16 al 18 de Noviembre del 2014
Transcription
16 al 18 de Noviembre del 2014
16 al 18 de Noviembre del 2014 Hotel “13 de Julio”, Mar del Plata. 9 de Julio 2777. Provincia de Buenos Aires. Autoridades de la Sociedad Argentina de Protozoología Presidente: Dr. Esteban Serra Vicepresidente: Dr. Alejandro Schijman Secretaria: Dra. Miriam Postan Prosecretaria: Dra. Silvina Wilkowsky Tesorera: Dra. Pamela Cribb Protesorero: Dr. Guillermo Daniel Alonso Vocales titulares: Dras. María Cristina Paveto y Julia Cricco Vocales suplentes: Dras. Alejandra C. Schoijet e Isabel Nocito Comité Organizador: Comité Científico: Presidente: Dr. Sergio O. Angel Presidente: Dra. Adriana Gruppi Miembros: Dra. Natalia de Miguel Miembros: Dr. Luis Alvárez Dra. María Corvi Dra. Patricia Romano Dra. Verónica Cóceres Dr. Pablo Gargantini Dra. Laura Vanagas Dr. Alejandro Schijman Dra. Andrea Cumino Dra. Ana Rosa Pérez Dra. Silvia Moreno Dra. Laura Chiapello Dra. Alicia Saura Dra. Patricia Juárez Dr. Ricardo Fretes Dra. Mara Rosenzvit AGRADECEMOS A NUESTROS AUSPICIANTES Consejo nacional de Investigaciones Científicas y Técnicas (CONICET) Comisión de Investigaciones Científicas (CIC) Agencia Nacional de Promoción Científica y Tecnológica (AGENCIA) Fundación Bunge & Born Natocor Embiotec Microlat Lovob Migliore Laclaustra Cienlab Elea SIGMA Biogénesis Bagó Villa del Sur Mundo Sano CRONOGRAMA Day 1 Day 2 Day 3 8.00 – 9.45 9.00 – 9.45 9.00 – 10.00 RECEPTION / INSCRIPTIONS MINICONFERENCE: Ariel Silber CONFERENCE: Silvia Moreno 9.45 – 10.15 COFFEE 9.45 – 10.15 COFFEE 10.00 – 10.30 COFFEE 10.15 – 11.45 10.15 – 11.45 10.30 – 11.45 SYMPOSIUM I: Advances in the treatment of parasitic diseases SYMPOSIUM II: Parasites of veterinary interest SYMPOSIUM V: Vectors SYMPOSIUM VII: Immune response to parasitic infections 12.00 – 13.00 hs OPENING CONFERENCE: Boris Striepen LUNCH SYMPOSIUM VI: Molecular and Cellular Biology SYMPOSIUM VIII: Parasite : host interaction 12.00 – 13.15 hs 12.00 – 13.00 hs MINICONFERENCE: Robert Hirt CLOSURE Conference: Hugo Lujan MINICONFERENCE: Andrew Tobin LUNCH LUNCH 14.30 – 15.15 hs 14.30 – 15.15 hs MINICONFERENCE: Gustavo Salinas MINICONFERENCE: Sergio Schenkman COFFEE: 15.15 – 15.45 hs 16.00 – 17.30 SYMPOSIUM III: Signaling in protozoan parasites COFFEE: 15.15 – 15.45hs 16.00 – 17.30 SYMPOSIUM IV: Molecular epidemiology in Trypanosoma cruzi SAP Internal Meeting 17.45 – 18.45 17.45 – 18.45 CONFERENCE: Barbara Papadopoulou CONFERENCE: Manuel Fresno 14.30 – 15.45 hs SYMPOSIUM IX: Diagnostic innovation in congenital Chagas Awards: 16.00 –16.15hs 19.00 – 20.30 19.00 – 20.30 POSTERS SESION: DIVERSE TOPICS POSTERS SESION: DIVERSE TOPICS …….. CONFERENCES SAP X Congress Mar del Plata 2014 CONFERENCES OPENING CONFERENCE: Boris Striepen CELL DIVISION IN APICOMPLEXAN PARASITES 6 OP Maria Francia1, Michael Cipriano1, Sumiti Vinayak1, Carrie Brooks1, Elena Suvrova2, Michael White2, and Boris Striepen1 1 Center for Tropical and Emerging Global Diseases & Department for Cellular Biology, University of Georgia, Athens, GA 30602, USA, striepen@uga.edu 2 Departments of Molecular Medicine & Global Health and the Florida Center for Drug Discovery and Innovation, University of South Florida, Tampa, FL 33612 Apicomplexan parasites are a major threat to the health of humans and their domestic animals. We are using Toxoplasma gondii as a genetic model to dissect parasite cell biology and metabolism. These parasites and many of their apicomplexan relatives undergo a complex developmental process in the cells of their hosts, which includes genome replication, cell division and the assembly of new invasive stages. Apicomplexan cell cycle progression is both globally and locally regulated. Global regulation is carried out throughout the cytoplasm by diffusible factors that include cell cycle-specific kinases, cyclins and transcription factors. Local regulation acts on individual nuclei and daughter cells that are developing inside the mother cell. We propose that the centrosome is a master regulator that physically tethers cellular components and that provides spatial and temporal control of apicomplexan cell division. We will describe a series of genetic and cell biological studies that demonstrate the molecular components of several of these tethers, and unravel the unique architecture and remarkable complexity of the apicomplexan cell division machinery. Coordination: Silvia Moreno CONFERENCE I Barbara Papadopoulou C01 MECHANISMS OF RNA DEGRADATION AND TRANSLATIONAL CONTROL IN THE PROTOZOAN PARASITE Leishmania Barbara Papadopoulou*, Prasad K. Padmanabhan, Hiva Azizi, Mukesh Samant, Ouafa Zghidi-Abouzid, Serge Cloutier, Karen Santos Charret, Larissa Mélo do Nascimento, Carole Dumas Research Center in Infectious Disease, CHU de Quebec Research Center (CHUL) and Department of Microbiology and Immunology, Laval University, Quebec, Canada Regulation of gene expression in Leishmania, an evolutionary early-branched unicellular parasitic protozoan, occurs almost exclusively post-transcriptionally. We have reported previously that the Leishmania genome is full of truncated versions of formerly active retroposons, SIDERs (Short Interspersed DEgenerate Retroposons), that are located mainly within 3'-untranslated regions and participate in distinct RNA networks. Members of the SIDER2 subfamily promote rapid mRNA degradation by a novel mechanism involving endonucleolytic cleavage without prior deadenylation. Primer extension analysis and RNase protection assays mapped the putative endonucleolytic cleavage site within the second conserved 79-nt SIDER2 signature sequence. Deletion and site-directed CONFERENCES 7 mutagenesis studies highlighted the importance of secondary structure in the SIDER2mediated decay process. To identity protein factors involved in this process, we used an optimized MS2 tethering approach with reporter transcripts harboring or not SIDER2, and we are currently investigating few selected SIDER2-interacting RNA-binding protein candidates. We have reported recently that conditions of reduced translation upon stress and druginduced apoptosis trigger fragmentation of antisense ribosomal RNA (rRNA) correlating with rRNA breakdown and translation inhibition. We found that this newly discovered process is tightly regulated by at least two RNA-binding proteins, a 67 kDa ATP-dependent DEAD-box RNA helicase (HEL67), which through its binding to both sense and antisense rRNAs protects rRNA from degradation by preventing antisense rRNA cleavage, and a 25 kDa RNA-binding protein (RBP25) that interacts with HEL67 to coordinate the parasite response to stress. Extensive phenotypic analysis of a Leishmania HEL67(-/-) null mutant demonstrated that HEL67 is a key regulator of the response to intracellular stress, and is therefore essential for amastigote survival within macrophages. Our findings support a model where HEL67 protects the parasite from reactive oxygen species (ROS) generated following oxidative phosphorylation in the mitochondrion or upon oxidative stress. While the lack of HEL67 increases dramatically the sensitivity of the parasite to stress, the opposite was observed with the RBP25(-/-) null mutant. Additional studies are now underway to determine the interplay between HEL67 and RBP25 in coordinating the response to stress. Another way Leishmania uses to control translation levels under stress is by phosphorylating the translation initiation factor 2 (eIF2) on its alpha-subunit. We recently identified a novel mechanism of eIF2alpha developmental regulation initiated by a Nterminal methionine excision to allow high levels of translation in the rapidly dividing promastigote form. While amastigotes produce a single eIF2alpha product of 47kDa, additional products of 41, 35, and 25 kDa are detected in promastigotes. Deletion and mutagenesis studies showed that the 94-aa N-terminal extension of eIF2alpha (unique to trypanosomatids) plays a central role in eIF2alpha differential processing through the action of methionine aminopeptidases. Interestingly, although the 47kDa protein is poorly phosphorylated in promastigotes, the 35 kDa sub-product (no functional in translation) seems to be highly phosphorylated. We are currently investigating whether phosphorylation of the 35 kDa product sequesters the regulatory sub-complex of the eIF2B GDP-GTP exchange factor, hence allowing a more efficient binding of the catalytic eIF2B sub-complex to eIF2 to increase ternary complex formation and translation initiation. Coordination: Jacqueline Bua CONFERENCE II Manuel Fresno C02 METABOLOMIC ANALYSIS OF T. cruzi INFECTION: INVOLVEMENT OF L-ARGININE METABOLISM IN THE IMMUNOPATHOGENESIS OF CHAGAS’ DISEASE Manuel Fresno, Sofia Carbajosa, Henar Cuervo, Nestor A. Guerrero, Hector O. Rodriguez and Nuria Gironès. Centro de Biologia Molecular. CSIC-UAM, Universisdad Autonoma de Madrid, Spain CONFERENCES 8 Chagas disease, caused by the protozoan parasite Trypanosoma cruzi, affects several million people in Latin America. Myocarditis, observed in the acute and chronic phases of the disease, is characterized by a mononuclear cell inflammatory infiltrate. Different types of T lymphocytes, Th1, Treg and Th17, and myeloid cells infiltrate the heart depending of the strain of mice. We identified CD11b(+) myeloid cells infiltratring the heart and other organs and analyzed their phenotype and function. Purified CD11b(+)Ly6G(-) cells, but not Ly6G(+) cells, showed a predominant monocytic phenotype, expressed arginase I and inducible NO synthase, and suppressed T cell proliferation in vitro by an NO-dependent mechanism, activity that best defines myeloid-derived suppressor cells (MDSCs). Contrarily, CD11b(+)Ly6G(+) cells, but not CD11b(+)Ly6G(-) cells, expressed S100A8 and S100A9, proteins known to promote recruitment and differentiation of MDSCs Besides, we have analyzed the presence of those cells in the heart of mice infected with different strains of T.cruzi belonging to all 6 different DTUs. We found that the amount of those MDSC infiltrating the hearts of infected mice varied among infecting strains. Interestingly, the extent of infiltrating MDSCs correlated with the extent and type of cardiac damage. By global metabolomic analysis we found important alterations of the L-Arginine metabolism both in plasma and heart resulting in plasma L-arginine depletion in the acute phase of infection that was coincident in time with the appearance of MDSCs. This suggests that in vivo arginase I could be contributing to L-arginine depletion and systemic immunosuppression. More notably, L-arginine supplementation decreased parasite replication and improve symptom and survival of infected mice suggesting that sustained arginase expression is detrimental for the host. Mechanistically, this was mostly due to increasing INOS activity and tripanocidal activity of myeloid cells Coordination: Adriana Gruppi CONFERENCE III Silvia Moreno C03 CALCIUM SIGNALING AND THE LYTIC CYCLE OF THE APICOMPLEXAN PARASITE Toxoplasma gondii Silvia N J Moreno, Ciara A McKnight, Lucas Borges, Christina Moore, Alexandre Budu, Jing Liu, Celia Garcia, Douglas A. Pace, Myriam Andrea Hortua Triana Center for Tropical and Emerging Global Diseases, University of Georgia, Athens, GA, USA. Toxoplasma gondii is a protist parasite that belongs to the phylum Apicomplexa and is an important cause of congenital disease and infection in immunocompromised patients. As an obligate intracellular parasite, active invasion of host cells with subsequent replication, egress and reinvasion of new cells are essential steps for the proliferation of the parasite and its resulting pathogenesis. Previous evidence showed that Ca2+ is a critical element required for invasion, replication, and egress but very few studies have looked into the source of Ca2+ released into the cytosol. We found that extracellular Ca2+ enters the parasite through a voltage gated mechanism leading to an increase in cytosolic Ca2+ which enhances invasion-related traits like microneme secretion, conoid extrusion and gliding activity (traits associated with host cell invasion). Importantly, blockage of extracellular CONFERENCES 9 Ca2+ entry with nifedipine resulted in a 75% decrease in invasion. In addition, we found that cytosolic Ca2+ itself stimulates Ca2+ entry. We have also looked at Ca2+ during the process of egress and for this we created T. gondii parasites expressing G-CaMPs to monitor Ca2+ dynamics in the parasites while inside their host cells. We infected HeLa and fibroblast cells transiently expressing Red-GECO or Blue-GECO to detect host Ca2+ fluctuations simultaneously. These indicators warrant studies of Ca2+ fluctuations in the parasite before and during egress from host cells. Cytosolic Ca2+ in the parasite fluctuates in response to host Ca2+ cytosolic fluctuations supporting Ca2+ entry as a potential mechanism by which the parasite keeps its Ca2+ stores filled and ready to be used for egress. GCAMP-expressing parasites will allow future studies on the role and identification of other second messengers preceding Ca2+ release into the cytosol. Considering that T. gondii is an early branching eukaryote this information will help understanding the origin of complex signaling pathways. Coordination: Maria Corvi CLOSURE CONFERENCE Hugo Lujan CC DEVELOPMENT OF AN ORAL VACCINE PLATFORM BASED ON THE PROTECTIVE PROPERTIES OF SURFACE PROTEINS OF THE INTESTINAL PARASITE Giardia lamblia. Laboratory of Biochemistry and Molecular Biology. Catholic University of Cordoba and Center for Research and Development in Immunology and Infectious Diseases (CONICET). Argentina. E-mail: hlujan@ucc.edu.ar Despite the impact of world-wide vaccination programs, there is still a great necessity to develop novel, cheap and safe vaccination strategies. Since most infectious agents invade the organism via mucosal surfaces, adaptive mucosal immunity plays a central role in protecting the host against infections. Oral administration of vaccines represents an attractive option because it is not invasive and suitable for mass vaccination. However, the main impediment for oral vaccine development has been that orally administered antigens are easily destroyed by the gastrointestinal tract. The intestinal parasitic protozoan Giardia lamblia expresses at its surface variant-specific surface proteins (VSPs) that are extremely resistant to the low pH of the stomach as well as to intestinal proteases, allowing the parasite to survive in the harsh environmental conditions of the small intestine. These VSPs are able to induce potent mucosal and systemic immunity against this diarrheacausing parasite upon immunization via the oral route. On the other hand, it has been reported that virus-like particles (VLPs) given by injection are efficient immunogens to induce both cellular and humoral responses. We thus hypothesized that expression onto VLPs of Giardia VSPs should shield these particles for oral administration. To obtain a proof of principle and, simultaneously, to develop a potential vaccine candidate, we used Influenza Hemagglutinin (HA) as a vaccinal antigen, for which we have already established all the procedures to monitor cellular and humoral anti-HA immune responses, including challenge experiments with live virus. We produced our vaccines composed of VSP-HA chimeric proteins as control or HA-expressing VLPs covered with VSPs and HA. Our results clearly demonstrated that Giardia VSP can protect vaccinal antigens in the gastrointestinal track, generating strong T and B cell-mediated protective responses. The development of this universal platform for oral delivery of vaccines should have a broad application to different infectious diseases. Coordination: Juan J. Cazzulo MINICONFERENCES SAP X Congress Mar del Plata 2014 MINICONFERENCES 10 MINICONFERENCE I Gustavo Salinas MC01 SINGULARITIES OF THE REDOX METABOLISM IN FLATWORM PARASITES: SHIFTING THE BALANCE TOWARDS THE HOST SIDE Depto de BIociencias, Universidad de la República, Uruguay. Laboratorio de Biología de Gusanos, Institut Pasteur Montevideo. The synthesis of DNA and the maintenance of redox homeostasis are essential for all organisms. The oxidative stress imposed by the host is one of the main adaptive problems faced by the parasites and the disruption of the subtle equilibrium between oxidative damage and antioxidant defense may shift the biochemical balance towards the host side. Contrary to what may be expected, the array of antioxidant defenses in flatworm parasites is limited. A hallmark of flatworm parasites´ antioxidant defenses is the absence of catalase and the restricted reliance on glutathione- and thioredoxin-dependent peroxidases for hydrogen and lipid peroxide detoxification. Flatworm parasites´ antioxidant defenses also differ from those of the host in a singular aspect: they lack conventional thioredoxin and glutathione systems, and possess a unique linked thioredoxin-glutathione system, in which a single core enzyme, termed thioredoxin glutathione reductase (TGR), provides reducing equivalents to both pathways. This enzyme, that supports DNA synthesis and the overall homeostasis in flatworm parasites, possesses at its active site the highly reactive amino acid selenocysteine, which is the central “hub” for transfer of electrons to both pathways. The druggability of TGR, due to the presence of this amino acid, together with the dissimilar arrangement of parasite´s and host´s redox pathways, have directed efforts to identify drug leads to control flatworm infections by disrupting redox homeostasis. Recent studies validated TGR as a drug target, and identified oxadiazole N-oxides and gold compounds as potent inhibitors of this enzyme. The sequencing of parasitic flatworm genomes has revealed the presence of a TGR-dependent redox network with an unexpected diversity of downstream targets of TGR. We will review the major advances made on the biochemical characterization of TGR, the TGRdependent redox network and the identification of TGR inhibitors that kill platyhelminth parasites. The energy metabolism of parasitic flatworms is also unusual. They are unable to oxidize lipids and obtain their energy primarily from carbohydrate sources. Carbohydrates, their main energy source, can be catabolized by aerobic respiration or by two complementary anaerobic pathways; the lactate fermentation and malate dismutation. This latter pathway occurs in the mitochondria and it is absent in their hosts. In this pathway, part of the malate is oxidized to acetate, via pyruvate, yielding NADH, and part is reduced to succinate. Electrons from NADH are transferred via complex I and rhodoquinone to fumarate reductase. Rhodoquinone is an electron transport absent in mammals and its biosynthetic pathway may provide a novel antiparasitic drug target for both flatworms. We have identified genes putatively involved in this pathway, also present in roundworms, and we are using C. elegans as a model to elucidate this metabolic route. This will be presented and discussed in the context of the helminhs “anaerobic” mitochondria. Coordination: Mara Rosenzvit MINICONFERENCES 11 MINICONFERENCE II Ariel Silber MC02 MITOCHONDRIAL METABOLISM AND NEW DRUG TARGETS FOR CHAGAS' DISEASE. Team: Brian A. Suarez Mantilla, Elisabeth M. F. Pral, Flávia Silva Damasceno, Gustavo Baptista, Higo Fernando Santos Souza, Leticia Marchese, Ludmila Nakamura Rapado, Marcell Crispim, María Julia Barisón, N. Carolina Manchola Varón, Raissa F. Pimentel Melo, Richard Girard, Sandra Carla Rocha Address: Departamento de Parasitologia - Instituto de Ciências Biomédicas - Universidade de São Paulo, São Paulo – Brasil asilber@usp.br Over the past few years we and others have revealed unique characteristics of Trypanosoma cruzi mitochondria and its metabolism that explain several peculiarities of T. cruzi metabolism and can be exploited as targets for new drugs against this parasite (Páes, Mantilla et al. 2011). Amino acids are major energy sources in most of T. cruzi stages. Presently, we are unveiling the molecular systems involved in parasite´s bioenergetics, focusing on most of amino acids degradation and biosynthesis pathways. We demonstrated a metabolic switch from a glucose-based to a proline-based metabolism during the mammalian host-cell infection (Silber, Tonelli et al. 2009). We further expanded our research focus to discover non-canonical functions for amino acids and their metabolites. We found that the equilibrium between proline degradation and biosynthesis is related to the balance between the cell energy, and the reductive capacity requirements (Magdaleno, Ahn et al. 2009, Paes, Suarez Mantilla et al. 2013). In addition, this equilibrium is regulated by the uptake/oxidation of branched chain amino acids, which, in turn, negatively regulates the development of the intracellular infection (unpublished data). We recently showed that the perturbation of proline oxidation by specific inhibitors of these pathway diminishes the ability of parasites to produce ATP and to survive to metabolic and oxidative stress conditions. We demonstrated also the perspectives of amino acids and derived keto acids dehydrogenases as drug targets. A library of compounds against these targets are being currently evaluated in vitro and in vivo. Glutamate, the main product of proline oxidation, is the main substrate for the glutamine biosynthesis, a major nitrogen reservatoir. We showed that the enzyme responsible for the biosynthesis of glutamine is involved also the resistance to oxidative unbalance and to the stress caused by the the excess of NH4+ (Magdaleno, Suarez Mantilla et al. 2011). The analysis of histidine metabolism is giving also some clues on amino acids and energy metabolism regulation: its metabolic fate can be related to the reinforcement of proline or energy production, depending on the physiological conditions of the cells (unpublished data). Taken together, these data exemplify how complex are these metabolic networks, and reveals a number of alternative ways of "traveling from one metabolite to another". We are currently devoted to understand the logics of amino acids metabolic pathways to identify bottlenecks as well as "exclusive" enzymes to be evaluated as new drug targets in vitro and in vivo. The present lecture will focus on the pathways connecting histidine, glutamate, proline, glutamine and the BCAA, and their role in the T. cruzi life cycle. Coordination: Claudio Pereira MINICONFERENCES 12 MINICONFERENCE III Robert Hirt MC03 Trichomonas vaginalis VAST POTENTIAL PROTEOME: AN EVOLUTIONARY AND FUNCTIONAL PUZZLE Institute for Cell and Molecular Biosciences, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne, NE2 4HH, UK The annotation of the genome sequence data from one strain (G3) of Trichomonas vaginalis identified ~60,000 protein coding genes. This is an unusually large set of proteins in general and for a microbial eukaryote in particular. We are investigating the origins of these genes and their potential function through detailed bioinformatics analyses focusing on genes underlying membrane trafficking, candidate surface proteins and those acquired through lateral gene transfers. Recent published transcriptomics data are also being exploited to further highlight likely functional genes. Phylogenetic analyses providing insights into the origin of T. vaginalis are also considered for future work on comparative genomics of the human parasite and its closely related species isolated from animals, which are also suggesting a zoonotic origin for T, vaginalis, probably from a bird infecting trichomonad. A selection of gene families will be discussed including TvRab small GTPases, adaptins, candidate surface proteins and genes of relatively recent bacterial origins. An important fraction of the annotated protein coding genes are likely to be functional. Many genes are part of genes families including some large ones with examples of dramatic amplification across a number of functional categories including those orchestrating membrane trafficking and candidate cell surface proteins. In addition lateral gene transfers have also contributed to the important coding capacity of the parasite. Together these data provide important new insights into the molecular and cellular basis of the parasite pathobiology. Coordination: Natalia de Miguel MINICONFERENCE IV Andrew Tobin ESSENTIAL PHOSPHO-SIGNALLING CASCADES IN MALARIA MC04 Andrew B. Tobin, Lev Solyakov and Mahmood Alam. MRC Toxicology Unit, University of Leicester, Hodgkin Building, Leicester LE1 9HN UK. The >500 mammalian protein kinases are organised into phospho-signalling modules that are co-ordinated in a complex and dynamic manner to mediate the many tens of thousands of cellular phosphorylation events. Whereas the nature of these phosphosignalling cascades are generally well understood in mammalian systems knowledge of the phospho-signalling pathways in malaria parasites is still in its infancy. Recently, published global phosphoproteomic studies conducted on the most virulent species of human malaria parasites, Plasmodium falciparum, have revealed that the 80-100 parasite protein kinases 1-3 phosphorylate proteins involved in nearly every aspect of the asexual blood stage of the parasite life cycle 4-7. These studies have indicated that targeting the highly divergent parasite protein kinases might be a fruitful area for development of novel anti-malaria therapies. MINICONFERENCES 13 One of the barriers to exploiting parasite kinases in drug development is, however, the paucity of information regarding the role of the essential protein kinases and the nature of phospho-signalling cascades in malaria. In this talk we address this issue by focusing on the essential P. falciparum protein kinase PfPKG. I describe here a chemical genetic approach that has allowed us to distinguish between the off-target and on-target actions of a chemical inhibitor to PfPKG called compound 2. Combining this with quantitative global phospho-proteomics we are able to determine 113 cellular targets for PfPKG - that implicate PfPKG in a broad range of cellular processes. I will also discuss how we are taking this approach and applying it to other parasite protein kinases and importantly how we are employing all these approaches in drug discovery projects in collaboration with the pharmaceutical industry. Coordination: Julia Cricco MINICONFERENCE V Sergio Schenkman MC05 TRANSLATION CONTROL AND OXIDATIVE RESPONSE IN TRYPANOSOMES Leonardo da Silva Augusto, Nilmar Silvio Moretti, Beatriz A. Castilho, Sergio Schenkman Departamento de Microbiologia, Imunologia e Parasitologia, Escola Paulista de Medicina, Universidade Federal de São Paulo, São Paulo, São Paulo, Brasil Trypanosoma cruzi, the causative agent of Chagas’ disease, faces different environmental conditions during its life cycle, such as starvation and alterations in temperature and pH, which requires the activation of specific metabolic pathways to allow its survival. Among those, regulation of translation initiation through the phosphorylation of the alpha subunit of translation initiation factor 2 (eIF2) has been demonstrated to play a key role (Tonelli et al. 2011, PlosOne 6:e27904). Here we show that one of the eIF2 kinases (TceIF2-K2) is associated with endosomal organelles called reservosomes in the epimastigote form. This kinase is modulated by the presence of heme, which also inhibits the differentiation of proliferative epimastigotes to infective metacyclic-trypomastigotes. Parasite lines lacking TcK2 lose the differentiation capacity and displayed a growth deficiency due to the accumulation of hydrogen peroxide as consequence of an increase in the superoxide dismutase activity and peroxidase down modulation. In the presence of iron, the accumulated peroxide generates oxygen species that damage the parasite. As these phenotypes could be restored by the wild type but not by a kinase dead mutant, we conclude that this unusual eIF2 kinase is a key factor in controlling growth, responses to oxidative stress and parasite differentiation. FAPESP / CNPq Coordination: Hugo Lujan SYMPOSIA SAP X Congress Mar del Plata 2014 SYMPOSIA 15 SYMPOSIUM I Advances in the treatment of parasitic diseases Coordination: Alejandro Schijman / Sergio Sosa Israel Molina NEW THERAPEUTIC PERSPECTIVES AGAINST CHAGAS DISEASE ST01 Unidad de Medicina Tropical y Salud International. Hospital Universitario Vall d’Hebron. PROSICS Barcelona Treatment against Chagas disease is bounded to Nifurtimox and Benznidazole. In the acute phase of the disease both drugs have acceptable rates of cure, but in the chronic phase, the numbers do not exceed 40% cure. Nevertheless, the current trend is to treat adult patients with Chagas disease in chronic phase.This is mainly based on the lower clinical progression of cardiomyopathy among treated patients compared with those who did not receive treatment, as demonstrated the group of Dr. Viotti. Another problem linked to the nitroderivatives drugs, is the high proportion of side effects experienced by patients that lead to a final discontinuation in almost 15% of cases. This therapeutic scenario has conditioned several initiatives in recent years with the aim of finding new evidence that strengthened the classic treatments, finding new drugs or even analyzing drug combinations. One promising group of drugs, is ergosterol synthesis inhibitors, essential for the stability of the membrane of the protozoa. The group of Dr. Urbina, after evaluating such drugs in the mouse model, both acute and chronic, noted that posaconazole might be the most potent inhibitor of ergosterol ever tested against Trypanosoma cruzi. Subsequently other drugs in this family have been evaluated in both animal models and humans. Therefore we pretend to do a comprehensive review of the major published works and initiatives that are being undertaken in order to bring new developments in this field. Faustino Torrico ST02 AVANCES EN EL TRATAMIENTO ESPECÍFICO DE LA ENFERMEDAD DE CHAGAS EN EL PACIENTE ADULTO CRONICAMENTE INFECTADO Universidad Mayor de San Simón, Cochabamba – Bolivia El Reporte del Comité de expertos de la OMSS, publicado el año 1991 referente al tratamiento específico de la enfermedad de Chagas indica: “…Ambos medicamentos (Benznidazol y Nifurtimox) son aceptados como útiles en la Enfermedad de Chagas aguda… el tratamiento tripanomicida está indicado para pacientes con enfermedad enfermedad de Chagas aguda, la mayoría de los cuales son jóvenes y más tolerantes que los adultos a los efectos secundarios derivados del usos de estos medicamentos” y continua … Dado que no hay información sobre la eficacia del tratamiento tripanomicida para prevenir el desarrollo de la enfermedad de Chagas crónico, este no está indicado durante la fase indeterminada de la infección …” El segundo Reporte del Comité de expertos de la OMSS del año 2002 referente al mismo tema indica: “dadas las realidades epidemiológicas de cada país, se ha establecido el consenso que las personas con enfermedad de Chagas Crónica (individuos con serología positiva para Chagas) deben ser tratadas con medicamentos específicos … El beneficio general aportado por el benznidazol en las fases agudas y crónicas de la enfermedad de SYMPOSIA 16 Chagas indica que el tratamiento con este medicamento se debe recomendar para todo individuo con serología positiva” Estos dos posicisionamientos, a una década de diferencia, constituyen en si un cambio de paradigma referente al tratamiento del Chagas crónico y abre la posibilidad de beneficiar a millones de personas adultas que se encuentra en esta situación y que actualmente viven en regiones donde el control vectorial la reducido de forma importante el riesgo de re infecciones. Este misma publicación de la OMS del año 2002 indica “aunque el Benznidazol es eficaz en la enfermedad de Chagas, para aumentar la eficacia del tratamiento se necesitan nuevos fármacos que se puedan administrar durante menor tiempo y tengan menos efectos secundarios” Siguiendo estas recomendaciones se han iniciado estudios de nuevos fármacos contra la enfermedad de Chagas crónica del adulto asi tenemos el estudio de Molina I y col: Randomized trial of posaconazole and benznidazole for chronic Chagas' Disease (N Engl J Med. 2014 May) que muestra que el Posaconazol tiene una actividad tripanocida durante el tratamiento en pacientes con Chagas pero rápidamente se observa una recaída en estos pacientes después del tratamiento, al contrario los pacientes tratados con benznidazol muestran una actividad tripanocida sostenida de un 94% de los pacientes que completaron el tratamiento y el seguimiento hasta los 360 días de iniciado el mismo. De igual manera se ha realizado en Bolivia un estudio clínico fase II de prueba de concepto del E1224 un pro-fármaco del ravuconazoll (estudio concluido y en etapa de publicación) que de igual manera Benznidazol tuvo un actividad tripanocida rápida y sostenida, del 81% a los 12 meses, además de una caída significativa en el recuento de parásitos después de sólo una semana de tratamiento mientras que el Eliminación del parásito, pero no una respuesta sostenida muy inferior con E1224 a 12 meses de iniciado el tratamiento (DNDi, CRESIB, CEADES) Actualmente se está desarrollando en Bolivia el “Estudio de Eficacia y Seguridad de Fase 2 Aleatorizado, Multicéntrico, Controlado con Placebo, para la Evaluación de Seis Esquemas de Dosis Orales de Fexinidazol para el Tratamiento de Pacientes Adultos con Enfermedad de Chagas Crónica Indeterminada” (DNDi, CRESIB, CEADES). Este estudio está en fase de reclutamiento de pacientes y se esperan los resultados dentro de 14 meses. En conclusión podemos indicar que hay un cambio importante de paradigma respecto al tratamiento del Chagas crónico y una clara recomendación de la OMS para el tratamiento con Benznidazol de toda persona con serología positiva para Chagas, este concepto debe ser difundido y explicado al personal de salud, que aun 12 años después de la recomendación sigue cuestionando el mismo. Después de más de 40 años se han iniciado estudios clínicos para buscar nuevos medicamentos para esta enfermedad y por el momento los resultados muestran que aunque estos tienen un efecto parasiticida inmediato, la respuesta a a largo plazo no es la esperada. Sin embargo también estos estudios han demostrado que el Benznidazol es un muy buen medicamento contra el Trypanosoma cruzi con una respuesta parasiticida prolongada superior al 80% y que los efectos secundarios del mismo pueden ser bien controlados por personal de salud bien entrenado. Claudio Salomón ST03 NUEVAS FORMULACIONES DE BENZONIDAZOL PARA EL MAL DE CHAGAS Facultad de Cs. Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario, IQUIRCONICET SYMPOSIA 17 Chagas’ disease or American tripanosomiasis is a zoonosis discovered by Dr. Carlos Chagas, a Brazilian physician, who first identified the infection caused by Trypanosoma cruzi in 1909. His valuable study included description of the entire lifecycle of the parasite, vectors, and animals and humans that act as reservoir hosts. Although the vectorial transmission has been reduced, Chagas’ disease is still amajor public health problem and one of the leading causes of morbidity, long-term disability, andmortality in Latin America, with estimates of nearly 90million people at risk of infection and more than eight million infected in 18 endemic countries. Furthermore, the number of yearly new cases due to vectorial transmission was around 42,000 people, and the infected neonates by congenital Chagas’ disease per year were nearly 15,000. Additional to human morbidity and mortality, this parasitic infection places a substantial burden in poorer, developing countries, increasing both the poverty and vulnerability of those people. Chagas’ disease is transmitted primarily by insects, known as “kissing bugs,” through the bite wound or mucous membranes. Moreover, the dissemination of this parasitic infection may occur by transfusion of blood from persons infected with T. cruzi and/or organ transplantation. Also, infected pregnant women may transmit T. cruzi to her newborn, resulting in congenital Chagas’ disease. A noncommon route of infection is through ingesting food and drink contaminated with the faeces of a triatomine carrying the parasite. Lately, and due to the great dissemination from endemic areas in Latin America to the United States, Canada, and several countries of the European Community, Chagas’ disease has become a serious concern for the nonresident tropical population. Nearly 300,000 people live with Chagas’ disease in the United States, and more than 80,000 cases are being reported in Spain. In North America, as recently stated, this parasitic infection is becoming a serious concern, which can have severe consequences for public health, principally because of its potential to contaminate the blood transfusion supply as well as its dissemination through surgical implantation of infected donor organs to patients in nonendemic areas. Although some progress focused in the process of drug discovery have been made in recent years, the significant cost of these projects and the lack of assurances that they can make a return on their investment discouraged pharmaceutical companies from investing in research and development programs against Chagas’ disease. As a consequence, to date, there are only two therapeutic agents applied to the treatment of Chagas’ disease. One of them is nifurtimox, manufactured as Lampit® available only as 120mg tablets. The other drug, benznidazole, is manufactured as Rochagan® (Brazil) or Radanil® (Argentina), available as a unique presentation of 100mg tablets. Recently, an Argentinian drug development consortium was able to develop Abarax® as 100 mg and 50 mg tablets. Although both active compounds are included in the World Health Organization project “Better medicines for children,” an effective chemotherapy for paediatric population infected with Chagas’ disease is still lacking. Thus, basic concepts and principles relating the development of novel solid dosage forms of Benznidazole will be presented. In addition, the in-vitro/in-vivo evaluation of cosolvent systems, defined as water-miscible organic solvents, to increase the solubility of Benznidazole in order to formulate syrups and drops for treating Chagas´disease in pediatric patients will be discussed. SYMPOSIA 18 SYMPOSIUM II: Farmacological and immunological control of parasites with veterinary interest Coordination: Luis Alvarez / Silvina Wilkoski Gonzalo Suarez SFV01 COMBINACIÓN DE FÁRMACOS COMO ESTRATEGIA DE CONTROL PARASITARIO. UNA MIRADA DESDE LA MEDICINA VETERINARIA Facultad Veterinaria, Universidad de la República, Montevideo, Uruguay e-mail: gsuarez@fvet.edu.uy; gsuarez@adinet.com.uy Con el objetivo minimizar la falla terapéutica ante la generalizada aparición de resistencia nematodos gastrointestinales del ovino, se han desarrollado diferentes presentaciones farmacéuticas que incluyen dos o más principios activos nematodicidas de diferente mecanismo de acción. La justificación del uso de combinaciones, apunta a minimizar las probabilidades de un fracaso terapéutico tras un único tratamiento. En un contexto epidemiológico con presencia de poblaciones parasitarias resistentes, el uso de combinaciones no parece ser una alternativa sustentable de control. Sin embargo, cuando la presencia de resistencia se encuentra en niveles mínimos, podría demorarse el desarrollo de resistencia con el uso de combinaciones. La administración de dos productos en forma combinada puede derivar en interacciones farmacocinéticas/farmacodinámicas. Dichas interacciones han sido descriptas para diferentes combinaciones incluyendo albendazole+ivermectina y levamisol+albendazole+ivermectina. Es necesario conocer el impacto clínico de dichas interacciones a la hora de diseñar una estrategia de control farmacológica racional. El uso de combinaciones requiere de un conocimiento del contexto epidemiológico en el cuál se va a utilizar, inmerso en un plan de Control Integrado de Parásitos, donde el diagnóstico de resistencia es un componente fundamental. Se discutirán las principales ventajas y desventajas del uso combinado de fármacos en el control de helmintos, a partir de las experiencias logradas en el campo de la medicina Veterinaria. De esta forma, se pretende realizar un aporte original en la disciplina que sirva como punto de partida en el diseño de estrategias de control de otros parasitarios de importancia médica. José Tort SFV02 APORTES DESDE LA GENÓMICA Y TRANSCRIPTÓMICA A LAS ESTRATEGIAS DE CONTROL DE HELMINTOS Departamento de Genética, Facultad de Medicina, Universidad de la República, (UdelaR), Montevideo, Uruguay El control de las helmintiasis descansa mayormente sobre el uso de fármacos antiparasitarios, pero se reiteran los casos de resistencia a las distintas drogas utilizadas. Existe consecuentemente una necesidad de explorar nuevos blancos potenciales para el control parasitario. La creciente disponibilidad de genomas y transcriptomas de helmintos abre un nuevo campo de búsqueda de posibles blancos para el control de las parasitosis, existiendo diversas estrategias para esta búsqueda. Por un lado, la identificación in silico de moléculas secretadas y de superficie apunta a la interacción y el contacto directo con el hospedero. El estudio de las vías metabólicas permite identificar “cuellos de botella” metabólicos, cuyo bloqueo puede implicar el SYMPOSIA 19 agotamiento de algún producto esencial o la acumulación de un metabolito tóxico para el parásito. La genómica comparativa permite identificar los genes conservados en los parásitos, pero con ortólogos ausentes en los hospederos. Otra alternativa es la búsqueda de genes cuyos ortólogos en Caenorhabditis elegans o planarias presenten fenotipos asociados al desarrollo o letalidad en ensayos de RNAi. Estas estrategias combinadas resultan en listas de candidatos que pueden discriminarse identificando enzimas que son blancos de drogas verificados en otros organismos. En cualquier caso estos deberán ser validados en los modelos parasitarios, siendo los experimentos de RNAi una interesante estrategia de validación funcional. Los estudios de la variabilidad genética parasitaria son aun incipientes, pero aportan a la historia epidemiológica de las infecciones y pueden permitir identificar a partir de la comparación de aislados sensibles y resistentes a drogas los posibles mecanismos subyacentes a estos procesos. Recientemente se ha sugerido que algunos miRNAs podrían ser indicadores de infección y/o posibles blancos de intervención, agregando la regulación génica a la lista de candidatos. Diversos avances en estos enfoques serán presentados y discutidos. Prando Dadin Moore SFV03 SHOULD VETERINARIANS AND FARMERS BE AFRAID OF USING A LIVE VACCINE AGAINST Neospora caninum? 1 National Research Council, ARGENTINA INTA Balcarce, Balcarce, Argentina Since the description and denomination of Neospora caninum as cause of abortion in cattle, most research groups working on Toxoplasma gondii extrapolated their expertise, methodologies and techniques to know about this new coccidian parasite. N. caninum has emerged not only as the first cause of abortion in dairy cattle but also as being responsible of billion dollar losses in cattle industry worldwide (Reichel et al., 2013). For over 25 years of research, the control of the disease is reduced to interrupt the parasite cycle, limiting the access of canids (definitive hosts: dog, wolf, coyote and dingo) to the water and food supplies for cattle or eliminating tissues occasioned by abortions (Dubey et al., 2007). Costly management control also includes the culling of infected animals and not drug has been shown to prevent neither abortions nor infections in cattle (Reichel et al., 2013; Dubey et al., 2007). N. caninum has such adaptation to cattle that vertical transmission occurs efficiently without any clinical sign but abortion and sporadically neurological symptoms in newborn calves. Stress, genetic, immunosuppression, management have been identify as risk factors for the presentation of the disease. Also postnatal transmission occurs allowing the parasite to complete its life cycle (Dubey et al., 2007). Many live vaccines have been used as effective tools for preventing serious diseases including toxoplasmosis, theileriosis, babesiosis, coccidiosis (McAllister, 2014). More over naturally attenuated strains have been shown to be useful but a live Neospora vaccine is not in the market yet. Inactivated vaccine for preventing bovine neosporosis showed very low efficacy like in many other parasitic diseases (Reichel et al., 2013; Dubey et al., 2007). Disadvantages of live vaccines include reversion to pathogenicity, costly production and latency in the intermediate host (McAllister, 2014) but none of them have been proved for neosporosis yet. More over many molecular techniques are available for distinguish vaccinated from naturally infected animals, these includes genetic characterization or SYMPOSIA 20 development of live vaccine with deletion of genes coding for specific proteins which could be used in a given serological test. Farmers should not be afraid of using a live vaccine against bovine neosporosis. Reduced doses able to induced protective immunity should be investigated. The NC-6 strain of N. caninum is an Argentinean isolate obtained from the faeces of a naturally infected dog (Basso et al. 2001). The ability of tachyzoites from the NC-6 strain to induce protection in pregnant challenged heifers has been recently evaluated (Hecker et al., 2013) but NC-6 Argentina is pathogenic in cattle (Bacigalupe et al., 2013). A non pathogenic Neospora-strain used as vaccine could be very useful as a tool to control bovine neosporosis. Integrated control management control strategies including the use of inactivated vaccines even with low efficacy could be implemented. SYMPOSIUM III: Signaling in protozoan parasites Coordination: Esteban Serra / Tellez Inon Gustavo Arrizabalaga SS01 NOT SO GRACEFUL EXIT: ROLE OF CALCIUM DEPENDENT PROTEIN KINASE 3 IN Toxoplasma gondii EGRESS Raj Gaji, Kaice La Favers and Gustavo Arrizabalaga Indiana University, School of Medicine Egress from the host cell is a crucial and highly regulated step in the biology of the obligate intracellular parasite, Toxoplasma gondii. Active egress depends on calcium fluxes and appears to be a crucial step in escaping the attack from the immune system and, potentially, in enabling the parasites to shuttle into appropriate cells for entry into the brain of the host. Previous genetic screens have yielded mutants defective in ionophoreinduced egress. Using whole genome sequencing of one mutant and subsequent analysis of all mutants from these screens, we find that, remarkably, four independent mutants harbor a mis-sense mutation in the same gene, TgCDPK3, encoding a calcium-dependent protein kinase. All four mutations are predicted to alter key regions of TgCDPK3 and this is confirmed by biochemical studies of recombinant forms of each. By complementation we confirm a crucial role for TgCDPK3 in the rapid induction of parasite egress and we have establish that TgCDPK3 is critical for formation of latent stages in the brains of mice. To identify potential substrates and determine mechanism of TgCDPK3 function during egress we adopted the recently developed Bio-ID system, which entails fusing TgCDPK3 to the bacterial biotin ligase BirA. Toxoplasma mutant parasites (MBE 1.1) were complemented with TgCDPK3-BirA construct. MBE 1.1 parasites expressing either wildtype TgCDPK3 or TgCDPK3-BirA were treated with excess biotin and the biotinylated proteins were pulled down using streptavidin magnetic beads. Among the proteins specifically biotinylated in the TgCDPK3-BirA expressing parasites we identified myosin-A, TgGAP-45 and a protein phosphatase 2C. We have analyzed the three putative substrate proteins by peptide array analysis to identify residues that are phosphorylated by purified recombinant TgCDPK3 and found that S20, S21, S743, S744 in TgMysoin-A and T272, S276 in TgPP2C were strongly phosphorylated. Studies are currently underway to generate TgMyosin-A knockout parasites complemented with various phosphorylation mutants and also endogenous tagging of TgPP2C to examine localization within the parasite. These studies should reveal potential signaling pathway involving TgCDPK3 and generation of novel therapeutics against the intracellular parasite. SYMPOSIA 21 Julia Cricco SS02 Does Trypanosoma cruzi need heme? How is heme imported, distributed and used by it? Julia A. Cricco, Lucas Pagura, Marcelo L. Merli and Brenda A. Cirulli Instituto de Biología Molecular y Celular de Rosario. CONICET - Universiad Nacional de Rosario. Suipacha 531. 2000 Rosario, Santa Fe. Argentina. Heme plays a fundamental role in many cellular processes. It is an essential cofactor for proteins involved in oxygen transport and storage, mitochondrial electron transport (Complex II–IV), drug and steroid metabolism (cytochromes), signal transduction (nitric oxide synthases, soluble guanylate cyclases), and transcription and regulation of antioxidant defense enzymes. Heme is also a regulatory molecule; its cytosolic to nuclear ratio and the absolute amount of its concentration affects gene transcription and translation; thus, the intracellular heme level must be tightly regulated. The heme biosynthetic pathway is highly conserved through evolution. Iron, porphyrins and heme are highly toxic to cells; therefore the level of free heme inside the cell is maintained very low. There is a tight control of its biosynthesis and degradation based on cellular requirements. Most of the eukaryotic organisms are able to synthesize heme, however, the medically relevant trypanosomes are completely (T. cruzi and T. brucei), or partially (Leishmania spp.), deficient in heme synthesis and they must scavenge this molecule from their hosts. Once heme is imported, it has to be distributed inside the cell and inserted into the target heme-proteins. But, the processes of heme transport and distribution in trypanosomatids remain unknown. Besides, these parasites present heme-proteins involved in essential metabolic pathways like biosynthesis of sterols and polyunsaturated fatty acids (PUFAs) carried out in the endoplasmic reticulum (ER) and respiratory complexes in the mitochondrion. The understanding of how they import, distribute, utilize heme, and assemble heme-proteins can help elucidate the essential metabolic pathway in these trypanosomatids. We are interested in elucidating how T. cruzi imports, distributes and uses heme. Our results showed that this parasite takes heme from the environment (host), at least during the replicative life stages, and distributes heme inside cell. The blockage of heme transport or mitochondrial heme modification negatively affects cell proliferation. . Federico Rojas THE TRANSMEMBRANE PROTEIN HOMOLOGUE GPR89 DEVELOPMENT OF STUMPY FORMS IN Trypanosoma brucei PROMOTES SS03 THE Federico Rojas; Rachel Milne; Joanne Thompson; Keith R. Matthews Centre for Immunity, Infection and Evolution, Institute for Immunology and infection Research, School of Biological Sciences, Ashworth Laboratories, University of Edinburgh, West Mains Road, Edinburgh EH943JT, Scotland SYMPOSIA 22 G protein-coupled receptors are seven transmembrane domain (TM) proteins that transduce signals through their interactions with extracellular ligands and G proteindependent and -independent signaling cascades allowing cells to respond to changes within their environment. Although trypanosomes are conventionally described as lacking GPCRs, we have identified a T. brucei protein (TbGPCR-like 1; TbGPCR-L1) related to the GPR89 family members that have been implicated in abscisic acid signaling in plants and Golgi acidification in mammals. The T.brucei protein has eight predicted TM and localizes to the cell plasma membrane. Western blot and immunofluorescence analysis shows that in pleomorphic trypanosomes (i.e. capable of generating slender and stumpy forms), TbGPCR-L1 is expressed on slender forms but levels decrease as cells differentiate into intermediate and stumpy forms. In pleomorphic parasites, in contrast to monomorphic cells, inducible overexpression of TbGPCR-L1 protein drives premature differentiation in vitro and in vivo, generating stumpy cells at lower cell density compared to uninduced or the parental cell line. Overexpression of TbGPCR-L1 in a RNAi background targetting RBP7- a putative RNA binding protein required for normal quorum sensing- cells do not differentiate into stumpy cells, suggesting that TbGPR89 signalling acts upstream of RBP7 but on the same pathway. TbGPR89-L1 is rapidly degraded when overepxressed in what it seems to be an ubiquitin-dependent process involving the C-terminal portion of the protein, similar to the desensitization of GPCRs in other organisms. Our experiments indicate that TbGPR89-L1 might be expressed on slender forms as a sensor of an external stimulus thus initiating stumpy formation. SYMPOSIUM IV: Molecular epidemiology in Trypanosoma cruzi Coordination: Patricio Diosque María C. Cécere SE01 CHAGAS DISEASE IN THE SUBANDEAN VALLEYS OF NORTHWEST ARGENTINA: EPIDEMIOLOGICAL ROLE OF TWO TRIATOMINE SPECIES AND CAVIES. María C Cecere1, Victoria M Cardinal1, Marina Leporace1, María P Fernández1, Juan P Arrabal2, Claudio Moreno3, Ricardo E Gürtler1 1 Lab. Eco-epidemiología, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires- Instituto de Ecología, Genética y Evolución, CONICET, Argentina. 2 Instituto Nacional de Medicina Tropical-Ministerio de Salud Puerto Iguazú, Misiones, Argentina. 3 Coordinación Nacional de Control de Vectores, San Miguel de Tucumán, Tucumán, Argentina. e-mail: carla@ege.fcen.uba.ar Wild and synanthropic rodent species are implicated in the transmission of Trypanosoma cruzi in several regions where TcI is the most prevalent Discrete Typing Unit (DTU) detected. In Argentina, several rodent species of Sigmodontinae were infected with Tc while species of Caviinae (include “cuises” or guinea pigs) have received less attention. Regarding Triatoma eratyrusiformis (Te), its epidemiological relevance has not been assessed although it has a wider geographic distribution in western Argentina associated SYMPOSIA 23 with edentate and rodents. As part of a wider research project on Chagas disease vector control, the present study sought to understand the role of cavies and two peridomestic triatomine species in a well-defined rural area of Tafi del Valle (Tucumán). The occurrence of T. cruzi infection in Microcavia australis and its reservoir host competence were assessed by xenodiagnosis and by polymerase chain reaction amplification of the hyper-variable region of kinetoplast DNA minicircles of T. cruzi (kDNAPCR) from blood samples. For assessing host-vector contact across different ecotopes, bloodmeal contents in Te and Triatoma infestans (Ti) were tested with a direct ELISA assay against human, dog, cat, chicken, pig, goat, cavy, rabbit and murid rodent (rat or mouse) antisera. Bug infection by T. cruzi was evaluated by optical microscopy or kDNAPCR. The DTUs of T. cruzi infection in cavies, domestic animals and triatomine bugs were identified from fecal or rectal ampoule samples. Cavies presented a very high prevalence of infection (46.3%) and TcI was the only DTU identified. The infectiousness to Ti of cavies positive by xenodiagnosis or kDNA-PCR was very high (mean, 55.8%; 95% CI = 48.4-63.1%) and exceeded 80% in 44% of the individuals. The host-feeding patterns were spatially structured according to habitat type and correlated closely with the main resident host(s). The main bloodmeal sources for Te collected from fences and corrals was cavy (95%) followed by rat and pig. Ti fed on chicken (57%), goat, human, rabbit and less frequently on dog, cavy and pig. In domiciles, the main bloodmeal sources of Ti were humans (60%) followed by chickens and dogs. Most Te and Ti had unmixed blood meals (85-88%). T. cruzi infecction in bugs was greater in peridomiciles (53%, 79/149) than in domiciles (43%, 13/30). In peridomiciles, bug infection reached 81%in Te and 18% in Ti. TcVI was identified in one Te captured in a corral and in one cat, and TcI in another Te from fences and in Ti from corral, piled material, and fence. The novel finding of T. cruzi-infected M. australis cavies thriving in bug-infested habitats close to human dwellings represents a new scenario of TcI transmission in Argentina. Chemical control and environmental management measures directed to peridomestic habitats, especially to the dry-shrub fences, may be needed for improved vector control of Ti and other secondary vectors. Nicolás Tomasini SE02 ES CORRECTO ESTABLECER SUB-DTUS EN Trypanosoma cruzi I? ESTRUCTURACIÓN E INTERCAMBIO GENÉTICO DENTRO DEL LINAJE EN EL GRAN CHACO AMERICANO Nicolás Tomasini, Juan J. Lauthier, María M. Monje Rumi, Anahí M. Alberti D’Amato, Paula G. Ragone, Cecilia Pérez Brandán, Patricio Diosque Instituto de Patología Experimental – Facultad de Ciencias de la Salud – Universidad Nacional de Salta – CONICET Trypanosoma cruzi ha sido históricamente clasificado como una especie de evolución clonal preponderante (PCE). Sin embargo, el advenimiento de marcadores moleculares altamente polimórficos y el estudio poblacional en escalas geográficas reducidas ha llevado a cuestionar la validez de dicha teoría. De hecho, particularmente algunos estudios han sugerido que la recombinación en el linaje I de T. cruzi (TcI) es mucho más frecuente de lo que se creía anteriormente. Bajo el supuesto de no validez del modelo de PCE en este linaje, no sería adecuado establecer sub-DTUs para TcI. Por la relevancia de este marco teórico, se necesitan más estudios poblacionales de TcI en diferentes SYMPOSIA 24 regiones geográficas de América Latina para evaluar la frecuencia del intercambio genético. En esta presentación, contribuimos a la discusión sobre este tema mediante el análisis de la estructura poblacional de TcI en un área geográfica restringida en la región del Chaco, Argentina. Analizamos TcI aislados de diferentes huéspedes y vectores utilizando un enfoque de Multilocus Sequence Typing (MLST). En general, nuestros resultados muestran claras evidencias de PCE en TCI en nuestra zona de estudio con eventos aislados de intercambio genético. Por último, teniendo en cuenta nuestros resultados se discute la posible organización de la estructura genética de TcI y si es posible o no establecer sub-DTUs para este linaje. Victoria Cardinal SE03 EL CICLO DOMÉSTICO DE TRANSMISIÓN DE Trypanosoma cruzi EN COMUNIDADES RURALES DEL CHACO HÚMEDO ARGENTINO. Cardinal MV, Enriquez GF, Macchiaverna NP, Sartor PA, Gaspe MS, Provecho YM, Fernández MP y Gürtler RE. Laboratorio de Eco-Epidemiología, IEGEBA-CONICET, Dpto Ecología, Genética y Evolución, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Argentina. mvcardinal@ege.fcen.uba.ar Los ciclos silvestres y domésticos de transmisión del Trypanosoma cruzi involucran una gran diversidad de ambientes, hospedadores, triatominos y genotipos parasitarios (llamados Unidades Discretas de Tipificación, UDTs). Estos ciclos presentan diferentes grados de solapamiento. Con el fin de ahondar nuestro estudio sobre la estructura de los ciclos de transmisión, evaluamos la prevalencia de infección de T. cruzi, identificamos las unidades discretas de tipificación (UDTs) parasitarias y determinamos la distribución de UDTs (identificadas a partir de PCRs) en Triatoma infestans y Triatoma sordida (peri)domésticas, perros y gatos y humanos en el área rural del municipio de Pampa del Indio, Chaco. Las acciones de control vectorial disminuyeron significativamente la prevalencia de infección en triatominos y en los niños menores de 5 años de edad (i.e.: nacidos postrociado) en comparación con los valores obtenidos previo al rociado masivo de las viviendas. Sin embargo, se hallaron T. infestans infectadas con T. cruzi persistentemente aún luego de 22 meses de vigilancia entomológica y control sostenido. En el ambiente (peri)doméstico, las UDTs identificadas fueron TcVI, TcV, TcIII y TcI. TcVI predominó, hallándose en el 82% de 45 perros, en el 71% de 14 gatos, y en el 58% de 74 T. infestans (peri)domésticas. En humanos predominó TcV. TcI fue identificada en 1 perro y 2 gatos, y TcIII en dos perros. Ninguna de estas dos UDTs l fueron identificadas en T. infestans y TcI predominó (67%) entre los 18 T. sordida (peri)domiciliarias infectadas. Esto sugeriría una potencial unión con la transmisión silvestre local. Concluimos que en estas comunidades rurales la introducción de T. cruzi desde el medio silvestre al doméstico ocurriría raramente en el actual contexto epidemiológico. Las medidas de control efectuadas lograron una fuerte depresión de la transmisión doméstica pero nuevos estudios son necesarios para identificar el origen de las infecciones detectadas post-rociado Financiado por Fundación Bunge y Born, UBA, ANPCyT, CONICET. SYMPOSIA 25 SYMPOSIUM V: Vectors. Phisiology of triatomins: from cell to the vector insect Coordination: Patricia Juarez Francisco Panzera SV01 MOLECULAR CYTOGENETICS RELEVANCE IN THE TAXONOMY AND PHYLOGENY OF CHAGAS DISEASE VECTORS (TRIATOMINAE, REDUVIIDAE) PANZERA Francisco1, PITA Sebastián1, LORITE Pedro.2, SANCHEZ Antonio 2, PALOMEQUE Teresa2, PANZERA Yanina1 1 Sección Genética Evolutiva. Facultad de Ciencias. Udelar. Montevideo, Uruguay. 