity to
reduce the severity of the early stage manifestations of the diabetic nephropathy. This study was aimed to contribute to the
understanding the molecular mechanisms of lysozyme effectiveness in the diabetic nephropathy, using an in-vitro cellular model,
represented by the HK-2 cells, human proximal tubular epithelial cells. Lysozyme significantly reduced the AGE-induced IL-6
mRNA and an ELISA assay showed also a decreased release of the functional protein with a dose-dependent trend. In addition,
lysozyme prevented macrophage recruitment, suggesting its capacity to elicit an anti-inflammatory action. We may conclude that
the protective action of lysozyme on the nephrotoxic effects of AGE may depend, at least in part, on its ability to prevent the
production and release of inflammatory mediators, such as IL-6 and to reduce macrophage recruitment in the inflammatory sites.
Keywords: Lysozyme, advanced glycation endproducts, inflammation, diabetic nephropathy
Experimental Biology and Medicine 2014; 239: 337–346. DOI: 10.1177/1535370213518281
Introduction
Diabetic nephropathy is the most common cause of endstage kidney disease in developed countries1 with a significant impact on patient health and on the quality of life, also
including the corresponding costs for patients care.2,3
According to the results of the UK Prospective Diabetes
Study (UKPDS) clinical research, chronic hyperglycemia,
the typical condition in diabetes, is the most influent
factor related to the development of nephropathic complications.4,5 Diabetic nephropathy, similarly to other major
complications of this disease, is considered to have a multifactorial origin. A growing body of evidences indicates that
the development and progression of both microvascular
and macrovascular diseases are strictly associated to the
chronic hyperglycemia and to the consequent biochemical
processes.6 In fact, the main trait d’union between chronic
hyperglycemia and diabetic nephropathy is the production
of advanced glycation endproducts (AGEs).6,7 AGEs are
a group of modified proteins and/or lipids, formed by a
ISSN: 1535-3702
Copyright ! 2014 by the Society for Experimental Biology and Medicine
non-enzymatic glycation and oxidation processes after the
contact with aldose sugars,8,9 an event known as Maillard
reaction.10 Early glycation and oxidation lead to the formation of Schiff bases and Amadori’s products. The further
glycation of proteins and lipids causes molecular rearrangements leading to the generation of AGE stable products, the
formation of which is an irreversible event11; for an exhaustive explanation of AGE formation mechanisms and its relevance for diabetes, see Huebschmann et al..12 AGEs tend to
accumulate in the host tissues, altering their functions and
the mechanical properties through the formation of crosslinks with intracellular and extracellular matrix proteins.13
AGE-induced effects are also due to their ability to interact,
as specific ligands, with the membrane-bound receptor for
advanced glycation endproducts (RAGE), isolated and
characterized in 1992.14 The AGE–RAGE interaction leads
to a number of adverse phenomena, such as the generation
of an excess of intracellular reactive oxygen species
(ROS)15–17 or to the enhanced transcription and production
of a number of cytokines18 and pro-inflammatory mediators
Experimental Biology and Medicine 2014; 239: 337–346
338
Experimental Biology and Medicine Volume 239
March 2014
..........................................................................................................................
Table 1 Primer’s sequences used for RT-PCR analysis
Sample
Primers
Sequence 50 ! 30
18 S
Forward
ATCCCTGAAAAGTTCCAGCA
Reverse
CCCTCTTGGTGAAGGTCAATG
RAGE
Forward
GGGCAGTAGTAGGTGCTCAAA
Reverse
CGGCCTGTGTTCCAGTTTCAT
IL-6
Forward
GTACATCCTCGACGGCATC
Reverse
CCAGGCAAGTCTCCTCATTG
Forward
TCTTCATTGACCAAGGAAATCGG
Reverse
TCCGGGGTGCATTATCTCTAC
Forward
CCCAAAACTCTCCTCTGCTG
Reverse
AGGTGCTCTGCTGGTAAG
Forward
ATCAATGCCCCAGTCACC
Reverse
CCCAAACTCCGAAGACT
IL-18
CX3CL1
TNF-a
Annealing
temperature (! C)
60! C
61! C
60! C
60! C
60! C
60! C
via the nuclear factor-kB (NF-kB) pathway,19,20 e.g. the
intercellular adhesion molecule-1 (ICAM-1), the vascular
cell adhesion molecule (VCAM-1), E-selectin, the tumor
necrosis factor-a (TNF-a), interleukin-1 (IL-1), interleukin6 (IL-6) and cyclo-oxygenase-2 (COX-2).21–23 The AGE–
RAGE interaction can also induce other pathological
events, such as increased production of the extracellular
matrix24 and the activation of autoimmune processes.25
Recent findings have shown lysozyme (LZ), the enzyme
mainly known for its muramidase activity,26 can beneficially act in the context of the diabetic nephropathy. LZ
was shown to have a high binding affinity for AGE,27 to
be able to enhance AGE excretion in vivo28 and to ameliorate
AGE-induced oxidative stress.29 We have also previously
demonstrated that the orally administered microencapsulated LZ is able to reduce the severity of the diabetic
nephropathy, on a preclinical model of streptozotocininduced diabetic rats.30
The aim of the present work was therefore that of
contributing to the comprehension of the molecular mechanisms involved in the protective action of LZ against AGEinduced cell damages, using the in vitro HK-2 cell model
constituted by the human proximal tubule epithelial cells.
In particular, the attention will be placed on the inflammatory events associated to the diabetic nephropathy, focusing
on some pivotal pro-inflammatory mediators, such as the
ROS and the related cytokines.
(ABAP); 3,3’,5,5’-tetramethybenzidine (TMB); primer for
reverse transcriptase polymerase chain reaction (RT-PCR)
(Table 1); Phorbol 12-myristate 13-acetate (PMA/TPA);
and RPMI 1640 were obtained from Sigma Aldrich!
Chemical Co. (St Louis, MO).
Dulbecco’s Modified Eagle’s Medium (DMEM); Ham’s
F12; L-glutamine; penicillin and streptomycin; EuroGold
TrifastTM were obtained from Euroclone! (Devon, UK).
Fetal bovine serum (FBS) was obtained from GibcoInvitrogenTM (Paisley, Scotland, UK).
2’,7’-dihydrodichlorofluorescein-diacetate (H2DCF-DA)
was obtained from Molecular Probes (Eugene, OR).
iScript Reverse Transcriptase was obtained from Bio-Rad
Laboratories (Hercules, CA).
DynamoTM Flash SYBR! Green qPCR kit was obtained
from Finnzymes, Vantaa, Finland.
Materials and methods
HK-2 cells, gift of Prof. R. Bulla (Department of Life
Sciences, University of Trieste), an immortalized human
proximal tubular epithelial cell line, were cultured and passaged in 25 cm2 culture flasks that contained DMEM low
glucose, Ham’s F12 media (1:1) supplemented with decomplemented FBS 5%, antibiotics (100 U/mL penicillin G,
100 mg/mL streptomycin), L-glutamine 2 mmol/L, insulin
from bovine pancreas 5 mg/mL, holo-transferrin 5 mg/mL,
sodium selenite 5 ng/mL, hydrocortisone 5 ng/mL, EGF
10 ng/mL, T3 5 pg/mL, and PGE1 5 pg/mL.
U937 cells, gift of Dr S Pacor (Department of Life
Sciences, University of Trieste), a monocyte immortalized
Chemicals
Human recombinant lysozyme (Hr-LZ) was a gift of
Dr P Veronesi, Therapicon srl, Milano.
Bovine serum albumin (BSA) fatty acid free, low endotoxin; D-glucose; insulin from bovine pancreas; holo-transferrin; T3 (3,3’,5-triiodo-L-thyronine); prostaglandin E1
(PGE1); sodium selenite; hydrocortisone; endothelial growth factor (EGF); 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT); isoamilic chloroform;
2,2’-azobis (2-methylpropionamidine) dihydrochloride
AGE–BSA preparation
AGE–BSA was prepared by incubating BSA (50 mg/mL) at
37! C for six weeks with D-glucose 0.5 mol/L in a 0.2 mol/L
phosphate buffer containing azide.31 Then, preparation was
extensively dialyzed against phosphate buffer to remove
free glucose. The concentration of AGE, expressed in micromolar units, was determined considering the molecular
weight of BSA used for the AGE preparation.
Cell culture
Gallo et al.
In vitro effects of lysozyme toward an AGE-induced event
339
..........................................................................................................................
cell line, were cultured and passaged in 25 cm2 culture
flasks that contained RPMI 1640 supplemented with FBS
10%, antibiotics (100 U/mL penicillin G, 100 mg/mL
streptomycin), L-glutamine 2 mmol/L. All experiments
were preceded by a 24-h period starvation, in a serumfree medium.
Viability assay
The determination of cell viability was measured by assessing the reduction of MTT to formazan by the mitochondrial
enzyme, succinate dehydrogenase.32,33 Cells were seeded in
96-well plates at the concentration of 5 ! 103 cells/well, and
maintained at 37" C in 5% CO2 for 24 h, until confluence.
AGE and LZ alone, and both together were then added in
serum-free medium at the concentrations of 1, 10, and
20 mmol/L, for 24, 48, and 72 h. After the treatments, cells
were incubated with MTT (5 mg/mL). After 4 h at 37" C, the
supernatants were removed, the insoluble formazan crystals were dissolved in 200 mL of dimethyl sulfoxide (DMSO)
and the absorbance was determined at 570 nm using a spectrophotometer reader (SpectraCountTM, Packard).
RNA isolation, cDNA synthesis, and RT-PCR
Cells were cultured in 24-well plates at the density of
5 ! 104 cells/well. For RAGE investigation, cells were treated with LZ at the concentration of 1, 10, and 20 mmol/L for
24 and 96 h. For IL-6, IL-18, CX3CL1, and TNF-a investigation, cells were treated with AGE, LZ, and both at the concentrations of 1, 10, and 20 mmol/L for 24 h in serum-free
medium. After the treatments, cells were harvested in
EuroGoldTM Trifast according to the supplier’s instruction.
Total RNA was extracted with chloroform and precipitated
with isopropanol by 12,000 x g centrifugation at 4" C. In
order to digest contaminant genomic DNA, RNA samples
were treated with 5 U DNase free, re-extracted with omnizol/chloroform and precipitated with isopropanol. The
RNA pellet was washed with 75% ethanol, resuspended
in diethylpyrocarbonate-treated water. cDNA was synthesized from mRNA using iScript reverse transcriptase. Realtime quantitative PCR was carried out on a Rotor-Gene 6000
(Corbett, Explera, Ancona, Italy) using DynamoTM Flash
SYBR! Green qPCR kit.
Intracellular ROS detection
The quantification of ROS production was measured using
the probe H2DCFDA.34 Cells were seeded in 96-well plates
at the concentration of 5 ! 103 cells/well, and maintained at
37" C in 5% CO2 for 24 h, until the confluence. AGE were
then added in serum-free medium at the concentrations of
10, 20, 30, and 50 mmol/L for short time (from 30 min to 6 h)
and for longer time 24 h. At the end of treatments, the probe
was added for 1 h at 37" C. Then, cells were lysed adding
radioimmunoprecipitation assay (RIPA) buffer with Triton
X-1%. The fluorescence was determined at 485 nm excitation and 530 nm emission, with a fluorescence reader
(FluoroCountTM Packard).
Enzyme-linked immunosorbent assay (ELISA)
IL-6 released in the supernatants was quantified by means
of a sandwich ELISA assay. Firstly, cells were seeded in 96well plates at density of 5 ! 103 cells/wells and maintained
at 37" C for 24 h, until confluence. Then, cells were treated
with AGE, LZ, and both at the concentrations of 1, 10, and
20 mmol/L for 24 h in a serum-free medium. After 24 h of
treatments, supernatants were picked up and stored at
#80" C, until the use. For ELISA assay, a Peprotech
Human IL-6 kit was used. Briefly, 96-well plate was
coated with capture antibody with a final concentration of
100 mg/mL, at room temperature overnight. Then, after four
washes, block buffer was added in order to saturate the
unspecific sites. After 1 h at room temperature, standard
and samples were incubated at room temperature for 2 h.
Subsequently, a detection antibody at the concentration of
0.25 mg/mL was incubated for 2 h at room temperature.
After this incubation, the secondary antibody, avidin-horseradish peroxidase (HRP) conjugated, was used, diluted
1:2000, for 30 min at room temperature. The final step was
to add TMB, the substrate of HRP, and to monitor the color
development. To block the reaction 2 N sulfuric acid
was used. The plate was read at 450 nm by means of a
spectrophotometer reader (PowerWave, X Bio-Tek
Instruments, Ink).
Migration assay
The ability of LZ to influence the AGE-induced U937 migration was assessed by a migration assay. In order to induce
monocytic differentiation, U937 cells were first activated
with PMA/TPA 50 ng/mL for 72 h. Cell migration was
assayed in a 24-well plate, using Transwell! insert characterized by a polycarbonate filter with 8 mm pores. U937 cells
at the concentration of 1.5 ! 105, resuspended in 100 mL,
were seeded in the inserts while in the lower chamber
were placed supernatants obtained treating HK-2 cells
with 1, 10, and 20 mmol/L of AGE and LZ. The assembled
migration plate chamber system was incubated at 37" C for
90 min.
In order to determine the amount of migrated cells, the
cells attached to the upper parts of the polycarbonate filters
were removed, while the cells attached on the lower parts of
the filters and in the bottom chambers were fixed by means
of glutaraldehyde 1.1% for 15 min. Then, the cells were
washed with distilled water and stained with crystal
violet 0.1% in borate buffer 200 mmol/L, pH 9, for 20 min.
After other three washes with distillated water, the excess of
dye was removed. Crystal violet that stained cells was eventually solved through acetic acid 10% v/v for 10 min. The
data were acquired by means of a spectrophotometer reader
(SpectraCountTMPackard) at a wavelength of 570 nm.
Statistical analysis
Experimental data were subjected to computer-assisted
ANOVA statistical analysis using Tukey-Kramer post test
(Instat 2, GraphPad Software, San Diego, CA). Differences
of P < 0.05 were considered to be significant.
340
March 2014
..........................................................................................................................
Results
The concentrations of AGE used in the present study were
taken from literature data35,36 and from previous studies
performed in our laboratories.
variation in the levels of mRNA for RAGE when HK-2
cells were exposed to 1–20 mmol/L LZ for 24–96 h, independently of the dose and of the length of cell exposure to
this compound. Comparison is made versus cells in their
own medium (Figure 2a and b).
Cytotoxicity of AGE
The effects of AGE on the viability of HK-2 cells are
reported in Figure 1. Treatment for 24 h at concentrations
of 10 and 20 mmol/L AGE reduced the viability of HK-2 in a
statistically significant and dose-dependent way, respectively, by 20% and 50% (Figure 1a). Cell challenges with
AGE of 48 and 72 h produced similar result without any
further increase of cytotoxicity over that observed after
24 h (Figure 1b and c).
LZ is completely free of effects on the viability of HK-2
cells at 20 mmol/L concentration and 72 h treatment. Also,
LZ, at 1–20 mm l/L concentrations, is unable to prevent or
reduce the cytotoxicity induced by AGE (unreported
results). The doses of LZ used were selected in order to
get a 1:1 ratio with the concentration of AGE used.
RAGE mRNA quantification
The expression levels of RAGE in HK-2 cells, following
exposure to LZ, as determined by RT-PCR showed no
Intracellular ROS detection
The quantification of intracellular ROS production by HK-2
cells after treatments with 10–50 mmol/L AGE is reported in
Figure 3. Unlike the positive standard (ABAP), neither after
short treatments (at 30 min to 6 h cell exposure to AGE)
(Figure 3a) nor after longer treatments for 24 h (Figure 3b)
these cells showed increased ROS levels, at any of the concentrations used.
IL-6, IL-18, CX3CL1, and TNF-a mRNA quantification
Unlike ROS induction, data presented in Figure 4 show
AGE to induce a significant increase of the production of
IL-6. AGE at concentration of 1–20 mmol/L increased the
mRNA levels of IL-6, measured by means RT-PCR, from
30% to 70% versus the controls. In the same experimental
conditions, 1–20 mmol/L LZ, as expected, were devoid of
any effect on IL-6 production, whereas it decreased the
Figure 1 Effects of 1, 10, and 20 mmol/L AGE treatments on cells viability evaluated by means of MTT test. a: Cells incubated with AGE for 24 h. Data are expressed as
means ! SD. Statistical analysis: ANOVA followed by Tukey-Kramer. ***P < 0.001 versus C. b: Cells incubated with AGE for 48 h. Data are expressed as means ! SD.
Statistical analysis: ANOVA followed by Tukey-Kramer. ***P < 0.001 versus C. c: Cells incubated with AGE for 72 h. Data are expresses as means ! SD. Statistical
analysis: ANOVA followed by Tukey-Kramer. **P < 0.01 versus C. AGE: advanced glycation endproduct; MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide
Gallo et al.
341
..........................................................................................................................
Figure 2 Effects of 1, 10, and 20 mmol/L LZ-treatment on RAGE mRNA levels by means of RT-PCR. a: Cells incubated with LZ for 24 h show no significant variations
versus C. Data are expressed as means # SD. Statistical analysis: ANOVA followed by Tukey-Kramer. b: Cells incubated with LZ for 96 h show no significant variations
versus C. Data are expressed as means # SD. Statistical analysis: ANOVA followed by Tukey-Kramer. LZ: lysozyme; RAGE: receptor for advanced glycation
endproducts; RT-PCR: reverse transcriptase polymerase chain reaction
Figure 3 Quantification of intracellular ROS by means H2DCFDA probe. Positive controls (Cþ): cells treated with ABAP 1 mmol/L. Negative controls (C!): cells in own
medium. a: 10, 20, and 30 mmol/L AGE treatments for 6 h of AGE. No significant variations were measured between treatments and negative control. Data are expressed
as means # SD. Statistical analysis: ANOVA followed by Tukey-Kramer. ***P < 0.001 versus C!. b: 10, 20, and 50 mmol/L AGE-treatments for 24 h of AGE. No significant
variations were measured between treatments and negative control. Data are expressed as means # SD. Statistical analysis: ANOVA followed by Tukey-Kramer.
***P < 0.001 versus C!. ABAP: 2,2’-azobis (2-methylpropionamidine) dihydrochloride; AGE: advanced glycation endproduct; ROS: reactive oxygen species
AGE-induced IL-6 production to lower values, with a dosedependent relationship.
Concerning the quantification of mRNA for the other
cytokines tested, namely IL-18, CX3CL1, and TNF-a, data
reported, respectively, in Figure 5, panel A, B and C, show
no significant modifications versus controls after
1–20 mmol/L AGE treatments. In these conditions, LZ
alone globally decreases the levels of IL-18 and CX3CL1
mRNA, but has no effects on TNF-a. The effects of LZ on
the mRNA expression of IL-1, MCP-1, and RANTES, with
or without AGE, are not reported, considering that the
levels of mRNA measured in these experiments were very
low in the basal conditions (controls).
IL-6 ELISA assay
LZ at concentration of 1–20 mmol/L also reduced the release
of IL-6 stimulated by 1–20 mmol/L AGE in HK-2 cells.
AGE induced a dose-dependent increase of the release
of IL-6 (from 2-fold at 1 mmol/L to 5-fold at 20 mmol/L)
(Figure 6); the concomitant use of LZ significantly reduced
the AGE-induced release of IL-6, and this reduction was
significantly greater at the higher concentrations of LZ
used (from !30% at 1 mmol/L to the complete prevention
at 20 mmol/L).
Migration assay
Data reported in Figure 7 show that the use of supernatants
taken from HK-2 cells treated for 24 h with 1, 10, and
20 mmol/L AGE caused a significant increase of the migration ability of the tested U937 macrophages (from 2-fold at
1 mmol/L to 3-fold at 20 mmol/L). LZ was unable to modify
the migratory activity of U937 macrophages, whereas when
given to HK-2 cells, in the presence of AGE, it was able to
statistically reduce the migration-induction effect of the
supernatants of these cells on U937 macrophages (from
25% at 1 mmol/L to 50% at 20 mmol/L).
342
March 2014
..........................................................................................................................
Figure 4 IL-6 mRNA levels quantification by means of RT-PCR. AGE-treatment at concentrations of 1, 10, and 20 mmol/L for 24 h increase significantly IL-6 mRNA
levels. LZ at concentrations of 1, 10, and 20 mmol/L do not influence IL-6 mRNA levels. Contemporary treatment with LZ and AGE restore IL-6 mRNA levels to value
comparable to the controls. Data are expressed as means ! SD. Statistical analysis: ANOVA followed by Tukey-Kramer. ***P < 0.001 versus C; **P < 0.01 versus C.
AGE: advanced glycation endproduct; IL: interleukin; LZ: lysozyme; ROS: reactive oxygen species; RT-PCR: reverse transcriptase polymerase chain reaction
Discussion
Diabetic nephropathy, one of the major diabetic complications, is the leading cause of end-stage kidney disease in
Western countries. A number of evidences link diabetic
complications to the great increase of formation and accumulation of AGE occurring in diabetic patients. LZ can play
a role in the diabetic nephropathy by acting as an AGE’
scavenger28 and/or preventing some of the early manifestations of the diabetic nephropathy, such as microalbuminuria and glomerular hypertrophy.30
AGE interactions with their receptors can induce a
number of events, including the enhanced oxidative
stress6 and AGE were also shown to be involved in other
inflammatory phenomena.20 In the present work, we show
LZ to modulate important events associated to inflammatory processes such as macrophages mobility. Importantly,
these results were obtained in a cell line (HK-2) mimicking
the proximal tubule of the kidney, the site where diabetic
hyperglycemia exerts a large part of its pathological
changes.
It must be highlighted that the cellular model used in this
work was not able to show an AGE-induced increased oxidative stress. In fact, also using different approaches and
probes, such as H2DCFCDA and DHE (data not reported),
known to be able to detect a wide range of ROS (nitric oxide,
peroxynitrite anions, organic hydroperoxides, superoxide
anions)37–42 in a number of conditions (low and high concentrations after short and prolonged treatments), no significant variations were detected. The lack of AGE-induced
increase of ROS might depend on the difficulty to simulate
in-vitro events that are quantifiable in vivo after prolonged
exposure to the stimulating agents. It is remarkable to note
that cells cultured in vitro have lost their capacity to regulate
the RAGE expression. This effect might explain the lack of
the AGE-induced RAGE upregulation (data not reported)
and the consequent LZ downregulation, as it was expected
from the data reported after an in-vivo study.30 Considering
that ROS production is strictly associated to the AGE-RAGE
modulation, the lack of activation of this axis might explain
the absence of the expected increase of ROS production in
our conditions.
However, according to the available literature, LZ activity in inflammation can be related also to a number of other
events, among which we can include the induction of
macrophage migration and the consequent related cascade
of immunological events. In fact, LZ interferes with the
AGE-induced macrophage recruitment, and macrophages
are one of the central mediators of the renal vascular inflammation; their accumulation in the renal tissue is a characteristic feature of the diabetic nephropathy.43–46
There are several soluble factors involved in macrophages migration in the context of inflammation. We
focused our attention on some chemokines and cytokines
involved in the pathological process of the diabetic nephropathy, such as MCP-1, RANTES, IL-1, CX3CL1, TNF-a, IL-6,
and IL-18.20 Here we report the results on IL-6, IL-18,
CX3CL1, and TNF-a while the results on MCP-1,
RANTES, and IL-1 are not illustrated in detail. It is interesting to note that in our experimental conditions, with the
exception of IL-6, none of the chemokines (MCP-1,
CX3CL1, RANTES), and none of the other cytokines
tested (TNF-a, IL-1, IL-18), are upregulated by AGE.
Gallo et al.
343
..........................................................................................................................
Figure 5 a: IL-18 mRNA levels quantification by means of RT-PCR. 1, 10, and 20 mmol/L AGE and LZ treatments induce no significant variations versus C. Data are
expressed as means ! SD. Statistical analysis: ANOVA followed by Tukey-Kramer. b: CX3CL1 mRNA levels quantification by means RT-PCR. 1, 10, and 20 mmol/L AGE
and LZ treatments induce no significant variations versus C. Data are expressed as means ! SD. Statistical analysis: ANOVA followed by Tukey-Kramer. c: TNF-a
mRNA levels quantification by means RT-PCR. AGE at the concentrations of 1, 10, and 20 mmol/L and LZ treatments induce no significant variations versus C. Data are
expressed as means ! SD. Statistical analysis: ANOVA followed by Tukey-Kramer. AGE: advanced glycation endproduct; IL: interleukin; LZ: lysozyme; ROS: reactive
oxygen species; RT-PCR: reverse transcriptase polymerase chain reaction; TNF: tumor necrosis factor
Globally, also LZ has no significant effects on these inflammatory factors when they are not modified by AGE.
Concerning IL-6 release and production, it is interesting to
note that LZ was unable to modulate the production of this
cytokine in intact healthy HK-2 cells but it was capable to
inhibit that elicited by AGE, in terms of mRNA levels and in
comparison to untreated controls. These results were also
confirmed by ELISA assays of the protein showing the capacity of LZ to inhibit the release of IL-6 in the supernatants
of the treated cells in a dose-dependent manner.
The modulation of IL-6 production and release is considered a pivotal event in the development of diabetic
nephropathy. In fact, cells infiltrating the mesangium, interstitium, and tubules were shown positive to mRNA encoding IL-6.47 These data were confirmed by another, more
recent, research where IL-6 was shown to be significantly
overexpressed in diabetic rat kidneys, with increased levels
of mRNA encoding IL-6 in the renal cortex directly associated with the increase in its urinary excretion.48 In addition, a study by Seizuka et al.49 showed that serum levels of
IL-6, in patients with diabetic nephropathy, were significantly higher than in diabetic patients without kidney
injury.
Concerning the effects of LZ in the inflammatory
response, a large amount of aspects are still unknown.
Nevertheless, a work by Gordon et al.,50 demonstrated
LZ’s to modulate chemotaxis of polymorphonuclear
(PMN) cells in vitro, although the mechanisms was not
clear. LZ also showed the ability to inhibit the superoxide
generation, not quenching the already formed superoxide
anion but, probably, acting through a membrane-dependent
function.
344
March 2014
..........................................................................................................................
Figure 6 ELISA assay to evaluate the effects of LZ on the release of IL-6. IL-6 detection after treatments with 1, 10, and 20 mmol/L of AGE show a significant dosedependent increase in IL-6 release. LZ at concentrations of 1, 10, and 20 mmol/L do not influence IL-6 release. Contemporary treatments with LZ reduce significantly the
AGE-induced increase in IL-6 release. Data are expressed as means ! SD. Statistical analysis: ANOVA followed by Tukey-Kramer. § ¼ **P < 0.01 versus C;
# ¼ ***P < 0.001 versus C; a ¼ ***P < 0.001 versus AGE 1 and AGE 10; *P < 0.05 versus AGE 10 þ LZ 20; ***P < 0.001 versus AGE 20 þ LZ 20. AGE: advanced glycation
endproduct; ELISA: enzyme-linked immunosorbent assay; IL: interleukin; LZ: lysozyme
Figure 7 Migration assay. U937 cells migrated after 90 min treatments with supernatants of HK-2 cells 1, 10, and 20 mmol/L AGE-stimulated, 1, 10, and 20 mmol/L LZstimulated and contemporary treatments with LZ and AGE stimulated. Data are expressed as means ! SD. Statistical analysis: ANOVA followed by Tukey-Kramer.
a ¼ ***P < 0.001 versus C; b ¼ ***P < 0.01 versus AGE 1; c ¼ ***P < 0.001 versus AGE 10; d ¼ ***P < 0.001 versus AGE 20. AGE: advanced glycation endproduct;
LZ: lysozyme
Rather than to an effect on the AGE-RAGE axis, LZmediated IL-6 reduction could be attributable to some
‘‘alternative’’ mechanism. For example, to the capacity of
LZ to inhibit the AGE-activated NF-kB axis, through p38
phosphorylation, as resulting from a preliminary result
(Callerio Foundation, data on file, 2013). In addition,
a number of data suggest that the AGE–LZ interaction
could determine the increase of the lysosome degradation
of the complex.
Taken together, these data open the way to study the
effects of LZ on the cell pathways involved in the elicitations of the inflammatory processes, such as p38 MAPK
Gallo et al.
345
..........................................................................................................................
and/or NF-kB, and particularly on the target with which LZ
interacts to produce the anti-inflammatory effects observed
in the HK-2 cell model.
In conclusion, the present study indicates that the possible molecular mechanism of action of LZ responsible for
its AGE-protecting action may be related to its anti-inflammatory activity. In fact, in our in-vitro model, LZ shows the
ability to reduce the production and release of a typical
inflammatory mediator, such as IL-6 and to reduce another
pivotal manifestation of inflammation, such as macrophage
recruitment. Among all, these results might open the way to
the use of LZ, as a safe, simple, economic, and effective
drug, suitable for the oral use, for the control of the progression of the diabetic nephropathy.
Author contributions: All authors participated in the
design, interpretation of the studies, analysis of the data,
and review of the manuscript. DG conducted experiments
and wrote the manuscript. MC conducted experiment and
reviewed manuscript. EM contributed to discussion. CA
contributed to discussion. PV contributed to discussion.
EH conducted experiments. GS group leader, analyzed
data, discussed the experimental conditions and reviewed
the manuscript.
ACKNOWLEDGMENTS
This work was supported by Callerio Foundation Onlus.
The authors wish to thank Mr Michele Zabucchi for the technical assistance.
REFERENCES
1. Ichihara A, Suzuki F, Nakagawa T, Kaneshiro T, Kaneshiro Y,
Takemitsu T, Sakoda M, Nurun Nabi AHM, Nishiyama A, Sugaya T,
Hayashi M, Inagami T. Prorenin receptor blockade inhibits development of glomerulosclerosis in diabetic angiotensin II type 1a receptor
deficient mice. J Am Soc Nephrol 2006;17:1950–71
2. Williams R, Van Gaal L, Lucioni C. Assessing the impact of complications on the costs of type II diabetes. Diabetologia 2002;45:13–7
3. Thomas MC, Forbes JM, Cooper ME. Advanced glycation endproducts
and diabetic nephropathy. Am J Ther 2005;12:562–72
4. The Diabetes Control and Complication Trial Research Group. The
effect of intensive treatment of diabetes on the development and longterm complications in insulin-dependent diabetes mellitus. N Engl J
Med 1993;329:977–86
5. UK Prospective Diabetes Study (UKPDS) Group. Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type
2 diabetes. Lancet 1998;352:837–53
6. Go SY, Cooper ME. The role of advanced glycation end products in
progression and complications of diabetes. J Clin Endocrinol Metab
2008;93:1143–52.
7. Hall PM. Prevention of Progression in Diabetic Nephropathy. Diabetes
Spectrum 2006;19:18–24
8. Schmidt AM, Hori O, Brett J, Yan SD, Wautier JL, Stern D. Cellular
receptors for dvanced glycation endproducts: implications for induction of oxidant stress and cellular dysfunction in the pathogenesis of
vascular lesions. Arterioscler Thromb 1994;14:1521–8
9. Singh R, Barden A, Mori T, Beilin L. Advanced glycation end-products:
a review. Diabetologia 2001;44:129–46.
10. Miyata T, Sugiyama S, Saito A, Kurokawa K. Reactive carbonyl compounds related uremic toxicity (‘‘carbonyl stress’’). Kidney Intern Suppl
2001;78:25–31
11. Goldin A, Beckman JA, Schmidt AM, Creager MA. Advanced glycation
end products: sparking the development of diabetic vascular injury.
Circulation 2006;114:597–605
12. Huebschmann AG, Regensteiner JG, Vlassara H, Reusch JEB. Diabetes
and advanced glycoxidation end products. Diabetes Care
2006;29:1420–32
13. Hageb Z, Gibbons S, Neyses L, Mamas AM. Role of advanced glycation
end products. World J Cardiol 2012;4:90–102
14. Schmidt AM, Vianna M, Gerlach M, Brett J, Ryan J, Kao J, Esposito C,
Hegarty H, Hurley W, Clauss M, Wang F, Pan YCE, Tsang TC, Stern D.
Isolation and characterization of two binding propteins for advanced
glycation endproducts form bovine lung which are present on the
endothelial cell surface. J Biol Chem 1992;267:14987–97
15. Lander HM, Tauras JM, Ogiste JS, Hori O, Moss RA, Schmidt AM.
Activation of the receptor for advanced glycation endproducts triggers
a p21ras-dependent mitogen-activated protein kinase pathway regulated by oxidant stress. J Biol Chem 1997;272:17810–14
16. Cai W, He JC, Zhu L, Lu C, Vlassara H. Advanced glycation end
product (AGE) receptor suppresses cell oxidant stress and activation
signaling via EGF receptor. Proc Natl Acad Sci U S A 2006;103:13801–6
17. Coughlan MT, Thornburn DR, Penfold SA, Laskowski A, Harcourt BE,
Surris KC, Tan AL, Fukami K, Thallas-Bonke V, Nawroth PP,
Brownlee M, Bierhaus A, Cooper ME, Forbes JM. RAGE-induced
cytosolic ROS promote mitochondrial superoxide generation in diabetes. J Am Soc Nephrol 2009;20:742–52
18. Yang K, Wang XQ, He YS, Lu L, Chen QJ, Liu J, Shen WF. Advanced
glycation end products induce chemokine/cytokine production via
activation of p38 pathway and inhibit proliferation and migration of
bone marrow mesenchymal stem cells. Cardiovasc Diabetol 2010;9:66–76
19. Lindsey JB, Cipollone F, Abdullah SM, McGuire DK. Receptor for
advanced glycation end products (RAGE) and soluble RAGE (sRAGE):
cardiovascular implications. Diabetes Vasc Dis Res 2009;6:7–14
20. Navarro-Gonzalez JF, Mora-Fernandez C, Muros de Fuentes M, GarciaPerez J. Inflammatory molecules and pathways in the pathogenesis of
diabetic nephropathy. Nat Rev Nephrol 2011;7:327–40
21. Schmidt AM, Hasu M, Popov D, Zhang JK, Chen J, Yan SD, Brett J,
Cao R, Kuwabara K, Costache G. Receptor for advanced glycation end
products (AGE) has a central role in vessel wall interactions and gene
activation in response to circulating AGE proteins. Proc Natl Acad Sci
USA 1994;91:8807–11
22. Basta G, Lazzerini G, Massaro M, Simoncini T, Tanganelli P, Ku C,
Kislinger T, Stern DM, Schmidt AM, De Caterina R. Advanced glycation
end products activate endothelium through signal-transduction receptor RAGE: a mechanism for amplification of inflammatory responses.
Circulation 2002;105:812–22
23. Cipollone F, Iezzi A, Fazia M, Zucchelli M, Pini B, Cuccurullo C,
De Cesare D, De Blasis G, Muraro R, Bei R, Chiarelli F, Schmidt AM,
Cuccurullo F, Mezzetti A. Circulation 2003;108:1070–77
24. Berrou J, Tostivint I, Verrecchia F, Berthier C, Boulanger E, Mauviel A,
Marti HP, Wautier MP, Wautier JL, Rondeau E, Hertig A. Advanced
glycation end products regulate extracellular matrix protein and protease expression by human glomerular mesangial cells. Int J Mol Med
2009;23:513–20
25. Nienhuis HL, de Leeuw K, Bijzet J, Smit A, Schalkwijk CG, Graaf R,
Kallenberg CG, Bijl M. Skin autofluorescence is increased in systemic
lupus erythematosus but is not reflected by elevated plasma levels of
advanced glycation endproducts. Rheumatology 2008;47:1554–8
26. Yang B, Wang J, Tang B, Liu Y, Guo C, Yang P, Yu T, Li R, Zhao J,
Zhang L, Dai Y, Li N. Characterization of bioactive recombinant human
lysozyme expressed in milk of cloned transgenic cattle. Plos One
2011;6:17593–603
27. Mitsuashi T, Li YM, Fishbane S, Vlassara H. Depletion of reactive
advanced glycation end products from diabetic sera using a lysozymelinked matrix. J Clin Invest 1997;100:847–54
28. Zheng F, Cai W, Mitsuashi T, Vlassara H. Lysozyme enhances renal
excretion of advanced glycation end products in vivo and suppresses
adverse age-mediated cellular effects in vitro: a potential age sequestration therapy for diabetic nephropathy? Mol Med 2001;7:737–47
346
March 2014
..........................................................................................................................
29. Liu H, Zheng F, Cao Q, Ren B, Zhu L, Striker G, Vlassara H.
Amelioration of oxidant stress by the defensin lysozyme. Am J Physiol
Endocrinol Metab 2006;290:824–32
30. Cocchietto M, Zorzin L, Toffoli B, Candido R, Fabris B, Stebel M, Sava G.
Orally administered microencapsulated lysozyme downregulates
serum AGE and reduces the severity of early-stage diabetic nephropathy. Diabetes Metab 2008;34:587–94
31. Makita Z, Vlassara H, Cerami A, Bucala R. Immunochemical detection
of advanced glycation endproducts in vivo. J Biol Chem 1992;267:5133–8
32. Mossman T. Rapid colorimetric assay for cellular growth and survival:
application to proliferation and cytotoxicity assay. J Immunol Methods
1983;65:55–63
33. Alley MC, Scudiero DA, Monks A, Hursey ML, Czerwinski MJ,
Fine DL, Abbott BJ, Mayo JG, Shoemaker RH, Boyd MR. Feasibility of
drug screening with panels of human tumour cell lines using a micro
culture tetrazolium assay. Cancer Res 1988;48:589–601
34. Frengel K, Gleichauf C. Hydrogen peroxide formation by cells treated
with a tumour promoter. Free Radic Res Commun 1991;13:783–94
35. Yoshihara K, Okumura T, Yoshida T, Beppu M. Inhibitory effect of
peptide-free forms of advanced glycation end products on the proliferation and extracellular matrix protein production of cultured cells.
J Health Sci 2001;47:296–301
36. Gallicchio MA, Bach LA. Advanced glycation end products inhibit
NaþKþ ATPase in proximal tubule epithelial cells: role of cytosolic
phospholipase A2a and phosphatidylinositol 4-phosphate 5-kinase g.
Biochim Biophys Acta 2010;1803:919–30
37. Gabriel C, Camins A, Sureda FX, Aguirre L, Escubedo E, Pallas M,
Camarasa J. Determination of nitric oxide generation in mammalian
neurons using dichlorofluorescein diacetate and flow cytometry.
J Pharmacol Toxicol Meth 1997;38:93–8
38. Possel H, Noack H, Augustin W, Keilhoff G, Wolf G. 2, 7Dihydrodichlorofluorescein diacetate as a fluorescent marker for
peroxynitrite formation. FEBS Lett 1997;416:175–8
39. Cathcart R, Scwiers E, Ames BN. Detection of picomole levels of
hydroperoxides using a fluorescent dichlorofluorescein assay. Anal
Biochem 1983;134:111–6
40. Bindokas VP, Jordan J, Lee CC, Miller RJ. Superoxide production in rat
hippocampal neurons: selective imaging with hydroethidine. J Neurosci
1996;168:1324–36
41. Li N, Ragheb K, Lawler G, Sturgis J, Rajwa B, Melendez J, Robinson JP.
Mitochondrial complex I inhibitor rotenone induces apoptosis through
enhancing mitochondrial reactive oxygen species production. J Biol
Chem 2003;278:8516–25
42. Rivera A, Maxwell SA. The p-53 induced gene-6 (proline oxidase)
mediates apoptosis through a calcineurin-dependent pathway. J Biol
Chem 2005;280:29346–54
43. Bohle A, Wehrmann M, Bogenschutz O, Batz C, Muller CA, Muller GA.
The pathogenesis of chronic renal failure in diabetic glomerulosclerosis.
Pathol Res Pract 1991;187:251–9
44. Furuta T, Saito T, Ootaka T, Soma J, Obara K, Abe K, Yoshinaga K. The
role of macrophages in diabetic glomerulosclerosis. Am J Kidney Dis
1993;21:480–85
45. Sassy-Prigent C, Heudes D, Mandet C, Belair MF, Michel O,
Perdereau B, Bariety J, Bruneval P. Early glomerular macrophage
recruitment in streptozotocin-induced diabetic rats. Diabetes
2000;49:466–75
46. Chow F, Ozols E, Nikolic-Paterson DJ, Atkins RC, Tesch GH.
Macrophages in mouse type 2 diabetic nephropathy: correlation with
diabetic state and progressive renal injury. Kidney Int 2004;65:116–28
47. Suzuki D, Miyazaki M, Naka R, Koji T, Yagame M, Endoh M, Sakai H.
How to cite a prepublished article in ADA journals. Diabetes
1995;44:1233–8
48. Navarro-Gonzalez JF, Milena FJ, Mora C, Leon C, Garcia J. Renal proinflammatory cytokine gene expression in diabetic nephropathy: effect
of angiotensin-converting enzyme inhibition and pentoxifylline
administration. Am J Soc Nephrol 2006;26:562–70
49. Seizuka K, Tomino Y, Sei C, Kurusu A, Tashiro K, Yamaguchi Y,
Kodera S, Hishiki T, Shirato I, Kloide H. Detection of serum IL-6 in
patients with diabetic nephropathy. Nephron 1994;68:284–5
50. Gordon LI, Douglas SD, Kay NE, Yamada O, Osserman EF, Jacob HS.
Modulation of neutrophil function by lysozyme Potential negative
feedback system of inflammation. J Clin Invest 1978;64:226–32
(Received July 30, 2013, Accepted November 6, 2013)
www.nmletters.org
A Cationic [60] Fullerene Derivative Reduces
Invasion and Migration of HT-29 CRC Cells in
Vitro at Dose Free of Significant Effects on Cell
Survival
Marianna Lucafò1,† , Chiara Pelillo1,† , Marco Carini2 ,
Tatiana Da Ros2 , Maurizio Prato2 , Gianni Sava1,∗
(Received 19 November 2013; accepted 07 January 2014; published online 20 March 2014)
Abstract: Nanomaterials with unique characteristics exhibit favorable therapeutic and diagnostic properties,
implying their enormous potential as biomedical candidates. C60 has been used in gene- and drug-delivery, as
imaging agents, and as photosensitizers in cancer therapy. In this study, the influences of a cationic functionalized fullerene on cellular behavior of human colorectal cancer cell line (HT-29) were investigated. Results
indicated that HT-29 treated with the studied compound showed a lower sensitivity but a significant impairment in migration and invasion by interfering with the activities of matrix metalloproteinases (MMP-2 and
9). The presence of fullerene also altered the capacity of adhesion-related proteins to perform their activity,
thereby inducing dramatically adverse effects on the cell physiological functions such as cell adhesion. Thus,
our study suggests that this compound is a new potential anti-metastatic effector and a therapeutic component
for malignant colorectal cancer.
Keywords: Fullerene; Cancer; Anti-metastatic drug; Nanomedicine
Citation: Marianna Lucafò, Chiara Pelillo, Marco Carini, Tatiana Da Ros, Maurizio Prato and Gianni Sava,
“A Cationic [60] Fullerene Derivative Reduces Invasion and Migration of HT-29 CRC Cells in Vitro at Dose
Free of Significant Effects on Cell Survival”, Nano-Micro Lett. 6(2), 163-168 (2014). http://dx.doi.org/10.
5101/nml.v6i2.p163-168
Introduction
Current status of anticancer chemotherapy of solid
malignant tumors indicates the necessity for agents active against tumor metastases. Metastasis, the spread
of a primary tumor from its initial location to distant localities, is the main cause of death in cancer
patients. Colorectal cancer (CRC) can lead to metastasization and represents one of the leading causes of
cancer-related mortality [1]. Its progression to a highly
advanced, metastatic stage (mCRC) still decreases the
overall 5-year survival to less than 8-10% [2].
The rapid development of nanotechnology and its ap-
plications has allowed for a wide variety of nanoparticles
to provide a broad range of opportunities in multidisciplinary fields and particularly in medicine, for clinical
therapy and diagnosis [3].
Recent reports show that carbon nanomaterials, in
particular fullerenes, inhibit various angiogenic signalling pathways and, therefore, can be potentially used
in anti-angiogenic therapy [4-7]. Based on these properties, we might expect that fullerenes can have significant effects on tumour metastases either preventing their formation or inhibiting their growth. In this
context it might be interesting to note that the endohedral metallofullerenol Gd@C82 (OH)22 has been demon-
1
Department of Life Sciences, University of Trieste, Via Giorgieri 5, 34127, Trieste (TS), Italy
Department of Chemical and Pharmaceutical Sciences, University of Trieste, Piazzale Europa 1, 34127, Trieste (TS), Italy
† Contributed equally to this paper.
*Corresponding author. E-mail: gsava@units.it
2
Nano-Micro Lett. 6(2), 163-168 (2014)/ http://dx.doi.org/10.5101/nml.v6i2.p163-168
were then incubated for 4 h at 37◦ C. Cells were lysed
with isopropanol HCl 0.04 N. Absorbance was measured
at 540 and 630 nm using a microplate reader (Automated Microplate Reader EL311, BIOTEK® Instruments, Vermont, USA). All measurements were done
in six replicates, and at least three independent experiments were carried out.
A 96-well plate was pre-coated with fibronectin, collagen I, collagen IV, Poly-L-lysine, laminin (SigmaAldrich, St. Louis, USA) and Matrigel™ (20 µg/ml) for
4 h at 37◦ C or 4◦ C overnight and subsequently blocked
with PBS-BSA 0.1% (w/v) for 15 min at 37◦ C. Sub
confluent tumor cells were treated with C60 + (25 µM)
for 48 h and then grown in serum-free medium for additional 24 h. Cells were trypsinized with 1 mM EDTA,
resuspended in serum free medium with 0.1% BSA for
30 min at room temperature to ensure re-expression
of integrins on the cell surface and seeded in the plate
(5 × 104 cells/well). HT-29 were allowed to attach to
each substrate for 1 h at 37◦ C and subsequently fixed
with trichloroacetic acid 10% (v/v) for 1 h at 4◦ C and
stained with sulphorodamine B 0.4% (w/v). The absorbance was read at 570 nm and related to the adhesion rate.
Effects of the C60 + to inhibit cancer cells motility
were tested performing a conventional Boyden chamber assay.
HT-29 cells, sown 72 h before, were left in serum-free
medium containing 0.1% bovine serum albumin (BSA)
for 24 h after being treated with C60 + (25 µM) for 48 h,
at 37◦ C. At the end of the treatment, 5 × 104 cells were
sown in 200 µL of serum-free medium containing 0.1%
BSA, in the upper side of a polyvinylpirrolidone-free
polycarbonate filter (6.5-mm diameter and 8-µm pore
size) set in a Transwell® cell culture chamber (Corning Costar Italia, Milan, Italy) in triplicate. The lower
compartment was filled with the appropriate culture
medium, supplemented with 10% FBS. Plates were left
in the incubator for 72 h, at 37◦ C, 5% CO2 , 100% relative humidity. At the end of the incubation, cells that
had not invaded were mechanically removed from the
upper surface of the filter by wiping them with a cotton bud. Cells that had migrated to the lower surface
were fixed with 1.1% glutaraldehyde for 15 min, washed
with deionised water and air-dried. Transwells® were
then stained with 0.1% crystal violet in 200 mM borate buffer, pH 9.0 for 20 min at room temperature.
After washings with deionised water and complete drying, the dye was dissolved in 10% acetic acid and the
absorbance was read at 590 nm by a SpectraCount spectrophotometer (Packard Bell, Meriden, CT, USA).
Invasive capability was measured in a Transwell®
cell culture chamber (Corning Costar Italia, Milan,
Italy) according to a method modified from Albini et al.
[12]. In brief, the surface of a polyvinylpirrolidone-free
polycarbonate filter (6.5-mm diameter and 8-µm pore
strated to interfere with the neoplastic growth, as well
as with tumour metastasis, in a mouse cancer model,
with almost no toxicity to normal cells in vivo and in
vitro [8]. Also the water-soluble pristine (unmodified)
C60 inhibits the transplantable malignant Lewis lung
carcinoma growth and metastasis in C57Bl/6J male
mice [7]. Limited knowledge exists on the capacity of
the fullerenes to interfere with tumor invasion and the
mechanism involved in the fullerene anti-metastatic effect remains to be elucidated. To explore this further,
the effect of fullerene on key steps of tumor metastasis, including cell adhesion, migration and invasion, was
investigated.
Our previous studies demonstrated that a cationic
fullerene derivative (C60 +), a fulleropyrrolidinium salt,
was able to effectively inhibit tumor cell proliferation