2 Laboratorio de Genética. Departamento de Biología Experimental. Facultad de Ciencias Experimentales. Universidad de Jaén, España The subfamily Triatominae include hemipteran species called kissing bugs, vectors of Chagas disease or American trypanosomiasis, recognized as the most serious human parasitic disease of Latin America with around 7–8 million people infected (WHO 2013). This subfamily currently comprises 140 species assembled in five-six tribes and 15-19 genera (Schofield & Galvão 2009) with several taxonomic uncertainties due to the existence of cryptic species. Furthermore, the phylogenetic origin of many triatomine tribes and genera remains problematic (Hwang & Weirauch 2012). Karyotypic information for more than 80 species shows a highly conserved diploid chromosome number, ranging from 21 to 25 chromosomes in males (Panzera et al. 2010). However, C-banding pattern and chromosomal mapping of the 45S ribosomal genes (45S rDNA), have revealed that Triatominae is one of the most chromosomally diverse groups of Hemiptera (Panzera et al. 2010; 2012; Pita et al. 2013). Fluorescent in situ hybridization studies had shown a high variability in the number (1-4 loci) and chromosomal location of the 45S rDNA, never reported before in species with holocentric chromosomes. These repeated DNA sequences are important markers to disclose chromosomal differentiation at interspecific and populational levels (Panzera et al. 2012; 2014; Pita et al. 2013). The simultaneous application of these two cytogenetic markers (C-banding and 45S rDNA location) on the same individuals offers the possibility to identified and separated cryptic species. Chromosomal analyses using genomic in situ hybridization (GISH) and chromosome microdissection reveal the existence of different repeated DNA sequences, which are highly variable in their chromosomal location (Pita et al. 2014). GISH analyses determine that autosomal repeated DNA sequences are shared between closely related species and they permitted to evaluate the phylogenetic relationships within Triatominae subfamily. These techniques enabled us to acquire not only reliable information about autosomal repeated sequences distribution but also an insight into sex chromosome evolution. Repeated sequences of Y chromosome are highly conserved in Triatomini tribe species. Sequence conservation of the Y chromosome is a very uncommon phenomenon; hence Y chromosome conservation in triatomines could be caused by a selective pressure. Male fitness could be related to the Y chromosome, and the selective sweeps would be important selective forces that cause the Y conservation. The comparative study of repeated sequences is allowing us to elucidate evolutionary relationships among different triatomine groups and understand the main mechanisms involved in genome evolution of Triatominae subfamily. Katia Calp Gondim SV02 SYMPOSIA 26 SYNTHESIS OF LIPIDS IN Rhodnius prolixus – FROM GENOME TO THE INSECT PHYSIOLOGY Michele Alves-Bezerra, Felipe B. Saraiva, Katia C. Gondim Instituto de Bioquímica Médica Leopoldo de Meis, Universidade Federal do Rio de Janeiro, Brasil. In insects, products of digestion are used as substrates for oogenesis, locomotion and other activities. In adult females of Rhodnius prolixus, a blood sucking insect vector of Chagas’ disease, free fatty acids are absorbed and used, in the midgut epithelium cells, for the synthesis of complex lipids, such as phospholipids, triacylglycerol and diacylglycerol. In this insect, we have demonstrated, by genomic and biochemical data, that triacylglycerol is synthesized solely via the glycerol-3-phosphate (G3P) pathway, initiated with the acylation of G3P with acyl-CoA in a rate-limiting step catalyzed by glycerol-3-phosphate acyltransferase (GPAT). All the genes that encode enzymes required by this pathway were identified in R. prolixus genome, and expression pattern of some of them was also analyzed. Fatty acids are also produced de novo from other blood constituents, as amino acids. The first step of this pathway is the reaction catalyzed by acetyl-CoA carboxilase (ACC), and one gene coding this enzyme was identified in R. prolixus genome. RpACCexpression was measured in various organs and variation was observed at days after feeding. Fatty acids synthesis by fat body was followed with the use of radioactive acetate. The newly synthesized fatty acids are activated by acyl-CoA synthetase (ACSL), to be used in anabolic or oxidative routes. In R. prolixus the two ACSL isoforms are differentially expressed and they possibly have different roles in metabolism. Supported by: FAPERJ, CNPq, INCT-EM Gustavo Calderón Fernández SV03 EXPRESSION OF CUTICLE GENES AND INSECTICIDE RESISTANCE IN Triatoma infestans Instituto de Investigaciones Bioquímicas de La Plata (CCT-CONICET-UNLP), Facultad de Ciencias Médicas, calles 60 y 120, 1° piso, CP 1900, La Plata, Argentina. E-mail: guscalf@gmail.com The insect integument, or exoesqueleton, covers the surface of the insect body; it comprises the cuticle and the epidermal tissue. The cuticle consists of an outer thin epicuticle, formed by lipids and lipoproteins, and an inner thick procuticle, mostly formed by chitin embedded in a matrix of cuticular proteins. Shortly after its formation, the cuticle is sclerotized in an enzyme-mediated sequence of reactions, becoming hard and rigid. The epidermis is the cell layer that underlies the insect cuticle and is primarily responsible for its formation. It includes several different types of cells with specific roles, such as epidermal cells, oenocytes, dermal glands, and hair forming cells. The cuticle lipids include mostly hydrocarbons, fatty alcohols, waxes and fatty acids. Fatty acid synthases (FAS), fatty acid elongases (ELOVL) and fatty acid reductases (FAR) are key enzymes of cuticle lipid synthesis. Structural cuticle proteins represent several families of chitin-binding proteins involved in forming the bulk of the cuticle; the CPR family includes most of the cuticle proteins found in the cuticle. SYMPOSIA 27 The integument plays a crucial role in the fitness, general metabolism, communication and survival of insects. Evidence has also been gathered showing that this tissue might be involved in several aspects of insecticide resistance. In T. infestans, the cuticle thickness and hydrocarbon content were shown to be related to insecticide resistance. The sequences of several genes related to the metabolism of cuticle components were obtained from a sequencing project of T. infestans epidermal tissue transcriptome. Present work showed a differential expression pattern of several ELOVL and FAR genes in insecticide resistant T. infestans compared to susceptible insects, further supporting the cuticle barrier role. Very importantly, several cuticle protein genes, and also genes coding for detoxifying enzymes such as cytochrome P450s, were differentially expressed in resistant insects. These results suggest that the differential expression of integument genes may contribute to insecticide resistance in T. infestans through mechanisms not only involving a delayed penetration through the cuticle, but also an increased detoxification as the insecticide is transported through the epidermis. Palabras clave: insect epidermal tissue, cuticle lipid metabolism, cuticle proteins, insecticide resistance. Patricia Juárez SV04 CONTROL OF Triatoma infestans WITH ENTOMOPATHOGENIC FUNGI: FROM LAB TO FIELD RESEARCH Inibiolp, Fac Cs Médicas, UNLP, La Plata E-mail: mjuarez@isis.unlp.edu.ar Current vector control strategies, based on chemical insecticide spraying, are growingly threatened by the emergence of pyrethroid-resistant bug populations. We have already shown that entomopathogenic fungi have the ability to breach the insect cuticle and are effective both against pyrethroid-susceptible and pyrethroid-resistant Triatoma infestans bugs, both in laboratory and field assays. We also know that T. infestans cuticle lipids play a major role as contact aggregation pheromones. The aim of this study was to analyze the potential of pheromone–based infection traps to effectively kill bugs indoors, and its effect on the vector population dynamics. Laboratory and field assays were perfomed in order to analyze virulence parameters, and the contribution of fungal horizontal transmission to the infection process, among other factors. After modeling the infection effects on insect population dynamics, we will discuss the biopesticide trap efficacy and its potential in vector integrated management. This low cost, low-tech, ecologically friendly methodology is the first proven alternative to help control T. infestans, regardless their susceptibility to pyrethroid insecticides. SYMPOSIUM VI: Molecular and celular biology Coordination: Gustavo Salinas / Andrea Ropolo Augusto Simoes-Barbosa Trichomonas vaginalis AND lactobacilli: A TUG OF WAR Phukan N; Pinheiro J; Bar A K, Simoes-Barbosa A. The Centre for Microbial Innovation, School of Biological Sciences, University of Auckland, New Zealand. SBM01 SYMPOSIA 28 As an extracellular parasite of the human genital tract, Trichomonas vaginalis must interact with the indigenous vaginal microbiota which is dominated by lactobacilli. Although the vaginal ecosystem is clearly disturbed upon T. vaginalis infection, this parasite has not been studied in the context of the host natural microbiota. Evidence supports that these bacteria have a beneficial impact on the host. Here we initiate a study which aims to investigate the details of this microbial interaction at different levels. Can these bacteria protect the host against T. vaginalis infection? We developed a FACS-based approach to quantify levels of T. vaginalis adherence - a critical step of infection - when different strains of the parasite and bacterium are co-incubated with host cells. We observed that, in most cases, lactobacilli significantly inhibit the adherence of the parasite to different degrees depending on the paring between the strain of parasite and bacterium. We have further examined the nature of this inhibition suggesting the involvement of surface molecules from lactobacilli. We expect to identify quantitative differences on surface proteins from lactobacilli with different inhibitory profiles using iTRAQ proteomics. Putative S-layer proteins from lactobacilli, our first candidates responsible for the inhibitory adhesion properties against T. vaginalis, are being tested using a heterologous expression system. The ability of lactobacilli to modulate other virulence properties of T. vaginalis, such as cytotoxicity, is also under investigation. In this tug of war, how does T. vaginalis counteract against lactobacilli? We hypothesise that T. vaginalis can directly kill and/or inhibit the growth of lactobacilli. A total of nine cell-wall hydrolase genes, typical of bacteria, have been found in T. vaginalis genome probably derived from horizontal gene transfer. As an eukaryote, the absence of a cell wall makes us believe that these enzymes are used by the parasite to control the populations of vaginal bacteria by affecting their cell integrity. We have observed by qPCR that only a few of the nine genes are significantly upregulated when T. vaginalis comes in contact with lactobacilli. The participation of these genes/proteins in controlling the population of lactobacilli is under investigation. Acknowledgments: funding from the Health Research Council of New Zealand and the Faculty Research Development Fund (University of Auckland). Estela Castillo SBM02 STEM CELLS IN PARASITIC FLATWORMS, FROM MYTH TO REALITY. Estela Castillo, Fernanda Dominguez, Alicia Costábile, Ileana Corvo, Serrana Estrade,Germán Caurla, Uriel Koziol, José Tort. Sección Bioquímica- Biología Molecular, Facultad de Ciencias Departamento de Genética- Facultad de Medicina,UDELAR.Montevideo Uruguay In free-living flatworms, somatic differentiated cells do not divide, and a separatepopulation of stem cells is responsible for cell proliferation and renewal. In cestodes, there is evidence that similar mechanisms of cell renewal exist, and the undifferentiated stem cells are denominated "germinative cells". Cestodes show a remarkable proliferative capability that sustains the constant growthand differentiation of proglottids essential for their lifestyle. It is believed that a separatepopulation of undifferentiated stem cells (the so-called germinative cells) are the only cells capable of proliferation during growth and development. Cell proliferation and differentiation were studied during early adult development of themodel cestode Mesocestoides corti by bromodeoxyuridine pulse-chase analyses. Germinative cells have a typical neoblast morphology and are present only in the innerparenchyma, in close proximity to the inner muscle layer. This is a conserved niche ofproliferative cells in adult cestodes. After proliferation some of these cells migrate to SYMPOSIA 29 theexternal regions to differentiate. Periodic accumulations of germinative cells areobserved in the genital primordia. The innermost cells of genital primordia cease toproliferate and differentiate into muscle cells expressing specific tropomyosin isoforms. Limited studies on cell proliferation have been performed in parasitic cestodes, mainlyduring development, and never before from a molecular perspective. Therefore, inaddition to morphological characterization, we propose the identification of molecularmarkers expressed in these cells. Our results show the expression of pumilio and PCNA genes, being reduced by gamma irradiation, as it results in the depletion of germinative cells. During development of genital primordia, the accumulation of germinative cells, give rise to somatic structures and to the germ line. They express nanos and pl10 genes, both markers of the germ line in other organisms. Once determined the localization and molecular characterization of germinative cells in the whole organism, we continued its characterization in isolated cells in S and G2/M phases of cell cycle. The study of this particular cell subpopulation is hampered by the current lack of methods to isolate it. We developed a reproducible flow citometry and cell sorting method to quantify and isolate proliferating cells in the tetrathyridia larvae of M. corti, based on the DNA content of the cells. The isolated cells display the typical germinative cell morphology, and can be used for RNA isolation with a yield in the ng to μg range. We expect that this approach may facilitate further characterization of the germinative cells in M. corti and other model tapeworms. Morever, isolated cells morphology was characterized by histology and electron microscopy techniques and by the expression of specific molecular markers. We are also working in the first transcriptomic description of M.corti these cells. Now, we are optimizing the culture of these cells, taking as starting point the recent development of Echinococcus multilocularis stem cell culture. This is of great importance since it will allow us to perform RNAi transfection and cell transplant in M.corti. Finally, we studied cell proliferation in the trematode Fasciola hepatica, identifying proliferating cells by ethynyldeoxyuridine (EdU) incorporation and phosphorylated Histone H3 detection (mitoses), as well as several molecular markers of this cells and its gene expression pattern along the life- cycle. Mara Rosenzvit SBM03 SMALL RNAS OF CESTODE PARASITES AND POTENTIAL APPLICATIONS TO CONTROL Natalia Macchiaroli, Marcela Cucher, Laura Prada, Lucas Maldonado, Laura Kamenetzky and Mara Rosenzvit Instituto de Microbiología y Parasitología Médica (IMPaM), UBA-CONICET, Paraguay 2155, Piso 13. CP 1121. Buenos Aires, Argentina. marcecucher@gmail.com Tapeworms (Cestoda) cause neglected diseases such as cystic echinococcosis or cystic hydatid disease, alveolar echinococcosis and neurocysticercosis, caused by the larval stages of Echinococcus granulosus, Echinococcus multilocularis and Taenia solium, respectively. Understanding the mechanisms that regulate their particular characteristics of development may allow identifying new therapeutic targets. MicroRNAs are small silencing RNAs that impact eukaryotic development and are receiving growing attention as novel SYMPOSIA 30 therapeutic and diagnosis targets. We have employed high throughput small RNA sequencing to characterize the small RNAomes of Echinococcus spp. species/stages using recently available genomic information (Tsai et al, 2013). There were obtained up to 40 million reads per library with high percentage of genome mapping. Significant proportions of small RNA reads corresponded to microRNAs. The previously reported Echinococcus spp. microRNA catalog consisting of 20 miRNAs (Cucher et al, 2011) was expanded to 34 conserved and 5 new candidate microRNAs. Interestingly, one microRNA was present in the closely related Echinococcus granulosus G1 and E. canadensis G7 but absent from Echinococcus multilocularis. Expression analyses showed that some miRNAs were highly expressed in all the stages and species analysed. MicroRNAs differentially expressed between stages and species were also identified, suggesting they could play developmental roles. Echinococcus spp. microRNA biogenesis showed particularities that could impact on targeted genes. No evidence of other canonical small silencing RNAs like piRNAs has been obtained so far. Host origin tRNA fragments were detected in parasite stages facing the host surface. In conclusion, our results show that microRNAs are the principal small RNA silencing molecules in Echinococcus spp. Highly expressed cestode microRNAs absent or divergent in mammal hosts were indentified and could be candidates for drug and diagnosis targeting. SYMPOSIUM VII: Immune response in parasitic infections Coordination: Ana Rosa Perez / Laura Chiapello Juliana De Meis SI01. IMMUNE RESPONSE AFTER Trypanosoma cruzi INFECTION TROUGH THE ORAL ROUTE. Laboratory on Thymus Research, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil Oral transmission of Trypanosoma cruzi, the causative agent of Chagas disease, is presently the most important Brazilian route of infection (70-80% of cases). Moreover, Venezuela, Colombia, Bolivia, Argentina and Ecuador have also reported to have acute cases of Chagas disease associated with food/beverage consumption. In addition to the classic cardiac involvement, orally-infected patients progress to a highly symptomatic acute phase (fever, face oedema, exanthema, haemorrhage, meningoencephalitis, abdominal pain, among others). Increased mortality rate is marked in the first 2 weeks (835%), surpassing the calculated mortality (5-10%) produced by the disease resulting from metacyclic trypomastigote deposition with feces after vector biting – Classical vectorial pathway. In endemic regions of Chagas disease, people can be infected either vectorially or orally, and this condition raises questions as whether oral infection results in a different disease outcome. Moreover, experimental studies related to oral infection usually comprise inoculation in the mouth (oral infection, OI) or intragastrically/intrafaringeal (gavage infection, GI), being roughly considered as similar routes of infection. Using bioluminescent analysis of 1x106 Dm28c luc+/+ OI and GI infected mice, we are demonstrating that OI mice accumulate parasites within the oral cavity 1 and 48 hours after infection. These observations suggested that OI and GI may be considered different route of parasite entry, leading to specific regional immune responses and changes in the host protective immune response. To test this hypothesis, we have established an experimental protocol of OI and GI with 5x104 trypomastigotes (Tulahuén strain) in BALB/c mice. Interestingly, OI group presented significantly higher parasitemia and mortality rates SYMPOSIA 31 than their GI mice. Moreover, heart histopathology showed extensive microinfiltrates in GI mice whereas liver lesions were more severe in OI animals. Multiplex analysis revealed that OI mice presented higher type 1 cytokine (IFN-γ, TNF-α) serum levels than GI. Conversely, TGF-β serum levels were higher in GI animals. Interestingly, the higher mortality rate seen in OI mice paralleled the TNF-α serum rise, and death of these animals was blocked by anti-TNF-α antibody treatment. Overall, we can conclude that the site of parasite entrance, through the mouth or directly to the stomach, differentially affects host immune response and mortality. Finacial support: FAPERJ, CNPq, IOC/FIOCRUZ Laura Cervi SI02 MODULATION OF INNATE IMMUNE RESPONSE BY FASCIOLA HEPATICA PROTEIN: INTERFERENCE OF TLR SIGNALING Department of Clinical Biochemistry. School of Chemical Sciences. National University of Córdoba. CIBICI-CONICET. During infection with helminth parasites, different stimuli or ligands are recognized by receptors of innate immunity. Such ligands include both parasite molecules, which are excreted as they migrate through the tissues of the host, or endogenous ligands, from tissue breakdown. In this inflammatory context, the parasite has different molecules that prevent or modulate inflammation to ensure their survival. In previous work, we found that a total parasite F. hepatica extract (TE) is able to induce different tolerogenic properties in dendritic cells (DC) from mouse, such as resistance to TLR-induced maturation, inhibition of the co-stimulatory molecules expression and reducing the ability of DC matured with LPS to induce allogeneic responses. In this study, we found that a protein fraction of TE lower than 10 kDa, (F <10 kDa) obtained by ultrafiltration, was capable of maintaining total extract modulating properties on DC maturation. Furthermore, it was demonstrated that the F <10 kDa printed different regulation to DC, depending on the absence or presence of LPS. Thus, treatment of DC with F <10kDa, endow these cells to induce Foxp3 regulatory T cells in allogenic cultures, while treatment with F <10 kDa plus LPS reduced allogeneic responses by a mechanism dependent on IL-27. Moreover, it was established that the major protein present in the F <10 kDa, is a molecule of the family of protease inhibitors as described in Kunitz type F. hepatica (Fh-KTM), which was responsible for the modulation on TLR-induced DC maturation and the inhibition of allogeneic responses. Despite substantial evidence showing that helminth parasites use these inhibitors to protect from degradation by proteases secreted by themselves, very little is known about the role of these proteins in modulating the immune response. That is why we believe that the emerging knowledge on the modulation exerted by this new molecule in the immune system, may help not only to understanding the mechanisms of evasion used by the fluke, but it could also lead to a new target therapeutic for vaccines developing or anthelmintic drugs. Eva Acosta Rodríguez SI03 ROLE OF IL-17RA IN THE DEVELOPMENT OF SPECIFIC CD8+ T CELL RESPONSES TO Trypanosoma cruzi. Departamento de Bioquimica Clinica. Facultad de Ciencias Químicas. UNC SYMPOSIA 32 Centro de Investigaciones en Bioquímica Clínica e Inmunología. CONICET. Cytokines of the IL-17 family have been recently shown to contribute to host defense against many intracellular pathogens. As against extracellular microbes, the IL-17dependent protective roles during intracellular infections relied on the induction of inflammation and the recruitment of innate and, eventually, adaptive immune cells. Here, we describe a new effector mechanism by which IL-17RA-signaling cytokines are critically involved in the generation of pathogen-specific CD8+ T cell responses. IL-17RA knockout mice infected with the protozoan parasite Trypanosoma cruzi developed a reduced frequency of parasite-specific CD8+ T cells that resulted in decreased antigen-specific cytotoxicity in vivo and increased tissue parasitism. Adoptive transfer experiments established that CD8+ T cell intrinsic IL-17RA-signaling is required to support CD8+ T cell immunity to T. cruzi. Loss of IL-17RA-signaling during this parasite infection did not affect expansion but reduced survival of parasite-specific CD8+ T cells. Phenotypic, functional and genomic profiling determined that T. cruzi-specific CD8+ T cells arising in the absence of IL-17RA-signaling presented an aberrant phenotype resembling memory cells with signs of high activation and exhaustion. Altogether, our results identify IL-17RA-signaling cytokines as critical factors for the generation of robust CD8+ T cell immunity to T. cruzi SYMPOSIUM VIII: Interaction parasite – host cell Coordination: Patricia Romano / Andrea Cumino Marcel Ramírez SPH01 MICROVESICLES MODULATE HOST-PARASITE INTERACTION DURING Trypanosoma cruzi INFECTION Marcel I.Ramirez1, Ingrid Evans1, Andre Mojoli1 and Igor de Almeida2 . 1- Laborario de Biologia Molecular de Parasitas e vetores, Instituto Oswaldo Cruz. Av Brasil 4365- Rio de janeiro -Brasil. 2-Border Biomedical Research Center, University of Texas at El Paso, Texas , USA. Recently the description of Extracellular vesicles (Exosomes, Microvesicles and apoptotic bodies) released from eukaryotic cells have showed participate in multiple functions altering host cells. We have been interested in Microvesicles (MVs) (0.2 -1 μm size) that have been shown to be involved in intercellular communication, apoptosis, coagulant and immunological roles (Reviewed in J.Cell Biol. 2013 ;200(4):373-83). Our group has been demonstrating the role of MVs in Trypanosoma cruzi, the causative agent of Chagas disease. The MVs production during the interaction T. cruzi metacyclic forms -host cells protect the parasite from complement lysis, enhance the parasite infectivity and promote a high infection in mice (J Immunol 2012 188(4):1942-52). In this work we define as main aim how is the MVS release during the life cycle of T. cruzi and what is the role of these Mvs at the pathogenesis of Chagas disease? We have seen the involvement of MVs during parasite-host cell contact, using Trypanosoma cruzi and THP1 cells as biologic model. During the interaction an increase of intracellular calcium activate scramblase modifying phospolipids polarity of the membrane with budding of microvesicles with phosphotidilserin exposure. We are interested to know how is the contribution of different stages of T cruzi (metacyclic, blood trypomastigotes and epimastigotes) at the MVs formation. We have prepared microvesicles from different forms and strains of T. cruzi using 1.106 parasites in contact with 1.105 THP1 cell (1 h at 37 C 1 mM Cacl2) Later, microvesicles SYMPOSIA 33 were obtained after a cycle of centrifugations (1x 2000g x 5 min, 2 times 4000g x 30 min and 100000g x 1.5 hour). 1D-LC-MS/MS of all microvesicles-T. cruzi interaction were performed and analysed. Different strains of T. cruzi from cell derived trypomastigotes showed high number of MVs induction during contact with monocytes compared with other stages. Proteomic of MVs has shown that both cells, parasite and monocyte, contribute with membranes for the formation of these structures. However, trypomastigote membrane proteins were observed in higher number (25 %) than proteins from epimastigotes (4 %) and metacyclic (11 %).These vesicles presented phosphatidylserine (59%) and are important to enhance the parasite infectivity in vitro and in vivo. We stained differentially THP-1 and parasites membranes searching for stained MVs on the supernatant. We observed MVs from THP-1 (green ) and parasite (red) in a Ca2+ dose dependent process. All stages can release membranes and contribute for MVs formation. Moreover using NBD fluorocrome in a FRET methodology we have detected a decrease in fluorescence energy transfer, showing that MVs released from stained THP-1 membranes can fuse with MVs released from parasite. The fusion process was inhibited at 4oC. Interestingly, MVs from trypomastigotes present a higher fusogenic capacity when compared with other stages. The greatest fusogenic potential observed for MVs from trypomastigotes coincide with a higher presence of parasite proteins on the composition of MVs from trypomastigotes as seen by proteomic analisis. MVs carrying parasite antigens constitute a mechanism to modulate the proteins from epimastigotes (4 %) and metacyclic (11 %).These vesicles presented phosphatidylserine (59%) and are important to enhance the parasite infectivity in vitro and in vivo. We stained differentially THP-1 and parasites membranes searching for stained MVs on the supernatant. We observed MVs from THP-1 (green ) and parasite (red) in a Ca2+ dose dependent process. All stages can release membranes and contribute for MVs formation. Moreover using NBD fluorocrome in a FRET methodology we have detected a decrease in fluorescence energy transfer, showing that MVs released from stained THP-1 membranes can fuse with MVs released from parasite. The fusion process was inhibited at 4oC. Interestingly, MVs from trypomastigotes present a higher fusogenic capacity when compared with other stages. The greatest fusogenic potential observed for MVs from trypomastigotes coincide with a higher presence of parasite proteins on the composition of MVs from trypomastigotes as seen by proteomic analisis. MVs carrying parasite antigens constitute a mechanism to modulate the communication between the parasite and the host cell. Cell derived trypomastigotes seem to participate at the Mvs genesis and these MVs could be involved in immunopathogenesis. The understanding of intracellular trafficking and effect of these microvesicles at the host cells are under investigation. Financial support: Fiocruz, Faperj, CNPq and Programa de Parasitologia Basica-CAPES Patricia Veras SPH02 17-AAG INDUCES INCIDENTAL CELL DEATH OF Leishmania WITH AUTOPHAGIC FEATURES: EVIDENCE FOR A CROSSTALK BETWEEN AUTOPHAGIC AND PROTEOSOME PATHWAYS PETERSEN, A.L.O.A.1,2; CULL, B2; MOTTRAM, J.C2; VERAS, P.S.T.1* 1 Gonçalo Moniz Research Center/FIOCRUZ, Bahia, Brazil 2 University of Glasgow/Institute of Infection, Immunity & Inflammation SYMPOSIA 34 * pveras@bahia.fiocruz.br For 70 years, pentavalent antimonials have been the first line of treatment for leishmaniasis. However, the efficacy of this treatment is under scrutiny due to increases in drug-resistant cases. As such, we employed a proteomic approach that allowed the identification of modulated proteins in Leishmania-infected macrophages that might function as novel targets for alternative chemotherapeutic intervention against Leishmania infection. This approach revealed 162 proteins that exhibited altered expression due to Leishmania infection. Of the 15 with the greatest differences in expression, at least one of them, HIF-1a, is a potential candidate for targeted therapy using specific drugs. HIF-1α is one of the client proteins of HSP90, a heat-shock protein, which is highly abundant in mammalian cells and induced during stress responses. HSP90 is an ATP-dependent chaperone known to be involved in the stabilization, correct folding and assembly of several client proteins, including HIF-1α. Protozoan parasites also express HSP90, which plays a crucial role in stabilizing heat-labile proteins within these cells. We hypothesized that treatment of infected macrophages with a specific HSP90 inhibitor, such as geldanamycin or 17-AAG, would have a highly antileishmanial effect, since these benzoquinone ansamycin antibiotics provoke profound modifications in Leishmania differentiation processes. Furthermore, as these types of inhibitors are known to act on targets present in both host cells and in parasites, we postulated that treatment with 17AAG should enable macrophages to more efficiently kill intracellular parasites already weakened by this HSP90 inhibitor. As expected, treating infected macrophages with the 17-AAG significantly reduced both the percentage of infected cells and parasite load in a dose- and time-dependent manner. Interestingly, treatment with 17-AAG reduced the production of pro-inflammatory mediators, including TNF-a, IL-6 and MCP-1, yet IL-12 remained unaffected. The absences of changes in nitric oxide and superoxide production indicate that intracellular parasite death occurred independently. Electron microscopy revealed morphological alterations, which suggest that 17-AAG-induced parasite death resulted from an autophagic process. To further investigate 17-AAG-dependent parasite death, mutants of the components of the autophagic pathway of Leishmania parasites, such as GFP-ATG8 and ATG5-KO, were treated with this inhibitor. An increase in the number of L. amazonensis-bearing autophagic vacuoles was observed, and ATG5-KO mutants, which are unable to form autophagic vacuoles, were shown to be more resistant to 17-AAG than wild-type parasites, indicating that 17-AAG-induced parasite death appears to be linked to the autophagic process. We also showed that 17-AAG reduced the fusion between autophagosomes and lysosomes/glycosomes, contributing to increases in the number of autophagosomes in parasites upon 17-AAG treatment. Since the autophagic pathway can crosstalk with proteasome pathway, to assess the influence of this pathway in 17-AAG-induced L. amazonensis death, we evaluated the effect of MG132, a proteasome inhibitor, on autophagosome formation. MG132 was found to induce autophagosome formation and, as expected, western-blot analysis demonstrated that both MG132 and 17-AAG induce ubiquitilated protein accumulation. In addition, the presence of ubiquitilated proteins was more evident in ATG5-KO L. amazonensis parasites. These findings suggest that autophagy plays an important role in ubiquitilated protein degradation, which supports the idea that 17-AAG-induced parasite death occurs via a mechanism dependent on the activation of the parasite autophagic pathway. Furthermore, this is the first attempt that evidenced a cross talk between the autophagic and proteasome pathways in Leishmania parasites that have been linked to the process of parasite killing. SYMPOSIA 35 Ulrike Kemmerling SPH03 CONGENITAL CHAGAS DISEASE: TISSUE INVASION MECHANISMS OF Trypanosoma cruzi AND POSSIBLE LOCAL DEFENSES OF THE HUMAN PLACENTA Castillo C, Liempi A, Droguett D, Duaso J, Barahona K, Hernández A, Sandoval A, Maya JD, Galanti N and Kemmerling U. Institute for Biomedical Sciences, Faculty of Medicine, University of Chile. ukemmerling@u.uchile.cl Chagas disease, one of the major public health concerns in Latin America, is caused by the haemophlagelated protozoan Trypanosoma cruzi (T. cruzi). In the past few years congenital transmission of T. cruzi has become more important, and partly responsible for the “globalization of Chagas’ disease”, constituting a public health problem of increasing relevance. Diverse pathogens, including T. cruzi, are able to cross the placental barrier and infect both the placenta and fetus. The placental barrier is formed by the trophoblast tissue, that comprises a continuous multinucleated, non-replicating cell layer, the syncytiotrophoblast (STB), a replicating layer of cytotrophoblasts (CTB) that fuses with the STB, a basal lamina and an underlying villous stroma (VS) or connective tissue, that includes vascular endothelium. Therefore the trophoblast is the first tissue of the placental barrier to be in contact with the parasite in the maternal blood. In ex vivo infected human chorionic villi explants (HPCVE) as well as in placenta from women with chronic Chagas disease, the parasite induces detachment and disorganization of the trophoblast as well as selective destruction of basal laminae and collagen I in the VS. Endogenous proteases such as MMP-2 and MMP-9 (matrix metalloproteases) increase their expression and activity during this process. On the other hand, the global congenital infection rate is estimated to be less than 5%, therefore local placental antiparasitic mechanisms might exist. The trophoblast, is a renewing epithelia that forms part of the innate immune system. The turnover of the trophoblast implies a precise orchestration of various cellular processes including CTB cell proliferation, differentiation (meaning syncytial fusion by incorporating CTB cells into a non-replicative STB) and cell death. We have previously shown that ex vivo infection with a low concentration of parasites induces apoptosis in the trophoblast. In order to study cellular proliferation in that tissue DNA synthesis, mitotic index and proliferation markers were determined in T. cruzi infected and non-infected HPCVE and BeWo cells (a trophoblastic cell line). The effect of parasite infection on tissue differentiation was analyzed by assaying β-human chorionic gonadotropin (β-hCG) and syncytin, both major biochemical markers of trophoblast differentiation. Additionally, differentiation in BeWo cells by the two-color fusion assay and by desmoplakin redistribution was also analyzed. Our results clearly show that T. cruzi induces epithelial turnover of the trophoblast, most likely as part of a local anti-parasitic response in the placenta. Financed by FONDECYT Projects Nº1120230 (UK), Nº 1130189 (JM), Nº1130113 (NG). SYMPOSIA 36 SYMPOSIUM IX: Diagnostic innovation in congenital chagas Coordination: Sergio Angel Carolina Carrillo SD01 DESARROLLO DE UN TEST MOLECULAR DE DIAGNÓSTICO SIMPLIFICADO PARA CHAGAS EN NEONATOS. Luciana Larocca, Fabiana G. Stolowicz, Adrián A. Vojnov, Carolina Carrillo*. Instituto de Ciencias y Tecnología Dr. César Milstein – CONICET. Saladillo 2468, Buenos Aires, Argentina. ccarrillo@fundacioncassara.com.ar La enfermedad de Chagas, una parasitosis causada por el Trypanosoma cruzi, es endémica en América con más de 10 millones de personas infectadas. Las terapias para tratar el Chagas son relativamente efectivas en la fase aguda de la enfermedad y en los casos infantiles; aumentando la probabilidad de cura cuanto más precoz sea el diagnóstico. En este contexto, en Argentina rige la “Ley 26.281 - De Control y Prevención del Chagas” que exige que a todo/a recién nacido/a de una mujer portadora debe realizársele un diagnóstico de Chagas. Sin embargo, el algoritmo aplicado para el diagnóstico en neonatos/as puede tomar hasta unos 10 meses pues los métodos disponibles para diagnosticar Chagas en adultos/as e infantes no resultan aplicables en neonatos/as, o su aplicación requiere de tal infraestructura, equipamiento y recursos humanos que se restringe a pocos centros de investigación y/o salud. En el año 2011, el Ministerio de Ciencia, Tecnología e Innovación Productiva a través de la Agencia Nacional de Promoción Científica y Tecnológica (FONARSEC) convocó a la formación de consorcios público-privados para “la presentación de proyectos innovadores destinados a solucionar problemas tecnológicos … (asociados) al diagnóstico de la enfermedad de Chagas”, con especial énfasis en Chagas congénito y neonatos/as. En respuesta a este llamado, conformamos un consorcio entre CONICET y las empresas Unifarma S.A. y Laboratorio Pablo Cassará S.R.L., y propusimos diseñar un test de diagnóstico molecular, sensible y específico y a la vez simple e inclusivo (para todo tipo de condición) para neonatos/as. Para ello trabajamos sobre técnicas de amplificación molecular isotérmica, cuya funcionalidad se describe, en bibliografía, para iniciativas de diagnóstico simplificado en distintos patógenos. El desarrollo inicial del test incluyó 3 etapas: ETAPA 1: Selección de secuencias blanco y diseño de primers, mediante adquisición y aplicación un software específico para esta tecnología y análisis bioinformático y depuración de los sets de primers diseñados. ETAPA 2: Puesta a punto de la reacción in vitro. Se efectuaron pruebas para ajustar: i)- condiciones de reacción (tiempo, temperatura, componentes de las mezclas de reacción, etc.); ii)- sensibilidad, según carga de ADN o parasitaria y soportes donde se dispensa la muestra; con muestras artificialmente inoculadas y con dos muestras testigo (positiva y negativa) certificadas por el Instituto Nacional de Parasitología “Dr. Mario Fatala Chaben” iii)- especificidad, utilizando como controles otros parásitos filogenéticamente emparentados, células humanas y células no relacionadas al parásito ni al hospedador. ETAPA 3: Adecuación de la técnica a condiciones simplificadas o “POC” (siglas de “Point of care”), para todo tipo de condición (de equipamiento, infraestructura, de recursos humanos). Para ello, se trabajó en dos puntos clave: la simplificación de la obtención del templado molecular a partir de una muestra de sangre y del método de lectura. SYMPOSIA 37 La reacción de diagnóstico con el test desarrollado incluye los siguientes pasos: Obtención de una muestra de sangre: una gota de sangre del/a neonato/a (no requiere extraccionista). Siembra de la muestra en la mezcla de reacción. Incubación por 40 minutos a 65°C (en cualquier tipo de dispositivo térmico). Revelado del resultado, mediante el sistema de tiras reactivas “lateral flow lipsticks” (LFD) (del tipo de los tests de embarazo comerciales). El test está aún en etapa de desarrollo y ajuste de parámetros, y seguramente deban ajustarse más detalles tanto al momento de probarlo en muestras a campo como al momento de producirlo a mayor escala. Sin embardo esta experiencia nos anima a seguir adelante y, en un futuro, a proponer desarrollos para otras enfermedades infecciosas. Fernán Agüero SD02 DISCOVERY OF NOVEL SEROLOGICAL BIOMARKERS ASSOCIATED TO CONGENITAL CHAGAS DISEASE USING A HIGHLY-MULTIPLEXED DISCOVERY PLATFORM BASED ON HIGH-DENSITY PEPTIDE MICROARRAYS Santiago J Carmona1, Claus Schäfer-Nielsen2, Carlos A Buscaglia1, Juan S Mucci1, Jaime Altcheh3, Oscar Campetella1, Alberto CC Frasch1, Morten Nielsen1, and Fernán Agüero1,* 1 Instituto de Investigaciones Biotecnológicas – Instituto Tecnológico de Chascomús, Universidad de San Martín – Consejo Nacional de Investigaciones Científicas y Técnicas, B1650HMP, San Martín, Buenos Aires, Argentina 2 Schäfer-N ApS, DK2100, Copenhagen, Denmark 3 Servicio de Parasitología y Chagas, Hospital de Niños “Ricardo Gutiérrez”, C1425EFD, Ciudad Autónoma de Buenos Aires, Argentina * Presenting autor, fernan@unsam.edu.ar The full set of antibody (B-cell) specificities associated with the response to a natural infection remains largely unexplored. We developed a highly-multiplexed discovery platform based on next-generation high-density peptide microarrays and demonstrate for the first time its potential to simultaneously identify and finely map hundreds of B-cell epitopes from a complex natural human infection. The platform consists of a HD tiling peptide array containing ~200K unique 15mer peptides synthesized in situ on a microarray slide, using a maskless photolithographic method. The peptides completely cover the full length of 468 T. cruzi proteins, scanning the protein sequence at maximal resolution (1 residue shift). These proteins include 59 previously described antigens, 50 proteins randomly selected from the proteome, 100 proteins selected using a recently published bioinformatics method (Carmona SJ et al 2012); and 232 surface proteins from a number large gene families. The array also contains 24K 15mers corresponding to ~50 neoproteins of random sequence to estimate the array background baseline (negative control). Using this platform we have analyzed the B-cell immune response in humans with Chagas Disease, assaying 8 independent HD-arrays with 4 pools of purified IgGs from Chagas Disease patients and negative controls. After defining a very conservative cutoff we identified 1,193 positive 15mers in the set of serologically uncharacterized proteins, which define 98 new antigens. We also identified the location of linear epitopes for a number of known antigens, as well as a number of protein regions which are the target of nonspecific antibody binding (putative cross-reactive responses). This high-density peptide array platform now allows high-throughput identification and mapping of B-cell epitopes. In SYMPOSIA 38 this presentation we will discuss the use of this platform to discover epitopes associated with congenital Chagas Disease. Acknowledgements: Funded by a grant (FITS-Chagas-003) from the National Agency for the Promotion of Science and Technology (ANPCyT, Argentina). Alejandro Schijman SD03 DEVELOPMENT AND VALIDATION OF A NEW REAL TIME PCR BASED KIT PROTOTYPE FOR MOLECULAR DIAGNOSIS OF CONGENITAL CHAGAS DISEASE Grupo de Biología Molecular de la Enfermedad de Chagas. Instituto de Ingeniería Genética y Biología Molecular (INGEBI-CONICET), Buenos Aires, Argentina. En representación del Consorcio Público Privado formado por CONICET, Wiener Laboratorios S.A.I.C, Rosario, Argentina; Instituto Nacional de Parasitología (INP) “Dr. Mario Fatala Chaben”- ANLIS, Argentina. Background: Current diagnosis of Congenital Chagas disease (CCD) is based in parasitological detection during the first months of life or serological detection at 10 months. However, the former is highly operator-dependent and presents variable sensitivity. Due to socio-economical constrains, a high proportion of parasitologically undetected neonates cannot attend their second opportunity of diagnosis at 10 months, remaining undiagnosed. Objetives: In the context of FONARSEC FITS SALUD CHAGAS, a public-private consortium was conformed to develop a Real-Time PCR kit prototype for early detection of T.cruzi DNA in clinical samples optimized for its application to CCD diagnosis. Specific aims were: 1) Development, optimization and analytical validation of DNA extraction procedures from human blood followed by Real Time PCR approaches to select the best performing combination to generate a Kit prototype 2) Field validation of the kit prototype in the context of congenital transmission; 3) development and validation of an External Quality Control system for PCR. Materials and Methods: Different combinations of reagents and procedures for blood collection, storage, DNA extraction and amplification were evaluated in terms of analytical sensitivity and specificity using seronegative human blood samples spiked with known quantities of T.cruzi DNA to select the best combination for kit prototype production. DNAs from strains representative of the six discrete typing units (Tc I to Tc VI), as well as DNAs from T.rangeli and Leishmania spp were tested. Analytical performance of the prototype was determined following international guidelines for molecular diagnosis of the Clinical Laboratory Standard Institute, namely: inclusivity, exclusivity, reportable range and limit of detection (LOD). Moreover, stability of the reagents was assessed. Field validation: To compare the accuracy of the kit vs that of current diagnostics (micromethod in cord blood at birth or peripheral blood within the first 15 days and at 4-8 weeks of life, plus serodiagnosis at 10 months of life), a double-blinded prospective field study was designed and approved of CEMIC Ethical Committee and local IRBs. Activities at fellow centers involved screening, recruitment and consent processes, data management (filling the CRFs, data entry), sample inventory, weekly monitoring and reporting. Each center processed the micromethod and serodiagnosis, recruited and SYMPOSIA 39 refered samples for qPCR to INGEBI-CONICET and for serologic tests to INP. The logistics guidelines ensured traceability and proper transport for barcoded samples. External Quality Control panels were designed using seronegative blood spiked with serial numbers of cultured parasites. Results: The best analytical parameters of the test in terms of analytical sensitivity and specificity were obtained in 1 mL of blood collected in DNA stabilizer solution and processed using glass fiber columns. The best performing amplification procedure was duplex qPCR with primers and TaqMan probes designed to conservative regions in parasite satellite DNA nuclear repeats for all DTUs, and to an internal amplification standard. PCR included UDG for reduction of amplicon carry-over contamination. The kit Prototype has a LOD of 0.2 parasite equivalents/mL in spiked blood and 100% specificity in seronegative panels and T. rangeli and Leishmania spp DNAs. Reagents stability tested for at least 6months showed similar patterns of analytical sensitivity. Field validation is currently undergone in 100 out of 500 mother-newborns binomials recruited in Maternity Services from Tucumán, Santiago del Estero and Chaco and at the INP. Database will be disclosed at the end of study. Discussion: The performing parameters of the kit encourage its application not only to early diagnosis of CCD but also to oral outbreaks, organ transplantation and monitoring of trypanocidal therapy. POSTER SESIONS SAP X Congress Mar del Plata 2014 BIOCHEMISTRY & MOLECULAR BIOLOGY 40 BYBM01 EFFECT OF PERILLYL ALCOHOL IN Plasmodium spp. STUDIES IN VIVO AND IN VITRO Adriana A Marin Rodriguez(1), Emilia A Kimura(1) , Alejandro M Katzin 1) Universidade de São Paulo. Instituto de ciências Biomédicas - Dpto de parasitologia (1) E-mail: amarin@usp.br Malaria affects about 200 to 300 million people worldwide per year, being one of the most important infectious diseases and a major public health problem, furthermore, the emergence of strains resistant to chemotherapeutic drugs actually used, makes necessary the study of targets for new treatments against this disease. In our laboratory has demonstrated the biosynthesis of several isoprenoid in Plasmodium falciparum by the 2C-methyl-D-erythritol-4-phosphate (MEP) pathway and it is also known that inhibiting substances of the isoprenoids biosynthesis , among these, the terpenes , exhibit antimalarial activity "in vitro" and "in vivo". The perillyl alcohol (POH) is a monoterpene extensively studied that has been shown as an inhibitor of protein isoprenylation, inhibiting the enzymes farnesyl transferase and geranylgeranyl transferase, proteins Ras and p21 leading to apoptosis in tumor cells. Hence, it is believed that the isoprenoid pathway is a target for the development of new antimalarial drugs, and for this reason we propose to evaluate the antimalarial potential of POH through of "in vitro" test with P. falciparum and "in vivo " test with Balb / c mice infected with P. berghei Anka gfp, evaluating the influence of treatment on survival and parasitemia during infection. Also, determine the cytotoxic and genotoxic effects in Balb / c mice. Preliminary results indicate that POH inhibited 50% of population growth of P. falciparum (IC50 = 4.0 µm ± 0,5 ), however, the "in vivo" experiments showed no significant difference in the percentages of parasitemia in the treated group compared with control, in contrast, the survival of treated animals increased by 40% compared to the control group. Finally, the POH has antimalarial effect in Plasmodium falciparum, nevertheless, it is needed to improve the dosage of administration in order to have an effect in reducing parasitemia and increasing survival of treated animals. BYBM02 THE Trypanosoma cruzi ORTHOLOG OF P32/C1QBP INTERACTS WITH TCUBP1, PROMOTING ITS PHOSPHORYLATION AND AFFECTING ITS BINDING TO RNA Alejandro Cassola(1), Albertina Romaniuk(2), Gabriela Cervini(3), Ivan DOrso(4), Alberto C Frasch(5) (1)(2)(3)(5) IIB-INTECH-CONICET-Universidad Nacional de San Martín. (4)Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, TX, USA. E-mail: alecassola@gmail.com Kinetoplastid parasites regulate gene expression essentially by post-transcriptional mechanisms. Within this picture, few polycistronic transcription start sites give birth to immature RNA molecules that are rapidly processed by trans-splicing and polyadenylation, ending in different mature mRNAs. RNA-binding proteins (RBPs) associate to sequences within their 3´UTR, regulating mRNA stability and translation efficiency. One of the most characterized RBPs from trypanosomes is TcUBP1, an mRNA destabilizing factor that relies on its RNA-recognition motif (RRM) for recruitment to mRNA granules and BIOCHEMISTRY & MOLECULAR BIOLOGY 41 nucleocytoplasmic shuttling. In a screening for putative proteins affecting TcUBP1 function by binding to its RRM we identified TcP22, the ortholog of human P32/C1QBP. Endogenous TcP22 interacts in vivo with TcUBP1, and both proteins can share localization in few cytoplasmic foci. In vitro, TcP22 only interacts with TcUBP1 protein constructs that have a functional RRM and not with mutated ones. This interaction is however prevented when TcUBP1 is bound to RNA. Notwithstanding this, we found that addition of recombinant TcP22 to cell extracts affects TcUBP1 association to ribonucleoprotein complexes, and promotes its phosphorylation on tyrosine residues. This phosphorylation affects TcUBP1 affinity for RNA. In vivo analysis of TcUBP1 phosphorylation showed that it becomes detectable in parasites under a lag/early log phase of growth condition, while it cannot be detected parasites in a late log/stationary phase of growth. TcUBP1 colocalize extensively with poly(A) and in a few foci with TcP22 in early log phase parasites, while it only colocalize with mRNA granules under starvation stress, an extreme condition of stationary phase of growth. These results provide evidence of the phosphorylation of TcUBP1 induced by TcP22 interaction, consequently lowering its affinity for mRNA. BYBM03 DEVELOPMENT OF MOLECULAR TOOLS FOR THE CHARACTERIZATION AND FUNCTIONAL ANALYSIS OF TRYPANOTHIONE SINTHETASE (TryS) IN Trypanosoma cruzi Andrea C Mesías(1), María D Piñeyro(2), Carlos Robello(3), María P Zago(4) IPE-CONICET, Salta, Argentina. (2)(3)Institut Pasteur, Montevideo, Uruguay. E-mail: andrea_mesias@hotmail.com (1)(4) The antioxidant system of Trypanosoma cruzi is a sophisticated network of metabolic pathways, completely different to its human counterpart. Relying on thiols such as trypanothione, the system maintains redox homeostasis, deals with detoxification and respiratory burst, among other likely functions. It has also been proposed to have a role in drug resistance phenomena, ribonucleotides synthesis regulation and possibly in parasite persistence, avoiding the triggering of apoptosis in the infected tissue as part of the homeostatic clearance in the host. Trypanothione syntethase (TryS), encoded by a single copy gene, is a bifunctional enzyme in charge of trypanothione synthesis from glutathione and spermidine. Its essentiality has been confirmed in other organisms from the trypanosomatids. Its low abundance and substrate versatility makes it an ideal target for drug design. A direct correlation between overexpression of antioxidant enzymes, including TryS, and parasite virulence has formerly been shown in T. cruzi; moreover TryS is upregulated during metacyclogenesis. The aim of this work is the development of molecular tools to study TryS deeply. We propose the generation of parasites with different expression levels of this enzyme using two polar isolates, an attenuated strain(TCC) and a virulent one(Sylvio), both belonging to DTUI. In the TCC strain, we aim to overexpress TryS using the pTREX system. In the Sylvio strain, we attempt to knock down/out one or both alleles through the Gateway® technology. We have also designed two functional mutants in order to affect syntethase and amidase domains by a site directed mutagenesis strategy. Here we present the design and development of these tools, which will allow us to address the relationship among TryS expression and virulence or pathogenicity and parasite persistence as well. These parasites will be useful also for the study of other roles attributed to TryS(drug resistance, ribonucleotide synthesis, among others). BIOCHEMISTRY & MOLECULAR BIOLOGY 42 BYBM04 HIGH THROUGHPUT VIRTUAL SCREENING REVEALS A PROMISING SPECIFIC INHIBITOR OF Toxoplasma gondii N-MYRISTOYLTRANSFERASE. Andrés M Alonso(1), María Corvi(2), Diego M Bustos(3) Laboratorio de Parasitología Molecular, Instituto de Investigaciones BiotecnológicasInstituto Tecnológico de Chascomus (IIB-INTECH), UNSAM -CONICET. Intendente Marino Km 8,2 (B7130) Chascomús, Provincia de Buenos Aires, Argentina. (3)Laboratorio de Integración de Señales Celulares. Instituto de Histología y Embriología de Mendoza (IHEM)CONICET-UNCUyo 5500 Mendoza. E-mail: amalonso@intech.gov.ar (1)(2) N-myristoyltransferase (NMT) is a monomeric enzyme that catalyzes the covalent addition of myristate (C14:0 saturated fatty acid) onto proteins. This co- and post-translational modification affects a variety of proteins, many of them important for the life-cycle of cells, and influences different features such as localization, protein-protein interaction and function. Protein myristoylation is essential for cell viability and its peptide recognition sites are species-specific, which makes it an ideal drug target for different pathogens like fungi and protozooan parasites. In this work we performed a bioinformatic analysis that revealed that Toxoplasma gondii genome encodes for a putative NMT which contains the N- and Cterminal domains characteristic of the NMT family. Furthermore, primers designed for the T. gondii NMT coding sequence (CDS) published in the ToxoDB let us determine that NMT is expressed in the T. gondii RH strain. In parallel, a virtual screening (VS) on T. gondii NMT (TgNMT) was performed using over 5000 compounds filtered from the ZINC database. Since the crystal structure of TgNMT is not available, we created a homology model to run the VS. The analysis resulted in 10 compounds with a high predicted inhibition constant (Ki) over TgNMT, but only one of them was more specific for TgNMT than that of the host NMT (hNMT). Interaction analysis of the compound with TgNMT allowed us to infer that this compound might interact with the peptide binding site of the enzyme, a site that has been described to be species-specific. Besides, the compound interacts with the myristoil-CoA binding site of the hNMT, which is conserved along different species, but the interaction of the compound with hNMT was found to be a hundred times lower than with TgNMT. These preliminary results are the first report on specific TgNMT inhibitors and the starting point for the study of treatments designed specifically for toxoplasmosis. BYBM05 HISTONAS H2A DE FENOTIPO SILVESTRE Y MUTANTES EN Trypanosoma cruzi. EFECTO SOBRE PROLIFERACIÓN Y SOBREVIDA Bernardita Julio Kalajzic, Sofía Sepúlveda Contreras, Lucía Valenzuela Pérez, Gonzalo Cabrera Vallejos, Norbel Galanti Garrone Universidad de Chile. E-mail: ngalanti@med.uchile.cl Trypanosoma cruzi, agente causal de la enfermedad de Chagas, sobrevive al daño oxidativo al DNA tanto en el insecto vector como en el hospedero mamífero. En BIOCHEMISTRY & MOLECULAR BIOLOGY 43 eucariontes recientes la fosforilación de la histona H2AX en Ser139 es una respuesta temprana fundamental para la reparación del DNA. En tripanosomátidos no se ha identificado genes ortólogos para H2AX pero en T. brucei se detectó que H2A canónica es fosforilada en Thr130 a causa de daño al DNA. En T. cruzi este residuo corresponde a Thr132 y su rol en la respuesta al daño del DNA no se ha estudiado. Se realizaron tres mutaciones sitio-dirigidas en el codón que codifica para Thr132 de H2A de T. cruzi: alanina (no fosforilable), ácido glutámico y ácido aspártico (simulación fosforilación). Las secuencias nucleotídicas fueron insertadas en el vector pTREX y expresadas como proteínas de fusión con GFP en epimastigotes de T. cruzi. Se comprobó la expresión de las proteínas mediante visualización directa por microscopía de fluorescencia, IF y western blot. Las histonas unidas a GFP se localizan a nivel de núcleo, sugiriendo asociación con la cromatina. Parásitos que expresan H2A Thr132Ala poseen una constante de proliferación menor que aquellos que sobreexpresan la histona silvestre pero una viabilidad similar cuando se exponen a H2O2 por 30 min o 24 hrs. Se concluye que la sustitución Thr132Ala en la histona H2A afecta negativamente la proliferación del parásito pero no así su resistencia al daño oxidativo agudo o sostenido. BYBM06 THE SECRETOME OF Trypanosoma cruzi DURING THE METACYCLOGENESIS Carla Cristi Del Campo Avila, Giuseppe Palmisano Instituto de Ciências Biomédicas - Departamento de Parasitologia - Universidade de São Paulo - Brasil. E-mail: carla.cristi@gmail.com Trypanosoma cruzi, etiologic agent of Chagas disease, is a protozoan pathogen with a complex life cycle. Chagas disease is a serious health problem in Latin America and is an emerging disease in non-endemic countries. The differentiation of epimastigotes to metacyclic trypomastigotes, named metacyclogenesis, is central for the development of the disease. A deeper understanding of the molecular features, such as genes, proteins and metabolites, differentially expressed during metacyclogenesis is mandatory to identify effective drug targets. In particular, proteins released from T. cruzi modulate the pathogenhost interaction. This work aims at identifying T. cruzi secreted proteins and their functions during metacyclogenesis. Many research groups have highlighted the importance of T. cruzi secreted proteins. Recently it was investigated the secretome of Dm28c T. cruzi epimastigote and metacyclic trypomastigotes. In total, 367 proteins were identified from cell culture conditioned media and from vescicle-containing fractions. In this work, we have analyzed the T. cruzi strain CL clone 14 secretome released in chemically defined media, TAU3AAG, along different stages of the metacyclogenesis process. Shotgun LC-MS/MS proteomic approach combined with label-free protein quantification allowed us to identify 1300 proteins. Functional classification based on gene ontology allowed us to identify proteins involved in a variety of categories, such as signaling, transcription and protein synthesis, trafficking and membrane fusion and transport and oxidation reduction confirming the importance of this information-rich medium. Interestingly, many proteins were not previously identified in the secreted medium opening new ways of interpreting the T. cruzi signaling. These findings complement the current reports on secreted T. cruzi BIOCHEMISTRY & MOLECULAR BIOLOGY 44 proteins and allow us to understand and analyze in more detail and precision the mechanisms involved in the differentiation of T. cruzi. BYBM07 INTERACCIÓN ENTRE EL TRANSPORTE DE POLIAMINAS Y PENTAMIDINA EN Trypanosoma cruzi Chantal Reigada, Mariana R Miranda, Melisa Martínez Sayé, Fabio di Girolamo, Claudio A Pereira IDIM-CONICET. E-mail: chanreigada@hotmail.com Las poliaminas son moléculas esenciales para la proliferación de Trypanosoma cruzi debido a que el parásito es incapaz de sintetizarlas de novo, siendo el transporte la única vía de obtención de las mismas. Dada la esencialidad de estas moléculas y las diferencias existentes con el hospedador mamífero, el transporte y el metabolismo de poliaminas constituyen blancos terapéuticos promisorios. En trabajos anteriores se demostró que la pentamidina, una droga antiparasitaria utilizada contra la Leishmaniasis y la Tripanosomiasis Africana, también tiene efecto sobre T. cruzi mediante la inhibición del transporte de poliaminas. En el presente trabajo, se llevó a cabo un análisis bioinformático sobre el genoma del parásito que permitió identificar seis posibles transportadores de poliaminas. Entre éstos se encuentra el transportador de putrescina TcPT-1, que estaría también involucrado en el transporte de pentamidina. Bajo la hipótesis que la pentamidina ingresa a través de estos transportadores se comenzó a estudiar otro de ellos, el TcPT-3. Mediante la construcción de un modelo de levaduras que expresa heterólogamente dicho transportador, se observó que dichas levaduras transportan significativamente más espermidina que los controles. Además, se determinó su localización subcelular en el bolsillo flagelar y en el complejo de la vacuola contráctil. Por otro lado, se comprobó que el transporte de putrescina en parásitos wild type puede ser inhibida no sólo por pentamidina sino también por su análogo DAPI, validando que poseen vías en común de ingreso a la célula. Asimismo, los parásitos transgénicos que expresan niveles elevados del transportador TcPT-1 transportan mayor cantidad de DAPI que los controles. Estos resultados sugieren que los transportadores de poliaminas podrían ser una puerta de entrada para la pentamidina y destacan la importancia del transporte y metabolismo de dichos metabolitos como blancos terapéuticos de aplicación en la Enfermedad de Chagas. BYBM08 LA NUCLEÓSIDO DIFOSFATO QUINASA 1 DE Trypanosoma cruzi GRANULOS QUE DEPENDEN DE SU ESTRUCTURA CUATERNARIA FORMA Claudio A. Pereira(1), Arturo Gomez Barroso(2), Carlos F. Aguilar(3), Chantal Reigada(4), Fabio di Girolamo(5), Melisa Sayé(6), Mariana R. Miranda(7) (1)(4)(5)(6)(7) IDIM-CONICET. (2)(3)Laboratorio de Biología Estructural (UNSL-IMIBIO SL- BIOCHEMISTRY & MOLECULAR BIOLOGY 45 CONICET). E-mail: mirandamariana@gmail.com Las nucleósido difosfato quinasas (NDPK) son enzimas involucradas en la homeostasis intracelular de nucleótidos. En Trypanosoma cruzi, la TcNDPK1 es una enzima multifuncional por poseer, además de la actividad quinasa, la capacidad de unirse y degradar ácidos nucleicos, ser una enzima de secreción y estar involucrada en la resistencia a drogas tripanocidas. Asimismo, TcNDPK1 es hexamérica y localiza en el citoplasma de los parásitos, sin embargo, cuando está fusionada a una proteína dimerizante como la GFP genera gránulos. Este comportamiento es específico de la NDPK y depende de su estructura cuaternaria, sugiriendo que la enzima podría estar oligomerizándose. En el presente trabajo determinamos que los gránulos también se forman en parásitos que expresan la TcNDPK1 no fusionada a GFP bajo condiciones de estrés como ocurre en el proceso de metaciclogénesis. Estudios realizados sobre la estructura cristalina demuestran que la enzima adopta una estructura fibrilar formada por hélices levógiras constituidas por tetrámeros de hexámeros apilados entre sí, nunca antes observada. Interesantemente, mediante la construcción de diferentes mutantes en aminoácidos claves para la formación de la hélice, pudimos establecer que la fibra encontrada en los cristales está asociada a los gránulos observados en los parásitos. Estos resultados sugieren que la TcNDPK1 podría ensamblarse in vivo y que sus múltiples funciones podrían estar reguladas por un mecanismo de polimerizacióndepolimerización. BYBM09 INHIBITION OF PHOSPHOENOLPYRUVATE (PEP) CARBOXYKINASE OF Trypanosoma cruzi BY PYROPHOSPHATE AND ITS ROLE IN THE METABOLIC FATE OF PEP IN THE PARASITE Dante Maugeri(1), Juan José Cazzulo(2), Joaquín J B Cannata(3) (1)(2) IIB-INTECH. (3)IIB-INTECH - Facultad de Medicina, UBA. E-mail: maugeri@iibintech.com.ar Trypanosoma cruzi has a classic glycolytic pathway with two atypical characteristics absent in most organisms: 1) the first seven enzymes are compartmentalized in a peroxysome-like organelle, the glycosome, and 2) the presence of fermentative pathways operating inside the glycosome, both in aerobiosis and anaerobiosis, and required for the generation of ATP. The glycolytic intermediate PEP has a critical role in this fermentation, since it can follow two diverging metabolic pathways inside the glycosome. It can be used as a substrate for the ADP-dependent phosphoenolpyruvate carboxykinase (PEPCK), giving oxaloacetate as a product and ultimately leading to succinate. Alternatively, it can be used as a substrate by the AMP- and PPi-dependent pyruvate phosphate dikinase (PPDK) producing pyruvate, which then transaminates to L-alanine. Succinate and Lalanine are the two major final products of glycolysis in the epimastigote stage, as our group demonstrated by NMR. We show here that PPi, a substrate of PPDK, acts as an inhibitor of PEPCK, and can therefore be an important regulatory factor to direct PEP metabolism in the glycosome towards the formation of succinate or L-alanine. This BIOCHEMISTRY & MOLECULAR BIOLOGY 46 inhibition is unusual, since it is unidirectional, acting only on the carboxylation reaction. In addition, the reaction kinetics is very complex, since the type of inhibition depends on the concentration range of both, PEP and PPi, used in the experiments. Thus, the inhibition types obtained at PPi concentrations higher or lower than 70µM are completely different (mixed or uncompetitive, respectively). Moreover, the inhibition type also varies with the concentrations of PEP, being different at PEP concentrations higher that 75µM or lower (15 – 30µM). In addition, the use of these low PEP concentrations showed a property of the enzyme not previously described, namely allosteric behaviour, which is evident only at low PEP concentrations. BYBM10 BIOCHEMICAL CHARACTERIZATION OF TcCYC6: A PROTEIN WITH CYCLIN HOMOLOGY FROM Trypanosoma cruzi Di Renzo Maria A(1), Tellez-Iñón MariaT(2), Laverriere Marc(3), Schenkman Sergio(4), Potenza Mariana1(5) (1) Ingebi-Conicet CABA. (2)(5)INGEBI-CONICET, CABA. (3)Unité de Biologie des Interactions Cellulaires, Institut Pasteur, Francia. (4)Universidade Federal de São Paulo, Brasil. E-mail: mteresatellez@gmail.com The cell cycle is a highly regulated process that requires Cyclin-Dependent Kinases (CDKs) in association with cyclins and other factors to activate or inactivate biochemical pathways that leads to proper duplication and segregation into new daughter cells. Which are these regulators controlling the cell cycle in Trypanosoma cruzi, a pathogen parasite that alters between proliferative and non dividing forms, is still poorly understood and deserves further studies. The genome of T. cruzi codify for ten sequences with cyclin homology (TcCYC2 to TcCYC11), three of which were characterized at the functional level by our group (TcCYC2, TcCCY4 and TcCYC5). In order to further understand the role of the cyclin family in the cell cycle control of this parasite, a sequence with similarity to mitotic cyclins (TcCYC6), was studied. For this purpose, we first raised polyclonal antibodies against the N-terminal peptide of TcCYC6 protein. This antibody was unable to detect the endogenous expression of TcCYC6 in epimastigotes either by western blot or immunofluorescence microscopy. However, we isolated the TcCYC6 messenger RNA, indicating that this gene is processed at least as mature transcript. Then, we cloned the TcCYC6 coding sequence fused to the influenza hemagglutinin tag, HA (TcCYC6-HA) into the inducible expression vector pTcINDEX. Over-expression of TcCYC6-HA causes inhibition of epimastigote growth, although the cell cycle pattern of parasite population is not compromise. In agreement with this, studies using immunofluorescence microscopy did not reveal any cell cycle dependent re-localization of this recombinant protein. However, results from treatment with specific inhibitors and affinity chromatography suggested that TcCYC6-HA protein could be degraded by proteasome pathway. Complementation assays suggested that TcCYC6-HA does not complement the G1 cyclin deficiency in yeasts, although other functional experiments are in progress. Supported by PICT 2012; CONICET BIOCHEMISTRY & MOLECULAR BIOLOGY 47 BYBM11 REPAIR OF OXIDIZED PROTEINS IN Trypanosoma cruzi: CHARACTERIZATION OF METHIONINE SULFOXIDE REDUCTASE B FUNCTIONAL Diego G Arias, Alberto A Iglesias, Sergio A Guerrero Instituto de Agrobiotecnología del Litoral - UNL - CONICET. E-mail: darias@fbcb.unl.edu.ar Methionine is an amino acid susceptible to being oxidized to methionine sulfoxide (MetSO). The reduction of MetSO to methionine is catalyzed by methionine sulfoxide reductase (MSR), an enzyme present in almost all organisms. In trypanosomatids, the study of antioxidant systems has been mainly focused on the involvement of trypanothione, a specific redox component in these organisms. However, poorly information is available concerning their mechanisms for repairing oxidized proteins, which would be relevant for the survival of these pathogens in the various stages of their life cycle. Recently, we characterized two A-type MSR proteins from T. cruzi and T. brucei. In this work, we report the molecular cloning of a gene encoding a putative B type MSR in this pathogen. The gene was expressed in Escherichia coli, and the corresponding recombinant protein was purified and functionally characterized. The enzyme was specific for L-Met(R)SO reduction, using T. cruzi TXNI, TXNII and TRX as the reducing substrates. In addition, we found that TcMSRB could compensate for MSR deficiency in yeast mutant strain lacking both MSRA and MSRB genes. The protein presented redox-dependent change in monomer/dimer oligomerization states. The in vivo presence of the enzymes was evidenced by immunological detection in