in vitro [9] and, recently published data from our laboratory, obtained by RNA-sequencing on MCF7 cells
[10], indicated that the expression profile of several proteins involved in cell-cell adherence junctions was altered when treated by C60 +. Therefore, the question if
compound C60 + plays a role in the regulation of migration and adhesion of HT-29 colorectal cell line naturally
arose.
The present study examined the hypothesis that
derivative C60 + participates in colorectal cancer cell
invasion. Cells treated with it exhibited significant impairment in a series of preliminary migration and adhesion assays in vitro. Thus, compound C60 + may be a
new potential anti-tumor effector and therapeutic component for malignant colorectal cancer.
Experimental
The synthesis and the characterization of the
fullerene derivative C60 + was performed as previously
described [9,11].
The human colorectal carcinoma cell line were purchased from the ECACC N◦ 86012803 (HT-29). HT29 was maintained in RPMI-1640.
The culture
medium was supplemented with 10% (v/v) fetal bovine
serum (FBS), penicillin (100 U/mL), streptomycin (100
µg/mL), and L-glutamine 2 mM; cells were grown at
37◦ C in a 95% air and 5% CO2 humidified incubator.
HT-29 were harvested by trypsinization and plated
into 96-well culture plates at approximately 1.5 × 104
per well. After incubated for 24 h, different concentrations of C60 + (1, 5, 10, 25 and 40 µM) dissolved
in culture medium were added to each well. Then the
samples were incubated 48 h at 37◦ C in the humidified atmosphere (5% CO2 ). The colorimetric 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide
(MTT) assay was performed to assess the metabolic activity of cells treated as described above. 20 µl stock
MTT (5 mg/mL) were added to each well, and cells
164
size) was coated with 30 µg per 50 µL of Matrigel®
(Beckton Dickinson, Bedford, MA, USA) diluted in
DMEM and air-dried overnight at room temperature.
The filters were reconstituted with DMEM immediately
before use. HT-29 cells, sown 72 h before, were left in
serum-free medium containing 0.1% bovine serum albumin (BSA) for 24 h after to being treated with C60 +
(25 µM) for 48 h, at 37◦ C. At the end of the treatment,
cells were harvested with trypsin–EDTA, and 5 × 104
cells were sown in 200 µL of serum-free medium containing 0.1% BSA, in the upper compartment chamber, in
triplicate. The lower compartment was filled with the
appropriate culture medium, supplemented with 10%
FBS. Plates were left in the incubator for 96 h, at 37◦ C,
5% CO2 , 100% relative humidity. At the end of the incubation, the plate was processed as described in the
migration assay.
To perform gelatin zymography, supernatant was collected from sub confluent cell culture treated for 48 h
with C60 + and left 24 h in serum-free medium. Proteins present in the supernatant were concentrated by
centrifugation and quantified using Nano Drop spectrophotometer. 180 µg of total mixture of proteins
were separated on 10% polyacrylamide gel containing
0.06% gelatin (Sigma-Aldrich, St. Louis, USA). Then
the gel was washed for 30 minutes using 2.5% Triton X100 solution to remove SDS and then incubated in an
activating buffer (50 mm pH 7.5 TRIS, 5 mM CaCl2 ,
0.2 M NaCl) for 20 h at 37◦ C. Gelatinase activity was
demonstrated by gel staining with 0.5% Commasie blue
and destaining with 30% methanol solution and 10%
acetic acid. To assess activity, the stained gel was photographed and analyzed using ImageJ software.
Data were subjected to computer-assisted analysis by
Graph Pad Instat 3 and statistical significance or regression analysis, were reported in the text.
our RNA-seq analysis suggested that C60 + induced an
alteration of the gene expression targeting mTOR signaling at different levels in MCF7 cell line [10]. Among
the many factors potentially determining an inhibition
of mTOR signaling, we proposed a decrease of available cellular energy as the most plausible. We here
hypothesize that the mechanism of action of C60 + in
the HT-29 cell line could be the same, given that HT-29
represents a cell line with high in vitro invasive and in
vivo metastatic behavior.
Results and discussion
Cell adhesion analysis
Fullerene derivative C60 + inhibited HT-29 proliferation
Cell adhesion to the extracellular matrix (ECM) is
an important step that regulates different cellular functions including cell migration and proliferation, differentiation, and tissue organization [13]. This event is
mediated by cell surface receptors, the integrins, α and
β chain heterodimers with short cytoplasmic tails, the
enzymatic activity of which activates a variety of intracellular signalling pathways [14]. Integrins were shown
to be involved in the processes of cancer cell invasion
and metastasis [15], and, most notably, the integrinECM interactions were also demonstrated to have a
role for cell survival and resistance to chemotherapy
in many types of solid cancers, including colon cancer
[16].
In order to mimic the detachment of metastatic cells
from the primary mass and their adhesion in a secondary site, we performed a study where HT-29 cells
+
NH3 CF3COO−
O
O
H3C
N+
CF3COO−
C60+
Inhibition (%)
60
50
40
30
20
10
0
1
5
10
µM
25
40
Fig. 1 (a) Chemical structure of fullerene derivative C60 +;
(b) Effect of C60 + on proliferation of Colon Cancer Cell
Line (HT-29). The cells were treated for 48 h at different
concentrations. Each value represent the mean of 3 separate
experiments, each with at least three independent samples,
± S.D. (***) p < 0.01
The effects of C60 + (Fig. 1(a)) on the viability of HT29 cells after 48 h challenge with concentrations ranging from 1 to 40 µM are reported in Fig. 1(b). C60 +
caused a statistically significant reduction of cell viability (about 40% inhibition), as determined by the MTT
test only at the highest dose tested, being the other
dosages only marginally capable to influence HT-29 cell
growth during the experiment. This result is consistent
with unpublished data showing different degrees of cytotoxicity of this fullerene derivative in vitro on a number of tumor cell lines: MCF7 cells were particularly
sensitive to the cytotoxic effects [9], whereas other cell
lines, e.g. MDA-MB231, were much less sensitive, as reported here for HT-29 cells. The scenario depicted by
165
were exposed to C60 + at 25 µM for 48 h, then harvested from the plate and allowed to adhere to different
substrates components of the ECM such as laminin, fibronectin and collagens. Data reported in Table 1 show
that C60 + causes a similar inhibition of the adherence
ability of HT-29 cells independently whether the substrate used was a component of the ECM, an unspecific
substrate (poly-L-lysine) or no substrate at all. However, in all the cases, the HT-29 cells, after such treatment, showed a marked reduction (60-70% inhibition)
of their ability to adhere as compared to untreated cells.
Similar effects were obtained when we studied the invasion process. In this case, cells were seeded on a layer
of matrigel previously deposed on the Boyden chamber
grid and evaluated after 96 h. Compound C60 + inhibited more than 75% the capacity of the treated HT-29
cells to cross the matrigel barrier and to accumulate in
the lower compartment of the chamber (Fig. 2(b)).
Relative cells number (%)
120
Table 1 Inhibitory potential of C60 + to the interaction between HT-29-ECM substrates. After treatment with C60 +, cells were seeded on 96-well plate
functionalized with fibronectin, collagen I and IV,
laminin, poly-L-lysine and Matrigel (20 µg/mL) and
left to adhere 1 h at 37◦ C with 5% CO2 . Unbound
cells were removed while adhered cells were fixed,
stained with sulphorodamine B and absorbance read
at 570 nm. Results obtained for each substrate are
expressed as percentage of adhesion inhibition of
treated HT-29, considering the untreated HT-29 adhesion value as 100%
% Inhibition of Adhesion by C60 +
No substrate
78
Poli-L-lys
69
Laminin
63
Fibronectin
66
Collagen I
68
Collagen IV
62
80
60
40
20
0
HT-29
HT-29+C60+
(a)
120
Relative cells number (%)
Substrate
100
This effect might be related to a number of hypotheses. Integrins might be activated by extracellular events, aside from the intracellular signaling events
[17], such as ligand binding, divalent cation concentration, mechanical stress, all of them potentially perturbated by the fullerene treatment. However it must be
taken into account also the possible effect of this compound on cell viability that, although not leading to
cell death, might keep the treated cells to a lower stage
of “biological activity”.
100
80
60
40
20
0
HT-29
HT-29+C60+
(b)
Fig. 2 (a) Boyden chamber assay: HT-29 cells were treated
with C60 + for 48 h and then seeded in a Boyden chamber
and left to migrate for 72 h. At the end of this time, cells
that migrated were fixed, stained with crystal violet and the
absorbance read at 590 nm. Statistical analysis was performed with ANOVA Unpaired t test-One tail t test (∗ ∗ ∗)
p < 0.0001 vs control (HT-29). (b) Invasion assay: HT29 treated 48 h with C60 + were seeded on the upper side
of inserts functionalized with matrigel and were left invade
96 h. At the end of incubation, cells on the lower side of
the inserts were fixed, stained with crystal violet and the
absorbance read. Statistical analysis was performed with
ANOVA Unpaired t test-One tail t test (∗ ∗ ∗) p < 0.0001
vs HT-29.
Cell migration, invasion and zymography assays
Migration and invasion are two essential steps of
the pathological events leading to cancer metastasis.
We studied cell migration using a conventional Boyden
chamber assay (Fig. 2(a)).
HT-29 cells, treated with C60 + for 48 h, were left to
migrate for 72 h from the upper chamber through the
insert, following the chemotactic signal (serum) coming from the lower side of the chamber. Data reported
in Fig. 2(a) shows a pronounced (80%) and statistically significant reduction of the migration ability of
the treated cells as compared to control constituted by
untreated HT-29 cells.
The compared analysis of the effects of C60 + on migration and invasion suggests that this compound does
not reduce the capacity of HT-29 cells to degrade the
ECM. In fact, it seems that the effects of the considered fullerene derivative on these cells might consist of a
more general reduction of the cells ability to move or a
166
reduced capacity to respond to the chemotactic signal,
operated by the serum present in the lower wall. On the
contrary, the treated cells have a reduced gelatinolytic
ability, as shown by a study of MMP2 and MMP9 activity, performed on the supernatant obtained by the
HT-29 cells exposed to C60 + at 25 µM for 48 h (3842% inhibition, Fig. 3), suggesting that the treated cells
have a lower capacity to degrade the ECM.
this seems to rule out an effect of C60 + on cell integrins. Rather, it seems that C60 + might act on a more
generalized pathway responsible for multiple effects of
the metastatic capacity of the cells.
Anyhow, these data, although preliminarily and considering the role attributed to phenomena such as adhesion and migration for the process of metastasis formation suggest the ability of this fullerene derivative to
interfere with metastases of solid tumors, in agreement
with other data already reported in the literatures [7,8].
MMP-9
Acknowledgements
MMP-2
HT-29
The work was funded within the research contracts
Nanocancer Friuli Venezia Giulia, Fra-2011 University
of Trieste, and by Italian Ministry of Education MIUR
(FIRB RBAP11ETKA and PRIN 2010N3T9M4 001).
Thanks to Callerio Foundation Onlus for supporting
the fellowship grant to Marianna Lucafò and Chiara
Pelillo.
HT-29+C60+
Fig. 3 Gelatinolytic activity of MMP-2 and MMP-9 was
evaluated in HT-29 cells treated with C60 + at 48 h.
The activation of the zymogen form of MMP2 (proMMP2) is a cell-surface event that is mediated by members of the membrane-type (MT) subfamily of MMPs
as MT1-MMP and by the tissue inhibitor of metalloproteinase (TIMP-2), a member of the family of MMP inhibitors [18,19]. It has been demonstrated that this inhibitor directly interacts with MMP2 or through MT1MMP/TIMP-2 complex formation reducing the enzymatic activity of MMP2 [20-22].
Recently we found that C60 + increases 4-folds the expression level of TIMP-2 after 24 and 48 h of treatment
[10] in the human breast cancer cell line MCF7. This
result could suggest a similar effect of this compound
also on HT-29 colon cancer cell line and a consequent
reduced gelatinolytic activity of MMP2 detected after
treatment of cells with fullerene C60 +.
Moreover the complex pro-MMP2 and TIMP-2 is
able to inhibit other MMPs such as MMP9 through
the formation of a ternary complex pro-MMP2-TIMP2-MMP9 [23-25]. This data suggest that the reduced
MMP9 activity detected in treated HT-29 cells, could
be due to the increased level of TIMP-2 after C60 +
treatment and its modulation on MMP9 activity via
MMP2 involvement.
References
[1] A. Jemal, R. Siegel, J. Xu and E. Ward, “Cancer statistics, 2010”, CA Cancer J. Clin. 60(5), 277-300 (2010).
http://dx.doi.org/10.3322/caac.20073
[2] J. M. Davies and R. M. Goldberg, “Treatment
of metastatic colorectal cancer”, Semin. Oncol.
38(4), 552-60(2011). http://dx.doi.org/10.1053/j.
seminoncol.2011.05.009
[3] K. K. Jain, “Nanotechnology in clinical laboratory diagnostics”, Clin. Chim. Acta 358 (1-2), 37-54 (2005).
http://dx.doi.org/10.1016/j.cccn.2005.03.014
[4] P. Chaudhuri, R. Harfouche, S. Soni, D. M. Hentschel,
and S. Sengupta, “Shape effect of carbon nanovectors on angiogenesis”, ACS Nano 4(1), 574-82 (2010).
http://dx.doi.org/10.1021/nn901465h
[5] M. Grodzik, E. Sawosz, M. Wierzbicki, P. Orlowski,
A. Hotowy, T. Niemiec, M. Szmidt, K. Mitura and A.
Chwalibog, “Nanoparticles of carbon allotropes inhibit
glioblastoma multiforme angiogenesis in ovo”, Int. J.
Nanomed. 6, 3041-3048 (2011). http://dx.doi.org/
10.2147/IJN.S25528
[6] M. Wierzbicki, E. Sawosz, M. Grodzik, M. Prasek,
S. Jaworski and A. Chwalibog “Comparison of antiangiogenic properties of pristine carbon nanoparticles”, Nanoscale Res. Lett. 8(1), 195 (2013). http://
dx.doi.org/10.1186/1556-276X-8-195
[7] S. V. Prylutska, A. P. Burlaka, Y. I. Prylutskyy, U.
Ritter and P. Scharff, “Pristine C(60) fullerenes inhibit
the rate of tumor growth and metastasis”, Exp Oncol
33(3), 162-164 (2011).
[8] C. Chen, G. Xing, J. Wang, Y. Zhao, B. Li, J. Tang,
G. Jia, T. Wang, J. Sun, L. Xing, H. Yuan, Y. Gao,
H. Meng, Z. Chen, F. Zhao, Z. Chai and X. Fang,
“Multihydroxylated [Gd@C82 (OH)22 ]n nanoparticles:
Antineoplastic activity of high efficiency and low toxi-
Conclusions
The in vitro study of fullerene derivative C60 + on the
ability of HT-29 cells to migrate and invade, events that
mimic important steps of the process of metastasis formation, showed promising effects. The compound, in
fact, inhibited the capacity of HT-29 cells to re-adhere,
to migrate and to invade and these effects were, at least
in part, associated with the decrease of the gelatinolytic
activity of the treated cells. The treated HT-29 cells
did not present significant differences in the adherence
process in presence of the various ECM substrates and
167
city”, Nano Lett. 5(10), 2050-2057 (2005). http://dx.
doi.org/10.1021/nl051624b
[18] S. Hernandez-Barrantes, M. Bernardo, M. Toth, and
R. Fridman, “Regulation of membrane type-matrix
metalloproteinases”, Semin. Cancer Biol. 12(2), 131138 (2002). http://dx.doi.org/10.1006/scbi.2001.
0421
[19] H. Sato, T. Takino, Y. Okada, J. Cao, A. Shinagawa,
E. Yamamoto, and M. Seiki, “A matrix metalloproteinase expressed on the surface of invasive tumour
cells”, Nature 370(6484), 61-65 (1994). http://dx.
doi.org/10.1038/370061a0
[20] A. Y. Strongin, B. L. Marmer, G. A. Grant and G. I.
Goldberg “Plasma membrane-dependent activation of
the 72-kDa type IV collagenase is prevented by complex formation with TIMP-2”, J. Biol. Chem. 268(19),
14033-14039 (1993).
[21] Q. Nguyen, F. Willenbrock, M. I. Cockett, M. O’Shea,
A. J. Docherty and G. Murphy, “Different domain
interactions are involved in the binding of tissue inhibitors of metalloproteinases to stromelysin-1 and
gelatinase A”, Biochem. 33(8), 2089-2095 (1994).
http://dx.doi.org/10.1021/bi00174a015
[22] M. Bernardo and R. Fridman, “TIMP-2 (tissue inhibitor of metalloproteinase-2) regulates MMP-2 (matrix metalloproteinase-2) activity in the extracellular environment after pro-MMP-2 activation by
MT1 (membrane type 1)-MMP”, Biochem. J. 374
(Pt3), 739-745 (2003). http://dx.doi.org/10.1042/
BJ20030557
[23] P. Vempati, E. D. Karagiannis and A. S. Popel
“A Biochemical Model of Matrix Metalloproteinase 9
Activation and Inhibition”, J. Biol. Chem. 282(52),
37585-37596 (2007). http://dx.doi.org/10.1074/
jbc.M611500200
[24] H. Kolkenbrock D. Orgel, A. Hecker-Kia, W Noack,
N. Ulbrich “The complex between a tissue inhibitor
of metalloproteinases (TIMP-2) and 72-kDa progelatinase is a metalloproteinase inhibitor”, Eur. J.
Biochem. 198(3), 775-781 (1991). http://dx.doi.
org/10.1111/j.1432-1033.1991.tb16080.x
[25] N. Fujimoto, R. V. Ward, T. Shinya, K. Iwata, Y.
Yamashita and T. Hayakawa, “Interaction between tissue inhibitor of metalloproteinases-2 and progelatinase
A: immunoreactivity analyses”, Biochem. J. 313 (Pt3),
827-833 (1996).
[9] M. Lucafò, S. Pacor, C. Fabbro, T. Da Ros, S. Zorzet,
M. Prato and G. Sava, “Study of a potential drug delivery system based on carbon nanoparticles: Effects
of fullerene derivatives in MCF7 mammary carcinoma
cells”, J. Nanopart. Res. 14, 1-13 (2012). http://dx.
doi.org/10.1007/s11051-012-0830-8
[10] M. Lucafò, M. Gerdol, A. Pallavicini, S. Pacor, S.
Zorzet, T. Da Ros, M. Prato and G. Sava, “Profiling the molecular mechanism of fullerene cytotoxicity on tumorcells by RNA-seq”, Toxicology 314(1),
183-192 (2013). http://dx.doi.org/10.1016/j.tox.
2013.10.001
[11] K. Kordatos, T. Da Ros, S. Bosi, E. Vazquez, M.
Bergamin, C. Cusan, F. Pellarini, V. Tomberli, B.
Baiti, D. Pantarotto, V. Georgakilas, G. Spalluto and
M. Prato, “Novel versatile fullerene synthons”, J. Org.
Chem. 66, 4915-4920 (2001). http://dx.doi.org/10.
1021/jo015608k
[12] A. Albini, Y. Iwamoto, H. K. Kleinman, G. R. Martin,
S. A. Aaronson, J. M. Kozlowski and R. N. McEwan,
“A rapid in vitro assay for quantitating the invasive
potential of tumor cells”, Cancer Res. 47(12), 3239-45
(1987).
[13] P. Provenzano and P. J. Keely, “Mechanical signaling through the cytoskeleton regulates cell proliferation by coordinated focal adhesion and Rho GTPase
signalling”, J. Cell Sci. 124 (Pt8), 1195-1205 (2001).
http://dx.doi.org/10.1242/jcs.067009
[14] F. G. Giancotti and E. Ruoslahti, “Integrin signaling”,
Science 285(5430), 1028-1032 (1999). http://dx.doi.
org/10.1126/science.285.5430.1028
[15] J. D. Hood and D. A. Cheresh, “Role of integrins in
cell invasion and migration”, Nature Rev. Cancer 2(2),
91-100 (2002). http://dx.doi.org/10.1038/nrc727
[16] F. Aoudjit and K. Vuori, “Integrin signaling in cancer cell survival and chemoresistance”, Chemother.
Res. Pract. 1-16 (2012). http://dx.doi.org/10.
1155/2012/283181
[17] M. Millard, S. Odde and N. Neamati, “Integrin targeted therapeutics”, Theranostics 1, 154-188 (2011).
http://dx.doi.org/10.7150/thno/v01p0154
168
Home
Search
Collections
Journals
About
Contact us
My IOPscience
Hydrophilic polymer coated monodispersed Fe3O4 nanostructures and their cytotoxicity
This content has been downloaded from IOPscience. Please scroll down to see the full text.
View the table of contents for this issue, or go to the journal homepage for more
Download details:
IP Address: 140.105.48.10
This content was downloaded on 22/04/2014 at 14:49
Please note that terms and conditions apply.
Hydrophilic polymer coated monodispersed Fe3O4
nanostructures and their cytotoxicity
S Rajesh Kumar1, Lucafò Marianna2, Sava Gianni2, A Joseph Nathanael3,4,
S I Hong3, Tae Hwan Oh4, D Mangalaraj1, C Viswanathan1 and
N Ponpandian1
1
Department of Nanoscience and Technology, Bharathiar University, Coimbatore 641 046,
India
2
Department of Life Sciences, University of Trieste, Italy
3
Department of Nanomaterials Engineering, Chungnam National University, Daejeon 305-764,
Korea
4
Department of Nano, Medical and Polymer materials, Yeungnam University, Gyeongsan,
Korea
E-mail: ponpandian@buc.edu.in
Received 17 October 2013, revised 12 December 2013
Accepted for publication 12 December 2013
Published 30 January 2014
Materials Research Express 1 (2014) 015015
doi:10.1088/2053-1591/1/1/015015
Abstract
Surface functionalized monodispersed Fe3O4 magnetic nanoparticles were synthesized by the polyol method. Surfactants were used to control size, shape and
agglomeration of the magnetic nanoparticles during the preparation. The size of
these nanoparticles was in the range of 10–30 nm as observed in transmission
electron microscopy (TEM). The formation of monodispersed shapes was
controlled by varying the surfactants without changing the reaction conditions.
The x-ray diffraction (XRD) pattern validates the phase purity and cubic
structure even after the addition of surfactants. The functional groups were
observed from Fourier transform infrared (FTIR) spectroscopy analysis, confirming the surface modification with polymer molecules in the polyol medium.
The saturation magnetization value decreases from 89 to 59 emu g−1 for the
surfactant coated Fe3O4 nanoparticles and it also shows superparamagnetic
behavior at room temperature. Cell viability rate and percentage of dead cells
were accurately identified in human breast carcinoma cell lines using in vitro cell
viability experiments, which confirms that pristine and surfactant coated Fe3O4
nanoparticles are non-toxic and can be used for biomedical applications.
Keywords: nanoparticles, nanostructure, magnetic materials, superparamagnetism, biomaterials
Materials Research Express 1 (2014) 015015
2053-1591/14/015015+15$33.00
© 2014 IOP Publishing Ltd
Mater. Res. Express 1 (2014) 015015
S R Kumar et al
1. Introduction
In recent years functionalized magnetic nanoparticles have attracted great interest because of
their useful surface and magnetic properties, chemical stability and decreased toxicity [1].
Magnetic nanoparticles have potential biological applications such as in drug delivery, tissue
repair, magnetic resonance imaging (MRI), magnetic hyperthermia, water treatment etc [2],
which require the spherical shaped monodispersed superparamagnetic nanoparticles to have a
size of less than 50 nm [3]. Preparing these smaller-sized and agglomeration-free magnetic
nanoparticles with high colloidal stability is a challenging requirement for the synthesis
methodology [4]. But the inclusion of surfactants influences the formation of monodispersed
magnetic nanoparticles, and furthermore it avoids the surface oxidation and phase
transformations during the synthesis process [5]. Most importantly, the interaction of surfactant
coated Fe3O4 nanoparticles must be stable in the biomolecules with superior magnetic response
during targeted delivery. Hence, the surfactant has to play a significant role in the magnetic
nanoparticles to conjugate the drugs and to interact with the targeted molecules.
Polymer coating can reduce aggregation and improve the colloidal stability of magnetic
nanoparticles [4]. Amongst many polymers, polyethylene glycol (PEG) acts as both structure
directing and stabilizing agent during the preparation of Fe3O4 nanoparticles and enables the
growth of monodispersed particles [6]. But, the mixed surfactants containing PEG and crosslinked starch coated Fe3O4 nanoparticles produces agglomerated nanoparticles with a diameter
of 100 nm [7]. Similarly, the addition of polyvinyl pyrrolidone (PVP) leads to the formation of
spherical magnetic nanoparticles with high stabilization, which can be used for MRI contrast
agents [8]. PVP enables the oriented assembly of Fe3O4 primary nanoparticles due to the
change in surface energy [9] and it acts like a space block to form spherical aggregations.
Therefore, many PEG and PVP bonded superparamagnetic nanoparticles were prepared for safe
biological applications. Also, these polymers have been used to change the intrinsic properties
of magnetic nanoparticles such as size, surface charge, reactivity, water dispersiblity and biodistribution. Similarly, hexamine is also used to synthesize magnetic nanoparticles with uniform
shape and good size distribution. Hexamine is a chemically inert, cost effective, non-ionic
tertiary amine derivative. It is a stable and very good structure directing agent that can prevent
aggregation [10].
Numerous methods are available for the preparation of monodispersed ultra-fine magnetic
nanoparticles. Among them, the most common methods used are co-precipitation, microemulsion, oxidation, hydrothermal, solvothermal, sol-gel and thermal decomposition [11–15]. In this
study monodispersed magnetic nanoparticles were synthesized by the polyol method, which has
the capability to form particles of a very small size and with a narrow size distribution when
compared to other methods. This method encourages the preparation of spherical nanoparticles
by prohibiting agglomeration and also it allows the preparation of metal nanoparticles with a
spherical shape such as Co, Ni and FePt [16–18]. Moreover, it is a suitable technique for the
large scale synthesis of superparamagnetic Fe3O4 nanoparticles with high saturation
magnetization. Aggregation can also be minimized using high boiling point solvents.
Generally, ethylene glycol (EG) is used as a solvent and reducing agent for the preparation
of monodispersed Fe3O4 nanoparticles in the polyol process, because it behaves as a solvent at
low temperature and it acts as a strong reducing agent for the formation of magnetic
nanoparticles at boiling point [19].
2
S R Kumar et al
The present study reports the polyol synthesis of monodispersed Fe3O4 nanostructures,
with ethylene glycol as a solvent which also acts as reducing agent. Hexamine, PVP K-30 and
PEG-4000 were used as a surfactant to limit the agglomeration that enhances the uniformity in
size as well as the shape of the nanoparticles. The amine functionalized Fe3O4 nanoparticles
have a strong binding affinity on the surface when compared to polymers. Hence, the amine
functionalization leads to the formation of ultra-small monodispersed nanospheres with strong
coordination between metal oxide and hexamine. The possible cytotoxicity of these complexes
for eukaryotic cells has been studied with neutral red uptake and propidium iodide assays
besides the MTT assay.
2. Experimental section
2.1. Synthesis of polymer coated Fe3O4 nanoparticles
The amine and polymer encapsulated Fe3O4 magnetic nanoparticles were synthesized using the
polyol process at high temperature. Ferric chloride (FeCl3. 6H2O), hexamine, polyethylene
glycol-4000 (PEG-4000), polyvinyl pyrrolidone K-30 (PVP), potassium hydroxide, ethanol and
ethylene glycol were used as starting materials, which are of AR grade without further
purification. A typical synthesis process started with the vigorous stirring of 2 mmol of FeCl3
dissolved in 50 mL of ethylene glycol. The 4 mmol of KOH in 50 mL of ethylene glycol
solution is added to the mixture and stirred continuously to make an homogeneous solution with
continuous flow of Ar gas for 20 min at room temperature. The Ar gas flows during the reaction
were used to avoid oxidation and the formation of Fe2O3. The required amount of hexamine/
polymer was added to the above homogeneous solution and it was again stirred and heated at
210 °C for eight hours. The heating and stirring rates were maintained uniformly throughout the
course of the reaction to achieve the controlled and uniform growth of the magnetic
nanoparticles. After the reactions were completed, the solution was allowed to cool down to
room temperature and the nanoparticles were allowed to settle down at the bottom of the vessel.
The upper layer of the supernatant liquid was decanted and the resulting black precipitates were
carefully transferred into a beaker. It was washed several times with distilled water and ultrasonicated to separate the fine particles from the little agglomeration. Finally, these materials
were washed with ethanol for removing the impurities present and dried at 60 °C in a vacuum
overnight before further characterization.
2.2. Characterization of nanoparticles
The crystal structure and phase purity of the synthesized magnetic nanoparticles were
established by powder x-ray diffraction (XRD) analysis data carried out on a PANanalytical
X’Pert Pro MPD by using CuKα1 radiation. The functional groups were identified by Fourier
transformed infrared (FTIR) spectra recorded using a Nicolet 6700 in transmission mode in the
range 4000–400 cm−1 using the KBr pellet method. The morphology of the nanostructures were
studied using a transmission electron microscope (TEM, Hitachi H600) operating at 80 kV, and
a high resolution transmission electron microscope (HRTEM, JEOL) with an accelerating
voltage of 200 kV. The magnetic properties were studied by using a vibrating sample
magnetometer (VSM, EV X) at room temperature.
3
S R Kumar et al
2.3. Cell culture
The human breast carcinoma cell line MCF-7 was obtained from the European collection of cell
cultures (ECACC 86012803). It was maintained in Dulbecco’s modified Eagle’s medium
(DMEM) supplemented with 10% fetal bovine serum (FBS), 100 IU ml−1 penicillin,
100 μg ml−1 streptomycin, and 2 mM L-Glutamine. All the cells were grown at 37 °C under
an atmosphere of 95% air and 5% CO2 in a humidified incubator. These MCF-7 cells were
seeded in cell culture flasks (75 cm2; ~1 × 106 cells) and grown to 80% confluence at 37 °C in a
humidified 5% CO2 medium. They were harvested by trypsinization and plated at
approximately 1.5 × 104 per well into 96-well culture plates. After 24 h of incubation, different
concentrations of nanoparticles (5, 10, 15, 25 and 50 μg ml−1) were dissolved in the culture
medium and then added to each well. The samples were incubated for 72 h at 37 °C in the
humidified 5% CO2 atmosphere. Finally, the dead cells percentage was evaluated by using a
fluorescence microplate reader.
2.4. Cell viability determination using MTT, PI and NRU proliferation assays
The colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) assay
gives information about cell viability. 20 μl stock MTT (5 mg ml−1) was added to each well and
the cells were then incubated for four hours at 37 °C. Cells are lysed with 0.04 N isopropanol
with HCl solution. Absorbance was measured at 540 nm and 630 nm using a microplate reader
(Automated Microplate Reader EL311, BIO-TEK® Instruments, Vermont, USA). All the
measurements were made in six replicates and an experiment in triplicate was carried out.
The neutral red uptake (NRU) assay was used to measure the cell viability rate. Briefly,
cells were exposed to nanoparticles in the concentration range of 5 and 50 μg ml−1 for 72 h.
After the exposure time, the medium was aspirated and cells were washed twice with PBS and
incubated for 4 h in a medium supplemented with neutral red (0.33%). The medium was
washed off rapidly with a solution containing 0.5% formaldehyde and 0.1% calcium chloride.
The cells were subjected to further incubation of ten minutes at room temperature in a mixture
of acetic acid (1%) and ethanol (50%) to extract the dye, and the absorbance was read at 540 nm
on the micro-plate reader. The values were compared with the control set run under identical
conditions.
Propidium iodide (PI) (Sigma) was used to detect the percentage of dead cells. The cells
were seeded with 1.0 × 104 per well in 96 well plates. After 24 h of incubation the cells were
grown to 85% confluence before exposure to nanoparticles. The four compounds dissolved in
DMEM media were added to the wells at a concentration of 5, 10, 15, 25 and 50 μg ml−1 and
then incubated at 37 °C for 72 h. After incubation, the media was removed gently and diluted in
warm PBS for 20 min at room temperature. The cells were treated with 70% ethanol solution
were used as positive controls. Plates were read at 490–630 nm by a micro-plate fluorometer,
FLUORO COUNT (Packard Instrument Company, Meriden, USA).
3. Results and discussion
3.1. Structural analysis
The crystal structure and phase purity of the prepared iron oxide nanoparticles were identified
by measuring the XRD pattern as shown in figures 1(a)–(d) for the pristine, hexamine, PEG and
4
S R Kumar et al
Figure 1. XRD pattern for the nanostructured Fe3O4 (a) pristine and surface modified
with (b) hexamine, (c) PEG and (d) PVP.
PVP coated Fe3O4 nanoparticles. All the XRD peaks were well indexed with face centered
cubic (fcc) spinel structure corresponding to Fe3O4 nanoparticles. The peak broadening of the
XRD pattern is clear evidence for the formation of ultra small nanocrystals. The intensity of the
diffraction peak of (311) plane is stronger than the other peaks. The average crystal size
estimated from this peak using the Scherrer formula is 28 nm for the pure magnetite
nanoparticles. A slight decrease in the crystal size was estimated with the addition of surfactants
such as hexamine, and polymers in the range from 28 nm to 19 nm were observed. The
calculated cell volume, x-ray density and lattice parameters are similar to the data of the
International Centre for Diffraction Data [JCPDS#:89-3854]. These results confirm that the
amine functionalized and polymer coated magnetite nanoparticles do not stimulate any phase
transition, the phenomenon that ensures the high purity of the prepared materials. However, the
polymer coated magnetic nanoparticles show broadened XRD peaks without any peak shift
when compared to pure Fe3O4 nanoparticles for the reduction in crystal size and the sharpness
supports the high degree of crystallinity. The smaller variation in the lattice constants compared
to its bulk counterparts may be due to the partial oxidizations during the polyol process [20].
The FTIR spectra of pure and surfactant coated Fe3O4 nanoparticles were analyzed in the
range of 400–4000 cm−1 and are shown in figures 2(a)–(d). The FTIR spectrum of pristine
Fe3O4 in figure 2(a) shows the broad and strong absorption peak at 574 cm−1 that reveals the
presence of an Fe-O bond of Fe3O4 nanoparticles. A broad peak at 3405 cm−1 represents the OH stretching vibration with the presence of water molecules. No other extra peaks were
observed and this confirms the high purity of uncoated magnetic nanoparticles. Figure 2(b)
corresponds to the FTIR spectrum of hexamine functionalized Fe3O4 nanoparticles. The
characteristic peaks at 1074 cm−1 and 1638 cm−1 correspond to C-N stretching vibration and NH deformation vibration modes attributed to the characteristic frequencies of residual organic
materials. The broad peak at 1074 cm−1 supports the presence of tertiary amines of hexamine
molecules which do not undergo degradation at high temperature [10]. Also, the above
mentioned two peaks confirm the presence of hexamine molecules on the surface of magnetic
nanoparticles. In figure 2(c), the peak at 1040 cm−1 represents the stretching vibration of the C5
S R Kumar et al
Figure 2. FTIR spectra for the Fe3O4 (a) pristine and the surface modified with (b)
hexamine, (c) PEG and (d) PVP.
O-C group which confirms the appearance of a PEG molecule on the surface of Fe3O4
nanoparticles and this observation is well matched with the previously reported value [21]. It
further confirms the modification of the surface on magnetite nanoparticles by hydrophilic
molecules which facilitate the anisotropic crystal growth. In PVP coated magnetic
nanoparticles, the peak at 862 cm−1 represents the CH2 rocking vibration and another peak at
1047 cm−1 corresponds to the C-H stretching vibration mode which demonstrates the coating
effect of the PVP molecule on the surface of the Fe3O4 nanoparticles in figure 2(d) and the
values match well with the existing values [22]. The sharp characteristic peak at 1624 cm−1
obtained from the stretching vibration of C=O corresponds to a strong bond between the PVP
molecules and the Fe3O4 nanoparticles. The intense peak at 1682 cm−1 shifted to 1624 cm−1 is
due to the red shift in C=O stretching vibrations. The reduction in electron density is
responsible for this shift and it leads to a stronger interaction between PVP and Fe3O4
nanoparticles. In all four samples, the broad peak at 3400–3450 cm−1 belongs to the O-H
stretching vibration of hydroxyl groups, which concludes the higher hydrophilic nature of the
surface of Fe3O4 nanoparticles. The slight shifts in the Fe-O bond are in the range
480–590 cm−1 and were obtained in amine and polymer coated magnetic nanoparticles. This
may be due to the hexamine or to the polymers binding to the nanoparticles and the stabilization
through some physical interaction on the surface of Fe3O4. These results confirm the successful
wrapping of hexamine and of the polymers on the surface of the Fe3O4 nanoparticles.
3.2. Morphological analysis
The micro-structural features of the magnetite nanoparticles were studied using both TEM and
HRTEM. Figure 3 shows the TEM images of pure and surfactant coated Fe3O4 nanoparticles.
The TEM image of pure Fe3O4 in figure 3(a) consists of high quality polyhedral nanocrystals
with a few tiny nanoparticles. The size and shape of these nanocrystals are not uniform and are
a variety of shapes, such as spherical, cubic, polyhedric, hexagonal, triangular etc, and the
largest particles have a diameter of less than 25 nm. Figure 3(b) represents the histogram of the
6
S R Kumar et al
Figure 3. TEM images and histograms of Fe3O4 magnetic nanostructures for (a, b)
pristine and the surface modified with (c, d) hexamine, (e, f) PEG and (g, h) PVP.
Fe3O4 nanoparticles with an average particle size of 24 nm, calculated from more than one
hundred particles. The surface smoothness can be attributed to the uniform arrangement of the
lattice points without any lattice imperfection.
Figures 3(c) and (d) show the TEM image and histogram of the hexamine functionalized
magnetite nanoparticles with a uniform distribution of spherical shape and average size
calculated as 21 nm. The particles are well separated from the controlled nucleation, growth and
crystal orientation of the magnetic nanoparticles. The non-covalent bond between the amine and
the surface of the magnetite nanoparticles are important to obtain the colloidal stability, which is
useful for biodegradability. Also, the amine terminated Fe3O4 nanoparticles have the best
binding ability when compared with other functional groups, [23] and the functionalization
controls the growth of the smaller and spherical nanoparticles. In addition, the hexamine
molecules on the surface of Fe3O4 act as a soft template to enhance the reaction rate for fine
orientation as well as the formation of individual spherical nanoparticles due to controlled
magnetic dipole-dipole interaction. It was found to be the primary driving force responsible for
reducing the surface energy and enhancing the formation of monodispersed spherically shaped
nanoparticles.
The TEM image and the histogram of PEG coated Fe3O4 magnetic nanoparticles in
figures 3(e) and (f) also shows the monodispersed spherical nanoparticles are around 25 nm in
size. The slight increase in the particle size may be due to the high chemisorptions of PEG
molecules. Larger narrow spherical nanoparticles were obtained at the expense of smaller
particles by the Ostwald ripening process. The kinetics of crystal growth leads to the uniform
distribution of agglomeration free nanoparticles [24]. When the particles exceed their critical
size, the PEG molecules act as shape controlling agents but also as stabilizing agents to control
the growth of the magnetic nanoparticles. The micrograph of PVP coated magnetite
nanoparticles in figures 3(g) and (h) show an exceptionally agglomerated morphology with
7
S R Kumar et al
Figure 4. HRTEM image and Fast Fourier transform (FFT) pattern of lattice fringes for
nanostructured Fe3O4 for (a, b) pristine and coated with (c, d) hexamine, (e, f) PEG and
(g, h) PVP.
an average size of 14 nm. This may be due to the PVP molecule adsorbed on the particular
crystallographic facets of Fe3O4 nanoparticles due to surfactant [9]. However, the PVP
molecule bridges the surface of Fe3O4 nanoparticles [25] and reduces the surface energy of the
system due to strong inter-particle attractive forces (i.e. Van der Waals forces) on the magnetic
nanoparticles at higher temperatures. The PVPs play an important role in the aggregation via a
self assembly process and it cannot break the balance between the individual particles due to the
higher surfactant energy on the surface of Fe3O4 nanoparticles. Similarly, the mesoporous silica
nanoparticles are aggregated due to the existence of protein or lipid layers [26]. The reaction
rate and diffusion of Fe3+ ions decreases considerably between polyol media with the addition
of PVP and it leads to the aggregation of small spherical nanoparticles.
The HRTEM image in figure 4(a) for the cubic Fe3O4 shows a defect free surface. It
clearly indicates the well aligned and single crystalline structure with the d spacing of 0.258 nm
and 0.293 nm corresponding to (220) and (311) planes [27]. Thus, the HRTEM image of
pristine Fe3O4 shows the dissimilar shape of crystal growth to facilitate the nanoparticles to be
free from the preferred orientation due to a different lattice arrangement. Without adding the
surfactants like polymers or amines, the Fe nuclei in the magnetite nanoparticles try to assemble
in different orientations. The hexamine functionalized magnetite nanoparticles show a single
crystalline structure and the measured lattice fringe distance corresponds to the d spacing of the
(311) plane of Fe3O4 nanoparticles, and it also confirm the fcc inverse spinel structure of Fe3O4
as shown in figure 4(c). Consequently, the hexamine is selectively adsorbed on the (111) facet
to reduce its surface energy and to avoid the aggregation of magnetic nanoparticles. Therefore
the (311) plane direction of Fe3O4 crystals may exhibit a higher activity of crystal growth to
generate monodispersed spherical nanoparticles within electrostatic interaction. Accordingly,
the PEG coated nanoparticles in figure 4(e) represents the growth of bigger spherical
8
S R Kumar et al
nanoparticles and the top plane corresponds to the (111) direction, exhibiting clear lattice
fringes which shows their high crystalline nature without agglomeration. Thus, the surfactant
PEG is bound on the surface of magnetic nanoparticles for the formation of monodispersed
spherical nanoparticles and slows down the growth rate along this direction to form bigger
nanoparticles. Similarly, the PVP coated magnetite nanoparticles also show parallel fringes with
the d spacing of 0.258 nm corresponding to the crystal plane of the (311) direction. It is clearly
visible with the size of 10 nm as shown in figure 4(g). Therefore, PVP coated magnetite
nanoparticles demonstrate the close packed structure to form agglomeration with small
molecules of Fe atoms.
HRTEM results are compared with fast Fourier transform (FFT) data as shown in
figures 4(b), (d), (f) and (h), and indexed as (311), (511) and (440) planes of cubic Fe3O4
nanoparticles. The set of spots with the highest contrast could be indexed to (311) reflection,
indicating the assembled spherical magnetic nanoparticles with a good single crystalline shape
with a {111} basal plane. The XRD analysis also indicates the same cubic Fe3O4 nanoparticles,
supporting the role of the amine and polymer molecules to control the growth direction along
the (311) plane on the surface of the magnetite nanoparticles. The observed uniform and well
oriented spots in the FFT supports the good resolution of the monodispersed spherical
nanoparticles, having the same orientation due to sub-unit particles assembling to form single
crystalline Fe3O4 structures. These results confirm the important role of amine and polymers
that leads to the formation of small and large spherical nanocrystals via self-assembly. Time and
temperature were constant in all the reported experiments and cannot be claimed responsible for
the shape and size.
3.3. Formation mechanism
The possible reaction equation for the formation of Fe3O4 nanoparticles is given below:
Fe3+
OH
HO Fe OH
3OH-
Fe(OH)3
2Fe(OH)3
Fe(OH)2
OH
Fe O
H2O
Fe3O4
4H2O
Initially, the Fe3+ ions react with ethylene glycol to form iron hydroxide with the addition
of KOH at room temperature. The ethylene glycol acts both as solvent and reducing agent,
which plays an important role in the formation of magnetite. Potassium hydroxide is used as an
alkali medium to induce the reaction and make a deprotonation to reduce Fe2+ and Fe3+ ions
[28]. Finally, the iron hydroxides are converted into Fe3O4 at 210 °C with continuous flow of
Ar gas during the polyol process.
The schematic illustration for the plausible growth mechanisms of spherical Fe3O4
nanoparticles prepared with different polymers is shown in figure 5. The pristine Fe3O4
nanoparticles were formed with sharp edges and smooth surfaces of multiple shapes. However,
random growth of the crystal seeds due to fast nucleation of Fe ions with the addition of KOH is
responsible for the formation of multiple shapes of nanoparticles. Also, the lowest surface
energy at equilibrium produces agglomeration free Fe3O4 nanoparticles. The addition of
hexamine in pristine Fe3O4 nanoparticles provides the uniform distribution of spherical
9
S R Kumar et al
Figure 5. Schematic illustration for the proposed formation mechanism of Fe3O4
nanoparticles.
nanoparticles due to adsorption of chemical species that dramatically impinge on the surface
energies. Hence, hexamine controls the growth of magnetic nanoparticles due to its strong
electrostatic force [29] and prevents the aggregation with adjacent nanoparticles. Moreover, the
amine molecule converts the surface from hydrophobic to hydrophilic, facilitating water
solubility and target binding. Similarly, the addition of PEG contributes to the larger spherical
shape of the magnetic nanoparticles. Here, PEG acts as surface capping agent to increase the
size to 30 nm. Thus, PEG covers the surface of the Fe3O4 nanoparticles and controls the growth
of particles, stabilizing the reaction system due to effective confinement of their random
Brownian motion [30]. The steric repulsive force minimizes the agglomeration and produces
the uniform size of the resulting particles [31]. In contrast, non-uniform distribution of pure
Fe3O4 nanoparticles is converted into the uniform spherical nanoparticles, solely by changing
the concentration of Fe3+ ions under the confinement of surfactant molecules. The PVP coated
Fe3O4 nanoparticles show agglomerated spherical particles due to the high chemisorption on the
surface of magnetic nanoparticles. Also, the PVP acts as a mortar to hold the individual
magnetic nanoparticles to agglomerate via hydrogen bond. A constant temperature is
maintained in all these experiments and thereby, the metal ions nucleate at crystal planes,
closely packed in three dimensions to form a smooth surface of spherical nanoparticles, or selfassembly. The homogeneous distribution of spherical Fe3O4 magnetic nanoparticles was
obtained by minimizing the interfacial energy on the surface of nanoparticles by using polymers
or amines.
3.4. Magnetic measurements
The magnetic properties of the Fe3O4 and surface modified Fe3O4 nanoparticles were studied by
recording the hysteresis loop using a vibrating sample magnetometer at room temperature with
an applied magnetic field of 2T. Figure 6 shows the hysteresis loops for the pure and surfactant