replicative and infective stages of T. cruzi. Overexpression of TcMSRB in epimastigote cells confers resistance to oxidative stress. The results support the occurrence of a metabolic pathway in T. cruzi involved in the critical function of repairing oxidized macromolecules. BYBM12 Trypanosoma brucei: ENDOGENOUS BIOSYNTHESIS OF UBIQUINONE 9 AND EXOGENOUS UPTAKE OF UBIQUINONE 10 Esteban J Bontempi(1), Octavio Fusco(2), Estefanía Poropat(3), Juan C Engel(4), Juan B Rodríguez(5) (1)(3) Instituto Nacional de Parasitología, ANLIS. (4)Sandler Center for Basic Research in Parasitic Diseases and Department of Pathology, USA. (5)Departamento de Química Orgánica and UMYMFOR (CONICET-FCEyN), UBA. E-mail: ejbon@yahoo.com Our aim is to validate the solanesyl diphosphate synthase (SPPS) as a new target for trypanosomatids. The Trypanosoma brucei mitochondrial enzyme (Lai 2012) is essential, as demonstrated by RNAi experiments (Lai 2014). Identical metabolic effects were obtained by inhibiting the bloodstream forms with 1-[(n-oct-1-ylamino)ethyl] 1,1bisphosphonic acid (Compound 1), a bisphosphonate originally developed against the T. cruzi homologue enzyme (Ferella 2006, Szajnman 2008). Under its action, the ATP pool BIOCHEMISTRY & MOLECULAR BIOLOGY 48 diminished by 50%, resulting in cell death. In order to make the parasite more sensitive to the drug, interactions with another drugs were studied. Using the CompuSyn software we quantitated synergism, antagonism and additive effect between Compound 1 and other drugs. Unexpectedly, synergisms with protease inhibitors were detected. This suggested the existence of a mechanism of exogenous ubiquinone uptake. We hypothesized that LDL particles could carry ubiquinone 10 into the cell, as it was demonstrated for cholesterol. Then, different inhibitors, related to the binding, acquisition and processing of LDL particles were assayed. BYBM13 INTRACELLULAR AND FREE FORMS OF TRYPANOSOMATIDS ARE SENSITIVE TO A SOLANESYL DIPHOSPHATE SYNTHASE INHIBITING BISPHOSPHONATE Esteban J Bontempi(1), Nicolás Tomasini(2), Octavio Fusco(3), Alina Perrone(4), Patricia Garavaglia(5), Bruno Travi(6), Juan C Engel(7), Benoit Vanhollebeke(8), Laura E Fichera(9), Cristina Maidana(10), Gabriela García(11), Jacqueline E Búa(12), Juan B Rodríguez(13), Mónica I Esteva(14), Carlos Pravia(15), Patricio Diosque(16) (1)(3)(4)(5)(9)(10)(11)(12)(14)(15) (2)(16) Instituto Nacional de Parasitología, ANLIS. Instituto de Patología (6) Experimental, Universidad Nacional de Salta. Depts. of Internal Medicine and Microbiology and Immunology, University of Texas Medical Branch, USA. (7)Sandler Center for Basic Research in Parasitic Diseases and Department of Pathology, USA. (8) Laboratory of Molecular Parasitology, Institute of Molecular Biology and Medicine, Université Libre de Bruxelles, Belgium. (13)Departamento de Química Orgánica and UMYMFOR (CONICET-FCEyN), UBA. E-mail: ejbon@yahoo.com We have previously described that Trypanosoma cruzi and Trypanosoma brucei solanesyl pyrophosphate synthases can be inhibited by 1-[(n-oct-1-ylamino)ethyl] 1,1-bisphosphonic acid (Compound 1) (Ferella 2006, Szajnman 2008, Lai 2014). In T. brucei (Tb) Compound 1 showed metabolic effects similar to those displayed when inhibiting the enzyme or interfering with its expression (Lai 2014). We herein report that insect, bloodstream and intracellular forms of several pathogenic species of trypanosomatids are also sensitive to Compound 1. We found the following EC50s (in microM): T.b.brucei 2, T.b.rhodesiense 0.92 and T.b.gambiense 0.78 (bloodstream forms), L.donovani 200 (promastigote form), L.major >10 and L.donovani 3.3 (amastigote forms), T.cruzi 3.13 (amastigote form). Based on the detection of amino acid differences in several T. cruzi strains, a detailed analysis was carried out to analyze the gene philogeny in the six DTUs and to detect strain variation in drug sensitivities. Although encouraging, the in vitro and ex vivo effectivity of this “universal” trypanosomatid inhibitor by no means minimizes the need for in vivo experimentation. The tissue distribution of these different human pathogens, either extracellular in the bloodstream or intracellular in different organs, poses special challenges for efficient drug delivery. BIOCHEMISTRY & MOLECULAR BIOLOGY 49 BYBM14 EFFICIENT EXPRESSION OF INDEPENDENT PROTEINS FROM A SINGLE ORF DRIVEN BY THE VIRAL 2A PEPTIDE SEQUENCE IN Trypanosoma cruzi Gabriela Cervini Böhm, Maria A Romaniuk, Alberto C Frasch, Alejandro Cassola iIB-INTECH-CONICET-Universidad Nacional de San Martín. E-mail: gcervini@hotmail.com Trypanosoma cruzi is the causative agent of Chagas disease. Efforts towards a cure are being conducted towards identifying druggable targets and their inhibitors. However, this parasite is not amenable to genetic manipulation and recombinant protein expression. Current strategies for their synthesis involve the association to a resistance marker through the use of polycistronic constructs that give functional mRNAs after posttranscriptional processing. Usually, low levels of protein yield hamper the use of recombinant proteins to study protein functions. With this in mind we tested whether we could express functional proteins from a monocistronic construct with two open reading frames separated by the 2A peptide sequence (2A), which is derived from the foot and moth disease virus. This sequence codes for a peptide that provokes a “ribosome skipping” event, leading to an incomplete peptide bond formation, yielding two independent proteins. We analyzed the functionality of the 2A peptide in recombinant protein expression in T. cruzi using different DNA constructs coding for GST-2A-DsRed. Wild type 2A sequences showed complete separation of GST from DsRed when analyzed by Western blot. Although both proteins partially co-localized, a NLS-GST-2A-DsRed construct directed NLS-GST completely to the nucleus while DsRed was distributed throughout the cell, showing in vivo separation. As a control of the correct peptide-skipping event we generated a nonfunctional 2A peptide that behaved like a GST-2A-DsRed fusion when analyzed by Western blot, which also showed complete co-localization of both proteins. These results show that this short viral peptide sequence can be used to express two different and independent proteins from a single open reading frame, suggesting “ribosome skipping” mechanism conservation. Furthermore it provides an easy and successful approach to follow up the expression of a protein of interest in a humanthreatening parasite with few genetic tools. BYBM15 TcFEN1 ENDONUCLEASE IS EXPRESSED IN Trypanosoma cruzi AND INCREASES ITS RESISTANCE TO SUSTAINED OXIDATIVE STRESS Iván Ponce López, Carmen Aldunate Ruiz, Sofía Sepúlveda Contreras, Lucía Valenzuela Pérez, Rosalía Astorga , Fernando Ormeño , Camila Barrientos Bruna, Carla S. Perez Barja, Gonzalo Cabrera Vallejos, Norbel Galanti Garrone Universidad de Chile. E-mail: ngalanti@med.uchile.cl T. cruzi, the etiological agent of Chagas´s disease, survives to oxygen and nitrogen reactive oxidative species (ROS/RNS), both in vector insects and mammalian hosts. ROS BIOCHEMISTRY & MOLECULAR BIOLOGY 50 and RNS affect diverse macromolecules, including parasite DNA. A conserved mechanism for DNA repair is the base excision repair pathway (BER). Flap endonucleases (FEN) are enzymes that recognize DNA intermediates presenting a DNA single strand flap and process this flap both during DNA repair and DNA replication. Previously, we have found that a flap endonuclease activity is present in homogenates from different cellular forms of T. cruzi (TcFEN1) and that the expression of a recombinant flap endonuclease in the parasite (TcFEN1-GFP) results in increased proliferation rates and parasite resistance when exposed to oxidative agents (H2O2) for short times. Since in their hosts T. cruzi is exposed to oxidative agents for prolonged periods, we investigated whether the expression of the recombinant protein TcFEN-GFP confers resistance to the parasites against sustained oxidative stress conditions. Epimastigote were exposed to H2O2 as oxidant agent, produced by a glucose-glucose oxidase (GO) system added to the incubation medium, for sustained production of H2O2 for extended periods of time (24 hrs maximum). After incubation the viability of parasites was assessed by the MTT assay. Results show increased resistance of parasites expressing the recombinant TcFEN1-GFP, for GO concentrations of 25 and 50mU/ml. Under the described conditions, the localization of the recombinant protein was exclusively nuclear, as observed by direct fluorescence microscopy. These results suggest a role for TcFEN1 in the resistance of T. cruzi against ROS, acting as a nuclear genomic DNA maintenance factor. Acknowledgments: Projects FONDECYT 1130113 (NG) and 11100053 (GC). BYBM17 FUNCTIONAL CHARACTERIZATION OF MALIC ENZYMES FROM Leishmania PARASITES Lucila Giordana, Cristina Nowicki, Cristina Nowicki IQUIFIB, UBA Facultad de Farmacia y Bioquímica. E-mail: lgiordana@ffyb.uba.ar Leishmania spp. like trypanosomes are notably sensitive against oxidative stress. For survival these pathogens depend on a complex redox cascade which utilizes the reducing equivalents derived from trypanothione T(SH2) for detoxification of reactive oxygen and nitrogen species. T(SH2) is maintained in its reduced form by trypanothione reductase which exclusively relays on NADPH as electron source. Consequently, NADPH is essential for parasite survival and it is consumed at high rates. Pentose phosphate pathway is considered a good candidate for the supply of the reduced coenzyme; however amastigotes are believed to develop a glucose-sparing metabolism. To overcome this limitation, leishmanial amastigotes are expected to count on alternative sources for NADPH production, for instance malic enzymes (MEs). The survey of the sequenced genomes of Leishmania species put in evidence that L. major exhibited a single gene coding for putative ME (ME_Lmj), while L. mexicana, L. infantum and L. braziliensis displayed two putative gene copies encoding ME isoform(s), ME_1 and ME_2. The sequence identity between ME_1 and ME_2 is about 60%, while the putative ME_Lmj is >95% identical to ME_1. To shed light on the biochemical properties of leishmanial MEs we have cloned and expressed in E. coli the putative ME_1 and ME_2 from L. mexicana in addition to ME_Lmj. Our results showed that ME_1, ME_2 and ME_Lmj were active and specifically catalyzed the oxidative decarboxylation of malate with concomitant NADPH production. The recombinant MEs from L. mexicana and L. major exhibited equivalent BIOCHEMISTRY & MOLECULAR BIOLOGY 51 kinetic parameters (Kms and Vmax values) but only ME_2 showed to be allosterically activated by L-aspatate. In the presence of 0.5 mM of this amino acid, an increase in about 8-fold in the apparent Km value of ME_2 towards malate was observed. Presumably, leishmanial MEs might derive from different ancestors and their biochemical properties could reflect a specific-specie metabolism. BYBM18 APLICACIÓN DE LA BIOLOGÍA GENÓMICA EN EL DIAGNÓSTICO Y CARACTERIZACIÓN DE Leishmania spp EN ÁREAS ENDÉMICAS DE CHACO, ARGENTINA Marcelo G Medina, Horacio Lucero INSTITUTO DE MEDICINA REGIONAL-UNNE. E-mail: drmarcelomedina@gmail.com Leishmaniosis es una enfermedad parasitaria zoonótica. Leishmania braziliensis es la especie más frecuente en Argentina. La Reacción en Cadena de la Polimerasa (RCP) ha facilitado el diagnóstico, caracterización y tratamiento. La presentación de casos clínicos tiene por objetivo, mostrar la importancia de las técnicas moleculares en la detección y tipificación de Leishmania. Caso 1: Hombre de 74 años, de Quitilipi. Consultó por tres lesiones cutáneas, asintomáticas en miembro superior izquierdo y en ambos flancos abdominales, de ocho meses de evolución. Exploración física; úlcera en región anterolateral de brazo izquierdo y dos úlceras en ambos flancos abdominales bordes eritematosos elevados y centro vegetante. Caso 2: Hombre de 65 años, de Resistencia. Consulta por aparición de una lesión cutánea, asintomáticas en extremo distal de pierna derecha, cara externa, de 12 meses de evolución. Exploración física; úlcera en extremo distal de pierna derecha, cara externa, bordes irregulares, aspecto estrellado, centro con abundante fibrina, tejido necrótico y secretante. Caso 3: Mujer de 70 años, de Resistencia, consulta por lesión cutánea, asintomática en pierna tercio inferior izquierdo, de 12 meses de evolución. Exploración física; úlcera en tercio inferior izquierdo, bordes eritematosos elevados y centro vegetante, limpio. Estudios de laboratorio con coloración de Giemsa y anatomía patológica confirman la presencia de amastigotes. Se confirma el diagnóstico y tipificación por PCR para Leishmania brasiliensis, tomando muestra por cepillado de lesión. Se instauró tratamiento con antimoniato de meglumina. En dos semanas se observó la resolución completa de las lesiones dejando cicatriz residual. Conclusión: El interés de la presentación es la importancia de la utilización de las técnicas moleculares en la detección y tipificación de Leishmania lo cual proporciona un método de mayor sensibilidad y especificidad, sobre todo en áreas endémicas. BYBM19 TRANSLATIONAL CONTROL IN TRYPANOSOMATIDS Maria Camara(1), Santiago Bertotti(2), Santiago Carmona(3), Fernan Aguero(4), Leonardo G Panuzzi(5), Ian Flemming(6), Juan D. Alfonzo (7), Carlos A Buscaglia(8) (1)(2)(3)(4)(5)(8) IIB-INTECH-UNSAM. (6)(7)Department of Microbiology, The Ohio State BIOCHEMISTRY & MOLECULAR BIOLOGY 52 University, USA.. E-mail: milagritos.camara@gmail.com The protozoan T. cruzi is the etiological agent of Chagas disease, a major public health issue in Latin America. Due to its predominant clonal proliferation, this species is composed by multiple "discrete typing units" displaying considerable genetic diversity. TcSMUG is a multiple member family of Thr-rich mucins genes, composed of two groups of genes, named L and S, organized in independent tandem arrays and differing in the structure of their genomic loci. One notable feature is that TcSMUGL products in contrast to TcSMUGS show substantial differences in their expression levels among parasites stocks. In order to understand the variability in the expression of TcSMUGL we analyzed the secondary structure of the 3'UTR of TcSMUG L mRNAs for the Adriana and CL Brener strain revealing very minor inter-strain differences; suggesting that the observed expression variations may not respond to post-transcriptional mechanisms. Consequently we calculated TcSMUG L codon bias for both strains obtaining inter-strain distortions in the TcSMUG L usage for four codons: Thr(ACT), Val(GTT), Leu(CTT) and Leu(TTG). No codon significant inter-strain distortions were found for TcSMUG S genes. These results suggest that the variability in expression of TcSMUG L could be due to differences in codon bias. Furthermore 3 out of 4 codons displaying significant inter-strain distortions in our analysis; Thr(ACT), Val(GTT) and Leu(CTT) are affected by anticodon tRNA editing. In vivo editing analysis revealed significant inter-strain differences in the editing profile for the tRNAThrAGU isoacceptor, which decodes the inter-strain biased codon Thr(ACT). Finally overexpression of tRNA editing deaminases lead to an increase in the levels of tRNAThr editing and significant changes in the expression profile of TcSMUG L proteins Together these findings suggest a mechanism of gene expression regulation that relies on the efficient interaction of codons and anticodons. BYBM20 CONSTRUCTION OF FLUORESCENT TRANSGENIC STRAINS FROM DIFFERENT Trypanosoma cruzi DTUs María de los Ángeles Curto(1), Juan C Ramírez(2), Susana A Besuschio(3), Alejandro G Schijman(4) (1)(3)(4) LaBMECh-INGEBI. (2)LaBMEChINGEBI. E-mail: mcurto777@gmail.com At present Trypanosoma cruzi strains are classified in six Discrete Typing Units (DTUs).These categories differ, in their geographic locations, transmission cycle and host range, genetic content and genome organization, virulence and drug resistance. Studies regarding their association with Chagas’ disease clinical manifestations are currently undergone. In Argentina, in vitro assays are mostly performed with strains from DTUs I and VI, but parasites from DTU V are predominantly found in infected patients. Previously, we have reported the generation of transgenic cell lines from DTU I expressing a fluorescent marker. No difference in fitness or infection capacity was observed between wild type and transgenic parasites. Now, we are extending this methodology to the rest of T.cruzi DTUs. Transgenic parasites from DTUs I, II, IV and VI expressing at least two different fluorescent proteins (GFP, RFP, mCherry and dsRED2) have been obtained. Reporter genes are carried by a vector (pTREX) that integrates in the ribosomal promoter BIOCHEMISTRY & MOLECULAR BIOLOGY 53 of the parasite’s genome, thus enabling tests in the absence of selective pressure and yielding high expression of the protein of interest. Similar experiments with DTUs III and V are being performed.Furthermore, constructs carrying reporter genes that were fully functional as artificial chromosomes in CL Brener strain ( DTU VI) are being tested in other DTUs. We believe that these transgenic populations will be valuable tools in drug screening, genetic exchange assays as well as in histotropism studies of mixed infections. BYBM21 A MULTILAYER NETWORK APPROACH FOR GUIDING DRUG REPURPOSING IN NEGLECTED DISEASES María P Magariños(1), Ariel J Berenstein(2), Ariel Chernomoretz(3), Fernán Agüero(4) Instituto de Investigaciones Biotecnológicas, UNSAM. (2)Laboratorio de Bioinformática, Fundación Instituto Leloir. (3)Departamento de Física, Universidad de Buenos Aires. E-mail: mpmagarinos@gmail.com (1)(4) Historically, lack of interest from the pharmaceutical industry, resulted in the lack of drugs for the majority of the pathogens that cause neglected diseases. With the advent of open chemical resources and the release of data from high throughput screenings the availability of chemical information has increased greatly. However most of the information on targets and the activity of drugs is for humans or model organisms. This creates a huge opportunity for computational exercises that use comparative genomics and chemogenomic approaches. In this work, using chemical datasets containing bioactivity data for pathogen and non-pathogen targets we built a three-layer network containing three disjoint sets of vertexes with 1) 1.5 million drugs; 2) 167,000 proteins across 221 species; and 3) three affiliation-type protein features (orthology, Pfam domains, participation in metabolic pathways). Only statistically significant features (in the context of drug-target predictions) were taken into account. A bipartite projection of the protein layer was obtained capturing the protein affiliations to different annotation classes. Using this network model, we tackled the problems of i) prioritizing targets for drug discovery for pathogens; and ii) suggesting candidate targets for orphan compounds (those that are active in whole-cell screenings but whose target is currently unknown). We used a tenfold cross validation procedure to assess the performance of the network to prioritize relevant targets and show that he method overcomes traditional similarity-based searches against druggable targets. In the presentation we will discuss some of the top ranked proteins. We also obtained candidate target proteins for orphan molecules that were active in whole-cell assays against P. falciparum and will discuss the proposed targets that mediate the antiplasmodial activity for some of these orphan compounds. BYBM22 POLY(ADP-RIBOSE) METABOLISM IS INVOLVED IN PROCYCLIC Trypanosoma brucei SENSITIVITY TO GENOTOXIC DAMAGE Mariana Schlesinger, María L Kevorkian, Salomé C Vilchez Larrea, Mirtha M Flawiá, Silvia H Fernández Villamil BIOCHEMISTRY & MOLECULAR BIOLOGY 54 INGEBI. E-mail: schlesinger.ingebi@gmail.com Poly(ADP-ribosyl)ation is a covalent modification of proteins catalyzed by poly(ADPribose) polymerases (PARPs). Poly(ADP-ribose) (pADPr) metabolism plays a role in a wide range of biological processes among which DNA damage signaling and repair are the most extensively studied functions. Poly(ADP-ribose) glycohydrolase (PARG) represents the main pADPr hydrolyzing activity in the cell. In contrast to human and other higher eukaryotes, T. brucei contains only one PARP (TbPARP) and PARG (TbPARG). We have identified potent TbPARP inhibitors using an in vitro activity assay and verified that these compounds effectively reduced the formation of pADPr in T. brucei parasites exposed to genotoxic stress. Our previous results suggest that TbPARP is not necessary for T. brucei growth under normal conditions. Surprisingly procyclic parasites become more resistant to stress induced by hydrogen peroxide when TbPARP activity is abolished by chemical inhibition or RNAi. On the other hand, large amounts of basal pADPr in the nucleus of the parasites over-expressing TbPARP and down-regulating TbPARG lead to an increased sensitivity towards genotoxic stimulus. Indeed, transgenic parasites undergo, after extensive DNA damage, a cell death pathway different from wild type trypanosomes, suggesting a role of pADP r polymer metabolism in cell death. The duality of pADPr as a central player in both life and cell death has been proposed by many authors. pADPr is required for proper mitosis and is involved in DNA damage response. However, an augmented pADPr synthesis may deplete NAD+ and consequently remove ATP from the cell, inducing cell death. We showed that not only the quantity of the synthesized pADPr might have an effect on parasite survival, but also the polymer subcellular localization seems to affect this outcome. Disrupted pADPr metabolism with nuclear accumulated polymer has deleterious consequences to the cell, an outcome that is accelerated by genotoxic stimulus. BYBM23 PROTEIN PALMITOYLATION AND HOST-CELL INVASION IN Toxoplasma gondii Marina C Caballero, Maria M Corvi IIB-INTECH, CONICET-UNSaM, Chascomús, Buenos Aires, Argentina. E-mail: mcaballero@intech.gov.ar As most parasites belonging to the phylum Apicomplexa, Toxoplasma gondii is an obligate intracellular organism, which implies that host-cell invasion is a fundamental process for parasite's survival and propagation. This process comprises a series of highly coordinated steps which involves the sequential secretion of the contents of micronemes and rhoptries (apical organelles characteristic of the phylum). Besides, protein palmitoylation, the addition of palmitate (C16:0) to a cysteine residue, has been extensively proven in T. gondii. Moreover, experiments performed by our group using 2-bromopalmitate- a global inhibitor of protein palmitoylation- showed that host-cell invasion (among other vital processes) was affected by this lipid modification. For this reason, while working on the development of T. gondii's palmitoyl-proteome, we decided to explore more specifically which proteins involved in host-cell invasion were subject to palmitoylation. Here we present experimental confirmation that many of essential proteins involved in the attachment-invasion machinery, are indeed palmitoylated. Further studies to unveil the BIOCHEMISTRY & MOLECULAR BIOLOGY 55 influence of this modification on the invasion process itself are underway, since most of the identified rhoptry proteins are kinases specific of T. gondii which turns them into interesting therapeutic targets. BYBM24 ESTUDIO FUNCIONAL Y DE LA REGULACIÓN DEL TRANSPORTADOR DE PROLINA DE Trypanosoma cruzi Melisa S Martínez Sayé, Chantal Reigada, Fabio Di Girolamo, Mariana R Miranda, Claudio A Pereira Laboratorio de Parasitología Molecular (LPM), Instituto de Investigaciones Médicas (IDIMCONICET). E-mail: melisa.msaye@hotmail.com En tripanosomátidos, la prolina es un aminoácido esencial dado que constituye una fuente de carbono y energía alternativa a la glucosa. Adicionalmente, en Trypanosoma cruzi se ha demostrado que la prolina confiere resistencia ante estrés osmótico y que sustenta la invasión celular en tripomastigotes metacíclicos y la progresión del ciclo intracelular en el pasaje de epimastigotes intracelulares a tripomastigotes. Asimismo se ha establecido que la acumulación de prolina libre intracelular constituye un mecanismo de resistencia a estrés oxidativo. En nuestro laboratorio hemos generado una cepa transgénica de T. cruzi que sobre-expresa el transportador de prolina Tc069 (pTREX-Tc069), y hemos demostrado, no sólo que transporta más prolina que la cepa control, sino que además una mayor tasa de transporte se traduce en mayores niveles intracelulares de prolina libre. También hemos evaluado la respuesta de estos parásitos ante situaciones de estrés oxidativo y su respuesta al tratamiento con las dos drogas tripanocidas disponibles, y hemos reportado que los parásitos Tc069 presentan mayores IC50s que los parásitos control. Actualmente estamos estudiando la regulación del transportador de prolina en los parásitos Tc069. Hemos observado que la tasa de transporte varía a lo largo del crecimiento del cultivo, presentando un pico de máxima velocidad al inicio de la fase logarítmica, y que luego decae a valores nulos al alcanzarse la fase estacionaria. Asimismo hemos evaluado la expresión de la proteína recombinante y su localización subcelular mediante un “flag” durante todo el cultivo y, en concordancia con el transporte, hemos observado que también varían de manera similar al transporte. Estos resultados indicarían que el transporte de prolina se ve influenciado por el estado metabólico de los parásitos, y además, se estaría evidenciando una regulación proteica post-traduccional que llevaría a la degradación del transportador de prolina y no sólo a su inactivación. BYBM25 SEARCHING FOR HUMAN GENETIC POLYMORPHISMS CONGENITAL TRANSMISION OF CHAGAS DISEASE (CTCD) ASSOCIATED WITH Natalia A Juiz(1), Nelly M Cayo (2), Jacqueline Búa(3), Julio R Nasser(4), Silvia A Longhi(5), Alejandro G Schijman(6) (1)(5)(6) INGEBI-CONICET. (2)Instituto de Investigaciones en Enfermedades Tropicales. Sede Regional Orán. Universidad Nacional de Salta. CONICET. (3)Instituto Nacional de BIOCHEMISTRY & MOLECULAR BIOLOGY 56 Parasitología (INP) Dr. M. Fatala Chaben, Paseo Colón 568 (1063), Administración Nacional de Laboratorios e Institutos de Salud (ANLIS) Buenos Aires, Argentina.. (4) Laboratorio de Química Biológica. Facultad de Ciencias Naturales. Universidad Nacional de Salta. . E-mail: nataliaajuiz@gmail.com Placental alkaline phosphatase (PLAP) has been proposed as one of the receptors used by T. cruzi for placental invasion. Its encoding gene presents functional alleles: rs2014683 (A>G, decreases transcriptional activity) and rs1048988 (G>C associated with lower enzyme activity). Another placental expressed enzymes are the metalloproteinase 2 (MMP-2) and 9 (MMP-9) which degrade and remodel specific components of the extracellular matrix, and thus play a fundamental role in placental infections. It has been reported that T. cruzi infection increases MMP-2 and MMP-9 basal expression and activity in human chorionic villi explants. Some functional polymorphisms in these gene promoters are: rs243865 and rs2285053 (C>T, display a lower promoter activity in MMP-2 gene); rs3918242 (C>T enhances MMP-9 transcriptional activity) and rs2234681 (dCA repeat in MMP-9, high repetition number is associated with high promoter activity). Our aim was to compare the frequency of the above mentioned polymorphisms in DNA samples extracted from peripheral or umbilical cord blood collected from congenitally infected (CI, N = 88) and non-infected (NCI, N=103) children born to seropositive mothers. DNA was used for sequencing, and specific High Resolution Melting Analysis (HRMA) was designed for each polymorphism. This novel strategy was performed using the Type-it HRM PCR Kit (Qiagen, USA) and PCR cycling/HRMA on the Rotor-Gene 6000™ Real Time cycler. Out of the tested polymorphisms, only MMP-2 rs2285053 showed significant differences, being the T allele (p=0,032), as well as the T/T genotype (p=0,018) more represented in the CI group than in the NCI group, suggesting its association with congenital transmission. Future gene expression studies of these allelic variants in placental samples from transmitting and non-transmitting women will allow demonstrate if lower MMP-2 level of expression is associated to a higher risk of transplacental transmission. BYBM26 ASSOCIATION STUDY OF HUMAN SINGLE NUCLEOTIDE POLYMORPHISMS (SNPS) WITH CHRONIC CHAGAS CARDIOMYOPATHY (CCC) IN ARGENTINIAN POPULATION Natalia A Juiz(1), Daniel O Hernández(2), Yohana Sappa Figueroa(3), Silvana Dellamea (4), Raúl H Lucero (5), Silvia A Longhi(6), Clara I González(7), Alejandro G Schijman(8) (1)(6)(8) INGEBI-CONICET. (2)Consultorio de "Abordaje Integral del paciente con Enfermedad de Chagas-Mazza" de la Facultad de Medicina de la Universidad Nacional del Nordeste. (3)(4) Cátedra de Parasitología de la Carrera de Bioquímica de la Facultad de Ciencias Exactas de la Universidad Nacional del Nordeste. (5)Laboratorio de Biología Molecular, Instituto de Medicina Regional-Universidad Nacional del Nordeste, Resistencia, Chaco, Argentina. (7)Molecular Immunology and Epidemiology Group, GIEM, Facultad de Salud, Universidad Industrial de Santander, Bucaramanga, Colombia.. E-mail: nataliaajuiz@gmail.com Several studies have proposed different genetic markers as chemokines and cytokines genes for susceptibility to develop CCC. In particular, these studies have focused on BIOCHEMISTRY & MOLECULAR BIOLOGY 57 SNPs, the most represented type of polymorphisms in the human genome. Despite the level of complexity and heterogeneity of the populations, many genes may be involved, each one making a small contribution. For this reason, an appropriate approach for this problematic is to study a large number of SNPs in individuals sharing a genetic background. The aim of our work was to analyze functional promoter SNPs inTNFR1B (rs976881, rs1061624 and rs3397), CCR2 (rs3138042) and CCR5 (rs2856758, rs2734648, rs1799987, rs1799988, rs41469351, rs1800023 and rs1800024) genes and their association with CCC in Argentinean populations from high endemicity areas for Chagas Disease. SNPs were determined by TaqMan® 5´ allelic discrimination assay method in 199 seropositive individuals (Asymptomatic patiens, N=132; CCC, N=67) belonging to Wichi and Creole populations. We found statistically significant differences in genotypic frequencies of two CCR5 SNPs (rs1799987 and rs1799988), when both groups of patients were compared. We also observed that mutant alleles in rs976881 (TNFR1B), rs2734648, rs41469351 and rs1800023 (CCR5) were more represented in CCC patients. Moreover, some CCR2/CCR5 haplotypes with a higher prevalence in CCC patients may confer susceptibility to cardiopathy development. However, we detected differences between Creole and Wichí allelic frequencies when these populations were taken separately. These data are consistent with a previous study that showed although Wichí and Creoles share a same geographical area, these sympatric populations are differentiated from the genetic point of view. This analysis showed that only the CCR5 SNP rs41469351 maintained its significance in Creole population (paj=0.032), while among Wichí individuals the T allele was not represented. BYBM27 POSIBLE ROL DE LA ALDO-CETO REDUCTASA DE Trypanosoma cruzi(TCAKR) EN LA ACTIVACIÓN DEL BENZNIDAZOL Y SU MODO DE ACCIÓN TRIPANOCIDA Patricia Andrea Garavaglia(1), Joaquín J. B. Cannata(2), Gabriela Andrea García(3) INP . (2)IIB-INTECH, UNSAM-CONICET. CEFYBO, Facultad de Medicina-UBA. E-mail: pato_garavaglia@hotmail.com (1)(3) El Benznidazol (Bz) es un compuesto nitro-heterocíclico que debe ser reducido para activarse y ejercer su efecto citotóxico. Si bien esta droga se ha utilizado desde los años 60 para el tratamiento de la enfermedad de Chagas, su mecanismo de acción no ha sido totalmente dilucidado. Hasta el momento, la nitroreductasa tipo I, especifica para NADH, es la única enzima descripta de T. cruzi involucrada en la activación del Bz. Sin embargo, varios trabajos sugieren la participación de otras reductasas. Nuestro grupo identificó y caracterizó una aldo-ceto reductasa, NADPH dependiente, de T. cruzi (TcAKR) que posee actividad de AKR y de quinona-oxido reductasa, cuya actividad específica en presencia de Bz como sustrato al utilizar TcAKR recombinante fue de 104.5 nmoles NADPH/min/mg. Por otro lado, recientemente Trochine y col. describieron que la TcAKR interacciona con Bz inmovilizado, sugiriendo su participación en la activación de la droga. Con el objetivo de establecer una posible relación entre la TcAKR y la susceptibilidad al Bz, se evaluó la expresión de esta enzima por “western blot” y actividad enzimática en dos cepas de parásitos con diferentes susceptibilidades a esta a droga. La evaluación del Bz sobre epimastigotes de la cepa Nicaragua (DTU I) y del clon CL Brener (DTU VI) de T. cruzi mostró un IC50 de 20.8 µM y 10 µM, respectivamente, corroborando que el clon CL Brener es más susceptible. Por otro lado, la evaluación de la expresión de la TcAKR BIOCHEMISTRY & MOLECULAR BIOLOGY 58 sobre ambas cepas por “western blot” con un suero anti-TcAKRrec, mostró que el clon CL Brener posee 1,9 veces más cantidad de TcAKR que la cepa Nicaragua y, en correlación, la actividad específica evaluada con Bz fue significativamente mayor(20.4 nmoles NADPH/min/mg en clon CL Brener vs 8.25 nmoles NADPH/min/mg en Nicaragua). Nuestros resultados demuestran que la TcAKR puede reducir al Bz y además, sugieren que esta enzima podría participar en el mecanismo de acción tripanocida de dicha droga. BYBM28 ABIETANE OBTAINED FROM SALVIA CUSPIDATA IS ACTIVE AGAINST T cruzi Renata M Spina Zapata(1), Esteban Lozano(2), Miguel Angel Sosa(3), Carlos Tonn(4), Diego Cifuentes(5) (1)(2)(3) IHEM-CONICET, UNCuyo. (4)(5)INTEQUI-CONICET, UNSL. E-mail: rena_spina@yahoo.com.ar T.cruzi is a monoflagellate parasite, responsible for the Chagas` disease, that affects millions of people in Latinamerica. Since decades, many natural and synthetic compounds have been tested, but only Benznidazole and Nifurtimox remain as therapeutic agents against this disease. However, their use is restricted because of the toxic and side effects. Therefore, the search for new molecules with trypanocidal activity and with low toxicity to the host cells is required. Terpenoid and derivatives are attractive because they are abundant in the plant Kingdom and many of them showed activity against various parasites. In this study, we tested an abietane (12-hydroxy-11,14-diketo-6,8,12-abietatrien19,20-olide) obtained from Salvia cuspidata (Ruiz & Pav. Subsp. gilliesii (Benth) J.R.I. Wood (Lamiaceae) on the in-vitro growth of T.cruzi (strain Dm28C) and evaluated the effects on ultrastructure of parasites. Parasites (epimastigotes) were grown for 24-48 h in the Diamond liquid medium, in the presence or the absence of the compound at different concentrations. The compound showed to be active against T.cruzi, inhibiting the growth of parasites at low concentrations (1-10 ug/ml). However, the compound induced low mortality on parasites at concentrations lesser than 5 ug/ml. In turn, the compound was non toxic to mammalian cells at the concentrations used. We also observed that abietane induced an intense vacuolization on parasites, even at 7,5 ug/ml. Further studies should be done in future to identify the molecular targets on the parasites and the active groups on the molecule, through chemical modifications. These promising results are a breakthrough in the search for new molecules that could be used in future as a therapeutic agent for the Chagas` disease. BYBM29 REACTIVE OXYGEN SPECIES AND POLY(ADP-RIBOSE)POLYMER GENERATION DURING CELL INVASION BY Trypanosoma cruzi Salomé Vilchez Larrea, María L Kevorkian, Mariana Schlesinger, Mirtha M Flawiá, Silvia H Fernández Villamil INGEBI-CONICET. E-mail: vilchez.ingebi@gmail.com BIOCHEMISTRY & MOLECULAR BIOLOGY 59 Poly (ADP-ribose) (pADPr) metabolism has been demonstrated to be important for the normal progression of the infection cycle of T. cruzi in different host cell lines. Based on previous results obtained by our group and others, it is possible to hypothesize that cell invasion by T. cruzi leads to the production of reactive oxygen species (ROS) and the trigger of an inflammatory response. Generated ROS also cause DNA damage, which would in turn activate PARP-1, NFκB and cytokine expression. Up to date, we have proven that infection levels in Vero cells is diminished by the presence of Olaparib, a PARP-1 inhibitor, or DEA, a PARG inhibitor and that this is observed when using two different T. cruzi strains: CL Brener, of low infectivity, and Tulahuen II, a more aggressive strain. The use of a more specific PARG inhibitor, RBPI-5, corroborated the result obtained, indicating that the observed outcome is due to the specific absence of PARG activity. Using fluorescent probes, the formation of ROS in the cytoplasm of the cell after infection by trypomastigotes was seen and the generation of pADPr, both in the nuclei of intracellular amastigotes and in the cytoplasm of the host cell in the vicinity of these replicative forms, could also be detected, probably as a response to the action of ROS. Nevertheless, both PARP-1 and PARG remained in the nucleus of the host cell during the infection process. This could indicate that the cytoplasmatic pADPr observed would be synthesized by PARPs other than PARP-1, being Tankyrase a good candidate for this, a possibility to be studied by the use of specific inhibitors of this enzyme. The formation of pADPr in the host cell nucleus and its relationship to NFκB activation should be further investigated. BYBM30 CANONICAL H2BA HISTONE DIMMERIZES WITH H2A.X IN AN OPPOSITE GENOMIC LOCALIZATION TO H2A.Z/H2B.Z DIMMERS IN Toxoplasma gondii Silvina S Bogado(1), Maria C Dalmasso(2), Agustina Ganuza(3), Kami Kim(4), William J Sullivan(5), Sergio O Angel(6), Laura Vanagas(7) (1) Laboratorio de Parasitología Molecular, IIB-INTECH, CONICET-UNSAM. (2)Scientific Research Comission (CIC, Buenos Aires). (3)(6)(7)INTECH. (4)3Department of Microbiology & Immunology, Albert Einstein College of Medicine, Bronx, New York, USA. (5)Department of Pharmacology & Toxicology, Indiana University School of Medicine,. E-mail: solcito.silvina@gmail.com Toxoplasma gondii is a protozoan obligate intracellular parasite belonging to the Phylum Apicomplexa. In human T.gondii has two stages able to interconvert: tachyzoites and bradizoites. The epigenetic control during this interconvertion, including post-translational modifications (PTMs) of histones as well as histone variant replacement, has been proposed as a central player in the regulation of gene expression in apicomplexan parasites. In order to complete the nucleosome composition of T. gondii histone variants, in this work the recombinant histone rH2Ba was generated and used to obtain specific antibody. With such tool we were able to characterize and analyze the interactions of H2Ba with the other variants in the nucleosome conformation. The histone H2Ba of Toxoplasma gondii was expressed as recombinant protein (rH2Ba), and used to immunize a mouse. It was demonstrated that the obtained αH2Ba is highly specific for rH2Ba and detects a single band in total tachyzoite lysate of the expected molecular weight (12 kDa). By indirect immunofluorescence (IFA) in in vitro grown tachyzoites and bradyzoites, the signal was detected only in the nucleus. The nucleosome composition of H2Ba was determined by co-immunoprecipitation assays, where histone H2Ba was detected in the BIOCHEMISTRY & MOLECULAR BIOLOGY 60 same immunocomplex as H2A.X, but not with H2A.Z. Through chromatin immunoprecipitation (ChIP) assays and QPCR it was observed that H2Ba is located at promoters of inactive genes and silent regions, accompanying H2A.X, and opposed to H2B.Z. According to the results in this work, completing our previous findings, it is clear that T. gondii has a particular nucleosome composition. BYBM31 SCREENING OF PUTATIVE Toxoplasma SEQUENCES BINDING PROTEINS gondii TELOMERIC ASSOCIATED Susana M Contreras(1), Maria C Dalmasso(2), Bin Deng(3), Sergio O Angel(4) IIB INTECH. Laboratorio de Parasitología Molecular. Av. Intendente Marino 8200. (2) Fundacion Instituto Leloir. Laboratorio de Amiloidosis y Neurodegeneracion. Av. Patricias Argentinas 435. C1405BWE o 1405, CABA. (3) University of Vermont. Vermont Genetics Network Proteomics Facility. 337 Marsh Life Science Building 109 Carrigan Drive Burlington, VT 05405. E-mail: mcconts@gmail.com (1)(4) The Telomeric Associated Sequences (TAS) are heterochromatic regions that have an important role on regulation of gene expression and cell replication. In Plasmodium falciparum form clusters within the nucleus that favor rearrangements between var genes. A recently work of our lab has identified and partially characterized these regions in 9 of 14 chromosomes of T. gondii (TgTASL). These subtelomeric regions have approximately 30 kb and are organized by three Telomeric Associated Repeat Elements (TARE 1-3). TgTASLs are flanked by a novel T. gondii specific gene (tsf) family whose function is unknown. In order to identify putative TgTASL binding proteins (TgTASL-BP), we perform a pulldown assay with biotinylated sequences of 2000bp, between TARE1 and TARE3, using nuclear proteins from intracellular tachyzoites. As control we used a biotinylated plasmid DNA. The composition of the parasite lysate was determined by WB, resulting in 80% of nuclear proteins. Pulled down proteins were electrophoresed in SDS-PAGE and those bands that were present in the TgTASL lane but not in the control were analized by mass spectrometry. About 50 proteins were identified; 48, 5% of which were nuclear, 23,5% of the surface, 16% cytosolic, 10% ropthry/micronemes/dense granules, and 2% mitochondrial. Concerning nuclear proteins putative TgTASL-BP Alba, AP2 transcription factors, histone acetyltransferase, metiltransferases, RNA binding proteins, hypotetical proteins, among others, were found. All nuclear putative TgTASL-BP sequences were used to find the P. falciparum orthologues and on the basis of Y2H Pf Protein-protein interaction (PPI) database we generated a putative TgTASL-BP PPI network. Some of these putative TgTASL-Bps were chosen for further characterization. BYBM32 INSIGHTS INTO RESPONSES TO STRESS CONDITIONS MEDIATED BY ADENOSINE NUCLEOTIDES IN Trypanosoma cruzi BIOCHEMISTRY & MOLECULAR BIOLOGY 61 Tamara Sternlieb, Alejandra C Schoijet, Mirtha M Flawiá, Guillermo D Alonso INGEBI (CONICET-UBA). E-mail: galonso@dna.uba.ar Cyclic adenosine monophosphate (cAMP) is a key second messenger in several metabolic pathways. In Trypanosoma cruzi it was found to participate in proliferation, differentiation and osmoregulation. Here we explore the role of cAMP in the responses to oxidative and nutritional stress in T. cruzi epimastigotes. To determine the role of cAMP in oxidative stress, we established an optimal work concentration of hydrogen peroxide of 150 µM, which presents a moderate effect, allowing the recovery of the parasites’ normal growth 24 h later. Our results suggest a possible protective effect of cAMP analogs (Dibutyryl-cAMP and 8-Bromoadenosine 3′,5′-cyclic monophosphate) over the stress produced. We will continue analyzing this effect using Phosphodiesterases (PDEs) and Adenylate cyclase inhibitors. Currently, we are working to identify which PDE is involved in this response. In addition, and to deepen our research on stress responses in T. cruzi, we are studying the AMP-activated protein kinase (AMPK). This heterotrimeric enzyme is involved in maintaining energy homeostasis in response to nutrient stress in many organisms. The α subunit contains a kinase domain as well as a regulatory domain that inhibits the enzyme in the absence of AMP. The β subunit acts as a scaffold for the other components, while the γ subunit is thought to be involved in AMP binding. We have already identified the genes corresponding to β and γ subunits in T. cruzi and both have been cloned into vectors for E. coli and epimastigotes expression. Furthermore, AMP binding assays will be performed using the purified recombinant β subunit. Finally, to investigate the role in vivo of this enzyme, parasites will be transfected with both genes, and their product activity will be evaluated using synthetic activators. Taken together, our results unveil an unknown role for cAMP as a protective regulator against oxidative stress in T. cruzi and point to identify potential components of these signaling pathways. BYBM33 EPIGENETIC REGULATION OF GENES IMPLICATED IN ADHESION TO HOST CELLS IN Trichomonas vaginalis Tomás Pachano, Fernando Villarruel, Ayelén Lizarraga, Verónica M Coceres, Pablo H Strobl-Mazzulla, Natalia de Miguel IIB-INTECH. E-mail: tpachano@hotmail.com Trichomoniasis, caused by the flagellated protozoan Trichomonas vaginalis, is the most common non-viral sexually transmitted infection. Adhesion to the host epithelial cells is an essential step for the survival of this extracellular parasite and the process of pathogenesis. Surface proteins implicated in adhesion to mucosal epithelial cells were shown to be differentially expressed in pathogenic and non-pathogenic strains. Understanding the mechanisms involved in the control of genes related to pathogenesis and host cell adhesion could assist in the development of new therapeutic strategies. However, regulation of gene expression and the epigenetic influence in this parasite are poorly understood. To elucidate the existence of histone modification possibly implicated in the transcriptional regulation of genes associated with T. vaginalis pathogenesis, we performed an immunofluorescence assay using antibodies against histone epigenetic BIOCHEMISTRY & MOLECULAR BIOLOGY 62 marks. Histone modifications associated with active (H3Kac and H3K4me3) and repressive (H3K9me3 and H3K27me3) chromatin states were found in the pathogenic strain B7268 and non-pathogenic strain G3. In vivo chromatin immunoprecipitation assays followed by qPCR on these parasite strains reveal an association between repressive and permissive histone modifications and the expression of genes implicated on the parasite attachment to human host cells. BYBM34 CONGENITAL INFECTION OF Toxoplasma gondii AND Trypanosoma cruzi: HISTOPATHOLOGICAL AND HISTOCHEMICAL ANALYSIS OF EX VIVO INFECTED HPCVE ULRIKE KEMMERLING KEMMERLING, Christian Castillo, Priscilla Figueroa, Ana Liempi, Daniel Droguett, Norbel Galanti, Juan Diego Maya Instituto de Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile. E-mail: UKEMMERLING@MED.UCHILE.CL Trypanosoma cruzi (T. cruzi; phylum Euglenozoa) and Toxoplasma gondii (T. gondii, Phylum Apicomplexa) are two parasites, which may cross the placental barrier and infect the fetus. We have previously shown that T. cruzi induces severe tissue alteration in human placental chorionic villi explants (HPCVE), particularly in the extracellular matrix (ECM). Considering, that T. gondii presents a higher transmission rate than T. cruzi, our aim was to determine weather that parasite induces similar or more severe histopathological changes in ex vivo infected HPCVE. HPCVE, obtained from healthy women with uncomplicated pregnancies, were incubated with T. cruzi (strain Ypsilon; 106 parasites/ml) or different concentrations of T. gondii (strain RH; 103-106 parasites/ml) during 6 or 24 hours. Histopathological analysis was performed in haematoxylin-eosin (HE) stained samples, while ECM alterations were determined by analysis of carbohydrate rich molecules (periodic acid-Schiff) and collagen histochemistry (Picrosirius red– hematoxylin). Effective infection was tested by immunohistochemistry (anti-flagellar calcium-binding protein (T. cruzi); anti-histone 2HBv (T. gondii)) and PCR. A very low concentration of T. gondii (103 parasites/ml) induces similar tissue alterations as high concentration of T. cruzi (106 parasites/ml). Moreover, histopathological changes were evidenced earlier in T. gondii infected HPCVE than in T. cruzi infected ones. T. gondii parasites were easily identified by immunofluorescence. Contrarily, only a few parasite antigen of T. cruzi were evidenced by the same methodology. We conclude that T. gondii is more effective in destroying the placental barrier than T. cruzi; which is in concordance with the higher transmission rate of this parasite. Financed by FONDECYT Grants Nº1120230 (UK), Nº 1130189 (JM), Nº1130113 (NG) and CONICYT/MINCYT 2011-595 (UK). BYBM35 HISTONE DEACETYLATION INHIBITION AND ACTIVATION AFFECTS Trypanosoma cruzi REPLICATION, DIFFERENTIATION, INFECTIVITY AND GENE EXPRESSION BIOCHEMISTRY & MOLECULAR BIOLOGY 63 Vanina A Campo Instituto de Investigaciones Biotecnológicas “Dr. Rodolfo Ugalde” (IIB-INTECH). Universidad Nacional San Martín (UNSAM), Campus Miguelete, Av. 25 de Mayo y Francia, San Martín, Buenos Aires, Argentina.. E-mail: vcampo@iibintech.com.ar Introduction: Histones acetylation, mediated by histone acetyl transferases (HATs) and Histone deacetylases (HDACs) enzymes, is one of the most studied factors affecting gene expression. However, whether these enzymes affect gene expression in the human parasite T. cruzi has not been yet explored. In this study, four HDACs inhibitors and one activator for sirtuin deacetylases were used in order to assess their effect on the biology of the CL Brener strain from T. cruzi. Methodology: HDACs inhibitors (HDACis) Trichostatin A, Apicidin, Sirtinol and Nicotinamide and the activator Resveratrol were used on infective and proliferative forms of the parasite. Western blot analysis using anti-acetylated H4 antibodies was performed to show changes in the amount of acetylated histones produced by these drugs. Changes on the abundance of specific transcripts involved in cell cycle, differentiation, chromatin association and histone acetylation were analyzed by real time PCR. Results: All HDACis produced enrichment on acetylated histones while the opposite effect was observed with the activator Resveratrol on both proliferative and infective forms. Apicidin and Sirtinol caused changes of more than two fold on trypomastigotes transcript levels. Also, this study describes for the first time the effect of Resveratrol on T. cruzi biology. This drug killed epimastigotes, reduced infectivity of trypomastigotes and inhibited differentiation and/or replication of intracellular amastigotes. Conclusions: HDACis differentially affected transcripts levels and showed stage specific anti-parasitic effects, being inhibition of differentiation to infective forms by Apicidin and Trichostatin A the most important. Also, sirtuins activation by Resveratrol caused stronger anti-parasitic effects than the inhibition, making this drug an interesting candidate for further studies and sirtuins promising targets for development of therapeutic drugs. BYBM36 CHARACTERIZATION OF ECTOSOME-LIKE VESICLES RELEASED BY Trichomonas vaginalis Yésica R Nievas(1), Verónica M Coceres(2), Marlene Benchimol(3), Natalia de Miguel(4) Laboratorio de Parásitos Anaerobios. IIB-INTECH CONICET-UNSAM. Chascomús. Argentina. (3)Instituto de Biofísica C.C.F.-Universidade federal do Rio de Janeiro. E-mail: romina_nievas@intech.gov.ar (1)(2)(4) Trichomonas vaginalis is a common sexually transmitted parasite that colonizes the human urogenital tract where it remains extracellular and adheres to epithelial cells. Infections range from asymptomatic to highly inflammatory, depending on the host and the parasite strain. Here, we report the identification and further characterization of ectosomelike microvesicles (MVs) released by T. vaginalis. "Ectosomes" or "shedding vesicles" are derived from budding from the plasma membrane and are known to be heterogeneous in size. As exosomes, ectosomes are considered an universal transport vehicle for intercellular communication. Both types of MVs can incorporate peptides, proteins, lipids, miRNA, and mRNA, all of which can be transferred to target cells through receptor-ligand interactions, fusion with the cell membrane, and delivery of a functional cargo to the BIOCHEMISTRY & MOLECULAR BIOLOGY 64 cytoplasm of the target cell. In this report, using parasites transfected with a Tetraspanin (TSP1) fused to an haemaglutinin tag, we identify structures that shed from the plasma membrane of the parasite; reminiscent to ectosomes released from other types of cells. Hence, we set up a protocol based on filtration with different pore sizes and ultracentrifugation to differentially isolate ectosomes and exosomes from parasite conditioned media. Examination of the preparation by electron microscopy (EM) revealed vesicles with size ranging 0.1-1 µm in diameter. Using flow cytometry, isolated MVs were phosphatidil-serine (PS) positive with a size range between 0.5-1 µm diameter, similar as described for ectosomes in other cells. As mammalian ectosomes, these structures are enriched in three Tetraspanin proteins (TSP1, TSP3 and TSP8). Moreover, PCR analysis on isolated MVs of transfected parasites indicated that ectosomes from T. vaginalis can cargo DNA plasmid. Finally, we demonstrated that plasmid contained in isolated MVs could be transferred between parasites; suggesting a role in intercellular communication. BYBM37 LA VÍA AUTOFÁGICA INDUCIDA POR POLIAMINAS DEL HOSPEDADOR ES REQUERIDA PARA LA AMASTIGOGÉNESIS DE Trypanosoma cruzi EN LA CÉLULA HOSPEDADORA Maria C Vanrell(1), Darío Barcazar(2), Carolina Carrillo(3), Patricia S Romano(4) IHEM-Universidad Nacional de Cuyo. (2)(3)Instituto de Ciencias y Tecnología Dr. César Milstein - CONICET. E-mail: cristiv2002@hotmail.com (1)(4) Trypanosoma cruzi, el agente etiológico de la Enfermedad de Chagas; adopta en su ciclo biológico distintas formas parasitarias que le permiten adaptarse al ambiente en el que se encuentra. Los epimastigotes (E) presentes en el insecto vector se transforman en tripomastigotes metacíclicos (TM) que infectan la célula hospedadora y se diferencian a amastigotes (A) para poder replicarse y continuar con el ciclo. La Autofagia es un proceso de degradación de componentes intracelulares que participa activamente en los procesos de remodelación celular. La escasez de nutrientes y la poliamina (PA) espermidina, son dos inductores fisiológicos de la misma. En trabajos anteriores demostramos que la autofagia es requerida durante la metaciclogénesis de T. cruzi y que la mayor disponibilidad de PA favorecía este proceso. En este trabajo estudiamos el rol de la vía autofágica y de las PA en el proceso de diferenciación intracelular de T. cruzi, proceso que se inicia en el interior de la vacuola parasitófora (TcPV) formada en las primeras etapas de infección. En ensayos de diferenciación in vitro, observamos que condiciones que estimulan la autofagia favorecen el proceso mientras que la presencia de inhibidores lo reduce significativamente. La formación de amastigotes también se incrementó en presencia de PA y con la cepa Y-ODC, capaz de sintetizar sus propias PA. Teniendo en cuenta que la depleción de PA en la célula hospedadora reduce el número de autofagosomas de la misma y la infección por T. cruzi, medimos el nivel de PA presentes en una fracción celular enriquecida en autofagosomas en condiciones de inducción o inhibición de la autofagia observándose un alto contenido de las mismas en comparación con el control. Concluimos que la autofagia parasitaria participa en la amastigogénesis de T. cruzi. Este proceso sería probablemente inducido por las PA del hospedador que llegan al interior de la TcPV por fusión con compartimientos autofágicos. BIOCHEMISTRY & MOLECULAR BIOLOGY 65 BYBM38 DIFFERENT STRATEGIES FOR PROTEOMIC IDENTIFICATION OF SUMOYLATED PROTEINS IN Trypanosoma brucei Paula A Iribarren(1), María A Berazategui(2), Julio C Bayona(3), Triin Tammsalu(4), Ronald T Hay(5), Juan J Cazzulo(6), Vanina E Alvarez(7) (1)(2)(3)(6)(7) Instituto de Investigaciones Biotecnológicas-Instituto Tecnológico de Chascomús “Dr. Rodolfo A. Ugalde” IIB-INTECH / UNSAM-CONICET. (4)(5)Centre for Gene Regulation and Expression, College of Life Sciences, University of Dundee, Dow Street, Dundee DD1 5EH, UK. E-mail: piribarren@iibintech.com.ar SUMOylation is a post-translational modification involving the covalent attachment of a small ubiquitin-like protein called SUMO to a variety of proteins. In T. brucei, SUMO resulted essential for procyclic (PC) and bloodstream (BS) forms. Moreover, there is an association between SUMO and the expression of the variable surface glycoproteins. The aim of this work is to compare different strategies for proteomic identification of SUMO conjugates. We generated different cell lines with SUMO chromosomal tagging that enable its expression at physiological levels and provide tags for tandem affinity purification of the conjugates. We obtained parasites with a single and a double replacement of SUMO alleles, achieving a significant improvement in the yield of the purification of conjugates compared to SUMO overexpression cell lines. Proteomic analysis of these samples, however, showed that the proteins in the samples did not differ significantly from the control. To reduce the purification of contaminants we applied a complementary approach utilizing Lysine-deficient SUMO (Matic et al., 2010). Specific digestion of the sample with Lys-C cleaves all proteins but SUMO. Additionally, the introduction of an Arg residue prior to the GG motif in the C-terminus of SUMO allows to map its acceptor Lys in substrates by locating lysines modified by SUMO diGly-remnant after a subsequent cleavage of SUMOylated peptides with trypsin. Meanwhile, since trypsin digestion creates a diGly signature that can also derive from other Ubls, containing an Arg residue N-terminal to the GlyGly motif, such as Ubiquitin or NEDD8, we started to work on a new scheme with the Thr residue prior to GlyGly motif being mutated to Lys. This enables to purify SUMO modified proteins and enrich for diGly-Lys containing peptides following their digestion with Lys-C (Tammsalu et al., 2014). This approach allows the identification of SUMOylated proteins together with their acceptor sites in an unambiguous manner. BYBM39 TESTING BROMODOMAIN INHIBITORS AGAINST Trypanosoma cruzi: DISCOVERY OF NEW DRUGGABLE TARGETS Victoria L Alonso(1), Romina Manarin(2), Julia A Cricco(3), Esteban Serra(4) Facultad de Ciencias Bioquímicas y Farmacéuticas - Universidad Nacional de Rosario. IBR-CONICET. (2)Facultad de Ciencias Bioquímicas y Farmacéuticas Universidad Nacional de Rosario. E-mail: alonso@ibr.gov.ar (1)(3)(4) Bromodomains (BrDs) are conserved protein modules capable of binding acetylated lysines (Kac). They have an atypical four-helix bundle structure connected by two loops BIOCHEMISTRY & MOLECULAR BIOLOGY 66 that constitute the surface accessible hydrophobic pocket, where the Kac binding site is located. We previously characterized T. cruzi Bromodomain Factor 3 (TcBDF3), the first exclusively nonnuclear bromodomain-containing protein reported so far. TcBDF3 is expressed in all life cycle stages and interacts with acetylated α-tubulin, the major component of the flagellar and subpellicular microtubules and is essential for T. cruzi growth. Multiple studies had shown that BrD-containing proteins participate in disease processes and that they are bona fide drug targets. The GlaxoSmithKline group developed a bromodomain inhibitor (I-BET151) (Seal et al. 2012) that binds to the hydrophobic pocket and blocks the recognition of the Kac by mimicking the hydrogen-bonding and hydrophobic interactions of the native ligand. I-BET151 selectively inhibits human BRD2, which is a member of the BET (Bromodomain Extra Terminal) family. Selectivity for the BET family is achieved by making additional contacts outside the Kac cavity. We tested if I-BET-151 had any effect over T. cruzi epimastigotes and amastigotes in infected Vero cells. Cytotoxicity (by MTT assays) in this cell line was also evaluated. We were able to determine the IC50 of the compound (≈5µM) in epimastigotes, which is comparable to the IC50 of the reference drug Benznidazole. On the other hand, we confirmed in vitro that IBET-151 was able to bind to recombinant TcBDF3 by fluorescence quenching assays and UV-visible spectra. We also evaluated the effect of ten commercial Bromodomain inhibitors (ApexBio) in epimastigotes using an automatic cell counter and we determined their IC50 as well. These results corroborate that T. cruzi bromodomains are chemotherapeutic targets and open new perspectives for the development of novel drugs against this parasite. BYBM40 CHRONIC CHAGAS’ DISEASE IN ABORIGINAL COMMUNITIES FROM ENDEMIC REGION OF ARGENTINA Raul H Lucero(1), Bettina L Brusés(2), Laura B Formichelli(3), Gustavo J Fernández(4), Daniel O Hernandez(5), Carolina I Cura(6), Margarita Bisio(7), Alejandro G. Schijman(8) (1)(2)(3)(4) instituto de medicina regional-unne. (5)Facultad de Medicina-unne. (6)(8)INGEBI. (7) Hospital Ricardo Gutierrez. E-mail: rhlucero@hotmail.com Chagas’ disease mainly affects rural and neglected populations, such as indigenous groups, since they are highly exposed to the risk of vectorial transmission. The lack of a reliable assay to detect and quantify parasitic loads has been an obstacle to deepening our understanding of the impact of parasite persistence in the natural history of infection leading to chronic Chagas disease. The aim of our study was to characterize T.cruzi infection affecting the aboriginal people resident in an area of the Gran Chaco using molecular tools and associate parasite burden with geographical distribution and clinical manifestations. Peripheral blood samples from 494 individuals were studied. All seropositive patients underwent PCR studies for detection of kDNA using a PCR procedure. Determination of parasitic loads was determined using Real Time quantitative PCR by Taqman procedure for detection of a 166-bp segment from T. cruzi satellite DNA. Categorical variables were compared using the χ2 test or the Fisher test. The patients with cardiac compromise presented higher PCR positivity (Chi2: 46.22, p < 0.05) than asymptomatic patients. Indeed, out of 44 adult patients with chronic Chagas heart disease, 79.54 % were kDNA-PCR positives, whereas only 16.25% of the 80 tested asymptomatic adult cases were PCR positives (p: 0,0000000. OR: 20). In accordance with the kDNA- BIOCHEMISTRY & MOLECULAR BIOLOGY 67 PCR findings, the parasitic loads were higher among patients with cardiac disease in comparison with the parasitic loads obtained in samples from asymptomatic patients (p: 0.0229).The higher proportion of PCR positivity and higher parasitic loads among chronic patients with clinical symptoms suggest a role for parasite persistent infection in stimulating disease progression. Evidences regarding the role of parasite persistence in triggering tissue damage and clinical progression are in accordance with the existence of associations between higher parasitic burden and cardiac disease in exposed populations. BYBM41 CHARACTERIZATION OF Trypanosoma cruzi’s SIRTUINS Carla Ritagliati, Victoria L Alonso, Romina Manarin, Esteban C Serra IBR-CONICET. E-mail: ritagliati@ibr-conicet.gov.ar Trypanosoma cruzi is the protozoan pathogen responsible for Chagas disease, which affects 8 million people and causes nearly 14,000 deaths worldwide. Current therapies rely on a very small number of drugs, most of which are inadequate because of their severe host toxicity. To determine efficient therapeutic alternatives, the identification of new biotargets is essential. Class III KDACs, sirtuins, are highly conserved from Archaea to higher eukaryotes, and they have been recently considered as promising targets for the development of new treatments for Chagas disease. Genes encoding three Sir2 related proteins (SIR2RPs) were found in the TriTryps. SIR2RP1 from several Leishmania species and all three from T. brucei were characterized. T. cruzi lacks SIR2RP2, and nothing is known about the other two. Here, we report the first characterization of the T. cruzi sirtuins. Members of this family share a core domain of ~250 amino acids that exhibits 25-60% sequence identity between different organisms. SIR2RPs lack the N-terminal portion, required for nucleolar localization in ScSir2, but they contain a complete catalytic domain. To study the expression of TcSIR2RPs, antibodies were raised in rabbit against the recombinant proteins and used in western blot and immunofluorescence analysis. We also cloned the sirtuins with an HA tag in the pTcIndex-GW plasmid, which allows inducible expression in T. cruzi, and transfected Dm28 pLew epimastigotes. The expression of these constructs after Tetracycline addition, was tested by WB and IF analysis using antiHA antibodies, no leaky expression was observed in the un-induced cultures. We monitored the effect of sirtuins overexpression on epimastigote growth by counting cell numbers daily, on in vitro metacyclogenesis and on mammalian cell infection. Furthermore, we tested the effect of Nicotinamide treatment in Dm28c wt, un-induced and induced Dm28 pTcIndex-TcSIR2RP1 and Dm28 pTcIndex-TcSIR2RP3. BYBM42 THE TWO ISOFORMS OF RIBULOSE 5-PHOSPHATE EPIMERASE PRESENT IN Trypanosoma cruzi Soledad Gonzalez, Dante Maugeri, Juan José Cazzulo Instituto de Investigaciones Biotecnológicas Dr. Rodolfo Ugalde . E-mail: iaralorien_snm@hotmail.com BIOCHEMISTRY & MOLECULAR BIOLOGY 68 Ribulose 5-Phophate Epimerase (RPE) is an enzyme of the non oxidative branch of the Pentose Phosphate Pathway (PPP) that catalyses the interconversion of two phosphorylated pentoses: ribulose 5-phosphate and xylulose 5-phosphate. The importance of PPP is given by its implication in the protection of the parasite against the oxidative stress, because it is one of the major sources of the reduced coenzyme NADPH needed to maintain reduced the trypanothione, a molecule that plays a crucial role in intracellular thiol-redox balance in Trypanosoma cruzi. The genome of the CL Brener clone of T.cruzi contains two genes encoding RPEs with an identity of 52%; one of them (RPE2) predicts a PTS1 glycosomal targeting signal (SHL) at the C-terminus. The aim of this work was to perform the kinetic characterization and go into detail about the subcellular localization of the two RPE isoforms. To accomplish this, we cloned, expressed, and purified both RPEs as active enzymes which were used to determine the kinetic parameters. Both isoforms showed Michaelian behaviour, but the catalytic efficiency of RPE1 was two orders of magnitude higher than that of RPE2. For both isoforms the optimal pH with Ru5P as the substrate was 7.5. We performed denaturing SDS-PAGE analysis of both purified RPEs, which gave apparent molecular masses of 27 kDa for RPE1 and 28 kDa for RPE2. Superdex 75 gel filtration showed that both