coated Fe3O4 nanoparticles normalized with the sample weight. It shows the reversible
10
S R Kumar et al
Figure 6. Room temperature magnetic hysteresis loops for the nanostructured Fe3O4 for
(a) pristine and the surface modified with (b) hexamine, (c) PEG and (d) PVP.
hysteresis as expected for superparamagnetic nanoparticles with zero remanence and coercivity,
and it shows that the domain size of the spherical nanoparticles is smaller than single domain
size. The superparamagnetism occurs barely when the thermal energy exceeds the volume
energy and randomized magnetic moment. The saturation magnetization of the uncoated Fe3O4
nanoparticles has 89 emu g−1, which is close to the bulk value of 92 emu g−1 [32]. The
hexamine and polymer coated magnetic nanoparticles show a small decrease in the
magnetization values such as 59, 60 and 62 emu g−1. This reduction in magnetization may
be due to the formation of surface dead layers that produce a shielding effect, reducing the
energy of the spin moment compared to pure Fe3O4 nanoparticles [33]. The electron exchange
between surface atoms and polymer ligands also influences the changes in the saturation
magnetization with the influence of applied magnetic field. Moreover, the surface spin canting
effect on the surface of the nanoparticles might also reduce the total magnetic moment of the
nanoparticles. Therefore, all these effects may influence the decrease in the saturation
magnetization of the magnetite nanoparticles. These results confirm that the change in magnetic
properties strongly depends on the size, shape and surface effect of the nanoparticles.
3.5. In vitro toxicity studies
The cytotoxicity of pristine and surfactant coated magnetic nanoparticles for MCF-7 cells was
studied with the MTT assay, neutral red uptake and propidium assay after the cells were
exposed to the complete medium for 72 h (figures 7 and 8). Figure 7 shows the concentration
dependent cytotoxic effects of magnetic nanoparticles in the concentration range of
5–50 μg ml−1 for the MTT assay. Generally, MCF-7 cells exposed to the low concentrations
of 5–10 μg ml−1 show no significant reduction of their metabolic activity. Increasing the
11
S R Kumar et al
Figure 7. Cytotoxicity of Fe3O4 nanoparticles (a) pristine, coated with (b) hexamine, (c)
PEG and (d) PVP at different concentrations (exposure time 72 h). Results are mean
values ±SEM from six independent experiments; (***) p < 0.001 versus control,
Student-Newman-Keuls Multiple Comparisons Test, ANOVA.
Figure 8. PI uptake in human MCF7 cells exposed for 72 h for Fe3O4 (a) pristine,
coated with (b) hexamine, (c) PEG and (d) PVP at different concentrations of
nanoparticles. Ctrl −(negative control): cells not exposed to nanoparticles without
addition of ethanol 70%; Ctrl +(positive control): cells not exposed to nanoparticles plus
ethanol 70%. Independent experiments performed in triplicate.
concentration of 15–50 μg ml−1 causes a weak reduction of mitochondrial function that induces
a mild cytotoxicity to MCF-7 cells. The surface modified Fe3O4 nanoparticles had good
biocompatibility when compared to those of pristine nanoparticles like the results obtained for
mesoporous silica nanoparticles [34, 35]. Therefore, the percentage of inhibition of
mitochondrial activity observed in surfactant coated nanoparticles is due to the cell adhesive
12
S R Kumar et al
interactions of the nanoparticles. Our results confirm that superparamagnetic Fe3O4
nanoparticles cause low cytotoxicity due to their monodispersed shape and surface properties.
The study of cell cytotoxicity using the MTT assay was sometimes reported to interfere
with the relevant measures, when using various nanoparticles, leading to misleading data [36].
Therefore, the neutral red uptake (NRU) assay system is a means of measuring living cells via
the uptake of the vital dye neutral red. An increase or decrease in the number of cells or their
physiological state results in a concomitant change in the amount of dye incorporated by the
cells in the culture. This indicates the degree of cytotoxicity caused by the magnetic
nanoparticles. The results of NRU do not exhibit a concentration dependent decline in the
survival of cells exposed for 72 h to the magnetic nanoparticles. Untreated and treated cells
incorporate the same amount of dye revealing that no nanoparticles are toxic (data not shown).
The results obtained with NRU further confirmed, by the study of cell cytotoxicity with a
complementary assay called the propidium iodide (PI) assay. It was commonly used for
identifying dead cells because it can penetrate only in dead cell membranes. Under the same
conditions used in the previous tests (MTT and NRU), no evidence of induction of necrotic
events (PI assay) was found, as in figure 8. Detection of PI fluorescent is an index of the
presence of necrotic cells since PI binds to DNA and RNA by intercalating between the bases
with little or no sequence preference. Again these results indicate the absence of cytotoxicity for
the tested nanomaterials which indicates there is a relative safety for living cells. These data
strongly confirm the importance of verifying the cytotoxicity data with at least two or more
independent test systems for these nanomaterials.
4. Conclusions
The amine functionalized monodispersed iron oxide nanoparticles were successfully
synthesized by the polyol method with high saturation magnetization and their cytotoxicity
evaluated. The morphological studies by TEM confirm the surface modified magnetic
nanoparticles prevent agglomeration and it forms ultra-small nanospheres with a size range of
10–30 nm. Correspondingly, HRTEM and FFT pattern analysis further verify the single
crystallinity of the nanoparticles. The formation mechanism reveals that the amine, PEG and
PVP plays an important role to produce a monodispersed spherical shape when compared to
pristine magnetic nanoparticles. Furthermore, the room temperature magnetization studies
confirm the superparamagnetic behavior. A comparative cytotoxicity study carried out using
different assays of MCF-7 cell lines validates that the surface modified magnetic nanoparticles
are less toxic compared to pristine nanoparticles. Thus, the magnetic nanoparticles with uniform
size and shape with improved surface properties dramatically influences the biological activity.
Also, the in vitro analysis strongly confirms the non-toxic nature of the developed
nanoparticles. The nanoparticles can be used as a potential drug carrier for future applications.
Acknowledgements
The authors would like to thank DST-SERB for the financial support under the FAST TRACK
Young Scientist Scheme (SR/FTP/PS-102/2009). Also, the author SRK would like to thank the
DST-PURSE program (BU/DST PURSE PROG./APPT./22) for providing a fellowship to carry
out this work.
13
S R Kumar et al
References
[1] Xiao L et al 2011 Water-soluble superparamagnetic magnetite nanoparticles with biocompatible coating for
enhanced magnetic resonance imaging ACS Nano. 5 6315–24
[2] Chaudhuri R G and Paria S 2012 Core/shell nanoparticles: classes, properties, synthesis mechanisms,
characterization, and applications Chem. Rev. 112 2373–433
[3] Hai H T, Kura H, Takahashi M and Ogawa T 2010 Facile synthesis of Fe3O4 nanoparticles by reduction
phase transformation from γ-Fe2O3 nanoparticles in organic solvent Journal of Colloid Interface Science.
341 194–9
[4] Reddy L H, Arias J L, Nicolas J and Couvreur P 2012 Magnetic nanoparticles: design and characterization,
toxicity and biocompatibility, pharmaceutical and biomedical applications Chem. Rev. 112 5818−5878
[5] Huang C-C, Chuang K-Y, Chou C-P, Wu M-T, Sheu H-S, Shieh D-B, Tsai C-Y, Su C-H, Lei H-Y and
Yeh C-S 2011 Size-control synthesis of structure deficient truncated octahedral Fe3−δO4 nanoparticles:
high magnetization magnetite as effective hepatic contrast agents J. Mater. Chem. 21 7472–9
[6] Liu S, Han Y, Qiao R, Zeng J, Jia Q, Wang Y and Gao M 2010 Investigations on the interactions between
plasma proteins and magnetic iron oxide nanoparticles with different surface modifications J. Phys. Chem.
C 114 21270–6
[7] Cole A J, David A E, Wang J, Galban C J, Hill H L and Yang V C 2011 Polyethylene glycol modified crosslinked starch-coated iron oxide nanoparticles for enhanced magnetic tumor targeting Biomaterials 32
2183–93
[8] Arsalani1 N, Fattahi H and Nazarpoor M 2010 Synthesis and characterization of PVP-functionalized
superparamagnetic Fe3O4 nanoparticles as an MRI contrast agent eXPRESS Polymer Letters 4 329–38
[9] Zhang D-H, Li G-D, Li J-X and Chen J-S 2008 One-pot synthesis of Ag–Fe3O4 nanocomposite: a
magnetically recyclable and efficient catalyst for epoxidation of styrene Chem. Commun. 29 3414–6
[10] Sugunan A, Warad H C, Boman M and Dutta J 2006 Zinc oxide nanowires in chemical bath on seeded
substrates: role of hexamine J Sol-Gel SciTechn. 39 49–56
[11] Jiang W, Sun Z, Li F, Chen K, Liu T and Liu J 2011 A novel approach to preparing magnetic protein
microspheres with core-shell structure J. Magn. Magn. Mater. 323 435–9
[12] Iglesias-Silva E, Rivas J, Isidro L M L and Lopez-Quintela M A 2007 Synthesis of silver-coated magnetite
nanoparticles J. Non-Cryst. Solids 353 829–31
[13] Zou Z, Xuan A G, Yan Z G, Wu Y X and Li N 2010 Preparation of Fe3O4 particles from copper/iron ore
cinder and their microwave absorption properties Chemical Engineering Science 65 160–4
[14] Liang J, Li L, Luo M, Fang J and Hu Y 2010 Synthesis and properties of magnetite Fe3O4 via a simple
hydrothermal route Solid State Sciences 12 1422–5
[15] Yin Y, Zhou S, Min C and Wu L 2011 Preparation of rattle-type magnetic mesoporous carbon spheres and
their highly efficient adsorption and separation J. Colloid Interface Sci. 361 527–33
[16] Biao L, Jian-guo G, Qi W and Qing-jie Z 2005 Preparation of nanometer cobalt particles by polyol reduction
process and mechanism research Materials Transactions 46 1865–7
[17] Ying Z, Shengming J, Guanzhou Q and Min Y 2005 Preparation of ultrafine nickel powder by polyol method
and its oxidation product Materials Science and Engineering B 122 222–5
[18] Beck W, Souza C G S, Silva T L, Jafelicci M and Varanda L C 2011 Formation mechanism via a hetero
coagulation approach of Fept nanoparticles using the modified polyol process J. Phys. Chem. C 115
10475–82
[19] Zhan Y, Zhao R, Meng F, Lei Y, Zhong J, Yang X and Liu X 2011 Oriented growth of magnetite along the
carbon nanotubes via covalently bonded method in a simple solvothermal system Materials Science and
Engineering B 176 779–84
[20] Topfer J and Angermann A 2011 Nanocrystalline magnetite and Mn–Zn ferrite particles via the polyol
process: Synthesis and magnetic properties Materials Chemistry and Physics 129 337–42
14
S R Kumar et al
[21] Xie B J, Xu C, Kohler N, Hou Y and Sun S 2007 Controlled PEGylation of monodisperse Fe3O4
nanoparticles for reduced non-specific uptake by macrophage cells Adv. Mater. 19 3163–6
[22] Kayal S and Ramanujan R V 2010 Doxorubicin loaded PVA coated iron oxide nanoparticles for targeted drug
delivery Materials science and Engineering C 30 484–90
[23] Maltas E, Ozmen M, Vural H C, Yildiz S and Ersoz M 2011 Immobilization of albumin on magnetite
nanoparticles Materials letter 65 3499–501
[24] Wang X, Xi G, Liu Y and Qian Y 2008 Controllable synthesis of PbSe nanostructures and growth
mechanisms Crystal Growth & Design 8 1406–11
[25] Mahmoudia M, Simchi A, Imani M, Stroeve P and Sohrabi A 2010 Templated growth of superparamagnetic
iron oxide nanoparticles by temperature programming in the presence of poly(vinyl alcohol) Thin Solid
Films 518 4281–9
[26] Yang Y, Jia Y, Gao L, Fei J, Dai L, Zhao J and Li J 2011 Fabrication of auto fluorescent protein coated
mesoporous silica nanoparticles for biological application Chem. Commun. 47 12167–9
[27] Yang H, Zhang C, Shi X, Hu H, Du X, Fang Y, Ma Y, Wu H and Yang S 2010 Water-soluble
superparamagnetic manganese ferrite nanoparticles for magnetic resonance imaging Biomaterials 31
3667–73
[28] Qu H, Caruntu D, Liu H and O’ Connor C J 2011 Water-dispersible iron oxide magnetic nanoparticles with
versatile surface functionalities Langmuir 27 2271–8
[29] Xi G, Wang C and Wang X 2008 The oriented self-assembly of magnetic Fe3O4 nanoparticles into
monodisperse microspheres and their use as substrates in the formation of Fe3O4 nanorods Eur. J. Inorg.
Chem. 3 425–31
[30] Wang B, Wang B, Wei P, Wang X and Lou W 2012 Controlled synthesis and size-dependent thermal
conductivity of Fe3O4 magnetic nanofluids Dalton Trans. 41 896
[31] Pu Z, Cao M, Yang J, Huang K and Hu C 2006 Controlled synthesis and growth mechanism of hematite
nanorhombohedra, nanorods and nanocubes Nanotechnology 17 799–804
[32] Turcu R, Pana O, Nan A, Craciunescu I, Chauvet O and Payen C 2008 Polypyrrole coated magnetite
nanoparticles from water based nanofluids J. Phys. D: Appl. Phys. 41 245002
[33] Utkan G G, Sayar F, Batat P, Ide S, Kriechbaum M and Piskin E 2011 Synthesis and characterization of
nanomagnetite particles and their polymer coated forms Journal of Colloid Interface Science. 353 372–9
[34] Yang Y, Song W, Wang A, Zhu P, Fei J and Li J 2010 Lipid coated mesoporous silica nanoparticles as
photosensitive drug carriers Phys. Chem. Chem. Phys. 12 4418–22
[35] Yang Y, Yan X H, Cui Y, He Q, Li D X, Wang A H, Fei J B and Li J B 2008 Preparation of polymer-coated
mesoporous silica nanoparticles used as cellular imaging by ‘graft-from’ method. J. Mater. Chem. 18
5731–7
[36] Monteiro-Riviere N A, Inman A O and Zhang L W 2009 Limitations and relative utility of screening assays
to assess engineered nanoparticles toxicity in a human cell line Toxicology and Applied Pharmacology 234
222–35
15
CHEMMEDCHEM
FULL PAPERS
DOI: 10.1002/cmdc.201300501
Towards Matched Pairs of Porphyrin–ReI/99mTcI Conjugates
that Combine Photodynamic Activity with Fluorescence
and Radio Imaging
Teresa Gianferrara,[a] Cinzia Spagnul,[a] Roger Alberto,*[b] Gilles Gasser,[b] Stefano Ferrari,[c]
Vanessa Pierroz,[b, c] Alberta Bergamo,[d] and Enzo Alessio*[a]
We recently prepared two novel water soluble porphyrins
bearing a single peripheral chelator, either diethylenetriamine
(1) or bipyridyl (2), tethered to one meso position. The preparation of their conjugates with a fac-{99mTc(CO)3} + fragment and
the potential of these resulting conjugates as fluorescence and
radio imaging tools were also described. In this work, we focused on the corresponding non-radioactive analogues that
bear the fac-{Re(CO)3} + fragment (diethylenetriamine 3 and bipyridyl 4). We report on the uptake, in vitro PDT activity, and
cellular localization of ReI conjugates 3 and 4 in comparison to
the parent porphyrins 1 and 2. Compounds 1–4 have modest
or negligible cytotoxicity in the dark against HeLa human cervical cancer cells but become remarkably cytotoxic after exposure to moderate doses of red visible light (590–700 nm). This
phototoxicity was found to be directly proportional to the
total light dose. Although the four compounds show distinct
uptake patterns, they have comparable PDT activity. Confocal
fluorescence measurements showed that porphyrin 1 and its
ReI conjugate 3 have different cellular localization patterns in
HeLa cells.
Introduction
The development of new multifunctional agents that combine
different diagnostic imaging modalities in a single molecule[1, 2]
or both diagnostic and therapeutic functionalities (theranostic
agents),[3] is one of the major research goals in medicinal inorganic chemistry. As each imaging technique has its own distinctive features (particularly in terms of resolution and sensitivity), a clinical or biological problem is best investigated with
a multi-modality imaging probe. Affording exact co-localization
greatly simplifies and improves image interpretation. Different
strategies are being developed for the combined diagnosis
and treatment of several diseases, with an emphasis on
cancer.[4] In this respect, photodynamic therapy (PDT), a clinically approved medical technique involving visible light-induced
generation of cytotoxic singlet oxygen (1O2) from endogenous
3
O2, mediated by a photosensitizer (PS),[5–7] has great potential
for combination with other modalities.[8, 9]
[a] Dr. T. Gianferrara, Dr. C. Spagnul, Prof. Dr. E. Alessio
Department of Chemical & Pharmaceutical Sciences, University of Trieste
Via L. Giorgieri 1, 34127 Trieste (Italy)
E-mail: alessi@units.it
[b] Prof. Dr. R. Alberto, Prof. Dr. G. Gasser, V. Pierroz
Department of Chemistry, University of Zurich
Winterthurerstr. 190, 8057 Zurich (Switzerland)
E-mail: ariel@chem.uzh.ch
[c] S. Ferrari, V. Pierroz
Institute of Molecular Cancer Research, University of Zurich
Winterthurerstr. 190, 8057 Zurich (Switzerland)
[d] Dr. A. Bergamo
Callerio Foundation Onlus
Via A. Fleming 22-31, 34127 Trieste (Italy)
Supporting information for this article is available on the WWW under
http://dx.doi.org/10.1002/cmdc.201300501.
! 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Porphyrins—either natural or synthetic—are particularly attractive intrinsic bimodal photosensitizers, as they can be used
for both PDT activity and fluorescence imaging (and therefore,
image-guided phototherapy) by changing the irradiation conditions.[5, 6] Porphyrins have distinctive features that make them
unique for the development of imaging and therapy probes:
1) they are very chemically robust molecules with intense electronic absorptions in the visible region and relatively long fluorescence decay time with large Stokes shifts; 2) their chemistry
is well developed, both for synthesis and functionalization,
making them extremely versatile chemical scaffolds; 3) their
optical and redox properties can be fine-tuned by appropriate
peripheral modification and/or core metallation; and 4) they
have tumor-localizing properties, as they typically show preferential uptake and retention by tumor tissues.[5, 7] Indeed, most
of the clinical applications of PDT already involve porphyrins
and related chromophores (e.g. chlorins).[7] Fluorescence imaging, exploiting the strong emission of porphyrins, has excellent
resolution (down to the nanometer scale). This allows for localization of the compounds on the cellular or subcellular level,
and can provide real-time imaging. However, it has quite limited depth penetration (millimeters for visible light, centimeters
for near infrared), and is thus unsuitable for whole body imaging. Implementing an additional imaging modality in the same
molecule, capable of observing structures deep inside tissue,
enables us to overcome this limitation.
In this context, porphyrin–metal conjugates offer exciting
perspectives. The concept of attaching chelators for metal coordination to the periphery, rather than into the porphyrin
core, gives the possibility of site-specific and highly stable labeling without interference of the tetrapyrrolic system.[10, 11]
ChemMedChem 2014, 9, 1231 – 1237
1231
CHEMMEDCHEM
FULL PAPERS
Our research is focused on the design, synthesis, and evaluation of robust porphyrin–metal conjugates with g- or positronemitting radionuclides. Such architectures combined in
a single molecule have potential for PDT activity with both
fluorescence and radio imaging functionalities for in vitro and
in vivo applications. PET/SPECT and fluorescence imaging have
excellent complementarity in terms of sensitivity and applications.[12, 13] Radio imaging has limited resolution (millimeter
scale) but unlimited depth penetration, thus allowing whole
body imaging. In addition, it enables convenient quantification
of compound accumulation and pharmacokinetics after administration. In a plausible in vivo situation, whole body radio
imaging enables detection of a tumor, whereas fluorescence
techniques could subsequently provide further clinical support,
either through endoscopy or during surgery, by generating
fluorescence contrast at tumor borders and thus improving
the accuracy of resection.[5, 6] At the cellular level, fluorescence
provides additional valuable information on the biodistribution
and mechanism of action of the compound.
We recently reported the preparation and characterization
of two novel water-soluble porphyrins bearing a peripheral
chelator, either a diethylenetriamine (1) or a bipyridyl unit (2),
tethered to one meso position. Their conjugates with the fac{99mTc(CO)3} + fragment (3 a and 4 a, respectively), as well as the
corresponding nonradioactive analogues with fac-{Re(CO)3} + (3
and 4, respectively) (Figure 1), were also described.[14]
www.chemmedchem.org
Of note, Marzilli and co-workers recently described a symmetrical 1:4 porphyrin–Re conjugate in which each peripheral
fac-{Re(CO)3} + fragment is coordinated to a tridentate N-donor
moiety linked to the porphyrin meso positions.[15] The photophysical properties of these conjugates are excellent. However,
as not all four positions can be occupied by 99mTc at the same
time (dilution is too high), a homologue for radio imaging is
not accessible.
In this respect, conjugates 3/3 a and 4/4 a represent two unprecedented examples of the so-called matched pair strategy.[16, 17] As the coordination chemistry of TcI and ReI is very
similar, the two porphyrin conjugates in each matched pair are
expected to have close or identical physical and chemical
properties, including pharmacokinetics and biodistribution. In
addition, rhenium can be used as a model for 99mTc in order to
investigate coordination chemistry on nonradioactive (cold)
material. Here, we report on the uptake, in vitro PDT activity
against HeLa human cervical cancer cells, 1O2 quantum yields,
and the cellular localization of ReI conjugates 3 and 4, compared to the parent porphyrins 1 and 2.
Results and Discussion
Cellular uptake
The uptake of compounds 1–4 by HeLa cells, determined by
measuring the porphyrin luminescence emission after cell solubilization, is time- and concentration-dependent (Figure 2). At
0.1 mm and 1.0 mm concentrations, the uptake is low even
when cellular exposure is extended to 24 h. For concentrations
! 10 mm, some remarkable differences between the compounds can be observed. Porphyrin 1 is readily and effectively
taken up by cells, whereas the uptake of 2 is approximately
five- to six-times lower. Of note, conjugation to the Re fragment affects the uptake of 1 to a low extent (compounds
1 and 3, Figure 2) but induces a remarkable increase (ca. fourtimes) in the case of 2 (compounds 2 and 4, Figure 2). The two
porphyrin–Re conjugates also show different kinetics of cellular
uptake: whereas 3 is still actively taken up at 24 h, 4 attains
steady-state levels after 4–8 h.
Cytotoxicity and phototoxicity
Figure 1. Porphyrins 1 and 2 and their ReI conjugates (3 and 4, respectively).
The effects of compounds 1–4 on tumor cell growth were
evaluated both in the dark (cytotoxicity) and after irradiation
with red light (phototoxicity) (Table 1). HeLa cells were exposed
for 24 h to each compound at concentrations ranging from 0.1
to 100 mm. Subsequently, cells were irradiated at 590–700 nm
with a fluence rate of 9 mW cm"2 for increasing time intervals
corresponding to total light doses of 1 J cm"2, 5 J cm"2, or
10 J cm"2. Importantly, these light doses did not affect proliferation of untreated cells in control experiments (Supporting Information). Cell cytotoxicity was determined using the MTT
assay 24 h post-irradiation. Cells treated with the same concentrations of the test compounds but kept in the dark were used
as controls.
ChemMedChem 2014, 9, 1231 – 1237
1232
CHEMMEDCHEM
FULL PAPERS
www.chemmedchem.org
Figure 2. Time- and concentration-dependent uptake of a) porphyrin 1 (top left) and its Re conjugate 3 (top right), and b) porphyrin 2 (bottom left) and its
Re conjugate 4 (bottom right). Uptake was determined in HeLa cells at concentrations of 0.1 mm (&), 1.0 mm (~), 10 mm (*), and 100 mm (^). RFU = relative