RPEs are oligomeric, with two active protein peaks for RPE1 and one for RPE2; in both cases there were only traces of the monomer. BYBM43 TbRRM1 SILENCING LEADS TO DNA SYNTHESIS IMPAIRMENT AND DISTURBS NORMAL CELL CYCLE PROGRESSION IN PROCYCLIC Trypanosoma brucei Gabriela V Levy, Carolina P Bañuelos, Analía G Níttolo, Valeria S Tekiel, Daniel O Sánchez Instituto de Investigaciones Biotecnológicas "Rodolfo Ugalde" IIB-INTECH, UNSAMCONICET. E-mail: gvlevy@gmail.com TbRRM1 is an essential RNA binding protein from T. brucei which belongs to the SRrelated protein family. Previous studies from our lab indicated that TbRRM1 RNAi knockdown in procyclic cells disturbed normal cell cycle progression by arresting cells at G1 phase 24h post-RNAi induction, with the concomitant emergence of nozzled parasites which present an abnormal posterior cell end elongation. Here, we provide evidence that after TbRRM1 silencing DNA synthesis was severely compromised since BrdU incorporation dropped ~50% after 2 days of RNAi induction. Analysis of cell viability, using Rhodamine 123 and propidium iodide, showed that the number of viable cells decreased significantly only after 72h of RNAi induction, indicating that early DNA synthesis impairment is a primary effect caused by TbRRM1 ablation and not a consequence of parasite death. Nucleus-kinetoplast (NK) configuration studies showed that after TbRRM1 depletion, parasites with misplaced 2N2K arose along with 2N1K and 0N1K aberrant populations, indicating a disturbed mitotic or post-mitotic phase. Moreover, the nozzled parasite group presented an enrichment of the one nucleus-one elongated kinetoplast (1N1K*) configuration suggesting that kinetoplast segregation might be also affected. As shown previously, Annexin-V and cell-cycle analysis results indicated that TbRRM1 silencing led to programmed cell death. Here, we show that after TbRRM1 RNAi induction the cell population with reduced mitochondrial membrane potential increased significantly, BIOCHEMISTRY & MOLECULAR BIOLOGY 69 supporting the notion that cell death is mediated through an apoptotic mechanism. Altogether, our results indicate that depletion of TbRRM1 leads to DNA synthesis impairment and both cell-cycle arrest at G1 and disturbance of the mitotic/post-mitotic phase suggesting that TbRRM1 is involved in cell cycle control and progression, although its direct or indirect connection to the cell cycle regulation remains to be elucidated. BYBM44 ANALYSIS OF THE NUCLEAR TRANSLOCATION OF ARGININE DEIMINASE DURING Giardia DIFFERENTIATION Gonzalo F Mayol, Natacha Zlocowski, Cecilia Vranych, María C Touz, Andrea Rópolo Instituto de Investigaciones Médicas Mercedes y Martín Ferreyra. E-mail: gmayol@immf.uncor.edu SUMOylation, a posttranslational modification of proteins, is vital in eukaryotic cells. In a previous work, we analyzed the role of SUMO protein and the genes encoding the putative enzymes of the SUMOylation pathway in the parasite Giardia lamblia. Although we observed several SUMOylated proteins, only the enzyme Arginine Deiminase (ADI) was confirmed as a SUMOylated substrate. During the encystations process, ADI translocates to the nuclei. The first signal that drives ADI to the nuclei is SUMOylation which probably exposes nuclear localization signals (NLSs) promoting the entry of the enzyme to the nuclei. Once inside, ADI acts as a peptidyl arginine deiminase and induces the downregulation of cwp genes, allowing the encystation process to end. In this work we found that in trophozoites overexpressing the SUMO protein, ADI is highly observed inside the nuclei and also the production of cyst is lower than in wild type trophozoites. Moreover, in immunofluorescence assays, ADI and SUMO co-localize in the nuclear membrane. In other eukaryotic cells, proteins with NLSs are transported through the nuclear envelope by a family of transport proteins called karyopherins like importins and exportines. In the Giardia genome data base, only the importin β-3 subunit (GL50803_15106) is described. It shows the HEAT domain involved in intracellular transport and contains a domain with high probability of SUMO interaction. The entire open reading frame of the importin gene was amplified, cloned in the pTubHA pac vector and sequenced. After stable trophozoite transfection, immunofluoresce assays were performed. Co-localization studies with the enzyme ADI and with the SUMO protein are a matter of ongoing experiments. An important subject for future studies will be to analyze if there is an association of the SUMOylated form of ADI with importins, or with other cargo proteins, in order to crisscross the nuclear membrane during Giardia differentiation. BYBM45 ANALISIS RESTROSPECTIVO DE FROTIS DE PACIENTES DEL NORTE DE SALTA, MEDIANTE PCR-RFLP, PARA LA IDENTIFICACIÓN DE SUBGÉNEROS DE Leishmania Cristina Almazán(1), Gil José F(2), Marco Jorge D(3), Cajal Pamela(4), Portelli Marcela(5), Juarez Marisa(6), Krolewiecki Alejandro J(7), Barroso Paola A(8), Hoyos Carlos L(9), Nasser Julio R(10) BIOCHEMISTRY & MOLECULAR BIOLOGY 70 (1)(4)(6)(7)(10) Instituto de Investigación de Enfermedades Tropicales (IIET), UNSa- Sede Regional Orán. (2)Instituto de Investigaciones en Energía no Convencional (INENCO), UNSa-CONICET. (3)(8)(9)Instituto de Patología Experimental (IPE), UNSa-CONICET. (5) Cátedra de Química Biológica, FCN-UNSa. E-mail: cristina.almazan90@gmail.com Las leishmaniasis es causada por protozoos del género Leishmania. Se propuso que las especies circulantes en Salta son de los subgéneros Viannia y Leishmania, habiéndose reportado incluso infección por Leishmania (Leishmania) infantum en el Dpto San Martín. El objetivo del trabajo fue identificar, mediante PCR-RFLP, los subgéneros infectantes a partir de frotis de pacientes con leishmaniasis tegumentaria. Además, se analizó la posible relación entre los resultados de la PCR-RFLP y diagnóstico microscópico (DM), Intradermorreacción de Montenegro (IDRM) y tiempo de evolución (TE) de la lesión. Se analizaron 100 frotis de pacientes diagnosticados en el año 2002 y 2008-2012. Para la PCR se usaron los primers L5.8S 5’TGATACCACTTATCGCACTT3’ y LITSRn 5’CTGGATCATTTTCCGATG3’ y la digestión de los amplicones por RFLP se hizo con HaeIII. En la PCR 81 muestras fueron positivas, de estas el 93% (76/81) fue positivo para la restricción. En la totalidad de los casos, el subgénero identificado fue Viannia. Al analizar los resultados de PCR-RFLP en función del diagnóstico parasitológico, se vio que los frotis con DM 3+ tuvieron mayor positividad para la PCR, que aquellos 1+ y 2+ (p0.05). Con estos resultados pudo observarse que la positividad de la PCR disminuye cuando hay menor carga parasitaria en las úlceras y cuando existe una mayor respuesta inmune celular. Si bien es poco probable encontrar L. (L.) infantum en úlceras cutáneas, L. (L.) amazonensis fue reportada en varias ocasiones aunque no se observaron cuadros de leishmaniasis difusa. Así, la ausencia de L. (L.) amazonensis y L (L.) infantum en este estudio, es concordante con los cuadros clínicos atendidos en la zona de estudio. BYBM46 ANALYSIS OF THE SUBCELLULAR LOCALIZATION OF SNF7 PROTEIN IN Tritrichomonas foetus Daniel E Moros Duarte, Lorena Frontera, Natalia de Miguel , Veronica Coceres IIB-INTECH . E-mail: e_dio7@hotmail.com Tritrichomonas foetus is the causative agent of tritrichomonosis which is characterized by infertility, early embryonic death in cows and heifers. The SNF7 protein is member of the endosomal protein complex (or ESCRT III) evolutionarily conserved, whose components have been proposed to mediate membrane deformation and fission events during MVB biogenesis and at the end of cytokinesis . In this context we transfected parasites with the construct TfSnf7-HA and we analyzed the subcellular localization by immunofluorescence. Our studies show that the protein TfSNF7 is located in intracellular vesicles present in the cytoplasm and interestingly in the flagella of transfected parasites and also has been found in the midbody in cells in division. BIOCHEMISTRY & MOLECULAR BIOLOGY 71 BYBM47 CHARACTERIZATION OF Toxoplasma gondii TGDJ1 TYPE I HSP40 Jonathan Múnera López, Figueras María J, Fenoy Ignacio, Angel Sergio O IIB-INTECH, sede Chascomús. E-mail: jonathanmunera@intech.gov.ar The HSP40 proteins, many times called the J family of proteins, lead HSP70 to facilitate diverse cellular processes like protein folding, protein translocation across membranes, cellular signal transduction, DNA replication and protein degradation. Little is known about this HSP40 family in Toxoplasma gondii. Data mining of Toxoplasma database has shown that this family is quite large and diverse identifying until now 36 members. Among the Hsp40s, the J protein YDJ1 (Y for yeast) is a cytosolic chaperone able to participate also in the Hsp90-hetercomplex. Ydj1-like Hsp40s present a particular domain organization: the N-terminal J domain, a G/F rich region, a zinc finger domain (ZFD) motif containing region, a DNAJ_C or C-terminal CTD region and a homodimerization region. Based on that, we found only one Hsp40 that has this domain organization and cytosolic localization (TGME49_311240) named TgDJ1. The ORF of TgDJ1 was expressed as a recombinant protein (rTgDJ1) in E. coli, fused to a HIS-tag to enable its purification and posterior polyclonal antibodies generation in mice. The identity of the recombinant protein produced was confirmed by mass spectrometry analysis. The TgDJ1 antiserum was able to recognize a single band of the expected molecular weight (~47-kDa) in T. gondii tachyzoite lysate showing no cross-reaction with host cell protein extract. The subcellular localization of TgDJ1 was consistent with a cytosolic labeling in intracellular tachyzoites and bradyzoites. Based on co-immunoprecipitation (coIP) analysis and Western blot, TgDJ1 may be forming complexes with Hsp90 and Hsp70. CoIP analysis with anti-TgDJ1 on tachyzoites extract followed by mass spect retrieved near 63 proteins which comprise several subcellular localizations and biological functions suggesting a broad biological role for this chaperone in the parasite BYBM48 HEME IS TRANSPORTED DURING Trypanosoma cruzi REPLICATIVE LIFE STAGES Lucas Pagura, Marcelo L Merli, Brenda A Cirulli, Jerónimo Borra Beltrán, Julia A Cricco Instituto de Biología Molecular y Celular de Rosario. E-mail: pagura@ibr-conicet.gov.ar Trypanosoma cruzi shows nutritional requirements for different cofactors including heme, because it cannot synthesize the cofactor. However, it presents many heme-proteins involved in essential metabolic pathways. T. cruzi must incorporate heme from the different hosts to supply for the heme-protein pool and also, to serve as iron source. Several eucaryotic proteins have been assigned as heme transporters (or part of them) but none of them belongs to T. cruzi. In our laboratory we are interested in elucidate how heme is imported by T. cruzi, identifying and characterizing the proteins involved. We have used fluorescent heme analogues (ZnPP, GaPP, ZnMP and SnMP) to study heme transport in epimastigotes and amastigotes life stages of T. cruzi by confocal microscopy and direct measurement of fluorescence. We observed that all analogues impaired heme uptake in epimastigote competing for heme entrance but not all were imported by the BIOCHEMISTRY & MOLECULAR BIOLOGY 72 parasite. Only the incorporated analogues caused a negative effect on epimastigote proliferation, because they could not mimic heme functions. Besides, when cells infected with amastigotes were treated with heme analogues, the fluorescent signal was selectively detected in amastigotes confirming that heme is transported in this intracellular life stage. Also, we identified a T. cruzi protein (named TcHR1) that expressed in yeast cells localized in plasma membrane and enhanced heme incorporation. As conclusion of our studies, we can postulate that T. cruzi imports heme during the replicative life stages. This parasite presents a selective protein transporter for heme uptake and the protein TcHR1 might play a relevant role in regulation and/or function of this transporter. BYBM49 THE GIARDIAL EPSIN-LIKE PROTEIN POSSESS A DUAL EPSIN-EPSINR ROLE IN CLATHRIN-MEDIATED TRAFFICKING Constanza Feliziani(1), Nahuel Zamponi(2), Natalia Gottig(3), Adriana Lanfredi-Rangel(4), Andrea S Rópolo(5), María C Touz(6) (1)(2)(5)(6) Instituto de Investigaciones Médica Mercedes y Martín Ferreyra, INIMECCONICET-Universidad Nacional de Córdoba. (3)Facultad de Ciencias Bioquímicas y Farmacéuticas, Instituto de Biología Molecular y Celular de Rosario, CONICET, Universidad Nacional de Rosario. (4)Serviço de Microscopia Eletrônica, Centro de Pesquisas Gonçalo Moniz, FIOCRUZ-BA, Brazil. E-mail: cfeliziani@immf.uncor.edu In the protozoa parasite Giardia lamblia, endocytosis and lysosomal protein trafficking are vital parasite-specific processes that involve the action of the adaptor complexes AP-1 and AP-2 and clathrin. In this work, we have identified in Giardia a single gene encoding a protein containing an ENTH domain, which defines monomeric adaptor proteins of the epsin family. This domain is present in the adaptors epsin or epsin-related (epsinR) proteins, which are implicated in the endocytosis and Golgi-to-endosomes protein trafficking, respectively, in other eukaryotic cells. The main objective of this study was to functionally characterize GlENTHp (for Giardia lamblia ENTH protein) and determine whether it might play a dual function working either as epsin or epsinR. We found that GlENTHp localized in the cytosol and, like epsin, was associated with the alpha subunit of AP-2, clathrin and ubiquitin, strongly interacted with PI3,4,5P3, and was involved in receptor-mediated endocytosis. Also, this protein bonded the gamma subunit of AP-1 and PI4P, and was implicated in ER-to-PV trafficking, like epsinR proteins. Alteration of the GlENTHp function severely affected trophozoite growth showing an unusual accumulation of dense material in the lysosome-like peripheral vacuoles (PVs), indicating that GlENTHp might be implicated in the maintenance of the PV homeostasis. When the ENTH protein family was analyzed in an evolutionary context, it was suggested that the subfamily of epsin proteins was acquired more recently probably by duplication of the epsinR. In this study, we showed evidence that places GlENTHp at the beginning of the whole family, summarizing the function of epsin and epsinR and suggesting that GlENTHp might be the epsinR adaptor from which all the family evolves. BIOCHEMISTRY & MOLECULAR BIOLOGY 73 BYBM50 FUNCTIONAL CONSERVATION OF THE Giardia lamblia EPSIN-LIKE PROTEIN IN Sacharomyces cerevisiae Constanza Feliziani(1), Andrea S Rópolo(2), Beverly Wendland(3), María C Touz(4) Instituto de Investigaciones Médica Mercedes y Martín Ferreyra, INIMEC- CONICETUniversidad Nacional de Córdoba. (3)Department of Biology, Johns Hopkins University.Baltimore, USA.. E-mail: cfeliziani@immf.uncor.edu (1)(2)(4) Endocytosis and lysosomal protein trafficking is essential in pathogenic parasites since it is directly linked to vital parasite-specific processes. The epsin N-terminal homology (ENTH) domain is an evolutionarily conserved protein module found primarily in proteins that participate in clathrin-mediated trafficking. By searching in the GDB, we found the protein GlENTHp (for G. lamblia ENTH protein) contains an ENTH domain, which is present in the epsin or epsinR form and is involved in endocytosis and protein trafficking from the Golgi to the lysosomes, respectively. Our findings suggest a dual epsin-epsinR role of GlENTHp, since it was able to bind clathrin, ubiquitin and also interacts with αAP-2 and γAP-1, with the events of endocytosis and lysosomal hydrolase trafficking being equally affected by GlENTHp downregulation. There are two homologues of epsin, Ent1p and Ent2p, and two orthologous of epsinR, Ent3p and Ent5p in S. cerevisiae. ENT1 and ENT2 are two redundant genes and deletion of both genes (ent1Δent2Δ) is lethal. On the other hand, strains lacking both Ent3p and Ent5p (ent3Δent5Δ), but not single mutant strains, exhibit defects in TGN/endosome traffic and protein sorting into the vacuole lumen. Because many components of the endocytic machinery are structurally and functionally conserved between eukaryotes, the main objective of this work was to analyze whether GlENTHp might play a function working as epsin or epsinR (or both) in S. cerevisiae. We found that GlENTHp was expressed in S. cerevisiae and localized in patches at the plasma membrane. This expression neither complements the growth in ent1Δent2Δ mutants nor restores GFP-CPS1 vacuolar protein trafficking defect in ent3Δent5Δ. However, our recent results suggest that GlENTHp might act as epsinR dominant negative mutant in yeast cells. BYBM51 cAMP-EPAC DEPENDENT REGULATION OF Trypanosoma cruzi INVASION Daniel Musikant(1), Gabriel Ferri(2), Ignacio Durante(3), Carlos Buscaglia(4), Martín M Edreira(5) (1)(2)(5) Departamento de Química Biológica - FCEyN - UBA. (3)(4)Instituto de Investigaciones Biotecnológicas – Instituto Tecnológico de Chascomús – UNSAM – CONICET. E-mail: dmusikant@fmed.uba.ar The attachment of infective stages of T. cruzi to the host cell is accompanied by an increase of intracellular cAMP levels in the host that potentiate the Ca2+ dependent lysosome-mediated cell invasion by the parasite. In mammalian cells, both cAMP effector pathways, i.e. PKA and Epac, are involved in Ca2+ triggered exocytic events. However, the cAMP effectors involved in the process of invasion by T. cruzi are for the moment unknown. Since Epac-mediated Rap activation is involved in regulated exocytosis in BIOCHEMISTRY & MOLECULAR BIOLOGY 74 human sperm, insulin secretion and pancreatic amylase release, we hypothesized that the Epac-Rap1 cAMP pathway might play a functional role during T. cruzi invasion of the host cell. Using cAMP analogs to selectively activate/inhibit PKA or activate Epac in NRK cells, we shown that cAMP can induce invasion via specific activation of the Epac-mediated pathway. In contrast to the stimulatory effects Epac, PKA-dependent signaling had shown no effect on invasion. Moreover, data showed that PKA might be suppressing the effects of Epac when both pathways are simultaneously activated, suggesting a crosstalk between pathways in the regulation of invasion. BYBM52 A NOVEL Trypanosoma cruzi cAMP EFFECTOR PROTEIN Jésica Mild, Daniel Musikant, Gabriel Ferri, Bárbara Mc Cormack, Martín M Edreira Departamento de Química Biológica - FCEyN - UBA. E-mail: dmusikant@fmed.uba.ar Although cAMP plays an essential role in Trypanosoma cruzi life cycle, the exact mechanisms of action are unknown. Up to date, Protein Kinase A (PKA) is the only known T. cruzi cAMP effector, however experimental evidences suggest the existence of other effectors. In order to identify new cAMP effectors, we carried out in silico studies using the predicted T. cruzi proteome. As a result, we identified 27 proteins with putative cAMP binding domains. Within these proteins, we subcloned and characterized the paralogs proteins TcCLB.508523.80 and TcCLB.507035.110, the two most solid candidates. Computational models shown that the domain present in these proteins could fold in a similar manner than other know cAMP effectors. In fact, both proteins could specifically bind cAMP. Moreover, transgenic T. cruzi epimastigotes expressing TcCLB.508523.80 shown an increased infectivity when incubated with 8-Br-cAMP. Our results indicate that TcCLB.508523.80 and TcCLB.507035.110 are bona fide cAMP binding proteins that could act as novel T. cruzi cAMP effectors during host cell infection. BYBM53 IDENTIFICATION OF A NOVEL FAMILY OF RIBOFLAVIN TRANSPORTERS IN TRYPANOSOMATIDS Dario E Balcazar(1), Hernan R Bonomi(2), Claudio Pereira(3), Fernando Glodbaum(4), Carolina Carrillo(5) (1)(5) ICT-Milstein- CONICET. (2)(4)Fundación Instituto Leloir. (3)Instituto de Investigaciones Médicas Alfredo Lanari. E-mail: darioebalcazar@gmail.com Trypanosomatids Leishmania mexicana, Trypanosoma brucei and Trypanosoma cruzi are human pathogenic parasites. The current drug treatments are highly toxic, posses limited efficacy and can generate resistance, thus there is a need to identify targets to develop new therapies. Riboflavin (Rf), an essential vitamin for all living cells, is the precursor of the cofactors flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) responsible of a variety of vital cellular reactions. The aim of this work is to determine the BIOCHEMISTRY & MOLECULAR BIOLOGY 75 molecular basis of the Rf metabolism in trypanosomatids. Our in silico analyses suggest that trypanosomatids are auxotrophic for Rf because no biosynthetic Rf pathways are coded in their genomes. We also identified a putative novel transporter family for this vitamin by bioinformatic studies. Moreover, these studies indicate conservation of twelve transmembrane regions and an MSF domain (Major Facilitator Superfamily) in all members of the family. The corresponding transporters for L. mexicana, T. cruzi and T. brucei were cloned and expressed in an Rf auxothroph E. coli strain, which naturally lacks of Rf transport activities. We observed that T. cruzi and T. brucei genes were able to restore bacterial growth in low Rf media suggesting their functionality as flavin transporter. In vitro experiments with each trypanosomatid showed that the maximum density of parasites (in growth curves) increases with the concentration of Rf, FMN and FAD. Finally, overexpression of T. cruzi putative Rf transporter lowers the riboflavin dependency in culture, achieving higher number of epimastigotes per ml in Rf limited media compared to the wild-type strain. The putative Rf transporter family we identified in trypanosomatids would be essential for their survival. This transporter family is different from any other Rf transporter known to date, particularly the mammalian ones, thus we propose it as a potential target for the development of trypanocidal therapies. BYBM54 RIBOFLAVIN UPTAKE: POSSIBLE NEW TRYPANOCIDAL TARGETS Dario E Balcazar(1), Hernan R Bonomi(2), Cristina Vanrell(3), Patricia Romani(4), Fernando Goldbaum(5), Carolina Carrillo(6) (1)(6) ICT-Milstein- CONICET. (2)(5)Fundación Instituto Leloir. (3)(4)IHEM- Facultad de Ciencias Médicas- UNCuyo- CONICET. E-mail: darioebalcazar@gmail.com Chagas disease is a parasitosis endemic in Latin-America, caused by infection with a protozoan, Trypanosoma cruzi. The current drug treatments are highly toxic, possess limited efficacy and can generate resistance, thus there is a need to identify targets to develop new therapies. Riboflavin (Rf), an essential vitamin for all living cells, is the precursor of the cofactors flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) responsible of a variety of vital cellular reactions. Plants, fungi and prokaryotes synthesize it de novo while metazoans obtain it from their diet. Our previous findings show that T. cruzi also incorporates Rf through a putative Rf transporter (”RibTCR”), identified by in silico analyses. The aim of this work was to evaluate the role of Rf in different stages of the parasite life cycle. Assays performed in T. cruzi epimastigote cultures showed that flavins stimulate their proliferation (43%) and metacyclogenesis (98%) while Rf chemical analogues significantly inhibit these processes (50% and 45%, respectively). Moreover, the proliferative capacity of epimastigotes, reduced by the analogues, was restored by the addition of high concentrations of Rf, FMN or FAD. Epimastigotes over-expressing RibTCR improved their proliferative rate in Rf limited media compared with the wild-type counterpart. The inhibitory effect of Rf analogues in the overexpressing strain was outcompeted by Rf, FMN and FAD more efficiently than in the wild-type strain. Finally, analogues significantly reduced (25%) the intracellular amastigotes proliferation in cardiomyocyte monolayer infectivity model, although the infectivity of trypomastigotes was unaffected. In conclusion, Rf is a key metabolite involved in several relevant biological processes of the parasite. Our findings suggest that RibTCR is an essential protein BIOCHEMISTRY & MOLECULAR BIOLOGY 76 involved in development and survival of T. cruzi. We propose Rf metabolism and uptake as potential anti-chagasic target. BYBM55 COMPARACIÓN DE LA RESPUESTA HUMORAL INDUCIDA POR LOS LINAJES TCI Y TCV DE Trypanosoma cruzi AISLADOS DE UNA ZONA ENDÉMICA, EN UN MODELO MURINO Miryam A Romano(1), Paula Ragone(2), Julio Nasser(3), Patricio Diosque(4), Rubén Cimino(5) Cátedra de Química Biológica,FCN,UNSa. (2)(4)Instituto de Patología ExperimentalSalta. E-mail: miryamdelosangelesromano@gmail.com (1)(3)(5) Actualmente se clasifica a Trypanosoma cruzi en 6 Unidades Discretas de Tipificación (UDT TcI - TcVI); Esta diversidad genética se encuentra relacionada con la variabilidad biológica observada dentro de este parásito. El objetivo del trabajo fue evaluar la respuesta humoral inducida por los linajes TcI y TcV, aislados de un área endémica. Ratones BALB/C hembras de 45 días de edad se infectaron intraperitoneal con 10.000 tripomastigotes metacíclicos de T. cruzi pertenecientes a los linajes TcI y TcV. Se realizó la detección del parásito en sangre mediante parasitemia desde el día 7 hasta el día 30 post-inoculación y mediante la técnica de PCR a los 15 días post-inoculación (dpi). Se tomaron muestras de suero a diferentes tiempos de infección, desde el día 7 al día 120, para estimar títulos de anticuerpos inducidos por cada grupo experimental. Las parasitemias hasta los 30 dpi fueron negativas en todos los animales infectados tanto en TcI como TcV; por lo que únicamente se comprobó infección por PCR. Se aplicó la técnica de ELISA utilizando como antígeno un homogenado de parásitos de T. cruzi (TcI y TcV). Se plaquearon 1µg/poc/100 mL de antígeno. La dilución de suero fue de 1/100 en PBS-leche 1%, la de Ac 2º biotinilado y conjugado (avidina-peroxidasa) fueron de 1/2500 y 1/16.000, respectivamente. Evaluando la respuesta humoral se observó que hasta los 20 dpi, no hay diferencias significativas (p>0.05) entre los títulos de anticuerpos en los ratones infectados con TcI y aquellos infectados con TcV. A partir de los 30 dpi al día 50 post-infección, se observó mayor respuesta humoral en ratones infectados con TcI, en comparación con los animales infectados con TcV; ya que los títulos de anticuerpos antiTcI fueron de DO=0.80±0.064, mientras que los títulos anti-TcV fueron de DO=0.29±0.15. Este estudio preliminar de infección en un modelo murino, sugiere que aunque ambos linajes TcI y TcV presentan una parasitemia sub-patente, inducen diferentes respuestas serológicas. BYBM56 ANÁLISIS COMPARATIVO DE LA ESTRUCTURA GENÉTICA POBLACIONAL DE Trypanosoma cruzi I DEL GRAN CHACO MEDIANTE MICROSATÉLITES, RAPD, MLST Y SL-IR Anahí M Alberti DAmato(1), María M Monje Rumi(2), Juan J Lauthier(3), Nicolás Tomasini(4), Christian Barnabé(5), Martin Llewellyn(6), Paula G Ragone(7), Alejandro Uncos(8), María C Mora(9), Julio R Nasser(10), Miguel A Basombrío(11), Michel Tibayrenc(12), Patricio Diosque(13) BIOCHEMISTRY & MOLECULAR BIOLOGY 77 (1)(2)(3)(4)(7)(13) UNIDAD DE EPIDEMIOLOGÍA MOLECULAR-IPE-UNSA. (5)(12)Institut de Recherche pour le Développement (IRD), Francia. (6)London School of Hygiene and Tropical Medicine, UK. (8)(9)(11)Instituto de Patología Experimental (IPE)-CONICET-UNSA. (10) Instituto de Investigaciones en Enfermedades Tropicales, Orán, Facultad de Ciencias Naturales, UNSa. E-mail: anahialberti@hotmail.com El estudio de la estructura genética poblacional de Trypanosoma cruzi I (TcI) resulta de interés en cuanto al conocimiento básico y a la epidemiología de la enfermedad de Chagas. El objetivo de este trabajo fue analizar la estructuración poblacional encontrada previamente que permitió definir subgrupos de aislados intra-TcI provenientes de la provincia de Chaco (Argentina) mediante microsatélites y compararla con la estructuración hallada mediante RAPD (Random Amplified Polymorphic DNA), MLST (Multilocus Sequence Typing) y SL-IR (Spliced Leader Intergenic Region). Se examinaron mediante 9 loci de microsatélites 39 stocks de TcI provenientes de 28 hospedadores, y se observó la existencia de 4 subgrupos. Estas agrupaciones definidas por microsatélites se contrastaron con aquellas producidas por otros marcadores utilizados por nuestro grupo y aplicados a los mismos stocks. Se compararon los agrupamientos producidos por RAPD (32 loci), MLST (10 loci) y por el locus SL-IR. Los resultados indican una concordancia completa en la asignación de los subgrupos de TcI entre microsatélites y RAPD, lo que puede explicarse en parte porque ambos responden a la condición de marcadores neutros frente a la selección. La correspondencia entre microsatélites con MLST y SL-IR fue solo parcial, mostrando una distribución en mosaico de los grupos definidos por microsatélites y por los otros marcadores. Consideramos que no es sorprendente que un marcador como MLST muestre agrupamientos que no concuerdan completamente con microsatélites, ya que MLST está basado en análisis de genes metabólicos y por tanto sometido a otro tipo de selección. Asimismo, la concordancia parcial entre microsatélites y SL-IR, puede estar relacionada con el tipo de evolución de esta región, que posiblemente está condicionada por la función que desempeña el mini-exón y por los mecanismos que se han sugerido como responsables de homogeneizar estas secuencias. BYBM57 TRAFFIC, MEMBRANE DISTRIBUTION AND SHEDDING OF A VIRULENCE FACTOR OF Trypanosoma cruzi Andrés Lantos(1), Sayantanee Niyogi(2), Beatriz Araoz(3), Giannina Carlevaro(4), Mariano Bossi(5), Roberto Docampo(6), Juan Mucci(7), Oscar Campetella(8) (1) IIB UNSAM. (2)(6)Department of Cellular Biology and Center for Tropical and Emerging Global Diseases and University of Georgia, Athens, Georgia.. (3)(5)INQUIMAE. Departamento de Química Inorgánica, Analítica y Química Física, FCEN-UBA - CONICET. Buenos Aires, Argentina.. (4)(7)(8)Instituto de Investigaciones Biotecnológicas - Universidad Nacional de San Martín - CONICET. Buenos Aires, Argentina.. E-mail: alantos@iibintech.com.ar trans-Sialidase (TS) is a key virulence factor for T. cruzi, the etiological agent of Chagas disease. The enzyme is involved in crucial aspects of the parasite’s life cycle and also generates several abnormalities in the immune system of the infected mammal. TS is a GPI-anchored protein (GPI-AP) located in the plasma membrane of trypomastigotes, BIOCHEMISTRY & MOLECULAR BIOLOGY 78 which is shed to the milieu. In this work we follow how TS, as well as other GPI-AP like mucins and TSSA are delivered to the plasma membrane via the contractile vacuole complex (CVC) during differentiation of intracellular amastigotes into trypomastigotes. TS is transported from the CVC to the plasma membrane ushered by the small GTPase Rab11. Expression of a dominant negative mutant for Rab11 prevents TS from locating to the plasma membrane and also reduces T. cruzi infection. Infection reduction is rescued by addition of recombinant TS to the culture medium. In the plasma membrane TS appears in discrete domains, which are barely separated one from another when observed under a confocal microscope. To have a better insight of TS distribution we performed super-resolution (GSDIM) imaging of these domains and have determined that TS domains are about 50-nm thick and separated by 100 nm from each other in a zig-zag distribution, validating confocal observations. We evaluated whether TS belongs to detergent resistant domains (DRDs) and found that they do not given that they are susceptible to detergent extraction. However other GPI-AP in trypomastigotes, such as mucins, does belong to DRDs and, correspondingly, does not colocalize with TS in the trypomastigote’s membrane. In epimastigotes, the stage specific mucins (MW 35-50 kDa) also belong to DRD and the traffic to membrane is Rab 11 independent. Lastly, TS is shed to the milieu in exosomes and only appears as a soluble protein after digestion with recombinant PI-PLC. This finding suggests that there is no functional native PI-PLC in T. cruzi trypomastigotes. BYBM58 LA CICLOFILINA A DE Trypanosoma cruzi ES SECRETADA AL MEDIO E INTERACTÚA CON LA CÉLULA HOSPEDADORA Alina E Perrone(1), Bustos P(2), Milduberger N(3), Fuchs AG(4), Búa J(5) INP “Dr. M. Fatala Chaben” A.N.L.I.S.- C.G. Malbrán. (3)INP “Dr. M. Fatala Chaben” A.N.L.I.S.- C.G. Malbrán. CAECIHS, Universidad Abierta interamericana. (4)(5)INP “Dr. M. Fatala Chaben” A.N.L.I.S.- C.G. Malbrán. CAECIHS, Universidad Abierta Interamericana.. E-mail: alinaperrone@yahoo.com.ar (1)(2) En Trypanosoma cruzi existe una familia de genes que codifican para proteínas con actividad chaperona, denominadas ciclofilinas (CyPs). La ciclofilina de 19 kDa (TcCyP19), homóloga a la CyPA de mamíferos, es una de las isoformas más expresadas del parásito, de localización citoplasmática. La secreción de las ciclofilinas citosólicas al espacio extracelular ha sido descripta para células humanas así como también en los parásitos protozoarios Toxoplasma gondii y Trypanosoma brucei. En estudios previos habíamos demostrado que la TcCyP19 se secreta al medio extracelular por ensayos de Western Blot y que contiene un péptido señal para su secreción. Este hecho fue confirmado cuando la TcyP19 no se secretó integrando una proteína recombinante con una secuencia no relacionada en el extremo amino terminal. En el presente trabajo observamos que incubando la proteína recombinante, expresada en bacterias E. coli, con células de mamífero (VERO), la proteína se adhiere a las células. Experimentos adicionales por análisis por citometría de flujo demostraron que la TcCyP19 penetra en estas células. La proteína recombinante TcCyP19 inhibió entre un 40 y un 60 % la invasión de tripomastigotes de la cepa Tulahuén 2 en monocapas de células VERO, en estudios preliminares. Nuestros resultados indican que la TcCyP19 del T. cruzi se secreta, BIOCHEMISTRY & MOLECULAR BIOLOGY 79 interactúa con la célula del mamífero y podría estar involucrada en los procesos de infección en las células del hospedador. BYBM59 THE ALKALINE PHOSPHATASE ACTIVITY IS DIRECTLY ETINDRONATE IN Echinococcus granulosus CELL LINE (EGPE) MODIFIED BY Melisa S. Barbery Venturi, Emilio Roldán, Alicia G Fuchs Centro de Altos Estudios en Ciencias Humanas y de la Salud (CAECIHS)-UAI. E-mail: melisabarbery@hotmail.com Intracellular alkaline phosphatases (AP) have been associated with the down regulation of signaling pathways. Nitrogen-containing bisphohsphonates (BPs) disrupt protein prenylation (Tanimori et al., 2010). BPS were studied for anti parasitic activity on Trypanosomatides (Lai and Bontempi et al, 2014, Docampo et al 2008). We previously studied the effect of 5 BP on EGPE cell line. BP decreased cell grow, ATP and mitochondrial respiration and increased intracellular Ca2+ (Fuchs et al, 2014). Etindronate (EHdP) decreased AP activity after 3 days of incubation, corresponding to the maximum pharmacological effect. This effect could be mediated or be direct on the AP. This work compares the in vitro effect of two BP, EHDP and Ibandronate (IB) on AP activity from pig’s kidney and from EGPE cells homogenate. AP from pig’s kidney (Sigma) was assayed in 1M of 2-dimethilamine ethanol pH9.8, 0.5 mM MgCl2 reading at 405 nm the pnitrophenol. Vanadate (V) (Sigma) inhibition was used to identify AP activity. Dose response was studied with EHDP, IB (Gador S.A) and V from 6 to 110 µM. Slope was recorded during 10 min. In EGPE homogenate AP was measured in the same conditions but incubating 2hrs at 37C, initial and final abs. were reordered and proteins were measured by Bradford. The I50 of commercial AP with V was 52 µM and 50% AP activity increased with EHDP and IB at 110 µM (n=3 for every dose). On the contrary on EGPE cells EHDP decreased AP activity. p< 0.05 (n=3) as V. IB has no effect (control: 4.17x108U/ml*µg prot. ± 1.20x10-8 as 100%; EHDP 21.4 % ± 37.1; IB 76.6% ± 79.3 and V 17.7% ± 3) Conclusion Intracellular AP from EGPE cells are inhibited by V indicating an identity between both enzymes origin, but BP specially EHDP inhibits AP from EGPE, while BPS increased pig’s AP activity. These results indicate that EHDP acts directly on AP activity. Molecular differences between mammalian AP and E.g are reflected in BP effects on enzyme activity. BYBM60 INHIBIDORES DE LA ANTIPARASITARIOS SINTESIS DE ISOPRENOIDES COMO AGENTES Juan Bautista Rodriguez, Sergio H. Szajnman, María N. Chao, Carolina Exeni, Mariana Ferrer-Casal, Nahir Vadra, Tamila Galaka Departamento de Química Orgánica, FCEyN, UBA. E-mail: jbr@qo.fcen.uba.ar BIOCHEMISTRY & MOLECULAR BIOLOGY 80 La quimioterapia tanto para la enfermedad de Chagas como la toxoplasmosis es aún deficiente. Las drogas disponibles para la enfermedad de Chagas, descubiertas empíricamente, nifurtimox y benznidazol, están asociadas a tratamientos prolongados y severos efectos adversos. Las correspondientes para toxoplasmosis no son satisfactorias, especialmente, no son bien toleradas por individuos inmunosuprimidos. Entonces, existe una necesidad crucial de desarrollar nuevas drogas que sean efectivas y seguras basadas en el conocimiento de la bioquímica y la fisiología de estos microorganismos. La biosíntesis de isoprenoides es particularmente útil para la identificación de nuevos blancos moleculares contra trypanosomatideos o parásitos Apicomplexa. Nuestra hipótesis es que la biosíntesis de isoprenoides constituye un blanco molecular principal para el tratamiento de estas enfermedades parasitarias. Para evaluar esta hipótesis, nuestros objetivos centrales son (a) investigar el efecto de análogos de pirofosfato (bisfosfonatos) contra la actividad enzimática de farnesil pirofosfato sintetasa (FPPS) e in vitro contra células de T. cruzi y T. gondii; (b) investigar la acción derivados de tiocianatos de ariloxietilo, los cuales son inhibidores muy efectivos de la proliferación de T. cruzi y T. gondii, contra escualeno sintetasa de T. cruzi (SQS). WC-9 es un miembro representativo de esta familia de compuesto desarrollado en nuestro laboratorio cuyo mecanismo de acción es un bloqueo específico de la biosíntesis de novo de ergosterol a nivel de escualeno sintetasa. En particular, WC-9 es un potente inhibidor no-competitivo de la actividad enzimática de SQS de T. cruzi tanto glicosomal como mitocondrial en el rango bajo nanomolar. Por otro lado, se ha demostrado que T. gondii no biosintetiza colesterol y que lo importa del huésped sugiriendo que los inhibidores de SQS de mamíferos podrían eventualmente controlar la proliferación de T. gondii. BYBM61 COMPARATIVE GENOMIC STUDY OF TRANSPOSABLE ELEMENTS IN TWO VIRULENT STRAINS OF Entamoeba histolytica Ludmila S López Arias(1), Elisabet Caler(2), Martina S Paoletta(3), Hernán Lorenzi(4), Graciela Garbossa(5), Marisa D Farber(6) (1) Institulo de Biotecnología, CICVyA, INTA-Castelar. Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, CABA, Argentina. Instituto de Investigaciones en Salud Pública, Universidad de Buenos Aires, CABA, Argentina. (2)Division of Lung Diseases. National Heart, Lung and Blood Insitute. National Institute of Health. Maryland, USA. (3)(6)Institulo de Biotecnologia, CICVyA, INTACastelar. . (4)Department of Infectious Diseases. The J. Craig Venter Institute. Maryland, USA. (5)Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, CABA, Argentina. Instituto de Investigaciones en Salud Pública, Universidad de Buenos Aires, CABA, Argentina. E-mail: lud.lopez.arias@gmail.com Entamoeba histolytica is the parasite that causes dysentery and liver abscesses in humans. However, most infections are asymptomatic. Several strains were isolated from feces (E. histolytica Rahman), liver (E. histolytica HM3:IMSS (HM3)) and bowel (E. histolytica HM1:IMSS (HM1)). E. histolytica contains many Transposables Elements (TE) among which are the non-Long Terminal Repeats retroelements: Long and Short Interspersed Elements (LINEs and SINEs). TE can give rise to the appearance of different virulent phenotypes by changing the expression of adjacent genes. In this context, our BIOCHEMISTRY & MOLECULAR BIOLOGY 81 goal is to analyze the distribution of TE in the genomes of HM3 and HM1 and to assess their impact on the expression of genes involved in pathogenicity mechanisms. Our mapping of TE showed that the abundance of LINEs (HM3: 876; HM1: 1879 copies) was greater than that of SINEs (HM3: 354; HM1:867 copies). LINE1 (subtype of LINE) was the most frequent LINE: 56.2% (493/876) in HM3 and 49.7% (934/1879) in HM1. The full coverage (percentage of the corresponding length of the assembled genome) of LINEs was 1.38% in HM3 and 10.00% in HM1. To estimate the potential impact of TE on gene expression we defined a criterion of TE-gene association, where any coding sequence (CD) within 1 kb of a nearby TE is computed as associated and potentially modulated by that element. This analysis revealed that LINEs were slightly more frequently associated to CDs (HM3: 74.6%; HM1: 52.2%) than SINEs (HM3: 73.1%; HM1: 48.9% Subsequently, we performed a functional categorization of associated genes based on GO terms, in order to reveal the relatedness of TE insertions to functional categories. This analysis showed that kinase and binding proteins were preferentially associated with both SINEs and LINEs. These preliminary results indicate that the proposed in silico strategy will help in the identification of candidate genes for functional assays to elucidate novel virulence mechanisms in E. histolytica. BYBM62 IDENTIFICATION OF A METACASPASE PROTEIN SUBSTRATE CONSERVED AMONG Trypanosoma cruzi AND OTHER EARLY DIVERGENT EUKARYOTIC CELLS Gabriela Niemirowicz, León Alberto Bouvier, Juan José Cazzulo, Vanina Eder Alvarez IIB-UNSAM. E-mail: gniemiro@iib.unsam.edu.ar Knowledge of the mechanism of action of metacaspases (MCAs), distant relatives of the metazoan caspases, is still very limited, mostly because the targets of their activity are still unknown. In this direction we had conducted a search for natural substrates of T. cruzi metacaspases by the screening of a number of interactors (obtained by co-purification from parasite extracts and identified by mass spectrometry) expecting that some of them will be true substrates. Using a dual vector system that allowed us to simultaneously express both, the metacaspase and the putative substrate in E. coli, we were able to identify a potential substrate of TcMCA5. In vitro assays using both recombinant purified proteins, plus N-terminal Edman sequencing, helped us to identify an arginine residue upstream the cleavage site which matches perfectly the known metacaspase specificity. Furthermore, replacement of this residue by an Ala completely abolished TcMCA5 activity over this target protein. To further investigate the potential physiological consequences of this proteolytic cleavage we moved to two different well-established unicellular model organisms, the closely related Trypanosoma brucei; as well as the early divergent budding yeast Saccharomyces cerevisiae. Therefore each metacaspase/substrate pair was expressed, purified and assayed for cleavage in vitro. Both T. brucei TbMCA5 and YCA1, the only metacaspase ortholog present in the genome of S. cerevisiae, indeed processed their respective substrates after arginine residues as shown by N- terminal sequencing. Interestingly, in each respective substrate protein, the proteolytic events take place around the same region. Currently we are focusing on detecting the in vivo proteolytic event by means of simultaneous inducible expression and endogenous epitope tagging based methodologies. BIOCHEMISTRY & MOLECULAR BIOLOGY 82 BYBM63 SISTEMA REDOX DE T.cruzi COMO FACTOR DE VIRULENCIA: ROL DE LA TRIPAREDOXINA PEROXIDASA (TXNPx) EN LA PATOGENIA DE LA ENFERMEDAD DE CHAGAS Paola Zago(1), MD Piñeyro(2), A Mesías(3), N. Garg(4), C. Robello(5) Instituto de Patología Experimental (IPE-CONICET)- Salta. (2)(5)Univers de la Republica e Inst. Pasteur, Uruguay. (4)Dept Microbiology & Immunology, UTMB, Galveston, USA. . E-mail: mpzago@conicet.gov.ar M. (1)(3) Nuestro objetivo es estudiar el rol del sistema redox de T.cruzi en la patogenia de la Enfermedad de Chagas. Varios grupos le hemos atribuido un papel único en la virulencia al permitirle enfrentar la primera barrera de defensa impuesta por el sistema inmune innato. Previamente describimos la mayor expresión de proteínas de este sistema, entre ellas, las triparedoxinas peroxidasas (TcTXNPxs), en tripomastigotes de TcI. Para caracterizar su participación sobre la respuesta celular a la infección, se diseñaron mutantes funcionales y sobreexpresantes de TXNPx en la cepa Sylvio X10/cl4 utilizando el sistema pRibotex. Se clonaron la CDS wild type de TXNPx tanto citosólica como mitocondrial y a su vez se produjeron mutaciones sitio-dirigida en dominios cys claves tanto para su actividad redox como resolutiva, a fin de obtener de parásitos recombinantes que sobrexpresen formas activas y no funcionales de estas enzimas y así contar con una batería de clones con distintas capacidad antioxidante. Electroporamos estas construcciones obteniendo transfectantes bajo presión de selección con G418 (250400µg). Confirmamos tanto la sobrexpresión por western blot con anticuerpos específicos para ambas TXNPXs(CPX and MPX) como la actividad peroxidasa diferencial de las transfectantes (Peroxidase Assay Kit Invitrogen®) y la sensibilidad diferencial a especies oxidantes (H2O2 y ONOO.- ) con Alamar Blue®. Ensayamos tanto la infectividad de estos transfectantes como la respuesta del huésped tanto in vitro (macrofagos Raw 264) como in vivo (ratones C57BL/6). Hallamos una menor infectividad de las mutantes funcionales negativas de TXNPXs tanto por evaluación directa e indirecta. La determinación de estrés oxidativo global, lipoperoxidación lipídica y actividad mieloperoxidasa demostraron una respuesta diferencial del huésped a la infección, apoyando la hipótesis de que enzimas antioxidantes del parásito podría interaccionar con el huésped para el desarrollo de la patología chagásica. BYBM64 ANALYSIS OF AN UNUSUAL TRANSCRIPT WITH NON-AUG TRANSLATION INITIATION CODON IN Giardia lamblia Diego N Ríos(1), Gabriela A Merino(2), Marianela Serradell(3), Lucía Rupil(4), Alicia Saura(5), Mariana Martina(6), Elmer A Fernández(7), Hugo D Luján(8), Pablo R Gargantini(9) (1)(3)(4)(5)(6)(8)(9) CIDIE - UCC/CONICET. (2)(7)BDMG - UCC. E-mail: gargantini@ucc.edu.ar Giardia lamblia is a protozoan parasite that is found worldwide and has both medical and veterinary importance. The availability of second-generation sequencers has made it easier and less expensive to study the gene expression profile of Giardia, improving our understanding of the unique features of these parasites and allowing us to identify BIOCHEMISTRY & MOLECULAR BIOLOGY 83 expressed genes and verify annotated ones. We used the data from a RNA-seq study to analyze the correct identification and quantitation of expression for a putative Non-AUG translation initiation gene first described in this parasite. Visual inspection of the alignment obtained with the Integrative Genomics Viewer (IGV), revealed the presence of readings in the previous genomic region to the ATG site annotated in the public database. Transcript levels were calculated from the mapped sequences as fragments per kilobase per million fragments mapped (FPKM), using Cufflinks v.2.0.0. Another analysis revealed the presence of a putative downstream box (DB) in this transcript, we used a 15 nt sequence (5´-CAGGCGCGGGGGCUC-3´) as a query that complements precisely the 15 nt putative anti-DB sequence at the 3´-end of the Giardia 16S-like rRNA. We also examined this transcript looking for a frequent transcription-initiation site consensus, which could be upstream of the Non-AUG start codon previously identified by 5´RACE. All this in silico analysis complement others molecular experiments that could explain the unique mechanism of translation initiation that probably falls somewhere between that of a prokaryote and a eukaryote with a potentially close link with that in the Archaea. BYBM65 CARACTERIZACIÓN DE PATRONES ELECTROFORÉTICOS DE PROTEÍNAS OBTENIDAS DE LÍQUIDO HIDATÍDICO DE QUISTES HIDATÍDICOS BOVINOS DE Echinococcus granulosus Colette Burotto, Constanza Andrade, Pamina Horlacher, Felipe Corrêa, Caroll Stoore, Christian Hidalgo, Edgar Jiménez, Rodolfo Paredes Escuela de Medicina Veterinaria, Facultad de Ecología y Recursos Naturales, Universidad Andrés Bello, Santiago, Chile. E-mail: christian.hidalgo@unab.cl Introducción: La hidatidosis es una enfermedad zoonótica causada por el metacestodo de Echinococcus granulosus. Existen quistes hidatídicos de tipo fértil que presentan protoescólices y quistes de tipo infértil en los que no hay desarrollo de protoescólices. Las causas de fertilidad e infertilidad de quistes no están dilucidadas. En la cavidad del quiste hidatídico se presenta gran cantidad de líquido hidatídico que provee de nutrientes y otros componentes necesarios para el crecimiento y desarrollo del quiste Objetivo: Caracterizar el patrón electroforético proteico de líquido hidatídico provenientes de quistes hidatídicos fértiles e infértiles de Echinococcus granulosus. Material y Métodos: Quistes hidatídicos se obtuvieron desde pulmón e hígado de bovinos faenados en el Frigorífico La Pintana. Utilizando jeringa, se obtuvo asépticamente el líquido desde cada quiste de forma individual. La confirmación de fertilidad se realizó obteniendo un fragmento de la capa germinal y observándola al microscopio de luz para confirmar o descartar la presencia de protoescólices. 57 muestras de líquidos hidatídicos fueron liofilizadas, dializadas y luego reliofilizadas para finalmente ser resuspendidas en PBS más inhibidores de proteasas y separadas por SDS-PAGE en condiciones denaturantes. Resultados y Discusión: De las muestras procesadas se obtuvieron los patrones proteicos diferenciales de líquido fértil como infértil. Destacan las bandas diferenciales cercanas a 50 kDa solo en quistes infértiles, mientras que el líquido fértil presenta una banda diferencial de 37 kDa, mostrando que los líquidos hidatídicos poseen una constitución proteíca diferencial según el tipo de quiste hidatídico. Conclusión: Existe un proteoma diferencial en los líquidos hidatídicos según la fertilidad de quistes hidatídicos en bovinos infectados con E. BIOCHEMISTRY & MOLECULAR BIOLOGY 84 granulosus. Estas diferencias pueden generar nuevas líneas de diagnóstico o control para esta enfermedad. Agradecimientos: FONDECYT Nº 1130717 BYBM66 GENOTIPIFICACIÓN DE QUISTES HIDATÍDICOS DE Echinococcus granulosus DE BOVINOS DECOMISADOS EN SANTIAGO DE CHILE Felipe Corrêa(1), Caroll Stoore(2), Colette Burotto(3), Constanza Andrade(4), Pamina Horlacher(5), Edgar Jiménez(6), Christian Hidalgo(7), Henrique Ferreira(8), Guilherme Barros(9), Rodolfo Paredes(10) (1)(2)(3)(4)(5)(6)(7)(10) Escuela de Medicina Veterinaria, Facultad de Ecología y Recursos Naturales, Universidad Andrés Bello, Santiago, Chile. (8)(9)Laboratório de Genômica Estrutural e Funcional, Centro de Biotecnologia, UFRGS, Porto Alegre, RS, Brasil. E-mail: christian.hidalgo@unab.cl Introducción: Equinococus granulosus es un parásito del tipo cestodo que afecta cánidos (hospederos definitivo), y cuyo estado larval causa hidatidosis quística, que afecta seres humanos y animales ungulados (hospederos intermediarios). Hasta ahora se han descrito 10 cepas de E.granulosus (G1 a G10). El genotipo G1 es el más prevalente a nivel mundial, mientras que reportes en humanos y caninos indican que el genotipo G1 es el más prevalente en Chile. Sin embargo, no se encuentran reportes en nuestro país que determinen la cepa de este parásito con mayor presencia en quistes hidatídicos de bovinos. Objetivo: Genotipificar muestras de quistes hidatídicos presentes en bovinos faenados en Santiago de Chile. Material y Métodos: Se obtuvo un total de 338 quistes hidatídicos de pulmón e hígado a desde 274 bovinos de diferentes edades y sexo decomisados en Santiago. A partir de suaves raspados de la cara interna de los quistes se obtuvo capa germinal y se realizó extracción de ADN. A través de PCR anidado, se amplificó el gen COX1 en cada una de las muestras, específico para todos los genotipos de E.granulosus. Posteriormente, las muestras positivas a PCR fueron genotipificadas a través de la enzima de restricción endonucleasa ALU-1, específica para G1. Resultados y Discusión: El análisis determinó que dentro del total de muestras genotipificadas, el 98% de las muestras corresponde al genotipo G1, mientras que el 2% corresponde a quistes hidatídicos de otras cepas. Conclusiones: En este estudio preliminar se determinó que el genotipo G1 de E.granulosus es el más prevalente en bovinos decomisados en Santiago. Agradecimientos: FONDECYT Nº 1130717 BYBM67 EVALUACIÓN DE RESPUESTA INMUNE HUMORAL EN CAPA ADVENTICIA DE QUISTES HIDATÍDICOS EN BOVINOS Edgar Jiménez, Christian Hidalgo, Pamina Horlacher, Constanza Andrade, Caroll Stoore, Colette Burotto, Iván Contreras, Felipe Corrêa, Rodolfo Paredes Escuela de Medicina Veterinaria, Facultad de Ecología y Recursos Naturales, Universidad Andrés Bello, Santiago, Chile. E-mail: christian.hidalgo@unab.cl BIOCHEMISTRY & MOLECULAR BIOLOGY 85 Introducción: La hidatidosis en humanos ha demostrado que los anticuerpos IgG4 (relacionados con respuestas tipo Th2) se correlacionan con la enfermedad activa, mientras que los anticuerpos IgG1 (relacionados con Th1) se correlacionan con la enfermedad inactiva, lo que podría indicar que este parásito podría modular la respuesta inmune humoral del hospedero Objetivo: Evaluar la respuesta inmune humoral en la capa adventicia de quistes hidatídicos bovinos. Materiales y Métodos: Las muestras se obtuvieron a partir de hígados y pulmones infectados con E. granulosus de bovinos beneficiados en mataderos en Santiago, Chile. La pared del quiste hidatídico fue procesada e incluida en parafina. Cortes histológicos de 5 m desde quistes fértiles e infértiles fueron sometidos a técnica de Inmunohistoquímica contra IgG total, IgG1 e IgG2, reveladas con Liquid DAB-Plus Substrate Kit. Resultados y Discusión: La Inmunolocalización de IgG bovina y su isotipo IgG2 es más marcada y localizada en las zonas adyacentes a la capa laminar de los quistes fértiles, mientras que en quistes infértiles; IgG e IgG1 se distribuyen en toda la región inflamatoria que rodea al quiste hidatídico. Se aprecia que el subtipo IgG1 posee una mayor localización sólo en capas germinales de quistes infértiles. Conclusión: nuestros resultados corroboran que existe una respuesta inmune humoral diferencial según el tipo de quiste que presenta el animal infectado. El predominio del subtipo IgG1 en quistes infértiles se asocia con una respuesta de tipo Th1 semejante a lo reportado en humanos. Agradecimientos: FONDECYT Nº 1130717 BYBM68 CORTES HISTOLÓGICOS MEDIANTE LA TÉCNICA DE CRIOSTATO DE QUISTES FÉRTILES E INFÉRTILES DE Echinococcus granulosus Lorraine Santander, Constanza Andrade, Colette Burotto, Pamina Horlacher, Caroll Stoore, Christian Hidalgo, Rodolfo Paredes Escuela de Medicina Veterinaria, Facultad de Ecología y Recursos Naturales, Universidad Andrés Bello, Santiago, Chile. E-mail: christian.hidalgo@unab.cl Introducción: La hidatidosis o equinococosis quística es una enfermedad zoonótica causada por el metacestodo de Echinococcus granulosus. Existen quistes hidatídicos de tipo fértil que presentan protoescólices y quistes de tipo infértil en los que no hay desarrollo de protoescólices. Las causas de fertilidad e infertilidad de quistes no están dilucidadas. El quiste hidatídico está formado por tres capas: germinal, laminar y adventicia. El procesamiento histológico del quiste hidatídico permitirá hacer el estudio de diferentes marcadores y ver su distribución y localización en estas 3 capas. Objetivo: Realizar cortes histológicos mediante el uso de criostato en que se conserven intactas las 3 capas del metacestodo. Material y Métodos: Quistes hidatídicos se obtuvieron desde pulmón e hígado de bovinos faenados en el Frigorífico La Pintana, Santiago de Chile. De forma aséptica, se obtuvo una muestra de la pared de quiste, se embebió en OCT y se congeló a -40ºC utilizando un peltier. Inmediatamente, se obtuvieron cortes de 10 m de espesor, los que se tiñieron con hematoxilina-eosina y fotografiaron en un microscopio Olympus FSX100. Resultados y Discusión: Se realizaron cortes desde quistes hidatídicos fértiles e infértiles. En los quistes fértiles, la capa adventicia se desprendió en gran parte de las muestras, quedando las capas germinal y laminar juntas, obteniendo pocos campos en que se apreciaran las 3 capas en su conjunto. En el caso de los quistes BIOCHEMISTRY & MOLECULAR BIOLOGY 86 infértiles se observa en gran parte de los cortes un desprendimiento de la capa germinal, manteniéndose la laminar junto con la adventicia, resultados muy semejantes a los observados con procesamiento corriente en parafina. Estos resultados permitirán elaborar estudios de presencia de citoquinas y proteínas del hospedero, o de productos de excreción secreción del parásito que podrían tener actividad diferencial entre quistes fértiles e infértiles. Agradecimientos: FONDECYT Nº 1130717 BYBM69 MOLECULAR CHARACTERIZATION OF NATURAL POPULATIONS OF Trypanosoma cruzi IN CHAGAS DISEASE PATIENTS ENROLLED IN THE E1224 CLINICAL TRIAL Juan C Ramirez(1), Gonzalo R Acevedo(2), Rudy Parrado(3), Sandro Villarroel(4), Anabel de la Barra(5), Lineth Garcia(6), Joaquim Gascon(7), Faustino Torrico(8), Isabela Ribeiro(9), Alejandro G. Schijman(10) (1)(2)(10) LaBMECh, INGEBI-CONICET, Buenos Aires, Argentina. (3)(4)(5)(6)(8)IIBISMED, Universidad Mayor de San Simón, Cochabamba, Bolivia. (7)Barcelona Centre for International Health Research (CRESIB), Barcelona, Spain. (9)Drug for Neglected Diseases Initiative (DNDi), Geneva, Switzerland. E-mail: juankrg@yahoo.es Natural populations of T. cruzi are composed of multiple clones from six discrete typing units (DTUs). The role that this diversity plays in drug response remains unknown. We aimed to analyze the genetic polymorphism of parasite populations in Chagas disease patients enrolled in the E1224 (a pro-drug of ravuconazole) clinical trial conducted in Bolivia by DNDi. Besides E1224 treatment groups (high, single and low dose), benznidazole and placebo branches were included. Positive DNA samples from baseline and follow-up were used as template for PCR targeted to T. cruzi satellite DNA (SatDNA) and the variable regions of kinetoplastid DNA (vkDNA). SatDNA PCR products were purified, sequenced and aligned using ClustalX. RFLP-PCR profiles were obtained after digestion of purified vkDNA amplicons with 1U of HinfI/MspI/RsaI restriction enzymes, 10% PAGE and Sybr Gold staining. Genetic distances among baseline and follow-up signatures for each patient were estimated using the Jaccard's coefficient. At baseline, 31% of samples showed SatDNA type II sequences (present in DTUs II/III) and 69% type I/II (present in DTUs V/VI); whereas after treatment, 12.8% of samples showed SatDNA type II and 87.2% type I/II sequences. SatDNA type I sequences (present in DTUs I/IV) were not found. The mean of Jaccard's distances for placebo and the three E1224 branches were around 0.45, whereas it was 0.82 for the single refractory case treated with benznidazole. Our findings indicate that the variability in the genetic composition of T. cruzi bloodstream populations during follow-up reflects the natural fluctuation of multiclonal parasite populations during the chronic phase of Chagas disease. It is tempting to speculate that the high genetic distance found in the refractory case to benznidazole could be due to drug selective pressure and/or to natural resistance of the post-treatment population. Further analysis are currently ongoing in other clinical trials to deepen insight on this matter. BIOCHEMISTRY & MOLECULAR BIOLOGY 87 BYBM70 ESTUDIO DE PREVALENCIA DE ADN DE Trypanosoma cruzi EN RESIDENTES DE AREAS CON RIESGO VECTORIAL Y SIN RIESGO VECTORIAL Analia P Toledano(1), Rodrigo Rey (2), Maria L Gallo Vaulet (3), Mauro Fernández Toscano , Mariana Mestre(5), Aida J Tomeo(6), Laura D Albornoz(7), Alejandro Tapia (8), Norma Plebani(9), Alejandra Vellicce(10), Marcelo Rodríguez Fermepín (11), Jorge A Rey(12) (1)(4)(6)(10)(12) Departamento Hemoterapia e Inmunohematología. Hospital de Clínicas. Universidad de Buenos Aires.. (2)(3)(5)(11)Cátedra de Microbiología Clínica. Departamento de Bioquímica Clínica. Facultad de Farmacia y Bioquímica. Universidad de Buenos Aires.. (7) Hospital rural Misión Nueva Pompeya. Castelli Chaco.. (8)(9)Hospital rural Misión Nueva Pompeya. Castelli, Chaco.. E-mail: anat_21@hotmail.com (4) Introducción: La Tripanosomiasis Americana, es una enfermedad endémica en nuestro país. El riesgo de transmisión vectorial es alto o ausente según las áreas geográficas Objetivos: Estudiar marcadores moleculares para Tripanosoma cruzi (TC) en poblaciones con diferente riesgo de trasmisión vectorial y serología reactiva para la enfermedad. Materiales y Métodos: Se estudiaron 79 (de 10941) donantes de sangre (DS) residentes en área sin riesgo, y 22 individuos residentes (IR) en área con riesgo, todos con al menos un resultado reactivo de serología. La detección de anticuerpos anti TC se realizó con 3 ensayos comerciales: ELISA recombinante, ELISA lisado y Hemaglutinación Indirecta. Se usaron 2 técnicas de biología molecular (BM). Técnica 1: PCR en tiempo real (blanco ADN satélite) (PCRs) y Técnica 2: PCR convencional (blanco ADN Kinetoplasto) (PCRk). Test estadístico: Test exacto de Fisher. Resultados: Se lograron sensibilidades analíticas de 0.1 parásitos/ml y 0.1 fg/ul de ADN parasitario. El ADN del parásito se detectó en el 12,65% (10/79) de los DS y en el 36.6% (8/22) de IR (p=0,031), OR: 3.94(1.32-11.76), siendo en ambos grupos mayor entre los que presentaban 2 técnicas serológicas positivas (DS: 9/62, 14,51%. IR:8/20, 40%) que entre los que tenían una sola (DS: 1/17, 5.88%. IR: 0/2). Entre los DS una muestra dio solo PCRs + y 9 fueron + por ambas técnicas; entre los IR 1 muestra dio PCRs +, 2 dieron PCRk + y 5 fueron + por ambas. Conclusiones: La prevalencia de ADN de T. cruzi fue estadísticamente mayor en residentes del área con riesgo de transmisión vectorial y podría deberse a la posibilidad de reinfección a diferencia de los que migraron a otras áreas sin vector. Las discordancias encontradas entre las dos técnicas de BM justificarían la necesidad de implementar más de un blanco molecular en la detección. BYBM71 MONOALLELIC DELETION OF HMGR GENE IN Trypanosoma cruzi ASSOCIATES WITH DEFECTS IN EPIMASTIGOTE GROWTH AND DIFFERENTIATION Fernando Sánchez-Valdéz(1), Cecilia Perez Brandan(2), Paula Faral-Tello(3), Carlos Robello(4), Miguel Angel Basombrío(5) (1)(2)(5) Instituto de Patología Experimental-CONICET. (3)(4)Instituto Pasteur de Montevideo, Montevideo, Uruguay. E-mail: fersanchez80@hotmail.com BIOCHEMISTRY & MOLECULAR BIOLOGY 88 For more than 40 years, Chagas disease treatment was based on the use of relatively toxic drugs that produce serious side effects and have restricted indications in adult patients and pregnant women. Currently, one of the promissing target for the development of novel anti-T. cruzi drugs is the ergosterol byoshyntesis pathway. Ergosterol is a central component of the parasite plasma membrane, essential for parasite viability and proliferation during its entire life cycle. 