fluorescence units. The scale in the lower part of the y-axis is amplified.
Table 1. Cytotoxicity of compounds 1–4 against HeLa human cervical
cancer cells treated for 24 h with test compound and then exposed to increasing doses of red light (590–700 nm).
Compd
dark
1
2
3
4
> 100
> 100
20.5 " 7.2
> 100
IC50 [mm]
1 J cm!2
2.0 " 1.3
> 100
10.9 " 2.7
41.1 "13.0
5 J cm!2
10 J cm!2
0.5 " 0.1
24.0 " 6.5
1.9 " 1.1
4.0 " 2.8
0.2 " 0.1
5.8 " 1.0
0.9 " 0.1
3.3 " 2.3
[a] Data represent the mean " SD of three independent experiments performed in quadruplicate.
Compounds 1–4 were not cytotoxic against HeLa cells in the
dark (IC50 values > 100 mm), with the exception of conjugate 3,
for which moderate cytotoxicity was found (IC50 ~ 20 mm). All
compounds became remarkably more cytotoxic after exposure
to red light. Phototoxicity was found to be directly proportional to the total light dose used, as shown clearly by the dose–
effect curves (Figure 3). The most potent compound was the
unlabeled porphyrin 1, for which the IC50 value dropped from
> 100 mm in the dark to 2.0 mm at the lowest light dose used
in our experimental setting (1 J cm!2).
Conjugate 3 showed IC50 values slightly higher than its
parent porphyrin 1 (Table 1 and Figure 3), but this difference
tended to diminish upon increasing the light dose, suggesting
that the binding of fac-{Re(CO)3} + has a minor effect on the
phototoxic features of the porphyrin. On the contrary, conjugate 4 had much better phototoxic properties compared to its
parent porphyrin 2, in particular at the lowest light dose
(Table 1 and Figure 3).
The negligible cytotoxicity in the dark of ReI conjugates 3
and 4, an excellent prerequisite for potential PDT and imaging
applications, is consistent with what has been found for
mono-substituted porphyrin–RuII conjugates by several
groups.[18–20] In contrast, as found by us and by others,[10, 18]
tetra-substituted porphyrin–RuII conjugates are typically also
remarkably cytotoxic in the absence of light.
1
O2 quantum yields
Tricarbonyl rhenium(I) bis-imine complexes are known to photosensitize molecular oxygen to singlet oxygen,[9, 21–24] but
photo-excitation occurs with visible light at low wavelengths
(lexc < 400 nm), which are unsuitable for practical PDT applications.[25] We emphasize that in conjugates 3 and 4, the tagged
rhenium complex is not supposed to sensitize; its sole role is
ChemMedChem 2014, 9, 1231 – 1237
1233
CHEMMEDCHEM
FULL PAPERS
www.chemmedchem.org
Figure 3. Light dose- and concentration-dependent effect curves for a) 1 (top left) and its Re conjugate 3 (top right), and b) porphyrin 2 (bottom left) and its
Re conjugate 4 (bottom right) in HeLa human cervical cancer cells. Total light dose (J cm!2): 0 (&), 1 (~), 5 (*), and 10 (^).
to mimic the homologous 99mTc conjugates, which combine
radio imaging and photodynamic activity.
Singlet oxygen quantum yields (FD) in ethanol for compounds 1–4 with red light irradiation range from moderate to
good. The FD value for each ReI conjugate (0.36 for 3 and 0.62
for 4) is similar to that of the corresponding parent porphyrin
(0.33 for 1 and 0.66 for 2), indicating that the Re fragment
does not enhance or quench the excitation lifetime. Thus, the
phototoxicity of the tested compounds seems to be directly
related to their uptake, rather than to the singlet oxygen quantum yield. In fact, 1 shows a higher phototoxicity than 2 at low
light doses, despite having a lower FD value. It is worth noting
that FD values were determined in ethanol solution, conditions quite different from what the compounds experience in
cell culture. It is therefore not surprising that the FD value has
only a marginal impact in predicting the phototoxic potency
of the compounds.
Cellular localization
The cellular localization of porphyrins 1 and 2, and of their ReI
conjugates, 3 and 4 (all at 20 mm concentration and 2 h incubation), as investigated by confocal fluorescence microscopy in
HeLa cells, revealed different features. Treatment of cells with
porphyrin 1 induced the formation of aggregates that localized
mostly outside of the cells (Figure 4 a, green arrows) but also,
potentially, within the external cellular membrane (Figure 4 b,
white arrows). To a small extent, cellular uptake was also observed (Figure 4 a, yellow arrows). In contrast, ReI conjugate 3
showed clear cytoplasmic fluorescence, with an accumulation
near the nuclear membrane where it formed a ring-like structure (Figure 5 b). No extracellular aggregates were detected in
this case.
The different cellular localization patterns of 1 and 3, together with their different uptake and light-dependent effect
curves, suggest that the ReI fragment remains attached to the
porphyrin photosensitizer after internalization. It is worth
noting that despite these differences, porphyrin 1 and its ReI
conjugate 3 have comparable phototoxicity.
In contrast, no fluorescence could be detected with a regular
fluorescence microscope or with a confocal microscope (Supporting Information) for cells treated with porphyrin 2 or with
its ReI conjugate 4. Given the lower uptake of compounds 2
and 4 compared to 1 and 3 (Figure 2), it is quite possible that
at 20 mm, the amount of internalized porphyrin was below the
detection limit of the microscope. It is also possible that 2 and
4, having a multiple positive charge, do not enter easily inside
the cell and remain localized on/in the cell membrane, with
ChemMedChem 2014, 9, 1231 – 1237
1234
CHEMMEDCHEM
FULL PAPERS
www.chemmedchem.org
Figure 4. Confocal microscopy z-stacked images of HeLa cells incubated for 2 h with porphyrin 1 (20 mm). DAPI
staining (left), cellular distribution of 1 (center), and overlay (right) of a) nucleus- and b) membrane-focused
images.
exploited for determining cellular uptake and, in the case of
1 and 3, cellular localization of
the compounds.
In conclusion, this work represents a first ‘proof of concept’
that porphyrin–ReI/99mTcI conjugates
developed
within
a matched pair strategy, such as
3/3 a and 4/4 a, are indeed multifunctional agents endowed
with both diagnostic and therapeutic capabilities. Thus, in principle, radio imaging performed
with 3 a and 4 a might allow for
noninvasive, in vivo localization
of the corresponding PDT-active
“cold” Re conjugates 3 and 4
and determination of their pharmacokinetics.
Experimental Section
Porphyrins 1 and 2, and their ReI
conjugates 3 and 4, were prepared
as described elsewhere.[14]
Uptake experiments: HeLa cells
grown in 96-well plates were treated with compounds 1–4 (0.1–
100 mm) for 1, 2, 4, 8, or 24 h. At
the end of the incubation, the
medium was removed, and cells
Figure 5. Confocal microscopy images of HeLa cells incubated for 2 h with 3 (20 mm): a) DAPI staining; b) cellular
distribution of 3; c) overlay.
were thoroughly washed with
200 mL of phosphate-buffered
saline (PBS) and solubilized using
100 mL of 0.25 % Triton X-100 in
their emission either quenched or under the limit of detection
PBS. Finally, fluorescence emission was read at 430/670 nm (excitafor both fluorescence and confocal microscopes. However, as
tion/emission). Data reported in Figure 1 and 2 are the mean !
phototoxicity during microscopy of living cells was observed
S.D. calculated from values obtained in three separate experiafter 24 h treatment with both conjugates 3 and 4, even at
ments.
concentrations as low as 1 mm (Supporting Information), we
argue that some quantity of compound 4 is present either in
the cell or on its surface. This hypothesis is also consistent
with the uptake experiments (Figure 2), in which fluorescence
was measured after inducing cell lysis with Triton X-100.
Conclusions
We demonstrated here that the robust, water-soluble, porphyrin–ReI conjugates 3 and 4, that is, the nonradioactive analogues of the corresponding g-emitting 99mTc conjugates 3 a
and 4 a,[14] exert remarkable PDT activity in vitro against HeLa
human cervical cancer cells when irradiated with moderate
doses of visible red light (590–700 nm). Conversely, they have
a modest, or altogether negligible, cytotoxicity in the dark, ensuring selectivity of the treatment. In addition, the porphyrin
unit in these photosensitizers provides luminescence sensing
when irradiated with low doses of blue/green light, which was
Cell culture: HeLa cells were maintained in Dulbecco’s modified
Eagle’s medium (DMEM) supplemented with 10 % fetal calf serum
(FCS), 2 mm l-glutamine, penicillin (100 U mL"1), and streptomycin
(100 mg mL"1). The cell line was kept in a CO2 incubator with 5 %
CO2 and 100 % relative humidity at 37 8C. Cells from a confluent
monolayer were removed from flasks by a trypsin-EDTA solution.
Cell viability was determined by the trypan blue dye exclusion test.
Determination of cell cytotoxicity: Cell growth inhibition was determined by the MTT viability test.[26] Cells were seeded at 10 000 cells
per well on 96-well plates and allowed to grow for 24 h. The cells
were then incubated for 1, 2, 4, and 24 h with concentrations ranging from 0.1 to 100 mm of the appropriate compound, obtained by
serial dilutions of stock solutions (freshly prepared in DMSO at
a concentration of 10"2 m) with complete medium containing 5 %
FCS. The maximum DMSO concentration in the cell incubation
medium was # 0.3 % (v/v). Cell toxicity analysis was performed at
the end of the incubation time. Briefly, MTT dissolved in PBS
(5 mg mL"1) was added (10 mL per 100 mL of medium) to all wells,
and the plates were then incubated at 37 8C with 5 % CO2 and
ChemMedChem 2014, 9, 1231 – 1237
1235
CHEMMEDCHEM
FULL PAPERS
100 % relative humidity for 4 h. After this time, the medium was
discarded, and 200 mL of DMSO were added to each well according
to the method of Alley et al.[27] Optical density was measured at
570 nm on a SpectraCount Packard instrument (Meriden, CT). IC50
values were calculated from dose–effect curves with GraphPad
Prism version 4.03 for Windows (GraphPad Software, San Diego,
CA). Experiments were conducted in quadruplicate and repeated
three times.
Cell phototoxicity: Cells were seeded at 10 000 cells per well on 96well plates and allowed to grow for 24 h. They were then incubated for 24 h with 0.1–100 mm solutions of each compound, obtained
by serial dilutions of stock solutions (freshly prepared in DMSO at
a concentration of 10!2 m) with complete medium containing 5 %
FCS. The maximum DMSO concentration in the cell incubation
medium was " 0.3 % (v/v). Thereafter, the media containing compounds were replaced with drug-free medium, and the cells were
irradiated at 590–700 nm at a fluence rate of 9 mW cm!2 for
a length of time such that the total light dose was either 1 J cm!2,
5 J cm!2, or 10 J cm!2. Illumination was performed with a Techno
Light 270 Karl Storz instrument equipped with a 270W halogen
lamp connected to an optical fiber (F = 1 cm). The wavelength interval was isolated by the insertion of broadband optical filters.
The emitted power (mW) at the end of the optical fiber was measured with an Ophir NOVA Laser Measurement power meter. The
diameter of the circular irradiated surface was measured with
a ruler. Control experiments performed in the absence of any photosensitizer indicated that light doses up to 10 J cm!2 cause no evident cell damage (ESI). A plate treated similarly but not exposed to
light was used as a reference for the dark cytotoxicity under the
same experimental conditions. Analysis of cell phototoxicity using
the MTT assay was performed after a further 24 h incubation and
compared to the values of control cells without light irradiation.
Experiments were run in quadruplicate and repeated three times.
Determination of singlet oxygen quantum yield: The quantum yield
(FD) of singlet oxygen generated by compounds 1–4 upon photoexcitation was measured using 9,10-dimethylanthracene (DMA) as
a substrate.[28] Typically, 1.5 mL of a 20 mm EtOH solution of DMA
and 1.5 mL of the porphyrin solution (0.4 A at Soret band maximum, corresponding to a concentration ca. 10!6 m) in EtOH were
placed in a quartz cuvette of 1 cm optical path and irradiated with
590–700 nm light for different periods of time at 20 # 2 8C under
gentle magnetic stirring. The fluence rate was 100 mW cm!2. DMA
fluorescence emission was recorded in the 380–550 nm wavelength range, with excitation at 360 nm. The first-order rate constant of the photo-oxidation of DMA by 1O2 was obtained by plotting the natural log of F0/F (ln F0/F) as a function of the irradiation
time t, where F0 and F represent the fluorescence intensities at
time 0 and at time t, respectively. The rate constant was then converted into 1O2 quantum yield by comparison with the rate constant for DMA photo-oxidation sensitized by hematoporphyrin
(Hp), for which FD was shown to be 0.65.[29]
Fluorescence microscopy: For fluorescence microscopy, cells were
grown on 18 mm Menzel-glass coverslips (Menzel, Germany) at
a density of 2.5 ! 105 cells mL!1 and incubated with the indicated
compound. After 2 h of treatment, cells were fixed for 15 min at
4 8C in 1x formaldehyde solution (4 % formaldehyde (w/v) in 1 !
PBS) and mounted on microscopy slides. Fixed cells were examined with a CLSM Leica SP5 confocal microscope (excitation:
514 nm; emission: 600–700 nm) using 63 ! 1.20 oil immersion
lenses.
# 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemmedchem.org
Acknowledgements
This work was performed within the framework of the European
Cooperation in Science and Technology (COST) Actions D39 and
CM1105; C.S. is grateful to COST for supporting two Short-Term
Scientific Missions at the University of Zurich. G.G. acknowledges
the generous financial support of the Swiss National Science
Foundation (SNSF) through a professorship (PP00P2_133568), the
University of Zurich and the Stiftung f!r Wissenschaftliche Forschung of the University of Zurich. T.G. and E.A. acknowledge
Fondazione Casali and Fondazione Beneficentia Stiftung, respectively, for generous financial support. The authors gratefully acknowledge the assistance and support of the Center for Microscopy and Image Analysis of the University of Zurich.
Keywords: imaging · matched pair strategy · photodynamic
therapy · porphyrin conjugates · rhenium(I) · technetium(I)
[1] L. E. Jennings, N. J. Long, Chem. Commun. 2009, 3511 – 3524.
[2] A. Louie, Chem. Rev. 2010, 110, 3146 – 3195.
[3] a) S. S. Kelkar, T. M. Reineke, Bioconjugate Chem. 2011, 22, 1879 – 1903;
b) C. S. Cutler, H. M. Hennkens, N. Sisay, S. Huclier-Markai, S. S. Jurisson,
Chem. Rev. 2013, 113, 858 – 883.
[4] Z. Chen, M.-F. Penet, S. Nimmagadda, C. Li, S. R. Banerjee, P. T. Winnard, Jr., D. Artemov, K. Glunde, Z. M. Bhujwalla, ACS Nano 2012, 6,
7752 – 7762.
[5] J. P. Celli, B. Q. Spring, I. Rizvi, C. L. Evans, K. S. Samkoe, S. Verma, B. W.
Pogue, T. Hasan, Chem. Rev. 2010, 110, 2795 – 2838.
[6] J. F. Lovell, T. W. B. Liu, J. Chen, G. Zheng, Chem. Rev. 2010, 110, 2839 –
2857.
[7] D. E. J. G. J. Dolmans, D. Fukumura, R. K. Jain, Nat. Rev. Cancer 2003, 3,
380 – 387.
[8] a) S. Sortino, J. Mater. Chem. 2012, 22, 301 – 318; b) A. Fraix, N. Kandoth,
I. Manet, V. Cardile, A. C. E. Graziano, R. Gref, S. Sortino, Chem. Commun.
2013, 49, 4459 – 4461.
[9] A. Leonidova, V. Pierroz, R. Rubbiani, J. Heier, S. Ferrari, G. Gasser, Dalton
Trans. 2014, DOI: 10.1039/C3DT51817E.
[10] a) T. Gianferrara, I. Bratsos, E. Iengo, B. Milani, A. Ostrić, C. Spagnul, E.
Zangrando, E. Alessio, Dalton Trans. 2009, 10742 – 10756; b) T. Gianferrara, A. Bergamo, I. Bratsos, B. Milani, C. Spagnul, G. Sava, E. Alessio, J.
Med. Chem. 2010, 53, 4678 – 4690.
[11] a) M. Casanova, E. Zangrando, E. Iengo, E. Alessio, M. T. Indelli, F. Scandola, M. Orlandi, Inorg. Chem. 2008, 47, 10407 – 10418; b) T. Gatti, P. Cavigli, E. Zangrando, E. Iengo, C. Chiorboli, M. T. Indelli, Inorg. Chem. 2013,
52, 3190 – 3197.
[12] F. L. Thorp-Greenwood, M. P. Coogan, Dalton Trans. 2011, 40, 6129 –
6143.
[13] R. Alberto in Bioinorganic Medicinal Chemistry, (Ed.: E. Alessio), WileyVCH, Weinheim, 2011, pp. 253 – 282.
[14] C. Spagnul, R. Alberto, G. Gasser, S. Ferrari, V. Pierroz, A. Bergamo, T.
Gianferrara, E. Alessio, J. Inorg. Biochem. 2013, 122, 57 – 65.
[15] T. Perera, P. Abhayawardhana, P. A. Marzilli, F. R. Fronczek, L. G. Marzilli,
Inorg. Chem. 2013, 52, 2412 – 2421.
[16] a) T. Mindt, H. Struthers, E. Garcia-Garayoa, D. Desbouis, R. Schibli,
Chimia 2007, 61, 725 – 731; b) C. M"ller, P. A. Schubiger, R. Schibli, Nucl.
Med. Biol. 2007, 34, 595 – 601.
[17] D. Can, B. Spingler, P. Schmutz, F. Mendes, P. Raposinho, C. Fernandes, F.
Carta, A. Innocenti, I. Santos, C. T. Supuran, R. Alberto, Angew. Chem.
2012, 124, 3410 – 3413; Angew. Chem. Int. Ed. 2012, 51, 3354 – 3357.
[18] F. Schmitt, P. Govindaswamy, O. Zava, G. S"ss-Fink, L. Juillerat-Jeanneret,
B. Therrien, J. Biol. Inorg. Chem. 2009, 14, 101 – 109.
[19] K. Davia, D. King, Y. Hong, S. Swavey, Inorg. Chem. Commun. 2008, 11,
584 – 586.
[20] a) C.-T. Poon, P.-S. Chan, C. Man, F.-L. Jiang, R. N. S. Wong, N.-K. Mak,
D. W. J. Kwong, S.-W. Tsao, W.-K. Wong, J. Inorg. Biochem. 2010, 104, 62 –
70; b) J.-X. Zhang, J.-W. Zhou, C.-F. Chan, T. C.-K. Lau, D. W. J. Kwong, H.-
ChemMedChem 2014, 9, 1231 – 1237
1236
CHEMMEDCHEM
FULL PAPERS
[21]
[22]
[23]
[24]
[25]
L. Tam, N.-K. Mak, K.-L. Wong, W.-K. Wong, Bioconjugate Chem. 2012, 23,
1623 – 1638.
F. Ragone, H. H. M. Saavedra, P. M. D. Gara, G. T. Ruiz, E. Wolcan, J. Phys.
Chem. A 2013, 117, 4428 – 4435.
A. Kastl, S. Dieckmann, K. W!hler, T. Vçlker, L. Kastl, A. L. Merkel, A.
Vultur, B. Shannan, K. Harms, M. Ocker, W. J. Parak, M. Herlyn, E. Meggers, ChemMedChem 2013, 8, 924 – 927.
K. Y. Zhang, K. K.-S. Tso, M.-W. Louie, H.-W. Liu, K. K.-W. Lo, Organometallics 2013, 32, 5098 – 5102.
V. W.-W. Yam, K. K.-W. Lo, K.-K. Cheung, R. Y.-C. Kong, J. Chem. Soc.
Dalton Trans. 1997, 2067 – 2072.
K. Szaciłowski, W. Macyk, A. Drzewiecka-Matuszek, M. Brindell, G. Stochel, Chem. Rev. 2005, 105, 2647 – 2694.
# 2014 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemmedchem.org
[26] T. Mosmann, J. Immunol. Methods 1983, 65, 55 – 63.
[27] M. C. Alley, D. A. Scudiero, A. Monks, M. L. Hursey, M. J. Czerwinski, D. L.
Fine, B. J. Abbott, J. G. Mayo, R. H. Schoemaker, M. R. Boyd, Cancer Res.
1988, 48, 589 – 601.
[28] E. Gross, B. Ehrenberg, F. Johnson, Photochem. Photobiol. 1993, 57,
808 – 813.
[29] C. Fabris, M. G. H. Vicente, E. Hao, E. Friso, L. Borsetto, G. Jori, G. Miotto,
P. Colautti, D. Moro, J. Esposito, A. Ferretti, C. R. Rossi, D. Nitti, G. Sotti,
M. Soncin, J. Photochem. Photobiol. B 2007, 89, 131 – 138.
Received: December 2, 2013
Published online on February 23, 2014
ChemMedChem 2014, 9, 1231 – 1237
1237
J Membrane Biol (2014) 247:1239–1251
DOI 10.1007/s00232-014-9696-2
Modulation of Activity of Known Cytotoxic Ruthenium(III)
Compound (KP418) with Hampered Transmembrane Transport
in Electrochemotherapy In Vitro and In Vivo
Rosana Hudej • Damijan Miklavcic • Maja Cemazar • Vesna Todorovic
Gregor Sersa • Alberta Bergamo • Gianni Sava • Anze Martincic •
Janez Scancar • Bernhard K. Keppler • Iztok Turel
•
Received: 19 January 2014 / Accepted: 29 May 2014 / Published online: 24 June 2014
! Springer Science+Business Media New York 2014
Abstract To increase electrochemotherapy (ECT) applicability, the effectiveness of new drugs is being tested in
combination with electroporation. Among them two ruthenium(III) compounds, (imH)[trans-RuCl4(im)(DMSO-S)]
(NAMI-A) and Na[trans-RuCl4(ind)2] (KP1339), proved to
possess increased antitumor effectiveness when combined
with electroporation. The objective of our experimental
work was to determine influence of electroporation on the
cytotoxic and antitumor effect of a ruthenium(III) compound with hampered transmembrane transport, (imH)
[trans-RuCl4(im)2] (KP418) in vitro and in vivo and to
determine changes in metastatic potential of cells after
ECT with KP418 in vitro. In addition, platinum compound
cisplatin (CDDP) and ruthenium(III) compound NAMI-A
were included in the experiments as reference compounds.
Our results show that electroporation leads to increased
cellular accumulation and cytotoxicity of KP418 in murine
melanoma cell lines with low and high metastatic potential,
B16-F1 and B16-F10, but not in murine fibrosarcoma cell
line SA-1 in vitro which is probably due to variable
effectiveness of ECT in different cell lines and tumors.
Electroporation does not potentiate the cytotoxicity of
KP418 as prominently as the cytotoxicity of CDDP. We
also showed that the metastatic potential of cells which
survived ECT with KP418 or NAMI-A does not change
in vitro: resistance to detachment, invasiveness, and readhesion of cells after ECT is not affected. Experiments in
murine tumor models B16-F1 and SA-1 showed that ECT
with KP418 does not have any antitumor effect while ECT
with CDDP induces significant dose-dependent tumor
growth delay in the two tumor models used in vivo.
R. Hudej ! D. Miklavcic
Faculty of Electrical Engineering, University of Ljubljana,
1000 Ljubljana, Slovenia
G. Sava
Department of biomedical Science, University of Trieste,
34127 Trieste, Italy
R. Hudej
BIA Separations d.o.o., 5270 Ajdovscina, Slovenia
A. Martincic ! J. Scancar
Jozef Stefan Institute, 1000 Ljubljana, Slovenia
M. Cemazar ! V. Todorovic ! G. Sersa
Institute of Oncology Ljubljana, 1000 Ljubljana, Slovenia
B. K. Keppler
Institute of Inorganic Chemistry, University of Vienna,
1090 Vienna, Austria
M. Cemazar
Faculty of Health Sciences, University of Primorska, 6310 Izola,
Slovenia
A. Bergamo ! G. Sava
Callerio Foundation, 34127 Trieste, Italy
Keywords KP418 ! Electrochemotherapy ! Ruthenium !
Metastatic potential ! In vitro ! In vivo
Introduction
Electrochemotherapy (ECT) is one of the applications of
electroporation in which pulsed electric field is used to
I. Turel (&)
Faculty of Chemistry and Chemical Technology, University of
Ljubljana, 1000 Ljubljana, Slovenia
e-mail: Iztok.turel@fkkt.uni-lj.si
123
1240
improve delivery of non-permeant molecules into the cell
(Sersa et al. 2008). Today ECT is successfully used in
clinical practice for treatment of cutaneous and subcutaneous tumors, especially melanoma nodules, and is being
developed for treatment of deep-seated tumors and chestwall breast cancer recurrences (Haberl et al. 2013). In 2013
over 130 hospitals around the world implemented ECT
treatment in clinics. However, complete tumor eradication
after ECT treatment was obtained in 73.7 % according to
the results of the European Standard Operating Procedures
for Electrochemotherapy and Electrogenetherapy (ESOPE)
study (Marty et al. 2006). In order to increase ECT applicability, research and development are focused on ECT
treatment for deep-seated tumors (Miklavcic et al. 2010;
Miklavcic et al. 2012; Edhemovic et al. 2011), new medical devices with electrodes optimization and computerassisted simulations of field distribution (Spugnini et al.
2005; Corovic et al. 2013), treatment planning and suitable
software for clinicians (Pavliha et al. 2013a; 2013b), and
also on drug discovery adjusted for ECT (Jaroszeski et al.
2000; Hudej et al. 2010).
A drug effective in ECT treatment is a hydrophilic
molecule with hampered cellular transmembrane transport
and intracellular site of activity. The more pronounced these
properties are the more effective electroporation is in
increasing drug cytotoxicity (Orlowski et al. 1988). Only
two drugs are used in ECT in clinics, namely bleomycin and
cisplatin (CDDP) (Fig. 1). Although many chemotherapeutics have been tested, a significant increase in antitumor
effectiveness in vitro and in vivo was only obtained with the
two mentioned compounds (Heller et al. 2000). Electroporation in vitro potentiates bleomycin cytotoxicity by up to
100 000 times and CDDP cytotoxicity by up to 70 times
(Orlowski et al. 1988; Sersa et al. 1995; Jaroszeski et al.
2000; Miklavcic et al. 2014). It is also effective in resistant