3-hydroxy-3-methylglutaryl coenzyme a reductase A (HMGR) is a single copy gene that encodes a mitochondrial key enzyme of the ergosterol pathway. This enzyme is specifically inhibited by mevinolin, a potent statin widely used in humans as a hypocholesterolemic agent. The present work aims to delete HMGR gene in the Tulahuén T. cruzi strain generating mutant clones with reduced HMGR expression and highly sensitivity to mevinolin. The mevinolin hyper-susceptibility constitutes an interesting approach to control the possible persistence of genetically-attenuated parasites to be used as experimental vaccines in murine models. Using the Gateway cloning technology, we generated vectors carrying the neomycin or hygromicin phosphotransferase gene flanked by HMGR 5´ and 3´ UTRs. The recombination fragment was PCR-amplified from the vector and transfected into Tulahuén epimastigotes. G418 resistant parasites could be selected after transfection. PCR and Southern blot analysis of a cloned recombinant population confirmed the deletion of one allele of the HMGR gene. No double knock-out parasites could be obtained after several transfections. Furthermore, we generate HMGR overexpressing parasites by transfecting the pTrex-HMGR plasmid to Tulahuén parasites. Mutant epimastigotes presented a significant decrease in growth and differentiation rate in axenic culture media. We are characterizing at present the sensitivity to mevinolin and the infectivity and immunoprotective behavior of mutants in murine models. BYBM72 DESARROLLO DE UN SISTEMA DE EXPRESIÓN EN ESPORAS DE Bacillus subtilis DE ANTÍGENOS DE Leishmania CANDIDATOS PARA INMUNOPROFILAXIS DE LEISHMANIASIS Leonardo Acuña(1), Fernando Sánchez-Valdez(2), Ramiro Ortiz Moyano(3), Miguel Ángel Basombrío(4), Yoshihisa Hashiguchi(5), Diego Marco(6), Augusto Bellomio(7) (1)(3)(7) Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET-UNT, e Instituto de Química Biológica “Dr. Bernabé Bloj”, Facultad de Bioquímica, Química y Farmacia, UNT. San Miguel de Tucumán, Argentina.. (2)(4)(6)Instituto de Patología Experimental, Facultad de Ciencias de la Salud, Universidad Nacional de Salta, Argentina. (5) Departament of Parasitology, Kochi Medical School, Kochi University, Nankoku, Japan.. E-mail: fersanchez80@hotmail.com La leishmaniasis tegumentaria Americana (LTA), es una enfermedad endémica en Argentina para la cual no existen vacunas de aplicación en humanos. Las esporas bacterianas, como modelo de exposición de proteínas, podrían ser una alternativa válida para la formulación de vacunas. Con el objetivo de obtener un sistema de exposición de antígenos en la superficie de las esporas de Bacillus subtilis, se realizó una fusión transcripcional entre CotB (una proteína de la capa externa de la espora de B. subtilis) y LbAg3, una proteína inmunogénica de Leishmania (V.) braziliensis, agente causal de LTA. El gen estructural de CotB se amplificó por PCR a partir de B. subtilis 168 y posteriormente se reamplificó utilizando cebadores específicos que incorporan una pequeña región de clonado múltiple hacia el extremo 3’. El amplicón se clonó en el BIOCHEMISTRY & MOLECULAR BIOLOGY 89 plásmido pRSETa. La región del gen que codifica para LbAg3 se amplificó a partir de una cepa de L. (V.) braziliensis MHOM/AR/03/OLO1 y posteriormente se reamplificó, adicionando hacia el extremo 3’ un sitio de restricción XmaI, una secuencia que codifica para seis residuos de histidina y un sitio de restricción BamHI. Este amplicón se clonó a continuación de cotB. La fusión génica obtenida cotB-polylinker-lbAg3-6His se digirió con las enzimas HindIII y BamHI y se clonó en el vector de integración pDG364 obteniendo el plásmido denominado pSPOK. La expresión eficaz de la proteína heteróloga en la superficie de la espora y su estabilidad están en proceso de evaluación. La seguridad, estabilidad a temperatura ambiente y fácil manipulación de las esporas de B. subtilis, hace a este sistema de expresión particularmente útil para la expresión en la superficie de moléculas bioactivas como antígenos recombinantes capaces de disparar una respuesta inmune protectiva. DIAGNOSIS & TREATMENT 90 DYT01 EVALUATION OF LEISHMANICIDAL CYCLOPALLADATED COMPLEX AND TRIPANOCIDAL ACTIVITY OF Angela M Arenas Velásquez(1), Rodrigo Alves de Souza(2), Aline Ribeiro(3), Fabio A Esteves Torres(4), João Aristeu da Rosa(5,) Antonio E Mauro(6), Pio Colepicolo Neto(7), Marcia A S Graminha(8) (1)(3)(4)(5)(8) Faculdade de Ciencias Farmaceuticas, UNESP-Araraquara, Brasil. (2)(6)Instituto de Química, UNESP-Araraquara, Brasil. (7)Instituto de Química, USP-São Paulo, Brasil. E-mail: avellangel@gmail.com Leishmaniasis and Trypanosomiasis are several diseases in vertebrates caused by parasitic protozoan. These diseases are part of tropical infectious diseases (NTD) which have been neglected by governments and pharmaceutical industries. According to the World Health Organization, WHO, an estimated 310 million people are at risk of leishmaniasis in all continents, 7 to 8 million people are infected worldwide with Chagas’ disease and 70 million people are at risk of HAT(Human African Trypanosomiasis). The conventional drugs employed to treat these diseases are antiquated, high toxicity, produced several side effects and parasites have developed resistance against them.Therefore is urgent to develop new drugs to treatment. Recently was suggested that one cyclopalladated complex showed a high selectivity index with trypanocidal activity in the treatment of Chagas’ disease. Based on the potential activity of cyclopalladated, in this work we have evaluated in vitro leishmanicidal and trypanocidal activity of [Pd(dmba)(μCl)]2 and [Pd(dmba)(μ-NCO)]2 against L. amazonensis promastigote and amastigote forms, T. cruzi epimastigote and amastigote forms and T. brucei procyclic form. We show that cyclopalladated complex exhibit potential leishmanicidal and trypanocidal activity in all forms of strains. [Pd(dmba)(μ-NCO)]2 is the most active compound in all parasites and also exhibited a low toxicity in macrophages. The Safety Index values for this complex in L. amazonensis and T. cruzi amastigote forms are 14.47 and 28.42, respectively. Thereby, this compound could be a good candidate for drug. DYT02 PRIMER CASO IDENTIFICADO DE ENFERMEDAD RESPIRATORIA CAUSADA POR Lophomona spp. EN ESQUEL, PROVINCIA DE CHUBUT – PATAGONIA ARGENTINA Andrei Ambrossenkov, Patricia Benvenuto y Elena Sanero Clínica modelo esquel. E-mail: ambrossenkov@yahoo.com La Lophomona spp. es un protozoo multiflajelado, endocomensal en el intestino grueso de artrópodos/insectos como la cucaracha o termitas; también se las ha descripto en las heces de ciertas aves como las Avutardas (3). Es capaz de producir enfermedad respiratoria broncopulmonar en los seres humanos, en el contexto de compromiso inmune, en la mayoría de los casos se presentó posterior o concomiante a Enfermedad Respiratoria y una mínima proporción se reportó en el contexto de compromiso de la función inmune (HIV, transplantados y enfermedades sistémicas). Es nuestro objetivo sumar la descripción del caso clínico que tratamos de Enfermedad Respiratoria por DIAGNOSIS & TREATMENT 91 Lophomona spp. (en la Unidad de Terapia Intensiva de la Clínica Modelo de la ciudad de Esquel, provincia de Chubut – Patagonia Argentina) a la información brindada por los trabajos donde se revisó la literatura sobre Lophomona spp. en el contexto de enfermedad respiratoria. En estos trabajos se describieron un total de 61 casos la mayoría en China y casi todos en adultos (la mayor literatura disponible es de origen chino), luego se reportaron casos en Perú en mucha menor proporción y la mayoría de los casos fueron pediátricos y por último en España con 2 casos en adultos. La detección del parásito se realizo a partir de una muestra de lavado bronquioalveolar y visualización microscópica. Se ajustó el tratamiento agregando el antiprotozoario Metronidazol evidenciando mejoramiento de su cuadro clínico La presentación clínica fue inespecífica, incluyendo síntomas respiratorios, fiebre y tos. El 70 % de estos casos se presentaron en individuos de sexo masculino. DYT03 CRUZIPAIN INHIBITION ANTAGONIST BY MONTELUKAST, A LEUKOTRIENE RECEPTOR Carolina Bellera(1), Maria Laura Sbaraglini(2), Darío Balcazar(3), Laura Fraccaroli(4), Alan Talevi(5), Carolina Carrillo(6) (1)(2)(5) Cátedra de Química Medicinal-Departamento de Ciencias Biológicas-Facultad de Ciencias Exactas-UNLP. (3)(4)(6)Instituto de Ciencia y Tecnología Dr. César Milstein (ICT Milstein-CONICET). E-mail: cbellera@biol.unlp.edu.ar Cruzipain (Cz) is the major cystein protease of the hemoflagelate parasite Trypanosoma cruzi, etiologic agent of Chagas disease. This enzyme has been validated as drug target for novel antichagasic agents, being essential for T. cruzi amastigotes and playing a role in host-parasite interactions. In the present work, we have applied previously reported computational models to develop a ligand-based virtual screening campaign on two chemical repositories: DrugBank and Merck Index databases. The objective of this work is the discovery of novel antichagasic therapies in order to overcome the limitations of currently approved therapies, i.e. safety issues and low efficacy in the chronic stage of the disease. replace current unsatisfactory therapies. Four of the identified drugs, namely: the leukotriene blocker montelukast, the antinociceptive and anti-inflammatory agent atranorin, the synthetic pyrethroid fluvalinate and the calcium blocker methoxyverapamil, were acquired and tested on Cz activity and epimastigotes proliferative assays. Testing the four compounds at a concentration of 100 microM on purified Cz activity it was shown that only montelukast and atranorin had and inhibitory effect; however, only the first one maintained an inhibitory effect in lower concentrations showing a median inhibitory concentration (IC50) of 42.5±6.4 uM. Cultures of T. cruzi epimastigotes in the presence of montelukast showed inhibitory effects on proliferation, affecting the maximal cell density (treated: 29.6±2.8 million parasites/ml vs control: 59.0±9.2 million parasites/ml). This compound showed a median lethal dose (LD50) of 71.0±9.8 uM. Finding an a priori unpredictable inhibitory compound applying in silico screening confirms the utility of our models to identify, through a repurposing strategy, new trypanocidal therapeutics. DIAGNOSIS & TREATMENT 92 DYT04 TRATAMIENTO DE LA INFECCIÓN POR Trypanosoma cruzi EN FASE CRÓNICA EN UN MODELO MURINO: EFECTIVIDAD DE HIDROXIMETILNITROFURAZONA Carolina Davies(1), Ramiro Hugo Poma(2), María Celia Mora(3), Federico Ramos(4), Verónica Rajal(5), Miguel Ángel Basombrío(6) (1)(3)(4)(6) IPE-UNSa-CONICET. (2)(5)Laboratorio de Aguas y Suelo - Instituto de Investigaciones para la Industria Química (INIQUI, CONICET-UNSa) y Facultad de Ingeniería, Universidad Nacional de Salta. E-mail: carolina.davies@exa.unsa.edu.ar La infección por Trypanosoma cruzi, causante de la enfermedad de Chagas, se trata con Benznidazol (BZL), que presenta efectos adversos en adultos y no es efectivo en todas las poblaciones del parásito, necesitándose nuevas alternativas. Investigaciones en modelos murinos demostraron que el tratamiento con hidroximetilnitrofurazona (NFOH) es efectivo durante la fase aguda de la infección. En ese marco, el objetivo de este trabajo fue determinar la eficacia del tratamiento con NFOH en comparación con BZL durante la fase crónica de la infección por T. cruzi. Se inocularon 50 ratones hembra Swiss (30 días, 50 parásitos T. cruzi cepa Tulahuén) y se determinó el título de anticuerpos contra proteínas solubles totales de T. cruzi por ELISA a los 90 días post-infección. Los ratones con serología positiva (N=28) fueron agrupados en 4 lotes a los que se les administró v.o. diariamente durante 6 días/semana (60 dosis): BZL, (N=8; 150 mg/Kg/día), NFOH (N=9; 150 mg/Kg/día), BZL 30 mg + NFOH 60 mg/Kg/día (N=5), placebo (N=6; 9 % NaCl – 5 % Tween 80). A los 41 días post-tratamiento (dpt) se tomaron muestras para serología, y a los 180 dpt los ratones fueron sacrificados para tomar muestras de suero y músculo esquelético, tejido donde se determinó carga parasitaria por qPCR. Los niveles de anticuerpos anti-T. cruzi no mostraron diferencias significativas a los 6 meses pt. La carga parasitaria fue indetectable por qPCR en el grupo tratado con NFOH (0% positivos), seguida por BZL (50%), BZL+NFOH (60%) y placebo (71%). Estos resultados indican que NFOH es similar a BZL durante un tratamiento en fase crónica, como en tratamientos en fase aguda. Aunque la mortalidad fue mayor en el grupo NFOH (33%), seguido por BZL (12%), BZL+NFOH (40%) y placebo (14%), estudios previos indican que NFOH, en contraste con BZL, no induce inflamación ni fibrosis hepática en modelos murinos de tratamiento sin infección, por lo que NFOH podría ser una alternativa al tratamiento de la infección por T. cruzi. DYT05 IDENTIFICATION OF ANTICHAGASIC ACTIVITY OF CLOFAZIMINE, BENIDIPINE AND SAQUINAVIR THROUGH COMPUTER-AIDED DRUG REPURPOSING Carolina L Bellera(1), Darío E Balcazar(2), María C Vanrell(3), Florencia Casassa(4), Carlos A Labriola(5), Jorge Gálvez(6), Luis E Bruno-Blanch(7), Patricia Romano(8), Carolina Carrillo(9), Alan Talevi(10) (1)(7)(10) Cátedra de Química Medinal,Departamento de Ciencias Biológicas, Facultad de Ciencias Exactas, Universidad Nacional de La Plata, Buenos Aires, Argentina. (2)(9)Instituto de Ciencia y Tecnología Dr. César Milstein (ICT Milstein-CONICET). (3)(4)(8)Instituto de Histología y Embriología (IHEM-CONICET), Facultad de Medicina, Universidad Nacional DIAGNOSIS & TREATMENT 93 de Cuyo (UNCUYO), Mendoza, Argentina.. (5)Instituto de Investigaciones Bioquímicas de Buenos Aires (CONICET), Argentina. (6)Unidad de Diseño de Fármacos y Topología Molecular, Universidad de Valencia, España. E-mail: cbellera@biol.unlp.edu.ar Cruzipain (Cz) is the main cystein protease of Trypanosoma cruzi and has previously been validated as new drug target, proving to be essential for replication of the intracellular form of T. cruzi and playing a role in host-parasite interactions. We present an integrative approach for the search of novel antichagasic agents, including virtual screening (VS) of Cz inhibitors oriented to knowledge-based drug repositioning, and subsequent biochemical, cellular and pre-clinical testing. A computational classificatory model capable of discriminating between Cz inhibitors and non-inhibitors was obtained using DESMOL11software (Molecular Topology & Drug Design Unit. University of Valencia, Spain) and Statistica 10 (statsoft 2010). Such model was validated and applied in the VS of Merck Index 12th. 154 compounds were selected as promising candidates, 34 of them correspond to approved drugs, which are the most favorable, direct candidates for repositioning purposes, four of which were tested in enzymatic assays and epimastigote cultures. Three of them (clofazimine, benidipine and saquinavir) showed clear inhibitory effects on Cz and antiproliferative effects on T. cruzi.) Based on pharmacological criteria, clofazimine and benidipine were moved to preclinical stage, where they were effective in a mice model of acute infection. Clofazimine also reduced the allocation of T. cruzi nests in cardiac tissue, suggesting it could be useful to prevent the development of cardiac damage in Chagas disease. The present work successfully integrates computer-aided drug discovery with molecular and cellular biology and preclinical testing, confirming the utility of VS to develop knowledge-based drug repurposing. DYT06 IN VIVO ACTIVITY OF ALBENDAZOLE IN COMBINATION WITH THYMOL AGAINST Echinococcus multilocularis LARVAL STAGE Clara M Albani 1,2, Patricia E Pensel 1,2, María C Elissondo 1,2 1 Laboratorio de Zoonosis Parasitarias, Dpto de Biología, FCEyN, Universidad Nacional de Mar del Plata. 2 CONICET. . E-mail: albaniclara@gmail.com Human alveolar echinococcosis (AE) is caused by the fox tapeworm Echinococcus multilocularis and is usually lethal if left untreated. Infection of intermediate host (rodents and accidentally humans) is initiated by oral uptake of infectious eggs, which upon hatching in the host intestine, penetrates the intestinal epithelium and access to the host organs where undergoes towards the metacestode stage. The current strategies for treating human AE are surgical resection of the parasite mass complemented by chemotherapy with benzimidazoles. Although these drugs inhibit parasite proliferation, they do not cure the disease. Several investigations using in vivo rodent models have been carried out looking for alternative treatment for AE. However, none of the compounds investigated has been translated into clinical application. Recently encouraging findings have been reported using combined drugs albendazole (ABZ)/thymol in vitro. The aim of the current work was to investigate the efficacy of the combination ABZ/thymol on mice DIAGNOSIS & TREATMENT 94 infected with E. multilocularis metacestodes. Hydatid cysts developed in all the infected animals involved in the efficacy studies. The application of ABZ and thymol separately or combinated resulted in a statistically significant reduction on the cysts weight (ABZ/thymol group: 1.5±1.4g; ABZ suspension group: 4.69±1.48g; thymol group 3.72±1.25g) compared to those obtained for unmedicated mice (9.07±2.46). Moreover, differences were found on protoscoleces viability recovered from metacestodes. These differences were also verified after SEM analysis of the cysts and protoscoleces from all conditions. In conclusion, the therapeutic efficacy of ABZ/thymol was superior to ABZ suspension or thymol. The work reported here demonstrates that in vivo treatment with ABZ/thymol impairs the development of the AE and we propose that it could be a suitable alternative for treating AE in humans. DYT07 ACTIVIDAD SOBRE Trypanosoma cruzi DE DERIVADOS SINTÉTICOS DE 2FENILQUINOLINAS Fernanda M. Frank(1), Silvia E Asis(2), Fernanda M Frank(3) (1)(3) IMPaM (UBA-CONICET). (2)Química Orgánica II, FFyB- UBA. E-mail: ferfrank@ffyb.uba.ar Las drogas empleadas actualmente para la enfermedad de chagas son escasas, con lo cual existe una necesidad urgente de encontrar como alternativa terapéutica nuevas moléculas que sean de fácil obtención, económicas y efectiva. Alcaloides con núcleo quinolínico aislados de diversos productos naturales se destacaron por ser activos frente a T. cruzi. El objetivo de este trabajo es evaluar en una primera etapa, la actividad sobre el estadio de epimastigote y determinar la citotoxicidad de 11 derivados sintéticos nitrogenados. Estos derivados poseen en posición 6 un átomo de cloro ó un grupo nitro, mientras que en la posición 2 poseen un anillo fenilo sustituído con diversos sustituyentes o bien un resto indolilo. Un total de 11 compuestos se ensayaron forma epimastigote. Pudo observarse que los compuestos cuyo resto fenilo de la posición 2 está sustituido con grupos dadores de electrones tales como el grupo hidroxilo (OH) ó metoxi (OCH3) han demostrado mayor actividad (CI50 0.49 y 0.40 µg/mL, respectivamente) frente al compuesto que posee el resto fenilo sin sustituir (CI50 1.95 µg/mL). Cabe destacar que estos compuestos poseen un átomo de cloro en la posición 6. Por otro lado dos compuestos que poseen en la posición 6 un grupo nitro se destacaron por sus valores de actividad. Sin embargo en este caso el compuesto de mayor actividad resultó ser aquel cuyo resto fenilo de la posición 2 no está sustituído (CI50 1.30 µg/mL), con respecto a su análogo quien está sustituído con un grupo atractor de electrones (Br, CI50 6.85 µg/mL). Además se determinó la citotoxicidad de esta familia de compuestos sobre la línea celular HTP-1, obteniéndose valores de CC50 que demuestran que aquellos compuestos que poseen buenos valores de actividad no son citotóxicos. Debido a los valores de actividad obtenidos y a su baja citotoxicidad, estos compuestos fueron seleccionados y actualmente están siendo evaluados en una segunda etapa frente a las formas de tripomastigote y amastigote. DIAGNOSIS & TREATMENT 95 DYT08 COMPUTER-AIDED ANALOGS SEARCH OF NEW ANTITRYPANOSOMAL POLYAMINE Lucas N Alberca(1), Carolina Carrillo(2), Alan Talevi(3) (1)(3) Cátedra de Química Medicinal. (2)ICT Milstein. E-mail: lucas_abk@hotmail.com Chagas is a Latin-American endemic disease caused by Trypanosoma cruzi. In-spite-of its sanitary importance, there are still only two approved drugs for the treatment of Chagas: nifurtimox and benznidazole. Both present serious adverse effects and limited efficacy. Thus, there is a real sanitary need of new therapeutic alternatives. Recently, the role of computer-aided drug repositioning (i.e. searching for novel indications of already known, discontinued and/or shelved drugs) has been underlined as an efficient strategy to discover innovative medications for Chagas disease and other disorders traditionally labeled as “neglected diseases”. Here, we have applied computer-aided drug repositioning to search for new antichagasic polyamine analogs. Polyamines are typically found in high levels in fast proliferating cells such as cancerous cells and parasites. They mediate a number of essential functions for growth, proliferation and differentiation. Interestingly, T. cruzi lacks the enzyme responsible of the first step of the polyamines biosynthesis, thus being dependent on the uptake of polyamines. A database containing polyamine analogs with and without inhibitory effect on T. cruzi proliferation was compiled from literature. Afterwards, 100 computational models capable of discriminating between active and inactive polyamine analogs were inferred through application of Linear Discriminant Analysis as implemented in Statistica 10 software. After validating the models, the ten best models were combined through ensemble learning and applied in the virtual screening of the chemical repositories DrugBank 3.0 and Sweetlead, which compile approved and experimental drugs from the FDA and from other regulatory agencies worldwide, respectively. 31 new drug candidates were selected. On the basis of their structures, original therapeutic uses and safety, doses, costs and accessibility, a selection of these candidates will be tested on in vitro and in vivo cellular assays. DYT09 SUSCEPTIBILIDAD A DROGAS TRIPANOCIDAS DE UN AISLAMIENTO DE Trypanosoma cruzi OBTENIDO DE UN PACIENTE CON INFECCION CRONICA EN UN MODELO MURINO Luz P Quebrada Palacio, Mariela N González, Gabriela C. Olivera, Miriam Postan Instituto Nacional de Parasitología "Dr. Mario Fatala Chaben". E-mail: lupi90@gmail.com Se sospecha que el uso continuo de Benznidazol y el Nifurtimox aumentará la resistencia de T. cruzi, indicando la urgencia de desarrollar nuevas herramientas terapéuticas para la infección por este parásito. En este trabajo se evaluó la susceptibilidad in vivo del aislamiento de T. cruzi AR-SE23C, obtenido de un paciente con enfermedad de Chagas crónica de Argentina. Se inocularon ratones hembras C3H/He de 4 semanas de edad con 100 tripomastigotes AR-SE23C por via ip y se trataron con 30 ó 40 dosis de BZ o NX (100 DIAGNOSIS & TREATMENT 96 mg/Kg/d) o 20 dosis de Pentamidina (PENT; 4 mg/Kg/d) a partir de la detección de parasitemia. Los animales que sobrevivieron la etapa aguda de la infección se sacrificaron 70 dpi para histopatología. La prueba de Log-rank mostró aumento de la tasa de sobrevida de los animales infectados tratados en comparación con los infectados no tratados (P=0,0097). El tratamiento con BZ y NX negativizó la parasitemia a partir del 2° día de tratamiento independientemente de la dosis, mientras que la PENT redujo los niveles de parasitemia respecto de los ratones infectados no tratados (P= 0,0067). El tratamiento con 40 dosis de BZ ó NX, ó 20 dosis de PENT redujo el porcentaje de animales con nidos parasitarios en corazón y/ó musculo esquelético (p<0,05). El tratamiento con 40 dosis de BZ ó NX, ó 20 dosis de PENT redujo la extensión de la miocarditis respecto de los controles (p><0,05), mientras que no se observaron cambios en los ratones tratados con 30 dosis de BZ o NX. A nivel del musculo esquelético, el tratamiento con 30 y 40 dosis de BZ y 40 dosis de NX redujo la extensión de la inflamación respecto de los controles (p><0,05), no detectándose diferencias con 30 dosis de NX ó 20 dosis de PENT. Los resultados muestran que la susceptibilidad del aislamiento AR-SE23C a las drogas tripanocidas convencionales depende de la duración del tratamiento y muestran el potencial valor terapéutico de la PENT para la infección por T. cruzi. Financiado por FONCyT, PICT-2010-2148. > DYT10 COMPUTER-AIDED SEARCH ANTICHAGASIC EFFECTS OF NOVEL RIBOFLAVINE ANALOGS WITH María Laura Sbaraglini(1), Mauricio Di Ianni (2), Laura Fraccaroli(3), Dario Balcazar(4), Carolina Carrillo(5), Alan Talevi(6) (1)(2)(4)(5)(6) Facultad de Ciencias Exactas UNLP. (3)Instituto Milstein. E-mail: mariasbara@gmail.com Chagas disease is a parasitic disease endemic in Latin America, caused by the hemoflagelate Trypanosoma cruzi. Recent data from the World Health Organization indicate that there are around 10 million infected people and 25 million exposed to contagion. We have previously reported that the riboflavine permease from T. cruzi might be a promising new drug target. In this work we have applied a combination (ensemble) of molecular similarity search techniques to search for riboflavin analogs throughout chemical repositories DrugBank 3.0 and Sweetlead. Chemaxon (JChem 6.1.0 2013 www.chemaxon.com) and PowerMV (National Institute of Statistical Science V0.61) were used to compute a diversity of fingerprints (e.g. extended connectivity fingerprints, pharmacophere fingerprints, functional class fingerprints) and similarity metrics. These metrics were thus combined to enhance their enrichment ability. 80 compounds were selected as promising candidates; 2 of them (aloin and inosine) were acquired and their antiproliferative effect was tested on T. cruzi epimastigotes, counting, daily, the number of parasites per unit of volume in Neubauer chamber. Complementarily, MTT assay was used to assess the parasite viability. The present work constitutes and example of rational drug repurposing, in which novel therapeutic indications of already known drugs are sought with the aid of cheminformatic and bioinformatic tools. DIAGNOSIS & TREATMENT 97 DYT11 Sarcoptes scabiei VARIEDAD HOMINIS, SARNA COSTROSA Y COMORBILIDADES ASOCIADAS: NUESTRA CASUÍSTICA. Marcelo Gabriel Medina INSTITUTO DE MEDICINA REGIONAL-UNNE. E-mail: drmarcelomedina@gmail.com La sarna costrosa o noruega es una variedad clínica de escabiosis humana. Su hallazgo es más frecuente en pacientes con compromiso inmunitario. Dada su alta contagiosidad, esta forma de escabiosis requiere un diagnóstico temprano y adecuado tratamiento para evitar la rápida diseminación en el medio familiar y comunitario. El objetivo es describir, 6 casos clínicos de sarna costrosa diagnosticados en el área de Medicina tropical. Materiales y métodos: Se revisaron retrospectivamente las historias clínicas de pacientes que consultaron por sarna noruega al área de dermatoinfectología,del Instituto de Medicina Regional, Universidad Nacional del Nordeste, durante los últimos 6 años. Resultados: Se presentan 6 pacientes, 3 hombres y 3 mujeres. La edad promedio fue de 47 años. En todos hallamos diferentes patologías asociadas: dermatomiositis, eccema atópico, hipotiroidismo, psoriasis, diabetes mellitus con pénfigo seborreico y síndrome de Down. Se observaron cuadros eritrodérmicos, hiperqueratosis en zonas de extensión y palmoplantar fisurada de aspecto cretáceo asociadas a prurito de intensidad variable. Todos nuestros pacientes mejoraron con ivermectina en dosis única. Conclusiones: La sarna noruega ha experimentado un aumento de su incidencia debido a las malas condiciones socioeconómicas y la falta de condiciones higiénicas de la población, lo cual es un factor determinante junto a la depresión del sistema inmunológico. La ivermectina es una alternativa válida en el tratamiento de la sarna noruega. DYT12 EL TEST DE INMUNOFLUORESCENCIA DIAGNOSTICO DE ACANTHAMOEBOSIS COMO HERRAMIENTA PARA EL Sixto R Costamagna, Norma Basabe, Viviana Randazzo, María Prat, Elena Visciarelli, Leandro Lucchi Cátedra de Parasitología Clínica. Dto. Biología, Bioquímica y Farmacia. Universidad Nacional del Sur. Bahía Blanca. E-mail: rcosta@uns.edu.ar Acanthamoeba sp., es una Ameba de Vida libre, que puede afectar al hombre y animales produciendo Encefalitis Granulomatosa, sinusitis, Acanthamoebosis Cutánea o queratitis, y requieren un rápido diagnóstico. Los objetivos de este trabajo fueron: Realizar un test de inmunofluorescencia (IF), para identificar trofozoítos o quistes en materiales biológicos y otro de inmunofluorescencia indirecta (IFI) para cuantificar Ac(s). Materiales y Métodos: cultivos de Acanthamoeba polyphaga en agar no nutritivo enriquecido con Escherichia coli, axenizados por pasajes en medio MYAS y posterior suspensión en solución fisiológica fenolada al 5%. La inmunización se realizó en conejos, con 50000 formas / ml. (quistes o trofozoítos) con adyuvante de Freund. Previo a las inoculaciones se obtuvo suero pre-inmune. Controles negativos se realizaron inoculando solución fisiológica DIAGNOSIS & TREATMENT 98 estéril. A los 45 días se obtuvo suero, determinándose su eficacia frente a improntas de quistes y trofozoítos, separadamente con anti-IgG de conejo marcada con FITC, por IFD. Los resultados, que se mostrarán en imágenes, fueron altamente satisfactorios, tanto para quistes como para trofozoítos de Acanthamoeba, mostrando importante fluorescencia en la pared de quistes, y en el citoplasma y membrana celular de trofozoítos, destacándose las vacuolas de excusión de agua como zonas oscuras sin fluorescencia. Respecto a la IFI, los títulos en suero pre-inmune de conejo fueron menores a 1:32 y en sueros inmunes mayores a 1:64. Cuando se reemplazó el suero de conejo por suero humano de personas sanas, los títulos fueron de 1:16 o menores. Conclusión: los animales inmunizados mostraron valores indicativos de enfermedad activa a partir de títulos de IFI 1:64 y basales de 1:32; en humanos valores basales menores a 1:16. Los resultados en IF para quistes y trofozoítos fueron altamente satisfactorios. Actualmente estamos marcando los Ac(s) obtenidos, con FICT, para disponer de un kit de IFD para diagnóstico sobre tejidos. DYT13 EVALUACION IN VITRO DEL EFECTO DE Lactobacillus casei SOBRE ADULTOS DE Trichinella spiralis Sixto R Costamagna, Viviana Randazzo Cátedra de Parasitología Clínica. Dto. Biología, Bioquímica y Farmacia. Universidad Nacional del Sur. Bahía Blanca. E-mail: rcosta@uns.edu.ar En experiencias previas demostramos el efecto antagónico e inmunomodulador de los probióticos Lactobacillus casei y Kefir de leche sobre la infestación por larvas del nematode Trichinella spiralis. El objetivo del presente estudio fue evaluar la acción directa in vitro del probiótico Lactobacillus casei ATCC 7469 sobre el estado adulto de T. spiralis cepa BBSC01. Para la experiencia se utilizaron parásitos adultos, machos y hembras, de T. spiralis viables y el probiótico L. casei ATCC 7469. Treinta parásitos adultos fueron incubados con 5 ml de suspensión de L. casei 190000000 ufc/ml, en solución fisiológica. Las incubaciones se realizaron en estufa a 37ºC durante 8 hs y fueron observadas al microscopio óptico cada hora, verificándose la viabilidad del parásito mediante la coloración de azul de metileno, descripta por los autores. Cada uno de los ensayos fue realizado por duplicado, calculándose las medias y las desviaciones estándar en cada grupo. Los resultados en la primera hora de incubación no evidenciaron cambios significativos entre grupos, respecto a la viabilidad del parásito, manteniéndose intacto su tegumento. A partir de la segunda hora de incubación con el probiótico, se observó una significativa pérdida de viabilidad de los parásitos, evidenciándose un marcado daño de la cubierta externa parasitaria, dependiente directamente del tiempo de incubación. Los resultados, cuyas imágenes se mostrarán en el póster, demostraron el efecto nematocida del L. casei, por acción directa, probablemente por metabolitos tóxicos que afectan la cutícula externa del parásito. Actualmente se está tratando de determinar el mecanismo que destruye a T. spiralis en este estudio in vitro. Este efecto, directo, se sumaría a los efectos, inmunomoduladores de los probióticos, obstaculizando la entrada de las hembras grávidas de este helminto a la mucosa intestinal. Se abre una nueva hipótesis referida a la utilidad de los probióticos como antihelmínticos. DIAGNOSIS & TREATMENT 99 DYT14 EVALUATION OF 1-INDANONE THIAZOLYLHYDRAZONE DERIVATIVES PROBABLE SQUALENE EPOXIDASE INHIBITORS OF Trypanosoma cruzi AS Vanesa R Puente(1), Guido J Noguera(2), Alcira Batlle(3), Liliana M Finkielsztein(4), Elisa Lombardo(5) (1)(3)(5) Centro de Investigaciones sobre Porfirinas y Porfirias (UBA - CONICET). (2)(4)Química Medicinal, Depto de Farmacología, Facultad de Farmacia y Bioquímica, UBA. E-mail: vanesa_puente86@yahoo.com.ar Sterol biosynthesis inhibitors are promising entities for the treatment of trypanosomal diseases. Squalene epoxidase (SE) is a key enzyme of ergosterol biosynthetic pathway and an attractive potential target for antichagasic drugs. We have developed a serie (17 compounds) of 1-indanone thiazolylhydrazone derivatives (TZHs) with relevant activity against the proliferative stages of Trypanosoma cruzi. Previous results suggest that inhibition of ergosterol biosynthesis could be a possible target for the action of these TZHs. In this work, our aim was verify that the anti T. cruzi activity of this drugs is due to the inhibition of squalene epoxidase. Using the ShaEP software, the molecular overlap among TZHs and the terbinafine (specific inhibitor of squalene epoxidase) was assayed. This program evaluates the structural similarity based on the shape and electrostatic potential of overlapping molecules. Simultaneously, the effect of THZs on squalene epoxidase activity was evaluated, using a cell-free supernatant (derived from parasites sonicated and then centrifuged at 10000 g for 15 min) as enzyme source. After incubation the extracted lipids were dissolved in chloroform and analyzed by TLC. A higher percentage of enzyme inhibition was observed for a greater structural similarity index from computer analysis. So, for TZH 8 and 9, which showed the highest percentages of inhibition (38.88 ± 1.12 and 40.17 ± 6.50 respectively), the computational analysis yielded values of about 80.3 to 75.9 % similarity in shape and 73.7 to 65.7% similarity in electrostatic potential, respectively. In conclusion, the biological and computational results showed that TZHs could be able to inhibit squalene epoxidase activity. These results prompt us to continue with the structural modifcation of these compounds to obtain better inhibitors of this enzyme. DYT15 ANTIGENIC AND FUNCTIONAL STUDIES ON TRYPOMASTIGOTE SMALL SURFACE ANTIGEN OF Trypanosoma cruzi Virginia Balouz(1), María de los Milagros Cámara(2), Gaspar E Cánepa(3), Santiago Carmona(4), Romina Volcovich(5), Jaime Altcheh(6), Fernan Agüero(7), Carlos A Buscaglia(8) (1)(2)(3)(4)(7)(8) Instituto de Investigaciones Biotecnológicas . (5)(6)Servicio de Parasitología y Enfermedad de Chagas, Hospital de Niños “Dr. Ricardo Gutierrez”. E-mail: virginiabalouz@gmail.com Trypanosoma cruzi is the etiological agent of Chagas disease. TSSA (Trypomastigote Small Surface Antigen) is a 92-aa long mucin-like glycoprotein displayed on the surface of infective trypomastigote forms that elicits strong antibody responses in T. cruzi-infected humans. In addition, TSSA functions as a parasite adhesin, engaging surface receptor(s) and inducing signaling pathways on the host cell as a prerequisite for trypomastigote DIAGNOSIS & TREATMENT 100 internalization. Here, we used synthetic peptides and recombinant deletion molecules to map the antigenic region of TSSA-CL, the TSSA isoform expressed by the CL Brener clone. We verified specific antibody reactivity for most of the central region of TSSA-CL (from residue 24 to 58), indicating a complex linear B-cell epitope repertoire. Additional studies allowed us to define a 21-aa peptide (termed E2E3) showing the same performance (in terms of sensitivity and specificity) as serodiagnostic reagent for Chagas Disease than the whole TSSA-CL molecule. Tools generated to carry out these antigenic characterizations were further used to explore the variability of anti-TSSA-CL humoral responses along the human infection and to map the adhesive motifs of TSSA-CL towards non-macrophagic cell lines. Regarding the latter issue, we show that two discrete 15-aa peptides from TSSA-CL bound to HeLa cell monolayers in a dose-dependent manner. This binding has a functional correlate, since when exogenously added these peptides were able to significantly inhibit both adhesion and internalization of CL Brener trypomastigotes. These peptides, however, did not impair adhesion/internalization of CL Brener amastigotes (which do not express TSSA) or of Sylvio X-10 trypomastigotes (which display a different TSSA isoform on their surface), further supporting the specificity of our results. Overall, our data provide novel insights into the function and diagnostic properties of TSSA. DYT16 DETECCIÓN DE TOXOPLASMOSIS AGUDA MEDIANTE INMUNOAGLUTINACIÓN Leandro E Peretti(1), Verónica DG Gonzalez(2), Juan G Costa(3), Iván S Marcipar(4), Luis M Gugliotta(5) (1)(2)(5) INTEC (UNL – CONICET), Santa Fe, Argentina.. (3)(4)Laboratorio de Tecnología Inmunológica, FBCB, UNL, Santa Fe, Argentina.. E-mail: lperetti@santafe-conicet.gov.ar Este trabajo describe la obtención de complejos látex-proteína (CLP) y su evaluación como reactivos de inmunoaglutinación para la detección de Toxoplasmosis aguda. Se emplearon partículas de látex de diferente tamaño y densidad de carga superficial (2 látex de poliestireno y 4 látex tipo “core-shell” con funcionalidad carboxilo). Las partículas de látex fueron sensibilizadas con diferentes proteínas antigénicas de Toxoplasma gondii mediante adsorción física (AF) y unión covalente (UC). Los antígenos (Ags) empleados fueron 2 proteínas recombinantes de fase aguda de T. gondii, P35Ag y P22Ag, y el homogenato del parásito. Se observó que la mayor cantidad de proteína unida se obtuvo con las proteínas recombinantes. La menor eficiencia de unión observada con el homogenato del parásito podría deberse a que se trata de una mezcla indefinida que incluye un gran número de proteínas de diferentes masas molares, puntos isoeléctricos y afinidades por la superficie de las partículas. Con el objetivo de estudiar la antigenicidad de las proteínas ligadas a las partículas, los CLP se evaluaron en ensayos de ELISA frente a sueros controles (clasificados por técnicas de referencia) negativos, agudos y crónicos. Los resultados mostraron que la antigenicidad de los Ags unidos a la superficie de las partículas no se vio afectada seriamente durante la sensibilización por AF y UC. Finalmente, los CLP se evaluaron en ensayos de inmunoaglutinación frente a un panel de sueros, donde la reacción de aglutinación se detectó midiendo los cambios en la absorbancia óptica por turbidimetría. Se construyeron curvas ROC, donde los grupos analizados fueron: i) sueros agudos (n=8) y ii) sueros negativos + crónicos (n=12). El área DIAGNOSIS & TREATMENT 101 bajo la curva de los CLP-P35Ag y CLP-P22Ag fue de 0,927 y 0,881, respectivamente; indicando que estos reactivos serían capaces de discriminar los sueros agudos respecto a los crónicos y negativos. DYT17 VALIDACIÓN DEL RECUENTO DE EPIMASTIGOTES DE Trypanosoma cruzi MEDIANTE UN ANALIZADOR HEMATOLOGICO AUTOMATIZADO APLICADO AL SCREENING DE COMPUESTOS Isabel Nocito(1), Noelia Mingo(2), Romina Manarin(3), Adriana Cortadi(4), Victoria L Alonso(5) Facultad de Ciencias Bioquímicas y Farmacéuticas – Universidad Nacional de Rosario. (5)Facultad de Ciencias Bioquímicas y Farmacéuticas – Universidad Nacional de Rosario. IBR-CONICET. E-mail: alonso@ibr.gov.ar (1)(2)(3)(4) Con el propósito de reducir los tiempos de recuentos de epimastigotes de Trypanosoma cruzi en el screening de compuestos, nos propusimos comparar los resultados obtenidos mediante cámara de Neubauer con respecto al uso de un contador hematológico automatizado. Para esto se utilizó el equipo WL 19 Counter AA (Weiner Lab), diseñado para el recuento diferencial de leucocitos, glóbulos rojos y plaquetas. Después de ajustar ciertas variables en el equipo (reemplazo del reactivo lisante por agua destilada, ajuste de la ganancia del canal de leucocitos y cambios de unidades), observamos que los epimastigotes eran detectados correctamente dentro de la población de leucocitos. Diseño experimental: Se utilizaron epimastigotes de la cepa Dm28c los cuales se trataron durante 72 horas con extractos vegetales. Luego, los parásitos, previamente fijados en formaldehído al 3,7% y homogenizados, se contaron en cámara de Neubauer y en el contador automatizado. Además, se registraron los posibles cambios morfológicos por observación directa y/o coloración Giemsa. Resultados: Se evaluó el efecto de diferentes concentraciones (5 a 100 µg/mL) de 2 extractos vegetales de la especie Myrsine Parvifolia provenientes de fruto (A) y tallo (B). El extracto A disminuyó significativamente el crecimiento de los parásitos respecto de los parásitos control en todas las concentraciones empleadas. Sin embargo, el extracto B resultó ser poco efectivo. Como control se utilizo Benznidazol, la droga utilizada actualmente para el tratamiento de la Enfermedad de Chagas (0-20 µM) y se calculo su CI50, el cual fue comparable al reportado en la literatura. El recuento parasitario en todas las condiciones fue similar mediante ambas metodologías. Conclusión: Es posible reemplazar el recuento manual por el contador automático, ya que no hay diferencias significativas entre ambos métodos. Además, la reducción del tiempo de trabajo fue muy considerable, pudiendo evaluar un gran número de compuestos simultáneamente. DYT18 CLINICAL EFFICACY METACESTODES OF CARVACROL AGAINST Echinococcus granulosus DIAGNOSIS & TREATMENT 102 Julia Fabbri, Patricia E Pensel, Marina A Maggiore, Guillermo M Denegri, María C Elissondo Laboratorio de Zoonosis Parasitarias - FCEyN - UNMdP. E-mail: julia_fabbri@hotmail.com Human cystic echinococcosis is a zoonosis caused by the larval stage of the tapeworm Echinococcus granulosus. This disease represents an important zoonosis with highly endemicity in some countries in South America, especially in Argentina, Chile, Uruguay and Brazil. Echinococcosis in humans and animals is an economic and public health concern in many parts of the world. Currently, surgery is still the preferred method of treatment, despite the risk of intraoperative spillage of protoscoleces. However, the search of new therapeutic alternatives such as the use of traditional medicinal plants has been increased. Carvacrol is one of the main phenolic components from essential oils of Thymus vulgaris (thyme) and Origanum vulgare (oregano). Its activity in vitro against protoscoleces and cyst of E. granulosus has been reported. The aim of the present work was to determine the clinical efficacy of carvacrol against E. granulosus metacestodes. Carvacrol treatment resulted in a statistically significant reduction on the cysts weight compared to those obtained for control mice (p<0.05). All cysts in the samples removed from control mice appeared turgid, showing no observable collapse of the germinal layer. At ultrastructural level, the cyst showed typical features of E. granulosus metacestodes, with a germinal layer comprised of different cell types. In contrast, the ultrastructural study of cysts developed in mice treated with the carvacrol suspension revealed lost of the characteristic multicellular structure. The data obtained demonstrated that the in vivo treatment with carvacrol is effective against E. granulosus metacestodes. DYT19 ANTIPROTOZOAL POTENTIAL OF ANTARTIC MACROALGAE SOME TROPICAL, SUBANTARTICA AND Fábio Aurélio Esteves Torres(1), Thais Gaban Passalacqua(2), Letícia de Almeida(3), Angela Maria Arenas Velasquez(4), Erika Mattos Stein(5), Daniel Xavier Andreguetti(6), Leonardo Zambotti Villela(7), Andres Mansilla(8), Pio Colepicolo(9), Márcia Graminha(10) (1)(2)(3)(4)(10) Universidade Estadual Paulista Júlio de Mesquita Filho (UNESP) Faculdade de Ciência Farmacêuticas Campus Araraquara. (5)(6)(7)(9)Universidade de São Paulo (USP) Instituto de Química. (8)University of Magallanes (UMAG). E-mail: fab_trs@hotmail.com Neglected tropical diseases have a higher prevalence in tropical and subtropical regions and affect more than 1 billion people worlwide. The Whorl Health Organization developed a list of 17 NTDs including the protozoan-borne diaseases leishmaniasis and human African trypanosomiasis (HAT), the main focus of this work. They are called neglected because they persist only in the poorest, most marginzalized communities and conflict areas. The biochemical, pharmacological and molecular aspects Leishmania amazonensis and Trypanosoma brucei, the causative agents of tegumentar leishmaniasis and HAT have been performed by our group. In addition, the aim of our study is to perform the screening from different extracts of various algae species originated from Antarctic (Shetland island), Chile (subantarctic region) and from brazilian coast. To determine the DIAGNOSIS & TREATMENT 103 antiprotozoal activity (Ic50) of these extracts, counting of Neubauer chamber was performed using amastigotes and promastigotes forms of L. amazonensis and procyclic forms of T. brucei; for evaluation of citotoxicity (CC50) and selective index (SI), J774.A1 macrophages were used, according to Mosmann (1983). Preliminary results showed that the hexane extract of the Antartic algae Himanthotallus grandifolius showed both leishmanicidal (IC50promastigota = 112μg/mL) and trypanocidal (IC50 = 195,9 μg/mL) activities with SI values of 4,21 amd 2,41, respectively. For the Subantartic algae Sarcothala crispata, the antileishmanial (IC50promastigotes = 64,55μg/mL) and trypanocidal (IC50 = 20,15μg/mL) activities were also interesting, despite the low SI for L. amazonensis (SI = 1,49). None tropical algae presented relevant antiprotozoal activities. These results suggest that the algae from the Antartic and Subantartic regions probably produce different and interesting secondary metabolites from those found in the algae from the brazilian coast, probably responsible for the bioactivities and that will be explored by HPLC-MS analysis. DYT20 TRATAMIENTO COMBINADO DE BENZNIDAZOL (BZ) Y ALOPURINOL (ALO) EN LA INFECCIÓN CRÓNICA MURINA POR Trypanosoma cruzi NICARAGUA (TcN) M.Lujan Scalise (1), Marcela Rial (2), Micaela M López Alarcón (3), Mónica Esteva (4), Jacqueline Búa (5), Alejandro Benatar (6), Nilda Prado (7), Adelina Riarte (8), Laura E Fichera (9) (1)(3)(4)(5)(7)(8)(9) INP Dr. M. Fatala Chaben ANLIS/Malbrán. (2)INP Dr. M. Fatala Chaben ANLIS/Malbrán CAECIHS-UAI. (6)INGEBI-CONICET. E-mail: scaliselujan@yahoo.com.ar El objetivo de este estudio es obtener mayor conocimiento sobre la respuesta al tratamiento de BZ y ALO en la infección crónica con TcN en C3H/HeN y en C57BJ/6 con dos esquemas de tratamiento: uno, con dosis diarias bajas de BZ seguido de ALO y otro, intermitente, con 100 mg/kg cada 5 días de BZ seguido de ALO. Cuatro grupos de ratones por cada cepa, se trataron con 30 dosis orales de BZ 75 o 50 mg/kg/día y en un grupo de cada dosis de BZ se continuó con 30 dosis orales de ALO 64 mg/Kg/día. En el tratamiento intermitente se trataron 2 grupos de C57BJ/6 con BZ 100mg/kg/cada 5 d y un grupo fue continuado por 30 dosis de ALO. Luego del sacrificio, 7 meses post-infección, los C3H/HeN muestran un índice de inflamación (II) de 0.79 que disminuye a 0.21 y 0.10 con BZ 75mg y BZ 75mg con ALO respectivamente; la serología se negativiza en un 90% en los tratamientos con BZ 75 y en un 50 % con las dosis más bajas. En los C57BJ/6 el II de los tratados mejora en un 70 % la inflamación asociada a la infección. La parasitemia por qPCR disminuyó de 3.51 a 0.16 EqP/ml. La serología se negativiza con el tratamiento a bajas dosis de BZ y combinado con ALO en un 100% de los ratones tratados . El estudio electrocardiográfico de los C57BJ/6 crónicos muestra una significativa disminución de la frecuencia cardíaca mientras que con todos los tratamientos la bradicardia se revierte. El tiempo de conducción del nódulo aurículo-ventricular en los crónicos no tratados fue significativamente mayor que en los animales tratados. El tratamiento intermitente con BZ mostró que la serología se negativizó en un 83 % de los ratones tratados con BZ y en un 100 % en los combinados con ALO. Conclusiones: Por la acción del BZ a bajas dosis solo o combinado con ALO y en un protocolo de tratamiento intermitente a los 7 meses post- DIAGNOSIS & TREATMENT 104 infección , los ratones mostraron negativización de la serología, menor parasitemia por qPCR y menor patología cardíaca evaluada por índice de inflamación. DYT21 TRATAMIENTO CON BENZNIDAZOL (BZ) Y ALOPURINOL (ALO) EN RATONES C3H/HEN INFECTADOS CRÓNICAMENTE CON Trypanosoma cruzi SYLVIO X10/4 Marcela Rial(1), Luján Scalise(2), Micaela M López Alarcón (3), Jacqueline Búa(4), Mónica Esteva(5), Nilda Prado(6), Adelina Riarte(7), Laura E Fichera (8) (1) INP Dr. M. Fatala Chaben ANLIS/Malbrán/CAECIHS-UAI. (2)(3)(4)(5)(6)(7)(8)INP Dr. M. Fatala Chaben ANLIS/Malbrán. E-mail: marcelarial2@hotmail.com La cardíopatía chagásica es provocada por una diversidad de cepas virulentas como T. cruzi Nicaragua estudiado en nuestro laboratorio (Grosso, Lopez Alarcón y col., 2013; López Alarcón y col., SAP 2013; Scalise y col., SAP 2014). En este trabajo ampliamos nuestro estudio sobre el efecto de bajas dosis de BZ combinado con ALO en el modelo crónico de infección por T. cruzi SylvioX10/4. Cuatro grupos de ratones se trataron con 30 dosis orales de BZ 75 y 50 mg/kg/día y en un grupo de cada dosis de BZ se continuó con 30 dosis orales de ALO 64 mg/Kg/día. Los ratones infectados no tratados y los tratados se sacrificaron a los 7 meses post infección. Nuestros resultados mostraron que en los ratones tratados la inflamación asociada a la infección disminuyó en un 80 %, la serología se negativizó en un 64 % de los ratones tratados solo con BZ y en un 83 % en los que continuaron con ALO, además se normalizó la disminución de la frecuencia cardíaca, medida por electrocardiografía, en todos los tratamientos, Conclusiones: Estos resultados indican que los tratamientos con bajas dosis de BZ en combinación con ALO en la etapa crónica tiene efectos positivos en la evolución de la infección crónica murina por T. cruzi, previniendo alteraciones cardiacas. Una mejor comprensión de la respuesta a los tratamientos dada la interacción de las diferentes cepas de ratones y las diferentes cepas de T. cruzi, podría contribuir al desarrollo de terapias más eficaces para el tratamiento de la enfermedad de Chagas. DYT22 LAMP, DETECCIÓN COLORIMÉTRICA DE ADN DE Trypanosoma cruzi EN MUESTRAS DE NEONATOS INFECTADOS UTILIZANDO SYBR® GREEN Rocío Rivero(1), Elsa B Velázquez, (2), Mónica I Esteva(3), Ana María De Rissio, (4), Margarita Bisio(5), Andrés M Ruiz.(6) (1)(2)(3)(4)(6) Instituto Nacional de Parasitología . (5)Servicio de Parasitología y Enfermedad de Chagas, Hospital de Niños Dr. Ricardo Gutiérrez, Buenos Aires, Argentina. E-mail: rocior_04@yahoo.com.ar La técnica de LAMP se basa en el principio de síntesis de ADN por desplazamiento de cadena. Es efectuado por la enzima Bst, una ADN polimerasa con actividad de desplazamiento y un sistema de cuatro oligonucleótidos, que reconocen un total de seis DIAGNOSIS & TREATMENT 105 secuencias distintas en el ADN blanco. La amplificación se obtiene en una hora y es posible la lectura directa del producto amplificado, por la adhesión de sustancias que se integran al producto (cambian de color en presencia del blanco buscado) sin necesidad de recurrir a un gel de agarosa. En nuestro laboratorio se realizó la optimización de la reacción de LAMP para la detección de ADN de T. cruzi en neonatos nacidos de madres con serología reactiva al parásito (Thekisoe, O. M., et al., Am J Trop Med Hyg. 2010). Para la detección del ADN de T. cruzi a simple vista se adicionó SYBR® Green, Invitrogen (S7563) a la reacción de LAMP (Goto, M., et al., Bio Techniques 2009). Se ensayó adicionar 1µl del intercalante antes de iniciada la reacción y una vez finalizada la misma, en las diluciones 1:10, 1:50, 1:100 en 10 muestras de neonatos infectados con T. cruzi. Con la adición del intercalante a la master mix antes de iniciada la reacción no se obtuvo amplificación del ADN, pero cuando se adicionó el agente después de finalizada la misma, las muestras positivas (N=10) para T. cruzi viraron del color naranja a verde fluorescente según lo esperado para muestras positivas mientras que los controles negativos permanecieron de color naranja (N=3). Estas muestras fueron corridas en un gel de agarosa como control y se observó una perfecta correlación entre ambas formas de visualización del producto. Los resultados sugieren que LAMP puede surgir como una alternativa frente a las técnicas convencionales aplicable en condiciones de campo ya que no requiere equipos costosos para la amplificación así como para la lectura de los resultados. DYT23 EFICACIA DE LA PCR EN EL DIAGNÓSTICO DE LA TRANSMISIÓN DE CHAGAS CONGÉNITA Rocío Rivero, Elsa B Velázquez, , Mónica I Esteva, Débora L González, Daniela R Oliveto, Karenina Scollo, Ana María De Rissio, Andrés M Ruiz Instituto Nacional de Parasitología . E-mail: rocior_04@yahoo.com.ar La transmisión de Chagas congénita (TC) es la segunda forma de transmisión de importancia en Argentina. Se estima que entre 1100 y 1300 niños infectados con Trypanosoma cruzi nacen cada año. Cuando el diagnóstico parasitológico por métodos directos es negativo el diagnóstico final se completará por métodos serológicos a los 10 meses de vida y dadas las características socio-económicas de la población infectada se dificulta la finalización del seguimiento. En nuestra experiencia en TC, alrededor del 55,8% de los niños no completan el seguimiento. Cuando evaluamos el valor predictivo de la PCR en la detección de la infección, éste porcentaje se redujo al 27%. El objetivo de este trabajo fue evaluar la implementación de la PCR en el diagnóstico de rutina de TC durante el periodo 2010-2013 en el INP. Para ello se recolectaron muestras de 0,5 ml de sangre con igual volumen de guanidina se aisló el ADN con columnas y se utilizaron los primers Tcz 1 y 2. Se estudiaron 870 niños nacidos de madres con serología reactiva para T. cruzi con un seguimiento de hasta 24 meses. De los niños estudiados 660 completaron el seguimiento, de los cuales 6,21% (41/660) fueron PCR positivos confirmados por micro método o serología. El 17,07% (7/41) de los niños, que al primer control tenían menos de un mes, fue PCR positiva recién a partir del segundo control. El porcentaje con PCR negativa, confirmados al final del seguimiento, fue del 93,78% (619/660). La pérdida DIAGNOSIS & TREATMENT 106 durante el seguimiento fue del 24,13% (210/870). No se observaron falsos positivos y/o negativos durante el estudio. Es importante destacar que una PCR negativa antes del primer mes debe ser confirmada posteriormente. Los resultados obtenidos indican que la incorporación de la PCR en el diagnóstico de rutina permite un abordaje efectivo del niño infectado. Con la incorporación de las técnicas moleculares en el algoritmo del diagnóstico de la TC se podría realizar el tratamiento en forma precoz aumentando su eficacia terapéutica. DYT24 DIAGNÓSTICO DE LA INFECCIÓN CONGENITA POR Trypanosoma cruzi UTILIZANDO UN TEST SEROLÓGICO CON EL ANTÍGENO SAPA EN MUESTRAS BINOMIALES MADRE-HIJO Bibiana J Volta(1), Patricia L Bustos (2), Karenina Scollo (3), Ana María de Rissio(4), Rita L Cardoni(5), Graciela Russomando(6), Jacqueline Bua(7) (1)(2)(3)(4)(5)(7) INP Fatala Chaben. (6)Instituto de Investigaciones de Ciencias en Salud, Universidad Nacional de Asunción. E-mail: bvolta@gmail.com La transmisión madre-hijo del T. cruzi es de gran importancia epidemiológica. El diagnóstico temprano del niño infectado es por detección del parasito y generalmente requiere de un seguimiento hasta los 10 meses de edad. Con el objetivo de detectar recién nacidos infectados congénitamente por T. cruzi, se analizaron los niveles de anticuerpos (Acs) contra un antígeno secretado por tripomastigotes (SAPA) en 91 muestras apareadas de madres seropositivas y sus niños recién nacidos. Se estudiaron 70 muestras de madre-hijo no infectado y 21 muestras de madre-hijo con infección congénita. En 34/70 madres de recién nacidos sin infección, con títulos de Acs anti-SAPA > 0.4, se observó parasitemia detectable por qPCR (media= 1.71 eP/mL), mientras que en 36/70 madres con Acs anti-SAPA < 0.4, la parasitemia no fue detectable. En los casos de transmisión congénita, las 21 madres estudiadas tuvieron una media de Acs anti-SAPA = 0.358, con una carga parasitaria de 4.9 eP/mL y en sus bebés recién nacidos la media de Acs anti-SAPA fue muy superior, de 1.026, con carga parasitaria media de 167 eP/mL. Los niveles de Acs anti-SAPA correlacionaron con la carga parasitaria (coeficiente Spearman r2= 0.6921, P < 0.0001). Cuando se analizaron los niveles de Acs anti-SAPA diferenciales (título del bebé infectado – título de la madre), la relación fue mayor a 1, pronosticando la infección parasitaria en un 90 % de los 21 binomios madre-hijo estudiados. Los 2 niños que tuvieron un índice diferencial negativo no tenían parasitemia detectable, pero fueron positivos por serología y PCR a los seis meses de edad. Estos resultados indican que estudiando el binomio madre-hijo recién nacido es posible: i) detectar por serología casos de Chagas congénito, de utilidad en áreas rurales donde no se puede disponer del PCR; ii) evitar pérdidas por el largo seguimiento del diagnóstico de Chagas congénito; iii) asegurar inmediato tratamiento de niños, 100 % efectivo en edad precoz. DIAGNOSIS & TREATMENT 107 DYT25 ENERGETIC METABOLISM EVALUATED IN Taenia crassiceps cysticerci AFTER ADMINISTRATION OF PRAZIQUANTEL NANOPARTICLES Carolina Arrúa1, Luciana Damacena Silva2 Marina Clare Vinaud2, Claudio Salomon1,3. 1 IQUIR-CONICET, Rosario, Argentina. 2 Laboratory of studies of the host-parasite relationship, Tropical Pathology and Public Health Institute, Federal University of Goiás, Brazil. 3Área Técnica Farmacéutica, Departamento Farmacia. Facultad de Ciencias Bioquímicas y Farmacéuticas, UNR, Suipacha 531, S2002LRK Rosario, Argentina. csalomon@fbioyf.unr.edu.ar Taeniidae parasites remain public health issues in many regions of the world, especially in poor communities. In humans the most frequent form of the disease is neurocysticercosis. The aim of this work was to formulate Praziquantel (PZQ) nanoparticles to determine its effect on the energetic metabolism of T. crassiceps cysticerci. The influence of preparation parameters on particle size, stabilizer type and concentration were evaluated. PZQwas dissolved in etanol at 25°C, the organic solution was injected dropwise into an aqueous phase containing a poloxamer derivative and kept under agitation to get a desired dispersion. The dispersion was then stirred magnetically at 500 rpm at room temperature to evaporate organic solvent. Solids were collected after filtration, washed with deionized water and lyophilized. All samples were prepared in triplicate. Female Balb/c mice with 812 weeks old were intraperitoneally inoculated with 10 cysticerci of T. crassiceps (HYG strain). 30 days post-infection the mice were divided into three groups: a) Group 1 received one oral dose of 50mg/kg of PZQ-P188. b) Group 2 received one oral dose of 50mg/kg of Praziquantel. c) Group 3 received one oral dose of saline solution. 24 hours after the treatment the mice were euthanized and the cysticerci removed from the intraperitoneal cavity, washed with PBS and frozen in liquid nitrogen. The cysticerci were processed and analyzed through HPLC to detect the organic acids. It was possible to detect the following organic acids: citrate, oxaloacetate, pyruvate, malate, acetate and fumarate which confirmed the partial inversion of the tricarboxylic acid cycle that occurs in helminths. In groups 1 and 2 was possible to detect an increase in the oxaloacetate production and a decrease in the fumarate production when compared to the control group (group 3) (p<0.05). These results indicate an increase in the cytosolic pathways opposed to a partial inhibition of the mitochondrial ones. DYT26 FORMULATION OF CROSS-LINKED AND NON-CROSSLINKED CHITOSAN-BASED MICROPARTICLES FOR ORAL DELIVERY OF PRAZIQUANTEL FILLED IN HARDGELATIN CAPSULES Orlandi, S.C. 1 Leonardi, D. 1,2 Salomón, C.J. 1,2 1 Área Técnica Farmacéutica, 2IQUIR – CONICET. Facultad de Ciencias Bioquímicas y Farmacéuticas, UNR, Suipacha 531, S2002LRKRosario, Argentina. sorlandi@fbioyf.unr.edu.ar DIAGNOSIS & TREATMENT 108 The interest of novel drug delivery systems has been focused on oral controlled-release dosage forms. They distribute more uniformly in the gastrointestinal tract, resulting in more reproducible release profiles, more predictable gastric emptying, reduced local irritation, and a minimized risk of dose dumping. In this study, the development of novel microparticulate solid dosage form of Praziquantel (PZQ), an anthelmintic drug, mainly used to treat shistososomiasis, was investigated. PZQ was loaded into polymeric microparticles based on chitosan or chitosan-sodium lauryl sulfate, and then included into hard gelatin capsules. Spray drying technique was applied to produce the PZQ microparticles. The product was evaluated by X-ray powder diffractometry, infrared spectroscopy and scanning electron microscopy. Non-crosslinked microparticles were prepared without sodium lauryl sulfate. The results obtained suggested that spray-drying is a good technique for the preparation of both non-crooslinked and crosslinked PZQchitosan microparticles. The dissolution rate of the drug from all chitosan microparticles was significantly higher than that of drug alone. Unexpectedly, the reinforced crosslinked microparticles exhibited a higher dissolution rate in comparison with the non-crosslinked microparticles, probably due to the gelation process. Regarding the behavior of the particles when incorporated into hard gelatin capsules, it was found that the PZQ dissolution from crosslinked chitosan formulations was faster than the reference capsule. The characterization of the polymeric matrix indicated a clear ionic interaction between the polymer and the surfactant that would be responsible for the modified dissolution rate. In conclusion, chitosan-sodium lauryl sulphate microparticles prepared by spray drying, is a promising approach to deliver PZQ in hard gelatin capsules. DYT27 FLUORESCENT DRUG SCREENING FOR THE EVALUATION OF BENZNIDAZOLE SUSCEPTIBILITY OF DIFFERENT Trypanosoma cruzi FIELD ISOLATES Andrea Ramos, Paula G Ragone, Nicolás Tomasini, Mercedes Monje Rumi, Patricio Diosque, Miguel Ángel Basombrío, Cecilia Pérez Brandán Instituto de Patología Experimental- CONICET- Universidad Nacional de Salta. E-mail: perezbrandan@yahoo.com.ar Introduction: Chagas disease is one of the most serious public health problems in Latin America and is the clinical manifestation of the infection by Trypanosoma cruzi. Currently the drugs used to treat Chagas' disease are Benznidazole and Nifurtimox. Therapeutic failure of Benznidazole (BZN) has been widely documented in Chagas disease and has been mainly associated to variations in the drug susceptibility of T. cruzi strains. Objective: To evaluate the in vitro susceptibility to BZN of different T. cruzi genotypes from the Chaco region in Argentina. Materials and methods. 35 T. cruzi stocks from the Chaco region in Argentina, and belonging to the TcI, TcIII, TcV and TcVI Discrete Typing Units (DTUs) were selected to evaluate the in vitro susceptibility to BZN. In this first stage of the study, 5 TcI isolates were transfected with the plasmid pTrex-tdTomato in order to generate fluorescent lines to be analyzed in vitro with a fluorescent plate reader. As a preliminary step, the IC50 to BZN of epimastigotes was determined. Additionally, the in vitro susceptibility was correlated with genetic distances, biological and eco-epidemiological parameters. Results. The 5 TcI isolates examined were sensitive to BZN. The IC50 value of only one isolate showed to be slightly higher than the others. Correlations between the DIAGNOSIS & TREATMENT 109 IC50 and genetic distances, biological and eco-epidemiological parameters do not predict differences in susceptibility to BZN. Conclusions. Taking into account that in the Chaco region inhabit a large number of eligible individuals to be treated, the evaluation of the susceptibility to benznidazole of the different T. cruzi genotypes circulating in this region is relevant. Further in vitro and in vivo studies involving the rest of the isolates are planned. This work is supported by Fundación Fiorini, CIUNSa and ANPCyT. DYT28 IDENTIFICACIÓN DE ESPECIES DE Leishmania EN MUESTRAS DE PACIENTES DE SALTA: UTILIDAD DE LA TÉCNICA DE PS-PCR Gabriela González Prieto1, Fernanda García Bustos2, Federico Ramos1, Alejandro Uncos2, Paola Barroso2, Cecilia Parodi3 y Alejandra Barrio1 1 Fac de Cs de la Salud, Universidad Nacional de Salta- Argentina 2 Instituto de Patología Experimental-CONICET. Salta, Argentina 3 Instituto de Medicina Experimental-CONICET. Bs As, Argentina La identificación de especies de Leishmania tiene importancia epidemiológica en Salta, donde se encuentra la zona de mayor endemicidad en nuestro país. Sin embargo hasta el momento, excepto por trabajos de nuestro grupo, la identificación de muestras se ha llevado a cabo en laboratorios externos. Por este motivo nuestro objetivo fue optimizar la técnica de PCR de polimorfismo específica (PS-PCR) (Barrio y cols, 2009), identificar especies de Leishmania en muestras de pacientes y comparar su sensibilidad con la PCR con primers genéricos (PCRk) que utilizamos actualmente para diagnóstico (Barrio y cols, 2007). Se incluyeron muestras de pacientes con diagnóstico parasitológico positivo (microscópico y/o aislamiento en cultivo) y que fueron positivas mediante PCRk. Se trabajó con dos tipos de muestras: a) parásitos aislados en cultivo mediante aspirado de lesiones (n=38) y b) muestras clínicas obtenidas de raspado de lesiones (n=52). Además, con el fin de determinar la sensibilidad de la técnica de PS-PCR con respecto a PCRk, se realizaron diluciones sucesivas de parásitos en buffer TE (desde 0.0001p/300µl TE a 106 p/300µl TE). La PCRk mostró un límite de detección de 0.01 p/300µl TE, mientras que la PS-PCR (con primers de subgénero) 103p/300µl TE. De los 90 casos analizados, se pudo determinar el subgénero del 67.7%(n=61): 56 amplificaron subgénero Viannia (V) y 5 el subgénero Leishmania. A su vez, 38 muestras fueron identificadas como L (V) braziliensis y 3 como L (L) amazonensis. En el resto de casos (32.3%), no fue posible identificar la especie. A pesar de la baja sensibilidad de la técnica de PS-PCR con respecto a PCRk (sensibilidad=0.67) para ser utilizada en diagnóstico, es importante su aplicación en nuestro laboratorio para la identificación de aislados en cultivo, en los cuales se pudo determinar subgénero y especie en el 100% de casos. DYT29 DIAGNOSIS & TREATMENT 110 EVALUACIÓN PRELIMINAR DE LA SEGURIDAD DEL NUEVO BENZNIDAZOL EN EL TRATAMIENTO DE ADULTOS CON INFECCIÓN CRÓNICA POR Trypanosoma cruzi Marisa L Fernandez, Juan G Tomás, Yolanda M Hernandez, Nilda G Prado, Adelina R Riarte INP Dr Mario Fatala Chaben. E-mail: marisa.fernandez@gmail.com Desde el inicio del uso del benznidazol (BNZ), en la decada de 1970, se han registrado frecuentes efectos adversos (EAs) en los pacientes adultos. A partir de 2012 se inicia la producción en Argentina por Laboratorio Elea Métodos Se realizó un análisis retrospectivo de las historias clínicas de pacientes >17 años con infección crónica por Trypanosoma cruzi tratados con BNZ-Elea desde junio 2012 hasta julio 2014. Se registraron datos demográficos, clínicos, duración del tratamiento y aparición de EAs. Se compararon los resultados con los datos del estudio TRAENA, un ensayo clínico aleatorizado doble ciego con 352 pacientes tratados con BNZ-Roche. Se aplicó Test exacto de Fisher y se consideró significativo un valor de p< 0,05. Resultados: Se trataron 112 pacientes (p), entre 18 y 57 años (media 35,27 ± 9 años) de los cuales 67% (75 p) eran mujeres. El 72% (81 p) completaron el tratamiento; 12% (14 p) suspendieron por indicación médica; y 16% (18 p) abandonaron el mismo. Se detectaron 1,7% (2 p) EAs serios, que requirieron internación por neutropenia febril. El tipo y prevalencia de EA fueron: farmacodermia 49% (55 p), intolerancia digestiva 20% (22 p), artralgias 9% (10 p), fiebre 8% (9 p), adenopatías 4% (5 p), neuropatía periférica 6% (6 p), leucopenia 3% (4 p), eosinofilia 6% (7 p) y elevación de las transaminasas 7% (8 p) Se detectaron diferencias significativas para hepatitis toxica (p = 0,001), artralgia/artritis (p=0,017) y leucopenia (p= 0,032) en los pacientes tratados con BNZ-Elea vs BNZ-Roche. También se observó una mayor tendencia al abandono del tratamiento (p=0,08) y fiebre (p=0,09) en el primer grupo. No se observaron diferencias respecto a la presencia de farmacodermia, adenopatías y neuropatía periférica. Conclusiones: La evaluación con el nuevo BNZ sugiere una mayor frecuencia de ciertos EAs. Estos datos destacan la importancia de realizar un seguimiento estricto de las personas bajo tratamiento, un registro sistemático y la optimización del manejo de los mismos DYT30 EVALUACIÓN DEL EFECTO IN VITRO DE LA AZITROMICINA, SOLA O EN ASOCIACIÓN CON BENZNIDAZOL, SOBRE Trypanosoma cruzi Maria E Solana(1), Julián E Gulin(2), Catalina D Alba-Soto(3), Jaime Altcheh(4), Facundo García-Bournissen(5) (1)(3) IMPaM (UBA/CONICET). Fac. Medicina. UBA. (2)(4)(5)Servicio de Parasitología y Enfermedad de Chagas, Hospital de Niños Dr. Ricardo Gutiérrez, Buenos Aires. E-mail: melisolana@yahoo.com.ar La azitromicina (AZM) es un antibiótico macrólido con actividad contra Plasmodium sp, Toxoplasma gondii y algunas especies de Leishmania. A pesar de su actividad contra protozoos, no parece haber sido estudiado contra T. cruzi, el agente causante de la enfermedad de Chagas. El objetivo de este trabajo fue evaluar la acción de AZM in vitro contra T. cruzi como monodroga o en combinación con benznidazol (BZ). Células Vero DIAGNOSIS & TREATMENT 111 previamente irradiadas e infectadas con tripomastigotes sanguíneos (trip) de la cepa VD (relación 1:5) durante 2hs a 37°C y 5% CO2 fueron tratadas con 10-160 µg/ml de AZM durante 72 hs. Finalizado el tratamiento, las monocapas fueron teñidas con Giemsa y se determinó la actividad amastigoticida mediante el cálculo del porcentaje de infección por recuento microscópico de 200 células, y del número de amastigotes/célula utilizando el software ImageJ. La AZM mostró un efecto inhibitorio dependiente de la concentración con un valor de IC50 de 19,57 g/ml. La droga presentó un índice de selectividad para los parásitos de 58,69 por ensayo de reducción de resazurin sobre esplenocitos murinos al probarla en concentraciones de 0-1500 g/ml. El efecto amastigoticida de la combinación BZ (IC12,5 = 0,019 g/ml) y AZM (1,6-10 g/ml) se estudió sobre células Vero infectadas con T. cruzi . La interacción entre ambas drogas se analizó por cálculo del índice de combinación (IC) y construcción del isobolograma (software CompuSyn). Los resultados muestran IC <1 para todas las combinaciones BZ-AZM con menores valores a bajas dosis de AZM. Estos resultados sugieren que AZM presenta actividad inhibitoria in vitro y sinergismo en su combinación con BZ, siendo el efecto mayor a dosis bajas de AZM. La actividad de la AZM in vitro, sola y en combinación con BZ, sumada a su seguridad en el uso clínico, sugiere que esta droga amerita estudios en profundidad como potencial candidato para el tratamiento de la enfermedad de Chagas. Financiado por FONCyT, CONICET y UBACyT. DYT31 ALBENDAZOLE-LOADED LIPID NANOCAPSULES IN CYSTIC ECHINOCOCCOSIS: PLASMA/CYST DISPOSITION AND EFFICACY IN INFECTED MICE Patricia Pensel(1), Gabriela Ullio Gamboa (2), Julia Fabbri (3), Laura Ceballos (4), Sergio Sanchez Bruni(5), Luis Alvarez(6), Daniel Allemandi(7), Jean P Benoit (8), Santiago Palma (9), María C Elissondo (10) (1)(3)(10) Laboratorio de Zoonosis Parasitarias, Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Mar del Plata. CONICET. (2)(7)(9)Departamento de Farmacia, Fac. Ciencias Químicas, Universidad Nacional de Córdoba, Argentina. UNITEFA-CONICET. . (4)(5)(6) Laboratorio de Farmacología. CIVETAN-CONICET- Facultad de Medicina Veterinaria. UNCPBA-Tandil, Argentina . (8)INSERM U1066. Ingenierie de la Vectorisation Particulaire. Immeuble IBT. Angers. France.. E-mail: patricia_pensel@hotmail.com Cystic echinococcosis (CE) is a zoonotic disease caused by the larval stage of Echinococcus granulosus. The drugs commonly used for anti-hydatid cysts treatment are benzimidazoles. Therapeutic failures following albendazole (ABZ) administration have been primarily linked to the poor drug absorption rate resulting in low drug level in plasma and hydatid cysts. Lipid nanocapsules (LNCs) represent nanocarriers designed to encapsulate lipophilic drugs, such as ABZ. Structurally, the lipophilic drug is solubilised in the lipid core, surrounded by a tensioactive shell. The goals of the current work were: i) to characterize the plasma drug exposure and cyst concentration profiles for ABZ-LNCs and ABZ suspension in mice infected with E. granulosus, and ii) to compare ABZ efficacy against secondary CE in mice after the administration of both formulations. Enhanced ABZ sulphoxide (ABZSO) concentration profiles were obtained in plasma and cysts from LNCABZ treated animals. After oral administration of ABZ-LNC, ABZSO exposure was DIAGNOSIS & TREATMENT 112 significantly higher in plasma and cyst (area under the concentration-versus-time curve [AUC] plasma = 4.65±0.71 µg. h/mL; cyst = 9.37±1.42 µg. h/g) than that observed after ABZ suspension treatment (AUC plasma= 2.37±0.35 µg. h/mL; cyst = 4.25±0.38 µg. h/g). Additionally, ABZSO concentrations measured in cysts from ABZ-LNC treated mice were 1.5-fold higher than those detected in plasma. This enhanced drug availability correlated with an increased efficacy against secondary CE in mice observed for the ABZ-LNC (0.91±1.16 g), while the suspension formulation (5.38±2.4 g) did not reach differences with the untreated control group (8.98±4.61 g). In conclusion, the improved kinetic behavior of ABZ administered as ABZ-LNC resulted in a higher drug exposure of the hydatid cysts, which enhanced ABZ clinical efficacy on CE developed in mice. This new nanocarrier as drug delivery system for ABZ could be a suitable alternative for treating CE in humans. DYT32 LEISHMANIASIS TEGUMENTARIA AMERICANA (LTA): ANÁLISIS DE RESPUESTA AL TRATAMIENTO EN PACIENTES DE LA PROVINCIA DE SALTA LA María Fernanda García Bustos(1), Gabriela González Prieto(2), Federico Ramos(3), María C Mora(4), Cecilia Parodi(5), Miguel A Basombrío(6), Sonia Moreno(7), Josefina Beckar(8), Sibila Monroig(9), Luisa Ruiz Morales(10), Alejandra Barrio(11) (1)(3)(4)(5)(6) Instituto de Patología Experimental (UE CONICET - CCT Salta). (2)(11)Cátedra de Microbiología (Fac. Cs. Salud - UNSa). (7)Servicio de Dermatología (Hospital Señor del Milagro - Salta). (8)(9)Servicio de ORL (Hospital San Bernardo - Salta). (10)Servicio de Dermatología (Hospital San Bernardo - Salta). E-mail: mariafernandagarcia2008@yahoo.com.ar La provincia de Salta presenta la mayor endemicidad de LTA en Argentina. La quimioterapia constituye la mayor estrategia de control, y el antimoniato de meglumina (AM) el tratamiento de primera línea. En la ciudad de Salta se diagnosticaron numerosos pacientes con lesiones mucosas, que se desarrollan en su mayoría luego de una lesión cutánea inicial, por falta de tratamiento o por falla luego de su administración. Esto nos llevó a investigar las características de los regímenes terapéuticos a los que fueron sometidos los pacientes atendidos en la ciudad de Salta. Para ello se realizó un análisis retrospectivo de historias clínicas. Se investigaron características epidemiológicas, clínicas y del tratamiento en una población de 90 pacientes positivos diagnosticados entre 2000-2013. Se obtuvieron datos completos de tratamiento y seguimiento en 40 pacientes. Para evaluar la respuesta, se tomó como parámetro la cura clínica de las lesiones (lesiones cutáneas: re-epitelización completa y aplanamiento del borde, desaparición de induración de base y/o linfangitis o adenitis, y ausencia de nuevas lesiones; lesiones mucosas: regresión de todos los signos clínicos de las lesiones) posterior a los 6 meses post-tratamiento. Del total de pacientes evaluados, 19/40 (47,5%) mostraron falla terapéutica al primer esquema administrado, y 21/40 (52,5%) exhibieron buena respuesta. Se consideró tratamiento completo aquel que se ajustó a la recomendación de la OPS (2013), y tratamiento incompleto aquel administrado de manera interrumpida, y/o con cantidades subóptimas de droga. De los pacientes con falla terapéutica (de los cuales la mayoría - 17/19 - recibió AM), sólo en 9/19 se administraron tratamientos incompletos. En cuanto a los pacientes con buena respuesta, 16/21 recibieron esquemas completos. El importante número de fallas terapéuticas detectado, la mayoría asociadas al tratamiento DIAGNOSIS & TREATMENT 113 con AM, sugiere la importancia de investigar factores de riesgo para la aparición de las mismas. DYT33 SERONEGATIVIZACION ESPONTANEA EN PACIENTES ADULTOS CON ENFERMEDAD DE CHAGAS CRONICA EN LA RAMA PLACEBO DEL ESTUDIO TRAENA Nilda G Prado*, Yolanda M Hernández*, J Gonzalo Tomas*, Marisa L Fernández*, Elsa B Velázquez*, Mónica I Esteva*, Ana M De Rissio*, Juan C Ramírez^, Alejandro G Schijman^, Andres M Ruiz*, Adelina R Riarte* *Instituto Nacional de Parasitologia Dr Mario Fatala Chaben. ^INGEBI-CONICET E-mail: ngracielap@yahoo.com.ar Se compararon aspectos demográficos,serológicos, parasitológicos y clínicos del grupo placebo del ensayo clínico TRAENA, los que presentaron seronegativizacion espontánea (SNE) con los de títulos serológicos positivos (SP) estables durante 11 años de seguimiento. Se evaluaron 323 pacientes (p); 50 (15,5%) con SNE por al menos una de dos técnicas de ELISA convencional (ELISAc) y/o ELISA F29 (F29)), y 273(84,5%) SP. De los 50p SNE 28 fueron por ELISAc, 7 por F29 y 15 por ambas técnicas. La SNE por ambas técnicas fue más frecuente en nativos de Santiago del Estero (p=0.01). La ELISAc promedio basal fue 0,293(DO) en los SNE vs 0,352 en los SP (p<0,0001); mientras que F29 fue 0,301 en los SNE vs 0,412 en los SP (p<0,001). La cuantificación de la parasitemia (qPCR) inicial en los SNE fue de 56,68 ± 153,21 eq/ par./ml, y fue no detectable (ND) en el 23,2% vs los SP que fue de 67,17 ± 187,90 y 16,7% ND (p=NS). La qPCR en el tiempo 0 fue ND en 11/50 (22%), cuantificable en 39 (78%) y ND en 3 (6%) durante el seguimiento¸33/39 con qPCR cuantificable en tiempo 0 tuvieron mediciones entre 7-12 años, de los cuales 12 (36%) fue cuantificable x lo menos en una medición, y en 21 (64%) fue ND siempre. Progresaron clínicamente 7/50 (14%) de los SNE vs 50/273(18,3%) de los SP (p=NS). Ningún paciente falleció en el grupo SNE (0/50) vs 11/273(4%) en el grupo SP (p= NS). No se registraron eventos primarios en el grupo SNE (0/50) vs 18/273(6.6%) en SP (p= NS). Conclusiones. Los pacientes con SNE tuvieron títulos iniciales de anticuerpos más bajos que los SP; los procedentes de Santiago del Estero presentaron mayor SNE por ambas técnicas. Durante el seguimiento entre 7-12 años la técnica de qPCR fue cuantificable por lo menos en una medición. Más allá de las diferencias absolutas respecto de muertes y otros eventos primarios, los SNE no mostraron diferencias significativas en progresión clínica vs los SP del grupo placebo del estudio TRAENA. DYT34 DEVELOPMENT AND VALIDATION OF A NEW KIT PROTOTYPE FOR MOLECULAR DIAGNOSIS OF CONGENITAL CHAGAS DISEASE DIAGNOSIS & TREATMENT 114 Susana Alicia Besuschio INGEBI - LaBMECh. E-mail: bsusanaalicia@gmail.com Early diagnosis of Congenital Chagas disease (CCD) is a public health priority. In the context of FONARSEC FITS SALUD CHAGAS, a public-private consortium was conformed to develop a TaqMan Real-Time PCR (qPCR) kit prototype for CCD diagnosis. One mL of blood collected in DNA stabilizer solution is processed in glass fiber columns. Duplex qPCR uses primers and TaqMan probes targeting satellite DNA repeats conserved in all T. cruzi lineages and an internal standard. External Quality Control panels have been designed and reagents stability tested for 6 months. To compare the accuracy of the kit vs current diagnostics (micromethod in cord or peripheral blood within the first 15 days and at 4-8 weeks of life, plus serodiagnosis at 10 months), a double-blinded prospective field study with two follow-up events has started upon approval of CEMIC Ethical Committee and local IRBs. Activities at fellow centers involve screening, recruitment and consent processes, data management (filling the CRFs, data entry), sample inventory, weekly monitoring and reporting. Each center processes the micromethod and serodiagnosis, recruits and refers samples for qPCR and serologic tests to INGEBI and INP, respectively. The logistics guidelines ensure traceability and proper transport for barcoded samples. Database will be disclosed at the end of study. Prototype analytical validation followed Clinical Laboratory Standard Institute guidelines, rendered a Limit of detection of 0.2 parasite equivalents/mL in spiked blood and 100% specificity in seronegative panels and T. rangeli and Leishmania spp DNAs. Field validation is currently undergone in 100 out of 500 mother-newborns binomials to be recruited in Buenos Aires, Tucumán, Santiago del Estero and Chaco. The performing parameters of the kit encourage its application to early diagnosis of T. cruzi infection not only by vertical transmission but also in oral outbreaks, organ transplantation and monitoring of trypanocidal therapy. DYT35 DETECTION OF Strongyloides stercoralis INFECTION AMONG PATIENTS IN NORTHEAST ARGENTINA Cristina M Gené, María JF Rea, Carlos E Borda Centro Nacional de Parasitología y Enfermedades Tropicales (CENPETROP), Facultad de Medicina, Universidad Nacional del Nordeste. E-mail: cenpetrop@hotmail.com Strongyloides stercoralis is an intestinal helminth that infects humans through contact with soil containing the larvae. Between 30 and 100 million people are infected worldwide. Strongyloidiasis sometimes is asymptomatic and eosinophilia is usually the only indication of infection. Limited epidemiological information on S. stercoralis infection exists in Argentina. The aim of our study was to describe the occurrence of intestinal parasitic infections in our area, considering all people, including hospitalized, outpatients and healthy people, with the suspect of intestinal parasitosis. We examined 248 patients from February 2013 to July 2014. Six faecal samples from each subject were collected on alternate days in plastic tubes containing formalin 10% as the preservative for the sedimentation of Hoffmann-Pons-Janer (HPJ) assay. For the Baermann and Harada-Mori DIAGNOSIS & TREATMENT 115 (HM) assays, one additional faecal sample was subsequently collected in a container without a pre¬servative solution. A total of 124 (50%) specimens were positive for intestinal parasites that included 39 (41.5%) helminths and 55 (58.5%) protozoan infections. Nine species of parasites were found: 30 cases had co-infection with more than one species. Maximum worm infections belonged to S. stercoralis 30 (24.2%). The next prevalent geohelminth was hookworm (11.3%). At all, in 28 patients infected with S. stercoralis presented eosinophilia: mild eosinophilia 33.3%, moderate 36.7% and severe 23.2 %. Parasitologic diagnosis of S. stercoralis was detected in 23 patients with HPJ, six with Baermann method and one with HM only. This parasite was higher in females (71.8%) and in patients more than 50 years of age (66.6%) Our results indicate that S. stercoralis is the predominant parasite in the northeast. A negative result does not necessarily indicate absence of the infection. It is important to detect S. stercoralis infections before administering chemotherapy or immunosuppression in patients at risk. DYT36 MOLECULAR DETECTION OF Leishmania (Leishmania) chagasi EXPERIMENTALLY INFECTED MICE’S SPLEEN TISSUES BY REAL TIME PCR IN Márcia Jusi Márcia FCAV-UNESP. E-mail: marciajusi@yahoo.com.br In order to clarify the immunological mechanisms which confer Leishmania chagasi persistence and multiplication within the host, many studies have been performed to assess T cells subpopulations and subclasses of immunoglobulins using a murine model. BALB/c and C57BL/6 mice lineages are used for primary tests due to their susceptibly to the pathogen and immune response similar to those from humans. However, the infectivity of these animals is not always easy, depending on the virulence of the strain, route of inoculation, and amount of inoculated parasites. Since the parasite load in this animal species is frequently low, it is necessary the use of a very sensitive diagnostic test that may detect the presence of amastigotes. We aimed at evaluating the presence and quantification of amastigotes in spleen tissues of BALB/c mice inoculated with L. chagasi, by Real Time PCR. In the present study, twelve BALB/c mice were inoculated with 1 x 107 L. chagasi promastigotas/mL by intravenous or subcutaneous route. Three animals inoculated with saline were used as negative controls. Mice were euthanized 7, 15 and 45 days after inoculation in order to verify the presence of amastigotes in spleen tissues. DNA samples were submitted to both conventional and Real Time PCR assays, using primers previously described targeting a 120 bp of kinetoplastic DNA. The reagents concentration of PCR reactions was the same for both techniques but Syto 9 was only used as an intercalating in Real time PCR assays. All animals were positive in real time PCR but negative in conventional PCR assays. We also verify that positive results in Real Time PCR showed low Cqs, suggesting a low parasite load in spleen tissues. Our results demonstrated that Real Time PCR was more sensitive than conventional PCR in detecting L. chagasi burden in spleen tissues from experimentally infected mice. DYT37 DIAGNOSIS & TREATMENT 116 EPIDEMIOLOGY OF CYSTOISOSPORIASIS IN HIV/AIDS POPULATION ALONG 10 YEARS IN A REFERENCE INFECTION HOSPITAL Romero RS(1), Romero MM(2), Bava J(3) Htal JP Garrahan. (3)Htal FJ Muniz. E-mail: rominamed20@yahoo.com.ar (1)(2) Introduction: Subacute and cronic diarrheic episodes caused by Coccidia are frequent clinical pictures in HIV/AIDS population. Immunocompromised hosts would be more susceptible to acquisition and disemination of enteric parasitosis caused by protozoa. Objective: Clinical and epidemiological characterization of patients with diarrhea nursed in the FJ Muñiz Hospital along ten years with microbiological diagnosis of cystoisosporiasis. Results: 79 patients were studied (n=79) within an average age of 33.23(rank= 20-53), 48 men, 31 women, 88.06% argentinian, 8.95% peruvian. The clinical picture appeared as an opportunistic infection 3.97 years after HIV diagnosis. 2.18 was the positive sample average per patient, and 11.44% resulted positive for other parasites with or without coinfection with Cystoisospora spp. Blastocystis hominis was the most frequently found (n=11, 35.48%) followed by Strongyloides stercoralis (n=5, 16.13%). At diagnosis 54.43% of the patients presented chronical diarrhea, 46,15% recurrent diarrhea, vomiting 43%, abdominal pain 70.5%, fever 26.86% and weight loss 83%. The most frequent concommitant opportunistic infection was extrapulmonar Cryptococcosis (18%). 21.3% of the patients were under weakly profilaxis with TMS and 78.5% recieved treatment with TMS. The CD4 total count average was 113/mm3 and the CD4 percentage count 8.02%, 89.5% had equal or less than 200 CD4/mm3. The media of the total and percentage count of eosinophils was 272/mm3 and 4.33% respectively, 14% had severe eosinophilia,25.32% absolute leucopenia, mean of hemoglobin was 11.37 mg/dl, 69.33% had anemia diagnosis. From the plasmatic ionogram, sodium average concentration was 134.56 mmol/ml and 3.45 mmmol/ml for potasium, 49.36% had hipokalemia diagnosis. Conclusions: the etiological study of diarrheas lasting 30 days or more in patients infected with HIV in C3 stage, with suspicion of cystoisosporiasis, weight loss and new episodes of non filiated diarrhea, is of great importance. DYT38 DIAGNOSIS OF AMERICAN TEGUMENTARY LEISHMANIASIS ENDEMICITY IN ARGENTINA AND PARAGUAY IN AREA OF María JF Rea, Carlos E Borda Centro Nacional de Parasitología y Enfermedades Tropicales (CENPETROP), Facultad de Medicina, Universidad Nacional del Nordeste. E-mail: cenpetrop@hotmail.com American tegumentary leishmaniasis (ATL) is considered to be endemic in 88 countries and it is a major health problem in different foci of Argentina and Paraguay. The aim of this study was to describe eight new cases of disease from 2010 and 2014. Four patients were males and four females. Age range was between 28-82 years old. From the province of Corrientes were six patients (two from Corrientes city and four from the Departments of Lavalle, San Luis del Palmar, Itatí and Bella Vista), one from the province of Formosa (Fontana) and other from the Paraguay (Pilar). Ulcers were present in five patients with DIAGNOSIS & TREATMENT 117 lesions restricted to the skin located on leg and one woman with disseminated leishmaniasis. In one male with two skin ulcers, mucosal compromise was observed one year later of the primary lesion. Two patients presented only mucosal involvement (nasal and oral). The Montenegro skin test was positive in all patients and the average size was 9.3 mm. IM Glucantime® was administered in seven patients. No relapse of infection was recorded in cured patients, but in two women with a complete clinical cures both suffered traumatism in the same place of the lesion scar within four or five years later, thus they relapsed and a new ulcer was formed. A 66-year-old woman didn't receive the medication and years after she had surgery to remove breast cancer and received Immunosuppressive therapy. Two months later in mastectomy scar two ulcers were formed. A 64 year-old man had erroneously diagnosed of epithelium cancer, thus he received a transplantation of tissue. Between 9 and 12 months later this patient had relapse and a new ulcer was formed in the same place of transplant and with metastasis into the oral mucous. Leishmaniasis can directly or indirectly affect the presentation, diagnosis and course of various disorders or arising among patients receiving chemotherapy. Differential diagnosis of disease is essential in areas where it is endemic DYT39 ESTUDIO DE PACIENTES CON ENFERMEDAD DE CHAGAS Y OTRAS PATOLOGÍAS ASOCIADAS Bruno Selva, Romina Blasco, Noemi Miler, Silvina Lo Presti, Daniela Velazquez, Patricia Paglini, Walter Rivarola Centro de Estudios e Investigación de la Enfermedad de Chagas y Leishmaniasis de la Facultad de Ciencias Médicas de la Universidad Nacional de Córdoba. E-mail: brunoselva90@hotmail.com.ar La enfermedad de Chagas es un grave problema de salud pública, con estimaciones de al menos de 8 a 10 millones de personas que padecen la infección y alrededor de 110 millones en riesgo de adquirirla. Sin embargo no existe aún una explicación de por qué el 30% de las personas infectadas evolucionan hacia una enfermedad cardíaca y el 70% permanece asíntomático aunque con serología persistente, así como tampoco la amplia variabilidad clínica que puede resultar desde una cardiopatía sin consecuencias hasta producir una muerte súbita. El presente trabajo tiene por objeto analizar y relacionar las características clínicas, electrocardiográficas y ecocardiográficas de pacientes chagasicos con PCR positiva y negativa y no chagasicos. Material y método: Se estudiaron 49 pacientes del Servicio de Cardiología de un sanatorio de la ciudad de Córdoba de ambos sexos, con una mediana de edad de 63 años. A todos se les realizó serología (HAI y ELISA) inspección clínica, electrocardiograma (ECG) y ecocardiograma y aquellos con serología positiva se les realizo PCR (en una única toma de sangre). Resultados: De los 49 pacientes, 41 resultaron con serología positiva para Chagas y 8 con serología negativa. De los 41 pacientes con serología positiva un 78 % resultaron con PCR positiva y un 22 % negativa. Por otro lado un 18 % de los individuos con serología positiva fueron asintomáticos. Con respecto a la asociación con otras patologías como Hipertensión arterial (HTA), dislipemia, diabetes y tabaquismo, la mayoría de los pacientes que presentaban una clínica moderada a severa (85 %) son PCR positiva, frente a el resto de los pacientes chagasicos (15 %), con PCR negativa que presentaban una clínica DIAGNOSIS & TREATMENT 118 moderada. Estos hallazgos plantean la necesidad de intensificar estudios sobre los factores que podrían explicar la variabilidad de las formas clínicas, por ejemplo, la asociación con otras patologías y el tipo y virulencia de la cepa del T. cruzi y el papel que desempeñan. DYT40 APLICACIÓN DE ANTÍGENOS RECOMBINANTES DE braziliensis CANDIDATOS AL INMUNODIAGNÓSTICO TEGUMENTARIA AMERICANA Leishmania (viannia) DE LEISHMANIASIS María E. Bracamonte(1), Silvana P Cajal(2), Carlos L Hoyos(3), Mariza Juárez(4), Sabrina N Portelli(5), Leonardo Acuña(6), Olga Sánchez Negrette(7), Paola A Barroso(8), José F Gil(9), María F. García Bustos(10), Alejandra B Barrio(11), Augusto Bellomio(12), Rubén O Cimino(13), Masataka Korenaga(14), Yoshihisa Hashiguchi(15), Miguel Ángel Basombrío (16), Julio R Nasser(17), Jorge D Marco(18) (1)(3)(5)(7)(8)(10)(16) Instituto de Patología Experimental UNSa CONICET. (2)(4)(9)(17)Instituto de Investigaciones de Enfermedades Tropicales - UNSa , Orán, Salta. (6)(12)Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET-UNT, Tucumán. (11)Instituto de Patología Experimental UNSa CONICET; 4. Cátedra de Microbiología, Facultad de Ciencias de la Salud, UNSa, Salta. (13)Cátedra de Química Biológica, Facultad de Ciencias Naturales, UNSa, Salta. (14)(15)Dept. Of Parasitology, Kochi Medical Sch., Kochi Univ., Nankoku, Japan. (18)Instituto de Patología Experimental UNSa CONICET; Cátedra de Microbiología, Facultad de Ciencias Exactas, UNSa, Salta. E-mail: tefybracamonte@gmail.com Leishmaniasis tegumentaria americana(LTA) es un grupo de enfermedades desatendidas y emergentes cuyo agente causal prevalente en Argentina es Leishmania (Viannia) braziliensis. Las técnicas diagnósticas que se aplican actualmente en el país presentan una eficacia relativamente baja. En este trabajo se evaluó el desempeño inmunodiagnóstico de tres proteínas de fusión expresadas por un sistema bacteriano, y un extracto crudo soluble enriquecido con proteínas de membrana (ESM) obtenidos de una cepa local de L. (V.) braziliensis. Las proteínas recombinantes se denominaron HATLbAg1 (Masa Molecular: 49,76 kDa), HAT-LbAg2 (MM 94, 25) y HAT-LbAg3 (MM 40, 29). Se incluyeron 215 sueros de pacientes que presentaron las formas clínicas cutánea o mucocutánea, diagnosticados por la combinación de métodos parasitológicos, PCR, Intradermorreacción de Montenegro, y el criterio clínico-epidemiológico. La ausencia de LTA se representó con 212 muestras de pacientes diagnosticados no leishmaniásicos, donantes de áreas endémicas y no endémicas de LTA y pacientes seropositivos para Chagas (CH), toxoplasmosis y sífilis. Se estimó la sensibilidad (S) y especificidad (E) para los ELISAs ajustados por doble titulación para cada antígeno y combinación de los mismos. HAT-LbAg1 presentó mayor desempeño diagnóstico: S: 70,71% y E: 72,88% (IC 95%: 61,2-80,2; 60,7-85,1) con respecto a HAT-LbAg2 (68,32; 28,79%) y HAT-LbAg3 (68,37; 47,62%). La combinación de los mismos no mejoró el desempeño individual de HAT-LbAg1 (42,55; 74,17%). El ESM mostró el mejor desempeño diagnóstico 91,27%, 66,23% (IC 95%: 85,9-96,6; 55-77,4), a pesar de su baja especificidad marcada por las reacciones cruzadas con Chagas. Los métodos serológicos de inmunodiagnóstico tienen la ventaja de la aplicabilidad frente a los parasitológicos o moleculares. HAT-LbAg1 y DIAGNOSIS & TREATMENT 119 ESM podrían resultar buenas herramientas de tamizaje. Se deben estudiar nuevas proteínas candidatas y sistemas de expresión eucarióticos para mejorar su desempeño. DYT41 MÉTODO DE FLUORESCENCIA APLICADO AL SCREENING DE DROGAS CON ACTIVIDAD LEISHMANICIDAS Paola A Barroso(1), Cecilia Peréz-Brandán(2), Sabrina Portelli(3), Carlos Hoyos(4), Fernanda García Bustos(5), Estefanía Bracamonte(6), Miguel A Basombrío(7), Jorge D Marco(8) (1) Instituto de Patología Experimental-CONICET. UNSa. . (2)(3)(4)(5)(6)(7)(8)Instituto de Patología Experimental-CONICET. UNSa. E-mail: paobarar@yahoo.com.ar El método convencional para la evaluación de actividad leishmanicida de drogas noveles, se basa en el conteo de parásitos al microscopio óptico. Esta técnica resulta laboriosa en el caso de screening de compuestos. El objetivo de este trabajo fue normatizar un método para determinar la viabilidad de parásitos a través de la expresión de una proteína fluorescente. El gen tdtomato, que codifica para una proteína fluorescente, se subclonó en el plásmido pIR1SAT. Se electroporó una cepa de Leishmania (Leishmania) amazonensis (MHOM/BR/73/M2269) con 10 µg del plásmido linealizado. Los parásitos se seleccionaron con nourseotricina y se clonaron. La expresión de fluorescencia (FL) del clon M2269/tc3, se determinó en promastigotes (PM) y en amastigotes (AM) aislados de macrófagos (MC). Parásitos de M2269/tc3 se diluyeron desde 3x10e8 PM/ml y desde 3x10e7 AM/ml y la FL fue medida en un lector de placas. La eficacia de la miltefosina (MI) fue evaluada empleando el modelo de PM y MC-AM. Para ello, 1x10e7 PM/ml de M2269/tc3 se plaquearon con diferentes concentraciones de MI. En el modelo MC-AM, células J774.1 se infectaron en un radio de 10 PM y se incubaron con diferentes concentraciones de MI. La viabilidad M2269/tc3 se determinó midiendo la FL. Para M2269/WT, la viabilidad se determinó contando el número de PM vivos y calculando el porcentaje de infección en MC-AM. La concentración inhibitoria 50 (CI50) en ambos sistemas se calculó mediante el análisis de regresión no lineal. La expresión de FL de PM y AM fue proporcional al número de parásitos (r2 = 0,98). Los valores de CI50 de MI determinados por el método de FL (PM 5,3 μg/ml, AM 9,3 μg/ml) fueron similares a los obtenidos mediante los métodos convencionales (PM 5,2 μg/ml, AM 3,5 μg/ml). Concluimos que la expresión de FL es un buen indicador de la viabilidad de los parásitos transfectados, útil para el análisis de drogas leishmanicidas de manera simple y rápida en un modelo in vitro de Leishmania (L.) amazonensis. DYT42 TRATAMIENTO ETIOLÓGICO DE T. cruzi CON BENZNIDAZOL (ABARAX) EN UN ÁREA PERI-URBANA DE PAMPA DEL INDIO, CHACO. Paula Sartor(1), Diego Weinberg(2), Fernando Bittel(3), Marcia Goy(4), Cintia Delgado(5), Marcelo Abril(6) DIAGNOSIS & TREATMENT 120 (1)(3)(4) Hospital Dante Tardelli. (2)(5)(6)Fundación Mundo Sano. E-mail: p_sartor@yahoo.com.ar La producción nacional de benznidazol (Abarax, ELEA, ABX) mejoró el acceso al tratamiento para la enfermedad de Chagas (TTO), este tipo de estudios permiten evaluar su farmacoepidemiología en poblaciones prevalentes. En 2013, iniciaron el TTO con ABX (5-8 mg/kg/día, dos tomas, 60 días) 32 pacientes de 6 y 39 años de Pueblo Viejo, zona peri-urbana de Pampa del Indio, Chaco. La dosis media fue de 5,91±1,24 mg/kg/día (95% intervalo de confianza, IC). El 59,4% de los pacientes completó y el 15,6% realizó más de 30 días de TTO. Fue interrumpido por indicación médica a 2 pacientes y 6 lo hicieron voluntariamente (4 presentaron eventos adversos, EA). El 65,6% de los pacientes presentó de 1 a 4 EA. No se registraron diferencias significativas en la ocurrencia de EA según el sexo (15/20 femeninos vs 6/12 masculinos) o la etnia (12/20 Qom vs 9/12 Criollos, test de diferencia de proporciones); tampoco con la edad (con EA 12,5±7,0 vs sin EA 11,0±2,4 años, 95% IC, test de Krustal Wallis). El tiempo medio de aparición de EA fue de 9,6 ±1,9 días, durando 2,62 ±1,02 días (95% IC). El 80% de los EA fueron leves, el 16% moderados y el 4% severos. Del total de EA (n=31) los exantemas fueron los más frecuentes (n=11), seguidos de alteraciones gastrointestinales (n=7), cefalea (n=6), alteraciones de sistema nervioso (n=3), fiebre (n=3) y astenia (n=1). Dos pacientes requirieron internación y el resto de los EA fueron manejados ambulatoriamente con interrupción (n=6), disminución transitorias (n=2) o sin alteración de dosis (n=7), empleando tratamientos paliativos. Durante el TTO con ABX los EA registrados fueron mayoritariamente leves o moderados, que fueron fácilmente controlados. El porcentaje de EA fue superior y el tiempo de aparición de EA fue menor a lo informado en otros estudios con benznidazol (Roche) lo cual podría estar asociado a cambios en la biodisponibilidad de la droga. A diferencia de otros autores, no registramos diferencias en la ocurrencia de EA según la edad. DYT43 MANEJO DEL TRATAMIENTO ETIOLÓGICO DE Trypanosoma cruzi CON BENZNIDAZOL Y NIFURTIMOX EN ÁREAS RURALES LIBRES DE TRANSMISIÓN VECTORIAL Paula Sartor(1), Victoria Cardinal(2), Ivana Colaianni(3), Pilar Fernandez(4), Héctor Freilij(5), Ricardo Gürtler (6) (1) Hospital Dante Tardelli. (2)(3)(4)(6)Laboratorio de Eco-epidemiología-FCEN-UBA. (5) Programa Nacional de Chagas. E-mail: p_sartor@yahoo.com.ar El nifurtimox y el benznidazol son empleados para el tratamiento etiológico de pacientes infectados con T. cruzi. Es importante identificar estrategias que aseguren el acceso temprano al diagnóstico y tratamiento, así como una logística para el manejo de efectos adversos (EA) en poblaciones rurales vulnerables de áreas endémicas bajo control vectorial. En el año 2010 se realizó tratamiento con benznidazol a 90 pacientes de 2 a 27 años (GA) y en 2013 con nifurtimox a 37 individuos de 4 a 21 años (GB) de dos áreas rurales de Pampa del Indio, provincia del Chaco, según la Pauta del Ministerio de Salud de Nación, 2014. El diagnóstico y tratamiento fueron planificados participativamente con la DIAGNOSIS & TREATMENT 121 comunidad, personal del Hospital y Agentes Sanitarios de ambas áreas. El 85% y el 92% de los pacientes del grupo GA y GB completaron el tratamiento. El porcentaje de EA fue de 38% y 58% para GA y GB, respectivamente. El exantema fue el EA más frecuente (28/34) en GA y las cefaleas en GB (12/20). El tiempo medio de aparición de EA fue 12 (GA) y 11 (GB) días. Los pacientes que presentaron EA no modificaron el tratamiento (GA: 18/34; GB: 16/20), lo disminuyeron transitoriamente (GA:4/34; GB:1/20), o lo interrumpieron por indicación médica (GA:5/34; GB:2/20) o por decisión del paciente (GA:7/34; GB:1/20). Al emplear nifurtimox y el benznidazol la mayoría de los EA fueron leves o moderados, pudieron controlarse y requirieron mayor atención en las primeras semanas de tratamiento. Pese a que el porcentaje de EAs fue superior en GB, una mayor proporción de pacientes tratados con nifurtimox completó el tratamiento. Es factible realizar el tratamiento en áreas rurales (bajo vigilancia entomológica) incluso en poblaciones étnicas mixtas. La metodología participativa asegura buena adherencia y porcentaje de culminación del tratamiento y favorece la redefinición de roles de trabajadores de salud y empoderamiento comunitario asegurando la sostenibilidad de las intervenciones. DYT44 AISLAMIENTOS DE Trypanosoma cruzi DE PACIENTES DE ÁREAS RURALES A PARTIR DE UN XENODIAGNÓSTICO ARTIFICIAL Natalia P Macchiaverna, María del Pilar Fernandez , Paula A Sartor, Ricardo E Gürtler, M Victoria Cardinal Laboratorio de Eco-epidemiología, FCEyN, UBA. E-mail: natimacchia@hotmail.com El agente etiológico de la Enfermedad de Chagas, Trypanosoma cruzi, es un hemoparásito de fácil cultivo in vitro. Sin embargo, el aislamiento de parásitos a partir de pacientes crónicos de áreas rurales ha resultado clásicamente una tarea dificultosa no sólo debido a la baja parasitemia propia de esta fase de la enfermedad, sino también a la dificultad de contar con el equipamiento necesario en estudios a campo. Con el objetivo de obtener aislados de T. cruzi de pacientes residentes del área rural del Municipio de Pampa del Indio realizamos xenodiagnósticos artificiales con posterior cultivo del parásito a partir de las heces de las vinchucas infectadas. Se seleccionaron 13 pacientes entre 7 y 18 años, que resultaron seropositivos y estaban en condiciones de iniciar el tratamiento etiológico. Se los consideró pacientes crónicos ya que el área de estudio hacía 4 años que se encontraba bajo vigilancia vectorial. Se tomó hasta 5 ml de sangre heparinizada de cada paciente, la cual fue inmediatamente ofrecida a los triatominos a través de una membrana de profiláctico utilizando un alimentador artificial. Para cada paciente se utilizaron 2 tacos de madera cada uno conteniendo 10 Triatoma infestans de IV estadío hambreados, las cuales se alimentaron durante 20 minutos. A los 30 y 60 días post ingesta se estudió la infección de los triatominos examinando las heces al microscopio óptico y a partir de los positivos, se realizaron cultivos con medio bifásico (BHI enriquecido con SFB y base de agar-sangre). El 69,2% (n=13) de los pacientes tuvo al menos 1 triatomino infectado. La infectividad promedio fue del 14,7% (IC95=10,4-19,7). Se logró aislar y criopreservar el parásito en todos los pacientes con xenodiagnóstico positivo. La DIAGNOSIS & TREATMENT 122 relevancia de este trabajo radica en la elevada eficacia obtenida con este método, posibilitando la obtención de aislados de T. cruzi de pacientes en una zona rural. DYT45 GENETIC ANALYSIS OF TWO RECOMBINANT ANTIGENS IN Trypanosoma cruzi AND THEIR POSSIBLE IMMUNOLOGICAL USE TO DISCRIMINATE CLINICAL FORMS OF DISEASE Gustavo F Saldaña(1), Longhi Silvia(2), Diaz Isabel(3), Curto María de los Angeles(4), Osuna Antonio(5), Schijman Alejandro(6) (1)(2)(4)(6) INGEBI. (3)(5)Inst de BiotecnologiaGrupo Bioquimica y Parasitologia Molecular, Universidad de Granada. E-mail: gsaldania@gmail.com Gold standard diagnosis of chronic Chagas disease (cCD) is based on serological response to antibodies. However, serological kits, mostly those based on recombinant antigens do not depict similar accuracy in different geographic regions. A hypothesis for this is genetic diversity of T. cruzi, whose populations are clustered into six discrete typing units (DTUs) with diverse regional distribution and probably linked to varied clinical forms of chronic phase. Our aim was to characterize two widely used recombinant antigens (JL7 and 1F8) in parasite stocks representing the 6 DTUs. Coding regions were amplified from genomic DNA of six stocks. Primers were designed from CL Brener genome project databank; PCR products were cloned and recombinants were isolated for sequencing and multiple alignments using ClustalT-coffee software. Alignment of 1F8 translated ORFs showed no significant differences among DTUs (90% overall similarity, only 4 conservative substitutions in 198 aa, except for DTUIII with 3 non-conservative changes in the N-term). In contrast, alignment of JL7 ORFs showed significant differences mainly in the C-term region (14 conservative and 12 non-conservative aa substitutions in positions 51-131). The cladogram showed three clusters: Cluster 1 (DTUI and III); cluster 2 (DTUII) and cluster 3 (DTUIV, V, and VI). Accordingly, 18 peptides covering representing the different variants were synthetized to carry out ELISA assays with sera from patients of different regions and clinical manifestations (asymptomatic, cardiac and gastrointestinal). A preliminary assay in sera from DTU I infected patients showed peptides with differential reactivity: JL7-6/10/12 for asymptomatic; JL7-8 for cardiopaths and JL7-11 for gastrointestinal cases (p=0.01 Turkey test). A higher number of serum samples are currently under analysis. Our findings encourage further investigation of these peptides for discrimination of clinical status in cCD patients from different geographic origins. DYT46 ISOLATION OF AN ANTIPROTOZOAL FLAVONOID FROM Stevia satureiifolia var. satureiifolia Maria Florencia Beer(1), Laura C Laurella(2), Orlando Elso(3), Fernanda M Frank(4), Virginia S Martino(5), Maria R Alonso(6), Silvia I Cazorla(7), Emilio Malchiodi(8), Valeria P. Sülsen(9) (1) IQUIMEFA (UBA-CONICET), INTEQUI (CONICET). (2)(3)(5)(9)Cátedra de Farmacognosia, DIAGNOSIS & TREATMENT 123 IQUIMEFA (UBA-CONICET). (4)(7)IMPAM (UBA-CONICET). (6)IQUIMEFA (UBA-CONICET). IDEHU (UBA-CONICET). E-mail: florenciabeer@hotmail.com (8) Parasitic diseases such as Chagas' disease and Leishmaniasis, affect millions of people mainly in developing countries. These parasitosis are part of a group of diseases considered neglected, abandoned and poverty-related. Drugs available to treat these protozoal diseases have limitations due to adverse effects, emerging resistance and lack of effectivity. Taking in account this problem and the previous isolation of a trypanocidal flavonoid from Stevia satureiifolia var. satureiifolia organic extract, the aim of this work was to isolate other bioactive compounds that may be present in this species. The organic extract of S. satureiifolia was subjected to a bioassay-guided fractionation. From one of the most active fraction (F2), a compound (compound 1) was isolated. Compound 1 was evaluated against T. cruzi and L. braziliensis. This compound was active against epimastigotes and trypomastigotes of T. cruzi with IC50 values of 0.65 µg/ml and 58.79 µg/ml, respectively. When compound 1 was tested on promastigotes of L. braziliensis, it showed an IC50 value of 6.77 µg/ml. This compound showed no toxicity to mammalian cells. Chromatographic behavior and UV analysis indicated that compound 1 could be a 5hydroxy-tetra substituted flavone. Further analyses are being conducted in order to complete the identification of compound 1 and to determine its effects on the intracellular forms of the parasites. DYT47 EVALUATION OF FILTER PAPER PROVIDED BY THE NATIONAL NEWBORN SCREENING PROGRAM FOR PCR-BASED DETECTION OF Trypanosoma cruzi Cecilia Irurtia(1), Saldaña G(2), Besuschio S(3), Montenegro G(4), Schijman A G (5) Hospital Posadas-sección Microbiología. (2)(3)(5)INGEBI. E-mail: cecilia.irurtia@yahoo.com (1)(4) Our aim was to evaluate filter paper provided by the National Newborn Screening Program, as support for molecular diagnosis of Chagas disease. DNA was purified from spiked blood samples containing different quantities of T.cruzi cells (CL-Brener) collected in filter paper and in EDTA-tubes. The DNA lysates were amplified by conventional PCR tests targeted to Satellite DNA and Kinetoplastid DNA of T. cruzi and duplex TaqMan Real Time PCR for Satellite DNA and Internal amplification control (Duffy et al., 2013). Concordance between PCR positivity obtained from dry and fresh blood was analyzed by Kappa Index. Analytical sensitivity was 1 parasite equivalent /ml for all PCR approaches using filter paper and fresh blood. Clinical samples were analyzed using filter paper and by column-based fresh blood extraction. Concordance between both extraction methods processed by qPCR gave a Kappa index of 0,744, (p=0,011) and by conventional PCR a kappa index of 1 (p=0.001). Analytical sensitivity obtained from dry blood in filter paper appears adequate for diagnosis of T. cruzi infection. Our results show a very good agreement between processing of peripheral blood from filter paper or EDTA-tubes and encourage field validation studies to assess the application of less-invasive procedures and easier handling and storage of clinical samples for reliable molecular diagnosis of Chagas disease DIAGNOSIS & TREATMENT 124 DYT48 SEARCH FOR ANTIPROTOZOAL COMPOUNDS IN Mikania periplocifolia Laura Cecilia Laurella(1), Orlando Elso(2), Fernanda M Frank(3), Maria F Beer(4), Virginia S Martino(5), Silvia I Cazorla(6), Emilio Malchiodi(7), Valeria P Sülsen(8), Maria R Alonso(9) (1)(2)(5)(8) Cátedra de Farmacognosia, IQUIMEFA (UBA-CONICET),Facultad de Farmacia y Bioquímica, UBA. (3)(6)IMPAM (UBA-CONICET),Facultad de Medicina, UBA. (4)(9)IQUIMEFA (UBA-CONICET),Facultad de Farmacia y Bioquímica, UBA. (7)IDEHU (UBACONICET),Facultad de Farmacia y Bioquímica, UBA. E-mail: laurellacecilia@hotmail.com Chagas' disease and Leishmaniasis are protozoan diseases that cause significant morbidity and mortality. According to the World Health Organization (WHO) they are considered, among others, as Neglected Tropical Diseases (NTDs) affecting mainly poor people throughout developing countries. Chagas' disease or American Trypanosomiasis and Leishmaniasis are caused by the protozoan parasites Trypanosoma cruzi and Leishmania spp., respectively. These parasitosis are endemic in Argentina, where people co-infected with both parasites are commonly found. Nature has provided useful antiparasitic drugs such as artemisinin and chloroquine, within others. We have previously reported the antiprotozoal activity of the organic extract of Mikania periplocifolia. In this sense, the aim of the present work was to isolate the antiprotozoal compounds from M. periplocifolia. The organic extract of M. periplocifolia was fractionated by Silicagel column chromatography. A yellow powder, namely compound A, precipitated from fractions eluted with CH2Cl2: EtOAc (3:1). Chromatographic behavior and UV analysis of compound A indicated that it could be a tetrasubstituted flavone with a free 5 OH group. This compound was evaluated against T. cruzi epimastigotes and L. braziliensis promastigotes by the thymidine uptake technique. Compound A showed trypanocidal and leishmanicidal activity with IC50 values of 4.10 µg/ml and 1.18 µg/ml respectively and presented a CC50 value of 519.11 µg/ml when tested on mammalian cells. These findings prompt us to continue with the study of the antiprotozoal activity of compound A and with the search of other bioactive compounds in M. periplocifolia organic extract. DYT49 ANÁLISIS DE PRESENTACIÓN DE FERTILIDAD DE EQUINOCOCOSIS QUÍSTICA Y DE DISTOMATOSIS EN BOVINOS FAENADOS EN LA REGIÓN METROPOLITANA Constanza Andrade(1), Pamina Horlacher(2), Colette Burotto(3), Felipe Corrêa(4), Caroll Stoore(5), Christian Hidalgo(6), Edgar Jiménez(7), Marcela Hernández(8), Rodolfo Paredes(9) (1)(2)(3)(4)(5)(6)(7)(9) Escuela de Medicina Veterinaria, Facultad de Ecología y Recursos Naturales, Universidad Andrés Bello, Santiago, Chile. (8)Departamento de Patología y Medicina Oral, Facultad de Odontología, Universidad de Chile, Santiago, Chile. E-mail: christian.hidalgo@unab.cl Introducción: Echinococcus granulosus es un helminto que presenta un ciclo de vida de tipo indirecto. En los hospederos intermediarios, se desarrollan los quistes hidatídicos que DIAGNOSIS & TREATMENT 125 pueden ser de tipo fértil, en caso de generar protoescólices, o infértil, si es que no los producen. La razón por la que algunos quistes son fértiles y otros no aún no está clara. Objetivo: Analizar la frecuencia de presentación de la hidatidosis junto a distomatosis en bovinos de la región metropolitana, para determinar si existe una relación entre la infección concomitante de Fasciola hepatica y el estado de fertilidad de los quistes hidatídicos. Material y método: A partir de 2.000 bovinos faenados, se determinó la frecuencia de presentación de hidatidosis por inspección manual de hígados y pulmones de todos los bovinos faenados y en el laboratorio para determinar su estado de fertilidad/infertilidad. Para la detección de distomatosis se realizó la búsqueda manual y por análisis serológico. Resultados y Discusión: De los 2.000 bovinos, 6 presentaban hidatidosis con quistes hidatídicos fértiles, 121 padecían hidatidosis con quistes infértiles, 5 presentaban hidatidosis con quistes fértiles y distomatosis, y por último, 124 bovinos presentaban hidatidosis con quistes infértiles y distomatosis. De acuerdo a lo observado, no se pudo establecer una correlación entre la fertilidad de los quistes y la presencia de F. hepatica. Conclusiones: No se observó una asociación entre las patologías analizadas. Pese a ello se debe continuar estudiando los roles moduladores de la respuesta inmune producidos por estos parásitos y la forma en que ésta puede afectar la fertilidad de los quistes. Agradecimientos: FONDECYT Nº 1130717 DYT50 PCR: VALIDACIÓN DEL DIAGNÓSTICO DE Strongiloides stercORALIS (S.s) EN MUESTRAS CLÍNICAS Repetto S(1), Alba Soto C.(2), Solana ME(3), Ruybal P(4), Lopez C(5), Gonzalez Cappa SM(6) IMPaM. (5)Hospital Durand. E-mail: silvia_repetto@yahoo.com.ar (1)(2)(3)(4)(6) S.s es un nematodo endémico en Argentina. La infección crónica es usualmente asintomática. El diagnóstico se hace por observación de larvas en materia fecal (mf) con métodos convencionales y cultivo en agar nutritivo (CAN). El subdiagnóstico en inmunocomprometidos conduce a cuadros severos de infección. Por ello, estandarizamos una PCR cualitativa en mf que detecta 1 larva/g mf. La primera validación de esta técnica se realizó en un estudio descriptivo de cohorte transversal a doble ciego con pacientes (pac) > 18 años estratificados en 6 grupos (g). Área endémica, sin riesgo de reinfección exógena, inmunocomprometidos: (g A) con y (g B) sin eosinofilia (eo); inmunocompetentes: (g C) sin y (g F) con eo. Sin antecedentes de área endémica: (g D) con eo y (g E) pac con parasitológicos negativos. Se evaluó eo (>450eo/mm3), coproparasitológico seriado (Ritchie). En una muestra de mf fresca se realizó examen microscópico directo, PCR y CAN en 3 placas/ pac (3 gr/placa). El CAN se realizó en hasta 4 muestras sucesivas en diferentes días. Se utilizó el programa estadístico SSPS. Se estudiaron 237 pac: g A: 50; g B: 29; g C: 29; g D: 30; g E: 45 y g F: 30; 45,5% hombres. La mediana de edad fue 38 ±15,45 años. Se diagnosticó estrongiloidosis en 71 pac. La frecuencia fue de 57,3% y de 35,2 % en los grupos con antecedentes de área endémica con eo (g A y g F) y en grupos sin eo (g B y g C), respectivamente. El CAN fue positivo en 35/71 requiriéndose hasta cuatro muestras para arribar al diagnóstico por este método. La PCR fue positiva en la primera muestra en 69/71 pac. Se detectó S.s solo por PCR en 36 pac (50,7%). La sensibilidad de la PCR fue 94% y el VPN 98% cuando se la DIAGNOSIS & TREATMENT 126 comparó con el CAN. La frecuencia de esta parasitosis es alta en pac con antecedentes de área endémica sin riesgo de infección exógena. La PCR permite adelantar el diagnóstico en tres semanas con respecto al diagnóstico convencional. DYT51 ESTRATEGIAS PARA EL DIAGNÓSTICO DE LEISHMANIASIS TEGUMENTARIA AMERICANA (LTA) POR PCR EN EL NORTE DE SALTA Carlos L Hoyos(1), Silvana P Cajal(2), Marisa Juarez(3), Paola Barroso (4), Estefanía Bracamonte (5), Sabrina Portelli (6), José F Gil(7), Julio R Nasser(8), Alejandro J Krolewiecki (9) , Ruybal Paula(10), Jorge D Marco(11) (1)(7)(9) Instituto de Investigaciones en Enfermedades Tropicales. UNSa Sede Oran. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). . (2)(3)Instituto de Investigacion en enfermedades Tropicale . UNSa Sede Oran . (4)(5)(6)Instituto de Patología Experimental-Conicet, Univ. Nacional De Salta.. (8)Instituto de Investigaciones en Enfermedades Tropicales. UNSa Sede Oran. . (10)Instituto de Investigaciones en Microbiología y Parasitología Médica, UBA-CONICET, Facultad de Medicina, Universidad de Buenos Aires.. (11)Instituto de Patología Experimental-Conicet, Univ. Nacional De Salta. Instituto de Investigaciones de Enfermedades Tropicales (IIET), Sede Regional Orán, Fac. Cs de la Salud, Univ. Nacional de Salta.. E-mail: carloslhoyos@gmail.com La LTA es una enfermedad parasitaria endémica en norte de la provincia de Salta, causada principalmente por Leishmania (Viannia) braziliensis. Los métodos de diagnóstico directo actuales tienen una sensibilidad relativamente baja. En este trabajo se evaluaron 3 métodos de la obtención de ADN de las lesiones de pacientes, para mejorar el desempeño diagnóstico de métodos basados en PCR. Primero se comparó la capacidad de elusión de material biológico de tres soluciones, solución salina balanceada - Prolina (PBSS), buffer de lisis (BL) y solución fisiológica (SF). En una segunda fase, se compararon las capacidades de extracción de palillos e hisopos de algodón obtenidos de las lesiones. Los templados de ADN se obtuvieron siguiendo el método descripto por Higuchi (1989) y se normatizaron las condiciones de ciclado para la amplificación de un fragmento de 700 pb del minicirculo de Leishmania sp. por PCR. Para la primera etapa se obtuvo material biológico de 16 pacientes, de los cuales en 12 se observaron amastigotes en frotis. Se obtuvo la amplificación en el 66, 75 y 66% de las muestras procesadas en PBSS, BL y SF, respectivamente. Sin embargo, se obtuvieron bandas de mayor intensidad en material procesado con SF. En la segunda fase se utilizó SF para extraer 21 muestras, todas de pacientes con presencia de amastigotes. Se obtuvo amplificación en 70 y 81,8% de las muestras obtenidas con palillos o hisopos respectivamente que en conjunto representa un 76% de amplificación. Además, en estas últimas muestras, se logró observar la banda esperada, hasta en una dilución 1/600. La aplicación de estas estrategias de toma de muestra posibilita la amplificación eficiente en templados diluidos de ADN de lesiones. Es necesario evaluar el desempeño diagnóstico de las PCRs, evaluar nuevos primers, y condiciones que permitan la detección y tipificación de Leishmania spp., en muestras de pacientes que generalmente presentan baja carga parasitaria en sus lesiones. DIAGNOSIS & TREATMENT 127 DYT52 REACTIVIDAD DE LOS ANTÍGENOS TCTASV-A Y TCTASV-C DE Trypanosoma cruzi PARA LA DETECCIÓN DE LA INFECCIÓN EN SUEROS DE PERROS DE ÁREA ENDÉMICA Noelia Floridia Yapur(1), Valeria Tekiel(2), Anahí Alberti D’ Amato(3), Mercedes Monje Rumi(4), Juan J. Lauthier(5), Nicolás Tomasini(6), Paula Ragone(7), Patricio Diosque(8), Rubén O. Cimino(9), Julio R. Nasser(10) (1)(9)(10) Cátedra de Química Biológica. FCN, UNSa. Instituto de Investigaciones en Enfermedades Tropicales, Sede Orán, UNSa.. (2)CONICET. Instituto de Investigaciones Biotecnológicas “R. Ugalde”, IIB-Intech, UNSAM-CONICET.. (3)(4)(5)(6)(7)Unidad de Epidemiología Molecular (IPE), UNSa.. (8)CONICET. Unidad de Epidemiología Molecular (IPE), UNSa.. E-mail: narfy89@hotmail.com La determinación de la infección por T. cruzi de manera sensible y específica en perros es muy relevante para la implementación de programas de control epidemiológico en zonas endémicas. Las proteínas de la familia TcTASV (subfamilias A, B, C) no poseen ortólogos en otras especies y se expresan diferencialmente en los estadios de T. cruzi que parasitan al mamífero, lo que sugiere que podrían ser potencialmente útiles para el diagnosticar la infección. El objetivo de este trabajo fue determinar la reactividad de sueros de perros frente a las proteínas recombinantes TcTASV-A y TcTASV-C (fusionadas a GST) mediante ELISA. Los sueros fueron previamente clasificados como Tc+ (infectados) ó Tc- (no infectados) mediante ELISA, utilizando un homogenado del parásito como antígeno (ELISA-HT), que es una técnica de alta sensibilidad pero con demostrada reactividad cruzada con parásitos emparentados. Se analizó la reactividad anti-TcTASV de 30 sueros Tc- provenientes perros de área no-endémica y 70 sueros Tc+ de perros de área endémica (en 35 de éstos perros se detectó también la presencia de T. cruzi por xenodiagnóstico y/o PCR). La reactividad contra cada uno de los antígenos TcTASV se evaluó en ensayos de ELISA independientes; cada muestra se analizó por duplicado y se calculó la relación DOAg/DOGST. El 53% (37/70) y 57% (40/70) de los sueros Tc+ fueron reactivos contra TcTASV-A y TcTASV-C, respectivamente; ningún suero Tc- presentó reactividad contra TcTASV. La reactividad de los sueros con XD y/o PCR positiva fue, en promedio, superior a la de aquellos positivos sólo por ELISA-HT. En conjunto, el 76% (53/70) de los sueros Tc+ reaccionó contra TcTASV-A ó TcTASV-C, con una concordancia Kappa sustancial (IK=0,65) con la prueba ELISA-HT. La reactividad observada contra ambos antígenos permite plantear a futuro la utilización de mezclas TcTASV-A+C para optimizar la detección de la infección por T. cruzi en sueros de perros, en un único ensayo que presenta 100% de especificidad. DYT53 RIESGO DE INFECCIÓN CON Trypanosoma cruzi EN UNA POBLACIÓN RURAL INDÍGENA DEL CHACO ARGENTINO DIAGNOSIS & TREATMENT 128 María del Pilar Fernández(1), Paula Sartor(2), María Sol Gaspe(3), Yael Mariana Provecho(4), Ricardo Esteban Gürtler(5) (1)(3)(4)(5) Laboratorio de Eco-epidemiología, IEGEBA, CONICET- Depto. EGE, UBA. (2) Laboratorio de Eco-epidemiología, IEGEBA, CONICET- Depto. EGE, UBA / Hospital "Dante Tardelli", Pampa del Indio, Chaco. E-mail: mpfernandez@ege.fcen.uba.ar La enfermedad de Chagas constituye un sistema complejo compuesto por múltiples factores ecológicos, socio-demográficos y culturales operando a diversas escalas en ambientes variables. El objetivo de este trabajo fue evaluar la seroprevalencia de T. cruzi en 6 parajes rurales predominantemente indígenas (Qom) en Pampa del Indio, Chaco, mediante una encuesta transversal y con vistas a implementar el tratamiento etiológico. Este trabajo se encuadra en un programa más amplio sobre la (re)infestación por Triatoma infestans y la transmisión de T. cruzi, que incluyó un rociado con piretroides de todas las viviendas en 2008. La infestación domiciliaria pre-rociado era 31.9%, descendiendo a <0.5% post-rociado hasta la actualidad. Los diagnósticos serológicos se realizaron entre agosto de 2012 y julio de 2013, utilizando dos ensayos inmunoenzimáticos (EIA Lisado y Rec V3.0, Wiener), a aquellas personas que firmaron el correspondiente consentimiento informado. Se diagnosticó a 1202 personas (50.2% de la población) y la seroprevalencia fue del 24.2%, siendo significativamente mayor en los Qom (25.0%) que en la minoría criolla (14.2%). La seroprevalencia en niños nacidos luego de 2008 (<5 años en 2012) fue del 3.5%, aumentando desde 6.0 al 18.4% entre los 5 y 24 años de edad (OR=2.9) y alcanzando un plateau entre los mayores de 25 (40.0-67.7%; OR=29.3). Mediante un análisis de regresión logística multivariada con efectos aleatorios de la infección en el grupo etario 5-15 años (n=281), se halló que el riesgo aumentaba con la edad al momento del rociado (OR=1.5), si la madre era seropositiva (OR=13.1), si la vivienda se hallaba infestada en el pre-rociado (OR=6.4) y si el género era femenino (OR=6.7). La infección además estaba agregada a nivel del hogar. La relación de la seroprevalencia con factores demográficos y entomológicos hallada, evidencia una transmisión vectorial reciente y variable en el tiempo. DYT54 DETECCIÓN MOLECULAR DE Acanthamoeba spp Leonardo Fioravanti, María C Irurtia, Alejandra Magdaleno, Graciela Montenegro, Graciela Peluffo, Susana Di Bartolomeo, Silvia Balconi Hospital Posadas. E-mail: cecilia.irurtia@yahoo.com Introducción: Acanthamoeba spp. es una ameba de vida libre (AVL) que produce en el hombre Queratitis por Acanthamoeba (QA). Esta entidad tiene buena respuesta al tratamiento si es diagnosticada a tiempo, lo que hace importante su correcta detección. Esta enfermedad está asociada en un 80% a usuarios de lentes de contacto, principalmente aquellos que tienen una mala práctica higiénica de los mismos. Hoy existen técnicas de biología molecular que detectan especies de Acanthamoeba. Objetivos: Puesta a punto de la técnica de reacción en cadena de la polimerasa (PCR) para la identificación de Acanthamoeba spp. Materiales y métodos: Se cultivaron DIAGNOSIS & TREATMENT 129 muestras de agua en agar no nutritivo con una suspensión de E. coli como fuente de alimento para la ameba. Luego de incubar 48 hs a 37°C se observó al microscopio óptico entre porta y cubreobjetos y se realizó coloración de Giemsa del cultivo. También se obtuvo una suspensión de Acanthamoeba spp. en solución de Page y se extrajo su ADN con columnas comerciales. A partir de aquí se realizó una PCR descripta por Schroeder y cols. en el año 2001, que amplifica un segmento de ADN que codifica para la subunidad ribosómica 18S específica del género. Resultados: Al microscopio se observaron quistes y trofozoitos compatibles con Acanthamoeba spp. Con la PCR se obtiene una banda de entre 450 y 500 pb correspondiente al segmento amplificado. Conclusiones: La PCR es una técnica que podría utilizarse para la detección de Acanthamoeba spp. a partir de muestras biológicas. EPIDEMIOLOGY & VECTORS 129 EYV01 EVALUACIÓN DIAGNÓSTICA DE LOS ANTÍGENOS RECOMBINANTES P2ß Y B13 DE Trypanosoma cruzi EN SUEROS DE PERROS INFECTADOS NATURALMENTE Fátima C Gómez Gramajo(1), Mercedes Monge Rumi(2), Paula Ragone(3), Juan Lauthier(4), Nicolás Tomasini(5), Anahí Alberti DAmato(6), Patricio Diosque(7), Julio R Nasser(8), Iván Marcipar(9), Rubén Cimino(10) (1) 1Cátedra de Química Biológica, Facultad de Ciencias Naturales, UNSa.. (2)(3)(4)(5)(6)(7) 4Unidad de Epidemiología Molecular (IPE-CONICET), UNSa.. (8)1Cátedra de Química Biológica, Facultad de Ciencias Naturales, UNSa. 2Instituto de Investigaciones en Enfermedades Tropicales, Sede Regional Orán, UNSa.. (9)3Laboratorio de tecnología Inmunológica. Facultad de Bioquímica y Ciencias Biológicas. UNL.CONICET. . (10) 1Cátedra de Química Biológica, Facultad de Ciencias Naturales, UNSa. 2Instituto de Investigaciones en Enfermedades Tropicales, Sede Regional Orán, UNSa. . E-mail: faticeci712@gmail.com La enfermedad de Chagas es la parasitosis más importante de Latinoamérica que afecta a millones de personas y constituye un serio problema para la salud pública. El estudio de antígenos recombinantes, potencialmente específicos, frente a paneles de sueros de regiones endémicas es importante para determinar el valor diagnóstico de éstos. Los perros constituyen un importante reservorio del parásito en el ciclo domiciliario de la infección; por lo que en los últimos años se han llevado a cabo numerosos estudios para mejorar su diagnóstico debido a que estos animales pueden ser utilizados como “centinelas” en la transmisión de T. cruzi. El objetivo de este trabajo fue evaluar la capacidad diagnóstica de los antígenos recombinantes del parásito P2ß y B13 y de una mezcla antigénica de ambos. Se trabajó con 2 grupos de sueros; Controles positivos: 43 sueros de perros infectados naturalmente con serología y/o xenodiagnóstico y/o PCR positivo para T. cruzi; Controles negativos: 22 sueros de perros de un área no endémica, todos con serología negativa para T. cruzi. Para los ensayos serológicos se trabajó con los antígenos recombinantes P2ß, B13 y mezcla de ambos en concentración 0,25µg/poc/100µL en buffer bicarbonato (pH:9.6). La dilución de suero, Ac. 2° biotinilado (IgG total anti-dog) y de adivina-peroxidasa fue de 1/50, 1/1250 y 1/8000, respectivamente. Se utilizó el programa GraphPadPrism5 para calcular el Área Bajo la Curva (ABC) ROC para cada ensayo de ELISA. El ABC para ELISA-P2ß fue de 0,91 [IC95%: 0,83-0,99]; para ELISA-B13 [IC95%:0,80-0,10] fue de 0,91; mientras que la mezcla ELISA-P2ß+B13 tuvo un ABC 0,71 [IC95%:0,58-0,84]. Los antígenos recombinantes (P2ß y B13) evaluados individualmente presentaron mejor rendimiento que cuando fue evaluado usando una mezcla entre ambos, según la comparación del Área Bajo la Curva ROC para cada ensayo. EYV02 PRESENCIA DE Acanthamoeba EN AGUAS DE BEBIDA PARA CONSUMO GANADERO Maria del carmen rojas(1), Sixto Raúl Costamagna(2), Marcelo RodriguezFermepin(3) (1) EEA Anguil INTA. (2)Cátedra de Parasitología Clínica. Departamento de Biología, Bioquímica y Farmacia. Universidad Nacional del Sur. Bahía Blanca. (3)Cátedra de Análisis EPIDEMIOLOGY & VECTORS 130 Clínicos I, Área Inmunología Clínica, Departamento de Bioquímica Clínica, Facultad de Farmacia y Bioquímica, UBA. E-mail: rojas.maria@inta.gob.ar Introducción: Las amebas son protozoos que pueden desarrollarse en múltiples ambientes en condición de vida libre (AVL) o parásita. Estos organismos han adquirido mayor atención al ser causales de enfermedades en humanos y animales.Acanthamoeba ha sido aislada de una amplia variedad de hábitats, siendo el agua una importante vía de diseminación y contagio.El objetivo de este trabajo fue estudiar la presencia,identificación y confirmación por métodos moleculares, de Acanthamoeba en sistemas ganaderos de la provincia de La Pampa.Materiales y Métodos: Se analizaron aguadas de 50 establecimientos ganaderos de la provincia de La Pampa. Las muestras reposaron en laboratorio 24 horas. Se retuvo un volumen de 40 ml y se centrifugóa volumen cero 10 minutos a 2000 rpm. Los sedimentos se sembraron en agar no nutritivo al 1.5%, suplementado con una suspensión de Echerichia coli en solución de Page y cultivados a 37ºC. La muestra fue considerada negativa cuando no se detectó crecimiento después de 15 días de incubación.Se caracterizó microscópicamente la morfología de trofozoítos y quistes.Los cultivos fueron concentrados por centrifugación y purificados siguiendo el procedimiento UNSET. Los fragmentos del gen del ADNr18S de Acanthamoebafueron amplificados mediante el set de primers JDP1/JDP2. El control positivo fue una cepa de laboratorio.Resultados: Se identificaron AVL en 39 establecimientos (78%) pertenecientes al género Acanthamoeba. Los diámetros promedio de trofozoitos y quistes fueron 11.8 ± 2 y9.6± 0.2 µm, respectivamente. En el 54% (21) de lasmuestras correspondieron al grupo II y en 46% (18)al grupo III de Pussard. Hasta la fechase tipificaron 15 aislados, por PCR, 10 de los cuales confirmaron su correspondencia con Acanthamoeba sp.Conclusiones: Se confirmó la presencia de Acanthamoeba en aguadas de sistemas ganaderos en la provincia de La Pampa, existiendo una fuente de infección para el ganado y personal rural. EYV03 ORIGEN DE INDIVIDUOS REINFESTANTES DE Triatoma infestans EN UN PARAJE RURAL DEL GRAN CHACO ARGENTINO Romina V Piccinali, Ricardo E Gürtler Laboratorio de Eco-Epidemiología. EGE.FCEN. UBA. IEGEBA. CONICET. E-mail: rpicci@ege.fcen.uba.ar Un aspecto fundamental para el control vectorial de la enfermedad de Chagas es identificar las causas de la incompleta eliminación de Triatoma infestans en comunidades rurales aisladas que fueron tratadas con insecticidas. Estas fallas de control pueden deberse a múltiples factores y por esta razón resulta importante investigar el proceso de reinfestación y establecer si los insectos que se encuentran después de la aplicación de insecticidas son supervivientes o inmigrantes desde otras fuentes. En este trabajo se estudia la dinámica de reinfestación de las viviendas por T. infestans analizando la estructura genética de este insecto a una micro-escala (500-2000 m) y el origen de los individuos reinfestantes en un paraje rural del municipio de Pampa del Indio, Chaco, el cual fue rociado con insecticidas en 2007 y continúa bajo vigilancia entomológica. Se genotiparon para 10 loci microsatélites insectos colectados en 16 viviendas antes de un EPIDEMIOLOGY & VECTORS 131 rociado masivo con insecticidas (pre-rociado, N=225) y a los 6 y 10 meses del mismo (post-rociado, N=56). Se realizó un análisis de agrupamiento con STRUCTURE 2.3.4 y una prueba de asignación con Geneclass 2.0. Se detectaron 3 grupos genéticos diferentes, con niveles variables de admixture. Los individuos de pre-rociado de una misma vivienda fueron en general más parecidos entre sí que respecto de otras viviendas. Los insectos de post-rociado mostraron proporciones de cada grupo genético similares a las de los insectos de pre-rociado del mismo sitio, con excepción de un macho y una ninfa V colectados en 2 viviendas. Estos 2 individuos, junto con otras 2 ninfas V de una tercera vivienda, resultaron excluídos en la prueba de asignación cuando se los comparó con la población de pre-rociado de la vivienda donde fueron colectados. Estos resultados indican que la infestación post-rociado se origina principalmente en focos residuales pero que también existen eventos de migración de insectos desde otras viviendas o fuentes no muestreadas. EYV04 PREVALENCIA DE PARASITOSIS EN DISTINTOS BARRIOS DE LA CIUDAD DE ORAN PROVINCIA SALTA Silvana Pamela Cajal(1), Caro Nicolas(2), Juarez Marisa del Valle(3), Canavire Maria (4), Krolewiecki Alejandro (5) (1) Universidad Nacional de Salta - Instituto de Investigaciones de Enfermedades Tropicales. (2)(3)Universidad Nacional de Salta - Fundacion Mundo Sano. (4)Universidad Nacional de Salta. (5)Universidad Nacional de Salta - Instituto de Investigaciones de EnfermedadesTropicales . E-mail: spcajal@yahoo.com.ar INTRODUCCIÓN La alta incidencia de infección por parásitos intestinales afecta la salud de los individuos, pudiendo causar anemias y función cognitiva, principalmente en niños, quienes son los más afectados. El problema de las infecciones helmínticas se encuentra concomitantemente a la desnutrición en zonas de bajos recursos y con inadecuada infraestructura sanitaria. OBJETIVOS: Determinar prevalencia del parasitismo intestinal, en distintos barrios de la ciudad de Oran, mediante técnicas sencillas y de