cell lines (Cemazar et al. 1998) and it does not increase
metastatic potential of the cells that survived the ECT
treatment (Todorovic et al. 2011; Todorovic et al. 2012).
The effectiveness of both drugs in ECT was demonstrated in
several tumor models and for different tumor histologies in
preclinical studies in vivo and later on in clinical trials
(Sersa et al. 2008). Bioavailability of CDDP is reduced due
to its fast irreversible binding to the serum protein albumin
and as such when applied intravenously, its efficacy is
reduced in comparison to intratumoral application in ECT
(Mir et al. 2006; Hudej et al. 2010).
Until recently screening of drug, candidates for effective
ECT treatment has only included drugs that are classic
anticancer chemotherapeutics and that can be transported
by passive or active mechanisms across the cell membrane
(Orlowski et al. 1988; Jaroszeski et al. 2000; Miklavcic
et al. 2014). The search for new effective drugs in ECT
should also include screening of drugs which have shown
123
R. Hudej et al.: Electrochemotherapy with KP418 In Vitro and In Vivo
too low effect for classic chemotherapy due to their
hydrophilic nature and intracellular site of action and as
such have never entered clinical phase I/II trials.
Ruthenium(III) compounds are an interesting group of
metallotherapeutics whose anticancer activity is related to
some prominent properties (Hartinger et al. 2008). Ruthenium(III) compounds which have entered clinical trials
are (imH)[trans-RuCl4(im)(DMSO-S)] (im = imidazole)
(NAMI-A) as an antimetastatic drug, and (indH)[transRuCl4(ind)2](ind = indazole) (KP1019) and its sodium salt
analog Na[trans-RuCl4(ind)2] (KP1339) as antitumor drugs
effective against a variety of solid tumors including resistant colorectal tumors (Fig. 1) (Antonarakis and Emadi
2010). NAMI-A has a unique mechanism of activity which
is not fully understood yet. Its high antimetastatic properties are accompanied with low antitumor effect for primary
tumors in vivo and no cytotoxic effect in vitro (Gava et al.
2006; Antonarakis and Emadi 2010). Among other investigated ruthenium(III) compounds, (imH)[trans-RuCl4
(im)2] (KP418) had significant antitumor activity; however,
it did not reach clinical trials (Fig. 1). KP418 at equimolar
concentrations was more effective than KP1019 against
chemically induced autochthonous colorectal tumors
resistant to other chemotherapeutics, though systemic
toxicity accompanied its antitumor effect (Berger et al.
1989; Seelig et al. 1992). The nephrotoxicity of KP418 in
rats was, however, still lower than that of CDDP (Kersten
et al. 1998). It has been shown that cytotoxicity of all three
KP compounds is related to their transmembrane transport,
with KP418 being at least 10 times less efficiently taken up
into cells than KP1019 and KP1339 (Kapitza et al. 2005;
Hartinger et al. 2008). KP418 never entered clinical trials
due to its hampered transmembrane transport and consequently systemic toxicity at effective doses in vivo (Seelig
et al. 1992). However, it was never proven that lack of
activity of KP418 at low doses is actually due to the lack of
drug penetration into cells. Thus, the intrinsic cytotoxicity
of KP418 and KP1019 was never compared.
Ruthenium(III) compounds have already been tested in
combination with electroporation in vitro and in vivo in our
previous studies (Bicek et al. 2007; Kljun et al. 2010;
Hudej et al. 2010; 2012). The experiments in vivo have
shown that mechanisms of activity in ECT with ruthenium
compound KP1339 are significantly different from those
with CDDP (Hudej et al. 2010).
The aim of our present study was to evaluate whether
reversible electroporation would increase KP418 intracellular content and its cytotoxicity. In addition to this we
investigated the applicability of the ruthenium compound
KP418 in ECT treatment. We treated the cells with KP418
alone or in combination with electroporation and measured
cellular accumulation of KP418 and cytotoxic effect
in vitro. In addition, we studied metastatic potential of cells
1241
Fig. 1 Chemical structures of
CDDP (a), NAMI-A (b),
KP1019 (c), KP1339 (d) and
KP418 (e)
after treatment by measuring cell resistance to detachment,
migration, invasion, and re-attachment of cells in vitro.
Finally, we determined the antitumor activity of ECT with
KP418 in two mouse tumor models in vivo and compared it
to antitumor activity of ECT with CDDP.
Materials and Methods
Compound Solutions
A 10 mM solution of each of KP418 and NAMI-A in 0.9 %
NaCl were prepared directly before application. To dissolve
the compound, the solution was mixed on vortex for 10 min.
It was then sterile filtered through 0.22 lm pores filter (TPP,
Trasadingen, Switzerland) and different concentrations of
KP418 and NAMI-A were prepared in 0.9 % NaCl. For
experiments in vitro the concentrations prepared were 0.1, 1,
10 mM and for experiments in vivo, the concentrations were
2.6, 5.2, 10.4 ,and 20.8 mM. CDDP solutions were prepared
in a similar way. The concentrations prepared were 0.05,
0.5, and 5 mM for in vitro and 2.6 and 5.2 mM for in vivo
experiments. For in vitro experiments we used 99.9 % pure
CDDP (Sigma-Aldrich, St. Louis, MO, USA) and for in vivo
experiments the formulation of CDDP supplemented with
D-mannitol, NaCl, and HCl which is used in the clinics
(CDDP, 50 mg/1000 mg, Medac, Hamburg, Germany). The
compounds were dissolved whether in low conductive isoosmolar electroporation buffer NaPB (10 mM Na2HPO4/
NaH2PO4, 1 mM MgCl2, 250 mM sucrose; pH 7.4; SigmaAldrich) whether in physiological solution 150 mM NaCl
(0.9 % NaCl; pH 7.0; B. Braun, Melsungen, Germany).
After being thoroughly mixed on vortex they were sterile
filtered through 0.22 lm pores filter (TPP, Trasadingen,
Switzerland) and different concentrations were prepared.
Each solution was prepared directly before its application in
cells or in tumors.
Cell Lines
Three different cell lines were used in our experiments
where cytotoxicity of tested compounds in ECT in vitro
was determined: SA-1 (murine fibrosarcoma cells; Jackson
Laboratory, Bar Harbor, ME, USA), B16-F1, and B16-F10
(murine malignant melanoma cells with low (F1) and high
(F10) metastatic potential; European Collection of Cell
Cultures, Porton, UK). Cells were incubated in humidified
atmosphere with 5 % CO2 at 37 !C. SA-1 cells were grown
in Advanced Eagle’s Minimum Essential Medium (Gibco,
Grand Island, NY, USA) supplemented with 5 % FBS
(Gibco), 200 mM Glutamax (1009; Gibco), 50,000 U
Penicillin (PANPHARMA S.A., Fougeres, France) and
50 mg/l Gentamicin (Krka, Novo mesto, Slovenia). B16-F1
cells were grown in Dulbecco’s Modified Eagle’s Medium
123
1242
with high glucose (4.5 g/l; PAA, Pasching, Austria), 10 %
Fetal Bovine Serum (FBS; PAA), 1 % 200 mM L-glutamin
(Sigma-Aldrich), 0.01 % Penicillin/Streptomycin (1009;
PAA) and 0.1 % Gentamicin (50 mg/ml; PAA).
The experiments for evaluation of metastatic potential
of cells in vitro were performed in the laboratories of
Callerio Foundation, Trieste, Italy. The cell lines B16-F1
and B16-F10 (American Type Culture Collection, Manassas, VA, USA) were used. Cells were grown in Minimal
Essential Medium (EuroClone, Wetherby, UK) supplemented with 10 % FBS (Gibco), 2 % NaHCO3 (SigmaAldrich), 1 % sodium pyruvate (Sigma-Aldrich), 1 %
glucose (Sigma-Aldrich), 1 % 2 mM L-glutamine (EuroClone), 1 % nonessential amino acids (Sigma-Aldrich),
Penicillin (100 IU/ml), and Streptomycin (100 lg/ml).
Cell suspension was prepared from cell cultures in
exponential growth phase by trypsinization using trypsin–
EDTA (5 g trypsin/2 g EDTA in 0.9 % NaCl; SigmaAldrich) 10 9 diluted in Hanks’ Balanced Salt solution
(Sigma-Aldrich). From the obtained cell suspension, trypsin and growth medium were removed by centrifugation at
270 RCF for 5 min at 4 !C (Sigma 3-15 K, UK). The cell
pellet was resuspended to obtain a final cell density of
2.2 9 107 cells/ml. The solution used for cell resuspension
was whether NaPB whether NaCl, according to the solution
used for the tested compound.
Electrochemotherapy In Vitro
Aliquots of freshly prepared KP418 or CDDP solutions of
different concentrations were added to freshly prepared cell
suspension (2.2 9 107 cells/ml) in volume proportion 1:9.
The final concentrations of KP418 solutions were 0, 10,
100, and 1000 lM. Immediately after incubation (\30 s) a
60 ll droplet of cell suspension was placed between flat
parallel stainless-steel electrodes 2 mm apart. A train of
eight square-wave electric pulses with an amplitude of
160 V (800 V/cm), duration of 100 ls and a repetition
frequency of 1 Hz was applied with a Cliniporator electroporator (Igea, Carpi, Italy). After electroporation, cells
were incubated for 5 min at room temperature, allowing
KP418 molecules to pass through the electroporated cell
membranes. Cells were then diluted 40 times with the
appropriate cell growth medium, and 5 9 103 cells were
placed into each well of a 96 well-microtiter plate (TPP,
Trasadingen, Switzerland) and incubated in humidified
atmosphere with 5 % CO2 at 37 !C for 72 h. The same
procedure without electric pulses was used for cells
exposed to KP418 alone for 5 min or 60 min. After the
incubation time (72 h) a cell viability test was performed
using the MTS-based Cell Titer 96" AQueous One Solution Cell Proliferation Assay (Promega, Madison, WI,
USA). A volume of 10 ll of reagent per well was added
123
directly to each well. After 2 h of incubation at 37 !C, the
absorption at 490 nm was measured with a Tecan infinite
M200 spectrophotometer (Tecan, Switzerland). The percentage of viable cells 72 h after the therapy was determined as follows:
viable cells ¼
Absð490Þect
$ 100 ½%&;
Absð490Þ0
where Abs(490)ect is the absorbance of treated cells and
Abs(490)0 is the absorbance of control cells at 490 nm.
The IC50 values (Inhibitory Concentration 50 is the
concentration where 50 % of cells are viable) were
graphically determined from dose–response curves.
Experiments in vitro were repeated three times independently with six parallel measurements for each parameter.
Cellular Accumulation of Ruthenium After
To determine the ruthenium or platinum intracellular
concentration after ECT treatment, cells after ECT in vitro
were immediately centrifuged at 270 RCF and 4 !C for
5 min (Sigma 3–15 K, UK). Supernatant was carefully
discarded and cell debris digested with incubation in
100 ll HNO3 (Merck, s.p., KGaA, Darmstadt, Germany)
and 100 ll H2O2 (Merck, s.p.) at 80 !C for 12 h. Clear
solution was obtained. After that 50 ll HCl (Merck, s.p.)
and deionized water were added. The content of platinum
or ruthenium in the samples analyzed was determined by
inductively coupled plasma—mass spectroscopy (ICP-MS
7700x, Agilent Technologies, Tokyo, Japan). An aliquot of
cells after ECT treatment was used also for determination
of viable cells in these sets of experiments.
Metastatic Potential of Cells In Vitro
Resistance to Detachment
Immediately after the treatment (described under section » Electrochemotherapy in vitro «) the cells were diluted, and 2 9 104 cells per well were seeded in 96-well
microtiter plate. Cells were incubated at 37 !C and 5 % CO2
for 24 h. Medium was then removed, cells were washed and
incubated in 0.008 % trypsin/EDTA for 30 min with gentle
shaking of the plate. Thereafter, trypsin was removed. Nonadherent cells were washed and adherent cells were detected
by sulphorhodamin B assay (SRB). Cells were first fixed
with 10 % trichloroacetic acid (TCA; Sigma-Aldrich) for
1 h at 4 !C. TCA was then removed, cells were washed,
dried, and stained with 0.4 % SRB and 1 % acetic acid
(Sigma-Aldrich). The dye was then dissolved with 10 mM
Tris base (tris-hydroxymethyl-aminomethane) with pH 10.5
(Sigma-Aldrich). Absorbance was measured at 570 nm with
a spectrophotometer (SpectraCount, Packard, Meriden,
Conn, USA). The percentage of cells resistant to detachment
after the therapy was determined as follows:
cells resistance to detachment ¼
Absð570Þect
$ 100 ½%&;
Absð570Þ0
1243
assay (described under section » Resistance to detachment «). The percentage of adherent cells after the therapy
was determined as follows:
readhesion of cells ¼
Absð570Þect
$ 100 ½%&;
Absð570Þ0
Invasion Assay
Animals and Tumors
One day before the experiment the inserts for 24-well
microtiter plates with polycarbonate membrane with 8 lm
pores (Greiner bio-one, Frickenhausen, Germany) were
coated with 50 ll of Matrigel (600 lg/ml) (BD Bioscience,
Palo Alto, CA, USA) and incubated for 24 h at room
temperature to allow Matrigel polymerization. Next day
inserts were filled with DMEM and gently shaken for
90 min. In the meanwhile cells were treated as described
under section » Electrochemotherapy in vitro «. Cell suspension was diluted 200 times with DMEM with 0.1 %
BSA (Sigma-Aldrich), and 105 cells have been seeded per
insert. Complete growth medium (DMEM with all supplements as described under » Cell lines «) was added to
the wells with FBS as a chemoattractant. The cells were
incubated for 24 h at 37 !C and 5 % CO2 to allow cell
invasion through Matrigel layer and porous membrane. In
positive control group the cells were not treated while in
negative control group the cells were not treated and were
seeded in the inserts without the chemoattractant in the
growth medium. After the incubation, the medium was
removed and cells were fixed with 1.1 % glutaraldehyde
(Sigma-Aldrich) and stained with crystal violet (SigmaAldrich). The stained cells on the membranes and in the
wells were dissolved in 10 % acetic acid and the absorbance was measured at 590 nm with a spectrophotometer
(SpectraCount, Packard). The percentage of invasive cells
after the therapy was determined as follows:
Animal studies were carried out according to the guidelines
of the Ministry of Agriculture, Forestry and Food of the
Republic of Slovenia (permissions #:34401-36/2008/6 and
34401-1/2011/3) and the EU directive 86/609/EEC.
Inbred C57BL/6 and A/J mice were purchased from the
Institute of Pathology, Faculty of Medicine, University of
Ljubljana (Ljubljana, Slovenia) and kept at the Institute of
Oncology Ljubljana, Department of Experimental Oncology. Mice were kept at 18–22 !C at 55 ± 10 % humidity
with a controlled 12 h light/dark cycle in a specific pathogen-free animal colony. Healthy mice of both sexes,
8–10 weeks old, weighing 20–25 g, were included in the
experiments. Solid subcutaneous tumors were induced
dorsolaterally by the injection of 5 9 105 viable SA-1 cells
to A/J mice and B16-F1 cells to C57BL/6 mice. SA-1 cells
were obtained from the ascitic form of tumor, while B16F1 cells were obtained from cell culture. When tumors
reached 6 mm in diameter (approximately 40–50 mm3),
the mice were randomly divided into experimental groups
(6–10 and 6–7 animals per group in experiments in SA-1
and B16-F1 tumor model, respectively) and subjected to
the specific experimental protocol. The confirmatory second experiment was performed in SA-1 tumor model.
invasiveness of cells ¼
Absð590Þect
$ 100 ½% &;
Absð590Þ0
Re-adhesion
Immediately after the treatment (described under section » Electrochemotherapy in vitro «) the cells were
diluted, and 2 9 104 cells per well were seeded in 96-well
microtiter plate. Cells were incubated at 37 !C and
5 % CO2 for 1 h. Medium was removed, cells were
washed, and fixed with 10 % trichloroacetic acid for 1 h at
4 !C. The amount of cells was determined with the SRB
Electrochemotherapy In Vivo
The tumors were treated with KP418 and CDDP injected
intravenously (V = 100 ll) in the orbital sinus. For SA-1
tumor treatment KP418 was injected at equimolar concentrations to KP1339 in previous experiments on SA-1
tumor model (2.6, 5.2 and 10.4 mM) (Hudej et al. 2010).
As animals tolerated well, the highest concentration of
KP418, we decided to proceed with 2-times higher concentration of KP418 on B16-F1 tumors (10.4, 20.8 mM).
CDDP was injected at concentrations 2.6 and 5.2 mM for
SA-1 tumors and 5.2 mM for B16-F1 tumors. Higher
concentrations of CDDP are lethal for mice and were not
prepared. Animals in control group were treated with
0.9 % NaCl solution. Three minutes after injection, electric
pulses were locally applied to the tumor. Electroporation of
the tumors was performed by application of eight squarewave electric pulses, delivered in two sets of four pulses in
123
1244
perpendicular directions with an amplitude of 780 V
(1300 V/cm), duration of 100 ls and a repetition frequency
of 1 Hz. The electric pulses were delivered to the tumors
by two flat parallel stainless-steel electrodes (length
15 mm, width 7 mm, with rounded corners), which were
placed percutaneously at opposite margins of the tumor.
Inter-electrode distance was 6 mm. A good contact
between the electrodes and the skin was assured by means
of ultrasonographic conductive gel (Kameleon d.o.o.,
Maribor, Slovenia). The electric pulses were generated by a
Cliniporator electroporator (IGEA, Italy). All treatments
were well-tolerated by animals and were performed without anesthesia.
Tumor growth was followed by measuring three mutually orthogonal tumor diameters (a, b, and c) with a vernier
caliper, every second day. The tumor volumes were calculated as follows: V = p 9 a 9 b 9 c/6. The arithmetic
mean of the tumor volumes and the standard error of the
mean (SE) were calculated for each experimental group for
each measurement day. The tumor growth delay was
determined for each individual tumor by subtracting the
average doubling time of the control group from the doubling time of each individual tumor. Animals with tumors
in regression were followed up to 100 days after the
treatment. After that, if no tumor regrowth was observed,
animals were considered to be in complete remission.
All animals were monitored for possible systemic sideeffects with physical examination every second day from
the beginning of the experiment. This included monitoring
animal’s body weight and evaluation of the general health
status with observation of the animal’s appetite, locomotion, coat, and general appearance.
Statistical Analysis
Statistical analysis was performed using One–Way
ANOVA test and SigmaStat statistical software (SPSS,
Chicago, USA).
Results and Discussion
Cellular Accumulation of Ruthenium After
To get insight into the transmembrane transport of KP418 and
its intrinsic cytotoxicity we correlated intracellular accumulation of ruthenium with viability of cells after electroporation
alone (EP) or ECT with 1000 lM KP418. B16-F1 cells were
treated with KP418 and electroporated at different electric
field strengths (400–1,200 V/cm) to achieve different
amounts of cell membrane permeabilization. In addition, we
answered the question whether 0.9 % NaCl can be used in
123
Fig. 2 The influence of electroporation buffer (NaCl, NaPB) and
electric field strength on ruthenium (Ru) intracellular accumulation
(histogram) and cell viability (plots) after ECT with 1000 lM KP418
(ECT KP418) in vitro. 100 % cell viability represents the viability of
the untreated control group (C). Data points represent the mean values
± SD; aßvd indicates data point significantly different from defined
groups (p \ 0.05): a – ECT KP418 NaCl versus C, EP NaCl and ECT
KP418 NaPB; ß – ECT KP418 NaPB versus C and EP NaPB; v – EP
NaPB and EP NaCl versus C; d – ECT KP418 NaCl vs. C
ECT experiments instead of commonly used phosphate
electroporation buffers due to the fact that ruthenium KP
compounds are unstable in phosphate buffers. Two sets of
experiments were performed in two different electroporation
solutions: low conductivity phosphate buffer (NaPB) and high
conductivity NaCl solution (NaCl). Intracellular accumulation of ruthenium and viability of cells were measured
(Fig. 2). EP caused a decrease in cell viability which is due to
irreversible electroporation at electric fields above 1,000 V/cm
with approximately 20 and 40 % of non-viable cells at
1,000 V/cm and 1,200 V/cm, respectively. We determined
that 1,000 V/cm is a threshold for irreversible electroporation
of B16F1 cells in suspension regardless of electroporation
solution used in vitro meaning that reversible electroporation
for effective ECT should be performed at lower field strength.
The electric field strength threshold at which significantly
higher decrease of cell viability was achieved for ECT than
for EP was 800 V/cm in NaCl solution and 1,000 V/cm in
NaPB buffer. Intracellular accumulation of ruthenium after
ECT with KP418 was dependent on electric field strength and
correlated well with decrease in cell viability. Similar results
were obtained with CDDP (Fig. 3). Taken all together, we
assume that higher cytotoxicity of ECT in NaCl could be due
to the known fact that both compounds are more stable in
NaCl than in NaPB. It was shown that low concentration of
chloride ions leads to formation of reactive hydrolyzed CDDP
products which bind promptly and irreversibly to cell membrane phospholipids (Speelmans et al. 1996). These molecules do not exert cytotoxic effect, but are anyway measured
with ICP-MS as cellular CDDP which fully explain the
1245
Electrochemotherapy with KP418 In Vitro
Fig. 3 The influence of electroporation buffer (NaCl, NaPB) and
electric field strength on platinum (Pt) intracellular accumulation
(histogram) and cell viability (plots) after ECT with 50 lM CDDP
(ECT CDDP) in vitro. 100 % cell viability represents the viability of
the untreated control group (C). Data points represent the mean values
± SD; aßvd indicates data point significantly different from defined
groups (p \ 0.05): a – ECT CDDP NaCl versus C, EP NaCl, and ECT
CDDP NaPB; ß – ECT CDDP NaPB versus C and EP NaPB; v – EP
NaPB and EP NaCl versus C; d – ECT CDDP NaCl and ECT CDDP
NaPB vs. C
results we obtained. In ECT CDDP at electric fields above
1,000 V/cm cell viability reaches its plateau which is probably due to the low subcytotoxic CDDP concentration and the
fact that only 5–10 % of covalently bound CDDP in cells
binds to DNA exerting its cytotoxic effect (Cepeda et al.
2007). Another interesting observation at electric fields above
1,000 V/cm is decrease in intracellular Pt. Irreversible electroporation causes leaking of unbound CDDP which is not
observed in case of KP418 due to different pattern of binding
to cellular proteins already observed in vitro and also in ECT
in vivo (Hudej et al. 2010). Detailed study by Heffeter et al.
also revealed that majority of ruthenium KP compounds bind
to high molecular weight cytosolic proteins while majority of
cisplatin bind to low molecular weight cytosolic proteins
(Heffeter et al. 2010).
Our results show that 0.9 % NaCl can be used as an
electroporation solution as it does not affect the electrical
field threshold for irreversible electroporation but it
increases the cytotoxicity of ECT with both tested compounds. We showed that KP418 is a compound with
hampered transmembrane transport and that its cytotoxic
effect can be potentiated by reversible electroporation
achieved at 800 V/cm in NaCl solution. In addition, we
showed that cytotoxicity of a compound alone exposed to
electric field at 800 V/cm does not change (data not shown)
which is an additional confirmation that the electroporation-enhanced drug cytotoxicity is due to its effect on cells
and not on KP418. Based on these results next experiments
in vitro were performed with electroporation solution NaCl
and electric field strength applied at 800 V/cm.
The applicability of KP418 for ECT was first evaluated by
determining its cytotoxic effect in three different tumor cell
lines in vitro. Cells were exposed to different concentrations of KP418 alone or in a combination with reversible
electroporation. Eight rectangular unipolar pulses with
100 ls duration were applied with the repetitive frequency
1 Hz. The optimal electrical field strength for reversible