alto rendimiento. MATERIAL Y METODO: Se incluyo 449 individuos entre 1 y 70 años de edad, de ambos sexos, que asistieron en búsqueda de diagnostico coproparasitológicos al IIET. Se realizo estudios coproparasitologicos, de heces obtenidas por evacuación espontanea, mediante examen previa concentración, por centrifugación y método de flotación, ficha personal que incluye datos, epidemiológicos, número de identificación, nombre, edad, sexo, residencia. RESULTADOS: Se encontró que el 57,68 % (n=259) de las personas están parasitadas. Se los agrupo dependiendo de la precedencia 10 Centros de Salud. Los enteroparásitos más frecuentes fueron Giardia lamblia (22%) seguidas por Entamoeba coli (17,4%), Hymenolepis nana (12%), Ascaris lumbricoides (7,3%), Enterobius vermicularis (1,5%), Strongyloides stercorlis (0,9%) Uncinarias spp (0,9%). CONCLUSION: distribución uniforme de las parasitosis intestinalis en distintos grupos etareos evaluados y diferentes barrios de la ciudad, evidencia la exposición en todas regiones de la ciudad. DISCUSIÓN Los resultados muestran predominancia de protozoarios sobre helmintos, indicando que la población posee alta contaminación fecal, debido a medidas deficientes de salubridad, debiéndose implementar programas de EPIDEMIOLOGY & VECTORS 132 control y prevención de enteroparásitos; una sencilla, económica y eficaz técnica diagnóstica y adecuado tratamiento antiparasitario, para el control de las parasitosis intestinales. EYV05 LEISHMANIASIS VISCERAL CANINA (LVC): VÍAS DE TRANSMISIÓN (VdT) EN ZONAS NO ENDÉMICAS (ZnE) Victoria Fragueiro Frías, Vanesa Negri, Concepción Luna, Ángel Sinagra, Carlos Pravia, Adelina Riarte INP. Fatala Chabén. E-mail: vickyfragueiro@hotmail.com La LVC es una enfermedad zoonótica causada por Leishmania infantum syn L.chagasi, vector Lutzomia longipalpis y reservorio el perro infectado, con o sin manifestaciones clínicas. La investigación de foco del 1° caso autóctono reveló concurrencia de agente etiológico, vector y reservorio. Dado que LVC precede a la aparición de LV humana, la vigilancia laboratorial de caninos es parte de la estrategia de control. El diagnóstico de LVC es necesario para la implementación de medidas destinadas a interrumpir la transmisión. La vectorial es la VdT predominante en zonas endémicas (ZE), pero existen evidencias de VdT vertical, venérea, transfusional y horizontal, de escasa relevancia en ZE, perpetuando la presencia de portadores en ZnE. En el Instituto Nacional de Parasitología, período 2009 - 2013 se evaluaron 1649 canes por inmunocromatografía rK39 (KalazarDetect), frotis (PAAF de ganglio/médula ósea/ lesiones cutáneas), cultivos, inoculación en hámsters y/o PCR. Provenientes de estudios de campo en ZE, 1515 y de centros veterinarios, 134. En los perros positivos se evaluaron vías de contagio, aspectos epidemiológicos, clínicos y de laboratorio, resultando 44 positivos: 11 de ZnE adquirieron la enfermedad por viaje a ZE; 5 transmisión vertical; 1 transfusional; 1 horizontal y 5 en países limítrofes. La intervención sobre el reservorio impide la circulación y/o dispersión geográfica de la LV. El manejo del reservorio es complejo, debe desarrollarse de manera intersectorial y las medidas de control acompañarse de políticas públicas que den sustento legislativo a las acciones. Habiendo evidencias de otras VdT, los perros sospechosos de LVC se deben monitorear rigurosamente: evitar la transmisión venérea, el traslado de perros sanos y/o infectados desde/hacia ZE e ingresos provenientes de terceros países; normatizar el control de criaderos; realizar serología a dadores de sangre y difundir entre veterinarios el riesgo de las transfusiones sin control. EYV07 IMPACTO DE LA INSTALACIÓN DE NUEVAS VIVIENDAS SOBRE LA INFESTACIÓN POR Triatoma infestans EN LOS LLANOS(LA RIOJA) María J Cavallo, Ivana Amelotti, Silvia S Catalá, David E Gorla Centro Regional de Investigaciones Científicas y Transferencia Tecnológica (CRILAR). E-mail: mariajosecavallo@hotmail.com EPIDEMIOLOGY & VECTORS 133 El mal de Chagas, producido por Trypanosoma cruzi, es la enfermedad endémica más importante de Argentina. A través del Programa de Erradicación de Viviendas Rancho (VR), el Gobierno de La Rioja construyó nuevas viviendas (NV) en áreas rurales para reemplazar las VR y mejorar la calidad de vida de las comunidades. El objetivo de este trabajo es evaluar el efecto de la instalación de NV en un departamento provincial de Los Llanos riojanos sobre la infestación domiciliaria por T. infestans antes y después de la instalación de las NV. Durante 2014 se visitaron los 8 departamentos de los Llanos riojanos para realizar un relevamiento donde se registró la ubicación de cada una de las NV, características constructivas, coordenadas geográficas, datos demográficos, tipos de estructura del peridomicilio y la presencia/ausencia de VR asociadas a las NV. Se relevaron un total de 238 NV, de las cuales la mayoría pertenecían al Dpto. San Martin (91 NV), históricamente el de mayor prevalencia de infestación por T. infestans. De las 91 NV de San Martin, 68 cuentan con registros históricos de infestación en las bases de datos del Programa Chagas La Rioja. En el año 2006 se encontró 17% de infestación intradomiciliaria (ID) y 41% infestación peridomiciliaria (PD). En 2011, en las NV, se registró 13% de infestación ID y 37% de infestación PD. Estos resultados preliminares no muestran diferencias significativas en la prevalencia de infestación (OR=0.71 [0.2-2.3]) luego de la construcción de las NV. El 67 % de NV aún conserva a pocos metros (x=26.3 m) las VR, donde previamente había infestación de T. infestans. Es posible que en el movimiento de pertenencias domésticas a la NV exista transporte pasivo de T. infestans en alguno de sus estados de desarrollo, iniciando una nueva colonización. Aún cuando en la muestra de viviendas analizadas la infestación es relativamente elevada, no existen en la región niños <5 años infectados por T. cruzi. Financiación: CONICET y PICT-1109 (ANPCYT) EYV08 INTESTINAL PARASITES CAUSED BY GEOHELMINTHS IN CHILDREN FROM ARGENTINA Paola Cociancic(1), María L Zonta(2), Mariela Garraza(3), Graciela T Navone(4) Centro de Estudios Parasitológicos y de Vectores (CEPAVE). UNLP-CONICET-CCT La Plata . (3)Centro de Estudios Parasitológicos y de Vectores (CEPAVE). UNLPCONICET-CCT La Plata; Instituto de Genética Veterinaria “Ing. Fernando Noel Dulout” (IGEVET). FCV, UNLP- CONICET-CCT La Plata . E-mail: paolacociancic@cepave.edu.ar (1)(2)(4) In Argentina, the taxonomic composition and distribution of intestinal parasites in human populations differ depending on climatic, geographic and socio-economic factors of a particular area. The aim of the present study was to determine the prevalence of intestinal parasitism caused by geohelminths in children of Argentina according to biogeographical features of studied regions. Serial fecal samples of 3533 children of both sexes up to 14 years old were analyzed. They were grouped into two ranges of age (≤ 5 and ≥ 6 years old). This study was performed in different localities in Buenos Aires (BA), Corrientes (CO), Chubut (CH), Entre EPIDEMIOLOGY & VECTORS 134 Ríos (ER), La Pampa (LP), Mendoza (ME), Misiones (MI) y Salta (SA). Data was processed with Epi Info 7. Nine percent of the total population analyzed (310/3533) were parasitized by at least one geohelminth, such as Ancylostomids (4.7%), Strongyloides stercoralis (3.3%), Ascaris lumbricoides (2.5%) and Trichuris trichiura (0.7%), which were more frequent among children older than 6 years old (p˂0.01). Sex differences were nonsignificant. The highest prevalence of geohelminths was observed in MI (23.3%), followed by CO (6.7%), BA (5.7%), ER (0.75%) and ME (0.7%) (p<0.01). Geohelminths were not found in CH, LP and SA. Ascaris lumbricoides was highest in BA and CO (5%) followed by MI (2.6%) and ME (0.3%) (p˂0.01). In MI, S. stercoralis and Ancylostomids showed a higher value than in BA (11.1% vs. 0.2%) and ME (16.2% vs. 0.4%), respectively. In BA, the presence of A. lumbricoides was associated to T. trichiura. In MI, S. stercoralis was associated to A. lumbricoides and Ancylostomids. The differences observed in the distribution of the geohelminths could be caused by environmental humidity and temperature, as well as to the soil type where eggs and larvae develop, between other factors. In Argentina, the distribution and prevalence of geohelminths fluctuate, being possible to estimate a multiplicity of causal factors of these infections. EYV09 Cryptosporidium spp. PREVALENCE AND MOLECULAR IDENTIFICATION OF Cryptosporidium parvum IN DAIRY CALVES FROM CORDOBA, ARGENTINA Joaquín A Lombardelli(1), Guillermo Giaj-Merlera(2), Mariela L Tomazic(3), Leonhard Schnittger(4), Karina I Tiranti(5) (1)(5) Departamento de Patología Animal, Facultad de Agronomía y Veterinaria, Universidad Nacional de Río cuarto. (2)Departamento de Microbiologia e Inmunologia, Facultad de Ciencias Exactas, Fco-Qcas y Naturales, Universidad Nacional de Río cuarto. (3)(4)Instituto de Patobiología, Centro de Investigaciones en Ciencias Agronómicas y Veterinarias, INTA-Castelar. E-mail: jlombardelli@gmail.com Cryptosporidiosis is an important cause of gastrointestinal disease worldwide in a variety of hosts, including humans and cattle. Cryptosporidium parvum as a causative agent represents the main zoonotic species and is transmitted by ingestion of food and water contaminated with oocysts as the infective parasite stage. The objective of this study was to estimate Cryptosporidium spp. prevalence and identify C. parvum in dairy calves from Córdoba, Argentina. Fecal samples were obtained from calves less than 7 weeks of age and oocysts were concentrated with Telleman procedure, and subsequently stained using the modified Ziehl-Neelsen technique. DNA samples were subjected to PCR-RFLP analysis of the 18S rRNA in order to identify C. parvum. A total of 1050 samples from 54 dairy farms were recollected between April and October of 2013. Eighty nine percent of dairy herds presented at least one positive calf. Prevalence of Cryptosporidium spp. on positive dairy herds ranged from 8% to 57% (mean 27%), and in 44.4% of the herds the prevalence was higher than the mean value. Cryptosporidium spp. calf prevalence was EPIDEMIOLOGY & VECTORS 135 26.4% (95% CI: 23.6; 29.1), calves younger than two weeks were almost two times more likely to be positive to Cryptosporidium spp. in comparison to older ones (RP: 1.8, 95% CI: 1.4; 2.2). Six of 35 samples were identified as C. parvum by PCR-RFLP. The current study revealed that Cryptosporidium spp. has a high prevalence in the area, with higher rate of positives in calves younger than two weeks. C. parvum was identified in calves, representing a risk of zoonotic infection in high prevalence herds. EYV10 CARACTERIZACIÓN TOXICOLÓGICA, ENZIMÁTICA Y MOLECULAR DE Triatoma infestans RESISTENTES A DELTAMETRINA EN COMUNIDADES RURALES DE SANTA CRUZ, BOLIVIA Claudia V Vassena(1), Pablo L Santo Orihuela(2), Paula Marcet(3) Centro de Investigaciones de Plagas e Insecticidas (CONICET/UNIDEF). (3)CDC Centers for Disease Control and Prevention, Atlanta, EEUU. E-mail: cvassena@gmail.com (1)(2) Trabajos realizados durante la última década, mostraron que la resistencia a insecticidas en T.infestans es un problema complejo. En Bolivia se detectaron altos niveles de resistencia en poblaciones de Tarija, Chuquisaca y Cochabamba relacionados a fracasos en el control. Se estudió la susceptibilidad a deltametrina en poblaciones de T. infestans en comunidades rurales del departamento de Santa Cruz donde el control vectorial fue irregular y discontinuo. Se capturaron T. infestans en domicilios de Guasuanti, El Cruce e Itapicué que se criaron en laboratorio hasta la obtención de huevos. Se realizó un análisis toxicológico y se evaluó la contribución de piretroide-esterasas en ninfas I. Se compararon los parámetros de dosis letal (DL50) de las poblaciones de ensayo y la de referencia. Mediante secuenciación de ADN, se evaluó la presencia de mutaciones en el gen del canal de sodio, previamente descritas como causantes de resistencia a piretroides. Las poblaciones presentaron diferentes grados de resistencia la deltamentrina (Guasuanti RR=2.71; Itapicue RR=10.62 y El Cruce 13.90). Los valores de las piretroide-esterasas variaron entre 17.91 y 18,63 picomoles por minuto y por insecto. Los valores de actividad de enzimáticas difirieron significativamente respecto a los de la cepa de referencia. Los individuos de Guasuanti e Itapicoe no presentaron mutaciones en el gen kdr. Sin embargo, se encontró un individuo heterocigota (portador de las dos variantes, resistente y susceptible) en El Cruce, lo cual indicaría el potencial de desarrollo de resistencia molecular en esta población. La historia de control vectorial y la ubicación geográfica puede explicar el patrón diferencial de resistencia entre comunidades. Los valores de resistencia observados no significarían en la actualidad un problema para el control, pero indican la necesidad de monitoreo permanente para detectar tempranamente cambios en niveles de resitencia y adaptar los protocolos de intervención adecuadamente. EYV11 ESTUDIO TOXICOLÓGICO, BIOQUÍMICO Y MOLECULAR DE LA RESISTENCIA A INSECTICIDAS PIRETROIDES EN POBLACIONES DE Triatoma infestans DE SALTA, ARGENTINA EPIDEMIOLOGY & VECTORS 136 Pablo L Santo Orihuela(1), Claudia V Vassena(2), Paula Marcet(3) Centro de Investigaciones de Plagas e Insecticidas (CONICET/UNIDEF). (3)Centers for Disease Control and Prevention - Division of Parasitic Diseases and Malaria, Atlanta, USA.. E-mail: psorihuela@gmail.com (1)(2) El control de poblaciones de triatominos se ha basado principalmente en la utilización de insecticidas piretroides. Su empleo continuo ha llevado al desarrollo de resistencia y fallas de control. Con el objetivo de determinar los posibles mecanismos causantes de resistencia se evaluaron Triatoma infestans de dos localidades (Salvador Mazza y La Pista) de la provincia de Salta, Argentina. Se determinó la posible contribución a la resistencia de piretroide-esterasas y la presencia de dos mutaciones en la secuencia de un gen del canal de sodio (kdr) ya descriptas en diversos grupos de insectos resistentes a piretroides. Como colonia de referencia se utilizó una población criada en el CIPEIN sin exposición a insecticidas. Los grados de resistencia (RRs) fueron determinados mediante bioensayos y la actividad de piretroide-esterasas fue evaluada espectrofluorometricamente y de manera individual mediante un método desarrollado en el CIPEIN a partir de la síntesis de un nuevo sustrato, el 7-permetrato de cumarilo. Las poblaciones estudiadas presentaron RRs a deltametrina mayores a 130. Las actividades de piretroide esterasas de las poblaciones estudiadas se distribuyeron en un rango de entre 13,51 a 50,43 picomoles por minuto y por insecto. Individuos de ambas poblaciones presentaron una sustitución nucleotídica en la posición L1014 del gen kdr, mutación que genera un cambio de aminoácidos en la proteína del canal de sodio y que confiere resistencia a insecticidas piretroides. Esta mutación no se detectó en individuos de la población de referencia. Ninguna de las 3 poblaciones evaluadas presentó la mutación en el sitio L9251. El análisis de piretroide-esterasas demuestra que las enzimas evaluadas no realizarían un aporte contributivo a la resistencia a piretroides. Sin embargo y acorde con la caracterización toxicológica de las poblaciones analizadas, existe una correlación significativa entre los RRs detectados y la presencia de la mutación L1014F en el gen de kdr. EYV12 EFECTO REPELENTE DEL DEET SOBRE LA CHINCHE DE CAMA (Cimex lectularius l.) UNA PLAGA REEMERGENTE PRESENTE EN ARGENTINA Claudia V Vassena, Pablo L Santo Orihuela Centro de Investigaciones de Plagas e Insecticidas (CONICET/UNIDEF). E-mail: cvassena@gmail.com C. lectularius es un hemíptero hematófago ectoparásito de aves y mamíferos. En los últimos años se registró en el mundo la “resurgencia” de este insecto y la resistencia a insecticidas. En trabajos previos del CIPEIN demostramos la presencia de estas chinches en más de 40 ciudades y localidades de Argentina y la resistencia a insecticidas en tres colonias de Buenos Aires. Es pública y notoria la dificultad de control y la necesidad de evitar las picaduras en la personas. Una herramienta eficaz y de amplia distribución es el uso de la N, N-dietil-m-toluamida (DEET) como repelente. Con el objetivo de verificar la efectividad del DEET, se evaluó su efecto sobre la cepa susceptible de laboratorio (Harold Harlan) con ayuno de 5 y 10 días. Se prepararon arenas experimentales (papel de filtro) EPIDEMIOLOGY & VECTORS 137 con 2 áreas de igual superficie, una interna impregnada con acetona y otra externa tratada con distintas concentraciones de DEET. Grupos de 10 adultos se colocaron en la zona central y cada 5 minutos y durante 1 hora se registró el porcentaje de chinches presentes en cada área. Cada ensayo se replicó 3 veces. El comportamiento natural de los insectos es caminar hacia hacia la zona externa (tigmotaxis) por ello se impregna con el repelente en esta zona. El índice de repelencia (IR) para cada concentración y estado nutricional se calculó como el % de repelencia en la zona externa. El IR varía entre 1 y 100, a mayor repelencia mayor el índice. Se realizó una curva de índices de repelencia en función de las dosis. Para una concentración de 0.13 mg/cm2 se registraron IR mayores a 90 para ambos estados nutricionales. Posteriormente al tratamiento se dejó durante 30 minutos a todos los insectos en una arena control y se verificó que no existe fenómeno de adaptación. Este hallazgo sugiere que la aplicación de DEET sobre equipaje y pertenencias de viajeros y de técnicos especializados en el control de plagas es una buena alternativa para evitar el acercamiento del insecto. EYV13 A PROSPECTIVE STUDY OF Toxoplasma gondii SEROPREVALENCE AT THE LABORATORIES FROM THE TOXOPLASMOSIS NATIONAL NETWORK OF THE PROVINCE OF BUENOS AIRES Laura S Alvarez(1), Patricia K Campo(2), Lucia E Irazu(3), Delfina Gallo(4), Claudia Ferrer(5), Ana Musali(6), Elizabeth Manciola(7), María L Canil(8), Fernanda Russo(9), Mónica G Nigro(10), Bibiana A Ledesma(11) (1)(2)(3)(10)(11) INEI-ANLIS Dr . (4)H.M San Andrés de Giles. (5)HIGA “Presidente Perón” de Avellaneda. (6)H.Z.G de Las Flores . (7)Gral San Martín de La Plata. (8)Dr. H. Cura de Olavarria . (9)Htal Chivilcoy . E-mail: lalvarez@anlis.gov.ar Toxoplasmosis is a highly prevalent parasitic disease in the world. If it is firstly acquired during pregnancy it can cause serious fetal harm depending on the moment in which the mother becomes infected. With the purpose of estimating the seroprevalence of Toxoplasma gondii (Tg) infection in fertile women, describing by gravidy and sanitary region (SR), a pilot study was carried out during the period 2011-2013. A total of 2803 samples were received from the following hospitals: HIGA “Presidente Perón” from Avellaneda, Gral. San Martín from La Plata; HZG from Las Flores; HM San Andrés de Giles, Chivilcoy; and Dr. H. Cura from Olavarría; all belonging to different SR. The samples were processed by the total tachyzoites ELISA in house technique for the detection of IgG anti-Tg antibodies. Data was analyzed with theEPI info 2000 software. The results were: 1129 (40,2%) positive (33,6% pregnant, 66,4% non-pregnant); 1510 (53,9%) negative (35,5% pregnant, 64,5% non-pregnant) and 164 (5,9%) indefinite (30,5% pregnant; 69,5% non-pregnant). For SR IV from a total of 696 samples, 314 (45,1%) were positive, 340 (48,9%) negative, 42 (6,0%) indefinite. SR VI from a total of 785 samples, 262 (33,4%) were positive, 485 (61,8%) negative, 38 (4,8%) indefinite. SR IX from a total of 388 samples, 171 (44,1%) were positive, 177 (45,6%) negative, 40 (10,3%) indefinite. SR X from a total of 248 samples, 109 (44,0%) were positive, 130 (52,4%) negative, 9 (3,6%) indefinite. SR XI from a total of 686 samples, 273 (39,8%) were positive, 378 (55,1%) negative, 35 (5,1%) indefinite. Seroprevalence is 40,4% at provincial level and, in EPIDEMIOLOGY & VECTORS 138 pregnant women it is over 40% in four out of five regions. In pregnant women with positive serology, their developed immunity protects the foetus from infection. However, pregnant women with negative serology are prone to acquire toxoplasmosis and transmit the disease to the foetus. EYV14 MOLECULAR CHARACTERIZATION OF INFECTION BY Trypanosoma sp. IN WILD BLACK AND GOLD HOWLER MONKEYS FROM NORTHEASTERN ARGENTINA Mariela F Martínez(1), Martín M Kowalewski(2), Daniel O Salomón(3), Alejandro G Schijman(4) (1)(3) Instituto Nacional de Medicina Tropical (INMeT) - Ministerio de Salud de la Nación. (2) Estación Biológica Corrientes - Museo Argentino de Ciencias Naturales (EBCo - MACN) - CONICET. (4)Laboratorio de Biología Molecular de la Enfermedad de Chagas, Instituto de Investigaciones en Ingeniería Genética y Biología Molecular “Dr. Héctor Torres” (INGEBI) - CONICET. E-mail: marielafmartinez@gmail.com Natural populations of Trypanosoma cruzi have been classified in six discrete typing units (DTUs) associated to different environments, vectors and mammalian hosts. Our goal was to identify the different lineages of T. cruzi and other trypanosomes that infect howler monkeys in northeastern Argentina using molecular techniques. The study was conducted in Isla Brasilera (IB), a small island in the Paraná River with almost no human contact, and in the surroundings of the rural locality San Cayetano (SC). A total of 108 animals (51 in IB and 57 in SC) were captured using anesthetic darts. The animals were bleed by venipuncture and each blood sample was diluted in EDTA 0,5M. PCR-amplification of three different DNA target regions were used for diagnosis: kinetoplastid DNA (kDNAPCR), satellite DNA (SatDNA-PCR), and D7 domain 24Sα rRNA genes (rDNA-PCR). The kDNA-PCR detected 45% positive samples from IB and 48.3% from SC. Using SatDNAPCR in positive kDNA samples we detected infections by T. cruzi in three howlers from IB and five from SC. The SatDNA sequences obtained in one howler from IB and three from SC shared 99% identity with those previously reported in the DTUs II, V, and VI, which are associated to the domestic transmission cycle of T. cruzi. In contrast, a different SatDNA sequence in other howler from IB showed high similarity (99%) to those reported in the DTU I, which are more related to wild transmission cycle in Didelphis sp. The rDNA-PCR detected 98% positive samples from IB and 94.8% from SC. Nine rDNA sequences (4 from IB and 5 from SC) shared 98% identity with the homologous gene in T. minasense. This study provides the first report of infection by T. cruzi and T. minasense in wild howler monkeys in Argentina. Our results suggest that A. caraya could be acting as a potential reservoir in the wild transmission cycle of the Chagas disease in the study areas. EYV15 INFECCIÓN POR Toxocara canis EN POBLACIÓN RURAL DE CORRIENTES EPIDEMIOLOGY & VECTORS 139 María de los Angeles López(1), María V Bojanich(2), Leandro M García(3), Yohana Sappa Figueroa(4), Gustavo J Fernández(5), Silvia E Balbachan(6) (1)(3)(5)(6) Instituto de Medicina Regional - UNNE. (2)(4)Facultad de Cs. Exactas - UNNE. E-mail: mangeleslopez@yahoo.es Toxocara canis es un nematode de los caninos que infecta al hombre en forma accidental. Se encuentra distribuido en todo el mundo y la población de mayor riesgo es la que vive en condiciones socioeconómicas desfavorables. Según datos censales los deptos. San Cosme y San Luis del Palmar, en el NO de la prov. de Corrientes, poseen un 76% y 47% de población rural respectivamente. Su clima es subtropical con abundantes lluvias y temperaturas templadas. Objetivo: Determinar las características epidemiológicas de la toxocariosis en pobladores rurales de estas localidades. Se estudiaron 205 muestras de suero de niños y adultos, de áreas rurales de San Luis del Palmar y San Cosme. Se consignaron datos de edad y sexo de los individuos estudiados, y contacto con animales en el hogar. Se investigó la presencia de anticuerpos IgG anti-T. canis por ELISA en fase sólida utilizando antígeno de excreción/secreción de larvas L2 y anti-IgG humana marcado con peroxidasa. Entre los 205 individuos estudiados, hubo 97 varones y 108 mujeres, edades entre 1 y 88 años. La seroprevalencia global encontrada fue de 49,3%, siendo 41% entre los niños menores a 16 años (n=122) y 61,4% en adultos (n=83) p=0,004. En los varones la prevalencia fue de 53,6% y en las mujeres 45,3%. Todos los individuos refirieron la presencia de uno o más perros en la vivienda. Los valores hallados concuerdan con los reportados en otras poblaciones rurales de características climáticas semejantes; son más bajos a los encontrados en poblaciones carenciadas urbanas de Corrientes, pudiendo deberse a la mayor extensión de tierras y por ende a la menor contaminación con heces caninas en el peridomicilio. La seroprevalencia fue mayor en los adultos que en los niños, debido probablemente a que las actividades rurales suponen un contacto estrecho con el suelo contaminado en la edad adulta. Concluimos que la prevalencia de toxocariosis en la población estudiada es elevada, y son necesarias medidas sanitarias de control. EYV16 REINFESTACIÓN DE VIVIENDAS POR Triatoma infestans EN LOS LLANOS DE LA RIOJA EN EL PERÍODO 2005-2011 Ivana Amelotti, Silvia S Catalá, David E Gorla Centro Regional de Investigaciones y transferencia Tecnológica La Rioja. E-mail: iamelotti@crilar-conicet.gob.ar La enfermedad de Chagas es una zoonosis causada por Trypanosoma cruzi, parásito transmitido vectorialmente por el insecto Triatoma infestans. El Programa provincial de Chagas de La Rioja (PPChLR) realiza evaluaciones entomológicas y rociado con insecticidas como principal forma de control vectorial. Aunque el ideal sería que la evaluación se realizara con cobertura completa del territorio endémico en una frecuencia fija, los recursos disponibles afectan la periodicidad de evaluación. Al mismo tiempo, se conoce que la prevalencia de infestación en el área de estudio es heterogénea. El objetivo de este trabajo fue estimar el período en que es detectada la reinfestación de las viviendas pertenecientes a localidades que conforman el cluster de mayor infestación ubicado en la zona sur de Los Llanos (La Rioja). Utilizando los registros de infestación del EPIDEMIOLOGY & VECTORS 140 período 2005-2011 de las 7840 viviendas georeferenciadas por el PPChLR en Los Llanos, se detectaron clusters de alta infestación espacio-temporal y se calculó el porcentaje de reinfestación intradoméstica (ID). Se observó que de las 391 viviendas que conforman el cluster de alta infestación, luego del rociado masivo realizado en 2005, un 2% de las viviendas presenta reinfestación ID antes de cumplirse el año post-tratamiento. Aunque la frecuencia de evaluación es mayor en las localidades dentro del cluster que fuera del mismo (587 días ± 355 vs 700 días ± 408), esta frecuencia de evaluación no evita la reinfestación, ya que el 38 % de las reinfestaciones de ID ocurren en períodos menores a 485 días. Es necesario reconocer la heterogeneidad espacial del área a tratar al programar la frecuencia de las actividades de control. En zonas de alta infestación histórica sería necesario mantener una frecuencia de evaluación al menos anual, ya que luego de un año sin vigilancia aumenta la probabilidad de que ocurran reinfestaciones. Este trabajo fue realizado con apoyo del PPChLR. Financiación: CONICET y ANPCyT (PICT 2012-2883) EYV17 GEOHELMINTOS Y PARÁSITOS TRANSMITIDOS POR VECTORES EN PERROS RURALES DEL NORESTE ARGENTINO; IMPORTANCIA PARA LA SALUD HUMANA Gustavo F Enriquez(1), Natalia P Machiaverna(2), Hernán D Argibay(3), Paula A Sartor(4), Ricardo E Gürtler(5), Marta V Cardinal(6), Graciela Garbossa(7) (1)(2)(3)(4)(5)(6) Laboratorio de Eco-Epidemiología, Departamento de Ecología Genética y Evolución, Universidad de Buenos Aires-IEGEBA (UBA-CONICET). Ciudad Universitaria. (7) Laboratorio de Parasitología Clínica y Ambiental, Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Argentina, Instituto de Investigaciones en Salud Pública, Universidad de Buenos Aires, Argentina. E-mail: gfenriquez@ege.fcen.uba.ar Los perros juegan un importante rol como reservorios de múltiples patógenos que son compartidos con el humano. La presencia de coinfecciones podría desencadenar eventos de interacción sinérgica o antagónica entre los parásitos, causando una mayor o menor susceptibilidad a otras especies como también afectar la intensidad de infección en el hospedador. Con el objetivo de estudiar la co-ocurrencia de Trypanosoma cruzi y otros parásitos zoonóticos se hizo un relevamiento de perros en 6 comunidades rurales pertenecientes a Pampa del Indio, Chaco, las cuales tenían esporádicas intervenciones de control contra el principal vector del Mal de Chagas. Los parásitos gastrointestinales más frecuentemente hallados (n=85 perros) fueron ancylostomideos (64%), Toxocara canis (14%), trematodes (15%), Giardia sp. (27%) y Entamoeba sp. (12%). En menos del 5% se encontró Echinococus sp./Taenia, Spirocerca lupi, Trichuris vulpis, Capillaria sp., Hymenolepis diminuta, Hymenolepis nana, Dipylidium caninum, Cryptosporidium sp. y Sarcocystis sp. La seroprevalencia fue del 15% para T. cruzi (n=219 perros) y mediante el uso del SNAP 4D (Laboratorios IDEXX) se hallaron prevalencias del 8% para Ehrlichia canis, 2% para Anaplasma phagocytophylum y 1% para Dirofilaria immitis (n=153 perros). Se hallaron infecciones múltiples en el 79% de los perros. T. cruzi fue encontrado en coinfecciones con hasta otros 4 parásitos gastrointestinales o de transmisión vectorial. El número de infecciones múltiples y la prevalencia de infección por T. cruzi, E. canis, y trematodes, estuvo asociada a la edad del hospedador mediante un análisis de regresión EPIDEMIOLOGY & VECTORS 141 logística múltiple con efectos aleatorios. Estudiar la multiplicidad de parásitos y sus interacciones posibilitaría el desarrollo de intervenciones con el fin de disminuir la transmisión de un gran número enfermedades zoonóticas con un menor esfuerzo. EYV18 TYPIFICATION OF Acanthamoeba BY PCR IN ISOLATES FROM OCULAR LESIONS AND ENVIRONMENTAL SAMPLES FROM THE CITY OF MENDOZA Laura Silvina Alvarez(1), Diego E Cargnelutti(2), Ignacio H Velazquez(3), Marta G Cabrera(4), Rosa L Tonelli(5), María C Salomón (6) (1)(3)(4) INEI-ANLIS Dr . (2)(5)(6)Area Parasitologia , FCM UNCuyo. E-mail: lalvarez@anlis.gov.ar Acanthamoeba sp is on the most frequent protozoa in nature. Acanthamoeba species exert on humans and animals an accidental parasitism acting as opportunist in the production of pathology. There are 17 identified genotypes from which T4 is associated with the development of granulomatous amoebic encephalitis, cutaneous acanthamebiosis and keratitis. Has not been demonstrated inter human or zooantroponótica transmission so the acanthamebiosis is considered a econosis. The aim of this work was to isolate Acanthamoeba from environmental and ocular samples, confirmation of the isolates by molecular analysis and to determine the predominant genotype. We worked with environmental samples from the city of Mendoza and ocular material referred to the Área de Parasitología, Facultad de Ciencias Médicas, Universidad Nacional de Cuyo for diagnosis. 57 water samples, 68 soil samples and 30 ocular samples were cultured conventionally. 7 soil samples, 29 water samples and all of the ocular samples were positive for Acanthamoeba. The primers used for the PCR were JDP1 and JDP2 which generate the ASA.S1 amplicon from the highly variable DF3 region in the 18s rDNA gene. All environmental isolates and 27 of the 30 ocular samples were confirmed. The amplicons obtained were sequenced and compared with the NCBI database. The correlation obtained with Acanthamoeba genotype T4 was 95-97%. It is inferred that the soil and water of the city of Mendoza are a source of infection for humans regarding Acanthamoeba sp. Furthermore, the application of the PCR technique constituted an important tool for the confirmation of Acanthamoeba performed by morphological characterization, providing certainty in the determination of gender and allowing to know the prevalent genotype. EYV19 TRANSMISIÓN DE Trypanosoma cruzi EN TUCUMÁN: IMPORTANCIA EPIDEMIOLÓGICA DE Triatoma infestans, Triatoma eratyrusiformis Y Microcavia australis (CUIS) María Carla Cecere(1), Marina Leporace(2), Victoria M Cardinal(3), Maria P Fernandez(4), Juan P Arrabal(5), Claudio Moreno(6), Ricardo E Gürtler(7) (1)(3)(4)(7) FCEN, UBA-IEGEBA-CONICET. (2)FCEN, UBA. (5)Instituto Nacional de Medicina EPIDEMIOLOGY & VECTORS 142 Tropical-Ministerio de Salud. (6)Coordinación Nacional de Control de Vectores,. E-mail: carla.cecere@gmail.com Triatoma infestans (Ti) y Triatoma eratyrusiformis (Te) son halladas en las viviendas de comunidades rurales bajo vigilancia entomológica en Tafí del Valle, Tucumán. Con el fin de evaluar su importancia epidemiológica en estas comunidades analizamos su infección por Trypanosoma cruzi (Tc) y perfil alimentario en diferentes ecotopos. Posteriormente examinamos la infección natural y la infectividad (mediante xenodiagnóstico) de Microcavia australis (cuis) para evaluar su competencia como potencial reservorio de Tc. Las vinchucas fueron capturadas por diferentes métodos durante 2007-09 y examinadas para infección por microscopía óptica o kDNA-PCR. Para determinar el origen de su ingesta mediante ELISA consideramos 9 hospedadores. Los 51 cuises capturados con trampas Tomahawk instaladas en cercos peridomiciliarios próximos a las viviendas en Diciembre 2011 fueron examinados por xenodiagnóstico o kDNA-PCR; y se determinó la Unidad Discreta de Tipificación (UDT) de Tc. La principal fuente de alimentación en 22 Te reactivos fue cuis (95%) y en menor medida ratón y cerdo. En 68 Ti reactivos, las alimentaciones fueron 57% gallina, seguida de cabra, humano, conejo y en menor proporción perro, cuis y cerdo. En Te y Ti predominaron alimentaciones sobre una fuente de alimentación; el 65% de Te y 36% de Ti fueron no reactivas. Para Ti, la infección en domicilio (10/25) fue mayor que en peridomicilio (12/66); predominaron alimentaciones sobre humano en domicilio, y gallina y cabra en peridomicilio. Para Te, la infección en peridomicilio (67/83) fue mayor en los cercos (85%) seguido de los corrales y predominaron alimentaciones sobre cuis. La infección en cuises fue 46% y la infectividad media a Ti fue 56%; TCI fue la única UDT detectada. Ti y Te participan en el mantenimiento del ciclo de transmisión de Tc en peridomicilio, donde los cuises son un reservorio altamente competente de TCI y fuente de alimentación de Te en los cercos, no así para Ti que mostró un espectro más amplio de hospedadores. EYV20 DETERMINANTES ECOLÓGICOS Y SOCIODEMOGRÁFICOS DE LA INFESTACIÓN POR Triatoma infestans EN COMUNIDADES INDÍGENAS DEL CHACO ARGENTINO M Sol Gaspe, Yael M Provecho, M Victoria Cardinal, M del Pilar Fernández, Ricardo E Gürtler Laboratorio de Eco-epidemiologia, FCEyN, UBA. E-mail: solgaspe@ege.fcen.uba.ar En el Gran Chaco, hotspot de la enfermedad de Chagas y otras enfermedades desatendidas, habitan >20 pueblos indígenas. En este trabajo se identificaron los principales determinantes ecológicos y sociodemográficos de la infestación y abundancia de Triatoma infestans en las viviendas de una población Qom (Toba) incluyendo una minoría criolla en Pampa del Indio, Chaco, Argentina utilizando un abordaje de inferencia multimodelo. Se realizó un estudio transversal para determinar la infestación de las 386 viviendas habitadas a través de búsquedas manuales con un aerosol desalojante y se realizaron encuestas de hogares antes del rociado masivo con insecticidas. Los hogares Qom presentaron una prevalencia de infestación 3 veces mayor que la de los criollos; y habitaban viviendas pequeñas, de construcción reciente, precarias y con menor cantidad de sitios peridomésticos y animales de cría. Las familias Qom eran más numerosas, EPIDEMIOLOGY & VECTORS 143 tenían un menor clima educativo y una inesperada alta movilidad local. La infestación de las viviendas (31.9%) fue menor a la esperada dada la ausencia de rociados recientes y se halló espacialmente agregada. Cerca de la mitad de las viviendas infestadas presentaron insectos infectados con T. cruzi. Los factores con alta importancia relativa para la infestación y/o abundancia de triatominos en los domicilios fueron la disponibilidad de refugio, la distancia a la vivienda infestada más cercana, uso de insecticida, presencia de aves en el domicilio, hacinamiento y clima educativo. Estos resultados muestran la importancia de ciertos determinantes sociodemográficos en la infestación doméstica y corroboran el rol de la calidad de las viviendas, los animales domésticos y el uso de insecticidas. La compleja interacción entre la calidad de la viviendas, aspectos sociodemográficos y culturales, y la infestación de la vivienda refuerzan la necesidad de abordajes integrales para un control y vigilancia sostenibles. EYV21 ESTUDIO DE FRECUENCIA DE PRESENTACIÓN DE FERTILIDAD DE QUISTES HIDATÍDICOS BOVINOS DE Echinococcus granulosus EN MATADERO DE LA REGIÓN METROPOLITANA Pamina Horlacher(1), Constanza Andrade(2), Colette Burotto(3), Felipe Corrêa(4), Caroll Stoore(5), Christian Hidalgo(6), Edgar Jiménez(7), Marcela Hernández(8), Rodolfo Paredes(9) (1)(2)(3)(4)(5)(6)(7)(9) Escuela de Medicina Veterinaria, Facultad de Ecología y Recursos Naturales, Universidad Andrés Bello, Santiago, Chile. (8)Departamento de Patología y Medicina Oral, Facultad de Odontología, Universidad de Chile, Santiago, Chile. E-mail: christian.hidalgo@unab.cl Introducción: La equinococosis quística, es una patología causada por el metacestodo del platelminto parásito Echinococcus granulosus. Existen dos tipos de quistes hidatídicos, fértiles que presentan protoescólices adheridos a la capa germinal y libres en el líquido hidatídico e infértiles que no producen protoescólices. En Chile no se han realizado trabajos que midan la frecuencia de presentación de fertilidad de quistes hidatídicos en el ganado bovino, ya que las vísceras son decomisadas sin realizar este análisis. Objetivo: Analizar la frecuencia de presentación de quistes hidatídicos fértiles e infértiles de bovinos faenados en la Región Metropolitana. Material y Métodos: Se analizaron los quistes hidatídicos de pulmones e hígados de bovinos decomisados en la Región Metropolitana. Se registró el número de animales faenados y el número de bovinos positivos a equinococosis quística. La determinación de fertilidad/infertilidad se realizó por medio de inspección macro y microscópica de la capa germinal. Resultados y Discusión: De un total de 2005 animales, un 16% presenta equinococosis quística. De los animales positivos a esta enfermedad el 85,6% presentan quistes infértiles, 5,1% sólo quistes fértiles, 8,6% quistes menores a 3 centímetros y un 0,6% presentan quistes fértiles e infértiles en el mismo animal. El 61% de los quistes se localizan en el pulmón, 16% en hígado y 23% en ambos órganos. Conclusiones: Los bovinos infectados con hidatidosis presentan mayoritariamente quistes de tipo infértil sin una coexistencia importante de quistes fértiles e infértiles en el mismo animal, lo que podría indicar que los hospederos intermediarios participarían en la determinación de la fertilidad de quistes hidatídicos. Agradecimientos: FONDECYT Nº 1130717 EPIDEMIOLOGY & VECTORS 144 EYV22 PERFIL DEMOGRAFICO DE LA POBLACION CON ENFERMEDAD DE CHAGAS QUE CONCURRE A LA ATENCION MEDICA UN INSTITUTO DE REFERENCIA EN CABA ARGENTINA Stella M Lopez, Vanesa Negri, Marcela Seiler, Karenina Scollo, Constanza L Albizu, Adelina Riarte INP . E-mail: stmlopez@yahoo.com En el INP, instituto nacional de referencia de la Enfermedad de Chagas, situado fuera de la zona de transmisión vectorial, se recibe una población de demanda derivada para diagnostico y atención médica a personas con infección/enfermedad de Chagas. El objetivo de este trabajo fue conocer las variaciones del perfil demográfico de la población blanco en dos diferentes períodos, en los años 2003 y 2012. Se utilizaron los registros y base de datos de los años estudiados y se evaluaron las variables lugar de nacimiento, edad, sexo y ocupación. En 2003 se obtuvieron los datos de más de 320 pacientes de los cuales el 52% fueron mujeres con 34% de amas de casa, el 28% fue oriundo de países limítrofes con predominio de Bolivia, 25.5% del NOA, 22% del NEA, 16% del Centro, 11% de CABA y Gran Buenos Aires y el resto de Cuyo. El 49.5% de la población estaba en un rango de edad de 25 a 45 años, todos laboralmente activos, y una actividad laboral de: operarios, empleados, albañiles y changarines, entre otras, con un nivel de desocupación de 14%. En el año 2012 hubo un registro de 743 pacientes, de los cuales el 57% fueron mujeres con un 32% de amas de casa, el 27.5% procedente de países limítrofes con predominio de Bolivia y aumento de la población de Paraguay, y un 14% de la población de CABA y Gran Bs.As. El perfil laboral es similar al periodo 2003 con un nivel de desocupación del 4%. Conclusión: No hubo un cambio en el perfil demográfico de la población con infección y/o enfermedad de Chagas, que concurrió a nuestro Instituto. Se observó un aumento en la demanda de atención médica con un predominio estable de amas de casa en ambos periodos. No hubo variaciones significativas en la calidad del empleo que es esencialmente de tipo informal. Los datos sugieren una disminución del nivel de desocupación. EYV23 Babesia bovis DETECTION FROM CAPILLARY BLOOD IMPROVES DIAGNOSIS IN CARRIER CATTLE Eliana C. Guillemi(1), Sofía de la Fournière(2), Néstor Sarmiento(3), Marisa D. Farber(4), Silvina E. Wilkowsky(5) (1)(2)(4)(5) Inst. Biotecnología, INTA. (3)EEA-Mercedes, INTA. E-mail: farber.marisa@inta.gob.ar Babesia bovis infects bovine erythrocytes turning their membrane more rigid than in normal cells. This fact determine that B. bovis parasitized erythrocytes tend to be retained in capillary vessels. Besides, carrier cattle show undetectable parasitemia in blood smears turning into low sensitivity of detection by direct methods using venous blood The aim of this work was to improve B. bovis identification by comparing DNA detection from capillary EPIDEMIOLOGY & VECTORS 145 and venous blood in carrier cattle. Blood from three cows suffering chronic babesiosis were sampled from two different anatomic areas: jugular vein and capillary vessels. Venous blood was extracted by syringe and conserved in heparinized tubes. Capillary blood was obtained by pricking the tip of the tail with a needle and collected in Whatman papers. DNA was extracted from a drop of capillary blood and from 100 μl of venous blood by the phenol-chloroform method. For capillary blood, a previous step was needed for retrieving blood from the paper by pre-incubating the paper in lysis buffer. After the incubation, the supernatant was used for standard phenol-chloroform DNA extraction. DNA from capillary and venous blood was analyzed by an end point PCR and a quantitative PCR (qPCR); both reactions targeted simple copy genes: rip9 and rcc respectively. For the end point PCR, B. bovis DNA was detected in both capillary and venous samples of the three animals with a higher intensity of the amplification band in the capillary samples in all cases. For the qPCR, two capillary samples showed higher DNA copy numbers than the venous samples, although the latter had value levels below the detection threshold. These results suggest that B. bovis DNA detection from capillary blood is a much better approach for diagnosis in carrier cattle. EYV24 OCORRÊNCIA DE ESPÉCIES DE TRIATOMINAE (HEMIPTERA: REDUVIIDAE) NO MUNICÍPIO DE MARABÁ, PARÁ, BRASIL Eder S Souza (1), Noé V Atzingen(2), Maria B furtado(3), João A Rosa(4) (1)(4) Faculdade de Ciências Farmacéuticas - UNESP- Campus de Araraquara. (2)(3) Fundação Casa da Cultura de Marabá. E-mail: ederss1@hotmail.com Descrito por Carlos Chagas (1909), la tripanosomiasis americana o enfermedad de Chagas fue reconocida como una enfermedad humana, en la Amazonia a partir de 1969 y con una mayor énfasis desde 1996. Actualmente son conocidas 147 especies de triatomíneos agrupadas en seis tribus y 18 géneros. Mientras tanto, algunas son consideradas mejores vectores de Trypanosoma cruzi debido a la adaptación al medio ambiente domestico y a la antropofilia. Este estudio tuvo como objetivo verificar la ocurrencia de triatomíneos en la comarca de Marabá, que se encuentra localizada al noreste de Pará. Durante dos días se realizaron visitas a cinco casas en la comunidad de Nueva Marabá. Se recogieron los especímenes con una pinza entomológica y posteriormente fueron colocados en un frasco con agujeros en la tapa para que pueda facilitar la entrada del aire y posteriormente poder ser transportados para el laboratorio. Se recogieron 23 triatomíneos de dos casas inspeccionadas de los cuales 90% se encontraban en la parte interna de la casa (pared y del techo de las casas de paja) y 10% al aire libre (gallinero, corral y azulejos). Rhodnius pictipes fue la especie mas abundante (15 muestras), seguido por E.mucronatus 01; Rhodnius spp 07. De los insectos recolectados, todos fueron llevados al laboratorio de Parasitología de la Facultad de Ciencias Farmacéuticas de la UNESP – Araraquara donde fueron identificados y examinados. En una de estas muestras fue observada la presencia T. cruzi (Rhodnius pictipes). Este estudio muestra que las tres especies de triatomíneos y una nueva especie, invadieron y/o colonizaron residencias que determinan el alto riesgo de transmisión de la enfermedad de Chagas en la población de Nuevo Marabá EPIDEMIOLOGY & VECTORS 146 EYV25 EXPRESIÓN DIFERENCIAL DE GENES CODIFICANTES DE ÁCIDO GRASO REDUCTASAS EN Triatoma infestans EN FUNCIÓN DEL SEXO Y LA RESISTENCIA A INSECTICIDAS Natalín Valeff, Gustavo M Calderón-Fernández Instituto de Investigaciones Bioquímicas de La Plata (CONICET-UNLP), Facultad de Ciencias Médicas, calles 60 y 120, La Plata, 1900, Argentina. E-mail: guscalf@gmail.com La superficie cuticular de Triatoma infestans está cubierta por una mezcla compleja de lípidos, predominando los hidrocarburos y los alcoholes grasos. Estos compuestos tienen un rol fundamental en la supervivencia, fisiología y comportamiento de los insectos, evitando una deshidratación letal, participando como feromonas de contacto intraespecíficas y regulando la penetración de agentes químicos y biológicos. Hemos demostrado anteriormente el rol de los alcoholes grasos (FA) cuticulares en el reconocimiento sexual pero se desconoce si están relacionados con la resistencia a insecticidas. Los FA se forman a partir de ácidos grasos de cadena larga y muy larga producidos por la acción sucesiva de las ácido graso sintasas (FAS) y ácido graso elongasas (ELOVL) del integumento del insecto. Esos ácidos grasos son reducidos a FA de la misma longitud de cadena por ácido graso reductasas (FAR) también específicas del tejido integumentario. El objetivo de este trabajo fue analizar la expresión de los genes codificantes de las FAR del integumento de T. infestans en función del sexo y la resistencia a insecticidas. Se obtuvo RNA total a partir del integumento de machos y hembras y de ejemplares susceptibles y resistentes a insecticidas, y se sintetizó cDNA mediante RT-PCR. Empleando primers específicos diseñados a partir de secuencias parciales de FAR de T. infestans disponibles en nuestro laboratorio se analizó la expresión diferencial de los genes mediante PCR cuantitativa en tiempo real. Asimismo se obtuvo la secuencia completa de una FAR mediante la técnica de RACE (Rapid Amplification of cDNA Ends). Se obtuvieron diferencias significativas de entre 3 a 20 veces en la expresión de varios genes de FAR de T. infestans tanto en función del sexo como entre insectos susceptibles y resistentes. Se caracterizó la secuencia de una FAR con una identidad aproximada del 56% con secuencias ortólogas de Apis mellifera y otros insectos. EYV26 USO DE LA PCR CUANTITATIVA PARA IDENTIFICAR RESERVORIOS DOMÉSTICOS SUPERINFECCIOSOS DEL Trypanosoma cruzi Gustavo F Enriquez(1), Jacqueline Bua(2), María M Orozco(3), Alejandro G Schijman(4), Ricardo E Gürtler(5), Marta V Cardinal(6) (1)(3)(5)(6) Laboratorio de Eco-Epidemiología, Departamento de Ecología Genética y Evolución, Universidad de Buenos Aires-IEGEBA (UBA-CONICET). Ciudad Universitaria. (2) Instituto Nacional de Parasitología Dr. M. Fatala Chaben, Administración Nacional de Laboratorios e Institutos de Salud Dr. C.G. Malbrán, Buenos Aires, Argentina. EPIDEMIOLOGY & VECTORS 147 (4) Laboratorio de Biología Molecular de la Enfermedad de Chagas, Instituto de Investigaciones en Ingeniería Genética y Biología Molecular (INGEBI-CONICET), Argentina. E-mail: gfenriquez@ege.fcen.uba.ar Los perros y gatos son importantes reservorios domésticos de Trypanosoma cruzi ya que entre otros factores exhiben una mayor infectividad al vector que los humanos seropositivos. En este estudio se cuantificó la carga parasitaria de T. cruzi en sangre periférica de perros y gatos infectados y se evaluó su asociación con la infectividad al vector en una zona de alto riesgo del Chaco argentino. Cuarenta y cuatro perros y 15 gatos infectados fueron examinados por xenodiagnóstico (10-20 Triatoma infestans) y posteriormente los insectos fueron examinados individualmente por microscopía óptica. La carga parasitaria (cantidades equivalentes de ADN por ml, EP/ml) se estimó por PCR en tiempo real (qPCR) y a su vez se realizó una PCR cualitativa (PCR-kADN). Los perros y gatos fueron clasificados como de “alta infectividad” al vector (responsables de ≥80% del total de triatominos infectados usados en los xenodiagnósticos) o de “baja infectividad” el resto de los animales. La infectividad estuvo asociada positiva y significativamente con la carga parasitaria de los perros (mediana 8,1 EP/ml; OR =1,02) y gatos (mediana 9,7 EP/ml; OR =1,02), pero no con la UDT parasitaria. Sin embargo, los dos gatos y el único perro infectado con TcI tenían nula infectividad a pesar de tener 7,4, 9,7 y 20,5 EP/ml, respectivamente. La mitad de los perros y gatos mostraron una alta infectividad. La PCRkADN y el resultado cualitativo de la qPCR no permitieron distinguir entre hospedadores de alta o baja infectividad, ya que detectaron ADN por encima del 87% del total de animales examinados. El hallazgo de hospedadores con parasitemia patente pero con nula infectividad sugiere la presencia de otros factores afectando la asociación infectividad-carga parasitaria. Estos resultados implicarían que las estimaciones cuantitativas de la carga parasitaria por qPCR y no los resultados cualitativos de la qPCR o PCR-kADN serían una herramienta más precisa para identificar hospedadores altamente infecciosos. IMMUNOLOGY & PATHOGENESIS 148 IYP01 ALTERACIONES MITOCONDRIALES FUNCIONALES EN MÚSCULO CARDÍACO Y MÚSCULO ESQUELÉTICO DURANTE LA EVOLUCIÓN DE LA ENFERMEDAD DE CHAGAS. Alejandra Báez, Silvina Lo Presti, Noel Reynoso, Carolina Bazán, Mariana Strauss, Noemí Miler, Walter Rivarola, Patricia Paglini. Centro de Estudios e Investigación de la enfermedad de Chagas y Leishmaniasis. Fac de Ciencias Médicas. U.N.C. Córdoba, Argentina. INICSA-CONICET. El ingreso del Trypanosoma cruzi en las células cardíacas genera importantes procesos inflamatorios cuyos mediadores actúan de manera directa sobre las mitocondrias. Anteriormente demostramos que según el aislamiento de T. cruzi que infecte al huésped, estos influyen de manera diferente sobre la actividad funcional mitocondrial. En el presente trabajo se estudió el efecto de la infección con el aislamiento SGOZ12 y cepa Tulahuen, sobre la actividad enzimática mitocondrial de corazón (C) y músculo esquelético (M) en dos etapas de la Enfermedad de Chagas. Se estudiaron ratones albinos suizos infectados con 50 tripomastigotes de T. cruzi, cepa Tulahuen y aislamiento SGOZ12 en la fase aguda (35 días después de la infección, dpi, n=10), crónica indeterminada (75 dpi, n=10) y crónica cardíaca (365 dpi, n=10). Un grupo de ratones no infectados (control, n=10) también se analizó. Se midió la actividad de Citrato sintasa y de los complejos I a IV de la cadena respiratoria por espectrofotometría. Los datos fueron analizados por ANOVA (nivel de significación: p<0,05). La actividad enzimática (µm.min-1/ mg prot), disminuyó: en la Citrato sintasa (C) en Tulahuen y SGO Z12 en la fase crónica indeterminada; el CI (C) en las dos cepas en la fase crónica indeterminada; el CII (C) en Tulahuen; en SGOZ12 en la fase crónica (C), y en (M) en la fase aguda; el CIII (C) en ambas cepas durante toda la infección; el CIV (C) en ambas cepas en la fase crónica indeterminada. Demostramos que las mitocondrias estarían implicadas en la génesis y progresión de la cardiopatía chagásica crónica, y que el tipo de aislamiento o cepa, está involucrado en daños de diferente magnitud. Además estudios en músculo esquelético demuestran un paralelismo con los daños mitocondriales en miocardio lo que permitiría de manera sencilla (al realizar una biopsia) obtener información acerca de la evolución de la miocardiopatía. IYP02 EFECTO PROLIFERATIVO DEL ANTÍGENO TC13TUL DE Trypanosoma cruzi SOBRE ESPLENOCITOS DE RATONES BALB/C NAIVE Andrea C. Bruballa, Cecilia Albareda, Patricia A. Garavaglia y Gabriela A. García IMMUNOLOGY & PATHOGENESIS 149 Instituto Nacional de Parasitologia “Dr. Mario FatalaChaben”- ANLIS “Dr. Carlos G. Malbran” La activación o la prevención de la muerte celular es un factor crítico en la evolución de la infección por Trypanosoma cruzi, el agente etiológico de la enfermedad de Chagas. Varios trabajos muestran que la enzima trans-sialidasa, un miembro del grupo I de la superfamilia de las trans-sialidasas (TS), puede activar las células del sistema inmune y modular su apoptosis. A fin de estudiar el rol del antígeno Tc13Tul, miembro del grupo IV de la superfamilia TS, en la respuesta inmune innata contra T. cruzi, evaluamos su efecto sobre esplenocitos de ratones BALB/c naive. Después de cultivarlos durante 48 hs en presencia del antígeno recombinante Tc13Tul o su proteína carrier, MBP (maltose binding protein), se evaluó la viabilidad celular por tinción con ioduro de propidio (IP). Al estimular con Tc13Tul se observó un aumento del porcentaje de células viables (67,47 % con Tc13Tul vs. 35,55 % con MBP, p<0,001). La observación a microscopio óptico de los cultivos con Tc13Tul mostró la presencia de ramilletes celulares, sugiriendo un posible efecto proliferativo. Para confirmar esta hipótesis, los esplenocitos se tiñeron con CFSE y luego de 72 hs de cultivo se evaluaron por citometría de flujo. Los cultivos con Tc13Tul presentaron un 5,13% de células en división, mientras que con MBP un 1,19% (p<0,01). Para estudiar si Tc13Tul ejerce una modulación de la apoptosis, se utilizó tinción con anexina V e IP. El estímulo con Tc13Tul produjo un aumento de células en apoptosis temprana (35,98 % Tc13Tul vs. 15,04 % MBP, p<0,01) y una disminución de células viables (57,27 % Tc13Tul vs. 76,99 % MBP, p<0,01). Los resultados indican que el efecto de Tc13Tul sobre la viabilidad es producto de la proliferación celular y no de una inhibición de la apoptosis. La estimulación con la porción repetitiva C-terminal de este antígeno, no mostró diferencias con respecto a los controles. Nuestros resultados muestran que el antígeno Tc13Tul participaría en la respuesta inmune innata contra T. cruzi. IYP03 STUDY OF GALECTIN-8 ROLE IN MURINE Trypanosoma cruzi INFECTION Carla A Pascuale(1), Adriano Bertelli(2), Hernán García Rivello(3), Virginia Tribulatti(4), Gabriela Levy(5), Oscar Campetella(6), María S Leguizamón(7) (1)(2)(4)(5)(6)(7) Instituto de Investigaciones Biotecnológicas-Universidad Nacional de San Martín. (3)Servicio de Patología, Hospital Italiano. E-mail: carlapascuale@gmail.com Galectin-8 is distributed in different tissues and in the endothelium, which links it to various processes such as migration, apoptosis induction, and platelets activation, and to the role as pro-inflammation molecule. No information is available on Gal-8 in infections by Trypanosoma cruzi. We have started the analysis assaying various murine infection models combined with T. cruzi strains to induce different evolution. We studied Gal-8 expression in different organs during the acute period of the infection in BALB/cJ mice, using the RA strain (DTU TcVI). Assays were conducted at 17 days post-infection (dpi) with parasitemia levels ranging 7x105-1.5x 106 trypomastigotes/ml. qRT-PCR showed a significant decrease on Gal-8 expression in infected mice hearts. Organs were analyzed in triplicate and normalized to host β-actin expression. C57BL/6J (WT) and Gal-8KO four month old males were infected with the Ac strain, (DTU TcI), which induces chronic infection (survival 90%). Parasitemia was similar between groups (followed up to 80 dpi). IMMUNOLOGY & PATHOGENESIS 150 At four months pi, Gal-8KO mice showed more exacerbated splenomegaly than infected WT mice. The weight of infected Gal8-KO mice’s spleen was significantly larger (p=0.0079) than the WT counterpart, while the heart’s and liver’s weight were similar between groups. HE-stained spleen tissue samples showed greater degree of follicular hyperplasia in Gal-8KO along with numerous secondary follicles, a higher number of centerblasts and a pronounced amount of plasmocytes, when compared to WT both infected and normal. In Gal-8KO, while follicle structure was maintained, there was important lymphocyte movement towards the red pulp. These preliminary results show, for the first time, that T. cruzi modulates Gal-8 expression. The splenomegaly seen in Gal8KO mice could suggest the involvement of this galectin in the development of polyclonal activity, induced by T. cruzi infection. IYP04 IMPACT OF GALECTIN-3 ON THE COURSE OF EXPERIMENTAL Trypanosoma cruzi INFECTION. Danielle Silva-dos- Santos1, Juliana Barreto de Albuquerque1, Luiz Ricardo Berbert1, Désio A. Farias-de-Oliveira1, Landi V. C. Guillermo2, Wilson Savino1, Juliana de Meis1 and Déa M. S. Villa-Verde1. 1Laboratory on Thymus Research, Oswaldo Cruz Institute, FIOCRUZ; 2Biomedical Institute, UNIRIO, Rio de Janeiro, Brazil. FIOCRUZ. E-mail: ddanielle_santos@hotmail.com Galectin-3, a β-galactoside binding lectin, is expressed in cells of the immune system such as macrophages and activated lymphocytes, modulating cell adhesion, migration, activation and cytokine production. Chagas’ disease, caused by the protozoan Trypanosoma cruzi, is a public health problem, without effective vaccines and therapeutics. Here we evaluated the involvement of galectin-3 in experimental T. cruzi infection. Wild-type (WT) and galectin-3 deficient (Gal-3-/-) mice were infected with the Tulahuén strain. Parasitemia was individually evaluated in 5 l of blood drawn from the tail vein, by counting trypomastigote forms in 50 fields in neubauerTM chambre by optical microscopy. Serum cytokine levels were determined by Cytometry Beads Assay. Quantification of cell number and phenotype (CD4, CD8 and CD19) in peripheral lymphoid organs were analyzed by flow cytometry. Peritoneal macrophages were obtained from infected mice after 18 days post-infection. Our results showed that Gal-3-/- mice are more susceptible to infection than WT, with higher mortality rate and increased blood parasitemia. In addition, we observed a decrease in CD4+, CD8+ and CD19+ cell numbers in subcutaneous lymph nodes and in CD4+ and CD19+ cell numbers in the spleen of infected Gal-3-/- mice. No significant differences were observed in the total cell numbers of mesenteric lymph nodes from infected Gal-3-/- and WT mice. Analysis of the serum from infected Gal-3-/- mice showed a decrease in TH1 and TH2 cytokines secretion. We also showed that infected Gal-3-/- macrophages are less effective in eliminating intracellular parasites than those from WT animals, probably due to lower nitric oxide production. Our results suggest that galectin-3 is important in modulating the host response against T. cruzi, with implications for susceptibility to infection. IMMUNOLOGY & PATHOGENESIS 151 IYP05 T. cruzi: INDUCCIÓN DE MEDIADORES INFLAMATORIOS EN MACROFAGOS MURINOS POR LIPIDOS DE AMASTIGOTES DE DOS CEPAS DE COMPORTAMIENTO BIOLÓGICO POLAR Emanuel Bott, Guadalupe Gimenez, Estela M Lammel, Elvira LD Isola, Maria L Belaunzarán Instituto de Investigaciones en Microbiología y Parasitología Médica (IMPaM, UBACONICET). E-mail: parasitodife@yahoo.com.ar Existe vasta evidencia sobre la función inmunomoduladora de los lípidos de microorganismos. En T. cruzi demostramos degradación de lípidos endógenos y acumulación de ácidos grasos libres (AGL) y lisofosfatidilcolina (LisoPC) durante la autólisis de amastigotes (AMA) de la cepa letal RA. Otros autores determinaron que AGL y lisofosfolípidos (LisoPL) liberados de tripomastigotes tienen efectos citotóxicos. En este trabajo analizamos el perfil lipídico de AMA intactos y en autólisis de la cepa no letal K98 y el efecto de los lípidos totales (LT) de AMA K98 y RA, intactos/en autólisis, sobre la producción en macrófagos murinos de TNFα, óxido nítrico (ON) y ciclooxigenasa 2 (COX2). En AMA K98 el PL predominante fue fosfatidiletanolamina (PE, 23% LT), con incremento en la autólisis de AGL, lisoPE y diacilglicerol (3,0, 7,0 y 1,5 veces resp) mientras que en RA previamente determinamos que predomina PC con aumento de AGL y LisoPC en la autólisis. Los LT de K98 intactos estimularon la producción de ON 3,7 veces vs ctrl (por reacción de Griess) y los de RA no generaron respuesta, mientras que al estimular con LT de RA y K98 en autólisis se observó una reducción de la misma respecto a LT de AMA intactos (15 y 2 veces resp). Resultados similares se hallaron para TNFα por ELISA: LT de K98 intactos estimularon su secreción 5,5 veces vs ctrl y los de RA no generaron respuesta mientras que LT de RA y K98 en autólisis redujeron la misma 2,0 y 3,5 veces resp vs LT de AMA intactos. Sólo los LT de RA en autólisis promovieron la expresión de COX-2 (2 veces vs ctrl) determinada por Inmunoblot.En la infección por T. cruzi la presencia de desórdenes inmunológicos es una característica relevante. Los presentes resultados indican que los AMA de las cepas letal/no letal, intactos/en autólisis, poseen moléculas lipídicas capaces de modular diferencialmente la respuesta inflamatoria en macrófagos, lo que podría contribuir en distinto grado a la patogenia de la Enfermedad de Chagas. UBA/CONICET IYP06 EVALUACIÓN DE LA INMUNOGENICIDAD DE LA PROFILINA DE Neospora caninum EN BOVINOS: ESTRATEGIAS PARA MODULAR EL PERFIL DE RESPUESTA INDUCIDO Florencia C Mansilla(1), María Eugenia Quintana(2), Nancy P Cardoso(3), Wenzel Czepluch , Maximiliano Wilda(5), Dadín P Moore(6), Alejandra V Capozzo(7) (4) IMMUNOLOGY & PATHOGENESIS 152 (1)(2)(3)(4)(7) Instituto de Virología. CICVyA. INTA CNIA. (5)Centro de Estudios en Virología Animal, Cevan. (6)EEA Inta Balcarce. E-mail: mansilla_florencia@hotmail.com La neosporosis bovina es una enfermedad reproductiva producida por Neospora caninum, para la cual no hay vacunas. La inmunidad protectiva contra la neosporosis está mediada por anticuerpos (Ac) de alta avidez y por la actividad de células T-CD4+ que secretan IFNγ. La diferenciación a este perfil depende de células presentadoras de antígeno (APC) productoras de IFNγ e IL-12, activadas por la vía MyD88. Seleccionamos como inmunógeno la profilina de Neospora caninum (NcPro) producida en E.coli (rNcPro), que activa a las APC vía TLR11. Para mejorar la respuesta inmune fusionamos epitopes T ubicuos de la glicoproteína G del virus de la estomatitis vesicular (G) a la rNcPro e incorporamos a la formulación agonistas de TLRs. Se inmunizaron 5 grupos de 3 vaquillonas cada uno(vía subcutánea) con tres dosis (0, 21 y 240 días post vacunación, dpv) de 20 µg de rNcPro o rNcPro/G formuladas con un adyuvante acuoso (ProvideanAVEC®) con agonistas de TLR2 y de TLR9 (CpGs), o con hidróxido de aluminio (Alum). Todas las vacunas indujeron Ac específicos de alta avidez a los 45 dpv, principalmente IgG1. Los títulos más altos se obtuvieron con la vacuna NcPro/G + Alum. A los 247 DPV, se detectaron células T-CD4+ IFNγ+ en la sangre periférica de los bovinos inmunizados con rNcPro/G + Providean-AVEC® estimuladas ex vivo con lisado de taquizoítos. En los bovinos vacunados con rNcPro observamos un aumento del número de células TCD4+/IFNγ+ en respuesta a rNcPro, pero no al lisado. Detectamos células T-CD8+/IFNγ+ en algunos animales vacunados con rNcPro/G. Los resultados muestran que la adición de epitopes T y de ligandos de TLR que activan a las APC vía MyD88 permite obtener el perfil de respuesta buscado. El diseño racional de vacunas recombinantes considerando el tipo de respuesta que se desea inducir constituye una estrategia promisoria para el desarrollo de vacunas contra este parásito. IYP07 IMMUNE RESPONSE AFTER ORAL/INTRAGASTRIC INFECTION BY Trypanosoma cruzi IN MICE Juliana Barreto-de-Albuquerque(1), Danielle Silva-dos-Santos(2), Ana R Pérez(3), Luiz R Berbert(4), Eliane de Santana-van-Vliet(5), Désio A Farias-de-Oliveira(6), Otacilio Moreira(7), Eduardo Roggero(8), Carla E de Carvalho-Pinto(9), José Jurberg(10), Vinícius Cotta-deAlmeida(11), Oscar Bottasso(12), Wilson Savino(13), Juliana de Meis(14) (1)(2)(4)(5)(6)(11)(13)(14) Laboratory on Thymus Research, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil. (3)(8)(12)Immunology Institute, Faculty of Medical Science, National University of Rosario, Rosario, Argentina . (7)Laboratory on Molecular Biology and Endemic Diseases, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil. (9)Laboratory on Experimental Pathology, Immunobiology Department, Federal Fluminese University, Niteroi, Brazil. (10)National and International Laboratory on Triatomine Taxonomy, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil. E-mail: barretodealbuquerque@gmail.com Oral transmission of Chagas’ disease has been documented in Latin American countries, being the most important infection route in the Brazilian Amazon region. Most knowledge IMMUNOLOGY & PATHOGENESIS 153 concerning the immunology of Chagas’ disease derives from studies in mice infected intraperitoneally or subcutaneously. The few studies using oral route infection disregard that inoculation in the oral cavity (Oral infection, OI) or by gavage (Gastrointestinal infection, GI) represent different infection routes, as yet both show clear-cut parasitemia and heart parasitism during the acute infection. Here, BALB/c mice were subjected to acute oral (OI) or gavage (GI) infection, using 5x104 trypomastigotes (Tulahuén strain). The OI group presented significantly higher parasitemia and mortality rates than their GI counterparts (n=20/group) (0%, 45% and 20% of living mice, respectively, after 31 dpi). Heart histopathology showed extensive microinfiltrates in GI mice (n=5/dpi/group), although liver lesions were more severe in OI animals, which showed higher ASpartate Transaminase and ALanine Transaminase enzyme serum contents (n=3-7). Multiplex analysis revealed that OI mice presented higher type 1 cytokine (IFN-γ, TNF-α) (serum levels than GI animals (n=3-7/dpi). Real time PCR confirmed higher TNF-α, IFN-γ, as well as IL-10 gene expression in the cardiac tissue from OI group, compared to GI mice. Conversely, TGF-β serum levels were higher in GI animals (n=3/dpi/group). Interestingly, the high mortality rate seen in OI mice paralleled the TNF-α serum rise, and anti-TNF-α antibody treatment reduced the mortality rate (untreated, 100%; treated, 65%) (n=20/group). Overall, our data demonstrate that the site of parasite entrance, through the oral cavity (as observed in natural infection) or directly to the stomach, differentially affects the host immune response and mortality in mice. IYP08 RESPUESTA ANTI-RA Y DISAUTONOMIA EN INFECTADOS CRÓNICOS POR T. cruzi CON PROLONGADO SEGUIMIENTO Lorena Verónica Olivera, Maria Laura Bizai, Evelyn Elizabet Arias, Susana Denner, Diana Lucrecia Fabbro CIEN-FBCB-UNL. E-mail: veronicaolivera@yahoo.com.ar Se ha asociado la presencia de anticuerpos anti-RA con la disautonomía en la Enfermedad de Chagas. Objetivo: evaluar la correlación entre Ac anti-RA y disautonomía en infectados chagásicos crónicos en seguimiento, sin patología demostrada, tratados y no tratados con drogas tripanocidas. Diseño: Estudio longitudinal. Se utilizó el kit Chagacor para dosar Ac anti-RA. Se analizaron 240 sueros de 84 infectados agrupados en: A) 33 pacientes tratados con seguimiento de 18.3+/-7.3 años; B) 51 pacientes no tratados, seguidos 15,5+/-6.8 años. Además se procesaron 32 sueros de no infectados sanos. Se analizaron entre 2 y 4 muestras por paciente. Se midió dispersión de QT (dQT) y Maniobra de Valsalva (IV) En el grupo A, 11/33 (33,3%) pacientes presentaron Ac antiRA al inicio. Solo 2 (6,06%) fueron reactivos hasta el final del estudio, uno constante y el otro disminuyó. La diferencia de respuesta Ac anti-RA al inicio y final del seguimiento fue significativa (p<<0,05). En el grupo B, 22/51 (43,1%) mostraron reactividad anti-RA en la muestra inicial, sin variaciones durante un tiempo promedio de 15,5 años (p>0,05). No hubo reactividad anti-RA en los controles seronegativos. En el grupo B, de los 22 pacientes anti-RA positivo, uno presentó aumento de la dQT (60mseg) y 3 mostraron IV alterado. En el grupo tratado, los 2 pacientes con Ac anti-RA fueron normales para estas pruebas. El tratamiento tripanocida negativizó los anticuerpos anti-RA en 81,2% de los IMMUNOLOGY & PATHOGENESIS 154 pacientes. En los no tratados, quienes presentaron reactividad inicial permanecieron sin cambios clínicos ni serológicos durante 15 años, sugiriendo que estos Ac no constituyen un marcador de progresión hacia la cardiopatía. Además, no hubo asociación entre respuesta anti-RA, dQT e IV. Se requieren pruebas de disautonomía de mayor sensibilidad que las utilizadas para confirmar o descartar esta ausencia de correlación. IYP09 IMMUNOENDOCRINE INTERACTIONS DURING LYMPHOCYTE MIGRATION IN HUMAN CHAGAS DISEASE ARE RELATED TO SEVERE CARDIOPATHY Luiz R Berbert(1), Ana R Pérez(2), Romina Manarín(3), Florencia Gonzalez(4), Silvina Villar(5), Juan Beloscar(6), Jackeline Petrucci(7), Oscar Bottasso(8), Wilson Savino(9) (1)(9) LPT - Instituto Oswaldo Cruz - FIOCRUZ - Brasil. (2)(3)(4)(6)(7)(8)Instituto de Inmunología de Rosario - UNR - Argentina. (5)Instituto de Inmunología de Rosario -UNR - Argentina. E-mail: lrberbert@terra.com.br Chagas Disease remains a public health issue in Americas. In the pathological processes seen in patients, we found changes in imunoneuroendocrine interactions, which might be related to an imbalance in lymphocyte migration to inflammatory sites. We evaluated T lymphocyte migratory responses from chagasic patients with different forms of cardiopathy, correlating these events to immunoendocrine alterations that occur during chronic disease. We firstly observed that pro-inflammatory cytokines were more expressed in parallel with the severity of disease. Additionally, we found an imbalance on Hypothalamus-Pituitary-Adrenal axis, where a decreasing of DHEA hormone results in changes of circulating cortisol/DHEA ratio. Also in parallel, we found an enhanced migratory response over fibronectin, CXCL12 and TNF-alpha, as well as with Cortisol and DHEA pre-treatment. As miRNAs are known to be involved in migratory responses, we also investigated the presence of these small RNAs in patients sera, intending to analyze which mRNA targets are modulated in these events. These results indicate that endocrine disturbances, correlated to a systemic inflammatory profile, may also contribute to enhance migratory potential of T lymphocytes to inflammatory sites, including the heart tissue, being thus involved in the cardiopathy seen in this disease. IYP10 ESTUDIO FENOTIPICO DEL RECEPTOR DE IL7 Y SU ASOCIACIÓN CON FUNCIONES DOWNSTREAM DE STAT5 EN PACIENTES CON ENFERMEDAD DE CHAGAS CRÓNICA María Ailén Natale(1), María C Albareda (2), Damián Perez-Mazliah (3), Melisa Castro-Eiro , María G. Alvarez (5), Rodolfo Viotti(6), Graciela Bertocchi (7), Bruno Lococo(8), Rick L Tarleton(9), Susana A Laucella(10) (1)(2)(3)(4)(10) Instituto Nacional de Parasitología Dr. Mario Fatala Chaben . (5)(6)(7)(8)HIGA Eva Perón, San Martín Prov BsAs. (9)Center for Tropical and Emerging Global Diseases, Athens, Georgia, USA. E-mail: ailen.natale@gmail.com (4) IMMUNOLOGY & PATHOGENESIS 155 Resultados previos del laboratorio demuestran que la infección crónica por T. cruzi conduciría a la respuesta celular T específica para el parásito a un estado de agotamiento inmunológico, característico de las infecciones persistentes. Este perfil funcional se asoció con niveles disminuidos de linfocitos T totales “naive” y baja expresión del receptor de IL7 en la población T, comparado con los pacientes en mejores condiciones clínicas. Recientemente observamos que los niveles de fosforilación del factor de transcripción STAT5, luego de la estimulación de linfocitos T con IL7, fueron menores en pacientes crónicamente infectados comparado con los controles no infectados, y esta disminución fue más evidente en pacientes con cardiomiopatía más severa. En este trabajo realizamos un estudio fenotípico y funcional del receptor de IL7 analizando la expresión de las cadenas CD132 y CD127 del receptor y la capacidad de inducir la expresión del factor de sobrevida Bcl2 y del factor de diferenciación CD25, cuya expresión depende de la función de STAT5 en pacientes crónicamente infectados por T. cruzi (n=27) y controles no infectados (n=10). Encontramos una disminución de la subpoblación de linfocitos T CD8+ y CD4+ con fenotipo CD127+CD132+ y un aumento recíproco de la población CD127CD132+ en pacientes en estadío G0 comparado con pacientes en estadios G2-G3 y controles. La inducción de Bcl2 fue menor en la población de linfocitos T de pacientes en estadios G2-G3 comparado con pacientes en estadios G0, G1 y controles. En contraposición la expresión del marcador CD25 fue menor en la población de linfocitos T CD8+ de pacientes crónicamente infectados, independientemente de su estadío clínico. La estimulación persistente del sistema inmune sostenida por la infección crónica podría explicar las alteraciones observadas en la señalización a través de STAT5, contribuyendo a la dificultad de mantener los niveles de linfocitos T “naive” y de memoria a lo largo de la infección. IYP11 PREVALENCIA DE ANTICUERPOS ANTI-RA EN CHAGAS CRÓNICO: RELACIÓN CON CARDIOPATÍA Y EFECTO DEL TRATAMIENTO TRIPANOCIDA María Laura Bizai, Lorena Verónica Olivera, Evelyn Elizabet Arias, Florencia Sabbione, Diana Lucrecia Fabbro CIEN-FBCB.UNL. E-mail: mlbizai@fbcb.unl.edu.ar La presencia de Ac anti-RA ha sido relacionada con la fisiopatología de la enfermedad de Chagas encontrándose aun en etapas tempranas de la infección. Objetivo: comparar la frecuencia sérica de Ac anti-RA en infectados crónicos por T cruzi, sin patología demostrada tratados con drogas tripanocidas y sin tratar, y con cardiopatía chagásica (CCC). Diseño: Estudio transversal. Se utilizó el kit Chagacor para determinar la presencia de Ac anti-RA en 137 infectados crónicos por T. cruzi agrupados en: A) 33 asintomáticos que recibieron tratamiento (nifurtimox o benznidazol) con 24,5+/-6,5 años promedio post tratamiento; B) 51 no tratados sin patología demostrada y C) 53 con CCC, clasificados según Kuschnir en G1 (n=39), G2 (n=11) y G3 (n=3). Se procesaron 19 sueros de pacientes seronegativos con patología cardíaca y 32 controles sanos. La reactividad antiRA encontrada fue: grupo A 6,06%; grupo B 43,14%; grupo C 35,85%. Los controles no infectados resultaron negativos. La prevalencia y el nivel de reactividad de los Ac anti-RA fue similar para los grupos B y C (p>0,05 Test de Fisher, p>0,05 Test de student). En IMMUNOLOGY & PATHOGENESIS 156 cambio se encontraron diferencias significativas entre estos grupos (B y C) y el grupo A (p<0,05 Test de Fisher). No se encontró asociación entre el nivel de respuesta anti-RA y el grado de compromiso cardíaco. La prevalencia de Ac anti-RA en los grupos no tratados B y C fue similar a la hallada en otros trabajos. En los pacientes tratados el porcentaje de reactividad fue mucho menor, sugiriendo un beneficio del tratamiento tripanocida ya que estos Ac no se encontraron en personas sin infección. La ausencia de correlación entre la reactividad anti-RA y severidad de cardiopatía indicaría que por sí mismos estos Ac no son marcadores de patología. > IYP12 ANÁLISIS DE PACIENTES CON SEROLOGÍA POSITIVA PARA ENFEMEDAD DE CHAGAS CON PERSISTENCIA DE T. cruzi Noemí Miler, Romina Blasco, Daniela Velázquez, Silvina Lo Presti, Paola C Bazán, Mariana Strauss, Alejandra Báez, Héctor W Rivarola, Patricia Paglini Cátedra de Física Biomédica, Facultad de Ciencias Médicas. U.N.C.. E-mail: alejandralidiab@hotmail.com Se han propuesto diferentes hipótesis para explicar la patogenia de la miocardiopatía chagásica dándole relevancia a variables relativas al parásito o al huésped. Las técnicas más sensibles para la detección del T. cruzi rescató el rol primordial del parásito y actualmente se considera a la enfermedad como producto de la interacción entre el genoma del parásito y del humano. Sin embargo ninguna de estas hipótesis explica por qué el 30% de las personas infectadas evolucionan hacia una enfermedad cardíaca y el 70% permanece asíntomático aunque con serología persistente así como tampoco la amplia variabilidad clínica. Por ello que en el presente se estudiaron 48 pacientes con serología positiva para Enfermedad de Chagas (HAI, ELISA y TIF), edad 61,39± 2,35, para determinar mediante PCR (en una única toma de sangre), si el T. cruzi persiste en circulación en estos pacientes con y sin sintomatología cardíaca. Para ello se realizó inspección clínica, ECG y ecocardiograma. De los 48 pacientes el 23% la PCR fue negativa y en el 77% fue positiva. Los pacientes con PCR (-) en un 54% fueron asintomáticos mientras que los PCR (+) solamente el 35% (p<0.05). Los síntomas clínicos más frecuentes de los pacientes PCR (+) fueron disnea, 40% palpitaciones, 21% angor pectoris y 13% edema. Al analizar las alteraciones electrocardiográficas y ecográficas las alteraciones más frecuentes encontradas fueron: crecimiento de aurícula izquierda en un 36%, bradicardia sinusal 23%, bloqueo de rama derecha 16,6%, hemibloqueo anterior izquierdo e hipertrofia de ventrículo izquierdo 10%, disfunción diastólica 50% y disminución de la fracción de eyección en un 15%. Estos resultados claramente demuestran la persistencia del parásito en circulación en la mayoría de los pacientes con serología positiva hecho que tiene relación directa con mayor sintomatología cardiaca lo que con seguridad generará agravamiento en la cardiopatía, por lo cual el tratamiento en cualquier fase resulta de importancia > IYP13 IMMUNOLOGY & PATHOGENESIS 157 IMMUNE RESPONSE AND ITS RELATIONSHIP WITH THE PROFILE OF CYTOKINES IN DIFFERENT ORGANS OF DOGS WITH LEISHMANIASIS VISCERAL Pamela Rodrigues Reina Moreira(1), Márcio de Barros Bandarra(2), Filipe Santos Fernando(3), Helio José Montassier(4), Rosemeri de Oliveira Vasconcelos(5) (1)(4)(5) UNESP - Jaboticabal/Brasil-Departamento de Patología Veterinaria. (2)(3)UNESP Jaboticabal/Brasil. E-mail: pamela_rreina@yahoo.com.br The immune response of dogs with visceral leishmaniasis (VL) may present a varied profile of proinflammatory (resistance) or anti-inflammatory (susceptibility) cytokines, hindering or favoring the multiplication of the protozoan Leishmania infantum in the host tissues. The aim of this study was to evaluate the profile of Th1, Th2 and regulatory cytokines, transcription factors (T-bet/GATA-3) and quantification of parasite DNA in dogs with VL and control, in the liver, spleen, popliteal and prescapular lymph nodes. We used 16 symptomatic (S) and 12 asymptomatic (A) dogs naturally infected by the parasite and five control dogs from non-endemic area for VL. The quantification of the gene expression of cytokines (IFN-γ, TGF-β, IL-10, IL-4, IL-12 and MIF), transcription factors and quantification of parasite DNA was done using RT-qPCR in different organs. The spleen, popliteal and pre-scapular lymph nodes showed a higher number of copies of the DNA of Leishmania infantum. The expression of cytokine genes increased for pro-inflammatory (TNF-α, IFN-γ, MIF, IL-12), anti-inflammatory (IL-4) and regulatory cytokines (IL-10, TGFβ), in infected dogs (A, S), with significant differences from the control group (P<0.05). IL4, IL-10, TGFβ and MIF had higher expression levels of mRNA in the group S, in all organs. TNF-α and IFN-γ had higher levels in group A. The transcription factor T-bet had higher levels in group A and GATA-3 was less expressed in the infected dogs. Maybe IL10 and TGF-β can influence the progression of VL in the dog, because sub-regulate T-bet and GATA-3. MIF is acting in favor of the parasite and can be responsible for survival of parasitized macrophages. We conclude that the immune response that favors the systemic dissemination of the parasite. It has a mixed pattern Th1/Th2. This kind of response is not efficient in controlling the parasite in susceptible organs or in dogs with advanced disease. Acknowledgement: FAPESP-2013/00763-4 and 2010/16030-8.> IYP14 EVIDENCE OF EXPERIMENTAL BIOLOGICAL INTERACTIONS BETWEEN DIFFERENT ISOLATES OF Trypanosoma cruzi FROM THE CHACO REGION Paula Ragone(1), Cecilia Pérez Brandán(2), Mercedes Monje Rumi(3), Nicolás Tomasini(4), Juan J Lauthier(5), Rubén Cimino(6), Miguel A Basombrío(7), Patricio Diosque(8) (1)(2)(3)(4)(5)(7)(8) Instituto de Patología Experimental, Facultad de Ciencias de la Salud, Universidad Nacional de Salta. (6)Cátedra de Química Biológica, Facultad de Ciencias Naturales, Universidad Nacional de Salta. E-mail: p_ragone@yahoo.com.ar Many infectious diseases arise from co-infections or re-infections with more than one genotype of the same pathogen. These mixed infections could alter host fitness, the severity of symptoms, success in the pathogen transmission and the epidemiology of the disease. Trypanosoma cruzi, the etiological agent of Chagas disease, exhibits a high IMMUNOLOGY & PATHOGENESIS 158 biological variability often correlated with the genetic diversity. Here, we developed an experimental approach in order to evaluate biological interaction between three T. cruzi isolates belonging to different Discrete Typing Units (DTUs TcIII, TcV and TcVI). These isolates were obtained from a restricted geographical area in the Chaco Region; suggesting that they could be naturally co-infecting the same host. Different mixed infections involving combinations of two isolates (TcIII + TcV, TcIII + TcVI and TcV + TcVI) were evaluated in a mouse model. The parameters evaluated were number of parasites circulating in peripheral blood, histopathology and genetic characterization of each DTU in different tissues by DNA hybridization probes. The results suggest biological interactions between the analyzed isolates. We found a predominance of TcVI isolate in blood and tissues respect to TcIII and TcV; and a decrease of the inflammatory response in heart when the damage of mice infected with TcVI and TcIII + TcVI mixture were compared. In addition, simultaneous presence of two isolates in the same tissue was not detected, hence, that presence of one isolate could display a negative effect on isolates belonging to a different DTU. Overall, our results show that biological interactions between isolates with different biological behaviors lead to changes in their biological properties. The occurrence of interactions among different genotypes of T. cruzi observed in our mouse model suggests that these phenomena could also occur in the natural cycles in Chaco Region. IYP15 BIOMARCADORES DE DISFUNCIÓN ENFERMEDAD DE CHAGAS CRÓNICO ENDOTELIAL EN PACIENTES CON Claudia Pengue(1), Maria G Alvarez(2), Rodolfo J Viotti(3), Silvia S Cambiazzo(4), Marcos Petti(5), María C Albareda(6), Susana A Laucella(7) (1)(3)(5) Hospital Interzonal General de Agudos Eva Perón, San Martín. (2)Hospital Interzonal General de Agudos Eva Perón. (4)Hospital Teodoro Alvarez, Buenos Aires. (6)(7)Instituto Nacional de Parasitología "Dr. M.F. Chaben", Buenos Aires. E-mail: claudiapengue@hotmail.com La inflamación crónica producto de la infección por T. cruzi conlleva a un estado de activación persistente del sistema inmune. Los mediadores inflamatorios regulan la expresión de distintas moléculas de adhesión celular entre las que se encuentran la Pselectina(CD62P) y su receptor (PSGL-1). Estas moléculas participan en el reclutamiento de leucocitos durante la reacción inflamatoria, además se ha demostrado que estas moléculas participarían en el reclutamiento de micropartículas leucocitarias para la formación del trombo plaquetario. En este estudio se exploró la expresión de marcadores de activación plaquetaria, endotelial y de daño tisular en pacientes con enfermedad de Chagas crónica sin compromiso cardíaco (n= 13) y en pacientes con alteraciones cardiológicas(n= 10). La expresión de CD63 y CD62P en plaquetas; y de su ligando PSGL-1 en linfocitos CD4 y CD8 fueron evaluados por citometría de flujo. También se han evaluado los niveles de endotelina-1 y procolágeno en suero por ELISA de captura; y los niveles de fibrinógeno y el factor de Von Willebrand por nefelometría. La expresión de CD62P y CD63 así como el porcentaje de plaquetas que expresan estos marcadores se encuentran disminuídos en los pacientes crónicamente infectados por T. cruzi, no existiendo diferencias entre grupos clínicos. Se observó un aumento significativo en los niveles de endotelina-1 sólo en los pacientes con cardiomiopatía severa.Aunque no se IMMUNOLOGY & PATHOGENESIS 159 observaron diferencias ni en los niveles de fibrinógeno ni en el factor Von WIllebrand entre pacientes con o sin presencia de cardiomiopatía, un 40% de los pacientes mostraron valores por encima del valor de referencia.Contrariamente, la expresión de PSGL-1 y los niveles de procolágeno no se encuentran alterados. La activación plaquetaria evidenciada en este estudio, sugieren que la infección crónica por T. cruzi induce alteraciones de función endotelial en pacientes en los que no se evidencia aún compromiso cardíaco. IYP16 ADN DE Toxoplasma gondii INDUCE LA EXPRESION DE α-DEFENSINA-5 EN CELULAS DEL EPITELIO INTESTINAL Ricardo S Corral(1), Miguel H Santamaría(2) Servicio de Parasitología-Chagas, Hospital de Niños Dr. Ricardo Gutiérrez (CABA). (2) Centro de Estudios Metabólicos (CEM-Santander). E-mail: ricardocorral56@hotmail.com (1) El epitelio intestinal es una barrera selectiva que contribuye activamente a la homeostasis de la mucosa y a la resistencia frente a microorganismos patógenos, entre otros T. gondii. Múltiples mecanismos de inmunidad innata participan en dicha protección, incluyendo aquéllos mediados por péptidos antimicrobianos como las defensinas. Dentro de esta familia se destaca la α-defensina-5 (DEFA-5) intestinal, la cual es generada, vía receptor 9 de tipo Toll (TLR9), luego de la infección oral y es capaz de reducir la viabilidad e infectividad del toxoplasma. Nuestro objetivo fue determinar si la interacción de TLR9 con secuencias CpG no metiladas presentes en el ADN de T. gondii conduce a un aumento en la producción de DEFA-5 en células del epitelio intestinal. Mediante experimentos in vitro, se halló que el ADN purificado de taquizoitos de T. gondii cepa RH induce, en función de la dosis, la expresión de DEFA-5 en la línea celular pD015-f. Este efecto fue revertido por tratamiento con ADNasa y por metilación de CpG en el ADN del parásito. Por otra parte, en células transfectadas con ADN de T. gondii (100 μg/ml) se verificó por inmunoblotting un incremento de los niveles del péptido antimicrobiano al cabo de 24 h. Utilizando un oligonucleótido inhibidor de TLR9 se bloqueó por completo la inducción, reflejando así que la misma era mediada por activación de dicho receptor endosomal. En concordancia con estas observaciones, los estudios inmunocitoquímicos revelaron una intensa señal para DEFA-5 en las células epiteliales intestinales estimuladas con ADN del protozoo, mientras que el análisis por citometría de flujo mostró un mayor número de células pD015-f productoras de esta defensina en respuesta a la interacción con material genético aislado de taquizoitos. Nuestros resultados sugieren que los motivos CpG no metilados del ADN de T. gondii, actuando como activadores de TLR9, son importantes para la inducción de DEFA-5 en células del epitelio intestinal. IYP17 CYTOKINES LEVELS IN CARUNCLES OF PREGNANT HEIFERS IMMUNIZED WITH EXPERIMENTAL VACCINES AGAINST Neospora caninum AND CHALLENGED Yanina P Hecker(1), Javier Regidor-Cerrillo(2), Andrea Verna(3), Eleonora Morrell(4), Luis M Ortega-Mora(5), Anselmo Odeón(6), Carlos Campero(7), Dadín P Moore(8) (1)(8) Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). IMMUNOLOGY & PATHOGENESIS 160 (2)(5) SALUVET, Animal Health Department, Faculty of Veterinary Sciences, Complutense University of Madrid, Ciudad Universitaria s/n, 28040 Madrid, Spain. (3)(4)(6)(7)Instituto Nacional de Tecnología Agropecuaria (INTA), Balcarce, CC 276, 7620, Balcarce, Argentina. E-mail: hecker.yanina@inta.gob.ar The aim of the present study was to evaluate the immune response in maternal-fetal interface of pregnant cattle immunized with a live and two inactivated experimental vaccines against Neospora caninum and then challenged.Twenty pregnant heifers were divided in 5 groups of 4 animals, each receiving different inoculation before mating: group A animals were intravenously (iv) inoculated with 6.25×107 live tachyzoites of the NC-6 strain, group B heifers were inoculated twice subcutaneously (sc) with N. caninum native antigen extract formulated with ISCOMs; group C heifers were sc inoculated twice with three recombinant proteins (rNcSAG1, rNcHSP20, rNcGRA7) formulated with ISCOMs; group D were sc injected with sterile phosphate-buffered saline (PBS) and group E heifers received sc ISCOM-matrix (without antigen). All groups were iv challenged with the NC-1 strain at 70 days of gestation and were slaughtered at day 104 of gestation. Cytokine levels (IFN-γ, IL-4, IL-10, IL-12 and TNF-α) were measured using real-time reverse transcription-PCR. In the present study was found significantly low levels of IFN-γ, IL-4, IL10, IL-12 and TNF-α mRNA levels in group A in relation to group B, C, D and E (P<0.05). In contrast, cytokine mRNA levels showed a high levels of IFN-γ, IL-12p40 and TNF-α, which are representatives of Th1 response, and increased mRNA levels of Th2 (IL-4) and regulatory cytokines (IL-10), confirming a mixed Th1 and Th2 pattern in N. caninuminfected caruncles in group B, C, D and E. There were not differences among these last four groups (P>0.05). These findings indicated that in group A there was not active immune response in caruncles. Possibly the solid immune response developed in dams that received live tachyzoites (group A) avoided the arrival of N. caninum to materno-fetal interface. On the other hand, in group B and C were observed similar levels of cytokines to group D and E indicating the failed to induce memory response against experimental challenge. IYP18 USO DE PROTEINAS RECOMBINANTES COMO BLANCO DE LA RESPUESTA INMUNE CELULAR EN PACIENTES CON ENFERMEDAD DE CHAGAS CRONICA Melisa D Castro Eiro(1), Maria G Alvarez(2), Maria C Albareda(3), Ailen Natale(4), Rodolfo Viotti(5), Susana Laucella(6), Rick L Tarleton(7) (1)(3)(4)(6) Instituto Nacional de Parasitología “Dr. F. Chaben, Buenos Aires, Argentina. (2)(5) HIGA “Eva Perón, Buenos Aires, Argentina. (7)Center for Tropical and Emerging Global Diseases, Athens, Georgia, USA. E-mail: melisa_dce@yahoo.com.ar La utilización de proteínas recombinantes y péptidos como estímulo antigénico para evaluar la respuesta humoral ha sido extensamente validada. En la enfermedad de Chagas, el ensayo serológico de multiplex en el que se emplean proteínas recombinantes derivadas de T. cruzi plantea una alternativa de diagnóstico a la serología convencional utilizando extractos crudos del parásito. Sin embargo, el uso de proteínas recombinantes para la evaluación de la respuesta celular ha sido más limitado. El objetivo de este trabajo IMMUNOLOGY & PATHOGENESIS 161 fue estudiar la respuesta inmune celular hacia 7 proteínas recombinantes de T. cruzi incluídas en el multiplex (ANOH, ANOF, Kn104, Kn107, Kn117, Kn122, FABA). Para evaluar esto, se realizaron ensayos de ELISPOT para interferón-gamma (IFN-γ), utilizando células mononucleares periféricas. Se ensayaron distintas concentraciones de proteínas recombinantes: 2,5 μg/ml, 3 μg/ml, 10 μg/ml y 20μg/ml. También se evaluó la respuesta hacia un lisado proteico de amastigotes (10 μg/ml) para su comparación. Se analizaron 20 pacientes con enfermedad de Chagas crónica de estadío G0 y 10 controles no infectados. De los 20 pacientes, 11 resultaron positivos frente al estímulo con el lisado de T. cruzi y 5 de ellos respondieron a una o varias proteínas. De los 10 controles no infectados, sólo 1 resultó positivo para 1 sola proteína. De las 3 concentraciones ensayadas para las proteínas recombinantes, no se encontraron diferencias entre 10 μg/ml y 20 μg/ml pero sí entre éstas y 3 μg/ml. Estos hallazgos sugieren que blancos antigénicos de la respuesta humoral son también reconocidos por linfocitos T. IYP19 THE TRYPOMASTIGOTE SURFACE PROTEIN TcTASV-C INDUCES PARTIAL PROTECTION AGAINST Trypanosoma cruzi IN MICE Lucas D Caeiro(1), Catalina D Alba Soto(2), Daniel O Sanchez(3), Valeria S Tekiel(4) IIB-UNSAM. (2)IMPAM-UBA-CONICET. E-mail: lucaniel@gmail.com (1)(3)(4) TcTASV is an Alanine, Serine and Valine-rich protein family, initially identified by our group from a cDNA library of trypomastigote-enriched mRNAs. TcTASV family consists of ~40 members, is present in T. cruzi strains from different lineages and has no orthologs in other trypanosomatids. All members of the TcTASV family have conserved coding aminoand carboxy-termini, and a central variable core that allows partitioning of TcTASV proteins into three subfamilies, A, B and C. We showed that TcTASV-C is preferentially expressed in trypomastigotes and is highly phosphorylated and glycosylated. TcTASV-C is anchored to the trypomastigote’s membrane by a GPI anchor, is spontaneously released to the medium and is localized in discrete spots or patches on cell membrane and flagellum of trypomastigotes. Furthermore, approximately 30% of sera from infected host (experimental animals and humans) were reactive with TcTASV-C, confirming its expression in the natural cycle of the parasite. Preliminary results suggest that it may also be good vaccine candidate. In this project, we studied TcTASV-C to analyze its protective capacity against T. cruzi. We employed a prime and boost vaccination schedule (2 doses of DNA + GM-CSF/mouse and 2 doses of protein + alum/ mouse; TcTASV-C: n=10; controls: n=10). Fifteen days after the last dose, sera were obtained to test antibody response, in which we observed a significant response Th1/Th2 against TcTASV-C, and animals were challenged with the highly virulent T. cruzi RA strain (lineage VI). Vaccinated animals presented a delay in the appearance of detectable parasites in blood, and a significant higher survival rate in vaccinated mice than controls (100% vs 30% at 30 d.p.i.), suggesting that TcTASV-C induces a partially protective response and is a good vaccine candidate that deserves further studies. IYP20 IMMUNOLOGY & PATHOGENESIS 162 B CELLS REGULATE THE INFLAMMATORY CD4+ T CELL RESPONSE IN Trypanosoma cruzi INFECTION Melisa Gorosito Serrán, Jimena Tosello Boari, María C Ramello, Cristian Beccaría, Facundo Fiocca Vernengo, Daniela A Bermejo, María C Amezcua Vesely, Carolina L Montes, Eva V Acosta Rodriguez, Adriana Gruppi CIBICI - CONICET. E-mail: mgorosito@fcq.unc.edu.ar B cell-deficient mice (mMT) infected with T. cruzi are able to control parasitemia similar to C57BL/6 wild type (WT) mice but present increased parasitemia by 10 days post-infection (dpi) and accelerated mortality. mMT and WT mice have similar tissue parasite load as determined by RT-PCR, indicating that mortality is not caused by uncontrolled parasitism. To assess possible causes of the increased susceptibility of mMT mice, we analyzed cytokine production and CD4+T cell responses in mMT and WT mice infected i.p. with 10000 trypomastigotes Y-br strain. Groups of 4-7 mice were sacrificed by 4, 9, 15, 20 dpi and sera and splenocytes were obtained. By 9 dpi, amounts of serum IFNg were increased in both infected mice strains, but were higher in mMT mice (p<0.01). Serum TNF amounts were increased in both mice strains by 9 dpi and afterwards diminished in WT and increased in mMT mice (15 and 21 dpi, p<0.001). CD4+T cells where the main IFNg producing population by 9 dpi and were higher in mMT mice in comparison to WT (p=0.0013). CD4+T cells were also the main TNF producers by 15 and 20 dpi and in mMT mice preferentially had a pro-inflammatory phenotype (CD4+Ly6C+). IL-10-producing cells were reduced in infected mMT mice due to not only the absence of IL-10+B cells present in WT mice, but also a decrease in the numbers of IL10-producing CD4+T cells (15 dpi, p<0.001). In vitro co-culture experiments showed that B cells controlled TNF production in splenocytes from infected mice incubated with T. cruzi antigens. TNF neutralization by mAbs prevented the cachexia observed in infected mMT mice but accelerated even more their mortality due to an exacerbated Th1 response with high amounts of IL12, IFNg, TNF. In these mice, CD4+Ly6C+ cells were increased in spleen at 30 dpi. Our data suggests that B-cell absence in T. cruzi infection could cause an altered activation of the CD4+T-cells, leading to a systemic imbalance in the host and mortality. IYP21 NIVELES PLASMÁTICOS DE CITOCINAS Y QUIMIOCINAS EN NIÑOS CON INFECCIÓN CONGÉNITA POR Trypanosoma cruzi CON DISTINTOS NIVELES DE PARASITEMIA Bibiana Julieta Volta, Susana Laucella, Karenina Scollo, Ana María de Rissio, Rita L. Cardoni, Jacqueline Bua INP Fatala Chaben. E-mail: bvolta@gmail.com Si bien en adultos, la inmunidad protectora frente a T. cruzi es mediada por una respuesta Th1, se conoce menos sobre la respuesta inmune de neonatos con infección congénita. IMMUNOLOGY & PATHOGENESIS 163 En este estudio, se caracterizó el perfil inmunológico de niños infectados, en relación a su carga parasitaria, evaluando los niveles plasmáticos de citocinas (IL-1β, IL-2, IL-3, IL-4, IL5, IL-6, IL-7, IL-9, IL-10, IL-12p70, IL-13, IL-17A, IL-17F, IFN-γ, TNF) y quimiocinas (MIG, MIP-1β, MCP-1,RANTES) en 10 niños no infectados hijos de madres seropositivas para T. cruzi, 10 niños no infectados hijos de madres seronegativas y 40 niños infectados que se dividieron en 3 grupos (20 neonatos con altas parasitemias en el 1° mes de vida, 10 niños con bajas parasitemias en el 1° mes, diagnosticados en el 6° mes de vida, y 10 niños con bajas parasitemias diagnosticados por serología alrededor del año de vida. En los niños infectados se observó un incremento significativo de MCP-1y MIG, correlacionando la concentración de MIG al mes de vida con la carga parasitaria de los bebés (rs= 0,81 ; p= 0,0001). En niños infectados con bajas parasitemias se detectaron niveles significativamente más altos de IL-6 e IL-17A que en los bebés con altas parasitemias. La infección por T. cruzi no alteró la produccion de citocinas del perfil Th1 o Th2. En los bebés no infectados nacidos de madres seropositivas se observaron niveles plasmáticos de IL-12p70 e IFN-γ más altos que el resto de los grupos estudiados. Estos resultados sugieren que el perfil de citocinas y quimiocinas es diferente entre niños que contraen infección congénita y aquellos que no. En los niños con infección congénita por T. cruzi existe una polarización hacia el perfil Th17 mientras que en niños no infectados nacidos de madres seropositivas se observa una polarización hacia el perfil Th1. La concentración de MIG en plasma muestra una elevada capacidad predictiva de la infección congénita, que debería confirmarse en estudios futuros IYP22 CARACTERIZACION DE LINFOCITOS B Y ANALISIS DE FACTORES ASOCIADOS A LA INMUNIDAD HUMORAL EN LA LEISHMANIASIS MUCOSA Cecilia Parodi (1), María F García Bustos(2), Alejandra Barrio(3), Patricia Baré(4), Federico Ramos(5), María C Mora(6), María M de Elizalde de Bracco(7), Miguel A Basombrio(8) (1)(4)(7) Instituto de Medicina Experimental-CONICET, Academia Nacional de Medicina. (2)(3)(5)(6)(8) Instituto de Patología Experimental-CONICET, Universidad Nacional de Salta. E-mail: cecilia_parodi@hotmail.com Para contribuir en dilucidar el rol de los linfocitos B en la Leishmaniasis (L) caracterizamos receptores de memoria B, autoinmunidad y factores regulatorios, en muestras de células mononucleares periféricas y plasmas de pacientes con L. mucosa (LM, n=5-22) y sujetos sanos (N, n=5-11). Analizando (X±DS) la población B de memoria (CBM) CD19+, LM presentó menor expresión de CD27+ (26.26±14.99 vs. 32.57±10.16 %, p=0.0261) y de CBM sin cambio de isotipo CD27+ IgD+ (5.65±2.23 vs. 12.08±6.84 %, p=0.0018). En LM se observó tendencia a aumento de CBM con cambio de isotipo IgD- IgM- (36.86±21.90 vs. 26.39±14.61 %), IgG+ (22.08±8.09 vs. 11.34±5.51 %) e IgA+ (16.35±8.94 vs. 8.27±4.03 %). No obstante, la concentración plasmática de IgG resultó similar en LM (7.82±7.24 g/l) y en N (6.42±4.09 g/l). Además en LM aumentaron significativamente las CBM CD27- IgD- (12.52±4.97 vs. 7.27±2.57 %, p=0.0065). La expresión de los receptores de autoinmunidad, BAFF-R (LM: 89.96±10.95%; N: 97.62±2.02 %) y TACI (LM 32.54±13.02; N 42.32±16.64 %) fue similar en LM y N. La concentración de la citoquina reguladora IL10 en plasma resultó mayor en LM: 11.16±20.07 vs. N: 5.43±1.30 pg/ml. En cuanto a las células T CD4+ regulatorias, la expresión de CD25 (LM 11.79±5.59; N IMMUNOLOGY & PATHOGENESIS 164 11.70±3.54 %) y FoxP3 (LM 7.30±2.71; N 5.32±1.79 %) fue similar, pero disminuyeron las células regulatorias supresoras T CD4+ CD25+ CD127- en LM (1.72±0.72 vs. 2.83±0.93 %; p=0.0280). El aumento de CBM CD27- IgD-, observado también en pacientes con VIH o malaria, podría deberse a la persistencia del patógeno, que lleva a activación crónica inmune y puede manifestarse con signos de agotamiento celular. No encontramos diferencias en receptores relativos a autoinmunidad ni presencia de hipergammaglobulinemia por IgG. Debido a que en LM existe una respuesta inflamatoria exacerbada, el aumento de IL10 podría producirse para regular dicha respuesta, aunque en nuestro estudio, el porcentaje de células T regulatorias no aumentó paralelamente. IYP23 INMUNOMODULACIÓN LA ENFERMEDAD DE CHAGAS POR CÉLULAS NATURAL KILLER (NK): ROL DE LA CITOQUINA IL 10. Estela I Batalla, Agustina M Pino Martinez, Cristian G Miranda, Stella M Gonzalez Cappa, Catalina D Alba Soto IMPAM (UBA-CONICET). E-mail: catalina.alba@gmail.com Las NK participan en la inmunidad protectora contra patógenos intracelulares. Su interacción temprana con las células dendríticas (CD) promueve la activación recíproca, estimulando la respuesta adaptativa y la función efectora de ambas. También se atribuye a las NK un rol regulador en infecciones sistémicas e inflamación mediado por su producción de IL10. Hemos descrito que la infección temprana con una cepa de Trypanosoma cruzi de alta virulencia altera el diálogo entre NK/CD y que la IL10 participa en este mecanismo. Evaluamos ex vivo, en la interacción NK/CD, si la IL10 producida por NK modificaba la producción de citoquinas. Las CD IL10-/- aumentaron su producción de IL12 frente a NK wt de ratones infectados con T. cruzi y esto coincidió con una menor producción de IFNγ por NK. El bloqueo del consumo de IL10 (anti-IL10R1) no modificó la producción de IL12 pero incrementó la de IFNγ. La IL10 estaría limitando la producción de IFNγ por NK autócrinamente o actuando sobre las CD. En experimentos de transferencia de NK de ratones infectados (48hpi) con posterior desafío con T.cruzi evaluamos si esta intervención modula la respuesta a la infección. Para determinar el rol de la IL10 producida por NK, usamos donantes wt y receptores IL10-/- . La transferencia intradérmica de NK de ratones wt infectados a receptores IL10-/-, en simultánea con la infección, aumentó la susceptibilidad de los mismos a T. cruzi. Lo mismo se observó en receptores wt. Sin embargo, cuando realizamos la transferencia, por vía endovenosa, de NK de ratones wt infectados 6 días previo a la infección, los receptores desafiados aumentaron su resistencia al parásito. Las NK activadas por T.cruzi podrían promover un ambiente inflamatorio local favorable al establecimiento del parásito por su temprana producción de IFNγ. Transferidas previo a la infección podrían ejercer un efecto protector relacionado con la amplificación de mecanismos efectores o la supresión de mecanismos inflamatorios. IYP24 IMMUNOLOGY & PATHOGENESIS 165 DIFFERENTIAL IN VITRO RESPONSE AGAINST Trypanosoma cruzi BY T-CELLS DERIVED FROM CHRONIC CARDIAC AND ASYMPTOMATIC CHAGAS DISEASE PATIENTS Gonzalo R Acevedo(1), Silvia Longhi(2), Augusto Atienza(3), Pablo Chiale(4), Valeria Judkowski(5), Clemencia Pinilla(6), Karina A Gómez(7) (1)(2)(7) INGEBI-CONICET, Buenos Aires, Argentina. (3)(4)Hospital Ramos Mejía, Buenos Aires, Argentina. (5)(6)Torrey Pines Institute for Molecular Studies, San Diego, CA, EEUU. E-mail: acevedo.gonza@gmail.com The discovery of immunologically protective Trypanosoma cruzi antigens is a matter of particular interest, given the relevance of human Chagas disease as a major public health issue. Despite efforts in the field are profuse and diverse, they have thus far been of very limited success. Our line of research proposes a T-cell driven approach, by which amplified T. cruzi-specific memory T-cells from infected patients are used to scan combinatorial peptide libraries, allowing the discovery of T epitopes which would be, by definition, immunogenic. The first step on this strategy is the generation of T-cell lines from donors’ peripheral blood mononuclear cells (PBMC). This is achieved by an in vitro stimulation and culture protocol, consisting of an initial stimulation with T. cruzi lysate, an antigen-specific T-cells expansion stage and a challenge protocol for specificity evaluation. Among several combinations of experimental conditions tested, our preliminary results allowed us to adjust the following protocol variables: T. cruzi lysate concentration and incubation time (2.5 μg/ml and 1 day, respectively), initial culture density (200,000 PBMC/well), interleukin-2 addition in culture medium (since day 6, every 3-4 days), culture time span before specificity evaluation (27 days), antigen-specific T-cells to antigen presenting cells ratio (1:2), and readouts (Interferon-γ secretion, cell proliferation). Interestingly, experiments showed remarkable differences in the way T-cells respond to parasite antigens, depending on whether the donor was classified as asymptomatic (mainly proliferative response), or cardiac (predominantly interferon-γ secretion). Hopefully, our contribution will help to a better understanding of the immune response against T. cruzi in the context of Chagas disease, as it allows us to advance towards the discovery of potential prophylactic or therapeutic vaccine candidates. IYP25 VERTICAL TOXOPLASMOSIS IN A MURINE MODEL. PROTECTION AFTER IMMUNIZATION WITH THE SERINE PROTEASE INHIBITOR-1 OF Toxoplasma gondii Mariano S Picchio(1), Vanesa R Sanchez(2), Ignacio M Fenoy(3), Nadia Arcon(4), Ariadna S Soto(5), Mariela Urrutia(6), Alejandra Goldman(7), Valentina Martin(8) (1) CESyMA - ECyT - UNSAM. (2)(4)(5)(7)(8)CESyMA / ECyT / UNSAM. (3)IIB-INTECH / UNSAM. (6)Fundación Instituto Leloir; IIBBA-CONICET. E-mail: picchiomariano@gmail.com Primary Toxoplasma gondii infection during pregnancy can cause severe damage to the fetus as a result of congenital transmission in humans and abortion and loss of offspring in farm animals. The fact that infection before pregnancy normally results in immunity able to protect the fetus, suggests the possibility of blocking parasite vertical transmission by an appropriate vaccine. We have previously shown that the T. gondii serine protease IMMUNOLOGY & PATHOGENESIS 166 inhibitor-1 (TgPI-1) induced a protective immune response against parasite infection in both C3H/HeN and C57BL/6 mice. In the present work, we evaluated its protective capacity to prevent parasite vertical transmission in BALB/c mice. Female mice were immunized with rTgPI-1 (2 doses + alum id plus 2 doses +CpG-ODN in) or left untreated (control group), and then mated with males. Pregnant dams were infected orally on day 12 of gestation, with tissue cysts of T. gondii Me49 strain. Naturally delivered pups from rTgPI-1 vaccinated mice showed a significant increase in the neonatal survival rate on day 30 after birth compared to the control group (71% vs 40%). On the other hand, both groups presented similar rate of dead pups at birth (30% rTgPI-1 vs 44% control). In order to evaluate whether rTgPI-1 immunization could prevent Toxoplasma-induced fetal resorption, in another experiment the uteri of pregnant mice were removed on day 19/20 of gestation for the documentation of the implantation sites. A similar number of dams experienced abortions in both control and vaccinated groups (57% 50%), but the abortion rate in the control group was significantly higher compared to the vaccinated group (100% vs 17%, p<0.05). In fetus with visible normality, a similar rate of congenital infection was found as analyzed by Nested-PCR (41% vs 38%, vaccinated vs control). These results let us hypothesize that vaccination with rTgPI-1 could decrease the abortion rates and also increase the survival of pups born to dams infected during pregnancy. IYP26 LA PROLIL OLIGOPEPTIDASA DE 80 KDA (TC80) DE Trypanosoma cruzi CONFIERE PROTECCIÓN EN UN MODELO AGUDO DE INFECCIÓN MURINA Augusto E Bivona(1), Andrés Sanchez Alberti(2), Natacha Cerny(3), Alejandro C Cardoso Landaburu(4), Silvia I Cazorla(5), Emilio L Malchiodi(6) (1)(2)(3) IDEHU-UBA-CONICET. IMPaM-UBA-CONICET. (4)(6)IDEHU-CONICET-UBA. (5) IMPaM-CONICET-UBA. E-mail: augustobivona@gmail.com Tc80 es una proteína de secreción expresada principalmente en los estadíos de tripomastigotes y amastigotes. Esta serín proteasa degrada componentes de la matriz extracelular como fibronectina, colágeno tipo I y IV, por lo que estaría implicada en la invasión tisular del parásito. Se observó además, que su inhibición bloquea la infección de células in vitro. En base a estos antecedentes, la consideramos como un posible candidato vacunal frente a la infección por T. cruzi. Clonamos Tc80 en vectores de expresión procariota y eucariota. A partir del vector procariota se expresó Tc80 recombinante (rTc80) en células E. coli BL21 en forma soluble. Con el vector eucariota se transformó Salmonella enterica serovar Typhimurium aroA 7207, la que se utilizó como sistema delivery por vía oral, del ADN codificante de Tc80 (STc80). Inmunizamos los siguientes grupos de ratones. G1- Cuatro dosis de rTc80+CpG por vía intra muscular (rTc80 i.m.); G2-cuatro dosis por vía oral de STc80; G3- un priming de dos dosis orales de STc80 y un booster de dos dosis de rTc80+CpG por vía intramuscular (P.boost); y G4- un grupo control inmunizado con Salmonella atenuada (SaroA). La respuesta humoral desencadenada fue significativa en aquellos ratones que recibieron rTc80 i.m. Más interesante, el priming con STc80 aumenta el sesgo hacia el isotipo IgG2a, indicio de la estimulación de una respuesta del tipo Th1. Por el contrario, la respuesta celular fue significativamente mayor en los ratones inmunizados con STc80, reflejado por una mayor IMMUNOLOGY & PATHOGENESIS 167 reacción de hipersensibilidad retardada, proliferación y secreción de IL-2 por esplenocitos frente al estímulo con rTc80. Por último, todos los grupos inmunizados presentaron una reducida parasitemia y un aumento en la sobrevida ante un desafío letal con la cepa virulenta T. cruzi RA. Cabe destacar que aquellos que recibieron al menos una dosis del ADN de Tc80 presentaron una mayor sobrevida. Estos resultados consolidan a Tc80 como un candidato vacunal. IYP27 DECIPHERING THE PUTATIVE ROLE OF HIGH MOBILITY GROUP B PROTEIN FROM Trypanosoma cruzi IN INFLAMMATION Luis Tavernelli(1), Romina Manarín(2), Virginia perdomo(3), Jorge Barrios-Payán(4), Rogelio Hernandez Pando(5), Esteban Serra(6), Pamela Cribb(7) (1) Instituto de Biología Molecular y Celular de Rosario (IBR-CONICET). (2)Facultad de Ciencias Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario. (3) Instituto de Biología Molecular y Celular de Rosario (IBR-CONICET). Facultad de Ciencias Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario. (4)(5)Sección Patología Experimental, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubiran, México. (6)(7)Instituto de Biología Molecular y Celular de Rosario (IBR-CONICET). Facultad de Ciencias Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario. E-mail: cribb@br.gov.ar High Mobility Group B (HMGB) proteins are evolutionary-conserved ubiquitous proteins described more than 30 years ago and named for their high mobility in SDS-PAGE. As abundant components of chromatin, they act as architectural factors and take part of many nuclear processes like transcriptional regulation, DNA repair and replication. A member of this family of proteins, HMGB1, has gained a lot of interest in the last decade because, besides its nuclear functions, it can be secreted by activated macrophages or passively released by necrotic or injured cells and act as a pro-inflammatory mediator. We previously demonstrated that the HMGB protein from Trypanosoma cruzi (TcHMGB) is a nuclear protein expressed in all life cycle stages with architectural functions. We decided to test if TcHMGB can also act as an immune regulator, as a first approach to study its putative role in Chagas Disease. We first determined the presence of TcHMGB in the supernatants of epimastigote cultures and blood trypomastigotes incubated in PBS by western blot, suggesting the protein can be secreted. Consistent with observations in other organisms, acetylation may be the signal for TcHMGB secretion, since treatment with deacetylase-inhibitors enhance the protein signal in western blots. We then stimulated RAW 264.7 macrophages with the recombinant TcHMGB for different time periods. Culture supernatants were collected and nitric oxide production was analyzed measuring nitrite release by Griess reaction. Also, total RNA was purified from treated macrophages and mRNAs for different cytokines were quantified by qRT-PCR. Recombinant TcHMGB showed to be able of inducing macrophage activation in vitro. Finally, we tested the immune activity in vivo, stimulating male BALBc mice with the recombinant protein for different periods of time. Peritoneal fluid and spleens were collected to test for cytokineproduction. These preliminary results indicate that TcHMGB may have a role in inflammation. IMMUNOLOGY & PATHOGENESIS 168 IYP28 COMBINATION OF LIVE ATTENUATTED Trypanosoma cruzi PARASITES WITH IFNEXPRESSING PLASMID AS AN IMMUNIZATION STRATEGY Cecilia Pérez Brandán(1), Fernando Sánchez-Valdéz(2), Rubén Cimino(3), Patricio Diosque , Miguel Ángel Basombrío(5) (1)(2)(4)(5) Instituto de Patología Experimental- CONICET- Universidad Nacional de Salta. (3) Catedra de Quimica Biologica. UNSa. E-mail: perezbrandan@yahoo.com.ar (4) Immunization of mice with live attenuated Trypanosoma cruzi parasites has proven highly immunogenic and protective against acute lethal challenge. It is known that early interferon-gamma (IFN-γ) release by cells of the innate immune system is critical to lead type 1 response able to control intracellular pathogens. Therefore, the aim of the present work is to test whether the co-administration of a plasmid encoding IFN-γ could improve the protection gain through vaccination with live attenuated parasites. For this purpose C57BL/6J mice were immunized with three doses of 5x105 live metacyclic parasites in combination with 50ug of plasmid pCDNA3- IFN-γ or plasmid alone. The immunization regimens were done every 4 weeks either orally or intramuscularly. Thirty days after the last immunization, animals were challenge with highly virulent T. cruzi parasites and parasitemia was recorded weekly. During the immunization period, peripheral blood was taken to determine infection by attenuated parasites. Serum samples as well as spleen cells were collected to determined cytokines expression. Specific anti-T. cruzi antibodies, avidity index and trypanolitic activity was also evaluated in immunized sera. All immunized animals survive challenge with lethal parasites. So far, addition of IFN-γ, at least as administer in our experimental model, does not modified the protection confer by immunization with attenuated parasites alone. This work is supported by Fundacion Florencio Fiorini and ANPCyT. IYP29 HIGH QUANTITIES OF TRYPOMASTIGOTES OF Trypanosoma cruzi PRODUCES PLACENTAL STRUCTURAL ALTERATIONS ASSOCIATED TO OXIDATIVE STRESS IN VITRO María Fernanda Triquell(1), María José Moreira Espinoza(2), Cintia Díaz Luján(3), Mariana Piegari(4), Luciana Mezzano(5), Gina María Mazzudulli(6), Ricardo Fretes(7) (1)(2)(3)(4)(5)(6) Laboratorio de Placenta y Chagas, Biología Celular, Histología y Embriología, Facultad Ciencias Médicas- INICSA (CONICET), Universidad Nacional de Cór. (7) Laboratorio de Placenta y Chagas, Biología Celular, Histología y Embriología, Fac Cs Méd- INICSA (CONICET), UNC. 2Histología, Embriología y Genética-IICSHUM, Universidad Nacional de La Rioja . E-mail: mtriquell@gmail.com Placenta participates actively in the control of congenital Chagas infection, which would explain, the low transmission rate. Production of pro-inflammatory cytokines such as TNFα, promotes nitric oxide (NO) production by the placental endothelial Nitric Oxide Synthase (eNOS) that could play an important role of this control. NO reacts with oxygen IMMUNOLOGY & PATHOGENESIS 169 species and produce peroxynitrites which are both trypanosidal and potentially deleterious for placental tissue. Objective: To analyze structural alterations of the syncytiotrophoblast (STB), induced by two populations of T. cruzi through increased TNFα, NOS and oxidative stress. Placental villi explants co-cultured for 24 hs with 1x105 and 1x106 trypomastigotes of Tulahuen and Lucky strains (isolated from a congenital case); controls without parasites, and with addition of eNOS inhibitor L-NAME (1mM, 0,1mM, 0,01 mM). Histological quantification of the detachment area of STB. In culture media: quantification of NO (Griess), TNFα (ELISA).Tissue homogenates: NOSe and Nitrotyrosine expression by ELISA; and Gamaglutamiltranspeptidase (GGT) activity to measure oxidative stress. Placental explants in presence of both strains of T. cruzi showed a significant rise of TNFα, tyrosin nitrosilation, eNOS expression and GGT activity. The structural alterations (STB detachment) were significantly higher in presence of T. cruzi in a concentration dependent manner. L-NAME prevents a rise of detachment with T.cruzi. The presence of high quantity of T. cruzi in vitro produced detachment of the STB, associated with increased production of TNFα, eNOS and oxidative stress, which could facilitate the chorionic villi infection. These results could explain the association of some clinical aspects of the congenital Chagas disease, with structural alterations described in placentas from chagasic women. These results would constitute a new possible route of placental infection. FONCyT-PICT 2012-1061,SECyT-UNLaR,MINCyT-PID(Cba),SECyT-UNC. IYP30 EFFECTS OF PPAR-γ AGONISTS ON ADIPOSE TISSUE, IMMUNE AND METABOLIC PARAMETERS DURING ACUTE Trypanosoma cruzi INFECTION Florencia B González, Julia S Márquez, Eduardo A Roggero, Silvina R Villar, Oscar A Bottasso, Ana R Pérez IDICER / Instituto de Inmunología - FCM - UNR). E-mail: perez_anarosa@yahoo.com.ar Adipose tissue (TA) influences energy homeostasis and inflammation and at the same time can act as a T. cruzi (Tc) reservoir. We recently showed that mice infected with Tc displayed an exacerbated pro-inflammatory milieu associated with metabolic abnormalities like manifest lipolysis, hypoglycemia, hypoleptinemia, reduced body weight and food intake which may play a role in lethality. PPAR-γ is a ligand-activated nuclear factor mainly expressed in adipocytes and is involved in the modulation of energetic metabolism and down regulation of inflammation. Thus, we wished to ascertain whether therapeutic administration of endogenous (15dPGJ2; PGJ) or synthetic PPAR-γ agonists (Rosiglitazone, RGZ) improved metabolic and AT inflammatory parameters and influenced the course of T. cruzi infection. Mice were treated during the first 10 days post-infection (dpi) with PGJ (1 mg/kg) or RGZ (10 & 20 mg/kg) and sacrificed after 17 dpi or maintained alive to record survival. In infected mice both agonists failed to induce major changes in survival, body weight loss, food intake, glycemia and systemic leptin levels, probably related with a downregulation of PPAR-γ in AT during infection. On the other hand, both drugs slightly reduced lipolysis, AT inflammation and macrophage phagocytosis. ATderived immune cells from infected animals showed an increase in CD8+ T cells, CD11b+ and CD11c+ cells, with a diminution of CD4+Foxp3+ Treg cells. In addition, RZG treated Tc animals displayed a higher proportion of AT CD11b+ and CD11b+CD11c+ cells IMMUNOLOGY & PATHOGENESIS 170 compared to untreated Tc mice (p<0,05). Even though both agonists increased parasite load, only minor changes were found in heart tissue inflammation. Collectively, AT abnormalities and immune changes seen during acute Tc infection were slightly improved by PPAR-γ agonists, while they failed to modify the outcome of infection. Downregulation of PPAR-γ by pro-inflammatory cytokines might be responsible for the unresponsiveness of PPAR-γ agonists. IYP31 SEROPREVALENCIA A Toxocara canis EN PERROS DE LA CIUDAD DE CORRIENTES Leandro D.M. García, María de los A. López, María V. Bojanich, Silvia E. Balbachán, Ubaldo O. Martín UNNE. E-mail: ecnomartin@hotmail.com Toxocara canis es un nematode de los caninos que accidentalmente infecta al hombre. Los cachorros son responsables de la contaminación del ambiente a través de la eliminación de huevos infectantes. La toxocariosis humana constituye un serio problema sanitario, particularmente en los niños. El objetivo de este estudio fue determinar valores de prevalencia de Toxocariosis canina mediante serología. Se estudiaron perros de los barrios Laguna Seca, San Antonio Este y Alta Gracia, de la ciudad de Corrientes, que concurrieron junto a sus dueños a jornadas de castración. Se obtuvieron muestras de sangre por venopunción cefálica, y se consignaron datos de edad, sexo y barrio de procedencia. Se realizó un test de ELISA indirecto para detección de anticuerpos de tipo IgG específicos para Toxocara canis, empleando antígenos de excreción secreción de larvas L2, y anticuerpo anti IgG canina marcado con peroxidasa. Se empleó el test de Chi cuadrado para comparación de proporciones, empleando el software EpiInfo versión 6.0. Se consideró un valor de p<0,05 como estadísticamente significativo. Se estudiaron en total 62 perros, 11 machos y 51 hembras, de edades comprendidas entre 6 meses y 15 años (media 3.3 años; mediana 2 años).El ELISA indirecto reveló que el 72.5 % de los canes presentaba serología positiva. No existieron diferencias significativas con respecto al sexo. Al agruparlos por franja etaria, la mayor prevalencia correspondió al rango de 4 a 6 años (91.6%; n=12), mientras que fue del 25 % en menores de 1 año (n=8); 72.7% entre 1 y 3 años (n= 33) y del 88.8% en mayores de 7 años (n=9), siendo estas diferencias estadísticamente significativas (p=0,005). La mayor prevalencia se encontró en el barrio Alta Gracia con 79,4% (n= 34), sin diferencias estadísticamente significativas con respecto a los otros barrios estudiados. Estos resultados sugieren la necesidad de implementar medidas de control sanitario en perros y de esa manera reducir el riesgo de transmisión al hombre. IYP32 INTERACCIÓN DE CRUZIPAÍNA CON SU INHIBIDOR FISIOLÓGICO EN LA MODULACIÓN DE LA RESPUESTA INMUNE EJERCIDA POR Trypanosoma cruzi IMMUNOLOGY & PATHOGENESIS 171 Natacha Cerny(1), Augusto E Bivona(2), Andres Sanchez Alberti(3), Alejandro C Cardozo Landaburu(4), Emilio L Malchiodi(5), Silvia I Cazorla(6) (1) IDEHU (CONICET-UBA) FFyB; Dto.Cs.Básicas INEDES-UNLu. (2)(3)(4)(5)IDEHU (CONICET-UBA) FFyB. (6)IMPaM (CONICET-UBA) FMed. E-mail: natashacerny@yahoo.com.ar Comprender el rol de antígenos parasitarios y su interacción con las células del sistema inmune, es un paso clave en el diseño de estrategias de tratamiento de la enfermedad de Chagas, así como de vacunas preventivas y/o terapéuticas contra la infección por T. cruzi. Seleccionamos y clonamos dos proteínas esenciales en el ciclo de vida del parásito: Cruzipaína (Cz), principal cisteín proteasa, y su inhibidor, Chagasina (Chg). Siendo células dendríticas (CD) y macrófagos, importantes en la regulación de la respuesta de células T frente a la infección por T. cruzi, evaluamos la expresión de moléculas coestimulatorias en la superficie de estas células presentadoras de antígenos (CPA) en presencia de las proteínas recombinantes. Observamos un incremento en la expresión de CD80 y CMH-II en la superficie de CD y de macrófagos peritoneales (MP) de ratones Balb/C, coincubados con Cz y Chg, respecto a los controles. Este efecto desaparecía cuando las proteínas eran desnaturalizadas por calor. En los sobrenadantes de MP incubados con cada una de las proteínas, observamos un incremento significativo en la producción de óxido nítrico. Similares resultados observamos en presencia de las proteínas+polimixina. Más importante aún, detectamos un incremento en la producción de INF-γ e IL-12, pero no así de IL-10, en los sobrenadantes de CPA incubadas conjuntamente con Cz y Chg(10 μg/ml, de c/u) respecto a aquellas incubadas con las proteínas en forma individual. Estos resultados sugieren en que la interacción Cz-Chg esta última podría contribuir, al menos en parte a desviar la respuesta hacia un perfil Th1, a través de la expresión de citoquinas y moléculas coestimulatorias por CPA. A partir de estos resultados, evaluamos la capacidad protectiva de la inmunización conjunta de ratones con Cz+Chg coadyuvadas con CpG. Dicha inmunización redujo la carga parasitaria en la etapa aguda, así como las enzimas séricas marcadoras de daño tisular durante la etapa crónica de la infección. IYP33 EFFECT OF TRYPTOPHAN IN PLACENTAL EXPLANTS INFECTION BY Trypanosoma cruzi IN VITRO Maria J Moreira Espinoza(1), Maria F Triquell(2), Cintia M Díaz Lujan(3), Gina Mazzudulli(4), Mariana Piegari(5), Luciana Mezzano(6), Ricardo E Fretes(7) (1)(2)(3)(5)(6) Cell Biology, Histology and Embryology Department-INICSA (CONICET), Faculty of Medicine School, National University of Cordoba. (4)INICSA (CONICET). (7)Cell Biology, Histology and Embryology Department-INICSA (CONICET), Faculty of Medicine School, National University of Cordoba and La Rioja University. E-mail: sporseia@hotmail.com Tryptophan (Trp) catabolism participates in the maternal-fetal tolerance through indoleamine 2,3-dioxigenase (IDO), which is an enzyme strongly expressed in human placenta. IDO limits the infection of mice experimentally infected with Trypanosoma cruzi. Objective: To analyze the effect of Trp in the invasion of human placental chorionic villi by T. cruzi, in-vitro. Methodology: We employed explants of chorionic villi of placentas IMMUNOLOGY & PATHOGENESIS 172 obtained from normal pregnancies at term (n=4). Women have signed informed consents. Placental explants were treated with different concentrations (5mg, 10mg, 20mg y 40mg) of L-Trp and D-Trp (as control), for 3hs and/or infected for 24hs with 150.000 and 1.000.000 trypomastigotes Tulahuen strain of T. cruzi, then culture media were changed. Placental explants and their respective culture media were analyzed at 72hs using Student t test, ANOVA and correlation analysis (r). Results: All explants were positive to infection by T. cruzi detected by PCR and microscopical analysis, but they have distinct parasite charge (qPCR) with different Trp concentrations. According to western blot and indirect ELISA, IDO modified its expression at 3hs, but there was not significantly differences respect to controls in the subsequent times of culture (p>0,05). Parasite viability was quantified in culture media at 72 hs of cultures with decreased viability respect to controls (p<0.05). Conclusion: Different concentrations of Trp at the beginning of the invasion of host cell by T. cruzi do not avoid the infection of placental explants. However, Trp-IDO system would participate limiting the sustained infection (parasite reproduction) of placental tissue. These results could explain, at least in part, the low incidence of congenital Chagas transmission. Grants: FONCyT-PICT 2012-1061, SECyT-UNLaR, MINCyT-PID (Cba), SECyT-UNC. Keywords: Trpanosoma cruzi, placenta, indoleamina 2,3-dioxygenasa. IYP34 ASSESSMENT OF THE VERTICAL ROUTE AS A WAY OF TRANSMISSION OF Trichinella patagoniensis IN BALB/C MICE WITH LATE PREGNANCY Fernando A Fariña(1), Mariana Pasqualetti(2), Cardillo Natalia(3), Krivokapich Silvio(4), Rosa Adrian(5), Ribicich Mabel(6) (1) Cátedra de Parasitología y Enfermedades Parasitarias, FCV-UBA/Consejo Nacional de Investigaciones Científicas y Técnicas. (2)(5)(6)Cátedra de Parasitología y Enfermedades Parasitarias, FCV-UBA. (3)Cátedra de Parasitología y Enfermedades Parasitarias, FCVUBA/Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). (4) Departamento de Parasitología, INEI, ANLIS, “Dr. Carlos Malbrán”. E-mail: fernandoaf@fvet.uba.ar In Argentina, Trichinella spiralis was for years the only species involved in human and porcine outbreaks. Krivokapich et. al. in 2008 identified a novel Trichinella’s genotype from a cougar of the province of Rio Negro: T. patagoniensis. Although horizontal transmission is the most common route of infection, several authors have shown that vertical transmission of Trichinella is possible in rats, guinea pigs, mice and ferrets. Moreover, transplacental transmission is also possible in humans as Dubinsky et al. pointed out in 2001. The aim of the present study is to evaluate the presence of T. patagoniensis larvae 1 (L1) in offsprings belonging to experimentally infected mice in days 15 and 18 of pregnancy. Twenty 7-week-old Balb/c mice were randomly divided according to the time of pregnancy in two groups of ten animals each. Group 1: animals infected 15 days after the appearance of the vaginal plug and Group 2: animals infected 18 days after the appearance of the vaginal plug. Furthermore, each group were separated into 2 subgroups of 5 animals which were inoculated per os with 100 and 500 L1 of T. patagoniensis respectively. The T. patagoniensis isolate used in this study came from a cougar and was maintained by serial passages in CF1 mice. Euthanasia and artificial digestion technique IMMUNOLOGY & PATHOGENESIS 173 were performed on day 30 after birth on each offspring and on day 48 after infection in the dams. There was no evidence of L1 in none of the offspring analysed. Reproductive capacity index (RCI) mean values in dams of Group 1 were 64,1 ± 27.9 and 126,2 ± 32.1 for 100 and 500 L1 dose respectively while in Group 2 were 90,1 ± 21,2 and 178,7 ± 35,6 for 100 and 500 L1 dose respectively. There was no statistical evidence of a difference between the RCI mean values in Group 1 and Group 2. The present study suggests that vertical transmission of T. patagoniensis from infected dams on days 15 and 18 of pregnancy with a dose of 100 and 500 L1 were not possible. IYP35 HIDATIDOSIS: TRANSFERENCIA CALOSTRAL DE IGG ANTI EG95 Viviana Randazzo(1), Maria L Gertiser(2), Veronica T Poggio(3), Oscar Jensen(4) Universidad Nacional del Sur.Catedras Parasitologia clinica-Microbiologia y Parasitologia. (2)(4)Centro de Investigación en Zoonosis y Enfermedades que afecten la producción ganadera. Pcia del Chubut. (3)CEVAN-Centro de Virologia Animal- ICT Milstein -CONICET . E-mail: viviana.randazzo@uns.edu.ar (1) Introducción: La Echinococcosis quística o hidatidosis es una zoonosis controlable y cosmopolita causada por cestodes del género Echinococcus. La enfermedad es un problema para salud pública y ganadera en Argentina. Los Programas de control sanitario convencionales se aplican desde hace años en las provincias patagónicas de nuestro país con resultados no alentadores. La incorporación de la vacuna Providean Hidatil EG95(PHEG95) en rumiantes abre nuevos desafíos.Objetivo: Detectar presencia de anticuerpos anti-EG95 (Ac) transferidos por calostro a corderos nacidos de madres vacunadas con PH- EG95 determinando en los mismos el tiempo ideal de aplicación de la primera dosis. Materiales y Métodos:Ovejas Merino vientre se dividieron en M1 y M2 según vacunadas con una o dos dosis de PH-EG95. Pos-parto, y por 28 días, se extrajo suero y calostro/leche en cada grupo. Corderos recién nacidos se dividieron en C1 y C2 según hijos de M1 o M2 extrayéndoseles suero por 90 días. Se determinaron títulos de Ac en suero/calostro de cada grupo en diferentes tiempos. Resultados: En ningún cordero se detectó Ac previo a la primera ingestión de calostro observándose un pico en el nivel de Ac vacunales en las primeras 24 hs posteriores al parto. En todos los animales expuestos a dos dosis de vacunación los Ac fueron significativamente mayores a una única dosis. Conclusiones: Los Ac se concentraron significativamente en el calostro de las ovejas pre parto originándose transferencia efectiva a la cría. Teniendo en cuenta la persistencia en suero de los Ac vacunales adquiridos por los corderos en forma pasiva, se observa que sería ideal iniciar la vacunación durante la cuarta semana de vida de las crías de madres vacunadas. La incorporación de la vacunación con PH-EG95 abre nuevas perspectivas preventivas, afectando directamente al ciclo de la hidatidosis en un nuevo blanco.