electroporation in 0.9 % NaCl was determined to be
800 V/cm for B16-F1 cells and we used the same electric
field strength for the other two cell lines (B16–F10, SA–1)
as it was shown previously that electropermeabilization of
these cells is achieved at electrical fields already above
600 V/cm (Cemazar et al. 1998). However, ECT and EP
effects are dependent on cell size and cell type, as well as
on intrinsic sensitivity of cells to the chemotherapeutic
drug (Cemazar et al. 1998; 2001; Pucihar et al. 2006), thus
the effectiveness of ECT is not dependent only on electrical
parameters, but it depends also on types of tumor cells
used. The difference in sensitivity of B16 and SA-1 cells to
ECT with CDDP has already been shown using clonogenic
assay as a measure of ECT cytotoxicity (Cemazar et al.
2001). CDDP was used in our experiments in order to
compare the effect of KP418 with relevant chemotherapeutic agent used for ECT in the clinics.
Our results demonstrated that KP418 itself is not cytotoxic up to 1000 lM for the three cell lines tested. On the
other hand, statistically significant increase of KP418 cytotoxicity was achieved after only 5 min incubation time with
1,000 lM KP418 in combination with electroporation (ECT
KP418) (Fig. 4a, c, e). Electroporation did not increase the
cytotoxicity of KP418 in SA-1 cells (Fig. 4a) but it did
increase it in B16–F1 and B16–F10 cells (IC50 = 600 lM)
(Fig. 4c, e). In case of CDDP electroporation increased its
cytotoxicity in SA–1 cells (IC50 = 200 lM), proving that
electropermeabilization of SA–1 cells was indeed achieved,
however, the increase was more prominent in B16–F1 cells
(IC50 = 70 lM) (Fig. 4b, d). Comparison of cytotoxicity of
both tested compounds in B16–F1 cells revealed that KP418
is less cytotoxic than CDDP whether in combination with or
without electroporation (IC50 ECT KP418 = 600 lM vs. IC50
ECT CDDP = 70 lM; Fig. 4c, d). The B16F1 cell survival at
1,000 lM of KP418 differed between the experiments,
which is most probably due to the different experimental
protocols.
Metastatic Potential of Cells In Vitro
In anticancer treatment there is a certain possibility that not
all treated cancer cells are successfully eliminated. For a
treatment to be safe the remaining cells after the treatment
must not metastasize. A combination of three assays
123
1246
Fig. 4 KP418 (a, c, e) and CDDP (b, d) cytotoxicity in the cell lines
SA-1 (a, b), B16-F1 (c, d) and B16-F10 (e) in vitro. Dose–response
curves for KP418 or CDDP treatment with exposure time of 5 min
and 60 min, and for ECT treatment and 5 min exposure time (ECT
KP418 5 min, ECT CDDP 5 min; electroporation parameters: 800
V/cm, 8 9 100 ls, 1 Hz). Cell viability was determined 72 h after the
treatment by the MTS assay. Data points represent mean values ± SD
of three independent experiments; *p \ 0.05 versus control group
in vitro, namely invasion, resistance to detachment, and readhesion, can be used to evaluate the metastatic properties
of tumor cells in vivo (Bergamo et al. 2009). We performed
all three assays using cells that survived treatment with the
compound alone, the electroporation alone or a combination of both. In addition to KP418, the ruthenium(III)
123
compound NAMI-A was tested, as it is known to have
antimetastatic effect (Sava et al. 2003). The compounds
tested were applied at 100 lM concentration. This is the
subcytotoxic concentration of KP418 when in combination
with electroporation. In addition, this concentration of
NAMI-A was used in previous studies where it was shown
that antimetastatic properties are absent at lower concentrations of NAMI-A in vitro (Zorzet et al. 2000; Gava et al.
2006).
With the three assays, we determined the effect of ECT
with ruthenium compounds KP418 and NAMI-A on cell
metastatic potential in vitro. The results confirm the
observations from Todorovic et al. (2011), (2012) showing
that electroporation has no significant influence on metastatic potential of cells. We observed slight, however, not
statistically significant decrease in cells resistance to
detachment after EP, while no influence on re-adhesion and
invasion of cells after EP was observed. Similarly, no
effect was observed after NAMI-A treatment alone
(NAMI-A) or in combination with electroporation (ECT
NAMI-A). Gava et al. reported that incubation of adherent
B16-F10 cells with 100 lM NAMI-A for 1 h significantly
reduced invasion up to 85.8 % (Gava et al. 2006). However, the results should not be compared directly as the
incubation time in our experiments was much lower
(5 min) and cells were not adherent. The latter might be an
important factor as one of the main active sites of NAMI-A
is supposed to be collagen in extracellular matrix which is
not present on the trypsinized cells in suspension (Sava
et al. 2003).
It was already shown that KP418 is virtually devoid of
effects in similar assays in vitro (Bergamo et al. 2009). Our
results from the three assays performed are in accordance
with results from Bergamo. In addition, we showed that
subcytotoxic concentrations of KP418 in combination with
electroporation (ECT KP418) also did not affect the
invasive potential of cells as there was no significant difference between ECT KP418-treated cells and EP treated
cells in any of the three assays performed (Fig. 5). Overall,
our results showed that neither EP alone nor ECT with
NAMI-A or KP418 affected metastatic potential of cells
in vitro.
Electrochemotherapy In Vivo
To determine the antitumor effect of electrochemotherapy
with KP418 we continued the study in two different tumor
models in vivo, namely murine fibrosarcoma SA-1 and
murine melanoma B16-F1, by measuring tumor growth
after the treatment. In addition to KP418 we performed the
1247
Fig. 5 The change in cell resistance to detachment (a), invasion
ability (b) and re-adhesion ability (c) of B16-F10 cells that survived
treatment with a tested compound alone (5 min: 100 lM NAMI-A,
100 lM KP418), electroporation alone (EP: 800 V/cm, 8 9 100 ls, 1
Hz) or combined treatment (ECT 5min) was determined in relation to
control group of untreated cells (C) for which invasion was defined as
100 %. The cells were incubated for 24 h to allow invasion through
Matrigel and porous membrane and the amount of invaded cells was
determined spectrophotometrically after crystal violet staining. Data
points represent the mean values of three independently repeated
experiments ± SD; *p \ 0.05. versus control group (C)
123
1248
Fig. 6 Tumor growth curves representing antitumor effect of ECT
with KP418 (ECT KP418) in comparison with ECT with CDDP (ECT
CDDP) in two murine tumor models in vivo, SA-1 (a, b) and B16-F1
(c). Data points represent the mean values of all animal tumors ± SD;
*p \ 0.05 versus control group. Dashed lines represent the complete
responses (CR)—complete tumor eradication with no recurrence 100
days after the treatment
experiment also with equimolar concentrations of CDDP to
compare and evaluate the results of the tested compound
with a drug already used in the clinics. Both compounds
were applied systemically (i.v.). Tumors were measured
three times weekly using a digital caliper until tumors
reached 300 mm3 whereupon mice were humanely
euthanized.
Treatments with KP418 alone or in combination with
electroporation (ECT KP418) did not influence tumor
growth kinetics (Fig. 6a, c). On the other hand, ECT with
CDDP treatment caused dose-dependent tumor growth
delay in both tumor models used (Fig. 6b, c). Our results
are in good correlation with previous study. Cemazar et al.
obtained 10.3 days of growth delay after ECT with CDDP
(4 mg/kg) in SA-1 tumors (Cemazar et al. 1999) while we
obtained 7.5 days of growth delay and additional 5.9 %
complete regression after ECT with CDDP (3.9 mg/
kg = 2.6 mM CDDP, 100 ll). Comparing the response of
ECT CDDP treatment in two different tumor models
revealed that ECT CDDP is more effective in SA-1 than in
B16-F1 tumors. ECT with the highest dose of CDDP used
(5.2 mM = 7.8 mg/kg) resulted in a statistically significant
tumor growth delay calculated from tumor doubling time:
11.5 days and 5.5 days in SA-1 and B16-F1, respectively.
Additionally, three mice out of sixteen (18.8 %) were in
complete regression in case of SA-1 tumors (Fig. 6b).
However, in previous study Sersa et al. already compared
ECT CDDP tumor response between SA-1 and B16-F1
tumor models and observed no significant difference.
Similarly to experiments in vitro different effect of ECT on
different tumor models is observed often in experiments
in vivo (Sersa et al. 1994). The clinical data also support
the differential sensitivity of tumors to ECT, according to
their histology and tumor size (Mali et al. 2013a; 2013b).
Taking into account, the result from in vitro study where
IC50 for ECT KP418 was as high as 1,000 lM there is a
123
possibility that the effective concentration of KP418 in
tumors in vivo was not even reached. Comparison of these
results with our results from previous similar studies shows
distinct difference between KP418 and KP1339 effectiveness in ECT (Hudej et al. 2010). However, this can be
explained with the difference in intrinsic properties of the
two compounds. The increased accumulation of KP1339
found in SA-1 tumors as long as 48 h after the treatment
with KP1339 alone and even more pronounced when in
combination with electroporation was supposed to be due
to synergistic effect of KP1339 ability to cross cell membrane itself and its intrinsic cytotoxicity after 1 h incubation time on SA-1 cells in vitro (IC50 = 100 lM), its fast
and reversible binding to serum albumin, EPR effect
(Enhanced Permeability and Retention effect) and vascular
lock caused by electroporation (Sersa et al. 2002). All
mentioned leads to prolonged transmembrane transport of
compound during vascular-lock effect (Hudej et al. 2010).
On the contrary, KP418 binds to serum proteins slowly (in
hours) and as such cannot accumulate in tumors due to
EPR effect. It also cannot pass cell membrane itself
(Kapitza et al. 2005). Consequently it cannot exert its
activity during vascular lock and when the reversibly
electroporated cells reseal.
Negative effects of serum protein binding and vascular
lock can be overcome by local intratumoral administration
of a drug (Brincker 1993). In this way higher antitumor
activity is achieved in ECT with CDDP (Cemazar et al.
1995) and we suppose it might increase also the effectiveness of ECT with KP418. However, in accordance with
EU 3R strategy in animal experimentation and the lack of
significant effect of KP418 in vitro and in vivo compared to
effects caused by CDDP, further experiments with i.t.
administration of KP418 were not anticipated.
As KP418 was shown to be particularly active in colorectal cancers this result might suggest that KP418 targets
some specific molecule diferentialy expressed in different
cell types. Electroporation might be useful to increase the
anticancer activity of drugs provided that the tested tumors
express the target(s) for these drugs. In this context it
would be interesting to repeate experiments on colorectal
tumor models in vitro and in vivo where KP418 was shown
to be extremely potent (Berger et al. 1989; Seelig et al.
1992).
Conclusion
Ruthenium(III) compound KP418 cannot pass intact cell
membranes readily. We showed that higher intracellular
concentration of KP418 can be achieved by means of
reversible electroporation in vitro and this correlates well
with increased cytotoxicity of the compound in B16-F1 cell
1249
line in vitro. ECT with KP418 is cytotoxic for B16-F1 and
B16-F10 cells but not for SA-1 cells in vitro. Similarly,
ECT with CDDP was more cytotoxic for B16-F1 cells than
SA-1 cells. The difference in ECT effectiveness among cell
lines observed is a consequence of variable effectiveness of
ECT on different cell types (Cemazar et al. 1998). We also
showed that metastatic potential of cells that survived ECT
with KP418 or NAMI-A was not affected. Their ability to
resist detachment, their invasiveness and re-attachment
were not affected by ECT with KP418 nor NAMI-A
in vitro. However, these results are not sufficient to prove
that any of the treatments tested is devoid of metastasis
promotion in in vivo models.
ECT with up to 20.8 mM KP418 applied i.v. had no
antitumor effect on B16-F1 and SA-1 murine tumor models
in vivo. Based on the results in vitro, where IC50 for ECT
KP418 was as high as 1,000 lM, we speculate that the
effective concentration of KP418 was not achieved in
tumor cells in vivo. ECT with CDDP i.v. caused tumor
growth delay for both tumor models and also 18.8 %
complete responses in case of SA-1 tumors, which is in
accordance with the previous studies (Cemazar et al. 1999).
Taken all together, electroporation can increase in vitro
cytotoxicity of KP418 but its effectiveness in vitro and
in vivo is still lower than the effectiveness of chemotherapeutic already used in ECT in clinics, namely CDDP.
Acknowledgments The authors acknowledge the financial support
received from the State budget by the Slovenian Research Agency
(ARRS) for programmes No. P1-0175, P2-0249, P3-0003, project J14131 and junior researcher grants for R.H. The authors would also
like to acknowledge that all the experimental work related to metastatic potential of cells was performed at the Callerio Fundatione in
Trieste under the supervision of dr. Gianni Sava and dr. Alberta
Bergamo and with the help of their researches. The authors are also
thankful to Dr. M. Jakupec (University of Vienna) for critical reading
of the manuscript. This work was supported by COST D39 and COST
CM1105, in particular by a short-term scientific mission for R.H.
References
Antonarakis ES, Emadi A (2010) Ruthenium-based chemotherapeutics:
are they ready for prime time? Cancer Chemoth Pharm 66:1–9
Bergamo A, Masi A, Jakupec MA, Keppler BK, Sava G (2009)
Inhibitory effect of the ruthenium complex KP1019 in models of
mammary cancer cell migration and invasion. Met-Based Drugs.
doi:10.1155/2009/681270
Berger MR, Garzon FT, Keppler BK, Schmähl D (1989) Efficacy of
new ruthenium complexes against chemically induced autochthonous colorectal carcinoma in rats. Anticancer Res 9:761–766
Bicek A, Turel I, Kanduser M, Miklavcic D (2007) Combined therapy
of the antimetastatic compound NAMI-A and electroporation on
B16F1 tumour cells in vitro. Bioelectrochemistry 71:113–117
Brincker H (1993) Direct intratumoral chemotherapy. Crit Rev Oncol
Hemat 15:91–98
Cemazar M, Miklavcic D, Vodovnik L, Jarm T, Rudolf Z, Stabuc B,
Cufer T, Sersa G (1995) Improved therapeutic effect of
123
1250
electrochemotherapy with cisplatin by intratumoral drug administration and changing of electrode orientation for electropermeabilization on EAT tumor model in mice. Radiol Oncol
29:121–127
Cemazar M, Jarm T, Miklavcic D, Macek Lebar A, Ihan A, Kopitar
NA, Sersa G (1998) Effect of electric field intensity on
electropermeabilization and electrosensitivity of various tumorcell lines in vitro. Electro Magnetobiol 17:263–272
Cemazar M, Miklavcic D, Scancar J, Dolzan V, Golouh R, Sersa G
(1999) Increased platinum accumulation in SA-1 tumor cells
after in vivo electrochemotherapy with cisplatin. Br J Cancer
79:1386–1391
Cemazar M, Parkins CS, Holder AL, Chaplin DJ, Tozer GM, Sersa G
(2001) Electroporation of human microvascular endothelial
cells: evidence for an anti-vascular mechanism of electrochemotherapy. Brit J Cancer 84:565–570
Cepeda V, Fuertes MA, Castilla J, Alonso C, Quevedo C, Pérez JM
(2007) Biochemical machanisms of cisplatin cytotoxicity. Anticancer Agents Med Chem 7:3–18
Corovic S, Lackovic I, Sustaric P, Sustar T, Rodic T, Miklavcic D
(2013) Modeling of electric field distribution in tissues during
electroporation. Biomed Eng Online 12:16
Edhemovic I, Gadzijev EM, Brecelj E, Miklavcic D, Kos B, Zupanic
A, Mali B, Jarm T, Pavliha D, Marcan M, Gasljevic G, Gorjup
V, Music M, Pecnik Vavpotic T, Cemazar M, Snoj M, Sersa G
(2011) Electrochemotherapy: a new technological approach in
treatment of metastases in the liver. Technol Cancer Res Treat
10:475–485
Gava B, Zorzet P, Spessotto P, Cocchietto M, Sava G (2006)
Inhibition of B16 melanoma metastases with the ruthenium
complex imidazolium trans-imidazoledimethylsulfoxide-tetrachlororuthenate and down-regulation of tumor cell invasion.
J Pharmacol Exp Ther 317(1):284–291
Haberl S, Miklavcic D, Sersa G, Frey W, Rubinsky B (2013) Cell
membrane electroporation—Part 2: The applications. IEEE
Electr Insul M 29(1):29–37
Hartinger CG, Jakupec MA, Zorbas-Seifried S, Groessl M, Egger A,
Berger W, Zorbas H, Dyson PJ, Keppler BK (2008) KP1019, a
new redox-active anticancer agent-preclinical development and
results of a clinical phase I study in tumor patients. Chem
Biodivers 5:2140–2155
Heffeter P, Böck K, Atil B, Hoda MAR, Körner W, Bartel C,
Jungwirth U, Keppler BK, Micksche M, Berger W, Koellensperger G (2010) Intracellular protein binding patterns of the
anticancer ruthenium drugs KP1019 and KP1339. J Biol Inorg
Chem 15:737–748
Heller R, Gilbert R, Jaroszeski MJ (2000) Clinical trials for solid
tumors using electrochemotherapy. In: Electrochemotherapy,
Electrogenetherapy, and Transdermal Drug Delivery. Electrically Mediated Delivery of Molecules to Cells. Jaroszeski MJ,
Heller R and Gilbert R (eds.). New Jersey: Humana Press,
pp. 137-156
Hudej R, Turel I, Kanduser M, Scancar J, Kranjc S, Sersa G,
Miklavcic D, Jakupec MA, Keppler BK, Cemazar M (2010) The
influence of electroporation on cytotoxicity of anticancer ruthenium(III) complex KP1339 in vitro and in vivo. Anticancer Res
30:2055–2064
Hudej R, Kljun J, Kandioller W, Repnik U, Turk B, Hartinger CG,
Keppler BK, Miklavcic D, Turel I (2012) Synthesis and
Biological Evaluation of the Thionated Antibacterial Agent
Nalidixic Acid and its Organoruthenium(II) Complex. Organometallics 31:5867–5874
Jaroszeski MJ, Dang V, Pottinger C, Hickey J, Gilbert R, Heller R
(2000) Toxicity of anticancer agents mediated by electroporation
in vitro. Anti-Cancer Drug 11:201–208
123
Kapitza S, Pongratz M, Jakupec MA, Heffeter P, Berger W,
Lackinger L, Keppler BK, Marian B (2005) Heterocyclic
complexes of ruthenium(III) induce apoptosis in colorectal
carcinoma cells. J Cancer Res Clin Oncol 131:101–110
Kersten L, Bräunlich H, Keppler BK, Gliesing C, Wendelin M,
Westphal J (1998) Comparative nephrotoxicity of some antitumour-active platinum and ruthenium complexes in rats. J Appl
Toxicol 18:93–101
Kljun J, Petricek S, Zigon D, Hudej R, Miklavcic D, Turel I (2010)
Synthesis and Characterization of Novel Ruthenium(III) Complexes with Histamine. Bioinorg Chem Appl 183097:1–6
Mali B, Jarm T, Snoj M, Sersa G, Miklavcic D (2013a) Antitumor
effectiveness of electrochemotherapy: a systematic review and
meta-analysis. Eur J SurgOncol 39:4–16
Mali B, Miklavcic D, Campana LG, Cemazar M, Sersa G, Snoj M,
Jarm T (2013b) Tumor size and effectiveness of electrochemotherapy. Radiol Oncol 47:32–41
Marty M, Sersa G, Garbay JR, Gehl J, Collins CG, Snoj M, Billard V,
Geertsen PF, Larkin JO, Miklavcic D (2006) Electrochemotherapy—an easy, highly effective and safe treatment of cutaneous
and subcutaneous metastases: results of ESOPE (European
Standard Operating Procedures of Electrochemotherapy) study.
Eur J Cancer (Suppl 4): 3-13
Miklavcic D, Snoj M, Zupanic A, Kos B, Cemazar M, Kropivnik M,
Bracko M, Pecnik T, Gadzijev E, Sersa G (2010) Towards
treatment planning and treatment of deep-seated solid tumors by
electrochemotherapy. Biomed Eng Online 9:10
Miklavcic D, Sersa G, Brecelj E, Gehl J, Soden D, Bianchi G,
Ruggieri P, Rossi CR, Campana LG, Jarm T (2012) Electrochemotherapy: technological advancements for efficient electroporation-based treatment of internal tumors. Med Biol Eng Comput
50:1213–1225
Miklavcic D, Mali B, Kos B, Heller R, Sersa G (2014) Electrochemotherapy: from the drawing board into medical practice.
Biomed Eng Online 13:29
Mir LM, Gehl J, Sersa G, Collins CG, Garbay JR, Billard V, Geertsen
PF, Rudolf Z, O’Sullivan GC, Marty M (2006) Standard
operating procedures of the electrochemotherapy: instructions
for the use of bleomycin or CDDP administered either systemically or locally and electric pulses delivered by the CliniporatorTM by means of invasive or non-invasive electrodes. Eur J
Cancer 4:14–25
Orlowski S, Belehradek J Jr, Paoletti C, Mir LM (1988) Transient
electropermeabilization of cells in culture: increase of the cytotoxicity of anticancer drugs. Biochem Pharmacol 37(24):4727–4733
Pavliha D, Kos B, Marcan M, Zupanic A, Sersa G, Miklavcic D (2013a)
Planning of electroporation-based treatments using web-based
treatment-planning software. J Membrane Biol 246:833–842
Pavliha D, Music MM, Sersa G, Miklavcic D (2013b) Electroporationbased treatment planning for deep-seated tumors based on automatic liver segmentation of MRI images. PLoS ONE 8(8):e69068
Pucihar G, Kotnik T, Valic B, Miklavcic D (2006) Numerical
determination of transmembrane voltage induced on irregularly
shaped cells. Annals Biomed Eng 34:642–652
Sava G, Zorzet S, Turrin C, Vita F, Soranzo MR, Zabucchi G,
Cocchietto M, Bergamo A, DiGiovine S, Pezzoni G, Sartor L,
Garbisa S (2003) Dual action of NAMI-A in inhibition of solid
tumor metastasis: selective targeting of metastatic cells and
binding to collagen. Clin Cancer Res 9:1898–1905
Seelig MH, Berger MR, Keppler BK (1992) Antineoplastic activity of
three ruthenium derivatives against chemically induced colorectal carcinoma in rats. J Cancer Res Clin Oncol 118:195–200
Sersa G, Cemazar M, Miklavcic D, Mir LM (1994) Electrochemotherapy: variable anti-tumor effect on different tumor models.
Bioelectrochem Bioenerg 35:23–27
Sersa G, Cemazar M, Miklavcic D (1995) Antitumor effectiveness of
electrochemotherapy with cis-diamminedichloroplatinum(II) in
mice. Cancer Res 55:3450–3455
Sersa G, Krzic M, Sentjurc M, Ivanusa T, Beravs K, Kotnik V, Coer
A, Swartz HM, Cemazar M (2002) Reduced blood flow and
oxygenation in SA-1 tumours after electrochemotherapy with
cisplatin. Brit J Cancer. 87:1047–1054
Sersa G, Miklavcic D, Cemazar M, Rudolf Z, Pucihar G, Snoj M
(2008) Electrochemotherapy in treatment of tumours. Eur J Surg
Oncol 34:232–240
Speelmans G, Sips WHHM, Grisel RJH, Staffhorst RWHM, FichtingerSchepman AMJ, Reedijk J, de Kruijff B (1996) The interaction of
the anti-cancer drug cisplatin with phospholipids is specific for
negatively charged phospholipids and takes place at low chloride
ion concentration. Biochim Biophys Acta 1283:60–66
1251
Spugnini EP, Citro G, Porrello A (2005) Rational design of new
electrodes for electrochemotherapy. J ExpClin Cancer Res
24(2):245–254
Todorovic V, Sersa G, Mlakar V, Glavac D, Flisar K, Cemazar M
(2011) Metastatic potential of melanoma cells is not affected by
electrochemotherapy. Melanoma Res 21:196–205
Todorovic V, Sersa G, Mlakar V, Glavac D, Cemazar M (2012)
Assessment of the tumourigenic and metastatic properties of SKMEL28 melanoma cells surviving electrochemotherapy with
bleomycin. Radiol Oncol 46(1):32–45
Zorzet S, Bergamo A, Cocchietto M, Sorc A, Gava B, Alessio E,
Iengo E, Sava G (2000) Lack of in vitro cytotoxicity, associated
to increased G2-M cell fraction and inhibition of matrigel
invasion, may predict in vivo-selective antimetastasis activity of
ruthenium complexes. JPET 295(3):927–933
123

relazione scientifica 2014

Transcription

Similar documents

Dmitrii Ivolgin. Centre of Regenerative Medicine Organization on the

IJCA 44A(8) 1565

L`approccio neurochirurgico nelle lesioni midollari del

Pressures generated in vitro during Stabident intraosseous

– a) Esame macroscopico

26th September 19

Silica Nanoparticles: nano

097 - 128 (Dozza)

Antibacterial Efficiency of Nanofiber Membranes with Biologically

FOXP3 - SIES

kuliah limfatik darah BS2

Europass Curriculum Vitae - MONALISA

I tumori emolinfopoietici – classificazione

Liposomes for siRNA delivery